Entries |
Document | Title | Date |
20110123995 | TREATMENT OF DISEASE - The invention relates to the use of angiogenin, or a fragment or variant thereof, to treat diseases or conditions characterised by neuronal injury or death, or axonal degeneration, especially neurodegenerative diseases such as Amyotrophic Lateral Sclerosis (ALS). The invention also describes a plurality of mutations of the human angiogenin gene which are associated with a neurodegenerative disease phenotype, and particularly a ALS phenotype. Also described is a method of assessing whether an individual is afflicted with, or generically predisposed to develop, a disease or condition characterised by neuronal injury or death, or axonal degeneration. | 05-26-2011 |
20110123996 | METHODS AND COMPOSITIONS TO EVALUATE ANTIBODY TREATMENT RESPONSE - The present invention relates to methods and compositions to evaluate or assess the response of a subject to particular therapeutic treatment. More particularly, the invention provides methods to determine the response of subjects, or to adapt the treatment protocol of subjects treated with therapeutic antibodies. The invention is based on a determination of the FCGR3A genotype of a subject. The invention can be used for patients with malignancies, particularly lymphoma, and is suited to select best responders and/or adjust treatment condition or protocol for low responders. | 05-26-2011 |
20110123997 | MOLECULAR DIAGNOSIS AND CLASSIFICATION OF MALIGNANT MELANOMA - The present invention provides methods for diagnosing and providing a prognosis of melanoma using molecular markers that are overexpressed in melanoma cells. The invention provides kits for diagnosis and prognosis. Also provided are methods to identify compounds that are useful for the treatment or prevention of melanoma and melanoma progression. | 05-26-2011 |
20110123998 | Materials and Methods for Treatment of Cancer - Glypican 5 is shown for the first time to have a role in proliferation of cancer cells, including tumours which do not show chromosomal amplification at 13q31. The use of glypican 5 (GPC5) antagonists and binding agents for the treatment of cancer, particularly rhabdomyosarcoma and breast cancer, is disclosed. | 05-26-2011 |
20110123999 | Novel Polymorphism in Bovine Prion Protein Gene Sequence - A specific, non-synonymous SNP in the Prnp gene encoding the bovine prion protein affects the susceptibility of bovine animals to bovine spongiform encephalopathy (BSE). Depending on the number of octapeptide repeat units present in the Prnp gene, the position of the SNP is either nucleotide 631 of exon 3 (codon 211) when the Prnp gene comprises six octapeptide repeat region sequences, nucleotide 607 of exon 3 (codon 203) when the Prnp gene comprises five octapeptide repeat region sequences, or nucleotide 655 of exon 3 (codon 219) when the Prnp gene comprises seven octapeptide repeat region sequences. Alleles of the bovine Prnp wherein the SNP at these positions is lysine (K) at the corresponding amino acids (i.e., 211, 203 or 219) in the bovine prion protein are all indicative of increased susceptibility to BSE in comparison to alleles which encode glutamic acid (E) at the same position. This SNP may be used as a marker for selecting bovines susceptible to BSE for disposal and/or removal from breeding, the human food and animal feed supplies. | 05-26-2011 |
20110124000 | METHODS AND COMPOSITIONS FOR VITAMIN K EPOXIDE REDUCTASE - The present invention provides a method of identifying a human subject having increased or decreased sensitivity to warfarin, comprising detecting in the subject the presence of a single nucleotide polymorphism in the VKOR gene, wherein the single nucleotide polymorphism is correlated with increased or decreased sensitivity to warfarin, thereby identifying the subject having increased or decreased sensitivity to warfarin. | 05-26-2011 |
20110124001 | Compositions For Use In Detection Of Multiple Analytes - Methods, compositions and kits are disclosed. The methods are directed to determining the presence or relative amounts of two or more components in a medium. A combination is provided comprising a medium suspected of containing the components, at least two sensitizer reagents and at least one reactive reagent activatable by singlet oxygen. The sensitizer reagents are capable of generating singlet oxygen and are distinguishable by wavelength of sensitization. The combination of sensitizer reagents and reactive reagents allows differential detection of the components. The sensitizer reagents are differentially activated. The amount of signal generated as a result of the activation of said reactive reagent is determined wherein the amount thereof is related to the amount of each of the components in the medium. | 05-26-2011 |
20110129824 | DOUBLE-STRANDED PROBES FOR THE FLUORESCENT DETECTION OF NUCLEIC ACIDS - The present invention relates to a double-stranded probe intended for the fluorescent detection of at least one single-stranded or double-stranded target nucleic acid, comprising: —a first strand of formula X | 06-02-2011 |
20110129825 | COMPOSITIONS, METHODS AND SYSTEMS FOR THE SIMULTANEOUS DETERMINATION OF PARENTAGE, IDENTITY, SEX, GENOTYPE AND/OR PHENOTYPE AND BREED DETERMINATION IN ANIMALS - The invention provides for a universal genetic evaluation system capable of simultaneously determining multiple genetic characteristics in domestic and wild animals. In particular, the invention provides for the use of polymorphisms, such as single nucleotide polymorphisms (SNPs), insertions, deletions, inversions, and/or other mutations within gene sequences, as determinants of genetic characteristics, such as parentage, identity, sex, genotype and/or phenotype. The universal genetic evaluation system is utilized to simultaneously determine multiple genetic characteristics in horses and wild horses, dogs and wild canids, cats, goats and wild goats, sheep and wild sheep, cattle, bison, deer (cervidae), donkeys, mules, swine and wild swine, camelids and wild camelids, other domestic and certain species of wild animals (deer, elk, red deer, antelope, caribou and reindeer, moose and other exotic deer and antelope species), birds (including pet birds and commercial bird species), reptiles, amphibians, fish and rodents, concurrently for each species. | 06-02-2011 |
20110129826 | METHOD FOR DETERMINATION OF INFLAMMATORY DISEASE BY USING SINGLE NUCLEOTIDE POLYMORPHISM IN BRCA1-RELATED PROTEIN (BRAP) GENE - It is an object of the present invention to identify a novel single nucleotide polymorphism (SNP) associated with the development and advancement of inflammatory diseases such as myocardial infarction. The present invention provides a method for judging inflammatory diseases, which comprises detecting at least one gene polymorphism in the BRCA1-associated protein (BRAP) gene. | 06-02-2011 |
20110129827 | METHODS FOR TRANSCRIPT ANALYSIS - The invention takes a unique approach to transcript analysis that provides a novel DGE technology based on single-molecule sequencing. More particularly, the invention relates to methods and compositions for analyzing and identifying genes and gene expression and transcript profiles using a DGE-based technology and single molecule sequencing that does not require amplification or fragmentation. | 06-02-2011 |
20110129828 | SPECIFIC DOUBLE-STRANDED PROBES FOR HOMOGENEOUS DETECTION OF NUCLEIC ACID AND THEIR APPLICATION METHODS - Nucleic acid detection probes that comprise a pair of complementary, fluorophore/quencher labeled oligonucleotides, one of which is shorter than the other, are able to detect single-stranded and double-stranded targets in hybridization reactions and amplification reactions with real-time detection. Double-stranded probes of equal length are useful in PCR amplification reactions with real-time detection. | 06-02-2011 |
20110129829 | METHODS FOR DETECTION OF CORN EVENT DAS-59132 - The invention provides assays for detecting the presence of the maize DAS-59132 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided. | 06-02-2011 |
20110129830 | DETERMINATION OF KIR HAPLOTYPES ASSOCIATED WITH DISEASE - Disclosed is a method of determining KIR genotypes for one or more individuals in parallel, the method comprising: for each individual, amplifying the polymorphic exon sequences of the KIR genes, pooling the KIR amplicons, performing emulsion PCR followed by pyrosequencing in parallel to determine all the amplicon sequences present in the individual to determine which KIR alleles are present in the individual. | 06-02-2011 |
20110129831 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 06-02-2011 |
20110129832 | Polynucleotide Primers and Probes - The present invention provides a novel technology that involves improved primer design. These primer pairs have a wide range of applications and provide high sensitivity and specificity. | 06-02-2011 |
20110129833 | Gene Expression Markers for Predicting Response to Chemotherapy - The present invention provides sets of genes the expression of which is important in the prognosis of cancer. In particular, the invention provides gene expression information useful for predicting whether cancer patients are likely to have a beneficial treatment response to chemotherapy. FHIT; MTA1; ErbB4; FUS; BBC3; IGF1R; CD9; TP53BP1; MUC1; IGFBP5; rhoC; RALBP1; STAT3; ERK1; SGCB; DHPS; MGMT; CRIP2; ErbB3; RAP1GDS1; CCND1; PRKCD; Hepsin; AK055699; ZNF38; SEMA3F; COL1A1; BAG1; AKT1; COL1A2; Wnt.5a; PTPD1; RAB6C; GSTM1, BCL2, ESR1; or the corresponding expression product, is determined, said report includes a prediction that said subject has a decreased likelihood of response to chemotherapy. | 06-02-2011 |
20110129834 | SELECTIVE AMPLIFICATION OF POLYNUCLEOTIDE SEQUENCES - The application relates to compositions and methods which may be used for amplifying selected portions of nucleic acid samples. Samples may comprise an entire genome of a bacterium, plant, animal, or other organism. In some instances, methods allow for enrichment of hundred or thousands of target nucleic acids of interest in an efficient and cost effective manner. | 06-02-2011 |
20110129835 | METHODS AND COMPOSITIONS FOR DETECTING METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS - Provided are methods of detecting the presence and/or amount of methicillin-resistant | 06-02-2011 |
20110129836 | Automated Seed Sampler and Methods of Sampling, Testing and Bulking Seeds - An automated seed sampler includes a sampling station; a sampler for removing material from a seed in the sampling station; a seed conveyer for conveying the seed from the sampling station to a compartment in a seed tray; and a conveyor for conveying the material removed from the seed to a corresponding compartment in a sample tray. The method of the present invention comprises feeding seeds individually to a sampling station, removing a sample from the seed in the sampling station; conveying the sample to a compartment in a sample tray, and conveying the seed to a corresponding compartment in a seed tray. The samples can be tested, and the seeds can be sorted according to the results of the testing of their corresponding samples. | 06-02-2011 |
20110129837 | DETECTION OF NUCLEIC ACIDS AND PROTEINS - The invention generally relates to methods for detecting a target nucleic acid and a target protein in a single assay. | 06-02-2011 |
20110129838 | USING GENETIC POLYMORPHISMS OF THE BICD1 GENE AS A METHOD FOR DETERMINING A RISK OF DEVELOPING MYOPIA - A method and kit for determining an increased risk of developing myopia in a subject is provided by detecting an SNP in the BICD1 gene. The SNP is selected from a group consisting of rs10844126 (A/C), rs1151029 (A/T), rs2650122 (C/T), rs10771923 (A/G), rs1151009 (T/C), rs2125173 (A/G) and rs161959 (C/G). When the presence of the risk allele associated with myopia is detected at the SNP, the subject is determined in an increased risk of developing myopia. | 06-02-2011 |
20110136114 | NEURAL REGENERATING CELLS WITH ALTERATIONS IN DNA METHYLATION - Disclosed herein are cells, that are descendents of marrow adherent stem cells (MASCs), capable of rescuing and/or reversing various neural disorders after transplantation into sites of central nervous system (CNS) or peripheral nervous system (PNS) injury. The cells contain alterations in the methylation state of certain genes, compared to their methylation state in MASCs. Methods of making cells capable of rescuing and/or reversing various neural disorders after transplantation into sites of CNS or PNS injury, by alteration of the methylation status of certain genes, are also provided. | 06-09-2011 |
20110136115 | METHODS AND NUCLEIC ACIDS FOR THE ANALYSIS OF GENE EXPRESSION ASSOCIATED WITH THE DEVELOPMENT OF PROSTATE CELL PROLIFERATIVE DISORDERS - The invention provides methods, nucleic acids and kits for detecting prostate cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of said disorder, thereby enabling the improved diagnosis and treatment of patients. | 06-09-2011 |
20110136116 | DETECTION OF TARGET NUCLEIC ACID SEQUENCES USING FLUORESCENCE RESONANCE ENERGY TRANSFER - A method for identifying a plurality of target nucleic acid molecules in a sample. The method provides a plurality of oligonucleotide probe sets. Each set comprises a first and a second probe, each having a target-specific portion and a tunable portion with an acceptor or a donor group. The first probe further comprises an endcapped hairpin. A reaction comprises a denaturation and hybridization cycle. Under the hybridization, the set of probes hybridize in a base-specific manner to their respective target nucleotide sequences, and ligate to one another to form a ligation product. Under conditions that permit hybridization of the tunable portions of the ligation product to one another, an internally hybridized ligation product formed, which allows the detection of the fluorescence resonance energy transfer (FRET). A method comprising PCR amplification is also disclosed. | 06-09-2011 |
20110136117 | Method of Detecting Heat-Resistant Fungus - A method of detecting a heat-resistant fungus, which has a step of identifying the heat-resistant fungus using the following nucleic acid (I) or (II): | 06-09-2011 |
20110136118 | REAL TIME POLYMERASE CHAIN REACTION PROCESS USING A UNIVERSAL DETECTION SYSTEM - Provided are methods and kits for detecting amplification of a target nucleic acid during a real time quantitative polymerase chain reaction process using a universal detection system. The detection system uses an unlabeled probe that detects the amplified target nucleic acid and interacts with a universal detection module. | 06-09-2011 |
20110136119 | AIMP2-DX2 Gene and its Uses - The present invention relates to a variant of AIMP2 lacking exon 2 gene, named as AIMP2-DX2 gene, which is specifically expressed in cancer cells. The AIMP2-DX2 gene and siRNA targeting AIMP2-DX2 can be successfully used in the development of diagnosis and treatment of cancer | 06-09-2011 |
20110136120 | Methods of Identification of Methylation of CPG - The present invention relates to the materials and methods for the identification of methylated nucleotides in samples of genomic DNA. The present invention also relates to methods of diagnosis of specific conditions by identification of specific methylated nucleotides. | 06-09-2011 |
20110136121 | METHOD FOR DETECTING CANCER - The present invention relates to a method for detecting cancer, comprising measuring the expression of a polypeptide having a reactivity of binding to an antibody against a CAPRIN-1 protein having an amino acid sequence shown in any one of the even-numbered SEQ ID NOS: 2-30 in the Sequence Listing via an antigen-antibody reaction in a sample separated from a living organism, and, a reagent for detecting a cancer comprising the CAPRIN-1 protein or a fragment thereof, an antibody against the CAPRIN-1 protein or a fragment thereof, or a polynucleotide encoding the CAPRIN-1 protein or a fragment thereof. | 06-09-2011 |
20110143342 | NEW FETAL METHYLATION MARKERS - This application describes the discovery that, in a pregnant woman, certain genes (such as RASSF1A, APC, CASP8, RARB, SCGB3A1, DAB2IP, PTPN6, THY1, TMEFF2, and PYCARD) originated from a fetus are highly methylated, whereas the same genes of maternal origin are unmethylated. This discovery allows the easy detection of one or more of these methylated fetal genes in a biological sample from a pregnant woman, serving as a universal indicator of the presence of fetal DNA in the sample. These fetal methylation markers are particularly useful as positive controls for a non-invasive analytical process during which the quality and quantity of fetal DNA are monitored. These newly identified fetal markers can also be measured directly for diagnosis of certain pregnancy-related conditions. | 06-16-2011 |
20110143343 | Methods and Kits for Methylation Detection - Ligation-based methods and kits are disclosed for determining the degree of methylation of one or more target nucleotides. In certain embodiments, the methylation status of one or more target nucleotides is determined by generating misligation products. In certain embodiments, at least one target nucleotide is amplified prior to the ligation reaction. In certain embodiments, at least one ligation product, at least one ligation product surrogate, at least one misligation product, at least one misligation product surrogate, or combinations thereof are amplified. In certain embodiments, one or more ligation probes comprise at least one nucleotide analog, at least one Modification, at least one mismatched nucleotide, or combinations thereof. | 06-16-2011 |
20110143344 | GENETIC POLYMORPHISMS AND SUBSTANCE DEPENDENCE - The invention encompasses methods for identifying subjects at risk for substance dependence by detecting the presence of polymorphism in the CHRNA5-CHRNA3-CHRNB4 gene cluster and the CHRNA4 gene. The invention also encompasses determining the response of a subject to a therapeutic substance, treating substance dependence in a subject, and evaluating the response of a subject to a substance cessation treatment. | 06-16-2011 |
20110143345 | Genetic Markers for SCD or SCA Therapy Selection - Variations in certain genomic sequences useful as genetic markers of Sudden Cardiac Death (“SCD”) or Sudden Cardiac Arrest (“SCA”) risk are described. Novel genetic markers useful in assessing the risk of SCD or SCA and compositions containing the same are provided herein. Methods of distinguishing patients having an increased susceptibility to SCD or SCA, through use of these markers, alone or in combination with other markers, are also provided. Further, methods of detecting a polymorphism associated with SCD or SCA are taught. | 06-16-2011 |
20110143346 | COTTON EVENT MON15985 AND COMPOSITIONS AND METHODS FOR DETECTION THEREOF - The present invention provides cotton plants, cotton tissues, and cotton seeds that include the MON15985 event, which confers resistance to Lepidopteran insect damage. Also provided are assays for detecting the presence of the MON15985 event based on the DNA sequence of the recombinant construct inserted into the cotton genome that resulted in the MON15985 event and/or the genomic sequences flanking the insertion site. | 06-16-2011 |
20110143347 | SUBSTANCES AND METHODS FOR A DNA BASED PROFILING ASSAY - The present invention relates to a DNA profiling assay comprising the following steps, providing a sample to be analyzed, providing reagents, enzyme and primer oligonucleotides which are necessary for simultaneous polymerase chain reaction amplification of at least 20 loci, amplifying the loci, detecting the amplification products, wherein the amplification products and the loci to be amplified are characterized by the following features, each locus to be amplified is characterized by at least one deletion-insertion polymorphism known to be present in the population, wherein the two alleles from each locus differ in size by more than 2 nucleotides and less than 100 nucleotides, a first set of at least two amplification products ranging in size from about 20 nucleotides to about 300 nucleotides stemming from at least two different loci carries a first label, a second set of at least two amplification products ranging in size from about 20 nucleotides to about 300 nucleotides stemming from at least two different loci carries a second label, a third set of at least two amplification products ranging in size from about 20 nucleotides to about 300 nucleotides stemming from at least two different loci carries a third label, label one, label two and label three are each different fluorescent labels which can he differentiated and simultaneously detected by a multi-colour detector in combination with, e.g. a DNA sequencing device. | 06-16-2011 |
20110143348 | METHOD FOR QUANTIFYING OR DETECTING DNA - The present invention relates to a method for quantifying or detecting DNA having a target DNA region, and so on. | 06-16-2011 |
20110143349 | METHODS AND COMPOSITIONS FOR DETECTING BK VIRUS - The invention provides methods and compositions for rapid, sensitive, and highly specific nucleic acid-based (e.g., DNA based) detection of a BK virus in a sample. In general, the methods involve detecting a target nucleic acid having a target sequence of a conserved region of BK viral genomes. The invention also features compositions, including primers, probes, and kits, for use in the methods of the invention. | 06-16-2011 |
20110151451 | Use of Conjugates with linkers cleavable by photodissociation or fragmentation for mass spectromety analysis of tissue sections - The invention concerns a method for determining at least one target molecule map in a tissue section, using at east one (A-X)n-B conjugate, wherein A is a tag molecule of known molecular weight, X is a linker that is cleaved during sample desorption/ionization, n is an integer of at least 1, and B is a binding molecule that binds specifically to said target molecule. When using MALDI mass spectrometry, said linker molecule X may be cleaved by photodissociation during sample laser irradiation if photocleavable at the wavelength of said MALDI laser. Alternatively, when using UV-MALDI, IR-MALDI, SIMS or DESI mass spectrometry, said linker molecule X may be cleaved by fragmentation during sample desorption/ionization. | 06-23-2011 |
20110151452 | DETECTION OF STAPHYLOCOCCUS AUREUS AND IDENTIFICATION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS - Aspects of the present invention relate to methods and compositions for the detection and/or quantification of | 06-23-2011 |
20110151453 | NUCLEIC ACID SEQUENCES AND COMBINATION THEREOF FOR SENSITIVE AMPLIFICATION AND DETECTION OF BACTERIAL AND FUNGAL SEPSIS PATHOGENS - The present invention relates to methods of detection, as well as assays, reagents and kits for the specific detection of clinically important bacterial and fungal species. The present invention allows for the specific detection of nucleic acids of each of these pathogens in a single assay. | 06-23-2011 |
20110151454 | Gene expression markers of tumor resistance to HER2 inhibitor treatment - The present invention concerns markers of resistance of HER2 expressing tumors to treatment with HER2 inhibitors, such as HER2 antibodies, including trastuzumab. | 06-23-2011 |
20110151455 | Fish-ribosyn for antibiotic susceptibility testing - The subject invention concerns materials and methods for evaluating the susceptibility of bacterial cells to an antibiotic or other antimicrobial compound or agent. In one embodiment, a sample comprising a microbial population is exposed to an antibiotic of interest. The sample is then processed using FISH-RiboSyn methods to determine the specific growth rate of the antibiotic-exposed microbes as compared to an untreated control. The subject invention also concerns materials and methods for determining the most suitable and/or effective antibacterial treatment for a person or animal having a bacterial infection. | 06-23-2011 |
20110151456 | TEST METHOD FOR TYPE-2 DIABETES USING GENE POLYMORPHISM - The present invention relates to a method of testing for genetic susceptibility to type-2 diabetes in a subject that comprises detecting one or more polymorphisms present in the KCNQ1 gene and/or EIF2AK4 gene in a DNA-containing sample collected from the subject. The present invention permit a method of accurately, conveniently, and rapidly testing the genetic susceptibility of subjects to type-2 by targeting determinative genetic factors of genetic susceptibility to type-2 diabetes. | 06-23-2011 |
20110151457 | HYPERTHEROMOSTABLE ENDONUCLEASE IV SUBSTRATE PROBE - The present invention relates to a hyperthermostable endonuclease IV substrate probe to be used in nucleic acid assay methods which can be carried out using hyperthermostable enzymes, including detection of target nucleic acids, and detection of nucleic acid polymorphism. | 06-23-2011 |
20110151458 | METHODS AND REAGENTS FOR THE DETECTION OF SALMONELLA SPP - The invention relates to an in vitro method for the detection of bacteria of the | 06-23-2011 |
20110151459 | SIMULTANEOUS DETECTION OF MULTIPLE NUCLEIC ACID SEQUENCES IN A REACTION - The present invention relates to a method for simultaneously amplifying and detecting nucleic acid sequences in a reaction comprising the following steps: (i) providing a sample comprising at least one nucleic acid molecule; (ii) providing reagents for performing an amplification reaction, wherein the reagents comprise at least four, preferably at least five, more preferably at least six probes, wherein (a) each of the probes is specific for a nucleic acid sequence; (b) at least two, preferably at least three probes carry the same label; and (c) each of the probes that carry the same label has a melting temperature (Tm) which differs by more than 2° C. from the other probes with the same label when they are dissociated from their target nucleic acid sequence by heating; (iii) amplifying the nucleic acid sequences in the reaction; (iv) detecting the amplified nucleic acids by determining whether the labeled probe has bound its nucleic acid sequence; and (v) detecting the temperature at which each given labeled probe dissociates from the nucleic acid sequence to which it has bound. The invention also relates to kits for the use in such a method. | 06-23-2011 |
20110151460 | METHODS AND SYSTEMS OF USING EXOSOMES FOR DETERMINING PHENOTYPES - Exosomes can be used for detecting biomarkers for diagnostic, therapy-related or prognostic methods to identify phenotypes, such as a condition or disease, for example, the stage or progression of a disease. Cell-of-origin exosomes can be used in profiling of physiological states or determining phenotypes. Biomarkers or markers from cell-of-origin specific exosomes can be used to determine treatment regimens for diseases, conditions, disease stages, and stages of a condition, and can also be used to determine treatment efficacy. Markers from cell-of-origin specific exosomes can also be used to identify conditions of diseases of unknown origin. | 06-23-2011 |
20110151461 | DETECTION ALGORITHM FOR PCR ASSAY - The application provides methods for improving the detection accuracy of the binding of labeled nucleic acid probes, such as those used in PCR reactions. One such method comprises measuring the label intensity, e.g. fluorescence, at two different temperatures, a higher temperature and a lower temperature, and then calculating the ratio of the label intensity at the lower temperature over the label intensity at the higher temperature. Another method comprises measuring the label intensity at least two points in time post-PCR and calculating the slope of the label intensity as a function of time. Measuring the hybridization kinetics of the probe binding to the target nucleic acid allows an on-rate slope to be calculated which gives this method good specificity of detection. | 06-23-2011 |
20110159488 | Primers for Amplification and Sequencing of Eubacterial 16S rDNA for Identification - The invention relates to oligonucleotides for the qualitative and/or quantitative amplification and/or the sequencing of 16S rDNA-genes, as well as of fragments thereof and RNA derived thereof. It relates to their use as primers in amplification reactions and in sequencing, in particular in combination for the identification of the genus/species/strain of the bacterial sample or clinical isolate. | 06-30-2011 |
20110159489 | SINGLE NUCLEOTIDE POLYMORPHISMS ASSOCIATED WITH DIETARY WEIGHT LOSS - The present invention relates to genetic polymorphisms associated with obesity and obesity-related phenotypes and their use in predicting if an individual successfully completes a dietary weight loss intervention program. | 06-30-2011 |
20110159490 | USE OF THE COMBING PROCESS FOR THE IDENTIFICATION OF DNA ORIGINS OF REPLICATION - Eukaryotic genomes are duplicated by the activation of multiple bidirectional origins of replication. The replication programs of these cells depend on the temporal and spatial organisation of replication origins throughout the genome. To investigate the replication program in a higher eukaryote, we employed a technique called molecular combing. This technique allows for a quantitative analysis of DNA replication on a genome wide basis. As a model system, | 06-30-2011 |
20110159491 | Method for detecting cytosine methylation in DNA samples - Described is a method for detecting 5-methylcytosine in genomic DNA samples. First, a genomic DNA from a DNA sample is chemically converted with a reagent, 5-methylcytosine and cytosine reacting differently, and the pretreated DNA is subsequently amplified using a polymerase and at least one primer. In the next step, the amplified genomic DNA is hybridized to at least one oligonucleotide, forming a duplex, and said oligonucleotide is elongated by at least one nucleotide, the nucleotide carrying a detectable label, and the elongation depending on the methylation status of the specific cytosine in the genomic DNA sample. In the next step, the elongated oligonucleotides are analyzed for the presence of the label. | 06-30-2011 |
20110159492 | Diffuse Large B-Cell Lymphoma Markers and Uses Therefore - The present invention provides methods and compositions for prognosing treatment outcome in DLBCL patients, diagnosing DLBCL and monitoring efficacy of DLBCL treatment. | 06-30-2011 |
20110159493 | DIAGNOSTIC POLYMORPHISMS FOR CARDIAC DISEASE - One or more polymorphisms, including single nucleotide polymorphisms (SNPs), or combinations thereof, for diagnosis of cardiac disease, such as heart failure and atrial fibrillation. | 06-30-2011 |
20110159494 | Analyzing the FMR1 Gene - A method of predicting a degree of risk of autoimmunity in a human female is disclosed. The method may include analyzing the female's FMR1 gene, wherein the FMR1 gene has a first allele and a second allele, determining the number of triple CGG repeats on each of the first and second alleles; defining a normal range of triple CGG repeats; and comparing the number of triple CGG repeats on each of the first and second alleles to the normal range. If the triple CGG repeat number for one of the first and second alleles is in the normal range and the triple CGG repeat number for the other one of the first and second alleles is less than the lower boundary of the normal range, then the female is at increased risk of autoimmunity. Additionally, a method of predicting pregnancy chances for a human female is disclosed. The method may include analyzing the female's FMR1 gene, wherein the FMR1 gene has a first allele and a second allele; determining the number of triple CGG repeats on each of the first and second alleles; defining a normal range of triple CGG repeats; and comparing the number of triple CGG repeats on each of the first and second alleles to the normal range. If the triple CGG repeat number for one of the first and second alleles is in the normal range and the triple CGG repeat number for the other one of the first and second alleles is less than the lower boundary of the normal range, then the female has decreased chances of pregnancy. | 06-30-2011 |
20110159495 | METHOD FOR THE QUANTITATIVE DETECTION OF AN ORGANIC SUBSTANCE IN A SAMPLE - A method for the quantitative detection of an organic substance containing a nucleic acid to be detected in a sample based on a given threshold value for that organic substance in the sample, the use of this method, as well as a kit for practicing this method. | 06-30-2011 |
20110165564 | SEQUENCE-SPECIFIC DETECTION OF METHYLATION IN BIOMOLECULES - A method for detecting sequence specific methylation in a biomolecule, comprising: (a) contacting the biomolecule with an S-adenosyl- | 07-07-2011 |
20110165565 | COMPOSITIONS AND METHODS FOR POLYNUCLEOTIDE EXTRACTION AND METHYLATION DETECTION - The present invention features methods and compositions for methylation detection, as well as a novel method for polynucleotide extraction and sodium bisulfite treatment. | 07-07-2011 |
20110165566 | METHODS OF OPTIMIZING TREATMENT OF BREAST CANCER - Breast cancer treatment can be optimized by determining the level of expression of genes in a breast sample from a human to identify a human with an increased likelihood of recurrence of the breast cancer that would potentially benefit from a therapy to decrease the likelihood of recurrence of the breast cancer. | 07-07-2011 |
20110165567 | ABERRANT METHYLATION OF C6Orf150 DNA SEQUENCES IN HUMAN COLORECTAL CANCER - This application describes methods and compositions for detecting and treating C6Orf150-associated neoplasia. Differential methylation of the C6Orf150 nucleotide sequences has been observed in C6Orf150-associated neoplasia such as colon neoplasia. | 07-07-2011 |
20110165568 | SEQUENCES OF E.COLI 055:H7 GENOME - Disclosed is the genomic sequence for | 07-07-2011 |
20110165569 | COMBINATORIAL DNA TAGGANTS AND METHODS OF PREPARATION AND USE THEREOF - DNA taggants in which the nucleotide sequences are defined according to combinatorial mathematical principles. Methods of defining nucleotide sequences of the combinatorial DNA taggants, and using such taggants for authentication and tracking and tracing an object or process are also disclosed. | 07-07-2011 |
20110165570 | METHOD OF EFFECTING DE-DIFFERENTIATION OF A CELL - The invention provides a method of effecting de-differentiation of an at least partially differentiated cell or of maintaining pluripotency and/or self-renewing characteristics of an undifferentiated cell. The method comprises increasing the amount or the activity of an Err protein, or a functional fragment thereof, in the cell. | 07-07-2011 |
20110165571 | HERBICIDE TOLERANT RICE PLANTS AND METHODS FOR IDENTIFYING SAME - The invention provides specific transgenic rice plants, plant material and seeds, characterized in that these products harbor a specific transformation event at a specific location in the rice genome. Tools are also provided which allow rapid and unequivocal identification of the event in biological samples. | 07-07-2011 |
20110165572 | METHODS AND KITS FOR NUCLEIC ACID SEQUENCING - Various embodiments of the present disclosure generally relate to molecular biological protocols, equipment and reagents for the sequencing of target nucleic acid (DNA, RNA, cDNA, etc) molecules. | 07-07-2011 |
20110171637 | METHODS AND NUCLEIC ACIDS FOR ANALYSES OF CELLULAR PROLIFERATIVE DISORDERS - The invention provides methods, nucleic acids and kits for detecting, or for detecting and distinguishing between or among prostate cell proliferative disorders or for detecting, or for detecting and distinguishing between or among colorectal cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of and differentiation between said class of disorders, thereby enabling the improved diagnosis and treatment of patients. | 07-14-2011 |
20110171638 | DIAGNOSIS OF FETAL ABNORMALITIES USING POLYMORPHISMS INCLUDING SHORT TANDEM REPEATS - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, i.e. aneuploidy. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. | 07-14-2011 |
20110171639 | POLYMER FOR DETECTION OF TARGET SUBSTANCE, AND METHOD FOR DETECTION OF TARGET SUBSTANCE - Provided is a method of detecting a target substance by which the target substance can be detected with efficiency and a high sensitivity, and in a simple manner, a target substance detection polymer used in the method, and a method of forming the polymer. The method of detecting a target substance includes the steps of: (A) forming a target substance detection polymer by causing multiple kinds of nucleic acid probes for forming a polymer to react with a binding probe having a region capable of binding to the target substance and a region capable of binding to at least one of the nucleic acid probes in a solution; (B) binding the target substance detection polymer and the target substance; and (C) detecting the target substance detection polymer to which the target substance is bound. | 07-14-2011 |
20110171640 | Method for isolating cell free apoptotic or fetal nucleic acids - The present invention provides methods for isolating cell free nucleic acid, e.g., apoptotic or fetal nucleic acids and methods of detecting neoplastic cells or identifying the genetic composition of a fetus. The invention also provides magnetic particles comprising an anti-DNA antibody, and kits comprising the magnetic particles. | 07-14-2011 |
20110171641 | Gene Expression Markers of Recurrence Risk in Cancer Patients After Chemotherapy - The present invention relates to genes, the expression levels of which are correlated with likelihood of breast cancer recurrence in patients after tumor resection and chemotherapy. | 07-14-2011 |
20110171642 | Analysing Methylation Specific PCR by Amplicon Melting - The present invention provides a method of evaluating DNA methylation in a sample. The method comprises (i) reacting the DNA with an agent that differentially modifies methylated cytosine and non-methylated cytosine to produce modified DNA, (ii) amplifying the modified DNA by methylation specific PCR to produce amplified DNA, and (iii) subjecting the amplified DNA to melting analysis. In the method the methylation specific primers are selected such that the sequence between the primers includes a region of known sequence variation and/or at least one cytosine nucleotide. | 07-14-2011 |
20110171643 | METHOD, PROCESS, AND KIT FOR CANCER DIAGNOSIS, PROGNOSIS, AND AFTERCARE - A method or process for the diagnosis/prognosis/follow-up of cancer in vertebrates, comprising the following steps:
| 07-14-2011 |
20110171644 | Multiplex capture of nucleic acids - Methods of capturing two or more nucleic acids simultaneously from a single sample are provided. Different nucleic acids are captured through cooperative hybridization events on different subsets of particles or at different selected positions on a spatially addressable solid support. Methods of capturing one or more long nucleic acids and methods of capturing one or more nucleic acid for sequencing are also provided. Compositions, kits, and systems related to the methods are also described. | 07-14-2011 |
20110171645 | METHODS OF DIAGNOSING ACUTE CARDIAC ALLOGRAFT REJECTION - The present invention relates to methods of diagnosing acute rejection of a cardiac allograft using genomic expression profiling, proteomic expression profiling, metabolite profiling, or alloreactive T-cell genomic expression profiling, | 07-14-2011 |
20110171646 | MICRORNA EXPRESSION PROFILE ASSOCIATED WITH PANCREATIC CANCER - Methods are provided for diagnosing whether a subject has, or is at risk of developing, pancreatic cancer. The methods include measuring the level of at least one miR gene product in a biological sample derived from the subject's pancreas. An alteration in the level of the miR gene product in the biological sample as compared to the level of a corresponding miR gene product in a control sample, is indicative of the subject either having, or being at risk for developing, pancreatic cancer | 07-14-2011 |
20110171647 | METHOD FOR QUANTIFYING OR DETECTING DNA - The present invention relates to a method for quantifying or detecting DNA having a target DNA region, and so on. | 07-14-2011 |
20110171648 | METHOD OF DETECTING AND QUANTIFYING HEPATITIS C VIRUS - Methods, reagents, and kits for detecting hepatitis C virus (HCV) in biological samples. | 07-14-2011 |
20110171649 | DETECTION OF NUCLEIC ACIDS BY OLIGONUCLEOTIDE PROBES CLEAVED IN PRESENCE OF ENDONUCLEASE V - Particular aspects provide nucleic acid detection methods comprising contacting a test sample having a nucleic acid target sequence with at least one endo-V-cleavable oligonucleotide probe complementary to the target sequence in the presence of an endonuclease V, incubating the reaction mixture under conditions suitable to support hybridization of the endo-V-cleavable oligonucleotide probe with the target nucleic acid and endonuclease V-mediated cleavage of the target-hybridized probe, and detecting at least one endonuclease V-mediated cleavage product of the target-hybridized probe wherein the presence of the cleavage products is indicative of the presence of the target nucleic acid sequence in the sample. Particular aspects comprise amplification of the target nucleic acid sequence before and/or during the incubating and/or detecting, wherein detecting is post-amplification and/or real-time. Additional aspects provide suitable kits. Further aspects comprise use of at least one nick-directing modification or other structural modification of the at least one endo-V-cleavable oligonucleotide probe. | 07-14-2011 |
20110171650 | GENE EXPRESSION RELATED TO PREECLAMPSIA - Gene expression patterns contemporaneous with early placental development in the first trimester of preeclamptic versus unaffected pregnancies have been obtained. Observation of differences in these gene expression patterns has allowed the identification of biomarkers that are useful in predicting and monitoring preeclampsia. These biomarkers are also useful in screening potential therapeutics for efficacy in the prevention or treatment of preeclampsia. | 07-14-2011 |
20110177500 | IMMUNOHISTOCHEMISTRY DETECTION METHOD - The invention provides compositions and methods for the detection of targets in a sample; in particular, an immunohistochemistry (IHC) sample. Probes and detectable labels may be provided in multiple layers in order to increase the flexibility of a detection system, and to allow for amplification to enhance the signal from a target. The layers may be created by incorporating probes and detectable labels into larger molecular units that interact through nucleic acids base-pairing, including peptide-nucleic acid (PNA) base-pairing. Optional non-natural bases allow for degenerate base pairing schemes. The compositions and methods are compatible with immunohistochemistry (IHC), but also could be used in immunocytochemistry (ICC), in situ hybridization (ISH), flow cytometry, enzyme immuno-assays (EIA), enzyme linked immuno-assays (ELISA), blotting methods (e.g. Western, Southern, and Northern), labeling inside electrophoresis systems or on surfaces or arrays, and precipitation, among other general detection assay formats. The invention is also compatible with many different types of targets, probes, and detectable labels. | 07-21-2011 |
20110177501 | BIOSENSOR FOR DETECTION AND VISUALISATION OF SINGLE-STRANDED DNA - A modified protein of the single strand DNA-binding domain, SSB family comprising a detectable label is disclosed. The label has detectable characteristics which alter on binding single stranded DNA. The protein is thus useful in an assay for single stranded DNA. | 07-21-2011 |
20110177502 | IDENTIFICATION OF PEDIATRIC ONSET INFLAMMATORY DISEASE LOCI AND METHODS OF USE THEREOF FOR THE DIAGNOSIS AND TREATMENT OF THE SAME - Compositions and methods for detection and treatment of inflammatory bowel disease are provided. | 07-21-2011 |
20110177503 | CARDIAC RISK STRATIFICATION BY NOS1AP GENOTYPING - A risk-conferring genetic modifier is found in a large LQTS cohort. A NOS1AP tag SNP genotype provides an additional clinical assessment, which helps assess risk and choice of therapeutic strategies in LQTS as well as other conditions such as Brugada Syndrome, and catecholaminergic polymorphic ventricular tachycardia (CPTV). | 07-21-2011 |
20110177504 | METHODS FOR DETECTING INFLAMMATORY BOWEL DISEASE - The present invention provides for a method of detecting the presence of inflammatory bowel disease in gastrointestinal tissues or cells of a mammal by detecting increased expression of LY6 genes in the tissues or cells of the mammal relative to a control. | 07-21-2011 |
20110177505 | DNA Methylation Analysis of Regulatory T Cells Through DNA-Methylation Analysis of the TSDR Region of the Gene FOXP3 - The present invention relates to a method, in particular an in vitro method for identifying FoxP3-positive CD25+CD4+ regulatory T cells of a mammal, comprising analyzing the methylation status of at least one CpG position in the FOXP3 gene, in particular its “upstream” regulatory regions, and in particular the promoter and the TSDR region of the gene foxp3, wherein a demethylation to at least 90% of at least one CpG in the sample as analyzed is indicative for a FoxP3-positive CD25 | 07-21-2011 |
20110177506 | AMPLIFICATION OF TRP1 FOR SPECIFIC DETECTION OF PHYTOPHTHORA RAMORUM - is currently a devastating disease for many plant species and infection presents significant economic problems, and in particular has lead to devastating effects on many specie of oak trees. The present invention provides methods and kits for selective detection of | 07-21-2011 |
20110177507 | OLIGONUCLEOTIDES FOR GENOTYPING THYMIDYLATE SYNTHASE GENE - Oligonucleotides for genotyping the thymidylate synthase gene are provided. The number of tandem repeats in the promoter region of the thymidylate synthase gene can be identified based on the hybridization of an oligonucleotide of the invention to the genomic DNA of a subject. Therefore, the genotype of the thymidylate synthase gene can be identified based on the number of tandem repeats. The genotype relates to the responsiveness of a subject towards an antitumor agent. | 07-21-2011 |
20110177508 | UNIVERSAL METHYLATION PROFILING METHODS - This invention provides methods of derivatizing a double-stranded DNA comprising contacting double-stranded DNA with a CpG methyltransferase and an s-adenosylmethionine analog. This invention also provides methods of sequencing DNA to determine methylation patterns. This invention also provides neobases and methods of sequencing for methylation patterns using neobases. | 07-21-2011 |
20110177509 | RISK FACTORS AND A THERAPEUTIC TARGET FOR NEURODEGENERATIVE DISORDERS - Compositions and methods for detecting a neurodegenerative disorder, and methods of treating a neurogenerative disorder are disclosed. Biomarkers for a neurodegenerative disorder containing a polymorphism in the nucleotide sequence of PP3R1, GSK3beta, PPP3CA, FYN, WISP1, MGEA5, CTSD, F2, MAPT, OGT or PRKCA are also disclosed. A method for detecting a neurodegenerative disorder by detecting polymorphisms in the above genes is further disclosed. | 07-21-2011 |
20110177510 | METHOD AND PROBE SET FOR DETECTING CANCER - Methods for detecting cancer that include hybridizing a set of chromosomal probes to a biological sample obtained from a patient, and identifying if aneusomic cells are present in a selected subset of cells obtained from the biological sample are described. A set of chromosomal probes and kits for detecting cancer that include sets of chromosomal probes, are also described. | 07-21-2011 |
20110177511 | METHOD FOR DETERMINING BREAST CANCER METASTASIS AND METHOD FOR EVALUATING SERUM - It is determined that the breast cancer has metastasized when methylation is detected in the CpG island of at least one selected from the group consisting of GSTP1, RASSF1A and RARb by detecting methylation in CpG island of each of GSTP1, RASSF1A and RARb contained in serum obtained from a patient who has undergone surgery to remove breast cancer. | 07-21-2011 |
20110183326 | FREE CIRCULATING DNA BIO-MARKERS AND THEIR APPLICATIONS - This invention relates generally to methods for detecting cell damage as a consequence of pathophysiological or traumatic insults such as in a nuclear accident, bioterror attack, tumorigenesis, infections or in individuals with cardiovascular disease. | 07-28-2011 |
20110183327 | Labelled nucleotides - Nucleosides and nucleotides are disclosed that are linked to detectable labels via a cleavable linker group. | 07-28-2011 |
20110183328 | DETECTING NEOPLASM - This document relates to methods and materials for detecting premalignant and malignant neoplasms. For example, methods and materials for determining whether or not a stool sample from a mammal contains nucleic acid markers or polypeptide markers of a neoplasm are provided. | 07-28-2011 |
20110183329 | PROTEIN PHOSPHATASE-1 INHIBITOR-1 POLYMORPHISM AND METHODS OF USE - A method for diagnosing the presence of a G147D polymorphism of human phosphatase-1 inhibitor-1 protein is provided, wherein the method involves determining the presence of the polymorphism in a biological sample from a human subject by means which detect the presence of the polymorphism, wherein the presence of the polymorphism is indicative of a predisposition to impaired functioning of the β-adrenergic signaling pathway. | 07-28-2011 |
20110183330 | Analysis for Nucleic Acids by Digital PCR - The present invention provides a method for analyzing nucleic acids for their lengths and relative abundance in a sample, based on digital amplification of individual template molecules. This invention has many applications, including those in noninvasive prenatal diagnosis, transplantation monitoring, and the detection and monitoring of cancers and virus-associated diseases. | 07-28-2011 |
20110183331 | RNA IN SITU HYBRIDIZATION - Disclosed is a method for identifying the presence of a target gene mRNA, which comprises hybridizing one or more oligonucleic acid probes with the target gene mRNA expressed in a tissue sample, and detecting a low-molecular-weight compound label added to at least one of the bases of the oligonucleic acid probes,
| 07-28-2011 |
20110183332 | METHOD FOR RECOVERING NUCLEIC ACID FROM STOOL SAMPLE, NUCLEIC ACID ANALYSIS METHOD AND STOOL SAMPLE PROCESSING APPARATUS - The present invention relates to the a nucleic acid analysis method that uses nucleic acid recovered according to the nucleic acid recovery method, and a stool sample processing apparatus used in that method, wherein the method has steps of: (A) eluting nucleic acid amplification reaction inhibitory substances by preparing a stool sample by adding a collected stool to a solution for removing nucleic acid amplification reaction inhibitory substances that has a water-soluble organic solvent as an active ingredient thereof, and storing the stool sample for a predetermined time, (B) recovering a stool-derived solid fraction by removing the solution for removing nucleic acid amplification reaction inhibitory substances from the stool sample after step (A), and (C) recovering nucleic acid from the stool-derived solid fraction recovered in step (B). | 07-28-2011 |
20110183333 | METHOD FOR PREDICTION OF THE PROGRESSION RISK OF TUMORS - The present invention concerns a method for predicting the potential for aggressive growth and/or the risk to progress to high grade cancer for tumors in cell based detection procedures. In one aspect the invention concerns the detection of overexpression of cyclin-dependent kinase inhibitor gene products as a tool for predicting the progression risk and/or potential for aggressive growth of tumors. In a second aspect the invention concerns predicting the progression risk and/or potential for aggressive growth in tumors on the basis of the simultaneous co-detection of the presence of overexpression of cyclin-dependent kinase inhibitor gene products together with the expression of markers for active cell proliferation. Further the invention concerns preparations of probes for diagnosis namely for predicting the progression risk and/or the potential for aggressive growth of tumors. | 07-28-2011 |
20110183334 | METHOD FOR DETECTION OF CANCER BASED ON SPATIAL GENOME ORGANIZATION - The invention provides methods of detecting abnormal cells in a sample using the radial position of one or more genes within the nucleus of a cell, as well as a kit for detecting abnormal cells using such methods. The invention also provides methods of identifying gene markers for abnormal cells using the radial position of one or more genes within the nucleus of a cell. | 07-28-2011 |
20110183335 | METHODS AND COMPOSITIONS FOR PERIOPERATIVE GENOMIC PROFILING - The present invention relates to methods for perioperative genomic screening of subjects, in particular to perioperative screening for markers indicative of responses to anesthesia and other perioperative or operative treatments and procedures. The present invention also provides compositions for use in screening methods. The methods and compositions of the present invention find use in tailoring a subject's medical or surgical treatment to reflect genetic information that predicts a subject's response to medications or techniques used in the procedure. | 07-28-2011 |
20110189663 | ASSESSMENT OF RISK FOR COLORECTAL CANCER - Disclosed is a method for identifying an individual who has an altered risk for developing colorectal cancer comprising detecting a single nucleotide polymorphism (SNP). | 08-04-2011 |
20110189664 | DIAGNOSTICS IN A MONOPLEX/MULTIPLEX FORMAT - The present invention relates to a method of detecting and/or quantifying a target molecule from a sample obtained from a subject wherein the method comprises: (i) incubating a fusion protein or conjugate comprising a Ter binding polypeptide fused to at least one anti-target molecule or fragment thereof with a partially double-stranded oligonucleotide for a time and under conditions sufficient to bind to said Ter binding polypeptide thereby producing a complex; (ii) incubating said complex in the presence of said sample comprising said target molecule for a time and under conditions sufficient for said anti-target molecule to bind to said target molecule thereby producing a target-bound complex; (iii) incubating said target-bound complex in the presence of at least one immobilised molecule wherein said immobilised molecule has an affinity to said target molecule; (iv) incubating said immobilised molecule for a time and under conditions sufficient to bind to said target molecule thus immobilising said target molecule; and (v) detecting and/or quantifying said target molecule. | 08-04-2011 |
20110189665 | METHODS FOR DETECTING DRUG-RESISTANT MICROBES - The present invention provides methods and oligonucleotides for detecting drug-resistant microbes, such as vancomycin resistant | 08-04-2011 |
20110189666 | NUCLEIC ACID PROBE SET AND METHOD OF USING THE SAME - A nucleic acid probe set includes (A) a fluorescent probe and (B) a binding probe. The fluorescent probe (A) is formed of an oligonucleotide including (a) a nucleotide labeled with a fluorescent substance. The binding probe (B) is formed of an oligonucleotide having (b | 08-04-2011 |
20110189667 | METHOD OF SCREENING FOR NOVEL EXON 1 MUTATIONS IN MECP2 ASSOCIATED WITH CLASSICAL RETT SYNDROME - Recently, a new MECP2 isoform, which has an alternative N-terminus, transcribed from exon 1, was described. Since the incorporation of exon 1 into standard sequencing protocol for Rett syndrome, few patients with exon 1 mutations have been described and several groups have concluded that exon 1 mutations are a rare cause of Rett syndrome. The present invention provides an improved method of diagnosing Rett Syndrome by identifying two different mutations in exon 1 of the MECP2 gene, the first of which results in a switch from alanine to valine at the beginning of a polyalanine stretch, and the second of which results in a disruption of the ATG initiation codon of exon 1. Patients having either such mutation fit the clinical criteria for classic Rett syndrome, and further support previous reports that exon 1 mutations may be associated with a severe phenotype. | 08-04-2011 |
20110189668 | Methods for determining likelihood of longevity and of developing an age-related disease - The present invention provides a method for identifying a subject's likelihood of achieving longevity or of developing an age-related disease, the method for identifying a subject's likelihood of achieving longevity or of developing an age-related disease comprising detecting at least one specified single nucleotide polymorphisms or genotype at a single nucleotide polymorphism or combination of a genotype at a first single nucleotide polymorphism and a genotype at a second single nucleotide polymorphism in a sample of the subject's DNA and, wherein the detection of at least one single nucleotide polymorphisms or genotype at a single nucleotide polymorphism or combination of a genotype at a first single nucleotide polymorphism and a genotype at a second single nucleotide polymorphism identifies the subject's as likely achieving longevity or of developing an age-related disease. | 08-04-2011 |
20110189669 | METHODS OF AIDING IN THE DIAGNOSIS OF PROSTATE CANCER - The current invention provides a method for aiding in the assessment of prostate cancer (including metastatic prostate cancer) and/or benign prostate hyperplasia in a patient, wherein the method comprises the step of determining the level of Glycine N-methyltransferase (GNMT) nucleic acid and/or protein in a sample from the patient. The invention also provides compounds that target Glycine N-methyltransferase (GNMT) protein and/or nucleic acid for use in treating prostate cancer. Also provided are screening methods for selecting a compound considered to be useful in treating prostate cancer, comprising the steps of determining the ability of a test compound to reduce GNMT activity and selecting a compound that reduces GNMT activity. The invention also provides methods for aiding in the diagnosis of prostate cancer in a patient comprising obtaining a sample from the patient and assessing said sample for a marker of GNMT activity. | 08-04-2011 |
20110189670 | Circulating Tumor and Tumor Stem Cell Detection Using Genomic Specific Probes - The present invention comprises a method of detecting circular tumor cells and methods of detecting, evaluating, or staging cancer in a patient, as well as a method of monitoring treatment of cancer in a patient using the claimed method. The method comprises contacting a sample with a CD45 binding agent; selecting the cells based on positive or negative CD45 staining; contacting the selected cells with a labeled nucleic acid probe, and detecting hybridized cells by fluorescence in situ hybridization; and analyzing a signal produced by the labels on the hybridized cells to detect the CTCs. In other embodiments, the method provides for directed to a method of determining the level of CTCs in a sample having blood cells from a patient by contacting a sample having blood cells from a patient, wherein the sample has not been pre-sorted into CD45-positive and CD45-negative cells. | 08-04-2011 |
20110189671 | NUCLEOSIDE TRIPHOSPHATE DERIVATIVE, NUCLEIC ACID PROBE, MULTILABELED NUCLEIC ACID PROBE, METHOD FOR PRODUCTION OF MULTILABELED NUCLEIC ACID PROBE, AND METHOD FOR DETECTION OF TARGET NUCLEIC ACID - A novel nucleoside triphosphate derivative, a nucleic acid probe, and a multilabeled nucleic acid probe that can detect a target nucleic acid conveniently and with high sensitivity, as well as a method for producing the multilabeled nucleic acid probe, and a method for detecting a target nucleic acid using the multilabeled nucleic acid probe or the nucleic acid probe. A target nucleic acid can be detected conveniently and with high sensitivity by using a transglutaminase (TGase), and by using a multilabeled nucleic acid probe in which a plurality of labeling portions have been introduced in advance by covalent binding, or by introducing a plurality of labeling portions by covalent binding into a nucleic acid probe that has been hybridized with the target nucleic acid. | 08-04-2011 |
20110189672 | DIAGNOSTIC METHODS INVOLVING DETERMINING GENE COPY NUMBERS AND SNPs IN THE FcyRll/FcyRlll GENE CLUSTER, AND PROBES FOR USE IN SUCH METHODS TO DETECT SUSCEPTIBILITY TO AND TREATMENT EFFICACY IN AUTOIMMUNE DISEASES - The invention relates to diagnostic methods to predict whether a subject is predisposed for acquiring a disease or to predict the therapy responsiveness of an individual patient. Provided is a method for determining whether a subject is predisposed for developing an autoimmune disease, comprising determining in a sample isolated from said subject the amount of intact genes, or gene products thereof, of the FcγRII/FcγRIII gene cluster, said gene cluster comprising the FCGR2C, FCGR3A, FCGR2A and FCGR3B genes encoding an activating FcγR, and FCGR2B encoding an inhibitory FcγR; and correlating said amount to the amount observed in a healthy population. Also provided is a method to predict the responsiveness of a subject to therapy with intravenous immunoglobulin (IVIg) therapy or a monospecific biological, such as a humanized or human monoclonal antibody or a chimeric molecule, comprising the C-terminal Fc-tail of IgG. | 08-04-2011 |
20110189673 | STOOL SAMPLE PREPARATION METHOD, SOLUTION FOR PREPARING STOOL SAMPLE AND STOOL COLLECTION KIT - The present invention relates to the providing of a method for preparing a stool sample that enables nucleic acids in a stool to be stably preserved without requiring a complex procedure, a stool sample preparation solution and stool collection kit used in that method, and a method for recovering and analyzing nucleic acids in a stool using a stool sample prepared according to the preparation method of the present invention, and a stool sample having superior preservation of nucleic acids contained in the stool sample is prepared by mixing a collected stool with the stool sample preparation solution having for an active ingredient thereof a water-soluble organic solvent containing an organic acid. | 08-04-2011 |
20110189674 | METHOD FOR QUANTIFYING OR DETECTING DNA - The present invention relates to a method for quantifying or detecting DNA having a target DNA region, and so on. | 08-04-2011 |
20110189675 | Method For Administering Anticoagulation Therapy - The present invention provides a method for use in treating a patient with an anticoagulant to optimize drug therapy and/or to prevent an adverse drug response. More particularly, the present invention relates to a method and system for use in treating a patient with Coumadin® or a substance containing warfarin. Methods of the present invention utilize variables that include the patient's CYP4F2 genotype. | 08-04-2011 |
20110189676 | COMPOSITIONS FOR USE IN IDENTIFICATION OF FUNGI - The present invention relates generally to identification of fungi pathogens, and provides methods, compositions, systems and kits useful for this purpose when combined, for example, with molecular mass or base composition analysis. | 08-04-2011 |
20110195408 | Labeling Dye for Detecting Biomolecule, Labeling Kit, and Method for Detecting Biomolecule - A labeling dye of the present invention includes a coloring portion comprising an organic EL-dye, a bonding portion to be bonded with a biomolecule and a spacer portion for linking the coloring portion and the bonding portion. The present invention provides a high incorporation ratio and also high fluorescence intensity in solid state. | 08-11-2011 |
20110195409 | STREPTOCOCCUS PYOGENES CLASSIFICATION - The difference Lancefield T-serotypes correlate with the sequence of the pilus backbone protein (Pbp) in | 08-11-2011 |
20110195410 | Compositions and methods related to solid phase sequence detection and genotyping - The present invention provides improved compositions and methods of sequence detection and single nucleotide (“SNP”) genotyping. The methods of the present invention are related to combining sequence or allelic specific ligation on a solid phase platform with specific and efficient solid phase signal amplification. The methods for sequence detection include a first, second and third oligonucleotide. The methods of SNP genotyping include four oligonucleotides for SNPs associated with two alleles and additional oligonucleotides may be added for SNPs associated with more than two alleles. The usefulness of the present method is that it results in the determination of thousands of genotypes simply, rapidly and inexpensively on a solid support from a single genomic DNA sample. | 08-11-2011 |
20110195411 | ARL-1 SPECIFIC ANTIBODIES AND USES THEREOF - This invention provides antibodies immunologically specific for human ARL-1 (also referred to AKR1B10), a species of the aldo-keto reductase superfamily of proteins. The invention also provides methods of making and methods of using said antibodies. | 08-11-2011 |
20110195412 | Predictive Biomarkers for Response to Exercise - A set of biomarkers have been identified that allows one to predict subjects who will respond to an exercise regime in term of cardiorespiratory fitness as assessed by maximal oxygen uptake. These predictions may be used, for example, to predict risk of cardiovascular disease, to design a more effective program for cardiac rehabilitation, to predict capacity for athletic performance or physically demanding occupation, and to predict ability to maintain functional capacity with aging using exercise. | 08-11-2011 |
20110195413 | Integrated Method for Enriching and Detecting Rare Cells from Biological Body Fluid Sample - The present invention relates to an integrated method for enriching and detecting rare cells in biological body fluid sample. The enriching method comprises: (a) removing plasma protein by centrifugation; (b) optionally adding a red cell lysis solution to carry out red cell lysis so as to remove the red blood cells; (c) adding immunomicrospheres or immunoadsorbent to incubate; and (d) carrying out density centrifugation based on a special cell separation medium for separating the circulating rare cells, residual red blood cells after removing red blood cells and the white blood cells combined on the immunomicrospheres. The method for detecting the enriched rare cells according to the present invention comprises combining immunohistochemistry based staining with immunofluorescence, or bicolor, tricolor or multicolor staining based on immunohistochemistry, and observing and identifying by fluorescence or ordinary optical microscope or a scanner based on microscope principle. The novel and unique method for enriching and staining has been proved to have low cost and can rapidly, effectively and high specifically enrich and quantitatively detect the rare cells in blood. | 08-11-2011 |
20110195414 | Method and Markers for Determining the Genotype of Horned/Polled Cattle - Provided herein are methods to discover and use single nucleotide polymorphisms (SNP) for determining the genotype of a horned/polled ruminant subject. The present invention further provides specific nucleic acid sequences, SNPs, and SNP patterns that can be used for determining the genotype of a horned/polled ruminant subject. | 08-11-2011 |
20110200993 | NEW TREATMENT OF AUTOIMMUNE CONDITIONS - The invention relates to methods and materials involved in diagnosing and treating autoimmune conditions. In particular, the invention relates to methods and materials involved in identifying agent suitable for the prophylaxis, prevention and/or treatment of an autoimmune condition. The invention further relates to methods and materials involved in diagnosing autoimmune diseases like arthritis, multiple sclerosis and inflammatory bowels disease accompanied by decreased cellular uptake of amino acids caused by defects in cellular amino acid transporters like Slc38A1 (Solute carrier family 38, member 1). The invention also relates to methods and materials involved in diagnosing, treating, preventing, or delaying the onset and ameliorating the symptoms of autoimmune conditions that are accompanied by defects in cellular amino acid transporters. | 08-18-2011 |
20110200994 | Method for Diagnosing a Genetic Predisposition for Vascular Disease - The invention relates to a method for diagnosing a genetic predisposition for a vascular disease, in particular for a coronary artery disease (CAD). According to the invention, the method has the following steps: Providing a sample containing a nucleic acid derived from the gene GCH1; and determining the presence or absence of a nucleotide polymorphism (SNP) of the gene GCH1 in the nucleic acid, wherein the SNP is selected from the group consisting of rs8007267 G>A, rs3783641 A>T, and rs10483639 C>G, wherein the presence of at least one of said SNPs indicates a genetic predisposition for a vascular disease. | 08-18-2011 |
20110200995 | OPTIMIZED PROBES AND PRIMERS AND METHODS OF USING SAME FOR THE DETECTION, SCREENING, ISOLATION AND SEQUENCING OF VANCOMYCIN RESISTANCE GENES AND VANCOMYCIN RESISTANT ENTEROCOCCI - Described herein are primers and probes useful for detecting, screening, isolating, and sequencing of the vancomycin resistance genes and vancomycin resistant Enterococci and methods of using the described primers and probes. | 08-18-2011 |
20110200996 | COMPOSITIONS AND METHODS FOR DETECTION OF COLORECTAL CANCER - We have identified a new variant of ileal bile acid binding protein (IBABP), designated IBABP-L, which is a biomarker for colorectal cancer. The transcript for IBABP-L arises from an alternative start site and includes three exons that are absent in IBABP. IBABP-L also shares part of a fourth exon with IBABP. The protein encoded by IBABP-L contains a deduced 49 residue N-terminal sequence that is not found in the IBABP protein. The present invention provides methods for diagnosing colorectal cancer and other compositions and methods based on this discovery. | 08-18-2011 |
20110200997 | COMPOSITIONS FOR USE IN IDENTIFICATION OF ENTERIC BACTERIAL PATHOGENS - The present invention relates generally to identification of enteric bacterial pathogens, and provides methods, compositions and kits useful for this purpose when combined, for example, with molecular mass or base composition analysis. | 08-18-2011 |
20110200998 | Prognosis and Therapy Predictive Markers and Methods of Use - Disclosed is a set of genes differentially expressed in chemotherapy and radiation resistant tumors useful in predicting response to therapy and assessing risk of local-regional failure, survival and metastasis in cancer patients. Also disclosed are methods for characterizing tumors according to gene expression and kits for use in the methods of the invention. | 08-18-2011 |
20110200999 | NOVEL DEVICE AND METHOD FOR RAPID DETECTION OF MICROORGANISMS - The present invention is directed to a platform technology for quick and easy detection and identification of single or multiple microorganisms in a sample using peptide labeled oligonucleotides (PLONs). The PLONs are specifically designed to be complementary to certain nucleic acid sequences on a target microorganism. When the PLONs of the present invention are added to nucleic acids extracted from a sample (both biological and/or non-biological), they hybridize to the specific target nucleic acids of the microorganisms, and the PLONs are then detected with one or more specific enzymes coupled to antibodies that are specific to the conjugated peptides attached to the PLONs. The hybridized PLON-enzyme coupled antibody complex is further localized to a test region on a solid matrix or support by the presence of a composition comprising a secondary antibody to enzyme coupled antibody and provides a specific, sensitive, easy to use tool for the detection and identification that does not require any amplification step and any equipment for the final read out. A kit and methods of use of the invention are also provided. | 08-18-2011 |
20110201000 | METHODS AND MATERIALS FOR DETECTING GENETIC OR EPIGENETIC ELEMENTS - This document provides methods and materials for detecting genetic and/or epigenetic elements. For example, methods and materials for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, methods and materials for detecting the amount of target nucleic acid containing a genetic or epigenetic element within a sample, kits for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, kits for detecting the amount of target nucleic acid containing a genetic or epigenetic element present within a sample, and methods for making such kits are provided. | 08-18-2011 |
20110201001 | METHODS AND MATERIALS FOR ASSESSING RNA EXPRESSION - This document provides methods and materials for assessing RNA expression. For example, methods and materials for detecting the presence, absence, or amount of target nucleic acid (e.g., target RNA or target cDNA produced from target RNA), kits for detecting the presence, absence, or amount of target nucleic acid (e.g., target RNA or target cDNA produced from target RNA), and methods for making such kits are provided. | 08-18-2011 |
20110201002 | 2'-Terminator Nucleotide-Related Methods and Systems - The present invention provides methods of extending primer nucleic acids and sequencing target nucleic acids. The methods include the use of 2′-terminator nucleotides to effect chain termination. In addition to related reaction mixtures and kits, the invention also provides computers and computer readable media. | 08-18-2011 |
20110201003 | METHOD FOR OBTAINING PURKINJE PROGENITOR CELL BY USING NEPH3(65B13) AND E-CADHERIN - 65B13 was discovered to be a useful marker for isolating GABA neuron progenitor cells including Purkinje cells. Furthermore, E-cadherin was revealed to be a useful marker for isolating Purkinje progenitor cells from a 65B13-positive cell population. Specifically, when used in combination with 65B13, E-cadherin was found to be a useful marker for isolating Purkinje progenitor cells. | 08-18-2011 |
20110201004 | Digital Amplification - The identification of pre-defined mutations expected to be present in a minor fraction of a cell population is important for a variety of basic research and clinical applications. The exponential, analog nature of the polymerase chain reaction is transformed into a linear, digital signal suitable for this purpose. Single molecules can be isolated by dilution and individually amplified; each product is then separately analyzed for the presence of pre-defined mutations. The process provides a reliable and quantitative measure of the proportion of variant sequences within a DNA sample. | 08-18-2011 |
20110201005 | Methods and Nucleic Acids for the Detection of Metastasis of Colon Cell Proliferative Disorders - The invention provides methods, nucleic acids and kits for detecting metastasis of colon cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of metastasis of colon cell proliferative disorders, thereby enabling the improved diagnosis and treatment of patients. | 08-18-2011 |
20110201006 | Oligonucleotide Detection Method - The invention relates to a method for the detection of oligonucleotides using anion exchange high performance liquid chromatography. Fluorescently labelled peptide nucleic acid oligomers, complementary to the oligonucleotide are hybridized to the oligonucleotides. Anion exchange high performance liquid chromatography is then performed and the hybridized moieties detected and quantitated. The invention also relates to a method for the simultaneous detection of both strands of an oligonucleotide in parallel from one sample, and a kit for use in qualitative and quantitative detection of one or two strands of an oligonucleotide | 08-18-2011 |
20110201007 | DIAGNOSTIC TEST FOR STREPTOCOCCUS EQUI - The invention relates generally to methods and materials concerning diseases caused by | 08-18-2011 |
20110207122 | METHOD FOR DETERMINATION OF PROGRESSION RISK OF GLAUCOMA - A method of determining the presence or the absence of a glaucoma risk, including the steps of detecting in vitro an allele and/or a genotype of a single nucleotide polymorphism which is located on a 31st base of a base sequence, in a sample from a subject, wherein the base sequence is at least one base sequence selected from the group consisting of base sequences shown in SEQ ID NOs: 203 to 752 or a complementary sequence thereto (step A), and comparing the allele and/or the genotype detected in the step A with at least one of an allele and/or a genotype, containing a high-risk allele, in the base sequences shown in SEQ ID NOs: 203 to 752 (step B). According to the method of the present invention, the level of a progressive risk of glaucoma in a sample donor can be determined by analyzing an allele or a genotype of a single nucleotide polymorphism in the present invention in the sample, so that the sample donor can take a preventive measure of glaucoma, or can receive appropriate treatments, on the basis of this risk. | 08-25-2011 |
20110207123 | METHOD FOR DETECTING CHROMOSOMAL ABNORMALITIES - The invention relates to an in vitro method for detecting chromosomal abnormalities in a mammal, comprising the in situ hybridization of n chromosomes from a metaphase chromosome preparation with sets of a plurality of nucleic acids, each set hybridizing, over a length of 700 000 to 3 000 000 contiguous bp, specifically to the subtelomeric ends specific to said chromosomes, each set being detectably labeled with a fluorochrome, such that each chromosome is distinguishable by a particular fluorochrome or a particular fluorochrome combination. | 08-25-2011 |
20110207124 | Genetic Alterations Associated with Autism and the Autistic Phenotype and Methods of Use Thereof for the Diagnosis and Treatment of Autism - Compositions and methods for the detection and treatment of autism and autistic spectrum disorder are provided. | 08-25-2011 |
20110207125 | METHOD FOR LABELLING A PRODUCT USING A PLURALITY OF POLYNUCLEOTIDES, METHOD FOR IDENTIFYING THE LABELLING AND LABELLED PRODUCT - A method for labeling a product includes a step of adding on or in the product a plurality of single-stranded polynucleotides, which plurality of polynucleotides includes at least one target polynucleotide constituted of a single-stranded polynucleotide of predetermined length and sequence, and decoy polynucleotides which have identical or different predetermined lengths and identical or different predetermined sequence, which decoy polynucleotides have a length or lengths identical to or different from and sequences different from the sequence of the at least one target polynucleotide, wherein each of the target and decoy polynucleotides does not hybridize with any of the other polynucleotides of the plurality of polynucleotides and wherein the polynucleotides of the plurality of polynucleotides are deoxyribonucleic or ribonucleic acid sequences, respectively having the same proportion of the four, natural or modified, bases A, C, G, and T, or A, C, G and U. | 08-25-2011 |
20110207126 | CELL-BASED SCREEN FOR AGENTS USEFUL FOR REDUCING NEURONAL DEMYELINATION OR PROMOTING NEURONAL REMYELINATION - This invention is in the field of neurology. Specifically, the invention relates to the discovery and characterization of molecular components that play a role in neuronal demyelination or remyelination. In addition, the invention relates to the generation of an animal model that exhibits hypomyelination. The compositions and methods embodied in the present invention are particularly useful for drug screening and/or treatment of demyelination disorders. | 08-25-2011 |
20110207127 | MARKERS FOR DETECTION OF LEGIONELLA PNEUMOPHILA STRAINS - The invention relates to a method of detecting | 08-25-2011 |
20110207128 | METHODS AND KITS FOR DETERMINING BIOLOGICAL AGE AND LONGEVITY BASED ON GENE EXPRESSION PROFILES - Described herein are methods of predicting the likelihood of survival in a subject. Additionally, described herein are methods of modulating survival in a subject. | 08-25-2011 |
20110207130 | Method of detecting tumor-associated hypermethylated DNA in plasma or serum - This invention relates to detection of specific extracellular nucleic acid in human or animal blood plasma or serum associated with disease. Specifically, the invention relates to detection of nucleic acid derived from mutant oncogenes or other tumor-associated DNA including non-mutated hypermethylated DNA, and to methods of detecting and monitoring extracellular mutant oncogenes or tumor-associated DNA including non-mutated hypermethylated DNA found in blood plasma or serum. In particular, the invention relates to the detection, identification, or monitoring of the existence, progression or clinical status of neoplasia in humans or other animals that contain a mutation that is associated with the neoplasm through detection of the non-mutated hypermethylated nucleic acid of the neoplasm in plasma or serum fractions. | 08-25-2011 |
20110207131 | MULTIPLEX AMPLIFICATION AND DETECTION - The invention relates to the field of multiplex amplification. In particular, the invention relates to methods for assaying a sample for one or more nucleic acid targets in a single reaction based on the distinct melting temperatures or melting profiles of primers and/or probes. The invention also provides probes and kits for use in such methods. | 08-25-2011 |
20110207132 | PROBES AND METHODS FOR DETECTING ANALYTES - Embodiments disclosed herein relate generally to probes, methods, and kits for detecting the presence of a target analyte. The probe generally comprises two strands that have regions of complementarity and do not associate with each other at the reaction temperature. In the presence of an analyte, the two strands of the probe can hybridize to each other, and the analyte can hybridize to both strands of the probe in a juxtapose manner to form a tripartite structure (probe-analyte complex). If the region of complementarity between the two probe strands contain cognate restriction endonuclease (REN) sequences, then the formation of the tripartite structure will lead to the generation of a REN site that can be cleaved by a REN, and the cleavage can then be detected by a variety of methods to signal the presence of the analyte. | 08-25-2011 |
20110207133 | BINDING AND FUNCTIONAL ASSAYS THAT USE THE T1R3 RECEPTOR TO SCREEN FOR TASTE MODULATORY COMPOUNDS - Newly identified mammalian taste-cell-specific G protein-coupled receptors, and the genes and cDNA encoding said receptors are described. Specifically, T1R G protein-coupled receptors active in taste signaling, and the genes and cDNA encoding the same, are described, along with methods for isolating such genes and for isolating and expressing such receptors. Methods for representing taste perception of a particular tastant in a mammal are also described, as are methods for generating novel molecules or combinations of molecules that elicit a predetermined taste perception in a mammal, and methods for simulating one or more tastes. Further, methods for stimulating or blocking taste perception in a mammal are also disclosed. | 08-25-2011 |
20110207134 | MONITORING HEALTH AND DISEASE STATUS USING CLONOTYPE PROFILES - There is a need for improved methods for determining the diagnosis and prognosis of patients with conditions, including autoimmune disease and cancer, especially lymphoid neoplasms, such as lymphomas and leukemias. Provided herein are methods for using DNA sequencing to identify personalized, or patient-specific biomarkers in patients with lymphoid neoplasms, autoimmune disease and other conditions. Identified biomarkers can be used to determine and/or monitor the disease state for a subject with an associated lymphoid disorder or autoimmune disease or other condition. In particular, the invention provides a sensitive method for monitoring lymphoid neoplasms that undergo clonal evolutions without the need to development alternative assays for the evolved or mutated clones serving as patient-specific biomarkers. | 08-25-2011 |
20110207135 | METHODS OF MONITORING CONDITIONS BY SEQUENCE ANALYSIS - The invention is directed to methods of generating sequence profiles of populations of nucleic acids, whose member nucleic acids contain regions of high variability, such as populations of nucleic acids encoding T cell receptors or B cell receptors. In one aspect, the invention provides pluralities of sets of primers for generating nested sets of templates from nucleic acids in such populations, thereby insuring the production of at least one template from which sequence reads are generated, despite such variability, or dispite limited lenghs or quality of sequence reads. In another aspect, members of such populations are bidirectionally sequenced so that further sequence information is obtained by analyzing overlapping sequence reads in the zones of highest variability. | 08-25-2011 |
20110212441 | Methods and Systems for Inferring Bovine Traits - Methods, compositions, and systems are provided for managing bovine subjects in order to maximize their individual potential performance and edible meat value, and to maximize profits obtained in marketing the bovine subjects. The methods and systems draw an inference of a trait of a bovine subject by determining the nucleotide occurrence of at least one bovine SNP that is identified herein as being associated with the trait. The inference is used in methods of the present invention to establish the economic value of a bovine subject, to improve profits related to selling beef from a bovine subject; to manage bovine subjects, to sort bovine subjects; to improve the genetics of a bovine population by selecting and breeding of bovine subjects, to clone a bovine subject with a specific trait, to track meat or another commercial product of a bovine subject; and to diagnose a health condition of a bovine subject. Methods are also disclosed for identifying additional SNPs associated with a trait, by using the associated SNPs identified herein. | 09-01-2011 |
20110212442 | UNIVERSAL NUCLEIC ACID PROBE SET AND METHOD FOR UTILIZATION THEREOF - A nucleic acid probe set includes (A) a fluorescent probe and (B) a binding probe. The fluorescent probe (A) is formed of an oligonucleotide, which includes (a) a nucleotide unit labeled with (d) a fluorescent substance. The binding probe (B) is formed of an oligonucleotide having (b | 09-01-2011 |
20110212443 | Method for determining the specific growth rate of distinct microbial populations in a non-homogeneous system - The present invention pertains to a molecular biology-based method and kit for measuring the specific growth rate (or cell doubling time) of distinct microbial populations. The method and kit can be used to analyze mixed culture samples that have been exposed to chloramphenicol or other protein synthesis inhibitors for defined times. In a preferred embodiment, the method of the invention (also referred to herein as FISH-RiboSyn) is an in situ method that utilizes fluorescence in situ hybridization (FISH) with probes that target: (1) the 5′ or 3′ end of precursor 16S rRNA; or (2) the interior region of both precursor 16S rRNA and mature 16S rRNA. Images can be captured for a defined exposure time and the average fluorescent intensity for individual cells can be determined. The rate of increase of the whole cell fluorescent intensity is used to determine the specific growth rate. The method of the invention can be attractive for rapidly measuring the specific growth rate (or cell doubling time) of distinct microbial populations within a mixed culture in industries such as environmental systems (water and wastewater treatment systems), bioremediation (optimization of conditions for microbial growth), public health (identification of rapidly growing infectious microbes), and homeland security (identification of rapidly growing bioterrorism agents). | 09-01-2011 |
20110212444 | USE OF METHYLATION STATUS OF MINT LOCI AND TUMOR RELATED GENES AS A MARKER FOR MELANOMA AND BREAST CANCER - The invention relates to a method of detecting melanoma or breast cancer using DNA methylation in MINT17, MINT31, or the promoter region of WIF1, TFPI2, RASSF1A, SOCS1, GATA4, or RARβ2 as a biomarker. Also disclosed are methods of using the biomarker for determining the cancer status and predicting the outcome of the cancer. | 09-01-2011 |
20110212445 | SWI5 GENE AS A DIAGNOSTIC TARGET FOR THE IDENTIFICATION OF FUNGAL AND YEAST SPECIES - The invention relates to the SWI5 gene, the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/or discriminate between fungal and yeast species. | 09-01-2011 |
20110212446 | FAST PCR FOR STR GENOTYPING - Disclosed is a method of amplifying a nucleic acid sequence, wherein the method comprises subjecting a reaction mixture to at least one amplification cycle, wherein the reaction mixture comprises a double-stranded nucleic acid and at least two primers capable of annealing to complementary strands of the double-stranded nucleic acid and amplifying at least one short tandem repeat (STR) using a Family A DNA polymerase in a Fast PCR protocol having a two-step amplification cycle in 25 seconds or less. Also disclosed are real-time PCR methods using the two-step protocol and kits for STR profiling using the Fast PCR protocol. | 09-01-2011 |
20110212447 | Method of Using FOXO3A Polymorphisms and Haplotypes to Predict and Promote Healthy Aging and Longevity - The invention provides methods and compositions relating to identification and use of genetic information from the FOXO3A gene that can be used for determining and increasing an individual's likelihood of longevity and of retaining physical and cognitive function during aging, and for determining and decreasing an individual's likelihood of developing a cardiovascular-, metabolic- or age-related disease, including coronary artery (heart) disease, stroke, cancer, chronic pulmonary disease, diabetes, Parkinson's disease and dementia. | 09-01-2011 |
20110212448 | GAMMACARBOXYGLUTAMATE-RICH PROTEIN, METHODS AND ASSAYS FOR ITS DETECTION, PURIFICATION AND QUANTIFICATION AND USES THEREOF - The presently disclosed subject matter refers to a gammacarboxyglutamate-rich protein that shows in vivo a high capacity to bind calcium through specific gamma carboxylated glutamic acid residues (Gla). It includes a description of the referred protein, purification procedures, protein detection and quantification tools and methods. A kit for the detection and quantification of said protein in samples is contemplated. This kit can include the use of one or more antibodies produced against the homologous sequence of the target species to be analyzed, and thus, methods for the production of such antibodies are disclosed as well. In another aspect, the methods and tools described hereby can be used as biomarkers for evaluation of presence or risk to develop certain diseases. In another aspect of the disclosed subject matter, available complete GRP cDNA and gene sequences obtained from several species also enable the in vitro production of antigens, the quantification of GRP expression, the screening of GRP polymorphisms to access the predisposition for certain diseases and the screening for GRP mutations. | 09-01-2011 |
20110212449 | DISTINGUISHING PCA3 MESSENGER RNA SPECIES IN BENIGN AND MALIGNANT PROSTATE TISSUES - This invention concerns the discovery of two distinct PCA3 mRNA sequences. One of these sequences corresponds to a short PCA3 mRNA molecule whereas the other PCA3 RNA molecule is longer as it comprises an additional sequence between exon 3 and exon 4a. The short RNA is associated with prostate cancer whereas the long RNA sequence is associated with a non-malignant state of the prostate. Based on the differential expression levels of these two PCA3 RNA sequences, protocols for the diagnosis of prostate disease are provided. The invention also relates to therapeutic approaches to prostate cancer. | 09-01-2011 |
20110212450 | Polarization-enhanced detector with gold nanorods for detecting nanoscale rotational motion and method therefor - A nanoscale motion detector attaches a gold nanorod ( | 09-01-2011 |
20110212451 | RNA DETECTION METHOD - The present invention relates to methods for the detection of target RNA sequences and to RNA amplification methods making use of strand displacement techniques employing RNA-dependent RNA polymerases having RNA-oligonucleotide duplex separation activity and being capable of de novo RNA synthesis in the absence of a primer. The present invention further relates to kits for carrying out such methods. | 09-01-2011 |
20110217701 | Prognostic Marker for Endometrial Carcinoma - The present invention relates to a method for diagnosis of different stages of endometrial cancer in an individual. Further, the present invention relates to a method for evaluating the probability of survival for an individual suffering from endometrial carcinoma. In another aspect, the present invention relates to the stratification of therapy regimen of endometrial tumor, ovarian cancer, breast cancer, non-small lung cancer or hormone refractory prostate cancer therapy in an individual or monitoring therapeutic efficacy in an individual suffering from the same based on the expression status of STMN1 gene or protein. Moreover, the present invention relates to a kit for use in any of the above referenced methods comprising a means for determining amplifications and deletions of chromosomal regions 3q26.32 and 12p12.1, determining alterations of the gene expression profile of the genes (gene signature): upregulation of the genes PLEKHK1, ATP10B, NMU, MMP1, ATAD2, NETO2, TNNI3, PHLDA2, OVOL1 and down-regulation of the genes: NDP, KIAA1434, MME, CFH, MOXD1, SLC47A1, RBP1, PDE8B, ASRGL1, ADAMTS19, EFHD1, ABCA5, NPAS3, SCML1, TNXB, ENTPD3, AMY1A, ENPP, RASL11B, PDZK3, or the expression status of the STMN1 gene or protein, respectively. Finally, the present invention provides a method for predicting the response to taxanes in an individual suffering from a disease treated with the taxanes based on the expression status of the STMN1 gene or protein. | 09-08-2011 |
20110217702 | METHODS FOR DIAGNOSIS OF AND PREDICTING TREATMENT EFFICACY OF HORMONE RECEPTOR EXPRESSING TUMORS, CANCERS AND NEOPLASIAS - The invention relates to diagnosis, detection, screening, identifying and predicting methods. In various embodiments, methods of the invention include diagnosis, detection, or screening for a hyperproliferative disorder (e.g., a tumor, cancer or neoplasia) in the subject; identifying a subject that will or is likely to respond to a therapy for a hyperproliferative disorder (e.g., a tumor, cancer or neoplasia); and predicting therapeutic efficacy of a hyperproliferative disorder (e.g., a tumor, cancer or neoplasia) treatment in a subject. | 09-08-2011 |
20110217703 | P2/P2A/P2B GENE SEQUENCES AS DIAGNOSTIC TARGETS FOR THE IDENTIFICATION OF FUNGAL AND YEAST SPECIES - The present invention relates to nucleic acid primers and probes to detect one or more fungal and yeast species. More specifically the invention relates to the P2, P2A and P2B gene sequences (also known as 60S acidic ribosomal protein P2, RLA-2-ASPFU, Allergen ASP f8 or Afp2), the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/or discriminate fungal and yeast species. | 09-08-2011 |
20110217704 | LEPA/GUF1 GENE SEQUENCES AS A DIAGNOSTIC TARGET FOR THE IDENTIFICATION OF BACTERIAL SPECIES - The current invention relates to a diagnostic kit for a bacterial species and/or fungal and/or yeast species comprising at least one oligonucleotide probe capable of binding to at least a portion of the LepA and/or Guf1 genes or its corresponding mRNA. | 09-08-2011 |
20110217705 | METHODS AND COMPOSITIONS FOR SEQUENCE-SPECIFIC PURIFICATION AND MULTIPLEX ANALYSIS OF NUCLEIC ACIDS - Methods and materials for determining the presence of at least one nucleic acid in a sample are provided, said methods comprising (1) a purification step using sequence specific hybrid capture; (2) an amplification step; and (3) a detection step using two separate sequence-specific polynucleotide probes. Also provided are nucleic acids comprising SEQ ID NO: 1 to SEQ ID NO: 727 and nucleic acid probes and probe sets comprising the same. | 09-08-2011 |
20110217706 | GENE METHYLATION IN CANCER DIAGNOSIS - DNA biomarker sequences that are differentially methylated in samples from normal individuals and individuals with cancer are provided Additionally, methods of identifying differentially methylated DNA biomarker sequences and their use for the detection and diagnosis of cancer are provided. | 09-08-2011 |
20110217707 | EVALUATION/SCREENING METHOD FOR DISEASES ASSOCIATED WITH D-AMINO ACID UTILIZING DA01-/-MOUSE - Disclosed is an evaluation method which can rapidly discriminate a Dao | 09-08-2011 |
20110217708 | METHODS AND COMPOSITIONS FOR DETECTING COLON CANCERS - This application describes methods and compositions for detecting and treating vimentin-associated neoplasia. Differential methylation of the vimentin nucleotide sequences has been observed in vimentin-associated neoplasia such as colon neoplasia. | 09-08-2011 |
20110217709 | DETECTION OF CHROMSOMAL REGION COPY NUMBER CHANGES TO DIAGNOSE MELANOMA - This invention provides methods of detecting melanoma. The methods comprises detecting a gain or loss of certain chromosomal regions that undergo copy number changes in melanoma. | 09-08-2011 |
20110223592 | Multiple fluorophore detector system - A detector oligonucleotide comprises multiple pairs of a donor fluorophore and a quencher molecule, which donor fluorophores and quencher molecules are separated by a site that is capable of being cleaved when in double-stranded form. The detector oligonucleotide may be made double-stranded in a manner that depends on the presence of a target nucleic acid, allowing the cleavage sites to be cleaved. Separation of the donor fluorophores and the quencher molecules decreases fluorescence quenching and generates a detectable change in a fluorescence parameter of the fluorophores of the detector oligonucleotide. By using multiple donor/quencher pairs, the present detector oligonucleotide advantageously generates a high signal to noise ratio and high efficiency in detection of a target nucleic acid. | 09-15-2011 |
20110223593 | Predicting a response to olanzapine - The invention relates generally to the relative effect of specific genetic polymorphisms in predicting the clinical outcome of olanzapine therapy in patients suffering from a psychiatric disease such as schizophrenia. | 09-15-2011 |
20110223594 | METHODS, KITS AND COMPOSITIONS FOR DETERMINING SEVERITY AND SURVIVAL OF HEART FAILURE IN A SUBJECT - The application provides a method of determining a severity of heart failure in a human test subject, by determining a level of RNA encoded by one or more heart failure marker genes in blood of the test subject compared to controls. The application also provides a method of determining survival outcome and allows the ranking of test subjects based on the level of RNA encoded by one or more survival associated genes. | 09-15-2011 |
20110223595 | STANDARDIZED AND OPTIMIZED REAL-TIME QUANTITATIVE REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION METHOD FOR DETECTION OF MRD IN LEUKEMIA - The invention relates to in a real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) method for minimal residual disease detection in leukemic patients through amplification of a fusion gene transcript, the improvement comprising: (i) selecting amplifiable and qualified patient samples for subsequent analysis; (ii) defining optimal conditions for performing the RT reaction; (iii) defining optimal conditions RQ-PCR protocol; and (iv) establishing a standardized procedure for data analysis. | 09-15-2011 |
20110223596 | Multiplex Detection Compositions, Methods, and Kits - The present invention generally relates to the detection of analytes, particularly biomolecules in samples. The invention also relates to compositions, methods, and kits for detecting the presence of analytes, typically in multiplex detection formats. The invention also relates to methods for determining the presence of at least one analyte in a sample, the methods employing employ single molecule detection techniques to individually detect at least one molecular complex or at least part of a molecular complex. | 09-15-2011 |
20110223597 | METHODS RELATING TO OLANZAPINE PHARMACOGENETICS - There is significant variability in subject clearance, half-life and side-effects from treatment with olanzapine (OLZ) in subjects. Methods for aiding in determining therapeutic efficacy of olanzapine in a subject are provided according to embodiments of the present invention which include identifying in a subject sample whether UDP-glucuronosyltransferase 2B10 (UGT2B10) and/or UDP-glucuronosyltransferase 1A4 (UGT1A4) is “wild-type” or a variant associated with altered glucuronidation of an olanzapine metabolite compared to wild-type. | 09-15-2011 |
20110223598 | METHOD FOR REAL-TIME DETECTION OF SALMONELLA IN FOOD USING A CLEAVABLE CHIMERIC PROBE - A method is described for the real-time detection of | 09-15-2011 |
20110223599 | PARASITE DETECTION VIA ENDOSYMBIONT DETECTION - The present invention provides systems, methods, and compositions for identifying a subject as infected with a parasite by detecting nucleic acid from an endosymbiont of the parasite in a sample from the subject. In certain embodiments, the parasite is a nematode that infects humans or dogs (e.g., | 09-15-2011 |
20110223600 | Method For Predicting Athletic Performance Potential - A method and assay for predicting athletic performance potential of a subject, such as a thoroughbred race horse, comprising the steps of assaying a biological sample from a subject for the presence of a single nucleotide polymorphism in one or more genes associated with athletic performance. The athletic performance genes may be selected from one or more of MSTN, COX4I2, PDK4, CKM and COX4I1. | 09-15-2011 |
20110223601 | Method for pairwise sequencing of target polynucleotides - The invention relates to methods for pairwise sequencing of a double-stranded polynucleotide template, which methods result in the sequential determination of nucleotide sequences in two distinct and separate regions of the polynucleotide template. Using the methods of the invention it is possible to obtain two linked or paired reads of sequence information from each double-stranded template on a clustered array, rather than just a single sequencing read from one strand of the template. | 09-15-2011 |
20110223602 | Systems and Methods for Multiplex Analysis of PCR in Real Time - The present invention provides methods and systems for real-time measurements of PCR with multiplexing capability. Certain embodiments relate to methods and systems that use fluorescently encoded superparamagnetic microspheres for the immobilization of amplification products during the PCR process, and an imaging chamber of a measurement device that is also capable of controllable thermal cycling for assisting the PCR process. | 09-15-2011 |
20110223603 | DIAGNOSING AND MONITORING RESPONSE TO TREATMENT OF NON-INCONTINENT UROLOGICAL AND RELATED DISEASES - Techniques for diagnosing and monitoring response to treatment of non-incontinent urological disorders (NIUD) in a patient are provided. For example, a technique for diagnosing NIUD in a patient includes obtaining peripheral blood-derived nucleic acid containing nucleated acellular components such as serum and/or plasma and/or nucleated cellular components from the patient to provide a reporter function in the patient. Also, a technique for monitoring response to treatment of NIUD in a patient includes obtaining peripheral blood-derived nucleic acid containing nucleated acellular components such as serum and/or plasma and/or nucleated cellular components from the patient to provide a reporter function in the patient. | 09-15-2011 |
20110229883 | Biochemical Markers for Disease States and Genes for Identification of Biochemical Defects - The present invention relates to a system utilizing biochemical markers and genetic markers to diagnose, predict, and/or monitor intervention of a number of diseases and conditions that have unresolved oxidative stress as an important component. The present invention relates generally to markers and assays for diagnosing, predicting, and monitoring disease, particularly disease-relevant oxidative stress and lipid metabolites and mediators. The oxidative stress, lipid metabolite and lipid mediator biochemical and genetic markers may be further combined with other disease associated or disease relevant markers in methods and assays for diagnosis, monitoring, and assessment of disease, particularly of complex diseases with multi-component factors. The system, methods and assays are applicable to various diseases, including autism, asthma, and Alzheimer's disease. | 09-22-2011 |
20110229884 | METHOD OF GENOME-WIDE NUCLEIC ACID FINGERPRINTING OF FUNCTIONAL REGIONS - A method of specifically amplifying desired regions of nucleic acid from a sample is provided. The method uses a plurality of first and second PCR primers, each having a region of fixed nucleotide sequence identical or complementary to a consensus sequence of interest and a region of randomized nucleotide sequence located 5′ to, 3′ to, anywhere within, or flanking the region of fixed nucleotide sequence; and then amplifying the nucleic acid present in the sample via PCR using the plurality of first and second PCR primers; whereby a subset of the first primers binds to the consensus sequence of interest wherever it occurs in the sample, and a subset of the second primers binds to the sample at locations removed from the first primers such that DNA regions flanked by the first primer and the second primer are specifically amplified. | 09-22-2011 |
20110229885 | Methods and Compositions for Determining Predisposition to Inflammation-Mediated Cardiovascular Disease - The present invention provides methods and compositions for detecting a predisposition to an inflammation-mediated cardiovascular disease in a human subject by detecting a level of leukotriene C4 synthase (LTC4S) gene product in a sample from a human subject indicative of a predisposition to an inflammation-mediated cardiovascular disease or detecting the presence or absence of an allele of LTC4S indicative of a predisposition to an inflammation-mediated cardiovascular disease. In addition, the present invention also provides kits for practicing the methods. | 09-22-2011 |
20110229886 | Methods for detecting aneuploidy using microparticle multiplex detection - The present invention provides a method for the detection and sorting of microparticles in a mixture of microparticles. The method of the present invention allows for the detection and sorting of many distinct microparticle classes. Detection and sorting is on the basis of microparticle size, the fluorescence spectrum of any attached reporter molecule, the fluorescence intensity of the reporter molecule, and the number of particles in each classification bin. These microparticle classes have particular applications in many genetic or biochemical multiplexing studies and especially as binding agents for the detection of aneuploidy in an organism or embryo of the organism. In humans, the detection and sorting of at least 24 classes of microparticles would be sufficient for a single tube method for the simultaneous detection of aneuploidy in all chromosomes, wherein each distinct microparticle class comprises a polynucleotide sequence complementary to, and specific for, a polynucleotide sequence that is unique to a particular human chromosome. Furthermore, using currently available technology, the present method has application for the simultaneous detection of aneuploidy in all chromosomes for an organism that has 216 or fewer pairs of chromosomes. Kits for the simultaneous detection of aneuploidy in one or more human chromosomes are also provided. | 09-22-2011 |
20110229887 | DETECTION OF NUCLEIC ACID AMPLIFICATION PRODUCTS IN THE PRESENCE OF AN INTERNAL CONTROL SEQUENCE ON AN IMMUNOCHROMATOGRAPHIC STRIP - Compositions and methods useful in nucleic acid assays are provided. The invention permits detection of test and control nucleic acids. Test nucleic acids can be immobilized at multiple locations, such that amplification of either a test nucleic acid or a control nucleic acid provides a captured nucleic acid in a control capture zone. | 09-22-2011 |
20110229888 | Compositions and Methods for the Detection of Genomic Features - The invention provides compositions and methods for the detection of gene copy number and/or chromosome copy number in a multiplexed reaction. The assays and kits described herein are applicable for the identification, diagnosing, and monitoring of disorders including, but not limited to cancer, developmental and degenerative disease, neurological disorders, and stem cell disorders. | 09-22-2011 |
20110229889 | DOPAMINERGIC NEURON PROLIFERATIVE PROGENITOR CELL MARKER Msx1/2 - The present invention is a probe, a primer, and an antibody, for detecting a dopaminergic neuron proliferative progenitor cell. According to the present invention, there is provided a polynucleotide probe and a polynucleotide primer for use in the detection or selection of a dopaminergic neuron proliferative progenitor cell, which can hybridize with a polynucleotide consisting of a nucleotide sequence of an Msx1 gene or an Msx2 gene, or a complementary sequence thereto, and an antibody against an Msx1 protein or an Msx2 protein, or a part thereof for use in the detection or selection of a dopaminergic neuron proliferative progenitor cell. | 09-22-2011 |
20110229890 | EGFR MUTATIONS - The present invention relates to mutations in Epidermal Growth Factor Receptor (EGFR) and methods of detecting such mutations as well as prognostic methods method for identifying a tumors that are susceptible to anticancer therapy such as chemotherapy and/or kinase inhibitor treatment. The methods involve determining the presence of a mutated EGFR gene or mutated EGFR protein in a tumor sample whereby the presence of a mutated EGFR gene or protein indicates the tumor is susceptible to treatment. | 09-22-2011 |
20110229891 | SYNGAP1 DYSFUNCTIONS AND USES THEREOF IN DIAGNOSTIC AND THERAPEUTIC APPLICATIONS FOR MENTAL RETARDATION - The invention identifies Syngap1 dysfunctions as causative of mental retardation. Described are methods of detecting mental retardation and methods of detecting non-syndromic mental retardation (NSMR) in a human subject. Particular methods comprise sequencing a human subject's genomic DNA for comparison with a control sequence from an unaffected individual. Also described are probes, kits, antibodies and isolated mutated Syngap1 proteins. | 09-22-2011 |
20110229892 | METHOD FOR PREDICTING A PATIENT'S RESPONSIVENESS TO ANTI-FOLATE THERAPY - A method of predicting responsiveness of a subject to a folylpolyglutamate synthetase (FPGS) dependent anti-folate is provided. The method comprises analyzing for a presence or absence of a splice variant of FPGS or a polypeptide encoded thereby, in a sample of the subject, wherein the presence of the splice variant or the polypeptide encoded thereby is indicative of a negative response to a FPGS-dependent anti-folate. Kits for prediction responsiveness of a subject to FPGS-dependent anti-folate are also disclosed. Antibodies specific for splice variants, the splice variant nucleic acids and polypeptides encoded by the splice variants are also claimed. In particular splice variants missing exons selected from the group of exon 3, exon 7, exon 10 and exon 12 are disclosed. | 09-22-2011 |
20110229893 | METHOD OF MEASURING CYTOKERATIN 19 mRNA - Disclosed is a method of amplifying and detecting cytokeratin 19 mRNA in RNA amplification process, comprising: a step for forming a double-stranded DNA containing a promoter sequence with a reverse transcriptase by use of a combination of oligonucleotides consisting of a first primer having a sequence homologous to a portion of cytokeratin 19 mRNA and a second primer having a complementary sequence, wherein the promoter sequence is added to the 5′-end of either the first primer or the second primer, forming an RNA transcription product by use of an RNA polymerase with using the double-stranded DNA as template, and forming the double-stranded DNA by use of a reverse transcriptase by continuing to use the RNA transcription product as a template of DNA synthesis, by measuring an amount of amplified RNA produced over time with an oligonucleotide probe designed so that signal properties change with the formation of a complementary double strand with the amplified RNA. | 09-22-2011 |
20110229894 | METHODS FOR DETECTING AN INCREASED SUSCEPTIBILITY TO CANCER - The invention relates to methods for detecting an altered susceptibility to breast and ovarian cancer in a subject carrying a BRCA mutation, comprising determining the nucleic acid sequence of a polymorphism of a microRNA-related gene. | 09-22-2011 |
20110236890 | METHOD OF SCREENING FOR CANCER BY DETECTING MUTATIONS IN THE DELTA-CATENIN GENE PROMOTER AND 5'-UNTRANSLATED REGION - A method for screening for risk of cancer in a subject is carried out by detecting the presence or absence of at least one mutation in the delta-catenin gene promoter or 5′ untranslated region in a biological sample from said subject, the presence of such mutation or an increased frequency of mutation indicating said subject is afflicted with or at least at risk of developing cancer. | 09-29-2011 |
20110236891 | NUCLEIC ACID TEMPLATE PREPARATION FOR REAL-TIME PCR - The invention teaches a novel reagent formulation for the efficient preparation of a nucleic acid template from cells for high throughput real-time PCR analysis. The reagent permits rapid cell lysis and template preparation without the need for template purification and isolation. The reagent therefore dramatically improves throughput of real-time PCR analysis while at the same time permitting the rapid and sensitive real-time Catacleave PCR detection of a single molecule of nucleic acid template in as little as about 35 cycles of PCR amplification. | 09-29-2011 |
20110236892 | METHOD FOR LOWERING THE DEPENDENCY TOWARDS SEQUENCE VARIATION OF A NUCLEIC ACID TARGET IN A DIAGNOSTIC HYBRIDIZATION ASSAY - A primer or/and probe for a target sequence containing at least one variation, defined as either one non-conserved nucleotide, called genotype variation, or one nucleotide variation within one and the same genotype, wherein the primer or/and probe has a nucleic acid sequence that is complementary to said target sequence except for the at least complementary base of the variation(s), which is not present in the primer or/and probe. | 09-29-2011 |
20110236893 | LGR5 MODULATORS IN THE TREATMENT OF ALOPECIA - An in vitro method of screening for candidate compounds for the preventive or curative treatment of alopecia, which comprises determining the ability of a compound to modulate the expression or the activity of the LGR5 receptor is described. The use of modulators of the expression or of the activity of this receptor for treating alopecia is also described. In addition, methods for the diagnosis or prognosis, in vitro, of this disease are described. | 09-29-2011 |
20110236894 | SELECTIVE OXIDATION OF 5-METHYLCYTOSINE BY TET-FAMILY PROTEINS - The present invention provides for novel methods for regulating and detecting the cytosine methylation status of DNA. The invention is based upon identification of a novel and surprising catalytic activity for the family of TET proteins, namely TET1, TET2, TET3, and CXXC4. The novel activity is related to the enzymes being capable of converting the cytosine nucleotide 5-methylcytosine into 5-hydroxymethylcytosine by hydroxylation. | 09-29-2011 |
20110236895 | METHOD FOR PREPARING SAMPLE, SOLUTION FOR PREPARING SAMPLE AND STOOL COLLECTION KIT METHOD FOR ANALYZING A NUCLEIC ACID - The present invention relates to the providing of a method for preparing a sample from a nucleic acid-containing sample such as biological samples, where inhibitory substance's action against a enzyme reaction using a nucleic acid as substrate are decreased, a solution for preparing a sample used for the method, a stool collection kit used in that method, and a method for recovering and analyzing a nucleic acid in a nucleic acid-containing sample using a sample prepared using the preparation method of the present invention. A method for preparing a sample according to the present invention is a method for preparing a sample being used for analyzing a nucleic acid, and is characterized in that a nucleic acid-containing sample is mixed with a solution having one or more members selected from the group consisting of a polycation and a chelating agent as an active ingredient. | 09-29-2011 |
20110236896 | RGS2 GENOTYPES ASSOCIATED WITH EXTRAPYRAMIDAL SYMPTOMS INDUCED BY ANTIPSYCHOTIC MEDICATION - The present invention identifies genotypes associated with resistance to extrapyramidal symptoms induced by antipsychotic drugs. The present invention further identifies genotypes associated with predisposition to the onset or aggravation of extrapyramidal symptoms induced by antipsychotic drugs and use thereof for assessment of patient populations. Specifically, the present invention relates to particular polymorphisms in the RGS2 gene that are associated with resistance or susceptibility to drug-induced extrapyramidal symptoms. | 09-29-2011 |
20110244451 | Methods for prenatal diagnosis of chromosomal abnormalities - Chromosomal abnormalities are responsible for a significant number of birth defects, including mental retardation. The present invention is related to methods for non-invasive and rapid, prenatal diagnosis of chromosomal abnormalities based on analysis of a maternal blood sample. The invention exploits the differences in DNA between the mother and fetus, for instance differences in their methylation states, as a means to enrich for fetal DNA in maternal plasma sample. The methods described herein can be used to detect chromosomal DNA deletions and duplications. In a preferred embodiment, the methods are used to diagnose chromosomal aneuploidy and related disorders, such as Down's and Turner's Syndrome. | 10-06-2011 |
20110244452 | SEQUENCE DATA BY REDUCTION OF NOISE DUE TO CARRY-OVER PRIMER - The present invention provides methods of reducing the background signal of a nucleic acid sequencing reaction. In particular, the invention provides methods of specifically degrading unwanted chain termination reaction products generated by the extension of primers carried over from the amplification step of the sequencing reaction. These methods are amenable for use with both one step and two-step amplification/chain termination reaction sequencing protocols. | 10-06-2011 |
20110244453 | SALMONELLA DETECTION ASSAY - There is provided a method and reagents for detecting | 10-06-2011 |
20110244454 | FREEZE-DRIED COMPOSITIONS FOR BIOCHEMICAL REACTIONS - The use of raffinose as a glass-forming agent for freeze-dried compositions intended for use in conducting chemical or biochemical reactions such as the PCR. Thus, for instance, there is provided a composition for carrying out a chemical or biochemical reaction, said composition being in a freeze-dried form and comprising (i) a set of reagents comprising at least some of the chemical or biochemical reagents necessary for conducting said chemical or biochemical reaction, and (ii) raffinose. Kits comprising these compositions and methods of using them form a further aspect of the invention. | 10-06-2011 |
20110244455 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 10-06-2011 |
20110244456 | HERBICIDE TOLERANT COTTON PLANTS AND METHODS FOR IDENTIFYING SAME - The invention provides specific transgenic cotton plants, plant material and seeds, characterized in that these products harbor a specific transformation event at a specific location in the cotton genome. Tools are also provided which allow rapid and unequivocal identification of the event in biological samples. | 10-06-2011 |
20110244457 | IMMUNO-AMPLIFICATION - A high-sensitivity, low-background immuno-amplification assay is provided, which offers a streamlined workflow suitable for high-throughput assays of clinically relevant samples, such as blood and other bodily fluids. The assay comprises the use of two proximity members that each comprise an analyte-specific binding component conjugated to an oligonucleotide. Binding an analyte brings the oligonucleotide moieties of the proximity members in sufficiently close contact that the oligonucleotides form an amplicon. The presence of the analyte then is detected through amplification of the amplicon and detection of the amplified nucleic acids. The sensitivity of the assay of the present invention is improved by preventing spurious or non-specific amplicon formation by proximity members that are not complexed with an analyte. | 10-06-2011 |
20110244458 | Methods and Nucleic Acids for Analyses of Cellular Proliferative Disorders - Aspects of the invention provide methods, nucleic acids and kits for detecting, or for detecting and distinguishing between or among liver cell proliferative disorders or for detecting, or for detecting and distinguishing between or among colorectal cell proliferative disorders. Particular aspects disclose and provide genomic sequences the methylation patterns of which have substantial utility for the improved detection of and differentiation between said class of disorders, thereby enabling the improved diagnosis and treatment of patients. | 10-06-2011 |
20110244459 | METHODS FOR IDENTIFYING ERBB2 ALTERATION IN TUMORS - Methods for identifying ERBB2 (also named HER2) alteration in tumors, in particular cancer, based on the analysis of the expression of at least three genes of the ERBB2 amplicon located within less than one megabase on either side of ERBB2, and eventually of the gene corresponding to the Affymetrix probeset 234046_at (SEQ ID NO: 31), as well as a poynucleotide library useful for the molecular characterization of a cancer including polynucleotide sequences for detecting the genes, and a kit including the library. | 10-06-2011 |
20110244460 | METHOD FOR DETECTING CONTROLS FOR NUCLEIC ACID AMPLIFICATION AND USE THEREOF - The present invention provides a control detection method for easily detecting a positive control and a negative control simultaneously in one reaction system. An amplification reaction is carried out by adding a control template nucleic acid to a reaction system for detecting controls. The template nucleic acid can be amplified by a primer capable of amplifying an objective target sequence. An amplification region of the control template nucleic acid amplified by the primer can be hybridized with a detection probe capable of hybridizing to the target sequence. A Tm value (Tm | 10-06-2011 |
20110244461 | METHOD FOR PREPARING STOOL SAMPLE, SOLUTION FOR PREPARING STOOL SAMPLE AND STOOL COLLECTION KIT - The present invention relates to the providing of a method for preparing a stool sample that enables a nucleic acid in a stool to be stably preserved without requiring a complex procedure, a solution for preparing a stool sample, a stool collection kit used in that method, and a method for recovering and analyzing a nucleic acid in a stool using a stool sample prepared using the preparation method of the present invention. A method for preparing a stool sample according to the present invention is a method for preparing a stool sample being used for analyzing a nucleic acid contained in the stool, and is characterized in that a collected stool is mixed with a solution having a protease inhibitor as an active ingredient. | 10-06-2011 |
20110250594 | METHODS FOR GENETIC ANALYSIS OF TEXTILES MADE OF GOSSYPIUM BARBADENSE AND GOSSYPIUM HIRSUTUM COTTON - Methods for distinguishing between cotton species by analyzing a sample of mature cotton fibers from raw cotton materials or from textile goods are disclosed. DNA is extracted from the mature cotton fiber sample and subjected to PCR techniques which enable the identification of the species of cotton utilized in the textile or cotton material of interest. | 10-13-2011 |
20110250595 | ANALYSIS OF SINGLE NUCLEOTIDE POLYMORPHISMS USING END LABELING - A method for analyzing a sequence comprising a SNP site is provide. In general terms, the method comprises: a) contacting a first DNA sample with a first restriction enzyme to provide DNA fragments, wherein: i) the first restriction enzyme cleaves the sequence only if a first allele of a SNP is present at the SNP site; b) end-labeling the DNA fragments to produce an end-labeled sample; c) hybridizing the end-labeled sample to an array comprising a probe sequence; and d) comparing the amount of hybridization between the digested sample and the probe sequence to a reference signal | 10-13-2011 |
20110250596 | METHODS, KITS AND COMPOSITIONS PERTAINING TO LINEAR BEACONS - This invention is directed to methods for determining amplified nucleic acid using Linear Beacons | 10-13-2011 |
20110250597 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 10-13-2011 |
20110250598 | DETERGENT FREE POLYMERASES - The present invention relates to a formulation of a thermostable DNA polymerase which is completely free of detergents and its particular use in real time polymerase chain reaction (PCR). Such a formulation may be obtained if the selected purification method does not require the addition of a detergent at any purification step. | 10-13-2011 |
20110250599 | Methods and Compositions to Detect Nucleic Acids in a Biological Sample - Methods of the invention separate a target nucleic acid from a sample by using at least one capture probe oligonucleotide that contains a target-complementary region and a member of a specific binding pair that attaches the target nucleic acid to an immobilized probe on a capture support, thus forming a capture hybrid that is separated from other sample components before the target nucleic acid is released from the capture support and hybridized to a detection probe to form a detection hybrid that produces a detectable signal that indicates the presence of the target nucleic acid in the sample. Compositions for practicing the methods of the invention include a capture probe oligonucleotide made up a target-complementary region sequence and a covalently linked capture region sequence that includes a member of a specific binding pair. | 10-13-2011 |
20110250600 | MARKER FOR CANCER PROGNOSIS AND METHODS RELATED THERETO - The present invention is related to the novel discovery that HIF-2α, but not HIF-1α, selectively regulates adenosine A | 10-13-2011 |
20110250601 | Bisulfite Conversion of DNA - The present invention provides an improved method for the bisulfite conversion of DNA, and facilitates the analysis of cytosine methylation of genomic DNA. Novel combinations of denaturing solvents, new reaction conditions and new purification methods provide surprisingly efficacious methods for bisulfite conversion of DNA relative to prior art methods. The converted DNA may subsequently be analyzed by many different methods. | 10-13-2011 |
20110250602 | Methods and Computer Software Products for Identifying Transcribed Regions of a Genome - Methods and computer software products are provided for transcriptional annotation. In one embodiment of the invention, a region of the genome where the intensity of hybridization of all the probes are above a threshold value (usually the level of non-specific hybridization) is identified. The region may be identified by aligning the probes against the genome; walking through the genome to find regions where all consecutive probes have intensities above the threshold value. | 10-13-2011 |
20110256533 | METHODS AND COMPOSITIONS FOR THE IDENTIFICATION OF ANTIBIOTICS THAT ARE NOT SUSCEPTIBLE TO ANTIBIOTIC RESISTANCE - Compositions and methods are provided to identify functional mutant ribosomes that may be used as drug targets. The compositions and methods allow isolation and analysis of mutations that would normally be lethal and allow direct selection of rRNA mutants with predetermined levels of ribosome function. The compositions and methods of the present invention may be used to identify antibiotics to treat a large number of human pathogens through the use of genetically engineered rRNA genes from a variety of species. The invention further provides novel plasmid constructs to be used in the methods of the invention. | 10-20-2011 |
20110256534 | PREDICTION OF ANTIVIRAL THERAPY RESPONSE - The application relates to methods for determining whether or not antiviral therapies will be effective. In particular, the present application provides a method using miRNA, e.g. miR-122 or miR-296-5 | 10-20-2011 |
20110256535 | OPTIMIZED OLIGONUCLEOTIDES AND METHODS OF USING SAME FOR THE DETECTION, ISOLATION, AMPLIFICATION, QUANTIFICATION, MONITORING, SCREENING AND SEQUENCING OF CLOSTRIDIUM DIFFICILE GENES ENCODING TOXIN B, AND/OR TOXIN A AND/OR BINARY TOXIN - Described herein are oligonucleotides useful for detecting, isolating, amplifying, quantitating, monitoring, screening and sequencing the | 10-20-2011 |
20110256536 | Two stage nucleic acid amplification using an amplification oligomer - This invention provides methods, compositions and systems to detect a nucleic acid of interest in a two-stage amplification. The two-stage amplification begins with a first non-enzymatic accumulation of an amplification oligomer that is the target substrate for a second nucleic acid amplification or assay. Two or more amplification oligomers can be used to allow multiplexed amplifications of two or more nucleic acids of interest with deconvolution based on unique detection signals or unique signal locations. | 10-20-2011 |
20110256537 | OPTIMIZED OLIGONUCLEOTIDES AND METHODS OF USING SAME FOR THE SCREENING, DETECTION, ISOLATION, QUANTITATION, MONITORING AND SEQUENCING OF PROSTATE CANCER ASSOCIATED VIRUSES AND HOST BIOMARKERS - Described herein are oligonucleotides useful for screening, detecting, isolating, quantitating, monitoring and sequencing of viruses and host biomarkers associated with prostate cancer and methods and kits of using the described oligonucleotides. | 10-20-2011 |
20110256538 | EPIGENOMIC DNA MODIFICATIONS FOR TISSUE TYPING, EARLY CANCER DETECTION, AND DISEASE MANAGEMENT - Provided herein is a suitable method for detecting the presence or absence of a cancer in an individual, by determining the level of methylation of the sense strand of a selected regulatory region of a tumor suppressor gene. Also provided herein is a method of detecting the presence or absence a cancer in an individual by determining if there is an apparent 100% methylation by assay of the CpG sites in the anti-sense strand of a selected regulatory region of a tumor suppressor gene. Also provided herein is a method of tissue typing by determining the level of methylation of the anti-sense strand of a selected regulatory region of a tumor suppressor gene indicating an enhanced likelihood that a tissue is liver. | 10-20-2011 |
20110256539 | Methods for Detecting Tumor Origin Based on MUC1, MUC2, and CK-17 Expression Levels - Methods and compositions for detecting tumor origin are disclosed. In certain embodiments, the origin is determined by detecting expression levels of pan-epithelial membrane mucin (MUC1), intestinal-type secretory mucin (MUC2), cytokeratin 17 (CK17), or a combination thereof. Also disclosed are methods for aiding in the determination of an appropriate course of treatment for a subject with a tumor, or for predicting a therapeutic outcome of a subject, based on the expression levels of MUC1, MUC2, CK17, or a combination thereof. Kits for use in each of these methods are also provided. | 10-20-2011 |
20110262908 | ISOLATION OF PROTEIN FACTORS THAT ASSOCIATE DIRECTLY OR INDIRECTLY WITH NUCLEIC ACIDS - Methods for isolating polypeptides and polypeptide complexes that are associated with a target nucleic acid sequence are provided. The methods comprise the steps of obtaining a sample that comprises a target nucleic acid sequence and one or more polypeptides or proteins associated with that target nucleic acid sequence; contacting the sample with at least one oligonucleotide probe that comprises a sequence that is complimentary to and capable of hybridising with at least a portion of the target nucleic acid sequence, wherein the oligonucleotide probe comprises at least one locked nucleic acid (LNA) nucleotide and wherein the oligonucleotide probe further comprises at least one affinity label (e.g. biotin); allowing the at least one oligonucleotide probe and the target nucleic acid sequence to hybridise with each other so as to form a probe-target hybrid; isolating the probe-target hybrid from the sample by immobilizing the probe-target hybrid through a molecule that binds to the at least one affinity label (e.g. using streptavidin-coated magnetic beads); and eluting the one or more polypeptides that are associated with the target nucleic acid sequence. Probes (e.g. with long spacer) for use in the methods of screening are also provided. | 10-27-2011 |
20110262909 | Genetic Markers for Horned and Polled Cattle and Related Methods - Embodiments of the present invention provide methods for improving desirable animal traits including the horned/polled phenotype in bovine animals. Also provided are methods for determining a dairy animal's genotype with respect to multiple markers associated with polled, fitness and/or productivity traits. The invention also provides methods for selecting or allocating animals for predetermined uses such as progeny testing or nucleus herd breeding, for picking potential parent animals for breeding, and for producing improved progeny animals. Also provided are methods for identifying genetic markers associated with polled, fitness and/or productivity traits that are in allelic association with the SNPs disclosed herein. | 10-27-2011 |
20110262910 | MARKER FOR COLON CANCER AND METHOD FOR DETECTING COLON CANCER - In embodiments the expression or methylation of the TBX5 gene is used as a marker for the presence and prognosis of colon cancer. In further embodiments methods for detecting colon cancer are disclosed as are methods for inhibiting the growth of colon cancer cells. | 10-27-2011 |
20110262911 | CORRECTING AN ASSAY IMAGE OF AN ARRAY OF SIGNALS GENERATED FROM A MULTIPLEXED HYBRIDIZATION-MEDIATED ASSAY - Described are methods of assay design and assay image correction, useful for multiplexed genetic screening for mutations and polymorphisms, including CF-related mutants and polymorphs, using an array of probe pairs (in one aspect, where one member is complementary to a particular mutant or polymorphic allele and the other member is complementary to a corresponding wild type allele), with probes bound to encoded particles (e.g., beads) wherein the encoding allows identification of the attached probe. The methods relate to avoiding cross-hybridization by selection of probes and amplicons, as well as separation of reactions of certain probes and amplicons where a homology threshold is exceeded. Methods of correcting a fluorescent image using a background map, where the particles also contain an optical encoding system, are also disclosed. | 10-27-2011 |
20110262912 | METHOD FOR MEASURING DNA METHYLATION - The present invention relates to a method of measuring the content of methylated DNA in a DNA region of interest in a genomic DNA contained in a biological specimen, and so on. | 10-27-2011 |
20110262913 | MARKING - The invention provides a marking system, markers and methods of use of such marking systems and markers which enable unique marking of articles and subsequent detection of that marking. In particular the invention provides a marking system, the marking system comprising a plurality of different DNA fragment types, each of the plurality of different DNA fragment types comprising a plurality of different length DNA fragments and a method in which a sample of the DNA fragment type is taken, amplified and analysed to determine the identity of the marker for an article. | 10-27-2011 |
20110262914 | METHODS AND COMPOSITIONS FOR DIAGNOSING OR MONITORING AUTOIMMUNE AND CHRONIC INFLAMMATORY DISEASES - Methods of diagnosing or monitoring an autoimmune or chronic inflammatory disease, particularly SLE in a patient by detecting the expression level of one or more genes or surrogates derived therefrom in the patient are described. Diagnostic oligonucleotides for diagnosing or monitoring chronic inflammatory disease, particularly SLE infection and kits or systems containing the same are also described. | 10-27-2011 |
20110262915 | METHOD FOR PREDICTING THE ATHLETIC PERFORMANCE POTENTIAL OF A SUBJECT - A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP. The invention also provides an assay for determining the athletic performance potential of a subject. | 10-27-2011 |
20110262916 | NON-INVASIVE FETAL RHD GENOTYPING FROM MATERNAL WHOLE BLOOD - The present invention discloses methods of determining the RhD genotype of subject. In particular, the invention provides a non-invasive method of determining fetal RhD genotype from a maternal biological sample containing fetal cells. The invention also provides novel probes and primers useful in the described methods. Kits and mixtures comprising the novel probes and primers are also disclosed. | 10-27-2011 |
20110262917 | MODIFIED NUCLEOTIDES - Modified nucleotides, and methods to modify nucleotides with a moiety or label, such as biotin, that permits their detection and results in a modified nucleotide, and methods of use of the modified nucleotide in quantitative and qualitative assays. | 10-27-2011 |
20110262918 | IMPROVED NANOPARTICULATE COMPOSITIONS OF POORLY SOLUBLE COMPOUNDS - The present invention is related to a method for the quantification of one or more target ribonucleic acids in a sample comprising the steps of, (i) providing a sample comprising said one or more target ribonucleic acids, (ii) contacting said sample with a ribonucleic acid specific fluorescence dye under conditions allowing for binding of said dye to the one or more ribonucleic acids in said sample, (iii) measuring fluorescence of said RNA-bound dye in said sample, (iv) correlating said measured fluorescence to the total amount of RNA in the sample, (v) reverse transcribing said one or more ribonucleic acids, thereby creating double-stranded nucleic acids, (vi) amplifying said one or more created double-stranded nucleic acids, wherein one or more fluorescence probes specific for said one or more amplification products are present during and/or after amplification under conditions allowing for binding of said one or more probes to said one or more created double-stranded deoxyribonucleic acids in the sample, (vii) measuring fluorescence of said one or more probes bound to said one or more amplification products during and/or after the amplification reaction and correlating said measured fluorescence to the amount of target RNA sequence in the sample and (viii) normalizing the amount of target RNA sequence in the sample to the total amount of RNA in the sample. | 10-27-2011 |
20110262919 | METHOD FOR PRETREATING SPECIMEN AND METHOD FOR ASSAYING BIOLOGICAL SUBSTANCE - On magnetic particles serving as a first support, an antibody against a nonspecific reaction factor is immobilized. These magnetic particles are mixed with a specimen and suspended therein. After suspending, the suspension is sucked up into a pipette chip and a magnet comes close to the pipette chip. While remotely constraining with the magnet the magnetic particles carrying the nonspecific reaction factor bonded thereto, the residual liquid is discharged into a well. Thus, the removal of a contaminant contained in the specimen is completed. The thus treated specimen discharged into the well is subjected to an immunoassay. The magnetic particles carrying the antibody immobilized thereon are mixed with the treated specimen and suspended therein. The suspension is sucked up into a pipette chip and the magnetic particles carrying an antigen bonded thereto are separated by use of the magnet. The magnetic particles carrying the antigen bonded thereto are washed, mixed with an enzyme-labeling solution, which contains a second support, and suspended therein. After suspending, the magnetic particles being labeled and carrying the antigen bonded thereto are mixed with a substrate solution and subjected to the measurement of emission intensity, etc. | 10-27-2011 |
20110269123 | MARKER FOR GASTRIC CANCER AND METHOD FOR DETECTING GASTRIC CANCER - In embodiments the expression or methylation of the PAX5 gene is used as a marker for the diagnosis and prognosis of gastric cancer. In further embodiments methods for detecting gastric cancer are disclosed as are methods for inhibiting the growth of gastric cancer. | 11-03-2011 |
20110269124 | Methods, Primers, Probes and Kits Useful for the Detection of BRAF Mutations - The present invention relates to methods, primers and probes useful for detecting the presence of mutant BRAF sequences in a sample, specifically for detecting the presence of the BRAF V600E, V600D, V600K, and V600M mutations. | 11-03-2011 |
20110269125 | METHODS AND COMPOSITIONS FOR PREDICTING DEVELOPMENT OF ATOPIC DISEASES - The present invention relates to methods of testing for allergic diseases and methods for screening candidate compounds as therapeutic agents for allergic diseases. In particular the present invention provides genetic markers useful for the prediction of an individual's susceptibility to and/or the molecular diagnosis of atopic diseases such as bronchial asthma and allergic rhinitis. | 11-03-2011 |
20110269126 | EPIGENETIC METHODS AND NUCLEIC ACIDS FOR THE DETECTION OF BREAST CELL PROLIFERATIVE DISORDERS - The present application provides methods and nucleic acids for the detection and differentiation of breast cell proliferative disorders. This is achieved by the analysis of the methylation of a panel of genes, or subsets thereof. The invention may be used for the detection and/or differentiation of a variety of tissue types including breast cancer and benign breast disorders as well as other cancers and tissue types. | 11-03-2011 |
20110269127 | MEANS AND METHOD FOR DETERMINING TUMOR CELL PERCENTAGE IN A SAMPLE - The invention provides a method for determining the percentage of tumor cells in a sample of an individual, preferably a breast sample. More specifically, the invention provides one or more genes than can be used to determine the percentage of tumor cells. The invention further provides a set of probes, a set of primers, and uses thereof for detection of said one or more genes. | 11-03-2011 |
20110269128 | FORENSIC IDENTIFICATION - The invention provides allelic ladder mixtures and individual alleles suitable for use in such mixtures. The allelic ladder mixtures give improved identification and distinguishing capabilities, particularly suitable in forensic investigations. | 11-03-2011 |
20110269129 | BINARY PROBE SYSTEM FOR SENSITIVE DETECTION OF TARGET ANALYTES - The present disclosure encompasses systems, and their methods of use, for detecting a target analyte, the systems comprising: (a) a first oligonucleotide probe comprising a reporter oligonucleotide-binding arm complementary to the nucleotide sequence of a first region of a reporter oligonucleotide and an analyte-binding arm selectively binding to a first region of a target analyte, a second oligonucleotide probe comprising a reporter oligonucleotide-binding arm having a nucleotide sequence complementary to the nucleotide sequence of a second region of a reporter oligonucleotide, and an analyte-binding arm having a nucleotide sequence characterized as selectively binding to a second region of a target analyte; and a reporter oligonucleotide comprising a region complementary to the reporter oligonucleotide-binding arm of the first oligonucleotide probe, a second region complementary to the reporter oligonucleotide-binding arm of the second oligonucleotide probe, a fluorophore and a quencher disposed on the reporter oligonucleotide and a cleavable site disposed between the fluorescent label and the quencher. The cleavable site of the reporter oligonucleotide when in the presence of a target analyte can be cleaved by an enzyme such as a restriction endonuclease, an RNase H, a Flap-endonuclease-1 (FEN-1), and a DNA glycosylase. | 11-03-2011 |
20110269130 | Antibiotice Susceptibility Profiling Methods - The invention provides methods for the rapid determination of the antibiotic susceptibility of a microorganism, such as, an infectious microorganism in a biological sample, using fluorescence in situ hybridization (“FISH”). Methods of the invention may be applied to the rapid identification, typing, antibiotic susceptibility determination, and/or antibiotic minimum inhibitory concentration (MIC) determination for any infectious microorganism, such as a Gram positive bacteria, a Gram negative bacteria, or a yeast. | 11-03-2011 |
20110269131 | SUBSTRATE FOR MANUFACTURING DISPOSABLE MICROFLUIDIC DEVICES - Embodiments of the present invention relate to a UV-curable polyurethane-methacrylate (PUMA) substrate for manufacturing microfluidic devices. PUMA is optically transparent, biocompatible, and has stable surface properties. Embodiments include two production processes that are compatible with the existing methods of rapid prototyping, and characterizations of the resultant PUMA microfluidic devices are presented. Embodiments of the present invention also relate to strategies to improve the production yield of chips manufactured from PUMA resin, especially for microfluidic systems that contain dense and high-aspect-ratio features. Described is a mold-releasing procedure that minimizes motion in the shear plane of the microstructures. Also presented are simple yet scalable able methods for forming seals between PUMA substrates, which avoids excessive compressive force that may crush delicate structures. Two methods for forming interconnects with PUMA microfluidic devices are detailed. These improvements produce a microfiltration device containing closely spaced and high-aspect-ratio fins, suitable for retaining and concentrating cells or beads from a highly diluted suspension. | 11-03-2011 |
20110269132 | Methods for Determining Dysregulation of Methylation of Brain Expressed Genes on the X Chromosome to Diagnose Autism Spectrum Disorders - The discovery that alterations in methylation, which can cause one or more genes on the single X chromosome in males to be partially silenced or overexpressed, constitute a predisposition to autism spectrum disorders is generally disclosed herein. These alterations provide the rationale and basis for methods to diagnose autism spectrum disorders. | 11-03-2011 |
20110269133 | Compositions and Methods For Detecting The Presence Of Cryptosporidium Parvum In A Test Sample - The present invention describes novel oligonucleotides targeted to nucleic acid sequences derived from | 11-03-2011 |
20110275068 | METHOD - The present invention relates to a combination method for A) measuring the copy number frequency of one or more nucleic acid sequences in a sample; and B) analysing the sequence of at least part of the nucleic acid sequence(s), wherein method A) comprises the steps of:
| 11-10-2011 |
20110275069 | Method for the detection of gene transcripts in blood and uses thereof - The present invention is directed to detection and measurement of gene transcripts ad their equivalent nucleic acid products in blood. Specifically provided is analysis performed on a drop of blood for detecting, diagnosing and monitoring diseases using gene-specific and/or tissue-specific primers. The present invention also describes methods by which delineation of the sequence and/or quantitation of the expression levels of disease-specific genes allows for an immediate and accurate diagnostic/prognostic test for disease or to assess the effect of a particular treatment regimen. | 11-10-2011 |
20110275070 | HYBRIDIZATION AND MISMATCH DISCRIMINATION USING OLIGONUCLEOTIDES CONJUGATED TO MINOR GROOVE BINDERS - Conjugates between a minor groove binding molecule, such as the trimer of 1,2-dihydro-(3H)-pyrrolo[3,2- | 11-10-2011 |
20110275071 | Methods and Reagents for Combined PCR Amplification - An oligonucleotide probe is disclosed, the probe including an oligonucleotide, a fluorescer molecule attached to a first end of the oligonucleotide and a quencher molecule attached to the opposite end of the oligonucleotide. The probe is rendered impervious to digestion by the 5′→3′ exonuclease activity of a polymerase and the 5′→3′ extension of by a polymerase. The invention also includes methods for performing combined PCR amplification and hybridization probing, one such method including the steps of contacting a target nucleic acid sequence with PCR reagents and an oligonucleotide probe as described above, and subjecting these reagents to thermal cycling. One preferred refinement of the above method further includes the addition of a strand displacer to facilitate amplification. Additional similar combined PCR hybridization methods are disclosed, such methods not requiring probes having their 5′ ends protected, wherein (i) the polymerase lacks 5′→3′ exonuclease activity, (ii) a 5′→3′ exonuclease inhibitor is included, and (iii) an exonuclease deactivation step is performed. | 11-10-2011 |
20110275072 | EGFR MUTATIONS - The present invention relates to mutations in Epidermal Growth Factor Receptor (EGFR) and methods of detecting such mutations as well as prognostic methods method for identifying a tumors that are susceptible to anticancer therapy such as chemotherapy and/or kinase inhibitor treatment. The methods involve determining the presence of a mutated EGFR gene or mutated EGFR protein in a tumor sample whereby the presence of a mutated EGFR gene or protein indicates the tumor is susceptible to treatment. | 11-10-2011 |
20110275073 | Method for detecting tumor-associated DNA in blood or blood fractions - This invention relates to detection of specific extracellular nucleic acid in plasma or serum fractions of human or animal blood associated with neoplastic or proliferative disease. Specifically, the invention relates to detection of nucleic acid derived from mutant oncogenes or other tumor-associated DNA, and to those methods of detecting and monitoring extracellular mutant oncogenes or tumor-associated DNA found in the plasma or serum fraction of blood by using rapid DNA extraction followed by nucleic acid amplification with or without enrichment for mutant DNA. In particular, the invention relates to the detection, identification, or monitoring of the existence, progression or clinical status of benign, premalignant, or malignant neoplasms in humans or other animals that contain a mutation that is associated with the neoplasm through detection of the mutated nucleic acid of the neoplasm in plasma or serum fractions. The invention permits the detection of extracellular, tumor-associated nucleic acid in the serum or plasma of humans or other animals recognized as having a neoplastic or proliferative disease or in individuals without any prior history or diagnosis of neoplastic or proliferative disease. The invention provides the ability to detect extracellular nucleic acid derived from genetic sequences known to be associated with neoplasia, such as oncogenes, as well as genetic sequences previously unrecognized as being associated with neoplastic or proliferative disease. The invention thereby provides methods for early identification of colorectal, pancreatic, lung, breast, bladder, ovarian, lymphoma and all other malignancies carrying tumor-related mutations of DNA and methods for monitoring cancer and other neoplastic disorders in humans and other animals. | 11-10-2011 |
20110275074 | METHOD AND APPARATUS FOR CHROMOSOME PROFILING - A method and apparatus for generating an Interphase chromosome profile. The method comprises obtaining a sample containing cells having chromosomes for profiling; obtaining species specific DNA probes, wherein the DNA probes are capable of marking at least one chromosome at substantially equidistant locations on said chromosome; hybridizing the sample with the DNA probes with plurality of fluorescent labels; and using visual analysis for determining the profile of the chromosome. | 11-10-2011 |
20110275075 | SOX MODULATORS IN THE TREATMENT OF ALOPECIA - An in vitro method for screening candidate compounds for the preventive or curative treatment of alopecia is described. The method can include determining the capacity of a compound to modulate the expression or the activity of a SOX transcription factor. The use of modulators of the expression or the activity of the transcription factor for the treatment of alopecia is also described. Methods for the in vitro diagnosis or prognosis of the pathology are also described herein. | 11-10-2011 |
20110275076 | BULKED MUTANT ANALYSIS (BMA) - The current invention relates to a new strategy for identification, and optional isolation, of a nucleic acid sequence that is expressed in an organism and that is related to a particular phenotype (trait of a character) of said organism. With the method of the current invention it has become possible to, in contrast to known methods in the art, efficiently identify, isolate or clone genes in, for example, organism like (crop) plants for which no or only limited information with respect to the genome is available. | 11-10-2011 |
20110275077 | Oligonucleotide-Coated Affinity Membranes and Uses Thereof - A method of analyzing tissue sections in a manner that provides information about the presence and expression levels of multiple biomarkers at each location within the tissue section. The method comprises the preparation of membranes having covalently bound oligonucleotides and the use of those membranes for evaluation of various markers in the sample. The membranes may be arranged in stacks, wherein each layer has a different oligonucleotide capture strand. Transfer oligonucleotides complementary to the capture strands are attached through a cleavable bond to antibodies that recognize and bind to specific biomarkers present in the tissue sample. The tissue sample is exposed to the antibody-transfer strand conjugate and then treated with a cleaving reagent. Upon cleavage, the transfer strand migrates through the stack and binds to the capture strand. The level of expression of the biomarker may be determined by measuring expression of a reporter on the transfer strand. | 11-10-2011 |
20110275078 | RNA-Containing Microvesicles and Methods Thereof - Contemplated compositions and methods are directed to the use of microvesicles from an optionally recombinant donor cell to impart a desirable effect to a recipient cell. In certain preferred aspects, RNA of the microvesicles is employed to achieve the desirable effect. For example, microvesicles are used in vitro to increase the number of passages of a cell growing in a medium, reduce serum and/or growth factor requirements of a cell growing in a medium, and/or delay differentiation of a cell growing in a medium. Further preferred aspects include use of the microvesicles as therapeutic agents in which RNA, a membrane protein, and/or a cytosolic protein encapsulated in or coupled to the microvesicle provide a therapeutic effect. Additionally, diagnostic methods are contemplated in which RNA of a microvesicle isolated from a mammal is associated with a condition of the mammal. | 11-10-2011 |
20110281262 | DETECTION OF GERMS ASSOCIATED WITH PERIODONTITIS - The invention relates to a method for detecting and/or determining bacteria associated with periodontitis from a biological sample with at least one of the oligonucleotides SEQ ID No. 1 to SEQ ID No. 5 as well as a microfluidic device for detecting and/or determining at least one germ associated with periodontitis from a biological sample comprising a carrier consisting of at least one base part with a surface and at least one oligonucleotide bound to the carrier surface or nucleic acid molecule, in which the oligonucleotide represents at least one sequence of SEQ ID No. 1 to SEQ ID No. 5. | 11-17-2011 |
20110281263 | Compositions and Methods for Detection of Chromosomal Aberrations with Novel Hybridization Buffers - The present invention provides compositions and methods for the detection of nucleic acid sequences associated with chromosomal aberrations. The invention may, for example, eliminate the use of or reduce the dependence on formamide in hybridization. Compositions for use in the invention include an aqueous composition comprising at least one nucleic acid sequence and at least one polar aprotic solvent in an amount effective to denature double-stranded nucleotide sequences. | 11-17-2011 |
20110281264 | METHOD FOR DIAGNOSING AND PREDICTING CEREBELLAR ATAXIA - The present invention relates to an in vitro method for diagnosing and/or predicting hereditary cerebellar ataxia in a dog, and/or identifying a dog which is healthy carrier of hereditary cerebellar ataxia, comprising determining the presence or absence of an homozygous or heterozygous genetic variation in the arylsulfatase G gene sequence in a biological sample from said dog, as compared with the arylsulfatase G gene sequence of a healthy non-carrier dog, wherein the presence of said homozygous genetic variation indicates that said dog is or will be affected by hereditary cerebellar ataxia, and the presence of said heterozygous genetic variation indicates that said dog is healthy carrier of hereditary cerebellar ataxia, said dog being of a breed selected in the group consisting of American Staffordshire Terrier, American Pit Bull Terrier and Pit Bull type. | 11-17-2011 |
20110281265 | Primer set for amplifying UGT1A1 gene, reagent for amplifying UGT1A1 gene containing the same, and the uses thereof - Primer sets for amplifying target regions containing sites to be detected in the UGT1A1 gene by a gene amplification method are provided, wherein the primer sets can amplify the regions specifically Three pairs of primer sets are used including forward primers consisting of the base sequences of SEQ ID NOs: 4 or 81, 21, and 42 as well as reverse primers consisting of the base sequences of SEQ ID NOs: 13 or 91, 29 and 48, respectively. The use of these primer sets makes it possible to amplify three target regions including parts where three types of polymorphisms (UGT1A1*6, UGT1A1*27, and UGT1A1*28) of the UGT1A1 gene are generated, respectively, in the same reaction solution at the same time. | 11-17-2011 |
20110281266 | Identification of Nucleic Acids - This disclosure relates to methods for identifying target nucleic acids in a sample by detecting an amplified sequence corresponding to the target using a detectable probe and by monitoring its melting temperature (T | 11-17-2011 |
20110281267 | FUNCTIONALIZED MICROFLUIDIC DEVICE FOR IMMUNOFLUORESCENCE - It is described a microfluidic device, for use in the field of analytical fluorescence based assays and, in particular, in FISH assays. | 11-17-2011 |
20110287414 | Systems and methods for identifying a portion of a molecule - Techniques for identifying a portion of a molecule are described herein. In one example, multiple electrical measurements associated with a molecule are acquired, wherein each of the multiple electrical measurements corresponds to a discrete position of the molecule within a nanopore. The multiple electrical measurements are correlated with one or more sequences of electrical measurements corresponding to a possible structure of the molecule. The portion of molecule is determined to include the possible structure of the molecule based on the correlation. | 11-24-2011 |
20110287415 | IN-SITU HYBRIDIZATION TO DETECT RNA AND DNA MARKERS - The present invention provides probes, kits and methods for specifically binding mRNA of target cells, e.g., fetal cells, that allows visualization of the target cells, under conditions that allows a second probe to specifically bind the target cell's chromosomal DNA. | 11-24-2011 |
20110287416 | METHYLATION DETECTION - A real-time method of detecting the presence and/or amount of a methylated or unmethylated gene of interest in a DNA-containing sample, comprises the steps of: (a) contacting the DNA-containing sample with a reagent which selectively modifies unmethylated cytosine residues in the DNA to produce detectable modified residues but which does not modify methylated cytosine residues (b) amplifying at least a portion of the methylated or unmethylated gene of interest using at least one primer pair, at least one primer of which is designed to bind only to the sequence of methylated or unmethylated DNA following treatment with the reagent, wherein at least one primer in the primer pair is a primer containing a step loop structure carrying a donor and an acceptor moiety of a molecular energy transfer pair arranged such that in the absence of amplification, the acceptor moiety quenches fluorescence emitted by the donor moiety upon excitation and during amplification, the stem loop structure is disrupted so as to separate the donor and acceptor moieties sufficiently to produce a detectable fluorescence signal which is detected in real-time to provide an indication of the gene copy number of the methylated or unmethylated gene of interest (c) quantifying the results of the real-time detection against a standard curve for the methylated or unmethylated gene of interest to produce an output of gene copy number. The method may be characterized in that the amplification is considered valid where the cycle threshold value is less than (40). Alternatively the method, which may be carried out in real-time or at end point, is characterized in that the portion of the gene which is amplified is between approximately (50) and 250 bp, especially for plasma and serum samples. | 11-24-2011 |
20110287417 | Predicting a response to risperidone - The invention relates generally to the relative effect of specific genetic polymorphisms in predicting the clinical outcome of risperidone therapy in patients suffering from a psychiatric disease such as schizophrenia. | 11-24-2011 |
20110287418 | Compositions and Methods for Diagnosis and Treatment of Epilepsy - Compositions and methods for diagnosis or treatment of epilepsy disease with EFHC1, EFHC1 agonists, or EFHC1 analogs are provided. Compositions and methods for diagnosis or treatment of epilepsy disease with EFHC1 | 11-24-2011 |
20110287419 | Method For Genetic Analysis Of DNA To Detect Sequence Variances - Methods for determining genotypes and haplotypes of genes are described. Also described are single nucleotide polymorphisms and haplotypes in the ApoE gene and methods of using that information. | 11-24-2011 |
20110287420 | Compositions for diagnosis and therapy of diseases associated with aberrant expression of kremen and/or WNT - The present invention relates to a composition useful for the diagnosis and therapy of diseases associated with aberrant expression of the gene encoding the receptor Kremen 1 and/or Kremen 2 e.g. tumors or diseases of the kidneys, bones and eyes, lipid and glucose metabolism and obesity. The present invention also relates to a pharmaceutical composition containing a compound which is capable of modifying (a) the expression of the gene encoding Kremen 1 and/or Kremen 2 or (b) the activity of the Kremen 1 and/or Kremen 2 receptor. | 11-24-2011 |
20110287421 | Probes for Detection of NAT2 Gene, Reagent Containing the Same, and The Uses Thereof - Primer sets for amplifying target regions containing sites to be detected in the NAT2 gene by a gene amplification method are provided, wherein the primer sets can amplify the regions specifically. Three pairs of primer sets are used including forward primers consisting of the base sequences of SEQ ID NOs: 7, 33, and 60 as well as reverse primers consisting of the base sequences of SEQ ID NOs: 18, 48 and 81, respectively. The use of these primer sets makes it possible to amplify three target regions including parts where three types of polymorphisms (NAT2*5, NAT2*6, and NAT2*7) of the NAT2 gene are generated, respectively, in the same reaction solution at the same time. | 11-24-2011 |
20110287422 | NUCLEIC ACID PROBES AND METHODS FOR DETECTING PLASMODIUM PARASITES - This invention relates to novel nucleic acid probes and methods for detecting | 11-24-2011 |
20110287423 | DIAGNOSIS OF VIRAL INFECTIONS BY DETECTION OF GENOMIC AND INFECTIOUS VIRAL DNA BY MOLECULAR COMBING - A method for detecting in vitro the presence of a genome of a DNA virus or a viral derived DNA in an infected eukaryotic cell, tissue or biological fluid using Molecular Combing or other nucleic acid stretching methods together with probes, especially nucleic acid probes, having a special design. A method for monitoring in vitro the effects of anti-viral treatment by following the presence of genomic viral or viral derived DNA polynucleotides in a virus-infected cell, tissue or biological fluid. Detection of an infectious form of a virus using Molecular Combing and DNA hybridization. A kit comprising probes used to carry out these methods and a composition comprising the probes. | 11-24-2011 |
20110287424 | METHYLATION-SPECIFIC COMPETITIVE ALLELE-SPECIFIC TAQMAN POLYMERASE CHAIN REACTION (CAST-PCR) - In some embodiments, the present inventions relates generally to compositions, methods and kits for use in discriminating between different methylated and/or unmethylated nucleic acid loci. In certain embodiments, the inventions provides for detecting or quantitating undifferentiated embryonic stem cells in a population of differentiated cells. The invention is also useful for discriminating between fetal versus maternal cells, or healthy versus infected cells, or normal versus cancerous cells, or detecting reduction in viral load or measuring therapeutic efficiency in a patient, and more. | 11-24-2011 |
20110287425 | Assays to Detect Small-Scale Mutations in Individual Cells - Methods, compositions, and assays are described which are useful in identifying point mutations, identifying cancer cells, and diagnosing cancer. | 11-24-2011 |
20110287426 | Apparatus and Methods for Analyzing Samples - The present invention relates to apparatus, systems, and methods for analyzing biological samples. The apparatus, systems, and methods can involve using a vacuum source to pull microfluidic volumes through analytical equipment, such as flow cells and the like. Additionally, the invention involves using optical equipment in conjunction with the analytical equipment to analyze samples and control the operation thereof. | 11-24-2011 |
20110287427 | 3'OH-UNBLOCKED, NUCLEOTIDES AND NUCLEOSIDES BASE MODIFIED WITH LABELS AND PHOTOCLEAVABLE, TERMINATING GROUPS AND METHODS FOR THEIR USE IN DNA SEQUENCING - Provided are novel nucleotides, nucleoside, and their derivatives described herein, that can be used in DNA sequencing technology and other types of DNA analysis. In one embodiment, the nucleotide or nucleoside with an unprotected 3′-OH group is derivatized at the nucleobase to include a fluorescent dye attached via a linker to a photocleavable terminating group. The photocleavable-fluorescent group is designed to terminate DNA synthesis as well as be cleaved so that DNA oligomers can be sequenced efficiently in a parallel format. The design of such rapidly cleavable fluorescent groups on nucleotides and nucleosides can enhance the speed and accuracy of sequencing of large oligomers of DNA in parallel, to allow rapid whole genome sequencing, and the identification of polymorphisms and other valuable genetic information, as well as allowing further manipulation and analysis of nucleic acid molecules in their native state following cleavage of the fluorescent group. | 11-24-2011 |
20110287428 | NEISSERIA GONORRHOEAE DETECTION - A method for determining whether a human individual is or has been infected with | 11-24-2011 |
20110294117 | NUCLEIC ACID SEQUENCING DEVICE AND METHOD OF DETERMINING NUCLEOTIDE SEQUENCE OF TARGET NUCLEIC ACID USING THE SAME - A nucleic acid sequencing device includes at least one nanochannel, a first electrode and a second electrode disposed at opposite ends of the nanochannel for applying a voltage in the lengthwise direction of the nanochannel, and a first detector that detects a location signal of a target nucleic acid passing through the nanochannel and a second detector that detects a signal from a detectable label bound to the target nucleic acid. | 12-01-2011 |
20110294118 | WATER SOLUBLE FLUORESCENT COMPOUNDS - The invention provides a novel class of fluorescent compounds. Also provided are conjugates of the fluorescent compounds, methods of using the fluorescent compounds and their conjugates as well as kits including the fluorescent compounds and their conjugates. | 12-01-2011 |
20110294119 | NOVEL METHODS OF DIFFERENTIATING YEAST STRAINS AND/OR DETERMINING GENETIC STABILITY OF YEAST STRAINS, AND USES THEREOF - The invention relates to a method of determining the strain or strains of yeast in a sample, comprising: obtaining and screening nucleic acid from yeast for target sequences comprises all or part of a gene, or a flanking region associated with a gene, in the yeast mitochondrial DNA; and determining from the results of the screen the yeast strain or strains in the sample. Also provided is a method of determining the genetic stability of a yeast strain in a sample, wherein one target sequences in the nucleic acid comprises all or part of a gene, or a flanking region associated with a gene, in the yeast mitochondrial DNA or all or part of a gene, or a flanking region associated with a gene, located in the subtelomeric region of a chromosome; and determining from the results of the screen if the yeast strain is genetically stable. | 12-01-2011 |
20110294120 | Probes for Detection of SULT1A1 Gene, Reagent Containing the Same, and the Uses Thereof - A primer set for amplifying a region including sites to be detected of SULT1A1*2 and SULT1A1*3 in the SULT1A1 gene by a gene amplification method is provided, wherein the primer set can amplify the region specifically. A pair of primer set is used including a forward primer consisting of the base sequence of SEQ ID NO: 7 as well as a reverse primer consisting of the base sequence of SEQ ID NO: 18. The use of this primer set makes it possible to specifically and efficiently amplify a region including both sites where two types of polymorphisms (SULT1A1*2 and SULT1A1*3) of the SULT1A1 gene are generated. | 12-01-2011 |
20110294121 | METHODS AND COMPOSITIONS FOR PROGNOSING, DETECTING, AND TREATING AGE-RELATED MACULAR DEGENERATION - The invention provides methods and compositions for determining whether a subject is at risk of developing age-related macular degeneration, for example, the wet or neovascular form of age-related macular degeneration. The method involves determining whether the subject has a protective variant and/or a risk variant at a polymorphic site in the HTRA1 gene. In addition, the invention provides a method of treating or slowing the progression of age-related macular degeneration by reducing the expression of the HTRA1 gene, or reducing the biological activity of the HTRA1 gene product. | 12-01-2011 |
20110294122 | Synthesis of 2', 3'-Dideoxynucleosides for Automated DNA Synthesis and Pyrophosphorolysis Activated Polymerization - Methods for preparation of 2′,3′-dideoxynucleotides support structures, such as 2′,3′-dideoxyguanosine, 2′,3′-dideoxyadenosine, and 3′-deoxythymidine support structures are disclosed. Various methods of using such structures are also provided, such as their use for automated DNA synthesis and pyrophosphorolysis activated polymerization. | 12-01-2011 |
20110294123 | METHODS FOR DIAGNOSING OR TREATING PROSTATE CANCER - The present invention provides methods for detecting and/or diagnosing cancer through the determination of the expression level of the STC2 gene. The gene was discovered to discriminate cancer cells from normal cells. Furthermore, the present invention provides methods of screening for therapeutic agents useful in the treatment of cancer, methods for treating cancer. Moreover, the present invention provides double-stranded molecules targeting the STC2 gene, which are suggested to be useful in the treatment of cancer. The compositions and methods of the present invention find particular applicability to prostate cancer, more specifically, castration-resistant prostate cancer and aggressive prostate cancer. | 12-01-2011 |
20110294124 | METHOD FOR THE SYNTHESIS OF PHOSPHORUS ATOM MODIFIED NUCLEIC ACIDS - Described herein are methods of syntheses of phosphorous atom-modified nucleic acids comprising chiral X-phosphonate moieties. The methods described herein provide backbone-modified nucleic acids in high diasteteomeric purity via an asymmetric reaction of an achiral molecule comprising a chemically stable H-phophonate moiety with a nucleoside/nucleotide. | 12-01-2011 |
20110294125 | COLORIMETRIC BIOSENSOR WITH ALLOSTERIC DNAZYME ACTIVATION AND ROLLING CIRCLE SIGNAL AMPLIFICATION - The present disclosure includes a method of determining the presence of a target in a sample comprising an allosteric DNAzyme; rolling circle amplification dependent on the activity of the allosteric DNAzyme in the presence of target and a detection system. The methods further comprise quantifying the amount of target in the sample by comparing the detection with a control. Also included herein are kits for practicing the methods described herein and methods of designing biosensor systems. | 12-01-2011 |
20110294126 | KITS AND METHODS FOR ASSESSING OXIDATIVE STRESS - The invention relates to kits and methods for assessing the susceptibility of a human to oxidative stress or damage. The methods involve assessing occurrence in the human's genome of one or more polymorphisms (e.g., single nucleotide polymorphisms) that occur in one or more genes associated with oxidative stress and that are associated with a disorder in humans. Preferred assessment and scoring methods are disclosed, as are kit for performing the methods. | 12-01-2011 |
20110294127 | ELITE EVENT A2704-12 AND METHODS AND KITS FOR IDENTIFYING SUCH EVENT IN BIOLOGICAL SAMPLES - Tools are provided which allow rapid and unequivocal identification elite event A207-12 in biological samples. | 12-01-2011 |
20110300535 | METHOD OF IDENTIFYING INDIVIDUALS AT RISK OF THIOPURINE DRUG RESISTANCE AND INTOLERANCE - The invention relates to methods and kits for identifying individuals at risk of thiopurine drug intolerance based on detecting the presence of mutations in the TPMT gene promoter associated with thiopurine drug resistance or intolerance. | 12-08-2011 |
20110300536 | GENE MARKER AND METHOD FOR DETECTION OF ORAL CANCER - A gene marker for the detection of oral cancer, comprising methylated CpG sites in target genes, is provided. The CpG sites in the target genes are selected from a group consisting of the following CpG sites: FLT4_E206_F, ASCL1_E24_F, KDR_E79_F, TFPI2_P9_F, TERT_E20_F, ADCYAP1_P455_R, MT1A_P49_R, and combinations thereof. A method for the detection of oral cancer, comprising the following steps is also provided: a) providing a sample to be examined from an individual; b) detecting a methylation state of at least one CpG site in a target gene on the genomic DNA from cells of the sample, wherein the CpG site in the target gene is selected from a group consisting of the following CpG sites: FLT4_E206_F, ASCL1_E24_F, KDR_E79_F, TFPI2_P9_F, TERT_E20_F, ADCYAP1_P | 12-08-2011 |
20110300537 | METHODS OF DETECTING SEQUENCE DIFFERENCES - The invention relates to methods of genotyping single nucleotide differences in a nucleic acid sample. More particularly, the invention provides methods of identifying the nucleotide at a polymorphic site or a group of polymorphic sites in a sample of genomic DNA. The method uses tagged primer extension in which a set of tag sequences correspond to the identity of the nucleotides at the polymorphic sites. Primer extension products are PCR amplified using a common set of tag-specific primers, the downstream primers bearing distinguishable labels. Following separation by size and/or charge, the detection of distinguishable label in a product of the anticipated size determines the identity of the nucleotide at the polymorphic site. The method is well-suited for the genotyping of multiple single-nucleotide differences in one series of reactions. | 12-08-2011 |
20110300538 | BIFIDOBACTERIA CRISPR SEQUENCES - The invention relates to CRISPR sequences found in bifidobacteria and their uses. | 12-08-2011 |
20110300539 | Method for Detecting Polymorphism at Nucleotide Position -1639 of VKORC1 Gene, and Nucleic Acid Probe and Kit Therefor - A probe for detecting a polymorphism at position −1639 of the VKORC1 gene, the probe comprising an oligonucleotide having a nucleotide sequence having a length of 10 to 50 nucleotides, which nucleotide sequence comprises the nucleotides 80 to 89 of SEQ ID NO:1 or 2 and has a homology to SEQ ID NO:1 or 2 except that the nucleotide corresponding to the nucleotide at position 80 in SEQ ID NO:1 or 2 is cytosine, which nucleotide corresponding to the nucleotide at position 80 is labeled with a fluorescent dye. | 12-08-2011 |
20110300540 | METHODS AND PROBE COMBINATIONS FOR DETECTING MELANOMA - The present invention is based on the discovery of methods and combinations of probes to chromosomal regions that are gained or lost or imbalanced in melanoma that provide highly specific and sensitive assays for the detection of melanoma cells. | 12-08-2011 |
20110306043 | DEVICES AND METHODS FOR ENRICHMENT AND ALTERATION OF CIRCULATING TUMOR CELLS AND OTHER PARTICLES - The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject. | 12-15-2011 |
20110306044 | DELTA3, FTHMA-070, TANGO85, TANGO77, SPOIL, NEOKINE, TANGO129, AND INTEGRIN ALPHA SUBUNIT PROTEIN AND NUCLEIC ACID MOLECULES AND USES THEREOF - The invention provides novel Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 polypeptides, proteins, and nucleic acid molecules. In addition to isolated, full-length Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 proteins, the invention further provides isolated Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 fusion proteins, antigenic peptides and anti-Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 antibodies. The invention also provides Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 nucleic acid molecules, recombinant expression vectors containing a nucleic acid molecule of the invention, host cells into which the expression vectors have been introduced and non-human transgenic animals in which a Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 or A259 gene has been introduced or disrupted. Diagnostic, screening and therapeutic methods utilizing compositions of the invention are also provided. | 12-15-2011 |
20110306045 | Method for Confirming a Diagnosis of Rolandic Epilepsy - A strong association between variants in Elongator Protein Complex 4, (ELP4) (specifically single nucleotide polymorphisms, SNPs) at the 11p13 locus on chromosome 11 and the centrotemporal sharp wave trait (CTS) has been discovered, which association has diagnostic significance for rolandic epilepsy. It has further been discovered that the 11p13 locus has a pleiotropic role in the development of speech motor praxis and CTS, which supports a neurodevelopmental origin for classic rolandic epilepsy (RE). | 12-15-2011 |
20110306046 | Probes and Primers for Detection of Malaria - The present disclosure gives description of a method used for the detection and quantification of malarial infection caused either by | 12-15-2011 |
20110306047 | Compositions and Methods for RNA Hybridization Applications - The invention provides methods and compositions for hybridizing at least one molecule to an RNA target. The invention may, for example, eliminate the use of, or reduce the dependence on formamide in RNA hybridization applications. Compositions for use in the invention include an aqueous composition comprising at least one nucleic acid sequence and at least one polar aprotic solvent in an amount effective to enable hybridization to RNA. | 12-15-2011 |
20110306048 | BOVINE POLYMORPHISMS AND METHODS OF PREDICTING BOVINE TRAITS - Methods of predicting the phenotype of a trait in a bovine subject are provided. The methods include obtaining information about polynucleotide sequences specifically regarding the identity of the nucleotides present at one or more identified single nucleotide polymorphisms and using this information to make predictions regarding the trait in the subject. Also provided are kits for and methods of determining the nucleotide present in a bovine subject at a position in which a single nucleotide polymorphism is correlated with a trait. | 12-15-2011 |
20110311967 | Novel Single Nucleotide Polymorphisms and Combinations of Novel and Known Polymorphisms for Determining the Allele-Specific Expression of the IGF2 Gene - Single nucleotide polymorphisms and uses for determining the imprinting status of the Insulin Growth Factor-2 gene in a clinical specimen are described. | 12-22-2011 |
20110311968 | Allele-Specific Amplification of Nucleic Acids - The present invention includes a method of allele-specific amplification, utilizing an allele-specific oligonucleotide, at least partially complementary to more than one variant of the target sequence, having an internally-placed selective nucleotide complementary to only one variant of the target sequence wherein the allele-specific oligonucleotide is extended by a nucleic acid polymerase predominantly or exclusively when hybridized to the variant of the target sequence for which it has said complementary selective nucleotide. | 12-22-2011 |
20110311969 | Diagnostic Kit for Aspergillus Fumigatus Species - The use of the Ayg1 gene or an RNA transcript of the Ayg1 gene or fragments thereof as target regions in a diagnostic assay for the eukaryotic organism | 12-22-2011 |
20110311970 | COMPOSITIONS AND METHODS FOR INTRACELLULAR ANALYTE ANALYSIS - Compositions and methods for multiplex immunodetection of analytes in single cells or cell populations are described. The invention utilizes analytical nanotags (ANTs) each specific for a different target analyte (TA) species. Analytical nanotags typically comprise biocompatible composite organic-inorganic nanoparticles (bCOINs) that include probe molecules specific for a particular TA species. A plurality of ANTs each specific for a different TA species can be used in a single multiplex assay, including assays for analyzing intracellular analytes in living cells. | 12-22-2011 |
20110311971 | RT-LATE-PCR - An assay comprising more than one primer pair and more than one detection probe, a low copy number synthetic amplicon corresponding to each of the primer pairs. The assay can detect and distinguish between various sub-types and strains of an influenza virus using any suitable nucleic acid amplification technique. Related kits and methods are also described. | 12-22-2011 |
20110311972 | DPYD GENE VARIANTS AND USE THEREOF - Variants in DPYD gene are disclosed which can result in abnormal synthesis of DPD proteins and alteration of DPD activities. The invention provides methods for detecting the newly discovered genetic variants. The DPD genetic variants of the invention can be used as biomarkers in predicting toxicity to 5-FU and other drugs metabolized by the DPD enzyme. | 12-22-2011 |
20110311973 | COMPOSITIONS FOR DETECTING HUMAN INTERFERON-ALPHA SUBTYPES AND METHODS OF USE - The invention provides highly sensitive, specific and efficient quantitative real-time PCR compositions, methods and assay kits to detect at least one IFN subtype and/or IFN subtype allotypic variants. Primer/probe sets complementary to the coding sequence of an IFN subtype of interest avoid spurious detection of degraded mRNA and enhances the correlation between the IFN subtype that is measured by the assays of the invention and the protein that is actually expressed. The invention also provides methods for designing primers and methods of using the compositions and assay kits. The compositions, kits, and methods of the invention may be used, for example, to monitor vaccine efficacy, autoimmune disease, chronic infections, or tumor therapy. | 12-22-2011 |
20110311974 | COMPOSITIONS AND METHODS FOR PERFORMING A STRINGENT WASH STEP IN HYBRIDIZATION APPLICATIONS - The invention provides methods and compositions for performing a stringent wash step in a hybridization assay between at least one molecule and a target. The invention may, for example, eliminate the use of, or reduce the dependence on formamide in the stringent wash step. Compositions for use in the invention include an aqueous composition comprising at least one polar aprotic solvent in an amount effective to denature non-complementary sequences in a hybridization product. | 12-22-2011 |
20110311975 | GENOMIC SELECTION AND SEQUENCING USING ENCODED MICROCARRIERS - The present invention relates to a method for determining the sequence of a nucleic molecule. Herein a capture oligonucleotide probe is attached to an encoded microcarrier, wherein the code of said microcarrier identifies the sequence of said oligonucleotide probe. The capture oligonucleotide probe is hybridized with a sample comprising nucleic acids molecules, wherein said DNA fragment comprises a sequence which is complementary to the sequence of the capture oligonucleotide probe. The sequence of the DNA molecule is determined, wherein the capture oligonucleotide probe serves as a primer for a DNA polymerase, in the case of single molecule sequencing this is a sequencing primer. After the sequence determination, the nucleotide sequence of the capture oligonucleotide probe is identified by determining the code on the microcarrier, which corresponds with the capture oligonucleotide probe. This sequence information directly identifies the location of the sequenced DNA fragment on the genome, allowing direct comparison. | 12-22-2011 |
20110318732 | PREDICTION OF CHEMOTHERAPEUTIC RESPONSE VIA SINGLE-CELL PROFILING OF TRANSCRIPTION SITE ACTIVATION - The present invention generally relates to methods for determining tumor resistance or sensitivity to chemotherapeutic agents and the likelihood of tumor reoccurrence based on the expression levels of genes known to correlate to the chemotherapeutic agent. In particular, the expression levels of TYMS, MRGX, ATP7B and/or BAK in tumor cells, as measured by the number of active transcription sites detected by fluorescence in situ hybridization (FISH), are predictive of resistance and sensitivity to chemotherapy and the likelihood of reoccurrence following chemotherapy treatment. | 12-29-2011 |
20110318733 | TEST SYSTEM AND METHOD FOR THE DETECTION OF ANALYTES - The invention relates to analytical test systems and analytical methods, in which molecular switches are used for the qualitative and quantitative determination of analytes in a sample, which have a broad application by means of a selection of the molecular switch suitable for the analyte. The molecular switch comprises a probe, preferably a nucleic acid or a nucleic acid derivative, coupled to a catalytic component, preferably an enzyme. The analyse induces a conformation change in the probe, which alters the accessibility for a substrate in the probe to catalytic components and the change in substrate turnover, corresponding to the change in catalytic activity, is measured. | 12-29-2011 |
20110318734 | DIAGNOSING FETAL CHROMOSOMAL ANEUPLOIDY USING MASSIVELY PARALLEL GENOMIC SEQUENCING - Embodiments of this invention provide methods, systems, and apparatus for determining whether a fetal chromosomal aneuploidy exists from a biological sample obtained from a pregnant female. Nucleic acid molecules of the biological sample are sequenced, such that a fraction of the genome is sequenced. Respective amounts of a clinically-relevant chromosome and of background chromosomes are determined from results of the sequencing. The determination of the relative amounts may count sequences of only certain length. A parameter derived from these amounts (e.g. a ratio) is compared to one or more cutoff values, thereby determining a classification of whether a fetal chromosomal aneuploidy exists. Prior to sequencing, the biological sample may be enriched for DNA fragments of a particular sizes. | 12-29-2011 |
20110318735 | REGULATION OF THE SEROTONIN REUPTAKE TRANSPORTER AND DISEASE - Described herein is a CpG island in the 5′ region of the 5HTT gene that contains an alternative exon 1 and promoter for 5HTT. Methylation at this CpG island is associated with decreased levels of 5HTT mRNA, and this effect is evident when 5HTTLPR genotype is taken into account. Thus, this methylation status indicates 5HTT mRNA production, which serves as an indicator for the expression of the transporter and of a subject's vulnerability to diseases related to serotonergic activity. Accordingly, certain embodiments of the present invention provide diagnostic methods for determining whether a subject has, or is at risk for developing, a disease associated with serotonergic activity. | 12-29-2011 |
20110318736 | Allele Amplification Bias - Methods are provided for nucleic acid analysis. In an illustrative method, allele amplification bias is used to amplify preferentially a target nucleic acid that is present in a low allele fraction. | 12-29-2011 |
20110318737 | REAL-TIME POLYMERASE CHAIN REACTION DETECTION OF LEGIONELLA PNEUMOPHILA AND DIFFERENTIATION FROM OTHER LEGIONELLA SPECIES - Materials and processes are provided for the detection of | 12-29-2011 |
20110318738 | IDENTIFICATION AND REGULATION OF A NOVEL DNA DEMETHYLASE SYSTEM - Disclosed herein are methods and systems directed at detecting, evaluating, ameliorating, preventing and treating an oncogenic event. The disclosed methods and systems can comprise one or more Demethylase System Components or other compositions that can be used alone or in combination to detect, evaluate, treat, ameliorate, or prevent an oncogenic event. | 12-29-2011 |
20110318739 | DETERMINATION OF THE DEGREE OF DNA METHYLATION - The present invention provides oligonucleotides and processes for determining the normalized methylation level of DNA, and for determining the relative methylation level of DNA between at least two samples. The invention makes use of the random distribution of transposons in the genome. The disclosed oligonucleotides and processes are of importance, in particular, for clinical diagnostics. | 12-29-2011 |
20110318740 | Reduced Interference from Single Strand Binding Proteins - Disclosed, for example, are methods for detecting at least one target polynucleotide comprising cleaving a flap from a polynucleotide probe that is hybridized to a complementary target polynucleotide, and hybridizing the cleaved flap to a complementary capture probe immobilized on a surface, wherein said cleaving and/or hybridizing occurs in the presence of a single strand binding protein that is capable of binding single-stranded DNA, but that can bind neither the flap nor the capture probe. The cleaved flap and the complementary capture probe may each comprise PNA, RNA, LNA, L-DNA or other modified nucleotides or chimeras thereof that do not significantly bind to the single strand binding protein. | 12-29-2011 |
20110318741 | BIOMARKERS FOR THE TREATMENT OF PSORIASIS - Provided herein are the biomarkers for predicting or monitoring the efficacy of a treatment for psoriasis. The use of certain cell markers and mRNA levels as biomarkers to predict whether a psoriasis treatment is likely to be successful is also provided. Further, the expression of these genes or cell markers can be used to monitor progress of treatment effectiveness and patient compliance in psoriasis patients who are receiving treatment. | 12-29-2011 |
20110318742 | MICRO RNA MARKERS FOR COLORECTAL CANCER - There are disclosed methods for diagnosing or providing a prognosis for colorectal cancer cells in a biological sample, the method comprising the steps of detecting the presence in the biological sample of an RNA sequence at least about 98% similar over the full sequence length to a sequence selected from the group consisting of SEQ ID NOS:1-7, wherein the presence of the RNA sequence is indicative of the presence of colorectal cancer cells in the sample. Probes for detecting and providing a prognosis for colorectal cancer are also disclosed. | 12-29-2011 |
20110318743 | METHODS, WORKFLOWS, KITS, APPARATUSES, AND COMPUTER PROGRAM MEDIA FOR NUCLEIC ACID SAMPLE PREPARATION FOR NUCLEIC ACID SEQUENCING - A method for preparing a nucleic acid sample for nucleic acid sequencing includes amplifying a nucleic acid target sequence using a primer bound to a first capture substrate; capturing an amplified nucleic acid product by the first capture substrate; generating at least one sequencing ladder from the amplified nucleic acid product using at least one sequencing primer; capturing the at least one sequencing ladder by hybridizing the at least one sequencing ladder to a complementary capture compound on a second capture substrate; and removing the at least one sequencing ladder from the second capture substrate. The first and/or second capture substrate may include a magnetic particle. Other methods, workflows, kits, and computer program media for nucleic acid sample preparation are also disclosed. | 12-29-2011 |
20110318744 | Method For The Detection And Characterization Of Microorganisms On A Filter - The present invention relates to a method for the specific detection on a filter of one or more microorganisms present in a fluid, characterized in that it comprises the following steps:
| 12-29-2011 |
20110318745 | COMPOSITIONS AND METHODS FOR PERFORMING HYBRIDIZATIONS WITH SEPARATE DENATURATION OF THE SAMPLE AND PROBE - The invention provides methods and compositions for separately denaturing a probe and target in hybridization applications. The invention may, for example, eliminate the use of or reduce the dependence on formamide in hybridization applications. Compositions for use in the invention include an aqueous composition comprising at least one polar aprotic solvent in an amount effective to denature double-stranded nucleotide sequences. | 12-29-2011 |
20110318746 | RAPID OLIGO PROBES - Disclosed are methods, rapid probes, and kits for general purpose nucleic acid detection. | 12-29-2011 |
20110318747 | Nonseparation Assay Methods - Assay methods are disclosed involving specific binding reactions which are simplified compared to known methods. A compound capable of producing chemiluminescence is immobilized on a solid support as is a member of a specific binding pair for capturing an analyte from a sample. An activator compound that activates the chemiluminescent compound and is conjugated to a specific binding pair member is added in excess along with the sample to the solid support. Addition of a trigger solution causes a chemiluminescent reaction at the sites where the activator conjugate has been specifically bound. The assay methods are termed non-separation assays because they do not require removal or separation of excess detection label (activator conjugate) prior to the detection step. The methods are applicable to various types of assays including immunoassays, receptor-ligand assays and nucleic acid hybridization assays. | 12-29-2011 |
20120003632 | FRET-PROBES AND USE THEREOF - This invention relates to the detection of among others tumor-specific fusion proteins and protein interactions. Provided is a set of at least a first and a second molecular probe, each probe provided with a dye wherein said dyes together allow energy transfer, each probe additionally provided with a reactive group allowing juxtaposing said at least first and second probe, wherein said reactive group is an oligonucleotide and wherein the reactive group of said first probe is not directly reactive with the reactive group of said second probe. | 01-05-2012 |
20120003633 | MEANS AND METHODS FOR INVESTIGATING NUCLEIC ACID SEQUENCES - The invention provides improved methods for investigating nucleic acid sequences, wherein at least one additional probe is used which is specific for a (pseudo)gene variant of a target nucleic acid. | 01-05-2012 |
20120003634 | IDENTIFICATION OF SOURCE OF DNA SAMPLES - The present disclosure relates to methodology for fast and cost-effective identification of the source of DNA samples. DNA samples obtained from unknown or unrecognized tissues or cell types are analyzed according to the methodology described herein, yielding an identification of the tissue and/or cell type source. Identification is based on sequential biochemical procedures including methylation sensitive/dependent restriction and polymerase chain reaction, followed by analysis of the data. All biochemical steps are performed in a single test tube. The disclosure has immediate applications in forensic science for identification of the tissue source of DNA obtained from biological stains. The disclosure also has immediate applications in cancer diagnosis for identification. | 01-05-2012 |
20120003635 | DIAGNOSING FETAL CHROMOSOMAL ANEUPLOIDY USING MASSIVELY PARALLEL GENOMIC SEQUENCING - Embodiments of this invention provide methods, systems, and apparatus for determining whether a fetal chromosomal aneuploidy exists from a biological sample obtained from a pregnant female. Nucleic acid molecules of the biological sample are sequenced, such that a fraction of the genome is sequenced. Respective amounts of a clinically-relevant chromosome and of background chromosomes are determined from results of the sequencing. The determination of the relative amounts may count sequences of only certain length. A parameter derived from these amounts (e.g. a ratio) is compared to one or more cutoff values, thereby determining a classification of whether a fetal chromosomal aneuploidy exists. Prior to sequencing, the biological sample may be enriched for DNA fragments of a particular sizes. | 01-05-2012 |
20120003636 | DIAGNOSING FETAL CHROMOSOMAL ANEUPLOIDY USING MASSIVELY PARALLEL GENOMIC SEQUENCING - Embodiments of this invention provide methods, systems, and apparatus for determining whether a fetal chromosomal aneuploidy exists from a biological sample obtained from a pregnant female. Nucleic acid molecules of the biological sample are sequenced, such that a fraction of the genome is sequenced. Respective amounts of a clinically-relevant chromosome and of background chromosomes are determined from results of the sequencing. The determination of the relative amounts may count sequences of only certain length. A parameter derived from these amounts (e.g. a ratio) is compared to one or more cutoff values, thereby determining a classification of whether a fetal chromosomal aneuploidy exists. Prior to sequencing, the biological sample may be enriched for DNA fragments of a particular sizes. | 01-05-2012 |
20120003637 | DIAGNOSING FETAL CHROMOSOMAL ANEUPLOIDY USING MASSIVELY PARALLEL GENOMIC SEQUENCING - Embodiments of this invention provide methods, systems, and apparatus for determining whether a fetal chromosomal aneuploidy exists from a biological sample obtained from a pregnant female. Nucleic acid molecules of the biological sample are sequenced, such that a fraction of the genome is sequenced. Respective amounts of a clinically-relevant chromosome and of background chromosomes are determined from results of the sequencing. The determination of the relative amounts may count sequences of only certain length. A parameter derived from these amounts (e.g. a ratio) is compared to one or more cutoff values, thereby determining a classification of whether a fetal chromosomal aneuploidy exists. Prior to sequencing, the biological sample may be enriched for DNA fragments of a particular sizes. | 01-05-2012 |
20120003638 | KIT FOR HIGH THROUGHPUT MUTATION SCREENING METHODS - One example embodiment includes a kit to execute a method of simultaneously screening for genetic mutations in different genes in a multitude of samples. The kit includes an antisense deoxyribonucleic acid (DNA) probe, where the antisense DNA probe will be mixed with a strand of a ribonucleic acid (RNA) to be tested to form a heteroduplex molecule within a sample. The kit also includes a ribonuclease enzyme, an RNA-primed DNA polymerase, a single strand-specific nuclease, DNA-dependent DNA polymerase, a blocking adapter and a tagged reporter adapter. Through ribonuclease digestion, differential sequence fill-in (DSF) and full-length sequence extension, tagged mutant-dual adapter hybrids are formed for detection, quantification or amplification. The sequence ubiquity of said mutant-dual adapter hybrids enables the use of universalized primers for sequence amplification regardless of the numbers or the origins of the mutations involved. | 01-05-2012 |
20120003639 | CANCER BIOMARKERS AND METHODS OF USE THEREOF - Embodiments are provided for characterizing a biological sample. In some embodiments, one can estimate the risk that a subject with ductal carcinoma in situ will have a subsequent DCIS event and/or invasive cancers. | 01-05-2012 |
20120003641 | GENETIC POLYMORPHISMS IN AGE-RELATED MACULAR DEGENERATION - Methods for determining whether a patient is at increased risk of developing wet AMD or whether a patient has an increased likelihood of benefiting from treatment with a high-affinity anti-VEGF antibody. | 01-05-2012 |
20120003642 | OLIGONUCLEOTIDES AND METHODS FOR DETERMINING SUSCEPTIBILITY TO SOFT TISSUE INJURIES - A method of determining in a subject a predisposition to, or increased risk for, developing a tendon, ligament, or other soft tissue injury or pathology, the method comprising the step of screening the subject for the presence of at least one poly-morphism in at least one gene family selected from the group consisting of any one or more of: the matrix metallo-protease (MMP) family, the collagen family, including the COL5A1 and COL12A1 genes, the glycoprotein family, including the TNC and COMP genes, and derivatives thereof, which polymorphism is a polymorphism which results in a modified, augmented, or gated interaction with other members of the gene families mentioned herein, when compared to a wild-type interaction. | 01-05-2012 |
20120003643 | ENRICHMENT AND IDENTIFICATION OF FETAL CELLS IN MATERNAL BLOOD AND LIGANDS FOR SUCH USE - The present invention relates to enrichment and/or identification of fetal cells of a maternal blood sample using fetal cell specific ligands and/or fetal cell specific hybridization probes. Enriched or identified fetal cells may be subjected to steps of detection or diagnosis, wherefore the present invention enables non-invasive prenatal diagnostics. | 01-05-2012 |
20120003644 | METHODS AND KITS FOR DETERMINING PREDISPOSITION TO DEVELOP KIDNEY DISEASES - Provided are methods and kits for determining predisposition of a subject to develop a kidney disease, by identifying in a sample of the subject at least one APOL1 polypeptide variant which is characterized by a higher trypanolytic activity on | 01-05-2012 |
20120003645 | Compositions, Methods and Kits for Nucleic Acid Synthesis and Amplification - The present invention is directed to compositions, methods and kits useful for the synthesis of nucleic acid molecules. More specifically, compositions, methods and kits are provided for the amplification of nucleic acid molecules in a one-step RT-PCR procedure comprising one or more agents used to increase tolerance to PCR inhibitors. | 01-05-2012 |
20120003646 | METHOD AND APPARATUS FOR IDENTIFYING ANALYTE-CONTAINING SAMPLES USING SINGLE-READ DETERMINATION OF ANALYTE AND PROCESS CONTROL SIGNALS - Apparatus and method for detecting analyte in a reaction mixture comprising an internal control. The invention is illustrated using amplification and detection of nucleic acids, where the amplification reaction comprises an exogenous internal control. Magnitude of the detection signal serves as the variable for identifying invalid trials, identifying valid trials that are negative for analyte, and identifying trials that are positive for analyte. Detection of a signal indicating probe hybridization can be used for assigning the presence or absence of analyte nucleic acid in validated reactions using only a single detectable label, and without distinguishing the proportion of signal contributed by internal control probe binding, and analyte probe binding. | 01-05-2012 |
20120003647 | GENETIC POLYMORPHISMS IN THE PROSTATE-SPECIFIC ANTIGEN GENE PROMOTER - The present invention includes methods of identifying a subject at risk for increased cellular PSA production and/or prostate cancer by detecting the presence or absence of a genetic polymorphism in the prostate specific antigen gene. | 01-05-2012 |
20120003648 | Signal Multiplexing and Signal Amplification - Disclosed are methods, compositions and kits for amplifying signals for detecting the presence, quantity and/or sequence of nucleic acids and proteins, as well as methods, compositions and kits for increasing the number of such targets simultaneously detectable in a sample. Detection may be, for instance, in vivo, in cellulo or in situ. Amplification of signal is achieved by way of hybridization of nucleic acid label probe systems and structures. Increase in target multiplex capacity is achieved by way of varying the type of labels utilized in the nucleic acid label probe system. | 01-05-2012 |
20120003649 | METHODS FOR ASSESSING RISK OF ALZHEIMER'S DISEASE IN A PATIENT - Disclosed are methods for diagnosis or prognosis of Alzheimer's disease in a patient. The methods may include assessing whether a patient has Alzheimer's disease or assessing a patient's risk for developing Alzheimer's disease. The methods typically include determining, either directly or indirectly, whether the patient has mutations, such as single nucleotide polymorphisms, in a plurality of genes that encode gene products that function in steroid biosynthesis. | 01-05-2012 |
20120003650 | MARKER FOR PRENATAL DIAGNOSIS AND MONITORING - The present invention relates to new methods for diagnosing a pregnancy-associated disorder by analyzing fetal DNA present in the mother's blood. More specifically, this invention relies on the discovery that the maspin gene is differentially methylated in fetal DNA and in maternal DNA and provides these new diagnostic methods, which distinguish fetal DNA from maternal DNA and detect prenatal disorders based on abnormalities in fetal DNA level and methylation status. | 01-05-2012 |
20120003651 | TAGGED OLIGONUCLEOTIDES AND THEIR USE IN NUCLEIC ACID AMPLIFICATION METHODS - The present invention provides nucleic acid amplification methods that desirably reduce or eliminate false positive amplification signals resulting from contaminating biological material, e.g., nucleic acid, that may be present in one or more reagents used in an amplification reaction and/or that may be present in the environment in which an amplification reaction is performed. The invention offers the further advantage of requiring less stringent purification and/or sterility efforts than conventionally needed in order to ensure that enzymes and other reagents used in amplification reactions, and the environment in which an amplification reaction is performed, are free of bacterial or other nucleic acid contamination that may yield false positive results. | 01-05-2012 |
20120009570 | Restoration of Nucleic Acid From Degraded or Formalin-Fixed and Paraffin-Embedded Tissue and Uses Thereof - This invention provides methods, primers and kits for restoration of nucleic acid from tissue, in particular degraded tissue and formalin-fixed and paraffin-embedded (FFPE) tissue, where the methods involve complementary-template reverse-transcription (CT-RT) where short single-stranded DNA sequences reverse-transcribed from mRNA are used for reverse-transcription of complementary sense-RNA templates. The methods can be used to determine patterns of gene expression and chromosomal alterations in archived tissue samples, and may be used to identify expression of disease-related genes. | 01-12-2012 |
20120009571 | TMPRSS2 FOR THE DIAGNOSIS OF PROSTATE DISEASE - Described herein are methods, compositions and kits directed to the detection the 5′ portion of TMPRSS2 mRNA for the detection and diagnosis of prostate disease including prostate cancer and benign prostatic hyperplasia. | 01-12-2012 |
20120009572 | Novel single nucleotide polymorphisms and community-associated methicillin-resistant staphylococcus aureus - The present invention is based on the discovery of novel polymorphisms (SNPs) in the penicillin binding protein (pbp3) gene in | 01-12-2012 |
20120009573 | Antisense Transcriptomes of Cells - Transcription in mammalian cells can be assessed at a genome-wide level, but it has been difficult to reliably determine whether individual transcripts are derived from the Plus- or Minus-strands of chromosomes. This distinction can be critical for understanding the relationship between known transcripts (sense) and the complementary antisense transcripts that may regulate them. Here we describe a technique that can be used to (i) identify the DNA strand of origin for any particular RNA transcript and (ii) quantify the number of sense and antisense transcripts from expressed genes at a global level. We examined five different human cell types and in each case found evidence for antisense transcripts in 2900 to 6400 human genes. The distribution of antisense transcripts was distinct from that of sense transcripts, was non-random across the genome, and differed among cell types. Anti-sense transcripts thus appear to be a pervasive feature of human cells, suggesting that they are a fundamental component of gene regulation. | 01-12-2012 |
20120009574 | DETECTION OF LISTERIA SPECIES IN FOOD AND ENVIRONMENTAL SAMPLES, METHODS AND COMPOSITIONS THEREOF - Embodiments of the disclosure relate to isolated nucleic acid sequences, methods of use thereof, and workflows for detection of several | 01-12-2012 |
20120009575 | INDUCIBLE NUCLEIC ACID TARGETS FOR DETECTION OF PATHOGENS, METHODS AND COMPOSITIONS THEREOF - The present application describes compositions, methods and kits for rapid detection and identification of various microorganisms using inducible RNA. Methods for rapidly detecting microorganisms by detecting expression of inducible RNA of target genes following induction of a target gene using an inducer are described. Some embodiments describe methods and workflows for rapidly detecting microbes such as, but not limited to, | 01-12-2012 |
20120009576 | Probe for Detection of Polymorphism in ABL Gene, and Use Thereof - A probe for detecting a polymorphism in ab1 gene, said probe comprising at least one fluorescence-labeled oligonucleotide selected from P1 below:
| 01-12-2012 |
20120009577 | Detection of Nucleic Acids Through Amplification of Surrogate Nucleic Acids - Methods for detecting and optionally quantitating one or more target nucleic acids are provided, in which a surrogate nucleic acid is captured to each target nucleic acid, amplified, and detected. Compositions, kit, and systems related to the methods are also described. | 01-12-2012 |
20120009578 | Microvesicle-Based Compositions and Methods - Methods and compositions for diagnosis and/or analysis of a condition in a mammal are disclosed in which RNA from microvesicles is enriched and differentiated to so obtain a result that is indicative of the condition of tissue or organ from which the microvesicle originated. In especially preferred embodiments, the condition is a neoplastic disease of a human and can be identified and staged by differential analysis of one or more distinct RNAs, optionally together with identification and analysis of a non-RNA component of the microvesicle. | 01-12-2012 |
20120009579 | MONOCYTE-DERIVED NUCLEIC ACIDS AND RELATED COMPOSITIONS AND METHODS - Nucleic acids encoding various monocyte-derived proteins and related compositions, including purified proteins and specific antibodies are described. Methods of using such composition are also provided. | 01-12-2012 |
20120009580 | METHODS FOR QUANTITATING SMALL RNA MOLECULES - In one aspect, the present invention provides methods for amplifying a microRNA molecule to produce DNA molecules. The methods each include the steps of: (a) using primer extension to make a DNA molecule that is complementary to a target microRNA molecule; and (b) using a universal forward primer and a reverse primer to amplify the DNA molecule to produce amplified DNA molecules. In some embodiments of the method, at least one of the forward primer and the reverse primer comprise at least one locked nucleic acid molecule. | 01-12-2012 |
20120015355 | SIZE STANDARDS FOR USE IN NUCLEIC ACID ANALYSIS - A size standard, kit includes a size standard, method of defining a size standard and method of analysis using a size standard. The size standard is intended to include size standard elements which have a size greater than and/or less than and/or different from the components of a sample which are to be sized. This means that the same characteristic unit, such as a dye, can be used to label the component and the size standard. A further characteristic unit, from amongst a limited number of such characteristic units is liberated from use only on size standards for use on components. The method is therefore particularly useful in multiplex amplification of STRs. | 01-19-2012 |
20120015356 | CONNEXIN MUTATION DETECTION FOR LYMPHATIC VARIATION AND DISEASE - Methods are provided for identifying risk of developing lymphedema, including primary and secondary edema. The methods comprise identifying the presence in a biological sample of a polymorphism in one or more of GJA4, GJA5 and GJC2, resulting in a functional mutation of one or more of connixin 37 (Cx37), Cx40 or Cx47. | 01-19-2012 |
20120015357 | PREDICTION OF LIPID-METABOTYPE-RELATED PHYSIOLOGICAL SUSCEPTIBILITIES - The present invention relates to a method for determining a predisposition of a human subject for physiological susceptibilities that result from alterations in lipid metabolism, wherein the physiological susceptibilities are selected from sensitivity to functional food, physical health schemes, identification of non-responsiveness to treatment by diet or physical activity. The present invention further relates to a method for determining a predisposition of a human subject for physiological susceptibilities that result from alterations in lipid metabolism, wherein the physiological susceptibilities are selected from sensitivity to drug treatment or identification of non-responsiveness to treatment by medication. The methods of the present invention comprise determining, in a sample obtained from the human subject, the genotype of that person with respect to at least two genetic polymorphisms selected from the group consisting of a) rs2014355; b) rs11161510; c) rs2286963; d) rs174548; e) rs9393903; f) rs168622; g) rs541503; h) rs2046813; i) rs272889; j) rs2216405; k) rs7156144; l) rs8396; m) rs7094971; and n) rs603424; wherein the presence of one or two copies of the minor allele of at least two genetic polymorphisms is indicative of a predisposition for said physiological susceptibilities. The polymorphisms listed above are located in the following genes: SCAD, MCAD, LCAD, FADS1, ELOVL2, SPTLC3, PHGDH, ACSL1, OCTN1, CPS1, PLEKHH1, ETFDH, SLC16A9 and SCD. | 01-19-2012 |
20120015358 | ORTHOGONAL NUCLEIC ACID AFFINITY PAIRS - The invention provides methods to identify pRNA- and pDNA oligomer affinity pairs. Affinity pairs comprised of nucleic acid oligomers which demonstrate no cross-reactivity (“orthogonal”) are designed using software and empirically verified by thermodynamic study and lateral flow testing. The design software uses a semi-random algorithm to build such sequences of nucleic acid oligomers based on user-input parameters for affinity strength and orthogonal stringency. These pairs can be applied for use in multi-analyte solid support and lateral flow diagnostic tests. | 01-19-2012 |
20120015359 | METHODS FOR MOLECULAR DETECTION - This invention relates to methods for molecular detection, particularly to methods utilizing target-specific molecular probes. In exemplary embodiments, target-specific molecular probes include single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) aptamers. In general, the molecular probe may bind with relatively high specificity to a given target. In one aspect, a method for molecular detection comprises a molecular probe paired to a reporter molecule wherein the molecular probe impairs the amplification of the reporter molecule in the absence of the target molecule. | 01-19-2012 |
20120021412 | Compositions and Methods for Detecting Pathogen Specific Nucleic Acids in Urine - The invention is based upon the discovery that small nucleic acids from non-viral pathogens are able to cross the kidney and are present in urine of a subject when the subject is infected with the non-viral pathogen. These transrenal DNAs are especially prevalent at smaller sizes under about 300 bp. Thus the invention provides compositions and methods for the diagnosis of infection of a subject with non-viral pathogens through the detection of transrenal nucleic acids from those pathogens in the urine of the subject. | 01-26-2012 |
20120021413 | Method for Detecting Mutation in Exon 12 of JAK2 Gene, and Nucleic Acid Probe and Kit Therefor - A probe for detecting a polymorphism in exon 12 of the JAK2 gene, the probe comprising at least one of the oligonucleotides in (a) to (c) below:
| 01-26-2012 |
20120021414 | DIAGNOSTIC MARKERS OF IMMUNOSENESCENCE AND METHODS OF USE THEREOF - Embodiments of the present invention provide diagnostic markers of immunosenescence and methods of identifying individuals with impaired immune function based on a combination of such markers obtained from various analyses, primarily from blood, testing immune function including the analysis of immune cell subset frequencies, gene expression, cytokine and chemokine levels, and signaling responses to stimulation with cytokines (‘cytokine response’). Particular combinations of markers can predict with high accuracy whether an individual will respond to active vaccination and become protected against recurring diseases. | 01-26-2012 |
20120021415 | Methods for Determining Response to Neoadjuvant Therapy and Survival Using MicroRNA-10b - The present invention provides methods for determining response to neoadjuvant therapy and metastasis-free survival in pancreatic ductal adenocarcinoma based upon the level of microRNA expression and optionally the presence of a protein cancer cell marker in biological samples such as formalin-fixed paraffin-embedded specimens using in situ hybridization and optionally an immunohistochemical assay. | 01-26-2012 |
20120021416 | BIOLAYER INTERFEROMETRY MEASUREMENT OF BIOLOGICAL TARGETS - Disclosed are methods and compositions for the ultrasensitive detection of oligonucleotides, proteins, protein complexes, biomolecules, and infectious agents using a peroxidase driven deposition of substrates onto interferometry capable biosensors, coupled to the specific recognition of the target molecules. More specifically, methods are disclosed to specifically immobilize biological target molecules onto the surface of interferometry capable biosensors and to associate the target molecules with peroxidase enzymes. Through the peroxidase driven deposition of substrates onto the interferometry capable biosensors there is the ability to achieve ultrasensitive detection and quantification of specific target molecules. | 01-26-2012 |
20120021417 | DOPAMINERGIC NEURON PROLIFERATIVE PROGENITOR CELL MARKER Nato3 - The present invention is a probe, a primer, and an antibody, for detecting a dopaminergic neuron proliferative progenitor cell. According to the present invention, there is provided a polynucleotide probe and a polynucleotide primer for use in the detection or selection of a dopaminergic neuron proliferative progenitor cell, which can hybridize with a polynucleotide consisting of a nucleotide sequence of a Nato3 gene, or a complementary sequence thereto, and an antibody against a Nato3 protein, or a part thereof for use in the detection or selection of a dopaminergic neuron proliferative progenitor cell. | 01-26-2012 |
20120028252 | HUMAN MENA ISOFORMS SERVE AS MARKERS OF EPITHELIAL TO MESENCHYMAL TRANSITION AND SENSITIVITY TO EGFR INHIBITION IN HUMAN CANCER CELLS - The present invention discloses a method for discriminating between sensitive and resistant tumours to a treatment with EGFR inhibitor drugs comprising: in vitro testing whether tumour material expresses the hMena | 02-02-2012 |
20120028253 | METHOD FOR AMPLIFYING OLIGONUCLEOTIDE AND SMALL RNA BY USING POLYMERASE-ENDONUCLEASE CHAIN REACTION - A method for amplifying oligonucleotide in vitro by polymerase-endonuclease chain reaction (PECR) which utilizes a single-stranded DNA probe containing repeat sequences, extends a target oligonucleotide by a thermostable DNA polymerase, cleaves extended products with a thermostable endonuclease, and amplifies target oligonucleotide by thermocycling. In PECR, a specific oligonucleotide is exponentially amplified using one single probe instead of a pair of primers, and the reaction is precisely controlled by thermal cycles whose parameters are flexibly adjustable according to length, sequence, melting temperature and initial amount of the target oligonucleotide. Amplification speed depends totally on initial amount of target oligonucleotide present in the reaction system. The method can be used to amplify specific small nucleic acids, such as oligonucleotides and microRNAs, and further conduct quantitative analysis. PECR is easy to conduct with high efficiency, specificity and stability, and thus can be widely used in molecular biology studies. | 02-02-2012 |
20120028254 | SNP Marker of Breast and Ovarian Cancer Risk - The invention provides methods for predicting an increased risk or probability of developing breast or ovarian cancer in a patient based upon the patient's KRAS-Variant and BRCA status. | 02-02-2012 |
20120028255 | HIGH YIELDING SOYBEAN PLANTS WITH LOW LINOLENIC ACID - The invention overcomes the deficiencies of the prior art by providing methods for marker assisted selection to create plants of a soybean variety that exhibit a mid/low linolenic acid content with a commercially significant yield and an agronomically elite phenotype. The invention also provides derivatives and plant parts of these plants. Further provided by the invention are methods for the use of these plants. The invention is significant in that oil with decreased linolenic acid exhibits numerous beneficial characteristics yet prior art varieties with decreased linolenic acid also exhibited decreased yield and poor agronomic quality. | 02-02-2012 |
20120028256 | METHOD FOR PROVIDING INFORMATION ON ANTIDEPRESSANT THERAPEUTIC EFFECT USING SINGLE NUCLEOTIDE POLYMORPHISM - Disclosed is a method for providing information on the therapeutic effect of an SSRI antidepressant by identifying TPH2 gene polymorphism rs4760815, SLC6A4 gene polymorphism 5-HTTLPR, SLC6A4 gene polymorphism rs2066713, GAD1 gene polymorphism rs3828275, and GRIK2 gene polymorphism rs543196. Through the disclosed method, it is possible to select an antidepressant based on genetic information, to prevent the worsening or relapse of depression, and to establish customized depression treatment models which are effective in the development of customized new drugs, and appropriate for Korean people. Therefore, the base of domestic clinical trials can be expanded, which will enhance competitive power in the pharmaceutical market and preoccupy technology of drug prediction. | 02-02-2012 |
20120034603 | LIGATION-BASED DETECTION OF GENETIC VARIANTS - The present invention provides assays systems and methods for detection of genetic variants in a sample, including copy number variation and single nucleotide polymorphisms. The invention preferably employs the technique of tandem ligation, i.e. the ligation of two or more fixed sequence oligonucleotides and one or more bridging oligonucleotides complementary to a region between the fixed sequence oligonucleotides. | 02-09-2012 |
20120034604 | USE OF BASIC PROLIN-RICH LACRIMAL GENE PRODUCTS, SUCH AS OPIORPHIN, AS A BIOMARKER - The present invention relates to the use of Basic Prolin-rich Lacrimal protein (BPLP) gene products, such as Opiorphin, for establishing a prognosis, a diagnosis or the monitoring of a pathological state or of treatment efficacy in a subject and the related method of use. | 02-09-2012 |
20120034605 | METHOD FOR DETECTION OF COLORECTAL TUMOR - Disclosed is a method for determining the presence or absence of a colorectal tumor, specifically colorectal cancer or colorectal adenoma, with high sensitivity and high specificity by employing the methylation of DNA as a measure. Also disclosed is a kit for carrying out the method. Specifically, measurement is made on the degree of methylation of one or more CpG sequences contained in the region lying between positions -477 to -747, more preferably a CGCG sequence contained in the region lying between positions -688 to -691, in TWIST1 gene ( | 02-09-2012 |
20120034606 | DETECTION OF SALMONELLA ENTERICA SUBSPECIES ENTERICA SEROVAR ENTERITIDIS IN FOOD AND ENVIRONMENTAL SAMPLES, METHODS AND COMPOSITIONS THEREFOR - Embodiments of the disclosure relate to compositions of isolated nucleic acid sequences, methods, workflows and kits of use thereof for detection of | 02-09-2012 |
20120034607 | Methods and apparatus for measuring analytes using large scale fet arrays - Methods and apparatus relating to very large scale FET arrays for analyte measurements. ChemFET (e.g., ISFET) arrays may be fabricated using conventional CMOS processing techniques based on improved FET pixel and array designs that increase measurement sensitivity and accuracy, and at the same time facilitate significantly small pixel sizes and dense arrays. Improved array control techniques provide for rapid data acquisition from large and dense arrays. Such arrays may be employed to detect a presence and/or concentration changes of various analyte types in a wide variety of chemical and/or biological processes. In one example, chemFET arrays facilitate DNA sequencing techniques based on monitoring changes in hydrogen ion concentration (pH), changes in other analyte concentration, and/or binding events associated with chemical processes relating to DNA synthesis. | 02-09-2012 |
20120034608 | MICRORNA AS A BIOMARKER OF PANCREATIC ISLET BETA-CELL ENGAGEMENT - MicroRNAs (miRNAs) are short non-coding RNAs that regulate gene expression and which play important roles in many cell types, including as described herein, the pancreatic β-cell. Glucagon like peptide-1 (GLP-1), a hormone released from intestinal L-cells following meal intake, exerts pleiotropic effects on β-cell function including raising intracellular cAMP levels and now represents an important therapy for type 2 diabetes. Expression of miR-132 and miR212 is upregulated by CREB protein in response increased cAMP levels in the cell; therefore, methods for detecting and evaluating β-cell engagement by GLP-1 receptor agonists by monitoring miR-132 and miR-212 expression in a subject is described. The methods herein are particularly useful in the context of longitudinal clinical trials, such as those designed for testing the durability of any single or combination therapy in type 2 diabetes populations. Because the expression of these miRNAs is not affected by glucose, fatty acid, insulin, or β-cell function, monitoring miR-132 and miR-212 expression can be used to monitor the efficacy of any agent that effects an increase cAMP in β-cells. Such agents include for example, GLP-1, glucagon, GPR-119, and GIP receptor agonists; dipeptidyl peptidase IV (DPP IV) inhibitors; and phosphodiesterase inhibitors. | 02-09-2012 |
20120034609 | GENE DETECTION ASSAY FOR IMPROVING THE LIKELIHOOD OF AN EFFECTIVE RESPONSE TO AN EGFR ANTAGONIST CANCER THERAPY - The invention provides a method for more effective treatment of patients susceptible to or diagnosed with tumors overexpressing EGFR, as determined by a gene amplification assay, with an EGFR antagonist. Such method comprises administering a cancer-treating dose of the EGFR antagonist, preferably in addition to chemotherapeutic agents, to a subject in whose tumor cells erbB1 gene has been found to be amplified e.g., by fluorescent in situ hybridization. EGFR antagonists described include an anti-EGFR antibody. | 02-09-2012 |
20120034610 | IDENTIFICATION OF TOXIN-BINDING PROTEIN INVOLVED IN RESISTANCE TO CRY1 TOXINS, AND RELATED SCREENING METHODS - The subject invention relates in part to the surprising and unexpected discovery that insects that are resistant to | 02-09-2012 |
20120040341 | Method for the Detection and Diagnosis of Cancer Involving Primers and Probes for the Specific Detection of the MAGE-A3-Marker - The present invention relates to MAGE-3 specific primers and probes for use new diagnostic kits and methods. The invention further relates to immunotherapeutic treatment of specific populations of cancer patients, suffering from MAGE-3 expressing tumours. | 02-16-2012 |
20120040342 | Genetic Indicators Of Weight Loss - Methods for determining resistance to weight loss and susceptibility to binge eating episodes are described. The methods include determination of the presence of a obesity related alleles for a patient at single nucleotide polymorphism sites associated with the genes INSIG2, FTO, MC4R, and PCSK1. The total number of obesity alleles for the patient is indicative of the patient's resistance to weight loss and susceptibility to weight gain following bariatric surgery. The methods also include determining if a patient is homozygous for an obesity related allele at one or more single nucleotide polymorphism sites of the four genes. | 02-16-2012 |
20120040343 | Detecting and Sorting Methylated DNA Using a Synthetic Nanopore - Provided are methods for detecting, characterizing or separating DNA based on methylation. Heterogeneous DNA populations are separated based on DNA methylation by providing a membrane having a nanopore through which an electric field is applied. DNA of interest is introduced, and for a given threshold voltage across the nanopore, only DNA having a methylation parameter of interest may transit the pore, thereby facilitating detection, characterization, or separation of DNA based on methylation. The methods are optionally used to detect a disease state that is associated with DNA methylation including, but not limited to, cancer. | 02-16-2012 |
20120040344 | PREDICTIVE USE OF CpG METHYLATION - Determination of the methylation status of individual selected Cp/G dinucleotides/CpG groups 5′ to the coding region of selected genes, preferably in a perinatal tissue sample such as umbilical cord, can be used to predict future development of diverse phenotypic characteristics, such as indices of body composition indicative of for example, obesity or low bone mineral content, indices of impaired cardiovascular structure or function, ability to learn and cognitive function, neurobehavourial problems and allergic disorders such as atopic eczema. | 02-16-2012 |
20120040345 | 2-Nitrobenzyl-Modified Ribonucleotides - This disclosure provides novel reversibly terminated ribonucleotides which can be used as a reagent for DNA sequencing reactions. Methods of sequencing nucleic acids using the disclosed nucleotides are also provided. | 02-16-2012 |
20120040346 | Method of Determining Chemotherapy of Metastatic Tumor by Assaying DPD Gene Expression in Primary Tumors - The invention relates to a method for determining a chemotherapeutic regimen for an individual, comprising obtaining a mRNA sample from a primary tumor specimen; determining a gene expression level for a tumor gene determinant in the specimen; comparing the gene expression level for the tumor gene determinant with a predetermined threshold value for that gene; and providing a chemotherapeutic regimen comprising a chemotherapeutic agent appropriate for the tumor gene determinant to treat the tumor metastases. | 02-16-2012 |
20120040347 | Polymorphism in CYP3A4 Gene Affecting Drug Metabolizing and Uses Thereof - A method for predicting a subject's risk factors for CYP3A4-related disorders includes detecting the allelic status of a SNP in a nucleic acid sample of the subject. | 02-16-2012 |
20120040348 | METHODS FOR NUCLEIC ACID QUANTIFICATION - The invention relates to a method for quantification of amplified nucleic acids comprising the steps of: calculation of a measure of randomness M of the cycle-to-cycle amplification efficiency Ê(C) for target and comparative nucleic acids, —identification of the cycle numbers C | 02-16-2012 |
20120040349 | METHOD FOR DETECTING NUCLEIC ACIDS - Method for detecting nucleic acids which employs a double-stranded oligonucleotide probe containing i) a first probe including a first label moiety, and ii) a second probe partially complementary with the first probe and including a second label moiety capable of interacting with the first moiety when brought in close proximity with each other, the second moiety being a quencher or acceptor of emission of the first moiety. The first or second probe includes a sequence complementary to that of a target nucleotide, and the second or first probe, respectively, includes a sequence complementary to a complement of the target nucleotide sequence of the nucleic acid to be detected. Oligonucleotides for determining | 02-16-2012 |
20120040350 | GENETIC MARKERS OF SCHIZOPHRENIA - The invention includes method of determining if a subject has a genetic predisposition to clinically diagnosed schizophrenia (SZ), schizotypal personality disorder (SPD), and/or schizoaffective disorder (SD). | 02-16-2012 |
20120040351 | GENETIC MARKERS OF SCHIZOPHRENIA - The invention includes method of determining if a subject has a genetic predisposition to clinically diagnosed schizophrenia (SZ), schizotypal personality disorder (SPD), and/or schizoaffective disorder (SD). | 02-16-2012 |
20120045755 | HER-2 BINDING ANTAGONISTS - There is disclosed a pharmaceutical composition for treating solid tumors that overexpress HER-2, comprising an agent selected from the group consisting of (a) an isolated polypeptide having from about 50 to 79 amino acids taken from the sequence of SEQ ID NO. 1 or SEQ ID NO:12, wherein the polypeptide binds to the extracellular domain ECD of HER-2 at an affinity of at least 10 | 02-23-2012 |
20120045756 | METHODS AND COMPOSITIONS FOR SEQUENCE-SPECIFIC PURIFICATION AND MULTIPLEX ANALYSIS OF NUCLEIC ACIDS - Methods and materials for determining the presence of at least one nucleic acid in a sample are provided, said methods comprising (1) a purification step using sequence specific hybrid capture; (2) an amplification step; and (3) a detection step comprising contacting the target nucleic acid with a plurality of detectably labeled nucleic acid detection probes, wherein each (a) bears a different detectable label from the other detection probes, and/or (b) has a different melting temperature from probes bearing the same detectable label. Also disclosed are compositions and kits for use in such a method. | 02-23-2012 |
20120045757 | APPARATUS AND METHODS FOR ANALYSING FLUORESCENT PARTICLES - According to an embodiment of the invention, an apparatus to detect fluorescence from a sample is disclosed. The apparatus comprises a sample plane onto which the sample is arranged, an excitation light unit including at least a light source to illuminate the sample, and a detection unit comprising at least a detector having at least 100,000 active detection elements to detect a fluorescence signal from the sample. | 02-23-2012 |
20120045758 | IMPRINTING IN VERY SMALL EMBRYONIC-LIKE (VSEL) STEM CELLS - Methods for determining a degree of pluripotency in a first putative stem cell relative to a second putative stem cell are provided. In some embodiments the methods include comparing the imprinting status in the first versus the second putative stem cell of a locus selected from among Igf2-H19, Rasgrf1, lgf2R, Kcnq1, and Peg1/Mest. Also provided are methods for distinguishing very small embryonic like (VSEL) stem cells from hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs), methods for isolating VSELs from sources expected to include VSELs, methods for assessing the purity of a very small embryonic like stem cell (VSEL) preparation, and kits that include oligonucleotide primers that can be employed in the practice of the claimed methods. | 02-23-2012 |
20120045759 | Methods for detecting nucleic acid hybridization - Chemically reactive carbocyanine dyes that are intramolecularly crosslinked between the 1-position and 3′-position, their bioconjugates and their uses are described. 1,3′-crosslinked carbocyanines are superior to those of conjugates of spectrally similar 1,1′-crosslinked or non-crosslinked dyes. The invention includes derivative compounds having one or more benzo nitrogens. | 02-23-2012 |
20120045760 | Single Nucleotide Polymorphism Within An Intronic P53 Binding Motif of the Prkag2 Gene - The present invention relates to single nucleotide polymorphism (SNP). In particular, it relates to a SNP within an intronic p53 binding motif of the PRKAG2. Nucleic acid molecules and methods for aiding assessment of a patient's risk of developing cancer by determining the patient's genotype for a p53 binding motif within the PRKAG2 gene are included in the present invention. | 02-23-2012 |
20120045761 | PROBES AND PRIMERS FOR DETECTION OF CHIKUNGUNYA - The present disclosure gives a detailed description of methods for determining the presence of Chikungunya viral nucleic acids in blood/serum/plasma samples by employing “Oligonucleotide” probes. The designed “Oligonucleotide” probes can be used for qualitative or quantitative detection of Chikungunya virus in an infected sample by employing Real time PCR. | 02-23-2012 |
20120045762 | LMNA GENE AND ITS INVOLVEMENT IN HUTCHINSON-GILFORD PROGERIA SYNDROME (HGPS) AND ARTERIOSCLEROSIS - Disclosed herein are point mutations in the LMNA gene that cause HGPS. These mutations activate a cryptic splice site within the LMNA gene, which leads to deletion of part of exon 11 and generation of a mutant Lamin A protein product that is 50 amino acids shorter than the normal protein. In addition to the novel Lamin A variant protein and nucleic acids encoding this variant, methods of using these molecules in detecting biological conditions associated with a LMNA mutation in a subject (e.g., HGPS, arteriosclerosis, and other age-related diseases), are also described. Oligonucleotides and other compounds for use in examples of the described methods are also provided, as are protein-specific binding agents, such as antibodies, that bind specifically to at least one epitope of a Lamin A variant protein preferentially compared to wildtype Lamin A, and methods of using such antibodies in diagnosis, treatment, and screening. | 02-23-2012 |
20120045763 | Antibodies Against Cells of Fetal Origin - This invention relates to antibodies that specific bind to fetal CD36+ cells in preference to binding to maternal CD36+ cells and methods for using these antibodies to detect and separate fetal cells from adult biological fluids including maternal peripheral blood. | 02-23-2012 |
20120045764 | METHOD OF EXPANDING HUMAN HEPATOCYTES IN VIVO - Described herein is a method of expanding human hepatocytes in vivo using an immunodeficient mouse which is further deficient in fumarylacetoacetate hydrolase (Fah). The method comprises transplanting human hepatocytes into the immunodeficient and Fah-deficient mice, administering an IL-1R antagonist to the mouse and allowing the hepatocytes to expand. Alternatively, the method includes transplanting human hepatocytes into the immunodeficient and Fah-deficient mice, wherein the mouse is further deficient for IL-1R and allowing the hepatocytes to expand. The method also allows serial transplantation of the human hepatocytes into secondary, tertiary, quaternary or additional mice. | 02-23-2012 |
20120058471 | IDENTIFICATION OF NUCLEIC ACID SEQUENCES - The invention provides a method for use in the detection of a target nucleic acid comprising the steps of: (i) contacting a single-stranded probe nucleic acid with a sample of interest under conditions effective to generate a probe/target nucleic acid duplex by specific hybridisation of said probe nucleic acid to a target nucleic acid, if said target nucleic acid is present; (ii) contacting any probe/target nucleic acid duplex with an exonuclease to effect digestion of the duplex and release of a label molecule from the duplex; and (iii) detecting the label by Raman spectroscopy. | 03-08-2012 |
20120058472 | METHOD AND SYSTEM FOR NUCLEIC ACID DETECTION USING ELECTROCONDUCTIVE OR ELECTROCHEMICALLY ACTIVE LABELS - A method for electrochemically or electrically detecting nucleic acids, utilizes electrochemically active or electrically conductive reporter materials. An electric voltage is applied and electric signals are measured to the electrodes that are suitable for detecting or quantifying the nucleic acid(s) in a sample. This technique is suitable for point-of-use applications, e.g. detecting bioanalytes in remote locations. A microchip, device, kit used adapted to be used for this method is also disclosed. | 03-08-2012 |
20120058473 | Molecular Adaptors for Dye Conjugates - In various embodiments, the present invention provides fluorescent dyes that are linked to another species through an adaptor moiety. In an exemplary embodiment, the dye is linked to a polyphosphate nucleic acid through an adaptor. An adaptor can be a component of a linker. These conjugates find use in single molecule DNA sequencing and other applications. In various embodiments, the dye moiety is a cyanine dye. Cyanine dyes that are highly charged, such as those including multiple sulfonate, alkylsulfonate, carboxylate and/or alkylcarboxylate moieties are examples of cyanine dyes of use in the compounds of the invention. | 03-08-2012 |
20120058474 | PROBE-ANTIPROBE COMPOSITIONS AND METHODS FOR DNA OR RNA DETECTION - The invention provides novel compositions and methods for detecting unlabeled nucleic acid targets using labeled polynucleotide probes and partially complementary antiprobes. The interaction of probes, antiprobes and targets result in signaling changes that indicate target frequency. This novel detection mechanism is called a DNA detection switch, and it enable end-point detection, microarray detection and real-time PCR detection of a variety of nucleic acid targets including microbial species and subspecies, drug resistant mutants, and pathogenic strains. | 03-08-2012 |
20120058475 | Detection of Chromosomal Inversions - A method and a kit for the identification of chromosomal inversions is described. Chromosomal inversions are difficult to detect unless they are quite large. The improved ability to detect chromosomal inversions is important to a number of medical applications, such as cancer and birth defects, as examples. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids prepared by the CO-FISH procedure, as an example. If an inversion has occurred, these marker probes will be detected on the sister chromatid at the same location as the inversion on the first chromatid. | 03-08-2012 |
20120058476 | Method Of Oligonucleotide Labeling Using Cycloaddition Reaction - The invention provides a novel method of labeling oligonucleotides, with reporter moieties, including but not limited to, quenchers, fluorophores, biotin, digoxigenin, peptides and proteins. In addition, this invention provides a method of detecting hybridization of oligonucleotides. This invention also provides novel azo quenchers having the general formula shown below. The invention further provides compositions comprising labeled oligonucleotides and solid supports. The invention also provides kits comprising at least one composition of the present invention. | 03-08-2012 |
20120064520 | DIAGNOSIS AND PROGNOSIS OF VARIOUS TYPES OF CANCERS - The present invention provides nucleic acid sequences that are used for identification, classification and diagnosis of specific types of cancers. The nucleic acid sequences can also be used for prognosis evaluation of a subject based on the expression pattern of a biological sample. | 03-15-2012 |
20120064521 | DETECTION OF DNA HYDROXYMETHYLATION - Reagents and methods for analysis of DNA hydroxymethylation are provided. Methods comprise modification of hydroxymethylated cytosine residues with a bulky moiety to protect hydroxymethylated positions from cleavage with a DNA endonuclease. For example, methods may comprise contacting DNA with a glucosyltransferase to glucosylate hydroxymethylated DNA positions and digesting the DNA with a DNA endonuclease to cleave DNA in positions lacking hydroxymethylation. Reagents and kits for hydroxymethylated DNA analysis are also provided. | 03-15-2012 |
20120064522 | METHODS FOR DETERMINING GENE-ALPHA TOCOPHEROL INTERACTIONS - Method for predicting the change in the level of at least one pro-inflammatory cytokine in an individual due to alpha tocopherol supplementation are provided, as well as methods for predicting the response of an individual to alpha tocopherol supplementation, and methods of nutrigenetic screening of an individual. | 03-15-2012 |
20120064523 | Bioagent Detection Systems, Devices, And Methods - The present invention relates to portable systems and devices, and corresponding methods, for detecting bioagents. In particular, the present invention provides systems, devices, and methods that utilize one or more of a sample preparation component, sample analysis component employing broad range primers, and sample detection component. | 03-15-2012 |
20120064524 | TUMOR SUPPRESSOR GENE, P47ING3 - The invention provides isolated nucleic acid and amino acid sequences of novel human tumor suppressors, antibodies to such tumor suppressors, methods of detecting such nucleic acids and proteins, methods of screening for modulators of tumor suppressors, and methods of diagnosing and treating tumors with such nucleic acids and proteins. | 03-15-2012 |
20120064525 | METHOD FOR COLLECTION OF NUCLEIC ACID DERIVED FROM MAMMALIAN CELL, METHOD FOR ANALYSIS OF NUCLEIC ACID, AND KIT FOR COLLECTION OF FECES - A method of recovering a nucleic acid derived from a mammalian cell taken from feces is provided. The nucleic acid is recovered easily even from feces collected in routine health checkups or the like. The nucleic acid of mammalian cell can be recovered more selectively than that from an enterobacterial cell. The method of recovering of the present invention includes the steps of, (A) preparing a fecal sample by placing the feces in a treatment solution with a high salt concentration, immersing the feces in the treatment solution for a predetermined period; (B) recovering a solid component from the fecal sample after the step (A); and (C) recovering a nucleic acid from the solid component recovered in the step (B). | 03-15-2012 |
20120064526 | KITS FOR AND METHODS OF DIFFERENTIAL STAINING OF CERVICAL CANCER CELLS AND/OR TISSUES - Provided are methods and kits for staining cervical cell sample by contacting the cervical cell sample with a | 03-15-2012 |
20120064527 | NUCLEIC ACID ANALYSIS DEVICE, NUCLEIC ACID ANALYSIS APPARATUS, AND NUCLEIC ACID ANALYSIS METHOD - The present invention relates to a nucleic acid analysis device in a nucleic acid analysis apparatus, whereby waste of reaction spots on the nucleic acid analysis device is eliminated and leakage of fluorescence excitation light to unobserved nucleic acid measurement regions is minimized. Specifically, the nucleic acid analysis device has a plurality of nucleic acid measurement regions, which are characterized in that one nucleic acid measurement region is disposed at a sufficient distance from the other nucleic acid measurement regions such that the other nucleic acid measurement regions do not enter an irradiation region. | 03-15-2012 |
20120070826 | LAFORA'S DISEASE GENE - A novel gene (EPM2B) that is mutated in humans and dogs with Lafora's disease is described. | 03-22-2012 |
20120070827 | DETECTION OF FETAL CELLS FROM MATERNAL BLOOD - The present application relates to methods for identification of foetal cells and generation and isolation of binding members recognising foetal cells. Said methods may further be used for other purposes relating to characterisation of biological samples and biological antigens. The methods are characterised by the applicability in situations where the interesting objects are present in a limited amount, or where the interesting objects are intermixed with other material, thus the methods are suitable for use in situations where the ratio of the interesting material compared to other material is low. The application discloses methods for use of detecting foetal cells and method of generating/isolating binding members towards antigenic material of low abundancy. | 03-22-2012 |
20120070828 | METHODS FOR THE DETECTION AND IDENTIFICATION OF EXTENDED SPECTRUM BETA LACTAMASES - Embodiments disclosed herein relate to compositions for the detection and/or identification of microbes that carry extended spectrum beta-lactamase genes. Specifically, provided herein are oligonucleotides, probes, and kits containing the same, for the detection of bacterial CTX-M sequences. Also provided are methods for the detection and/or amplification of microbes harboring extended spectrum beta-lactamase genes, including CTX-M type extended spectrum beta-lactamase genes. | 03-22-2012 |
20120070829 | SIZE SELECTION OF DNA FOR CHROMATIN ANALYSIS - Methods for analyzing chromosomal DNA, including chromatin, are provided. | 03-22-2012 |
20120070830 | STABILIZATION OF OZONE-LABILE FLUORESCENT DYES BY THIOUREA - The present invention provides compositions and methods for stabilization of fluorescent dyes. In particular, the present invention provides buffer systems comprising thiourea to protect against degradation of ozone-labile fluorescent dyes. | 03-22-2012 |
20120070831 | Amplification of Distant Nucleic Acid Targets Using Engineered Primers - The invention is a method of amplifying nucleic acids by synthesizing an engineered amplicon containing the sequence of interest, but omitting intervening sequences present in the template molecule. The method utilizes an “amplicon bridge” incorporated into the amplification primers. The length and content of the desired amplicon can be chosen by the operator and can contain unique regions for probe binding. | 03-22-2012 |
20120070832 | SE33 MUTATIONS IMPACTING GENOTYPE CONCORDANCE - Disclosed are primer set compositions, methods and kits for human identification using the highly complex sequence locus, SE33 (ACTBP2) in single and multiplex PCR reactions. Additionally, disclosed are three newly discovered single nucleotide polymorphisms (SNPs) within the SE33 locus that can cause discordance seen as mobility shift or allelic dropout. Also disclosed are kits useful in human identification. | 03-22-2012 |
20120070833 | LATERAL FLOW MICROFLUIDIC ASSAYING DEVICE AND RELATED METHOD - Provided herein is a microfluidic device and related method for controlling flow of different fluid components of a fluid. The microfluidic device comprises an input channel, focusing channel and an assaying channel. The microfluidic device is adapted to separate a fluid into at least two fluid components, and is further adapted to detect a target material comprised within one of the fluid components. The method comprises providing a channel, the channel having a dimension which is a function of a dimension of one of the fluid components and deliver the fluid through the channel at a set flow rate. | 03-22-2012 |
20120070834 | Screening Methods for Transfusion Related Acute Lung Injury - The invention relates to the discovery that HNA-3a and HNA-3b are antigens within a polypeptide sequence that is highly similar to the CTL2 amino acid sequence. This invention provides methods and kits for screening for HNA-3a and HNA-3b specific antibodies, HNA-3a and HNA-3b polypeptides and HNA-3a and HNA-3b nucleic acids in a sample of a biological tissue intended for transplantation. | 03-22-2012 |
20120077191 | GENOTYPING DNA - Described herein are compositions and methods useful for the detection of nucleic acid variations. Ligation within a probe or between probes is used to distinguish between probes perfectly complementary to a target and those containing a mismatch. Nucleotide fill-in/extension steps are optionally applied according to the type of assay performed. A circularization and relinearization step can be applied to create a template for further amplification and detection. In certain aspects, portions of a target sequence or its complement are not amplified. | 03-29-2012 |
20120077192 | Risk Assessment For Adverse Drug Reactions - The present invention provides a method of predicting the risk of a patient for developing adverse drug reactions, particularly SJS or TEN. It was discovered that an HLA-B allele, HLA-B* 1502, is associated with SJS/TEN that is induced by a variety of drugs. The correlation with HLA-B* 1502 is most significant for carbamazepine-induced SJS/TEN, wherein all the patients tested have the HLA-B* 1502 allele. In addition, another HLA-B allele, HLA-B*5801, is particularly associated with SJS/TEN induced by allopurinol. Milder cutaneous reactions, such as maculopapular rash, erythema multiforme (EM), urticaria, and fixed drug eruption, are particularly associated with a third allele, HLA-B *4601. For any of the alleles, genetic markers (e.g., HLA markers, microsatellite, or single nucleotide polymorphism markers) located between DRB1 and HLA-A region of the specific HLA-B haplotype can also be used for the test. | 03-29-2012 |
20120077193 | METHOD OF DISTINGUISHING GENOTYPES - The present invention relates to a method of distinguishing genotypes using PCR-PHFA including: a nucleic acid amplification step in which a mutation site-including region of a gene is amplified by a nucleic acid amplification reaction, thereby obtaining an amplification reaction solution; and a distinction step in which the amplification reaction solution obtained from the nucleic acid amplification step is mixed with a reference double-stranded nucleic acid having a specific genotype on the mutation site as well as being labeled with a labeling substance, and the mixture is subjected to a competitive strand displacement reaction, and the level of the occurrence of strand displacement is assessed so as to distinguish the identity; and the competitive strand displacement reaction is performed under a condition to suppress a polymerase extension reaction, and a genotype distinguishing kit for use in the distinct of genotypes by this method. | 03-29-2012 |
20120077194 | APPARATUS AND METHODS FOR PARALLEL PROCESSING OF MICRO-VOLUME LIQUID REACTIONS - Disclosed herein are apparatuses and methods for conducting multiple simultaneous micro-volume chemical and biochemical reactions in an array format. In one embodiment, the format comprises an array of microholes in a substrate. Besides serving as an ordered array of sample chambers allowing the performance of multiple parallel reactions, the arrays can be used for reagent storage and transfer, library display, reagent synthesis, assembly of multiple identical reactions, dilution and desalting. Use of the arrays facilitates optical analysis of reactions, and allows optical analysis to be conducted in real time. Included within the invention are kits comprising a microhole apparatus and a reaction component of the method(s) to be carried out in the apparatus. | 03-29-2012 |
20120077195 | Method for Detecting Variations in Nucleic Acid Sequences - The present invention relates to a method and a kit for detecting nucleic acid sequence variation using melting curve analysis, especially relates to a method and a kit for detecting nucleic acid sequence variation by melting curve analysis using self-quenched probe. Said method provides the characteristics of the self-quenched probe employed, as well as the corresponding nucleic acid amplification conditions, so that the probe can bind to the amplified target sequence, and variations of the target sequence can be detected by melting curve analysis. The present invention also encompasses a kit assembled according to the method described. | 03-29-2012 |
20120082978 | Cell Analysis On Microfluidic Chips - The present invention provides for a method of implementing fluorescent in situ hybridization (FISH) or other cellular analysis processes using intact cells within a microfluidic, chip-based, apparatus. The invention further provides for a method of cellular immobilization within a microfluidic device. Also provided is a method for automated analysis of FISH or other cellular analysis using discrete colormetric probes. | 04-05-2012 |
20120082979 | COMPOSITIONS, METHODS, AND KITS FOR (MIS)LIGATING OLIGONUCLEOTIDES - Methods, reagents, and kits for (mis)ligating oligonucleotide probes or for identifying at least one target nucleotide are disclosed. One can enhance the generation of misligation product using a ligase under reaction conditions and with reagents where that particular ligase is prone to misligation. Alternatively, one can decrease or avoid generating misligation products using a particular ligase under reaction conditions and using reagents where that ligase is at least less prone to misligation. In certain embodiments, the recombinant ligase from | 04-05-2012 |
20120082980 | PNA Probes, Probe Sets, Methods and Kits Pertaining to the Detection of Candida - This invention is related to novel PNA probes, probe sets, methods and kits pertaining to the detection of one or more species of | 04-05-2012 |
20120082981 | ENZYME MIXTURE - Polymorphisms are present throughout an organism's genome, and understanding which alleles are present in a particular organism's genome can be advantageous. When probing the identity of these alleles, one must minimize incorrect readings due to inefficiencies in the system. In hydrolysis probe applications, these inefficiencies may be due to over-activity of an exonuclease functionality that excises nucleotides from probes that are only partially, complementary to a region of a target. The present invention provides a mixture that contains a plurality of polymerases including one that has a 5′→3′ exonuclease functionality and one that lacks or substantially lacks it, each in a sufficient relative amount and concentration to increase efficiencies of the system. | 04-05-2012 |
20120082982 | CYSTIC FIBROSIS GENE MUTATIONS - The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided. | 04-05-2012 |
20120082983 | Microbial Reductive Dehalogenation of Vinyl Chloride - Compositions and methods are provided that relate to the bioremediation of chlorinated ethenes, particularly the bioremediation of vinyl chloride by | 04-05-2012 |
20120082984 | NUCLEIC ACIDS FOR DETECTION AND DISCRIMINATION OF GENOTYPES OF CHLAMYDOPHILA PSITTACI - Methods of detecting | 04-05-2012 |
20120088234 | DEVICE FOR PERFORMING PCRS - A device is described to perform reactions, in which the device includes at least one test cell with a cavity to receive the test sample and at least a first, a second and a third spatially discrete regulatable temperature units. The three temperature units thus define three spatially discrete temperature areas. At least one means is provided to perform a rotary movement of the test cell. The cavity provided to receive the test sample can be moved across the three spatially discrete temperature areas, in which the cavity in one position of the test cell, remains in contact with a least two of the temperature areas. | 04-12-2012 |
20120088235 | HIGH THROUGHPUT NUCLEIC ACID SEQUENCING BY EXPANSION AND RELATED METHODS - Nucleic acid sequencing methods and related products and methods for detection and presentation of the same are disclosed. Methods for sequencing a target nucleic acid comprise providing a daughter strand produced by a template-directed synthesis, the daughter strand comprising a plurality of subunits coupled in a sequence corresponding to a contiguous nucleotide sequence of all or a portion of the target nucleic acid. | 04-12-2012 |
20120088236 | Methods and Systems for Sequential Determination of Genetic Mutations and/or Varients - The present invention relates to methods and systems for genome scanning using high resolution melting analysis for identifying mutations and/or variants in genes of interest. | 04-12-2012 |
20120088237 | Engineering a Novel Methylation-Specific Restriction Endonuclease - A restriction endonuclease is provided that has been engineered to have a cleavage specificity for a DNA recognition sequence containing a modified nucleotide. Methods for engineering enzymes to cleave DNA containing modified nucleotides at specific sequences are provided. | 04-12-2012 |
20120088238 | CONVERSION OF ALPHA-HYDROXYALKYLATED RESIDUES IN BIOMOLECULES USING METHYLTRANSFERASES - The present invention relates to targeted conversion of alpha-hydroxyalkylated residues in biomolecules in the presence of a directing methyltransferase, namely to targeted removal of the alpha-hydroxyalkyl moieties to give unmodified residues, or targeted derivatization of the alpha-hydroxyalkyl groups by covalent coupling of non-cofactor compounds represented by formula HQ-LX1 wherein X represents a functional group or a reporter group attached via a linker moiety L, and QH is selected from HS—, HSe—, HO—H | 04-12-2012 |
20120088239 | Detection of Chromosomal Inversions - A method and a kit for the identification of chromosomal inversions are described. Chromosomal inversions are difficult to detect unless they are quite large. The improved ability to detect chromosomal inversions is important to a number of medical applications, such as cancer and birth defects, as examples. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids prepared by the CO-FISH procedure, as an example. If an inversion has occurred, these marker probes will be detected on the sister chromatid at the same location as the inversion on the first chromatid. | 04-12-2012 |
20120088240 | FUNCTIONALIZED POLYMER BIOSENSOR - One aspect of the present disclosure relates to a novel sensor mechanism based on the aggregation of nanoparticles for target molecule detection and quantification. The nanoparticles that can be used include non-conducting polymers and conducting polymers such as polyaniline, polypyrrole and polythiophene derived nanofibers. Embodiments can include covalently functionalized nanoparticles with probes for target molecules, a biosensor where functionalized nanoparticles bind to one another upon presence of target to generate a visible conjugate induced aggregation, a biosensor wherein nanoparticles bind spontaneously in the presence of target molecules such as biological molecules, cells and biological markers. | 04-12-2012 |
20120088241 | Bioreactive Agents - This invention relates to agents and conjugates to detect and isolate target components from complex mixtures such as nucleic acids from biological samples, cells from bodily fluids, and nascent proteins from translation reactions. Agents comprise a detectable moiety bound to a photoreactive moiety. Conjugates comprise agents coupled to substrates by covalent bounds which can be selectively cleaved with the administration of electromagnetic radiation. Targets substances labeled with detectable molecules can be easily identified and separated from a heterologous mixture of substances. Exposure of the conjugate to radiation releases the target in a functional form and completely unaltered. Using photocleavable molecular precursors as the conjugates, label can be incorporated into macromolecules, the nascent macromolecules isolated and the label completely removed. The invention also relates to targets isolated with these conjugates which may be useful as pharmaceutical agents or compositions that can be administered to humans and other mammals. | 04-12-2012 |
20120088242 | ASSAY FOR MYCOBACTERIUM AVIUM/INTRACELLULARE NUCLEIC ACID - Disclosed is a method for determining the presence of | 04-12-2012 |
20120094283 | ACE2 AS A TARGET GENE FOR THE MOLECULAR IDENTIFICATION OF YEAST AND FUNGAL SPECIES - The present invention relates to nucleic acid primers and probes for use in the identification of one or more yeast species. More specifically the invention relates to the Ace2 gene, the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/or discriminate between yeast species. | 04-19-2012 |
20120094284 | Prediction of Early Virological Response in HCV Treatment - The present invention is based on the discovery of associations that exist between single nucleotide polymorphisms (SNPs) on chromosome 19 and virological outcomes in a diverse population of patients with hepatitis C virus (HCV) who received interferon-based treatment. | 04-19-2012 |
20120094285 | Ratiometric Pre-rRNA Analysis - Disclosed are compositions and methods for detecting the presence of viable cells in a sample. Included are compositions and methods for increasing the sensitivity of a nucleic acid amplification test for determining the presence of at least one target microorganism in a sample. Also disclosed are compositions and methods for detecting ribosomal RNA precursors (pre-rRNA) as dynamic indicators of viable microorganisms in a sample. | 04-19-2012 |
20120094286 | GENE DOSAGE ANALYSIS - The present invention relates to methods of detecting the presence of a genetic polymorphism within two or more closely linked, homologous genes, for example α-thalassemia, in a sample using RT-PCR by subjecting the sample to separate amplification reactions using (a) a pair of forward and reverse primers specific for the head region of each of said two or more closely linked, homologous genes and (b) a pair of forward and reverse primers specific for the tail region of each of said two or more closely linked, homologous genes; and detecting and quantitating the amplification products relative to a control product. | 04-19-2012 |
20120094287 | METHODS AND COMPOSITIONS FOR DETECTING GASTROINTESTINAL AND OTHER CANCERS - This application describes methods and compositions for detecting and treating vimentin-associated neoplasia. Differential methylation of the vimentin nucleotide sequences has been observed in vimentin-associated neoplasia such as neoplasia of the upper or lower gastrointestinal tract, pancreas, and/or bladder. | 04-19-2012 |
20120094288 | ASSAY FOR DETERMINING EPIGENETIC PROFILES OF MARKERS OF FRAGILE X ALLELES - The present invention relates generally to an assay for the determination of epigenetic profiles, particularly epigenetic profiles associated with a pathological condition. Even more particularly, the present invention provides an assay to detect epigenetic profiles within the Fragile X Mental Retardation (FMR) genetic locus indicative of a pathoneurological condition such as pathoneurodevelopmental and pathoneurodegenerative conditions. The epigenetic profiles can also identify potential non-neurological conditions. Kits and assays for medicaments also form part of the present invention as do computer programs to monitor changes in epigenetic patterns and methods for screening for agents which modulate epigenetic modification. | 04-19-2012 |
20120094289 | MATERIALS AND METHODS FOR DETERMINING CANCER RISK - This document relates to materials and methods involved in assessing inflammatory bowel disease patients at risk for developing cancer. For example, materials and methods for monitoring colorectal cancer risk in ulcerative colitis patients are provided. | 04-19-2012 |
20120094290 | Epigenetic Marker for the Identification of Natural Killer Cells - The present invention relates to a method, in particular an in vitro method for identifying natural killer cells of a mammal, which often express the surface proteins CD 16 and/or CD56, comprising analysing the methylation status of at least one CpG position in the CX3CR1 and/or FGR and/or NKG7 and/or GNLY genes, in particular their upstream regulatory regions, and in particular the promoter and other conserved regions of the genes CX3CR1 and/or FGR and/or NKG7 and/or GNLY, wherein a demethylation of at least one CpG in the analyzed sample to at least 70% is indicative for CD56 expressing NK cells, which might also be CD8+ or CD8−, CD56 dim or bright, CD 16+ or CD 16− NK cells. The methods of the present invention are useful for the detection and quality assurance and control of NK cells. Furthermore, the present invention relates to a kit for performing the above methods as well as respective uses of the inventive methods or kits. The present invention furthermore provides an improved method for analysing the methylation status of at least one CpG position in the gene CX3CR1 and/or FGR and/or NKG7 and/or GNLY genes that allows for a precise analysis even from sub-optimal quality samples, such as non-freshly obtained blood, tissue or serum samples. | 04-19-2012 |
20120094291 | FCgamma POLYMORPHISMS FOR PREDICTING DISEASE AND TREATMENT OUTCOME - The invention provides compositions and methods for determining the likelihood of successful treatment with Cetuximab or other equivalent. The methods comprise determining the genomic polymorphism present in a predetermined region of the FcγRIIa gene at amino acid position 131 and/or alternatively the FcγRIIIa gene at amino acid position 158. | 04-19-2012 |
20120094292 | FORENSIC IDENTIFICATION - The invention provides allelic ladder mixtures and individual alleles suitable for use in such mixtures. The allelic ladder mixtures give improved identification and distinguishing capabilities, particularly suitable in forensic investigations. | 04-19-2012 |
20120094293 | PGC-1 , A NOVEL PGC-1 HOMOLOGUE AND USES THEREFOR - The invention provides isolated nucleic acid molecules, designated PGC-1β nucleic acid molecules, which encode novel PGC-1 related coactivator molecules. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing PGC-1β nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in which a PGC-1β gene has been introduced or disrupted. The invention still further provides isolated PGC-1β proteins, fusion proteins, antigenic peptides and anti-PGC-1β antibodies. Diagnostic and therapeutic methods utilizing compositions of the invention are also provided. | 04-19-2012 |
20120100534 | EFFICIENT BASE DETERMINATION IN SEQUENCING REACTIONS - The present invention is directed to compositions and methods for nucleic acid identification and detection. Compositions and methods of the present invention include extracting and fragmenting target nucleic acids from a sample, using the fragmented target nucleic acids to produce target nucleic acid templates and subjecting those target nucleic acid templates to amplification methods to form nucleic acid nanoballs. The invention also includes methods of detecting and identifying sequences using various sequencing applications, including sequencing by ligation methods. | 04-26-2012 |
20120100535 | METHODS FOR QUANTITATIVE DETERMINATION OF METHYLATION DENSITY IN A DNA LOCUS - The present invention is a novel method of determining the average DNA methylation density of a locus of interest within a population of DNA fragments. | 04-26-2012 |
20120100536 | ASSOCIATION OF HTRA1 MUTATIONS AND FAMILIAL ISCHEMIC CEREBRAL SMALL-VESSEL DISEASE - The present invention provides a method of diagnosing a cerebrovascular disease in a human comprising the steps of: (a) measuring a mutation of HTRA1 gene in a test sample from said human; and (b) determining if the mutation of HTRA1 gene in said test sample correlates with a cerebrovascular disease in said human. | 04-26-2012 |
20120100537 | Method of Prenatal Molecular Diagnosis of Down Syndrome and Other Trisomic Disorders - The present invention encompasses a method of diagnosing chromosomal trisomy in a human subject. In one embodiment, the method comprises pyrosequencing at least one single nucleotide polymorphism on a chromosome being assessed for trisomy, where the SNP comprises two alleles. | 04-26-2012 |
20120100538 | Devices and methods of cell capture and analysis - The present invention provides a device for isolating target biomolecules or cells from samples, particularly biological samples. In particular, the device comprises a loading mixture, which contains the biological sample and a first binding entity that specifically binds to the target biomolecule or target cell; and a micro-channel coated with a second binding entity that binds directly or indirectly to the first binding entity. Methods of capturing, detecting, and/or evaluating target biomolecules or target cells (e.g. cancer cells) in biological samples are also disclosed. | 04-26-2012 |
20120100539 | METHOD FOR DETERMINING RISK FOR KIDNEY STONES DEVELOPING OR RECURRING AND METHOD FOR USING SINGLE-NUCLEOTIDE POLYMORPHISM RS12313273 AS BIOMARKER FOR DETERMINING DEVELOPMENT OR RECURRENCE OF KIDNEY STONE - The invention provides a method for determining a risk for kidney stones to develop in a subject, including: obtaining a biosample of the subject; detecting the presence of the single-nucleotide polymorphism rs12313273 (C/T) at position 30881 of the ORAI1 gene (SEQ ID No.: 1) in the biosample; and determining a risk for kidney stones to develop in the subject, wherein if the presence of a C allele of the single-nucleotide polymorphism rs12313273 (C/T) is detected, it indicates that the subject has an increased risk for kidney stones to develop. | 04-26-2012 |
20120100540 | ULTRA SENSITIVE METHOD FOR IN SITU DETECTION OF NUCLEIC ACIDS - Disclosed is a method for in situ detection of one or more target nucleic acids based on a combination of RNAscope® method and a general ISH signal amplification method. This new method produces high signal intensity and while keeps low background noise of signal amplification. The result can be consistently reproduced and the method can be easily adopted for routine clinic diagnostic use. Further, the invention relates to a kit, comprising the components of RNAscope® assay and a general ISH signal amplification assay, for sensitive detection of one or more target nucleic acids. | 04-26-2012 |
20120100541 | GENE METHYLATION IN CANCER DIAGNOSIS - The present invention provides DNA biomarker sequences that are differentially methylated in samples from normal individuals and individuals with cancer. The invention further provides methods of identifying differentially methylated DNA biomarker sequences and their use in detecting and diagnosing cancer. | 04-26-2012 |
20120100542 | METHOD FOR DETECTION OF TARGET NUCLEIC ACID, AND METHOD FOR TESTING FOR COLON CANCER - The present invention provides: a method for easily and simply obtaining highly reliable results of the detection of a target nucleic acid from nucleic acids that are directly recovered from feces; and a method for testing for diseases, particularly colon cancer, by using this method. Specifically, the present invention is a method for detecting an animal-derived target nucleic acid, comprising: (a) a step of collecting a fixed quantity of feces; (b) a step of recovering nucleic acids from the feces that has been collected in the step (a), and preparing a fixed volume of a nucleic acid solution; and (c) a step of dispensing a fixed volume of an aliquot from the nucleic acid solution that has been prepared in the step (b), and detecting the target nucleic acid in the dispensed solution. | 04-26-2012 |
20120100543 | COMPOSITIONS FOR THE USE IN IDENTIFICATION OF FUNGI - The present invention provides compositions, kits and methods for rapid identification and quantification of fungi by molecular mass and base composition analysis. | 04-26-2012 |
20120100544 | METHOD FOR QUANTIFYING DNA IN A BIOLOGICAL SAMPLE - Improved methods of quantifying nucleic acids that are unique to a transgenic corn event designated Bt11 in a biological sample and compositions thereof are disclosed. The invention further relates to primer pairs used in the method that are unique to event Bt11. | 04-26-2012 |
20120100545 | METHOD AND/OR PRIMERS FOR THE DETECTION OF MYCOBACTERIUM TUBERCULOSIS - The invention provides oligonucleotide(s) for simple, specific and/or sensitive test(s) for the presence of | 04-26-2012 |
20120107807 | Highly sensitive method for the detection of cytosine methylation patterns - The present invention concerns a method for the detection of cytosine methylation in DNA samples, wherein the following steps are conducted: (a) a genomic DNA sample, which comprises the DNA to be investigated and background DNA, is chemically treated in such a way that all of the unmethylated cytosine bases are converted to uracil, whereas the 5-methylcytosine bases remain unchanged; (b) the chemically treated DNA sample is amplified with the use of at least 1 primer oligonucleotide as well as a polymerase, whereby the DNA to be investigated is preferred as the template over the background DNA, and (c) the amplified products are analyzed and the methylation status in the DNA to be investigated is concluded from the presence of an amplified product and/or from the analysis of additional positions. | 05-03-2012 |
20120107808 | High throughput detection of gene-specific hydroxymethylation - This invention provides a method for the detection of hydroxymethylation patterns in a DNA sample, especially in genetic regions. A test sample containing hydroxymethylated DNA is hybridized to capture oligonucleotides immobilized on a solid phase. The hydroxymethylated DNA in hybrid is detected using an antibody which specifically recognizes hydroxymethylcytosine structure the marker of DNA hydroxymethylation-followed by immuno-signal amplification. The present invention provides a method to detect gene-specific hydroxymethylation in a simple, rapid and high throughput format with high specificity and sensitivity. | 05-03-2012 |
20120107809 | METHOD FOR SIMULTANEOUSLY DETECTING HISTOPLASMA CAPSULATUM AND PARACOCCIDIOIDES BRASILIENSIS - The present invention relates to a method for simultaneously detecting DNA of | 05-03-2012 |
20120107810 | Epigenetic Markers for the Identification of Blood Sub-Cells of Type 1 - The present invention relates to a method, in particular an in vitro method, for identifying CD3CD4 positive T lymphocytes of a mammal, wherein said method comprises analysing the methylation status of at least one CpG position in the CD3a/b/c/d/g genes, in particular their “upstream” regulatory regions, and in particular the promoter and other conserved regions of the gene cd3, wherein a demethylation of at least one CpG in the analyzed sample to at least 90% is indicative for memory and naive CD4 or/and memory and/or native T lymphocytes. Furthermore, the present invention is directed at the use of DNA-methylation analysis of the genes CD3a/b/c/d for the detection and quality assurance and control of T lymphocytes. Furthermore, the present invention relates to a kit for performing the above methods as well as respective uses thereof. In a preferred embodiment, the present invention furthermore provides an improved method for analysing the methylation status of at least one CpG position in the gene CD3, allowing for a precise analysis even from sub-optimal quality samples, such as non-freshly obtained blood or serum samples. | 05-03-2012 |
20120107811 | BURSTABLE LIQUID PACKAGING AND USES THEREOF - The present invention relates to systems, devices, and methods for performing biological and chemical reactions. In particular, the present invention relates to the use of burstable liquid packaging for delivery of reagents to biological and chemical assays. | 05-03-2012 |
20120107812 | Means and methods for investigating nucleic acid sequences - The invention provides improved methods for investigating nucleic acid sequences, wherein at least one additional probe is used which is specific for a (pseudo)gene variant of a target nucleic acid. The invention further provides improved calibrators which are particularly suitable for determining (pseudo)gene variants and copy number variation. | 05-03-2012 |
20120107813 | QUANTIFICATION OF NUCLEIC ACIDS - The invention relates to a method for the quantification of one or more nucleic acids in a sample. The method comprises the following steps: making a sample available which contains at least one nucleic acid to be quantified, adding an oligonucleotide probe to the sample, the oligonucleotide probe comprising a sequence which can specifically hybridize to the nucleic acid to be quantified or to a common sequence of the nucleic acids to be quantified, incubating the sample under conditions which allow the hybridization of the oligonucleotide probe to the nucleic acid(s) to be quantified, incubating the sample under conditions which allow the extension of hybridized probes, the nucleic acid(s) serving as a template in each case, removing the non-hybridized probes from the sample and quantifying the hybridized oligonucleotide probes to measure the quantity of the nucleic acid(s) to be quantified. The invention also relates to a kit for carrying out said method. | 05-03-2012 |
20120107814 | Method for Determining the Predisposition of a Patient to Changed Biotransformation and to the Development of Undesired Drug Effects in a Treatment of the Patient with Atrovastatin - A method for determining a predisposition of a patient to the development of muscular diseases and/or to changed biotransformation in a treatment of the patient with atorvastatin is disclosed. The presence of at least one single nucleotide polymorphism (SNP) in the UGT1A3 gene (uridine diphosphate glucuronosyltransferase gene 1A3) and/or an increased UGT1A3 gene expression is determined in a biological sample of the patient. The disclosure further relates to oligonucleotides that can be used in the method and to diagnostic kits that use the oligonucleotides. | 05-03-2012 |
20120107815 | Polymorphism Detection Probe, Polymorphism Detection Method, Evaluation of Drug Efficacy, and Polymorphism Detection Kit - The invention provides a probe which detects a polymorphism in the MDR1 gene. The probe has a P1 and/or a P2 oligonucleotide. The P1 oligonucleotide has a sequence that is complementary to a first base sequence, in which the first base sequence is a partial sequence of SEQ ID NO: 2 having a length of from 13 bases to 68 bases and including the 288th to 300th bases of SEQ ID NO: 2. The base complementary to the 288th base is labeled with a fluorescent dye. The P2 oligonucleotide has a sequence that is complementary to a second base sequence, in which the second base sequence is a partial sequence of SEQ ID NO: 2 having a length of from 6 bases to 93 bases and including the 300th to 305th bases of SEQ ID NO: 2. The base complementary to the 305th base is labeled with a fluorescent dye. | 05-03-2012 |
20120107816 | Primer Set for Detecting EGFR Exon 21 Polymorphism and Application Thereof - The invention provides a primer set for detecting a polymorphism in EGFR exon 21 L858R. The primer set has a P1 oligonucleotide and a P2 oligonucleotide and can performing amplification by using a region including the 172792nd base of SEQ ID NO: 1 as a template. As a base that is complementary to the 172792nd base of SEQ ID NO: 1, the P1 oligonucleotide has cytosine and the P2 oligonucleotide has adenine. The melting temperature of the P1 oligonucleotide is higher than the melting temperature of the P2 oligonucleotide, and/or the P1 oligonucleotide is one or more bases longer than the P2 oligonucleotide. The invention further provides a polymorphism detection primer, a polymorphism detection method using the primer set, a method of evaluating a EGFR tyrosine kinase inhibitor using the primer set, a primer used in the polymorphism detection method, and a kit including the primer set. | 05-03-2012 |
20120107817 | Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof - A polymorphism-detecting probe, an amplification primer and the use thereof are provided to enable simple and highly reliable determination of different polymorphisms in an EGFR gene. | 05-03-2012 |
20120107818 | DETECTION OF MULTIPLE NUCLEIC ACID SEQUENCES IN A REACTION CARTRIDGE - The present invention relates to a method for amplifying and detecting nucleic acid sequences in a reaction cartridge comprising the following steps, (i) providing a sample comprising at least one nucleic acid molecule, (ii) in a first reaction chamber of the cartridge providing reagents for an amplification reaction, (iii) mixing the sample with the amplification reagents, (iv) amplifying the at least one nucleic acid in the first reaction chamber of the cartridge, (v) transferring at least parts of the amplification reaction into a second and third reaction chamber of the cartridge each comprising a probe set, wherein (a) each probe set consists of at least three probes, (b) each of the probes is specific for a nucleic acid sequence, (c) there are at least two probes in each set which carry an identical label, (d) each of the probes in a given probe set that carries an identical label has a melting temperature (T | 05-03-2012 |
20120107819 | Detection of Clostridium difficile - The invention provides methods to detect | 05-03-2012 |
20120107820 | Multiplexed Quantitative PCR End Point Analysis of Nucleic Acid Targets - Certain embodiments of the present invention are directed to one pot multiplexed quantitative PCR methods for end point analysis of a plurality of nucleic acid targets in a complex sample without user intervention, and to various encoded particles on which are immobilized one or more probes that hybridize with the plurality of targets. Certain other embodiments are directed to a new “multiple-color genetic variation detection method” that can detect SNPs and kit using one chamber multiplexed endpoint PCR and differentially labeled allele-specific primers (one recognizing only the wild type allele and one only the mutant allele). | 05-03-2012 |
20120115131 | GENETIC LESION ASSOCIATED WITH CANCER - The invention comprises methods for identifying mutations within the 3′ UTRs of genes that lead to increased risk or probability of developing cancer. | 05-10-2012 |
20120115132 | IDENTIFICATION OF CENTROMERE SEQUENCES USING CENTROMERE ASSOCIATED PROTEINS AND USES THEREOF - The present invention is directed to methods of centromere discovery using centromere-associated proteins in a variety of experimental formats. The methods of the invention can be used on any organism, and include using Cal1, Cbf1, Cbf3, Cbf5, CenH3 (Cenp-A), Cenp-B, Cenp-C, Cenp-D, Cenp-E, Cenp-F, Cenp-G, Cenp-H, Cenp-I, Cenp-K, Cenp-L, Cenp-M, Cenp-N, Cenp-O, Cenp-P, Cenp-Q, Cenp-R, Cenp-S, Cenp-T, Cenp-U, Cenp-V, Cenp-W, Chd1, Chp1, cohesin, condensin, Dnmt3b, Fact, Gcn5p, H2A.Z, Haspin, Hjurp, HP1, Hst4, Ima1, Incep, Ino80, Kms2, Knl-2, Mif2, Mis6, Np95, Pich, Sad1, Scm3, Shugoshin, Sim3, Skp1, Sororin, Survivin, Tas3, ZW10, and homologs thereof to identify centromere sequences. The invention is also directed to artificial chromosomes comprising centromeres made according to the methods of the invention, as well as to cells comprising such artificial chromosomes. | 05-10-2012 |
20120115133 | CYANINE DYES - The invention provides a novel class of cyanine dyes that are functionalized with a linker moiety that facilitates their conjugation to other species. Also provided are conjugates of the dyes, methods of using the dyes and their conjugates and kits including the dyes and their conjugates. | 05-10-2012 |
20120115134 | METHODS FOR DIAGNOSIS AND PROGNOSIS OF CANCER - We have discovered a protein in humans, herein referred to as collagen like gene (CLG) product (SEQ ID NOS: 12 and 13), that is expressed in human prostate cancer and breast cancer cell lines but not in normal adult, placenta, lung, liver, skeletal muscle, kidney or pancreas tissues. We have also discovered that the level of CLG mRNA expression correlates positively with the metastatic potential of the cancer cell lines tested. | 05-10-2012 |
20120115135 | METHOD FOR DETECTION OF ACTIVE PERIODONTAL DISEASE AT THE LOCAL TOOTH SITE - A method for site-specific detection and early diagnosis of periodontal disease using periodontal pocket fluid biomarkers is disclosed. | 05-10-2012 |
20120115136 | PNA DIAGNOSTIC USE - The present invention pertains to certain nucleic acid analogs and related kits that are useful for the capture, recognition, detection, identification, or quantification of certain chemical or biological entities. | 05-10-2012 |
20120115137 | Methods of Predicting Osteoarthritis - The present invention relates generally to methods for predicting progression, initiation and susceptibility of osteoarthritis in human subjects using their genotype test results. | 05-10-2012 |
20120115138 | METHOD FOR IN VITRO DIAGNOSING A COMPLEX DISEASE - The present invention relates to a method and kit for in vitro diagnosing a complex disease such as cancer, in particular, acute myeloid leukemia (AML), colon cancer, kidney cancer, prostate cancer; transient ischemic attack (TIA), ischemia, in particular stroke, hypoxia, hypoxic-ischemic encephalopathy, perinatal brain damage, hypoxic-ischemic encephalopathy of neotatals asphyxia; demyelinating disease, in particular, white-matter disease, periventricular leukoencephalopathy, multiple sclerosis, Alzheimer and Parkinson's disease; in a biological sample. For the diagnosis, use is made of measuring at least two different species of biomolecules and classifying the results by means of suitable classifier algorithms and other statistical procedures. With the present invention, a significant improvement of the reliability of e.g. expression profiles alone, are achieved. In other words, in a defined collective, an up to 100% accurate positive diagnosis could be achieved, which renders the method of the present invention superior over the prior art. | 05-10-2012 |
20120115139 | METHOD FOR EVALUATING CANCER - Provided is a cancer evaluation method using a novel cancer marker for evaluating the onset, the preclinical stage, the clinical stage, or the prognosis of a cancer in a subject. At least one miRNA selected from hsa-miR-92 and hsa-miR-494 is used as the novel cancer marker in cancer evaluation. The cancer marker in a sample of a cell or a tissue is detected, and the possibility of a cancer in the sample is evaluated based on the expression level of the cancer marker. According to this evaluation method, by detecting the miRNA as the cancer marker, it becomes possible to evaluate the possibility of a cancer in the sample with excellent reliability. As a method for detecting the cancer marker, it is preferable to perform an in situ hybridization method using a labeled probe with respect to the sample that has been immobilized, for example. | 05-10-2012 |
20120115140 | Molecular Diagnosis of Fragile X Syndrome Associated with FMR1 Gene - The present invention includes a rapid, selective, and accurate method of diagnosing a human subject with a triplet repeat genetic disorder of the FMR1 gene that leads to fragile X syndrome. The present invention also includes a rapid, selective, and accurate method of diagnosing a human subject at risk for developing a triplet repeat genetic disorder of the FMR1 gene that leads to fragile X syndrome, or at risk of passing such a disorder on to their progeny. | 05-10-2012 |
20120115141 | ENDPOINT TAQMAN METHODS FOR DETERMINING ZYGOSITY OF COTTON COMPRISING Cry1F EVENT 281-24-236 - A method for zygosity analysis of the cotton Cry1F event 281-24-236 is provided. The method provides 281-24-236 event-specific and cotton endogenous reference gene-specific primers and TaqMan probe combinations for use in an endpoint biplex TaqMan PCR assay capable of determining event zygosity and for assisting in event introgression and breeding. | 05-10-2012 |
20120115142 | ENDPOINT TAQMAN METHODS FOR DETERMINING ZYGOSITY OF COTTON COMPRISING Cry1Ac EVENT 3006-210-23 - A method for zygosity analysis of the cotton Cry1Ac event 3006-210-23 is provided. The method provides 3006-210-23 event-specific and cotton-genome-specific primers and TaqMan probe combinations for use in an endpoint biplex TaqMan PCR assay capable of determining event zygosity and for assisting in event introgression and breeding. | 05-10-2012 |
20120115143 | Universal Probe Assay Methods - Reagents and methods are provided for detecting the presence of a target polynucleotide in a sample are disclosed. In one aspect, a method for producing a labeled amplification product by amplifying a target nucleic acid sequence to produce an amplification product comprising the target sequence, a first probe-binding sequence 5′ to the target sequence, and a second probe-binding sequence 3′ to the target sequence, thereby producing an amplification product; and hybridizing a first detection probe to the amplification product, said first detection probe comprising a first segment that hybridizes to the first probe-binding sequence and a second segment that hybridizes to the second probe-binding sequence, thereby producing a labeled amplification product is disclosed. | 05-10-2012 |
20120115144 | Detection of Extracellular Tumor-Associated Nucleic Acid in Blood Plasma or Serum - This invention relates to detection of specific extracellular DNA in plasma or serum fractions of human or animal blood associated with neoplastic, pre-malignant or proliferative disease. Specifically, the invention relates to detection tumor-associated DNA, and to those methods of detecting and monitoring tumor-associated DNA found in the plasma or serum fraction of blood by using DNA extraction and amplification with or without enrichment for DNA. The invention allows the selection and monitoring of patients for various cancer therapies including receptor tyrosine kinase inhibitor therapies. | 05-10-2012 |
20120115145 | STRAND DISPLACEMENT ACTIVITY OF MODIFIED POLYMERASES AND USES THEREOF - The present invention is directed to the use of the strand displacement activity of a modified polymerase. The present invention is more specifically directed to a modified Taq DNA polymerase, which exhibits strand displacement activity, whereas the native polymerase does not possess the strand displacement activity. | 05-10-2012 |
20120115146 | METHOD OF ANALYZING GENETICALLY ABNORMAL CELLS - The present invention relates to a method for analyzing genetically abnormal cells including (a) preparing a cell sample containing eukaryotic cells, (b) conducting an antigen-antibody reaction to cells contained in the cell sample using antibodies which specifically bind to a molecule existing on the cell surface of eukaryotic cells after (a), (c) subjecting the cells contained in the cell sample to a permeation treatment after (b), (d) subjecting the cells contained in the cell sample to an immobilization treatment after (b), (e) conducting FISH to the cells contained in the cell sample using nucleic acid probes after (d), (f) analyzing fluorescence signals from the nucleic acid probes in the cells contained in the cell sample using a three-dimensional image analysis method after (e), and (g) determining whether the cells contained in the cell sample are genetically abnormal cells or not based on the results of (b) and (f). | 05-10-2012 |
20120115147 | NEUROPSYCHIATRIC TEST REPORTS - Methods and reports for presenting genetic information that is patient-specific and relevant to treatment of neuropsychiatric disorders, including treatment resistant depression. The methods and reports described include genotype information for each of six specific genetic loci and allow patient-specific therapy for the effective treatment of treatment resistant disorders (TRD). | 05-10-2012 |
20120115148 | Reagents and Methods for Detecting Neisseria Gonorrhoeae - This invention provides compositions and methods for detecting | 05-10-2012 |
20120115149 | SEROTONIN TRANSPORTER GENE AND TREATMENT OF ALCOHOLISM - The gene (SLC6A4) responsible for encoding the serotonin transporter (SERT) has a functional polymorphism at the 5′-regulatory promoter region, which results in two forms, long (L) and short (S). The LL-genotype is hypothesized to play a key role in the early onset of alcohol use. The present invention discloses the differences in treatment and diagnosis based on the L or short genotypes as well as on a single nucleotide polymorphism of the SERT gene, the 3′ UTR SNP rs1042173. The present invention demonstrates the efficacy of using the drug ondansetron and similar drugs for treatment based on diagnosing variations in the polymorphisms of the SERT gene and expression and activity of the SERT gene, as well as methods for diagnosing susceptibility to abuse of alcohol and other addiction-related diseases and disorders, for monitoring treatment and/or abuse (addictive behavior), and for determining which treatment should be used. | 05-10-2012 |
20120115150 | miRNA BIOMARKERS FOR THE DIAGNOSIS OF DUCHENNE MUSCULAR DYSTROPHY, ITS PROGRESSION AND FOR MONITORING THERAPEUTIC INTERVENTIONS - The invention refers to diagnosis and therapy of muscle degenerative disorders, as Duchenne Muscular Dystrophy (DMD) by means of a class of specific miRNAs. | 05-10-2012 |
20120115151 | METHOD FOR TESTING A SUBJECT THOUGHT TO BE PREDISPOSED TO HAVING METASTATIC CANCER USING DELTA133P53BETA - The present invention concerns a method of testing a subject thought to be predisposed to having a metastatic cancer which comprises: analyzing a biological sample from said subject for detecting the presence of a p53 isoform selected from the group consisting of Δ133p53, Δ133p53γ and Δ133p53β, the presence of said p53 isoform being indicative of a metastatic cancer. | 05-10-2012 |
20120115152 | Screening Method - The present invention relates to clinical diagnosis of Alzheimer's disease or early-stage Alzheimer's disease in the live patient. In particular, the invention provides a screening method which can be used to assist with diagnosis of Alzheimer's disease in live human subjects, or to identify human subjects with a predisposition to Alzheimer's disease. | 05-10-2012 |
20120122086 | METHOD FOR RAPID DETECTION AND IDENTIFICATION OF BIOAGENTS IN EPIDEMIOLOGICAL AND FORENSIC INVESTIGATIONS - The present invention provides methods for rapid forensic investigations by identification of bioagents associated with biowarfare and acts of terrorism or crime. The methods are also useful for epidemiological investigations by genotyping of bioagents. | 05-17-2012 |
20120122087 | 5-Hydroxymethylcytosine as a biomarker for early detection, treatment and prognostic monitoring of cancer - The present invention is related to the use of 5-hydroxymethylcytosine or a biomolecule having general structure of 5-hydroxymethycytosine as a biomarker for the detection, treatment monitoring, and prognostic prediction of cancer. | 05-17-2012 |
20120122088 | METHYLATION ASSAY - A method for detecting a methylated genomic locus is provided. In certain embodiments, the method comprises: a) treating a nucleic acid sample that contains both unmethylated and methylated copies of a genomic locus with an agent that modifies cytosine to uracil to produce a treated nucleic acid; b) amplifying a product from the treated nucleic acid using a first primer and a second primer, wherein the first primer hybridizes to a site in the locus that contain methylcytosines and the amplifying preferentially amplifies the methylated copies of the genomic locus, to produce an amplified sample; and c) detecting the presence of amplified methylated copies of the genomic locus in the amplified sample using a flap assay that employs an invasive oligonucleotide having a 3′ terminal G or C nucleotide that corresponds to a site of methylation in the genomic locus. | 05-17-2012 |
20120122089 | Gene Marker For Evaluating Genetic Potential For Marbling In Bovine Individual And Method For Evaluating Genetic Potential For Marbling Using The Same - The present invention provides markers for evaluating a genetic potential for marbling of a bovine individual as well as methods for evaluating genetic potential for marbling using the markers. | 05-17-2012 |
20120122090 | GENE METHYLATION IN CANCER DIAGNOSIS - The present invention provides DNA biomarker sequences that are differentially methylated in samples from normal individuals and individuals with cancer. The invention further provides methods of identifying differentially methylated DNA biomarker sequences and their use the detection and diagnosis of cancer. | 05-17-2012 |
20120122091 | BIOLOGICAL SAMPLING DEVICE - A sampling device adapted for transcervical sampling of biological materials from a pregnant patient comprising: an elongate insertion tube ( | 05-17-2012 |
20120122092 | Compositions and methods for detecting Borrelia afzelii - Disclosed are oligonucleotides useful in methods for determining whether a sample contains | 05-17-2012 |
20120122093 | METHODS AND KITS FOR MULTIPLEX AMPLIFICATION OF SHORT TANDEM REPEAT LOCI - Compositions, methods and kits are disclosed for use in simultaneously amplifying at least 20 specific STR loci of genomic nucleic acid in a single multiplex reaction, as are methods and materials for use in the analysis of the products of such reactions. Included in the present invention are materials and methods for the simultaneous amplification of 23 and 24 specific loci in a single multiplex reaction, comprising the 13 CODIS loci, the Amelogenin locus, an InDel and at least six to ten additional STR loci, including methods, kits and materials for the analysis of these loci. | 05-17-2012 |
20120122094 | COMPOSITION AND METHOD FOR STABILIZING FLUORESCENT PARTICLES - Embodiments of a composition for stabilizing fluorescent signal of nanoparticles and methods for its use are disclosed. In some embodiments, the composition has a pH from 7 to 10 and includes borate, protein and/or protein hydrolysate, an amine, a preservative, and a nonionic surfactant. In particular embodiments, the amine is an N-ethanol substituted amine, such as ethanolamine, diethanolamine, triethanolamine, N-methyldiethanolamine, N,N-dimethylethanolamine, or a combination thereof. In some embodiments, a fluorescent particle solution, such as a quantum dot solution or quantum dot conjugate solution, is diluted in the composition and stored at 4° C. In certain embodiments, the fluorescence intensity of the diluted fluorescent particle remains substantially the same when stored at 4° C. for at least one month or at least three months. In particular embodiments, a diluted quantum dot conjugate is used to detect a hybridized probe or a protein antigen. | 05-17-2012 |
20120129165 | IMAGING INDIVIDUAL MRNA MOLECULES USING MULTIPLE SINGLY LABELED PROBES - A method for probing a target sequence of messenger ribonucleic acid molecules (mRNA's) in a fixed, permeabilized cell, said target sequence including at least 30 non-overlapping probe binding regions of 15-100 nucleotides, comprising immersing said cell in an excess of at least 30 nucleic acid hybridization probes, each singly labeled with the same fluorescent label and each containing a nucleic acid sequence that is complementary to a different probe binding region of said target sequence; washing said fixed cell to remove unbound probes; and detecting fluorescence from said probes. | 05-24-2012 |
20120129166 | METHOD OF DETECTING FUNGI BELONG TO GENUS GEOSMITHIA - A method of detecting a fungus belonging to genus | 05-24-2012 |
20120129167 | TRUNCATED CD20 PROTEIN, DELTACD20 - The present invention relates in particular to a protein from an alternative splicing of the gene encoding CD20, the nucleic acid sequences encoding the protein according to the invention, a mutated form of the CD20 gene as well as drugs, diagnostic tools, diagnostic methods and treatment methods using the protein and the nucleic acid sequences according to the invention. | 05-24-2012 |
20120129168 | TUMOR MARKER AND USE THEREOF - The present invention detects SNX5 in a sample from a subject. The SNX5 is used as a tumor marker specific to papillary thyroid carcinoma, whereby diagnosis of papillary thyroid carcinoma is carried out easily. The present invention provides also a technique of discriminating papillary thyroid carcinoma using the tumor marker. | 05-24-2012 |
20120129169 | Two-Step Cold Formalin fixation of organic tissue samples - A method for fixation of organic tissue samples includes immersing a tissue sample in a solution of Formalin at a temperature of between 2° C. and 10° C. for a first time period (A), and immersing the tissue sample in a cold fixation dehydrating agent for a second time period (B) following the first time period. An automated tissue fixation system for fixating organic tissue samples in Formalin is also described. | 05-24-2012 |
20120129170 | Methods for Identifying Genomic Deletions - The genomic locus responsible for Van Buchem's disease is narrowed to an approximately 92 kb region of human chromosome 17 at 17q21. Individuals afflicted with or carriers of Van Buchem's disease exhibit a 52 kb deletion within this 92 kb region. Methods are provided that permit the differentiation between individuals homozygous for and therefore afflicted with Van Buchem's disease, individuals heterozygous for and therefore carriers of Van Buchem's disease, and individuals who are normal with respect to Van Buchem's disease. Also provided are general methodologies for the detection of a wide variety of large genomic deletions. | 05-24-2012 |
20120129171 | Genetic Markers for Assessing Risk of Developing Bipolar Disorder - This document provides methods and materials related to genetic markers of Bipolar Disorder (BD) and Schizophrenia (SZ). For example, methods for using such genetic markers to assess risk of developing BD and/or SZ are provided, as are methods for making a differential diagnosis between BD and SZ. | 05-24-2012 |
20120129172 | METHOD FOR SELECTING CLONE OF INDUCED PLURIPOTENT STEM CELLS - To efficiently identify and select a clone from clones of induced pluripotent stem cells (iPS cell) having low tumor formation rate in vivo when allowed to differentiate and transplanted in a living body, iPS cells of the clones are induced to differentiate, undifferentiated cells among the cells after the induction of differentiation are detected, and a clone having the content of the undifferentiated cell below a control is selected. | 05-24-2012 |
20120129173 | RECOMBINASE POLYMERASE AMPLIFICATION REAGENTS AND KITS - This disclosure describes kits, reagents and methods for Recombinase Polymerase Amplification (RPA) of a target DNA that exploit the properties of re-combinase and related proteins, to invade double-stranded DNA with single stranded homologous DNA permitting sequence specific priming of DNA polymerase reactions. The disclosed kits, reagents and methods have the advantage of not requiring thermocycling or thermophilic enzymes, thus offering easy and affordable implementation and portability relative to other amplification methods. | 05-24-2012 |
20120129174 | Target Sequence Amplification Method, Polymorphism Detection Method, and Reagents for Use in the Methods - An object of the present invention is to provide an amplification method that inhibits amplification caused by erroneous annealing of a primer. Primers X1 and X2 are used in amplification of a target sequence including a target site showing a polymorphism. The primer X1 includes a sequence A1′ and a sequence E1. The sequence A1′ is complementary to a partial sequence A1 in a template nucleic acid, and has, in its 3′ region, a base x1′ complementary to a first base x1 at the target site in a 5′ region of the sequence A1. The sequence E1 is noncomplementary to a partial sequence B1 adjacent to the 3′ end of the partial sequence A1 in the template nucleic acid, and is bound to the 5′ end of the partial sequence A1′. The primer X2 includes a sequence A2′. The sequence A2′ is complementary to a partial sequence A2 in the template nucleic acid, and has, in its 3′ region, a base x2′ complementary to a second base x2 at the target site in a 5′ region of the partial sequence A2. Each of the primers X1 and X2 has a base complementary to the target site in its 3′ region. By these primers, when only a template in which the target site is the first base x1 is present, erroneous amplification of the target sequence having the second base x2 can be prevented. Thus, a false positive for the polymorphism of the second base x2 can be inhibited. | 05-24-2012 |
20120135401 | Methods and Compounds for the Diagnosis of Inflammatory Disease and Identification of Pharmacological Agents Useful in the Treatment of Inflammatory Disease - Methods for the diagnosis of inflammatory bowel diseases and the identification of agents useful in the treatment of such diseases based upon the agent's effect on reducing Pim-2 expression. | 05-31-2012 |
20120135402 | GENE SEQUENCE VARIANCES IN GENES RELATED TO FOLATE METABOLISM HAVING UTILITY IN DETERMINING THE TREATMENT OF DISEASE - The present disclosure describes the use of genetic variance information for folate transport or metabolism genes or pyrimidine transport or metabolism genes in the selection of effective methods of treatment of a disease or condition. The variance information is indicative of the expected response of a patient to a method of treatment. Methods of determining relevant variance information and additional methods of using such variance information are also described. | 05-31-2012 |
20120135403 | FIBROSIS SUSCEPTIBILITY GENE AND USES THEREOF - The present invention discloses the identification of a fibrosis susceptibility gene locus, the CTGF gene locus, which can be used for detecting predisposition to, diagnosis and prognosis of fibrosis as well as for the screening of therapeutically active drugs. The invention resides, in particular, in a method which comprises detecting in a sample from the subject the presence of an alteration in the CTGF gene locus, the presence of said alteration being indicative of the presence or predisposition to fibrosis. | 05-31-2012 |
20120135404 | OPTOELECTRONIC DETECTION SYSTEM - The invention described herein provides methods for the detection of soluble antigens. In particular, the methods provide for the detection of soluble proteins and chemicals. In addition, the invention provides methods of detecting a nucleic acid sequence in a sample. Also described is an emittor cell comprising an Fc receptor and an emittor molecule for the detection of a target particle in a sample wherein the target particle to be detected is bound by one or more antibodies. Also provided is an optoelectronic sensor device for detecting a target particle in a plurality of samples. | 05-31-2012 |
20120135405 | INSTRUMENT AND METHOD FOR OPTICAL PARTICLE SENSING - A new device capable of measuring the number of particles present in a colloidal suspension is disclosed, which includes a forward scatter detector, an extinction detector, a laser beam, a cylindrical lens with which to create a plane of light through which particles can pass, and the various pumps and tubing needed to pass the colloidal suspension through the plane of light. The device is particularly designed for measuring particles which have different refractive indices, and which are in the size range of between about 0.7 to 2 microns. The device can determine the presence or absence of biological particles of interest in a given sample, by incubating a sample with a given ratio of active particles and marker particles, and determining whether the ratio of active particles and marker particles has changed. Additional binding and/or non-binding particles can also be present, and kits including the particles are also disclosed. | 05-31-2012 |
20120135406 | METHOD FOR DETERMINING LYMPH NODE METASTASIS IN CANCER OR RISK THEREOF AND RAPID DETERMINATION KIT FOR THE SAME - The objective of the present invention is to provide a method and a means of rapidly and reliably detecting lymph node metastasis in cancer or the risk of lymph node metastasis. Specifically, the present invention provides a method and a rapid determination kit for detecting lymph node metastasis in cancer or its risk by identifying a certain genetic polymorphism of the human CRP gene, and it is clinically significant in determining the treatment strategy, because effective prediction/determination can be made regarding lymph node metastasis, which is an important phenomenon in cancer progression. | 05-31-2012 |
20120135407 | Compositions and Methods for Intramolecular Nucleic Acid Rearrangement - Aspects of the present invention are drawn to processes for moving a region of interest in a polynucleotide from a first position to a second position with regard to a domain within the polynucleotide, also referred to as a “reflex method”. In certain embodiments, the reflex method results in moving a region of interest into functional proximity to specific domain elements present in the polynucleotide (e.g., primer sites and/or MID). Compositions, kits and systems that find use in carrying out the reflex processes described herein are also provided. | 05-31-2012 |
20120141986 | Multivalent substrate elements for detection of nucleic acid sequences - The invention provides a method of detecting multiple nucleic acid sequences using multiplex substrate elements, each having predetermined sets of independent probes, and using mistures of distinguishably labeled nucleotides. | 06-07-2012 |
20120141987 | METHOD AND PROBES FOR THE DETECTION OF CANCER - Probe sets and methods of using probes and probe sets for the detection of cancer are described. Methods for detecting cancer that include hybridizing a set of chromosomal probes to a biological sample obtained from a patient, and identifying if cancer cells are present the sample. Also included are methods of selecting a combination of probes for the detection of cancer. | 06-07-2012 |
20120141988 | METHOD OF CELL-LINE IDENTIFICATION - The present invention discloses a method of cell-line identification comprising one or more of the following steps: (a) analysis of the calmodulin gene; (b) analysis of the Axl receptor tyrosine kinase gene; (c) analysis of an attacin gene; or a combination thereof. | 06-07-2012 |
20120141989 | KIT AND METHOD FOR RAPIDLY DETECTING A TARGET NUCLEIC ACID FRAGMENT - The invention provides a kit for rapidly detecting a target nucleic acid fragment comprising a magnetic bead; an inner primer pair and an outer primer pair suitable for loop-mediated isothermal amplification; and reagents for loop-mediated isothermal amplification. The invention also provides a kit for detecting a pathogen in fish, a method for rapidly detecting a target nucleic acid fragment, and a method for detecting a pathogen in fish. | 06-07-2012 |
20120141990 | METHODS, COMPOSITIONS AND KITS FOR DETECTION AND ANALYSIS OF ANTIBIOTIC-RESISTANT BACTERIA - The present invention relates generally to detection of antibiotic-resistant bacteria in a sample. In particular, the invention provides methods, compositions and kits for detecting and analyzing methicillin-resistant | 06-07-2012 |
20120141991 | METHODS AND PROBES FOR DETECTING ESOPHAGEAL CANCER - Probe sets and methods of using probes and probe sets for selectively detecting high grade dysplasia and esophageal adenocarcinoma or low grade dysplasia from biologic samples are described. Methods of the invention include contacting a biological sample obtained from a subject with a set of chromosomal probes to selectively detect an esophageal carcinoma or precursor lesion in the sample, if any, under conditions for specifically hybridizing the probes to their nucleic targets present in the sample. The presence or absence of high grade dysplasia and esophageal adenocarcinoma or low grade dysplasia is thereafter specifically determined from the hybridization pattern detected for the set of chromosomal probes to the biological sample. | 06-07-2012 |
20120141992 | COMPOSITIONS AND METHODS FOR TRICHOMONAS VAGINALIS DIAGNOSTIC TESTING - The invention provides methods, reagents and kits for determining the presence of | 06-07-2012 |
20120141993 | COMPOSITIONS AND METHODS FOR NEISSERIA GONORRHOEAE DIAGNOSTIC TESTING - The invention provides methods, reagent, and kits for detecting the presence of | 06-07-2012 |
20120141994 | METHODS AND COMPOSITIONS FOR PROGNOSING AND DETECTING AGE-RELATED MACULAR DEGENERATION - The invention provides methods and compositions for determining whether a subject is at risk of developing age-related macular degeneration, for example, the wet or neovascular form of age-related macular degeneration. The method involves determining whether the subject has a protective variant and/or a risk variant at a polymorphic site in the RORA gene. A protective or risk variant may be defined by a haplotype in the RORA gene. | 06-07-2012 |
20120141995 | Method for the Detection of Multiple Single Nucleotide Variations or Single Nucleotide Polymorphisms in a Single Tube - The present invention discloses a method for detecting multiple single nucleotide variations or polymorphisms in a single reaction tube, and the oligonucleotide, the probe, the set of probes, the kit used, as well as the use thereof. Specifically, it relates to a method for identifying the genotype of multiple single nucleotide variation or SNP sites from the melting temperature of a kind of artificial melting temperature tag sequence (AMTS) and the type of fluorescence labels. | 06-07-2012 |
20120141996 | CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR GENE MUTATIONS - The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided. | 06-07-2012 |
20120141997 | Compositions And Methods For Free-Solution Conjugate Nucleic Acid Analysis - The present invention provides compositions and methods for performing free-solution conjugate analysis of nucleic acid molecules. For example, the present invention provides multiplexed single-base extension assays for genotyping. In particular, the present invention provides a series of disperse polyamide “drag tags” for use in achieving high-resolution separation of nucleic acid reaction products. | 06-07-2012 |
20120141998 | ANTIGEN-PRESENTING CELL POPULATIONS AND THEIR USE AS REAGENTS FOR ENHANCING OR REDUCING IMMUNE TOLERANCE - The present invention is based on the discovery antigen-presenting cells (APCs) may be generated to have predetermined levels of expression of the intracellular enzyme, indoleamine 2,3-dioxygenase (IDO). Because expression of high levels of IDO is correlated with a reduced ability to stimulate T cell responses and an enhanced ability to induce immunologic tolerance, APCs having high levels of IDO may be used to increase tolerance in the immune system, as for example in transplant therapy or treatment of autoimmune disorders. For example, APCs having high levels of IDO, and expressing or loaded with at least one antigen from a donor tissue may be used to increase tolerance of the recipient to the donor's tissue. Alternatively, APCs having reduced levels of IDO expression and expressing or loaded with at least one antigen from a cancer or infectious pathogen may be used as vaccines to promote T cell responses and increase immunity. | 06-07-2012 |
20120149012 | DNA Methylation Detection Methods - The present teachings provide DNA methylation quantification methods that avoid bisulfite treatment of DNA. Methylation-specific binding proteins (MeDNA binding proteins) and non-methylation specific binding proteins (non-MeDNA binding proteins) are employed in various embodiments to modulate the accessibility of nucleic acids to primer extension reactions. After selectively removing the target nucleic acids, the extension products can be analyzed and methylation quantitated. In some embodiments, the analysis comprises real-time PCR. | 06-14-2012 |
20120149013 | METHODS OF EVALUATING CELLS AND CELL CULTURES - Methods of evaluating the composition of a cell culture (e.g., to distinguish chondrocytes from fibroblasts) and methods for evaluating the phenotype of an individual cell (e.g., as a chondrocyte) are disclosed. The methods may be used, for example, for assessing chondrocyte cultures used for treatment of cartilage defects. In some embodiments, the invention involves identifying cell culture composition or the identity of a cell based on expression level of a fibroblast marker. In other embodiments, the invention involves comparing expression levels of at least one chondrocyte marker and at least one fibroblast marker in a cell culture sample or in an individual cell. In illustrative embodiments, the chondrocyte marker is hyaluronan and proteoglycan link protein 1 (HAPLN1), and the fibroblast marker is microfibrillar associated protein 5 (MFAP5). | 06-14-2012 |
20120149014 | METHODS FOR OBTAINING FETAL GENETIC MATERIAL - The present invention relates to a method of enriching fetal nuclei from a sample. Enriched fetal nuclei can be used in a variety of procedures including, detection of a trait of interest such as a disease trait, or a genetic predisposition thereto, gender typing and parentage testing. | 06-14-2012 |
20120149015 | Soybean Plant And Seed Corresponding To Transgenic Event MON87701 And Methods For Detection Thereof - The present invention provides a transgenic soybean event MON87701, and cells, seeds, and plants comprising DNA diagnostic for the soybean event. The invention also provides compositions comprising nucleotide sequences that are diagnostic for said soybean event in a biological sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event in a biological sample, and methods for detecting the presence of said soybean event nucleotide sequences in a biological sample. The invention further provides methods of growing the seeds of such soybean event into soybean plants, and methods of breeding to produce soybean plants comprising DNA diagnostic for the soybean event. | 06-14-2012 |
20120149016 | Genetic Variants in the TCF7L2 Gene as Diagnostic Markers for Risk of Type 2 Diabetes Mellitus - Polymorphisms in the gene TCF7L2 are shown by association analysis to be a susceptibility gene for type II diabetes. Methods of diagnosis of susceptibility to diabetes, of decreased susceptibility to diabetes and protection against diabetes, are described, as are methods of treatment for type II diabetes. | 06-14-2012 |
20120149017 | DIAGNOSTIC MARKERS OF HUMAN FEMALE INFERTILITY - The subject invention pertains to methods and reagents for the diagnosis of female infertility, prognostic indicators for female infertility, compounds for the treatment of female infertility, compounds and methods for contraception. Methods and compounds are based on the levels of ebaf in endometrial tissue. Methods for diagnosing endometrial receptivity and bleeding function by screening a biological sample such as an endometrial tissue sample, or bodily fluid for the presence of ebaf. A contraceptive compound containing an effective amount of ebaf and a pharmaceutically acceptable carrier. A diagnostic kit for timing contraception containing reagents for screening a sample for the presence of ebaf. A method of treating endometrial irregularities by down-regulating the expression of ebaf. | 06-14-2012 |
20120149018 | Detection of Small Nucleic Acids - The present invention relates to compositions and methods for the detection and characterization of interfering RNAs such as micro RNAs (miRNAs) and small interfering RNAs (siRNAs) and other short nucleic acid molecules. More particularly, the present invention relates to improved methods for the detection and quantitation of interfering RNA expression. The present invention further provides for the detection of variants and types of miRNAs and siRNAs. | 06-14-2012 |
20120149019 | USE OF A BIS-MALEIC ANHYDRIDE CROSS-LINKING AGENT FOR FIXATION OF A CELL OR TISSUE SAMPLE - The present disclosure relates to novel bis-maleic anhydrides and to the surprising discovery that bis-maleic anhydride cross-linking agents can be used for preservation/fixation of a cell or tissue sample. Various bis-maleic anhydride cross-linking agent scan be used in methods requiring fixation of a cell or tissue sample. These reagents and methods are especially useful in procedures that require that the fixation agent be removed in order to facilitate analysis with other reagents. The inventive reagents and methods make it easier to reliably assay for various proteins, a nucleic acid and the like using analytical methods such as like immunohistochemistry, fluorescence in situ hybridization, RT-PCR, and the like. | 06-14-2012 |
20120156674 | METHODS OF DIFFERENTIATING BETWEEN NON-GENOTOXIN AND GENOTOXIN-ASSOCIATED TUMORS - Embodiments of the present disclosure are directed to methods of differentiation of non-genotoxin associated versus genotoxin-associated tumors. | 06-21-2012 |
20120156675 | PICOWELL CAPTURE DEVICES FOR ANALYSING SINGLE CELLS OR OTHER PARTICLES - A convenient way of isolating individual cells permits individual analysis of their contents. A capture support for individually capturing cells of interest comprises a first surface including at least one well sized to accommodate an individual cell, wherein the support is made of a differentially permeable material which permits transfer of a solvent and any low molecular weight species through the support from a second surface of the support to a well, but which is substantially impermeable to biopolymers. Single cells are captured, their contents are released, and the contents of individual cells are then analysed within a chamber containing suitable analytical components e.g. immobilised nucleic acid probes, immobilised antibodies, etc. Analysis of a single cell's genome, transcriptome, proteome, etc. thus becomes possible. | 06-21-2012 |
20120156676 | SINGLE NUCLEOTIDE POLYMORPHISMS IN BRCA1 AND CANCER RISK - The invention provides methods for identifying mutations, such as single nucleotide polymorphisms (SNPs), within breast and ovarian cancer associated genes that modify the binding efficacy of microRNAs (miRNAs). In a preferred embodiment, methods of the invention identify a SNP that decreases expression of the BRCA1 gene by increasing or decreasing the binding efficacy of at least one miRNA. Alteration of miRNA binding to BRCA1 by the introduction of SNPs within miRNA binding sites modulates or decreases BRCA1 expression, ultimately leading to the unregulated cell proliferation of a breast or ovarian cancer cells. | 06-21-2012 |
20120156677 | Detection and Quantification of Hydroxymethylated Nucleotides in a Polynucleotide Preparation - Methods and compositions are described for detecting hydroxymethylated nucleotides (hmNs) in a polynucleotide preparation with a view to mapping the location of hmNs in a genome, quantifying the occurrence of hmNs at selected loci and correlating the occurrence of hmNs with gene expression and phenotypic traits. Embodiments describe the use of modifying enzymes together with site-specific endonucleases to detect the hmNs. | 06-21-2012 |
20120156678 | BINDING-INDUCED HAIRPIN DETECTION SYSTEM - This application relates to a binding-induced hairpin detection system comprising: a. a first probe comprising a targeting molecule and an oligonucleotide that has a free end and an end attached to the targeting molecule; and b. a second probe comprising a targeting molecule and an oligonucleotide that has an end attached to the targeting molecule and a free end comprising a nucleotide sequence that is complementary to a nucleotide sequence at or near the free end of the oligonucleotide of the first probe; wherein upon binding of the targeting molecule to a target molecule, the free end of the oligonucleotide of the second probe hybridizes at or near the free end of the oligonucleotide of the first probe forming a hairpin stem, the non-hybridized portions of the first and second probes together with the target molecule bound thereto forming a hairpin loop, thereby providing a binding-induced hairpin. | 06-21-2012 |
20120164637 | SUSCEPTIBILITY TO BONE DAMAGE - In one aspect, the present invention provides methods for determining susceptibility to bone damage in a subject. In some embodiments, the methods comprise screening for polymorphisms in the MTHFR and collagen Iα1 genes that are associated with susceptibility to bone damage. In some embodiments, the methods comprise screening for elevated levels of homocysteine in a subject, wherein elevated levels of homocysteine are associated with an increased risk of bone damage. The methods of the invention may be used in predicting the response of a patient to treatment. Also provided are methods for prevention or reducing the risk of bone damage in a subject. | 06-28-2012 |
20120164638 | Digital Quantification of DNA Methylation - Abnormal DNA methylation can be used as a biomarker in cancer patients. For such purposes, it is important to determine precisely the fraction of methylated molecules in an analyzed sample. A technology we term Methyl-BEAMing achieves this goal. Individual bisulfite-treated DNA molecules can be PCR-amplified within aqueous nanocompartments containing beads, resulting in a population of beads each containing thousands of copies of the template molecule. After hybridization with probes specific for methylated sequences, the beads can be analyzed by flow cytometry. This approach enables detection and enumeration of one methylated molecule in a population of ˜5000 unmethylated molecules. Methyl-BEAMing provides digital quantification of rare methylation events and is generally applicable to the assessment of methylated genes in clinical samples. | 06-28-2012 |
20120164639 | METHODS FOR DETECTING LOW GRADE INFLAMMATION - The present invention relates to methods for detecting the presence of low grade inflammation in a patient. | 06-28-2012 |
20120164640 | METHODS AND COMPOSITIONS FOR CORRELATING GENETIC MARKERS WITH SUDDEN CARDIAC DEATH RISK - The present invention provides a method of identifying a subject as having an increased risk of sudden cardiac death or cardiac arrhythmia by detecting in the subject the presence of various polymorphisms associated with an increased risk of sudden cardiac death or cardiac arrhythmia. | 06-28-2012 |
20120164641 | Methods and Compositions for Detecting Mutation in the Human Epidermal Growth Factor Receptor Gene - The invention comprises reagents and methods for detecting cancer-causing mutations in the human EGFR gene. Further, a method of detecting the mutations and a method of treatment are disclosed. | 06-28-2012 |
20120164642 | METHODS AND MATERIALS FOR IDENTIFYING NODULAR FASCIITIS - This document provides methods and materials involved in detecting gene rearrangements indicative of nodular fasciitis. For example, methods and materials for determining if a mesenchymal neoplasm is nodular fasciitis based at least in part on the detection of a gene rearrangement (e.g. a USP6 or MYH9 rearrangement) are provided. | 06-28-2012 |
20120164643 | SET OF OLIGONUCLEOTIDE PROBES AS WELL AS METHODS AND USES THERETO - The present disclosure relates to a set of at least 100 single-stranded oligonucleotide probes directed against (or complementary to) portions of a genomic target sequence of interest. The present disclosure also relates to a method of detecting a genomic target sequence of interest using the set of oligonucleotide probes and a method of generating the set of oligonucleotide probes. Further, the present disclosure relates to a kit comprising the set of oligonucleotide probes and at least one further component. | 06-28-2012 |
20120164644 | NMR SYSTEMS AND METHODS FOR THE RAPID DETECTION OF ANALYTES - This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. | 06-28-2012 |
20120164645 | MULTIPLEX AMPLIFICATION AND DETECTION - The invention relates to the field of multiplex amplification. In particular, the invention relates to methods for assaying a sample for one or more nucleic acid targets in a single reaction based on the distinct melting temperatures or melting profiles of primers and/or probes. The invention also provides probes and kits for use in such methods. | 06-28-2012 |
20120164646 | DETECTION OF GENETIC ABNORMALITIES - The present invention provides assay systems and related methods for determining genetic abnormalities in mixed samples comprising cell free DNA from both normal and putative genetically atypical cells. Exemplary mixed samples for analysis using the assay systems of the invention include samples comprising both maternal and fetal cell free DNA and samples that contain DNA from normal cells and circulating cancerous cells. | 06-28-2012 |
20120164647 | METHODS FOR ASSESSING THE SUSCEPTIBILITY OF A HUMAN TO DIMINISHED HEALTH AND WELLNESS - The present invention relates to methods for assessing the advisability that a human should employ a compensatory composition comprised of one or more antioxidant ingredients. The methods involve assessing occurrence in the human's genome of a plurality of certain polymorphisms. Methods for determining the composition of preferred compensatory compositions are also disclosed. | 06-28-2012 |
20120171669 | Assay and Compositions for Detection of Bacillus Anthracis Nucleic Acid - The invention includes compositions and methods of detection of | 07-05-2012 |
20120171670 | BCR-ABL1 SPLICE VARIANTS AND USES THEREOF - The present invention is based on BCR-ABL1 splice variants which result from insertion and/or truncation of the bcr-abl1 transcript and the finding that these variants provide resistance to kinase domain inhibitors such as imatinib, nilotinib and dasatinib. | 07-05-2012 |
20120171671 | CHK2 POLYMORPHISM AS A CANCER MARKER - The invention relates to the use of gene modifications in the human gene CHK2 (CHEK2), which encodes the checkpoint kinase 2, for predicting the risk and progression of cancer diseases, for predicting the response to pharmacological or non-pharmacological therapeutic measures for treating cancer diseases, and for predicting undesired effects of drugs. The invention further relates to the provision of individual gene variants with the help of which further gene modifications that can be used for the aforementioned purposes can be detected and validated. Such gene modifications can comprise a substitution of adenine for guanine in position -7161 in the promoter of CHK2, a substitution of guanine for cytosine in position -7235, a substitution of adenine for guanine in position -10532, or a deletion of 29 base pairs in positions -10621 to -10649. | 07-05-2012 |
20120171672 | INFLAMMATORY BOWEL DISEASE PROGNOSTICS - The methods and systems of the present invention are useful in the diagnosis of inflammatory bowel disease (IBD) and in the prognosis of IBD progression and disease complications. With the present invention, it is possible to predict outcome of disease and patients who will have a particular risk of disease complications and/or progression to surgery. | 07-05-2012 |
20120171673 | SAMPLE ANALYSIS METHOD AND ASSAY KIT USED THEREIN - One embodiment is related to a method of analyzing plural samples. The method includes amplifying a plurality of samples using a first primer and second primer, wherein the first primer includes a tag sequence having a sequence different from a sample to one another and wherein a second primer used in pair with the first primer in independent reaction systems for the respective samples to obtain an amplified product in which the tag sequence is introduced, mixing amplified products obtained in the plurality of reaction systems, making the mixed amplified product react with a nucleic acid probe immobilized on a substrate, and detecting the amount of hybridization that has occurred. | 07-05-2012 |
20120171674 | Detection of Cells Expressing T1R2 Taste Receptor - Binding assays for identifying compounds that modulate human T1R2 polypeptide associated taste are disclosed. These assays detect the specific binding of compounds to a human T1R2 polypeptide or the modulation of the specific binding of a compound that specifically binds to a human T1R2 polypeptide. The binding assays may include the use of detectable labels, e.g., radionuclides, enzymes, fluorophases, and the like. Compounds identified in these binding assays have putative application as T1R2 taste modulators, particularly sweet taste, and potentially are useful additives in compositions for human or animal consumption. | 07-05-2012 |
20120171675 | METHOD FOR ISOLATING NUCLEIC ACIDS - The invention describes a method of and kits for isolating and/or purifying nucleic acids, more specifically short-chain nucleic acids such as miRNA, from a nucleic acid-containing starting material, characterized by the following method steps of:
| 07-05-2012 |
20120171676 | HIGHLY SENSITIVE RAPID ISOTHERMAL METHOD FOR THE DETECTION OF POINT MUTATIONS AND SNPs, A SET OF PRIMERS AND A KIT THEREFOR - The present invention refers to a method for detecting a point mutations of a nucleotide sequence by an improve- ment of the LAMP (loop amplification mediated polymerization) amplification method, as well as to a set of primers and kit there- for. As a non limitative embodiment, the invention refers to the G1849T mutation of the JAK2 gene. | 07-05-2012 |
20120171677 | COMPENSATION FOR SPECTRAL CROSSTALK IN MULTIPLEX NUCLEIC ACID AMPLIFICATION - A method includes performing a nucleic acid amplification of a nucleic acid sample using a detection probe, wherein the nucleic acid amplification occurs over one or more interrogation periods, and, from the nucleic acid amplification, acquiring amplification data that indicates an amount of nucleic acid present for each of the one or more interrogation periods. The method also includes, based on the amplification data, determining a crosstalk correction value associated with a spectral neighbor to the probe to reduce spectral crosstalk from the spectral neighbor; and applying the crosstalk correction value to amplification data collected from multiplex nucleic acid amplifications of nucleic acid samples. | 07-05-2012 |
20120171678 | APPARATUS FOR THERMAL CYCLING - This invention provides a system for performing PCR, and real time PCR in particular, with great speed and specificity. The system employs a heat block containing a liquid composition to rapidly transfer heat to and from reaction vessels. The system makes use of the reflective properties of the liquid metal to reflect signal from the PCR into the vessel and out the top. In this way, the signal can be measured by an optical assembly in real time without removing the vessels from the heat block. | 07-05-2012 |
20120178081 | Methods of Labeling Cells, Labeled Cells, and uses Thereof - Methods of detecting nucleic acids, proteins and cells including methods of detecting two or more nucleic acids, proteins and cells in multiplex bDNA assays, are provided. Assays may be conducted at least in vitro, in vivo, in cellulo, and in situ. Nucleic acids are detected, through cooperative hybridization that results in specific association of a label probe system with target nucleic acids. Embodiments are directed to concurrent detection of one or more nucleic acids and/or one or more proteins. The detected proteins may be intracellular or external markers on the surface of the cell. Detection of protein components is accomplished by use of specific antibodies and a label probe system and/or coated microparticles which bind to the outside surface of specific cells and contain specific probes that can be detected using the same label probe system. Compositions, kits, and systems related to the methods are also described. | 07-12-2012 |
20120178082 | METHODS AND COMPOSITIONS FOR CORRELATING GENETIC MARKERS WITH RISK OF AGGRESSIVE PROSTATE CANCER - The present invention provides a method of identifying a subject as having an increased risk of having or developing aggressive prostate cancer, comprising detecting in the subject the presence of various polymorphisms associated with an increased risk of having or developing aggressive prostate cancer. | 07-12-2012 |
20120178083 | SPECIFIC MARKER Lmx1a ON DOPAMINERGIC NEURONS - The present invention identified Lmx1a genes, which are expressed in dopaminergic neurons at all differentiation stages, from proliferating dopaminergic neuron progenitor cells before cell cycle exit to cells after cell cycle exit. Lmx1a expression in cells can be used as an indicator when selecting cells suitable for transplantation therapy for neurodegenerative diseases such as Parkinson's disease, and is useful as a marker for screening agents involved in the induction of dopaminergic neuron differentiation. | 07-12-2012 |
20120178084 | INTEGRATED ACTIVE FLUX MICROFLUIDIC DEVICES AND METHODS - The invention relates to a microfabricated device for the rapid detection of DNA, proteins or other molecules associated with a particular disease. The devices and methods of the invention can be used for the simultaneous diagnosis of multiple diseases by detecting molecules (e.g. amounts of molecules), such as polynucleotides (e.g., DNA) or proteins (e.g., antibodies), by measuring the signal of a detectable reporter associated with hybridized polynucleotides or antigen/antibody complex. In the microfabricated device according to the invention, detection of the presence of molecules (i.e. Polynucleotides, proteins, or antigen/antibody complexes) are correlated to a hybridization signal from an optically-detectable (e.g. fluorescent) reporter associated with the bound molecules. These hybridization signals can be detected by any suitable means, for example optical, and can be stored for example in a computer as a representation of the presence of a particular gene. | 07-12-2012 |
20120178085 | METHOD FOR EVALUATION OF CULTURED CELLS, AND METHOD FOR SCREENING OF BIOMARKER - Disclosed are novel means by which evaluation of cultured cells and screening of biomarkers can be attained without consuming the cultured cells. A method for evaluating cultured cells according to the present invention comprises culturing cells in a serum-free medium, and measuring at least one nucleic acid released from the cells into the culture medium. A method for screening of a biomarker according to the present invention comprises culturing cells in a serum-free medium, and measuring a nucleic acid(s) released from the cells into the culture medium. Nucleic acid used as an indicator is e.g. microRNA. | 07-12-2012 |
20120178086 | REDUCTIVE RELEASE PROBES CONTAINING A CHEMOSELECTIVELY CLEAVABLE ALPHA-AZIDOETHER LINKER AND METHODS OF USE THEREOF - Probes comprising one or more selectively cleavable α-azidoether moieties are provided; and linkers comprising the one or more selectively cleavable α-azidoether moieties. The α-azidoether moiety will undergo a Staudinger reaction with a suitable reducing agent, resulting in cleavage. The probes find use in a variety of detection assays, e.g. specific polynucleotide binding assays, polypeptide binding assays, etc. The cleavable linkers are suitable for synthetic reactions, e.g. to prepare probes of the invention; in the synthesis of cleavable peptide conjugates; and the like. | 07-12-2012 |
20120178087 | Genotyping Assay to Predict Gamma Glutamyl Hydrolase (GGH) Activity - Single nucleotide polymorphisms (SNPs) in the gene encoding gamma glutamyl hydrolase (GGH) associated with reduced GGH activity are disclosed. The primary SNP is a change from a cytosine to a thymine at a position corresponding to nucleotide 511 of Genbank sequence accession no. NM 003878. Methods and kits for detecting these SNPs are provided, along with primers useful in detecting these SNP and for amplifying portions of the GGH gene containing these SNPs. | 07-12-2012 |
20120178088 | THE TUMOR SUPPRESSOR KILLIN - The present invention relates to a new tumor suppressor, designated Killin. Also described are diagnostic and therapeutic uses of the Killin protein and the killin gene, alone or in combination with traditional cancer therapies. | 07-12-2012 |
20120183958 | METHODS FOR PREDICTING FAT AND LEAN PHENOTYPES IN CHICKENS - The invention provides molecular methods for predicting chickens that are more likely to have a lean phenotype, comprising detecting in samples of genetic material obtained from the chickens for the presence of paired single nucleotide polymorphisms (SNPs) in the beta-defensin 9 (DEFB9) gene. | 07-19-2012 |
20120183959 | SELECTIVE DETECTION OF BORDETELLA SPECIES - A process for detecting | 07-19-2012 |
20120183960 | METHOD FOR IDENTIFYING E. COLI M-17 - A method of identifying an M17 strain of | 07-19-2012 |
20120183961 | METHOD FOR FUNCTIONAL TESTING OF SITE-SPECIFIC DNA METHYLATION - Methods and kits are provided for testing the functional effect of methylating different cytosine residues or testing patterns of DNA methylation on gene expression. Methods are also provided for site-specific methylation, as well as methylated DNA constructs. | 07-19-2012 |
20120183962 | CRUDE BIOLOGICAL DERIVATIVES COMPETENT FOR NUCLEIC ACID DETECTION - The invention relates generally to the fields of making biological unit lysates or admixtures of body fluids and of RNA analysis. More specifically, it relates to direct methods for the detection of a specific sequence of RNA in a biological unit, for example a virus, cell or tissue sample, or a body fluid, for example saliva, sputum, blood plasma, etc. More generally, the invention may be used to enzymatically manipulate and protect the RNA in lysate or bodily fluids for a number of applications. | 07-19-2012 |
20120183963 | DETERMINATION OF FETAL ANEUPLOIDY BY QUANTIFICATION OF GENOMIC DNA FROM MIXED SAMPLES - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, i.e. aneuploidy. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. | 07-19-2012 |
20120183964 | MAMMALIAN CYTOKINE; RELATED REAGENTS - Purified genes encoding cytokine from a mammal, reagents related thereto including purified proteins, specific antibodies, and nucleic acids encoding this molecule are provided. Methods of using said reagents and diagnostic kits are also provided. | 07-19-2012 |
20120190016 | COMPOSITIONS FOR USE IN IDENTIFICATION OF SALMONELLA - The present invention relates generally to identification of | 07-26-2012 |
20120190017 | POLYMORPHISMS IN THE HUMAN GENE FOR THE MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN 1 (MRP-1) AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC APPLICATIONS - The present invention relates to a polymorphic MRP-1 polynucleotide, genes or vectors comprising the polynucleotides and a host cell genetically engineered with the polynucleotide or gene. Also provided are methods for producing molecular variant polypeptides, cells capable of expressing a molecular variant polypeptide and to a polypeptide encoded by the polynucleotide or the gene or obtainable by the method or cells produced herein. Also provided is an antibody to the polypeptide, a transgenic animal, and to a solid support comprising one or a plurality of the provided polynucleotides, genes, vectors, polypeptides, antibodies or host cells. Furthermore, methods of identifying a polymorphism, identifying and obtaining a pro-drug or drug or an inhibitor are also provided. In addition, the invention relates to methods for producing of a pharmaceutical composition, diagnosing a disease and, detection of the polynucleotide. Furthermore, provided herein are uses of the polynucleotides, genes, vectors, polypeptides or antibodies herein. | 07-26-2012 |
20120190018 | ENHANCED RISK PROBABILITIES USING BIOMOLECULE ESTIMATIONS - The present invention provides processes for determining more accurate risk probabilities for medical conditions. The risk probabilities of the presence or absence of a medical condition are calculated using frequency data from selected biomolecules and biomolecule source contribution of at least one source in a mixed sample. | 07-26-2012 |
20120190019 | CONCATAMERIC LIGATION PRODUCTS: COMPOSITIONS METHODS AND KITS FOR SAME - The present teachings relate to methods, compositions, and kits for detecting one or more target polynucleotide sequences in a sample, and methods compositions and kits for forming concatameric ligation products. In some embodiments of the present teachings, oligonucleotides are hybridized to complementary target polynucleotides and are ligated together to form a concatameric ligation product. In some embodiments of the present teachings, the concatameric ligation product can be amplified, and the identity and quantity of the target polynucleotides determined based on sequence introduced in the ligation reaction. Some embodiments of the present teachings provide methods for removing unligated probes from the reaction mixture. Some embodiments of the present teachings provide for highly multiplexed detection, identification, and quantification of a plurality of target polynucleotides using a variety of analytical procedures. | 07-26-2012 |
20120190020 | DETECTION OF GENETIC ABNORMALITIES - The present invention provides assay systems and related methods for determining genetic abnormalities in mixed samples comprising cell free DNA from both normal and putative genetically atypical cells. Exemplary mixed samples for analysis using the assay systems of the invention include samples comprising both maternal and fetal cell free DNA and samples that contain DNA from normal cells and circulating cancerous cells. | 07-26-2012 |
20120190021 | DETECTION OF GENETIC ABNORMALITIES - The present invention provides assay systems and related methods for determining genetic abnormalities in mixed samples comprising cell free DNA from both normal and putative genetically atypical cells. Exemplary mixed samples for analysis using the assay systems of the invention include samples comprising both maternal and fetal cell free DNA and samples that contain DNA from normal cells and circulating cancerous cells. | 07-26-2012 |
20120190022 | METHOD FOR DETERMINATION OF THE LENGTH OF THE G-TAIL SEQUENCE AND KIT FOR THE METHOD - A method of measuring the length of a G tail sequence, characterized by hybridizing the G tail of an nondenatured chromosomal DNA in a sample with a labeled DNA probe having a sequence complementary to the telomere repeat sequence, measuring chemiluminescence from the hybridized DNA probe, and determining the length of the G tail sequence from the measured value, and a kit used for use in such a method. | 07-26-2012 |
20120190023 | METHODS FOR DISTINGUISHING BETWEEN NATURAL AND ARTIFICIAL DNA SAMPLES - The present invention provides methods for distinguishing between natural and artificial DNA in samples containing nucleic acid molecules. In addition, the present invention provides methods for verifying that DNA profiles obtained from samples represent natural DNA. In various embodiments, the methods employ an array of nucleic acid based procedures for verifying that a DNA sample originates from a natural source. The invention further provides kits for verifying that a DNA sample originates from a natural source employing the methods and reagents described in the disclosure. | 07-26-2012 |
20120190024 | METHOD FOR DETERMINING PRESENCE OR ABSENCE OF EPITHELIAL CANCER-ORIGIN CELL IN BIOLOGICAL SAMPLE, AND MOLECULAR MARKER AND KIT THEREFOR - The present invention provides a method for determination of presence or absence of an epithelial cancer-derived cell in a biological sample obtained from a subject comprising the steps of: extracting DNA from the biological sample, analyzing methylation status of a CpG site located in at least one region represented by base sequences SEQ ID NOs: 1, 2, 3 and 4 in the DNA obtained from the step of extracting, and determining presence or absence of the epithelial cancer-derived cell in the biological sample based on an analysis result obtained from the step of analyzing. | 07-26-2012 |
20120190025 | ENTEROCOCCUS AND FECAL BACTEROIDES FOR RAPID WATER QUALITY ASSESSMENT - The present invention is drawn to methods and compositions for the rapid assessment of fecal indicator bacteria in a sample. Provided herein are novel primer and probe compositions for use in detecting the presence of these organisms in a sample, particularly using quantitative PCR methods. Provided herein are novel oligonucleotide primers and probes, including the primers set forth in SEQ ID NOS: 1-4, 7 and 8, the novel oligonucleotide probe sequences set forth in SEQ ID NOS:5, 6, and 9, and methods for using these primers and probes for the detection and/or quantification of fecal indicator bacteria, particularly | 07-26-2012 |
20120190026 | METHOD OF NORMALIZED QUANTIFICATION OF RNA - The present invention is related to normalized quantification of RNAs and to the normalization of quantities of RNAs in samples, e.g. mixtures of RNAs. The present invention relates to method for the normalization of the quantity of a RNA to be quantified in a sample to the total quantity of RNA in the sample; or to the total quantity of a specific class of RNA in the sample. | 07-26-2012 |
20120190027 | LIGATION-BASED METHOD OF NORMALIZED QUANTIFICATION OF NUCLEIC ACIDS - The present invention is related to normalized quantification of nucleic acids and to the normalization of quantities of nucleic acids in samples, e.g. mixtures of nucleic acids. The present invention relates to method for the normalization of the quantity of a nucleic acid to be quantified in a sample to the total quantity of nucleic acid in the sample; or to the total quantity of a specific class of nucleic acid in the sample. | 07-26-2012 |
20120190028 | NUCLEIC ACIDS AND METHODS FOR THE DETECTION OF ENTEROBACTER SAKAZAKII (CRONOBACTER SPP.) - Provided are detection means and method specific for the genus | 07-26-2012 |
20120190029 | METHODS FOR DETECTING DNA ORIGINATING FROM DIFFERENT INDIVIDUALS - In a first aspect, the present invention features methods for differentiating DNA species originating from different individuals in a biological sample. These methods may be used to differentiate or detect fetal DNA in a maternal sample or to differentiate DNA of an organ donor from DNA of an organ recipient. In preferred embodiments, the DNA species are differentiated by observing epigenetic differences in the DNA species such as differences in DNA methylation. In a second aspect, the present invention features methods of detecting genetic abnormalities in a fetus by detecting fetal DNA in a biological sample obtained from a mother. In a third aspect, the present invention features methods for differentiating DNA species originating from an organ donor from those of an organ recipient. In a fourth aspect, the present invention features kits for differentiating DNA species originating from different individuals in a biological sample. | 07-26-2012 |
20120190030 | Detection of Target Nucleic Acid Sequences by Cyclic Exonucleolytic Reactions - The present invention relates to the detection of a target nucleic acid sequence by a cyclic exonucleolytic reaction. The present method enabling to generate signals by probe digestion with no help of primers and to amplify signals with no help of simultaneous target amplification reactions may enable to detect multiple target sequences without any problems accounted in the conventional real-time PCR methods such as false positive signals and difficulties in oligonucleotides (primer and probe) selection and reaction condition optimization. | 07-26-2012 |
20120196282 | METHOD OF REGENERATING ELASTIC FIBER AND SCREENING METHOD - A method of regenerating an elastic fiber according in the present invention is characterized in that the method comprises bringing an elastic fiber regenerating agent containing LTBP-4 into contact with a cell having the fiber regenerating ability. Preferably, the elastic fiber regenerating agent further contains DANCE and/or LTBP-4 expression potentiating factor. According to the present invention, the elastic fiber regenerating ability is further enhanced than so far. | 08-02-2012 |
20120196283 | Qualitative and Quantitative Detection of Microbial Nucleic Acids - The present invention relates to new methods and uses for the qualitative and quantitative detection of microbial nucleic acids using at least a first control nucleic acid, or a first and a second control nucleic acid in different concentrations. The method is based on amplification of nucleic acids, for example the polymerase chain reaction. Further provided are kits comprising components for performing said methods and uses. | 08-02-2012 |
20120196284 | Method of Measuring Telomere Length - Disclosed herein is a novel method of measuring telomere length comprising determining the DNA content (Dx) of a sample, determining the telomeric content (T) of a sample, and determining the value of T/Dx. | 08-02-2012 |
20120196285 | Methods for Enriching Microparticles or Nucleic Acids Using Binding Molecules - Methods for enriching specific microparticles, such as fetal microparticles or disease specific microparticles, in a biological sample are disclosed. In certain embodiments, the methods include combining a biological sample with a molecule that binds specific microparticles, and separating fractions of the biological sample, wherein the fraction that contains the binding molecule is enriched for the specific microparticles. Also disclosed are methods for enriching fetal nucleic acids by enriching fetal microparticles in a fraction of the biological sample and isolating nucleic acids from the enriched fraction. Methods for facilitating prenatal diagnosis of fetal chromosomal abnormalities are disclosed. In certain embodiments, the methods include combining a biological sample with a molecule that binds fetal microparticles, separating fractions of the biological sample, isolating nucleic acids from the fraction enriched for fetal microparticles, and analyzing the nucleic acids for the presence of a mutation. | 08-02-2012 |
20120196286 | METHOD AND APPARATUS FOR DIAGNOSING AGE-RELATED MACULAR DEGENERATION - Disclosed is a method for identifying an individual who has an altered risk for developing age-related macular degeneration comprising detecting an insertion/deletion polymorphism in the ARMS2 gene | 08-02-2012 |
20120196287 | Tmsb4 as a Biomarker for IgA Nephropathy - The present invention provides a method for diagnosis or prognosis of IgA nephropathy in a subject based on detection of the expression level of one or more biomarker genes selected from the group consisting of thymosin β4 (Tmsb4), serine or cysteine proteinase inhibitor clade E member 2 (Serpine2), secreted phosphoprotein 1 (OPN), butyrophilin-like-2 (BTNL2), S100 calcium binding protein A8 (S100A8), Cystatin C (CysC), and any combination thereof. | 08-02-2012 |
20120202198 | PROCESS FOR THE SYNTHESIS OF A CDNA IN A SAMPLE IN AN ENZYMATIC REACTION - This invention relates to a process for synthesis of a cDNA in a sample, in an enzymatic reaction, whereby the process comprises the steps: simultaneous preparation of a first enzyme with polyadenylation activity, a second enzyme with reverse transcriptase activity, a buffer, at least one ribonucleotide, at least one deoxyribonucleotide, an anchor oligonucleotide; addition of a sample that comprises a ribonucleic acid; and incubation of the agents of the previous steps in one or more temperature steps, which are selected such that the first enzyme and the second enzyme show activity. The invention further relates to a reaction mixture that comprises a first enzyme with polyadenylation activity, a second enzyme with reverse transcriptase activity, optionally a buffer, optionally at least one ribonucleotide, optionally at least one deoxyribonucleotide, and optionally an anchor oligonucleotide. Moreover, the invention relates to a kit that comprises a corresponding reaction mixture. | 08-09-2012 |
20120202199 | METHOD FOR ADJUSTING AMPLIFICATION EFFICIENCY OF TARGET POLYNUCLEOTIDE - Disclosed is a method for adjusting the amplification efficiency of a target polynucleotide in the amplification of the target polynucleotide by PCR using primers (i) to (iii) below, the method comprising adjusting the amplification efficiency of the target polynucleotide by changing the quantity ratio of the primers (i) to (iii) below:
| 08-09-2012 |
20120202200 | METHODS FOR DETECTING HUMAN PAPILLOMA VIRUS-ASSOCIATED CANCERS - The present invention provides probes and methods of use thereof in the diagnosis and/or prognosis of certain types of cancers, particularly human papillomavirus (HPV)-associated cancers. The probes are designed for hybridization with genomic material in a manner indicative of one or more aberrations in the genetic material present in the test sample. The identified aberrations are biomarkers of HPV-associated cancer. The methods of the invention comprise contacting a sample to one or more probes, allowing any genetic material in the sample to hybridize to the genomic regions provided in the probes, analyzing the hybridizations, and analyzing the hybridizations to identify detected aberrations as biomarkers indicative of HPV-associated cancer progression. | 08-09-2012 |
20120202201 | DEVICE AND METHOD FOR ANALYSIS OF KIDNEY FAILURE - The invention provides a method for analysis of the status of kidney function in a sample of body fluid obtained from a patient who has not been diagnosed with acute kidney injury (AKI, also referred to as acute kidney failure) or in a sample of body fluid obtained from a patient who has been diagnosed with AKI, which analysis is suitable for evaluating the prospects for long-term survival, which method for analysis comprises or consists of determining the concentration of the microRNA-210 | 08-09-2012 |
20120202202 | METHODS FOR DETECTING RARE CIRCULATING CANCER CELLS USING DNA METHYLATION BIOMARKERS - Provided are new and improved methods for detecting circulating tumor cells and tumor cell DNA in patient blood or other biofluid samples. Particular aspects comprise three steps: DNA extraction from patient samples, DNA digestion with multiple selected methylation-sensitive enzymes, and target amplification by a conventional or a real-time PCR with specific probe and/or primers. Also provided are a total of 40 tumor-specific DNA methylation loci as biomarkers having substantial utility and specificity in major types of human malignancies including hematopoietic and solid tumors. | 08-09-2012 |
20120202203 | SINGLE PROBE, MULTIPLE TEMPERATURE, NUCLEIC ACID DETECTION METHODS, KITS, AND COMPOSITIONS - Provided herein are methods, kits, and compositions related to nucleic acid detection assays that allow discrimination of multiple target sequences with a single probe. In particular, provided herein are methods kits, and compositions that include single-probe target sequence discrimination where different target amplicons may have identical probe hybridization sequences by employing multiple temperature end-point signal probe detection. Also provided herein are methods, kits, and compositions for distinguishing between two or more target amplicons using multiple-temperature end-point probe detection. In certain embodiments, asymmetric PCR amplification methods are employed (e.g., LATE-PCR amplification). | 08-09-2012 |
20120202204 | Assay for Determining a Molecular Risk Assessment of a Complex Polymicrobial Sample Suspected to Contain an EHEC - The present invention relates to a process to perform a molecular risk assessment (MRA) upon a sample suspected to contain an enterohemorrhagic | 08-09-2012 |
20120202205 | DIAGNOSTIC METHODS - This invention relates to a method of determining the susceptibility of an individual to statin-induced myopathy, comprising detecting the presence or absence of one or more polymorphisms in the SLCO1B1 gene in a biological sample from an individual, whereby the presence of one or more polymorphisms indicates that the individual has altered susceptibility to statin-induced myopathy. | 08-09-2012 |
20120202206 | PHARMACEUTICAL COMPOSITIONS AND METHODS USEFUL FOR MODULATING ANGIOGENESIS, INHIBITING METASTASIS AND TUMOR FIBROSIS, AND ASSESSING THE MALIGNANCY OF COLON CANCER TUMORS - Methods and compositions suitable for modulating angiogenesis in a mammalian tissue are provided. Further provided are methods suitable for inhibiting metastasis and fibrosis in a mammalian tissue and for assessing the malignancy of colon cancer tumors. | 08-09-2012 |
20120202207 | GENETIC ALTERATIONS IN ISOCITRATE DEHYDROGENASE AND OTHER GENES IN MALIGNANT GLIOMA - We found mutations of the R132 residue of isocitrate dehydrogenase 1 (IDH1) in the majority of grade II and III astrocytomas and oligodendrogliomas as well as in glioblastomas that develop from these lower grade lesions. Those tumors without mutations in IDH1 often had mutations at the analogous R172 residue of the closely related IDH2 gene. These findings have important implications for the pathogenesis and diagnosis of malignant gliomas. | 08-09-2012 |
20120202208 | NUCLEIC ACID AND CORRESPONDING PROTEIN ENTITLED 193P1E1B USEFUL IN TREATMENT AND DETECTION OF CANCER - A novel gene 0193P1E1B (also designated 193P1E1B) and its encoded protein, and variants thereof, are described wherein 193P1E1B exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 193P1E1B provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 193P1E1B gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 193P1E1B can be used in active or passive immunization. | 08-09-2012 |
20120202209 | CELL IMAGING METHOD FOR VIEWING MICRORNA BIOGENESIS IN THE CELLS - The present invention relates to a method for viewing the biogenesis of at least one microRNA, preferably a microRNA group, in a living cell, characterised in that said method includes the following steps: transforming said cell by an encoding vector for a protein selected among the DGCR8 protein (DiGeorge syndrome critical region gene 8), the Drosha protein and derivatives thereof, said protein being coupled with a marker; expressing said protein coupled with said marker; and detecting said marker. | 08-09-2012 |
20120208182 | GENETIC TEST FOR LIVER COPPER ACCUMULATION IN DOGS AND LOW COPPER PET DIET - The present invention provides a method of determining the susceptibility of a dog to liver copper accumulation, comprising detecting the presence or absence in the genome of the dog of (a) a polymorphism in the GOLGA5, ATP7a or UBL5 gene that is indicative of susceptibility to liver copper accumulation and/or (b) a polymorphism in linkage disequilibrium with a said polymorphism (a). The invention also provides a method of determining the likelihood that a dog is protected from liver copper accumulation comprising detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO: 142) and (b) one or more polymorphisms in linkage disequilibrium with (a). | 08-16-2012 |
20120208183 | METHODS FOR DETERMINATION OF HAPLOTYPE DISSECTION - A method for molecular haplotyping of a subject is disclosed. The method comprises: randomly selecting a set of chromosomes in each of a plurality of lyzed diploid cells of the subject, collecting the selected chromosomes from said plurality of cells into a plurality of sample tubes, wherein each sample tube contains chromosomes selected from one or more cells, genotyping genomic DNA in each sample tube, and determining haplotype of the alleles based on allele nucleotide sequence information and corresponding nucleotide signal intensities from genotyping data. Other methods for molecular haplotyping using single cell lysate or single cell microdissection are also disclosed. | 08-16-2012 |
20120208184 | SYSTEMS AND METHODS FOR IMAGING AND PROCESSING TISSUE - In accordance with preferred embodiments of the present invention, a method for imaging tissue, for example, includes the steps of mounting the tissue on a computer controlled stage of a microscope, determining volumetric imaging parameters, directing at least two photons into a region of interest, scanning the region of interest across a portion of the tissue, imaging layers of the tissue, sectioning a portion of the tissue, capturing the sectioned tissue, and imaging additional layers of the tissue in a second volume of the tissue, and capturing each portion of sectioned tissue, and processing three-dimensional data that is collected to create a three-dimensional image of the region of interest. Further, captured tissue sections can be processed, re-imaged, and indexed to their original location in the three dimensional image. | 08-16-2012 |
20120208185 | METHOD FOR DETERMINING THE RISK OF DEVELOPING A NEUROLOGICAL DISEASE - Methods and kits are provided for determining whether a subject is at risk of developing a neurological disease such as Alzheimer's disease and multiple sclerosis. The methods and kits are based on the detection of one or more nucleic acid variants in the MBL gene of the subject. | 08-16-2012 |
20120208186 | Methods For The Diagnosis Of Fetal Abnormalities - The present invention relates to methods for detecting, enriching, and analyzing rare cells that are present in the blood, e.g. fetal cells. The invention further features methods of analyzing rare cell(s) to determine the presence of an abnormality, disease or condition in a subject, e.g. a fetus by analyzing a cellular sample from the subject. | 08-16-2012 |
20120208187 | Method and Kit for Determining Severity and Progression of Periodontal Disease - An improved method and kit of determining whether a patient is predisposed to having severe periodontal disease and/or having high risk of progression of periodontal disease, comprising the steps of (i) taking a biological sample from said patient; (ii) genotyping said biological sample for genetic polymorphism pattern comprising IL 1B (rs16944), IL 1B (rs1143623) and IL 1B (rs4848306); and (iii) comparing said genetic polymorphism patterns to a reference composite genotype pattern; wherein the similarity of said genetic polymorphism patterns to said reference pattern indicate said patient's predisposition to having severe periodontal disease and/or having high risk of progression of periodontal disease. | 08-16-2012 |
20120208188 | DIAGNOSTIC AND TREATMENT FOR CHRONIC AND ACUTE PHASE MYELOID LEUKEMIA - Disclosed are methods of predicting responsiveness of a cancer cell to a tyrosine kinase inhibitor, and methods of predicting the risk of progression of a cancer cell to a more aggressive form. Also provided are methods of reducing proliferation or promoting differentiation of a cancer cell having reduced level of Numb or increased level of Msi. Further disclosed are methods of treating a mammalian subject having cancer and methods of assessing an agent for chemotherapeutic potential. | 08-16-2012 |
20120208189 | METHODS FOR ISOLATION, IDENTIFICATION, AND QUANTIFICATION OF MIRNAS - Method and compositions and kits for isolation, identification, and quantification of miRNAs and other small RNAs, including but not limited to, siRNAs, mRNAs, and snRNAs are disclosed. Methods of diagnosing a disease or its progression are also disclosed. | 08-16-2012 |
20120208190 | LUMINESCENT METAL ION COMPLEXES - The present invention provides luminescent metal ion complexes for use in a wide range of biological and chemical studies. The luminescent metal ion complexes of the invention comprise a metal ion chelating component covalently bound to a carrier molecule. Also provided are methods of making and using the luminescent metal ion complexes. | 08-16-2012 |
20120208191 | STAPHYLOCOCCUS DETECTION ASSAYS - Provided herein are methods, kits, and compositions related to nucleic acid detection that allow the detection and discrimination of various | 08-16-2012 |
20120208192 | NUCLEIC ACID AMPLIFICATION EMPLOYING TEMPERATURE OSCILLATION - A method for carrying out an isothermal nucleic acid amplification reaction at a predetermined temperature, said method comprising changing the temperature of the reaction mixture away from the said predetermined temperature and allowing it to return to the predetermined temperature at least once during the amplification reaction so as to cause a temperature oscillation in particular of up to 15° C., for example of from 2-10° C. Apparatus adapted to carry out the method forms a further aspect of the invention. | 08-16-2012 |
20120208193 | DETECTING METHYLATION IN A SUBPOPULATION OF GENOMIC DNA - This invention provides methods of determining the biological, pathological, genetic, epigenetic or disease status in a biological sample by determining the methylation status of a subpopulation of genomic DNA in the sample. | 08-16-2012 |
20120208194 | Preparation of Templates for Nucleic Acid Sequencing - The invention relates to methods of generating templates for a nucleic acid sequencing reaction which comprise:
| 08-16-2012 |
20120208195 | DISEASE SUSCEPTIBILITY - Provided herein is a method of assessing the susceptibility of a subject to, or aiding the diagnosis of, an anxiety disorder or depression, the method including determining whether the subject has a haplotype including rs3216799, rs6814934, rs7658048, rs2070950 and rs2070951 with respective alleles ‘+CT, ‘C’, ‘T’, ‘C’ and ‘C’. Also provided is a kit of parts or solid substrate for use in assessing the susceptibility of a subject to an anxiety disorder or depression, the kit including or the solid substrate having attached thereto one or more nucleic acid molecules that hybridise selectively to a genomic region encompassing any two or more SNPs selected from the group consisting of rs3216799, rs6814934, rs7658048, rs2070950 and rs2070951, and/or that hybridise selectively to a genomic region encompassing two or more polymorphic sites in linkage disequilibrium with any one or more SNPs selected from rs3216799, rs6814934, rs7658048, rs2070950 and rs2070951. | 08-16-2012 |
20120208196 | Probe for Detecting Polymorphism in MPL Gene and Use of the Probe - The present invention provides a probe that can identify a polymorphism in an MPL gene easily and with high reliability and use of the probe. Used as the probe for detecting a polymorphism in the MPL gene is a probe containing any one of oligonucleotides (P1), (P1′), (P2), and (P2′), wherein:
| 08-16-2012 |
20120214158 | MUTATIONAL ANALYSIS - A method for analysing genetic mutations, and in particular single nucleotide polymorphisms (SNPs) and/or somatic mutations, is described, as well as methods for preferentially amplifying one allelic form compared with another form. The methods use an oligonucleotide probe which hybridises to a first allele with a lower melting temperature (Tm) than that with which it hybridises to a second allele, together with amplification primers which flank the oligonucleotide probe binding site and which bind to the sample with a higher Tm than that of the probe and the first allele. An amplification reaction may be carried out at a temperature such that the probe is preferentially hybridised to the second allele, thereby amplifying the first allele. The amplified sequences may be detected using the same probe as acted as the blocking probe during amplification. | 08-23-2012 |
20120214159 | SYSTEMS AND METHODS FOR OBTAINING AND MANAGING SEQUENCING DATA - Systems and methods for biological sample processing are described. A production line extracts genomic DNA from a biological sample, amplifies target components of the sample and produces sequence data for markers from the amplified components. The markers are associated with tests identified in a requisition received with the sample and some markers may be associated with unrequisitioned tests. A sample information management system (SIMS) controls and monitors the production line and subsequent analysis of the results using information in a quality control (QC) database to validate the results. A repository comprising the QC database and a research database receives and aggregates the results without identifying the source of the sample. A portal may be provided to provide access to the research database to a plurality of external contributors. Contributors can selectively provide additional research data and data can be processed using data mining and curation tools. | 08-23-2012 |
20120214160 | Methods, compositions, and kits for detecting rare cells - Disclosed herein are methods for identifying rare cells containing particular markers and/or alleles from biological samples that have not been substantially pre-processed (e.g., unprocessed whole blood). The methods described herein provide a system for digital enrichment of target cells from a biological sample and detection of such target cells, thereby allowing accurate and efficient detection and/or enumeration of such cells in the sample. | 08-23-2012 |
20120214161 | METHOD OF DETECTING OR QUANTITATING ENDOGENOUS WHEAT DNA AND METHOD OF DETERMINING CONTAMINATION RATE OF GENETICALLY MODIFIED WHEAT IN TEST SAMPLE - An object of the present invention is to discover an endogenous wheat sequence satisfying the conditions of: a) it is universally present in varieties of wheat, b) the amount present (detected amount) is not affected depending on the wheat variety, c) even if other grains are present, only wheat can be detected without cross-reactivity, and d) it is amplified quantitatively by the PCR reaction. A further object of the present invention is to provide a method of accurately detecting and quantitating endogenous wheat DNA in a test sample by the polymerase chain reaction. The present invention provides a kit for detecting or quantitating an endogenous wheat DNA sequence in a test sample by the polymerase chain reaction, the kit comprising at least one primer pair capable of amplifying the endogenous wheat DNA sequence. | 08-23-2012 |
20120214162 | ASSAY METHODS USING DNA BINDING PROTEINS - Assay methods for preparing a biomolecule analyte includes hybridizing a sequence specific oligonucleotide probe to a biomolecule template and reacting the resulting analyte with a binding moiety. | 08-23-2012 |
20120214163 | DISEASE-ASSOCIATED GENETIC VARIATIONS AND METHODS FOR OBTAINING AND USING SAME - The invention provides a comprehensive, rapid, unbiased, and accurate method for identifying and/or discovering disease-associated genetic variations, e.g., disease-associated variations. The present invention further provides novel disease-associated genetic variations for use as genetic markers of disease, e.g., cancer. The invention further provides methods for assessing an individual's risk for developing a disease, e.g., cancer, by detecting the presence the novel disease-associated genetic variations of the invention. | 08-23-2012 |
20120214164 | DNA SEQUENCING METHOD - A method for determining the sequence of a polynucleotide, the method relying on the detection of a conformational change in an enzyme that interacts with and processes along the polynucleotide. The detection of a conformational change may be carried out by measuring changes in a fluorophore bound to the enzyme. | 08-23-2012 |
20120214165 | Methods and Compositions for the Diagnosis and Treatment of Thyroid Cancer - Methods for detecting, diagnosing and monitoring thyroid cancer in a subject are described comprising measuring in a sample from the subject markers including Ep-ICD and EpEX. The invention also provides kits and compositions for carrying out the methods of the invention. | 08-23-2012 |
20120214166 | Probe for Detecting Polymorphism in EGFR Gene and Use of the Probe - The present invention provides a polymorphism detection probe that can identify a polymorphism in an EGFR gene easily and with high reliability and a polymorphism detection method using the probe. The probe of the present invention is a probe for detecting a polymorphism in an EGFR gene, including at least one of an oligonucleotide (P1) and an oligonucleotide (P2), wherein:
| 08-23-2012 |
20120219942 | Methods Employing McrA to Detect 5-Methyl Cytosine - The invention provides methods for using the rMcrA protein, and derivatives thereof, for direct or semi-direct determination of the methylation status of CpG dinucleotides in methyl-CpG island sequences of interest. | 08-30-2012 |
20120219943 | METHODS OF PROGNOSIS AND DIAGNOSIS IN CHRONIC HEART FAILURE - The present disclosure provides methods of diagnosing chronic heart failure in patients by detecting the presence and amounts of biomarkers of heart failure in samples from the patients. Such biomarkers may be used to develop a more accurate prognosis for a patient with heart failure, or to accurately diagnose a patient suspected of having heart failure. | 08-30-2012 |
20120219944 | MYH14 AS CAUSATIVE GENE RESPONSIBLE FOR COMPLEX PHENOTYPE OF PERIPHERAL NEUROPATHY, MYOPATHY, HEARING LOSS AND HOARSENESS, AND DIAGNOSTIC METHOD AND KIT FOR THE COMPLEX PHENOTYPE USING THE SAME - The present invention newly identified a missense mutation in the MYH14 gene as a cause responsible for a complex phenotype of peripheral neuropathy, myopathy, hearing loss, and hoarseness. Further, the present invention provides a method for diagnosing inherited neuromuscular disorders showing a complex phenotype of peripheral neuropathy, myopathy, hearing loss, and hoarseness via detection of the mutated MYH14 gene or the protein encoded thereby, and a diagnostic kit therefor. According to the present invention, simple examination of the gene allows early diagnosis of inherited neuromuscular disorders showing the complex phenotype of peripheral neuropathy, myopathy, hearing loss, and hoarseness, which shows high inheritance and is caused by a single gene defect, and accurate diagnosis of the disease makes it possible to tailor therapy. | 08-30-2012 |
20120219945 | USE OF SINGLE-STRANDED BINDING PROTEIN IN AMPLIFYING TARGET NUCLEIC ACID - A PCR composition is described that includes a single-stranded nucleic acid binding protein, e.g. the G5p protein, that binds cooperatively to single-stranded nucleic acids such as primers and/or probe or single stranded nucleic acid templates and shields them from nuclease degradation. The single-stranded nucleic acid binding protein complex also prevents the formation of primer dimers or other non-specific PCR products during PCR amplification. The composition promises to improve the specificity and the reliability of high throughput PCR protocols. | 08-30-2012 |
20120219946 | DNA METHYLATION MARKERS ASSOCIATED WITH THE CPG ISLAND METHYLATOR PHENOTYPE (CIMP) IN HUMAN COLORECTAL CANCER - Particular aspects confirm the existence of a CpG island methylator phenotype (CIMP) in colorectal cancer, and provide novel validated DNA methylation markers associated with CIMP. Additional aspects provide novel methods and compositions for: determining CIMP status in colorectal cancers, determining the relationship between CIMP status and other molecular features of the cancers (e.g., BRAF mutation, KRAS mutation and MSI status); determining the relationship between CIMP status and other variables (e.g., age, sex, tumor location, family history, race, country of origin, tumor characteristics (including, tumor type, tumor grade, invasive margin characteristics, lymphocyte infiltration characteristics, direct spread, lymph node spread, venous spread and type of residual adjacent polyp, if present)); and determining, between subgroups defined by CIMP status and BRAF mutations, effects of selected risk factors (e.g., body mass index, smoking history, alcohol intake, dietary folate intake, folate metabolic enzyme polymorphisms and history of hormonal use). | 08-30-2012 |
20120219947 | METHODS FOR FORMING MIXED DROPLETS - The invention generally relates to methods for forming mixed droplets. In certain embodiments, methods of the invention involve forming a droplet, and contacting the droplet with a fluid stream, wherein a portion of the fluid stream integrates with the droplet to form a mixed droplet. | 08-30-2012 |
20120219948 | APPLICATION OF QUANTUM DOTS FOR NUCLEAR STAINING - Embodiments of a system, method, and kit for visualizing a nucleus are disclosed. A tissue sample is pretreated with a protease to permeabilize the nucleus, and then incubated with a nanoparticle/DNA-binding moiety conjugate. The DNA-binding moiety includes at least one DNA-binding molecule. The conjugate binds to DNA within the nucleus, and the nanoparticle is visualized, thereby visualizing the nucleus. Computer and image analysis techniques are used to evaluate nuclear features such as chromosomal distribution, ploidy, shape, size, texture features, and/or contextual features. The method may be used in combination with other multiplexed tests on the tissue sample, including fluorescence in situ hybridization. Kits for performing the method include a protease enzyme composition, a nanoparticle/DNA-binding moiety conjugate, and a reaction buffer. | 08-30-2012 |
20120219949 | METHOD OF DETECTING METHYLATED DNA IN SAMPLE - In order to simply obtain a methylated DNA sample, a method including bringing a sample which may include methylated DNA into contact with a protein capable of binding to methylated DNA to bind the methylated DNA in the sample to the protein, bringing the sample obtained into contact with at least one deoxyribonuclease to degrade DNA in the sample; and detecting methylated DNA which is not degraded by the deoxyribonuclease by the binding of the sample obtained to the protein is used. In the method, at least one type of deoxyribonucleases is a deoxyribonuclease different from a methylation-sensitive restriction enzyme capable of degradating a single stranded DNA. | 08-30-2012 |
20120219951 | PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD - A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof. | 08-30-2012 |
20120219952 | CARBAPENEMASE AND ANTIBACTERIAL TREATMENT - The present invention relates to a carbapenemase and methods using said carbapenemase such as screening methods, predictive methods and therapeutic uses. | 08-30-2012 |
20120219953 | METHOD FOR DETECTING AND QUANTIFYING POLY(A) RNA AND MRNA - The present invention relates to a method for detecting and/or for quantifying poly(A) RNA and/or mRNA, wherein a poly(dT) oligonucleotide which features a fluorescent dye and also a quencher is hybridized to the nucleic acid to be detected. Non-hybridized poly(dT) oligonucleotide is degraded by an added nuclease, and as a result, fluorescently labelled nucleotides are released and the resulting fluorescent signal is measured. | 08-30-2012 |
20120219954 | GENOTYPING - The object of the present invention is to provide a novel method that addresses the problem of differentiating large sets of genomic sequences. The invention relates to a method for genotyping N loci present in a sample in a target nucleic acid molecule, wherein each locus is located in a genotype marker region of the nucleic acid molecule, and corresponds to two or more genotypes. Furthermore the invention relates to a kit for performing said method for genotyping. Also the invention relates to a method for designing and producing selection primers, as well as a method for producing detection primers, all of said primers to be used in the method for genotyping or in the kit for performing the genotyping method. The invention further relates to selection primers adapted for genotyping of loci in a target nucleic acid molecule and a computer program product for designing selection primers. | 08-30-2012 |
20120219955 | THD PRIMER TARGET DETECTION - The present invention relates to the detection of a target nucleic acid sequence using a target hybridization and detection primer (THD primer). The present invention allows for both a target amplification and a signal amplification by introducing a label into a primer used in PCR reactions, ensuring a real-time target detection by PCR reaction by no use of complicated oligonucleotides. The present invention could completely be free from the troublesome matters and shortcomings associated with conventional real-time PCR methods. The present invention allows for successful real-time target detection by using only a labeled primer. This feature makes it possible that the present invention exhibits excellent real-time target detection in multiplex manner. | 08-30-2012 |
20120225425 | Cathepsin E as a Marker of Colon Cancer - Elevated levels of cathepsin E (catE) are demonstrated to be diagnostic of intestinal forms of cancer, such as colorectal cancer. Elevated levels of cathepsin E (catE, monomeric forms) are demonstrated to be detectable in the urine of animals having colorectal cancer, and a diagnostic/screening method for identifying and/or detecting colorectal cancer in an animal from a urine sample is provided. Specific tissue immunohistochemcial staining for catE (monomeric forms) in dysplastic tissue is also disclosed, and is shown to correlate with the level of dysplastic lesion severity. Hence, a method for identifying and determining the level of dysplastic lesion severity is provided. Cathepsin E mRNA transcription and expression levels are also demonstrated to be upregulated in dysplastic tissue, relative to non-dysplastic tissue. Hence, a method for transcriptionally profiling an animal to monitor the progression of colorectal disease is provided. | 09-06-2012 |
20120225426 | BAALC EXPRESSION AS A DIAGNOSTIC MARKER FOR ACUTE LEUKEMIA - Overexpression of the gene, BAALC, in biological samples from a patient is prognostic for tumor aggressiveness and unfavorable patient outcome. The present invention provides polynucleotide primers and probes for assaying for overexpression of BAALC transcripts. Kits containing the primers and probes are also provided. Also provided are antibodies for assaying for overexpression of BAALC proteins as well as peptide immunogens for producing the anti-BAALC antibodies. The present invention also provides methods for characterizing acute myelogenous leukemia, chronic myelogenous leukemia and prostate cancer in a patient, base on detection of BAALC overexpression. | 09-06-2012 |
20120225427 | sPLA2 IIA Polymorphism Analysis for the Diagnosis/Prognosis of a Cardiovascular Disease/Event - The invention relates to a method of identifying a subject having or at risk of having or developing a cardiovascular disease and/or a cardiovascular event, comprising determining, in a sample obtained from said subject, the presence or absence of a variant allele of nucleotide polymorphism (SNP) of the sPLA2 type IIA nucleic acid, wherein the SNP is selected from the group consisting of rs11573156 and rs2236771, wherein the presence of the minor allele (G) of SNP rs11573156 indicates an increased risk of having or being at risk of having or developing a cardiovascular disease and/or cardiovascular event, and the presence of the minor allele (C) of SNP rs2236771 indicates a decreased risk of having or being at risk of having or developing a cardiovascular disease and/or cardiovascular event. | 09-06-2012 |
20120225428 | TYPE OF UNIVERSAL PROBE FOR THE DETECTION OF GENOMIC VARIANTS - The present disclosure relates to a composition comprising a first set of probes and a second set of probes, composed of one or more DNA nucleotide(s) and five or more LNA (locked nucleic acid) nucleotides, wherein the base at a discriminating position differs for a first probe of the first set and a first probe of the second set. The present disclosure relates to the composition comprising a plurality of probes in each of the first and second set of probes, wherein the probes in each set differ in one, two, or three LNA random position(s). Further, the present disclosure relates to a method of detecting genomic variants by means of the aforementioned probes. | 09-06-2012 |
20120225429 | METHODS, COMPOSITIONS AND KITS FOR DETECTION AND ANALYSIS OF ANTIBIOTIC-RESISTANT BACTERIA - The present invention relates generally to detection of antibiotic-resistant bacteria in a sample. In particular, the invention provides methods, compositions and kits for detecting and analyzing methicillin-resistant | 09-06-2012 |
20120225430 | METHODS FOR DETECTING HUMAN PAPILLOMA VIRUS-ASSOCIATED CANCERS - The present invention provides probes and methods of use thereof in the diagnosis and/or prognosis of certain types of cancers, particularly human papillomavirus (HPV)-associated cancers. The probes are designed for hybridization with genomic material in a manner indicative of one or more aberrations in the genetic material present in the test sample. The identified aberrations are biomarkers of HPV-associated cancer. The methods of the invention comprise contacting a sample to one or more probes, allowing any genetic material in the sample to hybridize to the genomic regions provided in the probes, analyzing the hybridizations, and analyzing the hybridizations to identify detected aberrations as biomarkers indicative of HPV-associated cancer progression. | 09-06-2012 |
20120231452 | ASSAY FOR METHYLATION IN THE GST-PI GENE - A diagnostic or prognostic assay is disclosed for a disease of condition characterized by abnormal methylation of cytosine at side or sites within the glutathione-S-transferase (GST) Pi gene and/or its regulatory flanking sequences (e.g., prostate cancer and liver cancer). The assay comprises: (i) isolating DNA from said subject, and (ii) determining (e.g., by selective PCR amplification) the presence of abnormal methylation of cytosine at a site or sites within the GST-Pi gene and/or its regulatory flanking sequences. | 09-13-2012 |
20120231453 | Brownian Microbarcodes for Bioassays - An encoded microparticle carrying a spatial code is provided; and a set of encoded microparticles are provided with distinguishable spatial codes, wherein the codes comply with a pre-determined coding scheme. Presented are also methods of using the encoded microparticles in various biological assays, such as various multiplex quantitative PCR (real-time PCR) and multiplex chromosomal immunoprecipitation (ChIP) assays. | 09-13-2012 |
20120231454 | Production of beta-cells - The present invention relates to in vitro and in vivo methods for the generation of pancreatic β-cells, comprising the step of providing at least one pancreatic α-cell or at least one precursor cell with Pax-4 or a nucleic acid encoding Pax-4. Furthermore, the invention relates to a screening method for the screening of a pancreatic-β-cell phenotype-inducing compound, comprising the step of contacting at least one pancreatic α-cell or at least one precursor cell with a given compound, and testing whether said compound is capable of inducing a pancreatic-β-cell phenotype. | 09-13-2012 |
20120231455 | PEPTIDE NUCLEIC ACID PROBES, KIT AND METHOD FOR DETECTING HELICOBACTER PYLORI AND/OR CLARITHROMYCIN RESISTANCE PROFILE AND APPLICATIONS - Four peptide nucleic acid probes (PNA) are for the detection of | 09-13-2012 |
20120231456 | INSTRUMENTS AND METHODS FOR MIXING THE CONTENTS OF A DETECTION CHAMBER - A receptacle having interconnected chambers arranged to permit multiple process steps to be performed independently or simultaneously. The receptacles are manufactured to separate liquid from dried reagents and to maintain the stability of the dried reagents. An immiscible liquid, such as an oil, is included to control loading of process materials, facilitate mixing and reconstitution of dried reagents, limit evaporation, control heating of reaction materials, concentrate solid support materials to prevent clogging of fluid connections, provide minimum volumes for fluid transfers, and to prevent process materials from sticking to chamber surfaces. The receptacles can be adapted for use in systems having a processing instrument that includes an actuator system for selectively moving fluid substances between chambers and a detector. The actuator system can be arranged to concentrate an analyte present in a sample. The detector can be used to detect an optical signal emitted by the contents of the receptacle. | 09-13-2012 |
20120231457 | COMPOSITIONS AND METHODS FOR ASSESSING A GENETIC RISK OF DEVELOPING LATE-ONSET ALZHEIMER'S DISEASE (LOAD) - The described invention provides compositions and methods for assessing a genetic risk of developing late-onset Alzheimer's disease (LOAD) in a subject by analyzing haplotypes of human Apolipoprotein E (APOE) and Translocase of Outer Mitochondrial Membrane 40 homolog (TOMM40) genes using a PCR- and restriction digest-based approach. | 09-13-2012 |
20120231458 | METHOD OF ACQUIRING STANDARD CURVE IN REAL-TIME PCR - A method of acquiring a standard curve for quantifying polynucleotide is provided. The method includes: (a) performing a real-time polynucleotide chain reaction (PCR) for plural samples having different initial polynucleotide concentrations, the PCR being performed with respect to plural amplification cycle numbers using detectable probes providing a signal according to an amount of polynucleotide; (b) acquiring plural amplification profile curves with respect to signal intensity values provided by the probes according to the amplification cycle numbers; (c) selecting one threshold from among the signal intensity values; (d) calculating amplification cycle numbers corresponding to the selected thresholds from the plural amplification profile curves, and determining the calculated amplification cycle numbers as threshold cycle (Ct) values corresponding to each of the initial polynucleotide concentrations; (e) selecting at least two Ct values among the Ct values determined in (d); and (f) acquiring a standard curve from the selected Ct values. | 09-13-2012 |
20120231459 | CHEMILUMINESCENT PROBES FOR MULTIPLEX MOLECULAR QUANTIFICATION AND USES THEREOF - A novel method is disclosed for simultaneous detection and quantification of two or more nucleic acid targets, without need for amplification. The method depends on spectral-temporal resolution of chemiluminescence emitted from independent hybridization-induced chemiluminescent signal (HICS) probes. The utility of this method has been demonstrated by use of resolvable N-linked acridinium and 2,7-dimethoxyacridinium ester labeled probes in a homogeneous assay for sensitive and simultaneous independent quantification of several bacterial and fungal target sequences. Compositions and kits for practicing the method of the present invention are also disclosed. | 09-13-2012 |
20120231460 | Method and Apparatus for Predicting Pharmacological Efficacy of Human Anti-TNFa Antibody Drug against Rheumatoid Arthritis - A method for predicting pharmacological efficacy of a human anti-TNFα antibody drug against rheumatoid arthritis, the method including: measuring a level of at least one of ADAMTS4 and ADAMTS5 in a sample derived from a subject, and determining whether or not the human anti-TNFα antibody drug is efficacious against rheumatoid arthritis of the subject, based on the level of the at least one of ADAMTS4 and ADAMTS5 serving as an index. | 09-13-2012 |
20120231461 | DETECTION OF NUCLEIC ACIDS - The present invention relates to compositions and methods for the detection and characterization of small nucleic acid molecules (e.g., RNA (e.g., small RNAs such as micro RNAs (miRNAs) and small interfering RNAs (siRNAs)) and other short nucleic acid molecules). More particularly, the present invention relates to methods for the detection and quantification of RNA expression. The present invention further provides for the detection of miRNA and siRNA variants. | 09-13-2012 |
20120231462 | ARTIFICIAL BASE PAIR CAPABLE OF FORMING SPECIFIC BASE PAIR - The present invention provides a double-stranded nucleic acid in which at least one nucleic acid strand includes an unnatural base that forms a self-complementary base pair or an unnatural base that forms a base pair with any natural base with substantially the same thermal stability. The present invention also provides a method of hybridizing a first nucleic acid strand with a second nucleic acid strand, wherein the first nucleic acid strand includes an unnatural base that forms a self-complementary base pair or an unnatural base that forms a base pair with any natural base with substantially the same thermal stability, and a method of applying the nucleic acid to SNP detection, a DNA chip, DNA/RNA computing, or an in vitro translation system. The present invention provides a method of introducing an unnatural base into a nucleic acid strand and thereby controlling the thermodynamic stability in hybridization of the nucleic acid strand. | 09-13-2012 |
20120231463 | Primer Set for Amplification of MTHFR Gene, MTHFR Gene Amplification Reagent Containing the Same, and Use of the Same - The present invention provides a primer set for specifically amplifying a target region in a MTHFR gene by a nucleic acid amplification method, a MTHFR gene amplification reagent containing the primer set, and use of the primer set. | 09-13-2012 |
20120237926 | RAPID SCREENING OF BIOLOGICALLY ACTIVE NUCLEASES AND ISOLATION OF NUCLEASE-MODIFIED CELLS - Disclosed herein are methods and compositions for rapidly identifying active nucleases and cells having nuclease-mediated genomic modifications. | 09-20-2012 |
20120237927 | Method of Mapping of mRNA Distribution With Atomic Force Microscopy Comprising Dendron - The present invention relates to a method of mapping of mRNA distribution, comprising the steps of a preparing a probe DNA attached to a apical liner region of the dendron on AFM cantilever where the probe DNA can specifically hybridize a target mRNA and measuring specific adhesive force between the probe DNA and the target mRNA on sectioned tissue at nanometer resolution. | 09-20-2012 |
20120237928 | METHOD FOR DETERMINING COPY NUMBER VARIATIONS - The invention provides a method for determining copy number variations (CNV) of a sequence of interest in a test sample that comprises a mixture of nucleic acids that are known or are suspected to differ in the amount of one or more sequence of interest. The method comprises a statistical approach that accounts for accrued variability stemming from process-related, interchromosomal and inter-sequencing variability. The method is applicable to determining CNV of any fetal aneuploidy, and CNVs known or suspected to be associated with a variety of medical conditions. CNV that can be determined according to the method include trisomies and monosomies of any one or more of chromosomes 1-22, X and Y, other chromosomal polysomies, and deletions and/or duplications of segments of any one or more of the chromosomes, which can be detected by sequencing only once the nucleic acids of a test sample. | 09-20-2012 |
20120237929 | LONG INTERSPERSED NUCLEAR ELEMENTS (LINE-1) AND ALU HYPOMETHYLATION AS BIOMARKERS FOR COLORECTAL CANCER METASTASIS - A method for determining a colorectal cancer metastasis in a human subject suffering from a primary colorectal cancer (CRC) is described herein. The method of the present invention comprises the steps of: i) identifying the human subject suffering from the primary CRC, ii) obtaining one or more biological samples from the human subject, iii) detecting a methylation level of Alu, LINE-1, or both in the one or more biological samples, and iv) increasing the level of the colorectal metastatic stage in the human subject when the methylation level of Alu, LINE-1 is lower compared to a corresponding control methylation level of Alu, LINE-1. | 09-20-2012 |
20120237930 | METHOD OF ANALYZING CHROMOSOMAL TRANSLOCATIONS AND A SYSTEM THEREFORE - The present disclosure relates to systems and methods for analyzing chromosomal translocations, and in particular to analysis of chromosomal translocation by in situ hybridization. | 09-20-2012 |
20120237931 | IDENTIFICATION AND MONITORING OF CIRCULATING CANCER STEM CELLS - The present invention comprises a method of detecting circular tumor cells and methods of detecting, evaluating, or staging cancer in a patient, as well as a method of monitoring treatment of cancer in a patient using the claimed method. The method comprises contacting a sample with a ALDH1 binding agent; selecting the cells based on positive or negative ALDH1 staining; contacting the selected cells with a labeled nucleic acid probe, and detecting hybridized cells by fluorescence in situ hybridization; and analyzing a signal produced by the labels on the hybridized cells to detect the CTCs. In other embodiments, the method provides for directed to a method of determining the level of CTCs in a sample having blood cells from a patient by contacting a sample having blood cells from a patient, wherein the sample has not been pre-sorted into ALDH1-positive and ALDH1-negative cells. | 09-20-2012 |
20120237932 | METHODS AND MATERIALS FOR ASSESSING THE CIS/TRANS NATURE OF HUMANS HAVING CYP2C19*2 AND CYP2C19*17 ALLELES - This document provides methods and materials involved in determining if a human heterozygous for CYP2C19*2 and heterozygous for CYP2C19*17 contains one CYP2C19 allele with both CYP2C19*2 and CYP2C19*17 (e.g., a cis relationship) or contains one CYP2C19 allele with CYP2C19*2 and one CYP2C19 allele with CYP2C19*17 (e.g., a trans relationship). | 09-20-2012 |
20120237933 | METHOD FOR SCREENING ACTIVE AGENTS FOR TREATING AT LEAST ONE CUTANEOUS SIGN OF AGING BY DETERMING THE ABILITY TO STIMULATE FN3K AND/OR FN3KP EXPRESSION - A method for screening active agents capable of treating at least one cutaneous sign of aging. The agents are identified based on their ability to stimulate fructosamine-3-kinase (FN3K) and/or fructosamine-3-kinase-related protein (FN3K RP) expression. | 09-20-2012 |
20120237934 | METHODS OF DETECTING MUTATIONS ASSOCIATED WITH ATAXIA-OCULAR APRAXIA 2 (AOA2) - Methods of identifying polymorphisms associated with ataxia-ocular apraxia 2 (AOA2), are described. The polymorphisms associated with AOA2 include specific mutations in the senataxin (SETX) gene. Also described are methods of diagnosis of AOA2, as well as methods of assessing an individual for carrier status for AOA2. | 09-20-2012 |
20120237935 | REAGENT KIT FOR QUANTITATIVELY DETECTING THE MUTATIONS OF EPIDERMAL GROWTH FACTOR RECEPTOR(EGFR) - The present invention relates to a detection method and a detection kit for EGFR gene mutations, which relates to the therapeutic efficacy of molecular-targeted anti-cancer drugs. Particularly, the present invention relates to a fluorescent quantitative PCR method and kit for detecting mutations at hotspots of EGFR gene, together with the use thereof. The present invention detects the mutations at specific sites of EGFR gene, and can predict the therapeutic efficacy of EGFR tyrosine kinase inhibitors. Therefore, it can provide a guidance to individualize treatments for cancer patients. | 09-20-2012 |
20120237936 | METHODS AND RELATED DEVICES FOR SINGLE MOLECULE WHOLE GENOME ANALYSIS - Provided are methods of labeling and analyzing features along at least one macro molecule such as a linear biopolymer, including methods of mapping the distribution and frequency of specific sequence motifs or the chemical or proteomic modification state of such sequence motifs along individual unfolded nucleic acid molecules. The present invention also provides methods of identifying signature patterns of sequence or epigenetic variations along such labeled macro molecules for direct massive parallel single molecule level analysis. The present invention also provides systems suitable for high throughput analysis of such labeled macro mo lecules. | 09-20-2012 |
20120244527 | Compositions, Kits and Methods for Synthesis and/or Detection of Nucleic Acids - A composition comprising a thermostable DNA polymerase; and a PCR inhibitor blocking agent, wherein the PCR inhibitor blocking agent is present in an amount effective to enhance tolerance of an assembled PCR to a PCR inhibitor. | 09-27-2012 |
20120244528 | Susceptibility Genes for Age-Related Maculopathy (ARM) on Chromosome 10q26 - Allelic variations in the genes PLEKHA1 and LOC387715 are identified herein as risk factor for Age Related Maculopathy (ARM). A method is therefore provided for identifying a risk of development of ARM in an individual that comprises identification of allelic variations in PLEKHA1 and/or LOC387715. Related apparatus, such as an array, are identified as being useful in implementing those methods. | 09-27-2012 |
20120244529 | MULTIPLEX ANALYSIS OF CELLS, PARTICLES, AND OTHER ANALYTES - In general, the invention features multiplexed devices, systems, methods, and kits for analysis of cells, particles, and other analytes on a porous membrane. Preferred devices detect, identify and quantify low levels of microorganisms in complex biological samples, such as blood. An exemplary device includes a housing having a fluid inlet that is in fluid communication with a plurality of channels, e.g., having substantially the same fluidic resistance. Each of the plurality of channels is in fluid communication with a reservoir containing reagents for analyzing cells, particles, or other analytes bound to particles, one or more substantially planar, porous membranes through which the cells or particles do not pass, and one or more outlets, wherein liquid flowing away from the inlet is divided between the plurality of channels and flows through the one or more membranes towards the outlet, and wherein the reservoir is disposed upstream of the one or more membranes. | 09-27-2012 |
20120244530 | METHODS OF DETECTING LUNG CANCER - Methods of detecting lung cancer, such as non-small cell lung cancer, including squamous cell carcinoma and adenocarcinoma, are provided. Methods of detecting changes in the levels of one or more small RNAs associated with lung cancer are also provided. Compositions and kits are also provided. | 09-27-2012 |
20120244531 | METHOD FOR PROVIDING INFORMATION FOR DIAGNOSING CANCER USING QUANTITATIVE REAL-TIME PCR AND KIT FOR DIAGNOSING CANCER FOR THE SAME - There is provided a method for providing information for diagnosing cancer using Real-Time RT-PCR, and a kit for diagnosing cancer for the method. | 09-27-2012 |
20120244532 | Device and Methods for Epigenetic Analysis - Provided herein are methods and devices for single object detection. The methods and devices can be used to identify a plurality epigenetic markers on a genetic material, or a chromatin, encompassing fragments thereof. The invention provides for the characterization of the genetic material flowing through a channel in a continuous body of fluid based on detection of one or more properties of the genetic material. The methods and systems provided herein allow genome-wide, high-throughput epigenetic analysis and overcome a variety of limitations common to bulk analysis techniques. | 09-27-2012 |
20120244533 | DETECTION OF AAD1 EVENT DAS-40278-9 - This invention relates in part to detecting herbicide tolerant plants—more specifically, an aad-1 transformation event in corn plants. The subject invention also provides assays for detecting the presence of the subject event in a sample (of corn grain, for example). Kits and conditions useful in conducting the assays are also provided. The subject invention also relates in part to plant breeding using the subject methods. In some embodiments, said event/polynucleotide sequence can be “stacked” with other traits. More specifically, the invention relates in part to an endpoint TaqMan PCR assay for AAD-1 corn event 40278-9. Some embodiments are directed to assays that are capable of high throughput zygosity analysis. The subject invention further relates, in part, to the use of a preferred reference gene for use in determining zygosity. | 09-27-2012 |
20120244534 | CLOSED-SYSTEM MULTI-STAGE NUCLEIC ACID AMPLIFICATION REACTIONS - The invention is directed to systems, methods, and apparatus for carrying out multi-stage amplification reactions, especially under fluidly closed conditions. In one aspect, methods of the invention are carried out in a fluidly closed reaction system that permits the isolation of a portion of a first (or prior) reaction mixture and its use as a sample or specimen in a second (or subsequent) reaction mixture, thereby substantially avoiding interfering effects that first reaction components may have in the second reaction if both reaction mixtures were simply combined together. In this aspect, systems, methods, and apparatus of the invention may be used with any amplification reaction that permits multiple stages of amplification based on the use of nested primers. | 09-27-2012 |
20120244535 | FUNCTIONALIZED 3-ALKYNYL PYRAZOLOPYRIMIDINE ANALOGUES AS UNIVERSAL BASES AND METHODS OF USE - 3-alkynyl inosine analogs and their uses as universal bases are provided. The inosine analogues can be incorporated into nucleic acid primers and probes. They do not significantly destabilize nucleic acid duplexes. As a result, the novel nucleic acid primers and probes incorporating the inosine analogues can be used in a variety of methods. The analogs function unexpectedly well as universal bases. Not only do they stabilize duplexes substantially more than hypoxanthine opposite A, C, T, and G but they are also recognized in primers by polymerases, allowing efficient amplification. | 09-27-2012 |
20120244536 | Detection of Bladder Cancer Recurrence - The present invention generally relates to methods of screening for cancer recurrence. Methods of the invention involve identifying a threshold parameter of a protein and of two or more nucleic acids, where the threshold parameters are indicative of the absence of cancer, conducting an assay in a sample to determine a parameter of the two or more nucleic acids and a parameter of the protein, and identifying the sample as positive for cancer recurrence if the parameters of at least one of the nucleic acids and the protein present in the sample are greater than their respective threshold parameters. In certain aspects of the invention, the nucleic acids include FGFR3, Vimentin, and NID2. In certain aspects of the invention, the protein includes MMP2 or MMP9. | 09-27-2012 |
20120244537 | Nanowire-Based System for Analysis of Nucleic Acids - System for detection and/or analysis of nucleic acids using nanowires to detect covalent modification of nucleic acids. | 09-27-2012 |
20120244538 | METHOD FOR DETECTING GENE MODIFICATIONS BY MEANS OF ASYMMETRICAL PCR AND BLOCKING AGENTS - A method of detecting at least one gene modification such as a mutation in a gene includes carrying out an asymmetric polymerase chain reaction (PCR) with a combined use of at least one detectable mutation-specific hybridization probe (sensor probe) and at least one wild-type specific blocking agent which inhibits a binding of the at least one detectable mutation-specific hybridization probe (sensor probe) to a wild-type gene so as to provide at least one of a selective intensification and an amplification of a detection of a gene segment of a mutation gene having a gene modification. | 09-27-2012 |
20120244539 | METHOD FOR SCREENING OF THERAPEUTIC AGENT FOR HYPERLIPEMIA - Disclosed are a highly safe treatment method for hyperlipidemia and a therapeutic agent for hyperlipidemia. Specifically, the invention provides a novel method for screening an agent for treating hyperlipidemia, more specifically, a method for screening a substance that can inhibit the production or function of gangliosides, particularly GM3, or inhibit the activity or expression of GM3 synthase to reduce a blood lipid level. A pharmaceutical composition, which can specifically inhibit the production of gangliosides, particularly GM3, thereby effective for hyperlipidemia treatment, and others are also provided. | 09-27-2012 |
20120244540 | Probe for Detecting Polymorphism in Disease-Related Gene and Use of the Probe - The present invention provides a polymorphism detection probe that can identify a different polymorphism in a K-ras gene easily with high reliability and use of the polymorphism detection probe. | 09-27-2012 |
20120252012 | METHOD FOR DETECTING PROKARYOTIC DNA FROM A FECES SAMPLE - The present invention concerns a method of detection and preferably of quantification of DNA, preferably comprising prokaryotic DNA, extracted from a stool sample of an individual, especially for the molecular determination of the composition of the intestinal flora in the stool. According to the invention, one controls the quality of the DNA extraction by verifying whether one detects a specific DNA of | 10-04-2012 |
20120252013 | METHODS FOR IDENTIFYING MULTIPLE DNA ALTERATION MARKERS IN A LARGE BACKGROUND OF WILD-TYPE DNA - Methods for simultaneously surveying the status of a large number of DNA mutation markers are described. In addition, methods for simultaneously determining the methylation status at multiple sites of a collection of genes, in a single assay, are described. | 10-04-2012 |
20120252014 | METHOD OF NORMALIZED QUANTIFICATION OF NUCLEIC ACIDS USING ANCHOR OLIGONUCLEOTIDES AND ADAPTER OLIGONUCLEOTIDES - The present invention is related to normalized quantification of nucleic acids and to the normalization of quantities of nucleic acids in samples, e.g. mixtures of nucleic acids. The present invention relates to method for the normalization of the quantity of a nucleic acid to be quantified in a sample to the total quantity of nucleic acid in the sample; or to the total quantity of a specific class of nucleic acid in the sample. | 10-04-2012 |
20120252015 | METHODS AND COMPOSITIONS FOR DETECTING GENETIC MATERIAL - The present disclosure provides methods and compositions for detecting polynucleotides in a sample and for quantifying polynucleotide load in a sample. The polynucleotides can be associated with a disease, disorder, or condition. In some applications, methylated DNA is quantified, e.g., in order to determine the load of polynucleotides in a sample. The present disclosure also provides methods and compositions for determining the load of fetal polynucleotides in a biological sample, e.g., the load of fetal polynucleotides (e.g., DNA, RNA) in maternal plasma. The present disclosure provides methods and compositions for detecting cellular processes such as cellular viability, growth rates, and infection rates. This disclosure also provides compositions and methods for detecting differences in copy number of a target polynucleotide. In some embodiments, the methods and compositions provided herein are useful for diagnosis of fetal genetic abnormalities, when the starting sample is maternal tissue (e.g., blood, plasma). | 10-04-2012 |
20120252016 | OPTIMIZED OLIGONUCLEOTIDES AND METHODS OF USING SAME FOR THE DETECTION, ISOLATION, AMPLIFICATION, QUANTITATION, MONITORING, SCREENING, AND SEQUENCING OF GROUP B STREPTOCOCCUS - Described herein are oligonucleotides useful for detecting, isolating, amplifying, quantitating, monitoring, screening and sequencing GBS genes and methods of using the described oligonucleotides. | 10-04-2012 |
20120252017 | DEVICE AND METHOD FOR EXTRACTION AND ANALYSIS OF NUCLEIC ACIDS FROM BIOLOGICAL SAMPLES - Device and methods for extracting and analyzing nucleic acids from biological samples. | 10-04-2012 |
20120252018 | METHOD OF DETECTING AN ANALYTE IN A SAMPLE USING SEMICONDUCTOR NANOCRYSTALS AS A DETECTABLE LABEL - The use of semiconductor nanocrystals as detectable labels in various chemical and biological applications is disclosed. The methods find use for detecting a single analyte, as well as multiple analytes by using more than one semiconductor nanocrystal as a detectable label, each of which emits at a distinct wavelength. | 10-04-2012 |
20120252019 | Detection of Bladder Cancers - The present invention generally relates to methods of screening for cancer. Methods of the invention involve identifying a threshold parameter of a protein and of two or more nucleic acids, where the threshold parameters are indicative of the absence of cancer, conducting an assay in a sample to determine a parameter of the two or more nucleic acids and a parameter of the protein, and identifying the sample as positive for cancer if the parameters of at least one of the nucleic acids and the protein present in the sample are greater than their respective threshold parameters. In certain aspects of the invention, the nucleic acids include FGFR3, TWIST1, and NID2. In certain aspects of the invention, the protein includes MMP2 or MMP9. | 10-04-2012 |
20120252020 | Screening Assay for Bladder Cancer - The present invention generally relates to methods of screening for cancer. Methods of the invention involve identifying a threshold parameter of a protein and of two or more nucleic acids, where the threshold parameters are indicative of the absence of cancer, conducting an assay in a sample to determine a parameter of the two or more nucleic acids and a parameter of the protein, and identifying the sample as positive for cancer if the parameters of at least one of the nucleic acids and the protein present in the sample are greater than their respective threshold parameters. In certain aspects of the invention, the nucleic acids include FGFR3, p53, TWIST1, Vimentin, and NID2. In certain aspects of the invention, the protein includes MMP2 or MMP9. | 10-04-2012 |
20120252021 | DOPAMINERGIC NEURON PROGENITOR CELL MARKER 187A5 - An object of the present invention is to provide a probe, a primer, a primer set and an antibody for use in the detection or selection of a dopaminergic neuron progenitor cell. The present invention provides a probe, a primer and a primer set for use in the detection or selection of a mesencephalon dopaminergic neuron progenitor cell, and preferably a dopaminergic neuron proliferative progenitor cell, which can hybridize with a nucleotide sequence of a 187A5 gene, or a complementary sequence thereto, and an antibody for use in the detection or selection of a mesencephalon dopaminergic neuron progenitor cell, and preferably a dopaminergic neuron progenitor cell, which is capable of binding to a 187A5 protein. | 10-04-2012 |
20120252022 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF THYROID CANCER - Methods for detecting, diagnosing and monitoring thyroid cancer in a subject are described comprising measuring in a sample from the subject markers including Ep-ICD and β-catenin. The invention also provides kits and compositions for carrying out the methods of the invention. | 10-04-2012 |
20120252023 | Materials and Methods Useful for Affecting Tumor Cell Growth, Migration and Invasion - It is disclosed herein that miR-221 and miR-222 down-regulate PTEN and TIMP3 tumor suppressors, resulting in TRAIL resistance. The present invention provides research, diagnostic, and therapeutic tools and methods related to this discovery. Diagnostics, prognostics and treatments for human hepatocellular cancer and non-small cell lung carcinoma having a TRAIL resistance are particularly described herein. | 10-04-2012 |
20120252024 | Probe for Detection of Polymorphism in C-Kit Gene and Use Thereof - The present invention provides probes that can identify different polymorphisms in a c-kit gene easily with high reliability and use thereof. | 10-04-2012 |
20120258453 | NUCLEIC ACID PROBE-BASED DIAGNOSTIC ASSAYS TARGETING SSRA GENES OF PROKARYOTIC AND EUKARYOTIC ORGANISMS - Use of the ssrA gene or tmRNA, an RNA transcript of the ssrA gene, or fragments thereof as target regions in a nucleic acid probe assay for the detection and identification of prokaryotic and/or eukaryotic organisms is described. Nucleotide sequence alignment of tmRNA sequences from various organisms can be used to identify regions of homology and non-homology within the sequences which in turn can be used to design both genus specific and species specific oligonucleotide probes. These newly identified regions of homology and non-homology provide the basis of identifying and detecting organisms at the molecular level. Oligonucleotide probes identified in this way can be used to detect tmRNA in samples thereby giving an indication of the viability of non-viral organisms present in various sample types. | 10-11-2012 |
20120258454 | Bisulfite conversion of DNA - The present invention relates to an improved method for the bisulfite conversion of DNA. In certain time-temperature ranges the efficacy of the bisulfite conversion is clearly improved. By combination with denaturating solvents, new reaction conditions and new purification methods the efficacy can be further increased The converted DNA can subsequently be analysed by different methods. The present invention facilitates the analysis of cytosine methylation. | 10-11-2012 |
20120258455 | RNase H-Based Assays Utilizing Modified RNA Monomers - The present invention provides methods of cleaving a nucleic acid strand to initiate, assist, monitor or perform biological assays. | 10-11-2012 |
20120258456 | MONITORING RECOMBINASE POLYMERASE AMPLIFICATION MIXTURES - A process includes providing a mixture that includes a recombinase, a single-strand binding protein, and one or more oligonucleotides; and detecting particles in the reaction mixture. | 10-11-2012 |
20120258457 | Methods for Detection of a Single- or Double-Stranded Nucleic Acid Molecule - The present invention is related to a method for the detection of a nucleic acid molecule comprising at least a strand comprising a sequence of nucleotides in a sample, whereby the method comprises the following steps: providing a sample containing the nucleic acid molecule; providing a capture probe, whereby the capture probe is at least partially complementary to a part of the nucleic acid molecule; allowing the capture probe to react with the nucleic acid molecule or a part thereof; and detecting whether or not the capture probe is hybridized to the nucleic acid molecule or part thereof. | 10-11-2012 |
20120258458 | INTERFERON-LIKE PROTEIN ZCYTO21 - The present invention relates to polynucleotide and polypeptide molecules for Zcyto21, an interferon-like protein, which is most closely related to interferon-α at the amino acid sequence level. The present invention also includes antibodies to the Zcyto21 polypeptides, and methods of using the polynucleotides and polypeptides. | 10-11-2012 |
20120258459 | SYSTEM AND METHOD FOR PARTICLE FILTRATION - Embodiments of the present disclosure feature a filtration system comprising a filtration module for particle filtration and methods of using the device for the isolation of particles (e.g., viable cells). Advantageously, embodiments of the device provide for the high throughput filtration of large volumes of sample while preserving cell viability and. providing high yields. | 10-11-2012 |
20120264119 | NEW METHOD FOR DECONTAMINATION AND PROCESSING OF CLINICAL SPECIMENS FROM A PATIENT - The present invention relates to a new method for decontaminating and processing clinical samples suspected of containing | 10-18-2012 |
20120264120 | SPECIMEN FOR DETECTING INFILTRATIVE LARGE INTESTINE TUMORS - An object of the present invention is to provide a method for non-invasively diagnosing invasiveness or degree of invasion of colorectal tumors. | 10-18-2012 |
20120264121 | RESOLVING GENOME FRACTIONS USING POLYMORPHISM COUNTS - Methods of reliably estimating genomic fraction (e.g., fetal fraction) from polymorphisms such as small base variations or insertions-deletions are disclosed. Sequenced data from a multigenomic source is used to determine allele counts for one or more of the polymorphisms. For one or more of the polymorphisms, zygosity is assigned, and genomic fraction is determined from the zygosity and allele counts. Certain embodiments employ SNPs as the relevant polymorphism. The disclosed methods can be applied as part of an intentional, pre-designed re-sequencing study targeted against known polymorphisms or can be used in a retrospective analysis of variations found by coincidence in overlapping sequences generated from maternal plasma (or any other setting where a mixture of DNA from several people are present). | 10-18-2012 |
20120264122 | METHODS AND COMPOSITIONS FOR NUCLEIC ACID AMPLIFICATION - Compositions that are used in nucleic acid amplification in vitro are disclosed, which include a target specific universal (TSU) promoter primer or promoter provider oligonucleotide that includes a target specific (TS) sequence that hybridizes specifically to a target sequence that is amplified and a universal (U) sequence that is introduced into the sequence that is amplified, by using a primer for the universal sequence. Methods of nucleic acid amplification in vitro are disclosed that use one or more TSU oligonucleotides to attached a U sequence to a target nucleic acid in a target capture step and then use a primer for a U sequence in subsequent amplification steps performed in substantially isothermal conditions to make amplification products that contain a U sequence that indicates the presence of the target nucleic acid in a sample. | 10-18-2012 |
20120264123 | Extracellular Serine Protease - The present invention provides a DNA encoding a novel extracellular serine protease termed Tumor Antigen Derived Gene-14 (TADG-14) which is overexpressed in ovarian, breast and colon carcinoma samples. Also provided are vector and host cells capable of expressing the DNA of the present invention, as well as the uses of the DNA and protein of the present invention. Also provided is a TADG-14 protein variant that has a potential role for detecting and targeting of ovarian carcinomas. | 10-18-2012 |
20120264124 | MICROSATELLITE MARKER COMBINATION AND METHOD FOR IDENTIFYING LANYU PIG BREED - The present invention provides a microsatellite marker combination for identifying Lanyu pig breed, and the identification method thereof. The identification method comprises the following steps: (a) providing a genomic DNA sample obtained from a pig; (b) identifying the polymorphism of microsatellite markers of said genomic DNA sample; and (c) analyzing the results obtained from step (b) to determine the phylogenetic relationship between said pig and Lanyu pig. | 10-18-2012 |
20120264125 | SCREENING METHOD FOR TRINUCLEOTIDE REPEAT SEQUENCES - A method for screening for a trinucleotide repeat sequence in a biological sample is provided. The method comprises the step of contacting a nucleic acid sequence obtained or derived from the biological sample under amplification conditions with i) a first primer having a target sequence in a region 3′ or 5′ of a trinucleotide repeat sequence; ii) a second primer having a target sequence within the trinucleotide repeat sequence and a unique 5′ tail sequence; and iii) a third primer, having a target within the unique 5′ tail sequence of the second primer to generate an amplified product comprising a trinucleotide repeat sequence. Primers, kits of primers together with the use of the primers in methods of screening are also provided. | 10-18-2012 |
20120264126 | METHODS FOR THE DIAGNOSIS OF BACTERIAL VAGINOSIS - The present invention relates to methods for the diagnosis of bacterial vaginosis based on an analysis of a patient sample. For example, patient test samples are analyzed for the presence or absence of one or more lactobacilli and two or more pathogenic organisms. The presence or absence of one or more lactobacilli and two or more pathogenic organisms may be detected using PCR analysis of nucleic acid segments corresponding to each target organism. The quantity of the target organisms can then be used to determine a score which is indicative of a diagnosis of bacterial vaginosis. | 10-18-2012 |
20120264127 | SIMULTANEOUS DETECTION OF MUTATIONAL STATUS AND GENE COPY NUMBER - The present invention provides compositions and methods for simultaneously detecting mutational status and gene copy number. In particular, the present invention provides simultaneous measurement of gene copy number and detection of the L858R and Exon 19 del mutations in a tissue sample. | 10-18-2012 |
20120264128 | METHOD FOR QUALITATIVE AND QUANTITATIVE DETECTION OF COMMON WHEAT - Disclosed are: a method for detecting common wheat among from wheat varieties contained in a sample of interest such as a food raw material or a processed food specifically, with high sensitivity, and in a qualitative and/or quantitative manner; a method for discriminating between common wheat and a wheat variety other than common wheat (e.g., durum wheat) contained in a food raw material or a processed food and detecting the common wheat in a qualitative and/or quantitative manner; and a primer set, a nucleic acid probe, and a detection kit, each of which can be used in the methods employing a PCR method. Specifically disclosed are: a method for detecting the occurrence of common wheat in a sample of interest, which comprises carrying out a PCR method using a nucleic acid extracted from the sample as a template and using a primer comprising the nucleotide sequence represented by SEQ ID NO:5 and a primer comprising the nucleotide sequence represented by SEQ ID NO:6 and detecting the occurrence of a PCR amplification product; and a method for detecting the occurrence of common wheat in a sample of interest, which comprises carrying out a quantitative PCR method using a nucleic acid extracted from the sample as a template and using a primer comprising the nucleotide sequence represented by SEQ ID NO:5, a primer comprising the nucleotide sequence represented by SEQ ID NO:6 and a nucleic acid probe comprising the nucleotide sequence represented by SEQ ID NO:11 and detecting the occurrence of common wheat qualitatively and/or quantitatively. | 10-18-2012 |
20120264129 | K-ras Mutations and Anti-EGFr Antibody Therapy - The present application relates to K-ras mutations, to polynucleotides encoding mutant K-ras polypeptides, and to methods of identifying K-ras mutations. The present application also relates to methods of diagnosing cancer; and methods and kits for predicting the usefulness of anti-EGFr specific binding agents in the treatment of tumors. | 10-18-2012 |
20120264130 | CORN EVENT MIR162 - A novel transgenic corn event designated MIR162 is disclosed. The invention relates to nucleic acids that are unique to event MIR162 and to methods for detecting the presence of the MIR162 event based on DNA sequences of the recombinant constructs inserted into the corn genome that resulted in the MIR162 event and of genomic sequences flanking the insertion site. The invention further relates to corn plants comprising the transgenic genotype of MIR162 and to methods for producing a corn plant by crossing a corn plant comprising the MIR162 genotype with itself or another corn variety. Seeds of corn plants comprising the MIR162 genotype are also objects of the present invention. The invention also relates to methods of controlling insects using MIR162 corn plants. | 10-18-2012 |
20120270212 | Methods for Non-Invasive Prenatal Ploidy Calling - The present disclosure provides methods for determining the ploidy status of a chromosome in a gestating fetus from genotypic data measured from a mixed sample of DNA comprising DNA from both the mother of the fetus and from the fetus, and optionally from genotypic data from the mother and father. The ploidy state is determined by using a joint distribution model to create a plurality of expected allele distributions for different possible fetal ploidy states given the parental genotypic data, and comparing the expected allelic distributions to the pattern of measured allelic distributions measured in the mixed sample, and choosing the ploidy state whose expected allelic distribution pattern most closely matches the observed allelic distribution pattern. The mixed sample of DNA may be preferentially enriched at a plurality of polymorphic loci in a way that minimizes the allelic bias, for example using massively multiplexed targeted PCR. | 10-25-2012 |
20120270213 | SCREENING METHOD FOR CELL AGING - The present invention relates to a method for increasing the chronological lifespan of a cell comprising disrupting the function of at least one of the SAGA1 SLIK and/or SALSA complexes in said cell. | 10-25-2012 |
20120270214 | METHODS FOR LOCALIZED IN SITU DETECTION OF mRNA - The present invention relates to the detection of RNA in a sample of cells. More particularly, the present invention relates to the localized detection of RNA in situ. The method relies on the conversion of RNA to complementary DNA prior to the targeting of the cDNA with a padlock probe(s). The hybridization of the padlock probe(s) relies on the nucleotide sequence of the cDNA which is derived from the corresponding nucleotide sequence of the target RNA. Rolling circle amplification of the subsequently circularized padlock probe produces a rolling circle product which may be detected. Advantageously, this allows the RNA to be detected in situ. | 10-25-2012 |
20120270215 | PROBE FOR DETECTING POLYMORPHISM IN CYP3A GENE, METHOD OF DETECTING POLYMORPHISM, METHOD OF EVALUATING DRUG EFFICACY, AND REAGENT KIT FOR DETECTING POLYMORPHISM - Provided in the present disclosure is a probe for detecting polymorphism that enables a simple detection of polymorphism in the CYP3A gene with high sensitivity. | 10-25-2012 |
20120270216 | COMPOSITIONS AND METHODS FOR DETECTING AND IDENTIFYING SALMONELLA ENTERICA STRAINS - The present specification describes several novel SNPs of | 10-25-2012 |
20120270217 | RESTRICTION ENDONUCLEASE ENHANCED POLYMORPHIC SEQUENCE DETECTION - Provided in part herein is an improved method for the detection of specific polymorphic alleles in a mixed DNA population. The method comprises enriching the relative percentage of a given polymorphic allele that is exponentially amplifiable by PCR. Provided also are methods for selectively enriching target nucleic acid, for example, fetal nucleic acid in a maternal sample. In the case of detecting fetal nucleic acid in a maternal sample, a restriction enzyme is introduced that can discriminate between the alleles of a polymorphic site. In some embodiments, the maternal allele is digested and nucleic acid comprising the paternal allele is relatively enriched. | 10-25-2012 |
20120270218 | Method for analyzing cervical lymph node metastasis, and tumor marker for head and neck cancer - Provided are a method for analyzing metastasis of head and neck cancer to a cervical lymph node, and a tumor marker for head and neck cancer used therein. Specifically, provided is a method for analyzing metastasis of head and neck cancer to a cervical lymph node, involving: measuring an expression level of at least one gene selected from the group consisting of genes represented by SEQ ID NOS: 1 to 36 in the sequence listing in a cervical lymph node sample; and comparing the aforementioned expression level with a reference value. Also provided is a tumor marker for head and neck cancer used in the aforementioned method for analyzing cervical lymph node metastasis, including at least one gene selected from the group consisting of genes represented by SEQ ID NOS: 1 to 36 in the sequence listing, and/or an expression product of the aforementioned gene and/or an expression level thereof. | 10-25-2012 |
20120270219 | NOVEL GENES ENCODING PROTEINS HAVING PROGNOSTIC, DIAGNOSTIC, PREVENTIVE, THERAPEUTIC, AND OTHER USES - The invention provides isolated TANGO 509 nucleic acid molecules and polypeptide molecules. The invention also provides antisense nucleic acid molecules, expression vectors containing the nucleic acid molecules of the invention, host cells into which the expression vectors have been introduced, and non-human transgenic animals in which a nucleic acid molecule of the invention has been introduced or disrupted. The invention still further provides isolated polypeptides, fusion polypeptides, antigenic peptides and antibodies. Diagnostic, screening and therapeutic methods utilizing compositions of the invention are also provided. | 10-25-2012 |
20120270220 | DETECTION OF NUCLEIC ACID SEQUENCE DIFFERENCES USING COUPLED LIGASE DETECTION AND POLYMERASE CHAIN REACTIONS - The present invention relates to a method for identifying a target nucleotide sequence. This method involves forming a ligation product on a target nucleotide sequence in a ligation detection reaction mixture, amplifying the ligation product to form an amplified ligation product in a polymerase chain reaction (PCR) mixture, detecting the amplified ligation product, and identifying the target nucleotide sequence. Such coupling of the ligase detection reaction and the polymerase chain reaction permits multiplex detection of nucleic acid sequence difference. | 10-25-2012 |
20120276528 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 11-01-2012 |
20120276529 | MUTATED SUMO ISOFORMS AND USES THEREOF - Disclosed herein are substantially pure nucleic acids encoding mutated SUMO isoforms, polypeptides, vectors, cells and methods of their use to identify and quantify protein SUMOylation in mammalian cells. Also disclosed is a dual affinity method for detecting a mutated SUMOylated protein substrate fragment. | 11-01-2012 |
20120276530 | LABEL-FREE SENSING OF PNA-DNA COMPLEXES USING NANOPORES - Embodiments disclosed herein relate to a method of detecting specific DNA sequences and the application of this method in the detection of pathogens, viruses, drug-resistant pathogens, genomic variations associated with disease/disorder susceptibility etc. based on specific signature sequences unique to the pathogens, viruses, drug-resistant pathogens or genomic variations. The method can also be used to distinguish a pool of same-sized dsDNA on the basis of sequence differences. The method uses non-optically labeled bis-PNA and/or gamma-PNA probes to tag specific target sequences for identification by solid-state nanopores. | 11-01-2012 |
20120276531 | GENES FOR PROGNOSIS OF CANCER - To provide a novel method for determining the risk of lymph node metastasis of breast cancer uses as an index the difference in the expression levels of marker genes in at least one material selected from the group consisting of a breast tissue and a breast cell of a patient. The method includes measuring an expression level of a marker gene in at least one material selected from the group consisting of a breast tissue and a breast cell of a patient with breast cancer, and determining the risk of lymph node metastasis of breast cancer in the patient using the expression level of the marker gene as an index. | 11-01-2012 |
20120276532 | SAMPLE PROCESSING DEVICE FOR PRETREATMENT AND THERMAL CYCLING - A sample processing device may include an opening, a sample pretreatment unit, a thermal cycling reaction unit, and a detection unit. | 11-01-2012 |
20120276533 | Method for Simultaneously Detecting Polymorphisms of Acetaldehyde Dehydrogenase 2 and Alcohol Dehydrogenase 2 - A probe for detection of at least 1 type of genetic polymorphism of the ALDH2 gene rs671 and the ADH2 gene rs1229984, a kit therefore, and methods of detecting the polymorphism(s). | 11-01-2012 |
20120276534 | Probe for Detecting Polymorphism in Exon 12 of NPM1 Gene and Use Thereof - The present invention relates to probes which detect a polymorphism(s) in exon 12 of the NPM1 gene, a kit therefor, and the method of detecting the polymorphism(s) thereof. | 11-01-2012 |
20120276535 | METHOD FOR THE DIAGNOSIS OF LIMBAL STEM CELL DEFICIENCY - The invention relates to a method for the diagnosis of limbal stem cell deficiency (LSCD) in a subject, based on detecting or quantifying the expression of the MUC5AC gene in a cornea sample from said subject. | 11-01-2012 |
20120276536 | Hair Shape Susceptibility Gene - A genetic polymorphism and a hair shape susceptibility gene that are related to hair shape, and a method for determining the genetic susceptibility to hair shape in individual test subjects are provided. Disclosed is a hair shape susceptibility gene, which overlaps with a haplotype block in in the 11q12.2 to 11q13.2 region (D11S4191 and D11S987) of human chromosome 11 and comprises a portion or the entirety of the base sequence of the haplotype block, wherein the haplotype block is determined by a linkage disequilibrium analysis conducted on a single nucleotide polymorphism (SNP) marker whose allele frequency differs statistically significantly between a group having a curly hair trait and a group having a non-curly hair trait, and consists of a base sequence set forth in any one of SEQ ID NO: 1 to NO: 5. | 11-01-2012 |
20120276537 | HOMOLOGOUS RECOMBINATION IN THE OOCYTE - The present invention relates to a method of modifying a target sequence in the genome of a mammalian or avian oocyte by homologous recombination with a donor nucleic acid sequence, the method comprising the steps (a) introducing into the oocyte a zinc finger nuclease or a nucleic acid molecule encoding the zinc finger nuclease in expressible form, wherein the zinc finger nuclease specifically binds within the target sequence and introduces a double strand break within the target sequence; and (b) introducing a nucleic acid molecule into the oocyte, wherein the nucleic acid molecule comprises the donor nucleic acid sequence and regions homologous to the target sequence. The present invention further relates to a method of producing a non-human mammal or an avian carrying a modified target sequence in its genome. | 11-01-2012 |
20120276538 | SEQUENCE-SPECIFIC METHODS FOR HOMOGENEOUS, REAL-TIME DETECTION OF LAMP PRODUCTS - Presented herein are methods and compositions for generating sequence-specific, secondary amplification products during Loop-mediated Isothermal Amplification (LAMP). Conventional LAMP produces a preponderance of high molecular weight DNA structures concatenated into self-complementary hairpins, which are not amenable to detection by routine probe-based hybridization methods, making multiplex detection of two or more targets or sequence variants in closed-tube formats extremely difficult. Provided herein, for example, are methods for generating secondary LAMP products bearing a fragment of the original target sequence embedded within low-molecular weight products that are devoid of competitive hairpin structures, the lack of which enhances probe-based detection of target sequences. These secondary products can, for example, be produced in real-time, during the LAMP process, and can provide the option of detecting multiple target sequences within a single tube using, e.g., a homogenous, real-time fluorescence format. | 11-01-2012 |
20120276539 | USE OF METASTASIS PROGRESSOR S100A4 TRANSCRIPTS IN BODY FLUIDS OF COLORECTAL AND GASTRIC CANCER PATIENTS - Transcript quantification of the metastasis progressor S100A4 is performed in body fluids. Methods, assays and kits relying on this quantification are disclosed that have diagnostic and/or prognostic applications in colorectal and gastric cancer patients. | 11-01-2012 |
20120276540 | METHOD AND PROBE SET FOR DETECTING CANCER - Methods for detecting cancer that include hybridizing a set of chromosomal probes to a biological sample obtained from a patient, and identifying if aneusomic cells are present in a selected subset of cells obtained from the biological sample are described. A set of chromosomal probes and kits for detecting cancer that include sets of chromosomal probes, are also described. | 11-01-2012 |
20120282604 | Copy Number Variation Determination, Methods and Systems - The present invention methods and systems for determining copy number variation of a target polynucleotide in a genome of a subject including amplification based techniques. Methods can include pre-amplification of the sample followed by distribution of sample and a plurality of reaction volumes, quantitative detection of a target polynucleotide and a reference polynucleotide, and analysis so as to determine the relative copy number of the target polynucleotide sequence in the genome of the subject. | 11-08-2012 |
20120282605 | PROCESS CONTROLS FOR MOLECULAR ASSAY - A full process control for use with a molecular assay and a method of determine the efficacy of the molecular assay. A full process control can include a fixed cell, and specifically can include a fixed vegetative cell. A method of determining the efficacy of a molecular assay can include providing an internal control, mixing the internal control with a sample, lysing the internal control and the sample, and detecting the lysis product. The full process control and/or the internal control can be | 11-08-2012 |
20120282606 | METHOD, KITS AND REACTION MIXTURES FOR HIGH RESOLUTION MELT GENOTYPING - Various methods are described that provide for high resolution melt (HRM) genotyping. Some embodiments comprise providing a locus specific primer, and two allele specific primers each comprising at least one single nucleotide polymorphism (SNP) allele-hybridizable sequence, wherein at least one of the allele specific primers also comprises at least one nucleotide alteration. In some embodiments, a nucleic acid is provided comprising a SNP base located within 1-20 bases of its 3′ end. Some embodiments comprise hybridizing the locus specific primer and at least one of the allele specific primers to the nucleic acid, amplifying the hybridized nucleic acid using pyrophosphorolysis activated polymerization (PAP) PCR, and determining the melting temperature (Tm) of the resulting amplicons, for example, using HRM. In some embodiments, reaction mixtures and kits for HRM genotyping are provided. | 11-08-2012 |
20120282607 | Probe, Polymorphism Detection Method, Method of Evaluating Drug Efficacy or Tolerance, Disease Prediction Method and Reagent Kit - A probe for detecting polymorphism in the ABCG2 gene is constituted by including, for example, an oligonucleotide which is complementary to a base sequence including the 301st to the 311th bases of the base sequence indicated in SEQ ID NO:1 and having a length of from 11 bases to 50 bases, and has an identity of at least 80%, and in which a base corresponding to the 311th base has been labeled with a fluorescent dye. | 11-08-2012 |
20120282608 | Probe, Polymorphism Detection Method, Method of Evaluating Drug Efficacy or Tolerance, and Reagent Kit - A probe for detecting polymorphism in the ABCC2 gene is constituted by including, for example, an oligonucleotide which is complementary to a base sequence including the 207th to the 217th bases of the base sequence indicated in SEQ ID NO:1 and having a length of from 11 bases to 60 bases, and has an identity of at least 80%, and in which a base corresponding to the 217th base has been labeled with a fluorescent dye. | 11-08-2012 |
20120282609 | Gene Mutation Detection Probe - A gene mutation detection probe for detection of a target gene mutation in a base sequence encoding a gene of interest that includes the target gene mutation and a non-target gene mutation, the probe including at least one oligonucleotide selected from the group consisting of oligonucleotides P1, P1-1, P1′, and P 1′-1. For example, the P1 oligonucleotide is an oligonucleotide that has, at a base position corresponding to the target gene mutation, a base complementary to either a wild-type base or a mutant base of the target gene mutation, and has, at a base position corresponding to the non-target gene mutation, a base complementary to neither a wild-type base nor a mutant base of the non-target gene mutation, and has an identity of at least 80% with a base sequence complementary to a part or an entirety of the base sequence encoding the gene of interest | 11-08-2012 |
20120282610 | Oligonucleotides for Detection Test of Polymorphism of EGFR Exon 19 and Use Thereof - An oligonucleotide for a detection test of a polymorphism of EGFR exon 19, the oligonucleotide being at least one selected from the group consisting of a P1 oligonucleotide and a P1′ oligonucleotide, the P1 oligonucleotide having a 3′ end subjected to an extension inhibition treatment, which has an identity of at least 80% with respect to a base sequence including at least the 115th to the 123rd bases of the base sequence indicated in SEQ ID NO: 1 and has a length of from 9 to 80 bases; and the P1′ oligonucleotide having a 3′ end subjected to an extension inhibition treatment, which hybridizes under stringent conditions with a complementary strand of a base sequence including at least the 115th to the 123rd bases of the base sequence indicated in SEQ ID NO: 1 and having a length of from 9 to 80 bases. | 11-08-2012 |
20120282611 | METHODS, KITS AND REACTION MIXTURES FOR ANALYZING SINGLE-STRANDED NUCLEIC ACID SEQUENCES - Provided herein are fluorescence detection methods for nucleic acid sequences and to kits for performing such methods. | 11-08-2012 |
20120282612 | METHOD FOR ANALYZING PSA, AND A METHOD FOR DISTINGUISHING PROSTATE CANCER FROM PROSTATIC HYPERTROPHY USING THAT METHOD FOR ANALYZING PSA - A method for distinguishing prostate cancer from prostatic hypertrophy using the method for analyzing PSA and an analysis kit of PSA are provided. | 11-08-2012 |
20120282613 | METHODS AND COMPOSITIONS FOR NONINVASIVE PRENATAL DIAGNOSIS OF FETAL ANEUPLOIDIES - The invention provides methods and compositions for noninvasive prenatal diagnosis of fetal aneuploidies. A large panel of differentially methylated regions (DMRs) have been identified. Certain of these DMRs are hypomethylated in adult female blood DNA and hypermethylated in fetal DNA, whereas others are hypermethylated in adult female blood DNA and hypomethylated in fetal DNA. Moreover, DMRs that are hypomethylated in adult female blood DNA and hypermethylated in fetal DNA have been shown to accurately predict a fetal aneuploidy in fetal DNA present in a maternal blood sample during pregnancy. In the methods of the invention, hypermethylated DNA is physically separated from hypomethylated DNA, preferably by methylated DNA immunoprecipitation. | 11-08-2012 |
20120282614 | METHODS AND NUCLEIC ACIDS FOR THE DETECTION OF METASTASIS OF COLON CELL PROLIFERATIVE DISORDERS - The invention provides methods, nucleic acids and kits for detecting metastasis of colon cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of metastasis of colon cell proliferative disorders, thereby enabling the improved diagnosis and treatment of patients. | 11-08-2012 |
20120282615 | METHODS OF SCREENING FOR COMPOUNDS FOR USE AS MODULATORS OF LEFT-RIGHT ASYMMETRY IN SCOLIOTIC SUBJECTS AND FOR MONITORING EFFICACY OF AN ORTHOPAEDIC DEVICE - A method of screening for a compound for treating or preventing adolescent idiopathic scoliosis (AIS), said method comprising: (a) contacting a test compound with a paraspinal skin fibroblast or a paraspinal muscle cell sample from the right and/or left side of the spine of a subject; and (b) determining at least one of Nodal, Notch1, Pitx2, Lefty1 and Lefty2's expression and/or activity in the cell sample; wherein the test compound is selected as potentially useful in treating or preventing AIS if at least one of Nodal, Notch1, Pitx2, Lefty1 and Lefty2's expression and/or activity in the cell sample is different in the presence of the test compound as compared to in the absence thereof. | 11-08-2012 |
20120288856 | MOLECULAR SEXING OF AVIAN SUBJECTS - The present invention provides oligonucleotides including amplification primers and probes as well as pairs of said oligonucleotides that are useful in methods and uses for the determination of the sex of an avian subject. Similarly, these oligonucleotides can be used for the preparation of a kit for the determination of the sex of an avian subject. Also, the present invention provides a method for the identification of a pair of oligonucleotides for sexing of an avian subject and a kit comprising such oligonucleotides. | 11-15-2012 |
20120288857 | MULTIFUNCTIONAL PROBE-PRIMERS - Methods and reagents for detection and analysis of nucleic acids are provided. Certain methods involves an encoding amplification in which a target sequence is associated with probe-binding sequences and optionally with indexing sequences, (2) an optional distribution step in which the product of the encoding amplification is split into multiple aliquots, and (3) a decoding and detection step in which the presence, absence, quantity, or relative amount of the target sequence in the aliquots is determined. The detection step makes use of a multifunctional “self-digesting” molecular probe comprising a primer polynucleotide and a probe oligonucleotide, linked in a 5′-5′ orientation. | 11-15-2012 |
20120288858 | ASSESSING SMALL CELL LUNG CANCER OUTCOMES - This document provides methods and materials involved in assessing lung cancer (e.g., SCLC). For example, methods and materials for identifying a mammal having lung cancer (e.g., SCLC) as being susceptible to a poor outcome are provided. | 11-15-2012 |
20120288859 | Probe for Detecting Poly A Repeat Number Polymorphism of HGF Gene and Uses Thereof - The present disclosure relates to probes for detecting a polymorphism of HGF gene. | 11-15-2012 |
20120288860 | DIFFERENTIAL GENE EXPRESSION FOR DETECTING AND/OR DIFFERENTIATING LUNG DISEASE - Disclosed herein are methods, constructs, kits, and the like, which can be used for detecting and/or differentiating interstitial lung disease. For example, idiopathic pulmonary fibrosis (IPF) and nonspecific interstitial pneumonia (NSIP) can be detected and/or differentiated using at least one biomarker. | 11-15-2012 |
20120288861 | GERMLINE POLYMORPHISMS IN THE SPARC GENE ASSOCIATED WITH CLINICAL OUTCOME IN GASTRIC CANCER - This disclosure provides compositions and methods for determining the likely tumor recurrence of gastric cancer patients based on genomic polymorphisms of the SPARC gene. The disclosure also provides compositions and methods for selecting gastric cancer patients for appropriate treatments and methods of treating them. | 11-15-2012 |
20120288862 | KITS FOR QUANTITATIVE DETECTION OF K-RAS MUTATIONS - The present invention relates to an assay kit for quantitatively detecting k-ras gene mutations. Particularly, the present invention relates to detection method and a detection kit for K-ras gene mutations, which relates to the therapeutic efficacy of targeted molecular anti-cancer drugs. More particularly, the present invention relates to a fluorescent quantitative PCR method and kit for detecting mutations at hotspots of K-ras gene, together with the use thereof. The present invention detects the mutations at specific sites of K-ras gene, and can predict the therapeutic efficacy of anti-EGFR tyrosine kinase inhibitors. Therefore, it can provide a guidance to individualized treatments for cancer patients. | 11-15-2012 |
20120288863 | Oligonucleotides and methods for detecting KRAS and PIK3CA mutations - Provided are oligonucleotides that are capable of detecting KRAS and PIK3CA mutations in both cancer patients and healthy individuals with high specificity in kPCR assays. When the oligonucleotides are used as forward primers in conjunction with a defined genotyping algorithm spreadsheet, the primers are capable of enhancing detection of KRAS codon 12, 13, and 61 and PIK3CA codon 542, 545, and 1047 single nucleotide polymorphisms (SNPs) in a background of wild-type sequences. The oligonucleotides of the present invention are also capable of preventing pseudogene amplification when the oligonucleotides are hybridized as reverse primers or detection probes to the mismatch sequences. | 11-15-2012 |
20120288864 | DETECTION OF SALMONELLA BY REAL-TIME MULTIPLEX PCR - The invention relates to the detection of | 11-15-2012 |
20120295254 | PNA PROBES, MIXTURES, METHODS AND KITS PERTAINING TO THE DETERMINATION OF MYCOPLASMA AND RELATED MOLLICUTES - This invention is related to PNA probes, probe sets, mixtures, methods and kits pertaining to the determination of | 11-22-2012 |
20120295255 | METHOD FOR HIGH RESOLUTION MELT GENOTYPING - Various methods are described that provide for high resolution melt (HRM) genotyping. The embodiments include providing a locus specific primer and two allele specific primers each having a 5′ end with a short tail, providing a nucleic acid having a single nucleotide polymorphism (SNP) base located within 1-20 base pairs of the 3′ end of nucleic acid, hybridizing the locus specific primer and the allele specific primers to the nucleic acid, amplifying the sample using pyrophosphorolysis activated polymerization (PAP) PCR enzyme, and determining the Tm of the amplicons using HRM. In other embodiments, reactions mixtures and kits for HRM genotyping are provided and disclosed. These kits comprise a locus specific primer, one or more allele specific primers each having a 5′ end with a short tail, a nucleic acid, and a pyrophosphorolysis activate polymerization (PAP) PCR enzyme. | 11-22-2012 |
20120295256 | WEIGHT MANAGEMENT GENETIC TEST SYSTEMS AND METHODS - Disclosed herein is a nutritional genomic weight management algorithm running on a computer system, and more specifically, a nutritional genomic weight management algorithm where an analysis of a customer's unique DNA results in individualized diet and exercise plans, in accordance with the present invention. Methods of weight management, weight management business methods, and panels of alleles for nutritional genomics are also disclosed. | 11-22-2012 |
20120295257 | METHOD, MICROCHIP AND MIXED REAGENT FOR ANALYSIS OF NUCLEIC ACID BASE SEQUENCE - A technology is provided for achieving high efficiency of nucleic acid amplification reaction and high precision of melting curve analysis when performing melting curve analysis in a nucleic acid amplification process of obtaining an amplification product in which the target nucleic acids are continuously arranged via a loop. A method for analysis of nucleic acid base sequence is provided, and includes: performing amplification reaction of target nucleic acid which is targeted for amplification, in presence of a probe nucleic acid that is capable of hybridizing with the target nucleic acid, to obtain an amplification product in which the target nucleic acids are continuously arranged via a loop site and employing as the probe nucleic acid, a probe nucleic acid having a melting temperature which is lower than the reaction temperature of the amplification reaction; and performing melting curve analysis of the amplification product and the probe nucleic acid. | 11-22-2012 |
20120295258 | UTILITY OF B-RAF DNA MUTATION IN DIAGNOSIS AND TREATMENT OF CANCER - The present invention discloses a method of detecting a wild-type or mutant B-RAF gene in a body fluid sample from a subject. Also disclosed are methods of using B-RAF as a biomarker for detecting cancer, predicting the outcome of cancer, and monitoring the treatment of cancer or the status of cancer. Furthermore, the invention discloses methods and compositions for detecting a mutant gene with a peptide nucleic acid clamp capable of hybridizing to a wild-type gene and a locked nucleic acid probe capable of hybridizing to a mutant of the gene. | 11-22-2012 |
20120295259 | Methods for Determining the Likelihood of Survival and for Predicting Likelihood of Metastasis in Cancer Patients - The present invention relates generally to methods of accurately quantifying HER2 and/or p95 expression in subjects with a HER2 positive cancer and indicating the risk of brain relapse in such patients. | 11-22-2012 |
20120295260 | METHODS FOR ACCURATE SEQUENCE DATA AND MODIFIED BASE POSITION DETERMINATION - Disclosed herein are methods of determining the sequence and/or positions of modified bases in a nucleic acid sample present in a circular molecule with a nucleic acid insert of known sequence comprising obtaining sequence data of at least two insert-sample units. In some embodiments, the methods comprise obtaining sequence data using circular pair-locked molecules. In some embodiments, the methods comprise calculating scores of sequences of the nucleic acid inserts by comparing the sequences to the known sequence of the nucleic acid insert, and accepting or rejecting repeats of the sequence of the nucleic acid sample according to the scores of one or both of the sequences of the inserts immediately upstream or downstream of the repeats of the sequence of the nucleic acid sample. | 11-22-2012 |
20120295261 | METHOD FOR THE IN VITRO DIAGNOSIS OF BRONCHOPULMONARY CARCINOMA BY DETECTION OF MAJOR ALTERNATIVE TRANSCRIPTS OF THE KLK8 GENE ENCODING KALLICREIN 8 AND USE THEREOF FOR PROGNOSTICATING SURVIVAL - A method for the in vitro diagnosis of bronchopulmonary carcinoma, in particular of non-small cell bronchial carcinoma, that includes a stage of detecting, in a biological sample derived from a patient suspected to be suffering from bronchopulmonary carcinoma, at least one of the major alternative transcripts of the KLK8 gene encoding kallikrein 8. This method is particularly useful for the survival prognostication of patients suffering from bronchopulmonary carcinoma. | 11-22-2012 |
20120295262 | MULTIBASE DELIVERY FOR LONG READS IN SEQUENCING BY SYNTHESIS PROTOCOLS - The present technology relates to molecular sciences, such as genomics. More particularly, the present technology relates to methods for obtaining long lengths of sequencing data. | 11-22-2012 |
20120295263 | Haplotype Analysis - The present invention provides an efficient way for high throughput haplotype analysis. Several polymorphic nucleic acid markers, such as SNPs, can be simultaneously and reliably determined through multiplex PCR of single nucleic acid molecules in several parallel single molecule dilutions and the consequent statistical analysis of the results from these parallel single molecule multiplex PCR reactions results in reliable determination of haplotypes present in the subject. The nucleic acid markers can be of any distance to each other on the chromosome. In addition, an approach wherein overlapping DNA markers are analyzed can be used to link smaller haplotypes into larger haplotypes. Consequently, the invention provides a powerful new tool for diagnostic haplotyping and identifying novel haplotypes. | 11-22-2012 |
20120295264 | METHOD FOR DETECTING ULCERATIVE COLITIS - An object of the present invention is to provide a method of detecting an inflammatory bowel disease, and particularly ulcerative colitis, by using a component contained in fecal matter as an indicator. Namely, the present invention provides a method for detecting ulcerative colitis comprising: (A) a step of extracting RNA contained in fecal matter collected from a subject, (B) a step of measuring the amount of RNA derived from a marker gene in the RNA obtained in step (A), and (C) a step of comparing the amount of the RNA derived from the marker gene measured in step (B) with a preset threshold value, wherein the marker gene is one or more types of genes selected from the group consisting of COX-2 gene, B2M gene, MMP-7 gene, Snail gene, CD45 gene and CEA gene. | 11-22-2012 |
20120301874 | Compositions and Methods for Detection of Staphylococcus Aureus - The present invention relates to methods for the rapid detection of the presence or absence of | 11-29-2012 |
20120301875 | AMPLICON MELTING ANALYSIS WITH SATURATION DYES - Methods are provided for nucleic acid analysis wherein a target nucleic acid that is at least partially double stranded is mixed with a dsDNA binding dye having a percent saturation of at least 50% to form a mixture. In one embodiment, the nucleic acid is amplified in the presence of the dsDNA binding dye, and in another embodiment a melting curve is generated for the target nucleic acid by measuring fluorescence from the dsDNA binding dye as the mixture is heated. Dyes for use in nucleic acid analysis and methods for making dyes are also provided. | 11-29-2012 |
20120301876 | METHOD TO QUANTIFY SIRNAS, MIRNAS AND POLYMORPHIC MIRNAS - The present teachings provide methods, compositions, and kits for quantifying target polynucleotides. In some embodiments, a reverse stem-loop ligation probe is ligated to the 3′ end of a target polynucleotide, using a ligase that can ligate the 3′ end of RNA to the 5′ end of DNA using a DNA template, such as T4 DNA ligase. Following digestion to form an elongated target polynucleotide with a liberated end, a reverse transcription reaction can be performed, followed by a PCR. In some embodiments, the methods of the present teachings can discriminate between polymorphic polynucleoitides that vary by as little as one nucleotide. | 11-29-2012 |
20120301877 | Use of Phenanthridium Derivatives for Distinguishing Between Intact and Membrane Comprised Cells Using Molecular Nucleic Acid-Based Techniques - The present invention provides novel chemicals and methods for selectively excluding DNA of dead cells from a mixture containing live and dead cells from molecular detection. | 11-29-2012 |
20120301878 | METHODS AND COMPOSITIONS FOR THE DETECTION OF DRUG RESISTANT BRAF ISOFORMS - The present invention provides methods and compositions for the detection of novel BRAF splice variants that mediate resistance to BRAF and/or pan-RAF inhibitors. In particular, the invention provides PCR primer(s) to be used in the disclosed methods of detection. In some embodiments, the compositions and methods of the present invention are used to predict resistance to BRAF and/or pan-RAF inhibitors in a subject suffering from or suspected of having cancer and further provides alternative treatment strategy(ies) for a subject, predicted to be resistant to BRAF and/or pan-RAF inhibitors. In a further embodiment, methods and composition for the identification of novel agents useful to overcome resistance to BRAF and/or pan-RAF inhibitors are disclosed. The present invention also provides isolated polynucleotide sequences of novel 5′ BRAF splice variant(s) and proteins produced from such polynucleotide sequences as well as cell line(s) that endogenously or exogenously express the splice variant(s). | 11-29-2012 |
20120301879 | NOVEL USE OF CA-125 - Provided is novel use of CA-125. As it is discovered that CA-125 level are positively associated with bone mineral density, thereby CA-125 can be used in biomarker to diagnose osteoporosis or osteopenia, or extent of growth plate development. | 11-29-2012 |
20120301880 | ALKYL AMINE COMPOUNDS FOR FLUORESCENT LABELING - Alkyl amine dyes, oligonucleotide probes prepared from the alkyl amine dyes, phosphoramidites and solid supports prepared from the alkyl amine dyes, and methods of labeling biological agents using the alkyl amine dyes. | 11-29-2012 |
20120301881 | Compositions, Methods and Related Uses for Cleaving Modified DNA - Compositions, methods and a kit are described relating to a novel family of enzymes which preferentially bind to a hydroxymethylated cytosine or a glucosylated hydroxymethylated cytosine and cleave double-stranded DNA at a defined distance 3′ of the recognition site to produce a cleavage fragment with a 1-3 base overhang. | 11-29-2012 |
20120301882 | METHODS FOR GENERATING DATABASES AND DATABASES FOR IDENTIFYING POLYMORPHIC GENETIC MARKERS - Processes and methods for creating a database of genomic samples from healthy human donors, methods that use the database to identify and correlate polymorphic genetic markers and other markers with diseases and conditions are provided. | 11-29-2012 |
20120301883 | SHEATH FLOW DEVICES AND METHODS - The invention relates generally to fluid processing and, in particular aspects, processing fluids for detection, selection, trapping and/or sorting of particulate moieties. Sheath flow devices described allow isolation of target species from fluid samples while avoiding non-specific binding of unwanted species to the surfaces of the separation device. Biological fluid processing, detection, sorting or selection of cells, proteins, and nucleic acids is described. The invention finds particular use in diagnostic settings, analyzing a patient's medical condition, monitoring and/or adjusting a therapeutic regimen and producing cell based products. | 11-29-2012 |
20120301884 | METHOD AND DEVICE FOR DETECTING THE PRESENCE OF A SINGLE TARGET NUCLEIC ACID IN A SAMPLE - A method comprising subjecting one or more sample portion(s) to a single amplification step, thereby amplifying a single molecule in the sample portion to a detectable level, and, in some embodiments, then determining whether the sample portion contains at least one molecule of the target nucleic acid. In some embodiments, the sample portion is in a porous sample structure, or in a sample chamber which comprises means for minimizing diffusion of the sample portion, or in a sample chamber which is inside a microcapillary device, or in a sample retaining means. | 11-29-2012 |
20120301885 | CYTOGENIC ANALYSIS OF METAPHASE CHROMOSOMES - The present invention relates to methods and systems for analyzing chromosomes, and in particular to methods and systems for simultaneously performing banding and in situ hybridization on metaphase chromosomes. | 11-29-2012 |
20120301886 | POLYTAG PROBES - The present invention provides probes and probe systems for detection of nucleic acids, and in particular probes and probe systems comprising target nucleic acid probes which comprise a plurality of detection sequences and detection nucleic acid probes which hybridize to the detection sequences of the target nucleic acid probes and which further comprise a plurality of detectable moieties, such as haptens. | 11-29-2012 |
20120308999 | DETECTION OF SHORT RNA SEQUENCES - An assay for detection of short sequences of RNA in a synthetic or clinically isolated sample is presented herein. Particular reference is made to detecting RNA based pathogens, such as H5 influenza. | 12-06-2012 |
20120309000 | MYCOBACTERIA-DERIVED DNA MISMATCH REPAIR NUCLEOTIDE SEQUENCES AND USES THEREOF - The present disclosure provides an isolated DNA molecule derived from Mycobacteria having a DNA mismatch repair function represented by a nucleic acid sequence as disclosed in SEQ ID NO: 1 or 2. Also provided is a promoter sequence having SEQ ID NO: 3, and a recombinant vector comprising the isolated DNA of the present disclosure and a promoter operatively linked to the DNA molecule. The isolated DNA molecule of the present disclosure is classified as MutS4A and MutS4 and confers cells with resistance to UV and macrophages when transformed into the cells. Further it increases the frequency of homologous recombination and the genetic stability of a heterologous plasmid in cells. | 12-06-2012 |
20120309001 | METHOD TO DETECT PROSTATE CANCER IN A SAMPLE - The present invention provides methods to detect prostate cancer by detecting the RNA encoded by PCA3. The disclosure provides a method for determining a predisposition, or presence of prostate cancer comprising: (a) contacting a sample with at least one oligonucleotide that hybridizes to a PCA3 polynucleotide; (b) detecting an amount of PCA3 and second prostate-specific polynucleotides; and (c) comparing the amount of PCA3 polynucleotide that hybridizes to the oligonucleotide to a predetermined cut off value, and determining the presence or absence of prostate cancer. Diagnostic kits are provided for detecting prostate cancer or the risk of developing same comprising: (a) at least one container means containing at least one oligonucleotide probe or primer that hybridizes to PCA3 (b) at least one oligonucleotide probe or primer that hybridizes with a second prostate specific nucleic acid; and (c) reagents for detecting PCA3 and the second prostate specific nucleic acid. | 12-06-2012 |
20120309002 | SAMPLE MULTIPLEXING - The invention generally relates to methods for sample multiplexing. In certain embodiments, methods of the invention obtaining a plurality of different reactant molecules, attaching a unique identifier to the reactant molecules, and forming a droplet including the reactant molecules. | 12-06-2012 |
20120309003 | ENTEROHEMORRHAGIC E. COLI O104:H4 ASSAYS - Disclosed are compositions, methods and kits for the specific detection of enterohemorrahagic | 12-06-2012 |
20120309004 | MICRO-DEVICE AND METHODS FOR DISRUPTING CELLS - A micro-device for disrupting cells includes a first chamber in which the cells are disrupted, a second chamber which is pressurized and depressurized, a flexible membrane which separates the first chamber and the second chamber and is vibrated by pressuring and depressurizing the second chamber, and a micro-unit confined in the first chamber, where the micro-unit disrupts the cells in the first chamber. | 12-06-2012 |
20120309005 | KIT AND METHOD FOR IDENTIFICATION OF CAUSATIVE BACTERIUM OF NAIL TINEA - It is an object of the invention to provide a kit and method for identification of causative fungi of tinea unguium, which allows rapid and accurate identification of causative fungi by real-time PCR using primer sets and probes specific for fungal species. An identification kit for identification of causative fungi of tinea unguium using real-time PCR, which comprises a primer set and a probe, wherein the primer set is at least one selected from the group consisting of a primer set consisting of a primer comprising the nucleotide sequence as set forth in SEQ ID NO: 1 and a primer comprising the nucleotide sequence as set forth in SEQ ID NO: 2, and a primer set consisting of a primer comprising the nucleotide sequence as set forth in SEQ ID NO: 3 and a primer comprising the nucleotide sequence as set forth in SEQ ID NO: 4, and wherein the probe is at least one selected from the group consisting of a probe comprising the nucleotide sequence as set forth in SEQ ID NO: 5 and a probe comprising the nucleotide sequence as set forth in SEQ ID NO: 6. | 12-06-2012 |
20120309006 | SPECIFIC METHOD OF PROSTATE CANCER DETECTION BASED ON PCA3 GENE, AND KITS THEREFOR - The invention relates to a method to diagnose prostate cancer by detecting a PCA3 sequence. In one embodiment the method and kit enables amplification of PCA3 RNA through an exon-exon junction of a spliced PCA3 mRNA, and methods and kits to detect an amplified PCA3 RNA, using a probe which spans the amplified exon-exon junction. The methods and kits can detect a PCA3 RNA lacking one intron or more. Also provided are methods of detecting PCA3 RNA expressed in non-prostate tissue or cells of the urinary tract, which comprises PCA3 intron 3. In addition, methods are provided to determine whether a sample from a subject contains or lacks prostate cells, by performing a hybridization and/or amplification reaction on RNA from the sample to detect the presence or level of PCA3 RNA that lacks at least one intron and distinguishing a prostate cell from a non-prostate cell. | 12-06-2012 |
20120309007 | PROSTATE CANCER PROGNOSTIC COMPOSITIONS AND KITS - Described herein are method, compositions and kits for prognosis of prostate cancer. The methods comprise: determining the ratio of PCA3 and of a prostate-specific marker expression in a urine sample and correlating the value of the PCA3/prostate-specific marker ratio with the aggressiveness and mortality risk of prostate cancer in the subject. The present invention features a method for prognosing prostate cancer in a sample of a patient comprising: assessing the amount of a prostate cancer specific PCA3 mRNA and the amount of prostate-specific marker in the sample; determining a ratio value of this amount of prostate cancer specific PCA3 mRNA over the amount of prostate-specific marker; comparing the ratio value to at least one predetermined cut-off value, wherein a ratio value above the predetermined cut-off value is indicative of a higher risk of mortality of prostate cancer as compared to a ratio value below the predetermined cut-off value. | 12-06-2012 |
20120315629 | Cloning and Expression of arNOX Protein Transmembrane 9 Superfamily (TM9SF), Methods and Utility - Described are cell surface and circulating markers for aging related disorders (specific isoforms of NADH oxidase (arNOX)). Recombinant age-related NADH oxidase isoforms and their coding sequences and methods for detecting arNOX isoform presence and quantitation in tissues and in blood, sera, urine, saliva, perspiration and in other body fluids, are provided. Recombinant arNOX proteins are useful in preparing antigens for use in the generation of monoclonal and polyclonal antibodies as well as immunogenic compositions for diagnosis and treatment of aging disorders. DNA probes based on the DNA sequence information provide may be used to identify individuals at risk for aging disorders and for development of therapeutic interventions or anti-aging cosmetic or other formulations of benefit in slowing the aging process in mammals. | 12-13-2012 |
20120315630 | METHODS FOR DIAGNOSING IRRITABLE BOWEL SYNDROME - The invention provides novel biomarkers, kits, and methods of diagnosing, prognosing, and subtyping IBS. Also provided are methods for aiding in the diagnosis of irritable bowel syndrome by detecting the serum level of novel IBS biomarkers identified herein. | 12-13-2012 |
20120315631 | TUMOR SUPPRESSOR DESIGNATED TS10Q23.3 - A specific region of chromosome 10 (10q23.3) has been implicated by series of studies to contain a tumor suppressor gene involved in gliomas, as well as a number of other human cancers. One gene within this region was identified, and the corresponding coding region of the gene represents a novel 47 kD protein. A domain of this product has an exact match to the conserved catalytic domain of protein tyrosine phosphatases, indicating a possible functional role in phosphorylation events. Sequence analyses demonstrated the a number of exons of the gene were deleted in tumor cell lines used to define the 10q23.3 region, leading to the classification of this gene as a tumor suppressor. Further analyses have demonstrated the presence of a number of mutations in the gene in both glioma and prostate carcinoma cells. Methods for diagnosing and treating cancers related to this tumor suppressor, designated as TS10q23.3, also are disclosed. | 12-13-2012 |
20120315632 | DETECTION OF E. COLI STRAINS TY2482 AND LB226692 - The present invention relates generally to strain typing of | 12-13-2012 |
20120315633 | METHODS OF ENRICHING AND DETECTING FETAL NUCLEIC ACIDS - The present invention relates to a method of enriching free fetal nucleic acids from a cervical sample. The enriched fetal nucleic acids can be used in a variety of procedures including, detection of a trait of interest such as a disease trait, or a genetic predisposition thereto, gender typing and parentage testing. | 12-13-2012 |
20120315634 | DISTINGUISHING PCA3 MESSENGER RNA SPECIES IN BENIGN AND MALIGNANT PROSTATE TISSUES - This invention concerns the discovery of two distinct PCA3 mRNA sequences. One of these sequences corresponds to a short PCA3 mRNA molecule whereas the other PCA3 RNA molecule is longer as it comprises an additional sequence between exon 3 and exon 4a. The short RNA is associated with prostate cancer whereas the long RNA sequence is associated with a non-malignant state of the prostate. Based on the differential expression levels of these two PCA3 RNA sequences, protocols for the diagnosis of prostate disease are provided. The invention also relates to therapeutic approaches to prostate cancer. | 12-13-2012 |
20120315635 | Universal Sample Preparation System And Use In An Integrated Analysis System - The invention provides for devices and methods for interfacing microchips to cartridges and pneumatic manifolds. The cartridges, microchips, and pneumatic manifolds can be integrated with downstream preparation devices, such as thermal regulating devices and separation and analysis devices. | 12-13-2012 |
20120322058 | Analysis of nucleic acids - Provided herein are improved methods, compositions, and kits for analysis of nucleic acids. The improved methods, compositions, and kits can enable copy number estimation of a nucleic acid in a sample. Also provided herein are methods, compositions, and kits for determining the linkage of two or more copies of a target nucleic acid in a sample (e.g., whether the two or more copies are on the same chromosome or different chromosomes) or for phasing alleles. | 12-20-2012 |
20120322059 | MUTATION WITHIN THE CONNEXIN 26 GENE RESPONSIBLE FOR PRELINGUAL NON-SYNDROMIC DEAFNESS AND METHOD OF DETECTION - A purified polynucleotide having a chain of nucleotides corresponding to a mutated sequence, which in a wild form encodes a polypeptide implicated in hereditary sensory defect, wherein said mutated purified polynucleotide presents a mutation responsible for prelingual non-syndromic deafness selected from the group consisting of a specific deletion of at least one nucleotide. | 12-20-2012 |
20120322060 | DIAGNOSIS AND MONITORING TREATMENT OF PSYCHIATRIC DISEASES WITH SPADIN AND RELATED METHODS - A method of diagnosing depression in a subject, comprising analyzing a biological sample from a subject in need of diagnosis of depression for the expression of spadin, detecting and measuring the amount of spadin in the sample, and diagnosing depression in the subject if an increase or a decrease in spadin expression in the biological sample is detected compared to a control, is described as are methods for monitoring treatment, remission and the course of the disease. Related kits are also described. Also described is a method for identifying candidate compounds for treating depression. | 12-20-2012 |
20120322061 | MACROMOLECULAR COMPOUND FOR DETECTING TARGET MATERIAL AND METHOD OF DETECTING TARGET MATERIAL BY USING THE SAME - Macromolecular compound for detecting a target material in a biological sample, and a method of using same. | 12-20-2012 |
20120322062 | Methods And Compositions For Detection Of Cowden Syndrome (CS) and CS-Like Syndrome - The invention is directed to methods of detecting Cowden syndrome (CS) or CS-like syndrome in an individual or determining whether an individual is at risk for developing Cowden syndrome (CS) or CS-like syndrome comprising detecting the presence of a mutated succinate dehydrogenase B (SDHB), mutated succinate dehydrogenase D (SDHD) or combination thereof in the individual, wherein detection of a mutated SDHB, SDHD or a combination thereof indicates that the individual is positive for, or at risk of developing, CS or CS-like syndrome. The invention is also directed to an article of manufacture for detecting Cowden syndrome (CS) or Cowden-like syndrome in an individual, comprising one or more agents that detects mutated succinate dehydrogenase B (SDHB), mutated succinate dehydrogenase D (SDHD) or combination thereof in the individual, and instructions for use. | 12-20-2012 |
20120322063 | METHODS FOR QUANTIFYING MICRORNA PRECURSORS - The present invention is directed to methods, reagents, kits and compositions for identifying and quantifying microRNA (miRNA) precursor expression in a biological sample. The method uses gene-specific primers and reverse transcriptase to convert the primary miRNA precursors (pri-miRNA) and pre-miRNA precursors (pre-miRNAs) to cDNA. The method also uses amplification reactions using gene specific forward and reverse primers that are targeted to the hairpin sequence of pri- and pre-microRNA precursors to detect the expression levels of both the pri- and the pre-micoRNAs. In one embodiment, the amplification reaction is a real-time PCR wherein the level of PCR amplification products produced is related to the levels of the microRNA precursors in the biological sample. In another embodiment, a probe is used to distinguish between similar isoforms of microRNA precursors. In another embodiment, the expression levels of a pre-miRNA precursor is calculated by using primers and amplification reactions that detect the pri-miRNA together with amplification reactions and primers that detect both pri- and pre-miRNAs, and calculating the difference. | 12-20-2012 |
20120322064 | HYBRIDIZATION PROBES AND METHODS OF THEIR USE - Hybridization probes for hybridizing to the same target nucleic acid are disclosed, the hybridization probes comprising an electrically-active magnetic nanoparticle-labeled detector probe and a capture probe including a conjugating moiety for immobilization. Also disclosed is a biodetection method including the steps of: providing hybridization probes for hybridizing to the same target nucleic acid, the hybridization probes comprising an electrically-active magnetic nanoparticle-labeled detector probe and a capture probe; hybridizing the target nucleic acid with each of the electrically-active magnetic nanoparticle-labeled detector probe and a capture probe in a sample including the target nucleic acid; magnetically separating the hybridized target nucleic acid from the sample; capturing the hybridized target nucleic acid on a substrate through the capture probe; and measuring the oxidation-reduction signal of the electrically-active magnetic nanoparticle-labeled detector probe. | 12-20-2012 |
20120322065 | Methods for Use with Nanoreactors - The invention relates to methods of using nanoreactor technology for sample analysis in microfluidic systems. | 12-20-2012 |
20120322066 | Development of Novel Detergents for Use in PCR Systems - This disclosure relates to novel detergents for use in various procedures including, for example, nucleic acid amplification reactions such as polymerase chain reaction (PCR). Methods for preparing the modified detergents are also described. | 12-20-2012 |
20120322067 | ASSAY METHOD FOR TARGET NUCLEIC ACID BY SIGNAL AMPLIFICATION USING PROBE HYBRIDIZATION AND RESTRICTION - Oligonucleotides for detection of nucleic acid in a sample that provide for an amplified signal by recycling probes and probe fragments. | 12-20-2012 |
20120322068 | METHOD FOR IDENTIFYING INCREASED RISK OF ANXIETY DISORDERS - The present invention is for methods for identifying a human having an increased risk for anxiety disorders. The method involves genotyping the human for a specific brain-derived neurotrophic factor (BDNF) single nucleotide polymorphism (SNP), and/or administering a fear conditioning procedure while measuring fear, and administering an extinction procedure while measuring fear. The method can also involve comparing/MRI images of the amygdala of the human acquired during conditioning and extinction and determining if the human is unresponsive to extinction therapy by noting heightened and non-declining activity in the amygdala during extinction. | 12-20-2012 |
20120322069 | Diagnositic Methods of Tumor Susceptibility With Nucleotide Polymorphisms Inside MicroRNA Target Sites - Methods of diagnosing tumor susceptibility or cancer including the step of determining whether a patient has one or more SNP-miRNA expression pattern combinations described herein. Each SNP-miRNA expression pattern combination is supported by data that shows that the SNP is associated with tumor susceptibility because of its ability to affect miRNA binding sites and/or miRNA:mRNA gene regulation. | 12-20-2012 |
20120322070 | CRYOGENIC BIOPSY SYSTEM AND METHOD - A cryogenic biopsy device is configured to provide thin, frozen tissue samples, which may be viewed under a microscope and selected for biomarker analysis. The device is configured to provide slices which are less than 50 micrometers in thickness, while snap-freezing the tissue and maintaining the sample in a deep-frozen state until it reaches the pathology lab for further processing. Alternatively, thicker slices can be harvested by the device and additional sectioning can be done in the pathology lab by using cryomicrotome. The device of the present invention may be used in rigid instruments and in flexible devices, such as endoscopes, for example, and may be suitable for single use or multiple use. | 12-20-2012 |
20120329045 | RISK ASSESSMENT FOR PHENYTOIN-INDUCED ADVERSE DRUG REACTIONS - A method of predicting the risk of a patient for developing phenytoin-induced adverse drug reactions (ADRs), including Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), or drug reactions with eosinophilia and systemic symptoms (DRESS) is disclosed. Genetic polymorphisms of CYP2C genes (including CYP2C9, CYP2C19, CYP2C8 and CYP2C18), HLA alleles (including HLA-A*0207, HLA-A*2402, HLA-B*1301, HLA-B*1502, HLA-B*4001, HLA-B*4609, HLA-B*5101, HLA-DRB1*1001 or HLA-DRB1*1502) and phenytoin concentration in the patient's plasma can all contribute to phenytoin-induced ADRs. | 12-27-2012 |
20120329046 | MOLECULAR MARKER FOR EVALUATING PATHOLOGICAL CONDITIONS AND TREATMENT OF MUSCULAR DYSTROPHY - Novel markers associated with the development of muscular dystrophy that elucidate the mechanisms of muscular dystrophy development and provide a means for diagnosis and treatment of muscular dystrophy are presented. The expression level of one or more markers selected from the group consisting of c-Fos, EGR1, IL-6, and IL-8 in a sample obtained from the subject can be compared with a reference value to diagnose muscular dystrophy in the subject. | 12-27-2012 |
20120329047 | METHODS AND ASSAYS FOR THE DETECTION OF ALTERNATIVE LENGTHENING OF TELOMERES (ALT) ACTIVITY IN CELLS - The invention relates to methods and assays for the detection of active Alternative Lengthening of Telomeres (ALT) activity in cells. The methods and assays involve detecting or assaying for partially double-stranded telomeric circles wherein the presence of said circles is specific for cells comprising an active ALT mechanism. In some embodiments the methods find application in, inter alia, determining the level of ALT activity in a cell, determining the ALT status of a cancer in a subject, diagnosing and/or treating disease, determining disease status, analysis of treatment efficacy, and the identification of novel therapeutic agents. | 12-27-2012 |
20120329048 | AUTHENTICATION METHOD OF DAIRY PRODUCTS - The present invention relates to a new method of establishing the authenticity and origin of dairy products, more specifically to the use of lactic acid bacterial strains having strain-specific insertion sequence elements as tools for marking dairy products (such as cheese) and identification thereof. The invention also extends to new lactic acid bacterial strains, their use in the production of dairy products as well as the dairy products containing these bacterial strains. | 12-27-2012 |
20120329049 | BCR-ABL1 SPLICE VARIANTS AND USES THEREOF - The present invention is based on BCR-ABL1 splice variants which result from insertion and/or truncation of the BCR-ABL1 transcript and the finding that these variants provide resistance to kinase domain inhibitors such as imatinib, nilotinib and dasatinib. | 12-27-2012 |
20120329050 | METHODS FOR THE DETECTION OF MICROORGANISMS - Presented herein are methods for the detection of the presence or absence of one or more microorganisms in a sample. The method deploys a plurality of probe sets to detect a plurality of microorganisms. The probes in the probe set are detectably labeled. At least one probe set has probes labeled with a combination of detectable labels. The number of detectable labels used in the plurality of probe sets numbers less than the number of microorganisms being detected by the probe set. | 12-27-2012 |
20120329051 | METHODS OF EVALUATING CELLS AND CELL CULTURES - Methods of evaluating the composition of a cell culture (e.g., to distinguish chondrocytes from fibroblasts) and methods for evaluating the phenotype of an individual cell (e.g., as a chondrocyte) are disclosed. The methods may be used, for example, for assessing chondrocyte cultures used for treatment of cartilage defects. In some embodiments, the invention involves identifying cell culture composition or the identity of a cell based on expression level of a fibroblast marker. In other embodiments, the invention involves comparing expression levels of at least one chondrocyte marker and at least one fibroblast marker in a cell culture sample or in an individual cell. In illustrative embodiments, the chondrocyte marker is hyaluronan and proteoglycan link protein 1 (HAPLN1), and the fibroblast marker is microfibrillar associated protein 5 (MFAP5). | 12-27-2012 |
20120329052 | IDENTIFICATION OF A DNA VARIANT ASSOCIATED WITH ADULT TYPE HYPOLACTASIA - The present invention relates to a nucleic acid molecule comprising a 5′ portion of an intestinal lactase-phlorizine hydrolase (LPH) gene contributing to or indicative of the adult-type hypolactasia. The present invention further relates to methods for testing for the presence of or predisposition to adult-type hypolactasia that are based on the analysis of an SNP contained in the above recited nucleic acid molecule. Additionally, the present invention relates to diagnostic composition and kit useful in the detection of the presence of or predisposition to adult-type hypolactasia. | 12-27-2012 |
20120329053 | MicroRNA Fingerprints During Human Megakaryocytopoiesis - Described herein is a method of decreasing expression of HOXA1 in a subject having a cancer and/or myeloproliferative disorder associated with overexpression of a HOXA1 gene product where an effective amount of at least one miR-10a gene product or an isolated variant or biologically-active fragment thereof is administered to the subject sufficient to decrease expression of the HOXA1 gene product in the subject. | 12-27-2012 |
20120329054 | METHOD AND SUBSTANCES FOR ISOLATING MIRNAS - A capture probe suitable for use with a method for isolating miRNAs. A method for isolating an miRNA of interest from a sample comprising the miRNA of interest comprising providing the capture probe. A method for identifying an miRNA of interest. | 12-27-2012 |
20130004950 | ASSAY SYSTEMS FOR GENETIC ANALYSIS - The present invention provides assays systems and methods for detection of chromosomal abnormalities and status of single loci associated with monogenic or polygenic traits in a sample containing nucleic acids from a maternal and a fetal source. | 01-03-2013 |
20130004951 | BULKED MUTANT ANALYSIS - The current invention relates to a new strategy for identification, and optional isolation, of a nucleic acid sequence that is expressed in an organism and that is causally related to a particular phenotype (trait of a character) of said organism. With the method of the current invention it has become possible to, in contrast to known methods in the art, efficiently enrich, identify, isolate and/or clone genes in, for example, organism like (crop) plants for which no or only limited information with respect to the genome is available. | 01-03-2013 |
20130004952 | CARTRIDGE FOR BIOCHEMICAL ANALYSES, SYSTEM FOR BIOCHEMICAL ANALYSES, AND METHOD OF CARRYING OUT A BIOCHEMICAL PROCESS - A cartridge for biochemical analyses includes a support, a structure, which is set on the support and contains wells for receiving a solution, and photodetectors on the support, in positions corresponding to respective wells. | 01-03-2013 |
20130004953 | METHODS FOR LOCALIZED IN SITU DETECTION OF mRNA - The present invention relates to the detection of RNA in a sample of cells. More particularly, the present invention relates to the localized detection of RNA in situ. The method relies on the conversion of RNA to complementary DNA prior to the targeting of the cDNA with a padlock probe(s). The hybridization of the padlock probe(s) relies on the nucleotide sequence of the cDNA which is derived from the corresponding nucleotide sequence of the target RNA. Rolling circle amplification of the subsequently circularized padlock probe produces a rolling circle product which may be detected. Advantageously, this allows the RNA to be detected in situ. | 01-03-2013 |
20130011831 | Compositions And Methods For The Rapid Detection Of Legionella pneumophila - The present application describes compositions and methods useful for the rapid detection of | 01-10-2013 |
20130011832 | Dual-mode microfluidic genetics testing platforms and methods of dual-mode genetics testing using same - Dual mode genetics testing systems are devised about a single element testing platform. A microfluidic network and system of interconnected receiving cells and reaction vessels supports at the same time genotyping and copy number analysis where the platform may be subject to a common thermal cycle schedule to cause the proper reactions (DNA replication) necessary in both test types. Further, the microfluidic platform which includes reaction vessels for genotyping which are spatially removed from reaction vessels for copy number analysis, is coupled to optical scanner and detection systems specifically arranged to apply test specific detection routines on each of these distinct regions or portions of the dual mode test platform. | 01-10-2013 |
20130011833 | METHOD FOR IDENTIFYING NUCLEIC ACIDS BOUND TO AN ANALYTE - A method for identifying a target nucleic acid bound by an analyte in a sample comprising: (a) contacting said sample with a first probe comprising a first nucleic acid and a first analyte binding domain and a second probe comprising a second nucleic acid and second analyte binding domain, wherein said first and second probes can bind to said analyte, such that said first and second nucleic acid are in spatial proximity to form a complex with said target nucleic acid if said target nucleic acid is bound by said analyte in said sample; (b) incubating said sample with a ligase that can ligate said complex to form a ligated target nucleic acid template; (c) amplifying said target nucleic acid template if present in said sample, and (d) detecting the presence or absence of an amplified target nucleic acid template. | 01-10-2013 |
20130011834 | MEAN DNA COPY NUMBER OF CHROMOSOMAL REGIONS IS OF PROGNOSTIC SIGNIFICANCE IN CANCER - Methods for predicting a disease free time interval (DFI) for a cancer patient under consideration for initial or further chemotherapy treatment are disclosed. The methods include obtaining a biological sample from a patient and detecting a copy number of chromosome region A1 and/or C2. The mean copy number per cell is correlated with a DFI for the subject. The chemotherapy can include doxorubicin and/or L-asparaginase treatment. Also provided are kits for predicting DFI in a subject with cancer and computer readable storage media for performing the presently disclosed methods. | 01-10-2013 |
20130011835 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATION - The present invention relates to compositions to treat inflammation (LIGHT pathway) related disorders, and specifically liver inflammation or hepatitis. The invention also relates to methods treating LIGHT pathway related disorders. The invention further relates to kits for treating LIGHT pathway related disorders in a subject. The invention further relates to methods of identifying novel treatments for treating LIGHT pathway related disorders in a subject. | 01-10-2013 |
20130011836 | KIT FOR THE DETECTION OF BED BUGS - A kit and method for the detection of bed bugs is discussed. The kit comprises at least one pair of polymerase chain reaction (“PCR”) amplification primers capable of forming a Cimicidae-DNA-amplification-product for a family of organisms of a Cimicidae. Additionally, the kit provides a specimen collection device for collecting a DNA sample from an area suspected of harboring one or more members of the Cimicidae family. The kit also provides a DNA probe having fluorescent primer chemistry. In a preferred embodiment, the nucleic acid amplification detection kit utilized a pair of PCR primers. The probe utilizes fluorescent primer chemistry and contains chemistry similar to TaqMan Probes, Molecular Beacons, Hybridization Probes; or Eclipse Probes. Additionally, the kit contains a positive-control-Cimicidae DNA template for confirming Cimicidae-DNA-amplification-product. | 01-10-2013 |
20130011837 | Assays for Affinity Profiling of Nucleic Acid Binding Proteins - Methods, compositions and kits are disclosed for assays to determine the binding affinity of DNA-binding proteins or RNA-binding proteins for their corresponding recognition site(s). In particular, assays are disclosed for measuring binding affinities when either the binding protein, or the recognition sequence of the recognition site, or cofactor proteins, contain one or more mutations. The disclosed assays can thus be utilized to measure the effect on transcription factor binding caused by mutations within the recognition site, or mutations within the binding domain of the protein, and to provide binding affinity information that can be correlated with altered gene regulation and expression. The disclosed assays can be personalized to a specific person or organism, with the measured binding affinities based upon an individual's specific binding proteins and recognition sites. Furthermore, embodiments are capable of measuring binding affinities between multiple binding proteins and multiple recognition sites through an entirely in vitro process. | 01-10-2013 |
20130011838 | Kits And Methods For Assessing Oxidative Stress - The invention relates to kits and methods for assessing the susceptibility of a human to oxidative stress or damage. The methods involve assessing occurrence in the human's genome of one or more polymorphisms (e.g., single nucleotide polymorphisms) that occur in one or more genes associated with oxidative stress and that are associated with a disorder in humans. Preferred assessment and scoring methods are disclosed, as are kit for performing the methods. | 01-10-2013 |
20130011839 | Methods for the Reduction of Stutter in Microsatellite Amplification - The invention provides a method for reducing stutter in the amplification of a microsatellite comprising the steps of providing a sample comprising a microsatellite having a G+C content of 50% or less; contacting the sample with at least one enzyme having nucleic acid polymerase activity; and incubating the sample with the enzyme for a sufficient amount of time and under conditions sufficient to amplify the microsatellite; wherein the incubation is performed in the presence of an amount of betaine, sorbitol or mixtures thereof, effective to reduce stutter relative to the amount of stutter observed in the absence of betaine and/or sorbitol. The invention also provides compositions containing betaine and/or sorbitol, kits for amplifying microsatellites having a G+C content of 50% or less, and methods of using all of the foregoing. | 01-10-2013 |
20130011840 | Methods, Compositions, and Kits Comprising Linker Probes for Quantifying Polynucleotides - The present invention is directed to methods, reagents, kits, and compositions for identifying and quantifying target polynucleotide sequences. A linker probe comprising a 3′ target specific portion, a loop, and a stem is hybridized to a target polynucleotide and extended to form a reaction product that includes a reverse primer portion and the stem nucleotides. A detector probe, a specific forward primer, and a reverse primer can be employed in an amplification reaction wherein the detector probe can detect the amplified target polynucleotide based on the stem nucleotides introduced by the linker probe. In some embodiments a plurality of short miRNAs are queried with a plurality of linker probes, wherein the linker probes all comprise a universal reverse primer portion a different 3′ target specific portion and different stems. The plurality of queried miRNAs can then be decoded in a plurality of amplification reactions. | 01-10-2013 |
20130011841 | Genetic Association of Polymorphisms in Perilipin (PLIN) Gene With Resistance to Weight Loss - Diagnostics and therapeutics for resistance to weight-loss, which are based upon the identification of a subject's PLIN polymorphisms, haplotype and genotype pattern, are described in this invention. | 01-10-2013 |
20130011842 | DNA Sequencing System - An apparatus for detecting labeled beads is provided. The apparatus can include: one or more irradiation sources disposed for irradiating the one or more detection zones with radiation; at least one detector disposed for collecting charges corresponding to light signals emitted from labeled beads in the one or more detection zones, which have been excited by the radiation; and a system coupled to the at least one detector for effecting time delay integration of the charges by accumulating the charges before reading the charges at the output of the at least one detector. | 01-10-2013 |
20130011843 | TISSUE SEPARATION METHOD - The invention relates to a method for non-destructively sampling individual seeds in a population of seeds. In one embodiment, the invention relates to an efficient, high throughput method for removing contaminating tissue from the other seed material. The methods of the invention are useful for determining the genotype of a seed and the detection of a genetic marker or genetic trait. The methods of the invention comprise removing maternal tissue, such as seed coat or pericarp from the seed, and analyzing the remainder of the seed. The methods of the invention reduce the degree of ambiguity in the genetic tests because complicating maternal tissue has been removed. | 01-10-2013 |
20130017538 | DEVICES, SYSTEMS, AND METHODS FOR MAGNETIC SEPARATIONAANM Ionescu-Zanetti; CristianAACI BerkeleyAAST CAAACO USAAGP Ionescu-Zanetti; Cristian Berkeley CA USAANM Nevill; Joshua TannerAACI El CerritoAAST CAAACO USAAGP Nevill; Joshua Tanner El Cerrito CA USAANM Schwartz; MichaelAACI OaklandAAST CAAACO USAAGP Schwartz; Michael Oakland CA USAANM Conant; Carolyn G.AACI San FranciscoAAST CAAACO USAAGP Conant; Carolyn G. San Francisco CA USAANM Rudoff; RogerAACI CupertinoAAST CAAACO USAAGP Rudoff; Roger Cupertino CA US - Methods, microfluidic devices, and instruments for magnetic separation of particles from a fluid are described. Examples include microfluidic devices having a removable portion. Examples include microfluidic devices having one or more regions of reduced fluid velocity. Examples further including instruments having pneumatic interfaces. Examples further includes instruments having controllable magnets, imaging components, or combinations thereof. | 01-17-2013 |
20130017539 | METHODS AND COMPOSITIONS FOR CHLAMYDIA TRACHOMATIS DIAGNOSTIC TESTING - The invention provides methods, reagent, and kits for detecting the presence of | 01-17-2013 |
20130017540 | IDENTIFICATION OF MUTATION TYPES ASSOCIATED WITH ACQUIRED RESISTANCE AND METHODS FOR USING SAME - Methods for identifying or classifying a gene mutation type associated with acquired drug resistance of cancer is provided. Said methods may include determining a total copy number (N) of a susceptible gene in a cancer cell, identifying a mutant copy number of the susceptible gene, determining a mutant copy number sufficient to cause acquired drug resistance (M); and comparing N with M to identify or classify the mutation type in the cancer cell. | 01-17-2013 |
20130017541 | Methods and Compositions for Segregating Target Nucleic Acid from Mixed Nucleic Acid Samples - The invention provides methods, compositions and kits for segregating a target nucleic acid from a mixed nucleic acid sample. The methods, compositions and kits comprise a non-processive endonuclease (e.g., a restriction enzyme) or an antibody that binds the target nucleic acid (e.g., has methylation specificity). The mixed nucleic acid sample can comprise prokaryotic and eukaryotic nucleic acid and/or nucleic acid from more than one prokaryotic or eukaryotic organisms. | 01-17-2013 |
20130017542 | Method and Kit for Amplifying and Detecting PolynucleotideAANM Hosomi; ToshiyaAACI Kyoto-shiAACO JPAAGP Hosomi; Toshiya Kyoto-shi JPAANM Hirai; MitsuharuAACI Kyoto-shiAACO JPAAGP Hirai; Mitsuharu Kyoto-shi JP - Disclosed is a method of amplifying a polynucleotide, comprising:
| 01-17-2013 |
20130017543 | Method and Kit for Amplifying and Detecting PolynucleotideAANM Hosomi; ToshiyaAACI Kyoto-shiAACO JPAAGP Hosomi; Toshiya Kyoto-shi JPAANM Hirai; MitsuharuAACI Kyoto-shiAACO JPAAGP Hirai; Mitsuharu Kyoto-shi JP - Disclosed is a method of amplifying a polynucleotide, comprising:
| 01-17-2013 |
20130017544 | High Resolution Melting Analysis on a Droplet Actuator - An integrated droplet actuator device and methods are provided for performing PCR amplification and high-resolution melting (HRM) analysis on a single droplet actuator. HRM analysis can be used in combination with PCR amplification for detection of sequence variations (e.g., single-nucleotide polymorphisms, nucleotide-repeat polymorphisms, mutation scanning and assessment of DNA methylation) within one or more genes of interest. The PCR amplicons can be fluorescently labeled during amplification using a saturating DNA intercalating fluorescent dye, a 5′-labeled primer, or labeled probes. Also provided are a droplet actuator device and methods for sample preparation using the droplet actuator and detection of sequence variations on the same droplet actuator. | 01-17-2013 |
20130022970 | Methods Of Classifying Biological Samples For Predicting Response To Tyrosine Kinase Inhibitor Treatment - Gene copy numbers of signaling components downstream of EGFR identify non-small cell lung cancer (NSCLC) patients with poor outcomes on 2nd/3rd line gefitinib therapy. | 01-24-2013 |
20130022971 | NON-THIOPURINE METHYLTRANSFERASE RELATED EFFECTS IN 6-MERCAPTOPURINE THERAPY - The present invention provides methods for predicting tolerance associated with 6-mercaptopurine drug treatment of an immune-mediated gastrointestinal disorder such as inflammatory bowel disease. In particular, the present invention provides methods for predicting a patient's risk of an adverse drug reaction (or tolerance) to a 6-mercaptopurine drug by genotyping a patient at a polymorphic site in at least one gene selected from the group consisting of a xanthine dehydrogenase (XDH) gene, molybdenum cofactor sulfurase (MOCOS) gene, and aldehyde oxidase (AOX) gene. The present invention further provides methods for optimizing therapeutic efficacy in a patient receiving a 6-mercaptopurine drug by determining whether the patient should be given an alternative drug based on the presence or absence of a polymorphism in at least one of the XDH, MOCOS, and AOX genes. | 01-24-2013 |
20130022972 | OLIGONUCLEOTIDES AND METHODS FOR DETECTING LAVENDER FOAL SYNDROME - A method for detecting a genetic polymorphism associated with Lavender Foal Syndrome or a predisposition thereto in a subject, the method including screening a genomic material sample from the subject for the presence of at least one polymorphism in a MYO5A gene. | 01-24-2013 |
20130022973 | Multiplex Amplification for the Detection of Nucleic Acid Variations - Kits, primers, and methods are provided herein for detecting relative target source to reference source ratios in a biological sample, by distributing the biological sample into discrete subsamples, wherein the biological sample includes, a plurality of target molecules on a target source; and a plurality of reference molecules on a reference source; providing target primers directed to one or more of the plurality of target molecules and reference primers directed to one or more of the plurality of reference molecules; performing digital amplification with the target primers and the reference primers; and detecting the presence or absence of amplified target products with target probes and detecting the presence or absence of amplified reference products with reference probes, wherein the ratio of amplified target products to amplified reference products is indicative of a relative amount of target source to reference source in a biological sample. | 01-24-2013 |
20130022974 | DNA METHYLATION PROFILES IN CANCER - The present invention relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to methylation levels of genes (e.g., in CGI islands of the promoter regions) as diagnostic markers and clinical targets for prostate cancer. | 01-24-2013 |
20130022975 | METHOD FOR DETECTING ARTERIOSCLEROTIC DISEASES ON THE BASIS OF SINGLE NUCLEOTIDE POLYMORPHISM AT HUMAN CHROMOSOME 5P15.3 - An atherosclerotic disease such as myocardial infarction or angina pectoris is detected by analyzing a single nucleotide polymorphism on human chromosome 5p15.3, and by associating results of the analysis with the risk of the onset thereof. Examples of the single nucleotide polymorphism on human chromosome 5p15.3 include a nucleotide corresponding to the nucleotide at position 61 in the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, and a polymorphism at a nucleotide which is in linkage disequilibrium with the above nucleotide. | 01-24-2013 |
20130022976 | HYPERTHERMOSTABLE ENDONUCLEASE IV SUBSTRATE PROBE - The present invention relates to a hyperthermostable endonuclease IV substrate probe to be used in nucleic acid assay methods which can be carried out using hyperthermostable enzymes, including detection of target nucleic acids, and detection of nucleic acid polymorphism. | 01-24-2013 |
20130022977 | METHODS FOR DETECTING FETAL NUCLEIC ACIDS AND DIAGNOSING FETAL ABNORMALITIES - The invention generally relates to methods for detecting fetal nucleic acids and methods for diagnosing fetal abnormalities. In certain embodiments, the invention provides methods for determining whether fetal nucleic acid is present in a maternal sample including obtaining a maternal sample suspected to include fetal nucleic acids, and performing a sequencing reaction on the sample to determine presence of at least a portion of a Y chromosome in the sample, thereby determining that fetal nucleic acid is present in the sample. In other embodiments, the invention provides methods for quantitative or qualitative analysis to detect fetal nucleic acid in a maternal sample, regardless of the ability to detect the Y chromosome, particularly for samples including normal nucleic acids from a female fetus. | 01-24-2013 |
20130022978 | Measurement of Brain CDP-Diacylglycerol Synthase 1 Enzyme and Uses Thereof - Provided herein are methods of diagnosing depressive disorders in a subject by comparing a CDP-diacylglycerol synthase 1 enzyme activity or expression level to enzyme activity or expression level of CDP-diacylglycerol synthase 1 in a control subject. Also herein are methods of predicting therapeutic efficacy of an antidepressant drug in a subject with depressive disorders by monitoring enzyme activity or expression level of CDP-diacylglycerol synthase 1 in the subject. Further provided herein are methods of identifying a compound effective to treat or alleviate the symptoms of depression by monitoring enzyme activity or expression level of CDP-diacylglycerol synthase 1 in a tissue. Further provided are kits for diagnosing depressive disorders. | 01-24-2013 |
20130029327 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS, METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, including groups of nucleic acid molecules that may be used as a signature marker set, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 01-31-2013 |
20130029328 | METHODS AND KITS FOR THE IDENTIFICATION OF ANIMALS HAVING A GREATER POTENTIAL FOR DESIRABLE CHARACTERISTICS, AND FOR THE EARLY IDENTIFICATION OF FAT DEPOSITS IN BOVINES - The present invention relates to a method and a kit for the identification of animals having greater potential for desirable characteristics of meat quality, rib eye area (REA), weaning weight and 18-month weight by means of the analysis of specific markers. | 01-31-2013 |
20130029329 | DETECTION OF AAD-12 SOYBEAN EVENT 416 - The invention relates in part to methods of detecting an AAD-12 soybean event. The subject invention provides assays for detecting the presence of the subject event in a sample (of soybeans, for example). Kits and conditions useful in conducting the assays are also provided. More specifically, the present invention relates in part to an endpoint TaqMan PCR assay for the AAD-12 soybean event. Some embodiments are directed to assays that are capable of high throughput zygosity analysis. The subject invention further relates, in part, to the discovery of a preferred reference gene for use in determining zygosity. This invention also relates in part to plant breeding using any of the subject methods. In some embodiments, said event/polynucleotide sequence can be “stacked” with other traits. The subject procedures can be used to uniquely identify soybean lines comprising the event of the subject invention. | 01-31-2013 |
20130029330 | MUTANT LDL RECEPTOR GENE - There is disclosed a method of identifying individuals susceptible to familial hypercholesterolemia and which method comprises identifying in a sample from said individual at least one polymorphism at position 1706-2 of the coding region (41902 of the genomic DNA) in the low density lipoprotein receptor gene, and wherein the presence of at least one said polymorphism is indicative of said individual being of a higher susceptibility to familial hypercholesterolemia. | 01-31-2013 |
20130029331 | NOVEL FLUORESCENCE-BASED ASSAY FOR THE RAPID DETECTION AND QUANTIFICATION OF DEOXYRIBONUCLEOSIDE TRIPHOSPHATES - The inventors have developed a rapid and sensitive fluorescence-based assay to quantify dNTPs. This assay relies on the principle that incorporation of a limiting dNTP is required for primer-extension and polymerase-mediated 5-3′ exonuclease hydrolysis of a quenched fluorophore-labeled probe resulting in fluorescence. The concentration of limiting dNTPs is directly proportional to the fluorescence generated. This assay has important applications in research that investigates the influence of pathological conditions or pharmacological agents on dNTP biosynthesis and regulation. | 01-31-2013 |
20130029332 | COMPOSITIONS AND METHODS FOR DETECTING NOONAN SYNDROME - Diagnostic and therapeutic applications for Noonan Syndrome are described. The diagnostic and therapeutic applications are based on certain mutations in a RAS-specific guanine nucleotide exchange factor gene SOS1 or its expression product. The diagnostic and therapeutic applications are also based on certain mutations in a serine/threonine protein kinase gen RAF1 or its expression product thereof. Also described are nucleotide sequences, amino acid sequences, probes, and primers related to RAF1 or SOS1, and variants thereof, as well as host cells expressing such variants. | 01-31-2013 |
20130029333 | Magnetic Bead Quantum Dot Nanoparticle Assay - The present disclosure includes a magnetic bead (MB) quantum dot (QD) nanoparticle assay for detecting, capturing, separating, and/or quantifying a target in a sample. | 01-31-2013 |
20130029334 | mRNA As Biomarkers For Liver Injury or Other Liver Perturbations - The present invention provides a method for assessing the likelihood or for detecting the presence of liver perturbation in an individual. The method is particularly useful for detecting drug-induced liver injury (DILI) or other forms of hepatotoxicity or hepatic perturbation. The method comprises measuring the level of at least one RNA biomarker comprising mRNA and comparing the measured level to an appropriate reference value for the sample type and RNA biomarker type, and wherein a significant difference between the measured level and the reference value is indicative of liver perturbation. | 01-31-2013 |
20130029335 | SPINOCEREBELLAR ATAXIA TYPE 8 AND METHODS OF DETECTION - The present invention provides an isolated nucleic acid molecule containing a repeat region of an isolated spinocerebellar ataxia type 8 (SCA8) coding sequence, the coding sequence located within the long arm of chromosome 13, and the complement of the nucleic acid molecule. Diagnostic methods based on identification of this repeat region are also provided. | 01-31-2013 |
20130029336 | KRAS Primers and Probes - The present invention provides oligonucleotide primers or probes for the detection of a mutation of the KRAS gene. The invention also provides a method for detecting a mutation in the KRAS gene using the oligonucleotide primers or probes disclosed therein. Furthermore, the present invention encompasses a method for predicting the sensitivity of a tumor in a patient to epidermal growth factor receptor-directed chemotherapy, comprising obtaining DNA from the tumor; and determining whether there is a mutation in codon 12 and/or a mutation in codon 13 in exon 2 of the KRAS gene in the DNA using a method utilizing at least one of the oligonucleotide primers and/or probes of the present invention. | 01-31-2013 |
20130029337 | METHODS AND USES INVOLVING GENETIC ABNORMALITIES AT CHROMOSOME 12 - The present invention relates to the fields of genetics and oncology and provides methods for predicting and identifying tumors of epithelial origin. Specifically, the present invention relates to a novel method of predicting tumor initiation, tumor progression and/or carcinomas, the method comprising detecting genetic abnormality associated with tumors of epithelial origin. The present invention further relates to a novel method of identifying an individual with potential for developing carcinoma, the method comprising detection of genetic abnormalities. The present invention also relates to a method of predicting the progression of carcinomas and the transformation thereof to an aggressive variant, the method comprising detection of genetic abnormalities, which indicate the probability to develop carcinoma. The present invention also relates to a use of specific chromosomal region, a gene or a fragment thereof, and/or genetic markers for predicting tumor initiation, tumor progression and/or carcinoma. The present invention also relates to a use of specific chromosomal region or a gene or a fragment thereof in therapy, for the development of therapy, and for the preparation of a medicament for treating tumors of epithelial origin. | 01-31-2013 |
20130034848 | TUMOR SUPPRESSOR GENE P33ING2 - The invention provides isolated nucleic acid and amino acid sequences of novel human tumor suppressors, antibodies to such tumor suppressors, methods of detecting such nucleic acids and proteins, methods of screening for modulators of tumor suppressors, and methods of diagnosing and treating tumors with such nucleic acids and proteins. | 02-07-2013 |
20130034849 | DIAGNOSIS OF HEREDITARY SPASTIC PARAPLEGIAS (HSP) BY DETECTION OF A MUTATION IN THE KIAA1840 GENE OR PROTEIN - The invention relates to an ex vivo method of diagnosing or predicting an hereditary spastic paraplegias (HSP), in a subject, which method comprises detecting a mutation in the KIAA1840 gene or protein (spatacsin), wherein said mutation is indicative of an hereditary spastic paraplegias (HSP). | 02-07-2013 |
20130034850 | MARKER FOR DETECTING MYOGENIC DISEASE AND DETECTION METHOD USING THE SAME - A marker for myogenic disease and a non-invasive, highly sensitive method for detecting the marker are presented. Analysis of blood levels of miR-1, miR-133a, miR-133b, and miR-206 in a subject is used to detect levels of the marker indicating myogenic disease. The method is independent of exercise-induced stress. | 02-07-2013 |
20130034851 | DETECTION OF METHYLATED DNA - The use of ion sensitive field effect transistor (ISFET) to detect methylated nucleotides in a DNA sample is described. A method of detecting methylated nucleotides in a DNA sample may include the steps of treating a sample of DNA with a reagent which discriminates between methylated and non-methylated nucleotides to provide treated DNA, amplifying the treated DNA and optionally sequencing the amplified DNA. An ISFET is used to monitor the addition of one or more dNTPs in the strand extension reactions during the amplification and/or sequencing step. Suitable apparatus is also provided. | 02-07-2013 |
20130034852 | METHOD FOR THE SELECTION OF A LONG-TERM PRODUCING CELL - Herein is reported a method for determining methylation of a promoter nucleic acid operably linked to a nucleic acid encoding a polypeptide and thereby determining the long-term productivity of a cell. Also an aspect is a method for selecting a cell for producing a polypeptide by determining the methylation of the promoter nucleic acid operably linked to the structural gene encoding the polypeptide. | 02-07-2013 |
20130034853 | TWO-COLOR CHROMOGENIC IN SITU HYBRIDIZATION - The present invention relates to systems and processes for chromogenic in situ hybridization (CISH), and in particular to methods that prevent interference between two or more color detection systems in a single assay. The present invention also relates to processes for scoring assays utilizing break-apart probes. | 02-07-2013 |
20130034854 | Antibody-Nanoparticle Conjugates and Methods for Making and Using Such Conjugates - Disclosed herein are antibody-nanoparticle conjugates that include two or more nanoparticles (such as gold, palladium, platinum, silver, copper, nickel, cobalt, iridium, or an alloy of two or more thereof) directly linked to an antibody or fragment thereof through a metal-thiol bond. Methods of making the antibody-nanoparticle conjugates disclosed herein include reacting an arylphosphine-nanoparticle composite with a reduced antibody to produce an antibody-nanoparticle conjugate. Also disclosed herein are methods for detecting a target molecule in a sample that include using an antibody-nanoparticle conjugate (such as the antibody-nanoparticle conjugates described herein) and kits for detecting target molecules utilizing the methods disclosed herein. | 02-07-2013 |
20130034855 | DETECTION OF MUTATIONS IN A GENE ENCODING IKB KINASE-COMPLEX-ASSOCIATED PROTEIN TO DIAGNOSE FAMILIAL DYSAUTONOMIA - A method for detecting the presence in a subject of a polymorphism linked to a gene associated with familial dysautonomia, said method comprising detecting a disruptive mutation in a gene of said subject encoding the IκB kinase-complex-associated protein, and, preferably, detecting a T→C change in position 6 of the donor splice site of intron 20 and/or a G→C transversion of nucleotide 2390 in exon 19 of the gene encoding the IκB kinase-complex-associated protein which is present on chromosome 9q31. Also disclosed are oligonucleotide primers useful in the detection method. This abstract is provided to comply with the rules requiring an abstract that will allow a searcher or other reader to ascertain quickly the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. | 02-07-2013 |
20130040292 | NANOPARTICLE BIOSENSOR, METHOD OF PREPARING SAME AND USES THEREOF - The invention relates to the field of biosensors and, more specifically, to nanoparticle biosensors comprising: a magnetic core, a silica layer, one or more outer metal layers which can be of different types and deposited in an alternating manner and immobilized on the outer surface, and a layer of synthetic or natural organic or inorganic biosensor molecules that can bind to biomolecules. The invention also relates to a method of obtaining the nanoparticle biosensors as well as to the different uses thereof. | 02-14-2013 |
20130040293 | METHODS FOR GENETIC ANALYSIS OF DNA TO DETECT SEQUENCE VARIANCES - Methods for determining genotypes and haplotypes of genes are described. Also described are single nucleotide polymorphisms and haplotypes in the ApoE gene and methods of using that information. | 02-14-2013 |
20130040294 | COMPOSITIONS AND METHODS FOR PERFORMING HYBRIDIZATIONS WITH NO DENATURATION - This disclosure is directed to, inter alia, methods and compositions for hybridizing at least one molecule to a target. The invention may, for example, eliminate the use of, or reduce the dependence on formamide in hybridization. Compositions for use in the invention include an aqueous composition comprising at least one nucleic acid sequence and at least one polar aprotic solvent in an amount effective to denature double-stranded nucleotide sequences. | 02-14-2013 |
20130040295 | METHOD TO INCREASE DETECTION EFFICIENCY OF REAL TIME PCR MICROARRAY BY QUARTZ MATERIAL - A reactor for the quantitative analysis of target nucleic acids using an evanescent wave detection technique and a method for the quantitative analysis of target nucleic acids are provided. The reactor includes a substrate with a cavity, a buffer layer arranged over the substrate, a quartz cover plate arranged over the buffer layer, and inlet and outlet ports. The reactor is thermally and chemically stable for PCR processing and suitable for an evanescent wave detection technique. | 02-14-2013 |
20130040296 | METHOD AND RAPID TEST DEVICE FOR DETECTION OF TARGET MOLECULE - Method and rapid test device for detection of target molecule from sample with which is performed purification and preprocessing of sample, preparation and modification, amplification, detection and capturing of target molecule, producing, of signal, amplification and visualization of read | 02-14-2013 |
20130040297 | PROCESS FOR THE PRODUCTION OF CELLS WHICH ARE CAPABLE OF CONVERTING ARABINOSE - The invention relates to a process for the production of cells which are capable of converting arabinose, comprising the following steps:
| 02-14-2013 |
20130040298 | Two-pore channels as regulators of proliferation in cancer - The present invention relates to the discovery that two pore K | 02-14-2013 |
20130040299 | METHOD FOR DETECTING OR MONITORING SEPSIS BY ANALYSING CYTOKINE MRNA EXPRESSION LEVELS - The present invention relates to a method for identifying patients who are likely to develop sepsis in response to infection, a method for monitoring the progress of sepsis in a patient and to an assay kit for identifying patients who are likely to develop sepsis and/or monitoring the progress of sepsis. | 02-14-2013 |
20130045476 | METHOD FOR COMBINED MONITORING OF DETECTION OF AT LEAST TWO MOLECULAR TARGETS AND TO A KIT THEREFOR - The invention relates to methods for combined monitoring of detection of at least two molecular targets. | 02-21-2013 |
20130045477 | DIRECT NUCLEIC ACID ANALYSIS - Methods and apparatus are described for nucleic acid analysis of swab samples without the need for purification. | 02-21-2013 |
20130045478 | NOVEL METHOD FOR ANALYZING DNA METHYLATION - This invention provides a method for efficiently detecting DNA methylation. The method for detecting DNA methylation comprises subjecting DNA to bisulfite treatment, subjecting DNA after bisulfite treatment to a first PCR, subjecting the resultant to nested PCR, and subjecting amplified DNA to denaturing gradient gel electrophoresis. | 02-21-2013 |
20130045479 | METHODS FOR EVALUATING THE STAGE OF OVARIAN CANCER OR THE SURVIVAL RATE OF AN OVARIAN CANCER PATIENT - An object of the present invention is to provide a method for detecting cancer through identification of genes exhibiting characteristic behavior in the cases of cancer such as ovarian cancer, and a cell growth inhibitor. The present invention provides a method for detecting cancer, which comprises detecting canceration including malignancy of a specimen through detection of at least one alteration of a gene existing in a chromosomal region 2q14. 2, 3p24. 1, 3q26. 2, 3q29, 4q34. 2, 6q23, 9p21. 3, 11q13. 3, 13q22.1, 13q33. 1, 13q33. 3, 15q12, 15q15. 1, 17p12, 17p13. 1, 17p13. 3, 18q21. 1, 18q21. 2, 18q21. 31, 18q21. 32, 18q21. 33, 18q23, 20q13. 13, 20q13. 2, 20q13. 31, 20q13. 33, Xp11. 23, Xp13.1, Xp13. 3, Xp26. 2, Xp26. 3, or Xq28 in the specimen. | 02-21-2013 |
20130052645 | METHOD FOR IDENTIFYING BACTERIA IN A SAMPLE - This invention describes a method for identifying bacteria. In particular, this invention relates to a method for identifying and quantifying mycobacteria from a sputum sample taken from a subject using flow cytometry. Further described is the use of flow cytometry to identify and quantify | 02-28-2013 |
20130059299 | ABERRANT MITOCHONDRIAL DNA, ASSOCIATED FUSION TRANSCRIPTS AND TRANSLATION PRODUCTS AND HYBRIDIZATION PROBES THEREFORE - The present invention provides novel mitochondrial fusion transcripts, the parent mutated mtDNA molecules, and the resulting translation products (proteins) for predicting, diagnosing and/or monitoring cancer. Hybridization probes complementary thereto for use in the methods of the invention are also provided. | 03-07-2013 |
20130059300 | Insect Resistant Cotton Plants And Methods For Identifying Same - The invention provides specific transgenic cotton plants, plant material and seeds, characterized in that these products harbor a specific transformation event at a specific location in the cotton genome. Tools are also provided which allow rapid and unequivocal identification of the event in biological samples. | 03-07-2013 |
20130059301 | ASXL1 AS A NEW DIAGNOSTIC MARKER OF MYELOID NEOPLASMS - A method for diagnosing a myeloid cancer in a subject, includes the step of analyzing a biological sample from the subject by determining the presence or the absence of a mutation in the ASXL1 (additional sex combs like 1) gene coding for the polypeptide having the sequence SEQ ID N°2. A kit for diagnosing myeloid cancer in a subject including at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a such a method is also described. | 03-07-2013 |
20130059302 | NUCLEIC ACID DETECTION APPARATUS, METHOD AND COMPUTER READABLE RECORDING MEDIUM - A light reception section receives fluorescence emitted according to the amount of target nucleic acid that has been amplified by PCR due to a light source illuminating excitation light onto a reaction liquid. Electrical signals from the light reception section whose level depends on the received fluorescence intensity are amplified by plural amplification circuits having different amplification factors. A multiplexor selects an electrical signal amplified with an amplification factor in an initial stage of an amplification reaction and detects a fluorescence value for that cycle. A CPU acquires the largest fluorescence value in the initial stage and determines the amplification factor for a corrected stage and inputs a selection signal to the multiplexor to select the electrical signal amplified by the determined amplification factor. In the corrected stage the electrical signal amplified with the determined amplification factor is selected and fluorescence values detected. | 03-07-2013 |
20130059303 | CDKN2A AS A PROGNOSTIC MARKER IN BLADDER CANCER - The present invention provides methods for predicting clinical outcome and for providing information for determining follow-up strategy of a subject affected with a non-muscle invasive bladder cancer, as well as a method for selecting a subject affected with a non-muscle invasive bladder cancer for an anti-tumoral therapy. The present invention also provides kits for implementing these methods. | 03-07-2013 |
20130059304 | TRANSLOCATION AND MUTANT ROS KINASE IN HUMAN NON-SMALL CELL LUNG CARCINOMA - In accordance with the invention, a novel gene translocation, (4p15, 6q22), in human non-small cell lung carcinoma (NSCLC) that results in a fusion proteins combining part of Sodium-dependent Phosphate Transporter Isoform NaPi-3b protein (SLC34A2) with Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS) kinase has now been identified. The SLC34A2-ROS fusion protein is anticipated to drive the proliferation and survival of a subgroup of NSCLC tumors. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of the new fusion protein enables new methods for determining the presence of these mutant ROS kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention. | 03-07-2013 |
20130059305 | TRANSLOCATION AND MUTANT ROS KINASE IN HUMAN NON-SMALL CELL LUNG CARCINOMA - In accordance with the invention, a novel gene translocation, (4p15, 6q22), in human non-small cell lung carcinoma (NSCLC) that results in a fusion proteins combining part of Sodium-dependent Phosphate Transporter Isoform NaPi-3b protein (SLC34A2) with Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS) kinase has now been identified. The SLC34A2-ROS fusion protein is anticipated to drive the proliferation and survival of a subgroup of NSCLC tumors. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of the new fusion protein enables new methods for determining the presence of these mutant ROS kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention. | 03-07-2013 |
20130059306 | PRIMER AND PROBE FOR DETECTING CHLAMYDIA TRACHOMATIS, AND METHOD FOR DETECTING CHLAMYDIA TRACHOMATIS USING SAME - The present invention relates to an oligonucleotide which is designed on the basis of a nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and hybridizes with the endogenous plasmid gene of | 03-07-2013 |
20130059307 | Methods And Compositions For Detecting Fungi And Mycotoxins - The invention relates to a method of identifying a specific fungal species in patient tissue or body fluid. The method comprises the steps of extracting and recovering DNA of the fungal species from the patient tissue or body fluid, amplifying the DNA, hybridizing a probe to the DNA to specifically identify the fungal species, and specifically identifying the fungal species. The invention also relates to a method of identifying a mycotoxin in patient tissue or body fluid. The method comprises the steps of extracting and recovering the mycotoxin from the patient tissue or body fluid, contacting the mycotoxin with an antibody directed against the mycotoxin, and identifying the myocotoxin. Both of these methods can be used to determine if a patient is at risk for or has developed a disease state related to a fungal infection, and to develop an effective treatment regimen for the patient. | 03-07-2013 |
20130059308 | POLYMER MICROFILTERS AND METHODS OF MANUFACTURING THE SAME - A microfilter comprising a polymer layer formed from epoxy-based photo-definable dry film, and a plurality of apertures each extending through the polymer layer. A method of forming a microfilter is also disclosed. The method includes providing a first layer of epoxy-based photo-definable dry film disposed on a substrate, exposing the first layer to energy through a mask to form a pattern, defmed by the mask, in the first layer of dry film, forming, from the exposed first layer of dry film, a polymer layer having a plurality of apertures extending therethrough, the plurality of apertures having a distribution defined by the pattern, and removing the polymer layer from the substrate. | 03-07-2013 |
20130065228 | GENOME-SCALE ANALYSIS OF ABERRANT DNA METHYLATION IN COLORECTAL CANCER - Particular aspects provide methods and compositions (e.g., gene marker panels) having substantial utility for at least one of diagnosis, identification and classification of colorectal cancer (CRC) (e.g., tumors) relating to distinctive DNA methylation-based subgroups of CRC including CpG island methylator phenotype (CIMP) groups (e.g., CIMP-H and CIMP-L) and non-CIMP groups. Exemplary marker panels include: B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 (CIMP marker panel); and FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel). Further aspects relate to genetic mutations, and other epigenetic markers relating to said CRC subgroups that can be used in combination with the gene marker panels for at least one of diagnosis, identification and classification of colorectal cancer (CRC) (e.g., tumors) relating to distinctive CIMP and non-CIMP groups. | 03-14-2013 |
20130065229 | BIOMARKERS FOR SYSTEMIC LUPUS ERYTHEMATOSUS - The present invention provides methods and reagents for diagnosing system lupus erythematosus and for monitoring system lupus erythematosus disease activity in a subject. | 03-14-2013 |
20130065230 | SOYBEAN EVENT pDAB9582.814.19.1 DETECTION METHOD - Soybean Event pDAB9582.814.19.1 comprises genes encoding Cry1F, Cry1Ac (synpro), and PAT, affording insect resistance and herbicide tolerance to soybean crops containing the event, and enabling methods for crop protection and protection of stored products. The invention provides PCR event detection methods. | 03-14-2013 |
20130065231 | Primer and Probe for Use In Detection of Mycobacterium Kansasii and Method for Detection of Mycobacterium Kansasii Using The Same - The present invention discloses an oligonucleotide which comprises a part or the entire sequence of the nucleotide sequence depicted in SEQ ID NOS: 1-4, or a part or the entire sequence of a nucleotide sequence complementary to SEQ ID NOS: 1-4, wherein the oligonucleotide is capable of hybridizing with the nucleotide sequence of | 03-14-2013 |
20130065232 | ASSAYS AND KITS FOR SEROTYPING PSEUDOMONAS AERUGINOSA AND OLIGONUCLEOTIDE SEQUENCES USEFUL IN SUCH METHODS AND KITS - The present invention relates to assays, kits and oligonucleotides for the detection of | 03-14-2013 |
20130065233 | DETECTION OF DNA METHYLATION - In a first aspect, the invention concerns a method for detecting or quantifying DNA methylation at a locus. In one embodiment, a methylation-sensitive endonuclease is formulated together with a polymerase enzyme in an appropriate reaction mixture such that amplification of DNA occurs in a methylation specific manor. Quantitative DNA amplification at selected loci can be used to determine the level of methylation. Kits and reagents for performing such methods are also provided. | 03-14-2013 |
20130065234 | METHOD FOR DIAGNOSING BONE AND JOINT DISEASE BASED ON SINGLE NUCLEOTIDE POLYMORPHISM IN CHROMOSOME 10Q24 - Provided is a method for diagnosing a bone and joint is disease such as scoliosis. A single nucleotide polymorphism present in region 24 on the long arm of chromosome 10 (region 10q24) is analyzed and the risk of onset of a bone and joint disease and/or the presence or absence of onset of the same are diagnosed on the basis of a result of the analysis. | 03-14-2013 |
20130065235 | BINDING AND FUNCTIONAL ASSAYS THAT USE THE T1R3 RECEPTOR TO SCREEN FOR TASTE MODULATORY COMPOUNDS - Newly identified mammalian taste-cell-specific G protein-coupled receptors, and the genes and cDNA encoding said receptors are described. Specifically, T1R G protein-coupled receptors active in taste signaling, and the genes and cDNA encoding the same, are described, along with methods for isolating such genes and for isolating and expressing such receptors. Methods for representing taste perception of a particular tastant in a mammal are also described, as are methods for generating novel molecules or combinations of molecules that elicit a predetermined taste perception in a mammal, and methods for simulating one or more tastes. Further, methods for stimulating or blocking taste perception in a mammal are also disclosed. | 03-14-2013 |
20130065236 | METHOD FOR REAL-TIME NUCLEIC ACID AMPLIFICATION BY DROPLET MANIPULATION - The present invention provides a real-time nucleic acid amplification method capable of quickly and accurately detecting fluorescence obtained by a nucleic acid amplification method performed in a droplet in a perfect closed system. A real-time nucleic acid amplification reaction method for performing a nucleic acid amplification reaction in a droplet present in a container, wherein the droplet is composed of a nucleic acid amplification reaction liquid including a nucleic acid to be amplified and magnetic particles; the container holds a droplet encapsulating medium immiscible with the nucleic acid amplification reaction liquid forming the droplet, and has a transport surface having a temperature gradient; and at least the droplet encapsulating medium out of the droplet and the droplet encapsulating medium includes a fluorochrome at start of the nucleic acid amplification reaction, the method comprising transporting the droplet together with the magnetic particles by generating a magnetic field by means for applying a magnetic field to start and maintain a nucleic acid amplification reaction so that the droplet is placed on the transport surface at a temperature point at which the nucleic acid synthesis reaction is started and maintained, thereby controlling a temperature of the reaction liquid. | 03-14-2013 |
20130065237 | NOVEL MIXTURES FOR ASSAYING NUCLEIC ACID, NOVEL METHOD OF ASSAYING NUCLEIC ACID WITH THE USE OF THE SAME AND NUCLEIC ACID PROBE TO BE USED THEREFOR - [Problems] To provide a novel mixture for assaying a target nucleic acid, characterized by enabling a nucleic acid assay while: 1) requiring no step of diluting the target nucleic acid; 2) requiring no procedure of changing a probe concentration depending on a concentration of the target nucleic acid. | 03-14-2013 |
20130065238 | SYNGAP1 DYSFUNCTIONS AND USES THEREOF IN DIAGNOSTIC AND THERAPEUTIC APPLICATIONS FOR MENTAL RETARDATION - The invention identifies Syngap1 dysfunctions as causative of mental retardation. Described are methods of detecting mental retardation and methods of detecting non-syndromic mental retardation (NSMR) in a human subject. Particular methods comprise sequencing a human subject's genomic DNA for comparison with a control sequence from an unaffected individual. Also described are probes, kits, antibodies and isolated mutated Syngap1 proteins. | 03-14-2013 |
20130071836 | COLON CANCER BIOMARKER DISCOVERY - The present application discloses an epigenetic marker for colon cancer. | 03-21-2013 |
20130071837 | Method and System for Characterizing or Identifying Molecules and Molecular Mixtures - A system and method for identifying a material passing through a nanopore filter wherein an electrical signal is detected as a result of the passage and that signal is processed in real-time using mathematical and statistical tools to identify the molecule. A carrier molecule is preferably attached to one or more molecule(s) under consideration using a non-covalent bond and the pore in the nanopore filter is sized so that the molecule rattles around in the pore before being discharged without passing through the filter pore. The present invention includes not only a method and system for identifying the molecule(s) under consideration but also a kit for setting up the filter as well as mathematical tools for analyzing the signals from the sensing circuitry for the molecule(s) under consideration. | 03-21-2013 |
20130071838 | PEPTIDE NUCLEIC ACID PROBES FOR ANALYSIS OF CERTAIN STAPHYLOCOCCUS SPECIES - The present invention relates to peptide nucleic acid (PNA) probes, PNA probe sets and methods for the analysis of certain | 03-21-2013 |
20130071839 | SYSTEMS AND METHODS FOR DETECTING BIOMARKERS OF INTEREST - In some embodiments, a strand displacement system is provided. Such a system may include a first nucleic acid catalyst molecule; a nucleic acid gate molecule, wherein the first nucleic acid catalyst molecule binds the nucleic acid gate molecule forming a nucleic acid gate-catalyst complex and releases an output molecule; and a nucleic acid sink molecule. The nucleic acid sink molecule sequesters a putative second nucleic acid catalyst, wherein the second nucleic acid catalyst differs from the first nucleic acid catalyst molecule by at least one nucleotide. In some aspects, the first nucleic acid catalyst may include a biomarker of interest or a nucleic acid aptamer which binds an amino acid-based biomarker of interest. | 03-21-2013 |
20130071840 | ENHANCED DETECTION OF NON-SOMATIC CIRCULATING NUCLEIC ACIDS - Methods, equipment and software for the detection of abnormal nucleic acid or fetal nucleic acid sequences circulating in the subject's blood or other body fluids. A scan of a subject's circulating nucleic acid (CNA) is compared to the CNA Data On Normal Healthy Population or to a scan of the subject's own Somatic Nucleic Acid (SNA). Abnormal peaks are identified by subtracting out the “normal” or somatic peaks. The resultant anomalous peaks are compared to anomalous CNA data to identify the abnormalities, or the anomalous peaks of the subject's CNA are isolated, amplified, and sequenced or probed to determine the nature of the anomaly. | 03-21-2013 |
20130071841 | TRANSLOCATION AND MUTANT ROS KINASE IN HUMAN NON-SMALL CELL LUNG CARCINOMA - In accordance with the invention, a novel gene translocation, (4p15, 6q22), in human non-small cell lung carcinoma (NSCLC) that results in a fusion proteins combining part of Sodium-dependent Phosphate Transporter Isoform NaPi-3b protein (SLC34A2) with Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS) kinase has now been identified. The SLC34A2-ROS fusion protein is anticipated to drive the proliferation and survival of a subgroup of NSCLC tumors. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of the new fusion protein enables new methods for determining the presence of these mutant ROS kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention. | 03-21-2013 |
20130071842 | Hypermethylation Biomarkers for Detection of Head and Neck Squamous Cell Cancer - Differentially methylated oral squamous cell carcinoma (OSCC) biomarkers, identified in-vitro and validated in well-characterized surgical specimens, have shown poor clinical correlation in cohorts with different risk profiles. To overcome this lack of relevance we used the HumanMethylation27 BeadChip, publicly available methylation and expression array data, and Quantitative Methylation Specific PCR to uncover differential methylation in OSCC clinical samples with heterogeneous risk profiles. A two stage-design consisting of Discovery and Prevalence screens was used to identify differential promoter methylation and deregulated pathways in patients diagnosed with OSCC and head and neck squamous cell carcinoma. This Phase I Biomarker Development Trial identified a panel of differentially methylated genes in normal and OSCC clinical samples from patients with heterogeneous risk profiles. This panel may be useful for early detection and cancer prevention studies. | 03-21-2013 |
20130071843 | METHODS, PROBE SETS, AND KITS FOR DETECTION OF DELETION OF TUMOR SUPPRESSOR GENES BY FLUORESCENCE IN SITU HYBRIDIZATION - Methods, probe sets, kits, and compositions for gene deletion assays are disclosed. In some embodiments, the methods relate to preparing probes for a deletion assay, performing a deletion assay, or optimizing a deletion assay. In some embodiments, the methods and probe sets can provide reduced artifactual deletion frequency, for example, when analyzing samples subject to truncation artifacts. In some embodiments, the methods and probe sets can distinguish between small and large deletions. | 03-21-2013 |
20130071844 | METHOD FOR DETECTING TARGET BASE SEQUENCE USING COMPETITIVE PRIMER - Disclosed is a method of detecting a target base sequence having a polymorphic base, the method including: (a) a step of adding to a nucleic acid sample having a target nucleic acid that includes a base sequence including the target base sequence: at least one type of detection primer, at least one type of competitive primer, and at least one type of common primer; (b) a step of annealing the detection primer and the competitive primer to the target nucleic acid in a competitive manner, thereby synthesizing an extension product A; (c) a step of annealing the common primer to the extension product A obtained in the step (b) or in the following step (d), thereby synthesizing an extension product B; (d) a step of annealing the detection primer or the competitive primer to the extension product B obtained in the previous step (c), thereby synthesizing the extension product A; and (e) a step of detecting the extension product A or the extension product B. | 03-21-2013 |
20130071845 | IDENTIFICATION OF HUMAN MOUSE DOUBLE MINUTE 2 HOMOLOG NUCLEOTIDE SEQUENCES - The invention is directed to isolated genomic polynucleotide fragments that encode human carboxypeptidase M and human mouse double minute 2 homolog, vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain human carboxypeptidase M and human mouse double minute 2 homolog and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 03-21-2013 |
20130071846 | KIT AND METHOD - The present invention relates to a kit comprising a DNA-dependant DNA polymerase and at least one natural deoxynucleoside and to a kit comprising a DNA-dependent DNA polymerase and a detection system comprising a DNA template molecule, a DNA primer molecule, and a fluorescent moiety capable of being displaced from,or bound to, dsDNA synthesized by said DNA-dependent polymerase. It further relates to A method for measuring deoxynucleoside kinase activity in a sample characterized by; (i) contacting the sample, in a container, with a reaction mix comprising a DNA-dependent DNA polymerase, at least one deoxynucleoside and a detection system comprising a DNA template molecule, a DNA primer molecule, and a fluorescent moiety capable of being incorporated in, displaced from,or bound to dsDNA synthesized by said DNA dependent polymerase; (ii) incubating said container; (iii) measuring the signal from the fluorescent moiety;and correlating the signal from the fluorescent moietyto the deoxynucleoside kinase activity in the sample. | 03-21-2013 |
20130078624 | Systems and methods for multi-purpose analysis - Systems and methods are provided for sample processing. A device may be provided, capable of receiving the sample, and performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing multiple assays. The device may comprise one or more modules that may be capable of performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing the steps using a small volume of sample. | 03-28-2013 |
20130078625 | FLUID HANDLING APPARATUS AND CONFIGURATIONS - Systems and methods are provided for sample processing. A device may be provided, capable of receiving the sample, and performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing multiple assays. The device may comprise one or more modules that may be capable of performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing the steps using a small volume of sample. | 03-28-2013 |
20130078626 | CATEGORIZATION OF DNA SAMPLES - The present application describes methods for accurate and cost-effective categorization of DNA samples into different types of in vitro generated DNA or different types of natural DNA such as from different tissues and/or physiological/pathological states. The invention achieves categorization by comparing “signal ratios” that are correlated to ratios of methylation levels at specific genomic loci, but does not rely on calculation of actual methylation levels at any genomic locus. Therefore the disclosed inventive method eliminates the requirement for external DNA species and controls, thereby simplifying and increasing the accuracy of the assay. The described inventive technology also enables performing the categorization of DNA together with DNA profiling in the same reaction, thereby allowing for concomitant categorization and determination of identity of the samples. | 03-28-2013 |
20130078627 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS, METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, including groups of nucleic acid molecules that may be used as a signature marker set, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 03-28-2013 |
20130078628 | Single nucleotide polymorphisms of human chromosome 4 in the inositol polyphosphate-4-phosphatase type II gene (INPP4b gene) for the diagnosis or pre-diagnosis of multiple sclerosis - The invention relates to a single nucleotide polymorphism (SNP) of the nucleobase at base position 143470133 (rs13102150) of human chromosome 4 in the inositol polyphosphate 4-phosphatase type II gene (INPP4b gene) for the diagnosis or pre-diagnosis of multiple sclerosis or for determining the risk of contracting multiple sclerosis. | 03-28-2013 |
20130078629 | METHOD FOR DETECTING NUCLEIC ACIDS BY PROMOTING BRANCHED DNA COMPLEX FORMATION - Disclosed is a method for detecting nucleic acids by promoting branched DNA complex formation. The target nucleic acid detection signal and sensitivity can be dramatically increased by promoting self assembly of branched DNA between a plurality of amplified DNA targets and a single-chain oligonucleotide probe, by means of the integrated implementation of PCR, thermal denaturation and hybridization in a single reaction mixture. | 03-28-2013 |
20130078630 | Use of G-Clamp for Improved Allele-SpecificPCR - The present invention includes a method of allele-specific amplification, utilizing an allele-specific oligonucleotide, at least partially complementary to more than one variant of the target sequence, but having at least one selective nucleotide complementary to only one variant of the target sequence and incorporating at least one “G-clamp” nucleotide. | 03-28-2013 |
20130078631 | Probe, and polymorphism detection method using the same - The present disclosure relates to a probe for detecting a polymorphism, a method of detecting a polymorphism, a method of evaluating the efficacy of a drug, and a reagent kit for detecting a polymorphism. | 03-28-2013 |
20130078632 | MATERIALS AND METHODS FOR PROGNOSIS OF PROGRESSION OF BARRETT'S ESOPHAGUS - A method of prognosticating progression of Barrett's esophagus in a patient comprising detecting in a sample of esophageal cells from the patient at least one abnormality selected from the group consisting of p16 loss, p53 loss, chromosome 7 aneuploidy, and chromosome 17 aneuploidy, which method can further comprise detecting at least one abnormality selected from the group consisting of 20q gain, C-myc gain, and Her2 gain; and a kit comprising (a) a set of probes comprising a probe for p16, a probe for p53, a probe for chromosome 7, and a probe for chromosome 17 and (b) instructions comprising determining at least one abnormality selected from the group consisting of p16 loss, p53 loss, chromosome 7 aneuploidy, and chromosome 17 aneuploidy, which kit can further comprise at least one additional probe selected from the group consisting of a probe for 20q, a probe for C-myc, and a probe for Her2 and additional instructions comprising determining at least one additional abnormality selected from the group consisting of 20q gain, C-myc gain, and Her2 gain. | 03-28-2013 |
20130078633 | Detection of Isotype Profiles as Signatures for Disease - The invention provides a non-invasive technique for the detection and quantification of immunoglobulin isotypes, in a biological sample containing a plurality of distinct cell populations. Methods are conducted using sequencing technology to detect and enumerate immunoglobulin isotype profiles within a heterogeneous biological sample. | 03-28-2013 |
20130078634 | SEQUENCES AND THEIR USE FOR DETECTION AND CHARACTERIZATION OF STEC BACTERIA - This invention relates to a rapid method for detection and characterization of STEC bacteria based on the presence of nucleic acid sequences, in particular, to a PCR-based method for detection, and to oligonucleotide molecules and reagents and kits useful therefore. This method is preferably employed to detect STEC bacteria in a food or water sample, such as a beef enrichment. The present invention further relates to isolated polynucleotides, replication compositions, kits, and reagent tablets for carrying out the method of the present invention. | 03-28-2013 |
20130078635 | RAPID METHOD FOR IDENTIFYING DRUG-RESISTANT GENE USING ARTIFICIAL CHROMOSOME OF PLASMODIUM, AND METHOD FOR PREPARING RECOMBINANT PLASMODIUM - The present invention relates to a rapid method for identifying a drug-resistant gene using an artificial chromosome of a protozoa. Specifically, it relates to a method for screening for a drug-resistant gene, which involves preparing a recombinant | 03-28-2013 |
20130078636 | METHOD FOR DETECTING AND QUANTITATING MULTIPLE SUBCELLULAR COMPONENTS - A method for detecting and quantitating multiple and unique fluorescent signals from a cell sample is provided. The method combines immunohistochemistry and a fluorescent-labeled in situ hybridization techniques. The method is useful for identifying specific subcellular components of cells such as chromosomes and proteins. | 03-28-2013 |
20130078637 | ANTIPSYCHOTIC-INDUCED PARKINSONISM GENOTYPES AND METHODS OF USING SAME - The present invention relates to genotypes associated with resistance to antipsychotic-induced parkinsonism and other extrapyramidal symptoms induced by antipsychotics, and use of said genotypes for assessment of patient populations. The methods and kits of the invention are based on identifying in a sample obtained from a subject, specific SNPs in the ZFPM2 and RGS2 genes. | 03-28-2013 |
20130084564 | ASSESSMENT OF CANCER RISK BASED ON RNU2 CNV AND INTERPLAY BETWEEN RNU2 CNV AND BRCA1 - Polynucleotides useful for detecting copy number variation of RNU2 sequences and methods of assessing risk of developing breast or ovarian cancer using molecular combing and/or detection or quantification of BRCA1 expression. | 04-04-2013 |
20130084565 | VERSATILE, VISIBLE METHOD FOR DETECTING POLYMERIC ANALYTES - The invention provides methods to detect or determine the presence or amount of a polymeric analyte in a sample, which employ magnetic substrates and subjects the sample and the magnetic substrate to forms of energy so as to induce aggregate formation. | 04-04-2013 |
20130084566 | FETAL METHYLATION MARKERS - This application describes the discovery that, in a pregnant woman, certain genes (such as RASSF1A, APC, CASP8, RARB, SCGB3A1, DAB2IP, PTPN6, THY1, TMEFF2, and PYCARD) originated from a fetus are highly methylated, whereas the same genes of maternal origin are unmethylated. This discovery allows the easy detection of one or more of these methylated fetal genes in a biological sample from a pregnant woman, serving as a universal indicator of the presence of fetal DNA in the sample. These fetal methylation markers are particularly useful as positive controls for a non-invasive analytical process during which the quality and quantity of fetal DNA are monitored. These newly identified fetal markers can also be measured directly for diagnosis of certain pregnancy-related conditions. | 04-04-2013 |
20130084567 | Systems and Methods of Sample Processing and Temperature Control - Systems and methods of sample processing and temperature control are disclosed. The invention may especially relate to temperature control, and may in some embodiments be methods of temperature control of an automated sample processing system and methods of automated sample processing. Specifically, the present invention provides temperature control in relation to sample processing systems and methods of processing samples, and in some embodiments provides temperature control in relation to sample carriers and processing materials such as reagents. Corresponding systems and devices are disclosed, including sample processing systems ( | 04-04-2013 |
20130084568 | Probe, and polymorphism detection method using the same - The present disclosure relates to a probe for detecting a polymorphism, a method of detecting a polymorphism, a method of evaluating the efficacy of a drug, and a reagent kit for detecting a polymorphism. | 04-04-2013 |
20130084569 | NANOMOTORS AND MOTION-BASED DETECTION OF BIOMOLECULAR INTERACTIONS - Techniques and systems are disclosed for detecting biomolecular interactions based on the motion of nanomotors. In one aspect, a method of detecting biomolecular interactions based on a motion of a nanomachine includes functionalizing a nanomachine with a capture probe adapted to interact with biological targets; and detecting a presence of the biological targets in an environment based on a motion of the nanomachine. | 04-04-2013 |
20130084570 | METHODS OF EVALUATING RESPONSE TO CANCER THERAPY - A method of evaluating a cancer patient comprising evaluating gene expression levels in a patient sample, calculating a predictor score using the gene expression levels, and assessing the likelihood of a therapeutic outcome using the predictor score is disclosed. | 04-04-2013 |
20130084571 | METHYLATION PROFILING OF DNA SAMPLES - The present disclosure relates to methodology for fast and cost-effective identification of the source of DNA samples. DNA samples obtained from unknown or unrecognized tissues or cell types are analyzed according to the methodology described herein, yielding an identification of the tissue and/or cell type source. Identification is based on sequential biochemical procedures including methylation sensitive/dependent restriction and polymerase chain reaction, followed by analysis of the data. All biochemical steps are performed in a single test tube. The disclosure has immediate applications in forensic science for identification of the tissue source of DNA obtained from biological stains. The disclosure also has immediate applications in cancer diagnosis for identification. | 04-04-2013 |
20130089859 | COMPOSITIONS, METHODS AND KITS TO DETECT ADENOVIRUS NUCLEIC ACIDS - The disclosed invention is related to methods, compositions, kits and isolated nucleic acid sequences for targeting Adenovirus nucleic acid. Compositions include amplification oligomers and/or detection probe oligomers. Kits and methods comprise at least one of these oligomers. | 04-11-2013 |
20130089860 | COMPARATIVE TRANSCRIPT ANALYSIS - One example embodiment includes a method of comparative transcript analysis. The method includes providing an antisense DNA probe. The method also includes linking a blocking adapter to the antisense DNA probe. | 04-11-2013 |
20130089861 | Detection of Immune Cells, In Particular T Cells Through DNA-Methylation Analysis of the Genes CCR6 and BLR1 - The present invention relates to a method, in particular an in vitro method, for identifying certain immune cells of a mammal, comprising analysing the methylation status of at least one CpG position in the gene CCR6 and/or BLR1 or an orthologous or paralogous gene thereof, and the use of DNA-methylation analysis of the genes of the proteins CCR6 and/or BLR1 for a detection and quality assurance and control of certain immune cells. In particular, the present invention relates to analysing the methylation status of at least one CpG position in the gene CCR6 in T cells. Furthermore, the present invention relates to a kit for performing the above methods, as well as to respective uses. | 04-11-2013 |
20130089862 | Genetic Lesion Associated With Cancer - The invention comprises methods for identifying mutations within the 3′UTR of genes that lead to increased risk or probability of developing cancer. | 04-11-2013 |
20130089863 | RISK CALCULATION FOR EVALUATION OF FETAL ANEUPLOIDY - The present invention provides processes for determining accurate risk probabilities for fetal aneuploidies. Specifically, the invention provides non-invasive evaluation of genomic variations through chromosome-selective sequencing and non-host fraction data analysis of maternal samples. | 04-11-2013 |
20130089864 | METHODS FOR CHARACTERIZING KIDNEY FUNCTION - Embodiments of the invention relate generally to methods of characterizing kidney function. In particular, several embodiments quantify kidney-associated marker RNA isolated from vesicles contained in patient urine samples. In some embodiments, the quantified RNA from urine vesicles is compared to a normal population and in some embodiments is compared to the patient to evaluate kidney function over time | 04-11-2013 |
20130095474 | DESIGN OF STEM-LOOP PROBES AND UTILIZATION IN SNP GENOTYPING - Stem-loop probe for single nucleotide polymorphism (SNP) genotyping of individual SNP nucleic acid target sequences has first, second, and third single stranded nucleic acid portions. Second portion is between the first and third portions. First and third portions build a double stranded, intramolecular stem. Second portion forms a single stranded oligonucleotide loop with a nucleotide sequence, complementary to individual SNP nucleic acid target sequences. The nucleotide sequence of probe is matches probe/target hybrids have a melting point T | 04-18-2013 |
20130095475 | GENES FROM THE 20Q13 AMPLICON AND THEIR USES - The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases. | 04-18-2013 |
20130095476 | DETECTION OF QUANTITATIVE GENETIC DIFFERENCES - A method for detection of a quantitative difference between the amount of a first target region of nucleic acid and a second target region of nucleic acid in a sample, comprising the steps of: providing the sample comprising the nucleic acid; amplifying the first and second target regions of the nucleic acid to obtain multiple copies of a first and a second sequence of nucleic acid; associating the amplified first sequence with the amplified second sequence to form associated nucleic acid complexes which comprise the first sequence and the second sequence in a 1:1 ratio, wherein any excess of either the first sequence or the second sequence remain un-associated; detecting any un-associated sequences, wherein detection of any un-associated sequences is indicative of a quantitative difference between the amount of the first and second target regions of nucleic acid in the sample. | 04-18-2013 |
20130095477 | Non-Invasive Method for the Early Detection of Stomach Cancer - The invention relates to a non-invasive method for the early detection of stomach cancer, based on the identification of a biomarker. The biomarker corresponds to the methylated promoter region of the Reprimo gene. | 04-18-2013 |
20130095478 | HtSNPs FOR DETERMINING A GENOTYPE OF CYTOCHROME P450 1A2, 2A6 AND 2D6, PXR AND UDP-GLUCURONOSYLTRANSFERASE 1A GENE AND MULTIPLEX GENOTYPING METHODS USING THEREOF - The present invention relates to htSNPs for determining a genotype of cytochrome P450 1A2 (CYP1A2), 2A6 (CYP2A6) and 2D6 (CYP2D6), PXR and UDP-glucuronosyltransferase 1a (UGT1A) genes and a gene chip using the same, and more particularly, to a selection method of htSNPs for determining a haplotype of human CYP1A2, CYP2A6, CYP2D6, PXR and UGT1A genes, a method of determining a genotype of the genes by using the htSNPs and a gene chip therefor. | 04-18-2013 |
20130095479 | PRIMERS, PROBES AND METHODS FOR NUCLEIC ACID AMPLIFICATION - Homogenous detection during or following PCR amplification, preferably LATE-PCR, utilizing fluorescent DNA dye and indirectly excitable labeled primers and probes, improves reproducibility and quantification. Low-temperature homogeneous detection during or following non-symmetric PCR amplification, preferably LATE-PCR, utilizing fluorescent DNA dye and indirectly excitable labeled mismatch-tolerant probes permits analysis of complex targets. Sequencing sample preparation methods following LATE-PCR amplifications reduce complexity and permit “single-tube” processing. | 04-18-2013 |
20130095480 | Chondroitin Sulfate Sulfotransferases and Proteoglycans as Cancer Biomarkers: Use of Expression and Methalytion Status - A method of determining a prognosis of a cancer in a human comprising: determining expression level of CHST11 in a cancer tissue sample or determining methylation status of CHST11 gene in a cancer tissue sample. CHST11 is Carbohydrate (Chondroitin 4) Sulfotransferase 11. | 04-18-2013 |
20130095481 | METHODS FOR PREDICTING LIKELIHOOD OF RESPONDING TO TREATMENT - The disclosure provides materials and methods related to using biomarkers for prediction of duration of response to prostate cancer treatment and for treating prostate cancer. | 04-18-2013 |
20130095482 | METHODS OF DETECTING PREGNANCY-ASSOCIATED PLASMA PROTEIN-A2 (PAPP-A2) - The present invention provides pregnancy associated plasma protein A2 (PAPP-A2), its nucleotide and amino acid sequences, antisense molecules to the nucleotide sequences which encode PAPP-A2, expression vectors for the production of purified PAPP-A2, antibodies capable of binding specifically to PAPP-A2, hybridization probes or oligonucleotides for the detection of PAPP-A2-encoding nucleotide sequences, genetically engineered host cells for the expression of PAPP-A2, and methods for screening for pathologies in pregnant and non-pregnant patients. Methods for screening for altered focal proliferation states in pregnant and/or non-pregnant patients, which include detecting levels of PAPP-A2, are also described. | 04-18-2013 |
20130095483 | PREDICTIVE BIOMARKERS FOR BREAST CANCER - The invention relates to compositions and methods for detecting, screening, diagnosing or determining the progression of, regression of and/or survival from a proliferative disease or condition, specifically breast cancer. The invention also provides new assays and kits for the staging or stratifying breast cancer patients or patients suspected of having breast cancer. | 04-18-2013 |
20130095484 | Systems And Methods For Predicting Response To Anti-Androgen Therapy For The Treatment Of Androgenetic Alopecia - Methods, processes, systems, and apparatuses are disclosed for predicting anti-androgen therapy response in the treatment of androgenetic alopecia based on a fluorometric assay and proteomics. | 04-18-2013 |
20130095485 | Materials and Methods for Detecting the Aryloxyalkanoate Dioxygenase Gene (AAD-12) Containing Event pDAB4472-1606 in Plants - This application provides materials and methods for the detection of the aad-12 gene and event pDAB4472-1606 in biological samples derived from plants. | 04-18-2013 |
20130095486 | Materials and Methods for Detecting the Aryloxyalkanoate Dioxygenase Gene (AAD-12) in Plants - This application provides materials and methods for the detection of aad-12 gene events in biological samples derived from recombinant plants and a materials and methods for the detection of contaminating events in samples derived from recombinant plants. | 04-18-2013 |
20130095487 | Interferon-Gamma Response as a Diagnostic Test for Persistent Chlamydial Infections - The present invention provides a non-invasive, sensitive, and convenient diagnostic test for persistent Chlamydial infection and diseases arising from persistent Chlamydial infection. The present invention also provides kits for diagnosis of persistent Chlamydial infection. | 04-18-2013 |
20130095488 | Nucleotide Sequences Encoding Insecticidal Proteins - The present invention provides nucleotide sequences encoding an insecticidal protein exhibiting lepidopteran inhibitory activity, as well as a novel insecticidal protein referred to herein as a Cry1A.105 insecticide, transgenic plants expressing the insecticide, and methods for detecting the presence of the nucleotide sequences or the insecticide in a biological sample. | 04-18-2013 |
20130095489 | PROCESS FOR DETECTION OF MULTIDRUG RESISTANT TUBERCULOSIS USING REAL-TIME PCR AND HIGH RESOLUTION MELT ANALYSIS - Compositions and process are provided for the rapid and specific detection of drug resistant forms of | 04-18-2013 |
20130101997 | GENETIC MARKER FOR THE DIAGNOSIS OF DEMENTIA WITH LEWY BODIES - Specific alterations in BChE gene have been found which allow determining whether a patient suffers from dementia with Lewy bodies (DLB), and allow distinguishing it from Alzheimer's disease. The invention provides an in vitro method for the diagnosis of DLB comprising determining in a biological sample from a subject, the genotype of the following alterations in butyrylcholinesterase (BChE) gene: the polymorphic sites at position 68974 in NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 28), and the polymorphic sites 3687, 4206, 4443, and the poly-thymine region at positions 4780 to 4786, said positions with reference to NCBI Accession Number NG_009031 (i.e. positions 3687, 4206 and 4443 respectively in SEQ ID NO: 1), which corresponds to the nucleotide sequence of human BChE gene. | 04-25-2013 |
20130101998 | METHOD FOR DIAGNOSING KIDNEY DISEASE COMPRISING DETECTING THE LEVEL OF ANNEXIN A2 OR S100A6 - The present invention provides biomarkers for detecting kidney disease, selected from the oligonucleotide sequence, complementary sequence or derivatives, amino acid sequence or derivatives, fragment, variants, antibody of annexin A2 or S100A6 or combinations thereof. Moreover, the present invention also provides an assay kit and a method for kidney disease detecting, practically for the kidney disease resulting from acute tubular necrosis. | 04-25-2013 |
20130101999 | MULTI-LEG LUMINESCENT NANOPARTICLES, MULTI-LEG LUMINESCENT NANOPARTICLE COMPOUNDS AND VARIOUS APPLICATIONS - Multi-leg luminescent nanoparticles (“MLN's”) that can be paired to other MLN's as well s biological molecules to film branched multi-leg luminescent nanoparticles (“BMLN's) that can be used in biological multiplexing applications, imaging applications, biological detection applications and other biological applications. | 04-25-2013 |
20130102000 | PEPTIDE NUCLEIC ACID PROBE, KIT AND METHOD FOR DETECTION AND/OR QUANTIFICATION OF SALMONELLA SPP. AND APPLICATIONS THEREOF - The present invention refers to the development of a Peptide Nucleic acid (PNA) probe for the detection of the | 04-25-2013 |
20130102001 | METHOD TO DETERMINE ZYGOSITY OF THE FAD2 GENE IN CANOLA USING END-POINT TAQMAN PCR - The subject disclosure relates in part to endpoint TaqMan® PCR assays for the detection and high throughput zygosity analysis of the fad-2 gene in canola. The subject disclosure further relates, in part, to the use of wild type DNA as a reference for use in determining zygosity. These and other related procedures can be used to uniquely identify the zygosity and variety of canola lines comprising the subject gene. The subject disclosure also provides related kits for determining zygosity from a sample of a canola plant or seed, for example. | 04-25-2013 |
20130102002 | METHOD TO DETERMINE ZYGOSITY OF THE FAD3 GENE IN CANOLA USING END-POINT TAQMAN.RTM. PCR - The subject disclosure relates in part to endpoint TaqMan® PCR assays for the detection and high throughput zygosity analysis of the fad-3c gene in canola. The subject disclosure further relates, in part, to the use of wild type DNA as a reference for use in determining zygosity. These and other related procedures can be used to uniquely identify the zygosity and variety of canola lines comprising the subject gene. The subject disclosure also provides related kits for determining zygosity from a sample of a canola plant or seed, for example. | 04-25-2013 |
20130102003 | Point-of-Care Immunoassay for Quantitative Small Analyte Detection - Point-of-care assays for quantitatively measuring the amount of small analytes, such as opioids, tetrahydrocannibinol (“THC”), or hormones, in a biological sample are disclosed. The assays are capable of non-competitive detection of a small analyte using binding agents that selectively bind the analyte and capture agents that selectively bind a complex of the binding agent and analyte but do not bind either free binding agent or free analyte. The assay is capable of simultaneous diction of multiple analytes for multiplex analysis and quantitative control. Quantitative measurements are obtained by plotting results against a response surface calculated from a plurality of analyte standards and adjusted using internal controls. | 04-25-2013 |
20130102004 | Endometrial Phase or Endometrial Cancer Biomarkers - Methods for detecting endometrial diseases or an endometrium phase in a subject are described comprising measuring endometrial markers or polynucleotides encoding the markers in a sample from the subject. The invention also provides localization or imaging methods for endometrial diseases, and kits for carrying out the methods of the invention. The invention also contemplates therapeutic applications for endometrial diseases employing endometrial markers, polynucleotides encoding the markers, and/or binding agents for the markers. | 04-25-2013 |
20130109013 | PROBE AND PRIMER FOR TUBERCLE BACILLUS DETECTION, AND METHOD OF DETECTING HUMAN TUBERCLE BACILLUS THEREWITH | 05-02-2013 |
20130109014 | AUTOMATIC SYSTEM FOR DETECTION AND IDENTIFICATION OF ISOLATED CELLS FROM BLOOD OR TISSUE | 05-02-2013 |
20130109015 | Single Nucleotide Polymorphisms Associated with Left Ventricular Hypertrophy and Use Thereof | 05-02-2013 |
20130109016 | PRIMER COMPOSITION FOR AMPLIFYING A GENE REGION HAVING VARIOUS VARIATIONS IN A TARGET GENE | 05-02-2013 |
20130109017 | MULTIPLE MYELOMA PROGNOSIS AND TREATMENT | 05-02-2013 |
20130109018 | Methods and Compositions for Detection and Enrichment of Target Small RNAs | 05-02-2013 |
20130109019 | HAPTEN CONJUGATES FOR TARGET DETECTION | 05-02-2013 |
20130115594 | HIGH SPECIFICITY AND HIGH SENSITIVITY DETECTION BASED ON STERIC HINDRANCE & ENZYME-RELATED SIGNAL AMPLIFICATION - The present invention relates to a molecular probe capable of high sensitivity and high specificity detection of a target nucleic acid in a sample. Also disclosed is a detection method using this probe. | 05-09-2013 |
20130115595 | METHOD TO DETECT REPEAT SEQUENCE MOTIFS IN NUCLEIC ACID - Methods for determining the presence or absence of expansion of CGG repeat sequence in the FMR1 gene presence or absence of expansion of CCG repeat sequence in the FMR2 gene are provided. The methods are useful in identifying an individual with normal/intermediate, versus premutation or full mutation allele of FMR1 gene and FMR2 gene due to the expansion of CGG repeats and CCG repeats in the 5′-untranslated region respectively. The methods are also useful for screening newborns for fragile X syndrome or for screening women to determine heterozygosity status with full premutation of the CCG repeat tract. The methods are also useful in estimating the premutation and full mutation carrier frequency and estimating the prevalence of FXTAS AND FXPOI in a population. The methods are simple, rapid and require small amount of sample. | 05-09-2013 |
20130115596 | DNA POLYMORPHISMS AS MOLECULAR MARKERS IN CATTLE - A method of predicting the phenotype of cattle through the analysis of one or more single nucleotide polymorphisms (SNPs) is described. More particularly, a method for predicting cattle temperament and behavior through the analysis of one or more single nucleotide polymorphisms (SNPs) mapped at specific regions of the bovine genome is described. | 05-09-2013 |
20130115597 | METHOD FOR DETECTING SPECIFIC NUCLEIC ACID SEQUENCES - The present invention relates to a method and test kit for detecting specific nucleic acid sequences, comprising the steps of: 1. matrix-dependent new synthesis of the target nucleic acid; 2. target-specific probe hybridization; and 3. detection of the hybridization event. The invention is characterized in that, in the first step, an oligonucleotide 1, which is marked by a marker 1 and is entirely or partially complementary to the target sequence, acts as a primer in the matrix-dependent new synthesis of the target nucleic acid and, in the second step, an oligonucleotide 2, which is marked by a marker 2 and, owing to its melting temperature being lower than that of the oligonucleotide 1, is not involved in the first step, partially or completely hybridizes with the DNA new synthesis product of oligonucleotide 1.The detection of the hybridization reaction can take place both fluorometrically in the form of a homogeneous assay and, for verification of the result, subsequently immunologically. The detection reaction always takes place in time after the matrix-dependent new synthesis has been carried out. | 05-09-2013 |
20130115598 | OLIGONUCLEOTIDE PROBE RETRIEVAL ASSAY FOR DNA TRANSACTIONS IN MAMMALIAN CELLS - Methods to measure a variety of DNA synthetic processes in live human cells by introducing and retrieving exogenous DNA probes are provided herein. Using fragments of bacterial plasmid or phage DNA, a wide array of DNA constructs may be assembled to mimic the intermediates of DNA transactions, including replication, translation synthesis, and end-joining. These DNA probes may be transfected into human cells and retrieved for mutational analysis using a modified Random Mutation Capture assay or NextGen DNA sequencing. These assays require only a small number of cells, such as might be available from biopsy material. Thus, the methods described herein may be applied to the early detection of cancer, predicting the responsiveness of individual cancers to chemotherapy, and measuring the DNA repair capacity of individuals to environmental DNA damaging agents. This approach may be automated and used for screening human populations for variations in DNA synthetic and repair activities. | 05-09-2013 |
20130115599 | INCREASED CIP2A EXPRESSION AND BLADDER CANCER IN HUMANS - The present invention provides a method of detecting CIP2A protein in a bladder tissue. Methods and compositions are provided herein for detecting and diagnosing bladder cancer by obtaining a bladder tissue from a human subject suspected of bladder cancer, followed by detecting CIP2A protein or mRNA levels in the bladder tissue using Western blot analysis or ELISA to specifically detect CIP2A protein or qRT-PCR to specifically detect CIP2A mRNA. The present method permits specific detection of CIP2A protein or mRNA in bladder tissue as a biomarker for bladder cancer in humans. | 05-09-2013 |
20130115600 | SEQUENCES AND THEIR USE FOR DETECTION OF SALMONELLA - This invention relates to a rapid method for detection of | 05-09-2013 |
20130115601 | TISSUE TYPING ASSAYS AND KITS - The present invention relates generally to compositions of lyophilised reagents suitable for nucleic acid amplification use in in-vitro diagnostics. More particularly, the invention relates to lyophilised PCR reagent compositions and methods for genotyping including HLA and/or ABO and/or HFE typing. | 05-09-2013 |
20130115602 | ENDOGENETIC RETROVIRAL SEQUENCES, ASSOCIATED WITH AUTOIMMUNE DISEASES OR WITH PREGNANCY DISORDERS - A genomic retroviral nucleic material, in an isolated or purified state, at least partially functional or non-functional, wherein the genome comprises a reference nucleotide sequence selected from the group including sequences of SEQ ID NOs: 1-15, their complementary sequences, and their equivalent sequences, in particular, nucleotide sequences having, for every series of 100 contiguous monomers, at least 70% and preferably at least 90% homology with the sequences of SEQ ID NOs: 1-15. | 05-09-2013 |
20130122492 | DETECTION, ISOLATION AND ANALYSIS OF RARE CELLS IN BIOLOGICAL FLUIDS - The invention provides a method for isolating or enriching a rare cell from a biological fluid of a mammal employing an antibody that binds a cell-surface antigen of the rare cell. The immobilized antibody is incubated with a sample of biological fluid that includes the rare cells and a plurality of other cells so as to form an antibody-rare cell complex. The complex can be detected or isolated and subsequently analyzed by any of a variety of physical, chemical and genetic techniques. | 05-16-2013 |
20130122493 | DETECTION OF NEIGHBORING VARIANTS - The present invention relates to methods, kits, probes, and systems for distinguishing between nucleotide variants that are close in proximity on a gene. The methods, kits, probes, and systems can include the use of a small amplicon assay in combination with two unlabeled probes in a high resolution thermal melting analysis of a biological sample containing a locus of interest in order to discern between disease-causing and benign variants that are close in proximity on a gene within the biological sample. The present invention also relates to method of detecting a disease in a patient based on the patient's genotype by determining whether the patient has a disease-causing variant at a locus of interest. The signature melt curves produced by the unlabeled probe tests can be analyzed using HRMA software to distinguish between disease-causing and benign variants that are close in proximity on a gene within the biological sample. | 05-16-2013 |
20130122494 | DETECTION OF CANCER - Assays for detecting and grading disease by assessing amounts of GSTP1 nucleic acid and ADAM protein in a sample, and methods of using the assays. In some embodiments, the assays use single molecule sequencing to simultaneously assay both GSTP1 nucleic acid and ADAM protein. The methods are especially useful for detecting and grading cancers, for example, prostate cancer. | 05-16-2013 |
20130122495 | DIAGNOSIS KIT AND CHIP FOR BLADDER CANCER USING BLADDER CANCER SPECIFIC METHYLATION MARKER GENE - The present invention relates to a kit and nucleic acid chip for diagnosing bladder cancer using a bladder cancer-specific marker gene. More particularly, the invention relates to a kit and nucleic acid chip for diagnosing bladder cancer, which can detect the promoter methylation of a bladder cancer-specific gene, the promoter or exon region of which is methylated specifically in transformed cells of bladder cancer. The use of the diagnostic kit or nucleic acid chip of the invention enables diagnosis of bladder cancer at an early stage of transformation, thus enabling early diagnosis of bladder cancer, and can diagnose bladder cancer in a more accurate and rapid manner compared to a conventional method. | 05-16-2013 |
20130122496 | STORAGE OF NUCLEIC ACID - Processes are disclosed for storing nucleic acid in a stable form. A solution comprising nucleic acid is applied to an unmodified, silica-based substrate whereby at least a portion of the nucleic acid binds to a surface of the substrate, the bound nucleic acid is washed and dried, and the resulting dried nucleic acid on the substrate is stored at from 5° C. to 60° C. for a period of at least one week. | 05-16-2013 |
20130122497 | THERAPEUTIC TARGETS FOR ADRENOCORTICAL CARCINOMA - This invention identifies and provides a recurrent translocation t(4;8) (p16.2; p23.1) associated with Adrenocortical Carcinoma, and diagnostic methods using the translocation by FISH hybridization or PCR based assays. | 05-16-2013 |
20130122498 | NUCLEIC ACID PROBES AND METHODS FOR DETECTING PLASMODIUM PARASITES - This invention relates to novel nucleic acid-based probes and methods for detecting | 05-16-2013 |
20130122499 | SYSTEM AND METHOD OF DETECTING LOCAL COPY NUMBER VARIATION IN DNA SAMPLES - Systems and methods for measuring local copy number variation in DNA samples are provided. In particular, methods for detecting copy number variation in circulating free DNA (cfDNA) that may be used to assay for copy number variations often corresponding to cancerous cells or tumors are provided. | 05-16-2013 |
20130122500 | ASSAY SYSTEMS FOR GENETIC ANALYSIS - The present invention provides assay systems and methods for detection of copy number variation at one or more loci and polymorphism detection at one or more loci in a mixed sample from an individual. | 05-16-2013 |
20130122501 | METHODS AND VECTORS FOR PRODUCING TRANSGENIC PLANTS - Methods of, and compositions for, assembling one or more transcription units in a genome without a linked selectable marker or other unwanted transcription unit are provided. Also provided methods of, and compositions for, assembling one or more transcription units in a genome with a reduced frequency of vector backbone. | 05-16-2013 |
20130122502 | NANOPROBES FOR DETECTION OR MODIFICATION OF MOLECULES - The disclosure provides probes for one or more target molecules. In particular examples, the probes include a molecular linker and first and second functional groups linked and spaced by the molecular linker, wherein the functional groups are capable of interacting with one another or with the target biomolecule in a predetermined reaction, and wherein the molecular linker maintains the first and second functional groups sufficiently spaced from one another such that the functional groups do not substantially interact in an absence of the target biomolecule. In the presence of the target biomolecule the functional groups interact (with each other, with the target biomolecule, or both), and in some examples a detectable signal is produced. In some examples, the functional groups can detect or modify a target molecule. Also provided are methods of using the probes, for example to detect or modify a target molecule. | 05-16-2013 |
20130122503 | METHOD FOR PRODUCING RNA-CONTAINING PROBE FOR DETECTING A TARGET NUCLEOTIDE - An object of the present invention is to provide a simple and useful method for producing an RNA-containing probe for detecting a target nucleotide, a simple and useful method, device, and system for processing nucleotide sequence information, and a simple and useful method for detecting a target nucleotide. The present invention provides a method for processing nucleotide sequence information, the method comprising the step of generating partial nucleotide sequences which has 7 to 14 nucleotides and a Tm value of 25 to 40° C. and in which a target nucleotide or a nucleotide adjacent to the target nucleotide is located at a position between 3 and 5 nucleotides from the 3′ or 5′ end. The method according to the present invention is useful for simply and efficiently producing an RNA-containing probe for detecting a target nucleic acid, without the basis of researchers' experiences or guess, and are extremely useful not only in the field of genetic engineering, but also in the field of medical research. | 05-16-2013 |
20130130239 | Test for Detecting Xanthomonas axonopodis pv. allii - The present invention relates to novel tools for detecting | 05-23-2013 |
20130130240 | METHODS FOR IDENTIFYING DRUG RESISTANT MYCOBACTERIUM - Presented herein are methods for determining the presence of a non-mutated | 05-23-2013 |
20130130241 | ANDROGEN RECEPTOR ISOFORMS AND METHODS - The invention relates to exploiting differences in androgen receptor gene amplification and expression of androgen receptor isoforms in various cell types such as, for example, prostate tumor cells. In one aspect, the invention provides a method for detecting unbalanced amplification of androgen receptor isoforms. Generally, the method includes receiving a biological sample obtained from a subject, the biological sample comprising cells expressing a plurality of non-wild-type androgen receptors, measuring the copy number of at least a polynucleotide encoding a first non-wild-type androgen receptor and a polynucleotide encoding a second non-wild-type androgen receptor, thereby producing an expression ratio, and identifying the sample as exhibiting unbalanced amplification of androgen receptor if the expression ratio is no less than a predetermined expression ratio. In another aspect, the invention provides a method of analyzing a biological sample from a subject. Generally, the method includes receiving the biological sample, the biological sample comprising cells expressing a plurality of androgen receptor isoforms, measuring expression of at least one androgen receptor isoform, and identifying the sample as exhibiting a predetermined pattern of androgen receptor isoform expression if at least one predetermined pattern of androgen receptor expression is detected. | 05-23-2013 |
20130130242 | METHOD FOR DETERMINING PRESENCE OR ABSENCE OF CANCER CELL IN BIOLOGICAL SAMPLE, AND MOLECULAR MARKER AND KIT FOR DETERMINATION - The present invention relates to a method for determining presence or absence of a cancer cell in a biological sample based on the analysis result obtained by analyzing methylation status of DNA extracted from the biological sample with a novel molecular marker allowing a determination of presence or absence of the cancer cell. | 05-23-2013 |
20130130243 | METHOD AND DEVICE FOR DETECTING AND QUANTIFYING AN ANALYTE WITH RECYCLING OF THE REAGENTS - The present invention relates to a method for detecting and quantifying an analyte present in a liquid of interest using a solid support, the surface of which comprises at least one active area on which at least one probe capable of binding said analyte is immobilized and a solution containing at least one secondary reagent capable of binding to the analyte, said method comprising a step consisting of recycling said solution in order to put it back into contact with the surface and notably with the active area at least one additional time. The present invention also relates to a device which may be applied within the scope of such a method. | 05-23-2013 |
20130130244 | P53 ASSAY FOR A URINE TEST FOR HCC SCREENING - A rapid and sensitive assay to detect p53 mutations in urine has been developed for use in screening cancer patients. The method uses a locked nucleic acid (LNA) clamp mediated one-step PCR-based assay with a sensitivity of up to a single copy and can be used not only in urine, but also other biological samples. The assay is particularly useful for hepatocellular carcinoma, colon cancer, breast cancer, lung cancer, prostate cancer, ovarian cancer, bladder cancer, lymphoma, and stomach cancer. | 05-23-2013 |
20130130245 | METHOD OF PLANT GENOME DESIGN, METHOD OF CREATING NEW CULTIVAR AND NEW CULTIVAR - Plant genome design method defines DNA markers M1 to M5, for each target region, DNA marker M2 is at an upstream side of a target region, or upstream thereof, DNA marker M1 is upstream of DNA marker M2, DNA marker M4 is at a downstream side of the target region, or downstream thereof, DNA marker M5 is downstream of DNA marker M4, and DNA marker M3 is in the target region; and designs a genome so that a substitution region, containing the target region, in a chromosome of the original cultivar to be substituted with a chromosome fragment derived from the foreign cultivar has an end on an upstream side between DNA marker M1 and DNA marker M2, and an end on a downstream side of the substitution region between DNA marker M4 and DNA marker M5. | 05-23-2013 |
20130130246 | METHODS FOR THE DETECTION, VISUALIZATION AND HIGH RESOLUTION PHYSICAL MAPPING OF GENOMIC REARRANGEMENTS IN BREAST AND OVARIAN CANCER GENES AND LOCI BRCA1 AND BRCA2 USING GENOMIC MORSE CODE IN CONJUNCTION WITH MOLECULAR COMBING - Methods for detecting genomic rearrangements in BRCA1 and BRCA2 genes at high resolution using Molecular Combing and for determining a predisposition to a disease or disorder associated with these rearrangements including predisposition to ovarian cancer or breast cancer. Primers useful for producing probes for this method and kits for practicing the methods. | 05-23-2013 |
20130130247 | Kits and Methods for Assessing Skin Health - The invention relates to kits and methods for assessing skin health for a human and the human's susceptibility to skin disorders. The methods involve assessing occurrence in the human's genome of one or more polymorphisms (e.g., single nucleotide polymorphisms) that occur in one or more genes associated disclosed herein and that are associated with a disorder in humans. Preferred assessment and scoring methods are disclosed, as are kits for performing the methods. | 05-23-2013 |
20130130248 | ENDORIBONUCLEASE COMPOSITIONS AND METHODS OF USE THEREOF - The present disclosure provides variant Csy4 endoribonucleases, nucleic acids encoding the variant Csy4 endoribonucleases, and host cells genetically modified with the nucleic acids. The variant Csy4 endoribonucleases find use in a variety of applications, which are also provided. The present disclosure also provides methods of detecting a specific sequence in a target polyribonucleotide; and methods of regulating production of a target RNA in a eukaryotic cell. | 05-23-2013 |
20130130249 | NUCLEIC ACID PRODUCTION AND SEQUENCE ANALYSIS - A method for producing a nucleic acid molecule from a template nucleic acid sequence and a linking unit attached to a primer, which method comprises a step of contacting the template nucleic acid sequence with a nucleic acid polymerase under conditions which allow the nucleic acid polymerase to produce the nucleic acid molecule from the primer based on the template nucleic acid sequence, wherein the linking unit is attached to a target site in the template nucleic acid sequence with a covalent linkage. | 05-23-2013 |
20130130250 | ISOLATED GLUCOKINASE GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM CHROMOSOME 7 - Provided are isolated genomic polynucleotide fragments that encode human SNARE YKT6, human glucokinase, human adipocyte enhancer binding protein (AEBP1) and DNA directed 50 kD regulatory subunit (POLD2), vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain SNARE YKT6, human glucokinase, AEBP1 protein and POLD2 and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 05-23-2013 |
20130130251 | IDENTIFICATION OF SNARE YKT6 SEQUENCES - Provided are isolated genomic polynucleotide fragments that encode human SNARE YKT6, human glucokinase, human adipocyte enhancer binding protein (AEBP1) and DNA directed 50 kD regulatory subunit (POLD2), vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain SNARE YKT6, human glucokinase, AEBP1 protein and POLD2 and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 05-23-2013 |
20130130252 | IDENTIFICATION OF POLD2 SEQUENCES - Provided are isolated genomic polynucleotide fragments that encode human SNARE YKT6, human glucokinase, human adipocyte enhancer binding protein (AEBP1) and DNA directed 50kD regulatory subunit (POLD2), vectors and hosts containing these fragments and fragments hybridizing to noncoding regions as well as antisense oligonucleotides to these fragments. The invention is further directed to methods of using these fragments to obtain SNARE YKT6, human glucokinase, AEBP1 protein and POLD2 and to diagnose, treat, prevent and/or ameliorate a pathological disorder. | 05-23-2013 |
20130130253 | METRONIDAZOLE RESISTANCE IN TRICHOMONAS VAGINALIS AND SINGLE NUCLEOTIDE POLYMORPHISMS - The present invention is directed to the discovery of single nucleotide polymorphisms (SNPs) in the presence of metronidazole-resistant | 05-23-2013 |
20130130254 | OPTICAL RESONATOR DIAGNOSTIC DEVICE AND METHODS OF USE - An implantable diagnostic device in accordance with the present disclosure provides various benefits such as a compact size thereby allowing implanting of the device inside animate objects; low cost due to incorporation of inexpensive detection circuitry and the use of conventional IC fabrication techniques; re-usability by heating thereby allowing multiple diagnostic tests to be performed without discarding the device; and a configuration that allows performing of simultaneous and/or sequential diagnostic tests for detecting one or more similar or dissimilar target molecules concurrently or at different times. | 05-23-2013 |
20130130255 | OPTICAL MAPPING OF GENOMIC DNA - A method for single-molecule optical DNA profiling using an exceptionally dense, yet sequence-specific coverage of DNA with a fluorescent probe, using a DNA methyltransferase enzyme to direct the DNA labeling, followed by molecular combing of the DNA onto a polymer-coated surface and subsequent sub-diffraction limit localization of the fluorophores. The result is a ‘DNA fluorocode’; a simple description of the DNA sequence, with a maximum achievable resolution of less than 20 bases, which can be read and analyzed like a barcode. The method generates a fluorocode for genomic DNA from the lambda bacteriophage using a DNA methyltransferase to direct fluorescent labels to four-base sequences reading 5′-GCGC-3′. A consensus fluorocode is constructed that allows the study of the DNA sequence at the level of an individual labeling site and is generated from a handful of molecules and entirely independently of any reference sequence. | 05-23-2013 |
20130130256 | ACF DETECTION METHOD - The present invention provides a method for detecting ACF by analyzing a test region of large intestine tissue at the molecular level. Namely, the present invention relates to a method for detecting aberrant crypt foci (ACF) that comprises detecting one or more types of molecules for which ACF-specific expression increases selected from the group consisting of GSTp, iNOS, CD44, EGFR, COX2 and Fzd1 present in a test region of large intestine tissue; the aforementioned ACF detection method wherein the diameter of the test region is 0.5 mm or less; a an ACF detection marker that is GSTp, iNOS, CD44, EGFR, COX2 or Fzd1; and, a method for evaluating risk of colorectal cancer and colorectal adenoma in subjects based on the results of detecting ACF in a test region of large intestine tissue of the subjects using the aforementioned ACF detection method. | 05-23-2013 |
20130130257 | MOBILE RAPID TEST SYSTEM FOR NUCLEIC ACID ANALYSIS - A mobile rapid test system for nucleic acid analysis. A method comprising the steps of amplification of the nucleic acids by means of rapid-PCR technology, conversion of a double-stranded amplification product into a single-stranded DNA fragment, hybridization with a labeled probe and detection of the nucleic acids on a lateral-flow test strip. A device comprising a reaction cavity which preferably consists of a thin film, inlet and outlet openings for the reaction cavity, one or more heatable sample blocks which are connected to miniaturized cooling bodies and a window for reading off the result. The lateral-flow test strip is a component of the mobile rapid test system. Operation of the instrument system requires no external power source, but only batteries or a rechargeable battery. | 05-23-2013 |
20130130258 | DETECTION, IDENTIFICATION AND DIFFERENTIATION OF EUBACTERIAL TAXA USING A HYBRIDIZATION ASSAY - The present invention relates to a method for the specific detection and/or identification of | 05-23-2013 |
20130130259 | Methods for evaluating the methylation status of a polynucleotide - The invention provides methods related to evaluating the methylation status of a polynucleotide that includes an internal control. | 05-23-2013 |
20130130260 | Methods to Fix and Detect Nucleic Acids - In one aspect, the invention relates to a method for fixing a short nucleic acid in a biological sample. In another aspect, the invention relates to a method for detecting a target short nucleic acid in a biological sample. The method includes contacting the biological sample with an aldehyde-containing fixative, and subsequently contacting the sample with a water-soluble carbodiimide. In a further aspect, the invention relates to a kit for fixing a short nucleic acid in a biological sample. The kit includes a support substrate for holding the sample; an aldehyde-containing fixative; and a water-soluble carbodiimide. | 05-23-2013 |
20130130261 | CHEMICAL SENSOR - A sensor comprising a memory device having a first electrode and a first chemical-sensing layer coupled to the first electrode. The chemical-sensing layer, in the presence of an analyte, is arranged to change a property of the Memristive device. The sensor can detect an analyte by providing a sample to be detected proximate the chemical sensing layer, observing the state of the memory element; and determining a property of the sample by comparing the observed state of the memory element with a previous state. The sensor is manufactured by depositing a second electrode on a surface, depositing an active layer or layers onto said second electrode, depositing a first electrode onto said active layer(s), and coupling a chemically sensitive layer to the first electrode. | 05-23-2013 |
20130137094 | One-Step Cell and Tissue Preservative for Morphologic and Molecular Analysis - The invention relates to a one-step chemical composition that preserves animal tissue, cells, and biomolecules, such as human tissue, human cells, and biomolecules therein. It improves the fidelity and morphologic structure of cells, organelles, and nuclear chromatin, and maintains and enhances the cellular antigenicity for immunohistochemistry and flow cytometry, while preserving proteins, post-translational modifications of proteins, and nucleic acids. In one embodiment, the composition comprises a) a non-aldehyde precipitating fixative at a concentration below 25% (volume/volume), b) a reversible/cleavable protein cross-linker that targets lipid-associated molecules, and c) a c reversible/cleavable protein cross-linker that targets water soluble molecules. In another embodiment, the composition further includes a kinase inhibitor, a phosphatase inhibitor, and a permeation enhancer. In still another embodiment, the compositions further include lactic acid at a concentration sufficient to maintain cellular nuclear volume at a level equivalent to aldehyde fixation of the same type of cell. In a further embodiment, the composition comprises: a) a precipitating fixative, b) a reversible/cleavable cross-linker, c) a permeation enhancer, d) a kinase inhibitor, e) a phosphatase inhibitor, and f) a carboxylic acid. In a still further embodiment, the invention comprises method for preserving a biological sample by contacting the sample with the composition of the invention under conditions effective for the preservation of the sample. | 05-30-2013 |
20130137095 | METHOD FOR IDENTIFYING TARGET BASE SEQUENCE - A method for identifying a base sequence accompanying competitive hybridization that includes a thermal denaturation subjecting a sample double-stranded nucleic acid and a reference double-stranded nucleic acid containing the same base sequence as a target base sequence to thermal denaturation treatment in a single reaction solution, a temperature lowering carrying out competitive hybridization between the sample double-stranded nucleic acid and the reference double-stranded nucleic acid by lowering the temperature of the reaction solution after the thermal denaturation, a measurement measuring a double-stranded nucleic acid formed by a nucleic acid strand that composed the reference double-stranded nucleic acid and a nucleic acid strand that composed the sample double-stranded nucleic acid, and an identification identifying identity between the reference double-stranded nucleic acid and the sample double-stranded nucleic acid based on measurement results obtained from the measurement, the temperature lowering being carried out in the presence of a cationic comb-type polymer. | 05-30-2013 |
20130137096 | Diagnosis of Hereditary Spastic Paraplegias (HSP) by Identification of a Mutation in the ZFVYE26 Gene or Protein - The Invention relates to an ex vivo method of diagnosing or predicting a hereditary spastic paraplegias (HSP), in a subject, which method comprises detecting a mutation in the ZFYVE26 gene or protein (spastizin), wherein said mutation is indicative of a hereditary spastic paraplegias (HSP). | 05-30-2013 |
20130137097 | HIGH THROUGHPUT SINGLE NUCLEOTIDE POLYMORPHISM ASSAY - A method consisting of a homogeneous assay detection system for a PCR process using FRET for detection and zygosity analysis of the HaAHASL1-A122(At)T single nucleotide polymorphism in sunflower is provided. The method provides specific sunflower-genome primers that can be used to detect the presence or absence of the HaAHASL1-A122(At)T single nucleotide polymorphism. The primer combinations for use in an endpoint PCR assay capable of determining zygosity and for assisting in breeding introgression are described. | 05-30-2013 |
20130137098 | METHOD OF DNA SEQUENCING BY HYBRIDISATION - Described herein is a method for determining a nucleic acid sequence, said method comprising: a) denaturing a double-stranded nucleic acid molecule corresponding to the said nucleic acid sequence by applying a physical force to the said molecule; b) providing a single-stranded nucleic acid molecule; c) renaturing the said double stranded nucleic acid molecule in the presence of the said single-stranded nucleic acid molecule; and d) detecting a blockage of the renaturation of the double-stranded nucleic acid. | 05-30-2013 |
20130137099 | TRANSGENIC REPORTER SYSTEM THAT REVEALS EXPRESSION PROFILES AND REGULATION MECHANISMS OF ALTERNATIVE SPLICING IN MAMMALIAN ORGANISMS - An object of the present invention is to develop a new alternative splicing reporter system and to provide a method for detecting alternative splicing patterns in a mammalian multicellular organism more precisely, a method for identifying efficiently substances and gene regions that affect alternative splicing in a mammalian multicellular organism, and the like by utilizing the alternative splicing reporter system. Specifically, the present invention relates to a method for detecting alternative splicing in a mammalian multicellular organism, and a method for identifying substances and gene regions that affect alternative splicing in a mammalian multicellular organism, which use a DNA construct in which at least two different reporter genes are inserted into a specific gene that undergoes alternative splicing, or a combination of DNA constructs (a combination of at least two different DNA constructs) in which DNA construct a reporter gene is inserted into a specific gene that undergoes alternative splicing. | 05-30-2013 |
20130137100 | GENETICALLY MODIFIED BACTERIUM OF THE SPECIES LISTERIA MONOCYTOGENES - The present invention relates to a genetically modified bacterium of the species | 05-30-2013 |
20130137101 | Methods of Modifying Eukaryotic Cells - A method for engineering and utilizing large DNA vectors to target, via homologous recombination, and modify, in any desirable fashion, endogenous genes and chromosomal loci in eukaryotic cells. These large DNA targeting vectors for eukaryotic cells, termed LTVECs, are derived from fragments of cloned genomic DNA larger than those typically used by other approaches intended to perform homologous targeting in eukaryotic cells. Also provided is a rapid and convenient method of detecting eukaryotic cells in which the LTVEC has correctly targeted and modified the desired endogenous gene(s) or chromosomal locus (loci) as well as the use of these cells to generate organisms bearing the genetic modification. | 05-30-2013 |
20130137102 | Methods and kits for modulating tumor invasiveness and metastatic potential - Methods and kits for evaluating invasive potential and metastatic potential of cancers by assessing Tiam1 expression levels in fibroblasts in the microenvironments surrounding tumors are provided. | 05-30-2013 |
20130143207 | METHODS AND COMPOSITIONS FOR IDENTIFYING BIOMARKERS USEFUL IN CHARACTERIZING BIOLOGICAL STATES - The present invention relates to methods, compositions, and kits for identifying biomarkers useful in characterizing biological states. In particular, the invention relates to methods and compositions for molecular characterization of biological states by gene expression profiling. The invention also relates to assessing effects of DNA polymorphisms on regulation of transcription. The biomarkers and polymorphisms identified find use in diagnostic and treatment approaches, e.g., some embodiments of the invention provide methods and kits for detecting bronchogenic carcinoma and risks thereof. | 06-06-2013 |
20130143208 | Oligonucleotide Trapping - Novel methods and compositions for identifying one or more factors associated with a nucleic acid sequence (e.g., DNA and/or RNA) of interest are provided. | 06-06-2013 |
20130143209 | PROCESSING OF ANALYTE SUPPORTS WITH OSCILLATING FLUID BY INTERRUPTED ROTATION - Analyte supports such as Western blots, gels, and the like is processed for purposes of detection and analysis, by placing the blot or gel on a plate and causing process fluids to oscillate across the blot or gel by intermittently rotating the plate. The plate can be inclined or flat, divided into sectors to accommodate multiple sheets, and multiple plates can be mounted to a single rotating shaft to process a large number of blots or gels simultaneously under the same protocol. | 06-06-2013 |
20130143210 | METHOD FOR THE PROGNOSIS OF OVARIAN CARCINOMA - The invention relates to a method for determining prognosis of subjects with ovarian carcinoma using a biological sample comprising genomic tumor DNA isolated from the subject. According to the invention, the method comprises the steps of: determining the methylation status of a CpG dinucleotide in a target sequence that is selected from the group consisting of the target sequences as referred to by name in Table 1 in a biological sample isolated from a subject; and deducing from the determined methylation status of the target sequence the prognosis of subject with ovarian carcinoma. The improved prognosis determination of the subject with ovarian carcinoma enables the improved treatment of the said patient. | 06-06-2013 |
20130143211 | PROCESSES AND COMPOSITIONS FOR METHYLATION-BASED ENRICHMENT OF FETAL NUCLEIC ACID FROM A MATERNAL SAMPLE USEFUL FOR NON-INVASIVE PRENATAL DIAGNOSES - Provided are compositions and processes that utilize genomic regions differentially methylated between a mother and her fetus to separate, isolate or enrich fetal nucleic acid from a maternal sample. The compositions and processes described herein are useful for non-invasive prenatal diagnostics, including the detection of chromosomal aneuploidies. | 06-06-2013 |
20130143212 | Method of Determining the Abundance of a Target Nucleotide Sequence of a Gene of Interest - The disclosure relates to a method of measuring gene abundance, including obtaining at least two types of amplification product, each of which contains a single additional base sequence and corresponds to each of at least two genes, by amplifying, in one reaction solution, nucleic acids encoding the at least two genes, whose abundances in nucleic acids contained in a subject sample may be different, using a first primer set, which includes at least two types of first primer, each of which is capable of introducing the single additional base sequence to a resulting amplification product and corresponds to each of the at least two genes, and a second primer for amplifying a nucleic acid containing the single additional base sequence; and determining the abundances of the at least two genes based on detected signals corresponding to the abundances of the at least two types of amplification product. | 06-06-2013 |
20130143213 | DETECTION OF GENETIC ABNORMALITIES - The present invention provides assay systems and related methods for determining genetic abnormalities in mixed samples comprising cell free DNA from both normal and putative genetically atypical cells. Exemplary mixed samples for analysis using the assay systems of the invention include samples comprising both maternal and fetal cell free DNA and samples that contain DNA from normal cells and circulating cancerous cells. | 06-06-2013 |
20130143214 | PROSTATE CANCER ASSOCIATED CIRCULATING NUCLEIC ACID BIOMARKERS - The invention provides methods and reagents for diagnosing prostate cancer that are based on the detection of biomarkers in the circulating nucleic acids from a patient to be evaluated. | 06-06-2013 |
20130143215 | Methods of Predicting Methotrexate Efficacy and Toxicity - The present invention provides methods for analyzing genetic and/or metabolite biomarkers to individualize methotrexate (MTX) therapy. For example, the assay methods of the present invention are useful for predicting whether a patient will respond to MTX and/or has a risk of developing toxicity to MTX based upon the genotype of one or more folate pathway genes. The assay methods of the present invention are also useful for optimizing the dose of MTX in a patient already receiving the drug to achieve therapeutic efficacy and/or reduce toxic side-effects based upon the genotype of one or more folate pathway genes. In addition, the assay methods of the present invention are useful for predicting or optimizing the therapeutic response to MTX in a patient based upon the methotrexate polyglutamate and/or folate polyglutamate levels in a sample from the patient. | 06-06-2013 |
20130143216 | Real Time Cleavage Assay - A cleavage-based real-time PCR assay method is provided. In general terms, the assay method includes subjecting a reaction mixture comprising a) PCR reagents for amplifying a nucleic acid target, and b) flap cleavage reagents for performing a flap cleavage assay on the amplified nucleic acid target to two sets of thermocycling conditions. No additional reagents are added to the reaction between said first and second sets of cycles and, in each cycle of the second set of cycles, cleavage of a flap probe is measured. | 06-06-2013 |
20130143217 | KITS FOR COMPARATIVE TRANSCRIPT ANALYSIS AND MUTANT SEQUENCE ENRICHMENT - A kit to execute a method of simultaneously performing comparative transcript analysis in a multitude of samples. The kit includes a blocking adapter. The blocking adapter includes an inert 3′ end. | 06-06-2013 |
20130143218 | DEVICE FOR AMPLIFYING TARGET NUCLEIC ACID - A device for amplifying a target nucleic acid in a sample containing one or more target nucleic acids may include a substrate assembly comprising a flow channel and an inlet, wherein the inlet is in flow communication with the flow channel and is configured to introduce sample containing one or more target nucleic acids into the flow channel. The device may further include a plurality of moieties disposed at inner surface regions of the flow channel along at least a portion of a length of the flow channel, each of the plurality of moieties being sufficient to respectively hybridize to the one or more target nucleic acids in the sample to facilitate amplification of the one or more target nucleic acids when hybridized. The device is further configured to retain amplified product of the one or more hybridized target nucleic acids at discrete locations proximate the inner surface regions after amplification. | 06-06-2013 |
20130149702 | PRIMER SET, METHOD AND KIT FOR DETECTING PATHOGEN IN FISH - The invention provides a method for rapidly detecting a pathogen in fish comprising conducting loop-mediated isothermal amplification with a specific primer set and a nucleic acid in a test sample. If at least one amplification is carried out, the test sample comprises the pathogen in fish. The invention also provides a primer set, probe and kit for detecting a pathogen in fish. | 06-13-2013 |
20130149703 | "MARKERS FOR PROSTATE CANCER PROGRESSION" - Purpose. The relationship between inherited genetic variations in 5α-reductase type 1 (SRD5A1) and type 2 (SRD5A2) genes and the risk of biochemical recurrence after radical prostatectomy (RP) in prostate cancer (PCa) remains a fairly unexplored area of research. Patients and Methods. We studied 526 men with organ-confined and locally advanced PCa with a median follow-up time of 7.4 years. We investigated the effects of allelic variants of SRD5A1 and SRD5A2 genes and haplotype-tagging single nucleotide polymorphisms (htSNPs; n=19) on recurrence-free survival after RP using Kaplan-Meier plots, the log-rank test, and Cox proportional hazard models. Results. Upon adjusting for known prognostic clinical and pathological factors, eight htSNPs were shown to be independent predictors of recurrence. The SRD5A1 rs166050 polymorphism was associated with an increased recurrence risk of HR=1.83 (95% CI, 1.04-3.21; P=0.035), while the rs518673 in SRD5A1 was associated with a decreased risk (HR=0.59, 95% CI, 0.41-0.85; P=0.004). The SRD5A2 gene was strongly associated with the risk of relapse with six polymorphisms being positively associated with recurrence including the known SRD5A2 V89L (rs523349) (HR=2.14, 95% CI, 1.23-3.70; P=0.007) and a protective htSNP rs12470143 with a HR of 0.66, (95% CI, 0.46-0.95; P=0.023). By combining SRD5A1 (rs518673T) and SRD5A2 (rs12470143 A), the protective effect was shown to be additive with the maximum protection conferred by 3 or 4 alleles (HR=0.33, 95% CL 0.17-0.63; P=0.001). Conclusion. Germline polymorphisms in 5α-reductase genes are independent prognostic genetic biomarkers that predict PCa biochemical recurrence after radical prostatectomy and may represent useful molecular tools for a genotype-tailored clinical approach. | 06-13-2013 |
20130149704 | MATERIALS AND METHODS FOR DIAGNOSIS OF MALIGNANT MELANOMA AND PROGNOSIS OF METASTASIS OF MALIGNANT MELANOMA - Methods, probes and kits for diagnosing malignant melanoma and prognosing metastasis thereof in a patient. | 06-13-2013 |
20130149705 | METHODS AND KITS FOR ROOM TEMPERATURE IN SITU DETECTION OF A TARGET NUCLEIC ACID IN A BIOLOGICAL SAMPLE - The present invention relates to in situ hybridization methods for detecting a target nucleic acid in a biological sample comprising performing one or more method steps (e.g., pretreatment, denaturation, hybridization, washes) at room temperature. The invention further relates to kits for performing such methods. | 06-13-2013 |
20130149706 | OPTICAL REPORTER COMPOSITIONS - This invention provides compositions that have a light emitting reporter linked to biomolecules, preferably, nucleotide oligomers. The light reporter particles are silylated and functionalized to produce a coated light reporter particle, prior to covalently linking the biomolecules to the light reporter particle. The light reporter particles of the invention can be excited by a light excitation source such as UV or IR light, and when the biomolecule is DNA, the attached DNA molecule(s) are detectable by amplification techniques such as PCR. | 06-13-2013 |
20130157265 | COMPOSITION, METHOD AND KIT FOR DETECTING BACTERIA BY MEANS OF SEQUENCING - The present invention describes a method for detecting the presence and type of a microorganism present in a sample by means of stabilization and sequencing techniques and subsequent analysis of microsequences in genes encoding the ribosomal RNA most conserved, and on specific areas of the 16-S region with taxonomic value. | 06-20-2013 |
20130157266 | ABSCRIPTION BASED MOLECULAR DETECTION OF DNA METHYLATION - The present invention provides methods for detecting biomarkers based on Abscription®, abortive transcription technology. Particularly, the present invention provides bisulfate free methods for detecting methylation of CpG islands from small samples containing DNA, including formalin fixed, paraffin embedded samples. The methods are suitable for multiplexing and can be used to analyze multiple CpG islands from a single sample in a short time. | 06-20-2013 |
20130157267 | Marker for Cancer Prognosis and Methods Related Thereto - The present invention is related to the novel discovery that HIF-2α, but not HIF-1 a, selectively regulates adenosine A | 06-20-2013 |
20130157268 | PHOSPHATIDYLINOSITOL PHOSPHATE KINASE TYPE 1 GAMMA SPLICE VARIANTS AS BIOMARKERS AND DRUG TARGETS FOR EPITHELIAL CANCERS - The present invention relates generally to the field of phosphatidylinositol based signaling pathways, and more specifically to the use of novel members of these pathways for disease prognosis and treatment. In some aspects, the present invention relates to the use of novel splice variants of type I phosphatidylinositol phosphate kinase γ, named PIPKIγ 700 and PIPKIγ 707, to determine breast cancer and breast cancer prognosis. | 06-20-2013 |
20130157269 | METHOD OF DETERMINING A RATIO OF RNA SPECIES IN A SAMPLE - A method of amplifying DNA from RNA in a sample by using circular RNA is provided. | 06-20-2013 |
20130157270 | Marker of Diagnosis and Prognosis in Multiple Sclerosis - The present invention provides a method for determining whether an individual with relapsing-remitting multiple sclerosis will suffer a relapse. In the method, measuring the level of Response Gene to Complement (RGC)-32 is measured in the individual, where a significantly lower level of RGC-32 therein indicates that the individual will have or is having a relapse of multiple sclerosis. | 06-20-2013 |
20130164742 | Droplet-Based Pyrosequencing - The present invention relates to droplet-based pyrosequencing including a method of identifying a base at a target position in a sample nucleic acid. The method includes: (a) providing a droplet microactuator including a first droplet including a sample nucleic acid immobilized on a bead; and (b) on the droplet microactuator: (i) contacting the first droplet with one or more reagent droplets to yield a second droplet, wherein the one or more reagent droplets include reagents for extending a double stranded portion of the sample nucleic acid by incorporating a nucleotide at the target position; (ii) splitting the second droplet to yield a third droplet including the bead and a fourth droplet lacking the bead; and (iii) assaying the third droplet to determine whether the nucleotide was incorporated at the target position. | 06-27-2013 |
20130164743 | METHOD FOR DIAGNOSING AND MONITORING SCHIZOPHRENIA AND TAUOPATHIES - The present invention provides methods and kits for diagnosing or monitoring conditions such as schizophrenia and tauopathies in a patient by determining the level of ADNP1 or ADNP2 in a sample from the patient. | 06-27-2013 |
20130164744 | Methods for Genetic Analysis of DNA to Detect Sequence Variances - Methods for determining genotypes and haplotypes of genes are described. Also described are single nucleotide polymorphisms and haplotypes in the ApoE gene and methods of using that information. | 06-27-2013 |
20130164745 | Methods for Assessing Risk for Cardiac Dysrythmia in a Human Subject - The present invention relates to methods for assessing the risk of a patient for developing a potentially fatal cardiac dysrhythmia and for diagnosing Andersen's Syndrome. A tissue sample from a patient is obtained and the DNA or proteins of the sample isolated. From the DNA and protein isolates the sequence of the KCNJ2 gene or the Kir2.1 polypeptide can be obtained. The KCNJ2 gene or the Kir2.1 can be screened for alteration as compared to the wile-type sequence. An alteration in a copy of the KCNJ2 gene or a Kir2.1 polypeptide indicates that the patient has a high risk for developing a cardiac dysrhythmia and can be diagnosed with Andersen's Syndrome. The invention also related to isolated nucleic acid molecules with one or more alterations as compared to the wild-type sequence. | 06-27-2013 |
20130164746 | Mutations in SF3B1 and Chronic Lymphocytic Leukemia - The disclosure provides methods of prognosing a subject with CLL and determining the response of the subject to treatment with fludarabine by determining the presence or absence of mutations within the SF3B1 gene. | 06-27-2013 |
20130164747 | Predicting Treatment Response in Cancer Subjects - The invention relates to methods of determining an appropriate cancer therapy for a subject based on intratumoral expression levels of a gene, such as the RRM1 or ERCC1 gene. Compositions and kits useful for the methods are also provided. | 06-27-2013 |
20130164748 | Detection of nucleic acid amplification - Methods for detecting a target polynucleotide sequences are provided that utilize a probe having a target-complementary segment and a detectable tag. By cleaving the detectable tab and associating the tag with a tag complement coupled to an electrode, an electrochemical signal can be detected that is related to the presence of the tag:tag complement complex. | 06-27-2013 |
20130164749 | DELETED SEQUENCES IN M. BOVIS BCG/M. BOVIS OR M. TUBERCULOSIS, METHOD FOR DETECTING MYCOBACTERIA USING SAID SEQUENCES AND VACCINES - The invention concerns the isolation of nucleotide and peptide sequences in particular for differentiating, in diagnostic terms, an immunisation resulting from BCG vaccination of an infection by | 06-27-2013 |
20130164750 | In Situ Hybridization Method And Buffer - An improved method of in situ hybridization which relies on an improved formulation of the in situ hybridization buffer is described. In at least some formulations the buffer are non-toxic. The combination of Locked Nucleic Acid (LNA) comprising ISH probes and the improved ISH buffer are useful for detection of small non-coding RNA as well as in the manufacturing of ISH kits directed to the detection of such small non-coding RNA. Further disclosed is a method of semi-quantitative ISH and demonstration of the semi-quantitative ISHs diagnostic potential. | 06-27-2013 |
20130164751 | CARCINOMA DIAGNOSIS AND TREATMENT, BASED ON ODC1 GENOTYPE - The present invention provides methods and kits a) for predicting colorectal cancer patient survival, as well as the survival of patients harboring other invasive cancers where cellular proliferation and carcinogenesis is linked, in part, to high levels of ODC activity and increased cellular polyamine contents, and b) for selecting the corresponding treatment options for such patients based on the allelic nucleotide sequence or SNP at position +316 of the ODC1 promoter gene as well as cancer treatment methods, in each case, which include the determination of the ODC1 promoter +316 position genotype, as a means to guide treatment selection. | 06-27-2013 |
20130164752 | Detection of mecA Variant Strains of Methicillin-Resistant Staphylococcus Aureus - The present invention provides improved tests for the detection of methicillin-resistant | 06-27-2013 |
20130164753 | DIAGNOSTIC METHODS FOR COLITIS - A method of screening for, diagnosing or detecting the presence of | 06-27-2013 |
20130171630 | METHODS OF USING TELOMERES AS MARKERS FOR AGING - The invention relates to a simple, reproducible, fast, and accurate method of quantifying and measuring telomeres in a clinical sample. The invention further relates to kits comprising premixed and optimized buffers, DNA polymerase, primers, and instructions for the detection of telomere length and quantities. Also envisioned are complete kits further including instrumentalities for the detection of telomere length and quantities. | 07-04-2013 |
20130171631 | CONJUGATES OF NUCLEOTIDES AND METHOD FOR THE APPLICATION THEREOF - The invention relates to a novel method for enzymatically marking nucleic acid chains (target sequences) by using nucleotide conjugates. Said nucleotide conjugates are capable of binding specifically to the target sequence under reaction conditions and of being incorporated in the complementary growing strand by means of a polymerase. The nucleic acid chains marked with such conjugates can be bound to the solid phase. The marking can be carried out in parallel with the enzymatic amplification of target sequences. | 07-04-2013 |
20130171632 | METHODS AND COMPOSITIONS FOR DETECTION AND ANALYSIS OF POLYNUCLEOTIDES USING LIGHT HARVESTING MULTICHROMOPHORES - Methods, compositions and articles of manufacture for assaying a sample for a target polynucleotide are provided. A sample suspected of containing the target polynucleotide is contacted with a polycationic multichromophore and a sensor polynucleotide complementary to the target polynucleotide. The sensor polynucleotide comprises a signaling chromophore to receive energy from the excited multichromophore and increase emission in the presence of the target polynucleotide. The methods can be used in multiplex form. Kits comprising reagents for performing such methods are also provided. | 07-04-2013 |
20130171633 | THERMAL REACTION DEVICE AND METHOD FOR USING THE SAME - An M×N matrix microfluidic device for performing a matrix of reactions, the device having a plurality of reaction cells in communication with one of either a sample inlet or a reagent inlet through a via formed within an elastomeric block of the device. Methods provided include a method for forming vias in parallel in an elastomeric layer of an elastomeric block of a microfluidic device, the method comprising using patterned photoresist masks and etching reagents to etch away regions or portions of an elastomeric layer of the elastomeric block. | 07-04-2013 |
20130171634 | BIOMARKERS FOR CANCERS RESPONSIVE TO MODULATORS OF HEC1 ACTIVITY - Contemplated compositions and methods are drawn to biomarkers and methods related to treatment of neoplastic disease with Hec1 inhibitor. Gene status and/or expression levels of Hec1(HEC), Rb(RB1), and/or p53 (TP53) may be useful as biomarkers for sensitivity to treatment with a Hec1 inhibitor. In addition, Hec 1 inhibitors may show synergistic effects when used in conjunction with cytotoxic drugs. | 07-04-2013 |
20130171635 | DUAL OLIGONUCLEOTIDE METHOD OF NUCLEIC ACID DETECTION - Methods for amplifying and detecting nucleic acids are described, as well as sets of 5′ labeled oligonucleotides. | 07-04-2013 |
20130171636 | METHOD OF DNA SEQUENCING BY POLYMERISATION - Described herein is a method for determining a nucleic acid sequence, said method comprising: a) denaturing a double-stranded nucleic acid molecule corresponding to the said nucleic acid sequence; b) hybridizing a single-stranded nucleic acid molecule, the primer, with the said denatured double-stranded nucleic acid molecule; c) applying a tension to the hybridized primer/double-stranded nucleic acid molecule obtained in b); d) incubating the hybridized primer/double-stranded nucleic acid molecule obtained in b) with a polymerase in conditions which will lead to at least one pause in replication; and e) determining a position of the said pause in replication with respect to one end of the double-stranded nucleic acid. | 07-04-2013 |
20130171637 | MATERIALS AND METHODS FOR DIAGNOSIS OF BLADDER CANCER AND MONITORING RECURRENCE THEREOF - A method of diagnosing bladder cancer in a patient comprising contacting a sample of urothelial cells obtained from the patient with a set of detectably labeled probes comprising locus-specific probes for c-myc and AURKA and centromeric probes for chromosomes 7 and 17 under hybridization conditions, and determining the presence of chromosomal abnormalities, wherein the presence of chromosomal abnormalities involving at least two of the detectably labeled probes indicates that the patient has bladder cancer; a method of monitoring recurrence of bladder cancer in a patient; a set of probes comprising locus-specific probes for c-myc and AURKA and centromeric probes for chromosomes 7 and 17; and a kit comprising (a) the set of probes and (b) instructions for diagnosing bladder cancer, or monitoring the recurrence thereof, in a patient. | 07-04-2013 |
20130171638 | MATERIALS AND METHODS FOR DIAGNOSIS, PROGNOSIS AND ASSESSMENT OF THERAPEUTIC/PROPHYLACTIC TREATMENT OF PROSTATE CANCER - A method to detect prostate cancer comprising contacting a sample of prostate cells from the patient with a set of detectably labeled probes under hybridization conditions and determining the presence of chromosomal abnormalities in prostate tumor tissue, PIN (intra-epithelial neoplasia), histologically benign tissue and benign prostatic hyperplasia (BPH); a method to combine immunofluorescence and FISH (IF-FISH) to facilitate the assessment of chromosomal abnormalities; a set of probes; and a kit comprising the set of probes and instructions for diagnosing prostate cancer in a patient. | 07-04-2013 |
20130171639 | MATERIALS AND METHODS FOR DIAGNOSIS, PROGNOSIS, MONITORING OF RECURRENCE, AND ASSESSMENT OF THERAPEUTIC/PROPHYLACTIC TREATMENT OF PANCREATOBILIARY CANCER - A method of detecting high-grade dysplasia, pancreatobiliary cancer, or metastatic cancer to the pancreatobiliary tract or inferring an increased risk thereof, comprising obtaining a sample of pancreatobiliary cells from a patient with a set of detectably labeled probes comprising a locus-specific probe for MCL1 (myeloid cell leukemia sequence 1), a locus-specific probe for EGFR (epidermal growth factor receptor), a locus-specific probe for MYC, and a locus-specific probe for P16 under hybridization conditions and determining the presence of chromosomal abnormalities; a set of probes comprising a locus-specific probe for MCL1, a locus-specific probe for EGFR, a locus-specific probe for MYC, and a locus-specific probe for P16; and a kit comprising the set of probes and instructions for detecting high-grade dysplasia, pancreatobiliary cancer, or metastatic cancer to the pancreatobiliary tract, or inferring an increased risk thereof, in a patient. | 07-04-2013 |
20130171640 | SOLID REAGENT DISSOLVING DEVICE AND METHOD OF DISSOLVING SOLID REAGENT BY USING THE SAME - A solid reagent dissolving device including a flexible layer; an upper plate disposed on the flexible layer; and a lower plate disposed under the flexible layer, wherein the upper plate comprises a plurality of minute channels, a dissolution chamber connected with the plurality of minute channels, and a protrusion for limiting a flow of a fluid flowing through one of the plurality of minute channels, the lower plate comprises a plurality of penetration holes that correspond to the protrusion and the dissolution chamber, respectively, and one side of each of the plurality of penetration holes, the plurality of minute channels, and the dissolution chamber are covered with the flexible layer, and method of using same. | 07-04-2013 |
20130171641 | METHOD AND COMPOSITIONS FOR DETECTING EPIDERMAL GROWTH FACTOR RECEPTOR VARIANT FORMS IN CANCER CELLS - Method and compositions for screening for the presence of Epidermal Growth Factor Receptor variant 3 (EGFR(v3)) in a sample are described. The method comprises obtaining a sample containing a plurality of cells; hybridizing a set of chromosomal probes to the sample, wherein the set comprises an EGFR(v3)-probe and a probe to chromosome 7 different from an EGFR(v3)-probe; and visualizing the hybridization pattern of the set of chromosomal probes in the plurality of cells of the sample, wherein the presence of at least one copy of chromosome 7 lacking a hybridization signal of the EGFR(v3)-probe in at least one cell is indicative of the presence of the EGFR(v3) in the sample. The method and compositions are suitable for diagnosing the therapeutic outcome for treating a patient having a cancer with an anti-EGFR therapeutic agent and for screening a sample for a predisposition for forming an EGFR-associated cancer. | 07-04-2013 |
20130171642 | AUTOMATED ANALYSIS OF CIRCULATING TUMOR CELLS - The disclosure provides methods for automated characterization of circulating tumor cells (CTCs), for example using automated tissue strainers. In specific examples, such methods permit characterizing a prostate cancer sample by simultaneously or contemporaneously detecting ERG rearrangements and PTEN deletions in the same CTC. Also provided are kits that can be used with such methods. | 07-04-2013 |
20130171643 | Sequence Specific Real-Time Monitoring of Loop-Mediated Isothermal Amplification (LAMP) - Gene-based diagnostics capable of rapidly discriminating selected strains of a selected pathogen from other populations within the same species are disclosed. Sequence-specific, real-time monitoring of LAMP of DNA may be accomplished through the use of oglionucleotide probes, referred to as “assimilating probes.” The assimilating probes include two oglionucleotide strands, one which includes a quencher (referred to as the quenching probe) and another which includes a fluorophore (referred to as the fluorescent probe). A fluorescent signal results when the two strands are displaced from one another during the LAMP reaction. By monitoring the emitted fluorescence, sequence specific amplification may be detected. | 07-04-2013 |
20130171644 | COINCIDENCE DETECTION - The invention relates to a method of detecting the coincidence of two biomolecular structures in a solid phase sample, said method comprising: (i) providing a first and a second fusion protein, each fusion protein comprising (a) a detection domain, said detection domain comprising a DNA binding domain; said detection domain capable of binding a cognate specific nucleotide sequence in co-operation with a further detection domain; (b) a recognition domain, said recognition domain capable of binding a target biomolecular structure; and (c) a connector domain; said connector domain being fused at one end to the detection domain and being fused at the other end to the recognition domain; wherein at least two of (a), (b) and (c) are heterologous to one another; wherein the recognition domains of said first and said second fusion proteins are capable of binding to first and second biomolecular structures; (ii) contacting the sample with said first and second fusion proteins; (iii) incubating to allow binding; (iv) removing unbound fusion protein; (v) contacting the sample with nucleic acid comprising said cognate specific nucleotide sequence; (vi) incubating to allow heterotrimeric binding of the nucleic acid; (vii) detecting nucleic acid bound to the sample wherein detection of nucleic acid in step; (vii) indicates that the two biomolecular structures are present coincidentally in said sample. | 07-04-2013 |
20130171645 | GENETIC MAKE-UP MODIFIES CANCER OUTCOME - A frequent SNP A259G (K87E) genotype switch in the MMP8 gene in has been found to modify the clinical behavior of cancers. The modification varies based on the patient's genotype for the SNP, and whether homozygous or heterozygous. One particular genotype for this SNP leads to more aggressive tumor behavior and worst clinical outcome than the others. | 07-04-2013 |
20130171646 | NANOP ARTICLE-OLIGONUCLEOTIDE HYBRID STRUCTURES AND METHODS OF USE THEREOF - The invention relates to hybrid structures comprising an amphiphilic nucleic acid-block co-polymer assembly on the exterior and a nanoparticle core, and methods of use thereof. | 07-04-2013 |
20130171647 | PREDICTING RESPONSES TO ANDROGEN DEPRIVATION THERAPY - This document provides methods and materials for identifying prostate cancer patients likely to respond to an androgen deprivation therapy. For example, methods and materials for identifying a prostate cancer patient likely to respond to an androgen deprivation therapy based at least in part on the presence of a genetic variation in a TMRT11 nucleic acid are provided. This document also provides methods and materials for identifying prostate cancer patients likely to survive prostate cancer related death for a short or long period of time. For example, methods and materials for identifying a prostate cancer patient likely to survive prostate cancer related death for a short or long period of time based at least in part on the presence of a genetic variation in a UGT1A3 nucleic acid, a UGT1A7 nucleic acid, and/or a UGT1A10 nucleic acid are provided. | 07-04-2013 |
20130177904 | ARNT ISOFORM 3 AS A PREDICTOR OF AMINOFLAVONE RESPONSIVENESS IN CANCER CELLS - The present invention is directed to methods for determining whether a selected cancer is susceptible to an activity of an arylhydrocarbon receptor agonist, such as aminoflavone, via screening the cancer for expression of isoform 3 of aryl hydrocarbon nuclear translocator. | 07-11-2013 |
20130177905 | SAMPLE PREPARATION FOR IN SITU NUCLEIC ACID ANALYSIS, METHODS AND COMPOSITIONS THEREFOR - Sample preparation processes for in situ RNA or DNA analysis, methods and compositions therefor are provided. Processes provided herein allow DNA or RNA analysis to be carried out in the same tube or on an aliquot of the prepared sample without centrifugation or extraction. The preparation process can be carried out at room temperature in as little as seven minutes and is amenable to high throughput processing using manual or robotic platforms. | 07-11-2013 |
20130177906 | ENHANCED AMPLIFICATION OF TARGET NUCLEIC ACID - Described herein are a composition for an improved amplification of a target nucleic material, a kit containing the composition and a method for an improved amplification. The composition contains a primer sequence which has a ribonucleic acid segment which can be cleaved by a RNase activity. The method using such primer improves probe cleavage kinetics is to increase availability or duration of a single strand template for probe binding. | 07-11-2013 |
20130177907 | GRAY LEAF SPOT TOLERANT MAIZE AND METHODS OF PRODUCTION - The invention relates to methods and compositions for identifying maize plants that have newly conferred tolerance or enhanced tolerance to, or are susceptible to, Gray Leaf Spot (GLS). The methods use molecular genetic markers to identify, select and/or construct tolerant plants or identify and counter-select susceptible plants. Maize plants that display newly conferred tolerance or enhanced tolerance to GLS that are generated by the methods of the invention are also a feature of the invention. | 07-11-2013 |
20130177908 | Probes for Detecting Paraoxonase 1 Gene Polymorphism (Q192R) and Methods of Use Thereof - The present disclosure provides probes for detecting a polymorphism in the PON1 gene. | 07-11-2013 |
20130177909 | METHOD FOR CONTROLLING THE AMOUNT OF GENE PRODUCT, AND AGENT FOR CONTROLLING THE AMOUNT OF GENE PRODUCT - The invention relates to a method of intracellularly controlling amounts of gene products, which can increase an amount of gene product intracellularly, comprising a step of introducing into the cell a substance having a sequence complementary to the base sequence of mRNA corresponding to the gene product, its precursor or another substance which can have equivalent action in the cell. | 07-11-2013 |
20130177910 | DETECTION, IDENTIFICATION AND DIFFERENTIATION OF SERRATIA SPECIES USING THE SPACER REGION - The present invention relates to new nucleic acid sequences derived from the ITS (Internal Transcribed Spacer) region, between the 16S and 23S rRNA genes, to be used for the specific detection and/or identification of | 07-11-2013 |
20130177911 | NOVEL SINGLE NUCLEOTIDE POLYMORPHISMS AND COMBINATIONS OF NOVEL AND KNOWN POLYMORPHISMS FOR DETERMINING THE ALLELE-SPECIFIC EXPRESSION OF THE IGF2 GENE - Single nucleotide polymorphisms and uses for determining the imprinting status of the Insulin Growth Factor-2 gene in a clinical specimen are described. | 07-11-2013 |
20130177912 | SELECTIVE OXIDATION OF 5-METHYLCYTOSINE BY TET-FAMILY PROTEINS - The present invention provides for novel methods for regulating and detecting the cytosine methylation status of DNA. The invention is based upon identification of a novel and surprising catalytic activity for the family of TET proteins, namely TET1, TET2, TET3, and CXXC4. The novel activity is related to the enzymes being capable of converting the cytosine nucleotide 5-methylcytosine into 5-hydroxymethylcytosine by hydroxylation. | 07-11-2013 |
20130183666 | PARTIAL GENOTYPING BY DIFFERENTIAL HYBRIDIZATION - In a method of detecting the number of repeat units in a selected short tandem repeat (STR) in a genomic sample, the genomic sample is amplified by PCR and a single stranded target DNA is selected and separated for use in differential hybridization experiments. Subsequent partial genotyping comprises the steps of admixing to the target DNA at least one fluorescent labeled STR probe oligonucleotide and one different fluorescent labeled reference probe oligonucleotide allowing hybridization to the single stranded target DNA in a hybridization experiment. Measurement of the fluorescence intensities of the probes that are bound to the repeat units of the selected STR and normalizing the fluorescence intensity of the STR probes on the base of the reference probe intensity reveals a relative fluorescence signal representing the result of the differential hybridization experiment. Also disclosed are kits for carrying out partial genotyping by differential hybridization. | 07-18-2013 |
20130183667 | METHODS FOR CANCER SCREENING IN LATIN AMERICAN/HISPANIC POPULATIONS - Provided herein are novel methods for diagnosing ovarian and breast cancer risk in a Latin American/Hispanic population based on the presence of specific BRCA1 and/or BRCA2 mutations. | 07-18-2013 |
20130183668 | METHODS RELATING TO IDENTIFICATION OF SUSCEPTIBILITY TO LIVER INJURY - The present invention relates to methods for identifying susceptibility of impaired hepatic wound healing in a patient, most particularly by identifying modifications of the of PPAR-γ and TGFβ1 genes. It further relates to stratifying populations of patients to determine susceptibility to impaired hepatic wound healing and direct appropriate healthcare resources. More specifically methods can be used to stratify liver disease patient populations to identify those most likely to progress to cirrhosis, or to identify the likelihood that a patient with liver disease will progress to having cirrhosis. | 07-18-2013 |
20130183669 | COMPOSITIONS AND METHODS FOR DIAGNOSING AUTISM - Mutations located within the gene encoding the homeobox transcription factor, ENGRAILED 2 (EN2), have now been identified as molecular markers associated with susceptibility for autism and related disorders. Thus, the present invention relates to compositions in the form of diagnostic kits, primers and target sequences, for use in methods for determining the predisposition, the onset or the presence of autism spectrum disorder in a mammal. Moreover, therapeutic methods for treating a person inflicted with, or predisposed to, an autism spectrum disorder based upon modulating the level or activity of EN2 are also provided. | 07-18-2013 |
20130183670 | METHOD FOR PRODUCING NUCLEIC ACID PROBES - The present disclosure provides nucleic acid probes, as well as kits that include such probes. Methods for producing and using (for example in chromosomal in situ hybridization) the probes are also provided. Such probes in some examples are used to detect chromosomal abnormalities or the presence of a pathogen. | 07-18-2013 |
20130183671 | ALLELIC DISORDERS CAUSED BY MUTATIONS IN TRPV4 - The present invention provides methods, kits, and compositions for detecting mutations in transient receptor potential cation channel, subfamily V, member 4 (TRPV4). In particular, mutations are detected in TRPV4 to detect diseases such as scapuloperoneal spinal muscular atrophy (SPSMA) and hereditary motor and sensory neuropathy type IIC (HMSN IIC) or Charcot-Marie-Tooth disease type 2C (CMT2C). | 07-18-2013 |
20130183672 | 3-D GENOMIC REGION OF INTEREST SEQUENCING STRATEGIES - The invention relates to methods for determining the sequence of a genomic region of interest comprising a target nucleotide sequence comprising, fragmenting a crosslinked DNA, ligating the fragmented cross linked DNA, reversing the crosslinking and determining at least part of the sequences of ligated DNA fragments which comprise a target nucleotide sequence. | 07-18-2013 |
20130183673 | NEW MARKERS FOR THE EPITHELIAL AND PROLIFERATIVE OR MESENCHYMAL INVASIVE PHENOTYPE OF HUMAN NEOPLASIAS - The present invention relates to a new Ena/VASP protein isoform, uses thereof, diagnostic methods and kits comprising the same. | 07-18-2013 |
20130189675 | Assay to Capture and Detect Circulating Multiple Myeloma Cells from Blood - The invention includes methods for isolating circulating multiple myeloma cells as well as method of treating patients suspected of having diseases of abnormal plasma cells. | 07-25-2013 |
20130189676 | USE OF GENETIC MODIFICATIONS IN HUMAN GENE CHK1 WHICH CODES FOR CHECKPOINT KINASE 1 - The invention relates to an in vitro method for predicting disease risks, progression of diseases, drug risks, success of treatment and for finding drug targets by looking for one or more genetic modifications in the promoter region of the CHK1 (CHEK1) gene on human chromosome 11q23, the genetic modifications being a substitution thymine for guanine in position −1143 in the promoter of CHK1, of thymine for cytosine in position −1400, a substitution of cytosine for thymine in position −1453 or an insertion of one cytosine in position −1454 and the genetic modifications being detected individually or in any combinations by way of known methods. | 07-25-2013 |
20130189677 | ABC terpenoid transporters and methods of using the same - Provided are ATP-binding cassette transporters (ABC transporters). More specifically, the present disclosure relates to ABC terpenoid transporters, nucleic acid sequences, amino acids, proteins, vectors, cells, transgenic organisms, uses, compositions, methods, processes, and kits thereof. | 07-25-2013 |
20130189678 | MACROPHAGE MIGRATION INHIBITORY FACTOR (MIF) PROMOTER POLYMORPHISM IN INFLAMMATORY DISEASE - Describe herein is a novel CATT-tetranucleotide repeat polymorphism at position −817 of the human Mif that functionally affects the activity of the Macrophage Inhibitory Factor (MIF) promoter in gene reporter assays. Four genotypes are described which comprise 5, 6, 7, or 8-CATT repeat units. Of these, the 5-CATT allele has the lowest level of basal and stimulated MIF promoter activity in vitro. The presence of the low expressing, 5-CATT repeat allele correlated with low disease severity in a cohort of rheumatoid arthritis patients. Methods, compositions and apparatus for detecting this CATT-tetranucleotide repeat polymorphism at position −817 of the human Mif gene, and for using same for assessing predisposition to severe inflammatory disease, are also disclosed. | 07-25-2013 |
20130189679 | PSEUDOGENES AND USES THEREOF - The present invention relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to pseudogenes as diagnostic markers and clinical targets for prostate cancer. | 07-25-2013 |
20130189680 | POLYMER STABILIZATION OF CHROMOGEN SOLUTIONS - Disclosed embodiments concern a composition comprising DAB chromogen, and/or derivative thereof, a stabilizer, and polymer capable of preventing or reducing DAB precipitation relative to a composition that does not comprise the polymer. Also disclosed herein is a method for using the disclosed composition and embodiments of a kit. | 07-25-2013 |
20130189681 | COTTON EVENT pDAB4468.19.10.3 DETECTION METHOD - Cotton event pDAB4468.19.10.3 comprises gene expression cassettes which contain genes encoding aad-12 and pat, affording herbicide tolerance to cotton crops containing the event, and enabling methods for crop protection. Embodiments of the subject invention provide polynucleotide-related event detection methods. | 07-25-2013 |
20130189682 | COTTON EVENT pDAB4468.18.07.1 DETECTION METHOD - Cotton event pDAB4468.18.07.1 comprises gene expression cassettes which contain genes encoding aad-12 and pat, affording herbicide tolerance to cotton crops containing the event, and enabling methods for crop protection. Embodiments of the subject invention provide polynucleotide-related event detection methods. | 07-25-2013 |
20130189683 | IDENTIFICATION OF A JAK2 MUTATION INVOLVED IN VAQUEZ POLYGLOBULIA - The present invention concerns the V617F variant of the protein-tyrosine kinase JAK2, said variant being responsible for Vaquez Polyglobulia. The invention also relates to a first intention diagnostic method for erythrocytosis and thrombocytosis allowing their association with myeloproliferative disorders, or to the detection of the JAK2 V617F variant in myeloproliferative disorders allowing their reclassification in a new nosological group. | 07-25-2013 |
20130189684 | QUANTIFICATION OF CELL-SPECIFIC NUCLEIC ACID MARKERS - The technology relates in part to selection, quantification and use of particular nucleic acid markers. In some embodiments, such markers are particular epigenetic markers, and sometimes each marker is a particular methylation state of a nucleic acid locus. | 07-25-2013 |
20130189685 | Method for Improved Diagnosis of Dysplasias - The present invention relates to a method for improved diagnosis of dysplasias based on simultaneous detection of INK4a gene products and at least one marker for cell proliferation. Particularly the present invention provides a method for discriminating dysplastic cells over-expressing INK4a gene products from cells over-expressing INK4a gene products without being dysplastic by detection of a marker suitable for characterising the proliferation properties of the respective cell. The characterisation of the proliferation properties may comprise the detection of a marker or a set of markers characteristic for active cell proliferation and/or a marker or a set of markers characteristic for retarded or ceased cell proliferation. The method presented herein thus enables for a specific diagnosis of dysplasias in histological and cytological specimens. | 07-25-2013 |
20130189686 | Method for Improved Diagnosis of Dysplasias - The present invention relates to a method for improved diagnosis of dysplasias based on simultaneous detection of INK | 07-25-2013 |
20130189687 | METHOD FOR MEASURING PYROPHOSPHORIC ACID AND SNP TYPING METHOD - One general aspect provides a method for detecting pyrophosphoric acid in a sample solution with high sensitivity and high accuracy by a small sensor element, and an SNP typing method. In the general aspect, a sample solution having a volume of more than that of a measurement cavity is supplied to the measurement cavity through a flow path, so as to expose a droplet from the opening. The droplet has a shape of sphere. The shape of the sphere is maintained by surface tension generated on a surface of the droplet. At least part of the sample solution contained in the droplet is evaporated so as to increase a concentration of pyrophosphoric acid in the sample solution included in the measurement cavity. | 07-25-2013 |
20130189688 | RARE CELL ANALYSIS USING SAMPLE SPLITTING AND DNA TAGS - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, e.g. aneuploidy. The present invention involves labeling regions of genomic DNA in each cell in said mixed sample with different labels wherein each label is specific to each cell and quantifying the labeled regions of genomic DNA from each cell in the mixed sample. More particularly the invention involves quantifying labeled DNA polymorphisms from each cell in the mixed sample. | 07-25-2013 |
20130189689 | RARE CELL ANALYSIS USING SAMPLE SPLITTING AND DNA TAGS - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, e.g. aneuploidy. The present invention involves labeling regions of genomic DNA in each cell in said mixed sample with different labels wherein each label is specific to each cell and quantifying the labeled regions of genomic DNA from each cell in the mixed sample. More particularly the invention involves quantifying labeled DNA polymorphisms from each cell in the mixed sample. | 07-25-2013 |
20130189690 | SCN5A Splice Variants for Use in Methods Relating to Sudden Cardiac Death and Need for Implanted Cardiac Defibrillators - Provided herein are methods of determining a subject's need for an implanted cardiac defibrillator, methods of determining a subject's risk for sudden cardiac death (SCD), arrhythmias, or heart failure, methods of determining a subject's need for an anti-arrhythmic agent, e.g., a sodium channel blocker, and methods of reducing risk of SCD in a subject. In exemplary embodiments, each of the methods comprise the step of determining a ratio, R | 07-25-2013 |
20130189691 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN CLUSTER OF DIFFERENTIATION ANTIGEN 81 AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the p15 arm of chromosome 11 and methods of use. | 07-25-2013 |
20130189692 | Single Nucleotide Polymorphisms (SNPs) in Genes Associated With Inflammatory Diseases - The present disclosure describes the identification of single nucleotide polymorphisms (SNPs) in inflammatory diseases and uses thereof, and methods of screening for, diagnosing, identifying susceptibility to or detecting a risk of developing an inflammatory disease comprising detecting the presence or absence of at least one SNP identified in a gene associated with inflammatory disease. | 07-25-2013 |
20130189693 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN SMS3 AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human SMS3 (SMS3) and methods of use. | 07-25-2013 |
20130189694 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN TUMOR SUPPRESSING SUBTRANSFERABLE CANDIDATE 6 (TSSC6) AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human tumor suppressing subtransferable candidate 6 and methods of use. | 07-25-2013 |
20130189695 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN RIBOSOMAL PROTEIN L26 (RIBO26) AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human ribosomal protein L26 (RIBO26) and methods of use. | 07-25-2013 |
20130189696 | Screening Methods for Transfusion Related Acute Lung Injury (TRALI) - The invention relates to the discovery that HNA-3a and HNA-3b are antigens within a polypeptide sequence that is highly similar to the CTL2 amino acid sequence. This invention provides methods and kits for screening for HNA-3a and HNA-3b specific antibodies, HNA-3a and HNA-3b polypeptides and HNA-3a and HNA-3b nucleic acids in a sample of a biological tissue intended for transplantation | 07-25-2013 |
20130189697 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN TUMOR SUPPRESSING SUBTRANSFERABLE CANDIDATE 4 (TSSC4) AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human and tumor suppressing subtransferable candidate 4 (TSSC4) and methods of use. | 07-25-2013 |
20130189698 | In Situ Cloning From Pathological Tissue Specimens - The present invention pertains to methods related to cloning nucleic acids from biological samples, particularly pathological tissue samples. This method includes hybridizing a population of oligonucleotide sequence probes comprising degenerate sequence tags to a fixed tissue, isolating the hybridized oligonucleotide sequence probes and amplifying the sequence tags in the hybridized oligonucleotide sequence probes. This method can be utilized to identify genes associated with disease and to quantitate the expression of disease-related transcripts. The method can also be used to identify truncated mRNAs. | 07-25-2013 |
20130189699 | IONIC SIGNAL ENHANCEMENT - Provided is a method of identifying an unknown nucleic acid comprising the steps of combining the unknown polynucleic acid with known nucleic acid reagents in a reaction chamber; producing a first quantity of protons from a polymerisation reaction when bases of one or more of the unknown nucleic acids are complementary to the bases of one or more known nucleic acids comprised within the known reagents; producing a second quantity of protons from a hydrolysis reaction of by-products of the polymerisation reaction with one or more enzymes; monitoring an electrical output signal derived from an ISFET exposed to the reaction chamber; and correlating changes in an output signal with said reactions between the unknown polynucleic acid and said known reagents to thereby identify the unknown nucleic acid. | 07-25-2013 |
20130196312 | GENOMIC LANDSCAPES OF HUMAN BREAST AND COLORECTAL CANCERS - Human cancer is caused by the accumulation of mutations in oncogenes and tumor suppressor genes. To catalogue the genetic changes that occur during tumorigenesis, we isolated DNA from 11 breast and 11 colorectal tumors and determined the sequences of the genes in the Reference Sequence database in these samples. Based on analysis of exons representing 20,857 transcripts from 18,191 genes, we conclude that the genomic landscapes of breast and colorectal cancers are composed of a handful of commonly mutated gene “mountains” and a much larger number of gene “hills” that are mutated at low frequency. We describe statistical and bioinformatic tools that may help identify mutations with a role in tumorigenesis. These results have implications for understanding the nature and heterogeneity of human cancers and for using personal genomics for tumor diagnosis and therapy. | 08-01-2013 |
20130196313 | Pharmacogenetic Method for Prediction of the Efficacy of Methotrexate Monotherapy in Recent-Onset Arthritis - Pharmacogenetic methods for determining a predicting responsiveness to antifolate therapy for subjects that present with recent-onset undifferentiated arthritis. The methods are based on the determination of a set of clinical parameter values and determining a predicted responsiveness to antifolate therapy by correlating the parameter values with predefined responsiveness values associated with ranges of parameter values. Parameters values that are decisive for responsiveness to antifolate therapy may include polymorphisms in the methylenetetrahydrofolate dehydrogenase (MTHFD1) gene as well as in three genes involved in the adenosine release pathway, the presence or absence of Rheumatoid factors, gender, pre- or postmenopausal status and/or smoking status. | 08-01-2013 |
20130196314 | Genes Differentially Expressed in Breast Cancer - A polynucleotide sequence as shown in SEQ ID NO:1 is associated with metastatic potential of cancer cells, especially breast cancer cells. Methods are provided for determining the risk of metastasis of a tumor, by determining whether a tissue sample from a tumor expresses a polypeptide or mRNA encoded by a polynucleotide as shown in SEQ ID NO:1. Also provided are therapeutic methods and compositions. | 08-01-2013 |
20130196315 | DEVICE FOR CELL CULTURE AND ANALYSIS - The present invention relates to a device for cell culture and analysis, comprising a first containing element, a second containing element sealingly couplable to one another to define a culture chamber and a flexible film housable in said culture chamber and available alternatively on one of said first element or second element. The flexible film can be made of a transparent material selected from the group consisting of polycarbonate, polystyrene and polyethylene. A method for cell analysis is also provided. | 08-01-2013 |
20130196316 | DETECTION OF SINGLE AND MULTIMODAL ANALYTES - A method for detecting analyte in a sample comprises:
| 08-01-2013 |
20130196317 | METHODS FOR DETECTING FETAL NUCLEIC ACIDS AND DIAGNOSING FETAL ABNORMALITIES - The invention generally relates to methods for detecting fetal nucleic acids and methods for diagnosing fetal abnormalities. In certain embodiments, the invention provides methods for determining whether fetal nucleic acid is present in a maternal sample including obtaining a maternal sample suspected to include fetal nucleic acids, and performing a sequencing reaction on the sample to determine presence of at least a portion of a Y chromosome in the sample, thereby determining that fetal nucleic acid is present in the sample. In other embodiments, the invention provides methods for quantitative or qualitative analysis to detect fetal nucleic acid in a maternal sample, regardless of the ability to detect the Y chromosome, particularly for samples including normal nucleic acids from a female fetus. | 08-01-2013 |
20130196318 | METHODS FOR MEASURING ENZYME ACTIVITY USEFUL IN DETERMINING CELL VIABILITY IN NON-PURIFIED SAMPLES - The present invention relates generally to the field of detection of microorganisms, in particular detection of bacteria, to methods for measuring enzyme activity, such as DNA polymerase activity, and particularly relates to such methods performed on microbial crude lysates, useful for determining microbial enzyme activities which can be linked to amplification signal generators such as real-time Polymerase Chain Reaction (PCR) techniques, thereby enabling determination of microbial pathogens in samples such as unpurified blood and other body fluids. This invention also relates to reagents for use in such methods, and to test kits comprising such reagents for carrying out the methods. | 08-01-2013 |
20130196319 | SERIAL QUANTITATIVE PCR ASSAY FOR DETECTION, SPECIES-DISCRIMINATION AND QUANTIFICATION OF LEISHMANIA SPP. IN HUMAN SAMPLES - The invention provides a method for determining the presence, species, and/or quantity of | 08-01-2013 |
20130196320 | METHOD FOR IMPROVING CLEAVAGE OF DNA BY ENDONUCLEASE SENSITIVE TO METHYLATION - The present invention concerns novel methods for improving cleavage of DNA by rare-cutting endonucleases, overcoming DNA modification constraints, particularly DNA methylation, thereby giving new tools for genome engineering, particularly to increase the integration efficiency of a transgene into a genome at a predetermined location, including therapeutic applications and cell line engineering. | 08-01-2013 |
20130196321 | Gene Expression Profile Algorithm and Test for Determining Prognosis of Prostate Cancer - The present invention provides algorithm-based molecular assays that involve measurement of expression levels of genes, or their co-expressed genes, from a biological sample obtained from a prostate cancer patient. The genes may be grouped into functional gene subsets for calculating a quantitative score useful to predict a likelihood of a clinical outcome for a prostate cancer patient. | 08-01-2013 |
20130196322 | MODIFICATION OF DNA ON MAGNETIC BEADS - Provided herein is technology related to the chemical modification and purification of DNA. Specifically, the technology provides methods for performing a bisulfate conversion reaction on small amounts of single-stranded, fragmented DNA and performing the subsequent desulfonation and purification steps on magnetic beads. | 08-01-2013 |
20130196323 | Methods Of Nucleic Acid Analysis - In one aspect, methods of nucleic acid analysis are described herein. In some embodiments, a method of nucleic acid analysis comprises providing a mixture of differing single-strand nucleic acid segments, including unamplified single-strand nucleic acid segments, combining the mixture of differing single-strand nucleic acid segments with a single-strand nucleic acid probe, contacting the mixture with a membrane comprising at least one nanopore, applying an electric field across the nanopore, and measuring change in current through the nanopore during one or more nucleic acid translocation events. | 08-01-2013 |
20130196324 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 08-01-2013 |
20130196325 | In Situ Chemiluminescent Substrates and Assays - Methods for generating a chemiluminescent enzyme substrate in situ, in aqueous or other assay conditions. Also disclosed are methods to use the substrates to generate light, detect and/or quantify enzymes, antigens, and/or nucleic acids. Kits relating to these methods are also disclosed. | 08-01-2013 |
20130196326 | METHOD FOR THE ISOLATION OF PROTEINS BINDING TO ANY KIND NUCLEIC ACID SEQUENCE OF INTEREST - The invention is to supply a novel way for the isolation and identification of proteins bound to any kind of interesting nucleic acid sequence (Sequence-of-Interest: SoI), advantageously to any kind of interesting DNA sequence, particularly in the context of chromosomal DNA or RNA or episomal DNA in living cells or in test tubes. | 08-01-2013 |
20130196327 | DNA Polymerase Variants with Reduced Exonuclease Activity and Uses Thereof - Compositions and methods are described to modify Family B DNA polymerases that contain residual exonuclease activity that interferes with sequencing techniques and with detection of single nucleotide polymorphisms. The compositions are mutant proteins with reduced exonuclease activity compared with presently available “exo | 08-01-2013 |
20130196328 | RARE CLONOTYPES AND USES THEREOF - The invention is directed to a method of selecting disease-correlated clonotypes that have a reduced likelihood of producing a false positive signal of relapse when, used to monitor minimal residual disease. In accordance with the invention, candidate correlating clonotype are obtained from a patient, the rarity of each is determined either by comparison with a clonotype database or a clonotype model, and one or more of the rarest of such clonotypes are used to monitor the minimal residual disease. | 08-01-2013 |
20130196329 | IDENTIFICATION OF ISOLATED GENOMIC NUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN ACHAETE-SCUTE HOMOLOG 2 (HASH2) AND VARIANTS THEREOF - Provided herein are isolated genomic polynucleotide fragments from the p15 arm of chromosome 11 encoding HASH2 and methods of use. | 08-01-2013 |
20130203049 | METHOD AND APPARATUS FOR CONDUCTING AN ASSAY - The present invention relates to methods and apparatus for conducting nucleic acid sequencing. The method comprises the steps of providing a platform having at least one well for containing at least one support surface, and providing at least one support surface within each well, wherein the support surface is adapted to immobilise a first binding partner or selectively immobilise a second binding partner. The method further comprises the steps of binding or immobilising the first or second binding partner to the support surface and dispensing into each well from a point external of said platform a reagent, wherein after the dispensing step the platform is rotated sufficiently such that any residual or unreacted said reagent is substantially centrifugally removed from each well and/or each support surface, wherein during rotation each support surface is held within each well. The invention also relates to kits and uses of the kits for conducting nucleic acid sequencing. In particular, the invention has been developed primarily for use in sequencing nucleic acid by pyrosequencing, however the invention is not limited to this field. | 08-08-2013 |
20130203050 | HYBRID NANOPORE DEVICE WITH OPTICAL DETECTION AND METHODS OF USING SAME - The invention is directed to a device comprising a protein nanopore immobilized in a lipid layer within an aperture of a solid phase substrate, which provides a stable platform for using first and second members of one or more FRET pairs to generate optical signals as a labeled analyte translocates through the bore of the protein nanopore. In another aspect, the invention is directed to the use of the device to determine the nucleotide sequence of a polynucleotide analyte. | 08-08-2013 |
20130203051 | Methods for prenatal diagnosis of chromosomal abnormalities - Chromosomal abnormalities are responsible for a significant number of birth defects, including mental retardation. The present invention is related to methods for non-invasive and rapid, prenatal diagnosis of chromosomal abnormalities based on analysis of a maternal blood sample. The invention exploits the differences in DNA between the mother and fetus, for instance differences in their methylation states, as a means to enrich for fetal DNA in maternal plasma sample. The methods described herein can be used to detect chromosomal DNA deletions and duplications. In a preferred embodiment, the methods are used to diagnose chromosomal aneuploidy and related disorders, such as Down's and Turner's Syndrome. | 08-08-2013 |
20130203052 | FREE CIRCULATING DNA BIO-MARKERS AND THEIR APPLICATIONS - This invention relates generally to methods for detecting cell damage as a consequence of pathophysiological or traumatic insults such as in a nuclear accident, bioterror attack, tumorigenesis, infections or in individuals with cardiovascular disease. | 08-08-2013 |
20130203053 | METHODS FOR IMPROVING INFLAMMATORY BOWEL DISEASE DIAGNOSIS - The present invention provides methods and systems to diagnose the ulcerative colitis (UC) subtype of inflammatory bowel disease (IBD) by detecting the presence or absence of one or more variant alleles in the GLI1, MDR1, and/or ATG16L1 genes. Advantageously, with the present invention, it is possible to provide a diagnosis of UC and to differentiate between UC and Crohn's disease (CD) with increased accuracy. | 08-08-2013 |
20130203054 | ANTIVIRAL TREATMENT SUSCEPTIBILITY GENE AND USES THEREOF - The present invention relates to an in vitro method for determining the likelyhood for a patient affected with a viral infection to respond to a treatment with an antiviral agent and/or an interferon, which method comprises determining alteration in CTGF gene locus or in CTGF expression or in CTGF activity in a biological sample of the patient. | 08-08-2013 |
20130203055 | METHODS AND KITS FOR IN SITU DETECTION OF NUCLEOTIDE SEQUENCES - The present invention relates to in situ hybridization methods comprising a room temperature hybridization step for detecting a target nucleic acid in a biological sample. The invention further relates to kits for performing such methods. | 08-08-2013 |
20130203056 | Detection of methicillin-resistant Staphylococcus aureus - The present invention provides improved tests for the detection of methicillin-resistant | 08-08-2013 |
20130203057 | STEP-WISE DETECTION OF MULTIPLE TARGET SEQUENCES IN ISOTHERMAL NUCLEIC ACID AMPLIFICATION REACTIONS - Compositions and methods useful in nucleic acid assays are provided. The invention permits detection of multiple target sequences and control nucleic acids using isothermal nucleic acid amplification methods and subsequent detection of amplification products at different temperature steps by at least two probes with different annealing temperatures. This method can be used in isothermal nucleic acid amplification reactions to detect multiple targets of interest. In a particular example, cycling hybridization probes with different spectral and hybridization temperatures are used to detect different target sequences. Probes become fluorescent when they are cleaved by a thermostable ribonuclease, which only acts when the probes are hybridized to their respective templates. | 08-08-2013 |
20130203058 | COMPOSITE ASSAY FOR DETECTING A CLINICAL CONDITION - The invention generally relates to methods for screening patients for one or more clinical conditions using a composite assay. According to certain aspects, methods of the invention involve isolating at least one nucleic acid from a biological sample obtained from the subject, detecting at least one sequence mutation and a chromosomal abnormality in the at least one nucleic acid in a single assay format, and identifying a clinical condition in said subject when both the sequence mutation and the chromosomal abnormality are present. | 08-08-2013 |
20130203059 | Method for Diagnosis of Bladder Cancer and Related Kits - The invention refers to a novel molecular biomarker, namely PTPD1, that is markedly increased in human bladder cancers. PTPD1 expression positively correlated with the grading and invasiveness potential of these tumors. PTPD1 can be detected at high levels in exfoliated bladder cells isolated from urine of bladder cancer patients, while no PTPD1 signal was evident in normal exfoliated bladder cells. Thus, PTPD1 detection in urine samples may represent a novel and reliable marker for non-invasive diagnosis of aggressive bladder cancer. | 08-08-2013 |
20130203060 | MAMMALIAN GENES; RELATED REAGENTS - Nucleic acids encoding a new family of small cysteine rich soluble proteins, from a mammal, reagents related thereto, including specific antibodies, and purified proteins are described. Methods of using said reagents and related diagnostic kits are also provided. | 08-08-2013 |
20130209998 | Microbial Assay - A method of detecting genetic material deriving from | 08-15-2013 |
20130209999 | SQSTM1 MUTATIONS IN AMYOTROPHIC LATERAL SCLEROSIS - Provided herein is technology relating to diagnosing, monitoring, and treating disease and particularly, but not exclusively, to methods, compositions, and kits for diagnosing, monitoring, and treating amyotrophic lateral sclerosis by detecting and identifying mutations in the gene SQSTM1 and providing therapies by targeting aberrant biological functions related to mutant forms of SQSTM1. | 08-15-2013 |
20130210000 | NEUROGENIC AND GLIOGENIC FACTORS AND ASSAYS THEREFOR - Disclosed herein are quantitative assays for measuring the potential of a substance, or a source of a substance, to promote neurogenesis and gliogenesis. Substances that promote neurogenesis and gliogenesis are also disclosed. | 08-15-2013 |
20130210001 | SEQUENCE DETECTION ASSAY - There is provided a method of detecting the presence in a sample of a first target sequence and a second target sequence within a test region of a nucleic acid sequence comprising conducting a nucleic acid amplification reaction, to form a forward amplicon strand and a reverse amplicon strand of the test region, contacting the forward amplicon strand with a first probe labelled with a first FRET label and capable of hybridising to the first target sequence of complement thereof in the forward amplicon strand, and contacting the reverse amplicon strand with a second probe labelled with a second FRET label and capable of hybridising to the second target sequence or complement thereof in the reverse amplicon strand; wherein the nucleic acid amplification reaction is conducted using a forward amplification primer labelled with a third FRET label and a reverse amplification primer labelled with a fourth FRET label, the forward primer being incorporated into the forward amplicon strand and the second primer being incorporated into the reverse amplicon strand during the amplification reaction; and further wherein the first and third FRET labels form a FRET pair and the second and fourth FRET labels form a different FRET pair, each FRET pair comprising a donor label; the method further comprising the steps of exposing the sample to an excitation source having a wavelength which excites the donor label in the first FRET pair and the donor label in the second FRET pair, detecting fluorescence from the sample and relating this to the presence or absence of the first and second target sequences. | 08-15-2013 |
20130210002 | METHOD OF ANALYZING CELLULAR CHROMOSOMES - The present invention involves an analysis method of cellular chromosomes, particularly involves a method of analyzing whether a difference exists in the chromosome number between amniotic cells and standard cells by a sequencing method. | 08-15-2013 |
20130210003 | COMPOSITIONS FOR USE IN DETECTION OF MULTIPLE ANALYTES - Methods, compositions and kits are disclosed. The methods are directed to determining the presence or relative amounts of two or more components in a medium. A combination is provided comprising a medium suspected of containing the components, at least two sensitizer reagents and at least one reactive reagent activatable by singlet oxygen. The sensitizer reagents are capable of generating singlet oxygen and are distinguishable by wavelength of sensitization. The combination of sensitizer reagents and reactive reagents allows differential detection of the components. The sensitizer reagents are differentially activated. The amount of signal generated as a result of the activation of said reactive reagent is determined wherein the amount thereof is related to the amount of each of the components in the medium. | 08-15-2013 |
20130210004 | EGFR-RELATED POLYPEPTIDES AND METHODS OF USE - Described herein are truncated EGF receptor polypeptides, nucleic acids encoding them, and methods of using them to help select a method of treatment for an EGFR-related cancer, to predict clinical outcome, and to detect micrometastases or minimal residual disease. High EGFR expression and phosphorylated EGFR predicts poor survival in head and neck cancer patients, but does not correlate with advanced stage disease. In our studies, we determined that clinical biological correlates are likely to be more accurate when different aspects of EGFR are evaluated in combination. We analyzed EGFR phosphorylation, expression and mutations in 60 primary head and neck tumors. We not only found that head and neck tumors with either truncated or activated EGFR tend to have higher tumor and nodal stage, but also discovered three EGFR truncations. | 08-15-2013 |
20130210005 | METHOD FOR DETECTING MYCOBACTERIUM TUBERCULOSIS AND NONTUBERCULOUS MYCOBACTERIA BY USING DUAL REAL-TIME POLYMERASE CHAIN REACTION - Disclosed are a primer set and/or a probe capable of detecting specific nucleotide sequences of MTC and NTM, a kit for the detection of MTC and NTM, comprising the same, and a method for detecting MTC and NTM by duplex real-time PCR using the same. Useful in detecting genes characteristic of MTC and NTM, the primer sets and/or probes, detection kits, and detection methods can be applied as the clinical diagnosis of diseases caused by MTC and NTM, and therefore find applications in the medical fields including hospitals, research institutes, etc. | 08-15-2013 |
20130210006 | PERICARP DNA EXTRACTION AND MATRILINEAGE DETERMINATION - This disclosure concerns the separation of pericarp tissue from surrounding tissues in grain. Some embodiments concern the isolation of high-purity pericarp DNA from a grain plant that reflects the genotype of the maternal parent of the grain plant, such that the isolated DNA may be used in a PCR-based genotyping assay. | 08-15-2013 |
20130210007 | TREATMENT AND DIAGNOSIS OF EPIGENETIC DISORDERS AND CONDITIONS - The present disclosure relates generally to the field of epigenetics and in particular epigenetic profiles associated with a pathological condition. The present specification teaches screening of individuals and populations for epigenetic profiles associated with a pathological condition. The epigenetic profiles can be from an intron, an intron/exon boundary or a splicing region. Epigenetic profiles are disclosed from the following sites in the FMR locus: FREES, intron 2 of FMR1, the genomic FREE2 region as a whole or specific FREE2 fragments including FREE2 (D) or FREE2 (E). Kits and diagnostic assays are also taught herein as are computer programs to monitor changes in epigenetic patterns and profiles. Further enabled herein is a method for screening for agents which can reduce or mask the adverse effects of epigenetic modification and the use of these agents in therapy and prophylaxis. | 08-15-2013 |
20130210008 | METHOD FOR AMPLIFYING NUCLEIC ACIDS - The present invention describes methods for amplifying a target nucleic acid wherein target nucleic acids hybridise to capture probe nucleic acids which are immobilized to a support via their 5′ end. The hybridization product is further extended with a polymerase to form a double stranded nucleic acid. To this double stranded nucleic acid, a hairpin nucleic acid is ligated. This ligation product is further amplified and sequenced. | 08-15-2013 |
20130210009 | CONJUGATE BETWEEN A THIOPHILIC SOLID PHASE AND AN OLIGONUCLEOTIDE COMPRISING A THIOOXONUCLEOTIDE - An oligonucleotide-solid phase conjugate, wherein the solid phase is thiophilic and the oligonucleotide comprises at least one thiooxonucleobase according to Formula I, | 08-15-2013 |
20130210010 | RAPID SALMONELLA SEROTYPING ASSAY - Processes for the serotype specific detection and identification of one or more | 08-15-2013 |
20130210011 | METHODS AND BIOMARKERS FOR DETECTION OF BLADDER CANCER - The invention relates to methods and biomarkers (e.g., epigenetic biomarkers) for detection of bladder cancer in biological samples (e.g., tissue samples, urine samples, urine sediments). In some embodiments, methods and biomarkers of the present invention find use in discriminating between bladder cancer, prostate cancer and renal epithelial tumors. | 08-15-2013 |
20130210012 | METHOD FOR ASSESSING BREAST CANCER SUSCEPTIBILITY - The present invention aims to provide a method for determining breast cancer susceptibility, in which a DNA copy number polymorphism associated with breast cancer susceptibility is identified and determination is made based on an increase or decrease in the DNA copy number polymorphism. The present invention attempts to achieve this by performing microarray assay using the peripheral blood of sporadic breast cancer patients, identifying a DNA copy number polymorphism associated with breast cancer susceptibility in a chromosomal region, detecting the number of copies of the above DNA copy number polymorphism by quantitative PCR, and then determining breast cancer susceptibility based on an increase or decrease in the DNA copy number polymorphism. Furthermore, the precision of the determination of breast cancer susceptibility can be improved by detecting a DNA copy number polymorphism by the aforementioned quantitative PCR by selecting two or more chromosomal regions and then performing a discriminant analysis based on the results thus obtained. | 08-15-2013 |
20130217009 | METHODS OF IDENTIFYING AN ORGANISM - This disclosure features methods of identifying an organism. In certain embodiments, the invention provides methods of distinguishing virulent and non-virulent strains of | 08-22-2013 |
20130217010 | CONTAINERS FOR AGITATION OF LIQUID SAMPLES AND METHODS OF USE THEREOF - The present invention relates to containers for holding liquid samples. The containers may be useful for mixing a liquid sample or lysing cells in a liquid sample. The invention also relates to methods of using the containers of the invention. | 08-22-2013 |
20130217011 | DIAGNOSTIC BIOMARKERS OF DIABETES - Methods are disclosed for the identification of gene sets that are differentially expressed in PBMCs of patients diagnosed with a pre-diabetic disease state and overt type II diabetes. 3 gene and 10 gene signatures are shown to accurately predict a diabetic disease state in a patient. The application also described kits for the rapid diagnosis of diabetic disease states in patients at a point of care facility. | 08-22-2013 |
20130217012 | C-CBL MUTATIONS AND USES THEREOF - The present invention relates generally to the fields of molecular biology and growth factor regulation. The invention concerns methods and compositions useful for diagnosing and treating human lung cancer associated with mutated c-CBL. | 08-22-2013 |
20130217013 | EXTERNAL FILES FOR DISTRIBUTION OF MOLECULAR DIAGNOSTIC TESTS AND DETERMINATION OF COMPATIBILITY BETWEEN TESTS - Embodiments disclosed herein relate to methods and systems for performing an automated assay, and particularly to performing an assay on a plurality of samples on an automated instrument. | 08-22-2013 |
20130217014 | METHODS OF USING CDK8 ANTAGONISTS - Provided herein are CDK8 antagonists and methods of using the same. | 08-22-2013 |
20130217015 | HMGA2 AS A BIOMARKER FOR DIAGNOSIS AND PROGNOSIS OF OVARIAN CANCER - The subject invention pertains to uses of HMGA2 as a diagnostic biomarker for ovarian cancer and for prediction of a subject's resistance to cancer therapy. The methods of the subject invention are particular useful for early detection of epithelial ovarian cancer. | 08-22-2013 |
20130217016 | METHOD FOR DETECTING MUTANT DNA - The present invention relates to a method for detecting of a mutant DNA using a probe, comprising:
| 08-22-2013 |
20130217017 | Detection and Assessment of Cancer Risk Using Telomere Health - Disclosed are compositions and methods related to assessing the risk of cancer, such as breast cancer and lung cancer, through analyzing the length of telomeres, such as chromosome 9p, 15p, and/or Xp telomere, such as the short arm of the 9p, 15p, and/or Xp telomere. For example, if the 9p, 15p, and/or Xp arm is shorter than normal, the risk of cancer is increased. | 08-22-2013 |
20130217018 | METHODS AND SYSTEMS FOR INFERRING BOVINE TRAITS - Methods, compositions, and systems are provided for managing bovine subjects in order to maximize their individual potential performance and edible meat value, and to maximize profits obtained in marketing the bovine subjects. The methods and systems draw an inference of a trait of a bovine subject by determining the nucleotide occurrence of at least one bovine SNP that is identified herein as being associated with the trait. The inference is used in methods of the present invention to establish the economic value of a bovine subject, to improve profits related to selling beef from a bovine subject; to manage bovine subjects, to sort bovine subjects; to improve the genetics of a bovine population by selecting and breeding of bovine subjects, to clone a bovine subject with a specific trait, to track meat or another commercial product of a bovine subject; and to diagnose a health condition of a bovine subject. Methods are also disclosed for identifying additional SNPs associated with a trait, by using the associated SNPs identified herein. | 08-22-2013 |
20130217019 | CORN EVENT MZDT09Y - A novel transgenic corn event designated MZDT09Y is disclosed. The invention relates to nucleic acids that are unique to event MZDT09Y and to methods of detecting the presence of event MZDT09Y based on DNA sequences of the recombinant constructs inserted into the corn genome that resulted in the MZDT09Y event and of genomic sequences flanking the insertion site. The invention further relates to corn plants comprising the transgenic genotype of event MZDT09Y and to methods for producing a corn plant by crossing a corn plant comprising the MZDT09Y genotype with itself or another corn variety. Seeds of corn plants comprising the MZDT09Y genotype are also objects of the invention. | 08-22-2013 |
20130224738 | DETECTING DNA METHYLATION OF BCL2, CDKN2A AND NID2 GENES TO PREDICT BLADDER CANCER IN HUMANS - The present invention provides a method of detecting DNA methylation of a plurality of genes consisting of CDKN2A, BCL2 and NID2 in a urine sample from a human. Methods and compositions are provided herein for detecting and diagnosing bladder cancer by obtaining a urine sample from a human subject suspected of bladder cancer, followed by detecting DNA methylation of CDKN2A, BCL2 AND NID2 in urine samples from the individual. The present method permits specific detection of DNA methylation of the selected gene promoters in urine as a biomarker for bladder cancer in humans. | 08-29-2013 |
20130224739 | GENETIC MARKERS FOR RISK MANAGEMENT OF VASCULAR DISEASE - Certain genetic markers have been found to be useful for risk management of vascular conditions, including abdominal aortic aneurysm, myocardial infarction, peripheral arterial disease and venous thromboembolism. The invention provides diagnostic applications using such markers, including methods of determining a susceptibility of vascular conditions. | 08-29-2013 |
20130224740 | ANALYTICAL METHODS FOR CELL FREE NUCLEIC ACIDS AND APPLICATIONS - The present invention is directed to an in vitro method of detecting cell free nucleic acids, preferably cell free DNA (cfDNA) in a body fluid sample from an individual or a patient, wherein the method comprises the step of accurately and sensitively determining the concentration of cell free nucleic acid in the sample and/or determining the concentration or amount of said cell free nucleic acid of a size range and/or the index of integrity or size fraction ratio (SFR) of said cell free nucleic acid and/or the determination of the presence of genetic polymorphisms (such as known Single Nucleotide Polymorphisms (SNPs) or mutations). The invention encompasses also a method to discriminate body fluid individuals where cfDNA are highly released by comparing the size profile obtained for at least one of three size ranges of cfDNA. The invention also encompasses a method for analysing cell nucleic acids in individuals for the diagnosis, prognosis or for assessing the evolution of a physiological state, such as the progression of a tumor or metastatic cancer, for monitoring the efficacy of a cancer treatment in a patient or for theragnostic purposes implementing the analysis of these biomarkers. | 08-29-2013 |
20130224741 | Molecular Method for the Identification of Mating Type Genes of Truffles Species - The invention concerns a method for determining the | 08-29-2013 |
20130224742 | METHOD FOR DETECTING AND/OR QUANTIFYING HUMAN DNA - The present invention relates to a method, kit and use of various nucleic acid sequences for deleting and/or quantifying one or more nucleic acids of a genome in a sample. Wherein the nucleic acid is amplified and the locus that is amplified is a multi copy locus within the genome, the multicopy locus has copies on at least two different chromosomes and the amplification product is detected and/or quantified. | 08-29-2013 |
20130224743 | Method for accurately counting starting molecules - Aspects of the present invention include methods and compositions for determining the number of individual polynucleotide molecules originating from the same genomic region of the same original sample that have been sequenced in a particular sequence analysis configuration or process. In these aspects of the invention, a degenerate base region (DBR) is attached to the starting polynucleotide molecules that are subsequently sequenced (e.g., after certain process steps are performed, e.g., amplification and/or enrichment). The number of different DBR sequences present in a sequencing run can be used to determine/estimate the number of different starting polynucleotides that have been sequenced. DBRs can be used to enhance numerous different nucleic acid sequence analysis applications, including allowing higher confidence allele call determinations in genotyping applications. | 08-29-2013 |
20130224744 | INTEGRATED DEVICE FOR REAL TIME QUANTITATIVE PCR - A method for real-time quantitative detection of single-type, target nucleic acid sequences amplified using a PCR in a microwell, comprising introducing in the microwell a sample comprising target nucleic acid sequences, magnetic primers, and labelling probes; performing an amplification cycle to form labelled amplicons; attracting the magnetic primers to a surface through a magnetic field to form a layer including labelled amplification products and free magnetic primers; and detecting the labelled amplification products in the layer with a surface-specific reading method. | 08-29-2013 |
20130224745 | COMPOSITIONS AND METHODS FOR DETECTION OF PROPIONIBACTERIUM ACNES NUCLEIC ACID - Methods for amplifying and detecting | 08-29-2013 |
20130224746 | DETECTION OF NUCLEIC ACID SEQUENCE DIFFERENCES USING COUPLED LIGASE DETECTION AND POLYMERASE CHAIN REACTIONS - The present invention relates to a method for identifying a target nucleotide sequence. This method involves forming a ligation product on a target nucleotide sequence in a ligation detection reaction mixture, amplifying the ligation product to form an amplified ligation product in a polymerase chain reaction (PCR) mixture, detecting the amplified ligation product, and identifying the target nucleotide sequence. Such coupling of the ligase detection reaction and the polymerase chain reaction permits multiplex detection of nucleic acid sequence difference. | 08-29-2013 |
20130224747 | Pathogenecity Islands of Pseudomonas Aeruginosa - Disclosed are | 08-29-2013 |
20130224748 | METHODS AND COMPOSITIONS FOR DETECTING ENDOMETRIAL OR OVARIAN CANCER - Some embodiments of the present invention relate to methods and compositions for assessing the absence, presence, progression, or stage of cancer. In particular, methods and compositions for detecting endometrial cancer or ovarian cancer are provided. | 08-29-2013 |
20130230847 | METHODS AND KITS FOR PREDICTING THE RESPONSIVENESS OF HEPATOCELLULAR CARCINOMA PATIENTS TO 5-FLUOROURACIL-BASED COMBINATION CHEMOTHERAPY - Disclosed herein is a method for identifying single nucleotide polymorphisms of a target nucleic acid for predicting whether a patient suffering from hepatocellular carcinoma will respond to a 5-fluorouracil (5-FU)-based combination chemotherapy. In some embodiments, biological sample derived from the patient is processed to determine the presence of a T/T genotype of rs9679162 GALNT14 gene. The presence of the above-identified genotype is an indication that the patient is responsive to the 5-FU-based combination chemotherapy. | 09-05-2013 |
20130230848 | Oligonucleotides Useful in Methods for Detecting and Characterizing Aspergillus fumigatus - Methods for using oligonucleotides in the detection of | 09-05-2013 |
20130230849 | SPINOCEREBELLAR ATAXIA TYPE 8 AND METHODS OF DETECTION - The present invention provides an isolated nucleic acid molecule containing a repeat region of an isolated spinocerebellar ataxia type 8 (SCA8) coding sequence, the coding sequence located within the long arm of chromosome 13, and the complement of the nucleic acid molecule. Diagnostic methods based on identification of this repeat region are also provided. | 09-05-2013 |
20130230850 | METHOD FOR USING PROBE BASED PCR DETECTION TO MEASURE THE LEVELS OF CIRCULATING DEMETHYLATED BETA CELL DERIVED DNA AS A MEASURE OF BETA CELL LOSS IN DIABETES - A method for measuring blood levels of β cell DNA that is released upon β cell death by using a quantitative probe technology to detect amplified methylated and demethylated forms of the insulin gene DNA, representing normal tissue and β cell specific origin, respectively. Using probes permits the sensitive and specific identification of demethylated insulin DNA patterns that are present only in β cells. The method offers a bioassay for detecting β cell loss in diabetes, useful for screening of prediabetes, monitoring of disease progression, and selection and monitoring of therapies. The technique finds potential use in both Type I and Type II diabetes, as well as gestational diabetes. | 09-05-2013 |
20130230851 | Nanoreporters And Methods Of Manufacturing And Use Thereof - The present invention relates to compositions and methods for detection and quantification of individual target molecules in biomolecular samples. In particular, the invention relates to coded, labeled probes that are capable of binding to and identifying target molecules based on the probes' label codes. Methods of making and using such probes are also provided. The probes can be used in diagnostic, prognostic, quality control and screening applications. | 09-05-2013 |
20130230852 | PROTEIN KINASE CK2 GENE MUTATIONS, AMPLIFICATIONS AND POLYMORPHISMS IN HUMAN CANCERS AND METHODS OF USE - The present disclosure provides methods and compositions for diagnosis and for providing a prognosis of a cancer patient by assessing CK2 alpha 1 pseudogene (CSNK2A1P) status. The present disclosure also provides polypeptide, polynucleotide, host cell, and transgenic animal compositions associated with CSNK2A1P. | 09-05-2013 |
20130230853 | Methods and Compounds For Detection of Molecular Targets - The present invention relates to methods and compounds for detection of molecular targets, such as biological or chemical molecules, or molecular structures, in samples using a host of experimental schemes for detecting and visualizing such targets, e.g. immunohistochemistry (IHC), in situ hybridization (ISH), ELISA, Southern, Northern, and Western blotting, etc. | 09-05-2013 |
20130230854 | Method and Device for Immunoassay Using Nucleotide Conjugates - A composition of matter for use in an immunoassay devices and method comprising a signal antibody, e.g., FAB fragment, covalently linked to a first nucleotide; and one or more signal elements, e.g., signal enzymes such as ALP or fluorescent dyes, each covalently linked to a second nucleotide, wherein the first nucleotide has one or more repeated sequences, and the second nucleotide is bound to one of the one or more repeated sequences on said first nucleotide, and wherein the ratio of the signal antibody to the signal element is controlled by the number of repeated sequences. | 09-05-2013 |
20130230855 | Monocyte-derived Nucleic Acids and Related Compositions and Methods - Nucleic acids encoding various monocyte-derived proteins and related compositions, including purified proteins and specific antibodies are described. Methods of using such composition are also provided. | 09-05-2013 |
20130230856 | CAPTURE OF TARGET DNA AND RNA BY PROBES COMPRISING INTERCALATOR MOLECULES - The present invention relates to a technology for specific capture of single stranded target Polynucleotide by a complementary probe comprising one or more intercalator molecules. The method further involves removal of one or more types of bases in the single stranded target Polynucleotide prior to interaction with the complementary probe. This results in generation of one or more abasic sites which can interact with and/or into where the intercalator molecule can be inserted. | 09-05-2013 |
20130230857 | HYBRID SELECTION USING GENOME-WIDE BAITS FOR SELECTIVE GENOME ENRICHMENT IN MIXED SAMPLES - The present invention provides methods for sequencing and genotyping of DNA useful for analysis of samples in which the target DNA represents a small portion (e.g., 10-1000-fold less) that a contaminating DNA source. Accordingly, the methods described herein are useful for sequencing or genotyping pathogen DNA, such as malaria DNA, in clinical samples taken from infected subjects. | 09-05-2013 |
20130236889 | Vascularization Inhibitors - This invention provides a therapeutic agent for inhibiting neovascularization, a therapeutic agent for a solid cancer, a therapeutic agent for a disease pathologically caused by neovascularization, and a therapeutic agent for repairing a tissue comprising as the effective ingredient, a substance that potentiates the action of CXCR4. | 09-12-2013 |
20130236890 | NOVEL METHOD FOR ANALYZING CIRCULATING TUMOR CELLS OF A PATIENT FOR THE PRESENCE OF METASTASIS-INITIATING CELLS - This invention relates to a novel method for analyzing circulating tumor cells of a patient for the presence of metastasis-initiating cells. The method comprises the step of detecting cells exhibiting the simultaneous presence of c-MET, CD44 and CD47. The invention further relates to novel kits, novel methods for treating patients, and novel bifunctional analytes. | 09-12-2013 |
20130236891 | METHOD AND COMPOSITION FOR THE TREATMENT, PREVENTION, AND DIAGNOSIS OF CANCER CONTAINING OR DERIVED FROM CANCER STEM CELLS - The invention provides a method and composition for the treatment, prevention, and diagnosis of cancer containing or derived from cancer stem cells. | 09-12-2013 |
20130236892 | MEANS AND METHODS FOR THE DETECTION OF A PREDISPOSITION OF A FEMALE SUBJECT TO RECURRENT PREGNANCY LOSS (RPL), PREECLAMPSIA (PE) AND/OR FETAL GROWTH RESTRICTION (FGR) - The present invention relates to a method for diagnosing or detecting a predisposition of a female subject to recurrent pregnancy loss (RPL), preeclampsia (PE) and/or fetal growth restriction (FGR), comprising examining the human annexin A5 (ANXA5) promoter in a sample obtained from the intended biological father or the biological father and to detect nucleotide exchanges therein, wherein the presence of the nucleotide exchanges defined in (i) and/or (ii) indicates a predisposition of said female subject to recurrent pregnancy loss (RPL), preeclampsia (PE) and/or fetal growth restriction (FGR). The present invention also relates to a nucleic acid sequence comprising a human annexin A5 (ANXA5) promoter, which promoter comprises specific nucleotide exchanges defined herein, for use in the methods disclosed herein. The present invention further relates to a kit for use in the diagnostic methods disclosed herein. | 09-12-2013 |
20130236893 | METHOD OF DETECTING TYPE II DIABETES - A single-nucleotide polymorphism in the UBE2E2 locus or C2CD4A-C2CD4B locus is analyzed and type II diabetes is examined based on the results of the analysis. | 09-12-2013 |
20130236894 | MUTATIONS IN SPTLC2 GENE ASSOCIATED WITH SENSORY NEUROPATHY - Described are methods and kits for identifying a subject at risk of, or having, a sensory neuropathy related disease, such as sensory neuropathies. In particular, the disclosure is based on the determination of mutations in the SPTLC2 gene causing sensory neuropathies. | 09-12-2013 |
20130236895 | METHOD OF SEQUENCE DETERMINATION USING SEQUENCE TAGS - The invention is directed to the use of sequence tags to improve sequence determination of amplicons of related sequences, particularly large and complex amplicons, such as those comprising recombined nucleic acids encoding immune receptor molecules. In one aspect, sequence reads having the same sequence tags are aligned after which final base calls are determined from a (possibly weighted) average base call from sequence read base calls at each position. Similarly, in another aspect, sequence reads comprising series of incorporation signals are aligned by common sequence tags and base calls in homopolymer regions are made as a function incorporation signal values at each “flow” position. | 09-12-2013 |
20130236896 | E. COLI O157:H7 SPECIFIC ASSAY - Disclosed are assays, methods and kits for the specific detection of | 09-12-2013 |
20130244232 | HIGH-EFFICIENCY CATALYSTS, PREPARATION AND USE THEREOF - Disclosed are new molecules, on a peptide-porphyrin base, with a low molecular weight (2000-5000 uma), optionally in covalent association with biomolecules, which are able to catalyse peroxidation, oxidation, hydroxylation, phenol nitration and inert compound epoxidation reactions, using clean reagents such as H | 09-19-2013 |
20130244233 | Methods and Materials for Determining Pain Sensitivity and Predicting and Treating Related Disorders - Methods of treating somatosensory disorders and modulating production of proinflammatory cytokines by administering to a subject an effective amount of a COMT modulator, ADRB2 modulator, ADRB3 modulator or combinations thereof are provided. Methods of predicting effective pharmacological therapies for a subject afflicted with a somatosensory disorder by determining a genotype of the subject with regard to a gene selected from the group consisting of COMT, ADRB2, ADRB3, and combinations thereof are further provided. Methods of determining pain responses or pain perception and predicting susceptibility of a subject to develop related disorders, such as somatosensory disorders and somatization, by determining a genotype of the subject with regard to a gene selected from the group consisting of COMT, ADRB2, ADRB3, and combinations thereof are further provided. | 09-19-2013 |
20130244234 | STOOL COLLECTION METHODS FOR ANALYSIS OF DNA IN STOOL - Methods of stool sample collection for improving DNA extraction and analysis from stool samples. More specifically, collecting stool samples from the same patient on two or more days (consecutively or randomly) and combining those stool samples for improved DNA extraction and analysis. | 09-19-2013 |
20130244235 | METHODS AND MATERIALS FOR NONINVASIVE DETECTION OF COLORECTAL NEOPLASIA ASSOCIATED WITH INFLAMMATORY BOWEL DISEASE - The present invention provides methods and materials related to the detection of colorectal neoplasia (CRN) associated with inflammatory bowel disease (IBD). The present invention provides markers specific for colorectal neoplasia associated with inflammatory bowel disease in or associated with a subject's stool sample. In particular, the present invention provides methods and materials for identifying mammals (e.g., humans) having colorectal neoplasia associated with inflammatory bowel disease by detecting the presence and level of indicators of colorectal neoplasia such as, for example, epigenetic alterations (e.g., DNA methylation) (e.g., CpG methylation) (e.g., CpG methylation in coding or regulatory regions of BMP3, NDRG4, vimentin, EYA4) in DNA from a stool sample obtained from the mammal. | 09-19-2013 |
20130244236 | PREDICTING RISK OF MAJOR ADVERSE CARDIAC EVENTS - Measurement of circulating ST2 and natriuretic peptide (e.g., NT-proBNP) concentrations is useful for the prognostic evaluation of subjects, in particular for the prediction of adverse clinical outcomes, e.g., mortality, transplantation, and heart failure. | 09-19-2013 |
20130244237 | Methods and Compositions for Discrimination Between Cytosine and Modifications Thereof and for Methylome Analysis - Compositions and methods are provided for discrimination between cytosine and modifications thereof using cytidine deaminases and/or oxygenases. Variants of wild type cytidine deaminases are described which show reduced bias with respect to adjacent nucleotides upstream of the cytosine. The methods provide a rapid and convenient use of enzymes to obtain methylomes. | 09-19-2013 |
20130244238 | NMR SYSTEMS AND METHODS FOR THE RAPID DETECTION OF ANALYTES - This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. | 09-19-2013 |
20130252238 | POLYMERASE CHAIN REACTION DETECTION SYSTEM - The present invention relates to methods and kits for nucleic acid detection in an assay system. | 09-26-2013 |
20130252239 | Primers and Methods for the Detection and Discrimination of Nucleic Acids - The present invention provides novel primers and methods for the detection of specific nucleic acid sequences. The primers and methods of the invention are useful in a wide variety of molecular biology applications and are particularly useful in allele specific PCR. | 09-26-2013 |
20130252240 | CRYOEMBEDDED CELL CONCENTRATES, METHODS FOR MAKING, AND METHODS FOR USING - Methods for preparing a cryoembedded cell concentrate are disclosed. The cryoembedded cell concentrate can be sectioned for use in methods (e.g., immunohistochemistry assays, immunocytochemistry assays, methods that use light or fluorescent microscopy, in situ hybridization assays, or diagnostic methods). Also disclosed are kits comprising cryoembedded cell concentrates. | 09-26-2013 |
20130252241 | METHOD OF DISTINGUISHING INFLAMMATORY PATHOGEN CAUSING ACUTE RESPIRATORY INFECTION - The present invention provides a method of distinguishing a respiratory pathogen causing acute respiratory infection, wherein a pathogen to be distinguished is a pathogen colonizing the respiratory tract, the method comprising: | 09-26-2013 |
20130252242 | SOYBEAN EVENT 3560.4.3.5 AND COMPOSITIONS AND METHODS FOR THE IDENTIFICATION AND/OR DETECTION THEREOF - Compositions and methods related to transgenic glyphosate/ALS inhibitor-tolerant soybean plants are provided. Specifically, soybean plants having a 3560.4.3.5 event which imparts tolerance to glyphosate and at least one ALS-inhibiting herbicide are provided. The soybean plant harboring the 3560.4.3.5 event at the recited chromosomal location comprises genomic/transgene junctions having at least the polynucleotide sequence of SEQ ID NO:10 and/or 11. The characterization of the genomic insertion site of the 3560.4.3.5 event provides for an enhanced breeding efficiency and enables the use of molecular markers to track the transgene insert in the breeding populations and progeny thereof. Various methods and compositions for the identification, detection, and use of the soybean 3560.4.3.5 events are provided. | 09-26-2013 |
20130260373 | Quantification of Human Mitochondrial DNA Using Synthesized DNA Standards - A real-time quantitative PCR assay that utilizes a duplex, synthetic DNA standard to ensure optimal quality assurance and quality control. One embodiment of the invention facilitates amplification of mtDNA by focusing on a 105-base pair target sequence that is minimally homologous to non-human mtDNA. The present invention can also be used to identify the presence of PCR inhibitors and thus indicate the need for sample repurification. | 10-03-2013 |
20130260374 | COMPOSITIONS AND METHODS FOR DETECTION OF MYCOBACTERIUM AVIUM PARATUBERCULOSIS - Disclosed are compositions, assays, methods, diagnostic methods, kits and diagnostic kits for the specific and differential detection of | 10-03-2013 |
20130260375 | COMPOSITIONS AND METHODS FOR DETECTION OF MICROORGANISMS OF THE MYCOBACTERIUM AVIUM COMPLEX EXCLUDING MYCOBACTERIUM AVIUM PARATUBERCULOSIS - Disclosed are compositions, assays, methods, diagnostic methods, kits and diagnostic kits for the specific and differential detection of a non- | 10-03-2013 |
20130260376 | Prediction of and Monitoring Cancer Therapy Response Based on Gene Expression Profiling - The invention utilizes gene expression profiles in methods of predicting the likelihood that a patient's cancer will respond to standard-of-care therapy. Also provided are methods of identifying therapeutic agents that target cancer stem cells or epithelial cancers that have undergone an epithelial to mesenchymal transition using such gene expression profiles. | 10-03-2013 |
20130260377 | CAPTURE BASED NUCLEIC ACID DETECTION - The present invention relates to methods and kits useful for the detection of a target nucleotide sequence in a sample. In general, the methods of the present invention are predicated on the target-mediated capture of a nuclease into a complex wherein the extent of complex formation, as measured by nuclease activity, is positively correlated with the presence of the target nucleic acid in the sample. | 10-03-2013 |
20130260378 | METHOD FOR DETERMINING CANCER PATIENT SURVIVAL BASED ON ANALYZING TUMORINFILTRATING OVERALL T-LYMPHOCYTES - The present invention relates to a method, in vitro or in vivo, for determining cancer patient survival, comprising analyzing the number and/or amount of tumor-infiltrating overall T-lymphocytes (oTLs) based on the methylation status of at least one CpG position in one or more of the genes for CD3 γ, -δ, and -ε in a tumor sample derived from said cancer patient, wherein a high number and/or amount of oTLs is indicative for a better survival of said cancer patient in a non-breast cancer, wherein in breast cancer a high number and/or amount of oTLs is indicative for an inferior survival of said patient. The present invention also relates to a respective kit for use in the methods of the invention. | 10-03-2013 |
20130260379 | SIGNALING CONJUGATES AND METHODS OF USE - Disclosed herein are embodiments of a signaling conjugate, embodiments of a method of using the signaling conjugates, and embodiments of a kit comprising the signaling conjugate. The disclosed signaling conjugate comprises a latent reactive moiety and a chromogenic moiety that may further comprise a linker suitable for coupling the latent reactive moiety to the chromogenic moiety. The signaling conjugate may be used to detect one or more targets in a biological sample and are capable of being covalently deposited directly on or proximally to the target. Particular disclosed embodiments of the method of using the signaling conjugate comprise multiplexing methods. | 10-03-2013 |
20130260380 | METHOD FOR DETECTING THE PRESENCE OF A DNA MINOR CONTRIBUTOR IN A DNA MIXTURE - The present invention concerns a method of detecting the presence of a DNA minor contributor in a DNA mixture by determining several haplotypes present in said one or more DNA samples. | 10-03-2013 |
20130260381 | COPY NUMBER VARIATION DETERMINATION, METHODS AND SYSTEMS - The present invention methods and systems for determining copy number variation of a target polynucleotide in a genome of a subject including amplification based techniques. Methods can include pre-amplification of the sample followed by distribution of sample and a plurality of reaction volumes, quantitative detection of a target polynucleotide and a reference polynucleotide, and analysis so as to determine the relative copy number of the target polynucleotide sequence in the genome of the subject. | 10-03-2013 |
20130266936 | Molecular Markers for the Diagnosis and Treatment of Tumors - The invention relates to the diagnosis, prognosis, monitoring, and treatment of neoplastic diseases such as tumor diseases, especially tumor diseases of the endometrium and the metastases thereof. | 10-10-2013 |
20130266937 | COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING MACULAR DEGENERATION - The present invention relates generally to biomarkers for macular degeneration. In particular, the present invention provides a plurality of biomarkers (e.g., polymorphisms and/or haplotypes) for monitoring and diagnosing macular degeneration. The compositions and methods of the present invention find use in diagnostic, therapeutic, research, and drug screening applications. | 10-10-2013 |
20130266938 | Format of Probes to Detect Nucleic Acid Differences - The invention provides, inter alia, novel probes, methods, reaction mixtures, and kits for detecting the presence or absence of a target nucleic acid sequence. | 10-10-2013 |
20130266939 | SYSTEMS AND METHODS FOR STUDYING INFLAMMATION-DRUG INTERACTIONS - The present disclosure provides compositions, systems, and tools for modeling liver inflammation and methods of using the same. The disclosure provides micropatterned hepatocyte co-cultures where individual cell populations remain functionally stable during long-term culture. The in vitro liver inflammation models of the present disclosure may be useful for evaluating inflammation-mediated toxicities of compounds in a pre-clinical setting. | 10-10-2013 |
20130266940 | Methods of Detecting Kidney-Associated Diseases or Conditions - The disclosure provides methods of using phagocytic cells alone or in combination with non-phagocytic cells in the diagnosis, prognosis, or monitoring of kidney associated diseases or conditions. The disclosure also provides methods of using phagocytic cells alone or in combination with non-phagocytic cells to identify markers of kidney-associated diseases or conditions. | 10-10-2013 |
20130266941 | DIAGNOSTIC ASSAYS FOR THE DETECTION AND IDENTIFICATION OF ASPERGILLI - Three important species of | 10-10-2013 |
20130266942 | SEQUENCES FOR DETECTION AND IDENTIFICATION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) OF MREJ TYPE XXI - Provided herein are compositions and methods for the detection and identification of | 10-10-2013 |
20130266943 | COMPOSITIONS AND METHODS FOR ADHESION-BASED CELL SORTING - In an aspect, provided is an apparatus for sorting cells. The device may include polymer nanofibers treated with gaseous plasma. The nanofibers may comprise at least one of polycaprolactone and collagen. The gaseous plasma may comprise at least one of CF | 10-10-2013 |
20130266944 | NMR SYSTEMS AND METHODS FOR THE RAPID DETECTION OF ANALYTES - This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. | 10-10-2013 |
20130266945 | GENETIC LOCI ASSOCIATED WITH MECHANICAL STALK STRENGTH IN MAIZE - The invention relates to methods and compositions for identifying and for selecting maize plants with mechanical stalk strength characteristics. The methods use molecular markers to identify and select plants with increased mechanical stalk strength or to identify and counter-select plants with decreased mechanical stalk strength. Maize plants generated by the methods of the invention are also a feature of the invention. | 10-10-2013 |
20130273531 | AMBIENT TEMPERATURE STABLE KITS FOR MOLECULAR DIAGNOSTICS - A method for processing DNA polymerase and/or dNTPs for use in an amplification procedure, includes providing a solution mixture, the solution mixture including a DNA polymerase and/or dNTPs, a buffer solution and at least one stabilizing agent and hydration reducing the solution mixture. The solution mixture is hydration reduced at a temperature between 0° C. and about 100° C. | 10-17-2013 |
20130273532 | UPREGULATION OF RACK-1 IN MELANOMA AND ITS USE AS A MARKER - The present invention concerns a method for diagnosing a melanoma in a mammal comprising the detection of the overexpression of RACK-1 protein in a melanocyte cell of said mammal, and the deduction of the presence of a melanoma from the overexpression of RACK-1 protein. The invention is also directed to a method for determining the tumoral status of a melanocyte cell of a mammal, comprising the detection of overexpression of RACK-1 protein in the melanocyte cell, and the deduction of the tumoral state of said cell from the overexpression of RACK-1 protein. | 10-17-2013 |
20130273533 | MOLECULAR FLUX RATES THROUGH CRITICAL PATHWAYS MEASURED BY STABLE ISOTOPE LABELING IN VIVO, AS BIOMARKERS OF DRUG ACTION AND DISEASE ACTIVITY - The methods described herein enable the evaluation of compounds on subjects to assess their therapeutic efficacy or toxic effects. The target of analysis is the underlying biochemical process or processes (i.e., metabolic process) thought to be involved in disease pathogenesis. Molecular flux rates within the one or more biochemical processes serve as biomarkers and are quantitated and compared with the molecular flux rates (i.e., biomarker) from control subjects (i.e., subjects not exposed to the compounds). Any change in the biomarker in the subject relative to the biomarker in the control subject provides the necessary information to evaluate therapeutic efficacy of an administered drug or a toxic effect and to develop the compound further if desired. In one aspect of the invention, stable isotope-labeled substrate molecules are administered to a subject and the label is incorporated into targeted molecules in a manner that reveals molecular flux rates through one or more metabolic pathways of interest. By this method, a comparison between subjects and control subjects reveals the effects of the chemical entity or entities on the biomarkers. This, in turn, allows for the identification of potential therapeutic uses or toxicities of the compound. Combinations of compounds can also be systematically evaluated for complementary, synergistic, or antagonistic actions on the metabolic pathways of interest, using the methods of the present invention as a strategy for identifying and confirming novel therapeutic or toxic combinations of compounds. | 10-17-2013 |
20130273534 | SOCS-3 PROMOTER METHYLATION IN CANCER - This invention provides compositions and methods for the diagnosis and treatment of cancers that exhibit decreased SOCS-3 expression. | 10-17-2013 |
20130273535 | NDM-1 POLYMERASE CHAIN REACTION (PCR) ASSAY - Provided herein are compositions, methods, and kits for detection, identification, and analysis of NDM-1 variant nucleic acid. In particular, provided herein are kits, compositions, and methods for the detection, identification, and analysis of the NDM-1 variant nucleic acid and bacteria o other organisms carrying the NDM-1 variant nucleic acid. | 10-17-2013 |
20130273536 | COMBINED CHEMICAL AND GENETIC APPROACHES FOR GENERATION OF INDUCED PLURIPOTENT STEM CELLS - The present invention provides for identification and use of small molecules to induce pluripotency in mammalian cells as well as other methods of inducing pluripotency. | 10-17-2013 |
20130273537 | Transcriptome In Vivo Analysis - The invention provides compositions and methods that permit a hybrid nucleic acid molecule to enter a cell and when specifically activated within the cell, the molecule anneals to endogenous cellular RNA and permits the isolation of the RNA. | 10-17-2013 |
20130273538 | METHOD FOR IDENTIFYING OLFACTORY RECEPTOR INCLUDED IN ONE OLFACTORY CELL - The present invention provides a novel method for identifying an olfactory receptor included in one olfactory cell. In the present invention, amplified is the cDNA derived from the mRNA of the one olfactory cell by a PCR method using a forward primer represented by SEQ ID: 01 and a reverse primer represented by SEQ ID: 02. Subsequently, determined is whether or not a gene sequence of the amplified cDNA corresponds with one gene sequence included in gene sequences coding for olfactory receptors included in the mouse olfactory receptor group A. Finally, determined is that the olfactory receptor included in the one olfactory cell is the olfactory receptor which corresponds to the one gene sequence which corresponds with the gene sequence of the cDNA in the previous step, if the gene sequence of the cDNA corresponds with the one gene sequence in the previous step. | 10-17-2013 |
20130273539 | METHOD FOR IDENTIFYING OLFACTORY RECEPTOR INCLUDED IN ONE OLFACTORY CELL - The present invention provides a novel method for identifying an olfactory receptor included in one olfactory cell. In the present invention, amplified is the cDNA derived from the mRNA of the one olfactory cell by a PCR method using a forward primer represented by SEQ ID: 01 and a reverse primer represented by SEQ ID: 02. Subsequently, determined is whether or not a gene sequence of the amplified cDNA corresponds with one gene sequence included in gene sequences coding for olfactory receptors included in the mouse olfactory receptor group A. Finally, determined is that the olfactory receptor included in the one olfactory cell is the olfactory receptor which corresponds to the one gene sequence which corresponds with the gene sequence of the cDNA in the previous step, if the gene sequence of the cDNA corresponds with the one gene sequence in the previous step. | 10-17-2013 |
20130273540 | METHOD FOR CHROMOGENIC DETECTION OF TWO OR MORE TARGET MOLECULES IN A SINGLE SAMPLE - The present invention provides a method and kit for detection of two or more target molecules in a single tissue sample, such as for gene and protein dual detection in a single tissue sample. Methods comprise treating a tissue sample with a first binding moiety that specifically binds a first target molecule. Methods further comprise treating the tissue sample with a solution containing a soluble electron-rich aromatic compound prior to or concomitantly with contacting the tissue sample with a hapten-labeled binding moiety and detecting a second target molecule. In one example, the first target molecule is a protein and the second is a nucleic acid sequence, the first target molecule being detected by immunohistochemistry and the second by in situ hybridization. The disclosed method reduces background due to non-specific binding of the hapten-labeled specific binding moiety to an insoluble electron rich compound deposited near the first target molecule. | 10-17-2013 |
20130273541 | Breast Cancer Susceptibility Gene GT198 and Uses Thereof - It has been discovered that the human GT198 gene (gene symbol PSMC3IP) at chromosome 17q21 acts as a tumor suppressor. The mutation of the GT198 gene causes the increased dominant negative splice variant activity and leads to the loss of wild type GT198 function, and in turn, induces breast and ovarian cancers. One embodiment provides compositions and methods for treating or alleviating one or more symptoms associated with cancer due to the GT198 gene mutations. Another embodiment provides methods and compositions for detecting cancer due to the mutation of the GT198 gene. Still another embodiment provides methods for identifying compounds, antibodies and natural product molecules that are useful for treating cancer due to the mutations of the GT198 gene. Preferably the disclosed compositions antagonize or interfere with the biological activity of splice variants of GT198. | 10-17-2013 |
20130273542 | DETECTION OF GLEEVEC RESISTANCE - The present invention relates to isolated polypeptides which comprise an amino acid sequence consisting of a mutated functional Abl kinase domain, said mutated functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such polypeptides to screen for compounds which inhibit the tyrosine kinase activity of such polypeptides, to nucleic acid molecules encoding such polypeptides, to recombinant vectors and host cells comprising such nucleic acid molecules and to the use of such nucleic acid molecules in the production of such polypeptides for use in screening for compounds which inhibit the tyrosine kinase activity of such polypeptides. | 10-17-2013 |
20130273543 | GENETIC VARIANTS USEFUL FOR RISK ASSESSMENT OF THYROID CANCER - The invention discloses genetic variants that have been determined to be susceptibility variants of thyroid cancer. Methods of disease management, including methods of determining susceptibility to thyroid cancer, methods of predicting response to therapy and methods of predicting prognosis of thyroid cancer using such variants are described. The invention further relates to kits useful in the methods of the invention. | 10-17-2013 |
20130280703 | METHOD OF ANALYZING A BRCA2 GENE IN A HUMAN SUBJECT - Five novel DNA and protein sequences have been determined for the BRCA2 gene, as have been ten polymorphic sites and their rates of occurrence in the normal alleles of BRCA2. The sequences BRCA2 | 10-24-2013 |
20130280704 | ENHANCED DETECTION OF NON-SOMATIC CIRCULATING NUCLEIC ACIDS - Methods, equipment and software for the detection of abnormal nucleic acid or fetal nucleic acid sequences circulating in the subject's blood or other body fluids. A scan of a subject's circulating nucleic acid (CNA) is compared to the CNA Data On Normal Healthy Population or to a scan of the subject's own Somatic Nucleic Acid (SNA). Abnormal peaks are identified by subtracting out the “normal” or somatic peaks. The resultant anomalous peaks are compared to anomalous CNA data to identify the abnormalities, or the anomalous peaks of the subject's CNA are isolated, amplified, and sequenced or probed to determine the nature of the anomaly. | 10-24-2013 |
20130280705 | METHODS AND COMPOSITIONS FOR ASSESSMENT OF PULMONARY FUNCTION AND DISORDERS - The present invention provides methods for the assessment of risk of developing lung cancer in smokers and non-smokers using analysis of genetic polymorphisms. The present invention also relates to the use of genetic polymorphisms in assessing a subject's risk of developing lung cancer, and the suitability of a subject for an intervention in respect of lung cancer. Nucleotide probes and primers, kits, and microarrays suitable for such assessment are also provided. | 10-24-2013 |
20130280706 | Compositions and Methods for Quantifying a Nucleic Acid Sequence in a Sample - The present invention features compositions and methods for quantifying detection of a target oligonucleotide in a sample in real time. These methods are compatible with target oligonucleotides amplified using a NEAR reaction. | 10-24-2013 |
20130280707 | TOP2A INHIBITION BY TEMOZOLOMIDE AND ITS PREDICTIVE VALUE OF GBM PATIENTS SURVIVAL - The present invention provides a TOP2A inhibition by temozolomide useful for predicting glioblastoma patient's survival. Glioblastoma (GBM) is the most common, malignant primary adult brain tumor. The conventional treatments for GBM, include surgery, radiation, and chemotherapy which have only modestly improved patient survival. The patients with GBM expressing higher TOP2A transcript levels had better prognosis. More interestingly, the present invention reports that temozolomide is an inhibitor of TOP2A activity in vitro. The present invention further shows that siRNA knock down of TOP2A rendered a glioma cell line resistant to temozolomide chemotherapy. Thus it is demonstrated for the first time that temozolomide is a TOP2A inhibitor and establishes that TOP2A transcript levels determines the chemosensitivity of glioblastoma to temozolomide therapy thus explaining the very high levels of TOP2A transcript being a good prognostic indicator in GBM patients receiving temozolomide chemotherapy. | 10-24-2013 |
20130280708 | COMPOSITIONS AND METHODS FOR DETECTION OF CANDIDA SPECIES - The invention features compositions and methods for the detection of | 10-24-2013 |
20130280709 | DIAGNOSIS OF FETAL ABNORMALITIES USING POLYMORPHISMS INCLUDING SHORT TANDEM REPEATS - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, i.e. aneuploidy. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. | 10-24-2013 |
20130280710 | Fluidically Integrated Rotary Bead Beader - A system for at least one of homogenization and lysis of a sample includes one or more walls forming an enclosed chamber having an inlet and a plurality of fluidic connections. A first fluidic network is coupled to at least one of the plurality of fluidic connections and a second fluidic network is coupled to at least one of the plurality of fluidic connections. The system further includes a rotary element within the chamber, and an actuator configured to rotate the rotary element. The first fluidic network is configured to introduce at least a sample into the chamber from at least one first reservoir. The second fluidic network is configured to expel at least the sample from the chamber to at least one second reservoir. The rotary element is rotated by the actuator about an axis extending along a length of the rotary element. | 10-24-2013 |
20130280711 | Probe, and Polymorphism Detection Method Using the Same - The present invention provides a probe for detecting a V600 polymorphism in the BRAF gene, which is (P1) a fluorescently labeled oligonucleotide which has an identity of at least 80% to a base sequence having a length of 10 to 50 bases including the 228th to the 237th bases of the base sequence indicated in SEQ ID NO:1, wherein the base corresponding to the 237th base is cytosine labeled with a fluorescent dye, the oligonucleotide recognizing a polymorphism in at least one of the 228th to the 230th bases of the base sequence indicated in SEQ ID NO:1 (with the proviso that the oligonucleotide is not the one indicated in SEQ ID NO:7 or 19). | 10-24-2013 |
20130280712 | Method of Detecting Nucleic Acid Targets Using a Statistical Classifier - A method of detecting a target nucleic acid in a test sample utilizes a learning statistical classifier system to build a general linear classifier based on an amplification-dependent parameter for the target and the control nucleic acids, in order to classify the test sample as containing or not containing the target nucleic acid. | 10-24-2013 |
20130280713 | POLYNUCLEOTIDE AND USE THEREOF - A first polynucleotide including at least two complementary regions that are complementary to a target nucleic acid and have a reverse configuration, a second polynucleotide complementary to the first polynucleotide, and uses thereof, are provided. | 10-24-2013 |
20130280714 | RAPID SALMONELLA SEROTYPING ASSAY - Processes for the serotype specific detection and identification of one or more | 10-24-2013 |
20130280715 | Methods, Systems and Compositions for Nucleic Acid Analysis Using Back-Scattering Interferometry - Disclosed are methods, systems, and apparatuses for the measurement of hybridization of nucleic acid polymers or binding other biological molecular species such as proteins, enzymes, receptors, and antibodies to binding partners, by backscattering interferometry (BSI). | 10-24-2013 |
20130280716 | Ratio of apoa2 to HDLc or Equivalents thereof, Risk Markers for Cardiovascular Disease - The present disclosure provides methods and markers for characterizing a subject's, particularly a human subject's, risk of having cardiovascular disease. The present disclosure also provides methods of characterizing a subject's risk of developing cardiovascular disease. In another embodiment, the present disclosure provides methods for characterizing a subject's risk of experiencing a complication of cardiovascular disease or major adverse cardiac event within 3 months, 6 months, 1 year, 3 years, 5 years, or 10 years. In another embodiment, the present disclosure provides a method for determining whether a subject presenting with chest pain is at risk near term of experiencing a heart attack or other major adverse cardiac event. The present methods are especially useful for identifying those subjects who are in need of highly aggressive CVD therapies as well as those subjects who require no therapies targeted at inhibiting or preventing CVD or complications of CVD. | 10-24-2013 |
20130280717 | METHOD TO DETERMINE EMBRYO AND OOCYTE QUALITY BASED ON CERAMIDASE - The present invention relates to a method of predicting the likelihood of embryo or oocyte survival. This method involves providing a sample of an embryo, an oocyte, or surrounding liquid or cells, and screening the sample for ceramidase expression or activity. The ceramidase expression or activity obtained through said screening is then correlated to a prediction of the likelihood of embryo or oocyte survival. Also disclosed is a kit. | 10-24-2013 |
20130288236 | WT1 MUTATIONS FOR PROGNOSIS OF MYELOPROLIFERATIVE DISORDERS - The invention provides methods for determining the prognosis of a patient diagnosed with a leukemia, including B-cell chronic lymphocytic leukemia, by measuring mutations of the WT1 gene in a biological sample. The invention also relates to the diagnosis of leukemia, including B-cell chronic lymphocytic leukemia. | 10-31-2013 |
20130288237 | QUANTIFICATION OF ADAPTIVE IMMUNE CELL GENOMES IN A COMPLEX MIXTURE OF CELLS - Compositions and methods are described for highly sensitive quantification of the relative representation of DNA from adaptive immune cells (e.g., T and/or B lymphocytes) in DNA extracted from complex mixtures of cells that include cells which are not adaptive immune cells. Included are methods for determining the relative presence in a tumor of tumor infiltrating lymphocytes (TIL), the relative presence of lymphocytes infiltrating a somatic tissue that is the target of an autoimmune disease, and the relative presence of lymphocytes infiltrating a transplanted organ. | 10-31-2013 |
20130288238 | Methods and Compositions for Detecting Serotypes of Chlamydia trachomatis Capable of Causing Lymphogranuloma Venereum - Disclosed are methods and compositions for conducting assays utilizing real-time polymerase chain reactions (“PCRs”) in detection of serotypes L I, L II, and L III, but not stereotype B, of | 10-31-2013 |
20130288239 | BIOMARKER FOR HUMAN LIVER CANCER - The disclosure relates to a method for determining incidence of liver cancer in a subject, including detecting methylation level or expression level of one microRNA miR-129-2 in a bio-sample from the subject. In the case that the methylation level of the microRNA in the bio-sample is higher or the expression level of the microRNA in the bio-sample is lower relative to that of the corresponding microRNA in a control sample, indicates that the subject is predisposed to or afflicted with liver cancer. | 10-31-2013 |
20130288240 | ALK AND ROS KINASE IN CANCER - A method for identifying a patient with cancer or suspected of having cancer as a patient likely to respond to an ALK- and/or ROS-inhibiting therapeutic is provided, the method comprising: contacting a biological sample from a patient with a first reagent that specifically binds a polypeptide having ROS kinase activity and a second reagent that specifically binds to a polypeptide having ALK kinase activity, and detecting whether the first reagent or the second reagent specifically binds to the biological sample, wherein detection of binding of either the first reagent or the second reagent to the biological sample identifies the patient as a patient likely to respond to an ALK-inhibiting and/or ROS-inhibiting therapeutic. | 10-31-2013 |
20130288241 | COMPOSITIONS AND METHODS FOR DETECTING A NEOPLASIA - The invention provides compositions and methods for detecting a neoplasia (e.g., pancreatic cancer, lung cancer, colon cancer) in a subject sample (e.g., serum, blood, plasma, tissue). In particular embodiments, the invention provides methods for detecting BNC1 and ADAMTS1 promoter methylation in circulating DNA in serum. | 10-31-2013 |
20130288242 | DETERMINATION OF FETAL ANEUPLOIDY BY QUANTIFICATION OF GENOMIC DNA FROM MIXED SAMPLES - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, i.e. aneuploidy. In addition, the present invention provides methods to determine when there are insufficient fetal cells for a determination and report a non-informative case. The present invention involves quantifying regions of genomic DNA from a mixed sample. More particularly the invention involves quantifying DNA polymorphisms from the mixed sample. | 10-31-2013 |
20130288243 | Mitochondrial DNA deletion between about residues 12317-16254 for use in the detection of cancer - The present invention relates to methods for predicting, diagnosing and monitoring cancer. The methods comprise obtaining biological samples, extracting mitochondrial DNA (mtDNA) from the samples, quantifying a mtDNA mutation in the sample and comparing the level of the mtDNA mutation present in the sample with a reference value The methods of the invention may also be effective in screening for new therapeutic agents and treatment regimes Further, said methods may be also be useful for monitoring the response of a subject to a preventative or therapeutic treatment. | 10-31-2013 |
20130288244 | METHODS AND PROCESSES FOR NON-INVASIVE ASSESSMENT OF GENETIC VARIATIONS - Provided herein are methods, processes and apparatuses for non-invasive assessment of genetic variations. | 10-31-2013 |
20130288245 | MODIFIED RNASE H ENZYMES AND THEIR USES - The invention provides a provides improvements to assays that employ RNase H cleavage for biological applications related to nucleic acid amplification and detection, where the RNase H has been reversibly inactivated. | 10-31-2013 |
20130288246 | COMPOSITIONS, METHODS, AND KITS FOR ANALYZING DNA METHYLATION - Compositions, methods, and kits for reducing strand amplification bias using bisulfite treated gDNA are provided. Methods for detecting and for quantitating the amplified bisulfite treated gDNA and inferring the presence, absence, and/or degree of methylation of target cytosine(s) in the gDNA are also provided. Such methods typically employ tailed first primer pairs, which can, but need not comprise nucleotide analogs, and optionally second primer pairs. | 10-31-2013 |
20130288247 | NOVEL DNA HYPERMETHYLATION DIAGNOSTIC BIOMARKERS FOR COLORECTAL CANCER - The present invention relates to the field of cancer. More specifically, the present invention relates to the use of biomarkers to detect colorectal cancer. In one aspect, the present invention provides methods for qualifying colorectal cancer status including, but not limited to, diagnosis, prognosis, and risk stratification, in patients. In one embodiment, a method for diagnosing colorectal cancer (CRC) in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the methylation levels of one or more biomarkers in the sample collected from the patient; and (c) comparing the methylation levels of the one or more biomarkers with predefined methylation levels of the same biomarkers that correlate to a patient having CRC and predefined methylation levels of the same biomarkers that correlate to a patient not having CRC, wherein a correlation to one of the predefined methylation levels provides the diagnosis. | 10-31-2013 |
20130288248 | CANCER STEM CELL MASS AND PROCESS FOR PRODUCTION THEREOF - The purpose of the present invention is to provide: a cancer stem cell mass from which cells incapable of forming cancer are substantially removed and which has a characteristic property of reproducing a layered structure of a cancer tissue; a process for producing the cancer stem cell mass; and use of the cancer stem cell mass. For achieving the purpose, the present inventors grew a human cancer tissue repeatedly in a NOG mouse, separated cancer cells from the grown cancer tissue, and made a comparison of various cancer cell culture processes with each other. As a result, a cancer stem cell composition which is homogeneous and is substantially free of the coexistence of cells capable of forming cancer and cells incapable of forming cancer in a mixed state can be produced successively by employing an attached culture process using a serum-free stem cell culture medium rather than a generally employed floating culture process, and consequently the present invention has been accomplished. | 10-31-2013 |
20130288249 | Dynamic Range Methods - The present invention relates to methods for detecting and quantifying an analyte in a sample, principally in proximity probe assays, and in particular to an improvement in such methods to extend the dynamic range of detection, which is particularly advantageous for the detection and quantification of an analyte where the concentration range of the analyte in said sample is unknown and/or the range is likely to be broad, said method comprising: (i) contacting said sample with at least a pair of proximity probes each comprising a proteinaceous target-binding domain coupled to a nucleic acid domain such that said nucleic acid domains may be allowed to interact directly or indirectly when the proximity probes have bound in proximity to their respective target, said target being either the analyte or a binding partner for the analyte; (ii) further contacting said sample with at least one set of markers which function to extend the dynamic range of detection of the method, wherein said set comprises at least two markers, wherein each marker is a nucleic acid molecule comprising a binding domain and a reporter domain which gives rise to a detectable signal, and each marker: (a) is capable of interacting either with said nucleic acid domains to form a nucleic acid molecule from which a detectable signal is generated, or with a nucleic acid molecule generated by interaction of said domains; (b) cannot interact with said nucleic acid domains simultaneously with another marker in the set; (c) generates a signal that is distinguishable from the signal of another marker in the set; and (d) is present in an amount capable of detecting the analyte at a range of concentrations that differs from the range of concentrations detectable by other markers; (ii) allowing said markers to interact with said nucleic acid domains or said generated nucleic acid molecule; and (iii) detecting said signal. | 10-31-2013 |
20130288250 | SIGNATURES OF CLINICAL OUTCOME IN GASTRO INTESTINAL STROMAL TUMORS AND METHOD OF TREATMENT OF GASTROINTESTINAL STROMAL TUMORS - A method for in vitro predicting survival and/or metastatic outcome of gastrointestinal stromal tumors (GISTs), characterized in that it comprises the measure of the level, in a patient-derived biological sample of GIST, of a pool of polypeptides or polynucleotides consisting in Aurora kinase A (AURKA); a kit for the in vitro prediction of the survival outcome of a patient suffering from GIST, and/or the development of metastases in a patient treated for or suffering from GIST, and/or the prediction of the efficacy of a treatment for GIST, characterized in that it comprises means for detecting and/or quantify, in a sample, AURKA expression or level, and means for the calculation of the GI; and a method for screening for compounds for the use in the treatment of GISTs and to an AURKA inhibitor for its use in the treatment of GISTs. | 10-31-2013 |
20130288251 | LACTOCOCCUS CRISPR-CAS SEQUENCES - The present invention relates to a nucleic acid comprising a | 10-31-2013 |
20130288252 | ASSAY SYSTEMS FOR GENETIC ANALYSIS - The present invention provides assay systems and methods for detection of copy number variation at one or more loci and polymorphism detection at one or more loci in a mixed sample from an individual. | 10-31-2013 |
20130288253 | Particles for Detecting Intracellular Targets - Methods describing the use of nanoparticles modified with binding moieties are provided. | 10-31-2013 |
20130295561 | Methods of enriching fetal cells - The present invention relates to methods of enriching fetal cells from a pregnant female. The present invention relates to removing, from a sample, cells that comprise at least one MHC molecule. The present invention also relates to methods that rely on using telomerase, mRNA encoding components thereof, as well as telomere length, as markers for fetal cells. Enriched fetal cells can be used in a variety of procedures including, detection of a trait of interest such as a disease trait, or a genetic predisposition thereto, gender typing and parentage testing. | 11-07-2013 |
20130295562 | METHODS FOR DETECTING RISK OF MYELODYSPLASTIC SYNDROME BY GENOTYPIC ANALYSIS - The present invention provides methods for detecting the risk of developing leukemia using genotyping analysis, for example of a SNP located in the promoter region of EPO. The present invention also provides kits and nucleic acids for the detection of the risk genotype. | 11-07-2013 |
20130295563 | NANOPARTICLES IN THE SHAPE OF NANOSNOWMAN WITH A HEAD PART AND A BODY PART, A PREPARATION METHOD THEREOF AND A DETECTION METHOD USING THE SAME - The present invention relates to nanoparticles in the shape of nanosnowman with a head part and a body part, a preparation method thereof, and a detection method using the same. More particularly, the present invention relates to nanoparticles in the shape of nanosnowman with head and body parts, which can offer platforms for DNA-based assembly of various aligned and unconventional nanostructures and is highly applicable to the detection of DNA and an analyte associated with the onset and progression of a particular disease, a preparation method thereof, and a detection method using the same. | 11-07-2013 |
20130295564 | PROCESSES AND COMPOSITIONS FOR METHYLATION-BASED ENRICHMENT OF FETAL NUCLEIC ACID FROM A MATERNAL SAMPLE USEFUL FOR NON-INVASIVE PRENATAL DIAGNOSES - Provided are compositions and processes that utilize genomic regions that are differentially methylated between a mother and her fetus to separate, isolate or enrich fetal nucleic acid from a maternal sample. The compositions and processes described herein are particularly useful for non-invasive prenatal diagnostics, including the detection of chromosomal aneuploidies. | 11-07-2013 |
20130295565 | RARE CELL ANALYSIS USING SAMPLE SPLITTING AND DNA TAGS - The present invention provides systems, apparatuses, and methods to detect the presence of fetal cells when mixed with a population of maternal cells in a sample and to test fetal abnormalities, e.g. aneuploidy. The present invention involves labeling regions of genomic DNA in each cell in said mixed sample with different labels wherein each label is specific to each cell and quantifying the labeled regions of genomic DNA from each cell in the mixed sample. More particularly the invention involves quantifying labeled DNA polymorphisms from each cell in the mixed sample. | 11-07-2013 |
20130295566 | Method of Using FOXO3A Polymorphisms and Haplotypes to Predict and Promote Healthy Aging and Longevity - The invention provides methods and compositions relating to identification and use of genetic information from the FOXO3A gene that can be used for determining and increasing an individual's likelihood of longevity and of retaining physical and cognitive function during aging, and for determining and decreasing an individual's likelihood of developing a cardiovascular-, metabolic- or age-related disease, including coronary artery (heart) disease, stroke, cancer, chronic pulmonary disease, diabetes, Parkinson's disease and dementia. | 11-07-2013 |
20130295567 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 11-07-2013 |
20130295568 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 11-07-2013 |
20130295569 | EPIGENOMIC INDUCED PLURIPOTENT STEM CELL SIGNATURES - Provided herein are methods of characterizing the epigenetic signature of human induced pluripotent stem cells. The methods are useful in identifying human induced pluripotent stem cells (hiPSCs), diagnostic markers for incomplete hiPSCs reprogramming, and characterization of the efficacy of different reprogramming techniques. | 11-07-2013 |
20130295570 | COMPOSITIONS AND METHODS FOR NUCLEIC ACID BASED DIAGNOSTIC ASSAYS - The present invention relates to compositions and methods for nucleic acid based diagnostic assays. In particular, the present invention provides probes and non-amplifiable controls for asymmetric PCR and other amplification modalities. In some embodiments, the present invention provides probe design criteria for probes for use in amplification/detection assays. Further embodiments of the present invention provide non-amplifiable controls for use in generating reference probe signal ratios in amplification detection assays. | 11-07-2013 |
20130295571 | MARKER OF BREAST TUMORS FROM THE LUMINAL-B SUBTYPE - An in vitro method for diagnosing a breast cancer from the luminal-B subtype in a female, includes the steps of analyzing a biological sample from the female by (i) determining the copies number of the ZNF703 gene, and/or (ii) determining the expression of the ZNF703 gene, wherein an increased copies number and/or an over-expression of the ZNF703 gene is indicative of a luminal B tumor; to a kit for diagnosing a breast cancer from the luminal-B subtype in a female including at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as defined previously, for determining the copies number of the ZNF703 gene, and/or determining the expression of the ZNF703 gene; and to the use of such a kit. | 11-07-2013 |
20130302794 | NUCLEIC ACID DETECTION BY OLIGONUCLEOTIDE PROBES CLEAVED BY BOTH EXONUCLEASE AND ENDONUCLEASE - Disclosed is a method in the fields of biochemistry and molecular biology. The method is related to improve cleavage kinetics of labeled oligonucleotide probes and, consequently, increases signal-to-noise ratio in detecting nucleic acids. | 11-14-2013 |
20130302795 | CYTOKINE ZALPHA11 LIGAND - Antibodies that bind to polypeptides and peptides comprising the sequence of zalpha11 Ligand as shown in SEQ ID NO: 2 are described. The antibodies may bind the full length sequence of 162 amino acid residues or a fragment thereof, including a mature polypeptide of 131 amino acid residues and smaller polypeptide and peptide sequences. The antibodies may include antibodies that are polyclonal, monoclonal, murine, humanized or neutralizing. Methods for producing the antibodies are also described. | 11-14-2013 |
20130302796 | Devices And Methods For Enrichment And Alteration Of Circulating Tumor Cells And Other Particles - The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject. | 11-14-2013 |
20130302797 | METHODS FOR DIAGNOSING, PROGNOSING, OR THERANOSING A CONDITION USING RARE CELLS - The invention encompasses methods for diagnosing, theranosing, or prognosing a condition in a patient based on the results of one or more analysis methods. The methods can comprise enriching a sample obtained from the patient for one or more rare cells. The analysis methods can include performing enumeration of the one or more rare cells or cell subtypes, performing nucleic acid analysis, or detecting a serum marker. | 11-14-2013 |
20130302798 | DETECTION OF MUTATIONS, IN PARTICULAR DELETIONS OR INSERTIONS - A method for detecting at least one gene modification, such as a mutation in a gene, such as a gene that codes for a protein associated with at least one of a tumor and a cancer. The method includes providing a detectable hybridization probe (sensor probe) which interacts with/binds to a gene not having a gene modification (wild type gene) and with a gene having a gene modification (mutation gene). The detectable hybridization probe (sensor probe) has at least one of a higher specificity, a higher binding affinity and a higher selectivity for the gene not having a gene modification (wild type gene) compared to the gene having a gene modification (mutation gene). At least one gene modification is detected with the detectable hybridization probe (sensor probe). | 11-14-2013 |
20130302799 | METHODS FOR DIAGNOSING OR TREATING PROSTATE CANCER - The present invention provides methods for detecting and/or diagnosing cancer through the determination of the expression level of the STC2 gene. The gene was discovered to discriminate cancer cells from normal cells. Furthermore, the present invention provides methods of screening for therapeutic agents useful in the treatment of cancer, methods for treating cancer. Moreover, the present invention provides double-stranded molecules targeting the STC2 gene, which are suggested to be useful in the treatment of cancer. The compositions and methods of the present invention find particular applicability to prostate cancer, more specifically, castration-resistant prostate cancer and aggressive prostate cancer. | 11-14-2013 |
20130302800 | TUMOR SUPPRESSOR GENE P47ING3 - The invention provides isolated nucleic acid and amino acid sequences of novel human tumor suppressors, antibodies to such tumor suppressors, methods of detecting such nucleic acids and proteins, methods of screening for modulators of tumor suppressors, and methods of diagnosing and treating tumors with such nucleic acids and proteins. | 11-14-2013 |
20130302801 | DETECTION AND QUANTIFICATION OF SAMPLE CONTAMINATION IN IMMUNE REPERTOIRE ANALYSIS - The invention is directed to methods for detecting and quantifying nucleic acid contamination in a tissue sample of an individual containing T cells and/or B cells, which is used for generating a sequence-based clonotype profile. In one aspect, the invention is implemented by measuring the presence and/or level of an endogenous or exogenous nucleic acid tag by which nucleic acid from an intended individual can be distinguished from that of unintended individuals. Endogenous tags include genetic identity markers, such as short tandem repeats, rare clonotypes or the like, and exogenous tags include sequence tags employed to determine clonotype sequences from sequence reads. | 11-14-2013 |
20130302802 | METHODS FOR DIAGNOSING EPISODIC MOVEMENT DISORDERS AND RELATED CONDITIONS - The present invention provides compositions and methods for research, diagnostic, drug screening, and therapeutic applications related to paroxysmal dystonic choreoathetosis and related conditions. In particular, the present invention provides mutations in the myofibrillogenesis regulator 1 (MR-1) gene associated with such conditions. | 11-14-2013 |
20130302803 | ENCAPSULATED REAGENTS AND METHODS OF USE - The present invention contemplates use of encapsulated aqueous and non-aqueous reagents, solutions and solvents and their use in laboratory procedures. These encapsulated aqueous or non-aqueous reagents, solutions and solvents can be completely contained or encapsulated in microcapsules or nanocapsules that can be added to an aqueous or non-aqueous carrier solution or liquid required for medical and research laboratory testing of biological or non-biological specimens. | 11-14-2013 |
20130302804 | Markerless Transformation - Methods for identification of successful transformation without a need for in vitro selection are provided. Direct detection of nucleotide sequences of interest is described which eliminate the need for use of ancillary nucleotide sequences. | 11-14-2013 |
20130302805 | METHODS FOR REMOVAL OF SPECIFIC SEED TISSUE OR STRUCTURE FOR SEED ANALYSIS - A method for reducing resources for selecting seed to be produced in commercial quantities or for research is disclosed. Samples of seed which are candidates for selection are collected and given an identifier. Specific tissue or structure from candidate seed is removed. A test or analysis is performed on the candidate seed or the removed tissue or structure. Results of the test or analysis are recorded and correlated to the seed's identifier. The results are evaluated and a decision is made whether to select a candidate seed for commercial production or for research. Time, space, and labor associated with growing plants in an experimental plot or greenhouse and taking tissue samples from growing plants is saved. | 11-14-2013 |
20130309663 | METHOD FOR DETECTING MUTATIONS AT IL28B AND ITPA - The disclosure relates to probes for detecting a polymorphism in the IL28B gene and in the ITPA gene, and methods of use thereof. | 11-21-2013 |
20130309664 | HEAT SHOCK PROTEINS AS AUTOANTIGENS - The present invention relates to methods of diagnosing and/or determining a prognosis for various diseases, including lung diseases such as idiopathic pulmonary fibrosis, chronic obstructive lung disease, and emphysema as well as osteoporosis, comprising detecting the presence of autoantibodies specific for heat shock proteins in a subject. | 11-21-2013 |
20130309665 | POLYMORPHISMS IN THE HUMAN GENE FOR THE MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN 1 (MRP-1) AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC APPLICATIONS - The present invention relates to a polymorphic MRP-1 polynucleotide, genes or vectors comprising the polynucleotides and a host cell genetically engineered with the polynucleotide or gene. Also provided are methods for producing molecular variant polypeptides, cells capable of expressing a molecular variant polypeptide and a polypeptide encoded by the polynucleotide or the gene or obtainable by the method or cells produced herein. Also provided is an antibody to the polypeptide, a transgenic animal, and a solid support comprising one or a plurality of the provided polynucleotides, genes, vectors, polypeptides, antibodies or host cells. Furthermore, methods of identifying a polymorphism, identifying and obtaining a pro-drug or drug or an inhibitor are also provided. In addition, the invention relates to methods for producing a pharmaceutical composition, diagnosing a disease and detection of the polynucleotide. Furthermore, provided herein are uses of the polynucleotides, genes, vectors, polypeptides or antibodies herein. | 11-21-2013 |
20130309666 | METHODS AND PROCESSES FOR NON-INVASIVE ASSESSMENT OF GENETIC VARIATIONS - Provided herein are methods, processes and apparatuses for non-invasive assessment of genetic variations. | 11-21-2013 |
20130309667 | PRIMERS FOR ANALYZING METHYLATED SEQUENCES AND METHODS OF USE THEREOF - Primers having abasic regions or mismatches for amplifying sequences suspected of having methylation. Primers having abasic regions or mismatches for amplifying sequences adjacent to suspected or known methylated sequences. Methods of using primers having abasic regions or mismatches for identification of methylated sequences or sequences adjacent to suspected or known methylation sequences. | 11-21-2013 |
20130309668 | METHODS AND COMPOSITIONS FOR GENERATING AND AMPLIFYING DNA LIBRARIES FOR SENSITIVE DETECTION AND ANALYSIS OF DNA METHYLATION - The present invention regards a variety of methods and compositions for obtaining epigenetic information, such as DNA methylation patterns, through the preparation, amplification and analysis of Methylome libraries. In particular, the method employs preparation of a DNA molecule by digesting the DNA molecule with at least one methylation-sensitive restriction enzyme; incorporating a nucleic acid molecule into at least some of the digested DNA molecules by either (1) incorporating at least one primer from a plurality of primers that have a 5′ constant sequence and a 3′ variable sequence, wherein the primers are substantially non-self-complementary and substantially non-complementary to other primers in the plurality; or (2) incorporating an oligonucleotide having an inverted repeat and a loop under conditions wherein the oligonucleotide becomes blunt-end ligated to one strand of the digested DNA molecule, followed by polymerization from a 3′ hydroxyl group present in a nick in the oligonucleotide-linked molecule; and amplifying one or more of the DNA molecules | 11-21-2013 |
20130309669 | Methods of Identification Using Methylation of CPG - The invention comprises a method of detecting cancer in a patient by detecting methylated DNA at a specific locus by treating the patient's sample with a methyl-active cleavage method utilizing 5-methyl deoxycytidine glycosylase/lyase. | 11-21-2013 |
20130309670 | Nuclease-Mediated Targeting With Large Targeting Vectors - Compositions and methods are provided for making one or more targeted genetic modifications at a target genomic locus by employing homologous recombination facilitated by single or double-strand break at or near the target genomic locus. Compositions and methods for promoting efficiency of homologous recombination between an LTVEC and a target genomic locus in prokaryotic or eukaryotic cells using engineered nucleases are also provided. | 11-21-2013 |
20130309671 | Spectro-Temporal Optical Encoding of Information Using a Time-Gated Fluorescence Resonance Energy Transfer (FRET) - Described herein is a time-gated, two-step FRET relay effective to provide temporal transference of a prompt FRET pathway, or provide spectro-temporal encoding analytical signals and other information. A FRET relay assembly includes a long lifetime FRET donor (for example, a lanthanide complex), a semiconductor quantum dot (QD) configured as an intermediate acceptor/donor in FRET, and a fluorescent dye configured as a terminal FRET acceptor, wherein the long lifetime FRET donor has an excited state lifetime of at least one microsecond and the QD and fluorescent dye each have excited state lifetimes of less than 100 nanoseconds. | 11-21-2013 |
20130309672 | Soybean Transgenic Event MON87705 and Methods for Detection Thereof - The present invention provides a transgenic soybean event MON87705, and cells, seeds, and plants comprising DNA diagnostic for the soybean event. The invention also provides compositions comprising nucleotide sequences that are diagnostic for said soybean event in a sample, methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event in a sample, growing the seeds of such soybean event into soybean plants, and breeding to produce soybean plants comprising DNA diagnostic for the soybean event. | 11-21-2013 |
20130309673 | METHODS AND COMPOSITIONS FOR NUCLEIC ACID AMPLIFICATION - Compositions, reaction mixtures, and methods for performing an amplification reaction, including multiplex amplification reaction, wherein the method comprises using one or more amplification oligomer complexes comprising linked first and second amplification oligomer members. In one aspect, the amplification oligomer complex is hybridized to a target nucleic acid, the target nucleic acid with hybridized amplification oligomer complex is then captured, and other components are washed away. Target sequences of the target nucleic acids are pre-amplified to generate a first amplification product. The first amplification product is amplified in one or more secondary amplification reactions to generate second amplification products. | 11-21-2013 |
20130309674 | ANALYSIS OF THE METHYLATION PATTERN OF THE ALPHA-SYNUCLEIN GENE FROM DNA OF PERIPHERAL BLOOD MONOCYTES FOR DIAGNOSING PARKINSON'S DISEASE - A method of using peripheral blood monocytes of a patient to at least one of diagnose and assess a risk of a patient of developing Parkinson's disease includes obtaining peripheral blood monocytes from the patient, and determining a methylation pattern of the SNCA | 11-21-2013 |
20130309675 | Microparticle having single-molecule nucleic acid probe, method for producing same, method for analyzing nucleic acid using same, device for nucleic acid analysis, and apparatus for analyzing nucleic acid - A microparticle having a probe molecule able to capture a specific nucleic acid group to be analyzed is used to extract only the specific nucleic acid group to be analyzed from a nucleic acid sample and the microparticle is thereafter directly immobilized on a smooth plate, whereby a device for nucleic acid analysis is rapidly prepared. Immobilizing a single capture probe molecule onto an individual microparticle in advance and forming, at regular positions on the smooth substrate, an adhesion pad on which a functional group that binds to the microparticle has been introduced makes it possible to readily and rapidly prepare the device for nucleic analysis, where the nucleic acid sample to be analyzed is arranged molecule by molecule in a lattice shape on the smooth substrate. | 11-21-2013 |
20130316337 | Methods of Diagnosing and Treating an Inflammatory Response - The present invention relates to the discovery that VEGF, PlGF, and sFlt-1 levels are increased in inflammatory response such as in sepsis, severe sepsis, or septic shock. Additionally, the invention provides methods of identifying treatments as well as providing treatments for such an inflammatory response, which include decreasing VEGF or PlGF levels, or increasing sFlt-1 or PlGF levels. | 11-28-2013 |
20130316338 | CCR6 As A Biomarker of Alzheimer's Disease - Disclosed are methods used to diagnose Alzheimer's disease (AD) in a subject. The methods involve determining the amount of chemokine receptor 6 (CCR6) expressed in a biological sample. Expression of CCR6 in the sample that exceeds a threshold level of expression signifies that the subject has AD, even if the subject has not yet developed symptoms of AD. The methods may also be used to monitor the effectiveness of an AD treatment. Kits that facilitate the use of the methods are also disclosed. | 11-28-2013 |
20130316339 | DETECTION OF NUCLEIC ACID SEQUENCES ADJACENT TO REPEATED SEQUENCES - The present invention provides methods of quantifying a target locus adjacent to an extended repeat sequence in genomic DNA. The present invention further provides methods and kits for detecting methylation at a target locus adjacent to an extended repeat sequence in genomic DNA. | 11-28-2013 |
20130316340 | SYSTEMS AND METHODS FOR MULTIPLEXED ELECTROCHEMICAL DETECTION - Contemplated methods and devices comprise performing electrochemical sample analysis in a multiplexed electrochemical detector having reduced electrical cross-talk. The electrochemical detector includes electrodes that share a common lead from a plurality of leads. The sample, which may be a liquid sample, is introduced into one or more sample wells and a signal is applied to at least one of the electrodes. A response signal is measured while simultaneously applying a substantially fixed potential to each of a remainder of the plurality of leads. | 11-28-2013 |
20130316341 | METHODS FOR DETECTING GENE DYSREGULATIONS - Described herein are methods, compositions and kits directed to the detection of gene dysregulations such as those arising from gene fusions and/or chromosomal abnormalities, e.g., translocations, insertions, inversions and deletions. Samples containing dysregulated gene(s) of interest may show independent expression patterns for the 5′ and 3′ regions of the gene. The methods, compositions and kits are useful for detecting mutations that cause the differential expression of a 5′ portion of a target gene relative to the 3′ region of the target gene. | 11-28-2013 |
20130316342 | Genetic Barcodes - Herein are described multicolor FISH probe sets termed “genetic barcodes” targeting several cancer or disease-related loci to assess gene rearrangements and copy number changes in tumor cells. Two, three or more different fluorophores are used to detect the genetic barcode sections thus permitting unique labeling and multilocus analysis in individual cell nuclei. Gene specific barcodes can be generated and combined to provide both numerical and structural genetic information for these and other pertinent disease associated genes. | 11-28-2013 |
20130316343 | DELTA3, FTHMA-070, TANGO85, TANGO77, SPOIL, NEOKINE, TANGO129, AND INTEGRIN ALPHA SUBUNIT PROTEIN AND NUCLEIC ACID MOLECULES AND USES THEREOF - The invention provides novel Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 polypeptides, proteins, and nucleic acid molecules. In addition to isolated, full-length Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 proteins, the invention further provides isolated Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 fusion proteins, antigenic peptides and anti-Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 antibodies. The invention also provides Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 and A259 nucleic acid molecules, recombinant expression vectors containing a nucleic acid molecule of the invention, host cells into which the expression vectors have been introduced and non-human transgenic animals in which a Delta3, FTHMA-070, Tango85, Tango77, SPOIL, NEOKINE, Tango129 or A259 gene has been introduced or disrupted. Diagnostic, screening and therapeutic methods utilizing compositions of the invention are also provided. | 11-28-2013 |
20130316344 | METHOD AND PROBE SET FOR DETECTING CANCER - Methods for detecting cancer that include hybridizing a set of chromosomal probes to a biological sample obtained from a patient, and identifying if aneusomic cells are present in a selected subset of cells obtained from the biological sample are described. A set of chromosomal probes and kits for detecting cancer that include sets of chromosomal probes, are also described. | 11-28-2013 |
20130316345 | Method of Determining the Genotype Relating to Hereditary Nasal Parakeratosis (HNPK) and Nucleic Acids Usable in Said Method - The invention concerns an in vitro method of determining a genotype relating to hereditary nasal parakeratosis (HNPK) in a dog. According to the invention the presence or the absence of a genetic variation in the SUV39H2 gene sequence is indicative of said disorder. The invention also concerns polypeptide based methods for determining said disorder. Further, nucleic acids, polypeptides and antibodies usable in said method are disclosed. | 11-28-2013 |
20130316346 | BRASSICA GENOMIC ASSAYS - Methods and compositions for detecting, identifying, and quantifying | 11-28-2013 |
20130316347 | PROCESS FOR MULTI-ANALYSES OF RARE CELLS EXTRACTED OR ISOLATED FROM BIOLOGICAL SAMPLES THROUGH FILTRATION - A process for isolating or extracting rare cells from a biological sample comprising filtering a biological sample, which may be treated or diluted, through a filter that has a pore size, pore density or other physical properties that retain rare cells, but which permits other kinds of cells to pass through the filter. This process also comprises multiple analyses performed on rare cells after their extraction or isolation by filtration to diagnostically identify the presence of rare cells in a biological sample and to use their diagnostic identification and molecular characterization for diagnostic purposes such as for early diagnosis of diseases, namely for early diagnosis of cancer and to select, guide, monitor treatments and in particular to select targeted treatments and to monitor the response and/or resistance to them. A kit comprising tools, equipment and/or reagents to accomplish both the filtration step and various kinds of multiple analyses performed after isolation and extraction of the rare cells by filtration. | 11-28-2013 |
20130316348 | HERBICIDE TOLERANT COTTON PLANTS AND METHODS FOR IDENTIFYING SAME - The invention provides specific transgenic cotton plants, plant material and seeds, characterized in that these products harbor a specific transformation event at a specific location in the cotton genome. Tools are also provided which allow rapid and unequivocal identification of the event in biological samples. | 11-28-2013 |
20130316349 | N-METHYLPURINE DNA GLYCOSYLASE AND POLYMERASE BETA AS BIOMARKERS FOR ALKYLATOR CHEMOTHERAPY POTENTIATION - Described herein is the finding that polymerase β (Polβ) and N-methylpurine DNA glycosylase (MPG) can be used as biomarkers to evaluate the sensitivity of a subject to combination therapy that includes treatment with either temozolomide (TMZ) and methoxyamine, or TMZ and a poly(ADP-ribose) polymerase (PARP) inhibitor. Thus, provided herein is a method of determining if a subject will be sensitive to TMZ and methoxyamine, or TMZ and a PARP inhibitor by measuring expression of Polβ and MPG in a sample from the subject and comparing expression of Polβ and MPG in the sample to a control. A decrease in expression of Polβ and an increase in expression of MPG relative to the control indicates the subject is sensitive to TMZ and methoxyamine, or sensitive to TMZ and the PARP inhibitor. | 11-28-2013 |
20130323724 | Chemiluminescence Proximity Nucleic Acid Assay - This invention relates to the detection and quantitation of target nucleic acids in a heterogeneous mixture in a Sample and the methods of use thereof. The detection system includes a chemiluminescent molecule, a chemiluminescent substrate, a dye that is light responsive when intercalated into nucleic acids and nucleic acids. This invention is useful in any application where detection of a specific nucleic acid sequence is desirable, or where the detection of enzymes that modify nucleic acids is desirable such as diagnostics, research uses and industrial applications. | 12-05-2013 |
20130323725 | TARGET ENRICHMENT AND LABELING FOR MULTI-KILOBASE DNA - This disclosure provides a method comprising: a) clamping the top and bottom strands of a double stranded DNA molecule to produce a duplex in which the top and bottom strands are linked; b) denaturing the duplex to produce a denatured product; and c) renaturing the denatured product in the presence of a labeled oligonucleotide that is complementary to a sequence of nucleotides in the double stranded DNA molecule, thereby producing a D-loop-containing product. Kits for performing the method and products made by the method are also provided. | 12-05-2013 |
20130323726 | METHODS AND MATERIALS USING SIGNALING PROBES - The present invention relates to methods of isolating cells, generating cell lines, and detecting RNAs in cells using signaling probes that produce a signal upon hybridization to a target sequence. Other methods that utilize the signaling probe include methods of detecting or quantifying the effect of an agent on RNAs in a cell, methods of quantifying the level of RNA expression, methods for identifying genetic recombinational events in living cells and methods of generating a transgenic animal using the isolated cells. The invention also provides protease probes. Signaling probes and protease probes that form stem-loop structures, three-arm junction structures, and dumbbell structures are provided. | 12-05-2013 |
20130323727 | METHOD OF DESIGNING PRIMERS, METHOD OF DETECTING SINGLE NUCLEOTIDE POLYMORPHISMS (SNPs), METHOD OF DISTINGUISHING SNPs, AND RELATED PRIMERS, DETECTABLE OLIGONUCLEOTIDES, AND KITS - A method of designing a primer for detecting a single nucleotide polymorphism (SNP), a method of detecting an SNP, a method of distinguishing SNPs, primers, detectable oligonucleotides, and kits. | 12-05-2013 |
20130323728 | METHODS AND KITS FOR DETECTION OF 5-HYDROXYMETHYLCYTOSINE - The present invention relates to methods and kits for the detection of 5-hydroxymethylcytosme (5hmC). In some embodiments, the present invention relates to methods and kits for detection of 5hmC in nucleic acid (e.g., DNA, RNA). In some embodiments, the present invention relates to detection of 5hmC in genomic DNA, e.g., mammalian genomic DNA. | 12-05-2013 |
20130323729 | Proximity Ligation Technology for Western Blot Applications - The invention provides a method for detecting a biomolecular feature (a protein, protein complex, or modified protein such as a phosphorylated protein) by a modified Western blot type of assay, which method either electrophoretic gel separation followed by transfer, or direct spotting of a sample containing the biomolecular feature onto a membrane; providing a proximity probe pair, each probe comprising a binding moiety with affinity for a different binding site on the bio molecular feature and a reactive oligonucleotide, coupled thereto; binding the proximity probes to their respective binding sites on the biomolecular feature through the binding moiety, adding a splint oligonucleotide and a backbone oligonucleotide which are complementary to the reactive oligonucleotide pair, and allowing hybridization among them; ligating the hybridized DNA oligonucleotides to create a circularized DNA molecule when both probes bind sufficiently close to each other on the bio molecular feature, amplifying the circularized DNA by isothermal amplification; and detecting the presence and quantity of the bio molecular feature using a detection oligonucleotide complementary to the amplification product. Also provided are methods for multiplexed detection of more than one bio molecular feature, as well as kits for performing the assays. | 12-05-2013 |
20130323730 | METHOD FOR DETERMINING PLOIDY OF A CELL - A method for determining the ploidy of a test genome is provided. In some embodiments, the method may comprises: a) obtaining a plurality of ratios for polymorphisms that are distributed throughout a test genome, wherein each of the ratios is a ratio of the measured copy number of uncut allele in a polymorphic site relative to the measured copy number of the uncut allele in the reference sample; b) taking the log of the ratios and plotting a distribution of the reference corrected log ratios of the SNP probes; and c) determining the ploidy of said the genome based on the number of peaks in that distribution. | 12-05-2013 |
20130323731 | DETERMINATION OF THE DEPTH COVERAGE OF THE FETAL GENOME - Systems, methods, and apparatus for determining at least a portion of fetal genome are provided. DNA fragments from a maternal sample (maternal and fetal DNA) can be analyzed to identify alleles at certain loci. The amounts of DNA fragments of the respective alleles at these loci can be analyzed together to determine relative amounts of the haplotypes for these loci and determine which haplotypes have been inherited from the parental genomes. Loci where the parents are a specific combination of homozygous and heterozygous can be analyzed to determine regions of the fetal genome. Reference haplotypes common in the population can be used along with the analysis of the DNA fragments of the maternal sample to determine the maternal and paternal genomes. Determination of mutations, a fractional fetal DNA concentration in a maternal sample, and a proportion of coverage of a sequencing of the maternal sample can also be provided. | 12-05-2013 |
20130323732 | SINGLE-PARTICLE ANALYSIS OF PARTICLE POPULATIONS - In certain embodiments, the invention provides methods and devices for assaying single particles in a population of particles, wherein at least two parameters are measured for each particle. One or more parameters can be measured while the particles are in the separate reaction volumes. Alternatively or in addition, one or more parameters can be measured in a later analytic step, e.g., where reactions are carried out in the separate reaction volumes and the reaction products are recovered and analyzed. In particular embodiments, one or more parameter measurements are carried out “in parallel,” i.e., essentially simultaneously in the separate reaction volumes. | 12-05-2013 |
20130323733 | METHODS OF ASSESSING A RISK OF DEVELOPING NECROTIZING MENINGOENCEPHALITIS - Methods of using single nucleotide polymorphisms (SNPs), SNP haplotype block, and haplotype to predict whether or not a subject will develop necrotizing meningoencephalitis (NME) and probe sets that facilitate those methods are disclosed. In preferred forms, the subject is a canine species. | 12-05-2013 |
20130323734 | Genetic Determinants of Prostate Cancer Risk - Described are methods of determining if a subject has a genetic predisposition to developing prostate cancer (PCa), e.g., an American or Caribbean subject of African descent and of reducing their risk. | 12-05-2013 |
20130323735 | MEANS AND METHODS FOR INVESTIGATING NUCLEIC ACID SEQUENCES - The invention provides improved methods for investigating nucleic acid sequences, wherein at least one additional probe is used which is specific for a (pseudo)gene variant of a target nucleic acid. | 12-05-2013 |
20130330719 | EML4-ALK TRANSLOCATIONS IN LUNG CANCER - The present disclosure relates to methods for the diagnosis and evaluation of neoplastic disorders, particularly non-small cell lung cancer. Assays are described in which patient test samples are analyzed for the presence of one or more specific EML4-ALK fusion genes associated with neoplastic disorders. | 12-12-2013 |
20130330720 | COMPOSITION AND KIT FOR DETECTION AND ANALYSIS OF STRAINS OF CLOSTRIDIUM DIFFICILE AND METHOD OF DETECTING STRAINS OF CLOSTRIDIUM DIFFICILE BY USING THE SAME - A composition and kit for detecting | 12-12-2013 |
20130330721 | POLYMER MICROFILTRATION DEVICES, METHODS OF MANUFACTURING THE SAME AND THE USES OF THE MICROFILTRATION DEVICES - A microfilter comprising a polymer layer formed from photo-definable dry film, and a plurality of apertures each extending through the polymer layer. A microfilter comprising two or more polymer layers formed from photo-definable dry film, and a plurality of apertures or open areas each extending through the polymer layer. Methods of forming apertures in one or more layers of photo-definable dry film are also disclosed. Filter holder designs and methods appropriate to hold microfilters to collect the rare cells and to perform of assays in the filter holder are provided. Microfiltration chip designs and methods appropriate to collect the rare cells and to perform assays in the microfluidic chips are provided. The invention also describes the use of the microfilter, filter holder and microfilter chips to collect rare cells from body fluids and perform assays, and these rare cells can be used for medical and biological research applications. | 12-12-2013 |
20130330722 | Methods and Compositions for Isolating Template Nucleic Acids - The present invention is directed to methods and compositions for isolating template nucleic acids containing target sequences of interest, wherein those isolated template nucleic acids can be further assessed for information related to sequence and nucleic acid modifications. | 12-12-2013 |
20130330723 | VARIOUS-SUBSTANCE HOLDER, VARIOUS-SUBSTANCE HOLDER TREATING APPARATUS, AND VARIOUS-SUBSTANCE HOLDER TREATING METHOD - A various-substance holder, a various-substance holder treating apparatus, and a various-substance holder treating method are provided which enable the mutual identification of particulate carriers to which various substances are or can be immobilized without the need to arrange the particulate carriers at predetermined positions or in a predetermined order, eliminating the need for time and effort to arrange the various substances at predetermined positions or in a predetermined order to allow treatments to be quickly and easily achieved. The various-substance holder has a plurality of particulate carriers or plural sets of particulate carriers to which plural types of chemical substances are or can be immobilized and a carrier holding portion holding the plurality of particulate carriers or the plural sets of particulate carriers in a substantially stationary state such that the plurality of particulate carriers or the plural sets of particulate carriers can be externally measured. | 12-12-2013 |
20130330724 | RISK ASSESSMENT FOR ADVERSE DRUG REACTIONS - The present invention provides a method of predicting the risk of a patient for developing adverse drug reactions, particularly SJS or TEN. It was discovered that an HLA-B allele, HLA-B* 1502, is associated with SJS/TEN that is induced by a variety of drugs. The correlation with HLA-B* 1502 is most significant for carbamazepine-induced SJS/TEN, wherein all the patients tested have the HLA-B* 1502 allele. In addition, another HLA-B allele, HLA-B*5801, is particularly associated with SJS/TEN induced by allopurinol. Milder cutaneous reactions, such as maculopapular rash, erythema multiforme (EM), urticaria, and fixed drug eruption, are particularly associated with a third allele, HLA-B *4601. For any of the alleles, genetic markers (e.g., HLA markers, microsatellite, or single nucleotide polymorphism markers) located between DRB1 and HLA-A region of the specific HLA-B haplotype can also be used for the test. | 12-12-2013 |
20130330725 | DIAGNOSTIC PROBE DETECTION SYSTEM - The invention provides methods for detecting target nucleic acid sequences with diagnostic probes including first and second probe regions that are substantially complementary to first and second target regions respectively on a target nucleic acid strand wherein the first probe region is located 5′ to the second probe region. The first probe region is substantially complementary to the first target region, on the target nucleic acid strand, which also includes a second target region, wherein when said first target region is contiguous with the second target region on the target nucleic acid strand, then the first and second probe regions on the diagnostic probe are separated by a spacer region of nucleic acid. | 12-12-2013 |
20130330726 | REAL-TIME PCR POINT MUTATION ASSAYS FOR DETECTING HIV-1 RESISTANCE TO ANTIVIRAL DRUGS - Disclosed are compositions including primers and probes, which are capable of interacting with the disclosed nucleic acids, such as the nucleic acids encoding the reverse transcriptase, protease, or integrase of HIV as disclosed herein. Thus, provided is an oligonucleotide comprising any one of the nucleotide sequences set for in SEQ ID NOS: 1-89, 96-122, and 124-141. Also provided are the oligonucleotides consisting of the nucleotides as set forth in SEQ ID NOS: 1-89, 96-122, and 124-141. Each of the disclosed oligonucleotides is a probe or a primer. Also provided are mixtures of primers and probes and for use in RT-PCR and primary PCR reactions disclosed herein. Provided are methods for the specific detection of several mutations in HIV simultaneously or sequentially. Mutations in the reverse transcriptase, protease, or integrase of HIV can be detected using the methods described herein. | 12-12-2013 |
20130330727 | INTRA-TISSUE IN VITRO DIAGNOSIS METHOD FOR DIAGNOSING BRAIN TUMOURS - An in vitro diagnostic method for diagnosing a brain tumour belonging to the group formed by two types of tumours: ODGs and GBMs, and for identifying the type of tumour, the method includes the measurement of at least two ratios of the expression levels of miRNA pairs extracted from a biological sample originating from a patient suspected of presenting one of the above-mentioned brain tumours. | 12-12-2013 |
20130337442 | GENETIC LOCI ASSOCIATED WITH SOYBEAN CYST NEMATODE RESISTANCE AND METHODS OF USE - Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resistance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. | 12-19-2013 |
20130337443 | METHODS FOR DETECTING DNA PRIOGINATING FROM DIFFERENT INDIVIDUALS - In a first aspect, the present invention features methods for differentiating DNA species originating from different individuals in a biological sample. These methods may be used to differentiate or detect fetal DNA in a maternal sample or to differentiate DNA of an organ donor from DNA of an organ recipient. In preferred embodiments, the DNA species are differentiated by observing epigenetic differences in the DNA species such as differences in DNA methylation. In a second aspect, the present invention features methods of detecting genetic abnormalities in a fetus by detecting fetal DNA in a biological sample obtained from a mother. In a third aspect, the present invention features methods for differentiating DNA species originating from an organ donor from those of an organ recipient. In a fourth aspect, the present invention features kits for differentiating DNA species originating from different individuals in a biological sample. | 12-19-2013 |
20130337444 | NANO46 Genes and Methods to Predict Breast Cancer Outcome - The present invention provides methods for classifying and for evaluating the prognosis of a subject having breast cancer are provided. The methods include prediction of breast cancer subtype using a supervised algorithm trained to stratify subjects on the basis of breast cancer intrinsic subtype. The prediction model is based on the gene expression profile of the intrinsic genes listed in Table 1. Further provided are compositions and methods for predicting outcome or response to therapy of a subject diagnosed with or suspected of having breast cancer. These methods are useful for guiding or determining treatment options for a subject afflicted with breast cancer. Methods of the invention further include means for evaluating gene expression profiles, including microarrays and quantitative polymerase chain reaction assays, as well as kits comprising reagents for practicing the methods of the invention. | 12-19-2013 |
20130337445 | METHOD FOR THE CLINICAL DEVELOPMENT AND MEDICAL APPLICATION OF MULTIPLEX ASSAYS DERIVED FROM PATTERNS OF INDIVIDUAL BIOMARKERS OF OXIDATIVE OR NITROSATIVE STRESS - A method and apparatus for the discovery, development and clinical application of multiplex synthetic assays based on patterns of free radicals, indicators of oxidative or nitrosative stress, or indicators of the redox state of biologic fluids and tissue specimens. These individual measurements are combined into an optimized clinical biomarker using known well-known mathematical, machine learning techniques. | 12-19-2013 |
20130337446 | METHOD OF PREPARING A STANDARD DIAGNOSTIC GENE TRANSCRIPT PATTERN - A method for preparing a gene transcript pattern probe kit characteristic of a disease or condition or a stage thereof in a prokaryotic or eukaryotic organism using mRNA which is differentially expressed in the disease or condition or stage as probes, methods of diagnosis using the method and kits for performing the same are disclosed. | 12-19-2013 |
20130337447 | METHODS AND COMPOSITIONS FOR EVALUATING GENETIC MARKERS - Aspects of the invention relates to methods and compositions that are useful to reduce bias and increase the reproducibility of multiplex analysis of genetic loci. In some configurations, predetermined preparative steps and/or nucleic acid sequence analysis techniques are used in multiplex analyses for a plurality of genetic loci in a plurality of samples. | 12-19-2013 |
20130337448 | Method and Kit for Determining Severity and Progression of Periodontal Disease - An improved method and kit of determining whether a patient is predisposed to having severe periodontal disease and/or having high risk of progression of periodontal disease, comprising the steps of (i) taking a biological sample from said patient; (ii) genotyping said biological sample for genetic polymorphism pattern comprising IL 1B (rs16944), IL 1B (rs1143623) and IL 1B (rs4848306); and (iii) comparing said genetic polymorphism patterns to a reference composite genotype pattern; wherein the similarity of said genetic polymorphism patterns to said reference pattern indicate said patient's predisposition to having severe periodontal disease and/or having high risk of progression of periodontal disease. | 12-19-2013 |
20130337449 | MARKER FOR PREDICTING GASTRIC CANCER PROGNOSIS AND METHOD FOR PREDICTING GASTRIC CANCER PROGNOSIS USING THE SAME - The present invention relates to a marker for predicting a gastric cancer prognosis, a composition and a kit for predicting gastric cancer prognosis comprising an agent for measuring the expression level thereof, and a method for predicting gastric cancer prognosis using the marker. According to the present invention, gastric cancer prognosis may be predicted promptly and accurately, and an appropriate treatment plan can be determined based on the predicted prognosis, which has an advantage of contributing to significant reduction of death caused by gastric cancer. Particularly, according to the present invention, the survival rate can be remarkably increased by using the treatment method for a stage III gastric cancer patient to a patient who has been predicted to have a negative prognosis among stage Ib/II gastric cancer patients. | 12-19-2013 |
20130337450 | DETECTION OF QUANTITATIVE GENETIC DIFFERENCES - The present invention relates to uses and methods for the detection of a quantitative difference between first and second target sequence regions present in a nucleic acid sample, in particular but not exclusively a DNA sample, and a kit for carrying out the uses and methods of the invention. | 12-19-2013 |
20130337451 | METHOD FOR DETECTING METHYLATED CYTOSINE - The invention provides a method for obtaining DNA after bisulfite reaction which can be stored with libraries in genome reserved and has excellent storage stability, and a method for detecting methylated cytosine. Specifically, the invention provides a method for obtaining DNA complementary to single-stranded DNA in which non-methylated cytosine has been uracilated by subjecting single-stranded DNA to a bisulfite reaction and then a reverse transcriptase reaction. The resulting complementary DNA can be amplified by a PCR reaction. Methylated cytosine can be detected in single-stranded DNA by subjecting the single-stranded DNA, in order, to a bisulfite reaction, a reverse transcriptase reaction, and a PCR reaction, and then subjecting the obtained PCR amplification product to nucleotide sequence analysis. | 12-19-2013 |
20130344481 | MOLECULAR DIAGNOSIS AND CLASSIFICATION OF MALIGNANT MELANOMA - The present invention provides methods for diagnosing and providing a prognosis of melanoma using molecular markers that are overexpressed in melanoma cells. The invention provides kits for diagnosis and prognosis. Also provided are methods to identify compounds that are useful for the treatment or prevention of melanoma and melanoma progression. | 12-26-2013 |
20130344482 | GENE FOR PREDICTING THE PROGNOSIS FOR EARLY-STAGE BREAST CANCER, AND A METHOD FOR PREDICTING THE PROGNOSIS FOR EARLY-STAGE BREAST CANCER BY USING THE SAME - The present invention relates to a method for selecting a gene intended to predict the prognosis for a cancer, to the selected gene for predicting the prognosis of cancer and to a kit for predicting and a method for predicting metastasis in breast-cancer patients by using the same. In the present invention, a straight forward method is used to achieve high-reliability prediction of the patient's prognosis by analysing for the genetic characteristics of early stage breast cancer, and thus the present invention can be used to advantage in prognosis diagnosis which can reduce unnecessary anticancer therapy. | 12-26-2013 |
20130344483 | DETECTION OF MUTATIONS IN A GENE ENCODING IKB KINASE-COMPLEX-ASSOCIATED PROTEIN TO DIAGNOSE FAMILIAL DYSAUTONOMIA - A method for detecting the presence in a subject of a polymorphism linked to a gene associated with familial dysautonomia, said method comprising detecting a disruptive mutation in a gene of said subject encoding the IκB kinase-complex-associated protein, and, preferably, detecting a T→C change in position 6 of the donor splice site of intron 20 and/or a G→C transversion of nucleotide 2390 in exon 19 of the gene encoding the IκB kinase-complex-associated protein which is present on chromosome 9q31. Also disclosed are oligonucleotide primers useful in the detection method. This abstract is provided to comply with the rules requiring an abstract that will allow a searcher or other reader to ascertain quickly the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. 37 CFR §1.72(b). | 12-26-2013 |
20130344484 | DETECTING MUTATIONS IN DNA - Provided herein are methods for detecting mutations in nucleic acid, and compositions and kits for performing such methods. In particular, nucleic acid amplification and fluorescence detection methods are provided to detect mutations and assess the mutational load. The methods are based on a set of adjacently binding probes wherein one probe is labelled with a quencher and the other is a self-indicating probe labelled with fluorophore and quencher. The binding of the probes is analysed by melting curve analysis. | 12-26-2013 |
20130344485 | NUCLEIC ACID TARGET DETECTION USING A DETECTOR, A PROBE AND AN INHIBITOR - The present invention generally pertains to methods for detecting the presence or absence of a particular nucleic acid sequence. The present invention generally relates to incorporating a detector into a target nucleic acid, adding an oligonucleotide probe, polymerase enzyme and an inhibitor to the reaction, and detecting interference of the oligonucleotide probe with the inhibitor as an indication of the presence of a particular target nucleic acid sequence as well as kits encompassing the same. | 12-26-2013 |
20130344486 | METHOD OF DIAGNOSING BREAST CARCINOMA - The present invention relates to methods of diagnosing a breast carcinoma, determining the prognosis of a patient diagnosed with breast carcinoma and determining the efficacy of a treatment regimen of breast carcinoma in a patient, using Calponin-h2 and/or CALML 5 as markers. Furthermore, the invention relates to a kit and a marker panel for use in these methods. | 12-26-2013 |
20130344487 | METHOD TO DETECT PROSTATE CANCER IN A SAMPLE - The present invention provides methods to detect prostate cancer by detecting the RNA encoded by PCA3. The disclosure provides a method for determining a predisposition, or presence of prostate cancer comprising: (a) contacting a sample with at least one oligonucleotide that hybridizes to a PCA3 polynucleotide; (b) detecting an amount of PCA3 and second prostate-specific polynucleotides; and (c) comparing the amount of PCA3 polynucleotide that hybridizes to the oligonucleotide to a predetermined cut off value, and determining the presence or absence of prostate cancer. Diagnostic kits are provided for detecting prostate cancer or the risk of developing same comprising: (a) at least one container means containing at least one oligonucleotide probe or primer that hybridizes to PCA3 (b) at least one oligonucleotide probe or primer that hybridizes with a second prostate specific nucleic acid; and (c) reagents for detecting PCA3 and the second prostate specific nucleic acid. | 12-26-2013 |
20140004508 | METHOD FOR ISOTHERMAL DNA AMPLIFICATION STARTING FROM AN RNA TEMPLATE | 01-02-2014 |
20140004509 | KIT FOR ISOTHERMAL DNA AMPLIFICATION STARTING FROM AN RNA TEMPLATE | 01-02-2014 |
20140004510 | METHODS AND COMPOSITIONS FOR PROGNOSING AND/OR DETECTING AGE-RELATED MACULAR DEGENERATION | 01-02-2014 |
20140004511 | IDENTIFICATION OF 5-METHYL-C IN NUCLEIC ACID TEMPLATES | 01-02-2014 |
20140004512 | QUALITY DETERMINATION OF STEM CELLS | 01-02-2014 |
20140004513 | COMPOSITIONS, METHODS, AND KITS FOR DETECTING AND IDENTIFYING MYCOBACTERIA | 01-02-2014 |
20140004514 | Snap-Back Primers And Detectable Hairpin Structures | 01-02-2014 |
20140004515 | COMPOSITIONS, METHODS, AND KITS FOR AMPLIFYING NUCLEIC ACIDS | 01-02-2014 |
20140004516 | Methods of Predicting Resistance to JAK Inhibitor Therapy | 01-02-2014 |
20140004517 | METHODS FOR MANIPULATING LIQUID SUBSTANCES IN MULTI-CHAMBERED RECEPTACLES | 01-02-2014 |
20140004518 | METHOD FOR IDENTIFYING POLYMORPHISM OF NUCLEIC ACID MOLECULES | 01-02-2014 |
20140004519 | METHOD FOR IDENTIFYING POLYMORPHISM OF NUCLEIC ACID MOLECULES | 01-02-2014 |
20140004520 | MATERIALS AND METHODS FOR PROFILING MICRORNAS | 01-02-2014 |
20140011196 | RESTRICTION ENDONUCLEASES AND THEIR USES - A restriction endonuclease with a recognition sequence 5′-TCGA-3′. The restriction endonuclease is sensitive to the presence of a modified cytosine residue in the recognition sequence. Methods and kits using the restriction endonuclease with a recongition sequence 5′-TCGA-3′ are also disclosed. | 01-09-2014 |
20140011197 | Alzheimer's Disease Cellular Model for Diagnostic and Therapeutic Development - Stem-cell derived human neuronal models that mimic human Alzheimer's disease, including hereditary and sporadic Alzheimer's disease, comprising neural stem cells derived from human induced pluripotent stem cells. Also provided are purified human neurons developed from the neural stem cells that carry genomes from the Alzheimer's disease patients. The human neuronal models are neuronal models for hereditary and sporadic Alzheimer's disease, and are suitable for measurement of key behaviors of the Alzheimer's disease, providing further diagnostic tools for the development of sporadic Alzheimer's disease, and assisting in drug testing for the therapeutic treatment of Alzheimer's disease. | 01-09-2014 |
20140017676 | BIOLOGIC SAMPLE COLLECTION DEVICES AND METHODS OF PRODUCTION AND USE THEREOF - Collection devices and kits for biological sample collection include a biologic sample collection device having a hydrophilic swab matrix that includes a modified polycaprolactone (PCL). Methods of production and use thereof are also described herein. The biologic sample collection devices, kits and methods described herein are used to collect a biologic sample (e.g., blood, buccal cells, etc.) and to enable extraction of nucleic acids (e.g., DNA) from that biologic sample so that the nucleic acids can be analyzed (e.g., sequencing and subsequent analyses of DNA). | 01-16-2014 |
20140017677 | METHOD FOR ESTABLISHMENT OF PERSONALITY-GENOTYPE CORRELATION MODEL AND APPLICATION THEREOF - The present invention discloses a method using gene detection to analyze personality traits of a human subject, which comprising steps of (a) providing a subject's test specimen; (b) conducting a gene polymorphism analysis for a plurality of genetic polymorphism biomarkers of the test specimen, wherein the plurality of genetic polymorphism biomarkers are composed of following single-nucleotide polymorphisms (SNPs); TPH1(SEQ ID NO:2), EGF(SEQ ID NO:4), NET_T-182C(SEQ ID NO:5), DRD1(SEQ ID NO:8), DRD4(SEQ ID NO:10) and COMT(SEQ ID NO:11), and following variable number tandem repeats (VNTRs): MAOA_VNTR(SEQ ID NO:16); and (c) determining the subject's surgerncy, negative affection and orienting/regulation of personality traits according to the results of the gene polymorphism analysis; wherein TPH1, DRD4 and COMT are correlated to surgency, EGF and DRD1, MAOA_VNTR are correlated to negative affection, and NET_T-182C and COMT are correlated to orienting/regulation of personality traits. | 01-16-2014 |
20140017678 | PATHWAY CHARACTERIZATION OF CELLS - The present invention provides methods, compositions and kits for the characterization of cellular pathways in cells containing genetic alterations. | 01-16-2014 |
20140017679 | IDENTIFICATION OF SURFACE-ASSOCIATED ANTIGENS FOR TUMOR DIAGNOSIS AND THERAPY - The invention relates to identifying tumor-associated genetic products and encoding nucleic acids thereof. A therapy and diagnosis of diseases in which the tumor-associated genetic products are aberrantly expressed, proteins, polypeptides and peptides which are expressed in association with tumor and the encoding nucleic acids for said proteins, polypeptides and peptides are also disclosed. | 01-16-2014 |
20140017680 | Real-Time Sequencing Methods and Systems - The present invention is generally directed to compositions, methods, and systems for performing single-molecule, real-time analysis of a variety of different biological reactions. The ability to analyze such reactions provides an opportunity to study those reactions as well as to potentially identify factors and/or approaches for impacting such reactions, e.g., to either enhance or inhibit such reactions. In certain preferred embodiments, RNA templates are used in single-molecule real-time sequencing reactions. | 01-16-2014 |
20140017681 | TREATMENT OF DISEASE - The invention relates to the use of angiogenin, or a fragment or variant thereof, to treat diseases or conditions characterised by neuronal injury or death, or axonal degeneration, especially neurodegenerative diseases such as Amyotrophic Lateral Sclerosis (ALS). The invention also describes a plurality of mutations of the human angiogenin gene which are associated with a neurodegenerative disease phenotype, and particularly a ALS phenotype. Also described is a method of assessing whether an individual is afflicted with, or generically predisposed to develop, a disease or condition characterised by neuronal injury or death, or axonal degeneration. | 01-16-2014 |
20140017682 | HIGH RESOLUTION MELTING ANALYSIS AS A PRESCREENING TOOL - Compositions and methods for determining an increased likelihood of a response to a targeted treatment of a cancer disease including isolating genomic DNA from a patient sample, amplifying a fragment of DNA by means of PCR with a specific pair of amplification primers, determining if the amplified fragment comprises a wildtype sequence or a mutation by means of a High Resolution Melting Analysis (HRM), and correlating the presence or absence of a mutation with an increased likelihood of success of said targeted treatment. Respective primer pairs, compositions and kits are also claimed. | 01-16-2014 |
20140017683 | METHOD FOR SINGLE CELL GENOME ANALYSIS AND KIT THEREFOR - A method for analyzing a genome of a single cell is provided, and a kit is also provided. The method for analyzing the genome of the single cell may comprise separating and lysing the single cell to obtain a whole-genome DNA of the cell; subjecting the whole-genome DNA to a whole-genome amplification to obtain a whole-genome amplification product; performing a PCR amplification using the whole-genome amplification product as template and using housekeeping-gene-specific primers to detect the housekeeping gene of the whole-genome amplification product; and determining whether the whole genome amplification product meets a requirement for sequencing based on the detection result, wherein a uniform distribution of the amplification product in each chromosome is an indication of the amplification product meeting the requirement for sequencing. | 01-16-2014 |
20140017684 | METHODS TO DETERMINE ZYGOSITY IN A BULKED SAMPLE - Methods of determining the presence or absence of an inserted nucleotide sequence at a particular insertion site in a nucleic acid include: isolating a nucleic acid from the bulked tissue sample; contacting the nucleic acid with a forward primer able to bind to the nucleic acid upstream of the insertion site, a first reverse primer specific for the inserted nucleotide sequence, and a second reverse primer able to bind to the nucleic acid downstream of the insertion site. The primers may be used to reproduce nucleic acids between the primers. The reproduced nucleic acids may be analyzed to determine if an inserted nucleotide sequence is present or absent in the sample. | 01-16-2014 |
20140017685 | METHODS, COMPOSITIONS, AND KITS FOR DETERMING THE PRESENCE/ABSENCE OF A VARIAN NUCLEIC ACID SEQUENCE - The present invention provides methods, compositions and kits for detecting the presence, absence or amount of a target nucleic acid or at least one variant nucleotide in one or more nucleic acids contained in a sample. | 01-16-2014 |
20140017686 | METHOD FOR ASSESSING RISK OF HEPATOCELLULAR CARCINOMA - The present invention aims at providing a method for assessing risk of hepatocellular carcinoma with high sensitivity and specificity. Extracted were 30 regions containing 45 CpG sites which have DNA methylation levels significantly different between in normal liver tissue samples and in noncancerous liver tissue samples from patients with hepatocellular carcinoma. It was found that the noncancerous liver tissue samples from patients with HCC were able to be assessed for risk of hepatocellular carcinoma by setting cutoff values for distinguishing between the normal liver tissue samples and the noncancerous liver tissue samples from patients with HCC for the extracted 30 regions. | 01-16-2014 |
20140017687 | METHOD FOR PERFORMING MOLECULAR REACTIONS BY USING IMMISCIBLE INTERMEDIATE FLUIDS - The present invention relates to a method for performing molecular reactions in a device comprising the steps of (a) introducing one or more reagent solution(s) and an immiscible intermediate fluid into the device, wherein the device comprises a substrate, on which chemically or biochemically recognizable entities are immobilized; (b) performing molecular reactions between the immobilized chemically or biochemically recognizable entities and the reagent solution(s); or on the immobilized chemically or biochemically recognizable entities in the presence of the reagent solution(s); (c) displacing the reagent solution(s) present on the substrate by the immiscible intermediate fluid; (d) separating the immiscible intermediate fluid and the reagent solution(s); and reusing the reagent solution(s) and/or immiscible intermediate fluid for one or more repetitions of steps (a) to (e). The invention further relates to a device for performing a molecular reaction, comprising a reaction zone, reservoirs and liquid connections and a col lection and regeneration zone wherein the immiscible intermediate fluid and the reagent solution(s) are separable by gravitational separation; or a redirection and distribution module, wherein the immiscible intermediate fluid and reagent solution(s) are separated. The invention also relates to the use of an immiscible intermediate fluid for displacing a reagent solution present in a reaction zone in a microfluidic device, as well as the use of a corresponding device for performing a sequencing reaction or a nucleic acid synthesis reaction. | 01-16-2014 |
20140017688 | Compositions and Methods for Diagnosing Cancer - The application describes methods for diagnosing subjects with leukemia by detecting fusion genes associated with the onset of leukemia. | 01-16-2014 |
20140017689 | METHOD FOR DETECTING NUCLEIC ACIDS - Method for detecting nucleic acids which employs a double-stranded oligonucleotide probe containing i) a first probe including a first label moiety, and ii) a second probe partially complementary with the first probe and including a second label moiety capable of interacting with the first moiety when brought in close proximity with each other, the second moiety being a quencher or acceptor of emission of the first moiety. The first or second probe includes a sequence complementary to that of a target nucleotide, and the second or first probe, respectively, includes a sequence complementary to a complement of the target nucleotide sequence of the nucleic acid to be detected. Oligonucleotides for determining | 01-16-2014 |
20140024024 | METHODS OF DETECTING DNA, RNA AND PROTEIN IN BIOLOGICAL SAMPLES - Novel methods of probing multiple targets in a biological sample are provide whereby the targets are DNA, RNA and protein. The method comprises subjecting the sample to an in situ hybridization reaction using a labeled nucleic acid probe that binds an RNA target, observing a signal, and optionally removing the signal. The method further comprises an antigen retrieval protocol, observing a signal, removing the signal, and optionally applying a protease treatment to access the sample's DNA targets by subjecting the sample to an in situ hybridization reaction using a labeled nucleic acid probe, observing a signal from the labeled DNA targets, and optionally removing the signal. | 01-23-2014 |
20140024025 | UV ASSOCIATED MTDNA FUSION TRANSCRIPTS AND METHODS AND USES THEREOF - The present invention provides novel mitochondrial fusion transcripts and related deletion molecules that are associated with UV exposure. Methods for in vivo and in vitro detection of mtDNA molecules and associated fusion transcripts is also provided, as is their use in the screening and testing of skin care products. | 01-23-2014 |
20140024026 | METALLIC NANOPARTICLE SYNTHESIS WITH CARBOHYDRATE CAPPING AGENT - The disclosure relates to metal nanoparticle compositions and their methods of formation and use, in particular gold nanoparticles (AuNP) and gold-coated magnetic nanoparticles. Compositions according to the disclosure include aqueous suspensions of metal nanoparticles that are stabilized with one or more carbohydrate capping agents and/or that are functionalized with one or more binding pair members for capture/detection of a target analyte. The nanoparticle suspensions are stable for extended periods and can be functionalized as desired at a later point in time, typically prior to use in an assay for the detection of a target biological analyte. The stable nanoparticle suspension can be formed by the aqueous reduction of oxidized metal precursors at non-acidic pH values in the presence of a carbohydrate-based capping agent such as dextrin or other oligosaccharides. | 01-23-2014 |
20140024027 | Methods of enriching for and identifying polymorphisms - The invention encompasses methods for enriching for and identifying a polymorphism within a nucleic acid sample either by separating a subset of a nucleic acid sample or by selectively replicating a subset of a nucleic acid sample such that the polymorphism is contained within a nucleic acid population with reduced complexity, and then identifying the polymorphism within the enriched nucleic acid sample. Methods also are disclosed for enriching for and identifying a polymorphism by contacting a nucleic acid sample that includes a subset of nucleic acid molecules having a sequence that binds to a sequence-specific binding activity with a molecule having a sequence-specific binding activity under conditions which permit specific binding, such that the subset of nucleic acid molecules bound to the activity is enriched for nucleic acid molecules having the sequence recognized by the sequence-specific binding activity, and detecting a polymorphism with respect to a reference sequence in the subset of nucleic acid molecules. | 01-23-2014 |
20140024028 | BRCA DEFICIENCY AND METHODS OF USE - The invention generally relates to a molecular classification of disease and particularly to methods and compositions for determining BRCA deficiency. | 01-23-2014 |
20140024029 | METHODS FOR SELECTING MEDICATIONS FOR TREATING PATIENTS HAVING ATTENTION-DEFICIT HYPERACTIVITY DISORDER - Methods for selecting a medication for a patient are described that include determining the patient's genotype for a panel of genes, identifying a phenotype associated with the genotype for each gene, and selecting the medication based on the phenotype. | 01-23-2014 |
20140024030 | PRESELECTION OF SUBJECTS FOR THERAPEUTIC TREATMENT WITH OXYGEN SENSITIVE AGENTS BASED IN HYPOXIC STATUS - The present invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of hypoxia in cancerous cells in the subject. In one embodiment, the invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of lactate dehydrogenase (LDH) in a cell, e.g., a cancerous cell. The invention also provides methods for treating cancer in a subject by administering an effective amount of an agent to the subject, wherein the subject has been selected based on a modulated level of hypoxia. The invention further provides kits to practice the methods of the invention. | 01-23-2014 |
20140024031 | Method For Determining DNA Fragmentation In Microorganisms - The present invention relates to a process for determining the DNA integrity in microorganisms and a kit for evaluating the DNA integrity therein. Due to the fact that cell death means DNA fragmentation, with the present process the DNA fragmentation levels in microorganisms can be clearly discriminated in a simple, quick and accurate manner. | 01-23-2014 |
20140024032 | Method for Detecting Chromosome Structure and Gene Expression Simultaneously in Single Cells - The present invention relates to systems and methods for measuring chromosome structure and gene expression. In one embodiment, the present invention includes an assay for determining the spatial organization of gene expression in the nucleus. The present invention also includes a method based on fluorescence in situ hybridization (FISH) that simultaneously yields information on the physical position and expression of individual genes. By lighting up a large number of targets on a particular chromosome using a bar-coding scheme, the large scale structure of an entire chromosome can be determined. | 01-23-2014 |
20140024033 | DETECTING NUCLEIC ACID VARIATIONS WITHIN POPULATIONS OF GENOMES - This disclosure relates to amplification and detection of a rare variant or variants of a DNA sequence in an abundant variant of the sequence, such as detection of a low-level somatic mutations and minority alleles in an excess of normal nucleic acid target sequences. | 01-23-2014 |
20140030709 | Biomarker for Detecting High-Altitude Adaptation and High-Altitude Pulmonary Edema - Present invention relates to the Biomarkers for detecting high altitude adaptation and hypoxia responsiveness and the method thereof. The invention specifically relates to the Gene variants SNPIDs rs479200 and rs480902 in the first intron of EGLN1 (Prolyl Hydroxylase 2) gene as biomarkers for adaptation to high altitude and predisposition for high altitude pulmonary edema and hypoxia responsiveness using a novel integrative approach of phenotyping concepts of Ayurveda with population genetics, and disease genomics. More specifically, the C allele of SNP ID rs480902 and T allele of rs479200 of EGLN1 gene is more frequent in patients of HAPE and nearly absent in native highlanders. The present invention also provides primers and methods suitable for the detection of these allelic variants for the prediction of individual's adaptability to high altitude and hypoxia and/or the genetic analysis of the EGLN1 gene in a population. | 01-30-2014 |
20140030710 | GARDNERELLA VAGINALIS ASSAY - The present invention relates to nucleic acid amplification assays for the detection of nucleic acid sequences of | 01-30-2014 |
20140030711 | METHODS AND BIOMARKERS FOR DETECTION OF LYMPHOMA - The present invention relates to methods and biomarkers for detection and characterization of lymphoma (e.g., splenic marginal zone lymphoma) in biological samples (e.g., tissue samples, blood samples, plasma samples, cell samples, serum samples). | 01-30-2014 |
20140030712 | GENOMIC APPROACH TO THE IDENTIFICATION OF BIOMARKERS FOR ANTIBIOTIC RESISTANCE AND SUSCEPTIBILITY IN CLINICAL ISOLATES OF BACTERIAL PATHOGENS - In certain embodiments, the present invention concerns genotypic identification of bacteria that are resistant to a bacteria and subsequent determination of an appropriate therapy. In specific embodiments, a high-throughput genotypic detection method for biomarkers for antibiotic resistance and susceptibility allows efficient prescription practice and increases the likelihood of a successful therapeutic outcome. In certain embodiments, the information from the genotypic detection method is utilized for determining antibiotics that should be avoided or, alternatively, employed. | 01-30-2014 |
20140030713 | FILLER FOR ION EXCHANGE CHROMATOGRAPHY AND METHOD FOR SEPARATING AND DETECTING NUCLEIC ACID STRAND - The present invention aims to provide a filler for ion exchange chromatography which can sufficiently detect nucleic acid chains that differ in sequence of bases or nucleic acid chains that differ by a single base substitution. The present invention also aims to provide a method for separating and detecting a nucleic acid chain using the filler for ion exchange chromatography. The present invention relates to filler for ion exchange chromatography, comprising base fine particles, each particle having a strong cationic group and a weak cationic group on the surface thereof. | 01-30-2014 |
20140030714 | Method and means for distinguishing malignant from benign tumor samples, in particular in routine air dried fine needle aspiration biopsy (FNAB) - The invention concerns a method and means for distinguishing malignant from benign tumor samples of the thyroid, by performing a RNA extraction in a standard fine needle aspiration biopsy (FNAB) sample, in particular an air dried FNAB smear. The presence of gene-rearrangements and/or the expression of miRNA is analyzed in the isolated RNA, wherein the presence of a gene-rearrangement and/or the differential expression of miRNA is indicative for a malignant tumor. | 01-30-2014 |
20140038180 | DISEASE-ASSOCIATED GENETIC VARIATIONS AND METHODS FOR OBTAINING AND USING SAME - The invention provides a comprehensive, rapid, unbiased, and accurate method for identifying and/or discovering disease-associated genetic variations, e.g., disease-associated variations. The present invention further provides novel disease-associated genetic variations for use as genetic markers of disease, e.g., cancer. The invention further provides methods for assessing an individual's risk for developing a disease, e.g., cancer, by detecting the presence the novel disease-associated genetic variations of the invention. | 02-06-2014 |
20140038181 | CHEMICALLY SUBSTITUTED THERMOSENSITIVE PROBES AND COFACTORS FOR HOT START LIGATION - Provided herein are methods for ligase mediated nucleic acid replication and amplification of oligo- and probes containing substituted ligase components, particularly substituted ligase cofactors, substituted oligo- and probe acceptors, substituted oligo- and probe donors, substituted adenylated oligo- and polynucleotide donor intermediates carrying thermolabile group or groups. The substituted ligase components are not active until Hot Start activation step converts them into unsubstituted or natural ligase components, which fully support ligase reaction. The described methods are readily applied to ligation-based assays, especially utilizing Ligase Chain Reaction (LCR), for detection of a nucleic acid sequence where the use of the substituted ligase components improves an overall efficiency of LCR, increase discrimination between matched and mismatched templates and reduces or eliminates appearance of false positive signal. Furthermore, the use of the substituted ligase components reduces or eliminates the false positive signal originated from the template independent and blunt-ended ligation. | 02-06-2014 |
20140038182 | COOPERATIVE PRIMERS, PROBES, AND APPLICATIONS THEREOF - Disclosed are compositions and a method relating to amplifying and detecting nucleic acids. | 02-06-2014 |
20140038183 | 5-HYDROXYMETHYLCYTOSINE IN HUMAN CANCER - The present invention relates to the field of cancer. More specifically, the present invention provides methods and compositions useful for diagnosing or predicting cancer in a patient. In one embodiment, a method for identifying a patient as having cancer comprises the steps of (a) providing a formalin-fixed, paraffin-embedded or fresh frozen sample of patient tissue; (b) steaming the sample in antigen retrieval buffer; (c) incubating the sample in hydrochloric acid (HCl); (d) incubating the sample with an affinity reagent specific for 5hmC under conditions to form a complex between the affinity reagent and 5-hydroxymethylcytosine (5hmC) present in the sample; (e) detecting the complexes formed between 5hmC and the affinity reagent with secondary detection reagents; (f) quantifying 5hmC levels; and (g) identifying the patient as having cancer if the 5hmC levels in the sample are reduced as compared to a control. | 02-06-2014 |
20140038184 | METHODS OF DIAGNOSING CLOSTRIDIUM DIFFICILE INFECTION - Methods of diagnosing | 02-06-2014 |
20140038185 | POLYNUCLEOTIDE PRIMERS AND PROBES - The present invention provides a novel technology that involves improved primer design. These primer pairs have a wide range of applications and provide high sensitivity and specificity. | 02-06-2014 |
20140045177 | KIT FOR DETECTING A MUTATION AND/OR POLYMORPHISM OF A SPECIFIC REGION IN A TARGET NUCLEOTIDE SEQUENCE - One embodiment of the disclosure provides a kit for detecting a mutation and/or polymorphism of a specific region in a target nucleotide sequence, including: at least one first primer consisting of a first segment and a second segment, wherein the first segment is a complementary strand of a first sequence and the second segment is a second sequence, and the 3′ end of the first segment connects to the 5′ end of the second segment; a second primer being a third sequence; at least one third primer consisting of a third segment and a fourth segment, wherein the third segment is a fourth sequence and the fourth segment is a complementary strand of a fifth sequence, and the 3′ end of the third segment connects to the 5′ end of the fourth segment; and a fourth primer being a complementary strand of a sixth sequence, wherein the specific region includes rs1799853, rs1057910, rs2108622, rs9923231 and rs9934438. | 02-13-2014 |
20140045178 | DETECTION OF NUCLEIC ACIDS USING A CANTILEVER SENSOR - Detection of miniscule amounts of nucleic acid is accomplished via binding of target nucleic acid to probe material, composed of nucleic acid, which is bound to a sensor configured to sense mass. The sensor is prepared by immobilizing a probe material to a surface of the sensor, wherein the probe material is known to bind to the target nucleic acid. The prepared sensor is exposed to the target nucleic acid. The target nucleic acid binds to the probe material. The mass accumulated on the sensor reflects the amount of target nucleic acid bound to the probe material. | 02-13-2014 |
20140045179 | NANO/MICROSCALE VEHICLES FOR CAPTURE AND ISOLATION OF TARGET BIOMOLECULES AND LIVING ORGANISMS - Techniques, systems, devices and materials are disclosed for capturing, isolating and transporting target biomolecules and living organisms. In one aspect, a device includes a tube structured to include a large opening and a small opening that are on opposite ends of the tube, and a tube body connecting the openings and having a cross section spatially reducing in size from the large opening to the small opening, in which the tube includes a layered wall including an inner layer having a catalyst material that is reactive with a fuel fluid to produce bubbles exiting the tube from the large opening to propel the tube to move in the fuel fluid and an external layer formed of a material capable of being functionalized, and a molecular layer functionalized onto the external layer of the tube and structured to attach to a targeted molecule in the fuel fluid. | 02-13-2014 |
20140045180 | METHOD FOR DETECTING METHYLATION OF COLORECTAL CANCER SPECIFIC METHYLATION MARKER GENE FOR COLORECTAL CANCER DIAGNOSIS - The present invention relates to a method for detecting methylation of the bowel-cancer-specific methylation marker GPM6A (NM_201591, glycoprotein M6A) gene in order to diagnose bowel cancer, and more specifically relates to a method for providing information for diagnosing bowel cancer by detecting the methylation of a bowel-cancer-specific marker gene that is specifically methylated in bowel cancer cells. The method for detecting methylation and a diagnostic composition, kit and nucleic-acid chip according to the present invention can be used to advantage in diagnosing bowel cancer more accurately and quickly than by normal methods as they permit bowel cancer to be diagnosed at the initial genetic transformation step and so allow early diagnosis. | 02-13-2014 |
20140045181 | DETERMINING PERCENTAGE OF FETAL DNA IN MATERNAL SAMPLE - Methods, systems, and apparatus are provided for determining whether a nucleic acid sequence imbalance exists within a biological sample. One or more cutoff values for determining an imbalance of, for example, the ratio of the two sequences (or sets of sequences) are chosen. The cutoff value may be determined based at least in part on the percentage of fetal DNA in a sample, such as maternal plasma, containing a background of maternal nucleic acid sequences. The percentage of fetal DNA can be calculated from the same or different data used to determine the cutoff value, and can use a locus where the mother is homozygous and the fetus is heterozygous. The cutoff value may be determined using many different types of methods, such as sequential probability ratio testing (SPRT). | 02-13-2014 |
20140045182 | C-Kit Oncogene Mutations in Melanoma - The present invention provides methods of detecting c-KIT-dependent-melanoma for diagnostic and prognostic purposes. The invention further provides methods of treating such melanoma by inhibiting c-KIT. | 02-13-2014 |
20140045183 | METHOD AND KIT FOR DETECTING 5-HYDROXYMETHYLCYTOSINE IN NUCLEIC ACIDS - Provided are a method and a kit for detecting 5-hydroxymethylcytosine in a nucleic acid. The method is a method for detecting 5-hydroxymethylcytosine in a nucleic acid, comprising the steps of: (1) oxidizing 5-hydroxymethylcytosine in a nucleic acid sample by treating the nucleic acid sample with a tungstic acid-based oxidizing agent comprising peroxotungstic acid, tungstic acid, a salt thereof, or a combination thereof with a reoxidizing agent; and (2) determining the position of the oxidized 5-hydroxymethylcytosine in the nucleic acid sample. | 02-13-2014 |
20140051072 | THERMOSTABLE POLYMERASES HAVING ALTERED FIDELITY AND METHODS OF IDENTIFYING AND USING SAME - The present invention provides a method for identifying a thermostable polymerase having altered fidelity. The method consists of generating a random population of polymerase mutants by mutating at least one amino acid residue of a thermostable polymerase and screening the population for one or more active polymerase mutants by genetic selection. For example, the invention provides a method for identifying a thermostable polymerase having altered fidelity by mutating at least one amino acid residue in an active site O-helix of a thermostable polymerase. The invention also provides thermostable polymerases and nucleic acids encoding thermostable polymerases having altered fidelity, for example, high fidelity polymerases and low fidelity polymerases. The invention additionally provides a method for identifying one or more mutations in a gene by amplifying the gene with a high fidelity polymerase. The invention further provides a method for accurately copying repetitive nucleotide sequences using a high fidelity polymerase mutant. The invention also provides a method for diagnosing a genetic disease using a high fidelity polymerase mutant. The invention further provides a method for randomly mutagenizing a gene by amplifying the gene using a low fidelity polymerase mutant. | 02-20-2014 |
20140051073 | METHOD OF ESTIMATING RISK OF SEVERE SEPSIS IN AN INDIVIDUAL WITH INFECTION - A method of estimating sepsis risk in an individual with infection comprises a step of assaying a biological sample from the individual for an IL-2 or IL-7 mRNA value, and correlating the mRNA value with sepsis risk. The IL-2 and IL-7 mRNA values are quantified by absolute quantification of mRNA copy number, wherein the copy numbers are normalised to a house keeping gene and corrected against a calibration curve for serial dilutions of the IL-2 and IL-7 cDNA. The method generally involves a step of assaying a biological sample from the individual for IL-2 and/or IL-7 mRNA values, optionally in combination with mRNA values for other cytokines, and correlating a sum or difference of the values with sepsis risk. | 02-20-2014 |
20140051074 | METHOD OF JUDGING INFLAMMATORY DISEASE BY USING SINGLE NUCLEOTIDE POLYMORPHISM - An object of the present invention is to identify a novel single nucleotide polymorphism (SNP) associated with the onset and the advancement of inflammatory diseases such as myocardial infarction. The present invention provides a method for judging an inflammatory disease which comprises detecting at least 1 type of genetic polymorphism existing in at least one gene selected from the group consisting of the LBP-32 gene, the TSBP gene, and the WAP gene. | 02-20-2014 |
20140051075 | DEVELOPMENT OF A HIGHLY SENSITIVE QUANTIFICATION SYSTEM FOR ASSESSING DNA DEGRADATION AND QUALITY IN FORENSIC SAMPLES - A process of quantifying the extent of degradation present in a human DNA sample is described. The process makes use of a real time PCR system to separately quantitate within a sample a first retrotransposon interspersed element and a relatively longer second retrotransposon interspersed element, where the longer element is expected to be disrupted at a faster pace than is the shorter element as the sample degrades. In one embodiment, the process makes use of the appearance of the relatively young (on an evolutionary scale) Alu Yb-lineage subfamily sequences appearing in every human genome and their virtual absence in non-human samples. In a preferred embodiment, the process quantifies longer 290 bp sequences of “SVA” elements and shorter 80 bp sequences of Alu Yb8-lineage. Newly designed primers and TaqMan probes that are useful in the process are presented. A related process additionally quantifies male specific human DNA. | 02-20-2014 |
20140051076 | IDENTIFICATION OF GENE ASSOCIATED WITH READING DISABILITY AND USES THEREFOR - The present invention relates to identification of a human gene, DCDC2 (MIM: 605755), associated with susceptibility for developing reading disability (RD), which is useful in identifying or aiding in identifying individuals at risk for developing RD, as well as for diagnosing or aiding in the diagnosis of RD. | 02-20-2014 |
20140051077 | METHODS OF ISOLATING NON-SENESCENT CARDIAC STEM CELLS AND USES THEREOF - The invention describes the isolation and methods of use of a non-senescent pool of adult cardiac stem cells. In particular, a subset of adult cardiac stem cells with superior regenerative capacity is disclosed. Such cells were found to have immortal DNA. Compositions comprising the non-senescent stem cells are also described. In addition, the present invention provides methods for repairing aged myocardium or damaged myocardium using the isolated non-senescent adult cardiac stem cells. | 02-20-2014 |
20140051078 | PLANT TRANSFORMATION WITHOUT SELECTION - The invention provides methods for identifying regenerated transformed plants and differentiated transformed plant parts, obtained without subjecting plant cells to selective conditions prior to regenerating the cells to obtain differentiated tissues. In particular embodiments, the plant cells are corn plant cells. Methods for growing and handling plants, including identifying plants that demonstrate specific traits of interest are also provided. | 02-20-2014 |
20140051079 | METHOD FOR PREDICTING THE RESPONSE TO A TREATMENT AGAINST HEPATITIS C - The invention relates to a method for predicting the response to an interferon-based treatment in a patient infected with hepatitis C virus. This method consists in determining the presence of apolipoprotein CIII and/or of a multimeric form of human serum albumin in a sample of biological fluid from the patient. | 02-20-2014 |
20140051080 | Novel Ferrocene Labels for Electrochemical Assay and their Use in Analytical Methods - Compounds of general formula I are used as labels in an electrochemical assay: (I) in which: Fc and Fc′ are substituted or unsubstituted ferrocenyl moieties, X is a C1 to C6 alkylene chain which is optionally interrupted by —O— or —NH—; Y is a C1 to C6 alkylene chain which is optionally interrupted by —O— or —NH—; Z is a C1 to C12 alkylene chain which may optionally be substituted and/or may optionally be interrupted by —O—, —S—, cycloalkyl, —CO—, —CON R1—, —NR1CO— or —NR1— in which R1 represents hydrogen or C1 to C4 alkyl; and R is a linker group. Compounds I are used to make labelled substrates, as well as functionalised compounds for making the labelled substrates. | 02-20-2014 |
20140051081 | METHOD OF SCREENING FOR CANCER BY DETECTING MUTATIONS IN THE DELTA-CATENIN CODING REGION - Aspects of the present invention provide methods such as screening for risk of cancer, detecting cancer and/or determining treatment for cancer in a subject including detecting the presence or absence of at least one mutation in the delta-catenin coding region. Aspects of the present invention also provide kits for carrying out the methods described herein. | 02-20-2014 |
20140051082 | PROSTATE CANCER MARKERS - The invention relates to the identification and selection of novel genomic regions (biomarker) and the identification and selection of novel genomic region combinations which are hypermethylated in subjects with prostate cancer compared to subjects without prostate cancer. Nucleic acids which selectively hybridize to the genomic regions and products thereof are also encompassed within the scope of the invention as are compositions and kits containing said nucleic acids and nucleic acids for use in diagnosing prostate cancer. Further encompassed by the invention is the use of nucleic acids which selectively hybridize to one of the genomic regions or products thereof to monitor disease regression in a patient and the efficacy of therapeutic regimens. | 02-20-2014 |
20140057251 | Cannabis Genomes and Uses Thereof - Using the efficiency of next generation sequencing, a draft de novo reference sequence for the | 02-27-2014 |
20140057252 | Binary DNA Probe for Fluorescent Analysis of Nucleic Acids - The invention is directed to binary oligonucleotide probes for nucleic analysis, which probes can be made of DNA or RNA that recognize nucleic acid analytes (both DNA and RNA) with unprecedented high selectivity under mild conditions and are highly sensitive to single nucleotide mismatches (SNP single nucleotide polymorphisms) without PCR amplification. In one group, the binary probes indicate that they have hybridized to a particular nucleic analyte by binding to a molecular beacon that gives off a fluorescent signal. A second group of binary probes bind to a dye such as malachite green, where upon hybridization to analyte the fluorescence of the dye increases dramatically and is easily detected and measured. The new binary probes require only about five minutes at room temperature to generate a detectable signal. | 02-27-2014 |
20140057253 | METHOD TO PREDICT THE PATTERN OF LOCOMOTION IN HORSES - The present invention provides methods for predicting the pattern of locomotion in a horse including the ability of a horse to use different gaits and the ability to trot at a fast speed. The methods comprise determining in a sample of DNA obtained from a horse the presence or absence of at least one genetic marker, wherein said at least one genetic marker is located on horse chromosome 23, said marker being associated with the ability to use different gaits. The invention further provides primers that amplify markers being associated with the ability to use different gaits and hybridization probes to detect markers being associated with the ability to use different gaits and the ability to trot at a fast speed. | 02-27-2014 |
20140057254 | METHODS AND REAGENTS FOR REDUCING NON-SPECIFIC AMPLIFICATION - The present invention provides methods and reagents for use in the amplification of nucleic acids. Amplification carried out using oligonucleotides containing modified nucleotides can result in less non-specific amplification compared to amplification carried out using unmodified oligonucleotides. | 02-27-2014 |
20140057255 | Systems and Methods for Collecting and Transmitting Assay Results - Systems and methods are provided for collecting, preparing, and/or analyzing a biological sample. A sample collection site may be utilized with one or more sample processing device. The sample processing device may be configured to accept a sample from a subject. The sample processing device may perform one or more sample preparation step and/or chemical reaction involving the sample. Data related to the sample may be sent from the device to a laboratory. The laboratory may be a certified laboratory that may generate a report that is transmitted to a health care professional. The health care professional may rely on the report for diagnosing, treating, and/or preventing a disease in the subject. | 02-27-2014 |
20140057256 | HAIRPIN-TYPE PROBE FOR DETECTING TARGET MATERIAL AND METHOD FOR DETECTING TARGET MATERIAL USING THE SAME - The present invention relates to a hairpin-type probe for detecting a target substance and a method for detecting a target substance using the probe. The hairpin-type probe comprises a loop comprising a target substance recognition site, and a stem comprising an aptamer having an electrochemical signaling material bound thereto. The hairpin structure is broken when it is hybridized to the target substance, and thus the signaling material is separated from the aptamer and can freely move to the electrode. Based on the change in the electrochemical signal generated from the signaling material, the amount of the target substance can be accurately detected in real-time. | 02-27-2014 |
20140057257 | IN VITRO METHOD FOR THE PROGNOSIS OF PROGRESSION OF A CANCER AND OF THE OUTCOME IN A PATIENT AND MEANS FOR PERFORMING SAID METHOD - The present invention relates to the prognosis of the outcome of a cancer in a patient, which prognosis is based on the quantification of one or several biological markers that are indicative of the presence of, or alternatively the level of, the adaptive immune response of said patient against said cancer. | 02-27-2014 |
20140057258 | METHOD OF DIAGNOSING MILD OSTEOARTHRITIS - The invention relates to the identification and selection of novel biomarkers and the identification and selection of novel biomarker combinations which are differentially expressed in individuals with mild osteoarthritis as compared with individuals without osteoarthritis. Polynucleotides and proteins which specifically and/or selectively hybridize to the products of the biomarkers of the invention are also encompassed within the scope of the invention as are kits containing said polynucleotides and proteins for use in diagnosing mild osteoarthritis. Further encompassed by the invention is the use of the polynucleotides and proteins which specifically and/or selectively hybridize to the product of the biomarkers of the invention to monitor disease regression in an individual and to monitor the efficacy of therapeutic regimens. The invention also provides for methods of using the products of the biomarkers of the invention in the identification of novel therapeutic targets for osteoarthritis. | 02-27-2014 |
20140057259 | METHODS FOR ANALYSIS OF NUCLEIC ACID MOLECULES DURING AMPLIFICATION REACTIONS - The present invention provides systems, methods and kits for performing a detection assay (e.g., invasive cleavage assay) in combination with an amplification assay (e.g., PCR), where the detection assay employs enzyme footprint probes with relatively short (e.g., 6-12 bases) analyte-specific regions configured to provide a preferred footprint length of duplex for use with a particular nucleic acid modifying enzyme. In some embodiments, such assays are used for target quantification, and in other embodiments, such assays are used for genotyping. In certain embodiments, the use of such short probes allows for assays with increased dynamic range. | 02-27-2014 |
20140057260 | MATERIALS AND METHOD FOR ASSAYING FOR METHYLATION OF CpG ISLANDS ASSOCIATED WITH GENES IN THE EVALUATION OF CANCER - Provided are methods, reagents, and kits for evaluating cancer, such as prostate cancer, in a subject. Disclosed methods of evaluating cancer include methods of diagnosing cancer, methods of prognosticating cancer and methods of assessing the efficacy of cancer treatment. The methods include assaying a biological sample for methylation of a CpG island associated with specified genes. Provided reagents and kits include primers suitable for amplifying at least a portion of a target CpG islands associated with specified genes. | 02-27-2014 |
20140057261 | METHODS OF DIAGNOSING, CLASSIFYING AND TREATING ENDOMETRIAL CANCER AND PRECANCER - Diagnostic and therapeutic applications for endometrial cancer are described. The diagnostic and therapeutic applications are based on certain activation mutations in the FGFR2 gene and its expression products. The present invention is directed to nucleotide sequences, amino acid sequences, probes, and primers related to FGFR2 activation mutants and kits comprising these mutants to diagnosis and classify endometrial cancer in a subject. | 02-27-2014 |
20140057262 | METHODS AND MATERIALS FOR USING THE CONTENTS OF PHAGOCYTES TO DETECT NEOPLASMS - This document provides methods and materials related to detecting premalignant or malignant neoplasms (e.g., colorectal and pancreatic cancer). For example, methods and materials for assessing the contents of phagocytes for the presence of one or more biological markers (e.g., Alu repeats or methylated nucleic acid) of premalignant or malignant neoplasms are provided. | 02-27-2014 |
20140057263 | MODIFIED HYBRIDIZATION PROBES - The invention relates to a method for detecting a nucleic acid of an organism in a composition, comprising the steps of, (i) amplifying the nucleic acid to be detected, (ii) during or after amplification, hybridizing to said nucleic acid to be detected a first probe that comprises an abasic site additionally optionally carrying a detectable label, (iii) wherein the position of the abasic site corresponds to a position in said nucleic acid to be detected, known to have a polymorphism in said organism, and wherein said nucleic acid is detected if hybridization occurs. | 02-27-2014 |
20140057264 | DETECTION OF TARGET NUCLEIC ACID SEQUENCE BY PTO CLEAVAGE AND EXTENSION-DEPENDENT CLEAVAGE - The present invention relates to the detection of a target nucleic acid sequence by a PCEC (PTO Cleavage and Extension-Dependent Cleavage) assay. The present invention is characterized by generating a cleavage site for a nucleolytic enzyme on the extended duplex of which the formation is dependent on the presence of a target nucleic acid sequence. The present investion detects the occurrence of the cleavage of the extended duplex, thereby determining the presence of the target nucleic acid sequence. | 02-27-2014 |
20140057265 | Composition and method for determination of ck19 expression - Disclosed is a method for quantitative determination of CK-19 mRNA positive cells in a biological sample. The method can be used, for instance, with peripheral blood to detect cancer in a patient. In one embodiment, the method can be used to detect the cancer before initiation of adjuvant treatment, thereby providing information about therapeutic efficacy. Practice of the invention method is sensitive, reliable, and easy to perform. | 02-27-2014 |
20140057266 | METHODS AND MATERIALS FOR DETECTING GENETIC OR EPIGENETIC ELEMENTS - This document provides methods and materials for detecting genetic and/or epigenetic elements. For example, methods and materials for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, methods and materials for detecting the amount of target nucleic acid containing a genetic or epigenetic element within a sample, kits for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, kits for detecting the amount of target nucleic acid containing a genetic or epigenetic element present within a sample, and methods for making such kits are provided. | 02-27-2014 |
20140057267 | COMPOSITION AND KIT FOR THE DIAGNOSIS OF MILD COGNITIVE IMPAIRMENT, WHICH MEASURE AN EXPRESSION LEVEL OF LIPOCALIN-2, AND METHOD FOR PROVIDING INFORMATION FOR THE DIAGNOSIS OF MILD COGNITIVE IMPAIRMENT - The present invention relates to a composition for the diagnosis of mild cognitive impairment, which includes a formulation measuring an mRNA or protein expression level of lipocalin-2 gene, to a kit for the diagnosis of mild cognitive impairment, and to a method for providing information for the diagnosis of mild cognitive impairment using the same. According to the present invention, by using the agent for measuring an mRNA or protein expression level of the lipocalin-2 gene, a patient having mild cognitive impairment can be specifically identified by measuring an expression level of lipocalin-2, which is higher in a group of patients having mild cognitive impairment than in both a normal group and a group of patients having Alzheimer's disease.; In particular, it is possible to distinguish between a group of patients having mild cognitive impairment and a group of patients having Alzheimer's disease | 02-27-2014 |
20140065609 | VARIETAL COUNTING OF NUCLEIC ACIDS FOR OBTAINING GENOMIC COPY NUMBER INFORMATION - A method for obtaining from genomic material genomic copy number information unaffected by amplification distortion, comprising obtaining segments of the genomic material, tagging the segments with substantially unique tags to generate tagged nucleic acid molecules, such that each tagged nucleic acid molecule comprises one segment of the genomic material and a tag, subjecting the tagged nucleic acid molecules to polymerase chain reaction (PCR) amplification, generating tag associated sequence reads by sequencing the product of the PCR reaction, assigning each tagged nucleic acid molecule to a location on a genome associated with the genomic material by mapping the subsequence of each tag associated sequence read corresponding to a segment of the genomic material to a location on the genome, and counting the number of tagged nucleic acid molecules assigned to the same location on the genome having a different tag, thereby obtaining genomic copy number information unaffected by amplification distortion. | 03-06-2014 |
20140065610 | METHOD FOR PREDICTING CLINICAL BENEFIT IN THE TREATMENT OF NEURODEVELOPMENTAL, NEUROLOGICAL OR NEUROPSYCHIATRIC DISORDERS - An in vitro method of predicting whether a patient, having a neurodevelopmental, neurological or neuropsychiatric disorder, will derive a clinical benefit if treated with a glycine reuptake inhibitor (GRI), via determination of the protein concentration of one, two, three, four five or six members of the complement factor H family or a mixture or a combination thereof and comparison against a representative value, wherein a higher value of the protein concentration in the patient's sample against the representative value is indicative of a patient whom will derive clinical benefit from treatment with GRI. | 03-06-2014 |
20140065611 | MODIFICATION OF NEUROBEHAVIORAL EFFECTS OF MERCURY BY A GENETIC POLYMORPHISM OF COPROPORPHYRINOGEN OXIDASE IN CHILDREN - In one aspect, the present invention provides a method and reagents for predicting a subject's susceptibility or risk to developing a neurobehavioral deficit associated with mercury exposure. The method comprises performing an assay to determine the presence or absence of a CPOX4 polymorphism in one or both alleles of the coproporphyrinogen oxidase (CPOX) gene, and classifying the susceptibility of the subject to developing a neurobehavioral deficit associated with mercury exposure. A subject determined to possess the CPOX4 polymorphism in at least one allele of the CPOX gene is classified as having an increased susceptibility to developing at least one neurobehavioral deficit associated with mercury exposure compared to a subject with no CPOX4 polymorphisms. | 03-06-2014 |
20140065612 | METHOD FOR IN VITRO DETECTING KERATIN GENE FUSION OF SQUAMOUS-CELL CANCER - A method for in vitro detecting keratin gene fusion of squamous-cell cancer comprises steps: (a) obtaining a sample of squamous cells from a testee; and (b) detecting whether the sample of squamous cells has gene fusion, which is likely to occur in squamous-cell cancer and unlikely to occur in healthy tissue. The sample of squamous cells is determined to have squamous-cell cancer if the gene fusion exists in the sample of squamous cells. | 03-06-2014 |
20140065613 | Multiplex Y-STR Analysis - Novel Y-STR multiplex analysis designs, primer design, allelic ladders, methods of use and kits are disclosed, including the use of primer sets designed to provide amplicons for at least 11 Y-STR loci having a base pair size of less than about 220 bp, as well as the use of primer sets designed to provide amplicons for at least 22 Y-STR loci including at least 5 rapidly mutating loci. | 03-06-2014 |
20140065614 | ESTROGEN RECEPTOR ALLELES THAT ARE PREDICTIVE OF INCREASED SUSCEPTIBILITY TO BONE FRACTURE - In one aspect, the present invention provides methods of determining susceptibility to bone fracture in a mammalian subject, wherein the methods comprise analyzing nucleic acid molecules obtained from the mammalian subject to determine which of the P, p X, and x alleles of the estrogen receptor α gene are present, wherein the presence of a haplotype comprising the p and x alleles is indicative of an increased susceptibility to bone fracture. The present invention also provides kits for determining susceptibility to bone fracture in a mammalian subject. | 03-06-2014 |
20140065615 | The KRAS Variant and Tumor Biology - The disclosure provides methods for identifying a subject at risk of developing cancer, predicting the onset of cancer, and predicting a subject's response to chemotherapy/treatment by determining the presence or absence of a SNP in the KRAS oncogene, known as the KRAS variant. | 03-06-2014 |
20140065616 | Isoltation of Factors Associated with Nucleic Acid - Methods for screening and isolating peptide, polypeptide, protein complexes and non-coding nucleic acids that are associated with selected target genomic locus are provided. The methods comprise the steps of obtaining a sample that comprises a modified target genomic DNA sequence and one or more peptide, polypeptide, protein complexes and non-coding nucleic acids as with that DNA sequence. The target genomic locus DNA sequence which contain all the elements that enable it keeping its function independently in spite of their genomic position are modified by introducing one or more labeling and cutting sequences. These modified target genomic locus DNA sequences are amplified and purified. The purified modified target genomic locus DNA sequences are introduced into cells or animals and their functions are regulated as the same as original endogenous target genomic locus. The modified target sequence and the factors associated with it are crosslinked and selectively isolated. | 03-06-2014 |
20140065617 | COMPOSITIONS AND METHODS FOR DETECTING BV-ASSOCIATED BACTERIAL NUCLEIC ACID - Disclosed are nucleic acid oligomers, including amplification oligomers, capture probes, and detection probes, for detection of a 16S rRNA or its encoding gene from bacterial species associated with bacterial vaginosis. Also disclosed are methods of specific nucleic acid amplification and detection using the disclosed oligomers, as well as corresponding reaction mixtures and kits. | 03-06-2014 |
20140065618 | METHOD FOR DETECTING A CHROMOSOMAL ABERRATION - The invention relates to a method for detecting several different chromosomes or DNA regions in a cell in order to provide evidence for structural chromosomal aberrations, wherein the chromosomal aberrations have at least two breaking point regions within a chromosome, on the basis of directly or indirectly labeled nucleic acid fragments (probes), wherein: a first probe labeled with label A (probe A) and a second probe labeled with label B (probe B) flank a breaking point region | 03-06-2014 |
20140072965 | 1, 2-Dichloropropane-to-Propene Reductive Dehalogenase Genes - The invention is directed to novel reductive dehalogenase genes encoding for reductive dehalogenases, which are capable of dehalogenating halogenated organic compounds and may be useful for environmental assessment and monitoring, and in the bioremediation of pollutants. In particular, the invention provides isolated polynucleotides of novel reductive dehalogenase genes dcpA and dcpB and fragments thereof as well as isolated polypeptides encoding the DcpA and DcpB proteins or fragments thereof. The invention is also directed to methods of identifying and/or quantifying dechlorinating bacterial organisms or polynucleotides encoding a reductive dehalogenase, such as the dcpA or dcpB polynucleotides or fragments thereof, in a sample. | 03-13-2014 |
20140072966 | GENETIC BIOMARKERS FOR GLUCOSE-6-PHOSPHATE DEHYDROGENASE DEFICIENCY - The genetic biomarkers for glucose-6-phosphate dehydrogenase (G6PD) deficiency are five haplotypes representing mutations of the G6PD gene on the X chromosome. Each of these haplotypes codes for more than one non-conservative amino acid change. The present inventors have discovered that when mutations of the G6PD gene result in at least two non-conservative amino acid changes in combination, expression of the G6PD enzyme or the stability of the G6PD enzyme is severely decreased, presenting a substantial risk of disease resulting from the deficiency, even in female patients who would normally be considered asymptomatic carriers of the genetic mutation(s). | 03-13-2014 |
20140072967 | METHOD OF DETECTING SINGLE NUCLEOTIDE POLYMORPHISMS - Use of low-temperature nucleic acid amplification and binary probes to detect sequences and single nucleotide polymorphisms. | 03-13-2014 |
20140072968 | Novel Genes Encoding Proteins Having Prognostic, Diagnostic, Preventive, Therapeutic, and Other Uses - The invention provides isolated TANGO 509 nucleic acid molecules and polypeptide molecules. The invention also provides antisense nucleic acid molecules, expression vectors containing the nucleic acid molecules of the invention, host cells into which the expression vectors have been introduced, and non-human transgenic animals in which a nucleic acid molecule of the invention has been introduced or disrupted. The invention still further provides isolated polypeptides, fusion polypeptides, antigenic peptides and antibodies. Diagnostic, screening and therapeutic methods utilizing compositions of the invention are also provided. | 03-13-2014 |
20140072969 | Differential Diagnosis Of Cancer And Other Conditions Based On Expression Of p63 - This invention relates to methods of distinguishing among various types of differentiated and undifferentiated epithelial carcinomas, and non-epithelial carcinomas, by detecting the presence of p63 nucleic acid or protein expression. The invention also provides methods for detecting p63 nucleic acids and proteins, as well as methods for diagnosing and treating certain tumors based on whether the tumors express p63. | 03-13-2014 |
20140072970 | LAFORA'S DISEASE GENE - A novel gene (EPM2B) that is mutated in humans and dogs with Lafora's disease is described. | 03-13-2014 |
20140072971 | PRAME DETECTION ASSAYS - Provided herein are molecular assays, including oligonucleotides and other reagents, for the detection and analysis of PRAME (Preferentially Expressed Antigen in Melanoma). The assays find use, for example, as diagnostic and prognostic applications, including use in assessing therapeutic courses of action. | 03-13-2014 |
20140072972 | TMPRSS2 FOR THE DIAGNOSIS OF PROSTATE DISEASE - Described herein are methods, compositions and kits directed to the detection the 5′ portion of TMPRSS2 mRNA for the detection and diagnosis of prostate disease including prostate cancer and benign prostatic hyperplasia. | 03-13-2014 |
20140072973 | LMNA GENE AND ITS INVOLVEMENT IN HUTCHINSON-GILFORD PROGERIA SYNDROME (HGPS) AND ARTERIOSCLEROSIS - Disclosed herein are point mutations in the LMNA gene that cause HGPS. These mutations activate a cryptic splice site within the LMNA gene, which leads to deletion of part of exon 11 and generation of a mutant Lamin A protein product that is 50 amino acids shorter than the normal protein. In addition to the novel Lamin A variant protein and nucleic acids encoding this variant, methods of using these molecules in detecting biological conditions associated with a LMNA mutation in a subject (e.g., HGPS, arteriosclerosis, and other age-related diseases), methods of treating such conditions, methods of selecting treatments, methods of screening for compounds that influence Lamin A activity, and methods of influencing the expression of LMNA or LMNA variants are also described. Oligonucleotides and other compounds for use in examples of the described methods are also provided, as are protein-specific binding agents, such as antibodies, that bind specifically to at least one epitope of a Lamin A variant protein preferentially compared to wildtype Lamin A, and methods of using such antibodies in diagnosis, treatment, and screening. Also provided are kits for carrying out the methods described herein. | 03-13-2014 |
20140072974 | METHODS FOR QUANTITATIVE AMPLIFICATION AND DETECTION OVER A WIDE DYNAMIC RANGE - Disclosed are compositions and methods for making differentiable amplicon species at unequal ratios using a single amplification system in a single vessel. The number of differentiable amplicons and their ratios to one another are chosen to span the required linear dynamic range for the amplification reaction and to accommodate limitations of the measuring system used to determine the amount of amplicon generated. Unequal amounts of distinguishable amplicon species are generated by providing unequal amounts of one or more amplification reaction components (e.g., distinguishable amplification oligomers, natural and unnatural NTP in an NTP mix, or the like). The amount of target nucleic acid present in a test sample is determined using the linear detection range generated from detection of one or more amplicon species having an amount within the dynamic range of detection. | 03-13-2014 |
20140072975 | COMPOSITIONS AND METHODS FOR DETERMINING GENETIC POLYMORPHISMS IN THE TMEM216 GENE - In alternative embodiments, the invention provides nucleic acid sequences that are genetic polymorphic variations of the human TMEM216 gene, and TMEM216 polypeptide encoded by these variant alleles. In alternative embodiments, the invention provides methods of determining or predicting a predisposition to, or the presence of, a ciliopathy (or any genetic disorder of a cellular cilia or cilia anchoring structure, basal body or ciliary function) in an individual, such as a Joubert Syndrome (JS), a Joubert Syndrome Related Disorder (JSRD) or a Meckel Syndrome (MKS). In alternative embodiments, the invention provides compositions and methods for the identification of genetic polymorphic variations in the human TMEM216 gene, and methods of using the identified genetic polymorphisms and the proteins they encode, e.g., to screen for compounds that can modulate the human TMEM216 gene product, and possibly treat JS, JSRD or MKS. | 03-13-2014 |
20140080124 | SYSTEMS AND METHODS FOR DIAGNOSING A PREDISPOSITION TO DEVELOP COLON CANCER - Systems and methods for diagnosing or characterizing a predisposition to colon cancer are provided. Cell nuclei may be evaluated for the presence or quantity of gamma-H2AX foci. Nucleic acids may be evaluated for the presence, type, or quantity of genomic instability or surrogates of dsDNA breaks such as ataxia telangiectasia mutated (ATM), Rad3-related protein (ATR), and Tumor suppressor p53-binding protein 1 (53BP1) in gamma-H2AX foci. Nucleic acids comprising a germline nucleic acid sequence of the ERCC6, WRN, TERT, and FAAP100 genes may be sequenced or probed to determine if the nucleic acid sequence includes one or more alterations that cause genomic instability, dsDNA breaks, or gamma-H2AX foci or otherwise predispose a subject to develop colon cancer. | 03-20-2014 |
20140080125 | Polymorphisms in the FCGR2B Promoter and Uses Thereof - The invention relates to the FCGR2B gene and its promoter. In particular, the invention relates to FCGR2B promoters with specific nucleotides at polymorphic sites. Characterization of the nucleotides at polymorphic sites is useful for characterizing the gene and the protein and is useful for determining predisposition or susceptibility to certain diseases and infections in a subject or a population of subjects. Such characterization of the gene or protein is also useful for determining immunoresponsiveness or responsiveness to therapeutic agents in a subject or population of subjects. Thus, disclosed herein are a variety of related nucleic acids, methods and tools. | 03-20-2014 |
20140080126 | QUANTIFICATION OF NUCLEIC ACIDS AND PROTEINS USING OLIGONUCLEOTIDE MASS TAGS - The invention provides a method for detecting and quantifying the amount of target molecules, such as nucleic acids or proteins in a sample. The target molecules are first recognized and bounded by target-specific probes, generally nucleic acids or proteins that bind specifically to the targets, each of which is labeled with a short single-stranded nucleic acid probe, either DNA or RNA, with distinct molecular weight. This label is called an oligonucleotide mass tag. One or several standard oligonucleotide sequences can be designed with similar sequence but distinct molecular weight to those oligonucleotide mass tags. Then the oligonucleotide mass tags associated with bounded probes and the standard sequences are co-amplified using a pair of common primers. The presence and/or amount of each oligonucleotide mass tag, which corresponds to the amount of corresponding target molecule, is determined by a primer extension reaction and quantification of the primer extension product. | 03-20-2014 |
20140080127 | HETEROARYLCYANINE DYES - The present invention provides heteroaryl functionalized cyanine dyes including a reactive functional moiety, or which are conjugated to a carrier molecule. | 03-20-2014 |
20140080128 | METHOD FOR DETERMINING WHETHER A SUBJECT IS AT RISK OF HAVING OR DEVELOPING A CHRONIC KIDNEY DISEASE - The invention relates to a method for determining whether a subject is at risk of having or developing a chronic kidney disease (CKD) comprising determining the expression level of the periostin gene in a biological sample obtained from said subject. The invention also relates to a method for staging a CKD in a patient comprising determining the expression level of the periostin gene in a biological sample obtained from said patient. The invention further relates to a method for determining the responsiveness of a patient suffering from a CKD to a treatment comprising determining the expression level of the periostin gene in a biological sample obtained from said patient. | 03-20-2014 |
20140087371 | Compositions and Methods for Detection of Clostridium Difficile - Methods for the rapid detection of the presence or absence of | 03-27-2014 |
20140087372 | PROBE, KIT, AND METHOD FOR DETECTING PATHOGENIC MICROORGANISM - Disclosed herein is a hairpin probe for detecting a target pathogenic microorganism in a sample. The hairpin probe includes a microbead and an oligonucleotide having its 3′-end coupled to the microbead. The oligonucleotide includes, from 5′ to 3′, a Tag sequence hybridizable to a specific identification sequence of the pathogenic microorganism, an internal control sequence having at least four words each having 4 nucleotides with a 75% AT-content, an anti-Tag sequence being a reverse complement of the Tag sequence, and a tail having at least two consecutive thymidine residues. The Tag and anti-Tag sequences are operable to form a stem of the hairpin probe with the internal control sequence being a loop. Also disclosed herein are, a kit including the hairpin probe and a method for using the kit in the detection of a target pathogenic microorganism. | 03-27-2014 |
20140087373 | Enclosed unit for rapid detection of a target nucleic acid amplification product - The invention relates to a method for rapid detection of a target nucleic acid amplification product while preventing cross-contamination between target nucleic acid amplification products and avoiding false positives, comprising the steps of: a) leaving the reaction tube unopened after the amplification reaction is finished, so as to prevent the target nucleic acid amplification product from leaking out and resulting in contamination; b) placing the unopened reaction tube inside an enclosed unit, making the target nucleic acid amplification product be transferred to a test strip from the reaction tube in a physically enclosed environment; c) performing detection in a visual read-out manner, and determining the result; d) discarding the enclosed unit in a safety place as a whole without opening it after the detection. The invention also relates to a totally enclosed unit for detecting a target nucleic acid amplification product, and still relates to applications of the totally enclosed rapid detection unit in detection of infectious pathogens, food industry, agriculture, livestock husbandry, customs quarantine control, and determination of DNA. | 03-27-2014 |
20140087374 | The Use of Microfluidic Systems in the Electrochemical Detection of Target Analytes - The invention relates generally to methods and apparatus for conducting analyses, particularly microfluidic devices for the detection of target analytes. | 03-27-2014 |
20140087375 | BIOPROBES AND METHODS OF USE THEREOF - Disclosed are biomolecule based bioprobes that exhibit improved water solubility and monolayer-forming properties with substantially little or no aggregation that can appreciably interfere with binding of the bioprobes to a target nucleotide. The bioprobes may be used in conjunction with a suitable reporter system to detect very small quantities of biological markers. The bio-probes comprise a nucleobase sequence capable of hybridizing to a target nucleotide; and at least one charged functional group attached to said nucleobase sequence. Also disclosed are biosensors, and sensing devices that comprise the bio-probe. Further disclosed are suitable electrochemical reporter systems for use with bioprobes. Methods of use of these devices and probes, including for the detection of target biomarkers, including biomarkers for cancer cells or pathogens, are also included. | 03-27-2014 |
20140087376 | METHODS OF DETECTING ANEUPLOIDY IN HUMAN EMBRYOS - Methods, compositions and kits for determining the developmental potential of one or more embryos or pluripotent cells and/or the presence of chromosomal abnormalities in one or more embryos or pluripotent cells are provided. These methods, compositions and kits find use in identifying embryos and oocytes in vitro that are most useful in treating infertility in humans. | 03-27-2014 |
20140087377 | METHOD OF IDENTIFYING NUCLEIC ACID-CONTAINING OBJECT - The present invention relates to a method of identifying nucleic acid-containing object, more precisely a method of identifying nucleic acid-containing object which comprises the following steps: (1) preparing nucleic acid-containing object having the nucleotide sequence complementary to the nucleotide sequence of RNA-dual probe; (2) reacting the nucleic acid included in the object with the buffer containing the RNA-dual probe conjugated with a reporter and a quencher respectively and RNase; and (3) detecting fluorescence generated from the reporter. The method of identifying an object of the present invention provides labeling sensitivity 100 times as high as that of the conventional method using sequencing or labeling with fluorescent materials, takes advantages of shorter analysis time, facilitates different labeling on a variety of products according to fluorescent materials, and makes possible unlimited product administration by product group and batch in real production process by differentiating the nucleotide sequence of each oligonucleotide. | 03-27-2014 |
20140087378 | METHOD, PROBE AND KIT FOR DNA IN SITU HYBRIDATION AND USE THEREOF - The invention relates to a method for the detection of the occurrence of initiation of replication events in genomic DNA in a eukaryotic cell, involving contacting said eukaryotic cell comprising said genomic DNA with a first nucleotide probe, under conditions enabling in situ hybridization of said first nucleotide probe with a target region in the DNA genome, wherein said target region comprises a nucleic acid sequence which has no identified corresponding annealing RNA in a metabolically active cell and therefore remains RNA-free during transcription and replication of said DNA genome and detecting said first nucleotide probe hybridized to said DNA. Further detection of at least one RNA molecule can be achieved. The invention also relates to a nucleic acid molecule suitable for use as a probe, hybridizing with a target region in a eukaryotic genomic DNA, and comprising a nucleic acid sequence which has no identified corresponding annealing RNA in the metabolically active cell containing said eukaryotic genomic DNA and therefore remains RNA-free during transcription and replication of said DNA genome. The invention also encompasses kit(s) for carrying out in situ hybridization and use of the method(s), nucleic acid molecule(s) or kit(s) of the invention in the detection of mitochondrial disease(s), neoplasic diseases(s) or cancer(s), or in the testing of the cytotoxicity of organic or chemical compounds, especially drugs, on eukaryotic cells. | 03-27-2014 |
20140087379 | Electrochemical Polynucleotide Detection Comprising Ligation - Disclosed, for example, are methods comprising cleaving an uncleaved probe to form a cleaved oligonucleotide flap, forming a hybridization complex between the cleaved oligo-nucleotide flap, a bridging oligonucleotide, and a capture oligonucleotide that is immobilized on a surface, such that the oligonucleotide flap and the capture oligonucleotide are hybridized to immediately adjacent, complementary regions of the bridging oligonucleotide, ligating the oligonucleotide flap to the capture oligonucleotide to form an immobilized ligation product, and detecting the ligation product. | 03-27-2014 |
20140087380 | Mutation Detection Probe, Mutation Detection Method, Method of Evaluating Drug Efficacy, and Mutation Detection Kit - The present invention provides a probe for detecting a mutation in the ALK gene, which is at least one fluorescently labeled oligonucleotide selected from the group consisting of P1 to P4, P7 and P8 oligonucleotides; an application thereof; and an oligonucleotide for the application. | 03-27-2014 |
20140087381 | DOUBLE STRANDED LINEAR NUCLEIC ACID PROBE - A double-stranded nucleic acid hybridization probe and methods of using the same are described. The probe described is particularly suited for real-time RT-PCR reactions and has high tolerance to mismatches. | 03-27-2014 |
20140087382 | NORMALIZATION OF POLYMERASE ACTIVITY - Provided herein is technology relating to the amplification-based detection of nucleic acids and particularly, but not exclusively, to methods and compositions for minimizing variability in the activity between different samples or manufacturing lots of DNA polymerases, such as Taq DNA polymerase. | 03-27-2014 |
20140087383 | NUCLEIC ACID PROBES AND METHODS FOR DETECTING PLASMODIUM PARASITES - This invention relates to novel nucleic acid probes and methods for detecting | 03-27-2014 |
20140087384 | DISTINGUISHING PCA3 MESSENGER RNA SPECIES IN BENIGN AND MALIGNANT PROSTATE TISSUES - This invention concerns the discovery of two distinct PCA3 mRNA sequences. One of these sequences corresponds to a short PCA3 mRNA molecule whereas the other PCA3 RNA molecule is longer as it comprises an additional sequence between exon 3 and exon 4a. The short RNA is associated with prostate cancer whereas the long RNA sequence is associated with a non-malignant state of the prostate. Based on the differential expression levels of these two PCA3 RNA sequences, protocols for the diagnosis of prostate disease are provided. The invention also relates to therapeutic approaches to prostate cancer. | 03-27-2014 |
20140087385 | SYSTEM AND METHOD FOR CLEANING NOISY GENETIC DATA FROM TARGET INDIVIDUALS USING GENETIC DATA FROM GENETICALLY RELATED INDIVIDUALS - A system and method for determining the genetic data for one or a small set of cells, or from fragmentary DNA, where a limited quantity of genetic data is available, are disclosed. Genetic data for the target individual is acquired and amplified using known methods, and poorly measured base pairs, missing alleles and missing regions are reconstructed using expected similarities between the target genome and the genome of genetically related subjects. In accordance with one embodiment of the invention incomplete genetic data is acquired from embryonic cells, fetal cells, or cell-free fetal DNA isolated from the mother's blood, and the incomplete genetic data is reconstructed using the more complete genetic data from a larger sample diploid cells from one or both parents, with or without genetic data from haploid cells from one or both parents, and/or genetic data taken from other related individuals. | 03-27-2014 |
20140093871 | Method for detecting mitochondria alterations - The present invention relates to a method for detecting mitochondria alterations, which comprises the following steps: (A) providing a separation element and a sample; (B) mixing the separation element and the sample, wherein a detecting sample is obtained through the binding of a DNA fragment on the separation element to mitochondrial DNA in the sample; (C) dividing the detecting sample into a comparison group and a detection group; (D) adding an amplification solution into the comparison group and the detection group respectively to begin a DNA amplified reaction, and further adding a restriction enzyme into the detection group, wherein the amplification solution comprises a labeling reagent and a primer pair; and (E) detecting amounts of the labeling reagent in the comparison group and the detection group respectively after the DNA amplified reaction. | 04-03-2014 |
20140093872 | Method of Mutation Detection in Blood Cell-Free DNA Using Primer Extension (PE) and PCR - A method of detecting mutation in blood cell-free DNA, includes providing a serum sample, isolating DNA from the serum sample, amplifying the DNA by polymerase chain reaction (PCR), subjecting the PCR product to primer extension (PE), and separating the PE reaction product and identifying the mutation by gel electrophoresis. In order to improve accuracy and sensitivity, the PE reaction can be carried out by using a primer that blocks the extension of the wild or non-mutated sequence. | 04-03-2014 |
20140093873 | PROCESSES AND COMPOSITIONS FOR METHYLATION-BASED ENRICHMENT OF FETAL NUCLEIC ACID FROM A MATERNAL SAMPLE USEFUL FOR NON-INVASIVE PRENATAL DIAGNOSES - Provided are compositions and processes that utilize genomic regions that are differentially methylated between a mother and her fetus to separate, isolate or enrich fetal nucleic acid from a maternal sample. The compositions and processes described herein are particularly useful for non-invasive prenatal diagnostics, including the detection of chromosomal aneuploidies. | 04-03-2014 |
20140093874 | METHOD FOR DETECTING NUCLEIC ACID MOLECULE IN BIOSAMPLE - A method for detecting a nucleic acid molecule comprises: preparing a sample solution which contains a nucleic acid probe which is specifically hybridizable with the nucleic acid molecule to be analyzed, and a biosample; associating the nucleic acid molecule with the nucleic acid probe in the sample solution that has been prepared in the preparing; and after the associating, calculating, by the scanning molecule counting method, the number of molecules of the associated bodies including the nucleic acid probe in the sample solution that has been prepared in the preparing. This method for detecting a nucleic acid molecule further comprises: removing proteins from the sample solution before the calculating, or removing proteins from the biosample before the preparing. | 04-03-2014 |
20140093875 | MAMMALIAN CYTOKINES; RECEPTORS; RELATED REAGENTS AND METHODS - Nucleic acids encoding mammalian cytokine receptor, e.g., for cytokine IL-B50, purified proteins and fragments thereof. Antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are described. | 04-03-2014 |
20140093876 | MULTIPLEX NUCLEIC ACID DETECTION METHODS AND SYSTEMS - The present invention relates to methods and systems for single molecule based nucleic acid amplification and subsequent detection of nucleic acid molecules, and particularly to the determination of SNPs, mutations, and to the diagnosis of diseases associated with the changes of these nucleic acid molecules. | 04-03-2014 |
20140099633 | DETECTION OF miRNA USING CAPILLARY ELECTROPHORESIS WITH LASER-INDUCED FLUORESCENCE DETECTION - Disclosed is a method for detecting a miRNA present in a sample in trace amounts and a kit for detecting the same. According to the present invention, the miRNA present in the sample in trace amounts can be quantitatively analyzed in short time. The detection method of the present invention may be used for fast diagnosis of various diseases wherein miRNAs are involved, for example, cardiovascular diseases including myocardial infarction. | 04-10-2014 |
20140099634 | USE OF PRE-MRNA SPLICING IN PLATELET CELLS FOR THE DIAGNOSIS OF DISEASE - The invention relates to materials and procedures for identifying or using tissue factor (TF) pre-mRNA splicing, Clk 1 activity or TF-dependent coagulation in platelet cells for the diagnosis, prognosis, or prediction of a disease or disorder associated with disordered coagulation. Since activated platelets splice pre-mRNAs to generate inflammatory and thrombotic mediators that contribute to diseases such as sepsis and septic shock, (TF) pre-mRNA splicing in platelets is an indicator of inflammatory and thrombotic disease states. TF pre-mRNA splicing in platelets is correlated with sepsis, increased age (≧65), APACHE II score, and bacteremia. Thus, TF snRNA expression patterns in platelets may be used for the diagnosis, prognosis, or prediction of a disease or disorder associated with disordered coagulation, for example, patients that are at a higher risk for severe sepsis, organ failure, and death. | 04-10-2014 |
20140099635 | DETECTION UNITS AND METHODS FOR DETECTING A TARGET ANALYTE - The present application relates to detection units and methods for detecting one or more target analytes in a sample. In certain embodiments, the detection unit provides a first and second surface connected by a filament which is capable of binding the target analyte in the sample. In other embodiments, the detection unit provides a circular molecule capable of binding the target analyte and accumulating torsional stress in the presence of a twisting agent. The methods provide for the detection of the target analyte through the generation of a detectable signal following the binding of the target analyte to the filament. | 04-10-2014 |
20140099636 | FIELD-BASED qPCR MICROBIAL MONITORING - DNA/RNA monitoring of microbes at an oil field to determine the presence and activity of harmful microbes is accomplished with a portable qPCR (quantitative polymerase chain reaction) machine. This permits the monitoring to occur on-site in the field and reduces the variability that may occur from the transportation of samples. | 04-10-2014 |
20140099637 | DETECTION OF TARGET NUCLEIC ACIDS IN A CELLULAR SAMPLE - Methods of assaying cells of a cellular sample for the presence of a target nucleic acid are provided. Aspects of the methods include evaluating a cellular sample that has been contacted with a nuclease inhibitor for the presence of a target nucleic acid. Also provided are devices and kits that find use in practicing the methods described herein. | 04-10-2014 |
20140099638 | BRASSICA GAT EVENT AND COMPOSITIONS AND METHODS FOR THE IDENTIFICATION AND/OR DETECTION THEREOF - Compositions and methods related to transgenic glyphosate tolerant | 04-10-2014 |
20140099639 | PANEL FOR THE DETECTION AND DIFFERENTIATION OF RENAL CORTICAL NEOPLASMS - The present invention provides a novel, highly sensitive and specific probe panel which detects the type of renal cortical neoplasm present in a biopsy sample. As such, the invention permits diagnosis of the predominant subtypes of renal cortical neoplasms without the use of invasive methods. The present invention further provides a molecular cytogenetic method for detecting and analyzing the type of renal cortical neoplasm present in a renal biopsy sample. | 04-10-2014 |
20140099640 | DETECTING FETAL CHROMOSOMAL ABNORMALITIES USING TANDEM SINGLE NUCLEOTIDE POLYMORPHISMS - The invention provides tandem single nucleotide polymorphisms and methods for their use, for example, in diagnosing Down Syndrome. | 04-10-2014 |
20140106346 | MULTIPLEXED VOLUMETRIC BAR CHART CHIP FOR POINT OF CARE BIOMARKER AND ANALYTE QUANTITATION - Apparatus for determining the quantity of a target protein, biomarker or analyte present in a sample, comprising a top plate and a bottom plate, each comprising a plurality of recesses arranged to form a plurality of rows extending parallel to one another, and a plurality of channels extending perpendicularly to the plurality of rows of the bottom plate; wherein the top plate and the bottom plate are assembled together so that the top plate is on top of the bottom plate and the recesses of the top plate communicate with the recesses of the bottom plate so as to form a plurality of rows; and wherein at least one of the top and bottom plate is configured to slide relative to the other of the top and bottom plate in order to form a plurality of columns, with each of the columns in communication with each of the channels. | 04-17-2014 |
20140106347 | BINDING INTERACTIONS IN DIPSTICK ASSAYS - Use of dipsticks to test for the presence of target nucleic acid in a sample solution is described. The dipsticks comprise a contact end for contacting the sample solution and a capture zone, remote from the contact end, to which a capture probe is immobilised. The capture probe is capable of hybridising to the target nucleic acid. The sample solution is contacted with the contact end of the dipstick and travels by capillary action to the capture zone. If target nucleic acid is present in the sample solution it is captured and can be detected at the capture zone. The capture probe is immobilised to the capture zone by a spacer. Use of the spacer increases the stability of the interaction between the capture probe and the target nucleic acid and thus improves the sensitivity of target nucleic acid detection. Detection probes with spacers are also described. | 04-17-2014 |
20140106348 | CULTURE MEDIUM COMPOSITION AND METHOD OF CULTURING CELL OR TISSUE USING THEREOF - The present invention provides a culture method of cells and/or tissues including culturing cells and/or tissues in a suspended state by using a medium composition wherein indeterminate structures are formed in a liquid medium, the structures are uniformly dispersed in the solution and substantially retain the cells and/or tissues without substantially increasing the viscosity of the solution, thus affording an effect of preventing sedimentation thereof, and the like. | 04-17-2014 |
20140106349 | Dyes and Labeled Molecules - Dimeric and trimeric nucleic acid dyes, and associated systems and methods are provided. Such a dye may form a hairpin-like structure that enables it to stain nucleic acids via a release-on-demand mechanism, for example. Such a dye may have low background fluorescence in the absence of nucleic acids and high fluorescence in the presence of nucleic acids, upon binding therewith, for example. A dye provided herein may be useful in a variety of applications, such as in DNA quantitation in real-time PCR, for example. | 04-17-2014 |
20140106350 | COMPOSITIONS, METHODS AND RELATED USES FOR CLEAVING MODIFIED DNA - Compositions, methods and related uses are provided relating to cleaving modified DNA. For example, a set of DNA fragments obtainable by enzymatic cleavage of a large DNA is described where at least 50% are similarly sized and have a centrally positioned modified nucleotide. In addition, an enzyme preparation is provided that includes one or more enzymes that recognize a modified nucleotide in a DNA and cleave the DNA at a site that is at a non-random distance from the modified nucleotide. The one or more enzymes are further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology to WXD(X) | 04-17-2014 |
20140106351 | METHODS AND SYSTEMS FOR IDENTIFYING MICRO-RNA TARGETS AND SYNTHESIZING NOVEL MICRO-RNAS AND USES OF THE SAME - Method of identifying a microRNA-recognition element and of generating microRNAs are disclosed. System and computer programs for performing such methods are disclosed. Recombinant nucleic acid molecule comprising a heterologous coding sequences and one or more MREs are also disclosed as are isolated nucleic acid molecule comprising one or more MRE sequences and being free of a coding sequence operably linked to regulatory elements. MicroRNA generated by a methods of the invention and the use of the microRNAs to downregulate gene expression are disclosed. | 04-17-2014 |
20140106353 | Methods And Kits For Multiplex Amplification Of Short Tandem Repeat Loci - Methods and materials are disclosed for use in simultaneously amplifying at least 11 specific STR loci of genomic DNA in a single multiplex reaction, as are methods and materials for use in the analysis of the products of such reactions. Included in the present invention are materials and methods for the simultaneous amplification of 16 specific loci in a single multiplex reaction, comprising the 10 AmpFlSTR® SGMplus® STR loci, the Amelogenin locus, and 5 new STR loci, including methods and materials for the analysis of these loci. | 04-17-2014 |
20140106354 | Method of Diagnosing Cancer - The present invention provides methods for diagnosing cancer (such as ovarian, breast, or colon cancer) or a predisposition thereto in a subject, for monitoring the efficacy of treatment of a subject suffering from cancer, or for determining the likelihood of survival of a subject suffering from cancer, comprising detecting modified chromatin (such as DNA methylation) within a locus of the LOC134466 gene in a sample taken from the subject. The invention further provides kits for use in these methods, and methods of treating subjects based on a diagnosis performed using the methods of the invention. | 04-17-2014 |
20140106355 | ARRANGEMENT AND PROCESS FOR OPTICAL ANALYSIS AND SPECIFIC ISOLATION OF BIOLOGICAL SAMPLES - A process is disclosed for detecting cells in a liquid sample, which includes: i) filtration of the liquid sample through a porous membrane which is suitable for retaining detectable cells, where at least one subregion of a support is configured as transparent supporting body and the membrane is arranged over its area on the transparent supporting body in such a way that detectable cells are retained on at least part of the surface of the membrane and that at least part of the sample liquid passes through the membrane, ii) application of a liquid optical medium which has essentially the same refractive index as the supporting body, and iii) optical measurement of at least a subarea of the membrane in order to detect detectable cells. | 04-17-2014 |
20140113284 | DIFFERENTIAL DETECTION AND QUANTIFICATION OF OXALOBACTER - Disclosed herein are PNA probes, or PNA probe sets and their use as well as kits useful for the analysis of certain | 04-24-2014 |
20140113285 | MUTATION WITHIN THE CONNEXIN 26 GENE RESPONSIBLE FOR PRELINGUAL NON-SYNDROMIC DEAFNESS AND METHOD OF DETECTION - A purified polynucleotide having a chain of nucleotides corresponding to a mutated sequence, which in a wild form encodes a polypeptide implicated in hereditary sensory defect, wherein said mutated purified polynucleotide presents a mutation responsible for prelingual non-syndromic deafness selected from the group consisting of a specific deletion of at least one nucleotide. | 04-24-2014 |
20140113286 | Epigenomic Markers of Cancer Metastasis - Methods and kits for assessing risk of metastasis in a cancer patient identified as having breast cancer, colon cancer or glioma use analysis of a classifier for CpG island methylator phenotype. | 04-24-2014 |
20140113287 | BASE SEQUENCE ANALYSIS METHOD, BASE SEQUENCE ANALYSIS APPARATUS, AND BASE SEQUENCE ANALYSIS PROGRAM - There is provided a base sequence analysis method including a nucleic acid amplification procedure of obtaining an amplification product by a nucleic acid amplification reaction, a turbidity measurement procedure of measuring turbidity of a reaction solution of the nucleic acid amplification reaction, and a melting curve analysis procedure of performing melting curve analysis of a probe nucleic acid chain and the amplification product at a reaction site of the nucleic acid amplification reaction. | 04-24-2014 |
20140113288 | METHODS OF IDENTIFYING RISK OF PREECLAMPSIA AND PREGNANCY-RELATED DISORDERS - Provided herein are methods of diagnosing a pregnancy disorder (e.g., preeclampsia or related pregnancy disorders) in a subject based on the level of High Temperature Requirement A4 (HtrA4). Also provided herein are diagnostic agents and devices for use in such diagnostic methods. | 04-24-2014 |
20140113289 | COMPOSITIONS AND METHODS TO DETECT LEGIONELLA PNEUMOPHILA NUCLEIC ACID - Compositions are disclosed as nucleic acid sequences that may be used as amplification oligomers, including primers, and detection probes that hybridize specifically to | 04-24-2014 |
20140113290 | ABERRANT METHYLATION OF C6ORF150 DNA SEQUENCES IN HUMAN COLORECTAL CANCER - This application describes methods and compositions for detecting and treating C6Orf150-associated neoplasia. Differential methylation of the C6Orf150 nucleotide sequences has been observed in C6Orf150-associated neoplasia such as colon neoplasia. | 04-24-2014 |
20140113291 | Salt-tolerant DNA polymerases - Four novel sequences of type B DNA polymerases and variants and analogues thereof useful for applications involving DNA polymerization in high salt conditions. | 04-24-2014 |
20140113292 | DETECTING NUCLEIC ACID - This document provides methods and materials for detecting target nucleic acid. For example, methods and materials for detecting the presence or absence of target nucleic acid, methods and materials for detecting the amount of target nucleic acid present within a sample, kits for detecting the presence or absence of target nucleic acid, kits for detecting the amount of target nucleic acid present within a sample, and methods for making such kits are provided. | 04-24-2014 |
20140113293 | METHOD FOR THE DETECTION OF EGFR MUTATIONS IN BLOOD SAMPLES - The present invention refers to the detection of EGFR mutations in a blood (serum/plasma) sample from a subject. The method comprises:
| 04-24-2014 |
20140120532 | METHOD OF SEQUENTIAL AND MULTIPLE IMMUNOSTAINING FOR DETECTION OF VARIOUS ANTIGENS IN THE SAME SPECIMENS - Provided herein is a method of sequential and multiple immunostaining for detection of various antigens in the same specimens, which may be used for qualitative or quantitative analysis of proteins expressed, gene analysis, and morphological analysis even in specimens where only a small amount is available. | 05-01-2014 |
20140120533 | GENETIC POLYMORPHISMS ASSOCIATED WITH CARDIOVASCULAR DISEASES, METHODS OF DETECTION AND USES THEREOF - The present invention provides compositions and methods based on genetic polymorphisms that are associated with cardiovascular diseases, particularly coronary heart disease (especially myocardial infarction) or hypertension. For example, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by these nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and variant proteins, and methods of using the nucleic acid molecules and proteins as well as methods of using reagents for their detection. | 05-01-2014 |
20140120534 | METHODS FOR IDENTIFYING NUCLEIC ACID SEQUENCES - Embodiments relate to the detection of RNA in a sample of cells. More particularly, methods concern the localized detection of RNA in situ. The method relies on the conversion of RNA to complementary DNA prior to the targeting of the cDNA with a padlock probe(s). The hybridization of the padlock probe(s) relies on the nucleotide sequence of the cDNA which is derived from the corresponding nucleotide sequence of the target RNA. Rolling circle amplification of the subsequently circularized padlock probe produces a rolling circle product which may be detected. Advantageously, this allows the RNA to be detected in situ. In additional methods, rolling circle amplification products are sequenced. | 05-01-2014 |
20140120535 | METHODS AND KITS FOR PERFORMING IN SITU HYBRIDIZATION - The invention relates to methods and kits for performing in situ hybridization on a biological sample on a solid surface using nucleic acid probes that are embedded in or sorbed to a dry, fibrous matrix. | 05-01-2014 |
20140120536 | POLYNUCLEOTIDES FOR THE AMPLIFICATION AND DETECTION OF CHLAMYDIA TRACHOMATIS AND NEISSERIA GONORRHOEAE - Polynucleotides useful for detecting | 05-01-2014 |
20140120537 | Collection and Concentration System for Biologic Substance of Interest and Use Thereof - A system and method thereof for collecting and concentrating a biologic substance of interest is provided. The biologic of interest obtained from a biologic sample present at an initial low concentration (or low number counts) can be captured and released through a collection device of the system to an intermediate second concentration, and further recovered through a concentration device of the system to a third concentration, thereby facilitating subsequent detection, characterization, enumeration, immunostaining, inspection, imaging, culturing, molecular analysis, and/or other assays. | 05-01-2014 |
20140120538 | COELENTERAZINE ANALOGUES AND COELENTERAMIDE ANALOGUES - Coelenterazine analogues with different luminescence properties from conventional ones and coelenteramide analogues with different fluorescence properties from conventional ones have been desired. The invention provides coelenterazine analogues modified at the 8-position of coelenterazine and coelenteramide analogues modified at the 2- or 3-position of coelenteramide. | 05-01-2014 |
20140120539 | Systems and Methods for Bead-Free Detection of Nucleotides - Methods and systems of quantifying a target material in solution include detection of a size change of a hybridized nucleic acid complex, without the use of nanobeads. In particular, the examples include providing a plurality of nucleic acid fragments and a species-specific oligonucleotide tags, measuring the size of the nucleic acid fragments and/or oligonucleotides to predetermine a standard distribution of the solution(s), introducing the oligonucleotides in a solution containing nucleic acid target materials and/or non-target materials, and hybridizing the oligonucleotides with the species-specific target material if present in the solution. The size of the nucleic acid complexes in solution are then measured after hybridization, and the presence or non-presence of the species-specific target material is detected and/or quantified by comparing the measured size of the nucleic acid complexes after hybridization to the standard distribution. | 05-01-2014 |
20140120540 | METHODS OF DETECTING GENE FUSIONS - Disclosed herein are methods of detecting presence of a gene fusion in a sample from a subject. In some embodiments, the methods of detecting presence of a fusion gene in a sample from a subject utilize a fusion probe that spans the point of fusion between two nucleic acids or genes, and detecting the fusion probe after nuclease treatment. In other embodiments, the methods of detecting presence of a fusion gene in a sample from a subject utilize two or more probes that flank the point of fusion between two nucleic acids or genes, and detecting these probes after nuclease treatment. In additional embodiments, the methods can include determining the percentage of gene fusion in the sample relative to the first nucleic acid or the second nucleic acid. | 05-01-2014 |
20140127683 | Compositions and Methods for Oxygenation of Nucleic Acids Containing 5-Methylpyrimidine - 5-methylpyrimidine oxygenases and their use in the modification of nucleic acids are described. | 05-08-2014 |
20140127684 | HIGHLY CONSERVED GENES AND THEIR USE TO GENERATE PROBES AND PRIMERS FOR DETECTION OF MICROORGANISMS - Provided herein are compositions and methods for the detection of | 05-08-2014 |
20140127685 | COMPOSITIONS AND METHODS FOR DIAGNOSING AUTISM - The invention provides methods featuring the use of polymorphisms in the JARID2 gene to diagnosis autism. | 05-08-2014 |
20140127686 | METHODS OF IDENTIFYING AN ORGANISM - This disclosure features methods of identifying an organism. In certain embodiments, the invention provides methods of distinguishing virulent and non-virulent strains of | 05-08-2014 |
20140127687 | Method for Separation, Determination or Enrichment of Different DNA Species - The present invention relates to a method for separating, determining or accumulating different DNA species that are present simultaneously in a sample, on the basis of unmethylated CpG-dinucleotides occurring with different frequency, within each DNA species present, wherein an unmethylated CpG motifs binding protein is immobilized on a base material and the DNA bound to the immobilized protein is eluted using an elution agent gradient, wherein specific concentration regions of the elution agent used correlate with specific CpG-dinucleotide frequencies in the DNA species present, so that during elution different fractions of DNA species are obtained that have different frequencies of CpG-dinucleotides. | 05-08-2014 |
20140127688 | METHODS AND SYSTEMS FOR IDENTIFYING CONTAMINATION IN SAMPLES - Methods and systems for determining if a sample has been contaminated with other genetic material, for example, from another sample in a parallel workflow. The methods and systems compare measured allele fractions to predetermined distributions of allele fractions in order to calculate a likelihood that the sample has been contaminated. | 05-08-2014 |
20140127689 | CXCR1 AS A PREDICTOR OF RESPONSE TO TREATMENT WITH EPIDERMAL GROWTH FACTOR RECEPTOR THERAPEUTIC - There is provided a molecular marker CXCR1 for predicting response and survival in subjects afflicted with cancer who would benefit from treatment with and Epidermal Growth Factor Receptor (EGFR) targeted therapeutic. | 05-08-2014 |
20140127690 | Mutation Signatures for Predicting the Survivability of Myelodysplastic Syndrome Subjects - Somatic non-silent mutations on selected biomarkers are reliable indicators for the overall survival of Myelodysplastic Syndrome subjects. | 05-08-2014 |
20140127691 | METHOD FOR DIAGNOSING TYPE OF PANCREATIC TUMOR - This invention is intended to provide a method capable of diagnosis of pancreatic tumor type at an early stage. More specifically, this invention relates to an examination method for determining pancreatic tumor type comprising detecting the degree of methylation in a 5′-untranslated region or a region comprising a 5′-untranslated region and a translated region of a gene encoding a mucin core protein in a pancreatic fluid sample from a subject, and identifying the pancreatic tumor as being of pancreatic tumor type selected from the group consisting of pancreatic ductal adenocarcinoma, an intraductal papillary mucinous neoplasm of the gastric type, an intraductal papillary mucinous neoplasm of the intestinal type, and an intraductal papillary mucinous neoplasm of the pancreatobiliary type using the degree of methylation as an index value. | 05-08-2014 |
20140127692 | Sample Preparation for in Situ Nucleic Acid Analysis, Methods and Compositions Therefor - Sample preparation processes for in situ RNA or DNA analysis, methods and compositions therefor are provided. Processes provided herein allow DNA or RNA analysis to be carried out in the same tube or on an aliquot of the prepared sample without centrifugation or extraction. The preparation process can be carried out at room temperature in as little as seven minutes and is amenable to high throughput processing using manual or robotic platforms. | 05-08-2014 |
20140127693 | Fertilization Prediction and Promotion - The outcome of an in vitro fertilization (IVF) of a woman in terms of chances of successful pregnancy or the fertility status of a woman is predicted based on nucleotide analysis of the histidine-rich glycoprotein (HRG) gene or protein analysis of HRG. The proline isoform of HRG or an amino acid fragment thereof can further be used to increases the success of pregnancy of a woman. | 05-08-2014 |
20140134611 | DUAL PROBE ASSAY FOR THE DETECTION OF HETEROGENEOUS AMPLICON POPULATIONS - The present invention relates to a method for amplifying and detecting a target nucleic acid in a sample, said target nucleic comprising subgroups with sequence variations and/or individual mutations, wherein an amplification of the nucleic acids in said sample is carried out. This amplification involves a polymerase, primers for generating an amplicon and at least two detectable probes specific for different sequence portions of said amplicon. Detection of the obtained amplicon is brought about by detecting hybridization of the probes mentioned above to said different sequence portions of the amplicon.
| 05-15-2014 |
20140134612 | LIGHT COLLECTION SYSTEM - The present teachings provide a detection cell for a biological material and methods for detecting biological material including a photosensitive material optically coupled to an interior volume containing the biological material so to avoid optical components or an external light source. | 05-15-2014 |
20140134613 | Direct Molecular Diagnosis of Fetal Aneuploidy - Methods and materials for detection of aneuploidy and other chromosomal abnormalities using fetal tissue are disclosed. Results can be obtained rapidly, without cell culture. The method uses digital PCR for amplification and detection of single target sequences, allowing an accurate count of a specific chromosome or chromosomal region. Specific polynucleic acid primers and probes are disclosed for chromosomes 1, 13, 18, 21, X and Y. These polynucleic acid sequences are chosen to be essentially invariant between individuals, so the test is not dependent on sequence differences between fetus and mother. | 05-15-2014 |
20140134614 | Novel Compositions, Methods and Kits for Enhancing PCR Specificity - The present disclosure provides novel primers and method for the detection of specific nucleic acid sequences. The primers and methods provided herein are useful in a wide variety of molecular biology applications and are particularly useful in allele-specific PCR. | 05-15-2014 |
20140134615 | DDAO Compounds as Fluorescent Reference Standards - According to the present teachings, methods and compositions are provided that utilize at least one reference dye of formula (I); | 05-15-2014 |
20140134616 | NUCLEIC ACID SEQUENCING USING TAGS - This disclosure provides chips, systems and methods for sequencing a nucleic acid sample. Tagged nucleotides are provided into a reaction chamber comprising a nanopore in a membrane. An individual tagged nucleotide of the tagged nucleotides can contain a tag coupled to a nucleotide, which tag is detectable with the aid of the nanopore. Next, an individual tagged nucleotide of the tagged nucleotides can be incorporated into a growing strand complementary to a single stranded nucleic acid molecule derived from the nucleic acid sample. With the aid of the nanopore, a tag associated with the individual tagged nucleotide can be detected upon incorporation of the individual tagged nucleotide. The tag can be detected with the aid of the nanopore when the tag is released from the nucleotide. | 05-15-2014 |
20140134617 | PROCESS CONTROLS FOR MOLECULAR ASSAY - A full process control for use with a molecular assay and a method of determine the efficacy of the molecular assay. A full process control can include a fixed cell, and specifically can include a fixed vegetative cell. A method of determining the efficacy of a molecular assay can include providing an internal control, mixing the internal control with a sample, lysing the internal control and the sample, and detecting the lysis product. The full process control and/or the internal control can be | 05-15-2014 |
20140134618 | CONCENTRATING A TARGET MOLECULE FOR SENSING BY A NANOPORE - Methods and related products are disclosed that improve the probability of interaction between a target molecule and a nanopore by capturing the target molecule on a surface comprising the nanopore. The captured target molecule, the nanopore, or both, are able to move relative to each other along the surface. When the leader of the target molecule is in proximity with the nanopore, interaction of the target portion of the target molecule with the nanopore occurs, thereby permitting sensing of the target portion. Confining the target molecule and nanopore in this manner leads to significantly enhanced interaction with the nanopore. | 05-15-2014 |
20140134619 | SYSTEMS AND METHODS FOR POINT-OF-CARE AMPLIFICATION AND DETECTION OF POLYNUCLEOTIDES - Composition and methods for amplifying and detecting solution-state polynucleotide targets in a single device are described. In one aspect, a method for a coupled isothermal amplification and detection process utilizes a coated solid support, including a solid substrate, a cationic layer, and a plurality of target-specific probes attached to the coated solid support. Polynucleotide targets in the sample are amplified by an isothermal amplification process involving in situ hybridization onto the coated solid support. The entire process can be carried out with a high degree of specificity under low salt conditions in less than one hour. Further aspects of the present invention include methods for coupled hybridization/detection of polynucleotide targets, coated silicon biosensors optimized for use with the coupled detection systems to provide visual detection of polynucleotide targets under visible light conditions, and kits for practicing in the above described methods. | 05-15-2014 |
20140134620 | OPTICAL MEASUREMENT DEVICE FOR REACTION VESSEL AND METHOD THEREFOR - The invention relates to an optical measurement device for a reaction vessel, and a method therefor. An object is to measure the optical state within a reaction vessel in an efficient, rapid, and highly reliable manner, without an expansion of the device scale. The configuration includes: a vessel group in which two or more reaction vessels are arranged; a light guide stage having two or more linking portions to which front ends of light guide portions, which have a flexibility, that optically connect with the interior of the linked reaction vessels, are provided; a connecting end arranging body that has an arranging surface that arranges and supports along a predetermined path two or more connecting ends, to which back ends of the light guide portions, in which the front ends thereof are provided to the linking portions, are provided, the connecting ends are provided corresponding to the respective linking portions; a measurement device provided approaching or making contact with the arranging surface that has measuring ends that are successively optically connectable with the respective connecting ends along the predetermined path, and in which light from within the reaction vessels is receivable by means of optical connections between the connecting ends and the measuring ends; and a light guide switching mechanism that relatively moves the respective connecting ends arranged on the connecting end arranging body and the respective measuring ends such that they are successively optically connected. | 05-15-2014 |
20140134621 | COMPOSITIONS, METHODS, AND SYSTEMS FOR INFERRING BOVINE BREED - Provided herein are methods to discover and use single nucleotide polymorphisms (SNP) for identifying breed, or line and breed, or line composition of a bovine subject. The present invention further provides specific nucleic acid sequences, SNPs, and SNP patterns that can be used for identifying breed or breed combinations for Angus, Holstein, Limousin, Brahman, Hereford, Simmental, Gelbvieh, Charolais and Beefmaster breeds. These patterns can be utilized to manage animals in a feedlot to obtain optimum performance based on known characteristics of specific breeds and identify animals for breeding in selection programs. In another aspect, these patterns can be used to ensure labeling on breed specific branded products. | 05-15-2014 |
20140134622 | METHODS FOR MAKING PLANTS RESISTANT TO FUNGAL PATHOGENS - This invention relates to polynucleotide sequences encoding genes that can confer resistance to the plant pathogen | 05-15-2014 |
20140141417 | METHODS FOR QUANTIFYING NUCLEIC ACID VARIATIONS - Provided herein is technology relating to evaluating the state of nucleic acids and particularly, but not exclusively, to methods for measuring variations between DNAs, including differences in methylation and mutation. | 05-22-2014 |
20140141418 | POLYNUCLEOTIDE AND USE THEREOF - Provided is a dual-hybridization polynucleotide including a first complementary region that is complementary to the 3′-terminus of a target nucleic and a second complementary region that is complementary to the 5′-terminus of the target nucleic acid, a composition and kit including the polynucleotide, and a method of producing a nucleotide sequence complementary to the target nucleic acid. The first complementary region to be bound at the 3′-terminus of the target nucleic acid can be shortened and the target nucleic acid may be amplified with excellent specificity and/or sensitivity. | 05-22-2014 |
20140141419 | SINGLE TUBE QUANTITATIVE POLYMERASE CHAIN REACTION (PCR) - Provided herein are systems and methods for quantitatively monitoring target amplicons produced by polymerase chain reaction (PCR). In particular, quantitative monitoring of target amplicon(s) in a single-tube PCR reaction without separate calibration reactions are provided. | 05-22-2014 |
20140141421 | PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD - A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof. | 05-22-2014 |
20140141422 | Fast PCR for STR Genotyping - Disclosed is a method of amplifying a nucleic acid sequence, wherein the method comprises subjecting a reaction mixture to at least one amplification cycle, wherein the reaction mixture comprises a double-stranded nucleic acid and at least two primers capable of annealing to complementary strands of the double-stranded nucleic acid and amplifying at least one short tandem repeat (STR) using a Family A DNA polymerase in a Fast PCR protocol having a two-step amplification cycle in 25 seconds or less. Also disclosed are real-time PCR methods using the two-step protocol and kits for STR profiling using the Fast PCR protocol. | 05-22-2014 |
20140141423 | miRNAs Differentially Expressed in Lymph Nodes from Cancer Patients - The present invention provides diagnostics and/or prognostic methods by identifying miRNAs that are differentially expressed or mis-regulated in various states of diseased, normal, cancerous, and/or abnormal tissues, including but not limited to cervix, skin, colon, breast, bladder, esophagus, liver, ovary, prostate, lung, pancreas, thyroid, kidney, stomach, testicle, uterus, spleen, tongue, brain, thymus, trachea and/or small intestine. In certain aspects, differential miRNA expression is initially determined by comparing miRNA expression between a normal tissue and cancer negative lymph node (LNneg), a normal tissue and a cancer positive lymph node (LNpos), a cancerous tissue and LNneg and/or LNpos, LNneg and LNpos. The methods of the invention are used to identify the presence or absence of non-lymphoid cells from other organs or tissues, and/or metastatic cancer cells present in lymph nodes. | 05-22-2014 |
20140141424 | METHOD FOR SEPARATING AN ANALYTE FROM A SAMPLE - An analyte is separated from a fluid sample by introducing the sample into a cartridge having a sample port and a first flow path extending from the sample port. The first flow path includes an extraction chamber containing a solid support for capturing the analyte from the sample. The cartridge has a second flow path for eluting the captured analyte from the extraction chamber, the second flow diverging from the first flow path after passing through the extraction chamber. The sample is forced to flow through the extraction chamber and into a waste chamber, thereby capturing the analyte with the solid support as the sample flows through the extraction chamber. The captured analyte is then eluted from the extraction chamber by forcing an elution fluid to flow through the extraction chamber and along the second flow path. | 05-22-2014 |
20140141425 | POLYNUCLEOTIDE PRIMERS FOR DETECTING PIK3CA MUTATIONS - A polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 3 to 16, 18, 20 to 33, 35 or 37 to 39. A method of detecting the presence or absence of a mutation in the PIK3CA gene, wherein the mutation is one of H1047R, H1047L, E542K and E545K, and preferably ARMS primers are combined with Scorpion primers. | 05-22-2014 |
20140141426 | Sequencing formalin fixed paraffin embedded samples - Personalized medicine involves the use of a patient's molecular markers to guide treatment regimens for the patient. The scientific literature provides multiple examples of correlations between drug treatment efficacy and the presence or absence of molecular markers in a patient sample. Methods are provided herein that permit efficient dissemination of scientific findings regarding treatment efficacy and molecular markers found in patient tumors to health care providers. | 05-22-2014 |
20140141427 | BCR-ABL1 SPLICE VARIANTS AND USES THEREOF - The present invention is based on BCR-ABL1 splice variants which result from insertion and/or truncation of the bcr-abl1 transcript and the finding that these variants provide resistance to kinase domain inhibitors such as imatinib, nilotinib and dasatinib. | 05-22-2014 |
20140141428 | Methods and Compositions for Detection and Analysis of Polynucleotides Using Light Harvesting Multichromophores - Methods, compositions and articles of manufacture for assaying a sample for a target polynucleotide are provided. A sample suspected of containing the target polynucleotide is contacted with a polycationic multichromophore and a sensor polynucleotide complementary to the target polynucleotide. The sensor polynucleotide comprises a signaling chromophore to receive energy from the excited multichromophore and increase emission in the presence of the target polynucleotide. The methods can be used in multiplex form. Kits comprising reagents for performing such methods are also provided. | 05-22-2014 |
20140141429 | METHODS OF IDENTIFYING INDIVIDUALS AT RISK OF PERIOPERATIVE BLEEDING, RENAL DYSFUNCTION OR STROKE - The present invention relates, in general, to perioperative bleeding and, in particular, to methods of identifying individuals at risk of perioperative bleeding. | 05-22-2014 |
20140141430 | METHODS AND COMPOSITIONS TO SELECT COTTON PLANTS RESISTANT TO COTTON ROOT KNOT NEMATODE - The present invention is in the field of plant breeding and disease resistance. More specifically, the invention provides a method for breeding cotton plants containing one or more quantitative trait loci that are associated with resistance to Root Knot Nematode (RKN), a disease associated with | 05-22-2014 |
20140141431 | USE OF ERBB4 AS A PROGNOSTIC AND THERAPEUTIC MARKER FOR MELANOMA - Members of the protein tyrosine kinase (PTK) family are highly mutated in patients with melanoma. Described herein are novel somatic mutations in the ERBB4 gene that result in increased kinase activity, transformation ability and anchorage-independent growth. These ERBB4 mutations contribute to the tumorogenicity of melanoma. Provided is a method of predicting the prognosis of a patient with melanoma by detecting the presence or absence of a mutation in the ERBB4 gene. In some examples, the ERBB4 mutation is selected from G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbering based on SEQ ID NO: 1). Also provided are methods of selecting a patient as a candidate for treatment with an ERBB4 and/or PI3K/AKT pathway inhibitor, and a method of identifying a therapeutic agent for the treatment of a subject diagnosed with melanoma. Oligonucleotides that specifically hybridize with an ERBB4 nucleic acid molecule comprising a novel mutation are also provided. | 05-22-2014 |
20140141432 | METHOD AND KIT FOR DIAGNOSING GLAUCOMA IN DOGS - The present invention provides a canine glaucoma-susceptibility gene and a method of using the gene. | 05-22-2014 |
20140147838 | METHOD FOR MULTICOLOR CODETECTION OF MICRORNA AND PROTEINS - The present invention is directed to systems and methods of conducting a purchase transaction of eligible goods or services using a stored value associated with an indicia. Methods in accordance with the invention may include steps | 05-29-2014 |
20140147839 | MICROVESICLE-BASED ASSAYS - Methods are disclosed herein for assaying a biological sample or a bodily fluid obtained from a subject by isolating, obtaining or using a microvesicle fraction from the biological sample or bodily fluid and detecting in the microvesicle fraction the presence or absence of a genetic aberration in an IDH1, IDH2, TP53, PTEN, CDKN2A, NF1, EGFR, RB1, PIK3CA, or BRAF gene. The methods may be used for aiding the diagnosis, prognosis, monitoring, or therapy selection in relation to a disease or other medical condition (e.g., a glioma) in a subject. | 05-29-2014 |
20140147840 | METHOD OF LABELING A TARGET NUCLEIC ACID - Methods of labeling and detecting a target nucleic acid by incubating a target nucleic acid with a terminal transferase to extend a terminus of the target nucleic acid and provide an extended region; hybridizing the extended region of the target nucleic acid with a template polynucleotide having a nucleotide sequence complementary to the extended region to obtain a hybridization product; and incubating the hybridization product with a nucleic acid polymerase and either a deoxynucleotide triphosphate (dNTP) having a detectable label or nucleotide triphosphate (NTP) having a detectable label to further extend the extended target nucleic acid. | 05-29-2014 |
20140147841 | Method of Enzymatic Gene Chip Detection Kit - A gene chip is provided for detection. When used on clinical detection, the gene chip directly detects blood without magnification. Gene expressions are examined with high sensitivity and convenience simultaneously. | 05-29-2014 |
20140147842 | METHOD FOR DETECTING SINGLE NUCLEOTIDE POLYMORPHISMS - An object of the present invention is to provide a method for rapidly and simply detecting single nucleotide polymorphisms. The present invention is a method for detecting single nucleotide polymorphisms, comprising analyzing wild-type and mutant-type products amplified by an AS-PCR method using ion-exchange chromatography. | 05-29-2014 |
20140147843 | METHOD FOR QUANTIFYING HUMAN DNA USING AN INTERNAL CONTROL - The present invention relates to a method for quantifying and/or detecting one or more nucleic acids of a genome in a sample, wherein in an amplification reaction, (i) a first nucleic acid is amplified, the locus that is amplified is a multicopy locus (MCL) within the genome, wherein the locus shares at least 80% sequence identity to a sequence according to SEQ ID NO. 1 over a stretch of 80 base pairs, and wherein the multicopy locus has copies on at least two different chromosomes, (ii) a second nucleic acid that has been added as an internal control (IC) is also amplified, and (iii) the amount of amplification product from the amplification of the first nucleic acid is determined. | 05-29-2014 |
20140147844 | Nucleic Acids, Methods and Kits for the Diagnosis of DYT6 Primary Torsion Dystonia - This invention relates generally to the THAP1 gene and mutations in this gene, as well as the THAP1 protein and mutations in this protein, that are associated with dystonia. The invention relates to the identification, isolation, cloning and characterization of the DNA sequence corresponding to the wild type and mutant THAP1 genes, as well as isolation and characterization of their transcripts and gene products. The invention further relates to methods and kits useful for detecting mutations in THAP1 that are associated with dystonia, as well as to methods and kits useful for diagnosing dystonia. The present invention also relates to therapies for treating dystonia, including gene therapeutics and protein/antibody based therapeutics. | 05-29-2014 |
20140147845 | CONCATAMERIC LIGATION PRODUCTS: COMPOSITIONS METHODS AND KITS FOR SAME - The present teachings relate to methods, compositions, and kits for detecting one or more target polynucleotide sequences in a sample, and methods compositions and kits for forming concatameric ligation products. In some embodiments of the present teachings, oligonucleotides are hybridized to complementary target polynucleotides and are ligated together to form a concatameric ligation product. In some embodiments of the present teachings, the concatameric ligation product can be amplified, and the identity and quantity of the target polynucleotides determined based on sequence introduced in the ligation reaction. Some embodiments of the present teachings provide methods for removing unligated probes from the reaction mixture. Some embodiments of the present teachings provide for highly multiplexed detection, identification, and quantification of a plurality of target polynucleotides using a variety of analytical procedures. | 05-29-2014 |
20140147846 | DETECTION OF SEQUENCE VARIANTS IN THE HUMAN EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) GENE - Provided herein are methods for detecting and identifying sequence variants in the human epidermal growth factor receptor (EGFR) gene, and compositions and kits for performing such methods. In particular, nucleic acid amplification and fluorescence detection methods are provided for the detection and identification of EGFR sequence variants. | 05-29-2014 |
20140147847 | Methods for producing polypeptides in enzyme-deficient mutants of fusarium venentatum - The present invention relates to methods of producing a polypeptide, comprising: (a) cultivating a mutant of a parent | 05-29-2014 |
20140154678 | CLEARANCE BUFFER - The invention concerns a composition comprising TCEP, biotin and dextran suitable for liquefying a viscous biological sample. The composition according to the invention can be used in diagnostic methods, preferably for use in diagnosis of an infection with a micro-organism, more preferably for use in diagnosis of HCAP. | 06-05-2014 |
20140154679 | DETERMINATION OF COPY NUMBER DIFFERENCES BY AMPLIFICATION - The present invention provides for determining relative copy number difference for one or more target nucleic acid sequences between a test sample and a reference sample or reference value derived therefrom. The methods facilitate the detection of copy number differences less than 1.5-fold. | 06-05-2014 |
20140154680 | DIAGNOSTIC, PREDICTIVE AND PROGNOSTIC TESTING FOR CANCER - The present invention relates generally to the field of cancer. In particular, the present invention relates to cancer prognostic and treatment protocols. | 06-05-2014 |
20140154681 | Methods to Predict Breast Cancer Outcome - The present invention provides methods for predicting the outcome of a subject having breast cancer. The prediction model is based on the gene expression profile of the genes listed in Table 1A or 1B. Further provided are compositions and methods for predicting outcome or response to therapy of a subject diagnosed with or suspected of having breast cancer. These methods are useful for guiding or determining treatment options for a subject afflicted with breast cancer. Methods of the invention further include means for evaluating gene expression profiles, including microarrays and quantitative polymerase chain reaction assays, as well as kits comprising reagents for practicing the methods of the invention. | 06-05-2014 |
20140154682 | METHODS FOR NON-INVASIVE PRENATAL PLOIDY CALLING - Disclosed herein are methods for determining the copy number of a chromosome in a fetus in the context of non-invasive prenatal diagnosis. In an embodiment, the measured genetic data from a sample of genetic material that contains both fetal DNA and maternal DNA is analyzed, along with the genetic data from the biological parents of the fetus, and the copy number of the chromosome of interest is determined. In an embodiment, the maternal serum is measured using a single-nucleotide polymorphism (SNP) microarray, along with parental genomic data, and the determination of the chromosome copy number is used to make clinical decisions pertaining to the fetus. | 06-05-2014 |
20140154683 | Enrichment of Nucleic Acids by Complimentary Capture - Assays can be used to detect mutations found in neoplasms of the pancreas, as well as for other neoplasms and other uses. Nucleic acids can be captured from body fluids such as cyst fluids. Thousands of oligonucleotides can be synthesized in parallel, amplified and ligated together. The ligated products can be further amplified. The amplified, ligated products are used to capture complementary DNA sequences, which can be analyzed, for example by massively parallel sequencing. | 06-05-2014 |
20140154684 | DIAGNOSIS OF MELANOMA AND SOLAR LENTIGO BY NUCLEIC ACID ANALYSIS - The present invention provides methods for diagnosing melanoma and/or solar lentigo in a subject by analyzing nucleic acid molecules obtained from the subject. The present invention also provides methods for distinguishing melanoma from solar lentigo and/or dysplastic nevi and/or normal pigmented skin. The methods include analyzing expression or mutations in epidermal samples, of one or more skin markers. The methods can include the use of a microarray to analyze gene or protein profiles from a sample | 06-05-2014 |
20140162249 | RNase H-Based Assays Utilizing Modified RNA Monomers - The present invention provides methods of cleaving a nucleic acid strand to initiate, assist, monitor or perform biological assays. | 06-12-2014 |
20140162250 | MARKER-ASSISTED SELECTION OF TOLERANCE TO CHLORIDE SALT STRESS - Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance to chloride salt stress. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to chloride salt stress. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with chloride salt stress tolerance. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance to chloride salt stress. | 06-12-2014 |
20140162251 | Methods for Detection and Quantification of Analytes in Complex Mixtures - The invention provides a diverse population of uniquely labeled probes, containing about thirty or more target specific nucleic acid probes each attached to a unique label bound to a nucleic acid. Also provided is a method of producing a population of uniquely labeled nucleic acid probes. Also provided is a method of detecting a nucleic acid analyte. The method consists of (a) contacting a mixture of nucleic acid analytes under conditions sufficient for hybridization with a plurality of target specific nucleic acid probes each having a different specifier; (b) contacting the mixture under conditions sufficient for hybridization with a corresponding plurality of anti-genedigits each having a unique label, the plurality of anti-genedigits having a diversity sufficient to uniquely hybridize to genedigits within the specifiers, and (c) uniquely detecting a hybridized complex between one or more analytes in the mixture, a target specific probe, and an anti-genedigit. | 06-12-2014 |
20140162252 | Composition for diagnosing Alzheimer's disease using methylation status of HMOX1 gene and method for diagnosing Alzheimer's disease using the same - The present invention relates to a diagnostic composition for Alzheimer's disease which includes an agent measuring the methylation level of HMOX1 gene promoter, a diagnostic kit and a method for diagnosing Alzheimer's disease using the same. | 06-12-2014 |
20140162253 | ANALYSIS OF DNA SAMPLES - The invention provides an improved method for obtaining information about DNA analysis of samples of uncertain origin by establishing the likelihood that they arose in certain manners compared with other possible manners. In this way all of the analysis information is taken into account and likelihood ratios are provided to express the results. The invention is particularly useful in analysing small DNA samples or DNA samples where the contribution from one or more sources is small. | 06-12-2014 |
20140162254 | BREAST TUMOUR GRADING - We describe a method of assigning a grade to a breast tumour, which grade is indicative of the aggressiveness of the tumour, the method comprising detecting the expression of a gene selected from the genes set out in Table D1 (SWS Classifier 0). | 06-12-2014 |
20140162255 | NOVEL SINGLE NUCLEOTIDE POLYMORPHISMS AND COMBINATIONS OF NOVEL AND KNOWN POLYMORPHISMS FOR DETERMINING THE ALLELE-SPECIFIC EXPRESSION OF THE IGF2 GENE - Single nucleotide polymorphisms and uses for determining the imprinting status of the Insulin Growth Factor-2 gene in a clinical specimen are described. | 06-12-2014 |
20140162256 | COMPOSITIONS AND METHODS FOR THE DETECTION OF ANAPLASMA PLATYS - Described herein are improved diagnostic tools for veterinary and human use which can be used for serodiagnosing | 06-12-2014 |
20140162257 | SYSTEMS AND METHODS FOR OBTAINING AND MANAGING SEQUENCE DATA - Systems and methods for biological sample processing are described. A production line extracts genomic DNA from a biological sample, amplifies target components of the sample and produces sequence data for markers from the amplified components. The markers are associated with tests identified in a requisition received with the sample and some markers may be associated with unrequisitioned tests. A sample information management system (SIMS) controls and monitors the production line and subsequent analysis of the results using information in a quality control (QC) database to validate the results. A repository comprising the QC database and a research database receives and aggregates the results without identifying the source of the sample. A portal may be provided to provide access to the research database to a plurality of external contributors. Contributors can selectively provide additional research data and data can be processed using data mining and curation tools. | 06-12-2014 |
20140162258 | COMPOSITIONS, METHODS, AND KITS FOR (MIS)LIGATING OLIGONUCLEOTIDES - Methods, reagents, and kits for (mis)ligating oligonucleotide probes or for identifying at least one target nucleotide are disclosed. One can enhance the generation of misligation product using a ligase under reaction conditions and with reagents where that particular ligase is prone to misligation. Alternatively, one can decrease or avoid generating misligation products using a particular ligase under reaction conditions and using reagents where that ligase is at least less prone to misligation. In certain embodiments, the recombinant ligase from | 06-12-2014 |
20140162259 | FHL1 MUTATIONS ASSOCIATED WITH NOVEL X-LINKED MUSCULAR MYOPATHIES - Four and a Half LIM domains protein 1 (FHL-1) mutations at positions 128 or 224 that are associated with X-linked muscular myopathy, methods of screening subjects to identify those susceptible to muscular myopathy including muscular dystrophy and cardiomyopathy and kits. | 06-12-2014 |
20140162260 | PRIMERS, SNP MARKERS AND METHOD FOR GENOTYPING MYCOBACTERIUM TUBERCULOSIS - The present application provides a primer set for genotyping | 06-12-2014 |
20140162261 | DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment. | 06-12-2014 |
20140162262 | Method and Device for Generating a Tunable Array of Fluid Gradients - Provided herein are devices and methods for generating microfluidic gradients, including an array of unique microfluidic gradients within an array of microchannels. Fluids within conduits are mixed in an intersection region to generate a mixed flow stream in a source reservoir channel that provides a gradient that varies with axial distance from the intersection region. Microchannels having an inlet connected to the source reservoir channel are configured to provide a microfluidic gradient in the microchannel. An outlet end of the microchannel is connected to a sink reservoir channel. By varying the ratio of fluid flow rates from the fluid conduits, the microchannel gradients are tuned. In this manner, a large number of unique gradients or array of microfluidic gradients is provided, wherein the gradient can be any number of physical or chemical parameters, including concentrations and physical fluid properties. | 06-12-2014 |
20140162263 | Polynucleotide Primers and Probes - The present invention provides a novel technology that involves improved primer design. These primer pairs have a wide range of applications and provide high sensitivity and specificity. | 06-12-2014 |
20140162264 | Systems and Methods for Multiple Analyte Detection - Systems and methods for multiple analyte detection include a system for distribution of a biological sample that includes a substrate, wherein the substrate includes a plurality of sample chambers, a sample introduction channel for each sample chamber, and a venting channel for each sample chamber. The system may further include a preloaded reagent contained in each sample chamber and configured for nucleic acid analysis of a biological sample that enters the substrate and a sealing instrument configured to be placed in contact with the substrate to seal each sample chamber so as to substantially prevent sample contained in each sample chamber from flowing out of each sample chamber. The substrate can be constructed of detection-compatible and assay-compatible materials. | 06-12-2014 |
20140162265 | COMPOSITIONS FOR USE IN TREATING OR DIAGNOSING BONE DISORDERS AND/OR CARDIOVASCULAR DISORDERS - The invention relates to methods for diagnosing bone disorders and/or cardiovascular disorders in a subject, by contacting a biological sample from the subject with (a) a nucleic acid molecule which hybridizes to miR-31 or its 5 or 3′ isoforms or variants, or (b) an agent that binds to miR-31 or its 5′ or 3′ isoforms or variants; detecting and evaluating the hybridization signal of the nucleic acid molecule or agent with a polynucleotide or said miR-31 or its 5′ or 3′ isoforms or variants; and comparing the detected and evaluated hybridization or binding signal with that of a control sample, wherein a stronger hybridization signal or a stronger binding signal in the sample of the subject compared to that of the control sample is indicative for a risk of developing or having a bone disorder and/or cardiovascular disorder | 06-12-2014 |
20140162266 | METHODS FOR POLYMERASE CHAIN REACTION COPY NUMBER VARIATION ASSAYS - This disclosure provides methods for measuring the copy number for highly amplified and/or abundant genomic loci. Recognized herein is a need for methods for determining nucleic acid copy number, particularly in instances where one locus to be quantified (i.e., the target) is relatively more abundant than a locus of known abundance (i.e., the reference). In some cases, the method involves combining a query nucleic acid sample with a diluting nucleic acid sample and measuring the relative copy number of a target sequence compared with a reference sequence in the combined sample. | 06-12-2014 |
20140162267 | DRY COMPOSITION OF REACTION COMPOUNDS WITH STABILIZED POLYMERASE - The present invention provides methods to obtain dry compositions of reaction compounds that maintain the biological activity of the compounds upon re-solubilization after a certain storage time. Preferably, the dry composition comprises a polymerase, and the dry composition is usable for polymerase chain reaction (PCR) amplification after re-solubilization. | 06-12-2014 |
20140162268 | OPTICAL ANALYSIS DEVICE, OPTICAL ANALYSIS METHOD AND COMPUTER PROGRAM FOR OPTICAL ANALYSIS USING SINGLE LIGHT-EMITTING PARTICLE DETECTION - In the scanning molecule counting method detecting light of a light-emitting particle in a sample solution using a confocal or multiphoton microscope, there is provided an optical analysis technique enabling the scanning in a sample solution with moving a light detection region in a broader area or along a longer route while making the possibility of detecting the same light-emitting particle as different particles as low as possible and remaining the size or shape of the light detection region unchanged as far as possible. In the inventive optical analysis technique, there are performed detecting light from the light detection region and generating time series light intensity data during moving the light detection region along the second route whose position is moved along the first route, and thereby, the signal indicating light from each light-emitting particle in a predetermined route is individually detected using the time series light intensity data. | 06-12-2014 |
20140162269 | METHODS FOR NON-INVASIVE PRENATAL PLOIDY CALLING - The present disclosure provides methods for determining the ploidy status of a chromosome in a gestating fetus from genotypic data measured from a sample of DNA from the mother of the fetus and from the fetus, and from genotypic data from the mother and optionally also from the father. The ploidy state is determined by using a joint distribution model to create a set of expected allele distributions for different possible fetal ploidy states given the parental genotypic data, and comparing the expected allelic distributions to the pattern of measured allelic distributions measured in the mixed sample, and choosing the ploidy state whose expected allelic distribution pattern most closely matches the observed allelic distribution pattern. In an embodiment, the mixed sample of DNA may be preferentially enriched at a plurality of polymorphic loci in a way that minimizes the allelic bias. | 06-12-2014 |
20140162270 | NOVEL SINGLE NUCLEOTIDE POLYMORPHISMS AND COMBINATIONS OF NOVEL AND KNOWN POLYMORPHISMS FOR DETERMINING THE ALLELE-SPECIFIC EXPRESSION OF THE IGF2 GENE - Single nucleotide polymorphisms and uses for determining the imprinting status of the Insulin Growth Factor-2 gene in a clinical specimen are described. | 06-12-2014 |
20140170645 | UNIVERSAL SAMPLE PREPARATION SYSTEM AND USE IN AN INTEGRATED ANALYSIS SYSTEM - The invention provides a system that can process a raw biological sample, perform a biochemical reaction and provide an analysis readout. For example, the system can extract DNA from a swab, amplify STR loci from the DNA, and analyze the amplified loci and STR markers in the sample. The system integrates these functions by using microfluidic components to connect what can be macrofluidic functions. In one embodiment the system includes a sample purification module, a reaction module, a post-reaction clean-up module, a capillary electrophoresis module and a computer. In certain embodiments, the system includes a disposable cartridge for performing analyte capture. The cartridge can comprise a fluidic manifold having macrofluidic chambers mated with microfluidic chips that route the liquids between chambers. The system fits within an enclosure of no more than 10 ft | 06-19-2014 |
20140170646 | DIAGNOSTIC AND SAMPLE PREPARATION DEVICES AND METHODS - Contemplated methods and devices are drawn to preparation and analysis of analytes from biological samples. In a preferred embodiment the analytes are nucleic acids that are both released from biological compartment present in the sample and fragmented through the use of a voltage potential applied to a pair of electrodes. The nucleic acids thus prepared are subsequently characterized. | 06-19-2014 |
20140170647 | Compositions and Methods for Analyzing Immobilized Nucleic Acids - The present invention provides methods of detecting a nucleic acid analyte in a sample. The methods generally involve modifying immobilized nucleic acids from a sample onto an insoluble support in a substantially elongated configuration, where modification generates an identifying feature that identifies the analyte; and detecting the identifying feature(s) using scanning probe microscopy, to detect the analyte. The present invention further provides a method for assigning a profile of a feature to a nucleic acid. The present invention further provides a computer program product for use in a subject method. The present invention further provides a system for detecting a nucleic acid in a sample; and a system for assigning a profile of a feature to a nucleic acid. The present invention further provides a method for immobilizing a nucleic acid onto an insoluble support; and further provides insoluble support having nucleic acid(s) immobilized thereon. The present invention further provides a method of diagnosing a disorder or condition in an individual, where the method involves use of a subject method for detecting a nucleic acid analyte. | 06-19-2014 |
20140170648 | CANCER MARKER, METHOD FOR EVALUATION OF CANCER BY USING THE CANCER MARKER, AND EVALUATION REAGENT - The present invention provides a novel cancer marker for evaluating the onset, the preclinical stage, the clinical stage, or the prognosis of a cancer in a subject, and an evaluation method using the same. A cancer marker containing at least one miRNA selected from hsa-miR-92 and hsa-miR-494 is used as a marker for cancers excluding breast cancer. A method for evaluating the possibility of cancers excluding breast cancer includes the step of detecting the expression level of a cancer marker in a biological sample collected from a subject. In this method, the cancer marker contains at least one miRNA selected from hsa-miR-92 and hsa-miR-494. | 06-19-2014 |
20140170649 | LATERAL FLOW DETECTION OF TARGET SEQUENCES - Provided is a sensitive method to specifically detect nucleic acid sequences using a combination of DNA replication based signal amplification (e.g., PCR) and lateral flow analyte detection. The disclosed method uses a dual-labeled DNA probe complementary to a region of the target DNA sequence. Cleavage of the probe, caused by the presence of the amplified DNA target, is detected using lateral flow methods. | 06-19-2014 |
20140170650 | Primers with Modified Phosphate and Base in Allele-Specific PCR - The present invention includes a method of allele-specific amplification, utilizing an allele-specific oligonucleotide, at least partially complementary to more than one variant of the target sequence, but having at least one selective nucleotide complementary to only one variant of the target sequence and incorporating both a nucleotide with a base covalently modified at the exocyclic amino group and a modified phosphate. | 06-19-2014 |
20140170651 | RECOVERY OF GENOMIC DNA FROM REMNANT EXTRACTED SEED SAMPLES - This disclosure concerns the isolation of nucleic acids (e.g., genomic DNA) from plant seed material that has been defatted. In some embodiments, such nucleic acids are of sufficient quality and abundance that they may be used in an amplification-based genetic analysis technique; for example and without limitation, to make selections in a plant breeding program. | 06-19-2014 |
20140170652 | TARGET CAPTURE SYSTEM - The invention generally relates to a system for isolating or separating a target from a sample. In certain aspects, processes performed by the target capture system include introducing a plurality of magnetic particles, in which a plurality of the particles include at least one binding moiety specific to a target, into a sample to form at least one target/particle complex and applying a magnetic field to isolate the magnetic particle/target complexes from the sample. The process starts at inputting a sample into the system and ends at delivering a capture target or nucleic acids of the target into a container for further analysis. | 06-19-2014 |
20140170653 | CHEMICAL LIGATION - Methods comprising chemical ligation of oligonucleotides are provided. In some embodiments, methods of detecting a polymorphisms in nucleic acids are provided. In some embodiments, methods of detecting at least one analyte are provided. In some embodiments, methods of labeling solid support particles are provided. Kits comprising oligonucleotides with chemically ligatable moieties are also provided. | 06-19-2014 |
20140170654 | Unfolding Proximity Probes and Methods for the Use Thereof - The present invention relates to a proximity-probe based detection assay for detecting an analyte in a sample and in particular to a method that comprises the use of at least one set of at least first and second proximity probes, which probes each comprise an analyte-binding domain and a nucleic acid domain and can simultaneously bind to the analyte directly or indirectly, wherein the nucleic acid domain of at least one of said proximity probes comprises a hairpin structure that can be unfolded by cleavage of the nucleic acid domain to generate at least one ligatable free end or region of complementarity to another nucleic acid molecule in said sample, wherein when the probes bind to said analyte unfolding said hairpin structure allows the nucleic acid domains of said at least first and second proximity probes to interact directly or indirectly. | 06-19-2014 |
20140170655 | ISOLATION OF SELECTED MARKER-FREE MICOORGANISMS WITH A KNOWN GENETIC ELEMENT - The invention relates to a method for isolating a microorganism containing a known genetic element. The method employs several rounds of 1) dilution of a mixed culture containing the selected microorganism in several replicates, 2) growing the replicates, 3) detecting the organism in at least one of the replicates and repeating steps 1) through 3) until the organism can be isolated by standard procedures. | 06-19-2014 |
20140170656 | Methods of Detecting Target Nucleic Acids - The present disclosure relates to methods of identifying target nucleic acids by using coded molecules and its analysis by translocation through a nanopore. Generally, coded molecules are subject to a target polynucleotide dependent modification. The modified coded molecule is detected by isolating the modified coded molecules from the unmodified coded molecules prior to analysis through the nanopore or by detecting a change in the signal pattern of the coded molecule when analyzed through the nanopore. | 06-19-2014 |
20140170657 | Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof - A polymorphism-detecting probe, an amplification primer and the use thereof are provided to enable simple and highly reliable determination of different polymorphisms in an EGFR gene. | 06-19-2014 |
20140170658 | MAMMALIAN CYTOKINES; RELATED REAGENTS - Purified genes encoding a cytokine or composite cytokine from a mammal, reagents related thereto including purified proteins, specific antibodies, and nucleic acids encoding these molecules are provided. Methods of using said reagents and diagnostic kits are also provided. | 06-19-2014 |
20140170659 | EXPRESSION OF ISOFORM 202 OF ERCC1 FOR PREDICTING RESPONSE TO CANCER CHEMOTHERAPY - An in vitro method for detecting the susceptibility of a tumor cell to a chemotherapy is disclosed. The method includes the step of measuring the expression level of the isoform 202 of the ERCC1 protein. | 06-19-2014 |
20140170660 | METHODS AND COMPOSITIONS FOR PREDICTING UNOBSERVED PHENOTYPES (PUP) - Methods for predicting unobserved phenotypes are provided. In some embodiments, the methods include (a) determining marker effects for a plurality of markers in a genotyped and phenotyped reference population with respect to a phenotype, wherein the reference population includes an F | 06-19-2014 |
20140170661 | NUCLEIC ACID AMPLIFICATION - A method of monitoring amplification of a nucleic acid by providing a nucleic acid and an amplification mixture using the kit of isothermal reagents to a pH sensor or pH indicator, amplifying the nucleic acid using isothermal amplification, and detecting a change in pH due to the amplification using the pH sensor or pH indicator. The kit of reagents comprises a magnesium salt, a quaternary ammonium salt, and an alkali base. | 06-19-2014 |
20140170662 | MUTATIONS IN THE EPIDERMAL GROWTH FACTOR RECEPTOR GENE - The invention relates to a new identified mutation in the epidermal growth factor receptor gene, leading to an amino acidic change which highly correlates with the resistance to a therapy regimen comprising cetuximab and the sensitivity to a therapy regimen comprising panitumumab. The invention includes peptide sequences, primers and probes to detect such a mutation, as well as kits for predicting the response of a subject to a therapy regime comprising cetuximab and/or panitumumab. In particular, the invention is useful in the therapy regimen applicable to metastasic colorectal cancer and to head and neck cancer. | 06-19-2014 |
20140170663 | METHYLATION SIGNATURE FOR REPLICATIVE SENESCENCE OF CELLS IN CULTURE - A method for determining a replicative senescence status of a cell includes determining a methylation status of at least one CpG-dinucleotide within a region of at least one of about 50,000 bp upstream and downstream of at least one CpG-dinucleotide selected from the group consisting of GRM7-CpG-site #1, CASR-CpG-site #1, PRAMEF2-CpG-site #1, SELP-CpG-site #1, CASP14-CpG-site #1, and KRTAP13-3-CpG-site #1. The methylation status of each of the at least one CpG-dinucleotide determined is compared with a reference methylation status of the respective CpG-dinucleotide. | 06-19-2014 |
20140178866 | GENETIC LOCI ASSOCIATED WITH SOYBEAN CYST NEMATODE RESISTANCE AND METHODS OF USE - Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with resistance or improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resistance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with resistance or improved resistance to soybean cyst nematode. | 06-26-2014 |
20140178867 | GENETIC LOCI ASSOCIATED WITH PHYTOPHTHORA TOLERANCE IN SOYBEAN AND METHODS OF USE - Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to | 06-26-2014 |
20140178868 | SELECTIVE DETECTION OF NEISSERIA MENINGITIDIS - A process for detecting | 06-26-2014 |
20140178869 | DETECTION OF IMMUNOGLOBULIN LIGHT CHAIN RESTRICTION BY RNA IN SITU HYBRIDIZATION - The invention provides a method for detecting immunoglobulin light chain restriction and clonality in B cells by obtaining a sample of B cells from a subject; conducting a duplex in situ hybridization assay on the sample using (i) at least one probe set which is designed to specifically hybridize to immunoglobulin kappa chain constant region (IGKCR) RNA; and (ii) at least one probe set which is designed to specifically hybridize to immunoglobulin lambda chain constant region (IGLCR) RNA; detecting signal associated with hybridized IGKCR probe and signal associated with hybridized IGLCR probe in a population of B cells in the sample; and determining a pattern of signal associated with hybridized IGKCR probe and hybridized IGLCR probe within individual cells in the B cell population, wherein the pattern of signal within individual cells indicates the presence or absence of light chain restriction and clonality of the B cells. | 06-26-2014 |
20140178870 | CYSTIC FIBROSIS GENE MUTATIONS - The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided. | 06-26-2014 |
20140178871 | RECURRENT GENE FUSIONS IN HEMANGIOPERICYTOMA - Provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent gene fusions as diagnostic markers and clinical targets for hemangiopericytoma. | 06-26-2014 |
20140178872 | METHODS OF NUCLEIC ACID QUANTIFICATION AND DETECTION USING ANOMALOUS MIGRATION - Described are approaches for the identification, detection, and quantification of nucleic acids in a biological sample. These methods are based, in part, on the elucidation of anomalous migration properties of short nucleic acid molecules when conjugated to a fluorescent label, such as fluorescein labels, such that a smaller nucleic acid reliably migrates slower than a larger nucleic acid under the same conditions of separation. | 06-26-2014 |
20140178873 | NOVEL METHODS FOR DETECTING HYDROXYMETHYLCYTOSINE - The present invention provides a method of detecting a hydroxymethyl (hm) cytosine (C) in a nucleic acid molecule preparation; comprising: (a) providing a single-stranded (ss) nucleic acid molecule; (b) synthesizing at least one copy of at least a portion of the complementary strand of said ss nucleic acid molecule thereby generating a double-stranded (ds) nucleic acid molecule, wherein said synthesis is carried out in the presence of hydroxymethylcytosine or analog thereof (e.g., protected hydroxyl group); and (c) reacting the product obtained in (b) (all or purified) with an endonuclease being capable of cleaving said ds nucleic acid molecule, wherein cleavage by said endonuclease requires a recognition site that contains hmC on opposite strands; and (d) analyzing the product obtained in step (c). | 06-26-2014 |
20140178874 | METHOD FOR EVALUATING CANCER - Provided is a cancer evaluation method using a novel cancer marker for evaluating the onset, the preclinical stage, the clinical stage, or the prognosis of a cancer in a subject. At least one miRNA selected from hsa-miR-92 and hsa-miR-494 is used as the novel cancer marker in cancer evaluation. The cancer marker in a sample of a cell or a tissue is detected, and the possibility of a cancer in the sample is evaluated based on the expression level of the cancer marker. According to this evaluation method, by detecting the miRNA as the cancer marker, it becomes possible to evaluate the possibility of a cancer in the sample with excellent reliability. As a method for detecting the cancer marker, it is preferable to perform an in situ hybridization method using a labeled probe with respect to the sample that has been immobilized, for example. | 06-26-2014 |
20140178875 | Devices, Compositions and Methods Pertaining To Microscopic Analysis Of Microorganisms and Other Analytes of Interest - This invention pertains to devices, compositions and methods that can be used for the rapid determination of microorganisms, cells and other analytes of interest (e.g. a nucleic acid target) as well as associated properties of said microorganisms, cells and analytes. For example, said devices, compositions and/or methods can be applied to the determination of a trait of a microorganism present in a sample. Said devices, compositions and methods utilize matrix-forming prolonged-dissolution hydrophilic polymer to encapsulate hybridization probes and optionally other assay reagents within two or more reagent zones and/or matrix zones disposed on the surface of a substrate. Each reagent zone and/or matrix zone can be designed as a separate assay. Thus, a plurality of assays can be performed on a single substrate. In some embodiments, devices can be supplied in a form ready for a customer to rapidly perform one or a plurality of assays. | 06-26-2014 |
20140178876 | UNIVERSAL NUCLEIC ACID PROBE SET AND METHOD FOR UTILIZATION THEREOF - A nucleic acid probe set includes (A) a fluorescent probe and (B) a binding probe. The fluorescent probe (A) is formed of an oligonucleotide, which includes (a) a nucleotide unit labeled with (d) a fluorescent substance. The binding probe (B) is formed of an oligonucleotide having (b1) a fluorescent probe binding region, which can hybridize to the fluorescent probe (A), and (b2) a target nucleic acid binding region, which can hybridize to a target nucleic acid sequence (C). The fluorescent substance (d) is a fluorescent substance which changes in fluorescent character upon interaction with guanine. At least one of nucleotide units which constitute the fluorescent probe (A) is an artificial nucleotide unit having a function to raise a dissociation temperature between the probe (A) and the fluorescent probe binding region (b1). The nucleic acid probe is provided with an improved fluorescence quenching efficiency. | 06-26-2014 |
20140178877 | Labeled Oligonucleotide Probes Used for Nucleic Acid Sequence Analysis - The present invention is directed to methods for generating a labeled oligonucleotide probe that contains a fluorescent rhodamine-derived dye for use in PCR reactions to detect a target nucleic acid. | 06-26-2014 |
20140178878 | OLIGONUCLEOTIDS COMPRISING A LABEL ASSOCIATED THROUGH A LINKER - The present application discloses a labeled nucleotide comprising a label attached via a linker, wherein said labeled nucleotide has the formula wherein R | 06-26-2014 |
20140178879 | Compositions and Methods for Modifying Cells - A method for engineering and utilizing large DNA vectors to target, via homologous recombination, and modify, in any desirable fashion, endogenous genes and chromosomal loci in eukaryotic cells. These large DNA targeting vectors for eukaryotic cells, termed LTVECs, are derived from fragments of cloned genomic DNA larger than those typically used by other approaches intended to perform homologous targeting in eukaryotic cells. Also provided is a rapid and convenient method of detecting eukaryotic cells in which the LTVEC has correctly targeted and modified the desired endogenous gene(s) or chromosomal locus (loci) as well as the use of these cells to generate organisms bearing the genetic modification. | 06-26-2014 |
20140178880 | METHOD OF PREPARING A REACTION MIXTURE AND RELATED PRODUCTS - The invention relates to a method of preparing a reaction mixture for Polymerase Chain Reaction (PCR) assay and a solution set for PCR. The method comprises providing a sample solution comprising a biological sample to be amplified in said PCR assay and first colorant providing the solution a first color, providing a reagent solution comprising at least one other substance required for performing said assay and second colorant providing the solution a second color different from the first color, and mixing the sample solution and the first reagent solution for providing a mixed solution to be subjected to the PCR process, the mixed solution having, due to said first and second colorants, a third color different from the first and second colors. The invention significantly aids in pipetting PCR assays. | 06-26-2014 |
20140178881 | Methods for Detection of Nucleotide Modification - This invention relates to the identification of modified cytosine residues, such as 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC) and 5-formylcytosine (5fC) to be distinguished from cytosine (C) in a sample nucleotide sequence. Methods may comprise oxidising or reducing a first portion of polynucleotides which comprise the sample nucleotide sequence; treating the oxidised or reduced first portion and a second portion of polynucleotides with bisulfite; sequencing the polynucleotides in the first and second portions of the population following steps ii) and iii) to produce first and second nucleotide sequences, respectively and; identifying the residue in the first and second nucleotide sequences which corresponds to a cytosine residue in the sample nucleotide sequence. These methods may be useful, for example in the analysis of genomic DNA and/or of RNA. | 06-26-2014 |
20140186826 | METHOD OF JUDGING RISK FOR ONSET OF DRUG-INDUCED GRANULOCYTOPENIA - Means for determining the presence of the risk of drug-induced granulocytopenia in a human is provided. | 07-03-2014 |
20140186827 | ASSAYS FOR THE DETECTION OF GENOTYPE, MUTATIONS, AND/OR ANEUPLOIDY - The present invention provides amplification-based methods for detection of genotype, mutations, and/or aneuploidy. These methods have broad applicability, but are particularly well-suited to detecting and quantifying target nucleic acids in free fetal DNA present in a maternal bodily fluid sample. | 07-03-2014 |
20140186828 | METHODS FOR DETERMINING CELL VIABILITY USING MOLECULAR NUCLEIC ACID-BASED TECHNIQUES - The present invention relates to novel methods, and kits, for selectively excluding dead cells from a mixture containing live and dead cells, such as microbe cells in clinical samples, blood products, medical/biotechnology products and food products where subsequent interrogation of the selected live cells are an indicator of the presence of microbe viability. In particular, the invention relates to improved methods for performing direct nucleic acid amplification techniques such as Polymerase Chain Reaction (PCR) and isothermal techniques in blood and other body fluids, for correlation with microbe cell viability from Bacteremia and Fungemia samples. The improved methods provided by the invention are particularly advantageous for the diagnosis of septicemia and to determine pathological conditions in all other normally sterile body fluids. | 07-03-2014 |
20140186829 | METHOD FOR PREDICTING INSULINOPENIC TYPE 2 DIABETES - The present invention relates to an in vitro method, for predicting a risk of onset of type 2 diabetes in a subject, which method comprises the steps of: a) measuring the concentration of bacterial 16S rDNA in a biological sample of said subject; and b) comparing said measured concentration of bacterial 16S rDNA to a threshold level; wherein a measured concentration of bacterial 16S rDNA higher than the threshold level is indicative of an increased risk of onset of type 2 diabetes in the subject, and a measured concentration of bacterial 16S rDNA lower than the threshold level is indicative of a decreased risk of onset of type 2 diabetes in the subject. | 07-03-2014 |
20140186830 | Methods for Analyzing Short Tandem Repeats and Single Nucleotide Polymorphisms - Methods for genotyping a sample comprising nucleic acid are provided. The methods comprise analyzing STR and SNP loci. | 07-03-2014 |
20140186831 | Solid Phases Optimized for Chemiluminescent Detection - Solid supports for chemiluminescent assays are provided. The solid support includes a plurality of probes covalently or physically attached to the support surface and a chemiluminescent enhancing moiety incorporated onto the surface or into the bulk of the support. The solid support can be a multi-layered support including an upper probe binding layer (e.g., an azlactone polymer layer or porous functional polyamide layer) adjacent to a cationic microgel layer. The azlactone-functional polymer can be a copolymer of dimethylacrylamide and vinylazlactone crosslinked with ethylenediamine. The cationic microgel layer can be a cross-linked quaternary onium salt containing polymer. A method and a kit for conducting chemiluminescent assays using the solid supports is also provided. The kit comprises a dioxetane substrate, a biopolymer probe-enzyme complex, and a solid support. The solid support can be an azlactone functional polymer layer adjacent to a cationic microgel layer; a porous polyamide functional layer adjacent to a cationic microgel layer; or a quaternized azlactone functional polymer layer. | 07-03-2014 |
20140186832 | SELECTIVE ULTRASONIC LYSIS OF BLOOD AND OTHER BIOLOGICAL FLUIDS AND TISSUES - The present invention features methods for selective lysis of endogenous cells in a biological sample. In preferred embodiments, the methods of the invention comprise contacting the biological sample with lysis solution, and subjecting the mixture to ultrasound, thereby selectively lysing the endogenous cells in the biological sample. The invention also features a lysis solution comprising Saponin and Proteinase. | 07-03-2014 |
20140186833 | CC2D2A GENE MUTATIONS ASSOCIATED WITH JOUBERT SYNDROME AND DIAGNOSTIC METHODS FOR IDENTIFYING THE SAME - The present invention provides a method of screening a subject for mutations in the CC2D2A gene that are associated with Joubert syndrome, an autosomal recessive form of mental retardation. The present invention also provides proteins that are associated with Joubert syndrome including proteins that includes an amino acid sequence that terminates in DHEGGSGMES (SEQ ID NO: 1). Also provided are nucleotide sequences encoding such proteins and methods of screening subjects to identify nucleotide sequences or proteins associated with Joubert syndrome. | 07-03-2014 |
20140186834 | MECP2E1 GENE - The invention is a novel MECP2E1 splice variant and its corresponding polypeptide. The invention also includes methods of using these nucleic acid sequences and proteins in medical diagnosis and treatment of neuropsychiatric disorders or development disorders. | 07-03-2014 |
20140186835 | IDENTIFICATION OF THE CAUSATIVE MUTATION FOR INHERITED CONNECTIVE TISSUE DISORDERS IN EQUINES AND METHODS FOR TESTING FOR SAME - Provided is a description of a mutation which is positively correlated with Warmblood Fragile Foal Syndrome Type 1 (WFFST1). The mutation is a G to A change at a specific location in the equine lysyl hydroxylase 1 (LH1) gene. Compositions and methods for use in diagnosing WFFST1 are provided. | 07-03-2014 |
20140186836 | DIAGNOSIS MARKER, DIAGNOSIS METHOD AND THERAPEUTIC AGENT FOR AMYOTROPHIC LATERAL SCLEROSIS, AND ANIMAL MODEL AND CELL MODEL DEVELOPING AMYOTROPHIC LATERAL SCLEROSIS - Provided are a diagnosis marker, a diagnosis method, and a therapeutic agent suitable for diagnosing and treating amyotrophic lateral sclerosis (ALS). Also provided are an animal model and a cell model suitable for developing a therapeutic agent and a treatment method for ALS. The diagnosis method for ALS includes: an isolation step in which a nucleic acid is isolated from a specimen taken from a subject; a detection step in which bases expressed in a human chromosome 10 optineurin (OPTN) gene region are detected from the isolated nucleic acid; and a determination step in which it is determined whether or not the detected bases are mutated. | 07-03-2014 |
20140186837 | Methods For Diagnosing Cancer - Methods and kits for the detection of cancer and for pre-cancer screening based on the expression of genes associated with altered metabolism and apoptosis in cancerous cells, particularly the expression of a mitochondrial antiviral-signaling (MAVS) or a voltage-dependent anion channel 1 (VDAC1) protein or mRNA in combination with additional genes associated with cell metabolism and/or apoptosis. | 07-03-2014 |
20140186838 | MOLECULAR FLUX RATES THROUGH CRITICAL PATHWAYS MEASURED BY STABLE ISOTOPE LABELING IN VIVO, AS BIOMARKERS OF DRUG ACTION AND DISEASE ACTIVITY - The methods described herein enable the evaluation of compounds on subjects to assess their therapeutic efficacy or toxic effects. The target of analysis is the underlying biochemical process or processes (i.e., metabolic process) thought to be involved in disease pathogenesis. Molecular flux rates within the one or more biochemical processes serve as biomarkers and are quantitated and compared with the molecular flux rates (i.e., biomarker) from control subjects (i.e., subjects not exposed to the compounds). Any change in the biomarker in the subject relative to the biomarker in the control subject provides the necessary information to evaluate therapeutic efficacy of an administered drug or a toxic effect and to develop the compound further if desired. In one aspect of the invention, stable isotope-labeled substrate molecules are administered to a subject and the label is incorporated into targeted molecules in a manner that reveals molecular flux rates through one or more metabolic pathways of interest. By this method, a comparison between subjects and control subjects reveals the effects of the chemical entity or entities on the biomarkers. This, in turn, allows for the identification of potential therapeutic uses or toxicities of the compound. Combinations of compounds can also be systematically evaluated for complementary, synergistic, or antagonistic actions on the metabolic pathways of interest, using the methods of the present invention as a strategy for identifying and confirming novel therapeutic or toxic combinations of compounds. | 07-03-2014 |
20140186839 | Compositions and Methods for Diagnosing Autism Spectrum Disorders - The invention generally relates to compositions and methods for diagnosing autism spectrum disorders. In certain embodiments, the invention provides a method for diagnosing presence or increased risk of developing an autism spectrum disorder in a subject. | 07-03-2014 |
20140193808 | NON-INVASIVE DETECTION OF FETAL GENETIC TRAITS - Blood plasma of pregnant women contains fetal and (generally>90%) maternal circulatory extracellular DNA. Most of said fetal DNA contains 500 base pairs, said maternal DNA having a greater size. Separation of circulatory extracellular DNA of <500 base pairs results in separation of fetal from maternal DNA. A fraction of a blood plasma or serum sample of a pregnant woman containing, due to size separation (e.g. by chromatography, density gradient centrifugation or nanotechnological methods), extracellular DNA substantially comprising 500 base pairs is useful for non-invasive detection of fetal genetic traits (including the fetal RhD gene in pregnancies at risk for HDN; fetal Y chromosome-specific sequences in pregnancies at risk for X chromosome-linked disorders; chromosomal aberrations; hereditary Mendelian genetic disorders and corresponding genetic markers; and traits decisive for paternity determination) by e.g. PCR, ligand chain reaction or probe hybridization techniques, or nucleic acid arrays. | 07-10-2014 |
20140193809 | METHODS FOR GENETIC ANALYSIS OF DNA TO DETECT SEQUENCE VARIANCES - Methods for determining genotypes and haplotypes of genes are described. Also described are single nucleotide polymorphisms and haplotypes in the ApoE gene and methods of using that information. | 07-10-2014 |
20140193810 | LIQUID INJECTION JIG SET - A liquid injection jig set includes a chip receiver in which a microchip having a plate shape is received in a case, and a jig that is configured to be fittable to the chip receiver includes a hollow needle that can pierce a side end surface of the microchip, which is exposed from the case, and introduces liquid into the microchip via the hollow needle. | 07-10-2014 |
20140193811 | Culture Based Screening Assay and Methods of Use Thereof to Identify Agents Which Modulate Tumor Development, Invasion and Differentiation - A 3D organotypic culture which phenocopies aggressive, invasive cancer and methods of use thereof are provided. | 07-10-2014 |
20140193812 | SINGLE-CELL NUCLEIC ACID ANALYSIS - The present invention provides methods for analysis of genomic DNA and/or RNA from small samples or even single cells. Methods for analyzing genomic DNA can entail whole genome amplification (WGA), followed by preamplification and amplification of selected target nucleic acids. Methods for analyzing RNA can entail reverse transcription of the desired RNA, followed by preamplification and amplification of selected target nucleic acids. | 07-10-2014 |
20140193813 | ISOLATION OF NUCLEIC ACIDS - Provided herein is technology relating to isolating nucleic acids. In particular, the technology relates to methods and kits for extracting nucleic acids from problematic samples such as stool. | 07-10-2014 |
20140193814 | ABCA1 DOWNREGULATION IN PROSTATE CANCER - A method of providing a prognosis or diagnosis of prostate cancer in a subject is described. The method includes obtaining a urine or prostate sample from the subject; determining the level of expression of ABCA1 in the sample; and comparing the level of expression of ABCA1 in the sample to the level of a control sample, wherein a decreased level of ABCA1 expression compared to the control indicates the subject has prostate cancer or a more severe form of prostate cancer. Methods of treating subjects identified as having prostate cancer, and kits for carrying out the method of prognosis or diagnosis are also described. | 07-10-2014 |
20140193815 | METHODS OF USING OLIGONUCLEOTIDES COMPRISING A MOLECULAR SWITCH - This invention relates to oligonucleotides comprising a molecular switch which may exist in an “open” or “closed” position. The molecular switch portion of the probe is particularly sensitive to the identity of sequences complementary to the molecular switch. Oligonucleotides containing a molecular switch are applicable to all kinds of hybridization processes. Due to the sensitivity of the switch domain of the oligonucleotide, probes containing a molecular switch are particularly useful in the identification of single point mismatches. More specifically, a portion, but not all, of the oligonucleotide becomes unbound from a mismatched target. The invention further relates to methods of using said oligonucleotides for research reagents, and clinical diagnostics. An exemplary oligonucleotide comprises a first hybridizable domain, a second bridging block domain, and a third binding domain. | 07-10-2014 |
20140193816 | SYSTEM AND METHOD FOR CLEANING NOISY GENETIC DATA FROM TARGET INDIVIDUALS USING GENETIC DATA FROM GENETICALLY RELATED INDIVIDUALS - A system and method for determining the genetic data for one or a small set of cells, or from fragmentary DNA, where a limited quantity of genetic data is available, are disclosed. Genetic data for the target individual is acquired and amplified using known methods, and poorly measured base pairs, missing alleles and missing regions are reconstructed using expected similarities between the target genome and the genome of genetically related subjects. In accordance with one embodiment of the invention incomplete genetic data is acquired from embryonic cells, fetal cells, or cell-free fetal DNA isolated from the mother's blood, and the incomplete genetic data is reconstructed using the more complete genetic data from a larger sample diploid cells from one or both parents, with or without genetic data from haploid cells from one or both parents, and/or genetic data taken from other related individuals. | 07-10-2014 |
20140193817 | METHODS AND KITS USEFUL FOR DETECTING AN ALTERATION IN A LOCUS COPY NUMBER - A method of identifying an alteration in a locus copy number is provided. The method is effected by determining a methylation state of at least one gene in the locus, wherein a methylation state differing from a predetermined methylation state of the at least one gene is indicative of an alteration in the locus copy number. | 07-10-2014 |
20140193818 | PARTITION DEFINED DETECTION METHODS - Methods are disclosed for resolving measurement problems such problems in measuring chromosomal copy number. Some disclosed methods involve first selecting a primary assay element characteristic to partition. Such characteristic may be a source of experimental variability such as the GC content of measured DNA sequences. Additionally, the disclosed methods may employ an abundance or copy number function to transform the assay element frequencies into an abundance, dose, copy number score, or the like. In some cases, the disclosed methods estimate an amount of certain fetal DNA in a sample. The methods can further compare the estimated amount to a measured amount of fetal DNA in the sample. The comparison can be used to determine the fetal sex or aneuploidy. | 07-10-2014 |
20140193819 | METHODS AND COMPOSITIONS FOR MODULATION OF AMPLIFICATION EFFICIENCY - Provided herein are methods and kits for modulating the amplification efficiency of nucleic acids, which are useful in multiplex reactions where the amplification efficiency of one or more nucleic acids in the mixture are desired to be modulated relative to one or more other nucleic acids. Embodiments relate to molecular diagnostics, including detecting sequence variants, such as SNPs, insertions deletions, and altered methylation patterns, as well as the modulation of the amplification efficiency of internal control sequences to provide more accurate control sequences for amplification reactions. | 07-10-2014 |
20140193820 | NANOWIRE-BASED SYSTEM FOR ANALYSIS OF NUCLEIC ACIDS - System for detection and/or analysis of nucleic acids using nanowires to detect covalent modification of nucleic acids. | 07-10-2014 |
20140193821 | EXONIC SPLICING ENHANCERS AND EXONIC SPLICING SILENCERS - Compounds and methods for regulation of exonic splicing enhancers and exonic splicing silencers. Compounds include polynucleotides targeted to aberrant exonic splicing enhancers and exonic splicing silencers. Compounds and methods for the diagnosis of diseases and conditions associated with aberrant exonic splicing enhancers and exonic splicing silencers. Methods for identifying splicing-sensitive disease mutations, and functional RNA elements as targets for amelioration of aberrant pre-mRNA splicing. | 07-10-2014 |
20140193822 | COMPLEX SETS OF MIRNAS AS NON-INVASIVE BIOMARKERS FOR KIDNEY CANCER - The present invention relates to non-invasive methods, kits and means for diagnosing and/or prognosing of kidney cancer in a body fluid sample from a subject. Further, the present invention relates to set of polynucleotides or sets of primer pairs for detecting sets of miRNAs for diagnosing and/or prognosing of kidney cancer in a body fluid sample from a subject. In addition, the present invention relates to sets of miRNAs for diagnosing and/or prognosing of kidney cancer in a body fluid sample from a subject. | 07-10-2014 |
20140199690 | MATERIALS AND METHODS FOR HIGH-THROUGHPUT DETERMINATION OF GENOME-WIDE DNA METHYLATION PROFILE - The present invention provides materials and methods for rapid and sensitive determination of global methylation profile of genomic DNA. In one embodiment, the present invention provides the fluorescence polarization (FP) based measurement of DNA methylation (FPDM) assay, wherein the FPDM assay comprises restriction digestion of DNA molecules using a pair of methyl-sensitive and methyl-insensitive restriction endonuclease enzymes, polymerase chain extension of digested DNA molecules via the incorporation of fluorescently labeled dNTP(s), and analysis via fluorescence polarization techniques. | 07-17-2014 |
20140199691 | METHODS OF FETAL ABNORMALITY DETECTION - Methods and kits for selectively enriching non-random polynucleotide sequences are provided. Methods and kits for generating libraries of sequences are provided. Methods of using selectively enriched non-random polynucleotide sequences for detection of fetal aneuploidy are provided. | 07-17-2014 |
20140199692 | TRANSLATIONAL DYSFUNCTION BASED THERAPEUTICS - Provided are methods and compositions for inhibiting eukaryotic translation initiation factor eIF4E. Such methods and compositions may be used alone or in conjunction with other therapies, such as gene therapies, for inhibiting cell proliferation and/or treating cancer. | 07-17-2014 |
20140199693 | METHOD OF ANALYSING A BLOOD SAMPLE OF A SUBJECT FOR THE PRESENCE OF A DISEASE MARKER - The present invention relates to a method of analysing a blood sample of a subject for the presence of a disease marker, said method comprising the steps of a) extracting nucleic acid from anucleated blood cells in said blood sample to provide an anucleated blood cells-extracted nucleic acid fraction, and b) analysing said anucleated blood cells-extracted nucleic acid fraction for the presence of a disease marker, wherein said disease marker is a disease-specific mutation in a gene of a cell of said subject, or wherein said disease marker is a disease-specific expression profile of genes of a cell of said subject. | 07-17-2014 |
20140199694 | MAJOR QTLS CONFERRING RESISTANCE OF CORN TO FIJIVIRUS - The invention relates to methods and compositions for identifying maize plants that have newly conferred resistance or enhanced resistance to, or are susceptible to, a Fijivirus, particularly Mal de Rio Cuarto Virus (MRCV) and/or Maize Rough Dwarf Virus (MRDV). The methods use molecular genetic markers to identify, select and/or construct resistant plants or identify and counter-select susceptible plants. Maize plants that display newly conferred resistance or enhanced resistance to a Fijivirus that are generated by the methods of the invention are also a feature of the invention. | 07-17-2014 |
20140199695 | Materials and Methods for Identifying Spinal Muscular Atrophy Carriers - Materials and methods for identifying carriers of genetic determinants of spinal muscular atrophy are disclosed. In particular, polymorphisms in linkage disequilibrium are associated as markers of spinal muscular atrophy alleles detectable by various techniques, including multiplex ligation-dependent probe analysis, sequence analysis, and RFLP detection. The materials and methods of the disclosure are particularly useful in identifying silent (2+0) carriers of spinal muscular atrophy in which two copies of the SMN1 gene are located on a single human chromosome 5 and no copies of the gene are located on the chromosome 5 homolog. | 07-17-2014 |
20140199696 | METHYLATION BIOMARKERS FOR OVARIAN CANCER - Different combinations of methylation status based biomarkers can be used to test for ovarian cancer with high sensitivity and high specificity. | 07-17-2014 |
20140199697 | QUANTIFICATION AND MOLECULAR DETECTION OF LACTIC ACID BACTERIA IN A SAMPLE - Methods and compositions are disclosed for detection of probiotic bacteria strains intentionally provided to animals comprising: providing an animal with a known amount or number of probiotic bacteria; following a pre-determined time, obtaining a biological sample suspected of comprising the inoculated probiotic bacteria from the animal; and quantitatively detecting the amount of probiotic bacteria in the biological sample. | 07-17-2014 |
20140199698 | METHODS OF PREDICTING AND DETERMINING MUTATED mRNA SPLICE ISOFORMS - Mutations that affect mRNA splicing often produce multiple mRNA isoforms containing different exon structures. Definition of an exon and its inclusion in mature mRNA relies on joint recognition of both acceptor and donor splice sites. The instant methodology predicts cryptic and exon skipping isoforms in mRNA produced by splicing mutations from the combined information contents and the distribution of the splice sites and other regulatory binding sites defining these exons. In its simplest form, the total information content of an exon, R | 07-17-2014 |
20140205998 | METHOD FOR ENHANCING EXTRACTION EFFICIENCY OF MIRNA FROM CELLS BY THE ADDITION OF TRITON X-100 - The present invention relates to a method for improving detection efficiency of miRNAs existing in cells in trace amounts by adding Triton X-100. In accordance with the present invention, miRNAs existing in a sample in trace amounts can be quantitatively analyzed in short time. Further, the miRNA detection method according to the present invention wherein Triton X-100 is used can improve detection efficiency by about 2 times as compared to when only a TRIzol reagent is used. | 07-24-2014 |
20140205999 | COMPOSITIONS FOR DETECTING SMALL RNAS - Compositions and reaction mixtures are provided for the detection of small RNA target nucleic acids, preferably miRNA target nucleic acids, wherein the compositions and reaction mixtures provide for sensitive and specific detection of the target nucleic acids. The compositions and reaction mixtures include one or more of a first amplification oligomer that is preferably an extender primer, a target capture oligomer that is preferably at least partially double stranded, a promoter primer/provider, a reverse primer that is preferably a universal primer and a detection probe. The compositions and reaction mixtures are useful for diagnostics, prognostics, monitoring the effectiveness of treatment and/or determining a treatment. | 07-24-2014 |
20140206000 | SEQUENCE AMPLIFICATION WITH LINEAR PRIMERS - The present disclosure relates to the amplification of target nucleic acid sequences for various sequencing and/or identification techniques. The use of these primers, as described herein, allows for the reduction in the amplification of nonspecific hybridization events (such as primer dimerization) while allowing for the amplification of the target nucleic acid sequences. | 07-24-2014 |
20140206001 | METHODS AND COMPOSITIONS FOR ENRICHMENT OF NUCLEIC ACIDS IN MIXTURES OF HIGHLY HOMOLOGOUS SEQUENCES - Provided are methods of enrichment and detection of target nucleic acids during target amplification in the presence of excess amounts of highly homologous sequences, said methods having substantial diagnostic utility (e.g., cancer diagnostics). Provided are amplification reaction mixtures having at least one cleavage-directing oligonucleotide, the respective binding sites of which, for the target and homologous sequences, include one or more nucleotide positions differing in sequence between the target homologous sequences. During target sequence amplification in the presence of DNA polymerase activity, a FEN1 activity, one or more amplification primers, deoxynucleoside 5′-triphosphates and other reagents suitable to support amplification of both target and homologous nucleic acid sequences, the cleavage-directing oligonucleotide hybridizes to the homologous sequence and its amplification products resulting in a FEN1-mediated cleavage of these sequences providing for increased amounts of the target nucleic acid sequence relative to that of the homologous nucleic acid sequences. | 07-24-2014 |
20140206002 | Methods of Diagnosing Breast Cancer - The disclosed subject matter is based on the discovery that a mutation (a single nucleotide polymorphism or “SNP”) in the gene encoding Abraxas (also referred to as ABRA1, CCDC98 or FAM175A), is associated with susceptibility to cancer, e.g., breast cancer. In particular, the disclosed subject matter is based on the identification of a heterozygous alteration in the Abraxas gene that is associated with breast cancer and specifically correlated with familial cancer. Accordingly, the SNP disclosed herein is useful for diagnosing, prognosing, screening for, and evaluating predisposition to cancer in humans. The disclosed subject matter also provides nucleic acid molecules containing the SNP, methods and reagents for the detection of the SNP, and assays or kits for detection of the SNP. | 07-24-2014 |
20140206003 | Genetic Lesion Associated with Cancer - The invention comprises methods for identifying mutations within the 3′UTR of genes that lead to increased risk or probability of developing cancer. | 07-24-2014 |
20140206004 | RATIONALE, METHODS, AND ASSAYS FOR IDENTIFYING HUMAN AND NON-HUMAN PRIMATE TASTE SPECIFIC GENES AND USE THEREOF IN TASTE MODULATOR AND THERAPEUTIC SCREENING ASSAYS - This invention relates to novel rationale and methods for identifying human and primate taste-specific genes, including genes involved in salty taste perception, especially human salty taste perception, but also genes involved in sweet, bitter, umami, and sour taste perception, and genes involved in other taste cell or taste receptor related activities such as digestive function and digestive related diseases, taste cell turnover, immunoregulation of the oral and digestive tract, and metabolic regulation such as in diabetes and obesity, the genes identified using these methods, and assays for identifying taste modulators (enhancers or blockers) and potential therapeutics using these genes. These compounds have potential application in modulating (enhancing or blocking) taste perception, especially salty taste perception and as potential therapeutics. In addition, this invention relates to novel methods for identifying taste-specific genes that can be used as markers for different taste cell types, including sweet, bitter, umami, sour, salty, and other taste cells in mammals as well as assays that measure the activity of the sweet, bitter, umami, or sour receptor in the presence of these genes to identify modulators of sweet, bitter, umami, and sour taste and to identify therapeutics especially for treating digestive or metabolic disorders, taste loss, and oral infections. Particularly, the genes identified herein and antibodies or oligos thereto can be used as markers to identify and/or purify specific taste cells e.g., from taste cell suspensions by use of FACS or magnetic bead cell selection or other known cell purification and isolation procedures. | 07-24-2014 |
20140206005 | Method and Kit for DNA Typing of HLA Gene - The purpose of the present invention is to provide a method and kit for highly precise DNA typing, in which ambiguity derived from phase ambiguity is eliminated. The present invention provides a method for the DNA typing of HLA, which is characterized by comprising: (1) a step of preparing a set of primers which can respectively anneal specifically to an upstream region and a downstream region of each of HLA-A, HLA-B, HLA-C, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB1 gene in the nucleotide sequence for the human genome, and a set of primers which can respectively anneal specifically to exon-2 and a 3′-side non-translated region in HLA-DRB1; (2) a step of carrying out the PCR amplification of a sample to be tested (DNA) using the sets of primers; (3) a step of determining the nucleotide sequence for a PCR-amplified product; and (4) an optional step of carrying out the homology search in a data base. | 07-24-2014 |
20140206006 | SINGLE CELL CLASSIFICATION METHOD, GENE SCREENING METHOD AND DEVICE THEREOF - Provided are a single cell classification method, a gene screening method and a device for implementing the method. In that, the single cell classification method includes the following steps: sequencing the whole genomes of a plurality of single cell samples from the same group, respectively, so as to obtain reads from each single cell sample; aligning the reads from each single cell sample to the sequence of a reference genome, respectively, and performing data filtering on said reads; on the basis of the filtered reads, determining a consistent genotype of each single cell sample, in which consistent genotypes of all the single cell samples constitute an SNP dataset of said group; aimed at said each single cell, on the basis of the SNP dataset of said group, determining a corresponding genotype for each cell at a site corresponding to a position in an SNP dataset of the reference genome; and selecting an SNP site associated with cell mutation, and on the basis of the genotype of said single cell at the site, classifying said single cell. | 07-24-2014 |
20140212869 | Nucleic Acid Proximity Assay Involving the Formation of a Three-way junction - Provided herein is a proximity assay that, in certain embodiments, involves: (a) hybridizing a first oligonucleotide and a second oligonucleotide with a target nucleic acid, wherein the first oligonucleotide comprises: i. a region that is complementary to a first sequence in the target nucleic acid and ii. a barcode sequence; and the second oligonucleotide comprises i. a region that is complementary to a second region in the target and ii. the complement of the barcode sequence; and (b) detecting hybridization between the barcode sequence and the complement of the barcode sequence, wherein hybridization between the barcode sequence and the complement of the barcode sequence indicates that the first and second target sequences are proximal to one another in the sample. | 07-31-2014 |
20140212870 | FET Sensors With Subtractive Probes for Indirect Detection and Methods - The present invention relates to compositions on a FET sensor for detecting wide variety of biological entities. The composition of the FET sensor comprises a linker probe having a region for binding a biological entity, and enzymatic region that can cleave or change the position of a cargo molecule bound to the linker probe. The binding of the biological entity may cause a first strand of DNA to dehybridize from a second strand of DNA resulting in a change in conductance of the FET sensor. When the conformation of the probe changes, the conductance of the FET changes. This method provides an advantage over the conventional FET biosensors that use antibodies as probes since the size of nucleotide aptamer probes is smaller, their conformation/shape is well controlled, and their charge is fixed for a wider range of solution conditions, enabling robust detection of target entities with high sensitivity and specificity. | 07-31-2014 |
20140212871 | Nucleic Acid Extraction from Heterogeneous Biological Materials - Methods for extracting high quality nucleic acids from a heterogenous collection of nucleic acid-containing materials from a biological sample are disclosed. The heterogenous collection of nucleic-acid containing materials may contain cells or microvesicles, or both. The extractions obtained by the methods described herein are characterized by high yield and high integrity, making the extracted nucleic acids useful for various applications in which high quality nucleic acid extractions are preferred, e.g., a diagnosis, prognosis, or therapy evaluation for a medical condition. | 07-31-2014 |
20140212872 | Identity Elucidation of Unknown Metabolites - A method of elucidating the identity of an unknown metabolite comprising measuring amounts of known and unknown metabolites in subjects; associating the unknown metabolite with a specific gene from a gene association study; determining a protein associated with the specific gene and analyzing information for the protein; associating the unknown metabolite with concentrations and/or ratios of other metabolites in subjects; obtaining chemical structural data for the unknown metabolite; and using the information obtained to elucidate the identity of the unknown metabolite. | 07-31-2014 |
20140212873 | TREATMENT AND DIAGNOSIS OF EPIGENETIC DISORDERS AND CONDITIONS - The present disclosure relates generally to the field of epigenetics and in particular epigenetic profiles associated with a pathological condition. The present specification teaches screening of individuals and populations for epigenetic profiles associated with a pathological condition. Epigenetic profiles are disclosed from the following sites in the FMR1 gene: FREE3, intron 2, an intron, intron/exon boundary and/or splicing region downstream of intron 2, and a site within the FREE2 portion of intron 1 in combination with a FM. Epigenetic profiles are also disclosed from a region in the FMR genetic locus selected from an intron, intron/exon boundary, a splicing region or an intragenic region in combination with an expansion mutation. Kits and diagnostic assays are also taught herein as are computer programs to monitor changes in epigenetic patterns and profiles. Further enabled herein is a method for screening for agents which can reduce or mask the adverse effects of epigenetic modification and the use of these agents in therapy and prophylaxis. | 07-31-2014 |
20140212874 | ENHANCED PROBE BINDING - Methods for enhancing the binding of oligonucleotide probes to DNA and RNA are disclosed. The methods make use of thermodynamic and kinetic effects to reduce probe mismatches and failure of complementary probes to bind to DNA and RNA templates. Mapping and sequencing of the probed DNA and RNA samples are contemplated herein. | 07-31-2014 |
20140212875 | Human Metabolically Active Brown Adipose Derived Stem Cells - A method of distinguishing a brown adipose cell from a white adipose cell. In one embodiment the method includes measuring the expression level of one or more genes in an adipose cell; comparing the measured expression levels to a control, and correlating the expression level of the one or more genes to an identity as a white adipose cell or a brown adipose cell. In one embodiment the one or more genes are selected from the genes listed in FIG. | 07-31-2014 |
20140212876 | TARGETING C-REL O-GLCNACYLATION AND USES THEREOF - Serine 350 has been identified as the site of O-GlycNAcylation of c-Rel. Methods are provided for identifying compositions capable of blocking c-Rel activation. The methods generally involve identifying compounds that inhibit O-GlcNAcylation of c-Rel at the serine 350 residue, thereby preventing c-Rel activation and production of c-Rel-dependent cytokines. | 07-31-2014 |
20140212877 | MAIZE LINKAGE DRAG AND GENOME ANALYSIS PROCESS - This invention relates to a method for improving a maize linkage drag and genome analysis process. Some embodiments produce a significant cost and time reduction in plant breeding projects. Particular embodiments concern a method to determine one amount of linkage drag flanking a desired, introgressed trait and to determine a recurrent parent percentage performed at a same stage of plant growth. This disclosure also concerns selecting plants containing the desired, introgressed trait based on results of genome analysis. | 07-31-2014 |
20140212878 | Mutation Detection Assay - A method of sample analysis is provided. In certain embodiments, the method involves: a) amplifying a product from a sample that comprises both wild type copies of a genomic locus and mutant copies of the genomic locus that have a point mutation relative to said wild type copies of the genomic locus, to produce an amplified sample, where: i. the amplifying is done using a first primer and a second primer; and ii. the first primer comprises a 3′ terminal nucleotide that base pairs with the point mutation and also comprises a nucleotide sequence that is fully complementary to a sequence in the locus with the exception of a single base mismatch within 6 bases of the 3′ terminal nucleotide; and b) detecting the presence of said product in said amplified sample using a flap assay that employs an invasive oligonucleotide. A kit for performing the method is also provided. | 07-31-2014 |
20140212879 | METHOD FOR DETECTING TOXIN-PRODUCING CLOSTRIDIUM DIFFICILE - Provided are an oligonucleotide which realizes specific and highly sensitive detection of toxigenic | 07-31-2014 |
20140220561 | QUANTITATIVE MULTIPLEX METHYLATION-SPECIFIC PCR - Methods are provided for diagnosing in a subject a condition, such as a carcinoma, sarcoma or leukemia, associated with hypermethylation of genes by isolating the genes from tissue containing as few as 50 to 1000 tumor cells. Using quantitative multiplex methylation specific PCR (QM-MSP), multiple genes can be quantitatively evaluated from samples usually yielding sufficient DNA for analyses of only 1 or 2 genes. DNA sequences isolated from the sample are simultaneously co-amplified in an initial multiplex round of PCR, and the methylation status of individual hypermethylation-prone gene promoter sequences is then determined separately or in multiplex using a real time PCR round that is methylation status-specific. Within genes of the panel, the level of promoter hypermethylation as well as the incidence of promoter hypermethylation can be determined and the level of genes in the panel can be scored cumulatively. The QM-MSP method is adaptable for high throughput automated technology. | 08-07-2014 |
20140220562 | Method of Predicting Responsiveness of B Cell Lineage Malignancies to Active Immunotherapy - Predictive biomarkers identify those patients suffering from immunoglobulin positive (Ig | 08-07-2014 |
20140220563 | Fluid Identification System and Production and Use Thereof - A fluid identification system comprising a plurality of particles, each particle encapsulating therein at least one tracer material having an identifiable DNA, the at least one tracer material being encapsulated by an encapsulation material, wherein the particles are adapted to retain the at least one tracer material in an encapsulated form after exposure of the particles to a temperature of at least 75° C. and/or a pressure of at least 1000 psi (6.9×10 | 08-07-2014 |
20140220564 | TT1 AND TTG1 Control Seed Coat Color In Brassica - Seed coat color is a very important trait in oilseed type | 08-07-2014 |
20140220565 | Microbe Detection Via Hybridizing Magnetic Relaxation Nanosensors - Disclosed herein are methods and materials for facilitating the detection of nucleic acid analytes of interest. Specifically exemplified herein are methods for detecting mycobacterial microorganisms, namely | 08-07-2014 |
20140220566 | MATERIALS AND METHODS FOR DETERMINING SENSITIVITY POTENTIAL OF COMPOUNDS - The invention concerns in vitro proteomic analysis of cells to determine the sensitizing potential (including allergic potential) of compounds on said cells. Several protein markers are provided that allow assays to be performed to determine whether a chemical has a sensitizing potential of contact and/or respiratory sensitizers. | 08-07-2014 |
20140220567 | DISCRIMINATION OF BLOOD TYPE VARIANTS - The present invention provides a method for detecting the presence or absence of, or for discriminating between, blood type variants, including RHD*r′s, RHD*DIIIa, RHD*DIVa-2, RHCE*cs | 08-07-2014 |
20140220568 | MEANS AND METHODS FOR THE DETERMINATION OF PREDICTION MODELS ASSOCIATED WITH A PHENOTYPE - The disclosure provides methods and means for identifying plants comprising a plant phenotype of interest. In particular, the disclosure provides breeding tools that can be used for the selection of a plant comprising a phenotype of interest and for the selection of an optimal plant genotype for the introduction of a trait. | 08-07-2014 |
20140220569 | DIGITAL ASSAY FOR TELOMERE LENGTH - Digital assay system, including methods and apparatus, for characterizing telomere length. | 08-07-2014 |
20140220570 | METHODS AND COMPOSITIONS FOR RISK PREDICTION, DIAGNOSIS, PROGNOSIS, AND TREATMENT OF PULMONARY DISORDERS - The invention provides diagnostic and therapeutic targets for pulmonary disease, in particular, fibrotic lung disease. The inventors have found that a genetic variant MUC5B gene is associated with increased expression of the gene, increased risk of developing a pulmonary disease, and an improved prognosis and survival among those developing the pulmonary disease. | 08-07-2014 |
20140220571 | TRANSGENIC PLANT EVENT DETECTION - The present invention relates to detection of materials derived from transgenic plant events. In particular, the invention provides methods, reagents, kits and reference materials for detecting the presence or absence in a sample of genetic material derived from and attributable to select transgenic plant events. | 08-07-2014 |
20140220572 | METHOD AND SYSTEM TO DETECT, DIAGNOSE, AND MONITOR THE PROGRESSION OF ALZHEIMER'S DISEASE - Various embodiments provide methods for the detection, the diagnosis, and/or the progression monitoring of Alzheimer's disease by observing the epigenetic markers in leukocytes. Methods for determining a state of Alzheimer's disease are provided. Accordingly, these methods can comprise the steps of placing a sample comprising at least one blood component onto a substrate labeling the sample to identify at least one epigenetic marker; determining an amount of the at least one epigenetic marker; comparing the amount to a reference value; and determining a state of Alzheimer's disease. | 08-07-2014 |
20140220573 | EMBODIMENTS OF A PROBE AND METHOD FOR TARGETING NUCLEIC ACIDS - Disclosed embodiments concern a probe comprising one or more pairs of monomers capable of targeting a nucleic acid target. The pair of monomers may be arranged in a manner that promotes thermoinstability of the probe complex, thus producing a probe capable of locating and/or detecting a target. The probe also may comprise one or more natural or non-natural nucleotides capable of Watson-Crick base pairing with an isosequential nucleic acid target. Particular disclosed embodiments concern a method of using the disclosed probe to target nucleic acids. In particular disclosed embodiments, the probe may be incubated with a target nucleic acid and then be detected. | 08-07-2014 |
20140220574 | METHODS FOR FIXING AND DETECTING RNA - The invention provides a method for fixing an RNA molecule in a biological sample. The method comprises contacting the biological sample with an aldehyde-containing fixative, and subsequently contacting the sample with a solution comprising a carbodiimide and a heterocyclic derivative selected from the group consisting of an imidazole, pyrazole, triazole or tetrazole or a combination thereof. A method for differentiating cells in a biological sample is also provided. A method for quantification of RNA retention in a biological sample is also provided. A kit for fixing RNA in a sample is provided as well. | 08-07-2014 |
20140220575 | ARTIFICIAL SELECTION METHOD AND REAGENTS - The present invention provides methods for estimating the breeding value of individuals in populations such as those having small effective population size (Ne) e.g., to identify selection candidates having high breeding values, wherein the methods comprise inferring one or more genotypes for one or more markers at a locus or QTL to be the same as for an ancestor or founder or a subset of ancestors and/or founders from which a corresponding chromosome segment is derived and estimating the breeding value of the individual based on the inferred genotype(s). | 08-07-2014 |
20140220576 | COMBINATORIAL DNA TAGGANTS AND METHODS OF PREPARATION AND USE THEREOF - DNA taggants in which the nucleotide sequences are defined according to combinatorial mathematical principles. Methods of defining nucleotide sequences of the combinatorial DNA taggants, and using such taggants for authentication and tracking and tracing an object or process are also disclosed. | 08-07-2014 |
20140234834 | METHOD FOR QUANTIFYING HUMAN DNA - The invention provides for a method for quantifying one or more nucleic acids of a genome in a sample comprising the steps of (a) amplifying a first nucleic acid to be quantified, (b) determining the amount of said first nucleic acid by comparison of the amount of amplification product from said first nucleic acid with at least one amplification product from a second template nucleic acid, (c) wherein said second template nucleic acid was generated using whole genome amplification and wherein the starting concentration of the second template nucleic acid is known. | 08-21-2014 |
20140234835 | RARE CLONOTYPES AND USES THEREOF - The invention is directed to a method of selecting disease-correlated clonotypes that have a reduced likelihood of producing a false positive signal of relapse when used to monitor minimal residual disease. In accordance with the invention, candidate correlating clonotypes are obtained from a patient, the rarity of each is determined either by comparison with a clonotype database or a clonotype model, and one or more of the rarest of such clonotypes are used to monitor the minimal residual disease. | 08-21-2014 |
20140234836 | Mutation Detection Assay - A method of sample analysis is provided. In certain embodiments, the method involves: a) amplifying a product from a sample that comprises both wild type copies of a genomic locus and mutant copies of the genomic locus that have a point mutation relative to said wild type copies of the genomic locus, to produce an amplified sample, where: i. the amplifying is done using a first primer and a second primer; and ii. the first primer comprises a 3′ terminal nucleotide that base pairs with the point mutation and also comprises a nucleotide sequence that is fully complementary to a sequence in the locus with the exception of a single base mismatch within 6 bases of the 3′ terminal nucleotide; and b) detecting the presence of said product in said amplified sample using a flap assay that employs an invasive oligonucleotide. A kit for performing the method is also provided. | 08-21-2014 |
20140234837 | EPIGENETIC MARKER FOR THE IDENTIFICATION OF NATURAL KILLER CELLS - The present invention relates to a method, in particular an in vitro method for identifying a subgroup of natural killer cells of a mammal, preferably CD3−, non T-lymphocyte derived NK cells, which often express the surface proteins CD56 and/or CD16, comprising analyzing the accessibility of the genomic DNA for OSBPL, such as OSBPL5, to bisulfite conversion and/or the methylation status of at least one CpG position in the genes for OSBPL, such as OSBPL5, in particular in their upstream and/or downstream regulatory regions, the promoter, introns, exons and introns exon borders and other conserved regions of said genes, wherein an increase of the accessibility of the genomic DNA and/or a demethylation in the sample as analyzed is indicative for said subgroup of NK cells. The analyses according to the invention can identify CD56+ cells and distinguish them from all other cells such as, for example, either CD56− and/or CD56 bright cells. The methods of the present invention are useful for the identification, the detection, the quantification and quality assurance and control of NK cells. Furthermore, the present invention relates to a kit for performing the above methods as well as respective uses of the inventive methods or kits. The present invention furthermore provides an improved method for analysing the accessibility of the genomic DNA for OSBPL, such as OSBPL5, to bisulfite conversion and/or an analysis of the methylation status of at least one CpG position in the genes for OSBPL, such as OSBPL5, allowing for a precise analysis of both optimally and even from sub-optimal quality samples, such as non-freshly obtained blood, tissue or serum samples. | 08-21-2014 |
20140234838 | SQUARE WAVE THERMAL CYCLING - Embodiments disclosed herein relate to methods and systems for analysis of melting temperatures, and particularly to analysis of duplex nucleic acids. | 08-21-2014 |
20140234839 | Method for the Cytological Analysis of Cervical Cells - The invention provides for a diagnostic test to monitor cancer-specific genetic abnormalities to diagnose cervical cell disorders and predict which patients might progress to cancer. Genetic abnormalities are detected by identification in chromosomal copy number of chromosome 3 and chromosome 5 using FISH analysis of probes targeted to 3q and/or 5p. | 08-21-2014 |
20140234840 | MOLECULAR MARKERS LINKED TO PPO INHIBITOR TOLERANCE IN SOYBEANS - This invention relates generally to the detection of genetic differences among soybeans. More particularly, the invention relates to soybean quantitative trait loci (QTL) for tolerance to protoporphyrinogen oxidase inhibitors, to soybean plants possessing these QTLs, which map to a novel chromosomal region, and to genetic markers that are indicative of phenotypes associated with protoporphyrinogen oxidase inhibitor tolerance. Methods and compositions for use of these markers in genotyping of soybean and selection are also disclosed. | 08-21-2014 |
20140234841 | COMPOSITIONS, METHODS AND KITS TO DETECT DICER GENE MUTATIONS - In one aspect, the disclosure provides isolated nucleic acids, polypeptides, primers, and probes for the detection of mutations in a nucleic acid sequence for a DICER1 polypeptide. | 08-21-2014 |
20140234842 | Mutations Associated With Cystic Fibrosis - The present invention provides novel mutations identified in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that can be used for a more accurate diagnosis of cystic fibrosis (CF) and CF related disorders. Methods for testing a sample obtained from a subject to determine the presence of one or more mutations in the CFTR gene are provided wherein the presence of one or more mutations indicates that the subject has CF or a CF related disorder, or is a carrier of a CFTR mutation. | 08-21-2014 |
20140234843 | METHODS AND COMPOSITIONS FOR EXPANDING CELLS AND IMPROVING ENGRAFTMENT - Methods of expanding FCs or stem cells are provided herein, as are methods of screening for compounds that increase expression of DOCK2 or decrease expression of Arhgap18, either of which improves engraftment. | 08-21-2014 |
20140234844 | HYBRIDIZATION COMPOSITIONS AND METHODS USING FORMAMIDE - The invention provides methods and compositions for hybridizing at least one molecule to a target. The composition comprises at least one nucleic acid sequence, formamide, and a hybridization solution, wherein the concentration of formamide is less than or equal to 25%. | 08-21-2014 |
20140242577 | C-PROBE LIBRARIES FOR DNA TARGET ENRICHMENT - Provided herein is a method for enriching a target nucleic acid molecule. In one embodiment, the method may involve hybridizing a C-probe to a strand of a target nucleic acid to produce a complex, enzymatically removing any 3′ overhanging end from the target nucleic acid of the complex to produce a 3′ hydroxyl group at the 3′ end; extending the 3′ end of the first sequence using the oligonucleotide sequence of the C-probe as a template; enzymatically removing any 5′ overhanging end from the target nucleic acid, either before or after the extending step, to produce an 5′ phosphate group at the end of the second sequence; and ligating the 5′ phosphate group at the end of the second sequence to the 3′ hydroxyl group at the end of the first sequence to produce a circular DNA molecule that contains the target sequence and the complement of the oligonucleotide sequence. | 08-28-2014 |
20140242578 | SIMULTANEOUS DETECTION OF MULTIPLE MIRNAS USING CAPILLARY ELECTROPHORESIS SYSTEM EQUIPPED WITH PLURAL LASER-INDUCED FLUORESCENCE DETECTORS - The present invention relates to a method for simultaneously detecting multiple miRNAs present in a sample and a kit for detecting same. According to the present invention, two or more miRNAs existing in trace amounts in a sample can be analyzed through only one measurement. The detection method of the present invention may be used for fast diagnosis of various diseases wherein miRNAs are involved, for example, cardiovascular diseases including myocardial infarction, with high accuracy. | 08-28-2014 |
20140242579 | REVERSIBLE TERMINATOR MOLECULES AND METHODS OF THEIR USE - The present invention relates generally to methods of sequencing of polynucleotides and compounds, compositions and kits useful for sequencing of polynucleotides. The chemical compounds include nucleotide and nucleoside analogs which possess a blocking group covalently attached to the 3′ hydroxyl of the sugar moiety. The blocking group may optionally be additionally covalently attached to a linker and/or detectable label. The nucleotide analogs may be ribonucleotide or deoxyribonucleotide analogs. Methods include incorporation of the reversible terminator molecules into growing polynucleotide strands by polymerase enzymes, such as in single base sequencing methodologies utilizing sequential reversible termination techniques. | 08-28-2014 |
20140242580 | METHOD FOR PREDICTING RESPONSE OR PROGNOSIS OF LUNG ADENOCARCINOMA WITH EGFR-ACTIVATING MUTATIONS - The invention provides a method for predicting the response of an EGFR-activating mutant subject suffering from a lung adenocarcinoma and receiving treatment with epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) and a method for predicting prognosis in an EGFR-activating mutant subject suffering from a lung adenocarcinoma and receiving treatment with EGFR-TKI. In the methods of the invention, clustered genomic alterations in specific chromosomes (in particular chromosomes 5p, 7p, 8q or 14q) are determined as a tool for predicting the response or prognosis. | 08-28-2014 |
20140242581 | COMPOSITIONS AND METHODS FOR GENETIC ANALYSIS OF EMBRYOS - The present disclosure provides for compositions and methods for genetic analysis of embryos. Generally, the compositions and methods provide for the acquisition of an sample containing RNA from an embryo, genetic analysis involving various techniques such as sequencing-, hybridization- or amplification-based methods, and the detection of genetic alterations that may affect the health and quality of the embryo. In some cases, compositions and methods of this disclosure may provide information useful in the selection and monitoring of embryos for implantation into a female. | 08-28-2014 |
20140242582 | DETECTION OF GENETIC ABNORMALITIES USING LIGATION-BASED DETECTION AND DIGITAL PCR - The present invention provides assays systems and methods for detection of genetic variants in a sample, including copy number variation and single nucleotide polymorphisms. The invention preferably employs the technique of tandem ligation, i.e. the ligation of two or more fixed sequence oligonucleotides and one or more bridging oligonucleotides complementary to a region between the fixed sequence oligonucleotides combined with digital PCR detection. | 08-28-2014 |
20140242583 | ASSAYS, METHODS AND COMPOSITIONS FOR DIAGNOSING CANCER - The present invention provides a method and single-tube assay for identification and quantitative analysis of differentially methylated MLH1 promoter sequences that are associated with certain types of cancer in an individual by obtaining a biological sample comprising DNA from the individual, detecting the presence of and measuring the level of methylated MLH1 promoter sequences, and comparing the presence of and level of methylation in the sample to a normalization reference of “normal” beta-actin gene promoters, wherein a difference in the level or pattern of MLH1 methylation of the sample compared to the Actin gene reference level identifies abnormally methylated MLH1 promoter sequences associated with cancer. | 08-28-2014 |
20140242584 | GENOMIC DNA EXTRACTION REAGENT AND METHOD - The present invention is directed to a genomic DNA extraction reagent and method for improved extraction of DNA from biological tissue. The extraction reagent of the invention is mixed with disrupted biological tissue to form a DNA extraction solute which is incubated in a DNA extraction step. The extraction reagent includes an alkali component to maintain the DNA extraction solute at a pH of about 10 to 14 substantially throughout the extraction step. The extraction solute is centrifuged to clarify the supernatant. The supernatant containing the extracted DNA is diluted with a neutralizing buffer resulting in a high throughout method of generating high quantities of high quality DNA. Major PCR inhibitors are managed with the unique chemical combinations of the DNA extraction reagent designed and optimized for extraction of DNA from plant tissue and cells. | 08-28-2014 |
20140242585 | Genetic Test for the Identification of Carriers of Complex Vertebral Malformations in Cattle - Genetic markers for identifying bovine carriers of complex vertebral malformation (CVM) disease gene are described. The genetic markers, including the microsatellite markers BM4129, INRAA003, BMS2790, ILSTS029, INRA123, BM220, HUJ246, BMS862, BMS937, BL1048, BMS2095 and BMS1266 and the bovine SLC35A3 gene, are located on bovine chromosome BTA3. The G/T polymorphism at position 559 of the bovine SLC35A3 gene is identified as being causative and diagnostic for CVM in cattle. | 08-28-2014 |
20140242586 | CHIMERIC PRIMERS WITH HAIRPIN CONFORMATIONS AND METHODS OF USING SAME - Methods and compositions for nucleic acid amplification, detection, and genotyping techniques are disclosed. In one embodiment, a nucleic acid molecule having a target-specific primer sequence; an anti-tag sequence 5′ of the target-specific primer sequence; a tag sequence 5′ of the anti-tag sequence; and a blocker between the anti-tag sequence and the tag sequence is disclosed. Compositions containing such a nucleic acid molecule and methods of using such a nucleic acid molecule are also disclosed. | 08-28-2014 |
20140242587 | Rapid and Reliable Detection of Infectious Agents - The present invention is directed to devices, systems and methods that enable the detection of low copy numbers of bacterial polynucleotides in a sample without having to use multiple species specific primer sequences. | 08-28-2014 |
20140242588 | METHODS AND PROCESSES FOR NON-INVASIVE ASSESSMENT OF GENETIC VARIATIONS - Technology provided herein relates in part to methods, processes and apparatuses for non-invasive assessment of genetic variations. | 08-28-2014 |
20140242589 | HYBRIDIZATION COMPOSITIONS AND METHODS - The invention provides methods and compositions for hybridizing at least one molecule to a target. The invention may, for example, utilize a of cyclic and/or non-cyclic solvent that is non-toxic and may eliminate or reduce the amount of formamide in the hybridization composition. | 08-28-2014 |
20140242590 | FLT3 MUTATIONS ASSOCIATED WITH DRUG RESISTANCE IN AML PATIENTS HAVING ACTIVATING MUTATIONS IN FLT3 - The invention provides methods and compositions for identifying acute myeloid leukemia (AML) patients that have an increased likelihood of a relapse following treatment with AC 220. | 08-28-2014 |
20140248609 | GENE DETECTION ASSAY FOR IMPROVING THE LIKELIHOOD OF AN EFFECTIVE RESPONSE TO AN EGFR ANTAGONIST CANCER THERAPY - The invention provides a method for more effective treatment of patients susceptible to or diagnosed with tumors overexpressing EGFR, as determined by a gene amplification assay, with an EGFR antagonist. Such method comprises administering a cancer-treating dose of the EGFR antagonist, preferably in addition to chemotherapeutic agents, to a subject in whose tumor cells erbB1 gene has been found to be amplified e.g., by fluorescent in situ hybridization. EGFR antagonists described include an anti-EGFR antibody. | 09-04-2014 |
20140248610 | Reagents, Methods, and Libraries for Bead-Based Sequencing - The present invention provides methods for determining a nucleic acid sequence by performing successive cycles of duplex extension along a single stranded template. The cycles comprise steps of extension, ligation, and, preferably, cleavage. In certain embodiments the methods make use of extension probes containing phosphorothiolate linkages and employ agents appropriate to cleave such linkages. The invention provides methods of determining information about a sequence using at least two distinguishably labeled probe families. In certain embodiments the methods acquire less than 2 bits of information from each of a plurality of nucleotides in the template in each cycle. In certain embodiments the sequencing reactions are performed on templates attached to immobilized beads. The invention further provides sets of labeled extension probes containing phosphorothiolate linkages. In addition, the invention includes performing multiple sequencing reactions on a single template by removing initializing oligonucleotides and extended strands and performing subsequent reactions using different initializing oligonucleotides. | 09-04-2014 |
20140248611 | NUCLEIC ACID PROBE FOR ASSAYING NUCLEIC ACIDS - Objects are to provide nucleic acid probes, which in the detection of target nucleic acids with fluorescent quenching probes, can assay a greater variety of target nucleic acids at the same time while suppressing increases in assay labor and cost, and also a method for assaying target nucleic acids by using the nucleic acid probes. | 09-04-2014 |
20140248612 | COMPOSITIONS AND METHODS FOR DETECTING ALLELIC VARIANTS - The present invention provides compositions, methods, and kits for discriminating sequence variation between different alleles. More specifically, in some embodiments, the present invention provides compositions, methods, and kits for determining the presence and/or level (e.g., quantitating) of rare (e.g., mutant) allelic variants, such as single nucleotide polymorphisms (SNPs) or nucleotide insertions or deletions, in samples comprising abundant (e.g., wild-type) allelic variants with high sensitivity and/or specificity. As such, in certain embodiments, the present invention provides a highly selective method for the detection of somatic mutations, e.g., in samples containing abundant levels of a wild-type allele compared to very low levels of a mutant allele. | 09-04-2014 |
20140248613 | AUTOMATIC DETECTION KIT FOR DETECTING HLA ALLELES USING REAL-TIME POLYMERASE CHAIN REACTION - Provided is an automatic detection kit for automatically detecting HLA alleles using a real-time polymerase chain reaction (PCR). The real-time PCR is performed on DNA isolated from a sample using a primer which is able to specifically bind to HLA alleles and a fluorescent probe which is able to detect amplification of the HLA alleles in real time, and the HLA allele typing is performed by analyzing a fluorescence value obtained from the real-time PCR using an HLA automatic typing. | 09-04-2014 |
20140248614 | METHODS, PRIMERS, PROBES AND KITS USEFUL FOR THE DETECTION OF BRAF MUTATIONS - The present invention relates to methods, primers and probes useful for detecting the presence of mutant BRAF sequences in a sample, specifically for detecting the presence of the BRAF V600E, V600D, V600K, and V600M mutations. | 09-04-2014 |
20140248615 | GENETIC VARIANTS ON CHR 11Q AND 6Q AS MARKERS FOR PROSTATE AND COLORECTAL CANCER PREDISPOSITION - It has been discovered that certain polymorphic markers on chromosome 6 and chromosome 11 are indicative of a susceptibility to prostate cancer and colon cancer. The invention describes diagnostic applications for determining a susceptibility to cancer using such markers, as well as kits for use in such applications. | 09-04-2014 |
20140248616 | METHODS OF MONITORING FLUID SAMPLES USING MULTI-DIMENSIONAL FLUID SENSORS - The present invention provides multi-dimensional sensors with fluidic flow channels for processing fluid samples. | 09-04-2014 |
20140248617 | MICROFLUIDIC FLOW CELL ASSEMBLIES FOR IMAGING AND METHOD OF USE - A microfluidic flow cell subassembly, which may be assembled into a flow cell having fluidic connections outside of the main substrate, is described for encapsulating a sample to allow for subsequent controlled delivery of reagents to the sample, such as multiplexed in situ biomarker staining and analysis. As configured, the subassembly comprises a substrate layer forms a flexible optically transparent lid which is capable of bending in either direction to alter the internal dimensions of the subassembly. Methods of use are also disclosed. | 09-04-2014 |
20140248618 | MICROFLUIDIC FLOW CELL ASSEMBLIES AND METHOD OF USE - A microfluidic flow cell subassembly, which may be assembled into a flow cell having fluidic connections outside of the main substrate, is described for encapsulating a sample to allow for subsequent controlled delivery of reagents to the sample, such as multiplexed in situ biomarker staining and analysis. The fluidic connectors are thin film fluidic connectors capable of connecting to a fluid delivery system. The subassembly may be sealed against a solid support to form a flow cell. Methods of use are also disclosed. | 09-04-2014 |
20140248619 | METHOD FOR DETECTING THE PRESENCE OF A NUCLEIC ACID IN A SAMPLE - An automated method for detecting the presence of a nucleic acid in a sample, where the method is performed within a housing of a self-contained, stand-alone analyzer. The method includes purifying the nucleic acid after it has been immobilized on a magnetically-responsive solid support. A pipette of the analyzer is used to form a reaction mixture comprising the purified nucleic acid and all reagents required to perform a nucleic acid amplification. Amplification products are synthesized that include a nucleotide sequence contained in the nucleic acid or the complement of the nucleic acid. The amplification products are exposed to a probe in a mixture, where the probe forms a hybrid with one of the amplification products. The formation of the hybrid in the mixture provides an indication of the presence of the nucleic acid in the sample. | 09-04-2014 |
20140255922 | Cotton polymorphisms and methods of genotyping - Polymorphic cotton DNA loci useful for genotyping between at least two varieties of cotton. Sequences of the loci are useful for providing the basis for designing primers and probe oligonucleotides for detecting polymorphisms in cotton DNA. Polymorphisms are useful for genotyping applications in cotton. The polymorphic markers are useful to establish marker/trait associations, e.g. in linkage disequilibrium mapping and association studies, positional cloning and transgenic applications, marker-aided breeding and marker-assisted selection, hybrid prediction and identity by descent studies. The polymorphic markers are also useful in mapping libraries of DNA clones, e.g. for cotton QTLs and genes linked to polymorphisms. | 09-11-2014 |
20140255923 | DISCRIMINATION OF BLOOD TYPE VARIANTS - The present invention provides a method for detecting the presence or absence of, or for discriminating between, blood type variants, including RHD*r′s, RHD*DIIIa and RHD*DIVa-2. The method comprises amplifying by PCR a sample obtained from a human subject at intron 3 of the RHD gene locus. The invention also provides products, in particular, probes, primers and kits for use in the method of the invention. | 09-11-2014 |
20140255924 | TWIST-TIE OLIGONUCLEOTIDE PROBES - A composition comprising population of labeled oligonucleotides is provided herein. In some embodiments, the probes are of the formula: T | 09-11-2014 |
20140255925 | MODIFIED RNASE H ENZYMES AND THEIR USES - The invention provides a provides improvements to assays that employ RNase H cleavage for biological applications related to nucleic acid amplification and detection, where the RNase H has been reversibly inactivated. | 09-11-2014 |
20140255926 | NUCLEIC ACID BEACONS FOR FLUORESCENT IN-SITU HYBRIDISATION AND CHIP TECHNOLOGY - The present invention relates to beacons for fluorescent in-situ hybridisation and chip technology. | 09-11-2014 |
20140255927 | RNA SPLICING ALTERATIONS AND U1 SMALL NUCLEAR RIBONUCLEOPROTEINS IN NEURODEGENERATIVE DISEASES - This disclosure relates to methods of diagnosing neurodegenerative disease by analyzing proteins or protein expression profiles in a subject, or RNA or RNA expression profiles in a subject. In certain embodiments, the disclosure contemplates the diagnosis of preclinical or symptomatic stages of Alzheimer's disease, mild cognitive impairment, or chronic traumatic encephalopathy by identification of components of U1 small nuclear ribonucleoproteins or fragments thereof which are capable of forming cytoplasmic tangle-like structures. | 09-11-2014 |
20140255928 | METHODS FOR TRUE ISOTHERMAL STRAND DISPLACEMENT AMPLIFICATION - Methods, primers and probes are provided for the isothermal amplification and detection, without denaturation, of double stranded nucleic acid targets for polymerase strand displacement amplification (“iSDA”). The methods and compositions disclosed are highly specific for nucleic acid targets with high sensitivity, specificity and speed that allow detection of clinical relevant target levels. The methods and compositions can easily be used to amplify or detect nucleic acid targets in biological samples. | 09-11-2014 |
20140255929 | MOSAIC TAGS FOR LABELING TEMPLATES IN LARGE-SCALE AMPLIFICATIONS - The invention relates to methods of labeling nucleic acids, such as fragments of genomic DNA, with unique sequence it referred to herein as “mosaic tag,” prior to amplification and/or sequencing. Such sequence tags are useful for identifying amplification and sequencing errors. Mosaic tags minimize sequencing and amplification artifacts due to inappropriate annealing priming, hairpin formation, or the like, that may occur with completely random sequence tags of the prior art. In one aspect, mosaic tags are sequence tags that comprise alternating constant regions and variable regions, wherein each constant region has it position in the mosaic tag and comprises a predetermined sequence of nucleotides and each variable region has a position in the mosaic tag and comprises a predetermined number of randomly selected nucleotides. | 09-11-2014 |
20140255930 | Materials and Methods Related to Dopamine Dysregulation Disorders - The present invention provides methods of identifying an increased risk of a dopamine dysregulation disorder in a human subject, including identifying increased risk of dementia, Parkinson's disease, Huntington's, epilepsy, mania, attention deficit disorder, anxiety, dyslexia, schizophrenia, depression, obsessive-compulsive disorders, alcoholism, obesity, addiction disorders, pathological gambling, attention deficit hyperactivity disorder, bipolar disorder, Tourette syndrome, substance dependence, sub stance abuse, substance overdose, and substance-related death. | 09-11-2014 |
20140255931 | SEQUENCE ASSEMBLY - The invention relates to assembly of sequence reads. The invention provides a method for identifying a mutation in a nucleic acid involving sequencing nucleic acid to generate a plurality of sequence reads. Reads are assembled to form a contig, which is aligned to a reference. Individual reads are aligned to the contig. Mutations are identified based on the alignments to the reference and to the contig. | 09-11-2014 |
20140255932 | Genotypes, Alleles and Molecular Markers Associated With Asian Soybean Rust, as Well as Methods, Processes and Uses Thereof - The present invention relates to screening methods for rust resistance or tolerance, in particular, Asian soybean rust (ASR— | 09-11-2014 |
20140255933 | SAMPLE ANALYSIS CHIP, SAMPLE ANALYSIS METHOD AND GENE ANALYSIS METHOD - A sample analysis chip of the present invention includes a base, a plurality of wells that are disposed on the base, a main channel, a first buffer portion that is in communication with a first end of the main channel and is capable of accommodating a portion of the solution, a second buffer portion that is in communication with a second end of the main channel and is capable of accommodating a portion of the solution, a solution supply channel a first end of which is in communication with the first buffer portion and a second end of which is opened to the atmosphere, an air vent channel a first end of which is in communication with the second buffer portion and a second end of which is opened to the atmosphere, and the channel that is disposed on the base and connected to the plurality of wells. | 09-11-2014 |
20140255934 | METHOD AND DEVICE FOR IDENTIFICATION OF NUCLEATED RED BLOOD CELLS FROM A MATERNAL BLOOD SAMPLE - A method for concentrating and isolating nucleated cells, such as maternal and fetal nucleated red blood cells (NRBC's), in a maternal whole blood sample. The invention also provides methods and apparatus for preparing to analyze and analyzing the sample for identification of fetal genetic material as part of prenatal genetic testing. The invention also pertains to methods and apparatus for discriminating fetal nucleated red blood cells from maternal nucleated red blood cells obtained from a blood sample taken from a pregnant woman. | 09-11-2014 |
20140255935 | ULTRAFAST SEQUENCING OF BIOLOGICAL POLYMERS USING A LABELED NANOPORE - Methods and systems for sequencing a biological molecule or polymer, e.g., a nucleic acid, are provided. One or more donor labels, which are attached to a pore or nanopore, may be illuminated or otherwise excited. A polymer having a monomer labeled with one or more acceptor labels, may be translocated through the pore. Either before, after or while the labeled monomer of the polymer passes through, exits or enters the pore, energy may be transferred from the excited donor label to the acceptor label of the monomer. As a result of the energy transfer, the acceptor label emits energy, and the emitted energy is detected in order to identify the labeled monomer of the translocated polymer and to thereby sequence the polymer. | 09-11-2014 |
20140255936 | DETECTING FRONTOTEMPORAL DEMENTIA AND AMYOTROPHIC LATERAL SCLEROSIS - This document provides methods and materials for detecting a nucleic acid expansion. For example, methods and materials for detecting the presence of an expanded number (e.g., greater than 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more copies) of a hexanucleotide repeat (e.g., GGGGCC) in the non-coding region of a C9ORF72 gene are provided. | 09-11-2014 |
20140255937 | MUTATIONAL ANALYSIS OF JAK2 - An assay for mutations in JAK2 is described. The assay uses selective amplification of mutant alleles with a blocker probe which preferentially hybridises to wild type alleles. The same probe is then used to detect presence or absence of wild type sequences. It is not necessary to know the specific mutant sequence beforehand. | 09-11-2014 |
20140255938 | METHOD FOR DETECTING SINGLE NUCLEOTIDE POLYMORPHISM IN NUCLEIC ACID - A method for detecting a single nucleotide polymorphism in nucleic acids, characterized in that the method includes mixing (A) a nucleic acid probe comprising a nucleotide sequence complementarily hybridizable to an evaluation subject nucleic acid/an antisense strand thereof containing at least one single nucleotide polymorphism, and tagged with a nucleotide sequence of a hairpin structure having a bulge at a 5′-terminal thereof, wherein a guanine residue is introduced at an adjoining position of the bulge, and wherein a naphthyridine derivative compound is immobilized to the bulge; and (B) the evaluation subject nucleic acids; and detecting a signal ascribed to the naphthyridine derivative compound when the above nucleic acid probe and the above evaluation subject nucleic acids are hybridized, thereby evaluating the above single nucleotide polymorphism. | 09-11-2014 |
20140255939 | NUCLEIC ACID-BASED LINKERS FOR DETECTING AND MEASURING INTERACTIONS - The invention provides compositions comprising nucleic acid complexes for use in monitoring binding interactions and in measuring association and/or dissociation kinetics with or without force, detecting analytes, screening aptamers, and encoding/encrypting information. In some instances, the nucleic acid complexes are double-stranded nicked nucleic acids comprising a scaffold nucleic acid hybridized to one or more oligonucleotides. In some instances, a first and/or a second oligonucleotide are linked to moieties that are known to interact with each other or which are suspected of interacting with each other. | 09-11-2014 |
20140272949 | Methods for Fully Segregating Recombinant Marine Cyanobacteria - Methods and compositions are provided for the full segregation of recombinant marine cyanobacteria. | 09-18-2014 |
20140272950 | METHOD AND SYSTEM TO PREDICT SSRI RESPONSE - The present inventions relates to methods and assays to predict the response of an individual to an SSRI treatment and to a method to improve medical treatment of a disorder, which is responsive to treatment with a selective serotonin reuptake inhibitor (SSRI). | 09-18-2014 |
20140272951 | METHODS OF IDENTIFYING MUTATIONS IN NUCLEIC ACID - The present invention provides methods of identifying mutations in nucleic acid. Also provided herein are methods of identifying subjects having Hirschsprung disease risk and diagnostic markers for Hirschsprung disease. | 09-18-2014 |
20140272952 | MULTI-PRIMER AMPLIFICATION METHOD FOR BARCODING OF TARGET NUCLEIC ACIDS - In certain embodiments, the present invention provides amplification methods in which nucleotide tag(s) and, optionally, a barcode nucleotide sequence are added to target nucleotide sequences. In other embodiments, the present invention provides a microfluidic device that includes a plurality of first input lines and a plurality of second input lines. The microfluidic device also includes a plurality of sets of first chambers and a plurality of sets of second chambers. Each set of first chambers is in fluid communication with one of the plurality of first input lines. Each set of second chambers is in fluid communication with one of the plurality of second input lines. The microfluidic device further includes a plurality of first pump elements in fluid communication with a first portion of the plurality of second input lines and a plurality of second pump elements in fluid communication with a second portion of the plurality of second input lines. | 09-18-2014 |
20140272953 | EGFR Mutation Blood Testing - Improved methods of assessing status of a solid tumor cancer in a subject involving detection of tumor-associated mutations in the subject's blood. | 09-18-2014 |
20140272954 | METHODS AND SYSTEMS FOR ELECTRONIC KARYOTYPING - Embodiments of the present invention relate to a method for producing patterns of sequence specific markers on a chromosomal segment. By comparing these patterns to those produced on a reference chromosome, various genetic abnormalities can be detected. | 09-18-2014 |
20140272955 | NUCLEIC ACID TARGET IDENTIFICATION BY STRUCUTRE BASED PROBE CLEAVAGE - The present invention provides for novel methods and compositions for nucleic acid sequence detection. Unique, identifying cleavage fragments from probes, bound to target nucleic acids, are produced during PCR by the 5′-nuclease activity of the polymerase. The identity of the targets can be determined by identifying the unique cleavage fragments. | 09-18-2014 |
20140272956 | METHOD FOR AMPLIFICATION AND ASSAY OF RNA FUSION GENE VARIANTS, METHOD OF DISTINGUISHING SAME AND RELATED PRIMERS, PROBES, AND KITS - Method for amplification, alone or in further combination with detection or detection and quantitation, of RNA from fusion gene variants, method of distinguishing same, and oligonucleotide primers and probes and kits for use in the methods. | 09-18-2014 |
20140272957 | METHODS AND KITS FOR DIAGNOSING, PROGNOSTICATING RISK/OUTCOME, AND/OR TREATING BREAST CANCER - Methods and kits for diagnosing, prognosticating risk of, and selecting and/or administering a therapy for breast cancer based upon detection of methylated glucocorticoid receptor gene or measurement of glucocorticoid receptor and BRCA1 gene expression levels are provided. | 09-18-2014 |
20140272958 | NANOFLUIDIC DEVICES FOR THE RAPID MAPPING OF WHOLE GENOMES AND RELATED SYSTEMS AND METHODS OF ANALYSIS - Devices and methods generate an ordered restriction map of genomic DNA extracted from whole cells. The devices have a fluidic microchannel that merges into a reaction nanochannel that merges into a detection nanochannel at an interface where the nanochannel diameter decreases in size by between 50% to 99%. Intact molecules of DNA are transported to the reaction nanochannel and then fragmented in the reaction nanochannel using restriction endonuclease enzymes. The reaction nanochannel is sized and configured so that the fragments stay in an original order until they are injected into the detection nanochannel. Signal at one or more locations along the detection nanochannel is detected to map fragments in the order they occur along a long DNA molecule. | 09-18-2014 |
20140272959 | Methods of Hybridizing Probes to Genomic DNA - The present invention relates to methods of hybridizing nucleic acid probes to genomic DNA. | 09-18-2014 |
20140272960 | Methods of Identifying Homologous Genes Using FISH - The present invention relates to methods of hybridizing nucleic acid probes to genomic DNA. | 09-18-2014 |
20140272961 | METHODS AND COMPOSITIONS FOR DETECTING MUTATIONS IN THE HUMAN PI3KCA (PIK3CA) GENE - The invention comprises reagents and methods for detecting cancer-associated mutations in the human PI3KCA (PIK3CA) gene and assessing the patients based thereon. | 09-18-2014 |
20140272962 | MATERIALS AND METHODS FOR ASSESSMENT OF COLORECTAL ADENOMA - Methods of assessing colorectal adenoma, probes, and a kit. | 09-18-2014 |
20140272963 | CELL PREPARATIONS AND CELL SUPPORTS AND THEIR USE IN THERANOSIS - A method of preparing cells from a patient specimen comprising a tissue or a clump of cells; a method of in situ hybridization (ISH) or immunohistochemistry (IHC); a method of theranosing a patient's response to an active agent that targets the tyrosine kinase pathway; an improvement of a method of theranosis comprising the method of ISH or IHC; a cell support on the surface of which are cells, which have been contacted with detectably labeled probes with the method of ISH or IHC; and a kit comprising (a) a cell support and/or at least one probe for ISH or IHC, and (b) instructions for carrying out the method of ISH or IHC on a cell support. | 09-18-2014 |
20140272964 | Blue Fluorescent Protein and Methods of Use Thereof - This invention provides methods of making and using a fluorescent probe from the Sandercyanin protein as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the invention provides a method of creating a fluorescent probe, comprising the steps of attaching a Sandercyanin moiety to a probe, wherein the probe is specific to a desired target. | 09-18-2014 |
20140272965 | SYSTEM AND METHOD FOR CAPTURING AND ANALYZING CELLS - A system and method for capturing and analyzing cells comprising: a fluid delivery module; a reservoir configured to receive a biological sample including a target cell population and at least one fluid from the fluid delivery module; a manifold configured to receive and distribute the biological sample and at least one fluid from the reservoir into a cell capture device; a waste chamber configured to couple to the manifold; and a pump configured to couple to the waste chamber. In embodiments of the system configured to promote further purification of captured cells, the system can further comprise a magnet that enables further separation of captured cells from undesired sample materials. The system can additionally further comprise a heater configured to heat at least one fluid and/or biological sample, and a cell capture device configured to couple to the manifold, in order to facilitate capture of the target cell population. | 09-18-2014 |
20140272966 | METHODS OF DIAGNOSING INCREASED RISK OF DEVELOPING MRSA - A method for diagnosing increased risk of developing Methicillin-resistant | 09-18-2014 |
20140272967 | SYSTEMS AND METHODS FOR ISOLATING NUCLEIC ACIDS - The present disclosure relates to systems and methods for nucleic acid isolation. In particular, the present disclosure provides systems and methods for isolating low molecular weight circulating nucleic acids from bodily fluids (e.g., plasma). | 09-18-2014 |
20140272968 | SYSTEMS AND METHODS FOR ISOLATING NUCLEIC ACIDS - The present disclosure relates to systems and methods for nucleic acid isolation. In particular, the present disclosure provides systems and methods for isolating low molecular weight circulating nucleic acids from bodily fluids (e.g., plasma). | 09-18-2014 |
20140272969 | CELL PREPARATIONS AND CELL SUPPORTS AND THEIR USE IN THERANOSIS - A method of preparing cells from a patient specimen comprising a tissue or a clump of cells; a method of in situ hybridization (ISH) or immunohistochemistry (IHC); a method of theranosing a patient's response to an active agent that targets the tyrosine kinase pathway; an improvement of a method of theranosis comprising the method of ISH or IHC; a cell support on the surface of which are cells, which have been contacted with detectably labeled probes with the method of ISH or IHC; and a kit comprising (a) a cell support and/or at least one probe for ISH or IHC, and (b) instructions for carrying out the method of ISH or IHC on a cell support. | 09-18-2014 |
20140272970 | METHOD FOR QUANTIFYING 5-HYDROXYMETHYLCYTOSINE - Provided herein are methods for detecting and quantifying 5-hydroxymethylated cytosine bases in a DNA molecule. | 09-18-2014 |
20140272971 | UNHEATED EXTRACTION OF GENOMIC DNA IN AN AUTOMATED LABORATORY SYSTEM - A method for analyzing genomic DNA includes introducing a plurality of samples comprising human cells into individual vessels in each of a plurality of multi-vessel well plates. At least a subset of the human cells in the plurality of samples is lysed without the use of heat. DNA in the at least a subset of lysed human cells is isolated with the use of a plurality of paramagnetic beads. The isolated DNA is analyzed to identify one or more single nucleotide polymorphisms (SNPs), wherein the lysing, isolating, and analyzing steps are performed substantially in parallel for each of the plurality of samples. | 09-18-2014 |
20140272972 | ENHANCED DNA SENSING VIA CATALYTIC AGGREGATION OF GOLD NANOPARTICLES BY DNA HYBRIDIZATION CHAIN REACTION - The present invention provides compositions and methods for colorimetric detection schemes for detecting a variety of biomolecules. The compositions and methods employ DNA hybridization chain reaction for catalytic aggregation of gold nanoparticles. In this catalytic aggregation scheme, a single target DNA strand triggers the formation of multiple inter-particle linkages in contrast to the single linkage formed in conventional direct aggregation schemes. | 09-18-2014 |
20140272973 | Nucleic Acid-Based Authentication and Identification Codes - The present disclosure relates to nucleic-acid based product authentication and identification by determining authentication codes comprising target nucleic acids using oligonucleotide probes associated with samples. The presence of the authentication code is determined using detection methods, such as flow cytometric methods, capable of particle discrimination based on the light scattering or fluorescence properties of the particle. Target-correlated fluorescence signal, originating from a target nucleic acid hybridized to labeled complementary oligonucleotides is determined as an indicator of the presence of the authentication code. In some embodiments, an intercalating dye is used to determine the presence of target nucleotide/oligonucleotide heterodimers and identify an authentication code. | 09-18-2014 |
20140272974 | NOVEL RETROELEMENT FOUND IN MOLLUSKS - This invention relates to a novel retroelement, named “Steamer”, found in mollusks, more specifically | 09-18-2014 |
20140272975 | DIAGNOSTIC METHOD - The present invention concerns a method for the detection or monitoring of cancer using a biological sample selected from blood, plasma, serum, saliva, urine from an individual, said method comprising:
| 09-18-2014 |
20140272976 | METHODS OF SCREENING FOR BINDING INTERACTION USING SETS OF MICROPARTICLES AND UNIQUE PROBES - The present invention relates to methods for screening for binding interactions using multiple sets of microparticles, wherein said set has the same identifiable characteristic and wherein one of more sets comprise subsets of microparticles and said subset presents at least one unique probe that acts as a binding partner for a target molecule in a biological sample. In particular, the invention provides for methods of detecting tissue-typing antigens in donor tissue or recipient tissue using these multiple sets of microparticles. | 09-18-2014 |
20140272977 | MOLECULAR TARGETS AND METHODS FOR FORMULATION SCREENING AND PRESERVATIVE EFFICACY TESTING - Methods and kits are disclosed for distinguishing viable from nonviable microbial cells. The methods and kits are useful in the screening of cell culture formulations and the testing of preservative efficacy. The methods involve the amplification and quantitation of microbe-specific DNA from precursor rRNA or Elongation Factor 3 mRNA in treated versus nontreated test samples using the reverse transcription polymerase chain reaction. | 09-18-2014 |
20140272978 | Method for detecting variation of gene for non-diagnostic purpose based on fluorescence quenching and probe thereof - A method for detecting variation of gene based on fluorescence quenching quantification comprises: performing single base extension at a specific site of a gene to be detected with marked probes and marked dideoxyribonucleotide triphosphate; detecting fluorescence quenching values, and determining SNP of the gene to be detected. The present invention also provides an oligonucleotide probe for the method. | 09-18-2014 |
20140272979 | FETAL CHROMOSOMAL ANEUPLOIDY DIAGNOSIS - The invention relates to prenatal detection methods using non-invasive techniques. In particular, it relates to prenatal diagnosis of a fetal chromosomal aneuploidy by detecting fetal and maternal nucleic acids in a maternal biological sample. More particularly, the invention applies multiplex PCR to amplify selected fractions of the respective chromosomes of maternal and fetal chromosomes. Respective amounts of suspected aneuploid chromosomal regions and reference chromosomes are determined from massive sequencing analysis followed by a statistical analysis to detect a particular aneuploidy. | 09-18-2014 |
20140287404 | DETECTION OF BISULFITE CONVERTED NUCLEOTIDE SEQUENCES - The invention is to improved compositions and methods for the detection of target bisulfite converted methylated nucleotide sequences. | 09-25-2014 |
20140287405 | METHOD FOR DETECTING AND QUANTIFYING WHEAT ENDOGENOUS GENE - Provided is a method of detecting or quantifying a wheat species-specific DNA in a test sample by polymerase chain reaction. The method comprises a step of amplifying a nucleic acid molecule having a partial sequence of a nucleotide sequence identified as SEQ ID NO: 1 using a nucleic acid molecule in the test sample or a nucleic acid molecule extracted from the test sample as the template and using a primer pair capable of amplifying the partial sequence and a step of detecting or quantifying the amplified nucleic acid molecule. | 09-25-2014 |
20140287406 | CORN PLANT MON88017 AND COMPOSITIONS AND METHODS FOR DETECTION THEREOF - The present invention provides a corn plant designated MON88017 and DNA compositions contained therein. Also provided are assays for detecting the presence of the corn plant MON88017 based on a DNA sequence and the use of this DNA sequence as a molecular marker in a DNA detection method. | 09-25-2014 |
20140287407 | SYSTEM AND METHOD FOR ANALYSIS OF PLANT MATERIAL FOR A SET OF UNIQUE EXOGENOUS GENETIC ELEMENTS - This disclosure concerns a system and method for detecting heterologous DNA in plant materials. | 09-25-2014 |
20140287408 | TARGET SEQUENCE ENRICHMENT - The present invention provides methods, systems, kits, and compositions for magnetically purifying target nucleic acid sequences from a sample using bait molecules configured to bind both target nucleic acid sequences and magnetic binding particles. In certain embodiments, the bait molecules comprise a short target capture sequence (e.g., 18 to 48 bases), and the methods employ a short hybridization time (e.g., 1-4 hours) and a low hybridization temperature (e.g., about room temperature). | 09-25-2014 |
20140287409 | Detection And Assessment Of Cancer Risk Using Telomere Health - Compositions and methods related to assessing the risk of cancer, such as breast cancer, lung cancer and bladder cancer, through analyzing the length of telomeres, such as chromosome 9p, 15p, and/or Xp telomere, such as the short arm of the 9p, 15p, and/or Xp telomere. | 09-25-2014 |
20140287410 | Probe:Antiprobe Compositions for High Specificity DNA or RNA Detection - Probe systems and methods are provided for detecting nucleic acid targets using labeled polynucleotide probes and antiprobes that interact together and with complementary targets. These interactions result in signaling changes that indicate target frequency and provide error-checking functions that facilitate single base discrimination. These probe:antiprobe compositions enable real-time PCR detection, end-point detection and microarray detection of microbial species, drug resistant mutants, and cancer related variants. The probe:antiprobe may be an internal probe between two primers or may be a primer-probe. The probe also may be modified by introducing a base mismatch to increase thermodynamic discrimination of a correct versus incorrect target differing by a single base. Probe systems also are provided for use in methods of increasing target amplification and detecting specific single base variants. | 09-25-2014 |
20140287411 | COMPOSITIONS, KITS AND RELATED METHODS FOR THE DETECTION AND/OR MONITORING OF LISTERIA - Provided are compositions, kits, and methods for the identification of | 09-25-2014 |
20140287412 | ACF DETECTION METHOD - The present invention provides a method for detecting ACF by analyzing a test region of large intestine tissue at the molecular level. Namely, the present invention relates to a method for detecting aberrant crypt foci (ACF) that comprises detecting an ACF detection marker in a test region of large intestine tissue, by using one or more types of molecules for which ACF-specific expression increases as the ACF detection marker, the molecule being selected from the group consisting of SLC2a1, and SLC7a7; an ACF detection marker for detecting the ACF in human-derived large intestine tissue, that is SLC2a1, or SLC7a7; and, a method for evaluating risk of colorectal cancer and colorectal adenoma in subjects based on the results of detecting ACF in a test region of large intestine tissue of the subjects using the aforementioned ACF detection method. | 09-25-2014 |
20140287413 | METHODS, COMPOSITIONS, AND DEVICES UTILIZING MicroRNA TO DETERMINE PHYSIOLOGICAL CONDITIONS - Methods, compositions, and devices are disclosed which use microRNA to detect, predict, treat, and monitor physiological conditions such as disease or injury. microRNA are isolated and their differential expression is measured to provide diagnostic information. This information may then be utilized for evaluation and/or treatment purposes. | 09-25-2014 |
20140295416 | Novel Method of Cancer Diagnosis and Prognosis and Prediction of Response to Therapy - The invention relates to pharmaceutical compositions comprising of FRY polypeptides and nucleotides, methods to treat cancer, methods to diagnose cancer, and methods to determine the effectiveness of the treatment of cancer, as well as methods to differentiate stem cells. | 10-02-2014 |
20140295417 | IDENTIFICATION OF ANTIBIOTIC RESISTANCE - The invention relates to a method and a kit for the detection of an antibiotic resistance in a predetermined micro-organism in a biological sample. The method according to the invention comprises the following steps: (a) contacting the biological sample with a first nucleic acid labelled with a first label and capable of selectively hybridizing with a nucleic acid in the micro-organism, (b) identifying the micro-organism by the detection of the presence of the first label in an individual cell of the micro-organism, (c) contacting the sample with at least one probe for detection of an antibiotic resistance in a micro-organism, wherein said at least one probe is labelled with at least a second label, and (d) determining the antibiotic resistance of the micro-organism by the detection of the presence of at least the second label, wherein steps (b) and (d) are performed simultaneously so as to allow quick identification of a pathogen directly from a sample without culturing and without prior amplification. | 10-02-2014 |
20140295418 | METHODS AND COMPOSITIONS FOR IMPROVING REMOVAL OF RIBOSOMAL RNA FROM BIOLOGICAL SAMPLES - The invention generally relates to compositions for maximizing capture of affinity-labeled molecules on solid supports. The disclosed methods and compositions were developed to maximize depletion of ribosomal RNA from total RNA samples, which is useful to improve the quality of RNA preparations used for applications such as massively parallel sequencing. The RNA depletion method is based on using long affinity-labeled RNA molecules that are complementary to all or part of the target ribosomal RNAs, as subtractive hybridization probes. | 10-02-2014 |
20140295419 | METHODS AND COMPOSITIONS FOR ISOTHERMAL WHOLE GENOME AMPLIFICATION - Disclosed are methods and compositions for amplification of genetic material, including isothermal WGA of single cells. | 10-02-2014 |
20140295420 | PROCESSING OF BIOLOGICAL SAMPLE COMPONENTS - The invention relates to means for processing a sample fluid containing different components, particularly magnetic particles (M) and targets (cells) (C+M) labeled with magnetic particles. A processing device ( | 10-02-2014 |
20140295421 | ENZYME QUANTIFICATION - The invention generally relates to methods for quantifying an amount of enzyme molecules. Systems and methods of the invention are provided for measuring an amount of target by forming a plurality of fluid partitions, a subset of which include the target, performing an enzyme-catalyzed reaction in the subset, and detecting the number of partitions in the subset. The amount of target can be determined based on the detected number. | 10-02-2014 |
20140295422 | Quantitative Real-Time PCR Assay Using FRET Dual-labeled Primers - This specification relates to non-radioactive methods, compositions and kits for non-radioactive real-time PCR using FRET dual-labeled primers and do not require the use of a probe. The non-radioactive methods may also be used for end-point PCR in which the signal is measured only at the endpoint of the PCR cycling. The dual-labeled primer maintains the molecular tether between fluorophore and quencher. Kits are also provided for the quantification or detection of one or more target nucleic acid molecules in a sample during nucleic acid synthesis, and include a dual-labeled oligonucleotide. | 10-02-2014 |
20140295423 | METHODS FOR GENETIC ANALYSIS OF TEXTILES MADE OF GOSSYPIUM BARBADENSE AND GOSSYPIUM HIRSUTUM COTTON - Methods for distinguishing between cotton species by analyzing a sample of mature cotton fibers from raw cotton materials or from textile goods are disclosed. DNA is extracted from the mature cotton fiber sample and subjected to PCR techniques which enable the identification of the species of cotton utilized in the textile or cotton material of interest. | 10-02-2014 |
20140295424 | Isolation and Enrichment of Nucleic Acids on Microchip - Techniques for isolating, enriching, and/or amplifying target DNA molecules using MEMS-based microdevices are disclosed. The techniques can be used for detecting single nucleotide polymorphism, and for isolating and enriching desired DNA molecules, such as aptamers. | 10-02-2014 |
20140295425 | Diagnosis for Alzheimer's Disease - The present invention relates to diagnosis and monitoring of Alzheimer's disease in the live subject. More particularly, the invention relates to methods involving the measurement of differential gene expression in non-neuronal cells taken from human subjects suspected of having Alzheimer's disease wherein the genes to be measured are genes within the m TOR signalling pathway. | 10-02-2014 |
20140295426 | Methods for Diagnosing Cancer by Characterization of Tumor Cells Associated with Pleural or Serous Fluids - A method for diagnosing or differentially diagnosing a cancer characterized by the presence of cancer cells in the pleural fluid of a mammalian subject, the method comprising contacting a sample of pleural fluid of the subject with colloidal magnetic particles coupled to a ligand which binds to a determinant on a cancer cell, but does not bind above a baseline threshold to other cellular and non-cellular components in pleural fluid; subjecting the pleural fluid-magnetic particle mixture to a magnetic field to produce a cell fraction enriched in ligand coupled-magnetic particle-bound cancer cells, if present in the pleural fluid; and analyzing the enriched fraction for the number of cancer cells in the pleural fluid. In certain aspects, this method involves preparing the pleural fluids for the above-noted method steps by, e.g., dilution of unprocessed pleural fluid. In certain aspect, the pleural fluid is subjected to the diagnostic method within 24 hours of withdrawal from the subject. This method has advantages to present diagnostic procedures for identifying malignant pleural effusions. The tumor cells present in pleural fluid can be characterized with cellular and molecular markers to determine prognostic and predictive factors. | 10-02-2014 |
20140295427 | FIBROSIS SUSCEPTIBILITY IL22RA2 GENE AND USES THEREOF - The present invention discloses the identification of a fibrosis susceptibility gene locus, the IL22RA2 gene locus, which can be used for detecting predisposition to, diagnosis and prognosis of fibrosis as well as for the screening of therapeutically active drugs. The invention further provides a method for determining the likelyhood of a patient affected with a viral infection to respond to a treatment with an antiviral agent and/or an interferon, which method comprises determining alteration in IL22RA2 gene locus or in IL22RA2 expression or IL22RA2 protein activity in a biological sample of the patient. | 10-02-2014 |
20140295428 | METHOD FOR HIGH-THROUGHPUT AFLP-BASED POLYMORPHISM DETECTION - The invention relates to a method for the high throughput discovery, detection and genotyping of one or more genetic markers in one or more samples, comprising the steps of restriction endonuclease digest of DNA, adaptor-ligation, optional pre-amplification, selective amplification, pooling of the amplified products, sequencing the libraries with sufficient redundancy, clustering followed by identification of the genetic markers within the library and/or between libraries and determination of (co-)dominant genotypes of the genetic markers. | 10-02-2014 |
20140295429 | BIOSAMPLE STORAGE DEVICES AND METHODS OF USE THEREOF - The present invention provides sample collection, shipping, and storage devices and methods of using the same. These devices and methods are useful, for example, for collecting, shipping, and storing biological samples, such as blood, serum, buccal samples, tissue homogenates, or cell lysates in a dry state. The devices and methods facilitate the rapid drying of biological samples collected on the devices, thereby improving the quality of the stored sample, particularly the protein and small molecule components of the stored sample. The present invention further provides methods of recovering biological samples from such devices. | 10-02-2014 |
20140295430 | METHOD FOR ANALYZING BIOMOLECULES AND BIOMOLECULE ANALYZER - The method for analyzing biomolecules, includes the steps of: immobilizing biomolecules to be analyzed on surfaces of magnetic microparticles; reacting labeled probe molecules with the biomolecules to be analyzed; collecting and immobilizing the microparticles on a support substrate; and measuring a label on the support substrate. Since single-molecule immobilized magnetic microparticles are used in the present invention, the number of biomolecules can be counted, and since hybridization and an antigen-antibody reaction are performed with the microparticles having biomolecules immobilized thereon dispersed, the reaction can be rapidly performed. Further, the type and the abundance of biomolecules of interest can be determined at a single molecular level, so as to evaluate, in particular, the absolute concentration of biomolecules. | 10-02-2014 |
20140295431 | METHOD OF ALLELE-SPECIFIC AMPLIFICATION - A method of selectively producing and amplifying a cDNA sequence of a target allele of a gene, wherein the target allele is a mutant allele or is a specific allele of a polymorphic gene, the method comprising: (a) providing a sample comprising an mRNA transcript of the target allele; (b) performing a reverse-transcription reaction to generate a cDNA sequence from the mRNA transcript, and (c) amplifying the cDNA of the target allele; wherein the reverse-transcription reaction is selective for reverse transcription of the mRNA transcript of the target allele over an mRNA transcript of an alternative allele of the same gene. | 10-02-2014 |
20140295432 | PARTICLE REPULSION TO ENHANCE SURFACE CONTACT IN MAGNETIC PARTICLE IMMUNOASSAYS - The present invention relates to a device for detecting a target molecule within a sample comprising a sample container for the measurement of the target molecule within a sample, a magnetic particle, wherein said particle is functionalized with a first binding molecule capable of specifically binding to said target molecule, wherein said first binding molecule is attached to the particle, and a repulsive surface structure, which is directly attached to the surface of said particle, wherein said repulsive surface structure covers the surface of the magnetic particle so as to result in a specific net charge and/or steric repulsion of the magnetic particle, and a sensor surface comprising a second binding molecule, wherein said magnetic particles are capable of binding said second binding molecule of the sensor surface directly or indirectly; wherein the number of bound particles is directly or inversely related to the amount of target molecules present in the sample; and wherein said repulsive surface structure conveys an electrostatic and/or steric pushing effect on said magnetic particles towards said sensor surface. In a second aspect the invention describes a device for detecting a target molecule within a sample comprising a mixture of at least two types of magnetic particles, wherein one type is functionalized with a first binding molecule capable of specifically binding to said target molecule, wherein said first binding molecule is attached to the particle, and a second type is functionalized with a repulsive surface structure, which is directly attached to the surface of said particle, wherein said repulsive surface structure covers the surface of the magnetic particle so as to result in a specific net charge of the magnetic particle, and a sensor surface comprising a second binding molecule, wherein said magnetic particles are capable of binding said second binding molecule of the sensor surface directly or indirectly. Furthermore, the invention describes a method of detecting the presence or amount of a target molecule within a sample, as well as the use of a magnetic particle for detecting a target molecule within a sample. | 10-02-2014 |
20140302494 | METHOD OF ANALYZING A BRCA2 GENE IN A HUMAN SUBJECT - Five novel DNA and protein sequences have been determined for the BRCA2 gene, as have been ten polymorphic sites and their rates of occurrence in the normal alleles of BRCA2. The sequences BRCA2 | 10-09-2014 |
20140302495 | NOVEL LISTERIA BACTERIOPHAGE TAILSPIKE PROTEIN AND USES THEREOF - The present invention relates to a novel tail spike protein (TSP) encoded by the novel | 10-09-2014 |
20140302496 | MULTIMODAL METHODS FOR SIMULTANEOUS DETECTION AND QUANTIFICATION OF MULTIPLE NUCLEIC ACIDS IN A SAMPLE - Described herein are approaches for the detection, identification, and/or quantification of target nucleic acids, including, but not limited to partially, substantially randomly, degraded target nucleic acids, in a biological sample, such as a formalin-fixed, paraffin-embedded (FFPE) sample. These approaches provide a means of detecting, identifying, and/or quantifying target nucleic acid molecules, including DNA and RNA molecules, further including RNAs of different classes, from the same sample, and in the same reaction, by using “expander oligonucleotides,” as the term is defined herein, to convert fragments of target nucleic acids into discretely sized DNA fragments, each with a chosen length characteristic for the target nucleic acid from which it is derived. | 10-09-2014 |
20140302497 | GENE CONTROLLING FRUIT COLOR PHENOTYPE IN PALM - Methods, compositions, and kits for predicting and controlling fruit color in palm. | 10-09-2014 |
20140302498 | RAPID DETECTION OF THE "HIGH VIRULENT" ST-17 CLONE OF GROUP B STREPTOCOCCUS - The present invention relates to polynucleotides enabling the rapid, simple and specific detection of Group B | 10-09-2014 |
20140302499 | PHARMACEUTICAL COMPOSITIONS AND METHODS USEFUL FOR MODULATING ANGIOGENESIS, INHIBITING METASTASIS AND TUMOR FIBROSIS, AND ASSESSING THE MALIGNANCY OF COLON CANCER TUMORS - Methods and compositions suitable for modulating angiogenesis in a mammalian tissue are provided. Further provided are methods suitable for inhibiting metastasis and fibrosis in a mammalian tissue and for assessing the malignancy of colon cancer tumors. | 10-09-2014 |
20140302500 | COMPOSITIONS AND METHODS FOR DETECTING BV-ASSOCIATED BACTERIAL NUCLEIC ACID - Disclosed are nucleic acid oligomers, including amplification oligomers, capture probes, and detection probes, for detection of a 16S rRNA or its encoding gene from bacterial species associated with bacterial vaginosis. Also disclosed are methods of specific nucleic acid amplification and detection using the disclosed oligomers, as well as corresponding reaction mixtures and kits. | 10-09-2014 |
20140302501 | MUTATION DETECTION IN HIGHLY HOMOLOGOUS GENOMIC REGIONS - The present invention relates to methods, kits, primers and probes for use in distinguishing highly homologous genomic regions and detecting variants in a locus of interest. In one aspect, the present invention is useful for distinguishing Exon 9 of the CFTR gene from a large homologous region of chromosome 20 in order to determine the presence of the A455E variant. | 10-09-2014 |
20140308663 | METHOD OF NUCLEIC ACID AMPLIFICATION AND MEASURING REAGENT AND REAGENT KIT THEREFOR - The object of the present invention is to provide a method that allows stable amplification of an internal standard material while maintaining an accurate assay value for a target nucleic acid in a nucleic acid detection system involving the use of an internal standard material and a reagent kit used therefor. The present invention relates to a method for nucleic acid amplification comprising preventing an internal standard amplification product from affecting amplification reaction of a target nucleic acid by performing amplification of an internal standard material prior to amplification of the target nucleic acid in the method for amplifying a target nucleic acid in a sample using an internal standard material and a reagent and reagent kit used therefor. | 10-16-2014 |
20140308664 | Compounds and Methods for the Enrichment of Mutated Nucleic Acid from a Mixture - The detection of the presence of rare somatic mutations from a biological sample is often challenging due to the simultaneous presence of a vast excess of wild-type DNA. The present invention describes novel compounds and methods that would allow the enrichment of mutant DNA by depleting amplifiable wild-type DNA. | 10-16-2014 |
20140308665 | DIAGNOSIS OF HEREDITARY SPASTIC PARAPLEGIAS (HSP) BY DETECTION OF A MUTATION IN THE KIAA1840 GENE OR PROTEIN - An ex vivo method of diagnosing or predicting an hereditary spastic paraplegias (HSP) in a subject is provided which comprises detecting a mutation in the KIAA1840 gene or protein (spatacsin), wherein that mutation is indicative of an hereditary spastic paraplegias (HSP). | 10-16-2014 |
20140308666 | DEVELOPMENT OF NOVEL DETERGENTS FOR USE IN PCR SYSTEMS - This disclosure relates to novel detergents for use in various procedures including, for example, nucleic acid amplification reactions such as polymerase chain reaction (PCR). Methods for preparing the modified detergents are also described. | 10-16-2014 |
20140308667 | METHODS FOR ANALYZING NUCLEIC ACIDS - The invention generally relates to methods for analyzing nucleic acids. In certain aspects, methods of the invention involve obtaining a sample including a nucleic acid template. A plurality of molecular inversion probes are tiled across a portion of the template. The probes are designed such that immediately adjacent probes hybridize to opposite strands of the nucleic acid template and probes on the same strand hybridize to the template in an overlapping manner. A region between targeting arms of a plurality of the molecular inversion probes is filled-in with nucleotides, and the filled-in region of a plurality of the probes is analyzed to obtain sequence information about the nucleic acid template. | 10-16-2014 |
20140308668 | Method of Determining Susceptibility of a Tumor Cell to a Chemotherapeutic Agent: Novel Use of Herpes SImplex Virus - The present invention provides a method of determining if a tumor cell is susceptible to killing by a chemotherapeutic agent, comprising: (a) providing a tumor cell; (b) infecting said tumor cell with a herpes simplex virus or a herpes simplex virus defective in an immediate early gene selected from the group consisting of ICP27, ICP4, and ICP22; and (c) determining the presence of apoptotic killing of said tumor cell, wherein the presence of apoptotic killing is indicative of susceptibility to said chemotherapeutic agent. Chemotherapeutic agent may include doxorubicin, etoposide, paclitaxel, cisplatin, or 5-fluororuacil. The present invention also provides a herpes simplex virus promoter construct having a lacZ gene to assess tumor resistance to chemotherapeutic agents. | 10-16-2014 |
20140315192 | Characterizing Prostate Cancer - Methods and kits for predicting the course or aggressiveness of prostate cancer include detecting the methylation status of various genes. | 10-23-2014 |
20140315193 | Kits and Methods for Assessing Antioxidant Requirement of a Human - The invention relates to kits and methods for assessing the desirability of supplementing the diet of a human with reduced coenzyme Q (CoQH | 10-23-2014 |
20140315194 | METHODS OF DIAGNOSING CANCER IN A PATIENT - The present disclosure relates to methods for determining the presence, activity, and/or concentrations of certain cancer biomarkers and their use in determining the presence of cancer. | 10-23-2014 |
20140315195 | METHOD FOR EXOSOMAL BIOMARKER DETECTION BY ELECTRIC FIELD-INDUCED RELEASE AND MEASUREMENT - The molecules harbored in exosomes play important roles in biological science. A highly desirable goal for exosome research is the rapid, simple, simultaneous tracking and quantification of exosome harbored molecules. Disclosed herein are methods and devices for inducing the release and measurement of biomolecules harbored in exosomes. The disclosed method, Electric Field Induced Release and Measurement (EFIRM) technique, uses an electrical field to simultaneously disrupt exosomes to release the contents and measure the harbored exosomal RNA/proteins. The exosome vesicle contents can be released within minutes. This provides a potential on-site method for the detection of exosome-harbored biomolecules. | 10-23-2014 |
20140315197 | MULTIFUNCTIONAL PROBE-PRIMERS - Methods and reagents for detection and analysis of nucleic acids are provided. Certain methods involves an encoding amplification in which a target sequence is associated with probe-binding sequences and optionally with indexing sequences, (2) an optional distribution step in which the product of the encoding amplification is split into multiple aliquots, and (3) a decoding and detection step in which the presence, absence, quantity, or relative amount of the target sequence in the aliquots is determined. The detection step makes use of a multifunctional “self-digesting” molecular probe comprising a primer polynucleotide and a probe oligonucleotide, linked in a 5′-5′ orientation. | 10-23-2014 |
20140315198 | DACH1 AS A BIOMARKER FOR DIABETES - The present invention provides a method for assessing the presence and risk of developing type 2 diabetes or cardiovascular disease in a subject by detecting sequence variation in DACH1 (Dachshund homolog 1) gene. A kit and device useful for such a method are also provided. In addition, the present invention provides a method for treating type 2 diabetes or cardiovascular disease in patients who have been tested and shown to have the pertinent genetic variations. | 10-23-2014 |
20140315199 | GENE FUSIONS AND GENE VARIANTS ASSOCIATED WITH CANCER - The disclosure provides gene fusions, gene variants, and novel associations with disease states, as well as kits, probes, and methods of using the same. | 10-23-2014 |
20140315200 | DETERMINING FETAL GENOMES FOR MULTIPLE FETUS PREGNANCIES - Techniques are provided for determining inheritance of maternal and paternal haplotypes in preganncies with multiple fetuses. Maternal inheritance can be determined at loci where the mother is heterozygous and the paternally inherited alleles are known (e.g., the father is homozygous). Two types of loci may be used, where one type has the paternal allele appear on a first maternal haplotype, and another type has the paternal allele appear on a second maternal haplotype. Paternal inheritance can be determined from loci where the father is heterozygous and the maother is homozygous. Amounts of different alleles at each locus can be measured. A comparison of the amounts (e.g., using a fractional concentration of each allele and cutoffs) can be used to determine the haplotype inheritance. A haplotype can be linked to a condition of interest. | 10-23-2014 |
20140315201 | METHOD FOR HIGH-THROUGHPUT SCREENING OF TRANSGENIC PLANTS - The invention relates to a method for quantifying levels of expression and/or quantifying copy number of a heterologous polynucleotide in a transgenic plant using quantitative or real-time polymerase chain reaction (QPCR or real-time PCR), wherein the real-time PCR is performed using a primer set specific to a heterologous terminator sequence operably linked to the heterologous polynucleotide. | 10-23-2014 |
20140315202 | METHOD FOR ASSEMBLING MULTIPLE TARGET LOCI TO SINGLE NUCLEIC ACID SEQUENCE - A method for assembling multiple target loci to a single assembled nucleic acid sequence involves assembling the multiple target loci to a single assembled nucleic acid sequence through two polymerase chain reactions (PCRs). A pair of primers for a primary amplification include a target-specific sequence and a 5′-flanking assembly spacer sequence. A primary amplified product amplified by the pair of primers for a primary amplification is assembled to a single shortened nucleic acid sequence in a convenient and easy manner through a set of primers for a secondary amplification, thus enabling the simultaneous detection of multiple target loci. Accordingly, the method and a kit of the present invention may simultaneously detect and analyze multiple variabilities in DNA sequences of a sample, thus remarkably reducing sequencing costs for detecting variabilities, and providing a critical approach and means for achieving the concept of customized medicine. | 10-23-2014 |
20140315203 | DNA METHYLATION IN COLORECTAL AND BREAST CANCER DIAGNOSTIC METHODS - The present invention relates generally to nucleic acid molecules in respect of which changes to DNA methylation levels are indicative of the onset or predisposition to the onset of a neoplasm. More particularly, the present invention is directed to nucleic acid molecules in respect of which changes to DNA methylation levels are indicative of the onset and/or progression of a large intestine or breast neoplasm, such as an adenoma or adenocarcinoma. The DNA methylation status of the present invention is useful in a range of applications including, but not limited to, those relating to the diagnosis and/or monitoring of colorectal or breast neoplasms, such as colorectal or breast adenocarcinomas. Accordingly, in a related aspect the present invention is directed to a method of screening for the onset, predisposition to the onset and/or progression of a neoplasm by screening for modulation in DNA methylation of one or more nucleic acid molecules. The nucleic acid molecules used for diagnostics in the present invention are sequences from LOC 100526820, subsequently named CAHM (colorectal adenocarcinoma hypermethylated). | 10-23-2014 |
20140315204 | Immunohistochemistry Detection Method - The invention provides compositions and methods for the detection of targets in a sample; in particular, an immunohistochemistry (IHC) sample. Probes and detectable labels may be provided in multiple layers in order to increase the flexibility of a detection system, and to allow for amplification to enhance the signal from a target. The layers may be created by incorporating probes and detectable labels into larger molecular units that interact through nucleic acids base-pairing, including peptide-nucleic acid (PNA) base-pairing. Optional non-natural bases allow for degenerate base pairing schemes. The compositions and methods are compatible with immunohistochemistry (THC), but also could be used in immunocytochemistry (ICC), in situ hybridization (ISH), flow cytometry, enzyme immuno-assays (EIA), enzyme linked immuno-assays (ELISA), blotting methods (e.g. Western, Southern, and Northern), labeling inside electrophoresis systems or on surfaces or arrays, and precipitation, among other general detection assay formats. The invention is also compatible with many different types of targets, probes, and detectable labels. | 10-23-2014 |
20140315205 | TREATMENT AND DIAGNOSIS OF IMMUNE DISORDERS - Disclosed are composition and methods for treating immune disorders. Also disclosed are diagnosis methods and prognosis methods. | 10-23-2014 |
20140315206 | Scanning System and Method for Imaging and Sequencing - A scanning detection system is provided wherein emissions from locations in a flow cell are detected. In some embodiments, the system can comprise an excitation source, a photocleavage source, and modulating optics configured to cause an excitation beam generated by the excitation source to irradiate a first group of the fixed locations and to cause a photocleavage beam generated by the photocleavage source to irradiate a second group of the fixed locations, which is separate and apart from the first group of fixed locations. Methods of detecting sequencing reactions using such a system are also provided. | 10-23-2014 |
20140315207 | MOLECULAR BEACON BASED ASSAY FOR THE DETECTION OF BIOMARKERS FOR BREAST CANCER METASTASIS - The invention encompasses molecular beacon (MB) probes for monitoring the presence of human breast cancer biomarkers and for the analysis of breast cancer metastasis. The molecular beacon is an oligonucleotide probe which sensitively and specifically identifies biomarker mRNA in samples, in the presence of serum, in minimal time using fluorescence detection. The molecular beacons may be comprised in kits for the detection/quantitation of cancer biomarkers in clinical samples. The invention provides improvements in simplicity, accuracy, and speed over current methods, which could allow for improved patient treatment and prognoses. | 10-23-2014 |
20140315208 | METHOD FOR PREDICTING RISK OF PORENCEPHALY OR CEREBRAL HEMORRHAGE - As a result of intensive screening on mutations of the COL4A2 gene in 35 Japanese patients with porencephaly, it was found that the COL4A2 gene is a causative gene for familial and sporadic porencephalies. Since an identical heterozygous mutation of the COL4A2 gene was found in both a porencephaly patient and healthy individuals, this pathogenic mutation is considered to be dominantly inherited with incomplete penetrance. It can be predicted that a living body having a COL4A2 gene mutation has a high risk of occurrence of porencephaly and/or cerebral hemorrhage. | 10-23-2014 |
20140315209 | MOLECULAR ASSAY FOR THE AMPLIFICATION AND DETECTION OF KPC GENES RESPONSIBLE FOR HIGH-LEVEL RESISTANCE TO CARBAPENEM IN GRAM NEGATIVE BACTERIA - Methods and kits useful for the detection and identification of carbapenem-resistant pathogens harboring carbapenemase-encoding nucleic acids. Said methods comprise PCR amplification of a target region of the beta-lactamase encoding | 10-23-2014 |
20140315210 | METHODS RELATING TO IDIOPATHIC PULMONARY FIBROSIS (IPF) - The invention concerns methods of classifying patients having idiopathic pulmonary fibrosis (IPF) and of determining a preferred therapy for the treatment of IPF based on the presence or absence of the C1234T polymorphism in the toll-like receptor 3 (TLR3) gene of such patients. | 10-23-2014 |
20140322705 | Cancer diagnostic and cancer therapeutic - This invention relates to methods and kits for making a prognosis of disease course in a neoplastic disease patient by determining the level, expression and/or activity of a biomarker. | 10-30-2014 |
20140322706 | INTEGRATED MULTIPELX TARGET ANALYSIS - This invention provides biochip cartridges and instrument devices for the detection and/or analysis of target analytes from patient samples. | 10-30-2014 |
20140322707 | COMPOSITION AND METHODS RELATED TO MODIFICATION OF 5-METHYLCYTOSINE (5-mC) - The present invention relates to methods and compositions for detecting, evaluating, and/or mapping 5-methyl-modified and/or 5-hydroxylmethyl-modified cytosine bases within a nucleic acid molecule. | 10-30-2014 |
20140322708 | METHOD FOR MEASURING SOMATIC DNA MUTATIONAL PROFILES - Methods are provided for determining if an agent causes somatic mutations in a genome, and kits, systems and computer-readable medium therefor. | 10-30-2014 |
20140322709 | METHODS FOR DETECTING FETAL NUCLEIC ACIDS AND DIAGNOSING FETAL ABNORMALITIES - The invention generally relates to methods for detecting fetal nucleic acids and methods for diagnosing fetal abnormalities. In certain embodiments, the invention provides methods for determining whether fetal nucleic acid is present in a maternal sample including obtaining a maternal sample suspected to include fetal nucleic acids, and performing a sequencing reaction on the sample to determine presence of at least a portion of a Y chromosome in the sample, thereby determining that fetal nucleic acid is present in the sample. In other embodiments, the invention provides methods for quantitative or qualitative analysis to detect fetal nucleic acid in a maternal sample, regardless of the ability to detect the Y chromosome, particularly for samples including normal nucleic acids from a female fetus. | 10-30-2014 |
20140322710 | DEVICE AND METHODS FOR EPIGENETIC ANALYSIS - Provided herein are methods and devices for single object detection. The methods and devices can be used to identify a plurality epigenetic markers on a genetic material, or a chromatin, encompassing fragments thereof. The invention provides for the characterization of the genetic material flowing through a channel in a continuous body of fluid based on detection of one or more properties of the genetic material. The methods and systems provided herein allow genome-wide, high-throughput epigenetic analysis and overcome a variety of limitations common to bulk analysis techniques. | 10-30-2014 |
20140322711 | SPINOCEREBELLAR ATAXIA TYPE 8 AND METHODS OF DETECTION - The present invention provides an isolated nucleic acid molecule containing a repeat region of an isolated spinocerebellar ataxia type 8 (SCA8) coding sequence, the coding sequence located within the long arm of chromosome 13, and the complement of the nucleic acid molecule. Diagnostic methods based on identification of this repeat region are also provided. | 10-30-2014 |
20140322712 | DIAGNOSIS AND TREATMENT OF MACULAR DEGENERATION - The present invention relates generally to biomarkers for macular degeneration. In particular, the biomarkers and related compositions and methods of the present invention find use in diagnostic, therapeutic, research, and drug screening applications. | 10-30-2014 |
20140322713 | POLYMETHINE COMPOUNDS AND THEIR USE AS FLUORESCENT LABELS - The present disclosure relates to new polymethine compounds and their use as fluorescent labels. The compounds may be used as fluorescent labels for nucleotides in nucleic acid sequencing applications. | 10-30-2014 |
20140322714 | Methods of Detecting Mutations and Epigenetic Changes - Disclosed are methods for assessing the methylation and mutation status of nucleic acid in a sample. The methods provide for methylation-dependent modification of the nucleic acid in a sample, and subsequently nucleic acid amplification processes to distinguish between mutated and non-mutated target sequence. | 10-30-2014 |
20140329238 | DETECTION OF GENE DUPLICATIONS - Methods of detecting a candidate genetic anomaly such as a candidate duplication in a genome are disclosed. The methods comprise quantifying fluorogenic assays for alleles of a genetic locus from a plurality of individual genomes, identifying ranges of fluorescent intensities indicative of individual genomes homozygous for a first allele, homozygous for a second allele, or heterozygous for both alleles, and identifying individual genomes in which the fluorescence intensities are outside the range of intensities indicative of homozygosity or heterozygosity for the genetic locus. | 11-06-2014 |
20140329239 | DIGITAL ANALYTE ANALYSIS - The invention generally relates to droplet based digital PCR and methods for analyzing a target nucleic acid using the same. In certain embodiments, methods of the invention involve forming sample droplets containing, on average, a single target nucleic acid, amplifying the target in the droplets, excluding droplets containing amplicon from the target and amplicon from a variant of the target, and analyzing target amplicons. | 11-06-2014 |
20140329240 | CHIP-BASED SEQUENCING NUCLEIC ACIDS - A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced. | 11-06-2014 |
20140329241 | HYDROLASE ENZYME SUBSTRATES AND USES THEREOF - The present invention provides novel methods for determining the presence or amount of a hydrolytic enzyme in a sample, based on novel substrates for the enzymes, and also provides compositions and methods that provide highly sensitive assay methods for such hydrolytic enzymes. | 11-06-2014 |
20140329242 | CHARACTERIZING MULTIPLE SCLEROSIS - A method for characterizing multiple sclerosis in a subject involves comparing ratios of expression levels of genes in a biological sample from a subject to references, wherein the multiple sclerosis is characterized based on a difference in the ratios of the expression values of genes in the biological sample from the subject as compared to the references. | 11-06-2014 |
20140329243 | METHOD FOR CHARACTERIZING CIRCULATING TUMOR CELLS, AND USE THEREOF IN DIAGNOSIS - Disclosed is a method for characterization, in a biological sample, of circulating tumour cells (CTCs) bearing at least one marker characteristic of the tumorous nature of the cell, the marker being selected from the groups constituted by: the oncogenic proteins characteristic of the CTCs, with the exception of the proteins encoded by the EML4-ALK fusion gene, and the tumour markers. Also disclosed is the use of this method for deciding on the implementation of a treatment for a cancer patient. | 11-06-2014 |
20140335513 | HYBRID NANOPORE DEVICE WITH OPTICAL DETECTION AND METHODS OF USING SAME - The invention is directed to a device comprising a protein nanopore immobilized in a lipid layer within an aperture of a solid phase substrate, which provides a stable platform for using first and second members of one or more FRET pairs to generate optical signals as a labeled analyte translocates through the bore of the protein nanopore. In another aspect, the invention is directed to the use of the device to determine the nucleotide sequence of a polynucleotide analyte. | 11-13-2014 |
20140335514 | METHODS FOR DETECTING NUCLEIC ACID SEQUENCE VARIANTS - The present invention provides methods for detecting the presence or absence of a nucleic acid variant in a target region. These methods include amplifying the target region with a forward primer and a reverse primer in the presence of a selector blocker. The selector blocker includes a sequence complementary to the target region in the absence of the nucleic acid variant. The methods further include detecting amplification of the target region where amplification of the target region indicates the presence of the nucleic acid variant in the target region. The nucleic acid variant can include deletions, mutations or insertions. | 11-13-2014 |
20140335515 | DROPLET DIGITAL PCR WITH SHORT MINOR GROOVE PROBES - Methods for the detection of ddPCR assay-generated amplicons by short minor groove binder-fluororophore-oligonucleotide-quencher (MGB-Fl-oligo-Q) probes. The short MGB-Fl-oligo-Q probes not only reduce background, but also show improved mismatch discrimination when compared to the same length non-MGB probes for detecting the ddPCR generated targets at room temperature. | 11-13-2014 |
20140335516 | INDUCIBLE CELL-BASED MODEL FOR THE STUDY OF FRIEDREICH'S ATAXIA - Isolated transduced cells exhibiting FRDA characteristics in an inducible fashion are disclosed. Isolated transduced cells comprise an expression vector having a nucleic acid sequence encoding an shRNA for frataxin protein knockdown and a heterologous expression control sequence. Additionally, methods of screening for a candidate therapeutic agent for treating Friedreich's Ataxia using isolated transduced cells are disclosed. Further, a recombinant nucleic acid construct for frataxin knockdown is disclosed that comprises a nucleic acid encoding an shRNA operably linked to a heterologous expression control sequence and expressing an shRNA molecule in a dose-responsive fashion. | 11-13-2014 |
20140335517 | DETECTION AND TREATMENT OF SCHIZOPHRENIA - The present invention provides a method for diagnosing schizophrenia, and a schizophrenia diagnostic reagent or device for use in the method. The present invention further provides a therapeutic or ameliorating agent for schizophrenia, which is effective for the treatment or amelioration of schizophrenia. The therapeutic or ameliorating agent for schizophrenia contains a carbonyl scavenger or a carbonyl-modified protein formation inhibitor as an active ingredient. The method for diagnosing schizophrenia according to the present invention includes measuring at least one parameter in a subject, the parameter being selected from the group consisting of: (1) a genetic abnormality of glyoxalase I gene; (2) the expression level or activity of glyoxalase I in a biological sample; (3) the amount of a carbonyl compound or a carbonyl-modified protein that is a protein modified with the carbonyl compound; and (4) the amount of pyridoxal in a biological sample. | 11-13-2014 |
20140335518 | ENCAPSULATED REAGENTS AND METHODS OF USE - The present invention contemplates use of encapsulated aqueous and non-aqueous reagents, solutions and solvents and their use in laboratory procedures. These encapsulated aqueous or non-aqueous reagents, solutions and solvents can be completely contained or encapsulated in microcapsules or nanocapsules that can be added to an aqueous or non-aqueous carrier solution or liquid required for medical and research laboratory testing of biological or non-biological specimens. | 11-13-2014 |
20140335519 | CAPTURE PROBES FOR USE IN DETECTING THE PRESENCE OF TRICHOMONAS VAGINALIS IN A SAMPLE - Oligomers useful for determining the presence of | 11-13-2014 |
20140335520 | DIRECT NUCLEIC ACID ANALYSIS - The present disclosure provides methods, systems, and apparatuses for collecting and/or amplifying nucleic acids. In general, provided methods, systems, and apparatuses involve contacting a sample including a nucleic acid with a nucleic acid amplification reagent without purification of nucleic acids from the sample. | 11-13-2014 |
20140335521 | Method for Designing RNA Binding Protein Utilizing PPR Motif, and Use Thereof - A method for designing a protein capable of binding in an RNA base selective manner or RNA base sequence specific manner is provided. The protein of the present invention is a protein containing one or more of PPR motifs (preferably 2 to 14 PPR motifs) each consisting of a polypeptide of 30- to 38-amino acid length represented by the formula 1 (wherein Helix A is a moiety of 12-amino acid length capable of forming an α-helix structure, and is represented by the formula 2, wherein, in the formula 2, A | 11-13-2014 |
20140335522 | ENRICHMENT & ISOLATION OF MICROBIAL CELLS & MICROBIAL NUCLEIC ACIDS FROM A BIOLOGICAL SAMPLE - A method for enrichment and isolation of microbial cells and microbial nucleic acids from a biological sample is described. The method comprises (i) adding to an initial volume of biological sample a differential cell lysis solution to obtain a final concentration of 0.1 to 1% of SDS in the sample; (ii) mixing the solution obtained in step (i) for a period of time sufficient to lyse the host cells present in the biological sample, while preserving the integrity of cells; and (iii) separating the microbial cells from the lysed host cells components. Differential cell lysis solutions and kits for practicing the method of the present invention are also provided. | 11-13-2014 |
20140335524 | METHOD FOR CONTROLLING THE PRODUCTION OF SULPHITES, OF HYDROGEN SULPHIDE AND OF ACETALDEHYDE BY YEASTS - The present invention relates to the identification of alleles of the MET2 and SKP2 genes having the effect of reducing the production of sulphites, of hydrogen sulphide and of acetaldehyde by | 11-13-2014 |
20140342353 | Reagents, Methods, and Libraries for Bead-Based Sequencing - The present invention provides methods for determining a nucleic acid sequence by performing successive cycles of duplex extension along a single stranded template. The cycles comprise steps of extension, ligation, and, preferably, cleavage. In certain embodiments the methods make use of extension probes containing phosphorothiolate linkages and employ agents appropriate to cleave such linkages. The invention provides methods of determining information about a sequence using at least two distinguishably labeled probe families. In certain embodiments the methods acquire less than 2 bits of information from each of a plurality of nucleotides in the template in each cycle. In certain embodiments the sequencing reactions are performed on templates attached to beads. The invention further provides sets of labeled extension probes containing phosphorothiolate linkages. In addition, the invention includes performing multiple sequencing reactions on a single template by removing initializing oligonucleotides and extended strands and performing subsequent reactions using different initializing oligonucleotides. | 11-20-2014 |
20140342354 | SYSTEMS AND METHODS FOR PRENATAL GENETIC ANALYSIS - The present disclosure provides for compositions and methods for the testing and analysis of genetic alterations of a sample comprising maternal and fetal polynucleotides. Generally, the composition and methods of this disclosure provide for the isolation of a mixture of maternal and fetal polynucleotides from a sample, generally from the mother. Polynucleotides are isolated and purified and further tested to determine the presence or absence of genetic alterations, such as copy number variation, or causal variants at one or more loci in the sample. | 11-20-2014 |
20140342355 | CARDIOVASCULAR DISEASE - The invention relates to a method for the reclassification of a subject to a more appropriate risk assessment to that obtained using the algorithms for such risk estimation such us but not limited to Framingham, Regicor, Score, Procamor Qrisk based on the presence of different polymorphisms. The invention also relates to a method for determining the risk of suffering a cardiovascular disease by combining the absence or presence of one or more polymorphic markers in a sample from the subject with conventional risk factors for CVD as well as computer-implemented means for carrying out said method. | 11-20-2014 |
20140342356 | REAGENTS, METHODS AND KITS FOR CLASSIFICATION OF FUNGI AND DIRECTION OF ANTI-FUNGAL THERAPY - Provided herein are methods, kits and compositions to classify fungi. Methods are provided for classification of fungi according to established phenotypes, for example, antimicrobial susceptibility profiles. More specifically, the invention provides methods for the use of PNA probes in diagnostic applications, which will aid in the direction of appropriate therapy against fungi. | 11-20-2014 |
20140342357 | METHODS OF INHIBITING ALU RNA AND THERAPEUTIC USES THEREOF - The presently-disclosed subject matter includes methods of identifying an Alu RNA inhibitor, and methods and compositions for inhibiting Alu RNA. Methods and compositions can be used for the treatment of geographic atrophy and other conditions of interest. | 11-20-2014 |
20140342358 | BIOLOGICAL SAMPLE TREATMENT APPARATUS - Apparatus for treating biological samples disposed on substrates, including: an input buffer for receiving one or more substrate holders each being adapted to support a plurality of the substrates; a treatment zone including a plurality of treatment stations each being adapted to receive one of the substrates; a reagent dispenser configured by a controller to dispense reagents to the substrates at the treatment stations; a substrate transport device configured by the controller to transport individual substrates between the substrate holders in the input buffer and the treatment stations. | 11-20-2014 |
20140342359 | VERSATILE AND SENSITIVE BIOSENSOR - Contemplated methods and devices comprise use of a charged probe and a neutralizer in the electrochemical detection of a wide range of analytes, including nucleic acids, proteins, and small molecules. In certain embodiments the neutralizer forms a complex with the probe that has a reduced charge magnitude compared to the probe itself, and is displaced from the probe when the complex is exposed to the analyte. | 11-20-2014 |
20140342360 | METHOD OF MEASURING IMMUNE ACTIVATION - The invention is directed to methods for measuring immune activation by the level of clonotypes having the same unique regions and different isotype-determining regions. In one aspect, the method of the invention comprises forming a sequence-based clonotype profile from a sample containing B lymphocytes, wherein each clonotype of such profile comprises a unique region, such as a portion of a VDJ segment, and an isotype determining region, such as a portion of a C gene segment. Immune activation is indicated whenever the level of such clonotypes exceeds an upper bound of a reference range determined from multiple individual measurements or population measurements. | 11-20-2014 |
20140342361 | METHODS AND BIOMARKERS FOR ANALYSIS OF COLORECTAL CANCER - The present invention relates to methods and biomarkers (e.g., gene expression biomarkers) for detection of colorectal cancer in biological samples (e.g., tissue samples, biopsy samples, stool samples, blood samples, plasma samples, serum samples). In some embodiments, methods and biomarkers of the present invention find use in detection of colon cancer, providing a prognosis to colorectal cancer patients, and in companion diagnostics. | 11-20-2014 |
20140342362 | COMPOSITIONS, KITS, AND RELATED METHODS FOR DETECTING AND/OR MONITORING SHIGA TOXIN PRODUCING ESCHERICHIA COLI - ECF, such as the ecf operon/gene cluster (e.g., ECF2-1- and ECF2-2 described herein) may be used to detect virulent STECs including virulent non-0157:H7 STEC and virulent non-0157:H7 EHEC. Use of this nucleic acid target, in combination with other targets, such as Z5866, rfb | 11-20-2014 |
20140349283 | KIT USEFUL FOR DETECTING OF DONKEY MEAT PRESENT IN MEAT - The present invention relates to a kit comprising specific primer-probe set which is used for detecting donkey meat present in meat products by means of real-time PCR TaqMan probe technique. In the present invention contamination of donkey meat up to 0.1 picogram is enabled to be detected. The specific detection of donkey meat is made possible in raw and heat treated meat mixtures, by means of no cross-reaction until 40 | 11-27-2014 |
20140349284 | SAMPLE NUCLEIC ACID FOR SINGLE NUCLEOTIDE POLYMORPHISM DETECTION PURPOSES, PCR PRIMER FOR PREPARING SAMPLE FOR SINGLE NUCLEOTIDE POLYMORPHISM DETECTION PURPOSES, AND METHOD FOR PREPARING SAMPLE FOR SINGLE NUCLEOTIDE POLYMORPHISM DETECTION PURPOSES WHICH CAN BE USED IN ION EXCHANGE CHROMATOGRAPHIC ANALYSIS - An object of the present invention is to provide a sample nucleic acid for single nucleotide polymorphism detection which is for use in a simple method for quickly detecting a single nucleotide polymorphism, PCR primers for preparation of a sample for single nucleotide polymorphism detection, and a sample for single nucleotide polymorphism detection which is for use in ion exchange chromatography analysis. The present invention provides a sample nucleic acid for single nucleotide polymorphism detection having the following features:
| 11-27-2014 |
20140349285 | POLYMERASE DRIVEN NESA - The present invention relates to a novel method for detecting a target polynucleotide having a target sequence, comprising (a) exposing the target polynucleotide to an initiating oligonucleotide; (b) extending the initiating oligonucleotide with an extended sequence complementary to the target sequence; (c) ligating the initiating oligonucleotide sequence with the extended sequence to form a circular oligonucleotide having a nicking endonuclease (NE) recognition/cutting sequence; (d) exposing the circular oligonucleotide to a DNA polymerase and a DNA synthesis primer to synthesize DNA having a NE recognition sequence; (e) exposing the synthesized DNA to a probe having the NE recognition/cutting sequence to form a double stranded DNA having a full NE site; (f) exposing the double stranded DNA to a nicking endonuclease (NE) to cleave the probe; and (g) detecting the cleaved probe. The presence of the cleaved probe indicates the presence of the target polynucleotide. | 11-27-2014 |
20140349286 | EXONUCLEASE CYCLING ASSAY - The present invention relates to a novel method for detecting a target polynucleotide having a target sequence, comprising hybridizing the target polynucleotide with a probe to form a hybrid; exposing the hybrid to a 5′ exonuclease so that the probe in the hybrid is digested and the target polynucleotide is dissociated from the digested probe; repeating the hybridization step and the digestion step; and detecting the digested probes. The presence of the digested probes indicates the presence of the target polynucleotide. | 11-27-2014 |
20140349287 | Method and Apparatus for a Nanopipette Biosensor - A nanopipette biosensor capable of detecting a small concentration of target molecules within a sample solution using optical detection methods. The biosensor includes a nanopipette that connects a nanocolloid reservoir containing a nanocolloid solution and a sample reservoir containing a sample solution, where the nanopipette is tapered at the end connected to the sample reservoir. The nanocolloid solution includes nanoparticles functionalized with probes specific to miRNA of the target molecules and reporters. During the detection process, the nanocolloids nanoparticles aggregate such that plasmonic hotspots are formed. These hotspots magnify the reporter signals produced when the probes hybridize with target molecules. | 11-27-2014 |
20140349288 | Methods for Making Nucleotide Probes for Sequencing and Synthesis - Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided. | 11-27-2014 |
20140349289 | COMPOSITIONS AND METHODS FOR DETECTING NUCLEOTIDE VARIANTS - Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition. | 11-27-2014 |
20140349290 | PKD MUTATIONS AND EVALUATION OF SAME - The present invention relates to methods of detecting novel mutations in a PKD1 and/or PKD2 gene that have been determined to be associated with autosomal dominant polycystic kidney disease (ADPKD) in order to detect or predict the occurrence of ADPKD in an individual. | 11-27-2014 |
20140349291 | NUCLEIC ACID PREPARATION COMPOSITIONS AND METHODS - Provided herein are methods and compositions to extract and enrich by, physical separation or amplification, relatively short nucleic acids from a nucleic acid composition containing a high background of longer nucleic acids (e.g., host or maternal nucleic acids; genomic nucleic acid and the like). | 11-27-2014 |
20140349292 | OLIGONUCLEOTIDE N3'-->P5' THIOPHOSPHORAMIDATES: THEIR SYNTHESIS AND USE - Oligonucleotides with a novel sugar-phosphate backbone containing at least one internucleoside 3′-NHP(O)(S | 11-27-2014 |
20140349293 | METHOD AND KIT FOR PROTOZOA CHARACTERIZATION - Disclosed are compositions, kits, and methods for detecting, extracting, visualizing, characterizing, and/or identifying one or more protozoa. Various types of polymerase chain reaction techniques in connection with specifically designed oligonucleotide probes can be used to detect a variety of, e.g., pathogenic, protozoa in samples. | 11-27-2014 |
20140349294 | Sequencing by Structure Assembly - A method of sequencing nucleic acids is provided using sequencing by ligation and/or sequencing by hybridization. | 11-27-2014 |
20140349295 | METHOD FOR DETECTING TARGET NUCLEIC ACID - The purpose of the present invention is to provide: a novel method for detecting a target nucleic acid; and a kit for use in the method. In the detection method according to the present invention, a fluorophore-labeled primer/probe and a quencher-labeled probe, which have complementarity to each other, are so designed as to have different melting temperatures (Tm) from each other so that the fluorophore-labeled primer can anneal preferentially to the target nucleic acid. The detection method is so designed that the fluorophore-labeled primer/probe that is not bound to the target nucleic acid is bound to the quenching probe so as to emit no fluorescence. The method enables the detection of the target nucleic acid in a simpler manner, at lower cost, and without requiring the use of any technique or device. | 11-27-2014 |
20140349296 | METHODS OF ENHANCING GENETIC DIAGNOSIS - The present disclosure relates to the use of laminin-521. Laminin-521 can maintain stem cells in vitro pluripotency, enable self-renewal, and enable single cell survival of human embryonic stem cells. When pluripotent human embryonic stem cells are cultured on plates coated with recombinant laminin-521 (laminin-11), in the absence of differentiation inhibitors or feeder cells, the embryonic stem cells proliferate and maintain their pluripotency. Methods of enhancing genetic diagnosis by expanding a single stem cell on laminin-521 prior to PCR amplification are disclosed herein. | 11-27-2014 |
20140349297 | FLUORESCENT DYES BASED ON ACRIDINE AND ACRIDINIUM DERIVATIVES - The present invention relates to fluorescent dyes based on acridine and acridinium derivatives and use of such dyes in for example, biochemical and/or cell-based assays. | 11-27-2014 |
20140356866 | COMPUTER READABLE MEDIUM FOR ENABLING A COMPUTER TO CARRY OUT PROVISION OF INFORMATION ON COLON CANCER AND MARKER AND KIT FOR OBTAINING INFORMATION ON COLON CANCER - The present invention is to provide a computer readable medium comprising a computer program for enabling a computer to carry out provision of information on colon cancer in a subject based on an analysis result on methylation status of a novel marker specific for colon cancer. | 12-04-2014 |
20140356867 | NUCLEIC ACID ENRICHMENT USING CAS9 - A method of enriching for a fragment of a genome, as well as corresponding compositions and kits, are provided. In certain embodiments, the method comprises: (a) contacting a sample comprising fragmented DNA with a Cas9-gRNA complex comprising mutant Cas9 protein that has inactivated nuclease activity and a Cas9-associated guide RNA that is complementary to a site in the DNA, to produce a Cas9-fragment complex that comprises a fragment of the fragmented DNA; and (b) isolating the complex. In addition, other methods and compositions for Cas9/CRISPR-mediated nucleic acid manipulation are also provided. | 12-04-2014 |
20140356868 | MACC1 AS A PROGNOSTIC BIOMARKER FOR HEPATOBILIARY TUMORS - The present invention is directed to a method of diagnosis and prognostication of a hepatobiliary tumor, the method comprising the step of determining expression of MACC1 polypeptide or of a nucleic acid encoding said MACC1 polypeptide in a biological sample. | 12-04-2014 |
20140356869 | SINGLE NUCLEOTIDE POLYMORPHISMS ASSOCIATED WITH DIETARY WEIGHT LOSS - The present invention relates to genetic polymorphisms associated with obesity and obesity-related phenotypes and their use in predicting if an individual looses weight during a dietary weight loss intervention program. | 12-04-2014 |
20140356870 | METHOD FOR TRANSCRIPTIONAL AMPLIFICATION OF NUCLEIC ACIDS COMBINING STEPS OF DIFFERENT TEMPERATURES - A method of transcriptional amplification includes: (a) obtaining a mixture by combining (i) a biological sample comprising nucleic acids, (ii) amplification primers, (iii) amplification reagents including enzymes required for amplification, and (iv) at least one polyol capable of stabilizing the enzymes required for amplification; (b) denaturing the nucleic acids by heating the mixture at a temperature above 41° C.; and (c) transcriptionally amplifying at least one target nucleic acid at a temperature above 41° C. when present in the mixture. | 12-04-2014 |
20140356871 | DIAGNOSTIC TESTS FOR THE DETECTION OF INHERITED PERIPHERAL NEUROPATHIES - The disclosure relates to the field of human genetics, particularly the field of peripheral neuropathy, particularly inherited peripheral neuropathy. Specifically, the disclosure relates to methods and materials to detect hereditary peripheral neuropathy, more particularly autosomal recessive Charcot-Marie-Tooth disease. | 12-04-2014 |
20140356872 | HOMOLOGOUS PAIRING CAPTURE ASSAY AND RELATED METHODS AND APPLICATIONS - A Homologous Pairing Capture Assay is described which enables detection of coalignment between homologous DNA sequences. The assay involves ligating closely positioned homologous sequences to each other thereby generating head-to-head ligation products or inverted repeats. DNA fragments containing an inverted repeat are then converted into hairpin DNA molecules. The hairpin DNA molecules can then be readily separated from DNA molecules free of inverted repeats. Also described are various diagnostic applications and kits relating to the assay. | 12-04-2014 |
20140356873 | Derivatives of 1,2-dihydro-7-hydroxyquinolines Containing Fused Rings - The present invention describes novel dyes, including coumarins, rhodamines, and rhodols that incorporate additional fused aromatic rings. The dyes of the invention absorb at a longer wavelength than structurally similar dyes that do not possess the fused aromatic rings. Many of the dyes of the invention are useful fluorescent dyes. The invention includes chemically reactive dyes, dye-conjugates, and the use of such dyes in staining samples and detecting ligands or other analytes. | 12-04-2014 |
20140363811 | COMPOSITIONS FOR DETECTING ALICYCLOBACILLUS MICROORGANISMS - The invention provides nucleic acids, collections of nucleic acids, supports, assay kits, and methods for the sensitive and specific detection of microorganisms in a foodstuff. The nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-15 and having a length of no more than 35 nucleotides. | 12-11-2014 |
20140363812 | METHOD FOR DETECTING NUCLEOSOMES CONTAINING NUCLEOTIDES - The invention relates to a method for detecting and measuring the presence of mono-nucleosomes and oligo-nucleosomes and nucleosomes that contain particular nucleotides and the use of such measurements for the detection and diagnosis of disease. The invention also relates to a method of identifying nucleosome associated nucleotide biomarkers for the detection and diagnosis of disease and to biomarkers identified by said method. | 12-11-2014 |
20140363814 | STREPTOCOCCUS PNEUMONIAE DETECTION IN BLOOD - The present invention provides a method and a kit for detecting a | 12-11-2014 |
20140363815 | METHODS AND KITS FOR DETECTION OF METHYLATION STATUS - The present invention relates to methods and kits for the detection of 5-hydroxymethylcytosine (5hmC) and/or 5-methylcytosine (5meC). In some embodiments, the present invention relates to methods and kits for detection of 5hmC and/or 5meC in nucleic acid (e.g., DNA, RNA). In some embodiments, the present invention relates to detection of 5hmC in genomic DNA, e.g., mammalian genomic DNA | 12-11-2014 |
20140363816 | METHODS FOR PREDICTION OF CLINICAL RESPONSE TO RADIATION THERAPY IN CANCER PATIENTS - Disclosed are biomarkers, methods and assay systems for the identification of cancer patients who are predicted to respond, or not respond to the therapeutic administration of radiation therapy to treat cancer. Thus, the invention provides a diagnostic paradigm to select cancer patients who will benefit from radiation therapy. In particular, the invention provides a novel 41-gene biomarker model associated with clinical outcome following radiotherapy across multiple histological tumor types, including the biomarker Cyclophilin B (PPIB). | 12-11-2014 |
20140363817 | METHOD FOR SPECIFICALLY LABELING LIVING BACTERIA - The present invention concerns a method for labeling specifically living bacteria of a given category in a sample, the method including: a) incubating said bacteria of said sample with at least one analog of a monosaccharide compound, and b) contacting the bacteria with a labeling molecule having a second reactive group. | 12-11-2014 |
20140363818 | EGFR and PAR2 Regulation of Intestinal Permeability - The present invention provides methods for diagnosing an immune-mediated disease, e.g., an autoimmune disease, an allergy or an inflammatory disease. Diagnosis is made by detecting a heterozygous or homozygous genotype of haptoglobin 2 or by detecting and quantifying pre-haptoglobin 2 mRNA or protein. After diagnosis, the disease may be treated by decreasing cell permeability leading to increased transepithelial electrical resistance, for example, by administering an antibody directed against single chain zonulin thereby inhibiting epidermal growth factor receptor and inhibiting proteinase-activated receptor 2 (PAR | 12-11-2014 |
20140370501 | HYDROLASE ENZYME SUBSTRATES AND USES THEREOF - The present invention provides novel methods for determining the presence or amount of a hydrolytic enzyme in a sample, based on novel substrates for the enzymes, and also provides compositions and methods that provide highly sensitive assay methods for such hydrolytic enzymes. | 12-18-2014 |
20140370502 | MULTILEVEL ANALYTE ASSAY - The present invention provides methods and devices for detecting the presence of two or more threshold levels of an analyte, including markers of myocardial damage such as cardiac troponins, in a sample. In various embodiments, the invention provides convenient point-of-care tests for determining the condition of a patient, so as to guide cost effective health care. | 12-18-2014 |
20140370503 | METHOD FOR THE DIAGNOSIS OR PROGNOSIS, IN VITRO, OF PROSTATE CANCER - The present invention relates to a method for the in vitro diagnosis or prognosis of prostate cancer, which includes a step of detecting at least one expression product of at least one HERV nucleic acid sequence, the use of said nucleic acid sequences, once isolated, as one or more molecular marker(s) and a kit comprising at least one specific binding partner of at least one of the expression products of the HERV nucleic acid sequences. | 12-18-2014 |
20140370504 | METHOD FOR DETECTING GENETIC VARIATION - The present invention relates to a method for detecting genetic variation, comprising the following steps: acquiring reads from a test sample; aligning said reads with a reference genome sequence; dividing said reference genome sequence into windows, calculating the number of said reads which are aligned to each window, and acquiring the statistic for each window on the basis of the number of said reads; and for a fragment of the reference genome sequence, acquiring the genetic variation sites on the basis of the change in the statistics of all the windows thereon in the fragment of the reference genome sequence. | 12-18-2014 |
20140370505 | SALIVA-DERIVED MEASURES OF TELOMERE ABUNDANCE AND SAMPLE COLLECTION DEVICE - This invention provides devices and methods for sample collection. Devices can include (a) a container having an opening and adapted to receive a liquid sample through the opening; (b) a cover configured to reversibly seal the opening; and (c) a capture device configured to be introduced into the container, wherein the capture device is configured to selectively bind cells of a first type and not to substantially bind cells of a second cell type. The sample can be analyzed to make a measure of telomere abundance and the abundance can be correlated to a measure of health. | 12-18-2014 |
20140370506 | ASYMMETRIC HAIRPIN TARGET CAPTURE OLIGOMERS - The invention provides an improved stem-loop target capture oligomer and methods of use. Such a target capture oligomer has a target-binding segment forming a loop flanked by stem segments forming a stem. The stem segments are of unequal length. Such probes show little or no binding to immobilized probes in the absence of a target nucleic acid but offer good target sensitivity. The probes are particularly useful in multiplex methods of detection in which multiple target capture oligomers are present for detecting of multiple target nucleic acids (for example, detecting multiple polymorphic forms of a target gene). | 12-18-2014 |
20140370507 | NUCLEIC ACID MELTING ANALYSIS WITH SATURATION DYES - Methods are provided for nucleic acid analysis wherein a target nucleic acid is mixed with a dsDNA binding dye to form a mixture. Optionally, an unlabeled probe is included in the mixture. A melting curve is generated for the target nucleic acid by measuring fluorescence from the dsDNA binding dye as the mixture is heated. Dyes for use in nucleic acid analysis and methods for making dyes are also provided. | 12-18-2014 |
20140377745 | Method for Enhanced SNP Discrimination and Detection - The present invention describes an enhanced method for detection and discrimination of unique single nucleotide polymorphisms (SNPs) using up to 4 forced nucleotide mismatches near the 3 prime end of an allele-specific primer(s) in a PCR reaction. This method also incorporates a fluorescently labeled primer(s) for detection by capillary electrophoresis. Allele specific primers may also be tailed at the 5 prime end to enable accurate discrimination between different amplicons. | 12-25-2014 |
20140377746 | RAPID BREEDING OF ANIMALS - Various embodiments disclosed herein include systems, methods, compositions, and products by process for in vitro cycling of gametes for rapid breeding of animals. In certain embodiments, the systems and/or methods are at least partially automated. | 12-25-2014 |
20140377747 | CHEMICALLY-ENHANCED PRIMER COMPOSITIONS, METHODS AND KITS - A chemically-enhanced primer is provided comprising a negatively charged moiety (NCM), an oligonucleotide sequence having a) non-nuclease resistant inter-nucleotide linkages or b) at least one nuclease resistance inter-nucleotide linkage. The chemically-enhanced primer can be used for sequencing and fragment analysis. Methods for synthesizing the chemically-enhanced primer as well as a method of preparing DNA for sequencing, a method of sequencing DNA, and kits containing the chemically-enhanced primer are also provided. The method of sequencing DNA can comprise contacting amplification reaction products with the composition wherein excess amplification primer is degraded by the nuclease and the chemically-enhanced primer is essentially non-degraded. | 12-25-2014 |
20140377748 | Method to Quantify siRNAs, miRNAs and Polymorphic miRNAs - The present teachings provide methods, compositions, and kits for quantifying target polynucleotides. In some embodiments, a reverse stem-loop ligation probe is ligated to the 3′ end of a target polynucleotide, using a ligase that can ligate the 3′ end of RNA to the 5′ end of DNA using a DNA template, such as T4 DNA ligase. Following digestion to form an elongated target polynucleotide with a liberated end, a reverse transcription reaction can be performed, followed by a PCR. In some embodiments, the methods of the present teachings can discriminate between polymorphic polynucleotides that vary by as little as one nucleotide. | 12-25-2014 |
20140377749 | METRONIDAZOLE RESISTANCE IN TRICHOMONAS VAGINALIS AND SINGLE NUCLEOTIDE POLYMORPHISMS - The present invention is directed to the discovery of single nucleotide polymorphisms (SNPs) in the presence of metronidazole-resistant | 12-25-2014 |
20140377750 | Methods and Systems for Detecting Nucleic Acids - Methods and kits for detecting a target nucleic acid in a sample are described. In some embodiments, the sample to be analyzed includes a primer which hybridizes to at least a portion of the target nucleic acid, a probe having a first region which hybridizes to at least a portion of the target nucleic acid and a second region having a detectable label, a polymerase which extends the hybridized primer and an enzyme comprising nuclease activity that can cleave the hybridized hybridization probe to thereby release a labeled probe fragment. In some embodiments, the sample can then be contacted with a solid support comprising surface bound capture probes which can hybridize to the labeled probe fragment(s). These capture probes more readily bind to the probe fragment(s) than to the intact hybridization probe. The label can then be detected on the support surface. In this manner, improved discrimination between the probe fragments and the intact hybridization probes can be achieved. | 12-25-2014 |
20140377751 | NUCLEIC ACID ANALYSIS USING EMULSION PCR - The present invention provides methods for analyzing large nucleic acids including chromosomes and chromosomal fragments. In one aspect, the present invention provides a method of nucleic acid analysis comprising the steps of (a) obtaining a sample of nucleic acid comprising at least one chromosome or fragment greater than about 1 000 base pairs in length and containing a target region; (b) creating an emulsion in which each drop of the emulsion contains an average of between about 0-2, 0-1.75, 0-1.5, 0-1.0, 0-0.75, 0-0.5, or fewer chromosomes or fragments of step (a), (c) performing emulsion PCR, (d) quantifying the number of emulsion droplets containing amplified nucleic acid from the target region; (e) calculating the ratio of droplets containing amplified nucleic acid from the target region to total droplets; and (f) comparing the ratio of step (e) to a reference ratio representing a known genotype. | 12-25-2014 |
20140377752 | NOVEL SYNTHESIS-REGULATING SRNA AND METHOD FOR PREPARING SAME - The present invention relates to a novel customized sRNA that reduces gene expression in prokaryotic cells, a preparation method thereof, and the use thereof, and more particularly to a synthetic sRNA comprising an Hfq binding site, derived from the sRNA of any one of MicC, SgrS and MicF, and a region that base-pairs with the target gene mRNA, and to a preparation method thereof and the use thereof. The synthetic sRNA according to the invention has an advantage in that the degree of inhibition of the target gene can be controlled by regulating the ability of the synthetic sRNA to bind to the mRNA of the target gene. The use of the synthetic sRNA that regulates the expression of the target gene makes it possible to effectively construct a recombinant microorganism without using a conventional gene deletion method and to reduce the expression of the target gene, and thus the synthetic sRNA is useful for the production of recombinant microorganisms. Also, the synthetic sRNA can be quickly applied to various strains, and thus is very suitable for the measurement of metabolic capabilities of strains and the selection of the most suitable strain. In addition, recombinant microorganisms, which are obtained by metabolic flux manipulation using the synthetic sRNA and produce tyrosine or cadaverine with high efficiency, are useful in the drug and industrial fields. In other words, the use of the sRNA according to the present invention can make it easy to select target genes whose expression is to be inhibited for the highly efficient production of metabolites. Accordingly, the synthetic sRNA can be used to construct recombinant strains for efficient production of various metabolites and to establish efficient methods for production of various metabolites, and thus is highly useful. | 12-25-2014 |
20140377753 | SYSTEM FOR DETECTING GENES IN TISSUE SAMPLES - A computer-based specimen analyzer ( | 12-25-2014 |
20140377754 | Genomic Landscapes of Human Breast and Colorectal Cancers - Human cancer is caused by the accumulation of mutations in oncogenes and tumor suppressor genes. To catalogue the genetic changes that occur during tumorigenesis, we isolated DNA from 11 breast and 11 colorectal tumors and determined the sequences of the genes in the Reference Sequence database in these samples. Based on analysis of exons representing 20,857 transcripts from 18,191 genes, we conclude that the genomic landscapes of breast and colorectal cancers are composed of a handful of commonly mutated gene “mountains” and a much larger number of gene “hills” that are mutated at low frequency. We describe statistical and bioinformatic tools that may help identify mutations with a role in tumorigenesis. These results have implications for understanding the nature and heterogeneity of human cancers and for using personal genomics for tumor diagnosis and therapy. | 12-25-2014 |
20140377755 | Universal Tags with Non-natural Nucleobases - The present invention relates to amplification primers with a universal tag and sequencing primers comprising at least one non-natural nucleobase capable of hybridizing to a complementary non-natural nucleobase. The present invention further relates to amplification methods of nucleic acid amplification and sequencing using an amplification primer with a universal tag and sequencing primers, as well as kits and solid supports comprising such primers and tags. | 12-25-2014 |
20140377756 | METHOD FOR QUANTIFYING SKIN CHANGES CAUSED BY SIX EXTERNAL EVILS AND METHOD FOR SCREENING SKIN CONDITION-IMPROVING MATERIALS USING THE SAME - A method for quantifying skin changes caused by six external evils and a method of screening skin condition-improving materials using the quantification method are described. More specifically, disclosed are a method of measuring cellular changes caused by external stimuli in a skin cell culture system, in which the degree of cellular changes obtained by applying suitable stimuli of six external evils to skin cells being cultured is measured by cellular biochemical methods, such that the conceptual effects of six external evils suggested in the prior art can be scientifically and quantitatively expressed, and a method of screening skin condition-improving materials using the measurement method. | 12-25-2014 |
20150010905 | Methods for Genotyping Selected Polymorphism - Methods for genotyping polymorphisms using a locus specific primer that is complementary to a region near a selected polymorphism are described. Methods for synthesizing pools of locus specific primers that incorporate some degenerate positions are also disclosed. A plurality of different sequence capture probes are synthesized simultaneously using degenerate oligonucleotide synthesis. The sequence of the locus specific regions of the capture probes are related in that they have some bases that are identical in each sequence in the plurality of sequences and positions that vary from one locus specific region to another. The sequences are selected based on proximity to a polymorphism of interest and because they conform to a similar sequence pattern. | 01-08-2015 |
20150010906 | CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR GENE MUTATIONS - The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided. | 01-08-2015 |
20150010907 | SERIAL ISOLATION OF MULTIPLE DNA TARGETS FROM STOOL - Provided herein is technology relating to isolating nucleic acids. In particular, the technology relates to methods and kits for extracting multiple DNA targets from human stool samples. | 01-08-2015 |
20150010908 | STR GENOTYPING BY DIFFERENTIAL HYBRIDIZATION - In a method of deducing the number of repeat units in a selected short tandem repeat (STR) in a genomic sample, at least a single stranded target DNA generated from a genomic sample comprising a selected STR, an STR probe (P1,P1′), a reference probe (P2), and two blockers (B1,B2) are provided, and at least three differential hybridization experiments are carried out, based on which the number of STR probe oligonucleotides (P1,P1′) bound per target DNA strand in each differential hybridization experiment is determined. The method further comprises the step of comparing these numbers of STR probe oligonucleotides (P1,P1′) bound per target DNA strand in the differential hybridization experiments for deducing the number of repeat units in the selected STR on the single stranded target DNA strand. Also disclosed are kits for carrying out STR genotyping by differential hybridization. | 01-08-2015 |
20150010909 | METHOD FOR CORRECTING DETECTION SIGNAL IN ISOTHERMAL NUCLEIC ACID AMPLIFICATION REACTION - The present invention provides a method for stably correcting a detection signal in an isothermal nucleic acid amplification reaction, particularly an isothermal nucleic acid amplification reaction performed at low temperature. | 01-08-2015 |
20150010910 | BIOMARKERS FOR AGE-RELATED MACULAR DEGENERATION (AMD) - A method for identifying a risk profile for age-related macular degeneration (AMD) or choroidal neovascularisation (CNV) in a subject, comprising identifying the nucleotide at one or more of the following positions: rs2071277, rs12153855 and rs9391734, or a proxy of any of those sites, in a sample obtained from the subject. | 01-08-2015 |
20150017632 | Complexity Management of Genomic DNA - The presently claimed invention provides for novel methods and kits for analyzing a collection of target sequences in a nucleic acid sample. A sample is amplified under conditions that enrich for a subset of fragments that includes a collection of target sequences. The invention further provides for analysis of the above sample by hybridization to an array, which may be specifically designed to interrogate the collection of target sequences for particular characteristics, such as, for example, the presence or absence of one or more polymorphisms. | 01-15-2015 |
20150017633 | METHODS AND COMPOSITIONS TO EVALUATE ANTIBODY TREATMENT RESPONSE - The present invention relates to methods and compositions to evaluate or assess the response of a subject to particular therapeutic treatment. More particularly, the invention provides methods to determine the response of subjects, or to adapt the treatment protocol of subjects treated with therapeutic antibodies. The invention is based on a determination of the FCGR3A genotype of a subject. The invention can be used for patients with malignancies, particularly lymphoma, and is suited to select best responders and/or adjust treatment condition or protocol for low responders. | 01-15-2015 |
20150017634 | Detection and Prognosis of Cervical Cancer - The present invention relates to methods and kits for identifying, diagnosing, prognosing, and monitoring cervical cancer. These methods include determining the methylation status or the expression levels of particular genes, or a combination thereof. | 01-15-2015 |
20150017635 | Direct Capture, Amplification and Sequencing of Target DNA Using Immobilized Primers - Certain embodiments provide a method for capturing a genomic fragment. The method may comprise: obtaining a substrate comprising a first population of surface-bound oligonucleotides and a second population of surface-bound oligonucleotides; hybridizing a first member of the first population of surface-bound oligonucleotides to a selection oligonucleotide comprising a region that hybridizes with the first member and a region that contains a genomic sequence; extending the first member of the first population of surface-bound oligonucleotides to produce a support-bound selection primer that comprises a sequence that is complementary to the genomic sequence; hybridizing the support-bound selection primer to a nucleic acid fragment comprising the genomic sequence; extending the support-bound selection primer to produce an extension product that contains a sequence that flanks the genomic sequence, e.g., in a genome; and amplifying the extension product on the substrate. | 01-15-2015 |
20150017636 | Detection and Monitoring of Macrocyclic Lactone Resistance in Nematodes - The present disclosure concerns the determination of the resistance or the susceptibility of a nematode to a macrocyclic lactone anti-helminthic based on the characterization of the Dyf-7 gene (or Dyf-7 gene ortholog) or its corresponding gene products. The present disclosure also provides tools and commercial packages for making such characterization. | 01-15-2015 |
20150017637 | RECURRENT GENE FUSIONS IN CANCER - The present disclosure relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present disclosure relates to gene fusions as diagnostic markers and clinical targets for cancer. | 01-15-2015 |
20150017638 | METHODS FOR ASSESSING RISK FOR CANCER USING BIOMARKERS - The present disclosure is directed to methods and kits for detecting, characterizing, preventing, and treating cancer, e.g., pancreatic cancer, or inflammation, by determining the presence of circulating epithelial in a biological sample and further identifying the tissue of origin using a tissue-specific biomarker, e.g., Pdx-1. | 01-15-2015 |
20150017639 | Molecular Diagnostic Assay Device And Method Of Use - Lateral flow devices and methods of use for a molecular diagnostic assay are provided. The method is suitable for detection or monitoring of targets, including biological, chemical, and material targets that exist in very low concentrations in biological samples. The methods and devices of the present application are amenable to power source-free point of care testing. | 01-15-2015 |
20150017640 | Combinations of Molecular Markers in Prostate Cancer providing a Diagnostic Tool with Improved Sensitivity/Specificity - The present invention relates to methods for in vitro establishing, or diagnosing, high grade or low grade prostate cancer in a sample, preferably from a readily obtainable sample such as an urine, a prostatic fluid or ejaculate sample or a processed, or derived sample thereof, originating from human individual suspected of suffering from prostate cancer using expression level analysis of a combination of two, or three molecular markers for prostate cancer selected from DLX1, HOXC6 and HOXD10. The present invention further relates to the use in expression level analysis of these combined markers for in vitro establishing high grade or low grade prostate cancer and to a kit of parts providing expression analysis of combinations of the present molecular markers for establishing high grade or low grade prostate cancer. | 01-15-2015 |
20150017641 | Mechanical Washing and Measuring Device for Performing Analyses - The invention describes simple and reliable cartridge constructions for carrying out analytical procedures in a closed system, especially for carrying out bioaffinity analyses. The cartridge exploits a measuring component, or a test strip ( | 01-15-2015 |
20150017642 | METHOD FOR THE DIAGNOSIS OF MYELOID NEOPLASIAS AND SOLID TUMORS AND DIAGNOSTIC KITS - The present application relates to an ex vivo or in vitro method to determine the presence or absence of a mutation or a variation in the NF-E2 gene in a sample from a patient suffering from a myeloid neoplasm or solid tumor whereby said method comprises: | 01-15-2015 |
20150017643 | METHOD OF MOLECULAR TYPING - The invention relates to the identification of genetic traits in an individual. More specifically, the invention relates to identifying human leukocyte antigen (HLA) alleles and haplotypes in a potential donor sample. The invention can be used for matching a donor with a recipient for transplantation, other medical needs and high-through put screening of samples. | 01-15-2015 |
20150017644 | PLANT TRANSFORMATION WITHOUT SELECTION - The invention provides methods for identifying regenerated transformed plants and differentiated transformed plant parts, obtained without subjecting plant cells to selective conditions prior to regenerating the cells to obtain differentiated tissues. In particular embodiments, the plant cells are corn plant cells. Methods for growing and handling plants, including identifying plants that demonstrate specific traits of interest are also provided. | 01-15-2015 |
20150017645 | Qualitative and Quantitative Detection of Microbial Nucleic Acids - The present invention relates to new methods and uses for the qualitative and quantitative detection of microbial nucleic acids using at least a first control nucleic acid, or a first and a second control nucleic acid in different concentrations. The method is based on amplification of nucleic acids, for example the polymerase chain reaction. Further provided are kits comprising components for performing said methods and uses. | 01-15-2015 |
20150017646 | SYSTEMS AND METHODS FOR MULTIPLEX ANALYSIS OF PCR IN REAL TIME - The present invention provides methods and systems for real-time measurements of PCR with multiplexing capability. Certain embodiments relate to methods and systems that use fluorescently encoded superparamagnetic microspheres for the immobilization of amplification products during the PCR process, and an imaging chamber of a measurement device that is also capable of controllable thermal cycling for assisting the PCR process. | 01-15-2015 |
20150017647 | TISSUE PROCESSING APPARATUS - An apparatus for processing a biological sample is provided. The biological sample being arranged on a first planar surface of a carrier, the apparatus having a second planar surface arranged substantially parallel to said first planar surface and at a first distance from said first planar surface. The first planar surface and said second planar surface are arranged at an angle (A) greater than zero degree from the horizontal plane (HP). The apparatus having a supply for supplying an amount of a liquid that is to be applied to said biological sample. The first planar surface and said second planar surface are configured to be arranged at a second distance from each other, said second distance being such that said supplied amount of liquid is distributed over said biological sample when said first planar surface and said second planar surface are brought to said second distance from each other. | 01-15-2015 |
20150024386 | METHOD AND RAPID TEST FOR THE DETECTION OF SPECIFIC NUCLEIC ACID SEQUENCES - A universally usable method for specific detection of target nucleic acid sequences, which method can be performed very rapidly and also simply and furthermore which does not need any expensive instrumental systems. The method is intended to be suitable as a molecular genetic rapid test and to respect the requirements of diagnostic specificity assurance. In this regard it is important that only one specific amplification product be detected and that amplification artifacts can be unambiguously discriminated. A nucleic acid amplification kit suitable for performing this method. | 01-22-2015 |
20150024387 | Methods for the Reduction of Stutter in Microsatellite Amplification - The invention provides a method for reducing stutter in the amplification of a microsatellite comprising the steps of providing a sample comprising a microsatellite having a G+C content of 50% or less; contacting the sample with at least one enzyme having nucleic acid polymerase activity; and incubating the sample with the enzyme for a sufficient amount of time and under conditions sufficient to amplify the microsatellite; wherein the incubation is performed in the presence of an amount of betaine, sorbitol or mixtures thereof, effective to reduce stutter relative to the amount of stutter observed in the absence of betaine and/or sorbitol. The invention also provides compositions containing betaine and/or sorbitol, kits for amplifying microsatellites having a G+C content of 50% or less, and methods of using all of the foregoing. | 01-22-2015 |
20150024388 | Expression of SEP-like Genes for Identifying and Controlling Palm Plant Shell Phenotypes - Methods and compositions are provided for optimizing fruit morphology. | 01-22-2015 |
20150024389 | METHOD FOR DETECTING BLADDER CANCER CELLS, PRIMER USED IN METHOD FOR DETECTING BLADDER CANCER CELLS, AND BLADDER CANCER MARKER - Provided are: a method for detecting bladder cancer with high detection sensitivity, which has a high specificity for bladder cancer and is capable of detecting bladder cancer tissues with low grade of malignancy; and a bladder cancer marker. A method for detecting bladder cancer cells, which comprises detection of the amount of expressed bladder cancer marker in a subject sample collected from a subject, said bladder cancer marker being composed of one or more miRNAs selected from among miR-124, miR-9 and miR-137; a primer which is used in the method for detecting bladder cancer cells; and a bladder cancer marker. | 01-22-2015 |
20150024390 | METHOD AND KIT FOR DETECTING SPECIFIC SINGLE NUCLEOTIDE POLYMORPHISM ASSOCIATED WITH ANKYLOSING SPONDYLITIS - Disclosed is a nucleotide fragment of pathogenic single nucleotide polymorphism associated with ankylosing spondylitis with genome-wide correlation analysis of the ankylosing spondylitis patient and healthy control population in large sample by an intensive genome-wide SNP chip, the nucleotide fragment being located at the site of rs17095830, wherein for the ankylosing spondylitis patients, the base as G is significantly more frequent than that of the healthy control; in contrast, the base as A at the site is significantly less than the healthy control, i.e., the base at the site of rs17095830 as G may be effective to aid diagnosis of the AS disease. Provided herein are a method and kit for detecting the corresponding pathogenic single nucleotide polymorphism associated with ankylosing spondylitis, which enables early aided specific diagnosis of ankylosing spondylitis and has broad application prospects. | 01-22-2015 |
20150024391 | COMPOSITIONS AND METHODS FOR DETECTING ALLOGENEIC MATTER IN A SUBJECT - The present disclosure provides a panel of nucleic acid molecule primers specific for HLA-specific alleles and other genetic polymorphisms, which are useful for quantitatively amplifying these markers to detect, diagnose, and monitor individuals who have or are at risk of certain disease conditions, such as autoimmune disease, proliferative disease, infectious disease, allograft rejection, or pregnancy-related pathologies. | 01-22-2015 |
20150024392 | METHOD FOR PRODUCING A BIOSENSOR - An object of the present invention is to provide a biosensor comprising a hydrogel capable of immobilizing a physiologically active substance thereon, which can be produced conveniently by use of a safe material, and a method for producing the same. The present invention provides a method for producing a biosensor, which comprises bringing a polymer containing an activated carboxyl group into contact with a substrate surface coated with an organic layer having an amino group to thereby bind the polymer to the organic layer. | 01-22-2015 |
20150024393 | Method and System for Automated Image Analysis in Cancer Cells - A method of screening for the presence and/or extent of a pathology in a subject, the pathology characterized by an abnormal chromosomal component in a cell of the subject, comprising the steps of: contacting a biological sample comprising cell nuclei from said subject with, one or more distinguishable labeled probes directed to at least one chromosomal sequence that characterizes the abnormality under conditions that promote hybridization of the one or more probes to the at least one sequence, automatically obtaining a representation of the one or more distinguishable labels hybridized to the chromosomal sequences, automatically analyzing the distribution and intensity of binding of the one or more labels in the representation to determine the presence and/or extent of an abnormal chromosomal component; and automatically reporting results of the analysis; wherein the steps are carried out without intervention by a human. | 01-22-2015 |
20150024394 | Method and System for Automated Image Analysis in Cancer Cells - A method of screening for the presence and/or extent of a pathology in a subject, the pathology characterized by an abnormal chromosomal component in a cell of the subject, comprising the steps of: contacting a biological sample comprising cell nuclei from said subject with, one or more distinguishable labeled probes directed to at least one chromosomal sequence that characterizes the abnormality under conditions that promote hybridization of the one or more probes to the at least one sequence, automatically obtaining a representation of the one or more distinguishable labels hybridized to the chromosomal sequences, automatically analyzing the distribution and intensity of binding of the one or more labels in the representation to determine the presence and/or extent of an abnormal chromosomal component; and automatically reporting results of the analysis; wherein the steps are carried out without intervention by a human. | 01-22-2015 |
20150024395 | Method and System for Automated Image Analysis in Cancer Cells - A method of screening for the presence and/or extent of a pathology in a subject, the pathology characterized by an abnormal chromosomal component in a cell of the subject, comprising the steps of: contacting a biological sample comprising cell nuclei from said subject with, one or more distinguishable labeled probes directed to at least one chromosomal sequence that characterizes the abnormality under conditions that promote hybridization of the one or more probes to the at least one sequence, automatically obtaining a representation of the one or more distinguishable labels hybridized to the chromosomal sequences, automatically analyzing the distribution and intensity of binding of the one or more labels in the representation to determine the presence and/or extent of an abnormal chromosomal component; and automatically reporting results of the analysis; wherein the steps are carried out without intervention by a human. | 01-22-2015 |
20150024396 | BRASSICA AHAS GENES AND GENE ALLELES THAT PROVIDE RESISTANCE TO IMIDAZOLINONE HERBICIDES - Plants, plant parts and plant seeds that are resistant to imidazolinone herbicides are provided. Plants are disclosed that contain a mutation in an AHAS gene. Specifically, plants are disclosed that contain a mutant AHAS gene allele of the | 01-22-2015 |
20150031021 | METHODS AND NUCLEIC ACIDS FOR DETERMINING THE PROGNOSIS OF A CANCER SUBJECT - The invention provides methods, nucleic acids and kits for determining the prognosis of a subject having cancer. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of said disorder, thereby enabling the improved diagnosis and treatment of patients. | 01-29-2015 |
20150031022 | DNA METHYLATION MARKERS AND METHODS OF USE - The present invention provides methods for identifying metastases by detecting nucleic acid hypermethylation of one or more genes in one or more samples, and in particular in the lymph nodes. The invention further relates to DNA methylation as a predictor of disease recurrence and patient prognosis, specifically in the field of cancer biology. | 01-29-2015 |
20150031023 | METHOD OF DETECTING NUCLEIC ACIDS CONTAINING A GENETIC VARIATION - Provided are a composition or a kit for detecting a nucleic acid with genetic variation including a first amplification blocking nucleic acid and a second amplification blocking nucleic acid, and a method of detecting a nucleic acid with genetic variation by using the same. Based on the above, a nucleic acid with genetic variation can be detected with high sensitivity and accuracy. | 01-29-2015 |
20150031024 | ENZYMATIC PREPARATION OF 10 BASE TO 50 KB DOUBLE-STRAND DNA REAGENT FOR SEQUENCING WITH A NANOPORE-POLYMERASE SEQUENCING DEVICE - The invention herein disclosed provides for devices, reagents, and methods that can detect and control an individual polymer in a mixture is acted upon by another compound, for example, an enzyme, in a nanopore. Of particular note is the use of reagents to rapidly sequence a polynucleotide. The invention is of particular use in the fields of forensic biology, molecular biology, structural biology, cell biology, molecular switches, molecular circuits, and molecular computational devices, and the manufacture thereof. | 01-29-2015 |
20150031025 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND USE THEREOF - The invention relates to the identification of genetic products that are expressed in association with a tumor and the nucleic acid coding therefor. The invention relates to the therapy and diagnosis of diseases in which said genetic products that are expressed in association with a tumor are expressed in aberrant manner. The invention also relates to proteins, polypeptides, and peptides which are expressed in association with a tumor and the nucleic acids coding therefor. | 01-29-2015 |
20150031026 | ENHANCED LIGATION REACTIONS - In some embodiments, methods for ligating nucleic acid ends comprise: conducting a nucleic acid ligation reaction in the presence of at least one agent that generates a ligatable terminal 5′ phosphate group by removing an adenylate group from a terminal 5′ phosphate of a nucleic acid. In some embodiments, an aprataxin enzyme can catalyze removal of an adenylate group from a terminal 5′ phosphate of a nucleic acid. In some embodiments, methods for ligating nucleic acid ends comprise: conducting a nucleic acid ligation reaction in the presence of an aprataxin enzyme under conditions suitable for ligating nucleic acid ends. | 01-29-2015 |
20150031027 | USE OF SAA1 beta/beta HOMOZYGOTE IN THE PROGNOSIS DIAGNOSIS AND DIAGNOSIS OF LIVER CIRRHOSIS - Provided is uses of SAA1β/β(1.5/1.5) homozygote in prognosis and/diagnosis of liver cirrhosis, and in preparation of a reagent for liver cirrhosis prognosis and/or liver cirrhosis diagnosis. Recognition of liver cirrhosis susceptible populations can be achieved by detection of human SAA1β/β homozygote and non-SAA1β/β homozygote through real-time fluorescence quantitative allele specific PCR. | 01-29-2015 |
20150031028 | METHOD OF DNA DETECTION AND QUANTIFICATION BY SINGLE-MOLECULE HYBRIDIZATION AND MANIPULATION - The present invention relates to a fast method for the detection and the quantification of a nucleic acid, DNA or RNA. Specifically, the invention provides a method for detecting and quantifying the presence of a specific nucleic acid molecule which is based on physical and electronic treatments. The method of the invention is particularly useful for applications as diverse as detection of chromosomal abnormal distributions or gene expression analysis. | 01-29-2015 |
20150031029 | METHOD OF DETECTING RESIDUAL GENOMIC DNA AND A KIT THEREOF - The present disclosure relates to a highly specific and sensitive method of detecting host cell impurities in a biological sample by using quantitative real time polymerase chain reaction (q PCR). The present disclosure also provides novel designed primer and probe to amplify only the specific Alu family of dispersed repetitive sequences from Chinese hamster ovary cells used for expression of therapeutic proteins. | 01-29-2015 |
20150031030 | METHOD FOR ANALYSING FOETAL NUCLEIC ACIDS - The invention relates to a method for analyzing fetal nucleic acids from the supernatant of the culture medium of fetal cell cultures of an in vitro fertilization, comprising the steps: a) removing from the culture vessel used for cultivating the fertilized egg cell the cell-free supernatant of the in vitro fertilization culture medium, which supernatant contains fetal nucleic acid, b) enriching the fetal nucleic acids contained in the supernatant, and c) carrying out an analysis of the nucleic acids present in the cell-free supernatant. The invention further relates to a method for analyzing fetal nucleic acids from the liquid surrounding the embryo within the zona pellucida, the blastocoel or the blastocyst cavity, comprising the steps: a) removing the fluid containing the cell-free fetal nucleic acid from the liquid surrounding the embryo within the zona pellucida, the blastocoel or the blastocyst cavity of the blastula or blastocyst, b) enriching the nucleic acid contained in the fluid surrounding the embryo within the zona pellucida, or the fetal nucleic acids contained in the blastocoel or the blastocyst cavity, and c) carrying out an analysis of the nucleic acids present in the cell-free supernatant. | 01-29-2015 |
20150031031 | APPARATUS FOR COLLECTING FINGERPRINTS AND BUCCAL SWABS - Disclosed are devices and methods for collection, labeling and matching biological samples containing nucleic acid in conjunction with collecting at least one ridge and valley signature such as a fingerprint or footprint of an individual. Such devices and methods are used in forensic, human identification, paternity, tissue typing, and screening technologies to rapidly process an individual's identity, determine the identity of an individual along with the genotype profile of the individual. | 01-29-2015 |
20150031032 | Methods and Compositions for Determining Indication for Prostate Biopsy - The present invention provides a method of identifying a subject for whom a prostate biopsy is indicated, comprising: a) determining, from a nucleic acid sample obtained from the subject, a genotype for the subject at a plurality of biallelic polymorphic loci, wherein each of said plurality has an associated allele and an unassociated allele, wherein the genotype is selected from the group consisting of homozygous for the associated allele, heterozygous, and homozygous for the unassociated allele; b) calculating a genetic risk score (GRS) for the subject based on the genotype determined in step (a); and c) analyzing the GRS of the subject in combination with a prostate specific antigen (PSA) level of the subject to identify a prostate cancer detection rate for the subject, whereby a prostate cancer detection rate of greater than or equal to a reference value identifies the subject as a subject for whom a prostate biopsy is indicated. | 01-29-2015 |
20150031033 | METHOD AND KIT FOR DETECTION OF CANCER, AND THERAPEUTIC AGENT FOR CANCER - The object aims to comprehensively analyze miRNA that undergoes epigenetic silencing in cancer to identify miRNA associated with cancer, elucidate the role of the identified miRNA in cancer, and develop a novel method for detecting cancer and a novel therapeutic agent for cancer both of which relate to the miRNA. Disclosed is a method for detecting cancer in a subject, which comprises detecting methylated CpG in a CpG island located in a promoter region of a microRNA 34b gene and/or a microRNA 34c gene in a biological sample collected from the subject. Also disclosed is a therapeutic agent for cancer, which comprises a nucleic acid encoding a BTG4 gene or BTG4, or comprises a nucleic acid encoding a miR-34b gene and/or an miR-34c gene or miR-34b and/or miR-34c. | 01-29-2015 |
20150031034 | METHODS AND COMPOSITIONS FOR DETECTING GENETIC MATERIAL - This invention provides compositions and methods for detecting differences in copy number of a target polynucleotide. In some cases, the methods and compositions provided herein are useful for diagnosis of fetal genetic abnormalities, when the starting sample is maternal tissue (e.g., blood, plasma). The methods and materials described apply techniques for allowing detection of small, but statistically significant, differences in polynucleotide copy number. | 01-29-2015 |
20150037789 | SYSTEMIC GENOTOXICITY AS BLOOD MARKER FOR ALLERGIC INFLAMMATION - The invention provides a method for detection of allergic inflammation in a subject that comprises assaying a test sample of peripheral blood from the subject for a marker of DNA damage. An elevated amount of marker present in the test sample compared to control sample is indicative of inflammation. The method can be adapted for quantitatively monitoring the efficacy of treatment of allergic inflammation in a subject. Markers of DNA damage include single- and/or double-stranded breaks in leukocytes, oxidative DNA damage in leukocytes, or a marker of nitric oxide oxidative activity (protein nitrosylation in leukocytes). This unexpected discovery of markers of systemic genotoxicity present in circulating leukocytes enables detection of allergic inflammation with a relatively simple and minimally invasive assay using peripheral blood. | 02-05-2015 |
20150037790 | CYTOSINE VARIANT DETECTION - This invention relates to methods for variant cytosine detection, and kits and probes for variant cytosine detection. In particular the variant cytosine detection is related to detection of methylated cytosine, hydroxymethylated cytosine, carboxycytosine and/or formylcytosine in nucleic acid. | 02-05-2015 |
20150037791 | METHODS AND KITS FOR MULTIPLEX AMPLIFICATION OF SHORT TANDEM REPEAT LOCI - Compositions, methods and kits are disclosed for use in simultaneously amplifying at least 20 specific STR loci of genomic nucleic acid in a single multiplex reaction, as are methods and materials for use in the analysis of the products of such reactions. Included in the present invention are materials and methods for the simultaneous amplification of 23 and 24 specific loci in a single multiplex reaction, comprising the 13 CODIS loci, the Amelogenin locus, an InDel and at least six to ten additional STR loci, including methods, kits and materials for the analysis of these loci. | 02-05-2015 |
20150037792 | PRIMERS AND METHODS FOR THE DETECTION AND DISCRIMINATION OF NUCLEIC ACIDS - The present invention provides novel primers and methods for the detection of specific nucleic acid sequences. The primers and methods of the invention are useful in a wide variety of molecular biology applications and are particularly useful in allele specific PCR. | 02-05-2015 |
20150037793 | DETECTION METHODS FOR OIL PALM SHELL ALLELES - Methods, compositions, and kits for determining SHELL genotype and predicting shell fruit form of oil palm plants. | 02-05-2015 |
20150037794 | MARKER FOR DIAGNOSING FORELIMB-GIRDLE MUSCULAR ANOMALY IN MAMMAL INDIVIDUAL, AND DETECTION METHOD USING SAME - The present invention uses an isolated polynucleotide having a part or whole of GFRA1 gene, mutant GFRA1 protein, and mRNA encoding the mutant GFRA1 protein, each of which includes a loss-of-function mutation of GFRA1, as markers for diagnosing an animal as affected by forelimb-girdle muscular anomaly or as a carrier of forelimb-girdle muscular anomaly. In addition, an isolated polynucleotide comprising one or more selected from the group consisting of MOK2630, MOK2637, SNP B, and SNP D can be used as markers for diagnosing whether a bovine animal is affected by forelimb-girdle muscular anomaly or whether a bovine animal is a carrier of forelimb-girdle muscular anomaly. | 02-05-2015 |
20150037795 | METHOD AND PRIMER SET FOR DETECTING MUTATION - Disclosed herein is a polymerase chain reaction (PCR)-based method for detecting an insertion/deletion variant, as compared with a reference sequence, in a selected region of a target gene in a sample. The target gene has a template strand and a coding strand complementary to the template strand. The method uses a primer set that includes a blocking primer, and a forward primer. The blocking primer and the forward primer are partially overlapping and have different melting temperatures, and the 3′-end of the blocking primer is modified to prevent the extension of the blocking primer during the PCR. Accordingly, under specific PCR conditions, the presence of the PCR product is indicative of the presence of an insertion/deletion mutation in the selected region, and the absence of the PCR product is indicative of the absence of an insertion/deletion mutation in the selected region. | 02-05-2015 |
20150037796 | TBL1XR1 AND TP63 TRANSLOCATIONS - This document provides methods and materials involved in detecting translocations of TBL1XR1 and TP63 nucleic acid. For example, methods and materials for detecting TBL1XR1 and TP63 gene rearrangements (e.g., translocations) associated with cancer (e.g., T-cell lymphomas) as well as methods and materials for detecting cancers (e.g., T-cell lymphomas) with a dominant negative TP63 phenotype are provided. | 02-05-2015 |
20150037797 | IMMUNOASSAY FOR DETECTION OF SPECIFIC NUCLEIC ACID SEQUENCES SUCH AS MIRNAS - The invention relates to a method of detecting nucleic acid molecules by immunoassay detection. Detection of a specific nucleic acid molecule of interest is achieved by using a nucleic acid probe in solution which hybridizes in solution to the nucleic acid molecule of interest. Immunoassay detection is achieved by using an antibody specific for the hybrid formed by hybridization of the nucleic acid probe to the nucleic acid molecule of interest. | 02-05-2015 |
20150037798 | PRECURSOR miRNA LOOP-MODULATED TARGET REGULATION - Modulation of mRNA activity is achieved with precursor miRNAs (ta-RNAs). ta-RNAs, primarily pre-miRNAs and pri-miRNAs, including truncated and mutated ta-RNAs, are employed for modulation of mRNA expression where it is found that pri- and pre-miRNA have activity independently of the presence of functional mature miRNAs. Modification of at least one of the stem and loop of the ta-RNAs to enhance binding of the ta-RNA to the target mRNA is employed. The modification may be enhanced complementarity between the ta-RNA and the target mRNA and/or improved thermodynamic efficiency in binding of the ta-RNA to the target. | 02-05-2015 |
20150037799 | BIOCHIP AND TARGET DNA QUANTITATIVE METHOD - A biochip used for quantitative analysis of a target DNA contained in a sample. The biochip includes a type I chamber that includes a primer designed to bind to the target DNA, an internal standard DNA of a first amount that has a sequence different from a sequence of the target DNA, and is amplifiable with the primer, and a fluorescent probe that is designed to bind to a part of a PCR product of the target DNA and to a part of a PCR product of the internal standard DNA. The fluorescent probe fluoresces differently for the PCR product of the target DNA and the PCR product of the internal standard DNA. The biochip also includes a type II chamber that includes the internal standard DNA of a second amount, the primer, and the fluorescent probe. The first and second amounts are different. | 02-05-2015 |
20150037800 | METHODS AND VECTORS FOR PRODUCING TRANSGENIC PLANTS - Methods of, and compositions for, assembling one or more transcription units in a genome without a linked selectable marker or other unwanted transcription unit are provided. Also provided methods of, and compositions for, assembling one or more transcription units in a genome with a reduced frequency of vector backbone. | 02-05-2015 |
20150044670 | PROSTATE CANCER-SPECIFIC ALTERATIONS IN ERG GENE EXPRESSION AND DETECTION AND TREATMENT METHODS BASED ON THOSE ALTERATIONS - The disclosure describes alterations in ERG gene expression. ERG isoforms and promoter sequence of the ERG gene that are involved in, or associated with, prostate cancer are provided. The disclosure further provides therapeutic compositions and methods of detecting, diagnosing, prognosing, and treating prostate cancer, including biomarkers for detecting the expression of two or more of the following genes: PSA/KLK3, PMEPA1, NKX3.1, ODC1, AMD1, and ERG. | 02-12-2015 |
20150044671 | PROBES TARGETING THE GENE ENCODING THE SHIGA TOXIN AND USE THEREOF FOR DETECTION OF ENTEROHEMORRHAGIC ESCHERICHIA COLI (EHEC) - The invention relates to a method for detection of enterohemorrhagic | 02-12-2015 |
20150044672 | STREPTAVIDIN COMPLEXES AND USES THEREOF - Provided are compositions including a streptavidin composition in which a plurality of biotin binding sites are blocked by tethered biotins. Also provided are methods of using such compositions, including cell imaging, nucleic acid analysis or detection, or biotinylation quantification. | 02-12-2015 |
20150044673 | DIAGNOSIS OF STEATOHEPATITIS - The invention discloses the use of the methylation of the keratin 23 (KRT23) gene as a marker for distinguishing between steatosis and steatohepatitis. | 02-12-2015 |
20150044674 | Hyperthermophilic Polymerase Enabled Proximity Extension Assay - The present invention relates to a proximity probe based detection assay (“proximity assay”) for an analyte in a sample, specifically a proximity probe extension assay (PEA), an in particular to an improvement in the method to reduce non-specific “background” signals, wherein the improvement comprises the use in such assays of a hyperthermophilic polymerase, said method comprising: (a) contacting said sample with at least one set of at least first and second proximity probes, which probes each comprise an analyte-binding domain and a nucleic acid domain and can simultaneously bind to the analyte; (b) allowing the nucleic acid domains of the proximity probes to interact with each other upon binding of said proximity probes to said analyte, wherein said interaction comprises the formation of a duplex; (c) extending the 3′ end of at least one nucleic acid domain of said duplex to generate an extension product, wherein the extension reaction comprises increasing the temperature of assay above room temperature and uses a polymerase enzyme which is characterised as having less than 20% of its maximal enzyme activity at 40° C. and having less than 10% of its maximal enzyme activity at 25° C., wherein the optimum temperature for maximal activity of the polymerase is more than 40° C. and wherein the polymerase is selected from | 02-12-2015 |
20150044675 | MODIFIED GENE OF HUMAN ACTIVATION-INDUCED CYTIDINE DEAMINASE (AID), A METHOD OF MODIFICATION OF HUMAN AID GENE, A COMPOSITION SHOWING AID ACTIVITY, A METHOD OF PREPARATION OF SUCH COMPOSITION IN A BACTERIAL SYSTEM AND USE OF THE COMPOSITION IN THE ANALYSES OF DNA/RNA AMINATION/DEAMINATION AND/OR METHYLATION/DEMETHYLATION - The subject of the invention is a modified gene of human activation-induced cytidine deaminase (AID), a method of modification of human AID gene, a composition showing AID activity, and a method of preparation of such composition. In particular, the invention concerns a modified gene of human AID for the production of an active enzyme in a bacterial system and use of the composition in the analyses of DNA/RNA amination/deamination and/or methylation/demethylatiori. | 02-12-2015 |
20150044676 | MULTIPLEX METHODS TO ASSAY MIXED CELL POPULATIONS SIMULTANEOUSLY - Methods to simultaneously test and screen multiplexed, mixed cell populations, e.g., populations comprising genetically heterogeneous cancer cells, in common conditions. | 02-12-2015 |
20150044677 | CLEM2, ACTIVE RETROTRANSPOSON OF COFFEE PLANTS - The present invention relates to Clem2, the first active LTR retrotransposon identified in the coffee plant, and its use in the clonal and/or varietal identification of coffee plants. The invention provides PCR primers, kits comprising such PCR primers, and methods using such kits and/or PCR primers for the clonal and/or varietal identification of several coffee species. The primers, kits and methods are particularly useful for coffee certification and traceability. | 02-12-2015 |
20150044678 | COMPOSITIONS, METHODS, AND PLANT GENES FOR THE IMPROVED PRODUCTION OF FERMENTABLE SUGARS FOR BIOFUEL PRODUCTION - Described herein are compositions comprising at least one auxin transport inhibitor for pre-treating a plant or seed to increase saccharification, or saccharide release by hydrolysis, the at least one auxin transport inhibitor being in an amount effective to increase sugar release from a plant tissue by hydrolysis. Also described are plant mutations, and methods to screen for such plant mutations, having an improved sugar release phenotype. The described compositions, methods and plant mutations are particularly useful for producing biofuel crops, such as maize, to improve sugar extractability from lignocellulosic biomass and hence, the efficiency of bioethanol production overall. | 02-12-2015 |
20150044679 | SYSTEMS, DEVICES, AND METHODS FOR DEPLOYING ONBOARD REAGENTS IN A DIAGNOSTIC DEVICE - Disclosed herein are systems, devices, and methods for detecting the presence of a pathogen in a biological host, such as in a point of care setting. In certain aspects, materials and methods improve point of care devices by providing pre-loaded, preferably dried, agents for performing one or more of sample lysis and signal enhancement inside the device. | 02-12-2015 |
20150044680 | PROBES FOR IMPROVED MELT DISCRIMINATION AND MULTIPLEXING IN NUCLEIC ACID ASSAYS - Methods and compositions for the detection and quantification of nucleic acids are provided. In certain embodiments, methods involve the use of primers or probes that comprise a non-natural nucleotide linked to a reporter. Target nucleic acids are detected by the polymerization of a complementary probe or primer that incorporated a cognate non-natural nucleotide linked to a quencher. | 02-12-2015 |
20150044681 | METHOD TO PREDICT THE PATTERN OF LOCOMOTION IN HORSES - The present invention provides methods for predicting the pattern of locomotion in a horse including the ability of a horse to use different gaits and the ability to trot at a fast speed. The methods comprise determining in a sample of DNA obtained from a horse the presence or absence of at least one genetic marker, wherein said at least one genetic marker is located on horse chromosome 23, said marker being associated with the ability to use different gaits. The invention further provides primers that amplify markers being associated with the ability to use different gaits and hybridization probes to detect markers being associated with the ability to use different gaits and the ability to trot at a fast speed. | 02-12-2015 |
20150050644 | Method for Detecting Pyrophosphoric Acid Using Support Having Boronic Acid Group Immobilized Thereon - An object of the present invention is to provide a method capable of easily and directly performing DNA sequencing by directly detecting pyrophosphoric acid released by an enzymatic reaction, particularly with a DNA polymerase or a DNA ligase. The present invention provides a method and a device for detecting pyrophosphoric acid by measuring an electrical change occurring when a boronic acid group immobilized on an electrically conductive support reversibly binds to pyrophosphoric acid. | 02-19-2015 |
20150050645 | METHOD OF DETECTING TARGET MATERIAL, SENSOR CHIP, AND DETECTING DEVICE - A method of detecting a target material ( | 02-19-2015 |
20150050646 | Methods and Reagents for Treatment and Diagnosis of Vascular Disorders and Age-Related Macular Degeneration - Disclosed are screening methods for determining a human subject's propensity to develop a vascular disorder and/or age-related macular degeneration (AMD), therapeutic or prophylactic compounds for treating disease or inhibiting its development, and methods of treating patients to alleviate symptoms of the disease, prevent or delay its onset, or inhibit its progression. The inventions are based on the discovery that persons with a genome having a deletion of the CFHR-1 and/or CFHR-3 gene, which normally lie on human chromosome 1 between DNA encoding CFH and CFHR-4, are at reduced risk of developing AMD, and elevated risk of developing vascular disease such as aneurysm. | 02-19-2015 |
20150050647 | Methods for Diagnosing Prostate Cancer and Predicting Prostate Cancer Relapse - The present invention relates to methods and compositions for diagnosing prostate cancer and/or determining whether a prostate cancer patient is at increased risk of suffering a relapse, or a rapid relapse, of his cancer. It is based, at least in part, on the results of a comprehensive genome analysis on 241 prostate cancer samples (104 prostate cancer, 85 matched bloods, 49 matched benign prostate tissues adjacent to cancer, and 3 cell lines) which indicate that (i) genome copy number variation (CNV) occurred in both cancer and non-cancer tissues, and (ii) CNV predicts prostate cancer progression. | 02-19-2015 |
20150050648 | Synthetic DNA-Antibody Complex as External Reference for Chromatin Immunoprecipitation - The present invention provides an external standard in the form of a nucleic acid-antibody complex to be used in a chromatin immunoprecipitation method. | 02-19-2015 |
20150050649 | METHOD FOR DETECTING DNA HAVING MICROSATELLITE REGION - The invention provides a method of detecting DNA having a microsatellite region without causing the problem of a non-specific reaction product. The method includes (1) contacting a probe, which does not have a nucleotide sequence complementary to the microsatellite region and hybridizes with both sides of the nucleotide sequences of the microsatellite region, with DNA having the microsatellite region, to form a hybrid of the DNA and the probe, which has a loop structure including a microsatellite region, (2) separating the obtained hybrid, (3) detecting the hybrid. The invention also provides a hybrid of DNA and a probe, having a loop structure including a microsatellite region, which is made by contacting DNA having a microsatellite region with the probe which does not have a nucleotide sequence complementary to the microsatellite region, and hybridizes with both sides of the nucleotide sequence of the microsatellite region. | 02-19-2015 |
20150050650 | METHODS FOR GENERATING AN IMAGE OF A BIOLOGICAL SAMPLE - A method for generating an image of a region of interest in a biological sample comprising the steps of: generating a first image including the region of interest of the biological sample having undergone a first protocol but not a second protocol; and generating a second image including the region of interest of the biological sample after having undergone a second protocol; wherein the region of interest is smaller than said sample. Also provided is a method of analyzing a biological sample, comprising providing an image of the biological sample according to the method for generating an image of a region of interest in a biological sample, and analyzing the biological sample from the image. Further provided are system and kit that comprise the means for executing the novel methods. | 02-19-2015 |
20150050651 | NUCLEIC ACIDS FOR NUCLEIC ACID AMPLIFICATION - Nucleic acids sequences that can be used for nucleic acid amplification, for example quantitative nucleic acid amplification, are provided herein. | 02-19-2015 |
20150050652 | COMPOSITION FOR PROCESSING HISTOLOGICAL, POSTMORTEM, CYTOLOGICAL SAMPLES - The present disclosure describes a composition for preparing histological, postmortem, cytological or similar samples for the analysis thereof, wherein the composition is not harmful, non-toxic, and able to rapidly produce dehydration and diaphonization of the biological samples. | 02-19-2015 |
20150050653 | Sample Preparation for in Situ Nucleic Acid Analysis, Methods and Compositions Therefor - Sample preparation processes for in situ RNA or DNA analysis, methods and compositions therefor are provided. Processes provided herein allow DNA or RNA analysis to be carried out in the same tube or on an aliquot of the prepared sample without centrifugation or extraction. The preparation process can be carried out at room temperature in as little as seven minutes and is amenable to high throughput processing using manual or robotic platforms. | 02-19-2015 |
20150056613 | METHODS AND SYSTEMS FOR DETECTING SEQUENCE VARIANTS - The invention provides methods for identifying rare variants near a structural variation in a genetic sequence, for example, in a nucleic acid sample taken from a subject. The invention additionally includes methods for aligning reads (e.g., nucleic acid reads) to a reference sequence construct accounting for the structural variation, methods for building a reference sequence construct accounting for the structural variation or the structural variation and the rare variant, and systems that use the alignment methods to identify rare variants. The method is scalable, and can be used to align millions of reads to a construct thousands of bases long, or longer. | 02-26-2015 |
20150056614 | DEVICES AND METHODS OF CELL CAPTURE AND ANALYSIS - The present invention provides a device for isolating target biomolecules or cells from samples, particularly biological samples. In particular, the device comprises a loading mixture, which contains the biological sample and a first binding entity that specifically binds to the target biomolecule or target cell; and a micro-channel coated with a second binding entity that binds directly or indirectly to the first binding entity. Methods of capturing, detecting, and/or evaluating target biomolecules or target cells (e.g. cancer cells) in biological samples are also disclosed. | 02-26-2015 |
20150056615 | ISOLATION OF FACTORS THAT ASSOCIATE DIRECTLY OR INDIRECTLY WITH NON-CODING RNAS - Methods and assays are provided for isolating factors including polypeptides, ribonucleic acids (RNAs) and polypeptide complexes that are associated with a target nucleic acid sequence. The target nucleic acid sequence may be comprised within chromatin. The methods are suitable for identification and characterisation of factors including non-coding RNAs (ncRNAs) that associate with specified genomic loci. | 02-26-2015 |
20150056616 | COMPOSITION AND METHODS RELATED TO MODIFICATION OF 5-HYDROXYMETHYLCYTOSINE (5-hmC) - The present invention relates generally to the field of molecular biology. More particularly, it concerns methods and compositions for detecting, evaluating, and/or mapping 5-hydroxymethyl-modified cytosine bases within a nucleic acid molecule. | 02-26-2015 |
20150056617 | METHODS AND COMPOSITIONS FOR ANALYZING AHASL GENES IN WHEAT - The present disclosure provides methods, kits, and primers for analyzing AHASL genes of plants, including wheat. The methods, kits, and primers of the present disclosure can make use of forward AHASL primers designed without use of software or other assay-design technology and can be used in a real-time PCR assay to determine the zygosity of AHASL genes encoding AHAS enzymes providing tolerance to AHAS enzyme inhibitors. | 02-26-2015 |
20150056618 | METHOD AND APPARATUS - A method for mapping the number and location of restriction enzymes sites for a given restriction enzyme in a target nucleic acid comprises the steps of (1) translocating a target nucleic acid having detectable elements characteristic of the presence of the restriction enzyme sites therein through an analysing device comprising a nanopore and a detection window and (2) causing the detectable elements to be detected as they pass though the detection window. Typically the detectable elements are formed by attaching to the restriction enzyme sites a restriction enzyme to which one or more marker moieties have been added. The data or signal obtained from the detection is suitably in the form of a distribution profile of the detectable elements, and therefore the restriction enzyme sites along the length of the target nucleic acid and can be used to create a reference set of like distribution profiles against which new distributions can be compared. When the target nucleic acid is for example double stranded human DNA such comparisons enable valuable insights to be drawn about an individual's identity or his or her susceptibility to certain health conditions. | 02-26-2015 |
20150056619 | METHOD AND SYSTEM FOR DETERMINING COPY NUMBER VARIATION - Disclosed are a method and a system for determining genome copy number variation, which relates to the technical field of bioinformatics. The method comprises obtaining reads; determining sequence labels according to the reads; counting the number of sequence labels falling into each window; performing GC correction on the sequence label number of each window and a correction according to an expected sequence label number adjusted by a control set to obtain a corrected sequence label number; selecting a demarcation point with a small significance value as a candidate CNV breaking point; rejecting the least significant candidate CNV breaking point at every turn, updating difference significance values of two candidate CNV breaking points on the left and right of the rejected candidate CNV breaking point and performing cyclic iteration until difference significance values of all candidate CNV breaking points are smaller than a termination threshold value, thereby determining a CNV breaking point. The method and the system the present invention have clinical feasibility, and can precisely detect a micro-deletion/micro-duplication area of 0.5 M under the situation of using data of about 50 M. | 02-26-2015 |
20150056620 | METHODS FOR RAPID IDENTIFICATION OF PATHOGENS IN HUMANS AND ANIMALS - The present invention provides methods of: identifying pathogens in biological samples from humans and animals, resolving a plurality of etiologic agents present in samples obtained from humans and animals, determining detailed genetic information about such pathogens or etiologic agents, and rapid detection and identification of bioagents from environmental, clinical or other samples. | 02-26-2015 |
20150056621 | PRIMERS, METHODS AND KITS FOR DETECTING KILLER-CELL IMMUNOGLOBULIN-LIKE RECEPTOR ALLELES - Embodiments of the present invention describe primer pairs, methods and kits for identifying and/or detecting killer-cell immunoglobulin-like receptor (KIR) alleles. The present primer sets include one or more primer pairs that can produce amplicons specific for an individual KIR allele and that are less than 1000 bp in size. Additionally, the primer sets can target intra-exon and/or extracellular domains of KIR alleles for amplification. | 02-26-2015 |
20150064695 | METHODS FOR SCREENING AND DIAGNOSING GENETIC CONDITIONS - The present invention relates to methods and systems useful for screening and/or diagnosing genetic conditions in a fetus. | 03-05-2015 |
20150064696 | METHOD FOR DETECTING TARGET SUBSTANCE, ASSAY KIT, AND DETECTION APPARATUS - A method for detecting a target substance, provided by the present invention, is a method for detecting a target substance, characterized in that the method comprising the steps of: preparing a complex (hybrid) comprising an aptamer which binds to the target substance, a first nucleic acid fragment comprising a nucleotide sequence complementary to the aptamer and a photoisomerizable molecule bound to a portion of the complementary nucleotide sequence, wherein the aptamer and the first nucleic acid fragment bound with the photoisomerizable molecule form double-stranded nucleotides binding; subjecting the photoisomerizable molecule in the complex to a first photoisomerization treatment to destabilize the double-stranded nucleotides binding in the complex; forming a complex of the target substance and the aptamer so as to dissolve the destabilized double-stranded nucleotides binding in the complex (hybrid); subjecting the photoisomerizable molecule to a second photoisomerization treatment to restabilize double-stranded nucleotides binding in the complex; and detecting dissolution of double-stranded nucleotides binding wherein the first nucleic acid fragment bound with the photoisomerizable molecule separates from the aptamer. | 03-05-2015 |
20150064697 | P53 COOPERATION WITH DNA METHYLATION AND SUICIDAL INTERFERON RESPONSE TO CONTROL SILENCING OF REPEATS AND NCRNAS - Provided is a disclosure of methods involving determining RNA transcripts transcribed from repeats of polynucleotide sequences, the transcription of which are normally repressed by a combination of functional p53 and DNA methylation, and methods of detecting interferon, and determining constitutive activation of an interferon type I response. The methods permit identification of cancerous or precancerous cells, can identify non-functional p53, and provide therapeutic and prophylactic approaches for cancer. | 03-05-2015 |
20150064698 | METHOD FOR DETECTING TARGET NUCLEIC ACID USING MOLECULAR BEACON-TYPE PROBE - The present invention provides a detection system using a nucleic acid probe which is commonly used in a measurement system using a recombinase (e.g., nucleic acid amplification reaction). Specifically, the present invention provides a method for detecting a target nucleic acid, comprising measuring the target nucleic acid using a cleavage enzyme, a recombinase, and a probe having characteristics of the following (a) to (c): | 03-05-2015 |
20150064699 | APPARATUS FOR PHOTOMETRIC MEASUREMENT OF BIOLOGICAL LIQUIDS - An apparatus for photometric measurement of biological liquids and a method of simultaneously measuring the presence or quantity of an analyte in a sample region are disclosed. The apparatus includes a plurality of spaced apart sample regions; a light source adapted to emit light including at least one frequency; a lens system including a light coupling system, wherein the light coupling system is disposed between the light source and the plurality of sample regions. A method is also disclosed including illuminating the sample region with a light beam emitted from a light source, wherein said light beam passes a light coupling system, the light coupling system including a telecentric element and a plurality of light mixing rods, wherein the light coupling system is disposed between the light source and the sample region such that the light beam is directed into the sample region. | 03-05-2015 |
20150064700 | MARKERS FOR PRE-CANCER AND CANCER CELLS AND THE METHOD TO INTERFERE WITH CELL PROLIFERATION THEREIN - A novel family of human mitochondrial RNAs, referred to as chimeric RNAs, which are differentially expressed in normal, pre-cancer and cancer cells, are described. Oligonucleotides targeted to the chimeric RNAs are provided. The described oligonucleotides or their analogs can be used for cancer diagnostics and cancer therapy as well as for research. In one embodiment of this invention, these oligonucleotides hybridize with the sense or with the antisense mitochondrial chimeric RNAs, and the result of the hybridization is useful to differentiate between normal proliferating cells, pre-cancer cells and cancer cells. In another embodiment of the invention, the compositions comprise oligonucleotides that hybridize with the human chimeric RNAs resulting in cancer cell and pre-cancer cell death, while there is no effect in normal cells, constituting therefore, a novel approach for cancer therapy. | 03-05-2015 |
20150064701 | METHODS AND KITS FOR PERFORMING IN SITU HYBRIDIZATION - The invention relates to methods and kits for performing in situ hybridization on a biological sample on a solid surface using nucleic acid probes that are embedded in or sorbed to a dry, fibrous matrix. | 03-05-2015 |
20150072341 | IDENTIFICATION OF METASTASIS-SPECIFIC MIRNA AND HYPOMETHYLATION SIGNATURES IN HUMAN COLORECTAL CANCER - The present invention includes methods and biomarkers for diagnosing or detecting colorectal cancer metastasis in a human subject by comparing the Alu repeat methylation level in the biological sample to an Alu repeat methylation control level from a normal non-cancerous sample from the human subject, wherein a decrease in the Alu repeat methylation level is indicative of colorectal cancer and colorectal cancer metastasis. The invention also includes methods and biomarkers for diagnosing or detecting colorectal cancer (CRC) metastasis in a human subject by determining a level of expression of let-7i, miR-10b, miR-320a, and miR-221 in the sample from the one or more biological samples; and comparing the level of expression of let-7i, miR-10b, miR-320a, and miR-221 in the sample with the level of expression of let-7i, miR-10b, miR-320a, and miR-221 from normal colorectal tissue, wherein high expression of at least on of let-7i or miR-320a is indicative of a good prognosis for the CRC, while the low expression of at least one of miR-10b or miR-221 is indicative of a good prognosis for the CRC or CRC metastasis. | 03-12-2015 |
20150072342 | METHODS OF USING FET LABELED OLIGONUCLEOTIDES THAT INCLUDE A 3'-5' EXONUCLEASE RESISTANT QUENCHER DOMAIN AND COMPOSITIONS FOR PRACTICING THE SAME - Methods and compositions are provided for detecting a primer extension product in a reaction mixture. In the subject methods, a primer extension reaction is conducted in the presence of a polymerase having 3′→5′ exonuclease activity and at least one FET labeled oligonucleotide probe that includes a 3′→5′ exonuclease resistant quencher domain. Also provided are systems and kits for practicing the subject methods. The subject invention finds use in a variety of different applications, and are particularly suited for use in high fidelity PCR based reactions, including SNP detection applications, allelic variation detection applications, and the like. | 03-12-2015 |
20150072343 | METHOD FOR DETERMINING THE PRESENCE OR ABSENCE OF SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) IN A FOOD SAMPLE - A method for detecting the presence or absence of pathogenic STEC in food samples includes
| 03-12-2015 |
20150072344 | Barcoded Universal Marker Indicator (BUMI) Tags - The BUMI tag is an invention which allows different species of mRNAs from different samples to be quantitatively measured at the first strand cDNA generation step, and is not affected by variations in amplification efficiency of different species of molecules, regardless of amplification method. It consists of a blend of defined nucleotides which comprise the bar-coding portion of the tag along with a set of randomly synthesized nucleotides which comprise the UMI (universal marker indicator) portion of the tag. This blend of Barcode and UMI parts comprises the BUMI tag. The two are interspersed so that the fixed nucleotides of the barcode do not form a contiguous region which might cause biases between different barcodes due to undesired complementarity between the barcode and amplification primers/adaptors. | 03-12-2015 |
20150072345 | 2'-ARABINO-FLUOROOLIGONUCLEOTIDE N3'-->P5' PHOSPHORAMIDATES: THEIR SYNTHESIS AND USE - Oligonucleotides with a novel sugar-phosphate backbone containing at least one 2′-arabino-fluoronucleoside and an internucleoside 3′-NH—P(—O)(OR)—O-5′ linkage, where R is a positively charged counter ion or hydrogen, and methods of synthesizing and using the inventive oligonucleotides are provided. The inventive phosphoramidate 2′-arabino-fluorooligonucleotides have a high RNA binding affinity to complementary nucleic acids and are base and acid stable. | 03-12-2015 |
20150072346 | Biofluid Collection and Filtration Device - The present specification discloses filtration devices for processing a biofluid sample, methods of purifying a biofluid sample using the disclosed filtration devices, and systems comprising components of the filtration devices. | 03-12-2015 |
20150072347 | METHODS AND KITS FOR SYNTHESIS OF siRNA EXPRESSION CASSETTES - Amplification-based methods and kits for rapidly producing siRNA expression cassettes are provided. Also provided are methods for expressing amplified siRNA expression cassettes in cells. | 03-12-2015 |
20150072348 | SYSTEMS AND METHODS FOR DIAGNOSING AND TREATING CANCER - This invention identifies and provides a recurrent translocation t(4;8) (p16.2; p23.1) associated with certain cancers and other abnormal cell growth disorders and diagnostic methods using the translocation by FISH hybridization or FOR based assays. | 03-12-2015 |
20150079587 | METHOD FOR DETECTING NUCLEIC ACIDS BY SIMULTANEOUS ISOTHERMAL AMPLIFICATION OF NUCLEIC ACIDS AND SIGNAL PROBE - Method for detecting target nucleic acids by simultaneous isothermal amplification of the target nucleic acids and a signal probe 5 using an external primer set, a DNA-RNA-DNA hybrid primer set and a DNA-RNA-DNA hybrid signal probe. The method can be used to amplify target nucleic acids in a sample, rapid and exact manner without the risk of contamination compared to the conventional methods such as PCR, and it can simultaneously amplify target nucleic acid and a signal probe, so that it can be applied to various genome projects, detection and identification of a pathogen, detection of gene modification producing a predetermined phenotype, detection of hereditary diseases or determination of sensibility to diseases, and estimation of gene expression. Thus, the method is useful for molecular biological studies and disease diagnosis. | 03-19-2015 |
20150079588 | METHODS FOR OBSERVING CELLS WITH CELL WALL OR INVERTEBRATE EMBRYOS WITH OBLONG EGGSHELL - The present invention relates to methods and devices for observing or studying cells having a cell wall or invertebrate embryos with an oblong eggshell, the devices comprising wells having a conical or frustoconical shape. | 03-19-2015 |
20150079589 | DETECTION OF DRUG RESISTANT MYCOBACTERIUM TUBERCULOSIS - This invention relates to nucleic acids, reagents and methods for detecting Rifampicin-resistant | 03-19-2015 |
20150079590 | CHARACTERIZATION AND ANALYSIS OF THE COMPOSITION AND DYNAMICS OF THE MAMMALIAN RIBOPROTEOME - The present invention relates to methods for identifying compounds that modulate the translation machinery and methods of diagnosing cancer related to deregulation of the translation machinery. In particular, the methods and diagnostic tests include determining an association between one or more targets and one or more components of the riboproteome and treating a subject with cancer by administering a compound that modulates the association between one or more targets and one or more components of the riboproteome. | 03-19-2015 |
20150079591 | PREDICTING RESPONSE TO CHEMOTHERAPY USING GENE EXPRESSION MARKERS - The present invention provides gene expression information useful for predicting whether a cancer patient is likely to have a beneficial response to treatment with chemotherapy, comprising measuring, in a biological sample comprising a breast tumor sample obtained from the patient, the expression levels of gene subsets to obtain a risk score associated with a likelihood of a beneficial response to chemotherapy, wherein the score comprises at least one of the following variables: (i) Recurrence Score, (ii) ESRI Group Score; (iii) Invasion Group Score; (iv) Proliferation Group Score; and (v) the expression level of the RNA transcript of at least one of MYBL2 and SCUBE2, or the corresponding expression product. The invention further comprises a molecular assay-based algorithm to calculate the likelihood that the patient will have a beneficial response to chemotherapy based on the risk score. | 03-19-2015 |
20150079592 | APPARATUS AND METHOD FOR PROCESSING BIOLOGICAL SAMPLES - A method and an automated apparatus for processing at least one biological sample arranged on a slide. At least one capillary staining module has a slide rack holder configured to detachably hold a slide rack configured to hold slides, and a capillary lid rack holder configured to detachably hold a capillary lid rack configured to hold capillary lids, wherein the slide rack can be removed independently of removing the capillary lid rack. A first fluid container has a first fluid. The apparatus being configured to automatically rotate the one or more slides, and to move the lids towards the slides to automatically form a capillary gap between each slide and each capillary lid, said capillary gap functioning as a capillary chamber; and to supply an amount of the first fluid to the slide. | 03-19-2015 |
20150079593 | Mutations of the PIK3CA Gene in Human Cancers - Phosphatidylinositol 3-kinases (PI3Ks) are known to be important regulators of signaling pathways. To determine whether PI3Ks are genetically altered in cancers, we analyzed the sequences of the PI3K gene family and discovered that one family member, PIK3CA, is frequently mutated in cancers of the colon and other organs. The majority of mutations clustered near two positions within the PI3K helical or kinase domains. PIK3CA represents one of the most highly mutated oncogenes yet identified in human cancers and is useful as a diagnostic and therapeutic target. | 03-19-2015 |
20150079594 | DIAGNOSTIC METHODS - This invention relates to a method of determining the susceptibility of an individual to statin-induced myopathy, comprising detecting the presence or absence of one or more polymorphisms in the SLCO1B1 gene in a biological sample from an individual, whereby the presence of one or more polymorphisms indicates that the individual has altered susceptibility to statin-induced myopathy. | 03-19-2015 |
20150079595 | METHODS AND MATERIALS FOR DETECTING GENE AMPLIFICATION - This document relates to methods and materials involved in detecting gene amplification in a mammal. For example, methods and materials for detecting amplification at CPM and MDM2 loci to determine the presence or absence of a malignant lipomatous neoplasm in a mammal are provided. | 03-19-2015 |
20150079596 | BIOSENSORS FOR BIOLOGICAL OR CHEMICAL ANALYSIS AND SYSTEMS AND METHODS FOR SAME - A biosensor is provided including a detection device and a flow cell mounted to the detection device. The detection device has a detector surface with a plurality of reaction sites. The detection device also includes a filter layer that is configured to at least one of (a) filter unwanted excitation light signals; (b) direct emission signals from a designated reaction site toward one or more associated light detectors that are configured to detect the emission signals from the designated reaction site; or (c) block or prevent detection of crosstalk emission signals from adjacent reaction sites. | 03-19-2015 |
20150086981 | NUCLEOSIDE-TRIPHOSPHATE CONJUGATE AND METHODS FOR THE USE THEREOF - The invention relates to a novel method for the enzymatic marking of nucleic acid chains (target sequences) with nucleotide conjugates. Under reaction conditions, said nucleotide conjugates are able to bind to a target sequence, and can be incorporated into the complementary growing strand by way of a polymerase. The nucleotide conjugates can be used for sequencing nucleic acid chains. | 03-26-2015 |
20150086982 | COMPOSITIONS AND METHODS FOR DETECTING AND DISCRIMINATING BETWEEN YEAST OR MOLD - The invention features compositions, methods, and kits for detecting and distinguishing between yeast or mold in a sample suspected of being contaminated with yeast or mold. | 03-26-2015 |
20150086983 | METHOD OF USING MICROFLUIDIC CHIP FOR NUCLEIC ACID HYBRIDIZATION - The present invention relates to method of using a microfluidic chip for rapid nucleic acid hybridization, comprising: activating a porous substrate with positive charges; injecting a mixed solution of a test nucleic acid and a nucleic acid probe into the microfluidic chip for maintaining the test nucleic acid hybridized to the nucleic acid probe being absorbed to the periphery of the substrate; continuously washing the microfluidic chip with an anionic surfactant; and detecting the hybridization signals on the substrate after washing for a predetermined time; wherein the activation of the substrate with positive charges allows the test nucleic acid hybridized to the nucleic acid probe to form a micelle during washing and the diffusion of such from the periphery toward the center of the substrate to accelerate. Thus, it is possible to accomplish detection in a very short time for application of specific DNA complementary hybridization. | 03-26-2015 |
20150086984 | DETECTION OF TARGET NUCLEIC ACID SEQUENCES BY PTO CLEAVAGE AND EXTENSION ASSAY - The present invention relates to the detection of a target nucleic acid sequence by a PTOCE (PTO Cleavage and Extension) assay. The present invention detects a target nucleic acid sequence in which the PTO (Probing and Tagging Oligonucleotide) hybridized with the target nucleic acid sequence is cleaved to release a fragment and the fragment is hybridized with the CTO (Capturing and Templating Oligonucleotide) to form an extended duplex, followed by detecting the presence of the extended duplex. The extended duplex provides signals (generation, increase, extinguishment or decrease of signals) from labels indicating the presence of the extended duplex and has adjustable T | 03-26-2015 |
20150086985 | CELLULAR UPTAKE CONTROL SYSTEMS - Aspects of the invention relate to novel methods and compositions for assessing the level of cellular uptake of a nanoparticle construct, assessing the level of target binding of a nanoparticle construct and assessing the levels of RNAs and proteins in a given cell. | 03-26-2015 |
20150086986 | METHOD TO PREDICT THE PRESENCE OF INFLAMMATION OR ITACONIC ACID, IRG1 AND/OR PROTEIN IRG1 IN A SUBJECT AND PHARMACEUTICAL COMPOSITION FOR TREATING OR PREVENTING INFLAMMATION - The present invention is directed to in vitro methods to predict the presence of inflammation, gene IRG1 or protein encoded by IRG1 in a subject by determining presence of itaconic acid in a biological sample isolated from the subject. The invention is also directed to methods to predict the ability of a subject to produce itaconic acid under inflammation by determining the presence IRG1 in a biological sample. The invention is also related to pharmaceutical composition to initiate production of itaconic acid in a subject for preventing or treating inflammation, or bacterial infection. | 03-26-2015 |
20150086987 | REAL-TIME PCR FOR THE DETECTION OF PATHOGENS - Disclosed herein are methods for detecting presence of one or more of | 03-26-2015 |
20150086988 | COMPOSITIONS AND METHODS OF SELECTIVE NUCLEIC ACID ISOLATION - The invention relates to methods for isolating and/or identifying nucleic acids. The invention also provides kits for isolating and/or identifying nucleic acids. | 03-26-2015 |
20150086989 | METHODS AND NUCLEIC ACIDS FOR ANALYSES OF CELLULAR PROLIFERATIVE DISORDERS - Aspects of the invention provide methods, nucleic acids and kits for detecting, or for detecting and distinguishing between or among liver cell proliferative disorders or for detecting, or for detecting and distinguishing between or among colorectal cell proliferative disorders. Particular aspects disclose and provide genomic sequences the methylation patterns of which have substantial utility for the improved detection of and differentiation between said class of disorders, thereby enabling the improved diagnosis and treatment of patients. | 03-26-2015 |
20150086990 | DETECTION OF BACTERIAL (MOLLICUTES) CONTAMINATION - The present disclosure provides a method and system for the PCR amplification of a target sequence which suppresses non-specific amplification products. The disclosure concerns the use of a primer pair optimized to amplify a nucleic acid of a contaminant in the background of genomic DNA of a first organism. When DNA from a second organism suspected for comprising the contaminant is subjected to the same PCR-based amplification reaction, detection sensitivity and specificity of the contaminant is enhanced when an amount of genomic DNA of the first organism is present in the amplification reaction. | 03-26-2015 |
20150086991 | USES OF ANTI-CD40 ANTIBODIES - Methods for treating a human patient for a cancer or pre-malignant condition that is associated with CD40-expressing cells are provided, where the human patient is heterozygous or homozygous for FcγRIIIa-158F (genotype V/F or F/F). Also provided are methods of inhibiting antibody production by B cells in a human patient who is heterozygous or homozygous for FcγRIIIa-158F (genotype V/F or F/F). The methods comprise administering to the human patient a therapeutically or prophylactically effective amount of an anti-CD40 antibody. Methods and kits for identifying a human patient with a cancer or pre-malignant condition that is treatable with an anti-CD40 antibody and which is refractory to treatment with rituximab (Rituxan®), as well as methods and kits for selecting an antibody therapy for treatment of a human patient having a cancer or pre-malignant condition that is refractory to treatment with rituximab (Rituxan®), are also provided. | 03-26-2015 |
20150093747 | MAIZE EVENT DP-004114-3 AND METHODS FOR DETECTION THEREOF - The invention provides DNA compositions that relate to transgenic insect resistant maize plants. Also provided are assays for detecting the presence of the maize DP-004114-3 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided. | 04-02-2015 |
20150093748 | METHOD AND PRIMERS FOR THE DETECTION OF MICROCYSTIN-PRODUCING TOXIC CYANOBACTERIA - The present invention provides a method for detecting the presence of microcystin-producing toxic | 04-02-2015 |
20150093749 | REAL-TIME PCR DETECTION OF STREPTOCOCCUS PYOGENES - The present invention relates to assays, diagnostic kits and methods for real-time PCR detection of | 04-02-2015 |
20150093750 | MAGNETICALLY ASSISTED PROCESSING OF A MEDIUM - The invention relates to a processing device ( | 04-02-2015 |
20150093751 | PRIMERS FOR DIAGNOSING AVELLINO CORNEAL DYSTROPHY - The present invention relates to a real-time PCR primer pair and probe for diagnosing Avellino corneal dystrophy, and more particularly to a real-time PCR primer pair and probe for diagnosing Avellino corneal dystrophy, which can accurately diagnose the presence or absence of a mutation in exon 4 of BIGH3 gene, which is responsible for Avellino corneal dystrophy. The use of the primer pair and probe according to the invention can diagnose Avellino corneal dystrophy in a more rapid and accurate manner than a conventional method that uses a DNA chip or PCR. | 04-02-2015 |
20150093752 | Conversion of alpha-hydroxyalkylated residues in biomolecules using methyltransferases - The present invention relates to targeted conversion of alpha-hydroxyalkylated residues in biomolecules in the presence of a directing methyltransferase, namely to targeted removal of the alpha-hydroxyalkyl moieties to give unmodified residues, or targeted derivatization of the alpha-hydroxyalkyl groups by covalent coupling of non-cofactor compounds represented by formula HQ-LX, wherein X represents a functional group or a reporter group attached via a linker moiety L, and QH is selected from HS—, HSe—, HO—H | 04-02-2015 |
20150093753 | METHODS FOR QUANTITATIVE AMPLIFICATION AND DETECTION OVER A WIDE DYNAMIC RANGE - Disclosed are compositions and methods for making differentiable amplicon species at unequal ratios using a single amplification system in a single vessel. The number of differentiable amplicons and their ratios to one another are chosen to span the required linear dynamic range for the amplification reaction and to accommodate limitations of the measuring system used to determine the amount of amplicon generated. Unequal amounts of distinguishable amplicon species are generated by providing unequal amounts of one or more amplification reaction components (e.g., distinguishable amplification oligomers, natural and unnatural NTP in an NTP mix, or the like). The amount of target nucleic acid present in a test sample is determined using the linear detection range generated from detection of one or more amplicon species having an amount within the dynamic range of detection. | 04-02-2015 |
20150099265 | DETECTION SIGNAL AND CAPTURE IN DIPSTICK ASSAYS - Improved dipstick assays for testing for the presence of a target nucleic acid in a sample solution are described. A dipstick is provided which comprises a contact end for contacting the sample solution and a capture zone remote from the contact end for capturing target nucleic acid. Sample solution is contacted with the contact end to cause sample solution to move by capillary action to the capture zone. Target nucleic acid in the sample solution is captured at the capture zone and is detected by a plurality of different labelled detection probes each capable of hybridizing to a different region of the target nucleic acid. The detection signal is thereby enhanced. In other methods a plurality of different capture probes are added to the sample solution which can then be bound by a capture moiety at the capture zone to indirectly capture target nucleic acid. Capture of target nucleic acid is thereby improved. Kits and dipsticks for carrying out such methods are also described. | 04-09-2015 |
20150099266 | DIGITAL ANALYSIS OF NUCLEIC ACID MODIFICATION - In certain aspects, methods of the invention involve performing modification state specific enzymatic reaction of nucleic acid in a sample, determining a value associated with efficiency of the modification state specific enzymatic reaction based on a control, determining an amount of target nucleic acid in the sample, and normalizing the amount of target nucleic acid based on the efficiency value. Based on the normalized amount of target nucleic acid, the method further includes determining whether the normalized amount of target nucleic acid is indicative of a condition. | 04-09-2015 |
20150104788 | COMPOSITIONS AND METHODS QUANTIFYING A NUCLEIC ACID SEQUENCE IN A SAMPLE - The present invention features compositions and methods for quantifying detection of a target oligonucleotide in a sample in real time. These methods are compatible with target oligonucleotides amplified using a NEAR reaction. | 04-16-2015 |
20150104789 | ANTIBIOTIC SUSCEPTIBILITY TESTING USING PROBES FOR PRERIBOSOMAL RNA - Described are probes and methods for detecting antibiotic susceptibility of a specimen. The method comprises contacting the specimen with an oligonucleotide probe that specifically hybridizes with a target nucleic acid sequence region of ribosomal RNA. The target sequence is at the junction between a pre-ribosomal RNA tail and mature ribosomal RNA of 23S or 16S rRNA. Performing the method in the presence and absence of an antibiotic permits detection of antibiotic susceptibility. | 04-16-2015 |
20150104790 | Reverse Transcriptase with Enhanced Properties - Compositions and methods are provided for improved reverse transcriptases and their uses in reverse transcription where the improvement may include increased temperature, increased salt, increased activity and/or increased dUTP tolerance. | 04-16-2015 |
20150104791 | Process and Device for Separating Biological Particles Contained in a Fluid by Means of Filtration - The invention relates to a method of separating biological particles from the liquid containing same for purification, analysis and optionally diagnostic purposes. The inventive method comprises at least one step involving vertical filtration through a filter having a porosity that is adapted to the type of biological particles to be separated, such that said particles are retained by the filter. The invention is characterised in that: (i) the method involves the use of a filter comprising at least one basic filtration zone, whereby each basic filtration zone has a limited surface area; and (ii) the surface area of each basic filtration zone and the number of basic filtration zones are selected as a function of the type of liquid to be filtered, the type of biological particles to be separated and the volume of liquid to be filtered. | 04-16-2015 |
20150104792 | Portable Fluorimetric Apparatus, Method and System - A fluorimetric system, apparatus and method are disclosed to measure an analyte concentration in a sample. A sensor reagent housing is also disclosed which comprises a channel and a porous medium having an analysis chemistry reagent, such as a nucleic acid analysis chemistry reagent. The apparatus and system are portable for field use, with an apparatus housing having a size adapted to fit into a user's hand. An apparatus also includes a sensing chamber and cover, a user interface, a light source; a photomultiplier tube, an amplifier, an A/D converter, a memory, and a processor. In various embodiments, the processor performs a data fitting, determines a sample reaction rate parameter, and determines the analyte concentration from a comparison of the sample reaction rate parameter with stored calibration data. The processor may also generate the calibration data and site-specific offset factors, and modify the calibration data using an offset factor. | 04-16-2015 |
20150104793 | NON-INVASIVE FETAL GENETIC SCREENING BY DIGTAL ANALYSIS - The present methods are exemplified by a process in which maternal blood containing fetal DNA is diluted to a nominal value of approximately 0.5 genome equivalent of DNA per reaction sample. Digital analysis is then be used to detect aneuploidy, such as the trisomy that causes Down Syndrome. Since aneuploidies do not present a mutational change in sequence, and are merely a change in the number of chromosomes, it has not been possible to detect them in a fetus without resorting to invasive techniques such as amniocentesis or chorionic villi sampling. Digital amplification allows the detection of aneuploidy using massively parallel amplification and detection methods, examining, e.g., 10,000 genome equivalents. | 04-16-2015 |
20150111203 | METHODS FOR DETERMINING CARRIER STATUS - The invention generally relates to methods for determining carrier status with respect to a condition or disease. In certain embodiments, the method involves exposing a sample to a plurality of molecular inversion probes capable of capturing DNA from at least one genomic region suspected of having an altered copy number and at least one internal control DNA known or suspected to have a stable copy number, capturing and sequencing DNA that binds to the molecular inversion probes, and determining a copy number state of the at least one genomic region based on the sequence results. | 04-23-2015 |
20150111204 | Single Molecule Sequencing of Captured Nucleic Acids - The invention provides methods and devices for detecting, enumerating or identifying target nucleic acid molecules using immobilized capture probes and single molecule sequencing techniques. | 04-23-2015 |
20150111205 | Methods for Mapping Bar-Coded Molecules for Structural Variation Detection and Sequencing - The invention includes methods for optimally designing probes and analyzing data from sequence-by-hybridization and related methods of stretched molecules or other experimental approaches that provide local information. | 04-23-2015 |
20150111206 | DETECTION METHOD FOR MYOCOBACTERIUM AVIUM SPP. PARATUBERCULOSIS - The invention relates to a method for specifically detecting and optionally for quantifying | 04-23-2015 |
20150111207 | Detection of Mycoplasma in Cell Cultures and Cell Culture derived Biologicals - Sequences having specificity for | 04-23-2015 |
20150111208 | METHODS FOR ASSESSING A GENOMIC REGION OF A SUBJECT - The invention generally relates to method for assessing a genomic region of a subject. In certain embodiments, methods of the invention involve obtaining a sample including nucleic acid from a subject. The nucleic acid includes a target sequence from a target genomic region and a paralogous sequence from a non-target genomic region. The target sequence and the paralogous sequence are isolated from the sample. The target sequence and the paralogous sequence are sequenced to obtain sequence reads that include target sequence reads and paralogous sequence reads. The paralogous sequence reads are excluded, and the genomic region of the subject are assessed based on the target sequence reads. | 04-23-2015 |
20150111209 | Gene Amplification of Coactivator COAA and Uses Thereof - It has been discovered that amplifications in the gene coactivator activator (CoAA) blocks stem cell differentiation and induces cancer stem cells. One embodiment provides compositions and methods for treating or alleviating one or more symptoms associated with cancer due to gene amplifications in CoAA. Another embodiment provides methods and compositions for detecting cancer due to gene amplifications in CoAA. Still another embodiment provides methods for identifying compounds, antibodies and nucleic acid molecules that are useful for treating cancer due to gene amplifications in CoAA. Preferably the disclosed compositions antagonize or interfere with the CoAA amplicons and the biological activity of CoAA and or splice variants thereof. | 04-23-2015 |
20150111210 | DETECTION OF SHIGA TOXIN GENES IN BACTERIA - The disclosed invention is related to methods, compositions and kits for targeting nucleic acid derived from Shiga toxin-producing bacteria such as | 04-23-2015 |
20150111211 | PREDICTING RESPONSE TO A HER INHIBITOR - The present application describes the use of low HER3 as a selection criterion for treating patients with a HER inhibitor, such as pertuzumab. | 04-23-2015 |
20150111212 | COMPOSITIONS, KITS AND RELATED METHODS FOR THE DETECTION AND/OR MONITORING OF PSEUDOMONAS AERUGINOSA - The present invention provides compositions, methods and kits for the species-specific detection of | 04-23-2015 |
20150118680 | Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels - Compositions, methods and kits are disclosed for high-sensitivity single molecule digital counting by the stochastic labeling of a collection of identical molecules by attachment of a diverse set of labels. Each copy of a molecule randomly chooses from a non-depleting reservoir of diverse labels. Detection may be by a variety of methods including hybridization based or sequencing. Molecules that would otherwise be identical in information content can be labeled to create a separately detectable product that is unique or approximately unique in a collection. This stochastic transformation relaxes the problem of counting molecules from one of locating and identifying identical molecules to a series of binary digital questions detecting whether preprogrammed labels are present. The methods may be used, for example, to estimate the number of separate molecules of a given type or types within a sample. | 04-30-2015 |
20150118681 | METHOD FOR PREDICTING PROGNOSIS OF RENAL CELL CARCINOMA - In order to provide a method for detecting an unfavorable prognostic risk of renal cell carcinoma easily with quite high sensitivity and specificity, a methylome analysis was performed on normal renal tissues, and non-cancerous tissues and renal cell carcinomas derived from patients with renal cell carcinomas. The result revealed that it was possible to detect an unfavorable prognostic risk of renal cell carcinoma by detecting a DNA methylation level at at least one CpG site of FAM150A, GRM6, ZNF540, ZFP42, ZNF154, RIMS4, PCDHAC1, KHDRBS2, ASCL2, KCNQ1, PRAC, WNT3A, TRH, FAM78A, ZNF671, SLC13A5, and NKX6-2 genes. | 04-30-2015 |
20150118682 | METHODS FOR PRODUCING INTERFERING RNA MOLECULES IN MAMMALIAN CELLS AND THERAPEUTIC USES FOR SUCH MOLECULES - Methods for producing interfering RNA molecules in mammalian cells are provided. Therapeutic uses for the expressed molecules, including inhibiting expression of HIV, are also provided. | 04-30-2015 |
20150125855 | METHOD OF SNP DETECTION BY USING GENE DETECTION TECHNIQUE IN BEAD-BASED MICROFLUIDICS - The present invention provides a method of SNP detection by using gene detection in bead-based microfluidics comprising following steps: (a) preparing a microbead with a duplex DNA; (b) inserting a dye into the duplex DNA; (c) delivering the microbead into a microchannel with a temperature gradient region; (d) heating the temperature gradient region to denature the duplex DNA; (e) monitoring a fluorescence intensity of the duplex DNA during the step (d) to obtain a melting curve; and (f) determining the SNP by a melting curve analysis method; wherein the duplex DNA is synthesized by a target single-strand DNA and an allele-specific probe. Furthermore, the present invention offers a temperature gradient region to enhance the measurement accuracy. The continuous-flow mechanism in this region is validated and optimized. | 05-07-2015 |
20150125856 | Assays for resistance to echinocandin-class drugs - Nucleic acid amplification assays for mutations to two short sections of the fungal gene FKS1. Mutations in these target sequences have been shown to correlate with resistance to echinocandin-class drugs. Assays may include detection by sequencing or by labeled hybridization probes. Also, primers, probes and reagent kits for performing such assays. | 05-07-2015 |
20150125857 | CANCER PATIENT SELECTION FOR ADMINISTRATION OF Wnt SIGNALING INHIBITORS USING RNF43 MUTATION STATUS - Disclosed are biomarkers, methods and assay for the identification of cancer patients who are predicted to benefit from the therapeutic administration of Wnt antagonist. The biomarkers include detection of RNF43 and ZNRF3 gene deletion, reduced RNF43 and ZNRF3 mRNA expression, reduced RNF43 and ZNRF3 protein expression, RNF43 and ZNRF3 inactivation mutation, phosphorylated LRP6, phophorylated Dishevelleds, and the expression of Frizzleds. These biomarkers can be associated with the better outcome for cancer patients treated with Wnt pathway inhibitors. | 05-07-2015 |
20150125858 | DETERMINING PROSTATE CANCER RECURRENCE USING POLYMORPHISMS IN ANGIOGENESIS-RELATED GENES - In particular, disclosed is a method for treating a patient with prostate cancer that involves genotyping a nucleic acid sample from the subject for one or more single nucleotide polymorphism (SNP) alleles in one or more genes angiogenesis, comparing the one or more SNP alleles to control allele frequencies to produce a SNP signature, and analyzing the SNP signature to generate a risk score. The risk score can represent the likelihood that the patient's prostate cancer will recur following radical prostatectomy. In particular embodiments, a high risk score in a patient with positive margins is an indication of a high risk of prostate cancer recurrence. | 05-07-2015 |
20150125859 | Nucleic Acid Chromatography Method, Composition for Nucleic Acid Chromatography and Kit Containing Same - Provided is a nucleic acid chromatography method ensuring a stable detection state, and a composition and kit for use in nucleic acid chromatography. For this purpose, the nucleic acid chromatography method is provided with a step of performing chromatography by supplying a chromatography liquid containing a target nucleic acid to a solid-phase carrier on which is fixed a detection probe capable of capturing the nucleic acid, wherein the chromatography liquid contains one or two or more kinds of water-soluble polymers. | 05-07-2015 |
20150125860 | Methods and Compositions for Detecting Aspergillus Terreus, Aspergillus Niger, and Mycotoxins - The invention relates to a method of identifying an | 05-07-2015 |
20150125861 | Methods and Compositions for Identifying Sulfur and Iron Modifying Bacteria - The invention relates to methods and compositions for identifying specific bacterial species, which are sulfur and iron oxidizers and/or reducers, from wall board (e.g., dry wall) and/or a patient tissue or body fluid. The method comprises the steps of extracting and recovering DNA of the bacterial species from the wall board and/or the patient tissue or body fluid, amplifying the DNA, hybridizing a probe to the DNA to specifically identify the bacterial species, and specifically identifying the bacterial species. Kits and nucleic acids for use in the methods are also provided. Methods for eliminating the sulfur and iron oxidizing and/or reducing bacteria from wall board using a zeolite are also provided. | 05-07-2015 |
20150125862 | ISOLATION OF RNA-PROTEIN COMPLEXES USING CROSS-LINKING REAGENTS AND OLIGONUCLEOTIDES - Provided herein is a method of sample analysis. In certain embodiments, the method comprises: a) cross-linking protein of a cell using a first compound to produce a first cross-linked product comprising cross-linked protein, and RNA; b) contacting the first cross-linked product and a second compound under conditions by which an oligonucleotide portion of the second compound hybridizes to the RNA; c) activating a reaction the first and second compound, thereby covalently crosslinking the oligonucleotide to the cross-linked protein to produce a second cross-linked product; d) isolating the second cross-linked product using an affinity tag; and e) analyzing the isolated second cross-linked product. Compounds for performing the method are also provided. | 05-07-2015 |
20150125863 | CXCL5 AS A MARKER OF HORMONE ESCAPE IN PROSTATE CANCER - The invention relates to the use of CXCL5 as a marker for assessing hormone escape in prostate cancer cells. The invention further provides diagnostic methods and kits for assessing hormone escape in prostate cancer cells, and CXCL5 antagonists for use in the treatment or prevention of prostate cancer and/or hormone escape in prostate cancer. | 05-07-2015 |
20150132750 | Compositions and Methods for Oxygenation of Nucleic Acids Containing 5-Methylpyrimidine - 5-methylpyrimidine oxygenases and their use in the modification of nucleic acids are described. | 05-14-2015 |
20150132751 | Detecting Single Nucleotide Polymorphism Using Overlapped Primer and Melting Probe - Methods for the detection of the presence or absence of a single nucleotide polymorphism (SNP) in a target nucleic acid in a biological or non-biological sample are described. The methods can include performing an amplifying step using primers, a hybridizing step utilizing a melting probe, and a detecting step, wherein a decreasing shift in the predefined melting temperature of the melting probe is indicative of the presence of the SNP in the sample and wherein the absence of a decreasing shift in the predefined melting temperature of the melting probe is indicative of the absence of the SNP in the sample. | 05-14-2015 |
20150132752 | METHOD FOR DETERMINING HLA-A*24 GROUP - The method of the present invention is a method for determining an HLA-A*24 group, which includes determining the HLA-A*24 group on the basis of the results of the typing of (a) a 211st base and (b) a 395th base, in which A (adenine) in the initiation codon for an HLA gene is defined as the 1st base in the genomic DNA of a test subject. | 05-14-2015 |
20150132753 | MICROFLUIDIC DEVICES FOR MULTI-INDEX BIOCHEMICAL DETECTION - In one aspect, a microfluidic device for multiple reactions is provided, which comprises a reaction channel comprising multiple reaction chambers connected to a closed chamber or an elastic balloon outside of the microfluidic device, wherein a wall of the closed chamber is an elastic membrane; and a control channel comprising an elastic side wall, wherein the intersections between the side wall of the control channel with the reaction channel form multiple pneumatic microvalves. In another aspect, a method for conducting multiple reactions using the microfluidic device is provided, which comprises: a) filling the reaction chambers with a sample; and b) applying pressure to the control channel to expand the elastic side wall of the control channel, wherein the expanded elastic side wall forms a pneumatic microvalve that separates the reaction chambers. | 05-14-2015 |
20150132754 | METHOD FOR INCREASING ACCURACY IN QUANTITATIVE DETECTION OF POLYNUCLEOTIDES - Disclosed is a method for improving the sensitivity and accuracy of quantitative detection of polynucleotides in a sample, such a clinical specimen, by a method that utilizes a two- or three-step process of tagging/labeling target molecules and adding an adapter sequence for adding a universal primer for efficient amplification of targets while decreasing target amplification bias. When combined with the step of statistically correcting for sequencing errors, the method can significantly increase the accuracy of quantitative detection of polynucleotides in a sample. | 05-14-2015 |
20150132755 | MULTIWELL PLATE - An assembly for processing a sample is provided. The assembly comprises a first body having a plurality of spaced-apart conduits and a second body having a plurality of chambers wherein each conduit is fluidically connected to a separate chamber. The assembly forms a plurality of liquid flow paths, each flow path comprising a conduit and a chamber. An analyte capture element is detachably attached to a conduit and is in fluidic communication with the liquid flow path of the conduit. Optionally, the assembly further may comprise a third body comprising a plurality of reservoirs. The assembly can be used to process a liquid sample for detecting an analyte. | 05-14-2015 |
20150132756 | POLYMERASE IDLING METHOD FOR SINGLE MOLECULE DNA SEQUENCING - A method for sequencing a nucleic acid is provided. In certain embodiments the method comprises obtaining a duplex comprising a nucleic acid and a primer, wherein the primer has a nuclease resistant 3′ end, combining the duplex with a chain terminator nucleotide and a proof-reading polymerase to produce a reaction in which the polymerase idles on the added chain terminator nucleotide, identifying the chain terminator nucleotide added to the end of the primer; and adding a nuclease-resistant nucleotide to the end of the primer after the polymerase has idled on and removed the added chain terminator nucleotide, thereby producing a duplex comprising the template and an extended primer that has a nuclease resistant 3′ end. | 05-14-2015 |
20150132757 | METHOD OF DETECTING AND IDENTIFYING CIRCULATING ANTIGENS IN HUMAN BIOLOGICAL SAMPLES - Disclosed herein is a method of detecting and identifying antigens that are shed into human bodily fluids during infection. The disclosed method allows circulating antigens associated with a particular infection to be detected within minutes or hours from testing as compared to days required with the current methods. Methods of identifying diagnostic indicators/targets for a given condition or disease are disclosed which include immunizing a verterinary subject with biological fluids obtained from a human infected with particular antigens to identify diagnostic targets for immunoassay. Also disclosed are methods of diagnosing and monitoring a | 05-14-2015 |
20150132758 | MAGNETIC NANOCOMPOSITE RETRIEVAL OF NUCLEOTIDE SEQUENCE - Disclosed is a process for retrieval of nucleotide sequence. The process includes mixing iron chloride tetrahydrate with iron (III) chloride hexahydrate in solution; adding ammonium hydroxide to the mixture and stirring to form maghemite nanoparticles; stirring the maghemite nanoparticles in a solution with an inorganic acid, a surfactant and a monomer precursor of a conducting polymer; initiating polymerization of the monomer by adding the inorganic acid and an oxidizing agent to the stirred solution and further stirring to yield Polyaniline/maghemite nanocomposites; adding the nanocomposites to an first aqueous solution of the nucleotide sequence and stirring so as to electrostatically interact the nanocomposites with the nucleotide sequence; and weakening the electrostatic interaction between the nanocomposite and the nucleotide sequence to recover the nanocomposite independently of the nucleotide sequence. | 05-14-2015 |
20150132759 | SOLID SUPPORT ASSAY SYSTEMS AND METHODS UTILIZING NON-STANDARD BASES - Solid support assays using non-standard bases are described. A capture oligonucleotide comprising a molecular recognition sequence is attached to a solid support and hybridized with a target. In some instances, the molecular recognition sequence includes one or more non-standard bases and hybridizes to a complementary tagging sequence of the target oligonucleotide. In other instances, incorporation of a non-standard base (e.g., via PCR or ligation) is used in the assay. | 05-14-2015 |
20150132760 | METHODS OF DETECTING CHARCOT-MARIE TOOTH DISEASE TYPE 2A - Methods are described for screening a subject for risk of Charcot-Marie-Tooth Disease Type 2A or for diagnosing Charcot-Marie-Tooth disease or a predisposition for developing Charcot-Marie-Tooth disease in a subject, by detecting the presence or absence of a mutation in the mitofusin gene in a biological sample collected from the subject. Methods are also described for detecting the presence of a genetic polymorphism associated with Charcot-Marie-Tooth Disease Type 2A in a sample of patient nucleic acid, by amplifying a mitofusin gene sequence in the patient nucleic acid to produce an amplification product; and identifying the presence of a Charcot-Marie-Tooth Disease Type 2A associated polymorphism in the amplification product. | 05-14-2015 |
20150140554 | Detection Methods for Target DNA - The invention pertains to a safe, quick and reliable method of detecting the presence of a target DNA sequence in a sample. The invention also pertains to a system for detecting presence of a target DNA sequence in a biological sample. The system includes an ITC template that includes a probe binding sequence that binds to a corresponding ITC probe and a first and second flanking primer recognizing sequence that binds to a first and second primer, respectively. The system also includes an ITC probe that binds to the ITC template probe binding sequence. The ITC probe includes a first marker molecule. The system also includes a first primer that binds to the first flanking primer sequence and a second primer that binds to said second primer sequence. The system further includes a target DNA sequence probe, wherein the target DNA sequence probe comprises a second marker molecule. | 05-21-2015 |
20150140555 | METHOD OF IDENTIFYING FOETAL ERYTHROBLAST - There is provided a method for identifying at least one foetal erythroblast the method comprising: (a) detecting the expression of at least one foetal erythroblast specific marker selected from the group consisting of neutral amino acid transporter B (SLC1A5), solute carrier family 3 (activators of dibasic and neutral amino acid transport) member 2 isoform A (SLC3A2), Splice Isoform A of Chloride channel protein 6, Transferrin receptor protein 1, Splice Isoform 3 of Protein GPR107 precursor, Olfactory receptor 11H4, Splice Isoform 1 of Protein C9orf5, Cleft lip and palate transmembrane protein 1, BCG induced integral membrane protein BIGM103, Antibacterial protein FALL-39 precursor, CAAX prenyl protease 1 homolog, Splice Isoform 2 of Synaptophysin-like protein, Vitamin K epoxide reductase complex subunit 1-like protein 1, Splice Isoform 1 of Protein C20orf22 (ABHD12), Hypothetical protein DKFZp564K247 (Hypoxia induced gene 1 protein) (IPI Accession No. IPI00295621), Hypothetical protein DK-FZp586C1924 (IPI Accession No. IPI00031064), ALEX3 protein variant, Hypothetical protein MGC14288 (IPI Accession No. IPI00176708), protein with IPI Accession No. IPI00639803 and protein with IPI Accession No. IPI00646289, wherein detection of the marker indicates the presence of the foetal erythroblast. | 05-21-2015 |
20150140556 | OPTICAL FIBER WITH GRATING AND PARTICULATE COATING - The present invention provides, in addition to other things, methods, systems, and apparatuses that involve the use of an optical fiber with grating and particulate coating that enables simultaneous heating; optical detection; and optionally temperature measurement. Methods, systems, and apparatuses of the present invention may be used in many applications including isothermal and/or thermal cycling reactions. In certain embodiments, the present invention provides methods, systems, and apparatuses for use in detecting, quantifying and/or identifying one or more known or unknown analytes in a sample. | 05-21-2015 |
20150140557 | METHODS, COMPOSITIONS, AND KITS FOR DETECTING ALLELIC VARIANTS - In some embodiments, the present inventions relates generally to compositions, methods and kits for use in discriminating sequence variation between different alleles. More specifically, in some embodiments, the present invention provides for compositions, methods and kits for quantitating rare (e.g., mutant) allelic variants, such as SNPs, or nucleotide (NT) insertions or deletions, in samples comprising abundant (e.g., wild type) allelic variants with high specificity and selectivity. In particular, in some embodiments, the invention relates to a highly selective method for mutation detection referred to as competitive allele-specific TaqMan PCR (“cast-PCR”). | 05-21-2015 |
20150140558 | Methods of Identifying and Isolating Cells Using Molecular Beacons - Methods are provided for isolating lineage-specific cells from a population of cells using molecular beacons which bind to mRNA markers and then isolating the lineage specific cells from the population of cells based on the label of the molecular beacon. | 05-21-2015 |
20150140559 | NUCLEOTIDES AND NUCLEOSIDES AND METHODS FOR THEIR USE IN DNA SEQUENCING - The present invention relates generally to labeled and unlabled cleavable terminating groups and methods for DNA sequencing and other types of DNA analysis. More particularly, the invention relates in part to nucleotides and nucleosides with chemically cleavable, photocleavable, enzymatically cleavable, or non-photocleavable groups and methods for their use in DNA sequencing and its application in biomedical research. | 05-21-2015 |
20150140560 | ASYNCHRONOUS MAGNETIC BEAD ROTATION (AMBR) MICROVISCOMETER FOR ANALYSIS OF ANALYTES - The disclosure provides a label-free viscosity-based analyte detection system using paramagnetic beads as an asynchronous magnetic bead rotation (AMBR) microviscometer. It is disclosed herein that the bead rotation period is linearly proportional to the viscosity of a solution comprising analytes surrounding the paramagnetic bead. Optical measurement of asynchronous microbead motion determines solution viscosity precisely in microscale volumes, thus allowing an estimate of analyte concentration. The results demonstrate the feasibility of viscosity-based analyte detection using AMBR in microscale aqueous volumes. | 05-21-2015 |
20150140561 | COMPOUND FOR SEQUENCING BY SYNTHESIS - The present invention provides deoxynucleoside tri- or tetraphosphate comprising a 3′ nitrate and a detectable label covalently bound to the oxygen atom of an oxymethyl or oxyallyl or oxypropargyl substitution of a nucleobase. Such compounds provide new possibilities for future Sequencing by Synthesis technologies. | 05-21-2015 |
20150140562 | LAB ON CHIP IMAGE ANALYSIS - An optical analyzer, configured to receiving a cartridge for biochemical analyses including a plurality of wells, and carrying out fluorescence analysis of the cartridge, in particular of the wells. The analyzer comprises a control unit (microprocessor and memory) configured to: (a) acquiring an image associated to the fluorescence emitted by the cartridge; (b) identifying, in the image, pixels belonging to boundary lines of the wells by generating a black and white binary image; (c) recognizing, between the geometrical shapes identified in step (b), the ones that best approximate a reference geometrical shape identifying an ideal well; (d) acquiring, from the starting image, values of light intensity only in portions of the image itself that in turn correspond to the regions recognized in step (c); and (e) evaluating a state of advance and/or a result of the biochemical analysis on the basis of the values of light intensity acquired in step (d). | 05-21-2015 |
20150140563 | LAB ON CHIP CARTRIDGE - A cartridge for an optical analysis, including a supporting body, having a first face and a second face opposite to one another; a plurality of wells adapted to receive a biological solution to be analyzed, the wells extending in the supporting body on the first face; at least one biocompatible layer extending inside each well; an anti-reflection layer extending on the first face outside the wells; and a reflection layer extending inside each well. Methods of using same are also provided. | 05-21-2015 |
20150147754 | HERBICIDE-RESISTANT SUNFLOWER PLANTS WITH MULTIPLE HERBICIDE RESISTANT ALLELES OF AHASL1 AND METHODS OF USE - Herbicide resistant sunflower plants comprising two different herbicide-resistant alleles of the sunflower acetohydroxyacid synthase large subunit 1 (AHASL1) gene are described. Methods for making these sunflower plants and methods for controlling weeds or other undesired vegetation growing in the vicinity of these sunflower plants are disclosed. Such methods involve the use of acetohydroxyacid synthase-inhibiting herbicides. Methods for controlling parasitic weeds growing on sunflower plants are also described. Additionally provided are methods for determining the genotype of sunflower plants for AHASL1 gene. | 05-28-2015 |
20150147755 | PROBE BASED NUCLEIC ACID DETECTION - The invention provides a method for detecting a target nucleotide sequence by tagging the nucleotide sequence with a nucleotide tag, providing a probe oligonucleotide with a melting temperature Tm1, comprising a regulatory sequence and a nucleotide tag recognition sequence; incorporating the probe oligonucleotide into the tagged polynucleotide in a polynucleotide amplification reaction, providing a regulatory oligonucleotide with a melting temperature Tm2, comprising a sequence segment that is at least partially complementary to the regulatory sequence, amplifying the tagged target nucleic acid sequence in a PCR amplification reaction using the probe oligonucleotide as a primer, and detecting the amplification product; wherein Tm1 and Tm2 are higher than the annealing temperature associated with the polynucleotide amplification reaction. | 05-28-2015 |
20150147756 | Sensor Device and Method for Label-Free Detecting of Nucleic Acid Sequences - A sensor device ( | 05-28-2015 |
20150147757 | BRASSICA GENOMIC ASSAYS - Methods and compositions for detecting, identifying, and quantifying | 05-28-2015 |
20150147758 | DOT1 Histone Methyltransferases as a Target for Identifying Therapeutic Agents for Leukemia - The present invention provides polypeptides with histone H3 lysine 79 methyltransferase activity as well as nucleic acids encoding the same. Also provided are methods of using the polypeptides and nucleic acids of the invention in screening assays to identify compounds of interest. Further provided are diagnostic methods for leukemia and prognostic methods to predict the course of the disease in a subject. | 05-28-2015 |
20150147759 | Chimeric Oligonucleotides for Ligation-Enhanced Nucleic Acid Detection, Methods and Compositions Therefor - Ligation-enhanced nucleic acid detection assay embodiments for detection of RNA or DNA are described. The assay embodiments rely on ligation of chimeric oligonucleotide probes to generate a template for amplification and detection. The assay embodiments are substantially independent of the fidelity of a polymerase for copying compromised nucleic acid. Very little background amplification is observed and as few as 1000 copies of target nucleic acid can be detected. Method embodiments are particularly adept for detection of RNA from compromised samples such as formalin-fixed and paraffin-embedded samples. Heavily degraded and cross-linked nucleic acids of compromised samples, in which classic quantitative real time PCR assays typically fail to adequately amplify signal, can be reliably detected and quantified. | 05-28-2015 |
20150147760 | Methods for the Enrichment of Mutated Nucleic Acid from a Mixture - The detection of the presence of rare somatic mutations from a biological sample is often challenging due to the simultaneous presence of a vast excess of wild-type DNA. The present invention describes methods that would allow the enrichment of mutant DNA by depleting amplifiable wild-type DNA. | 05-28-2015 |
20150292004 | DETECTION OF TOXIGENIC STRAINS OF CLOSTRIDIUM DIFFICILE - Primers and probes for detection of toxin-producing (toxigenic) strains of | 10-15-2015 |
20150292010 | Methods and Compositions for Improved Fertilization and Embryonic Survival - Single nucleotide polymorphic sites at positions 19069 and 25402 of the bovine STAT3 gene are associated with improved fertilization rate and/or improved embryo survival rate. The interactions between these two polymorphisms, and between them and the bovine STAT1 gene and fertilization and early embryonic survival rates were also disclosed. The interactions between STAT3 SNPs, and between STAT1 and STAT3 SNP19069 were highly significant for embryonic survival rate. Also disclosed are nucleic acid molecules, kits, methods of genotyping and marker assisted bovine breeding methods. | 10-15-2015 |
20150292015 | SELECTIVE REDUCTION OF ALLELIC VARIANTS - Disclosed herein are antisense compounds and methods for selectively reducing expression of an allelic variant of a huntingtin gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate Huntington's Disease (HD). | 10-15-2015 |
20150292021 | PROGNOSTIC METHODOLOGY - The invention concerns a prognostic method for determining at least one, or a combination, of the following: time to first treatment, response to treatment or overall survival for a patient presenting with a disease including or characterised by telomere shortening, comprising an assessment of the longest mean telomere length at which telomere end-end fusion events can be detected and then a determination of the mean telomere length in the fusogenic range (i.e. the range below said mean telomere length at which telomere end-end fusion events can be detected) and the subsequent use of the mean telomere length in the fusogenic range as a prognostic indicator. | 10-15-2015 |
20150292037 | METHOD FOR DETERMINING LYMPH NODE METASTASIS IN CANCER OR RISK THEREOF AND RAPID DETERMINATION KIT FOR THE SAME - The objective of the present invention is to provide a method and a means of rapidly and reliably detecting lymph node metastasis in cancer or the risk of lymph node metastasis. Specifically, the present invention provides a method and a rapid determination kit for detecting lymph node metastasis in cancer or its risk by identifying a certain genetic polymorphism of the human CRP gene, and it is clinically significant in determining the treatment strategy, because effective prediction/determination can be made regarding lymph node metastasis, which is an important phenomenon in cancer progression. | 10-15-2015 |
20150292040 | DEVELOPMENT OF SIMPLE DISCRIMINATION METHOD FOR LOW-QUALITY ES CELLS AND iPS CELLS AS INDICATOR OF BIOLOGICAL CLOCK, AND DEVELOPMENT OF CELL EVALUATION METHOD AS INDICATOR OF BIOLOGICAL CLOCK - A present invention provides a method for evaluating pluripotent stem cells comprising: analyzing expression of a clock gene in cells differentiated from a pluripotent stem cell, and evaluating the pluripotent stem cells based on the degree of the expression. | 10-15-2015 |
20150293026 | Automated system for tissue histomorphometry - The present invention relates to a method for tissue histomorphometry and system suitable therefore. More specifically, the present invention relates to a bone histomorphometry system comprising processing, pattern recognition, and morphological processing components. | 10-15-2015 |
20150299654 | Lrp4/CORIN DOPAMINE-PRODUCING NEURON PRECURSOR CELL MARKER - The present invention relates to polynucleotide probes and antibodies for detecting Lrp4/Corin dopaminergic neuron progenitor cell markers, which enable the efficient separation of dopaminergic neuron progenitor cells; and methods for selecting the progenitor cells by the use thereof. | 10-22-2015 |
20150299772 | SINGLE-STRANDED POLYNUCLEOTIDE AMPLIFICATION METHODS - The present invention provides amplification methods for producing a population of single stranded polynucleotides from a target polynucleotide, comprising (a) extending an RNA primer in a complex comprising (i) a DNA template comprising a sequence that is complementary to the target polynucleotide, and (ii) the RNA primer, wherein the RNA primer is hybridized to the DNA template, and (b) cleaving the RNA primer with an enzyme that cleaves RNA from an RNA/DNA hybrid such that another RNA primer hybridizes to the DNA template and repeats primer extension by strand displacement. | 10-22-2015 |
20150299773 | METHODS FOR IMPROVED ISOLATION OF GENOMIC DNA TEMPLATES FOR ALLELE DETECTION - The present disclosure relates to improved methods for the isolation of genomic material and detection of disease related single nucleotide polymorphisms. In some aspects, these methods increase the total recovery of genomic DNA from buccal cell samples by improving cell lysis conditions. In other aspects, these methods allow for the reuse of patient buccal swab samples, reducing the likelihood of having to collect additional patient samples for re-testing. Finally, in some aspects, these methods increase the sensitivity of SNP detection using an improved real-time PCR assay protocol. | 10-22-2015 |
20150299780 | COMPOSITIONS AND METHODS FOR DETECTION OF CLOSTRIDIUM DIFFICILE - Methods for the rapid detection of the presence or absence of | 10-22-2015 |
20150307925 | Methods of Detecting Target Nucleic Acids - The present disclosure relates to methods of identifying target nucleic acids by using coded molecules and its analysis by translocation through a nanopore. Generally, coded molecules are subject to a target polynucleotide dependent modification. The modified coded molecule is detected by isolating the modified coded molecules from the unmodified coded molecules prior to analysis through the nanopore or by detecting a change in the signal pattern of the coded molecule when analyzed through the nanopore. | 10-29-2015 |
20150307930 | DETECTION METHOD FOR HYDROXYMETHYLATED CYTOSINE IN DNA AND REAGENT KIT FOR DETECTION - The present invention is to provide a method for detecting a hydroxymethylated cytosine in DNA and a detection kit therefor. The present invention relates to “a method for detecting the hydroxymethylated cytosine in DNA, which the method comprises: (1) a step in which a single-stranded DNA is contacted with (i) a polyvalent metal oxide or a polyvalent metal acid salt of a metal atom selected from group 6, group 8, group 9 and group 10 of the periodic table, and contacted with (ii) a peroxide selected from persulfuric acid, percarboxylic acids and the salts thereof; (2) a step in which a specific region of the single-stranded DNA treated in (1) is subjected to amplification treatment; (3) a step in which the presence or absence of an objective amplification product obtained in (2) is detected; and (4) a step in which on the basis of the results of (3), the presence or absence of hydroxymethylated cytosine in the specific region of DNA is determined.”, “a reagent kit for detecting hydroxymethylated cytosine in DNA comprising of a reagent including the above polyvalent metal oxide or a polyvalent metal acid salt and the above peroxide”. | 10-29-2015 |
20150307932 | Methods for Analyzing Minute Cellular Nucleic Acids - The invention generally relates to methods for analyzing cellular nucleic acid. Methods of the invention involve capturing RNA from a lysed cell onto a substrate, producing a cDNA/RNA duplex, removing the RNA from the cDNA/RNA duplex, priming the cDNA to produce a primer/cDNA duplex, exposing the primer/cDNA duplex to at least one detectably labeled nucleotide in the presence of a polymerase capable of catalyzing addition of the nucleotide to the primer/cDNA duplex, detecting incorporation of the nucleotide into the primer portion, and repeating the exposing and detecting steps at least once. | 10-29-2015 |
20150307937 | ACTIVITY-DEPENDENT GENE PAIRS AS THERAPEUTIC TARGETS AND METHODS AND DEVICES TO IDENTIFY THE SAME - Activity-dependent gene pairs as therapeutic targets and methods and devices to identify the same are provided. The methods and devices allow transcriptome-wide analysis of regulatory long non-coding RNAs (IncRNAs), matched with differentially expressed protein-coding genes (mRNAs) and/or with other IncRNAs. The described methods and devices allow analysis of these activity-dependent gene pairs as therapeutic targets in a number of clinical conditions associated with altered electrical brain activity, including epilepsy. | 10-29-2015 |
20150307941 | MUTATIONS ASSOCIATED WITH LONG QT SYNDROME - The invention is based, at least in part, on the observation that the presence of particular biomarkers, e.g., particular mutations in any of the KCNQ1, KCNH2, SCN5A, KCNE1 and KCNE2 genes as identified in Tables 1-5 (and, in particular, those identified with an asterisk), is associated with Long QT Syndrome (LQTS). | 10-29-2015 |
20150307950 | Method of Detecting Heat-Resistant Fungus - A method of detecting a heat-resistant fungus, which has a step of identifying the heat-resistant fungus using the following nucleic acid (I) or (II):
| 10-29-2015 |
20150309048 | METHODS AND KITS FOR DETECTING ANTIGEN-INDUCED MEMORY CD8+ T CELLS - The present invention relates to methods and kits for detecting antigen-induced memory CD8+ T cells. In particular, the invention relates to a method for determining the presence of a population of antigen-induced memory CD8+ T cells in a sample, comprising i) isolating the population of the CD8+ T cells from the sample and ii) detecting in said population the expression of CCL5 or NKG2D and iii) concluding that at least one population of antigen-induced memory CD8+ T cells is present in a sample when CCL5 or NKG2D is detected as step ii). | 10-29-2015 |
20150309059 | LINEAR MOVEMENT TYPE REACTION TREATMENT APPARATUS AND METHOD THEREOF - The invention relates to a linear movement type reaction treatment apparatus and a method thereof, and an object thereof is to reliably prevent cross-contamination and to decrease a working time or a working space involved with reaction treatment. | 10-29-2015 |
20150310164 | SYSTEM AND METHOD FOR PROCESSING GENOTYPE INFORMATION RELATING TO PAIN PERCEPTION - There are systems and methods for preparing or using prognostic information about pain perception or performing an assay based on such information. The information may include whether subject has a subject genotype that includes a COMT haplotype diploid, at least two SNP diploids, one or more demographic phenotypes or a combination thereof. The COMT haplotype diploid is a combination of two COMT haplotypes selected from an LPS haplotype, an APS haplotype, a HPS haplotype or a combination thereof in the COMT gene. The at least two SNP diploids are each a combination of two SNP alleles associated with one SNP location in the DRD1 gene, the COMT gene, the OPRK1 gene, the DRD2 gene, the MTHFR gene, the SLC6A4 gene, the HTR2A gene, the DBH gene, the GABRG2 gene, the OPRM1 gene or the SLC6A3 gene. | 10-29-2015 |
20150315629 | PRE-AMPLIFICATION ASSAY - Provided herein are methods and compositions to determine the efficacy of a nucleic acid pre-amplification reaction. | 11-05-2015 |
20150315633 | MOLECULE DETECTION SYSTEM ON A SOLID SUPPORT - Disclosed herein are compositions and methods used for detecting different types of molecules associated with a site on a solid support. | 11-05-2015 |
20150315636 | SELECTIVE AMPLIFICATION AND REAL-TIME PCR DETECTION OF RARE MUTATIONS - Provided herein are methods and kits for the improved detection of rare mutations within a high background. Exemplary embodiments relate to kits and methods that include amplification primers, a blocking oligonucleotide, and one or more allele-specific detector probes, useful in the specific detection of rare allelic variants or mutations. | 11-05-2015 |
20150315637 | BOW TIE DNA COMPOSITIONS AND METHODS - A bow tie DNA composition is three duplex DNA segments in a forked structure comprising a duplex stem, a duplex first fork and a duplex second fork, wherein a first strand of the stem and a first strand of the first fork form a first contiguous DNA strand, wherein a second strand of the stem and a first strand of the second fork form a second contiguous DNA strand, and wherein the first strand of the first fork and the first strand of the second fork are not complementary. | 11-05-2015 |
20150315650 | CC2D2A GENE MUTATIONS ASSOCIATED WITH JOUBERT SYNDROME AND DIAGNOSTIC METHODS FOR IDENTIFYING THE SAME - The present invention provides a method of screening a subject for mutations in the CC2D2A gene that are associated with Joubert syndrome, an autosomal recessive form of mental retardation. The present invention also provides proteins that are associated with Joubert syndrome including proteins that includes an amino acid sequence that terminates in DHEGGSGMES (SEQ ID NO: 1). Also provided are nucleotide sequences encoding such proteins and methods of screening subjects to identify nucleotide sequences or proteins associated with Joubert syndrome. | 11-05-2015 |
20150315653 | METHOD FOR INHIBITING SIGNALING MEDIATED BY ERBB2, SIGNALING INHIBITOR TO BE USED THEREFOR AND USE THEREOF - An object of the present invention is to provide a method for inhibiting activation of signaling pathway mediated by ErbB2 in a human cell and a signaling inhibitor to be used therefor. The above-described activation of signaling pathway can be inhibited by a polypeptide comprising at least one of PTB domain or ERK2 binding domain of human FRS2β. The above-described polypeptide may be introduced directly into a cell, or nucleic acid which encodes for the above-described polypeptide may be introduced into a cell to allow expression of the polypeptide in the cell. Such polypeptide and nucleic acid can be used, for example, as a signaling inhibitor. In addition, since ErbB2 is involved in development of cancer, the above-described signaling inhibitor is also useful, for example, as an anticancer drug. | 11-05-2015 |
20150315654 | Chondroitin Sulfate Sulfotransferases and Proteoglycans as Cancer Biomarkers: Use of Expression and Methalytion Status - A method of determining a prognosis of a cancer in a human comprising: determining expression level of CHST11 in a cancer tissue sample or determining methylation status of CHST11 gene in a cancer tissue sample. CHST11 is Carbohydrate (Chondroitin 4) Sulfotransferase 11. | 11-05-2015 |
20150315661 | NON-INVASIVE DETECTION OF BLADDER CANCER BY FLOURESCENCE IN SITU HIBRIDIZATION OF AURORA A - We disclose a method of detecting bladder cancer in a patient, comprising isolating bladder cells from the patient's urine; hybridizing the bladder cells with a labelled DNA probe, wherein the probe recognizes at least a portion of the aurora kinase A gene, to yield a sample of bladder cells hybridized with the labeled DNA probe: and counting the number of bladder cells in the sample, the number of copies of the aurora kinase A gene in each bladder cell in the sample, and the number of bladder cells in the sample having at least a first threshold number of copies of the aurora kinase A gene. | 11-05-2015 |
20150322483 | METHOD FOR DETECTING NUCLEIC ACID AND NUCLEIC ACID DETECTION KIT - Disclosed is a method for detecting a nucleic acid using a substance that suppresses, in the labeling step of the post-staining method, detachment of a target nucleic acid that has once hybridized with a capture probe immobilized on a support, which method enables detection of the target nucleic acid with a sensitivity equivalent to or higher than that achieved by a method using sodium ion even in cases where the substance is used at a lower concentration. The method for detecting a nucleic acid comprises the steps of: (1) hybridizing a capture probe with a target nucleic acid to form a double-stranded nucleic acid; bringing the formed double-stranded nucleic acid into contact with a solution containing a labeling substance and a divalent metal cation at a concentration of not less than 10 mM to introduce the labeling substance into the double-stranded nucleic acid; and detecting the labeling substance introduced into the double-stranded nucleic acid. | 11-12-2015 |
20150322484 | NUCLEIC ACID DENATURATION APPARATUS, METHOD FOR DENATURING NUCLEIC ACID AND METHOD FOR AMPLIFYING NUCLEIC ACID - [Problem] To provide an apparatus for denaturing double strand nucleic acids to single strand nucleic acids, and a method for denaturing double strand nucleic acids to single strand nucleic acids, which may become an alternative means to the thermal denaturation. | 11-12-2015 |
20150322486 | LABEL-FREE METHODS FOR ISOLATION AND ANALYSIS OF NUCLEIC ACIDS ON SOLID PHASE DEVICE - Methods and system for the isolation and/or analysis of nucleic acids on a solid phase device comprising (i) incubating a nucleic acid sample with Dimethyl adipimidate (DMA) on said solid phase under conditions that allow formation of a complex of the nucleic acid with the DMA; contacting the complex of (i) with said surface; and isolating and/or analyzing the nucleic acid of the complex. | 11-12-2015 |
20150322497 | RAPID SALMONELLA SEROTYPING ASSAY - Processes for the serotype specific detection and identification of one or more | 11-12-2015 |
20150322498 | METHOD FOR LABELLING OF CLEAVAGE OF NUCLEIC ACID SEQUENCE - Method for properly identifying and determining a target nucleic acid when the target nucleic acid is cleaved. The method includes a step of bringing a hybridization solution into contact with a target nucleic acid, wherein the hybridization solution contains a probe set that is composed of at least two labelled probes respectively labelled with different identifying factors and may hybridize with almost the full length of the sequence for the target nucleic acid. The method further includes a step of causing the identifying factors to develop the functions thereof to produce signals. | 11-12-2015 |
20150322499 | METHOD FOR ANALYZING MOLECULE USING THERMOPHORESIS - A method for analyzing a target molecule using thermophoresis is provided. The method of the invention comprises (1) providing a solution containing samples, labeled molecules, and probe particles; (2) providing a temperature control system to create a temperature gradient within the solution; (3) detecting the expression level of the labeled molecule in a predetermined area and a contrast area; and (4) analyzing the difference in the expression level of the labeled molecules between the predetermined area and the contrast area to determine the result. In another embodiment of the invention, the solution contains samples and “labeled molecule-reactant-probe particle” complexes. In the present invention, the probe particles are used to increase the difference in thermophoresis between the molecular complexes and the free labeled molecules, which can improve the accuracy of the quantification of the target molecules using thermophoresis. | 11-12-2015 |
20150322522 | NOVEL HUMAN SINGLE NUCLEOTIDE POLYMORPHISMS - Disclosed are methods for human identification utilizing newly discovered single nucleotide polymorphisms (SNPs) within CODIS loci which can cause allelic dropout. Also disclosed are kits useful in human identification. | 11-12-2015 |
20150322525 | Quantification of Human Mitochondrial DNA Using Synthesized DNA Standards - A real-time quantitative PCR assay that utilizes a duplex, synthetic DNA standard to ensure optimal quality assurance and quality control. One embodiment of the invention facilitates amplification of mtDNA by focusing on a 105-base pair target sequence that is minimally homologous to non-human mtDNA. The present invention can also be used to identify the presence of PCR inhibitors and thus indicate the need for sample repurification. | 11-12-2015 |
20150322535 | METHODS AND COMPOSITIONS FOR SELECTING CORN PLANTS RESISTANT TO DIPLODIA EAR ROT - The present invention relates to the field of plant breeding and disease resistance. More specifically, the invention includes a method for breeding corn plants containing quantitative trait loci that are associated with diplodia ear rot (DER), a fungal disease associated with | 11-12-2015 |
20150322537 | DELAYED FRUIT DETERIORATION ALLELE IN PLANTS AND METHODS OF DETECTION - The present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence at least 90% identical to a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO:4, where the protein as an aspartic acid (Asp) at amino acid position 106. The present invention also relates to a transgenic plant with reduced or delayed softening and deterioration of fruit compared to wild-type plants, methods of genetic screening for plants having reduced or delayed softening and deterioration of fruit, isolated oligonucleotides, and a method of imparting to a plant the dfd trait. | 11-12-2015 |
20150323524 | BIOLOGICALLY ENHANCED ELECTRICALLY- ACTIVE MAGNETIC NANOPARTICLES FOR CONCENTRATION, SEPARATION, AND DETECTION APPLICATIONS - The disclosure generally relates to a particulate composition formed from a conductive polymer (e.g., conductive polyanilines, polypyrroles, polythiophenes) bound to magnetic nanoparticles (e.g., Fe(II)- and/or Fe(III)-based magnetic metal oxides). The particulate composition can be formed into a biologically enhanced, electrically active magnetic (BEAM) nanoparticle composition by further including a binding pair member (e.g., an antibody) bound to the conductive polymer of the particulate composition. Methods and kits employing the particulate composition and the BEAM nanoparticle composition also are disclosed. | 11-12-2015 |
20150329920 | AMPLIFICATION AND SEQUENCING OF TRANSRENAL NUCLEIC ACIDS - The present invention provides highly sensitive methods used for diagnosing and monitoring various diseases and disorders by detecting and analyzing “ultra short” (20-50 base pair) nucleic acids obtained from bodily fluids. | 11-19-2015 |
20150329922 | CORN EVENT 5307 - A novel transgenic corn event designated 5307, is disclosed. The invention relates to DNA sequences of the recombinant constructs inserted into the corn genome and of genomic sequences flanking the insertion site that resulted in the 5307 event. The invention further relates to assays for detecting the presence of the DNA sequences of event 5307, to corn plants and corn seeds comprising the genotype of and to methods for producing a corn plant by crossing a corn plant comprising the event 5307 genotype with itself or another corn variety. | 11-19-2015 |
20150330900 | DUAL-MODE MICROFLUIDIC GENETICS TESTING PLATFORMS AND METHODS OF DUAL-MODE GENETICS TESTING USING SAME - Dual mode genetics testing systems are devised about a single element testing platform. A microfluidic network and system of interconnected receiving cells and reaction vessels supports at the same time genotyping and copy number analysis where the platform may be subject to a common thermal cycle schedule to cause the proper reactions (DNA replication) necessary in both test types. Further, the microfluidic platform which includes reaction vessels for genotyping which are spatially removed from reaction vessels for copy number analysis, is coupled to optical scanner and detection systems specifically arranged to apply test specific detection routines on each of these distinct regions or portions of the dual mode test platform. | 11-19-2015 |
20150337357 | USE OF RAPID ONSITE BACTERIA TEST FOR OIL AND GAS APPLICATIONS - A method for onsite bacteria testing for oil and gas applications including collecting at least one component of a wellbore fluid; exposing at least one contaminant in the at least one component to at least one substrate that produces a detectable moiety; and performing a quantitative or qualitative detection of the detectable moiety. | 11-26-2015 |
20150337365 | Polymerase Chain Reaction Detection System - The present invention relates to methods and kits for nucleic acid detection in an assay system. | 11-26-2015 |
20150337378 | METHODS OF DIAGNOSIS AND TREATMENT OF INFLAMMATORY BOWEL DISEASE - The present invention relates to methods of diagnosing and predicting susceptibility to Crohn's Disease and/or IBD, by determining the presence or absence of susceptibility to genetic variants, risk haplotypes and/or protective haplotypes. In an embodiment, the invention provides methods of diagnosing and/or predicting susceptibility to Crohn's Disease in an individual by determining the presence or absence of risk variants at the IL12RB1, IL12RB2, IL17A, IL17RA, IL17RD and/or IL23R locus. | 11-26-2015 |
20150337389 | Use Of Genetic Modifications In Human Gene CHK1 Which Codes For Checkpoint Kinase 1 - The invention relates to an in vitro method for predicting disease risks, progression of diseases, drug risks, success of treatment and for finding drug targets by looking for one or more genetic modifications in the promoter region of the CHK1 (CHEK1) gene on human chromosome 11q23, the genetic modifications being a substitution thymine for guanine in position −1143 in the promoter of CHK1, of thymine for cytosine in position −1400, a substitution of cytosine for thymine in position −1453 or an insertion of one cytosine in position −1454 and the genetic modifications being detected individually or in any combinations by way of known methods. | 11-26-2015 |
20150337394 | SOYBEAN EVENT pDAB9582.816.15.1 DETECTION METHOD - Soybean Event pDAB9582.816.15.1 comprises gene expression cassettes which contain genes encoding Cry1F, Cry1Ac (synpro), and PAT, affording insect resistance and herbicide tolerance to soybean crops containing the event, and enabling methods for crop protection and protection of stored products. The disclosure provides polynucleotiderelated event detection methods. The present disclosure relates to a method for detecting a new insect resistant and herbicide tolerant transgenic soybean transformation event, designated Soybean Event pDAB9582.816.15,1. The DNA of soybean plants containing this event includes the junction/flanking sequences described herein that characterize the location of the inserted DNA within the soybean genome. SEQ ID NO: 1 and SEQ ID N0:2 are diagnostic for Soybean Event pDAB9582.816.15.1. | 11-26-2015 |
20150337395 | Molecular markers and methods for identifying date palm genotypes - The present invention concerns two sets of mini- and micro-satellite molecular markers, and the use thereof to study the genetic diversity and/or identify the genotypes of date palms. The invention also concerns method for identifying date palm cultivars using these sets of molecular markers, and kits for implementing these methods. | 11-26-2015 |
20150337396 | METHOD AND COMPOSITIONS FOR DETECTING FUNGI AND MYCOTOXINS - The invention relates to a method of identifying a specific fungal species in patient tissue or body fluid. The method comprises the steps of extracting and recovering DNA of the fungal species from the patient tissue or body fluid, amplifying the DNA, hybridizing a probe to the DNA to specifically identify the fungal species, and specifically identifying the fungal species. The invention also relates to a method of identifying a mycotoxin in patient tissue or body fluid. The method comprises the steps of extracting and recovering the mycotoxin from the patient tissue or body fluid, contacting the mycotoxin with an antibody directed against the mycotoxin, and identifying the myocotoxin. Both of these methods can be used to determine if a patient is at risk for or has developed a disease state related to a fungal infection, and to develop an effective treatment regimen for the patient. | 11-26-2015 |
20150342577 | METHOD FOR OBTAINING FETAL CELLS AND FETAL CELLULAR COMPONENTS - Methods are disclosed for non-invasively obtaining fetal cells from a pregnant female. The methods include placing an absorbent medium in an interlabial or intravaginal space or adjacent to the perineum at the vaginal opening of the pregnant female, and collecting vaginal fluid comprising cells in the absorbent medium while the absorbent medium is interlabial or intravaginal space or adjacent to the perineum at the vaginal opening. The absorbent medium is removed and cells are isolated from the absorbent medium to obtain the fetal cells. The fetal cells can be, for example, somatic cells, embroyic stem cells, fetal stem cells or trophoblast cells. | 12-03-2015 |
20150344936 | COELENTERAZINE ANALOGS AND MANUFACTURING METHOD THEREOF - There has been a need for coelenterazine analogs that exhibit luminescence properties different from those of known coelenterazine analogs. The present invention provides the compound represented by general formula (1). | 12-03-2015 |
20150344945 | COMPOSITIONS, SYSTEMS, AND METHODS FOR DETECTING EVENTS USING TETHERS ANCHORED TO OR ADJACENT TO NANOPORES - Compositions, systems, and methods for detecting events are provided. A composition can include a nanopore including a first side, a second side, and an aperture extending through the first and second sides; and a permanent tether including head and tail regions and an elongated body disposed therebetween. The head region can be anchored to or adjacent to the first or second side of the nanopore. The elongated body including a reporter region can be movable within the aperture responsive to a first event occurring adjacent to the first side of the nanopore. For example, the reporter region is translationally movable toward the first side responsive to the first event, then toward the second side, then toward the first side responsive to a second event. The first event can include adding a first nucleotide to a polynucleotide. The second event can include adding a second nucleotide to the polynucleotide. | 12-03-2015 |
20150344950 | Functionalized Cyanine Dyes (PEG) - The invention provides a novel class of cyanine dyes that are functionalized with a linker moiety that facilitates their conjugation to other species and substituent groups which increase the water-solubility, and optimize the optical properties of the dyes. Also provided are conjugates of the dyes, methods of using the dyes and their conjugates and kits including the dyes and their conjugates. | 12-03-2015 |
20150344975 | COMPOSITIONS AND METHODS FOR DETECTING, EXTRACTING, VISUALIZING, AND IDENTIFYING PROTOMYXZOA RHUEMATIC - Disclosed are compositions, kits, and methods for detecting, extracting, visualizing, and identifying Protomyxzoa Rhuematic. | 12-03-2015 |
20150346097 | PORTABLE FLUORESCENCE DETECTION SYSTEM AND MICROASSAY CARTRIDGE - Disclosed is a compact, microprocessor-controlled instrument for fluorometric assays in liquid samples, the instrument having a floating stage with docking bay for receiving a microfluidic cartridge and a scanning detector head with on-board embedded microprocessor operated under control of a ODAP daemon resident in the detector head for controlling source LEDs, emission signal amplification and filtering in an isolated, low noise, high-gain environment within the detector head. Multiple optical channels may be incorporated in the scanning head. In a preferred configuration, the assay is validated using dual channel optics for monitoring a first fluorophore associated with a target analyte and a second fluorophore associated with a control. Applications include molecular biological assays based on PCR amplification of target nucleic acids and fluorometric assays in general, many of which require temperature control during detection. | 12-03-2015 |
20150352544 | SYSTEMS AND METHODS OF LOADING OR REMOVING LIQUIDS USED IN BIOCHEMICAL ANALYSIS - System configured to conduct designated reactions for biological or chemical analysis. The system includes a liquid-exchange assembly comprising an assay reservoir for holding a first liquid, a receiving cavity for holding a second liquid that is immiscible with respect to the first liquid, and an exchange port fluidically connecting the assay reservoir and the receiving cavity. The system also includes a pressure activator that is operably coupled to the assay reservoir of the liquid-exchange assembly. The pressure activator is configured to repeatedly exchange the first and second liquids by (a) flowing a designated volume of the first liquid through the exchange port into the receiving cavity and (b) flowing a designated volume of the second liquid through the exchange port into the assay reservoir. The system also includes a fluidic system that is in flow communication with the liquid-exchange assembly. | 12-10-2015 |
20150353918 | METHOD AND MATERIALS FOR NUCLEIC ACIDS EXTRACTION AND PURIFICATION - Provided herein is materials and method relating to nucleic acids extraction and purification from biological samples. In particular, a pre-treatment buffer is used to facilitate the extraction and purification of nucleic acids from biological samples, more specifically, removing inhibitors and impurities from biological samples and resulting in a highly concentrated and purified nucleic acids preparation. | 12-10-2015 |
20150361483 | LABEL FREE MOLECULAR DETECTION METHODS, SYSTEMS AND DEVICES - Methods, systems, and devices are disclosed for capturing, concentrating, isolating, and detecting molecules. In one aspect, a molecular probe device includes a molecular probe having a complimentary base pair region initially zipped and structured to include a binding agent to chemically attach the molecular probe to an outer surface of a magnetic bead, and a binding molecule to chemically attach the molecular probe to a substrate of a microfluidic device, in which the complimentary base pair region is configured to hybridize to a complementary nucleic acid sequence of a DNA or RNA molecule. | 12-17-2015 |
20150361486 | NUCLEIC ACID DETECTION USING PROBES - The invention provides a method for detecting a target nucleotide sequence by tagging the nucleotide sequence with a nucleotide tag, providing a probe oligonucleotide with a melting temperature Tm1, comprising a regulatory sequence and a nucleotide tag recognition sequence; incorporating the probe oligonucleotide into the tagged polynucleotide in a polynucleotide amplification reaction, providing a regulatory oligonucleotide with a melting temperature Tm2, comprising a sequence segment that complementary to the regulatory sequence and a tail segment that does not hybridize to the probe nucleotide when the sequence segment and the regulatory sequence are annealed, amplifying the tagged target nucleic acid sequence in a PCR amplification reaction using the probe oligonucleotide as a primer, and using a DNA polymerase with high strand displacement activity and low 5′-nuclease activity, and detecting the amplification product; wherein Tm1 and Tm2 are higher than the annealing temperature associated with the polynucleotide amplification reaction. | 12-17-2015 |
20150361495 | METHOD FOR THE DIAGNOSIS AND/OR PROGNOSIS OF NEURODEGENERATIVE DISEASES - This invention refers to the use of mitochondrial DNA as a quantitative biomarker of neurodegenerative diseases, preferably Alzheimer's disease, as well as a method and a diagnostic and/or prognostic kit of these diseases through the use of this biomarker. | 12-17-2015 |
20150361497 | THERAPEUTICS AND DIAGNOSTICS BASED ON MINISATELLITE REPEAT ELEMENT 1 (MSR1) - The use of minisatellite repeat element 1 (MSR1) in a process of identifying therapeutic agents for use in the treatment or therapy of diseases or conditions relating to one or more genes associated with MSR1 or functional variants or derivatives thereof or use in a process of gene therapy. Also provided are tests for the prediction, diagnosis, prognosis or response to therapy in a disease or condition in a subject, said disease or condition relating to one or more genes associated with a minisatellite repeat element 1 (MSR1) or functional variants or derivatives thereof wherein said test is or comprises means for assessing the copy number variation (CNV) at an MSR1 locus of the gene or genes so as to determine the risk of the disease or condition being present or developing in the subject. Also provided are processes and kits for said tests, and targeted screening or genotyping programs using said tests. | 12-17-2015 |
20150361501 | METHODS AND MATERIALS FOR DETECTING GENETIC OR EPIGENETIC ELEMENTS - This document provides methods and materials for detecting genetic and/or epigenetic elements. For example, methods and materials for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, methods and materials for detecting the amount of target nucleic acid containing a genetic or epigenetic element within a sample, kits for detecting the presence or absence of target nucleic acid containing a genetic or epigenetic element, kits for detecting the amount of target nucleic acid containing a genetic or epigenetic element present within a sample, and methods for making such kits are provided. | 12-17-2015 |
20150361506 | DONOR KIR3DL1 AND HLA-B SUBTYPES AND LEUKEMIA CONTROL IN HLA-COMPATIBLE ALLOGENIC HEMATOPOIETIC STEM CELL TRANSPLANTATION - This disclosure generally relates to donor selection for hematopoietic stem cell transplantation. In particular, this disclosure relates to typing KIR3DL1 and HLA-B alleles as basis for donor selection. | 12-17-2015 |
20150362488 | PROCESS FOR DETECTION OF DNA MODIFICATIONS AND PROTEIN BINDING BY A SINGLE MOLECULE MANIPULATION - The present invention relates to a method for determining whether a protein binds to a specific DNA sequence. This method is useful in particular for identifying modifications to the DNA sequence (e.g. methylations) via the binding of proteins that specifically recognize those modifications (e.g. antibodies), but also to identify the binding sequence on DNA of a variety of proteins. | 12-17-2015 |
20150368696 | GENE-MATCHED ENRICHMENT AND POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF MICROORGANISMS - A method for amplifying and detecting microorganisms, such as species of | 12-24-2015 |
20150368701 | Methods And Kits For Room Temperature In Situ Detection Of A Target Nucleic Acid in a Biological Sample - The present invention relates to in situ hybridization methods for detecting a target nucleic acid in a biological sample comprising performing one or more method steps (e.g., pretreatment, denaturation, hybridization, washes) at room temperature. The invention further relates to kits for performing such methods. | 12-24-2015 |
20150368712 | UNIVERSAL NUCLEIC ACID PROBE SET AND METHOD FOR UTILIZATION THEREOF - A nucleic acid probe set includes (A) a fluorescent probe and (B) a binding probe. The fluorescent probe (A) is formed of an oligonucleotide, which includes (a) a nucleotide unit labeled with (d) a fluorescent substance. The binding probe (B) is formed of an oligonucleotide having (b | 12-24-2015 |
20150368723 | Identification of Surface-Associated Antigens for Tumor Diagnosis and Therapy - The invention relates to identifying tumor-associated genetic products and encoding nucleic acids thereof. A therapy and diagnosis of diseases in which the tumor-associated genetic products are aberrantly expressed, proteins, polypeptides and peptides which are expressed in association with tumor and the encoding nucleic acids for said proteins, polypeptides and peptides are also disclosed. | 12-24-2015 |
20150369772 | PROCESSING OF NUCLEOTIDE SEQUENCES - The invention relates to a method and an apparatus ( | 12-24-2015 |
20150376677 | Methods for Separation and Characterization of Microorganisms Using Identifier Agents - The present invention is directed to a method for separating, characterizing and/or identifying microorganisms in a test sample. The method of the invention comprises an optional lysis step for lysing non-microorganism cells that may be present in a test sample, followed by a subsequent separation step. The method may be useful for the separation, characterization and/or identification of microorganisms from complex samples such as blood-containing culture media. The invention further provides for the use of one or more identifier agents and interrogating the microorganism sample and/or said one or more identifier agents to produce measurements which characterizing and/or identifying the microorganism based on the produced measurements and/or the presence or absence of the identifier agent or a metabolized form of the identifier agent in the microorganism sample. | 12-31-2015 |
20150376687 | DIRECT QUANTITATIVE PCR ABSENT MINOR GROOVE BINDERS - Disclosed herein are methods, compositions and kits for the quantification of a nucleic acid target present on a solid support. This entails quantitative real-time polymerase chain reaction wherein minor groove binders are excluded. | 12-31-2015 |
20150376696 | USE OF GLYCANS AND GLYCOSYLTRANSFERASES FOR DIAGNOSING/MONITORING INFLAMMATORY BOWEL DISEASE - Diagnostic methods for assessing risk of or presence of inflammatory bowel disease in a patient based on glycosyltransferase or histo-blood group antigen signatures or a combination thereof. Also disclosed herein are prognostic methods for monitoring inflammatory bowel disease progression in a patient. | 12-31-2015 |
20150376699 | METHODS OF DETECTING SEPSIS - Methods of sepsis in a sample from a patient are provided. Methods of detecting changes in expression of one or more RNAs associated with sepsis are also provided. Compositions and kits are also provided. | 12-31-2015 |
20150376706 | METHOD FOR USING PROBE BASED PCR DETECTION TO MEASURE THE LEVELS OF CIRCULATING DEMETHYLATED BETA CELL DERIVED DNA AS A MEASURE OF BETA CELL LOSS IN DIABETES - A method for measuring blood levels of β cell DNA that is released upon β cell death by using a quantitative probe technology to detect amplified methylated and demethylated forms of the insulin gene DNA, representing normal tissue and β cell specific origin, respectively. Using probes permits the sensitive and specific identification of demethylated insulin DNA patterns that are present only in β cells. The method offers a bioassay for detecting β cell loss in diabetes, useful for screening of prediabetes, monitoring of disease progression, and selection and monitoring of therapies. The technique finds potential use in both Type I and Type II diabetes, as well as gestational diabetes. | 12-31-2015 |
20150376711 | METHODS OF DETECTING LUNG CANCER - Methods of lung cancer in a sample from a patient are provided. Methods of detecting changes in expression of one or more target RNAs associated with lung cancer are also provided. Compositions and kits are also provided. | 12-31-2015 |
20150376715 | ANALYTICAL METHOD FOR INCREASING SUSCEPTIBILITY OF MOLECULAR TARGETED THERAPY IN HEPATOCELLULAR CARCINOMA - Provided herein is an analytical method for determining whether a hepatocellular carcinoma patient has susceptibility or resistance to sorafenib treatment by analyzing the mRNA expression of FGFR1, optionally along with the mRNA expressions of other biomarkers (i.e., VEGFR2, PDGFRβ, c-KIT, c-RAF, EGFR, and/or mTOR) to select a patient having susceptibility to sorafenib treatment and a patient having resistance to sorafenib treatment before employing molecular targeted therapy with sorafenib. | 12-31-2015 |
20150377834 | THIN FILM BULK ACOUSTIC RESONATOR WITH SIGNAL ENHANCEMENT - Sensitivity of thin film bulk acoustic resonance (TFBAR) sensors is enhanced by mass amplification and operating a high frequency. | 12-31-2015 |
20160000840 | Probiotic Strains for Treating and/or Preventing Diarrhea - The present invention relates to a method of selecting or identifying probiotic strains capable of acting on the absorption of water in the colon, and use thereof as medicinal products in the treatment and/or prevention of diarrhea. The invention relates in particular to the strain of | 01-07-2016 |
20160002309 | FHL1 MUTATIONS ASSOCIATED WITH NOVEL X-LINKED MUSCULAR MYOPATHIES - Four and a Half LIM domains protein 1 (FHL-1) mutations at positions 128 or 224 that are associated with X-linked muscular myopathy, methods of screening subjects to identify those susceptible to muscular myopathy including muscular dystrophy and cardiomyopathy and kits. | 01-07-2016 |
20160002621 | METHOD, SUBSTRATE AND DEVICE FOR SEPARATING NUCLEIC ACIDS - A method is provided herein, the method includes: applying a sample comprising target nucleic acids to a sample application zone of a substrate; and flowing a nucleic acid amplification reaction mixture across a length of the substrate through the sample application zone to amplify the target nucleic acid forming a nucleic acid amplification product; wherein the target nucleic acid having a first molecular weight is substantially immobilized at the sample application zone and wherein the amplification product having a second molecular weight migrates away from the sample application zone. An associated device is also provided. | 01-07-2016 |
20160002711 | PRIMER AND PROBE SEQUENCES FOR DETECTING CHLAMYDIA TRACHOMATIS - The present invention relates to primers and probes that can be used in various assays to detect a new strain of | 01-07-2016 |
20160002712 | Polymerase Chain Reaction Detection System - The present invention relates to methods and kits for nucleic acid detection in an assay system. | 01-07-2016 |
20160002716 | Novel Ligase Activity - Compositions and methods are provided for ligating polynucleotides having a length that is greater than 8 nucleotides on an RNA splint. The ligation reaction provides consistent results in high or low ATP concentrations. The reaction can occur rapidly and is generally at least 10 fold more efficient than T4DNA ligase under optimal conditions for T4DNA ligase and the reaction time is less than 6 hours for example, less than 1 hour. | 01-07-2016 |
20160002718 | SYSTEM AND METHOD FOR GENERATING OR ANALYZING A BIOLOGICAL SAMPLE - A system including a reaction valve having a mating side and a valve inlet. The reaction valve includes a sample chamber, and the valve inlet is in fluid communication with the sample chamber. The system also has a manifold having an engagement surface. The manifold may include first and second manifold ports at the engagement surface. The engagement surface and the mating side of the reaction valve may be positioned adjacent to each other along an interface. The system may also include a positioning assembly that is operatively coupled to at least one of the reaction valve or the manifold. The positioning assembly is configured to move at least one of the reaction valve or the manifold along the interface to fluidly disconnect the valve inlet from the first manifold port and to fluidly connect the valve inlet to the second manifold port. | 01-07-2016 |
20160002728 | MEANS AND METHODS FOR HAPLOTYPING MHC-DRB LOCI IN MAMMALS AND USES THEREOF - The invention relates to the typing of MHC-DRB loci in mammals. In particular, the invention provides a typing procedure for the mammalian DRB region that allows an easy, economical, high resolution, fast and accurate haplotyping protocol. The invention further provides the use of said typing procedure in genetic applications, and provides a kit for typing of MHC-DRB loci. | 01-07-2016 |
20160002730 | METHOD FOR CLASSIFYING AN INFLAMMATORY BOWEL DISEASE AS A CROHN'S DISEASE OR AS AN ULCERATIVE COLITIS - The present invention relates to a method for classifying an inflammatory bowel disease in a patient as a Crohn's disease or as an ulcerative colitis, said method comprising a step of measuring an expression profile of miRNA in a sample from the patient, wherein said miRNA are miR15a, miR26a, miR29a, miR29b, miR30c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b-5p, miR150, miR-181d, miR-182, miR185, miR196a, miR199a-3p, miR199a-5p, miR199b-5p, miR-203, miR223, miR-299-5p, miR320a, miR324-3p, miR-328. | 01-07-2016 |
20160002738 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND USE THEREOF - The invention relates to the identification of genetic products that are expressed in association with a tumor and the nucleic acid coding therefor. The invention relates to the therapy and diagnosis of diseases in which the genetic products that are expressed in association with a tumor are expressed in an aberrant manner. The invention also relates to proteins, polypeptides, and peptides which are expressed in association with a tumor and the nucleic acids coding therefor. | 01-07-2016 |
20160002740 | DETECTION OF NUCLEIC ACIDS IN URINE - Provided are methods of determining whether a subject comprises a target nucleic acid sequence that is 51-110 nucleotides in length. Also provided are methods of monitoring a condition or treatment effect in a subject. | 01-07-2016 |
20160002741 | METHOD FOR PREDICTING SENSITIVITY TO EGFR INHIBITOR - A method for predicting sensitivity to an EGFR inhibitor includes: (a) determining whether there is a KRAS gene-derived nucleic acid or a protein thereof in a blood sample which has been collected from a subject, and whether the KRAS gene-derived nucleic acid or the protein thereof in the blood sample is wild type or mutant; and (b) determining that there is a high possibility that a tumor of the subject is sensitive to an EGFR inhibitor when a wild type KRAS gene-derived nucleic acid or a protein thereof is detected and no mutant KRAS gene-derived nucleic acid or a protein thereof is detected in the blood sample in the process (a). | 01-07-2016 |
20160002742 | Maize event HCEM485, compositions and methods for detecting and use thereof - Maize event HCEM485 is provided, in which plants comprising the event are tolerant to exposure to a glyphosate herbicide. Maize genomic polynucleotides flanking the insert DNA providing glyphosate tolerance are provided. The plant or part thereof having the event comprises a junction region of the insert DNA and maize plant genomic sequences. Methods and primers and probes to detect the presence of the event are provided, as well as kits which employ such primers and probes. | 01-07-2016 |
20160003817 | Rapid and sensitive analyte measurement assay - This disclosure provides, among other things, a method to speed up the time in an assay, comprising: obtaining a plate comprising a local electric-field and electric-field gradient enhancement layer on a substrate surface; attaching capture agents to the surface of the enhancement layer; applying a voltage between the enhancement layer and at least one counter electrode to produce a local electric field and an electric-field gradient in the solution; and detecting binding of the target analyte to the capture agents on the plate; wherein the speed of movement of the analyte, the orientation of the analyte, the orientation of the capture agent, the speed of binding and/or the strength of binding of the analyte to the capture agent are improved by the electric field gradient and/or the electric field, and the time in detecting the analyte is reduced. Systems for performing the method are also disclosed. | 01-07-2016 |
20160003831 | ANALYSIS METHOD FOR ASSESSING STAGE OF PROSTATE CANCER, PROSTATE-CANCER STAGE ASSESSMENT METHOD, PROSTATE-CANCER DETECTION METHOD, AND TEST KIT - Each of (i) an analysis method of the present invention for assessing a degree of progression of prostate cancer and (ii) a method of the present invention for assessing a degree of progression of prostate cancer includes the step of measuring an amount of neuropeptide Y in a sample derived from blood or urine obtained from a living organism. A method of the present invention for detecting prostate cancer includes the step of measuring respective amounts of neuropeptide Y and prostate-specific antigen in a sample derived from blood or urine obtained from a living organism. | 01-07-2016 |
20160008814 | SYSTEM AND METHOD FOR CAPTURING AND ANALYZING CELLS | 01-14-2016 |
20160009771 | NOVEL POLYPEPTIDE EXHIBITING FLUORESCENT PROPERTIES AND USE THEREOF | 01-14-2016 |
20160010081 | SYSTEMS, METHODS AND KITS FOR EXTRACTING NUCLEIC ACID FROM DIGESTIVE FLUID | 01-14-2016 |
20160011085 | SIMULTANEOUS ACQUISITION OF BIOMETRIC DATA AND NUCLEIC ACID | 01-14-2016 |
20160017357 | POLYNUCLEOTIDES AND METHODS FOR IMPROVING PLANTS - The invention provides methods and compositions for producing plant with altered biomass, the methods comprising the step of altering the expression and/or activity of the polypeptide comprising the sequence of SEQ ID NO:1, or a variant thereof, in a plant cell or plant. The invention also provides a polypeptide comprising the sequence of SEQ ID NO:1, and fragments of variants thereof the sequence. The invention also provides polynucleotides encoding such polypetide sequences. The invention also provides constructs, cells and plants comprising such polynucleotides. | 01-21-2016 |
20160017405 | FAST HYBRIDIZATION FOR NEXT GENERATION SEQUENCING TARGET ENRICHMENT - The present invention relates to compositions and methods of target enrichment or selection of nucleic acids using hybridization, which can be used in, e.g., next-generation sequencing. | 01-21-2016 |
20160017428 | Recombination Sequence (RS) Rearrangement Frequency as a Measure of Central B Cell Tolerance - The invention relates to methods and materials for diagnosing an autoimmune disease such as SLE, Type 1 diabetes, and the like. More particularly, the invention relates to methods and materials for assessing the frequency of recombination sequence (RS) rearrangement as a novel marker for an autoimmune disease. Such an assay can allow clinicians to diagnose an autoimmune disease based on the RS rearrangement frequency in an autoimmune patient as compared to an otherwise healthy control. In addition, the method includes identifying individuals who are at increased risk of developing autoimmunity. The method may also be helpful in directing the type of therapy and monitoring the effects of therapy in patients with autoimmune or non-autoimmune conditions. | 01-21-2016 |
20160024557 | SIMULTANEOUS DETECTION OF TARGET PROTEIN AND TARGET NUCLEIC ACIDS IN A SINGLE CELL - Methods and reagents for detection and analysis of nucleic acids are provided. The methods employ proximity extension assays for detection of a target nucleic acids of interest, e.g., a target RNA. The method can additionally be used in multiplex assays with a protein proximity extension assay to detect protein. | 01-28-2016 |
20160024560 | DETECTION OF NEISSERIA GONORRHOEAES - Methods and compositions for detection of | 01-28-2016 |
20160024562 | POLYNUCLEOTIDES FOR THE AMPLIFICATION AND DETECTION OF CHLAMYDIA TRACHOMATIS AND NEISSERIA GONORRHOEAE - Polynucleotides useful for detecting | 01-28-2016 |
20160024563 | METHOD FOR PERFORMING A MELTING CURVE ANALYSIS - The present invention related to methods for improving probe-based melting curve analysis methods. The improvement comprises the inclusion of a compound (A) which is a water-soluble polyanionic co-polymer comprising maleic acid, preferably poly(acrylic acid-co-maleic acid) (PAMA) in the analytical sample that is subjected to the melting curve analysis. | 01-28-2016 |
20160024565 | FRAGMENT COMPLEMENTATION OF BASED ASSAYS - The present disclosure provides, among other things, methods and compositions for detecting and/or quantifying analytes using fragment complementation technologies. In accordance with various embodiments of the present disclosure, a kit can include a) a capture probe immobilized on a surface, wherein the capture probe can associate with an analyte in a sample, thereby forming at least one captured analyte; b) a detection element including a target interacting probe associated with a first subunit of a detectable entity, wherein the target interacting probe can associate with the captured analyte so that a first complex is formed; and c) a second subunit that can complement the first subunit and generate a detectable entity, wherein the presence and/or amount of the analyte is indicated by detecting level or activity of the detectable entity. | 01-28-2016 |
20160024570 | RAMAN CLUSTER TAGGED MOLECULES FOR BIOLOGICAL IMAGING - This invention provides nucleoside polyphosphate analogs each of which comprises a tag comprising a plurality of Raman-scattering moieties; compounds comprising said nucleoside polyphosphate analogs; and methods for determining the sequence of a single-stranded DNA or RNA using said nucleoside polyphosphate analogs. This invention also provides methods for detecting the interaction of a plurality of predetermined compounds, at least one of which having attached thereto a tag comprising a plurality of Raman-scattering moieties. | 01-28-2016 |
20160024586 | METHODS OF DETECTING CANCER - Methods of detecting cancer are provided. Methods of detecting changes in the levels of one or more small RNAs associated with cancer are also provided. Compositions and kits are also provided. | 01-28-2016 |
20160024597 | miRNAs AS THERAPEUTIC TARGETS IN CANCER - Methods for modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising an miR-140 nucleic acid sequence in an amount sufficient to modulate the cellular component are provided. Overexpression of miR-140 inhibits cell proliferation in both U-2 OS (wt-p53) and HCT 116 (wt-p53) cell lines. Cells transfected with miR-140 are more resistant to chemotherapeutic agent methotrexate. mi-140 expression is related to HDAC4 protein expression. The claimed methods reduce the protein expression level of HDAC4 without degrading the target mRNA. | 01-28-2016 |
20160025738 | PROGNOSTIC MARKER TO DETERMINE THE RISK FOR EARLY-ONSET PREECLAMPSIA - The present application relates to an in vitro method for identifying a pregnancy related syndrome selected from the group consisting of pre-eclampsia, eclampsia, Hemolysis Elevated Liver enzymes and Low Platelets (HELLP) and intra-uterine growth restriction (IUGR), the method including (i) measuring the amount of ESM-1 in a biological fluid sample from a pregnant subject, wherein the pregnant subject is between week 1 to 20 of gestation; (ii) comparing said amount of ESM-1 to a reference value, and (iii) identifying the subject as being likely to have or develop the pregnancy related syndrome based on a comparison of the amount of ESM-1 to the reference value. A device and a kit for identifying such a pregnancy related syndrome are also claimed. | 01-28-2016 |
20160025760 | SYSTEMS AND METHODS FOR MULTI-ANALYSIS - Systems and methods are provided for sample processing. A device may be provided, capable of receiving the sample, and performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing multiple assays. The device may comprise one or more modules that may be capable of performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing the steps using a small volume of sample. | 01-28-2016 |
20160032357 | METHOD FOR RELATIVE QUANTIFICATION OF CHANGES IN DNA METHYLATION, USING COMBINED NUCLEASE, LIGATION, AND POLYMERASE REACTIONS - The present invention is directed to methods for identifying the presence of one or more methylated or unmethylated target nucleotide sequences in a sample that involve a nuclease-ligation reaction. In some embodiments, the ligation products formed in the nuclease-ligation process of the present invention are subsequently amplified using a polymerase chain reaction. The ligated product sequences or extension products thereof are detected, and the presence of one or more methylated or unmethylated target nucleotide sequences in the sample is identified based on the detection. | 02-04-2016 |
20160032362 | Method for Enriching Methylated CpG Sequences - Compositions and methods are provided for facilitating the enrichment of single-stranded DNA containing methylated CpG in a mixture containing methylated and unmethylated DNA. The compositions relate to methylation-binding protein domains that selectively bind to methylated single strand DNA. In embodiments of the invention, the methylated DNA is eluted in 0.4M-0.6M NaCl while the unmethylated single strand DNA is eluted in less than 0.4M salt. The ability to readily enrich for methylated DNA permits high throughput sequencing of the methylated DNA and identification of abnormal methylation patterns associated with disease. | 02-04-2016 |
20160032368 | METHYLATION DETECTION - A real-time method of detecting the presence and/or amount of a methylated or unmethylated gene of interest in a DNA-containing sample, comprises the steps of (a) contacting the DNA-containing sample with a reagent which selectively modifies unmethylated cytosine residues in the DNA to produce detectable modified residues but which does not modify methylated cytosine residues (b) amplifying at least a portion of the methylated or unmethylated gene of interest using at least one primer pair, at least one primer of which is designed to bind only to the sequence of methylated or unmethylated DNA following treatment with the reagent, wherein at least one primer in the primer pair produces a detectable fluorescence signal during amplification which is detected in real-time (c) quantifying the results of the real-time detection against a standard curve for the methylated or unmethylated gene of interest to produce an output of gene copy number. | 02-04-2016 |
20160032388 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS, METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 02-04-2016 |
20160032389 | Method, Kits, and Reaction Mixtures For High Resolution Melt Genotyping - Various methods are described that provide for high resolution melt (HRM) genotyping. Some embodiments comprise providing a locus specific primer, and two allele specific primers each comprising at least one single nucleotide polymorphism (SNP) allele-hybridizable sequence, wherein at least one of the allele specific primers also comprises at least one nucleotide alteration. In some embodiments, a nucleic acid is provided comprising a SNP base located within 1-20 bases of its 3′ end. Some embodiments comprise hybridizing the locus specific primer and at least one of the allele specific primers to the nucleic acid, amplifying the hybridized nucleic acid using pyrophosphorolysis activated polymerization (PAP) PCR, and determining the melting temperature (Tm) of the resulting amplicons, for example, using HRM. In some embodiments, reaction mixtures and kits for HRM genotyping are provided. The reaction mixtures and kits can each comprise a locus specific primer, one or more allele specific primers each comprising at least one SNP allele-hybridizable sequence, and a PAP PCR enzyme, wherein at least one of the allele specific primers also comprises a nucleotide alteration, for example, a tail. | 02-04-2016 |
20160032394 | METHOD FOR REVERSING RECENT-ONSET TYPE 1 DIABETES (T1D) BY ADMINISTERING SUBSTANCE P (sP) - Described herein is a treatment comprising the following step: (a) injecting a therapeutically effective amount of a pharmaceutical composition into the celiac artery of an individual, wherein the pharmaceutical composition reverses recent onset Type 1 Diabetes (T1D). Also described is a method for identifying an individual who will be responsive to this treatment. In addition there is described a device containing the pharmaceutical composition for injecting the pharmaceutical composition into the celiac artery. | 02-04-2016 |
20160033507 | USE OF ACY-1 AS A MARKER OF ISCHAEMIA/REPERFUSION, DELAYED GRAFT FUNCTION AND GRAFT VIABILITY AS WELL AS METHOD THEREOF - The invention relates to use of ACY-1 as a biomarker for ischaemia-reperfusion injury. | 02-04-2016 |
20160039932 | MONOCLONAL ANTIBODIES WITH SPECIFICITY FOR FETAL ERYTHROID CELLS - The present invention concerns a monoclonal antibody and corresponding hybridoma cells and antigens suitable for isolating fetal cells from maternal blood. The inventive monoclonal antibody reacts with a surface antigen present on fetal red blood cells including their nucleated precursor cells, but not with surface antigens on adult erythroid cell. | 02-11-2016 |
20160040214 | Nucleic Acid Quantitation Method - The present method relates to methods of quantifying nucleic acids, and in particular to the use of a universal reference nucleic acid to generate a calibration curve from which the level of a target nucleic acid in a sample can be calculated. | 02-11-2016 |
20160040217 | METHODS AND KITS TO DETECT AND GENOTYPE CRYPTOCOCCUS SPECIES - Embodiments of the invention provide a method of genotyping a | 02-11-2016 |
20160040219 | PROBES FOR IMPROVED MELT DISCRIMINATION AND MULTIPLEXING IN NUCLEIC ACID ASSAYS - Methods and compositions for the detection and quantification of nucleic acids are provided. In certain embodiments, methods involve the use of cleavable probes that comprise a ribonucleotide position that is susceptible to endoribonuclease (e.g., RNase H) cleavage in the presence of target nucleic acid molecules. Probes of the embodiments may also comprise non-natural nucleotide linked to a reporter and/or quenching moiety. | 02-11-2016 |
20160040224 | SINGLE NUCLEOTIDE DETECTION METHOD - A method for determining the sequence of nucleotide bases in a polynucleotide analyte is provided. It is characterised by the steps of (1) generating a stream of single nucleotide bases from the analyte by pyrophosphorolysis; (2) producing captured molecules by reacting each single nucleotide base with a capture system labelled with detectable elements in an undetectable state; (3) releasing the detectable elements from each captured molecule in a detectable state and (4) detecting the detectable elements so released and determining the sequence of nucleotide bases therefrom. The method can be used advantageously in sequencers involving the use of microdroplets. | 02-11-2016 |
20160040242 | Methods and Kits for Detecting Nucleic Acid Mutants in Wild-Type Populations - This disclosure relates to amplification and detection of a rare variant or variants of a DNA sequence in an abundant variant of the sequence, such as detection of a low-level somatic mutations and minority alleles in an excess of normal nucleic acid target sequences. | 02-11-2016 |
20160040243 | METHODS AND NUCLEOTIDE FRAGMENTS OF PREDICTING OCCURRENCE, METASTASIS OF CANCERS AND PATIENTS' POSTOPERATIVE SURVIVAL IN VITRO - Provided in the present invention are a method using in vitro measurement of the content of methylation or demethylation of GFRal CpG islands to estimate a risk of tumorigenesis and of tumor metastasis, or postoperative life expectancy, and a nucleotide sequence used. | 02-11-2016 |
20160040255 | Polynucleotide Primers For Detecting PIK3CA Mutations - A polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 3 to 16, 18, 20 to 33, 35 or 37 to 39. A method of detecting the presence or absence of a mutation in the PIK3CA gene, wherein the mutation is one of H1047R, H1047L, E542K and E545K, and preferably ARMS primers are combined with Scorpion primers. | 02-11-2016 |
20160040256 | METHODS, COMPOSITIONS, AND KITS FOR DETECTING ALLELIC VARIANTS - In some embodiments, the present inventions relates generally to compositions, methods and kits for use in discriminating sequence variation between different alleles. More specifically, in some embodiments, the present invention provides for compositions, methods and kits for quantitating rare (e.g., mutant) allelic variants, such as SNPs, or nucleotide (NT) insertions or deletions, in samples comprising abundant (e.g., wild type) allelic variants with high specificity and selectivity. In particular, in some embodiments, the invention relates to a highly selective method for mutation detection referred to as competitive allele-specific TaqMan PCR (“cast-PCR”). | 02-11-2016 |
20160041193 | METHOD FOR OPERATING A SYSTEM FOR THE INTEGRATED AND AUTOMATED ANALYSIS OF DNA OR PROTEIN - A method for the integrated and automated analysis of DNA or protein, including a single-use cartridge, with an analysis device having a control device, and devices for capturing and processing signals, the control device carrying out a completely automatic process and evaluation of molecular diagnostic analysis via single-use cartridges (Lab-on-a-Chip). Controlling of an analysis process, which occurs in the cartridge, involve the subsequent displacement and thermostatisation of liquids with a first device, and with a second device the signals which are obtained during the analysis are processed. The first and the second devices are synchronized in such a manner that the analysis process of the sample can be carried out in a totally integrated manner thus producing an immediate result. | 02-11-2016 |
20160046932 | SITE-SPECIFIC INDUCTION OF BIMOLECULAR QUADRUPLEX-DUPLEX HYBRIDS AND METHODS OF USING THE SAME - A method for the generation of a G-quadruplex structure on a target nucleic acid sequence is presented. The approach combines the specificity of Watson-Crick base pair with the stability associated with a robust G-quadruplex scaffold. The induction of such bimolecular quadruplex-duplex hybrids can be applied within the antigene or antisense context for enhanced steric blockage to the transcriptional or translational machinery. In addition, such structures provide unique features for ligand design. This approach also allows the site-specific generation of G-quadruplex structures within nucleic acid nanoarchitectures. | 02-18-2016 |
20160046984 | Robust Detection of Nucleic Acids in Situ - Methods of detecting nucleic acids, including methods of detecting nucleic acids in situ, are provided. The methods can detect even target nucleic acids that are partially degraded and/or masked by extensive crosslinking. Compositions, kits, and systems related to the methods are also described | 02-18-2016 |
20160046988 | DETECTION OF NUCLEIC ACIDS - Provided herein is technology relating to detecting and identifying nucleic acids and particularly, but not exclusively, to compositions, methods, kits, and systems for detecting, identifying, and quantifying target nucleic acids with high confidence at single-molecule resolution. | 02-18-2016 |
20160046991 | GENETIC POLYMORPHISMS ASSOCIATED WITH LIVER FIBROSIS, METHODS OF DETECTION AND USES THEREOF - The present invention is based on the discovery of genetic polymorphisms that are associated with liver fibrosis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, including groups of nucleic acid molecules that may be used as a signature marker set, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 02-18-2016 |
20160046993 | NANOPROBE-BASED GENETIC TESTING - The present application relates to methods of detecting a mutation in a target nucleic acid molecule. Two phosphorodiamidate morpholino oligomer probes that differ by at least one base are each covalently coupled to a nano article and hybridised to a target sequence. The melting temperature of the complexes between each of the two probes and the target nucleic acid are measured and compared to determine whether the sample contains a nucleic acid with the mutation. Further, the present invention relates to kits comprising a first and second conjugate as described herein and to the use of such kits for the detection of mutations in a target nucleic acid molecule or for assigning a genotype to a target nucleic acid molecule. | 02-18-2016 |
20160046999 | METHOD FOR DETECTING MUTATIONS IN SINGLE CELLS OR SINGLE MOLECULES - The invention provides a high efficiency fluorescence in situ hybridization (FISH) method for detecting mutations on individual RNA transcripts, including both exonic and intronic RNA transcripts. In certain embodiments, the method is used to quantify allelic expression at the population and single cell level, and also to distinguish maternal chromosomes from paternal chromosomes in single cells. | 02-18-2016 |
20160047778 | NANOFLUIDIC DEVICES FOR THE RAPID MAPPING OF WHOLE GENOMES AND RELATED SYSTEMS AND METHODS OF ANALYSIS - Devices and methods generate an ordered restriction map of genomic DNA extracted from whole cells. The devices have a fluidic microchannel that merges into a reaction nanochannel that merges into a detection nanochannel at an interface where the nanochannel diameter decreases in size by between 50% to 99%. Intact molecules of DNA are transported to the reaction nanochannel and then fragmented in the reaction nanochannel using restriction endonuclease enzymes. The reaction nanochannel is sized and configured so that the fragments stay in an original order until they are injected into the detection nanochannel. Signal at one or more locations along the detection nanochannel is detected to map fragments in the order they occur along a long DNA molecule. | 02-18-2016 |
20160047800 | Method and Device for Immunoassay Using Nucleotide Conjugates - A composition of matter for use in an immunoassay devices and method comprising a signal antibody, e.g., FAB fragment, covalently linked to a first nucleotide; and one or more signal elements, e.g., signal enzymes such as ALP or fluorescent dyes, each covalently linked to a second nucleotide, wherein the first nucleotide has one or more repeated sequences, and the second nucleotide is bound to one of the one or more repeated sequences on said first nucleotide, and wherein the ratio of the signal antibody to the signal element is controlled by the number of repeated sequences. | 02-18-2016 |
20160047814 | METHODS OF DIAGNOSING AND DIFFERENTIATING ONCOCYTOMA AND MALIGNANT RENAL CARCINOMA AS WELL AS PRODUCTS AND USES RELATING THERETO - The present invention relates to a method for the diagnosis of a benign oncocytoma and a method to differentiate a benign oncocytoma from malignant renal cell carcinoma, a kit for use in these methods, as well as antibody relating thereto, a hybridoma cell capable of producing the same as well as the uses relating thereto. | 02-18-2016 |
20160053260 | BIOCOMPATIBLE INFINITE COORDINATION POLYMER NANOPARTICLE -NUCLEIC ACID CONJUGATES FOR ANTISENSE GENE REGULATION - Disclosed herein are metal-ligand complexes containing polynucleotides, compounds for making the same, and methods of using the same. | 02-25-2016 |
20160053291 | PROBABILITY-DIRECTED ISOLATION OF NUCLEOTIDE SEQUENCES (PINS) - The present invention pertains to an in vitro method in which the frequency of the targeted nucleotide sequence containing the DNA fragment of interest is increased stepwise, by several rounds of 1) dilution of a sample containing the DNA fragment of interest into several replicates (separation), 2) randomly amplifying DNA in the replicates (concentration), 3) detecting the DNA fragment of interest in at least one of the diluted and amplified replicates (selection) and repeating steps 1) through 3) until the DNA fragment of interest can be sequenced by standard sequencing techniques. | 02-25-2016 |
20160053317 | FETAL DIAGNOSTICS USING FETAL CELL CAPTURE FROM MATERNAL BLOOD - Non-invasive fetal diagnostic methods are provided. In particular, provided are methods of obtaining a fetal cell-enriched sample from a maternal sample and methods of assessing a maternal sample for a fetal nucleotide sequence or expression of a fetal gene. | 02-25-2016 |
20160053333 | Novel Haplotype Tagging Single Nucleotide Polymorphisms and Use of Same to Predict Childhood Lymphoblastic Leukemia - The present invention is directed to novel haplotype tagging single nucleotide polymorphisms (SNPs) in specific regions outside the HFE gene that serve as a reliable biomarker for a decreased risk for childhood lymphoblastic leukemia (ALL) in a child. There is provided herein methods and reagents for assessing the haplotype tagging SNPs selected from the group consisting of rs807212, rs198853, rs9467664, rs2213284, rs2230655 and rs12346. The method useful in applying these SNPs in predicting a decreased risk of childhood lymphobastic leukemia (ALL) is also disclosed. | 02-25-2016 |
20160054300 | REFERENCE STANDARD FOR DIAGNOSTIC APPLICATIONS - We disclose a reference standard for a detectable entity, the reference standard comprising a support medium, preferably an embedding medium, a compact particle having a compact shape with a quantity of detectable entity coupled thereto and supported by the medium, in which the compact particle is a biological, preferably cellular compact particle, preferably a cellular compact particle. We also disclose a reference standard for a detectable entity, the reference standard comprising a support medium, preferably an embedding medium, a compact particle having a compact shape with a quantity of detectable entity coupled thereto and supported by the medium, in which the compact particle is a non-biological compact particle, preferably a non-cellular compact particle having cell-like dimensions, preferably less than 1.5 mm. | 02-25-2016 |
20160054308 | SYSTEM AND METHOD FOR ITERATIVE DETECTION OF BIOLOGICAL MOLECULES - A system for the iterative detection of biological molecules includes a probe, and a fluorophore tethered to the probe with an azide-based linker. The linker is configured to be cleaved in the presence of tris(2-carboxyethyl)phosphine (TCEP), and the on/off ratio between a signal measured before treatment with TCEP and a signal measured after treatment with TCEP is at least about 20:1. | 02-25-2016 |
20160060684 | RAPID SALMONELLA SEROTYPING ASSAY - Processes for the serotype specific detection and identification of one or more | 03-03-2016 |
20160060689 | AUTOMATED METHOD FOR DETECTING CANCERS AND HIGH GRADE HYPERPLASIAS - Automated methods for detecting cancer and related hyperplasias in biological samples. | 03-03-2016 |
20160060698 | SIMPLE DETECTION METHOD FOR RNA MODIFICATION, AND METHOD FOR DETECTING TYPE-II DIABETES USING SAID DETECTION METHOD - An object of the present invention is to provide a method for detecting a modification present in RNA using a small amount of RNA sample. Another object of the present invention is to provide a method for detecting a modification present in tRNA, for example, thiomethylation. Still another object of the present invention is to provide a method for detecting the thiomethylation of tRNA, thereby diagnosing human type 2 diabetes or the risk thereof. The present invention is characterized in that, with respect to a modification present in RNA in an RNA sample, cDNA is produced by reverse transcription of RNA using a first primer, and the resulting amount of cDNA is compared with the amount of cDNA produced by reverse transcription of RNA using a second primer, thereby detecting a modification (e.g., thiomethylation) present in RNA. | 03-03-2016 |
20160060710 | COMPAS-PCR METHOD AND METHODS FOR DETECTING, IDENTIFYING OR MONITORING SALMONID SPECIES - The present invention provides an asymmetric PCR method, the COMplementary-Primer-Asymmetric (COMPAS)-PCR, and specific methods for detecting, identifying or monitoring salmonid species. The present invention also encompasses oligonucleotide primers corresponding to species specific sequences. The use of the methods and primers are also an aspect of the present invention together with kits comprising said primers. | 03-03-2016 |
20160061837 | ANTIBODY TO CYTOLETHAL DISTENDING TOXIN OF CAMPYLOBACTER JEJUNI - Methods for preventing IBS, reducing the likelihood of developing IBS and/or treating IBS by administering COT inhibitors and/or COT neutralizers to a subject in need thereof are described. Methods of eliciting a specific immune response and methods of vaccinating a subject to prevent IBS or to reduce the likelihood of developing or having IBS are also provided. Methods of diagnosing IBS by detecting the presence or absence of COT or a COT marker in a subject are described. | 03-03-2016 |
20160068848 | YEAST ALLELES INVOLVED IN MAXIMAL ALCOHOL ACCUMULATION CAPACITY AND TOLERANCE TO HIGH ALCOHOL LEVELS - The disclosure relates to a specific yeast allele of KIN3 that is involved in maximal alcohol accumulation and/or in tolerance to high alcohol levels. Preferably, the alcohol is ethanol. In a preferred embodiment, this specific allele is combined with specific alleles of ADE1 and/or VPS70. More specifically, the disclosure relates to the use of these alleles for the construction and/or selection of high alcohol tolerant yeasts, by stacking of positive alleles, or the selection and construction of low alcohol producing yeasts by stacking of negative alleles. | 03-10-2016 |
20160068888 | Method for bisulfite treatment - The present application is directed to a method for performing a bisulfite reaction to determine methylation positions in a nucleic acid, i.e. methylated and non-methylated cytosines, whereby the nucleic acid is bound to a solid phase during the deamination and/or desulfonation step of the bisulfite reaction. The solid phase is preferably a material comprising glass or silica, more preferably a glass fleece, glass membrane or a magnetic glass particle. Further, the use of a solid phase for binding a nucleic acid during the deamination and/or desulfonation step of the bisulfite reaction is disclosed and a kit containing a bisulfite reagent and a solid phase. | 03-10-2016 |
20160068892 | QUANTIFICATION OF TARGET NUCLEIC ACID USING MELTING PEAK ANALYSIS - The present invention relates to a method for quantifying a target nucleic acid sequence performed in such a manner that at least two cycles in the nucleic acid amplification subject to melting peak analysis are predetermined before the nucleic acid amplification and melting peak analyses are performed for the at least two predetermined cycles, followed by quantifying the target nucleic acid sequence using data values from the melting peak curve (e.g., the presence or absence, height and area). | 03-10-2016 |
20160068900 | Methods for Amplifying Fragmented Target Nucleic Acids Utilizing an Assembler Sequence - The present invention provides methods of amplifying a fragmented target nucleic acid containing short target nucleic acid fragments utilizing an assembler sequence to convert these short fragments into longer sequences enabling their identification and interrogation. This is particularly important when attempting to identify small genetic variations, such as SNVs, present in highly fragmented nucleic acid samples. Amplification is accomplished by hybridizing the short target nucleic acid sequences to the assembler sequence, where these short sequences serve as primers for extension. Since the fragmented target nucleic acids that contain SNVs are utilized as primers on the assembler sequence they are preserved during amplification and can be detected. | 03-10-2016 |
20160068904 | METHODS OF SKIN ANALYSIS AND USES THEREOF - Disclosed herein are skin analysis methods and assays which objectively identify biological strengths and weaknesses in a patient's genetic coding that affect the health and beauty of their skin. Generated results can be utilized to develop personalized skin care and nutritional regimens to prevent, reduce and treat skin deterioration, disorders and diseases. In some embodiments, a method of characterizing a subject's skin is provided which includes generating a personalized skin profile by determining a subject's genetic potential in at least one area of skin health by analyzing one or more skin health-associated single nucleotide polymorphisms or other genetic marker associated with the particular area of skin health being assessed in a sample obtained from the subject. The generated skin profile reveals the subject's genetic strengths, weaknesses and/or risks related to the one or more areas of skin health allowing a personalized skincare and/or nutritional regimen to be developed and implemented. | 03-10-2016 |
20160075744 | DNA-BINDING PROTEIN USING PPR MOTIF, AND USE THEREOF - The object of the present invention is to, by analyzing PPR proteins that act to bind to DNA with a prediction that RNA recognition rules of PPR motifs can also be used for recognition of DNA, find a PPR protein showing such a characteristic. According to the present invention, it was revealed that, with a protein that can bind in a DNA base-selective manner or a DNA base sequence-specific manner, which contains one or more, preferably 2 to 30, more preferably 5 to 25, most preferably 9 to 15, of PPR motifs having a structure of the following formula 1 (wherein, in the formula 1, Helix A is a part that can form an α-helix structure; X does not exist, or is a part consisting of 1 to 9 amino acids; Helix B is a part that can form an α-helix structure; and L is a part consisting of 2 to 7 amino acids), and having a specific combination of amino acids corresponding to a DNA base or DNA base sequence as amino acids of three positions of No. 1 A.A., No. 4 A.A., in Helix A of the formula 1 and No. “ii” (-2) A.A. contained in L of the formula 1, the aforementioned object could be achieved. | 03-17-2016 |
20160076084 | Method of examining the identity of strains of lactobacillus fermentum - The invention relates to a pharmaceutical and/or dietetic composition for increasing the impact of the immune defense of higher living beings, wherein bacteria of the species | 03-17-2016 |
20160076088 | LASER MARKING FOR AUTHENTICATION AND TRACKING - Methods for incorporating and/or immobilizing security markers by exposure to an electromagnetic pulse, such as for instance a LASER pulse, to produce a marked object that can be authenticated only by using proprietary biological, chemical or physical analysis, the method includes: exposing a surface of the object to be marked to an electromagnetic pulse to activate the surface or a coating on the surface, and exposing the surface to a detectable marker molecule and thereby immobilizing the detectable marker molecule, such as a biological marker molecule, e.g. DNA on the surface of the object. The method of marking the object may include exposing a photo-polymerizable monomer on at least a portion of the surface of an object to be marked to a LASER pulse to initiate a reaction to cross link the photo-polymerizable monomer binding, trapping or encapsulating a detectable marker on the surface of the object. | 03-17-2016 |
20160076102 | MOLECULAR TARGETS FOR ALS AND RELATED DISORDERS - Provided herein are compositions and methods for diagnosis, risk assessment, research, and therapy related to amyotrophic lateral sclerosis (ALS) and ALS-related disorders. In particular, the present invention relates to mutations in the UBQLN2 gene that cause dominantly inherited chromosome X-linked ALS and ALS/dementia. | 03-17-2016 |
20160076105 | COMPOSITIONS AND METHODS FOR DIAGNOSIS AND TREATMENT OF EPILEPSY - Compositions and methods for diagnosis or treatment of epilepsy disease with EFHC1, EFHC1 agonists, or EFHC1 analogs are provided. Compositions and methods for diagnosis or treatment of epilepsy disease with EFHC1a, EFHC1a agonists, or EFHC1a analogs are provided. | 03-17-2016 |
20160083780 | Recombinase Polymerase Amplification - This disclosure describes related novel methods for Recombinase-Polymerase Amplification (RPA) of a target DNA that exploit the properties of recombinase and related proteins, to invade double-stranded DNA with single stranded homologous DNA permitting sequence specific priming of DNA polymerase reactions. The disclosed methods have the advantage of not requiring thermocycling or thermophilic enzymes, thus offering easy and affordable implementation and portability relative to other amplification methods. Further disclosed are conditions to enable real-time monitoring of RPA reactions, methods to regulate RPA reactions using light and otherwise, methods to determine the nature of amplified species without a need for gel electrophoresis, methods to improve and optimize signal to noise ratios in RPA reactions, methods to optimize oligonucleotide primer function, methods to control carry-over contamination, and methods to employ sequence-specific third ‘specificity’ probes. Further described are novel properties and approaches for use of probes monitored by light in dynamic recombination environments. | 03-24-2016 |
20160083784 | COINCIDENCE DETECTION - The invention relates to a method of detecting the coincidence of two biomolecular structures in a solid phase sample, said method comprising
| 03-24-2016 |
20160083785 | TARGET DETECTION AND SIGNAL AMPLIFICATION - The present invention relates to compositions and methods for the detection of target molecules, and the amplification of detectable signals generated by detection assays. More specifically, the present invention relates to methods utilizing catalytic nucleic acid enzymes to generate and/or amplify a signal indicative of the presence of target molecules (e.g. nucleic acids and proteins), and compositions for use in the methods. | 03-24-2016 |
20160083792 | AN ASSAY FOR QUANTITATING THE EXTENT OF METHYLATION OF A TARGET SITE - An assay quantifies the extent of methylation in a DNA sample. Kits and clinical diagnostic assays include assays to determine clinical phenotypes based on extent of methylation of a DNA target site. | 03-24-2016 |
20160083796 | Diagnostic test for skeletal atavism in horses - The present invention relates to methods for detecting a genetic deletion at the SHOX locus of a horse, where the presence of such a genetic deletion indicates that the horse is a carrier of disease-causing mutation that can lead to skeletal atavism. The invention further provides nucleic acid primers and probes for use in methods for detecting the presence or absence of disease-causing genetic deletion at the SHOX locus of a horse. | 03-24-2016 |
20160083803 | METHODS AND MATERIALS FOR DETECTING COLORECTAL NEOPLASM - The present invention provides methods and materials related to the detection of colorectal neoplasm-specific markers in or associated with a subject's stool sample. In particular, the present invention provides methods and materials for identifying mammals having a colorectal neoplasm by detecting the presence of exfoliated epithelial markers (e.g., human DNA, tumor assoicated gene alterations, tumor associated proteins) and blood markers (e.g., homoglobin, serum proteins) in a stool sample obtained from the mammal. | 03-24-2016 |
20160083804 | HIGH RESOLUTION MELTING ANALYSIS AS A PRESCREENING TOOL - Compositions and methods for determining an increased likelihood of a response to a targeted treatment of a cancer disease including isolating genomic DNA from a patient sample, amplifying a fragment of DNA by means of PCR with a specific pair of amplification primers, determining if the amplified fragment comprises a wildtype sequence or a mutation by means of a High Resolution Melting Analysis (HRM), and correlating the presence or absence of a mutation with an increased likelihood of success of said targeted treatment. Respective primer pairs, compositions and kits are also claimed. | 03-24-2016 |
20160083805 | METHODS AND COMPOSITIONS FOR ASSESSMENT OF PULMONARY FUNCTION AND DISORDERS - The present invention provides methods for the assessment of risk of developing lung cancer in smokers and non-smokers using analysis of genetic polymorphisms. The present invention also relates to the use of genetic polymorphisms in assessing a subject's risk of developing lung cancer, and the suitability of a subject for an intervention in respect of lung cancer. Nucleotide probes and primers, kits, and microarrays suitable for such assessment are also provided. | 03-24-2016 |
20160090625 | METHOD AND SYSTEM TO PREDICT SSRI RESPONSE - The present inventions relates to methods and assays to predict the response of an individual to an SSRI treatment and to a method to improve medical treatment of a disorder, which is responsive to treatment with a selective serotonin reuptake inhibitor (SSRI). | 03-31-2016 |
20160090628 | DETECTION OF MINERALOCORTICOID RECEPTOR ACTIVATION AND PERSONALIZED ANTIHYPERTENSIVE THERAPY BASED THEREON - Provided herein are compositions and methods for the assessment of mineralocorticoid receptor activation or repression, and methods of customizing antihypertensive therapies based thereon. In particular, assays are provided for the detection of targets of mineralocorticoid receptor activation. | 03-31-2016 |
20160091501 | METHOD FOR DIAGNOSING AND TREATING CROHN'S DISEASE - The present invention relates to an in vitro method for diagnosing Crohn's disease or for determining predisposition in a person to develop Crohn's disease, by detecting an overexpression of the CD66c receptor in subjects suffering from said disease or at risk of developing the disease. The invention also relates to preventive or curative treatment for Crohn's disease. | 03-31-2016 |
20160097096 | Composition for Detecting Undifferentiated Human Pluripotent Stem Cell, Monoclonal Antibody 6-1 and Use Thereof - The present invention relates to a composition for detecting the undifferentiated human pluripotent stem cells comprising an agent useful for measuring the level of Desmoglein 2 (Dsg 2) mRNA or the protein thereof, a kit for detecting the undifferentiated human pluripotent stem cells comprising the said composition, a method for detecting the undifferentiated human pluripotent stem cells containing the step of measuring the level of Desmoglein 2 mRNA or the protein thereof, a method for evaluating the differentiation of human pluripotent stem cells and thereafter for separating the undifferentiated human pluripotent stem cells, a method for reducing the undifferentiated status of human pluripotent stem cells by inhibiting the expression or activation of Desmoglein 2, and a monoclonal antibody binding specifically to human Desmoglein 2. | 04-07-2016 |
20160097097 | METHOD FOR DETERMINING P1/P2 BLOOD TYPE AND DETECTION KIT THEREOF - The present invention provides a method for determining P | 04-07-2016 |
20160097103 | Primer reagent for amplifying ALK fusion gene, ALK fusion gene amplification reagent kit including the same, and ALK fusion gene amplification method and ALK fusion gene analysis method using the same - The present disclosure provides a novel primer reagent for detecting a plurality of variants of the ALK fusion gene. | 04-07-2016 |
20160102315 | Methods for producing polypeptides in enzyme-deficient mutants of fusarium venentatum - The present invention relates to methods of producing a polypeptide, comprising: (a) cultivating a mutant of a parent | 04-14-2016 |
20160102339 | Sequence Conversion and Signal Amplifier DNA Having Locked Nucleic Acids and Detection Methods Using Same - Disclosed are methods for detecting a target nucleic acid in a sample. The methods include contacting said sample, in the presence of a polymerase and an endonuclease, with a sequence conversion oligonucleotide having locked nucleic acids at select positions sufficient to decrease non-specific background signal amplification. Also disclosed are methods for detecting a target nucleic acid in a sample in which said sample is contacted, in the presence of a polymerase and an endonuclease, with a sequence conversion oligonucleotide and a signal amplifier oligonucleotide, both having locked nucleic acids at select positions sufficient to decrease non-specific background signal amplification. The disclosure also provides compositions and kits comprising such sequence conversion and signal amplifier oligonucleotides. | 04-14-2016 |
20160102356 | ALLELIC DISORDERS CAUSED BY MUTATIONS IN TRPV4 - The present invention provides methods, kits, and compositions for detecting mutations in transient receptor potential cation channel, subfamily V, member 4 (TRPV4). In particular, mutations are detected in TRPV4 to detect diseases such as scapuloperoneal spinal muscular atrophy (SPSMA) and hereditary motor and sensory neuropathy type IIC (HMSN IIC) or Charcot-Marie-Tooth disease type 2C (CMT2C). | 04-14-2016 |
20160102359 | GENETIC MARKER FOR EARLY BREAST CANCER PROGNOSIS PREDICTION AND DIAGNOSIS, AND USE THEREOF - A gene for predicting or diagnosing the prognosis of early-stage breast cancer and to a use thereof is disclosed, and more specifically a genetic marker for predicting or diagnosing the prognosis of breast cancer, including TRBC1 (T cell receptor beta constant 1), BTN3A2 (butyrophilin, subfamily 3 member A2) or HLA-DPA1 (major histocompatibility complex, class II, DP alpha 1) for providing information necessary for predicting or diagnosing the prognosis of a breast cancer patient. The genetic marker allows the prediction or diagnosis of the prognosis of a breast cancer patient, and can therefore advantageously be used for the purpose of providing a direction as to the future course of breast cancer treatment, including a decision on whether anticancer therapy is necessary. | 04-14-2016 |
20160102371 | EVENT-SPECIFIC DETECTION METHODS - The present disclosure concerns methods for identifying genetic material in recombinant potato plants, including in food products made from such plants. The disclosure relates to the materials, including nucleotide primers and probes, utilized in the methods set forth herein. Furthermore, the disclosure provides for non-naturally occurring nucleotide junction sequences per se that result from genetic recombination events and methods of detecting said junction sequences. | 04-14-2016 |
20160103123 | SYSTEMS AND METHODS FOR MULTI-ANALYSIS - Systems and methods are provided for sample processing. A device may be provided, capable of receiving the sample, and performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing multiple assays. The device may comprise one or more modules that may be capable of performing one or more of a sample preparation, sample assay, and detection step. The device may be capable of performing the steps using a small volume of sample. | 04-14-2016 |
20160103136 | METHODS AND SYSTEMS FOR DISTINGUISHING IRRITABLE BOWEL SYNDROME FROM INFLAMMATORY BOWEL DISEASE AND CELIAC DISEASE - Described herein are methods and systems for distinguishing irritable bowel syndrome (IBS) from inflammatory bowel disease (IBD) and celiac disease. The methods and systems can utilize the detection of anti-vinculin antibodies and anti-CdtB antibodies to distinguish IBS from IBD and celiac disease. Further described are methods for selecting a therapy to treat IBS, IBD or celiac disease. | 04-14-2016 |
20160103950 | Method and System for Displaying Genetic and Genealogical Data - A method and system for displaying genetic and genealogical data includes displaying indicators of related individuals. At least one genetically related individual is identified from a database in response to a genetic input of an inquiring individual. Indicators of the inquiring individual and each of the at least one genetically related individual are displayed. The system includes a computer system having a display device, a processor device, a database and media having computer-executable instructions configured to display indicators of related individuals according to a method. The method includes identifying at least one genetically related individual from a database in response to a genetic input of an inquiring individual and geographically displaying indicators of the inquiring individual and each of the at least one genetically related individual. | 04-14-2016 |
20160108369 | METHODS AND COMPOSITIONS FOR GENERATING OR MAINTAINING PLURIPOTENT CELLS - Methods and compositions are provided for generating or maintaining human iPS cells in culture. Methods include the use of a low osmolality medium to make human iPS cells, or use of a low osmolality medium to maintain human iPS cells. Methods for making targeted genetic modification to human iPS cells cultured in low osmolality medium are also included. Compositions include human iPS cells cultured and maintained using the low osmolality medium defined herein. | 04-21-2016 |
20160108459 | AUTOMATED ISOLATION AND CHEMICAL REACTION(S) OF NUCLEIC ACIDS - The present teachings relate to methods, kits and devices for performing automated sequential nucleic acid isolation and conversion/purification in a single closed system. In various embodiments, the present teaching enable a user to (i) load a device with test samples, reagents and consumables; (ii) select or program the device for the desired nucleic acid isolation and subsequent chemical treatment and/or conversion reaction(s) without further user intervention; and recovering the isolated and treated and/or converted nucleic acid at the conclusion of the program once the device is activated. | 04-21-2016 |
20160115461 | Polymerases - Modified DNA polymerases have an affinity for DNA such that the polymerase has an ability to incorporate one or more nucleotides into a plurality of separate DNA templates in each reaction cycle. The polymerases are capable of forming an increased number of productive polymerase-DNA complexes in each reaction cycle. The modified polymerases may be used in a number of DNA sequencing applications, especially in the context of clustered arrays. | 04-28-2016 |
20160115536 | METHODS FOR ESTIMATING THE SIZE OF DISEASE-ASSOCIATED POLYNUCLEOTIDE REPEAT EXPANSIONS IN GENES - Methods for estimating the size of disease-associated polynucleotide repeat expansions in genes are disclosed which use restriction enzymes that do not cut within a repeat expansion and which are frequent cutting restriction enzymes that cut genomic DNA outside of the expansion into fragments of a size below the threshold capable of detection. A hybridisation probe that can bind to multiple sites within the expansion is then used to estimate its length and to correlate that to the diagnosis or prognosis of disease. | 04-28-2016 |
20160115542 | BIOMARKER OF Nrf2 ACTIVATION - Provided is FGF21 that is a metabolism-related biomarker reflecting the activation of Nrf2 in vivo. Also provided are a method for monitoring a response of a subject to which an Nrf2 activator is administered, said method comprising a step for measuring the FGF21 level, at a point during or after the administration of the Nrf2 activator, in a biosample that is derived from the subject, wherein an increase in the FGF21 level indicates a positive response to the administration of the Nrf2 activator, etc. According to the present invention, a metabolism-related biomarker that reflects the activation of Nrf2 in vivo is provided. | 04-28-2016 |
20160115556 | DETECTING MUTATIONS IN DISEASE OVER TIME - Provided is a method determining responsiveness to a treatment in a patient with a cancer. | 04-28-2016 |
20160116476 | METHOD FOR SELECTING DUODENAL FLUID SAMPLE FOR DETECTING PANCREATIC DISEASE MARKER AND METHOD FOR DETECTING PANCREATIC DISEASE MARKER - Provided are a method for exclusively selecting a duodenal fluid sample having a high possibility of containing pancreatic fluid and favorable sample suitability for subjecting to detection of a pancreatic disease marker by evaluating the quality of the sample prior to detecting the pancreatic disease marker, and a method for detecting a pancreatic disease marker using a duodenal fluid sample selected according to that method. Namely, a method is provided for selecting a duodenal fluid sample for detecting a pancreatic disease marker, comprising: (a1) a step of comparing the color depth of a duodenal fluid sample with a prescribed standard color, and (b1) a step of determining that a duodenal fluid sample is subjected to a test for a pancreatic disease marker if the color depth thereof is equal to or higher than the standard color, but that the duodenal fluid sample is not subjected to a test for a pancreatic disease marker if the color depth thereof is lower than the standard color. | 04-28-2016 |
20160122800 | SIGNAL AMPLIFICATION OF FLUORESCENCE IN SITU HYBRIDIZATION - Among other things, this disclosure provides a method of detecting a target nucleic acid. Aspects of the method include: (a) obtaining a labeled nucleic acid probe that is complementary to a target nucleic acid, wherein the probe comprises a capture tag; (b) hybridizing the probe with the target nucleic in a fixed cell, in situ, to produce a duplex; (c) linking the probe in the duplex to a peroxidase conjugate via the capture tag to produce a peroxidase-labeled duplex; and (d) incubating the peroxidase-labeled duplex with a peroxidase substrate, wherein the peroxidase activity of the peroxidase conjugate catalyzes deposition of the substrate in the vicinity of the duplex, thereby producing a detectable signal. | 05-05-2016 |
20160122807 | METHOD FOR DISCRIMINATING PRESENCE OR ABSENCE OF MUTATION IN DNA - A method for discriminating the presence or absence of a mutation in a DNA having a plurality of mutated forms includes performing a thermal cycle for amplifying the DNA in the presence of a pair of primers which can bind to the DNA, a first probe which does not bind to the DNA having a mutation, can bind to the DNA having no mutation, and is labeled with a first fluorescent substance, and a second probe which can bind to both of the DNA having a mutation and the DNA having no mutation and is labeled with a second fluorescent substance which emits a light having a fluorescence wavelength different from that of a light emitted from the first fluorescent substance. | 05-05-2016 |
20160122808 | METHOD FOR DETECTING THE PRESENCE OF A NUCLEIC ACID IN A SAMPLE - An automated method for detecting the presence of a nucleic acid in a sample, where the method is performed within a housing of a self-contained, stand-alone analyzer. The method includes purifying the nucleic acid after it has been immobilized on a magnetically-responsive solid support. A pipette of the analyzer is used to form a reaction mixture comprising the purified nucleic acid and all reagents required to perform a nucleic acid amplification. Amplification products are synthesized that include a nucleotide sequence contained in the nucleic acid or the complement of the nucleic acid. The amplification products are exposed to a probe in a mixture, where the probe forms a hybrid with one of the amplification products. The formation of the hybrid in the mixture provides an indication of the presence of the nucleic acid in the sample. | 05-05-2016 |
20160122828 | METHOD FOR PREDICTING THE RESPONSE TO TREATMENT WITH RADIOTHERAPY COMBINED WITH CHEMOTHERAPY BASED ON CISPLATIN - The invention relates to a method to predict the response to treatment with radiotherapy combined with cisplatin-based chemotherapy in patients with cancer, preferably non-microcytic lung cancer, wherein said method is based on the detection of the presence of methylation in the IGFBP-3 gene. The present invention also relates to an in vitro method to design a customised treatment for an individual with said disease. The method of the invention may be quantitative or semi-quantitative. The present invention also relates to a probe designed for the quantitative detection of the methylation of the IGFBP-3 gene, to a kit that comprises it and to the use of the kit to predict the response of a subject to the aforementioned treatment. | 05-05-2016 |
20160123959 | METHODS AND MATERIALS USING SIGNALING PROBES - The present invention relates to methods of isolating cells, generating cell lines, and detecting RNAs in cells using signaling probes that produce a signal upon hybridization to a target sequence. Other methods that utilize the signaling probe include methods of detecting or quantifying the effect of an agent on RNAs in a cell, methods of quantifying the level of RNA expression, methods for identifying genetic recombinational events in living cells and methods of generating a transgenic animal using the isolated cells. The invention also provides protease probes. Signaling probes and protease probes that form stem-loop structures, three-arm junction structures, and dumbbell structures are provided. | 05-05-2016 |
20160123960 | METHOD FOR PREPARING THREE-DIMENSIONAL, ORGANOTYPIC CELL CULTURES AND USES THEREOF - The present invention is directed to methods for generating isolated, unencapsulated, three-dimensional, cell culture products comprising a naturally-derived cell matrix distributed throughout the product and having dimensions suitable for use in in vitro applications including histological applications and imaging. | 05-05-2016 |
20160130574 | METHODS OF MEASURING GENE EXPRESSION IN FACS-SORTED CELLS - Improved methods of measuring gene expression in intracellularly immunostained FACS-sorted cell populations are provided. Exemplary methods involve fixing cells with formalin and permeabilizing with mild detergent in the presence of ribonucleoside vanadyl complex prior to FACS sorting, followed by RNA extraction in the presence of de-crosslinking agents. The resulting RNA is suitable for gene expression analysis. The method allows for analysis of the gene expression pattern specifically associated with any sortable cell population or subpopulation. | 05-12-2016 |
20160130635 | ISOLATION OF NUCLEIC ACIDS - Provided herein is technology relating to isolating nucleic acids. In particular, the technology relates to methods and kits for extracting nucleic acids from problematic samples such as stool. | 05-12-2016 |
20160130641 | HIGHLY SENSITIVE METHOD FOR DETECTING LOW FREQUENCY MUTATIONS - The disclosed edge-blocker oligonucleotide based AS-NEPB-PCR method amplifies allele specific DNA (or RNA) while dramatically blocking amplification of wild type (WT) DNA (or RNA). The AS-NEPB-PCR design allows ready modification of an existing PCR reaction setup with an edge-blocker oligonucleotide together with an allele specific primer complementary to the mutant sequence to achieve allele specific amplification. The method simplifies assay optimization procedures and achieved sensitivity sufficient to detect a signal present at 0.1% level with close to 100% specificity, which is useful in detecting SNP or genetic mutations. The method was used to detect three different genetic mutations in cancer, in KRAS, BRAF, and EGFR, with three different types of modified edge-blocker oligonucleotides (phosphate, inverted dT and amino-C7). It was possible to detect one copy of mutant DNA in 1000-copy of normal DNA background of a heterogeneous sample, and was far more sensitive than the other blocking method. | 05-12-2016 |
20160130662 | NOVEL GENOMIC MARKER OF METASTATIC PROSTATE CANCER - The present invention relates to the field of cancer. More specifically, the present invention provides methods and compositions useful for assessing prostate cancer in a patient. In a specific embodiment, a method for predicting metastasis in a prostate cancer patient comprises the steps of (a) genotyping the ASPN D repeat domain length in both alleles of the patient using a polymerase chain reaction; (b) predicting metastasis in the patient if the ASPND repeat domain length is 13 in one allele and 14 in the other allele or have at least one allele with 14 D repeats as compared to other common allelic genotypes; and (c) predicting no metastasis in the patient if the ASPN D repeat domain length is 13 in both alleles as compared to other allelic genotypes. | 05-12-2016 |
20160130667 | Method For The Selection Of A Long-Term Producing Cell - Herein is reported a method for determining methylation of a promoter nucleic acid operably linked to a nucleic acid encoding a polypeptide and thereby determining the long-term productivity of a cell. Also an aspect is a method for selecting a cell for producing a polypeptide by determining the methylation of the promoter nucleic acid operably linked to the structural gene encoding the polypeptide. | 05-12-2016 |
20160130671 | GENETIC LOCI ASSOCIATED WITH SOYBEAN CYST NEMATODE RESISTANCE AND METHODS OF USE - Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with resistance or improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resistance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with resistance or improved resistance to soybean cyst nematode. | 05-12-2016 |
20160131604 | Thermally Resolved Molecule Assays - Provided herein are compositions and methods including the step of thermally scanning a sample that can be used and implemented to detect the presence of and/or concentration of a molecule in a sample. | 05-12-2016 |
20160131656 | TUMOR MARKER, MONOCLONAL ANTIBODIES AND METHODS OF USE THEREOF - Newly identified proteins as markers for the detection of colon, ovary, kidney, esophagus and prostate tumors, or as therapeutic targets for their treatment; affinity ligands and particularly antibodies capable of selectively interacting with the tumor markers and methods for tumor diagnosis and thereapy using such antibodies. | 05-12-2016 |
20160137693 | PEPTIDE NUCLEIC ACID PROBE (PNA), KIT AND METHOD FOR DETECTION OF ASPERGILLUS FUMIGATUS AND APPLICATIONS THEREOF - The present invention refers to the development of a Peptide Nucleic Acid (PNA) probe for the detection and discrimination of | 05-19-2016 |
20160138080 | METHYLCYTOSINE DETECTION METHOD - To provide a method for selectively detecting the methylation of particular cytosines in genomic DNA using a methylcytosine detection method using an anti-methylcytosine antibody to improve quantitativity and reliability. A method for detecting the methylated state of cytosine at a specific position contained in a nucleic acid, includes fragmenting the nucleic acid using a restriction enzyme; forming a double-stranded nucleic acid between the fragmented nucleic acid and a single-stranded nucleic acid having a base sequence capable of hybridizing with the fragmented nucleic acid but incapable of resulting in the formation of a base pair with cytosine at a specific position in the fragmented nucleic acid and a solid phase-binding site; binding the double-stranded nucleic acid on a solid phase using the solid phase-binding site; and measuring the amount of an antibody binding to the double-stranded nucleic acid on the solid phase. | 05-19-2016 |
20160138090 | DETERMINATION OF INTRACELLULAR BACTERIA - This application pertains to methods for the whole-cell analysis of intracellular bacteria. The methods are capable of making a determination of whether or not a sample (e.g. a clinical sample) comprises one or more select bacteria within host cells, for example, predatory host cells such as phagocytic cells. The method is performed on substantial intact bacteria and may be performed without the use of permeabilising or lysis reagents and using PNA probes. Furthermore, the application pertains to in situ hybridization methods for Gram-positive bacteria performed using buffered saline for hybridization. | 05-19-2016 |
20160138092 | PHOTOBLOCKED PROBES AND METHODS FOR SEQUENTIAL DETECTION OF NUCLEIC ACIDS - Photoblocked probes are disclosed including a specific hydrolysis probe having a first nucleic acid sequence complementary to a target having a second nucleic acid sequence, a first and a second interactive labels, a 5′ end and a 3′ end, and one or more photocleavable moieties coupled to one or more nucleotides of the specific hydrolysis probe, wherein the photocleaveable moiety interferes with the hybridization of the specific hydrolysis probe with the region of the amplification product. Also disclosed are PCR methods for the detection of the presence or absence of a target nucleic acid in a sample utilizing the photoblocked probes, as well as kits. | 05-19-2016 |
20160138097 | METHOD FOR DETECTING METHYLATED DNA - Provided is a rapid and simple method of detecting methylated DNA. The method of detecting methylated DNA includes the following steps of: (1) treating sample DNA with a hydrogen sulfite; (2) amplifying the sample DNA treated with the hydrogen sulfite by PCR; and (3) subjecting the resultant PCR amplification product to ion-exchange chromatography. | 05-19-2016 |
20160138102 | STANDARD PLASMID FOR ASSAYING GENETICALLY MODIFIED ORGANISM, AND ANALYSIS METHOD AND ASSAY KIT USING SAME - Provided is a standard plasmid for assaying a genetically modified plant, a method for quantitatively analyzing a target transgene within the genetically modified plant using the standard plasmid, and a kit for quantitatively analyzing the genetically modified plant including the standard plasmid, wherein the standard plasmid of the present invention is possible to be utilized for assaying a genome containing a 5-enoyl-4-pyruvylshikimate-3-phosphate synthase (EPSPS) gene or a cry1Ab gene, and in particular, significantly useful as a standard material capable of analyzing whether the genetically modified plant such as soybean RRS or GM maize MON810 is incorporated or an incorporation ratio thereof. | 05-19-2016 |
20160138118 | METHOD FOR ANALYZING PSA, AND A METHOD FOR DISTINGUISHING PROSTATE CANCER FROM PROSTATIC HYPERTROPHY USING THAT METHOD FOR ANALYZING PSA - A method for distinguishing prostate cancer from prostatic hypertrophy using the method for analyzing PSA and an analysis kit of PSA are provided. | 05-19-2016 |
20160138119 | SEX-DETERMINATION METHOD FOR DATE PALM - A sex-determination method for a date palm plant includes obtaining a sample of a date palm plant and determining a presence or absence of the date palm SRY gene (SEQ ID NO: 1) in the sample. The presence of the date palm SRY gene (SEQ ID NO: 1) in the sample is indicative that the sample is from a male date palm plant. Using the sex determination method for a date palm plant, the sex of date palm plants may even be determined when the date palm plants are still young, i.e., prior to flowering of the plants. | 05-19-2016 |
20160139150 | METHODS FOR DIAGNOSING AND ASSESSING NEUROLOGICAL DISEASES - The present invention provides methods for diagnosing a neurological disease in a subject, screening for or assessing the risk of developing a neurological disease in a subject, monitoring progression of a neurological disease in a subject, assessing efficacy of a therapy for a neurological disease in a subject, and identifying a subject suffering from a neurological disease that may be successfully treated by an agent that affects levels of a biomarker such as a tau protein or an amyloid beta. The methods generally feature (a) obtaining a cerebrospinal fluid (CSF) sample from a subject; (b) providing a cerebrospinal fluid (CSF) correction factor for CSF obtained from a subject for at least one biomarker; and (c) determining whether the biomarker is present in elevated amounts or concentrations in the cerebrospinal fluid (CSF) sample. The neurological disease may be, for instance, impaired cognition or dementia such as Alzheimer's Disease (AD) or Mild Cognitive Impairment (MCI). The biomarker may be a tau protein such as P-tau | 05-19-2016 |
20160139161 | SEROTONIN TRANSPORTER GENE AND TREATMENT OF ALCOHOLISM - The gene responsible for encoding SERT has a functional polymorphism at the 5′-regulatory promoter region, which results in two forms, long (L) and short (S). The LL-genotype is hypothesized to play a key role in the early onset of alcohol use. The present invention discloses the differences in treatment and diagnosis based on the L or short genotypes as well as on a single nucleotide polymorphism of the SERT gene, the 3′ UTR SNP rs1042173. The present invention demonstrates the efficacy of using the drug ondansetron and similar drugs for treatment based on variations in the polymorphisms of the SERT gene as well as methods for diagnosing susceptibility to abuse of alcohol and other addiction-related diseases and disorders. | 05-19-2016 |
20160145281 | NEW IRIDIUM-BASED COMPLEXES FOR ECL - Novel iridium-based Ir(III) luminescent complexes, conjugates comprising these complexes as a label and their application, for example in the electrochemiluminescence based detection of an analyte. | 05-26-2016 |
20160145646 | METHODS AND COMPOSITIONS FOR TARGETED GENETIC MODIFICATION USING PAIRED GUIDE RNAS - Compositions and methods are provided for creating and promoting biallelic targeted modifications to genomes within cells and for producing non-human animals comprising the modified genomes. Also provided are compositions and methods for modifying a genome within a cell that is heterozygous for an allele to become homozygous for that allele. The methods make use of Cas proteins and two or more guide RNAs that target different locations within the same genomic target locus. Also provided are methods of identifying cells with modified genomes. | 05-26-2016 |
20160145672 | PARAOXONASE 1 ENZYMATIC ACTIVITY, A RISK PREDICTOR FOR MAJOR ADVERSE CARDIOVASCULAR EVENTS - Provided herein are methods for assessing the risk a subject or patient without significant evidence of cardiovascular disease has of experiencing a major adverse cardiac event or requiring revascularization near term. Also provided are methods of determining whether a subject who has experienced a major adverse cardiac event is at risk of experiencing a recurrent major adverse cardiac event near term. The present methods comprise determining the levels of paraoxonase 1 enzymatic activity in the blood, serum, plasma, or any combination of said bodily fluids in the subject. | 05-26-2016 |
20160145673 | DETECTING SINGLE NUCLEOTIDE POLYMORPHISM USING OVERLAPPING HYDROLYSIS PROBES - Methods for the rapid detection of the presence or absence of a SNP in a target nucleic acid in a sample are described. The methods can include performing an amplifying step, a hybridizing step utilizing a double stranded probe with two overlapping SNP specific hydrolysis probe sequences where one of the probe sequences can include a hairpin structure toward the 3′ end, and a detecting step. Furthermore, the double stranded SNP specific hydrolysis probes along with kits are provided that are designed for the detection of a SNP in a target nucleic acid. | 05-26-2016 |
20160145674 | NUCLEIC ACID AMPLIFICATION METHOD - A nucleic acid amplification method includes: heating a first region of a nucleic acid amplification reaction vessel filled with a nucleic acid amplification reaction mixture and a liquid which has a specific gravity different from that of the nucleic acid amplification reaction mixture and is immiscible with the nucleic acid amplification reaction mixture to a first temperature; heating a second region of the nucleic acid amplification reaction vessel to a second temperature; switching over from a first arrangement in which the first region is located lower than the second region in the direction of the gravitational force to a second arrangement in which the second region is located lower than the first region in the direction of the gravitational force; and switching over from the second arrangement to the first arrangement, wherein the nucleic acid amplification reaction mixture contains a probe, and the probe contains an artificial nucleic acid. | 05-26-2016 |
20160145680 | METHOD AND APPARATUS FOR DETECTING TRANSLOCATION - Disclosed are a method and an apparatus for detecting a translocation. The apparatus acquires BAM for a first pair of chromosomes and a second pair of chromosomes. Also, the apparatus detects a translocation generated in at least one chromosome by selecting at least one translocation case corresponding to the translocation information produced on the basis of BAM from among multiple translocation cases in which a translocation may be generated in at least one of the first and the second chromosomes. | 05-26-2016 |
20160153028 | COMPOSITIONS AND METHODS FOR DETECTING MECC-CONTAINING METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS | 06-02-2016 |
20160153038 | CLASSIFICATION OF NUCLEIC ACID TEMPLATES | 06-02-2016 |
20160153874 | APPARATUS AND METHOD FOR PROCESSING A SAMPLE | 06-02-2016 |
20160160198 | MUTANT ENDONUCLEASE V ENZYMES AND APPLICATIONS THEREOF - Provided herein are mutant endonuclease V enzymes that are capable of nicking an inosine-containing DNA sequence. Nucleic acid assays and agents that employ such mutant endonuclease V enzymes to introduce a nick into a target DNA including one or more inosine, and uses a DNA polymerase to generate amplicons of a target DNA are also described. | 06-09-2016 |
20160160278 | In Situ Hybridization Method And Buffer - An improved method of in situ hybridization which relies on an improved formulation of the in situ hybridization buffer is described. In at least some formulations the buffer are non-toxic. The combination of Locked Nucleic Acid (LNA) comprising ISH probes and the improved ISH buffer are useful for detection of small non-coding RNA as well as in the manufacturing of ISH kits directed to the detection of such small non-coding RNA. Further disclosed is a method of semi-quantitative ISH and demonstration of the semi-quantitative ISHs diagnostic potential. | 06-09-2016 |
20160160279 | PROGNOSIS OF RESPONSE TO TREATMENT WITH ANTI-TNF-ALPHA IN PATIENTS WITH RHEUMATOID ARTHRITIS - The invention relates to the use of SNP rs3794271, and/or an SNP that is in total linkage disequilibrium with same, as a marker in predicting the response to treatment with anti-TNF in a patient with RA. The invention also relates to methods for predicting the response to treatment with anti-TNF, as well as for deciding on or recommending a treatment for a patient with RA, based on determining the genotype for rs3794271 and/or an SNP that is in total linkage disequilibrium with same. | 06-09-2016 |
20160160289 | EML4-ALK TRANSLOCATIONS IN LUNG CANCER - The present disclosure relates to methods for the diagnosis and evaluation of neoplastic disorders, particularly non-small cell lung cancer. Assays are described in which patient test samples are analyzed for the presence of one or more specific EML4-ALK fusion genes associated with neoplastic disorders. | 06-09-2016 |
20160160291 | COMPOSITIONS AND METHODS FOR CHARACTERIZING A DNA REPAIR VARIANT POLYPEPTIDE - As described below, the present invention provides quantitative homologous recombination assays developed to characterize the pathogenicity DNA repair polypeptides (e.g., BRCA1, BRCA2, Rad51) and provide urgently needed functional information on the significance of DNA repair variants of uncertain significance (VUS) alleles. The invention also provides a method of generating site-specific recombination at a genomic locus or site-specific genome editing by inhibiting replication at the genomic locus, e.g., involving contacting the genomic locus with polypeptides that specifically bind target sequences at the genomic locus. | 06-09-2016 |
20160161480 | METHOD FOR THE DETECTION OF THE PROZONE EFFECT OF PHOTOMETRIC ASSAYS - A method for determination of the amount of a specific analyte in a sample which may show a prozone effect by photometric assays, wherein the specific analyte is quantified from the change in the optical signal of the reaction mixture after the interaction of the analyte with analyte specific assay reagents. The optical signal is measured simultaneously for the specific analyte in the sample to be determined at the wavelength used for the determination of the analyte and at least at an additional specific wavelength used for the detection of the prozone effect over the complete reaction time. The reaction rate ratio R is calculated by using the signals obtained at the wavelength used for the detection of the prozone effect. By comparison of the calculated ratio value R with predetermined limit values it is judged if a prozone effect is present in the sample. | 06-09-2016 |
20160168628 | METHODS AND COMPOSITIONS FOR DETECTING ANTIBIOTIC RESISTANT BACTERIA | 06-16-2016 |
20160168643 | COMPOSITIONS AND METHODS FOR PERFORMING METHYLATION DETECTION ASSAYS | 06-16-2016 |
20160168648 | COMPOSITIONS AND METHODS FOR DETECTING METASTASIS | 06-16-2016 |
20160171154 | ENHANCED DETECTION OF NON-SOMATIC CIRCULATING NUCLEIC ACIDS | 06-16-2016 |
20160177271 | COMBINATIONAL USE OF MECHANICAL MANIPULATION AND PROGRAMIN TO GENERATE PLURIPOTENT STEM CELLS FROM SOMATIC CELLS | 06-23-2016 |
20160177379 | DETECTION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS | 06-23-2016 |
20160177391 | ANALYSIS FOR TAKOTSUBO CARDIOMYOPATHY BY MEANS OF DIFFERENTIALLY REGULATED MICRORNA MOLECULES | 06-23-2016 |
20160177406 | PREVENTIVE AND THERAPEUTIC DRUG FOR CARTILAGINOUS HYPERPLASIA AND METHOD OF SCREENING FOR THE SAME | 06-23-2016 |
20160186244 | Real Time Cleavage Assay - A cleavage-based real-time PCR assay method is provided. In general terms, the assay method includes subjecting a reaction mixture comprising a) PCR reagents for amplifying a nucleic acid target, and b) flap cleavage reagents for performing a flap cleavage assay on the amplified nucleic acid target to two sets of thermocycling conditions. No additional reagents are added to the reaction between said first and second sets of cycles and, in each cycle of the second set of cycles, cleavage of a flap probe is measured. | 06-30-2016 |
20160186249 | TAGGED OLIGONUCLEOTIDES AND THEIR USE IN NUCLEIC ACID AMPLIFICATION METHODS - The present invention provides nucleic acid amplification systems and methods that desirably reduce or eliminate false positive amplification signals resulting from contaminating biological material, e.g., nucleic acid, that may be present in one or more reagents used in an amplification reaction and/or that may be present in the environment in which an amplification reaction is performed. The invention offers the further advantage of requiring less stringent purification and/or sterility efforts than conventionally needed in order to ensure that enzymes and other reagents used in amplification reactions, and the environment in which an amplification reaction is performed, are free of bacterial or other nucleic acid contamination that may yield false positive results. | 06-30-2016 |
20160186268 | GENE DEFECTS AND MUTANT ALK KINASE IN HUMAN SOLID TUMORS - Novel gene deletions and translocations involving chromosome 2 resulting in fusion proteins combining part of Anaplastic Lymphoma Kinase (ALK) kinase with part of a secondary protein have been identified herein in human solid tumors, e.g. non-small cell lung carcinoma (NSCLC). Secondary proteins include Echinoderm Microtubule-Associated Protein-Like 4 (EML-4) and TRK-Fusion Gene (TFG). The EML4-ALK fusion protein, which retains ALK tyrosine kinase activity, was confirmed to drive the proliferation and survival of NSCLC characterized by this mutation. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ALK kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of this new fusion protein enables methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides. | 06-30-2016 |
20160187318 | SCREENING ASSAYS BASED ON MAG AND/OR ABHD6 FOR SELECTING INSULIN SECRETION PROMOTING AGENT - The present application relates to a method of characterizing an agent's ability to increase insulin secretion in a subject. The method comprises determining whether the agent is able to modulate MAG level at the inner surface of the cytoplasmic membrane of a cell and/or ABHD6 activity. The agent is characterized as having the ability to increase insulin secretion in the subject when it is capable of upregulating MAG level at the inner surface of the cytoplasmic membrane and/or downregulating ABHD6 activity. | 06-30-2016 |
20160188795 | Systems and Methods for Error Correction in DNA Sequencing - Disclosed are systems and methods for polynucleotide sequencing where detection and correction of base calling errors can be achieved without reliance on a reference sequence. In certain embodiments, redundant information can be introduced during measurement so as to allow such detection of errors. Such redundant information and measurements can be facilitated by encoding of nucleotide sequence being measured. Various examples of such encoding, redundancy introduction, and decoding are provided. | 06-30-2016 |
20160194689 | Pathogenicity Islands of Pseudomonas Aeruginosa | 07-07-2016 |
20160194705 | Methods of Predicting Mortality Risk By Determining Telomere Length | 07-07-2016 |
20160194706 | Restriction Endonucleases and Their Uses | 07-07-2016 |
20160194711 | PREDICTIVE METHOD FOR BONE FRACTURE RISK IN HORSES AND HUMANS | 07-07-2016 |
20160194721 | COMPOSITIONS AND METHODS FOR DETECTING EPITHELIAL CELL DNA | 07-07-2016 |
20160194723 | Systems, Kits, and Tests for Detecting Colorectal Cancer | 07-07-2016 |
20160195525 | DIAGNOSIS AND TREATMENT OF MYCOBACTERIA INFECTIONS | 07-07-2016 |
20160198752 | NUTRITIONAL AND EXERCISE PLAN BASED ON A PERSON'S INDIVIDUAL GENETIC APO E GENOTYPE | 07-14-2016 |
20160201113 | KITS AND METHODS FOR DETECTING METHYLATED DNA | 07-14-2016 |
20160201122 | Rapid Assays for T-Cell Activation by RNA Measurements Using Flow Cytometry | 07-14-2016 |
20160201141 | WT1 MUTATIONS FOR PROGNOSIS OF MYELOPROLIFERATIVE DISORDERS | 07-14-2016 |
20160201144 | RED BLOOD CELL LYSIS SOLUTION | 07-14-2016 |
20160201148 | DIAGNOSTIC METHODS AND COMPOSITIONS | 07-14-2016 |
20160252523 | METHOD FOR REMOVING GENOMICALLY UNSTABLE IPS CELLS AND SYNTHETIC PEPTIDE USED THEREFOR | 09-01-2016 |
20160252538 | NON-MODAL INTERPLATE MICROWAVE HEATING SYSTEM AND METHOD OF HEATING | 09-01-2016 |
20160376642 | Localised RCA-based Amplification Method - The present invention provides a method for performing a localised RCA reaction comprising at least two rounds of RCA, wherein the product of a second RCA reaction is attached, and hence localised, to a product of a first RCA reaction, said method comprising: (a) providing a first RCA product; (b) directly or indirectly hybridising to said first RCA product a probe which comprises or provides a primer for a second RCA reaction; and (c) performing a second RCA reaction using said RCA primer of (b) to form a second RCA product, wherein in said reaction: (i) said probe and said primer are not able to prime extension using said first RCA product as template or any such extension is limited to avoid displacement of any probe hybridised to the first RCA product; (ii) the direct or indirect hybridisation of the RCA primer of (b) to the first RCA product is maintained and, by virtue of said hybridisation, the second RCA product is attached to the first RCA product; (iii) a RCA template for said second RCA reaction is comprised in or provided by the probe, or is separately provided. The method finds particular utility in the detection of analytes, wherein the analyte is a nucleic acid or wherein a nucleic acid is used or generated as a marker for the analyte. | 12-29-2016 |
20160376645 | Methods for Beaming - Improvements on the basic method used for BEAMing increase sensitivity and increase the signal-to-noise ratio. The improvements have permitted the determination of intrinsic error rates of various DNA polymerases and have permitted the detection of rare and subtle mutations in DNA isolated from plasma of cancer patients. | 12-29-2016 |
20160376646 | NUCLEIC ACID SEQUENCING IN FREE SOLUTION USING PROTEIN POLYMER DRAG-TAGS - The present invention relates to systems, compositions, and methods for nucleic acid sequencing and analysis in free-solution using protein polymer drag-tags. As such, the present invention provides protein-based molecular compositions that find use as drag-tags for use in sequencing and nucleic acid analysis methods and provides systems and methods for automated sequencing and analysis of nucleic acids in free solution. | 12-29-2016 |
20160376655 | TRPC6 INVOLVED IN GLOMERULONEPHRITIS - Focal and segmental glomerulosclerosis (FSGS) is a kidney disorder of unknown etiology and up to 20% of patients on dialysis have this diagnosis. A large family with hereditary FSGS carries a missense mutation in the TRPC6 gene on chromosome 11q, encoding the ion channel protein Transient Receptor Potential Cation Channel 6. The missense mutation is a P112Q substitution, which occurs in a highly conserved region of the protein, enhances TRPC6-mediated calcium signals in response to agonists such as angiotensin II, and alters the intracellular distribution of TRPC6 protein. Previous work has emphasized the importance of cytoskeletal and structural proteins in proteinuric kidney diseases. Our findings suggest a novel mechanism for glomerular disease pathogenesis. | 12-29-2016 |
20160376658 | SEROTONIN TRANSPORTER GENE AND TREATMENT OF ALCOHOLISM - The gene responsible for encoding SERT has a functional polymorphism at the 5′-regulatory promoter region, which results in two forms, long (L) and short (S). The LL-genotype is hypothesized to play a key role in the early onset of alcohol use. The present invention discloses the differences in treatment and diagnosis based on the L or short genotypes as well as on a single nucleotide polymorphism of the SERT gene, the 3′ UTR SNP rs1042173. The present invention demonstrates the efficacy of using the drug ondansetron and similar drugs for treatment based on variations in the polymorphisms of the SERT gene as well as methods for diagnosing susceptibility to abuse of alcohol and other addiction-related diseases and disorders. | 12-29-2016 |
20170233792 | Fixation Method for Single Cell Analysis | 08-17-2017 |
20170233795 | NUCLEIC ACID AMPLIFICATION REAGENT, NUCLEIC ACID AMPLIFICATION CARTRIDGE, AND NUCLEIC ACID AMPLIFICATION METHOD | 08-17-2017 |
20170233796 | Polyphenolic Additives in Sequencing by Synthesis | 08-17-2017 |
20170233800 | Thermolabile Exonucleases | 08-17-2017 |
20170233801 | Methods and Compositions for Nucleic Acid Detection | 08-17-2017 |
20170233806 | METHODS AND SYSTEMS FOR DETECTION OF ABNORMAL KARYOTYPES | 08-17-2017 |
20170233807 | Epigenetic Markers for the Identification of Blood Sub-cells of Type 1 | 08-17-2017 |
20170233816 | MARKERS OF IMMUNE RESPONSE | 08-17-2017 |
20170233818 | MULTIPLE TARGET NUCLEIC ACID DETECTION METHOD USING CLAMPING PROBE AND DETECTION PROBE | 08-17-2017 |
20170233820 | METHODS FOR DETECTING CpG METHYLATION AND FOR DIAGNOSING CANCER | 08-17-2017 |
20170233821 | METHOD OF DETERMINING PIK3CA MUTATIONAL STATUS IN A SAMPLE | 08-17-2017 |
20170233825 | METHOD OF MULTIVARIATE MOLECULE ANALYSIS | 08-17-2017 |
20170233826 | MRNA AND/OR PROTEIN OF ERCC1 ISOFORM 3 FOR USE IN DIAGNOSING A RESISTANCE AGAINST A THERAPEUTIC AGENT AND METHOD FOR DIAGNOSING A RESISTANCE AGAINST A THERAPEUTIC AGENT USING SAID MRNA AND/OR PROTEIN | 08-17-2017 |
20170233831 | Sidt1 GENE CONTROLLING DETERMINATE GROWTH HABIT IN SESAME AND SNP MOLECULAR MARKER THEREOF | 08-17-2017 |
20170234778 | DIRECT SPECIMEN COLLECTION DEVICE AND CASSETTE | 08-17-2017 |
20170234861 | REAL-TIME DETECTION OF WATER CONTAMINANTS | 08-17-2017 |
20170234887 | METHOD FOR DETECTING A SPATIAL PROXIMITY OF A FIRST AND A SECOND EPITOPE | 08-17-2017 |
20170235877 | SIZE-BASED ANALYSIS OF TUMOR DNA | 08-17-2017 |
20180021782 | SYSTEM AND METHOD FOR CAPTURING AND ANALYZING CELLS | 01-25-2018 |
20180023091 | METHOD FOR INDUCING TARGETED MEIOTIC RECOMBINATIONS | 01-25-2018 |
20180023123 | Methods And Kits For Theranostic Applications | 01-25-2018 |
20180023124 | Arrays for Single Molecule Detection and Use Thereof | 01-25-2018 |
20180023126 | ADDITIVE FOR ACCELERATING HYBRIDIZATION | 01-25-2018 |
20180023127 | VISUALLY DETERMINABLE GENETIC TESTING | 01-25-2018 |
20180023134 | Methods and Compositions for Delivery of Molecules and Complexes to Reaction Sites | 01-25-2018 |
20180023144 | METHODS AND NUCLEIC ACIDS FOR ANALYSES OF CELL PROLIFERATIVE DISORDERS | 01-25-2018 |
20180023147 | METHODS AND BIOMARKERS FOR DETECTION OF BLADDER CANCER | 01-25-2018 |
20180023148 | MAIZE EVENT DP-004114-3 AND METHODS FOR DETECTION THEREOF | 01-25-2018 |
20190144924 | BIOSENSORS | 05-16-2019 |
20190144931 | SYSTEM AND METHOD FOR CAPTURING AND ANALYZING CELLS | 05-16-2019 |
20190144932 | CONSECUTIVE HYBRIDIZATION FOR MULTIPLEXED ANALYSIS OF BIOLOGICAL SAMPLES | 05-16-2019 |
20190144940 | METHOD FOR SELECTING A TARGET NUCLEIC ACID SEQUENCE | 05-16-2019 |
20190144941 | PROFILING MICROVESICLE NUCLEIC ACIDS AND USES THEREOF AS SIGNATURES IN DIAGNOSIS OF RENAL TRANSPLANT REJECTION | 05-16-2019 |
20190144948 | SYNTHETIC NUCLEIC ACID CONTROL MOLECULES | 05-16-2019 |
20190144949 | METHOD FOR PREDICTING THE RESPONSE TO CHEMOTHERAPY IN A PATIENT SUFFERING FROM OR AT RISK OF DEVELOPING RECURRENT BREAST CANCER | 05-16-2019 |
20190144950 | METHODS OF DETECTING A MUTATED GENE BY MULTIPLEX DIGITAL PCR | 05-16-2019 |
20190145869 | METHOD OF RETRIEVING ELEMENTS FROM FIXED TISSUE | 05-16-2019 |
20190145982 | MACROMOLECULE ANALYSIS EMPLOYING NUCLEIC ACID ENCODING | 05-16-2019 |
20190147974 | Systems And Methods For Characterizing And Sampling Nucleic Acid Sequences And Structures Of Same | 05-16-2019 |
20220136040 | USING TETHERED ENZYMES TO DETECT NUCLEIC ACIDS - The present application relates to methods of detecting a target nucleic acid molecule in a sample. The method includes providing a sample containing a target nucleic acid molecule and a capture oligonucleotide molecule. In one embodiment, the capture oligonucleotide molecule has (i) a length of 30-60 base pairs, (ii) a 4-8 base pair overhang on its 3′ end, (iii) a 5′ tail, (iv) a target-specific portion between the 3′ end and the 5′ tail, (v) a deoxy-adenosine diphosphate content of 40-50%, (vi) no deoxy thymidine phosphate in the 3′ end or the 5′ tail, and (vii) the 3′ end and the 5′ tail having an ATP content which is 40-50% of that of the capture oligonucleotide molecule. In another aspect of the method of detecting, certain reagents are coupled to a solid support. The present application also relates to compositions and kits useful in carrying out the methods of the present application. | 05-05-2022 |
20220136042 | IMPROVED NUCLEIC ACID TARGET ENRICHMENT AND RELATED METHODS - The invention is an improved method of target enrichment and target depletion where probe binding is facilitated by the FANCA protein. Improved workflows for next regeneration sequencing and related methods involving nucleic acid probe hybridization are improved by the use of FANCA protein. | 05-05-2022 |
20220136045 | COMPOSITIONS AND TECHNIQUES FOR NUCLEIC ACID PRIMER EXTENSION - A method of characterizing a nucleic acid that includes steps of (a) contacting a primer-template nucleic acid hybrid with a polymerase and a mixture of nucleotides to produce an extended primer hybrid and to form a stabilized ternary complex including the extended primer hybrid, the polymerase and a nucleotide cognate of the next base in the template, wherein the mixture contains nucleotide cognates of four different base types, wherein the nucleotide cognate of the first base type has a reversible terminator, and wherein nucleotide cognates of the second, third and fourth base types are extendable; (b) detecting the stabilized ternary complex to distinguish the next base from other base types in the template; and (c) determining the presence of a base multiplet in the template nucleic acid, the base multiplet including the first base type followed by the next base. | 05-05-2022 |
20220136049 | SEQUENCE ANALYSIS USING META-STABLE NUCLEIC ACID MOLECULES - The present disclosure relates in some aspects to methods for analyzing a target nucleic acid in a biological sample. In some aspects, the methods involve the use of a set of probe polynucleotides, for example a set of three or more probe polynucleotides, for assessing target nucleic acids. In some aspects, the presence, amount, and/or identity of region of interest in a target nucleic acid is analyzed in situ. Also provided are polynucleotides, sets of polynucleotides, compositions, and kits for use in accordance with the methods. | 05-05-2022 |
20220136051 | METHODS FOR IDENTIFYING AND IMPROVING T CELL MULTIPOTENCY - Provided herein are methods and compositions for determining T-cell differentiation by comparing the methylation status of T cells relative to a T cell methylation index and using this determination to identify or isolate populations of T cells having desired T cell multipotency. Further, the present methods and compositions can be used to monitor or treat symptoms of chronic infections, autoimmune diseases, and cancer. | 05-05-2022 |
20220136058 | CHARACTERIZING METHYLATED DNA, RNA, AND PROTEINS IN THE DETECTION OF LUNG NEOPLASIA - Provided herein is technology relating to detecting neoplasia and particularly, but not exclusively, to methods, compositions, and related uses for detecting neoplasms such as lung cancer. | 05-05-2022 |
20220136069 | MACROPHAGE EXPRESSION IN BREAST CANCER - The present invention relates to the field of breast cancer diagnosis and treatment. The present invention provides methods comprising a) analysing a biological sample obtained from a subject to determine the presence of target molecules representative of expression of at least two biomarkers selected from the group listed in Table 1, wherein the biological sample is a breast tissue sample or derivative thereof; and b) comparing the expression levels of the biomarkers determined in (a) with one or more reference values, wherein whether there is a difference in the expression of the biomarkers in the sample from the subject compared to the one or more reference values is indicative of a clinical indication. The invention further provides methods of treatment and kits and assays for use in the methods of the invention. | 05-05-2022 |
20220137065 | PHOTOCLEAVABLE MASS-TAGS FOR MULTIPLEXED MASS SPECTROMETRIC IMAGING OF TISSUES USING BIOMOLECULAR PROBES - The field of this invention relates to immunohistochemistry (IHC) and in situ hybridization (ISH) for the targeted detection and mapping of biomolecules (e.g., proteins and miRNAs) in tissues or cells for example, for research use and for clinical use such by pathologists (e.g., biomarker analyses of a resected tumor or tumor biopsy). In particular, the use of mass spectrometric imaging (MSI) as a mode to detect and map the biomolecules in tissues or cells for example. More specifically, the field of this invention relates to photocleavable mass-tag reagents which are attached to probes such as antibodies and nucleic acids and used to achieve multiplex immunohistochemistry and in situ hybridization, with MSI as the mode of detection/readout. Probe types other than antibodies and nucleic acids are also covered in the field of invention, including but not limited to carbohydrate-binding proteins (e.g., lectins), receptors and ligands. Finally, the field of the invention also encompasses multi-omic MSI procedures, where MSI of photocleavable mass-tag probes is combined with other modes of MSI, such as direct label-free MSI of endogenous biomolecules from the biospecimen (e.g., tissue), whereby said biomolecules can be intact or digested (e.g., chemically digested or by enzyme). | 05-05-2022 |