Entries |
Document | Title | Date |
20080199459 | Mitotic Kinesin Inhibitors - The present invention relates to dihydropyrrole compounds that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin. The invention is also related to compositions which comprise these compounds, and methods of using them to treat cancer in mammals. | 08-21-2008 |
20080199460 | Use of IL-23 and IL-17 antagonists to treat autoimmune ocular inflammatory disease - Novel methods and drug products for treating autoimmune ocular inflammatory disease are disclosed, which involve administration of agents that antagonize one or both of IL-17 and IL-23 activity. | 08-21-2008 |
20080199461 | Ovr 110 Antibody Compositions and Methods of Use - The invention provides isolated anti-head and neck, ovarian, pancreatic, lung, endometrial or breast cancer antigen (Ovr110) antibodies that internalize upon binding to Ovr110 on a mammalian in vivo. The invention also encompasses compositions comprising an anti-Ovr110 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-Ovr110 antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-Ovr110 antibodies. The invention encompasses a method of producing the anti-Ovr110 antibodies. Other aspects of the invention are a method of killing an Ovr110-expressing cancer cell by contacting the cancer cell with an anti-Ovr110 antibody and a method of alleviating or treating an Ovr110-expressing cancer in a mammal by administering a therapeutically effective amount of the anti-Ovr110 antibody to the mammal. | 08-21-2008 |
20080199462 | PREVENTING AIRWAY MUCUS PRODUCTION BY ADMINISTRATION OF EGF-R ANTAGONISTS - Hypersecretion of mucus in the lungs is inhibited by the administration of an epidermal growth factor receptor (EGF-R) antagonist. The EGF-R antagonist may be in the form of a small organic molecule, an antibody, or portion of an antibody that binds to and blocks the EGF receptor. The EGF-R antagonist is preferably administered by injection in an amount sufficient to inhibit formation of goblet cells in pulmonary airways. The degranulation of goblet cells that results in airway mucus production is thereby inhibited. Assays for screening candidate agents that inhibit goblet cell proliferation are also provided. | 08-21-2008 |
20080199463 | METHOD FOR TREATING MULTIPLE MYELOMA - The present invention relates to methods for the treatment of multiple myeloma. More particularly, the present invention relates to a method for inducing apoptosis in myeloma cells by administration of a K121-like antibody. | 08-21-2008 |
20080199464 | Combination Therapy with Angiogenesis Inhibitors - Disclosed herein are methods of treating tumors using a combination therapy with angiogenesis inhibitors. | 08-21-2008 |
20080199465 | IMMUNOSUPPRESSIVE COMBINATION AND ITS USE IN THE TREATMENT OR PROPHYLAXIS OF INSULIN-PRODUCING CELL GRAFT REJECTION - A pharmaceutical combination comprising an accelerated lymphocyte homing agent in free form or in pharmaceutically acceptable salt form, and one or more compounds selected from the group consisting of an antibody to the IL-2 receptor, an immunosuppressive macrocyclic lactone and a soluble human complement inhibitor is used to treat or prevent insulin-producing cell graft rejection. | 08-21-2008 |
20080206238 | Angiogenesis-Inhibiting Chimeric Protein and the Use - The present invention is directed to DNA sequence encoding angiogenesis-inhibiting recombinant chimeric protein, the chimeric protein per se, the pharmaceutical use of the chimeric protein, and to the pharmaceutical composition containing the recombinant protein and the formulation thereof. | 08-28-2008 |
20080206239 | Human Antibodies And Proteins - The present invention provides composite proteins, including antibodies, which show reduced immunogenicity. In particular, composite antibodies for use in humans are provided, in particular antibodies which have been modified to remove one or more T-cell epitopes. Methods for generating such proteins are also provided. | 08-28-2008 |
20080206240 | Antilymphocyte Antibody Induction - An immunosuppressive treatment combining a S1 P receptor modulator, one or more immunosuppressive drug(s) and an antilymphocyte antibody in the course of the treatment of a transplant recipient prolongs the survival of a transplant allograft. | 08-28-2008 |
20080206241 | Methods of Treating Chronic Inflammatory Diseases Using a GM-CSF Antagonist - The invention is based on the discovery that GM-CSF antagonists can be used for the treatment of chronic inflammatory disease, such as rheumatoid arthritis. Accordingly, the invention provides methods of administering a GM-CSF antagonist, e.g., a GM-CSF antibody, and an anti-folate compounds, e.g., methotrexate, to a patient that has RA and pharmaceutical compositions comprising such antagonists. | 08-28-2008 |
20080206242 | METHOD OF TREATMENT OF TH2-MEDIATED CONDITIONS USING OPTIMIZED ANTI-CD30 ANTIBODIES - A method of treating Th2-mediated conditions, e.g., atopic conditions, e.g., atopic asthma and/or atopic dermatitis, using effective amount of an antibody that targets CD30, where the antibody has at least one modification relative to a parent antibody and the antibody binds with altered affinity to an FcγR or alters effector function as compared to the parent antibody. | 08-28-2008 |
20080206243 | Methods for Treating Kidney Disorders - Provided are methods of treating kidney disorders in a subject by administering an effective amount of VEGFR agonist, e.g., a Flt1 agonist to a subject. The agonists are composed of compositions comprising VEGFR agonists, e.g., VEGF, antibodies directed to Flt1, Flt1 ligands, Flt1 small molecule activators, or Flt1 selective agents in a pharmaceutically acceptable carrier for use in activating Flt1. | 08-28-2008 |
20080213256 | Less Immunogenic Binding Molecules - The present invention provides a bispecific binding molecule, wherein said molecule comprises or consists of at least two domains whereby one of said at least two domains specifically binds to/interacts with the human CD3 complex and said domain comprises an amino acid sequence of an antibody derived light chain, wherein said amino acid sequence is a particularly identified amino acid sequence comprising specific amino acid substitutions, and a second domain is or contains at least one further antigen-interaction-site and/or at least one further effector domain. The invention further provides nucleic acid molecules encoding the bispecific binding molecules of the invention, vectors comprising said nucleic acid molecules and host cells transformed or transfected with said vectors. Moreover, the invention concerns a method for the production of bispecific binding molecules of the invention and compositions comprising the bispecific binding molecules of the invention, the nucleic acid molecules of the invention or the host cells of the invention. | 09-04-2008 |
20080213257 | Methods for treating IL-18 mediated disorders - The invention pertains to methods for treating medical disorders characterized by elevated levels or abnormal expression of IL-18 by administering an IL-18 antagonist, such as soluble IL-18 receptor, a soluble IL-18 binding protein and/or an antibody. | 09-04-2008 |
20080213258 | Method of Predicting and Reducing Risk of Metastasis of Breast Cancer to Lung - A signature for breast cancer tissue derived from a patient is established that is indicative of the virulence and risk of lung metastasis by determining the expression levels to define a sample signature, and comparing this sample signature to a reference signature. The reference signature defines a standard expression level for each gene and a significant change direction, i.e., either overexpressed or underexpressed. A sample signature that differs from the reference signature in the significant change direction for a predetermined number of the genes tested is indicative of a significant risk of lung metastasis. This determination is used to define appropriate treatment and monitoring options for the patient. Risk of metastasis to the lung can be reduced by treatment with a therapeutic combination that either (1) contains a first agent effective to inhibit epiregulin activity and a second agent effective to inhibit activity of a protein selected from the group consisting of MMP1, MMP2 and PTGS2, or (2) contains a therapeutic agent or combination of agents effective to inhibit activity MMP1, MMP2 and PTGS2. Agents that inhibit the CXCL1 pathway also can be used individually or in combination with these combinations. | 09-04-2008 |
20080213259 | Methods for Treating Autoimmune and Chronic Inflammatory Conditions Using Antagonists of CD30 or CD30L - The invention provides methods of treating autoimmnune and chronic inflammatory conditions by administering agents that hinder the CD30/CD30L interaction, combination treatments, and methods of treating conditions resistant to treatment with TNFα inhibitors by administering agents that inhibit signal transduction by CD30 or IL-1. Included also are treatments involving concurrently administering agents that block the CD30/CD30L interaction and agents that antagonize the IL-4/IL-4R interaction. Additionally provided is an animal model for screening candidate agents for their efficacy in treating conditions that are resistant to treatment with TNFα inhibitors. | 09-04-2008 |
20080213260 | USE OF CD23 ANTAGONISTS FOR THE TREATMENT OF NEOPLASTIC DISORDERS - Methods and kits for the treatment of neoplastic disorders comprising the use of a CD23 antagonist are provided. The CD23 antagonist may be used alone or in combination with chemotherapeutic agents. In particularly preferred embodiments the CD23 antagonists may be used to treat B cell chronic lymphocytic leukemia (B-CLL). | 09-04-2008 |
20080213261 | Transdiscal administration of specific inhibitors of pro-inflammatory cytokines - The present invention relates to injecting a high specificity cytokine antagonist into a diseased intervertebral disc. | 09-04-2008 |
20080213262 | Inhibition of Islet Amyloid Polypeptide (Iapp) Aggregation for the Treatment of Type 2 Diabetes - The present invention relates to the targeting and clearance of soluable unprocessed Islet Amyloid Polypeptide (hIAPP) in order to prevent the nucleation of hIAPP amyloidogenesis and to interfere with pancreatic cell death which is associated with the aggregation of hIAPP. Agents and methods for reducing hIAPP aggregation are provided herein and may be useful in the treatment of type 2 diabetes. | 09-04-2008 |
20080213263 | METHODS AND COMPOSITIONS FOR TREATMENT OF IMMUNE DYSFUNCTION DISORDERS - Methods and compositions are disclosed for modulating the immune system of animals. Applicants have identified that oral administration of immunoglobulin or plasma fractions purified from animal serum can modulate serum IgG and/or TNF-α levels for treatment of autoimmune disorders, potentiation of vaccination protocols, and improvement of overall health and weight gain in animals, including humans. | 09-04-2008 |
20080213264 | COMPOUNDS AND METHODS FOR TREATMENT AND DIAGNOSIS OF CHLAMYDIAL INFECTION - Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a | 09-04-2008 |
20080213265 | HUMAN CYTOMEGALOVIRUS NEUTRALISING ANTIBODIES AND USE THEREOF - The invention relates to neutralising antibodies which are specific for human cytomegalovirus and bind with high affinity as well as immortalised B cells that produce such antibodies. The invention also relates to the epitopes that the antibodies bind to as well as the use of the antibodies and the epitopes in screening methods as well as the diagnosis and therapy of disease. | 09-04-2008 |
20080213266 | Method for Treating CCR4-Related Diseases - The present invention provides an antibody composition comprising an antibody molecule which specifically binds to human CC chemokine receptor 4 (CCR4) and has complex type N-glycoside-linked sugar chains in the Fc region, wherein the complex type N-glycoside-linked sugar chains have a structure in which fucose is not bound to N-acetylglucosamine in the reducing end in the sugar chains; a transformant which produces the antibody composition; a process for producing the antibody composition; and a pharmaceutical composition comprising the antibody composition. | 09-04-2008 |
20080213267 | Cytotoxicity mediation of cells evidencing surface expression of TROP-2 - This invention relates to the staging, diagnosis and treatment of cancerous diseases (both primary tumors and tumor metastases), particularly to the mediation of cytotoxicity of tumor cells; and most particularly to the use of cancerous disease modifying antibodies (CDMAB), optionally in combination with one or more CDMAB/chemotherapeutic agents, as a means for initiating the cytotoxic response. The invention further relates to binding assays, which utilize the CDMAB of the instant invention. The anti-cancer antibodies can be conjugated to toxins, enzymes, radioactive compounds, cytokines, interferons, target or reporter moieties and hematogenous cells. | 09-04-2008 |
20080219974 | OPTIMIZED ANTIBODIES THAT TARGET HM1.24 - The present disclosure describes antibodies that target HM1.24. In various aspects, the antibodies have specific CDR, variable, or full length sequences, have modifications with the parent antibody, or include at least one modification relative to a parent antibody that alters affinity to an FcγR or alters effector function as compared to the parent antibody. Nucleic acids encoding the antibodies and methods of using the antibodies are also disclosed. | 09-11-2008 |
20080219975 | VEGFR3 INHIBITORS - The present invention relates to the use of some of the macrocyclic quinazoline derivatives described in PCT publication WO2004/105765 as inhibitors of VEGFR3 mediated biological activities, especially those activities which are mediated by VEGFR3 ligands VEGF-C and/or VEGF-D. | 09-11-2008 |
20080219976 | METHODS AND COMPOSITIONS FOR TREATMENT AND PREVENTION OF STAPHYLOCOCCAL INFECTIONS - The invention features methods and compositions for treatment or prevention of infection by, or disease caused by infection with, | 09-11-2008 |
20080219977 | Combinations Comprising Gemcitabine and Tyrosine Kinase Inhibitors for the Treatment of Pancreatic Cancer - The invention relates to a method of treating a warm-blooded animal having pancreatic cancer, in particular it relates
| 09-11-2008 |
20080226626 | IMMUNOREGULATORY ANTIBODIES AND USES THEREOF - A combination antibody therapy for treating B cell malignancies using an immunoregulatory antibody, especially an anti-B7, anti-CD23, or anti-CD40L antibody and a B cell depleting antibody, especially anti-CD19, anti-CD20, anti-CD22 or anti-CD37 antibody is provided. Preferably, the combination therapy will comprise anti-B7 and anti-CD20 antibody administration. | 09-18-2008 |
20080226627 | Hn-33 Compositions and Methods - This application is based, inter alia, on the discovery of a binding interaction between the Hn-33 hemagglutinin polypeptide of the type A | 09-18-2008 |
20080226628 | CDR-Grafted Anti-Tissue Factor Antibodies and Methods of Use Thereof - The present invention provides CDR-grated antibodies against human tissue factor that retain the high binding affinity of rodent monoclonal antibodies against tissue factor but have reduced immunogenicity. The present humanized antibodies are potent anticoagulants and are thus useful in the treatment and prophylaxis of human thrombotic disease. The invention also provides methods of making the CFR-grafted antibodies and pharmaceutical compositions for the attenuation or prevention of coagulation. | 09-18-2008 |
20080226629 | ANTI-VEGF ANTIBODIES - Humanized and variant anti-VEGF antibodies and various uses therefor are disclosed. The anti-VEGF antibodies have strong binding affinities for VEGF; inhibit VEGF-induced proliferation of endothelial cells in vitro; and inhibit tumor growth in vivo. | 09-18-2008 |
20080226630 | Recombinant antibodies for treatment of respiratory syncytial virus infections - Disclosed are novel polyclonal antibodies, which target respiratory syncytial virus (RSV), as well as novel high affinity antibody molecules reactive with RSV. The polyclonal antibodies may comprise antibody molecules which are reactive with both RSV protein F and RSV protein G, and preferably the polyclonal antibodies target a variety of epitopes on these proteins. The antibody molecules of the invention have shown superior efficacy in vitro and/or in vivo. Also disclosed are methods of producing the antibodies of the invention as well as methods of their use in treatment or prevention of RSV infection. | 09-18-2008 |
20080226631 | METHODS OF MODULATING CYTOKINE ACTIVITY; RELATED REAGENTS - Provided are methods of modulating cytokine activity, e.g., for the purpose of treating inflammation of the airways and lung. Also provided are reagents for use in screening for agonists or antagonists of IL-19 or IL-24. | 09-18-2008 |
20080233113 | METHOD OF INHIBITING COMPLEMENT ACTIVATION WITH HUMAN ANTI-FACTOR C3 ANTIBODIES AND USE THEREOF - A method of inhibiting complement activation mediated by C3b inhibitors in a subject includes administering a C3B inhibitor to the subject to inhibit at least one of C3b binding to factors B and properdin, inhibit C3 cleavage, inhibit the activation of neutrophils, monocytes, platelets, and endothelium; or inhibit the formation of C3a, C5a, and MAC. | 09-25-2008 |
20080233114 | NOVEL FGF HOMOLOGS - The present invention relates to polynucleotide and polypeptide molecules for zFGF5 a novel member of the FGF family. The polypeptides, and polynucleotides encoding them, are proliferative for muscle cells, in particular cardiac cells and may be used for remodeling cardiac tissue and improving cardiac function. The present invention also includes antibodies to the zFGF5 polypeptides. | 09-25-2008 |
20080233115 | ANTI-IL-20 ANTIBODIES AND BINDING PARTNERS AND METHODS OF USING IN INFLAMMATION - The present invention relates to blocking, inhibiting, reducing, antagonizing or neutralizing the activity of IL-20 polypeptide molecules. IL-20 and IL-22 are cytokines that are involved in inflammatory processes and human disease. The present invention includes anti-IL-20 and anti-IL-22RA antibodies and binding partners, as well as methods for antagonizing IL-20 using such antibodies and binding partners. | 09-25-2008 |
20080233116 | Human monoclonal antibodies to CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 09-25-2008 |
20080233117 | REDUCING TUMOR GROWTH - This document provides methods and materials for reducing tumor growth in a mammal. For example, methods and materials for using PLVAP inhibitors to reduce tumor growth in a mammal (e.g., a human) are provided. | 09-25-2008 |
20080241134 | USES OF HUMAN MONOCLONAL ANTIBODIES AGAINST OXIDIZED LDL RECEPTOR - Various human monoclonal antibodies that bind to human LOX-1 and inhibit the binding of in-vivo LOX-1 ligands to LOX-1, and the LOX-1-mediated incorporation of the ligands into cells, were obtained by immunizing human antibody-producing transgenic mice (created by genetic engineering) with soluble human oxidized LDL receptor (LOX-1). Furthermore, the human monoclonal antibodies were found to be effective in preventing and treating a variety of diseases | 10-02-2008 |
20080241135 | Methods for reducing viral load in HIV-1-infected patients - This method provides a method for reducing HIV-1 viral load in an HIV-1-infected human subject which comprises administering to the subject at a predefined interval effective HIV-1 viral load-reducing doses of (a) a humanized antibody designated PRO 140, or of (b) an anti-CCR5 receptor monoclonal antibody. This invention also provides a method for inhibiting in a human subject the onset or progression of an HIV-1-associated disorder, the inhibition of which is effected by inhibiting fusion of HIV-1 to CCR5 | 10-02-2008 |
20080241136 | Humanized Anti-CCR2 Antibodies and Methods of Use Therefor - The present invention relates to a humanized antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 2 (CCR2) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a cell bearing mammalian CCR2 with a ligand thereof, and to use of the antibodies and fragments in therapeutic, prophylactic and diagnostic methods. | 10-02-2008 |
20080241137 | Cancerous disease modifying antibodies - The present invention relates to a method for producing cancerous disease modifying antibodies using a novel paradigm of screening. By segregating the anti-cancer antibodies using cancer cell cytotoxicity as an end point, the process makes possible the production of anti-cancer antibodies for therapeutic and diagnostic purposes. The antibodies can be used in aid of staging and diagnosis of a cancer, and can be used to treat primary tumors and tumor metastases. The anti-cancer antibodies can be conjugated to toxins, enzymes, radioactive compounds, and hematogenous cells. | 10-02-2008 |
20080241138 | SOLUBLE IL-17RA/RC FUSION PROTEINS AND RELATED METHODS - Disclosed are antagonists of IL-17A and IL-17F. The antagonists are based on soluble IL-17RA and IL-17RC fusion proteins, including hybrid soluble receptors comprising portions of both IL-17RC and IL-17RA (“IL-17RC/IL-17RA”). Such antagonists serve to block, inhibit, reduce, antagonize or neutralize the activity of IL-17F, IL-17A, or both IL-17A and IL-17F. Also disclosed are methods of using such antagonists for treating disease, particularly inflammatory diseases mediated at least in part by IL-17A and/or IL-17F. | 10-02-2008 |
20080248028 | Immunoglobulin Variants Outside the Fc Region - The present invention relates to antibody variants outside the Fc region that alter binding affinity to one or more effector ligands, methods for their generation, and their therapeutic application. | 10-09-2008 |
20080248029 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASES - Disclosed are pharmaceutical compositions and methods for preventing or treating a number of amyloid diseases, including Alzheimer's disease, prion diseases, familial amyloid neuropathies and the like. The pharmaceutical compositions include immunologically reactive amounts of amyloid fibril components, particularly fibril-forming peptides or proteins. Also disclosed are therapeutic compositions and methods which use immune reagents that react with such fibril components. | 10-09-2008 |
20080248030 | Method of Treating Angiogenic Diseases - The present invention relates to methods for treating cancer comprising administering an anti-VEGF (vascular endothelial growth factor) monoclonal antibody (e.g. Avastin) and a N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer-TNP-470 conjugate (e.g. Caplostatin) to a patient in need thereof. | 10-09-2008 |
20080248031 | CELL SURFACE MOLECULE MEDIATING CELL ADHESION AND SIGNAL TRANSMISSION - Novel cell surface molecules recognized by monoclonal antibodies against a cell surface molecule of lymphocytic cells that play an important role in autoimmune diseases and allergic diseases have been isolated, identified, and analyzed for their functions. The cell surface molecules are expressed specifically in thymocytes, lymphocytes activated by ConA-stimulation, and peripheral blood lymphocytes, and induce cell adhesion. Antibodies against the cell surface molecules significantly ameliorate pathological conditions of autoimmune diseases and allergic diseases. | 10-09-2008 |
20080248032 | COMPOSITIONS AND METHODS FOR PROTECTION AGAINST CARDIAC AND/OR CENTRAL NERVOUS SYSTEM TISSUE INJURY BY INHIBITING SPHINGOSINE-1-PHOSPHATE LYASE - The present invention relates generally to the prevention and/or treatment of cardiac and stroke injury. In particular, the present invention provides compositions and methods for preventing and treating tissue injury in cardiac and stroke settings and injury due to ischemia/reperfusion, hypoxia, cardiotoxicity of certain therapeutic regimens, and other causes, by administering an agent that inhibits sphingosine-1-phosphate lyase (SPL) activity. | 10-09-2008 |
20080248033 | VEGF-specific antagonists for adjuvant and neoadjuvant therapy and the treatment of early stage tumors - Disclosed herein are methods of treating benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating a subject at risk of developing benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating or preventing recurrence of a tumor using an anti-VEGF-specific antagonist as well as use of VEGF-specific antagonists in neoadjuvant and adjuvant cancer therapy. | 10-09-2008 |
20080248034 | Methods For Inhibiting The Binding Of Endosialin To Ligands - The invention provides methods for inhibiting the interaction of endosialin with endosialin ligands. The inhibition is effectuated on the genetic level, by inhibiting endosialin gene expression, and on the protein level, by blocking the interaction of cell-surface expressed endosialin with ligands such as fibronectin and collagen. The invention provides methods for identifying inhibitors of the interaction of endosialin with endosialin ligands. Also provided are methods for inhibiting angiogenesis and neovascularization in vivo and in vitro. | 10-09-2008 |
20080248035 | Pharmaceutical Combination - This invention relates to a combination product or medicament comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixture thereof. Also provided herein are the pharmaceutical compositions comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixture thereof and optionally together with at least one pharmaceutically acceptable carrier, and methods for the treatment or prophylaxis of cardiovascular diseases, Alzheimer's disease, obesity, diabetes or inflammatory diseases comprising administering to a mammal in need thereof therapeutically effective amounts of combination pharmaceutical composition comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixtures thereof. | 10-09-2008 |
20080254023 | Treating Gliosis, Glial Scarring, Inflammation or Inhibition of Axonal Growth in the Nervous System by Modulating Eph Receptor - The present invention relates to a method of treating disorders of the nervous system and more particularly disorders associated with a gliotic response and/or an inflammatory response within the central nervous system and to therapeutic agents useful for same. More particularly, the present invention involves a method of preventing or reducing the amount of Eph receptor-mediated gliosis and/or glial scarring and/or inflammation and/or Eph receptor-mediated inhibition of axonal growth which occurs during and/or after disease or injury to the nervous system. The present invention also facilitates the identification of therapeutic agents which modulate Eph receptor-mediated signaling. The method and therapeutic agents of the present invention are useful for treating a range of nervous system diseases, conditions and injuries including, inter alia, paralysis induced by physiological-, pathological- or trauma-induced injury to the brain or spinal cord. | 10-16-2008 |
20080254024 | ANTI-EPHB2 ANTIBODIES AND METHODS USING SAME - The invention provides anti-EphB2 antibodies, immunoconjugates, and compositions comprising and methods of using these antibodies and immunoconjugates. | 10-16-2008 |
20080254025 | Human IL-1 epsilon DNA and polypeptides - The invention is directed to purified and isolated novel human IL-1 epsilon polypeptides, the nucleic acids encoding such polypeptides, processes for production of recombinant forms of such polypeptides, antibodies generated against these polypeptides, the use of such polypeptides in cellular and immune reactions, the use of such polypeptides in screening for agonists or antagonists of IL-1 epsilon activity, and kits comprising such polypeptides. | 10-16-2008 |
20080254026 | ANTAGONIST ANTI-CD40 MONOCLONAL ANTIBODIES AND METHODS FOR THEIR USE - Compositions and methods of therapy for treating diseases mediated by stimulation of CD40 signaling on CD40-expressing cells are provided. The methods comprise administering a therapeutically effective amount of an antagonist anti-CD40 antibody or antigen-binding fragment thereof to a patient in need thereof. The antagonist anti-CD40 antibody or antigen-binding fragment thereof is free of significant agonist activity, but exhibits antagonist activity when the antibody binds a CD40 antigen on a human CD40-expressing cell. Antagonist activity of the anti-CD40 antibody or antigen-binding fragment thereof beneficially inhibits proliferation and/or differentiation of human CD40-expressing cells, such as B cells. | 10-16-2008 |
20080254027 | Optimized CD5 antibodies and methods of using the same - The present invention describes antibodies that target CD5, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 10-16-2008 |
20080254028 | CASPASE-8 BINDING PROTEIN, ITS PREPARATION AND USE - The present invention relates to a caspase-8 interacting polypeptide (Cari), methods for its preparation, and its use. | 10-16-2008 |
20080254029 | Use of an Inhibitor of TNFa Plus an Antihistamine to Treat Allergic Rhinitis and Allergic Conjunctivitis - Disclosed are methods of treating allergic conjunctivitis and allergic rhinitis in a subject that involve topically administering to the subject a composition comprising a pharmaceutically effective amount of an H | 10-16-2008 |
20080260727 | Modulation of Nkg2d - The present invention relates to methods and compositions for treating or preventing autoimmune and/or inflammatory disease. In particular, the present invention provides therapeutics for impairing the expansion and function of autoreactive T cells and/or NK cells, by modulating NKG2D. | 10-23-2008 |
20080260728 | Treatment of Severe Multiple Sclerosis - Methods of treating multiple sclerosis are disclosed. | 10-23-2008 |
20080260729 | Method of Treating Cancer Comprising a Vegf-B Antgonist - The present invention relates generally to the field of cancer therapy and prophylaxis. More particularly, the present invention provides growth factor antagonists which inhibit the growth of cancers including tumors and pre-cancerous tissue. Even more particularly, the present invention is directed to antagonists of vascular endothelial growth factor-B and their use to inhibit the growth of cancer including tumor tissue and pre-cancerous tissue. | 10-23-2008 |
20080260730 | Treatment of Crohn's disease or psoriasis using anti-interferon gamma antibodies - The present invention provides a method of treating autoimmune diseases. In particular, it provides a method for the treatment of Crohn's disease or psoriasis comprising administering to a subject in need thereof a therapeutically effective amount of an antibody against interferon γ. | 10-23-2008 |
20080260731 | OPTIMIZED ANTIBODIES THAT TARGET CD19 - The present invention describes antibodies that target CD19, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 10-23-2008 |
20080260732 | CHIMERIC AND HUMANIZED ANTIBODIES TO ALPHA5BETA1 INTEGRIN THAT MODULATE ANGIOGENESIS - The present invention provides chimeric and humanized antibodies that specifically recognize α5β1 integrin, and methods for using the antibodies for reducing or inhibiting angiogenesis in a tissue. Also provided are methods of determining therapeutically acceptable doses of the antibodies and pharmaceutical compositions including the same. | 10-23-2008 |
20080260733 | HUMANIZED COLLAGEN ANTIBODIES AND RELATED METHODS - The invention provides a grafted antibody, or functional fragment thereof, comprising one or more complementarity determining regions (CDRs) having at least one amino acid substitution in one or more CDRs of a heavy chain CDR, where the grafted antibody or functional fragment thereof has specific binding activity for a cryptic collagen epitope. The invention also provides methods of using an antibody having specific binding activity for a cryptic collagen epitope, including methods of inhibiting angiogenesis, tumor growth, and metastasis. | 10-23-2008 |
20080260734 | COMPOSITIONS AND METHODS FOR CHARACTERIZING, REGULATING, DIAGNOSING, AND TREATING CANCER - The present invention relates to compositions and methods for characterizing, regulating, diagnosing, and treating cancer. For example, the present invention provides compositions and methods for inhibiting tumorigenesis of certain classes of cancer cells, including breast cancer cells and preventing metastasis. The present invention also provides systems and methods for identifying compounds that regulate tumorigenesis. | 10-23-2008 |
20080260735 | Transfer request (37 CFR 1.821(e)) humanised antibodies to the epidermal growth factor receptor - The present invention provides a humanised form of the antibody 340 obtainable from the cell line deposited with the ECACC under accession number 97021428. Such antibodies have been found to have an increased ability to kill cells compared to the murine antibody 340. Also provided are nucleic acids encoding such antibodies, as well as the use of the antibodies in medicine, in particular in the treatment of cancer. | 10-23-2008 |
20080267951 | Methods for Treating Cancer Using Agents That Inhibit Wnt16 Signaling - This invention relates to methods of inhibiting the growth of cells, in particular cancer cells that over express Wnt16 protein. The methods comprise contacting the cell with an agent that binds to Wnt16 mRNA or Wnt16 protein, interferes with Wnt16 signaling or inhibits binding of the Wnt16 protein to another protein, such as a Frizzled receptor. | 10-30-2008 |
20080267952 | Antibodies to Cross-Linked Beta-Amyloid Protein Oligomers - The invention relates to antibodies that bind cross-linked amyloid β oligomers, and methods for using such antibodies for diagnosis and treatment of Alzheimer's disease. | 10-30-2008 |
20080267953 | Anti-perp recombinant antibody - An antibody which binds to a polypeptide encoded by human PERP (p53 apoptosis effector related to PMP-22) gene which is considered to be related to incidence of cancer or the like is desired. The present invention provides a gene recombinant antibody which has no consensus sequence of an N-linked sugar chain in a variable region, specifically recognizes three-dimensional structure of an extracellular region of a polypeptide encoded by the PERP gene and binds to the extracellular region. The antibody is useful for treatment of various diseases expressing a polypeptide encoded by the PERP gene. | 10-30-2008 |
20080267954 | Treatment of multiple sclerosis (MS) - A method for treatment of multiple sclerosis (MS) with Campath-1H with significant efficacy and a favourable safety profile is described, which offers an acceptable benefit/risk ratio. Especially described is the use of Campath-1H (alemtuzumab) for the production of a medicament for the treatment of multiple sclerosis (MS), comprising a first treatment cycle followed by at least one further treatment cycle of Campath-1H (alemtuzumab), in which each treatment cycle comprises 1-5 daily doses which are applied on consecutive days, wherein the daily dose is >0 and ≦12 mg, and wherein each treatment cycle is separated from the next cycle by at least 1-24 months. Also described are treatment regimens comprising the administration of less than 12 mg/day of Campath-1H for a period of 1-5 consecutive days. | 10-30-2008 |
20080267955 | FRIZZLED 9 AS TUMOR MARKER - The present invention relates to a method for treating and a method for identifying a tumor of a human or animal comprising administering composition comprising an agent which binds to Frizzled 9. | 10-30-2008 |
20080267956 | GROWTH FACTOR ANTAGONISTS FOR ORGAN TRANSPLANT ALLOIMMUNITY AND ARTERIOSCLEROSIS - The present invention provides materials and methods for antagonizing the function of vascular endothelial growth factor receptors, platelet derived growth factor receptors and other receptors, to prevent, inhibit, or ameliorate allograft rejection or arteriosclerosis in organisms that receive an organ transplant. | 10-30-2008 |
20080267957 | Combination cancer therapy - Methods and compositions for treating tumors or tumor metastases in a patient, comprising administering to the patient simultaneously or sequentially (a) a therapeutically effective amount of an anti-cancer agent and (b) an IGF1R inhibitor compound of Formula I, with or without additional agents or treatments, such as other anti-cancer drugs or radiation therapy. Suitable IGF1R inhibitor may be represented by Formula I: | 10-30-2008 |
20080267958 | Common lymphatic endothelial and vascular endothelial receptor-1 (CLEVER-1) and uses thereof - A novel protein Common Lymphatic Endothelial and Vascular Endothelial Receptor-1 (CLEVER-1) is described. CLEVER-1 mediates leukocyte and malignant cell binding to vascular and lymphoid endothelial cells. CLEVER-1 is the first protein that has been reported to mediate both influx into and efflux from the lymph nodes. Also provided are methods of treating inflammation and preventing metastasis of malignant cells by providing an inhibitor of CLEVER-1 binding. | 10-30-2008 |
20080267959 | Anti-Il13 Human Antibodies - The present invention relates to human anti-IL-13 binding molecules, particularly antibodies, and to methods for using anti-IL-13 antibody molecules in diagnosis or treatment of IL-13 related disorders, such as asthma, atopic dermatitis, allergic rhinitis, fibrosis, inflammatory bowel disease and Hodgkin's lymphoma. | 10-30-2008 |
20080267960 | METHODS OF TREATING NEOPLASTIC, AUTOIMMUNE AND INFLAMMATORY DISEASES - Methods of treating cancer and autoimmune and inflammatory diseases are provided. | 10-30-2008 |
20080267961 | SOLUBLE ErbB3 AND TREATMENT OF CANCER - Regulation of sErbB3 isoforms in methods of regulating heregulin activity or ErbB receptor activities is disclosed. Cancer therapeutics and methods of therapeutically treating cancer comprising sErbB3 are also disclosed. Detection of sErbB3 in biological samples for risk assessment and prevention, screening, diagnosis, prognosis, theragnosis, evaluation of responsiveness to treatment, and/or monitoring of disease progression, recurrence, or metastasis of a cancer is disclosed as well. In examples, sErbB3 nucleic acid sequences, polypeptides, molecular probes, and antibodies are useful agents for regulation, expression, detection, and cancer therapeutics related to sErbB3. | 10-30-2008 |
20080274103 | Adenylyl Cyclase Antibodies, Compositions and Uses Thereof - The invention relates to compositions and methods for diagnosing and treating cardiac conditions and neurodegenerative diseases using antibodies which specifically recognize and bind to the adenylyl cyclase 5 isoform in the heart and brain. These antibodies demonstrate high specificity to the AC5 isoform and do not cross react to any other AC5 isoform. The invention further relates to methods of delivery of drugs to the site of injured tissue using the antibodies of the present invention. | 11-06-2008 |
20080274104 | Targeting a Secreted Pro-Apoptotic Factor for Cancer Therapeutics - The present invention concerns targeting a cell death factor associated with cancer. More specifically, an apoptosis-inducing factor is targeted to prevent destruction of non-cancerous cells. The factor may be a lipocalin molecule, and in specific embodiments its secretion and/or the secreted form is targeted by an inhibitory agent, such as an antibody, small molecule, antisense RNA, or siRNA, for example. | 11-06-2008 |
20080274105 | POLYPEPTIDE VARIANTS WITH ALTERED EFFECTOR FUNCTION - The present invention concerns polypeptides comprising a variant Fc region. More particularly, the present invention concerns Fc region-containing polypeptides that have altered effector function as a consequence of one or more amino acid modifications in the Fc region thereof. | 11-06-2008 |
20080274106 | Mesothelioma therapeutic agent - The present invention provides a mesothelioma therapeutic agent containing an interleukin-6 (IL-6) antagonist such as antibody to IL-6 receptor (IL-6R), and a mesothelioma cell growth inhibitor containing an IL-6 antagonist such as antibody to IL-6R. | 11-06-2008 |
20080274107 | Tyrosine kinase inhibitors - The present invention relates to compounds which inhibit, regulate and/or modulate tyrosine kinase signal transduction, compositions which contain these compounds, and methods of using them to treat tyrosine kinase-dependent diseases and conditions, such as angiogenesis, cancer, tumor growth, atherosclerosis, age related macular degeneration, diabetic retinopathy, inflammatory diseases, and the like in mammals. | 11-06-2008 |
20080274108 | POLYPEPTIDE VARIANTS WITH ALTERED EFFECTOR FUNCTION - The present invention concerns polypeptides comprising a variant Fc region. More particularly, the present invention concerns Fc region-containing polypeptides that have altered effector function as a consequence of one or more amino acid modifications in the Fc region thereof. | 11-06-2008 |
20080279847 | Humanized Anti-Tag-72 Monoclonal Antibodies - The present invention relates to humanized antibodies specific to a tumor associated glycoprotein, TAG-72, and anticancer compositions comprising the humanized antibodies. In detail, the present invention relates to a humanized antibody which has enhanced antigen binding affinity by mutating a heavy chain of a humanized antibody PXA/HzK specific for TAG-72, an antibody which is prepared by replacing a light chain of the humanized antibody with a human light chain, and anticancer compositions including the antibodies. | 11-13-2008 |
20080279848 | Methods of treating lupus using CD4 antibodies - Methods of treating lupus, including systemic lupus erythematosus, cutaneous lupus erythmetosus, and lupus nephritis, are provided. The methods involve administration of a combination of a non-depleting CD4 antibody and another compound used clinically or experimentally to treat lupus. Methods of treating lupus nephritis by administration of a non-depleting CD4 antibody that results in an improvement in renal function and/or a reduction in proteinuria or active urinary sediment are also provided. Methods of treating lupus or decreasing autoantibody titer by administration of a non-depleting CD4 antibody are also provided. Methods of treating multiple sclerosis by administration of a non-depleting CD4 antibody, optionally in combination with another compound used clinically or experimentally to treat MS, are described. Methods of treating transplant recipients and subjects with rheumatoid arthritis, asthma, psoriasis, Crohn's disease, ulcerative colitis, and Sjogren's syndrome are also provided. | 11-13-2008 |
20080279849 | Lymphoid Chemokines In The Diagnosis, Monitoring And Treatment Of Inflammatory Disease - Experimental autoimmune encephalomyelitis (EAE) is a Th1-mediated autoimmune disease of the central nervous system that is widely used as an animal model of multiple sclerosis (MS). In this study it was demonstrate that CXCL13, a chemokine involved in the development of secondary lymphoid tissues, is expressed in CD11c+ myeloid cells that accumulate in EAE lesions. Blockade or deficiency of CXCL13 ameliorates clinical EAE, both during acute and relapsing stages. CXCL13 deficiency did not inhibit the priming or differentiation of autoimmune effector T-cells in the periphery, but appeared to exert its effects during the effector phase of pathogenesis. These findings indicate that reagents that antagonize or inhibit CXCL13 are useful for the treatment of neuroinflammatory diseases such as MS. | 11-13-2008 |
20080279850 | B-Cell Reduction Using CD37-Specific and CD20-Specific Binding Molecules - The present invention generally provides methods for B-cell reduction in an individual using CD37-specific binding molecules. In particular, the invention provides methods for B-cell reduction using CD37-specific binding molecules alone, or a combination of CD37-specific binding molecules and CD20-specific binding molecules, in some instances a synergistic combination. The invention further provides materials and methods for treatment of diseases involving aberrant B-cell activity. In addition, the invention provides humanized CD37-specific binding molecules. | 11-13-2008 |
20080279851 | ANTI-ICOS ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY, TRANSPLANTATION AND AUTOIMMUNE DISEASE - The present invention provides anti-human ICOS antibodies with increased effector function. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human ICOS antigen and that may mediate ADCC, CDC, and/or antibody-dependent phagocytosis (opsonisation) for the treatment and prevention of T cell-mediated diseases and disorders, such as, but not limited to, chronic infection, autoimmune disease or disorder, inflammatory disease or disorder, graft-versus-host disease (GVHD), transplant rejection, and T cell proliferative disorder. | 11-13-2008 |
20080279852 | Methods of treatment with glycosylated antibodies - The present invention relates to methods of treating a human patient suffering from rheumatoid arthritis, comprising:
| 11-13-2008 |
20080286269 | Anti-alpha(v)beta(6) antibodies and uses thereof - The present invention is in the fields of cell biology, immunology and oncology. The invention provides humanized antibodies that recognize α | 11-20-2008 |
20080286270 | Stabilized liquid anti-RSV antibody formulations - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 11-20-2008 |
20080286271 | Methods and Compositions for Modulating Tweak and Fn14 Activity - Agonists and antagonists which modulate the activity of TWEAK and TWEAK receptor are provided. The methods, compositions and kits of the invention may be employed in the treatment of disorders such as cancer and immune-related diseases. | 11-20-2008 |
20080286272 | EphA3 Antibodies for the Treatment of Solid Tumors - The invention provides methods and compositions comprising anti-EphA3 antibodies for the treatment of solid tumors. | 11-20-2008 |
20080286273 | Knowledge-Based Proliferation Signatures and Methods of Use - The present invention provides methods and compositions for predicting patient responses to cancer treatment using a proliferation gene signature. These methods can comprise measuring in a biological sample from a patient the levels of gene expression of a group of the genes designated herein. The present invention also provides for microarrays that can detect expression from a group of genes. | 11-20-2008 |
20080292620 | PRLR-Specific Antibody and Uses Thereof - PRLR-specific antibodies are provided, along with pharmaceutical compositions containing such antibody, kits containing a pharmaceutical composition, and methods of preventing and treating cancer. | 11-27-2008 |
20080292621 | Optimized Fc Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 11-27-2008 |
20080292622 | METHODS OF EVALUATING PATIENTS - Methods of treating patients and evaluating patients for disease stage and/or severity are disclosed. | 11-27-2008 |
20080292623 | MAMMALIAN CELL MEMBRANE PROTEINS; RELATED REAGENTS - The purification and isolation of various genes which encode mammalian cell surface polypeptides. Nucleic acids, proteins, antibodies, and other reagents useful in modulating development of cells, e.g., lymphoid and myeloid, are provided, along with methods for their use. | 11-27-2008 |
20080292624 | Method of detecting and treating tuberous sclerosis complex associated disorders - Disclosed are methods of detecting and treating tuberous sclerosis complex associated disorders. Also disclosed are methods of identifying agents for treating tuberous sclerosis complex associated disorders. | 11-27-2008 |
20080292625 | PREVENTION AND TREATMENT OF CEREBRAL AMYLOID ANGIOPATHY - The invention provides improved agents and methods for treatment of cerebral amyloid angiopathy (CAA) and methods to effect prophylaxis of CAA. The methods can treat CAA concurrently with Alzheimer's disease or separately. The methods can effect prophylaxis of CAA concurrently with Alzheimer's disease or separately. The methods involve administering antibody that is specific for the N-terminus of Aβ or an agent that can induce such an antibody. | 11-27-2008 |
20080292626 | KINESIN INHIBITORS - This invention relates to the compounds of formula (I) shown below. Each variable in formula (I) is defined in the specification. These compounds can be used to treat a kinesin Eg5 protein-mediated disorder. | 11-27-2008 |
20080299113 | Combined treatment with and composition of 6,6-bicyclic ring substituted heterobicyclic protein kinase inhibitor and anti-cancer agents - The present invention provides a method for treating tumors or tumor metastases in a patient, comprising administering to the patient simultaneously or sequentially a therapeutically effective amount of an EGFR kinase inhibitor and an IGF1R inhibitor compound of Formula I combination, with or without additional agents or treatments, such as other anti-cancer drugs or radiation therapy. The invention also encompasses a pharmaceutical composition that is comprised of an EGFR kinase inhibitor and IGF1R inhibitor compound of Formula I combination with a pharmaceutically acceptable carrier. The IGF1R inhibitor is represented by Formula I: | 12-04-2008 |
20080299114 | HUMANEERED ANTI-FACTOR B ANTIBODY - This invention relates to humaneered anti-factor B antibodies and antigen-binding fragments thereof with reduced immunogenicity. The humaneered anti-factor B antibodies and antigen-binding fragments thereof are derived from murine monoclonal antibody 1379, which binds factor B in the third short consensus repeat (“SCR”) domain and selectively inhibits activation of the alternative complement pathway by preventing formation of the C3bBb complex. The invention also relates to methods of treating diseases or disorders in which activation of the alternative complement pathway plays a role, and methods of selectively inhibiting activation of the alternative complement pathway in an individual in need thereof. | 12-04-2008 |
20080299115 | Antibody Variants with Faster Antigen Association Rates - Antibody variants with faster antigen association rates are disclosed. The antibody variants have one or more amino acid alteration(s) in or adjacent to at least one hypervariable region thereof which increase charge complementarity between the antibody variant and an antigen to which it binds. | 12-04-2008 |
20080299116 | Vascular Endothelial Cell Growth Factor Antagonists and Uses Thereof - The present invention provides vascular endothelial cell growth factor (VEGF) antagonists and methods of using VEGF antagonists. VEGF antagonists contemplated by the invention include VEGF antibodies and VEGF receptor fusion proteins. Methods of treating edema and stroke using VEGF antagonists are also provided. | 12-04-2008 |
20080299117 | Treatment Method - The invention provides methods of treating autoimmune diseases using lower doses of anti-CD20 antibodies of 100 mg to 200 mg effective to deplete B cells in the patient. | 12-04-2008 |
20080299118 | FXR Agonists for the Treatment of Malignancies - Provided are certain methods of treating maligancies with farnesoid X receptor agonists. Also provided are certain methods of inducing RECK gene expression with farnesoid X receptor agonists and methods of reducing at least one feature of a cell with farnesoid X receptor agonists | 12-04-2008 |
20080299119 | POLYPEPTIDES HOMOLOGOUS TO VEGF AND BMP1 - The present invention involves the identification and preparation of vascular endothelial growth factor-E (VEGF-E). VEGF-E is a novel polypeptide related to vascular endothelial growth factor (VEGF) and bone morphogenetic protein 1. VEGF-E has homology to VEGF including conservation of the amino acids required for activity of VEGF. VEGF-E can be useful in wound repair, as well as in the generation and regeneration of tissue. | 12-04-2008 |
20080305104 | Cytotoxicity mediation of cells evidencing surface expression of TROP-2 - This invention relates to the staging, diagnosis and treatment of cancerous diseases (both primary tumors and tumor metastases), particularly to the mediation of cytotoxicity of tumor cells; and most particularly to the use of cancerous disease modifying antibodies (CDMAB), optionally in combination with one or more CDMAB/chemotherapeutic agents, as a means for initiating the cytotoxic response. The invention further relates to binding assays, which utilize the CDMAB of the instant invention. The anti-cancer antibodies can be conjugated to toxins, enzymes, radioactive compounds, cytokines, interferons, target or reporter moieties and hematogenous cells. | 12-11-2008 |
20080311115 | ANTI-IL-20 ANTIBODY AND ITS USE IN TREATING IL-20 ASSOCIATED INFLAMMATORY DISEASES - This invention features an antibody specifically binding to human IL-20 (e.g., mAb 7E and a equivalent thereof) and its use in treating an IL-20 associated inflammatory disease, such as atherosclerosis, RA, psoriasis, psoriatic arthritis, bacteria-induced gastric ulcer, and acute renal failure. | 12-18-2008 |
20080311116 | Process for the Determination of Inflammatory Process and Pharmaceutical Compositions for the Treatment Thereof - A method for analyzing extracellular body fluids as to the presence of the Y-box protein YB-1 and fragments thereof, which are secreted by the cell, in order to determine inflammatory processes and malignant diseases in mammals. Also, it relates to the use of YB-1 as a marker and a kit for detecting YB-1, polypeptide fragments of YB-1, and combinations thereof. Also disclosed is a pharmaceutical composition which is used for treating inflammatory processes and malignant diseases and which contains the YB-1 protein, fragments of protein YB-1, and antibodies against the YB-1 protein and/or fragments of protein YB-1. | 12-18-2008 |
20080311117 | Antibodies against PD-1 and uses therefor - This disclosure provides antibodies and antigen-binding fragments that can act as agonists and/or antagonists of PD-1 (Programmed Death 1), thereby modulating immune responses in general, and those mediated by TcR and CD28, in particular. The disclosed compositions and methods may be used for example, in treating autoimmune diseases, inflammatory disorders, allergies, transplant rejection, cancer, and other immune system disorders. | 12-18-2008 |
20080311118 | VASCULAR ENDOTHELIAL CELL GROWTH FACTOR ANTAGONISTS AND USES THEREOF - The present invention provides vascular endothelial cell growth factor (VEGF) antagonists and methods of using VEGF antagonists. VEGF antagonists contemplated by the invention include VEGF antibodies and VEGF receptor fusion proteins. Methods of treating edema and stroke using VEGF antagonists are also provided. | 12-18-2008 |
20080311119 | ANTIBODY FORMULATIONS - Formulations of VLA-4 binding antibody are described. | 12-18-2008 |
20080311120 | AUTOCRINE GROWTH FACTOR RECEPTOR ANTIBODIES AND METHODS - Disclosed herein are antitumor compositions and methods of interfering with the biological activity of PC cell derived growth factor (PCDGF), anti-PCDGF receptor antibodies, fragments thereof, and methods of making anti-PCDGF receptor antibodies. The methods involve inhibiting the proliferation of tumor cells expressing the PCDGF receptor by contacting the surface of the cell with anti-PCDGF receptor antibodies. Anti-PCDGF receptor antibodies are capable of binding to the surface of a cell and interfering with the binding of PCDGF to its receptor. Also provided are compositions comprising anti-PCDGF receptor antibodies and cytotoxic molecules (e.g., toxins, oncotoxins, mitotoxins, immunotoxins, and antisense oligonucleotides). | 12-18-2008 |
20080317744 | Indole and Benzimidazole Derivatives - The present invention relates to new indole and benzimidazole compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds. The compounds of the invention have the following general formula: | 12-25-2008 |
20080317745 | Methods of diagnosing, treating, or preventing plasma cell disorders - The present invention relates to methods and compositions for the diagnosis, treatment, management, or prevention of plasma cell disorders, including systemic light-chain amyloidosis (AL) and multiple myeloma (MM). In particular, the invention encompasses the use of anti-CD32B antibodies, analogs, derivatives or fragments thereof, or compounds or agents that bind to CD32B and modulate CD32B activity in the plasma cells of mammals. The invention also encompasses the use of anti-CD32B antibodies, analogs, derivatives or fragments thereof, or CD32B binding compounds or agents in combination with or in addition to other cancer therapies for the treatment, prevention, management, or amelioration of a plasma cell disorder characterized by the expression of CD32B, or one or more symptoms thereof. The invention further relates to the use of anti-CD32B antibodies, analogs, derivatives or fragments thereof for the detection of aberrant or altered expression of CD32B in plasma cells, to diagnosis and/or characterize a plasma cell disorder. | 12-25-2008 |
20080317746 | Anti-Il2 Antibodies - The invention relates to a humanized monoclonal antibody or fragment thereof which specifically binds to human interleukin-2 (IL2), wherein said humanized monoclonal antibody neutralizes the activity of human IL2 by binding to said human IL2 prior to, during, and/or subsequent to the binding of said human IL2 to the human IL2-receptor, and wherein the light chain variable region of said humanized monoclonal antibody comprises in its second framework region the contiguous amino acid sequence KAPKA at amino acid positions 42-46. | 12-25-2008 |
20080317747 | RECOMBINANT ANTI-CD30 ANTIBODIES AND USES THEREOF - The present invention relates to methods and compositions for the treatment of Hodgkin's Disease, comprising administering proteins characterized by their ability to bind to CD30, or compete with monoclonal antibodies AC10 or HeFi-1 for binding to CD30, and exert a cytostatic or cytotoxic effect on Hodgkin's disease cells in the absence of effector cells or complement. Such proteins include derivatives of monoclonal antibodies AC10 and HeFi-1. The proteins of the invention can be human, humanized, or chimeric antibodies; further, they can be conjugated to cytotoxic agents such as chemotherapeutic drugs. The invention further relates to nucleic acids encoding the proteins of the invention. The invention yet further relates to a method for identifying an anti-CD30 antibody useful for the treatment or prevention of Hodgkin's Disease. | 12-25-2008 |
20080317748 | MAMMALIAN RECEPTOR PROTEINS; RELATED REAGENTS AND METHODS - Nucleic acids encoding mammalian, e.g., primate, receptors, purified receptor proteins and fragments thereof. Antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are described. | 12-25-2008 |
20080317749 | Use of Cytokine Expression to Predict Skin Inflammation; Methods of Treatment - Provided are methods for diagnosing the propensity of a subject to develop skin inflammation, in particular, psoriasis. Also provided are methods of treatment with antagonists of IL-17, IL-19, and/or IL-23. | 12-25-2008 |
20090004181 | Method for Modulating Appetite - The present invention provides a method of modulating appetite and/or body weight in a subject, said method comprising administering to said subject an effective amount of a MIC-1 modulating agent, wherein said agent increases or decreases the amount of MIC-1 present in said subject, or inhibits or enhances the biological activity of present in said subject. | 01-01-2009 |
20090004182 | Methods to Treat or Prevent Viral-Associated Lymphoproliferative Disorders - The disclosure relates to methods to prevent, treat, or slow the progression viral-associated lymphoproliferative disorders, EBV-associated lymphoproliferative disorders, and post-transplant lymphoproliferative disorders. In the methods, a TGF-β antagonist, e.g., an anti-TGF-β antibody is administered to a subject. Methods for treating viral-associated lymphoproliferative disorders and for enhancing T-cell responsiveness to a viral-associated lymphoproliferative disorder by administering a TGF-β antagonist are also described. | 01-01-2009 |
20090004183 | Compositions and Methods for Regulating the Alternative Pathway of Complement - The present invention provides compositions and methods for regulating the alternative complement pathway. | 01-01-2009 |
20090004184 | Polynucleotides and polypeptides associated with the development of rheumatoid arthritis - The present invention is directed to polynucleotides encoding polypeptides associated with the development of rheumatoid arthritis and homologs thereof. The invention further relates to diagnostic and therapeutic methods for utilizing these polynucleotides and polypeptides in the diagnosis, treatment, and/or prevention of rheumatoid arthritis and related disease states. The invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention, and compounds identified thereby. | 01-01-2009 |
20090004185 | AMINO-SUBSTITUTED QUINAZOLINE DERIVATIVES AS INHIBITORS OF BETA-CATENIN/TCF-4 PATHWAY AND CANCER TREATMENT AGENTS - The present invention relates to amino-substituted quinazoline derivatives as inhibitors of β-catenin/tcf-4 pathway, which can be useful in the treatment of cancer; to processes for their preparation; to pharmaceutical compositions comprising them; and to methods of using them. | 01-01-2009 |
20090004186 | EFFECTOR FUNCTION ENHANCED RECOMBINANT ANTIBODY COMPOSITION - The present invention relates to a recombinant antibody composition which is a human IgG1 antibody, comprises a CH2 domain in which amino acids at positions 276 and 339 indicated by the EU index as in Kabat, et al. are replaced by other amino acids and has more improved complement-dependent cytotoxic activity than an antibody comprising a CH2 domain before the amino acids are replaced; a DNA encoding the antibody molecule or a heavy chain constant region of the antibody molecule contained in the recombinant antibody composition; a transformant obtainable by introducing the DNA into a host cell; a process for producing the recombinant antibody composition using the transformant; and a medicament comprising the recombinant antibody composition as an active ingredient. | 01-01-2009 |
20090004187 | POLYMORPHISM IN THE APO(A) GENE PREDICT RESPONSIVENESS TO ACETYLSALICYLIC ACID TREATMENT (RIDKER) - This invention relates to nucleotide polymorphisms in the human Apo(a) gene and to the use of Apo(a) nucleotide polymorphisms in identifying whether a human subject will respond or not to treatment with acetylsalicylic acid. | 01-01-2009 |
20090004188 | Train R: A Cysteine Rich Member of the TNF-Receptor Family - Novel receptor in the TNF family: TRAIN-receptor. | 01-01-2009 |
20090004189 | BIOLOGICAL MARKERS PREDICTIVE OF RHEUMATOID ARTHRITIS RESPONSE TO B-CELL ANTAGONISTS - Methods and assays examining expression of one or more biomarkers in a sample are provided for predicting or indicating the effectiveness of treatment of a rheumatoid arthritis patient with a B-cell antagonist. Methods are provided for identifying patients whose rheumatoid arthritis is likely to be responsive to B-cell-antagonist, anti-rheumatoid arthritis therapy. Methods for treating such patients with B-cell antagonists that incorporate the above methodology are also provided. Further provided are kits and articles of manufacture useful for such methods. | 01-01-2009 |
20090010925 | ANTIBODY VARIANTS - Antibody variants of parent antibodies are disclosed which have one or more amino acids inserted in a hypervariable region of the parent antibody and a binding affinity for a target antigen which is at least about two fold stronger than the binding affinity of the parent antibody for the antigen. | 01-08-2009 |
20090010926 | Extended Treatment of Multiple Sclerosis - Methods for extended treatment of multiple sclerosis are described. | 01-08-2009 |
20090010927 | Mapkap kinase-2 as a specific target for blocking proliferation of P53-defective cells - The present invention relates to compounds and pharmaceutical compositions for treating cellular proliferative disorders, e.g., in patients having one or more p53-deficient cells, screening assays for identifying such compounds, and methods for treating such disorders. | 01-08-2009 |
20090010928 | Anti-anthrax antibody, formulations thereof, and methods of use - The present invention provides an antibody which binds to | 01-08-2009 |
20090010929 | Therapeutic Antibodies, Antibody Fragments and Antibody Conjugates - The present invention provides compositions, including pharmaceutical compositions, comprising an amount of an antibody, antibody fragment or antibody conjugate sufficient to treat Group A | 01-08-2009 |
20090010930 | ANTIBODIES TO VLA-1 - Antibodies that specifically bind to VLA-1 integrin and methods of using these antibodies to treat immunological disorders in a subject. Also included are crystal structures of complexes formed by VLA-1 antibodies and their ligands, and VLA-1 antagonists and agonists identified by using the structure coordinates of these structures. | 01-08-2009 |
20090010931 | COMPOSITIONS AND METHODS FOR RESTORING SENSITIVITY TO TREATMENT WITH HER2 ANTAGONISTS - Methods and compositions for restoring growth inhibition sensitivity to a tumor cell resistant to growth inhibition by HER2 antagonists. The methods involve administering a PCDGF antagonist to the cell in an amount effective to stimulate or restore growth inhibition sensitivity to HER2 antagonists. The invention also provides treatment regimens, and therapeutic compositions comprising an HER2 antagonist and a PCDGF antagonist. | 01-08-2009 |
20090010932 | GB VIRUS C (HEPATITIS G VIRUS) FOR THE TREATMENT OF HIV - GB virus C (GBV-C or hepatitis G virus) is a flavivirus that frequently leads to chronic viremia in humans. The invention provides compositions and methods involving an anti-GBV-C antibody or other GBV-C binding agent, or a GBV-C antigen, for inhibiting and treating HIV infections. | 01-08-2009 |
20090017017 | Anti-rhesus d recombinant polyclonal antibody and methods of manufacture - The invention relates to a method for manufacturing an anti-RhD recombinant polyclonal antibody composition (anti-RhD rpAb). The method comprises obtaining a collection of cells transfected with a library of anti-RhD antibody expression vectors, wherein each cell in the collection is capable of expressing from a VH and VL comprising nucleic acid segment, one member of the library, which encodes a distinct member of anti-RhD recombinant polyclonal antibody composition and which is located at the same site in the genome of individual cells in said collection. The cells are cultured under suitable conditions for expression of the recombinant polyclonal antibody, which is obtained from the cells or culture supernatant. The nucleic acid segments encoding the anti-RhD rpAb is introduced into the cells by transfection with a library of vectors for site-specific integration. The present method is suitable for manufacturing anti-RhD rpAb, thereby making available a superior replacement of plasma-derived prophylactic and therapeutic immonoglobulin products. | 01-15-2009 |
20090017018 | USES OF MAMMALIAN CYTOKINE: RELATED REAGENTS - Provided are methods of modulating dendritic cell activity using agonists or antagonists of a mammalian cytokine. Also provided are methods of treating immune disorders. | 01-15-2009 |
20090017019 | METHODS AND COMPOSITIONS FOR MODULATING BMP-10 ACTIVITY - Methods and compositions for modulating cardiac, renal and vascular cell function and homeostasis using agonists and antagonists of BMP-10 are disclosed. In particular, methods for treating, preventing and/or diagnosing BMP-10-associated vascular, renal, fibrotic and cardiac conditions and/or disorders are disclosed. Screening methods for evaluating BMP-10 modulators, e.g., agonists and antagonists, are also disclosed. | 01-15-2009 |
20090017020 | RECOMBINANT IL-5 ANTAGONISTS USEFUL IN TREATMENT OF IL-5 MEDIATED DISORDERS - Chimeric, humanized and other IL-5 mAbs, derived from high affinity neutralizing mAbs, pharmaceutical compositions containing same, methods of treatment and diagnostics are provided. | 01-15-2009 |
20090017021 | Methods and compositions for inducing innate immune responses - The invention relates to TLR ligand formulations that comprise immune stimulating complexes and their use in inducing innate immunity. | 01-15-2009 |
20090017022 | SULFATASES AND METHODS OF USE THEREOF - Novel sulfatases and polypeptides related thereto, as well as nucleic acid compositions encoding the same, are provided. The subject polypeptides and nucleic acid compositions find use in a variety of applications, including various diagnostic and therapeutic agent screening applications. Also provided are methods of inhibiting tumor-induced angiogenesis and methods of treating disease conditions associated therewith, particularly by administering an inhibitor of a subject sulfatase. | 01-15-2009 |
20090017023 | FcGammaRIIB Specific Antibodies and Methods of Use Thereof - The present invention relates to antibodies or fragments thereof that specifically bind FcγRIIB, particularly human FcγRIIB, with greater affinity than said antibodies or fragments thereof bind FcγRIIA, particularly human FcγRIIA. The invention provides methods of enhancing the therapeutic effect of therapeutic antibodies by administering the antibodies of the invention to enhance the effector function of the therapeutic antibodies. The invention also provides methods of enhancing efficacy of a vaccine composition by administering the antibodies of the invention. | 01-15-2009 |
20090017024 | Methods and Compositions for the Treatment of Cancer, Tumors, and Tumor-Related Disorders - Described herein are compositions and methods for using these compositions in the treatment of cancer, tumors, and tumor-related disorders in a subject. | 01-15-2009 |
20090017025 | Combinations Comprising a CDK Inhibitor and a Growth Factor Antibody or Anti-Mitotic - The present invention provides a combination comprising a compound A of formula (I) as set forth in the specification or a pharmaceutically acceptable salt thereof, and an antibody inhibiting a growth factor or its receptor and/or an antimitotic agent or a derivative or prodrug thereof, useful in the treatment of tumors. The chemical name of compound A is 8-[4-(4-methyl-piper-azin-1-yl)-phenylamino]-1,4,4-trimethyl-4,5-dihydro-1H-pyrazolo[4,3-h]quinazoline-3-carboxylic acid methylamide. | 01-15-2009 |
20090022714 | Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist - The present invention provides a method of reducing or inhibiting tumor growth in a mammal comprising treating the mammal with an effective amount of a combination of a VEGFR antagonist and an EGFR antagonist. | 01-22-2009 |
20090022715 | Antibodies that bind human protein tyrosine phosphatase beta (HPTPbeta) and uses thereof - Antibodies and antigen binding fragments thereof that bind to human protein tyrosine phosphatase beta (HPTPβ), and uses thereof. | 01-22-2009 |
20090022716 | COMBINATION METHODS OF INHIBITING TUMOR GROWTH WITH A VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR ANTAGONIST - The present invention provides a method of reducing or inhibiting tumor growth in a mammal comprising treating the mammal with an effective amount of a combination of a VEGF receptor antagonist and radiation, chemotherapy, and/or an additional receptor antagonist. | 01-22-2009 |
20090022717 | ANTIBODIES THAT BIND CXCR7 EPITOPES - Antibodies that bind CXCR | 01-22-2009 |
20090022718 | Methods of treating a blood pathology using anti-TNF antibodies and fragments thereof - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 01-22-2009 |
20090022719 | Preventive and/or therapeutic method for systemic lupus erythematosus comprising anti-IL-6 receptor antibody administration - A preventive and/or therapeutic agent for systemic lupus erythematosus comprising an anti-interleukin-6 (IL-6) receptor antibody as an active ingredient. | 01-22-2009 |
20090028850 | Prolongation of survival of an allograft by inhibiting complement activity - Methods of prolonging survival of allotransplanted cells, tissues or organs are presented. These methods are directed to administering to the allotransplant recipient an inhibitor of complement activity together with one or more immunosuppressants. The inhibitor of complement activity is administered chronically. These methods have been determined to aid in preventing chronic rejection of allografts. These methods can additionally be used in cases in which the recipient has been presensitized to the allograft or in which there is an ABO mismatch between the allograft and the recipient. | 01-29-2009 |
20090028851 | Novel Antibodies Directed to the Mammalian Eag1 Ion Channel Protein - The present invention relates to a particularly advantageous antibody, antibody fragment or derivative thereof, which specifically binds to/interacts with at least one epitope of the extracellular or intracellular domain or the mammalian EAG1 ion channel and to nucleic acid molecules encoding the same and to vectors comprising said nucleic acid molecules. The invention additionally relates to methods for the preparation of said antibody, antibody fragments or derivatives thereof and to pharmaceutical compositions comprising the same. Furthermore, the use of said antibody, antibody fragment or derivative thereof and also diagnostic compositions comprising said components are disclosed in the specification. The invention also relates to a method of assessing for the presence of EAG1 expressing cells and for a method of blocking EAG1 function in said cells. The invention further relates to a method of treating diseases with the help or said antibody or antibody fragment or derivative thereof. | 01-29-2009 |
20090028852 | Roles For Dual Endothelin-1/Angiotensin II Receptor (DEAR) In Hypertension and Angiogenesis - The present application is directed to the identification of mutations and/or polymorphisms in the Dual Endothelin-1/Angiotensin II Receptor (Dear) that indicate susceptibility to, or show current affliction with, hypertension. Additionally, the present invention discloses methods for the modulation of angiogenesis via the regulation of Dear. | 01-29-2009 |
20090028853 | TREATMENT AND PREVENTION OF CHRONIC ASTHMA USING ANTAGONISTS OF INTEGRIN ALPHAvBETA6 - The present invention relates to methods of asthma treatment and prevention using α | 01-29-2009 |
20090028854 | sc(Fv)2 SITE-DIRECTED MUTANT - To solve the above-mentioned problems, the present inventors introduced site-specific mutations into sc(Fv)2 and examined the stabilizing effects on sc(Fv)2. As a result, they succeeded for the first time in significantly increasing the Tm value of sc(Fv)2 by amino acid substitutions. Furthermore, they discovered that sc(Fv)2 is stabilized by introducing site-specific mutations into sc(Fv)2. | 01-29-2009 |
20090028855 | INHIBITORS OF AKT/PKB WITH ANTI-TUMOR ACTIVITY - The subject invention concerns materials and methods for inhibiting the Akt/PKB pathway. In one embodiment, a compound of the invention inhibits kinase activity and/or phosphorylation levels of Akt proteins. The subject invention also concerns methods for inhibiting or killing a cancer cell or other cell in which expression of an Akt protein is elevated or constitutively active, comprising contacting the cell with an effective amount of a compound of formula I. The subject invention also concerns methods for treating cancer or a tumor in a person or animal comprising administering all effective amount of a compound of formula I to the person or animal. | 01-29-2009 |
20090028856 | Anti-CD79B Antibodies and Immunoconjugates and Methods of Use - The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same. | 01-29-2009 |
20090028857 | PD-1 ANTIBODIES IN COMBINATION WITH A CYTOKINE-SECRETING CELL AND METHODS OF USE THEREOF - The present invention relates to a method of enhancing the anti-tumor response in a mammal. More particularly, the invention is concerned with combinations comprising a cytokine-secreting cell and an anti-PD-1 antibody, and methods of administering the combination for enhanced immune response to tumor cells in a patient with a cancer. | 01-29-2009 |
20090028858 | SUBSTITUTED QUINOLINE DERIVATIVES - The present invention relates to new substituted quinoline compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds. The compounds of the invention have the following general formula: | 01-29-2009 |
20090035303 | METHODS OF DETECTING METHYL TRANSFERASE ACTIVITY AND METHODS OF SCREENING FOR METHYL TRANSFERASE ACTIVITY MODULATORS - The invention features a method for determining methyl transferase activity of a polypeptide and screening for modulators of methyl transferase activity. The invention further provides a method or pharmaceutical composition for prevention or treating of colorectal cancer or hepatocellular carcinoma using the modulator. | 02-05-2009 |
20090035304 | Use of Tgf-beta Antagonists to Limit Nephrotoxicity of Immunosuppressive Agents - The disclosure relates to methods of ameliorating nephrotoxic side effects of immunosuppressive agents whose immunosuppressive activity is mediated via upregulation of TGF-β such as, for example, cyclosporine (CsA). The disclosure provides treatment modalities for use in patients that require immunosuppression, e.g., patients at risk of transplant rejection or having an autoimmune disease. In the methods of the invention, a TGF-β antagonist, e.g., an anti-TGF-β antibody, is administered to a patient treated with an immunosuppressive agent. Such a TGF-β antagonist is administered in a therapeutically effective amount sufficient to alleviate the nephrotoxic effects of the immunosuppressive agent without substantially interfering with immunosuppressive activity of the agent. | 02-05-2009 |
20090035305 | Compositions and Methods for Treating Viral Infection - Described are methods of treating viral disease using compounds that block inhibitory NK cell receptors, thereby reducing their inhibition of NK cell cytotoxicity in killing infected target cells. In one embodiment, the compound is an antibody binding, for example, one or more of the human KIR2DL1, KIR2DL2, and KIR2DL3 receptors. In another embodiment, the method further comprises administering a therapeutic antibody or fusion protein which binds an antigen expressed on cells infected with the virus. | 02-05-2009 |
20090035306 | QUINAZOLINONE MODULATORS OF TGR5 - The present invention relates to quinazolinone compounds useful as modulators of TGR5 and methods for the treatment or prevention of metabolic, cardiovascular, and inflammatory diseases. | 02-05-2009 |
20090035307 | Abeta CONFORMER SELECTIVE ANTI-Abeta GLOBULOMER MONOCLONAL ANTIBODIES - The subject invention relates to monoclonal antibodies that may be used in the treatment and diagnosis of Alzheimer's Disease. In particular, the present invention relates to monoclonal antibodies referred to as 10F4 and 3C5 and to other monoclonal antibodies (e.g., murine, human or humanized) having similar properties thereto. | 02-05-2009 |
20090035308 | Methods for using and identifying modulators of Delta-like 4 - In certain embodiments, this present invention provides methods of identifying and using agonists and antagonists of Delta-like 4 (Dll4) signaling. | 02-05-2009 |
20090035309 | Substituted Benzazoles and Methods of Their Use as Inhibitors of RAF Kinase - New substituted benzazole compounds, compositions and methods of inhibition of Raf kinase activity in a human or animal subject are provided. The new compounds compositions may be used either alone or in combination with at least one additional agent for the treatment of a Raf kinase mediated disorder, such as cancer. | 02-05-2009 |
20090035310 | CANCER TREATMENT - Pharmaceutical compositions and methods for inhibiting tumor growth and/or for inducing apoptosis are provided. Such compositions comprise at least one polypeptide of contiguous amino acids 1-198, 197-454, or 896-1150 of CARP-1 protein, and derivatives thereof, and may optionally comprise one or more cancer chemotherapeutic agents. Also provided are plasmids encoding the polypeptides, and methods of using the polypeptides and plasmids to inhibit cancer cell growth, including in mammals. | 02-05-2009 |
20090035311 | Identification and use of prognostic and predictive markers in cancer treatment - The present invention provides a method of screening for markers useful in predicting the efficacy of the treatment of a specified cancer that includes: (a) constructing a tissue microarray from a tissue bank comprising multiple tissue samples that are annotated with clinical follow-up data; (b) labeling polynucleic acid probes specific for oncogenes or cancer-associated genes known to be potential amplicons; (c) performing fluorescent in situ hybridization analysis on the tissue microarray; and (d) correlating the result of the fluorescent in situ hybridization with the clinical follow-up data. In addition, the present invention provides a method of treating breast cancer that includes measuring the expression levels or amplification of HTPAP in a patient having breast cancer and then providing a patient having increased levels of HTPAP expression or HTPAP amplification with therapeutic quantities of at least one compound that interferes with the phosphatidic acid phosphatase activity of HTPAP. The present invention also encompasses a method of treating breast cancer that includes screening a breast cancer patient for amplification of the cMYC gene and then treating a patient having amplification of the cMYC gene with therapeutic quantities of a compound that interferes with HER | 02-05-2009 |
20090041762 | Methods of treating ankylosing spondylitis using anti-TNF antibodies and peptides of human tumor necrosis factor - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, including ankylosing spondylitis, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 02-12-2009 |
20090041763 | Composition Comprising Humanized Antibody HBBK4 for the Treatment of Cancer and the Use Thereof - The present invention is related to a pharmaceutical composition comprising humanized anti-4-1BB antibody (HBBK4) for treating cancer by inducing increase of CD11+CD8+ T cell and IFN-γ, and inhibiting proliferation of cancer cells, together with a pharmaceutically acceptable carrier and the use. Accordingly, it can be useful in the prevention or treatment of cancer without adverse response. | 02-12-2009 |
20090041764 | Methods for the treatment of muscular dystrophy associated with dysferlin-deficiency - The use of therapeutics capable of inhibiting complement such as an anti-C5 antibody to treat muscular dystrophy associated with dysferlin-deficiency is disclosed. | 02-12-2009 |
20090041765 | Materials and methods for improved immunoglycoproteins - Immunoglycoproteins, including antibodies, with improved ADCC and altered glycosylation patterns are provided. Also provided are cell culturing methods and media for producing such immunoglycoproteins, and therapeutic uses of such immunoglycoproteins. | 02-12-2009 |
20090041766 | ANTIBODIES FOR INHIBITING BLOOD COAGULATION AND METHODS OF USE THEREOF - The invention includes antibodies that provide superior anti-coagulant activity by binding native human TF with high affinity and specificity. Antibodies of the invention can effectively inhibit blood coagulation in vivo. Antibodies of the invention can bind native human TF, either alone or present in a TF:VIIa complex, effectively preventing factor X binding to TF or that complex, and thereby reducing blood coagulation. Preferred antibodies of the invention specifically bind a conformational epitope predominant to native human TF, which epitope provides an unexpectedly strong antibody binding site. | 02-12-2009 |
20090041767 | PHARMACEUTICAL COMBINATIONS - Pharmaceutical combinations comprising an α5β1 antagonist in combination with a tyrosine kinase inhibitor. In some embodiments, the α5β1 antagonist is volociximab. In some embodiments, the tyrosine kinase inhibitor is sunitinib or a pharmaceutically acceptable salt thereof. The invention also relates to methods for treating cancer by administering the pharmaceutical combinations to a subject. | 02-12-2009 |
20090041768 | Modified Fc molecules - The present invention concerns compositions of matter, for example, but not limited to, modified antibodies, in which one or more biologically active peptides are incorporated into a loop region of a non-terminal domain of an immunoglobulin Fc domain. | 02-12-2009 |
20090047277 | RECOMBINANT IL-9 ANTIBODIES AND USES THEREOF - The present invention provides novel antibodies that immunospecifically bind to an IL-9 polypeptide and compositions comprising said antibodies. The present invention also provides methods and compositions preventing, treating, managing, and/or ameliorating diseases and disorders associated with aberrant expression and/or activity of IL 9 or IL-9 receptor or subunits thereof, autoimmune diseases, inflammatory diseases, proliferative diseases, and infections comprising administration of one or more antibodies thereof that immunospecifically bind to an IL-9 polypeptide. The invention also encompasses methods and compositions for diagnosing, monitoring, and prognosing these disorders. The present invention further relates to articles of manufacture and kits comprising antibodies that immunospecifically bind to an IL-9 polypeptide. | 02-19-2009 |
20090047278 | Novel Combinational Use of Sulfonamide Compound - The present invention relates to a pharmaceutical composition, a kit and a method for treating cancer, comprising a sulfonamide compound in combination with a substance having an EGF inhibitory activity. | 02-19-2009 |
20090047279 | (R)-N-Stereoisomers of 7,8-Saturated-4,5-Epoxy-Morphinanium Analogs - Novel (R)—N-stereoisomers of 7,8-saturated-4,5-epoxy-morphinanium analogs are disclosed. Pharmaceutical compositions containing the (R)—N-stereoisomers of 7,8-saturated-4,5-epoxy-morphinanium analogs and methods for their pharmaceutical uses are also disclosed. Such analogs are disclosed as being useful in treating, among varying conditions, opioid-induced constipation. | 02-19-2009 |
20090047280 | Antibody inhibiting infection of papillomavirus - The present invention relates generally to an antibody that binds specifically to a neutralization epitope at the surface of papillomavirus (residues 36-49 of the minor capsid L2) that does not interfere with virus entry into endosomes and lysosomes. This antibody neutralizes infection of the virus in a dose dependent manner. | 02-19-2009 |
20090053211 | Optimized Fc variants - The present invention relates to optimized Fc variants, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants. | 02-26-2009 |
20090053212 | HUMANIZED ANTI-HUMAN OSTEOPONTIN ANTIBODY - The present invention provides a humanized anti-human osteopontin antibody having better activities (antigen binding activity, leukocyte migration inhibitory activity and the like) and/or stability (resistance to heat, low-pH conditions, denaturants and the like) than those of conventional anti-human osteopontin antibodies. | 02-26-2009 |
20090053213 | Anti-Gm-Csf Antibodies and Uses Therefor - The present invention provides recombinant antigen-binding regions, antibodies and functional fragments thereof that are specific for GM-CSF, which plays an integral role in various disorders or conditions. These antibodies, accordingly, can be used to treat, for example, inflammatory diseases such as rheumatoid arthritis. Antibodies of the invention also can be used in the diagnostics field, as well as for further investigating the role of GM-CSF in the progression of various disorders. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. | 02-26-2009 |
20090053214 | Humanised Anti-MAG Antibody or Functional Fragment Thereof - The present invention relates to altered antibodies to myelin associated glycoprotein (MAG), pharmaceutical formulations containing them and to the use of such antibodies in the treatment and/or prophylaxis of neurological diseases/disorders. | 02-26-2009 |
20090053215 | Cytotoxicity mediation of cells evidencing surface expression of CD63 - This invention relates to the diagnosis and treatment of cancerous diseases, particularly to the mediation of cytotoxicity of tumor cells; and most particularly to the use of cancerous disease modifying antibodies (CDMAB), optionally in combination with one or more chemotherapeutic agents, as a means for initiating the cytotoxic response. The invention further relates to binding assays which utilize the CDMABs of the instant invention. | 02-26-2009 |
20090053216 | Treatment with Anti-VEGF Antibodies - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents. | 02-26-2009 |
20090053217 | Human anti-VEGF polyclonal antibodies and uses thereof - This invention relates to IVIG and fragments thereof and their use, specifically, provided herein are compositions and methods of inhibiting VEGF or VEGF receptor using polyclonal antibodies (pAb), or fragments thereof derived from human immunoglobulins. | 02-26-2009 |
20090053218 | FcGammaRIIB Specific Antibodies and Methods of Use Thereof - The present invention relates to antibodies or fragments thereof that specifically bind FcγRIIB, particularly human FcγRIIB, with greater affinity than said antibodies or fragments thereof bind FcγRIIA, particularly human FcγRIIA. The present invention also encompasses the use of an anti-FcγRIIB antibody or an antigen-binding fragment thereof, as a single agent therapy for the treatment, prevention, management, or amelioration of a cancer, preferably a B-cell malignancy, particularly, B-cell chronic lymphocytic leukemia or non-Hodgkin's lymphoma, an autoimmune disorder, an inflammatory disorder, an IgE-mediated allergic disorder, or one or more symptoms thereof. The present invention also encompasses the use of an anti-FcγRIIB antibody or an antigen-binding fragment thereof, in combination with other cancer therapies. The present invention provides pharmaceutical compositions comprising an anti-FcγRIIB antibody or an antigen-binding fragment thereof, in amounts effective to prevent, treat, manage, or ameliorate a cancer, such as a B-cell malignancy, an autoimmune disorder, an inflammatory disorder, an IgE-mediated allergic disorder, or one or more symptoms thereof. The invention further provides methods of enhancing the therapeutic effect of therapeutic antibodies by administering the antibodies of the invention to enhance the effector function of the therapeutic antibodies. The invention also provides methods of enhancing efficacy of a vaccine composition by administering the antibodies of the invention with a vaccine composition. | 02-26-2009 |
20090053219 | METHODS AND COMPOSITIONS FOR INCREASING ALPHA-L-IDURONIDASE ACTIVITY IN THE CNS - Provided herein are methods and compositions for treating a subject suffering from a deficiency in α-L-Iduronidase in the CNS. The methods include systemic administration of a bifunctional fusion antibody comprising an antibody to a human insulin receptor and an α-L-Iduronidase. A therapeutically effective systemic dose is based on the specific CNS uptake characteristics of human insulin receptor antibody-α-L-Iduronidase fusion antibodies as described herein. | 02-26-2009 |
20090053220 | METHODS AND COMPOSITIONS FOR THE INHIBITION OF HIV INFECTION OF T CELLS - The present invention is based upon the surprising discovery that exposure of a non-resistant HIV to a first entry inhibitor, such as an anti-CD4 antibody or a co-receptor inhibitor, which like all current HIV drugs selects for mutations that result in a resistant HIV, surprisingly results in HIV viruses much more susceptible to neutralization by a second entry inhibitor, such as soluble CD4 (sCD4) or an HIV gp41 inhibitor. Therefore, the present invention provides methods and compositions for inhibiting HIV-1 infection in a subject that overcomes the problem of drug resistance. | 02-26-2009 |
20090053221 | IMMUNE RESPONSE ENHANCING GLUCAN - This invention discloses a composition for enhancing the protective immunity in a subject, comprising an effective amount of a β-glucan and a vaccine, wherein the β-glucan enhances the immune response of the vaccine against cancer or infectious agents. The infectious agents can be viruses, fungi, bacteria or parasites. In one embodiment, the β-glucan is derived from yeast and comprises side chains attached to a β-(1,3) backbone. In another embodiment, the vaccine comprises an antibody and whole tumor cells. The invention also provides a method of enhancing protective immunity using said composition. | 02-26-2009 |
20090053222 | Methods of Treating Cancer by Administering Antibodies to CD200 - Methods and compositions for regulating immunity are disclosed. For enhancing an immune response, agents that inhibit OX-2 are administered. Such methods are useful in treating cancer. For suppressing an immune response, an OX-2 protein or a nucleic acid encoding an OX-2 protein is administered. Such methods are useful in preventing graft rejection, fetal loss, autoimmune disease, allergies and in inducing tumor cell growth. | 02-26-2009 |
20090060907 | Antibody against secreted N-terminal peptide of GPC3 present in blood or C-terminal peptide of GPC3 - Disclosed is an antibody against a secreted form of GPC3 capable of detecting a secreted form of glypican 3 (GPC3) in a test sample. It is possible to determine whether a subject suffers from cancer, in particular hepatoma. Also disclosed is an antibody against GPC as well as a cell disrupting agent and an anti-cancer agent comprising the same, which can disrupt cells, in particular cancer cells. | 03-05-2009 |
20090060908 | Monoclonal Antibodies Against Prostate Specific Membrane Antigen (PSMA) Lacking in Fucosyl Residues - The invention pertains to anti-PSMA antibodies that lack fucosyl residues. The antibodies of the invention exhibit increased antibody-dependent cellular cytotoxicity (ADCC) activity as compared to the fucosylated form of the antibodies. The invention also provides host cells that express the anti-PSMA antibodies that lack fucosyl residues, wherein the host cells are deficient for a fucosyl transferase. Methods of using the antibodies to inhibit the growth of PSMA+ cells, such as tumor cells, are also provided. | 03-05-2009 |
20090060909 | ANTIBODY ANTAGONISTS OF VE-CADHERIN WITHOUT ADVERSE EFFECTS ON VASCULAR PERMEABILITY - The murine epitope sequence recognized by antibody E4B9 shares 100% homology with human VE-cadherin, so this antibody was examined to determine if it cross-reacts with human VE-cadherin. Western-blot analysis of several VE-cadherin expressing human and murine cells indicated that E4B9 indeed cross-reacts with human VE-cadherin (FIG. | 03-05-2009 |
20090060910 | COVALENT DIABODIES AND USES THEREOF - The present invention is directed to diabody molecules and uses thereof in the treatment of a variety of diseases and disorders, including immunological disorders, infectious disease, intoxication and cancers. The diabody molecules of the invention comprise two polypeptide chains that associate to form at least two epitope binding sites, which may recognize the same or different epitopes on the same or differing antigens. Additionally, the antigens may be from the same or different molecules. The individual polypeptide chains of the diabody molecule may be covalently bound through non-peptide bond covalent bonds, such as, but not limited to, disulfide bonding of cysteine residues located within each polypeptide chain. In particular embodiments, the diabody molecules of the present invention further comprise an Fc region, which allows antibody-like functionality to engineered into the molecule. | 03-05-2009 |
20090060911 | ENHANCEMENT OF ANTIBODY-MEDIATED IMMUNE RESPONSES - The present invention is related to enhancing the function of anti-tumor antibodies by regulating FcγRIIB-mediated activity. In particular disrupting SHIP activation by FcγRIIB enhances cytotoxicity elicited by a therapeutic antibody in vivo in a human. The invention further provides an antibody, e.g., an anti-tumor antibody, with a variant Fc region that results in binding of the antibody to FcγRIIB with reduced affinity. A variety of transgenic mouse models demonstrate that the inhibiting FcγRIIB molecule is a potent regulator of cytotoxicity in vivo. | 03-05-2009 |
20090060912 | SMALL MOLECULE PI 3-KINASE INHIBITORS AND METHODS OF THEIR USE - Compounds having formula I are provided where the variables have the values described herein. | 03-05-2009 |
20090060913 | COMBINATION THERAPY WITH TYPE I AND TYPE II ANTI-CD20 ANTIBODIES - The present invention is directed to a combination therapy involving a type I anti-CD20 antibody and a type II anti-CD20 antibody for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. | 03-05-2009 |
20090060914 | DEIMMUNIZED MONOCLONAL ANTIBODIES FOR PROTECTION AGAINST HIV EXPOSURE AND TREATMENT OF HIV INFECTION - This invention is directed to deimmunized antibodies that are useful as immunotherapeutic drugs against Human Immunodeficiency Virus (HIV) and CD4-mediated autoimmune disorders. More specifically, antibodies expressed by clones, Clone 7 containing the recombinant genes B4DIVHv1/VK1CHO#7, Clone 16 containing the recombinant genes B4DIVHv1/VK1#16, and clone 21 containing the recombinant genes B4DIVHv1/VK1#21, are derived from mouse monoclonal B4 antibody (mAb B4). The antibodies were produced by removing particular murine determinants recognized as foreign by the human immune system. These recombinant antibodies were generated by the chimerization and deimmunization of the Fv region of mouse monoclonal antibody (mAb) B4. For improved safety, the coding sequence may further be mutated to express an aglycosylated IgG | 03-05-2009 |
20090068173 | NOVEL CC-CHEMOKINE ANTAGONISTS - A novel CC-chemokine binding protein is isolated from the saliva of | 03-12-2009 |
20090068174 | THERAPEUTIC ALKALINE PROTEASE COMPOSITIONS AND USE IN FACILITATING THE TRANSPORT OF AGENTS ACROSS THE GASTROINTESTINAL MUCOSAL LINING - A method of treating an inflammatory condition involving TNF-α in a mammal by administering to a patient a composition with an effective amount of an isolated alkaline protease in an amount effective to inactive TNF-α. The invention also involves compositions, including pharmaceutical compositions containing an isolated alkaline protease in an amount effective to inactive TNF-α especially those from | 03-12-2009 |
20090068175 | Optimized FC Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 03-12-2009 |
20090068176 | HUMAN NEUTRALIZING ANTIBODIES AGANST HEMOLYTIC UREMIC SYNDROME - Human and humanized monoclonal antibodies which binds specifically to subunit A of Shiga like toxin II have been developed which are effective to prevent or ameliorate one or more symptoms of HUS in a human. Effective dosages for treatment or prevention range from approximately 0.1 to 5.0 mg of antibody/kg of patient weight. The examples demonstrate the preferred dosage ranges based on the pig model, and what is being tested in phase I clinical trials. Antibodies are preferably transfused over a period of two hours, although this will depend on the patient and the disease state at the time of treatment. Preferred dosages for treatment of humans are between 0.1 mg/kg-5.0 mg/kg of 5C120, or an equivalent dosage of another antibody to subunit A of STX2. In the most preferred embodiments, dosages of 0.1 mg/kg, 0.5 mg/kg, or 5.0 mg/kg of 5C12 (low dose, anticipated therapeutic dose based on animal data and high dose) are administered. | 03-12-2009 |
20090068177 | Optimized Fc variants and methods for their generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 03-12-2009 |
20090068178 | Compositions and Methods for the Treatment of Tumor of Hematopoietic Origin - The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same. | 03-12-2009 |
20090068179 | Methods for Inhibiting Carcinogenesis and/or Metastasis in an Individual with Endogenous C-Met Ligands and Inhibitors - Methods for inhibiting carcinogenesis and/or metastasis in an individual comprise administering to the individual an effective amount of endogenous c-met ligand or fragment thereof such as endogenous anti c-met immunoglobulin, native and/or recombinant; endogenous biological active Hepatocyte Growth Factor (HGF), native and/or recombinant, and/or a combination thereof. | 03-12-2009 |
20090068180 | COMPOSITIONS AND METHODS FOR TREATING IMMUNOLOGICAL AND INFLAMMATORY DISEASES AND DISORDERS - Methods and compositions for treating immunological and inflammatory diseases and disorders are disclosed. Particular methods and compositions comprise the administration of an agent that inhibits S1P lyase activity and at least one additional immunosuppressive and/or anti-inflammatory agent. | 03-12-2009 |
20090068181 | BISPECIFIC ANTIBODIES - The present invention provides compositions and methods for targeting stem cells to injured cardiac tissue. | 03-12-2009 |
20090068182 | Cytotoxicity mediation of cells evidencing surface expression of CD9 - This invention relates to the staging, diagnosis and treatment of cancerous diseases (both primary tumors and tumor metastases), particularly to the mediation of cytotoxicity of tumor cells; and most particularly to the use of cancerous disease modifying antibodies (CDMAB), optionally in combination with one or more CDMAB/chemotherapeutic agents, as a means for initiating the cytotoxic response. The invention further relates to binding assays, which utilize the CDMAB of the instant invention. The anti-cancer antibodies can be conjugated to toxins, enzymes, radioactive compounds, cytokines, interferons, target or reporter moieties and hematogenous cells. | 03-12-2009 |
20090068183 | METHOD OF TREATING CANCER AND/OR CELLULAR PROLIFERATIVE CONDITIONS AND AGENTS TARGETING HYALURONAN ANABOLISM USEFUL FOR SAME - The present invention is directed to compounds, agents, pharmaceutically active agents, medicaments, therapeutics, actives, drugs and the like which specifically target a portion of the HAS molecule which is accessible to the extracellular environment in a first form of a cell but which is not accessible to the extracellular environment in another form of or in a transformed cell form the same or related cell. In particular, the present invention provides compounds which target a portion of HAS which is accessible to the extracellular environment in malignant or inflammatory or proliferative cells but which portion is not accessible to the external environment in “normal” cells. A “normal” cell in this instance is a non-malignant, inflammatory or proliferative cell. | 03-12-2009 |
20090074755 | Use of panton-valentine leukocidin for treating and preventing staphylococcus infections - The present invention relates to compositions and methods for treating | 03-19-2009 |
20090074756 | USE OF LLT1 AND/OR CD161 FOR MODULATTING THE ACTIVITY OF CELLS OF THE IMMUNE SYSTEM - The present invention relates to a method for modulating in vivo or in vitro the activity of cells expressing CD161 and/or LLT1, characterized in that said cells are contacted respectively with LLT1 or fragments thereof, and/or with or fragments thereof. | 03-19-2009 |
20090074757 | Antitumor Combination Comprising Substituted Acryloyl Distamycin Derivatives and Antibodies Inhibiting Growth Factors or Their Receptors - The present invention provides the combined use of acryloyl distamycin derivatives, in particular α-homo- and α-chloro-acryloyl distamycin derivatives of formula (I), as set forth in the specification, and an antibody inhibiting a growth factor or its receptor, in the treatment of tumors. Also provided is the use of the said combinations in the treatment or prevention of metastasis or in the treatment of tumors by inhibition of angiogenesis. | 03-19-2009 |
20090074758 | IL-17 receptor a antigen binding proteins - The present invention relates to IL-17 Receptor A antigen binding proteins, such as antibodies, and compositions and methods for diagnosing and treating diseases mediated by IL-17 Receptor A activation. | 03-19-2009 |
20090074759 | Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof - Small animal models for assessing immunomodulatory effects of compounds are provided. | 03-19-2009 |
20090074760 | USE OF CHIMERIC ANTI-CD20 ANTIBODY AS IN VITRO OR IN VIVO PURGING AGENT IN PATIENTS RECEIVING BMT OR PBSC TRANSPLANT - The use of anti-CD20 antibodies as in vivo purging agents for patients receiving bone marrow or peripheral blood stem cell transplant during treatment of B-cell-related diseases, e.g., B-cell lymphomas or leukemias, is disclosed. Such purging may enhance engraftment and/or prevent disease relapse in such patients. | 03-19-2009 |
20090074761 | Therapeutic beta-glucan combinations - A therapeutic composition for treating a proliferative disorder includes a VEGF antagonist and β-glucan. VEGF is overexpressed in some tumor types. The efficacy of treatment with VEGF antagonists capable of activating complement in combination with β-glucan is significantly increased. | 03-19-2009 |
20090074762 | THERAPEUTIC USE OF ANTI-TWEAK RECEPTOR ANTIBODIES - Compositions and methods for treating solid tumors are provided herein. | 03-19-2009 |
20090074763 | METHOD FOR INHIBITING BONE RESORPTION - The invention is directed to a method of inhibiting bone resorption. The method comprises administering to a human an amount of sclerostin inhibitor that reduces a bone resorption marker level for at least 2 weeks. The invention also provides a method of monitoring anti-sclerostin therapy comprising measuring one or more bone resorption marker levels, administering a sclerostin binding agent, then measuring the bone resorption marker levels. Also provided is a method of increasing bone mineral density; a method of ameliorating the effects of an osteoclast-related disorder; a method of treating a bone-related disorder by maintaining bone density; and a method of treating a bone-related disorder in a human suffering from or at risk of hypocalcemia or hypercalcemia, a human in which treatment with a parathyroid hormone or analog thereof is contraindicated, or a human in which treatment with a bisphosphonate is contraindicated. | 03-19-2009 |
20090074764 | Methods for diagnosing and treating neuroendocrine cancer - The present invention relates to a method for diagnosing neuroendocrine cancers via detecting the presence of N-methyl D-asparate-associated (NMDA) glutamate receptors type 1 and/or type 2. Methods for preventing and treating neuroendocrine cancers are also disclosed. | 03-19-2009 |
20090074765 | INHIBITORS OF PLACENTAL GROWTH FACTOR FOR THE TREATMENT OF PATHOLOGICAL ANGIOGENESIS, PATHOLOGICAL ARTERIOGENESIS, INFLAMMATION, TUMOR FORMATION AND/OR VASCULAR LEAKAGE - The present invention relates to the field of pathological angiogenesis and arteriogenesis and, in particular, to a stress-induced phenotype in a transgenic mouse (PIGF | 03-19-2009 |
20090074766 | Methods of inhibiting HIV-2 infection - This invention provides methods of inhibiting HIV-2 infection of a susceptible cell by HIV-2 which comprises subjecting the susceptible cell to an effective HIV-2 infection inhibiting dose of a humanized antibody designated PRO 140, or of an anti-CCR5 receptor monoclonal antibody, wherein the effective HIV- | 03-19-2009 |
20090081207 | High affinity human and humanized anti-alpha5beta1 integrin function blocking antibodies with reduced immunogenicity - The present invention relates to recombinant human or humanized polypeptides which bind to α5β1 integrin with high affinity and blocking function. Further, diagnostic and pharmaceutic applications of the potypeptides are disclosed. | 03-26-2009 |
20090081208 | Optimized Fc variants and methods for their generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 03-26-2009 |
20090081209 | METHODS OF THERAPY AND DIAGNOSIS USING TARGETING OF CELLS THAT EXPRESS KILLER CELL IMMUNOGLOBULIN-LIKE RECEPTOR-LIKE PROTEINS - Certain cells, including various types of cancer cells, express KIRHy proteins. Targeting using KIRHy polypeptides, nucleic acids encoding for KIRHy polypeptides and anti-KIRHy antibodies provides a method of killing or inhibiting that growth of cancer cells that express the KIRHy protein. Methods of therapy and diagnosis of disorders associated with KIRHy protein-expressing cells, such as acute myelogenous leukemia (AML), are described. | 03-26-2009 |
20090081210 | Methods of Killing Tumor Cells by Targeting Internal Antigens Exposed on Apoptotic Tumor Cells - The invention provides in vitro and in vivo methods of killing cancer cells, including therapeutic methods in humans, and also provides antibodies specific for the cancer specific antigen C35, and polynucleotides encoding such antibodies, as well as therapeutic and diagnostic methods of using such antibodies. | 03-26-2009 |
20090081211 | C3b antibodies and methods for the prevention and treatment of complement-associated disorders - The present invention concerns antibodies to C3b and the prevention and treatment of complement-associated disorder using such antibodies. | 03-26-2009 |
20090081212 | USE AND TARGETING OF CD98 LIGHT-CHAIN PROTEINS IN THERAPIES FOR THYROID HORMONE DISORDERS - The invention is related to the normalization of thyroid hormone transport by modulation of 4F2hc, CD981c, and the 4F2hc-CD981c heterodimer. Approaches to identify compounds that modulate thyroid hormone disorders, methods of identifying agonists and antagonists that modulate thyroid hormone disorders, and methods of making pharmaceuticals that ameliorate a thyroid hormone disorder are described herein. | 03-26-2009 |
20090081213 | METHODS AND COMPOSITIONS FOR USE IN TREATMENT OF PATIENTS WITH AUTOANTIBODY POSITIVE DISEASE - The present invention relates to methods and compositions for use in treatment of patients with autoantibody positive disease. In a specific embodiment, the present invention relates to a method of treating a patient that has an ANA titer of 1:80 or greater and/or greater than or equal to 30 IU/ml of anti-dsDNA antibodies in his/her blood plasma or serum comprising administering a therapeutically effective amount of an immunomodulatory agent, such as an antagonist of Neutrokine-alpha. Additionally provided is a method of reducing the frequency and/or quantity of corticosteroid administration to patients. In preferred embodiments, the patient has systemic lupus erythematosus. Methods for determining if a lupus patient is responding to medical treatment are also provided. | 03-26-2009 |
20090081214 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND USE THEREOF - The invention relates to the identification of genetic products that are expressed in association with a tumor and the nucleic acid coding therefor. The invention relates to the therapy and diagnosis of diseases in which said genetic products that are expressed in association with a tumor are expressed in an aberrant manner. The invention also relates to proteins, polypeptides, and peptides which are expressed in association with a tumor and the nucleic acids coding therefor. | 03-26-2009 |
20090081215 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND USE THEREOF - The invention relates to the identification of genetic products that are expressed in association with a tumor and the nucleic acid coding therefor. The invention relates to the therapy and diagnosis of diseases in which said genetic products that are expressed in association with a tumor are expressed in an aberrant manner. The invention also relates to proteins, polypeptides, and peptides which are expressed in association with a tumor and the nucleic acids coding therefor. | 03-26-2009 |
20090081216 | TREATMENT OF PATHOLOGIES WHICH ESCAPE THE IMMUNE RESPONSE, USING OPTIMIZED ANTIBODIES - The invention relates to the use of potimised human or humanized chimeric monoclonal antibodies which are produced in selected cell lines, said antibodies having a strong affvinity for receptor CD16 of the effector cells of the immune system and being able to induce the secretion of cytokines and interleukins, in particular 1“IFN? Or 1” IL2, for the treatment of pathologies for which the target cells only express a low antigenic density and in which the effector cells can only be recruited in small quantities. | 03-26-2009 |
20090087429 | IL-17 homologous polypeptides and therapeutic uses thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 04-02-2009 |
20090087430 | SELECTIVE INHIBITION OF TOLL-LIKE RECEPTOR-2 - It has been found that Toll-like receptor 1 and Toll-like receptor 2 (TLR2) physically interact. Antibodies that specifically bind to TLR2 and selectively inhibit induction of cytokines are also described. The invention relates to specific antibodies that selectively bind to TLR2, and to methods of identifying compounds that selectively interfere with signaling through TLR1/TLR2 complexes. | 04-02-2009 |
20090087431 | METHODS OF TREATING BONE DISORDERS WITH MODULATORS OF AXL - The invention provides methods for treating or preventing bone and cartilage disorders comprising administering to a mammal an inhibitor of Axl gene expression or an inhibitor of Axl protein activity. | 04-02-2009 |
20090087432 | TREATING PROSTATE CANCER WITH ANTI-ErbB2 ANTIBODIES - The present application discloses treatment of prostate cancer with anti-ErbB2 antibodies. | 04-02-2009 |
20090092597 | MAMMALIAN CELL SURFACE ANTIGENS; RELATED REAGENTS - Purified genes encoding a T cell surface antigen from a mammal, reagents related thereto including purified proteins, specific antibodies, and nucleic acids encoding this antigen are provided. Methods of using said reagents and diagnostic kits are also provided. | 04-09-2009 |
20090092598 | Antibody Therapy - The present invention provides a composition comprising naked humanized, chimeric, and human anti-CEA antibodies and a therapeutic agent, which is useful for treatment of CEA expressing cancers and other diseases, and methods of use in treatment using this composition. | 04-09-2009 |
20090092599 | Optimized Fc variants and methods for their generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 04-09-2009 |
20090092600 | METHODS AND COMPOSITIONS RELATING TO THE REGULATION OF MUC1 BY HSF1 AND STAT3 - This invention relates to regulation of cell signaling, cell growth, and more particularly to the regulation of cancer or inflammatory cell growth and/or activation. The invention provides methods of inhibiting interactions between MUC1 and a heat shock factor, method of inhibiting interactions between transcription factors and the MUC1 promoter, and methods of inhibiting expression. The invention also provides screening methods for identifying compounds that inhibit the aforementioned interactions. Pharmaceutical compositions containing the identified compounds can be useful in treating cancers and inflammatory conditions. | 04-09-2009 |
20090092601 | HUMANIZED ANTI-LT-beta-R ANTIBODIES - Humanized antibodies to LT-β-R and methods of use thereof are provided. | 04-09-2009 |
20090092602 | USE OF ANTI-TISSUE FACTOR ANTIBODIES FOR TREATING THROMBOSES - Disclosed is a method for preventing or treating thrombosis in a mammal such as a primate and particularly a human patient. A preferred method includes administering to the mammal a therapeutically effective amount of at least one humanized antibody, chimeric antibody, or fragment thereof that binds specifically to human tissue factor (TF). Additional methods and kits are provided. | 04-09-2009 |
20090092603 | EARLY DIAGNOSIS AND TREATMENT OF DRUG RESISTANCE IN MUC1-POSITIVE CANCER - A method of determining likelihood of acquiring drug resistance of a tumor or cancerous cells, cancer metastasis, cancer recurrence, or decreased life expectancy, comprising measuring the level of MUC1 or MUC1-associated factor expressed in the cancerous cells or tumor. | 04-09-2009 |
20090092604 | Method for the Treatment of Multiple Sclerosis by Inhibiting IL-17 Activity - Provided are methods of treatment for inflammatory and autoimmune disorders of the central nervous system and gastrointestinal tract. Also provided are methods of diagnosis. | 04-09-2009 |
20090092605 | Compositions and methods for the treatment of immune related diseases - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 04-09-2009 |
20090098115 | Cell lines and animal models of HER2 expressing tumors - The present invention concerns cell lines and animal models of HER2-expressing tumors. In particular, the invention concerns cell lines and animal models of HER2-expressing tumors not responding or responding poorly to treatment with trastuzumab (HERCEPTIN®, Genentech, Inc.). The animal models and cell lines of the invention are useful for evaluating the efficacy of various therapeutic approaches for the treatment of such tumors. | 04-16-2009 |
20090098116 | IMMUNOGENIC COMPOSITIONS FOR INDUCTION OF ANTI-TUMOR IMMUNITY - The invention relates to the use of an immunogen selected from the group consisting of | 04-16-2009 |
20090098117 | COMPOSITION COMPRISING AND METHOD OF USING ANGIOPOIETIN-LIKE PROTEIN 3 ANGPTL3 - The present invention is directed to methods and means for making and using Angptl3 polypeptides. The invention specifically concerns the use of Angptl3 polypeptides in inducing liver regeneration and angiogenesis. Further methods include the use of Angptl3 polypeptides in the diagnosis and treatment of liver disease. Also provided herein are antibodies which bind to the polypeptides of the present invention. | 04-16-2009 |
20090098118 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH AN ANTI-BCL-2 ACTIVE AGENT - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and an anti-Bcl-2 active agent for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. | 04-16-2009 |
20090098119 | ANTIDOTES FOR FACTOR XA INHIBITORS AND METHODS OF USING THE SAME - The present invention relates antidotes to anticoagulants targeting factor Xa. The antidotes are factor Xa protein derivatives that bind to the factor Xa inhibitors thereby substantially neutralizing them but do not assemble into the prothrombinase complex. The derivatives describe herein lack or have reduced intrinsic coagulant activity. Disclosed herein are methods of stopping or preventing bleeding in a patient that is currently undergoing anticoagulant therapy with a factor Xa inhibitor. | 04-16-2009 |
20090098120 | Compositions and methods for the treatment of immune related diseases - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 04-16-2009 |
20090104185 | Methods and Compositions for Mycoplasma Toxins - The present invention provides | 04-23-2009 |
20090104186 | Melanoma-associated MHC class I associated oligopeptides and the uses thereof - The present invention relates to certain melanoma-associated oligopeptides that are recognized by CD8-positive cytotoxic T-lymphocytes (CTLs) as peptide antigen and which elicit a CTL-induced lysis and/or apoptosis of tumor cells. The present invention also relates to the use of these melanoma-associated oligopeptides in cancer therapy. | 04-23-2009 |
20090104187 | Novel Rabbit Antibody Humanization Methods and Humanized Rabbit Antibodies - The present invention is directed to novel and improved methods for humanizing rabbit heavy and light variable regions. The resulting humanized rabbit heavy and light chains and antibodies and antibody fragments containing are well suited for use in immunotherapy and immunodiagnosis as they retain the antigen binding affinity of the parent antibody and based on their very high level of sequence identity to human antibody sequences should be essentially non-immunogenic in humans. The invention exemplifies the protocol for the manufacture of therapeutic humanized anti-human TNF-alpha and anti-human IL-6 antibodies. | 04-23-2009 |
20090104188 | ANTI-HEPATITIS C VIRUS ANTIBODY AND USES THEREOF - Described are novel antibodies specifically recognizing conformation dependent epitopes of HCV glycoprotein E2 and that are capable of neutralizing the binding of E2 protein onto susceptible cells. Furthermore, antigens and epitopes recognized by the above-described antibodies as well as polynucleotides encoding said antibodies are provided. Also provided are to vectors comprising said polynucleotides as well as host cells transformed therewith and their use in the production of said antibodies. In addition, pharmaceutical and diagnostic compositions are provided comprising any of the aforedescribed antibodies, antigens, epitopes, polynucleotides, vectors or cells. Further described is the use of the aforementioned antibodies, antigens, polynucleotides and vectors in adoptive immunotherapy, preferably for the treatment or prevention of HCV infection during liver transplantation. | 04-23-2009 |
20090104189 | NEUTROKINE-ALPHA AND NEUTROKINE-ALPHA SPLICE VARIANT - The present invention relates to nucleic acid molecules encoding Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides, including soluble forms of the extracellular domain. Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to antibodies or portions thereof that specifically bind Neutrokine-alpha and/or Neutrokine-alphaSV and diagnostic and therapeutic methods using these antibodies. Also provided are diagnostic methods for detecting immune system-related disorders and therapeutic methods for treating immune system-related disorders using the compositions of the invention. | 04-23-2009 |
20090104190 | HUMANIZED ANTI-CD4 ANTIBODY WITH IMMUNOSUPPRESSIVE PROPERTIES - A humanized antibody derived from mouse monoclonal anti-CD4 antibody B-F5 is able to activate CD25+CD4+ regulatory T cells and is useful for preparing immunosuppressive compositions. | 04-23-2009 |
20090104191 | Prevention of tumors with monoclonal antibodies against neu - Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface are disclosed. The methods comprise administering an antibody which specifically binds to p185. Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface in an individual at high risk of developing tumors are disclosed. | 04-23-2009 |
20090104192 | Monoclonal Antibodies to Hepatocyte Growth Factor - The present invention is directed toward a neutralizing monoclonal antibody to hepatocyte growth factor, a pharmaceutical composition comprising same, and methods of treatment comprising administering such a pharmaceutical composition to a patient. | 04-23-2009 |
20090110678 | RECEPTOR ANTAGONISTS FOR TREATMENT OF METASTATIC BONE CANCER - The invention provides methods of treating bone cancer, particularly metastatic bone cancer, by administering an IGF-IR antagonist and/or a PDGFRα antagonist. The invention also provides antibodies that bind to human PDGFRα and neutralize activation of the receptor. The invention further provides a methods for neutralizing activation of PDGFRα, and a methods of treating a mammal with a neoplastic disease using the antibodie alone or in combination with other agents. | 04-30-2009 |
20090110679 | Methods and compositions for pulmonary administration of a TNFa inhibitor - The invention describes methods of pulmonary delivery of a TNFα inhibitor to a subject having a disorder in which TNFα is detrimental, such that the disorder is treated. Also included is a method of achieving systemic circulation of a TNFα inhibitor in a subject comprising administering the TNFα inhibitor to the central lung region or the peripheral lung region of the subject via inhalation, such that systemic circulation of the TNFα inhibitor is achieved. | 04-30-2009 |
20090117102 | Methods and compositions using CD3 agonists - Compositions of CD3 antibody and gastrin and uses thereof in the prevention and intervention of diabetes. | 05-07-2009 |
20090117103 | M-CSF Antibody compositions Having Reduced Levels of Endotoxin - The present invention provides for compositions of anti-M-CSF antibodies that are substantially free of endotoxin. Also provided are methods of treating M-CSF-mediated disorders with pharmaceutical formulations of anti-M-CSF antibodies having reduced endotoxin levels, including inflammatory diseases and neoplasia disorders. | 05-07-2009 |
20090117104 | GLP-2 Mimetibodies, Polypeptides, Compositions, Methods and Uses - Mammalian GLP-2 mimetibodies, polypeptides and nucleic acids are disclosed. Methods of utilizing the mimetibodies and polypeptides to treat GLP-2 related diseases are also disclosed. | 05-07-2009 |
20090117105 | HUMANIZED ANTI-VENEZUELAN EQUINE ENCEPHALITIS VIRUS RECOMBINANT ANTIBODY - A CDR grafted humanized rAb comprises a human Ig framework having CDRs from murine mAb 1A4A1 VH and VL. DNA sequences and vectors incorporating such sequences are also provided as are pharmaceutical preparations and methods of using the humanized rAbs. | 05-07-2009 |
20090117106 | Cancer Specific Glycans and Use Thereof - The present invention describes glycans, which are specifically expressed by certain cancer cells, tumours and other malignant tissues. The present invention describes methods to detect cancer specific glycans as well as methods for the production of reagents binding to said glycans. The invention is also directed to the use of said glycans and reagents binding to them for the diagnostics of cancer and malignancies. Furthermore, the invention is directed to the use of said glycans and reagents binding to them for the treatment of cancer and malignancies. Moreover, the present invention comprises efficient methods to differentiate between malignant and benign tumors by analyzing glycan structures. | 05-07-2009 |
20090117107 | Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases - The present invention relates to methods for identifying agents capable of inhibiting the expression or activity of proteins involved in the processes modulating osteoclastogenesis, which inhibition is useful in the prevention and/or treatment of bone and joint degenerative diseases and diseases involving aberrant activity or differentiation of osteoclasts. In particular, the present invention provides methods for identifying agents for use in the prevention and/or treatment of rheumatoid arthritis. | 05-07-2009 |
20090123463 | Methods and compositions for inducing apoptosis - The C-terminal domain of focal adhesion kinase (FAK-CD) was isolated using a Baculoviral system. Using phage display techniques, a phage encoding a 12 amino-acid peptide (peptide 35) and AV3 that binds to FAK-CD were identified. The peptides were also conjugated to TAT-FITC to produce a fluorescently labeled chimeric molecule capable of penetrating cell membranes. Contacting various breast cancer cell lines with these molecule caused detachment, rounding, apoptosis and cell death. These effects were not observed in normal (non-cancerous) breast cells. | 05-14-2009 |
20090123465 | ASSESSMENT OF CARDIAC HEALTH AND THROMBOTIC RISK IN A PATIENT - The invention features methods and compositions for assessing risk, particularly immediate risk, of thrombotic events in patients with suspected or known vascular disease, and more particularly to assessing risk of thrombotic events in patients with coronary artery disease, particularly acute myocardial infarction, stroke, unstable angina, stable angina, or restenosis. Risk of thrombosis can be assessed by analysis of platelet reactivity and/or velocity of thrombin or fibrin formation, and determining whether the patient has a score associated above a risk threshold value. In other embodiments, risk of thrombosis in a patient is evaluated in the context of a profile generated from values obtained from one or more assays that evaluate various factors associated with thrombosis and/or atherosclerosis. | 05-14-2009 |
20090123466 | ANTI-CD40 MONOCLONAL ANTIBODY - An antibody or a functional fragment thereof, acting agonistically or antagonistically on CD40. | 05-14-2009 |
20090130095 | ANTI-CD40 ANTIBODIES CAPABLE OF BLOCKING B-CELL ACTIVATION - Methods for preventing or treating an antibody-mediated disease in a patient are presented, the methods comprising administration of a monoclonal antibody capable of binding to a human CD40 antigen located on the surface of a human B cell, wherein the binding of the antibody to the CD40 antigen prevents the growth or differentiation of the B cell. Monoclonal antibodies useful in these methods, and epitopes immunoreactive with such monoclonal antibodies are also presented. | 05-21-2009 |
20090130096 | Gene Signature of Early Hypoxia to Predict Patient Survival - The present invention provides methods and compositions for predicting patient responses to cancer treatment using hypoxia gene signatures. These methods can comprise measuring in a biological sample from a patient the levels of gene expression of a group of the genes designated herein. The present invention also provides for microarrays that can detect expression from a group of genes. | 05-21-2009 |
20090130097 | Quinazolinone Compounds and Methods of Use Thereof - The present invention relates to quinazolinone compounds, and methods of preparation of these compounds. The present invention also relates to pharmaceutical compositions comprising the quinazolinone compounds. The present invention provides methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of a quinazolinone compound of the present invention | 05-21-2009 |
20090130098 | Specific therapy using integrin ligands for treating cancer - The invention relates to a combination therapy for the treatment of tumors and tumor metastases comprising administration of integrin ligands, preferably integrin antagonists, together with co-therapeutic agents or therapy forms that have synergistic efficacy when administered consecutively with said ligands, such as chemotherapeutic agents and or radiation therapy. The therapy results in a synergistic potential increase of the inhibition effect of each individual therapeutic on tumor cell proliferation, yielding more effective treatment than found by administering an individual component alone, concurrently or not in the dosage regime of the present invention. | 05-21-2009 |
20090130099 | HUMANIZED ANTIBODIES AND COMPOSITIONS FOR BINDING SPHINGOSINE-1-PHOSPHATE - The present invention relates to anti-S1P agents, particularly humanized monoclonal antibodies (and antigen binding fragments thereof) specifically reactive with S1P, compositions containing such antibodies (or fragments), and the use of such antibodies (or fragments), for example, to treat diseases and conditions associated with aberrant levels of S1P. | 05-21-2009 |
20090130100 | METHODS OF USING HUMANIZED ANTIBODIES AND COMPOSITIONS FOR BINDING SPHINGOSINE-1-PHOSPHATE - The present invention relates to anti-S1P agents, particularly humanized monoclonal antibodies (and antigen binding fragments thereof) specifically reactive with S1P, compositions containing such antibodies (or fragments), and the use of such antibodies (or fragments), for example, to treat diseases and conditions associated with aberrant levels of S1P. | 05-21-2009 |
20090130101 | ANTI-CANCER THERAPY WITH AN EXTRACT OF SCUTELLARIA BARBATA - Methods of treating cancer with a combination of an extract of | 05-21-2009 |
20090130102 | METHODS FOR HUMANIZING ANTIBODIES AND HUMANIZED ANTIBODIES MADE THEREBY - Disclosed herein is the use of three-dimensional structure information to guide the process of modifying antibodies with amino acids from one or more templates or surrogates such that the antigen binding properties of the parent antibody are maintained and the immunogenicity potential is reduced when administered as a therapeutic in humans. | 05-21-2009 |
20090136490 | OVR110 ANTIBODY COMPOSITIONS AND METHODS FOR USE - The invention provides isolated anti-ovarian, pancreatic, lung or breast cancer antigen (Ovr110) antibodies that internalize upon binding to Ovr110 on a mammalian in vivo. The invention also encompasses compositions comprising an anti-Ovr110 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-Ovr110 antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-Ovr110 antibodies. The invention encompasses a method of producing the anti-Ovr110 antibodies. Other aspects of the invention are a method of killing an Ovr110-expressing cancer cell, comprising contacting the cancer cell with an anti-Ovr110 antibody and a method of alleviating or treating an Ovr110 expressing cancer in a mammal, comprising administering a therapeutically effective amount of the anti-Ovr110 antibody to the mammal. | 05-28-2009 |
20090136491 | IL-17 homologous polypeptides and therapeutic uses thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 05-28-2009 |
20090136492 | THERAPY OF OCULAR DISORDERS - The present application describes therapy of ocular disorders using antagonists, such as antibodies, that bind to CD20. | 05-28-2009 |
20090136493 | MODIFIED FUSION MOLECULES FOR TREATMENT OF ALLERGIC DISEASE - The present invention comprises a fusion molecule comprising a Fcε fragment sequence including functionally active CH2, CH3 and CH4 domains of the constant region of an IgE heavy chain (CHε2-CHε3-CHε4 sequence) linked at its C-terminus to the N-terminus of a second polypeptide including functionally active hinge, CH2 and CH3 domains of the constant region of an IgG | 05-28-2009 |
20090136494 | Combination therapies employing GITR binding molecules - The present invention provides combination therapies that employ a GITR binding molecule in combination with one or more additional agents. | 05-28-2009 |
20090136495 | ANTI-HEPCIDIN ANTIBODIES AND USES THEREOF - Monoclonal antibodies are provided that selectively bind human hepcidin-25 and are characterized as having high affinity for human hepcidin-25 and strong human mature hepcidin neutralizing properties. The antibodies of the invention are useful therapeutically for increasing serum iron levels, reticulocyte count, red blood cell count, hemoglobin, and/or hematocrit in a human and for the treatment and diagnosis of mature hepcidin-promoted disorders such as anemia, in a human subject. | 05-28-2009 |
20090136496 | CHRONIC LYMPHOCYTIC LEUKEMIA PROGNOSIS AND TREATMENT - Provided herein are methods for identifying a subject afflicted with chronic lymphocytic leukemia who is responsive to treatment with a chemotherapeutic agent by detecting the presence or absence of at least one APOE4 allele in the subject, the presence of an APOE4 allele identifying the subject as responsive to the treatment. Also provided are methods of treating a subject afflicted with chronic lymphocytic leukemia, including administering an estrogenic agent, an androgen withdrawal agent, an apoE4 peptide or mimetic thereof, and/or a chemotherapeutic agent in an amount effective to treat said chronic lymphocytic leukemia. Methods of determining a prognosis for a patient diagnosed with chronic lymphocytic leukemia are also provided. In addition, methods for stratifying a subject into a subgroup of a clinical trial and methods for identifying a patient in a clinical trial of a treatment for chronic lymphocytic leukemia are herein provided. | 05-28-2009 |
20090136497 | Methods for inhibiting cutaneous inflammation and hyperpigmentation - This invention provides a method of preventing or treating in a subject contact dermatitis which comprises administering to the subject an amount of a compound capable of inhibiting the stem cell factor signaling pathway effective to prevent or treat contact dermatitis so as to thereby prevent or treat contact dermatitis in the subject. This invention also provides a method of preventing or treating in a subject hyperpigmentation, asthma, cutaneous inflammation, anaphylaxis and bronchospasm, mastocytosis, tumors which express activated kit, and conception. | 05-28-2009 |
20090136498 | Method for Manufacturing Recombinant Polyclonal Proteins - The invention relates to a method for manufacturing a recombinant polyclonal protein composition, in particular a recombinant polyclonal antibody composition. The method comprises obtaining a collection of cells transfected with a library of variant nucleic acid sequences, wherein each call in the collection is transfected with and capable of expressing one member of the library, which encodes a distinct member of a polyclonal protein that binds a particular antigen and which is located at the same single site in the genome of individual cells in said collection, wherein said nucleic acid sequence is not naturally associated with said cell in the collection. The cells are cultured under suitable conditions for expression of the polyclonal protein, which is obtained from the cells or culture supernatant. The nucleic acid sequence id introduced into the cells by transfection with a library of vectors for site-specific integration. The present method is suitable for manufacturing recombinant polyclonal antibodies, thereby making available a superior replacement of plasma-derived therapeutic immunoglobulin products. | 05-28-2009 |
20090136499 | RAF Inhibitors and Uses Thereof - The present invention provides imidazooxazole and imidazothiazole compounds and their synthesis. The compounds of the present invention are capable of inhibiting the activity of RAF kinase, such as B-RAF | 05-28-2009 |
20090142338 | Methods and Compositions for Treating Type 1 and Type 2 Diabetes Mellitus and Related Conditions - Embodiments of the present invention relate to compositions and methods of treating type 1 or type 2 diabetes mellitus or other conditions relating to metabolic dysfunction that may impact insulin secretion or action by administering an islet neogenesis agent in combination with an agent or agents that selectively inhibits, blocks or destroys the autoimmune destruction of pancreatic cells or agents that optimize function within existing islets in patients with type 1 diabetes, type 2 diabetes and related conditions. | 06-04-2009 |
20090142339 | Humanized Anti-CCR2 Antibodies and Methods of Use Therefor - The present invention relates to a humanized antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 2 (CCR2) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a cell bearing mammalian CCR2 with a ligand thereof, and to use of the antibodies and fragments in therapeutic, prophylactic and diagnostic methods. | 06-04-2009 |
20090142340 | Optimized Fc Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 06-04-2009 |
20090142341 | Mutated pseudomonas exotoxins with reduced antigenicity - The invention provides mutated | 06-04-2009 |
20090148438 | Binding Moieties Based on Shark Ignar Domains - The present invention relates to immunoglobulin new antigen receptors (IgNARs) from fish and uses thereof. In particular, the present invention relates to modified IgNAR variable domains and to domains from members of the immunoglobulin superfamily that have been modified to include structural features derived from IgNAR variable domains. | 06-11-2009 |
20090148439 | Methods for diagnosis and treatment of epithelial-derived cancers - The present invention relates to the use of a polypeptide (CD27L) for diagnosis of epithelial-related cancers, in particular kidney cancer e.g. renal cell cancer and colorectal cancer, e.g. colon cancers, as well as in methods of treatment of such cancers. | 06-11-2009 |
20090148440 | ANTIBODIES AGAINST INTERLEUKIN-22 BINDING PROTEIN AND ITS USES FOR THE TREATMENT OF METABOLIC DISORDERS - The present invention relates to antibodies and antigen-binding fragments that bind to interleukin-22 binding protein, in particular, human interleukin-22 binding protein (IL-22 BP), and are involved in regulating interleukin-22-associated biological responses. The invention also relates to methods of using the antibodies and antigen-binding fragments to treat disorders associated with interleukin-22. The antibodies disclosed herein are useful in diagnosing, preventing, or treating metabolic disorders including obesity, diabetes, hyperlipidemia and hyperinsulinemia etc. | 06-11-2009 |
20090148441 | Anti-Cancer Antibodies With Reduced Complement Fixation - The invention provides modified antibodies directed against GD2 that have diminished complement fixation relative to antibody-dependent, cell-mediated cytotoxicity, which is maintained. The modified antibodies of the invention may be used in the treatment of tumors such as neuroblastoma, glioblastoma, melanoma, small-cell lung carcinoma, B-cell lymphoma, renal carcinoma, retinoblastoma, and other cancers of neuroectodermal origin. | 06-11-2009 |
20090148442 | COMBINATION OF BLyS INHIBITION AND ANTI-CD 20 AGENTS FOR TREATMENT OF AUTOIMMUNE DISEASE - The invention relates to novel combination therapies involving BLyS or BLyS/APRIL inhibition and anti-CD20 agents for the treatment of autoimmune diseases. One preferred method is where the BLyS antagonist is a Fc-fusion protein which can be a TACI-Fc-fusion protein comprising the extracellular domain of TACI or a functional fragment thereof, a BAFF—R-Fc-fusion protein comprising the extracellular domain of BAFF—R or a functional fragment thereof, or a BCMA-Fc-fusion protein comprising the extracellular domain of BCMA or a functional fragment thereof. In the methods of the present invention some of anti-CD20 agents contemplated include RITUXAN®, ocrelizumab, ofatumumab (HuMax-CD20®), TRU-015, and DXL625, although any agent that binds to CD 20 may be suitable. The methods of the present invention reduce the levels of B cells in patients in need of such reduction, such as those suffering from autoimmune diseases. | 06-11-2009 |
20090148443 | HUMANIZED ANTIBODIES AND COMPOSITIONS FOR BINDING SPHINGOSINE-1-PHOSPHATE - The present invention relates to anti-S1P agents, particularly humanized monoclonal antibodies (and antigen binding fragments thereof) specifically reactive with S1P, compositions containing such antibodies (or fragments), and the use of such antibodies (or fragments), for example, to treat diseases and conditions associated with aberrant levels of S1P. | 06-11-2009 |
20090148444 | PHARMACEUTICAL COMPOSITION FOR TREATING IMMUNE DISEASES - An antibody against AILIM (alternatively called JTT-1 antigen, JTT-2 antigen, ICOS and 8F4) was found to have a significant therapeutic effect on arthrosis, for example, rheumatoid arthritis and osteoarthritis, graft versus host disease, graft immune rejection, inflammation (hepatitis and inflammatory bowel diseases), diseased condition accompanied by the excessive production of an antibody against a foreign antigen triggered by immunological sensitization by the antigen. | 06-11-2009 |
20090148445 | METHODS OF SENSITIZING CANCER TO THERAPY-INDUCED CYTOTOXICITY - The present application demonstrates that Salinosporamide A can be used to sensitize cancer cells to cancer therapy. Furthermore, the present application demonstrates that Salinosporamide A acts as a therapeutic agent to kill or inhibit cancer cells after sensitization of the cells by an antibody or other chemosensitizing reagents. The cancer cells can be either therapy-sensitive or therapy resistant. The present application further demonstrates that Salinosporamide A induces the expression of Raf kinase inhibitor protein (RKIP) and PTEN, tumor suppressor proteins, and inhibits the expression of YY1, a transcriptional regulator protein overexpressed in cancer cells and also inhibits the growth factor pleiotrophin (PTN). | 06-11-2009 |
20090148446 | Method and Composition for Treatment of Renal Failure with Antibodies and Their Equivalents as Partial or Complete Replacement for Dialysis - A method for treating renal failure associated with advanced stage renal disease includes administering a soluble cytokine receptor to one or more of tumor necrosis factor alpha, interferon gamma or interleukin 6; or antibodies to one or more of interleukin 6 or interleuking 1 beta. The method can be used as a supplement to or as partial or complete replacement for dialysis. A pharmaceutical composition includes antibody or functional equivalent thereof to urea, creatinine, or both; antibody, functional equivalent or soluble cytokine receptor to tumor necrosis factor alpha, interferon gamma, interleukin 6, interleukin 1 beta or any combination thereof. The composition can be included in a kit. | 06-11-2009 |
20090155246 | Antibodies Specific For Soluble Amyloid Beta Peptide Protofibrils and Uses Thereof - The invention pertains to the development of antibodies that specifically bind amyloid beta protein (Abeta) in its protofibril conformation. The invention also comprises methods of using anti-Abeta protofibril antibodies to diagnose or treat Alzheimer's disease, Down's syndrome Lewybody dementia, vascular dementia, and other neurodegenerative disorders. Furthermore, the invention pertains to the use of anti-Abeta protofibril antibodies to screen and identify substances that will modulate protofibril activity or formation in vitro or in vivo. The invention also pertains to methods for synthesising pure Abeta protofibril antigens as well as to a method for stabilising Abeta protofibrils antigens as well as to a method for stabilising Abeta protofibrils. | 06-18-2009 |
20090155247 | Methods of Using Death Receptor Agonists and EGFR Inhibitors - Methods for using death receptor ligands, such as Apo-2 ligand/TRAIL polypeptides or death receptor antibodies, and EGFR inhibitors to treat pathological conditions such as cancer are provided. Embodiments of the invention include methods of using Apo2L/TRAIL or death receptor antibodies such as DR5 antibodies and DR4 antibodies in combination with EGFR inhibitors, such as Tarceva™. | 06-18-2009 |
20090155248 | Antibodies to MT-SP1 serine protease - This invention provides a novel membrane-type serine protease (designated MT-SP1) elevated expression of which is associated with cancer. In one embodiment, this invention provides a method obtaining a prognosis or of detecting or staging a cancer in an organism. The method involves providing a biological sample from the organism and detecting the level of a membrane type serine protease 1 (MT-SP1) in the sample, where an elevated level of the membrane-type serine protease, as compared to the level of the protease in a biological sample from a normal healthy organism indicates the presence or stage of the cancer. | 06-18-2009 |
20090155249 | HUMANIZED ANTIBODY IGG1 - The present invention is related to chimeric and humanized antibody and to methods and compositions for the therapeutic and diagnostic use in the treatment of amyloidosis, a group of disorders and abnormalities associated with amyloid protein such as Alzheimer's disease. | 06-18-2009 |
20090155250 | MONOCLONAL ANTIBODIES AGAINST ORTHOPOXVIRUSES - The present invention relates to monoclonal antibodies that bind or neutralize Orthopoxviruses. The invention provides such antibodies, fragments of such antibodies retaining B5 or A33 binding ability, fully human antibodies retaining B5 or A33 binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 06-18-2009 |
20090155251 | Polypeptide compounds for inhibiting angiogenesis and tumor growth - In certain embodiments, this present invention provides polypeptide compositions, and methods for inhibiting Ephrin B2 or EphB4 activity. In other embodiments, the present invention provides methods and compositions for treating cancer or for treating angiogenesis-associated diseases. | 06-18-2009 |
20090155252 | CHIMERIC ANTI-VEGF-D ANTIBODIES AND HUMANIZED ANTI-VEGF-D ANTIBODIES AND METHODS OF USING SAME - The present invention relates to materials and methods for modulating angiogenesis and lymphangiogenesis. The compositions of the invention provide chimeric and/or humanized VEGF-D antibody substances, antibodies, polypeptides and fragments thereof useful for modulating angiogenesis and lymphangiogenesis in a subject. | 06-18-2009 |
20090155253 | ANTI-CD20 ANTIBODIES AND FUSION PROTEINS THEROF AND METHODS OF USE - The present invention provides humanized, chimeric and human anti-CD20 antibodies and CD20 antibody fusion proteins that bind to a human B cell marker, referred to as CD20, which is useful for the treatment and diagnosis of B-cell disorders, such as B-cell malignancies and autoimmune diseases, and methods of treatment and diagnosis. | 06-18-2009 |
20090155254 | Affinity Regions - The present invention provides a method for selecting from a collection of IgIV molecules, at least one IgIV molecule comprising an affinity region that is capable of interacting with a misfolded protein and/or with an epitope of a cross-β structure and/or with an epitope of a protein comprising a cross-β structure, said method comprising contacting a collection of IgIV molecules with a misfolded protein and/or with a cross-β structure and/or with a protein comprising a cross-β structure and collecting at least one IgIV molecule comprising an affinity region interacting with said misfolded protein and/or epitope. | 06-18-2009 |
20090155255 | CD23 BINDING MOLECULES AND METHODS OF USE THEREOF - The invention is based, at least in part, on the development of multivalent and stabilized forms of CD23 binding molecules and methods of use thereof for the treatment of immune cell disorders, including leukemias or lymphomas such as CLL. | 06-18-2009 |
20090155256 | Immunotherapy Regimes Dependent On APOE Status - The invention provides methods of immunotherapy of Alzheimer's and similar diseases in which the regime administered to a patient depends on the ApoE genotype of the patient. | 06-18-2009 |
20090155257 | IMMUNOGLOBULIN VARIANTS AND USES THEREOF - The invention provides humanized and chimeric anti-CD20 antibodies for treatment of CD20 positive malignancies and autoimmune diseases. | 06-18-2009 |
20090155258 | PEPTIDE-BASED PASSIVE IMMUNIZATION THERAPY FOR TREATMENT OF ATHEROSCLEROSIS - The present invention relates to passive immunization for treating or preventing atherosclerosis using an isolated human antibody directed towards at least one oxidized fragment of apolipoprotein B in the manufacture of a pharmaceutical composition for therapeutical or prophylactical treatment of atherosclerosis by means of passive immunization, as well as method for preparing such antibodies, and a method for treating a mammal, preferably a human using such an antibody to provide for passive immunization. | 06-18-2009 |
20090155259 | EXTENDING TIME TO DISEASE PROGRESSION OR SURVIVAL IN CANCER PATIENTS - The present application describes extending time to disease progression or survival in a cancer patient, where the patient's cancer displays HER activation, by treating the patient with a HER dimerization inhibitor, such as pertuzumab. | 06-18-2009 |
20090155260 | USE OF THYMOSIN ALPHA 1 FOR THE TREATMENT OF IMMUNOLOGICAL DISEASES - It is described the use of thymosin alpha 1 for preparing a medicament useful for the prevention or treatment of graft-versus-host disease or graft rejection reactions in organ transplantation, in a mammal subject, in which the cells, tissues or organs for transplant is selected from the group comprising: stem cells, hematopoietic stem cells, bone marrow, heart, liver, kidney, lung, pancreas, small intestine, cornea or skin. | 06-18-2009 |
20090155261 | METHODS AND COMPOSITIONS FOR TREATMENT AND DIAGNOSIS OF ENCEPHALITIS OR EPILEPSY - This invention provides methods of diagnosing or determining a cause of an autoimmune encephalitis or an epilepsy in a subject and of diagnosing a tumor in a subject, comprising the step of testing a biological sample of the subject for an antibody to an NR1 subunit of the NMDA receptor. This invention further provides methods of treating an autoimmune encephalitis or an epilepsy, comprising the steps of detecting an antibody to an NR1 subunit of the NMDA receptor and treating a tumor associated with the disease. | 06-18-2009 |
20090155262 | Cytotoxicity mediation of cells evidencing surface expression of CD63 - This invention relates to the diagnosis and treatment of cancerous diseases, particularly to the mediation of cytotoxicity of tumor cells; and most particularly to the use of cancerous disease modifying antibodies (CDMAB), optionally in combination with one or more chemotherapeutic agents, as a means for initiating the cytotoxic response. The invention further relates to binding assays which utilize the CDMAB of the instant invention. | 06-18-2009 |
20090155263 | Compositions and methods for the treatment of immune related diseases - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 06-18-2009 |
20090155264 | Novel composition and methods for the treatment of psoriasis - The present invention relates to compositions containing a novel protein and methods of using those compositions for the diagnosis and treatment of psoriasis. | 06-18-2009 |
20090155265 | METHOD FOR TREATING MULTIPLE MYELOMA USING 3-(4-AMINO-1-OXO-1,3-DIHYDROISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE IN COMBINATION WITH ANTIBODIES - Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 06-18-2009 |
20090162350 | NOVEL COMPOSITION AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASE - The present invention relates to compositions containing a novel protein and methods of using those compositions for the diagnosis and treatment of immune related disease. | 06-25-2009 |
20090162351 | Transdiscal administration of inhibitors of p38 MAP kinase - The present invention relates to methods, formulations and kits for administering a p38 MAP kinase inhibitor or other therapeutic agent into an intervertebral disc, such as a diseased disc, for example, for purposes of prevention and treatment of degenerative and other disorders. | 06-25-2009 |
20090162352 | ANTIBODY FORMULATION - The present invention relates to a pharmaceutical formulation comprising an anti-CD20 antibody. The formulation may additionally comprise a buffer, a surfactant and/or an isotonicity agent. | 06-25-2009 |
20090162353 | Compositions for the Prevention and Treatment of Smallpox - The present invention relates to improved compositions for the prevention and treatment of smallpox, and in particular to the use of compositions containing an antibody that binds to an epitope found on the MV form of the smallpox virus and an antibody that binds to an epitope found on the EV form of the smallpox virus. The invention relates to such compositions, especially to non-blood derived antibody compositions, such as chimeric or humanized antibodies, and to methods for their use in imparting passive immunity against smallpox infection to individuals at risk of smallpox virus infection or who exhibit smallpox. | 06-25-2009 |
20090162354 | INHIBITORS OF PLACENTAL GROWTH FACTOR FOR THE TREATMENT OF PATHOLOGICAL ANGIOGENESIS, PATHOLOGICAL ARTERIOGENESIS, INFLAMMATION, TUMOR FORMATION AND/OR VASCULAR LEAKAGE - The present invention relates to the field of pathological angiogenesis and arteriogenesis and, in particular, to a stress-induced phenotype in a transgenic mouse (PIGF | 06-25-2009 |
20090169546 | HIGH AFFINITY ANTIBODIES AGAINST HMGB1 AND METHODS OF USE THEREOF - Compositions and methods are disclosed for inhibiting the release of a proinflammatory cytokine from a vertebrate cell, and for inhibiting an inflammatory cytokine cascade in a patient. The compositions comprise, for example, high affinity antibodies that specifically bind HMG1 and antigenic fragments thereof. The high affinity antibodies of the present invention and pharmaceutical compositions comprising the same are useful for many purposes, for example, as therapeutics against a wide range of inflammatory diseases and disorders such as sepsis, rheumatoid arthritis, peritonitis, Crohn s disease, reperfusion injury, septicemia, endotoxic shock, cystic fibrosis, endocarditis, psoriasis, psoriatic arthritis, arthritis, anaphylactic shock, organ ischemia, reperfusion injury, and allograft rejection. In addition, the high affinity antibodies of the present inventions are useful as diagnostic antibodies. | 07-02-2009 |
20090169547 | MONOCLONAL ANTIBODIES AGAINST CLAUDIN-18 FOR TREATMENT OF CANCER - The present invention provides antibodies useful as therapeutics for treating and/or preventing diseases associated with cells expressing CLD18, including tumor-related diseases such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, and cancer of the gallbladder. | 07-02-2009 |
20090169548 | BINDING MOLECULES - The present invention relates to the manufacture of mono, di and multivalent polypeptide binding complexes, also mono, di or multispecific polypeptide binding complexes and uses thereof. The invention also relates to the manufacture and use of a diverse repertoire of antigen specific VH binding domains derived from phage display libraries, transgenic animals or natural sources. Preferably the VH binding domains and the dimerisation domains comprise human sequences. The polypeptide binding complexes comprise homo or heterodimerisation domains with four antigen binding [VH] domains fused at the amino and carboxyl termini of the dimerisation domains preferably using natural hinge or linker peptides. Where the polypeptide binding complexes lack CH2-CH3 effector functions they are preferably less than 120 kDa in size. Routes of manufacture are described herein. | 07-02-2009 |
20090169549 | CONFORMATIONAL ISOMERS OF ALPHA-SYNUCLEIN, ANTIBODIES THERETO AND METHODS OF THEIR MANUFACTURE AND USE - Conformational isomers of modified versions of α-Synuclein (αSyn), a protein that is associated with Parkinson's disease, have been designed and produced. These conformational isomers are produced by introducing cysteines into the α-Synuclein and scrambling the disulfide bonds to form stable and immunogenic isomers. These isomers are generically referred to as X-isomers. X-αSyn is an X-isomer of αSyn. X-αSyn is generally more immunogenic than wt-αSyn. Two groups of X-αSyn have been produced. One group is 3-disulfide X-αSyn(3SS) produced by introducing 6 Cys mutations into the αSyn. The second group is 2-disulfide X-αSyn(2SS), produced by introducing 4 Cys mutations into the α-Syn. In each of these two groups of X-αSyn, Cys was introduced not only wt-αSyn, but also in two Parkinson Disease associated αSyn mutants, A30P-αSyn and A53T-αSyn. All six sets of X-αSyn exhibit enhanced aggregation as compared to wt-αSyn, and should therefore more much more immunogenic. It was discovered that refolding the proteins in a CuSO | 07-02-2009 |
20090169550 | THERAPY OF RITUXIMAB-REFRACTORY RHEUMATOID ARTHRITIS PATIENTS - A method is disclosed of treating a rituximab-refractory rheumatoid arthritis (RA) patient comprising administering an anti-CD20 antibody other than rituximab to the patient in an amount effective to treat the RA. | 07-02-2009 |
20090175854 | Methods of using death receptor ligands and CD20 antibodies - Methods for using death receptor ligands, such as Apo-2 ligand/TRAIL polypeptides or death receptor antibodies, and CD20 antibodies to treat conditions such as cancer and immune related diseases are provided. Embodiments of the invention include methods of using Apo2L/TRAIL or death receptor antibodies such as DR5 antibodies and DR4 antibodies in combination with CD20 antibodies. | 07-09-2009 |
20090175855 | NOVEL COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES - The present invention relates to compositions containing a novel protein and methods of using those compositions for the diagnosis and treatment of immune related disease. | 07-09-2009 |
20090175856 | Anti-Proliferative Combination Therapy Using Certain Platinum-Based Chemotherapeutic Agents and EGFR Inhibitors or Pyrimidine Analogues - The present invention describes a method or uses of prevention and/or treatment of a cancer or a tumor, and in particular to a combination therapy, methods, compositions and pharmaceutical packages comprising an inhibitor of receptors of the EGFR family or a chemotherapeutically active pyrimidine analogue and certain platinum-based chemotherapeutic agents. | 07-09-2009 |
20090175857 | Human Antibodies That Bind Human IL-12 And Methods For Producing - Human antibodies, preferably recombinant human antibodies, that specifically bind to human interleukin-12 (hIL-12) are disclosed. Preferred antibodies have high affinity for hIL-12 and neutralize hIL-12 activity in vitro and in vivo. An antibody of the invention can be a full-length antibody or an antigen-binding portion thereof. The antibodies, or antibody portions, of the invention are useful for detecting hIL-12 and for inhibiting hIL-12 activity, e.g., in a human subject suffering from a disorder in which hIL-12 activity is detrimental. Nucleic acids, vectors and host cells for expressing the recombinant human antibodies of the invention, and methods of synthesizing the recombinant human antibodies, are also encompassed by the invention. | 07-09-2009 |
20090175858 | Crystalline EGFR - matuzumab complex and matuzumab mimetics obtained thereof - The invention relates to a crystal complex formed by the extracellular domain of EGF receptor (EGFR) and the Fab fragment of anti-EGFR antibody matuzumab (EMD 72000). Especially the invention relates to the identification of the epitope regions on said EGFR, which the antibody matuzumab recognizes as antigen an to which it specifically binds. The invention relates furthermore to protein, peptide and antibody structures which mimic the binding of matuzumab to its epitope region on EGFR, and may be used therefore, as EGFR antagonists with similar or improved properties as compared to matuzumab. | 07-09-2009 |
20090175859 | TNFalpha antagonists and methotrexate in the treatment of TNF-mediated disease - Methods for treating and/or preventing a TNF-mediated disease in an individual are disclosed. Also disclosed is a composition comprising methotrexate and an anti-tumor necrosis factor antibody. TNF-mediated diseases include rheumatoid arthritis, Crohn's disease, and acute and chronic immune diseases associated with transplantation. | 07-09-2009 |
20090175860 | Compositions and Methods of Use for Antibodies of c-Met - Antibodies and fragments that bind to the protein target c-Met, particularly to epitopes located in the c-Met extracellular domain, are provided, as are methods of use of the antibodies and kits, for treating an unwanted cell, in particular, a cell associated with a c-Met-related condition such as a cancer, a metastasis, or an inflammatory condition. | 07-09-2009 |
20090175861 | USE OF A B-CELL-DEPLETING ANTIBODY FOR TREATMENT OF POLYOMA VIRUS INFECTIONS - The present invention relates to uses of a B-cell-depleting antibody for the treatment of a polyoma virus infection. | 07-09-2009 |
20090175862 | COMBINATION THERAPY EMPLOYING LYMPHOTOXIN BETA RECEPTOR BINDING MOLECULES IN COMBINATION WITH SECOND AGENTS - This invention features combination therapies that include a composition that activates lymphotoxin-beta receptor signaling in combination with one or more other biologic agents, as well as therapeutic methods. | 07-09-2009 |
20090175863 | AGENTS TARGETING CD138 AND USES THEREOF - Disclosed is a human murine chimeric antibody which substantially retains the antigen binding region of its murine counterpart and displays improved binding affinities to the antigen and/or more homogenous binding to target cells. | 07-09-2009 |
20090175864 | IGF-1 AND IGF-2 CHIMERIC POLYPEPTIDES AND THERAPEUTIC USES THEREOF - Pharmaceutical compositions containing a chimeric protein comprising an IGF1 and an IGF2 component and optionally (F), a fusion component, and/or a signal sequence, are provided. The chimeric protein exhibits improved activity relative to the native IGF1 or IGF2 polypeptide. Further, therapeutic methods for treating IGF1 insufficiency diseases or conditions using the pharmaceutical compositions of the invention are also provided. The diseases or conditions treatable with the methods include muscle atrophy as a result of, for example, aging, cachexia, rheumatoid arthritis, diabetes, disuse or immobilization of muscle, and the like, as well as dwarfism and myocardial infarction. | 07-09-2009 |
20090175865 | CYSTEINE ENGINEERED ANTIBODIES AND CONJUGATES - Antibodies are engineered by replacing one or more amino acids of a parent antibody with non cross-linked, highly reactive cysteine amino acids. Antibody fragments may also be engineered with one or more cysteine amino acids to form cysteine engineered antibody fragments (ThioFab). Methods of design, preparation, screening, and selection of the cysteine engineered antibodies are provided. Cysteine engineered antibodies (Ab), optionally with an albumin-binding peptide (ABP) sequence, are conjugated with one or more drug moieties (D) through a linker (L) to form cysteine engineered antibody-drug conjugates having Formula I: | 07-09-2009 |
20090186018 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF RHEUMATOID ARTHRITIS - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 07-23-2009 |
20090186019 | Antigen binding molecules that bind EGFR, vectors encoding same, and uses thereof - The present invention relates to antigen binding molecules (ABMs). In particular embodiments, the present invention relates to recombinant monoclonal antibodies, including chimeric, primatized or humanized antibodies specific for human EGFR. In addition, the present invention relates to nucleic acid molecules encoding such ABMs, and vectors and host cells comprising such nucleic acid molecules. The invention further relates to methods for producing the ABMs of the invention, and to methods of using these ABMs in treatment of disease. In addition, the present invention relates to ABMs with modified glycosylation having improved therapeutic properties, including antibodies with increased Fc receptor binding and increased effector function. | 07-23-2009 |
20090186020 | Melanocortin Receptor Binding Mimetibodies, Compositions, Methods and Uses - Melanocortin receptor binding mimetibody polypeptides are disclosed. Polynucleotides encoding these polypeptides, cells comprising these polynucleotides or expressing the mimetibodies, and methods of making and using the forgoing are also disclosed. | 07-23-2009 |
20090186021 | Methods of preventing or treating inflammatory or autoimmune disorders by administering CD2 antagonists in combination with other prophylactic or therapeutic agents - The present invention provides to methods of preventing, treating or ameliorating an autoimmune or inflammatory disorder or one or more symptoms thereof utilizing combinatorial therapy. In particular, the present invention provides methods of preventing, treating, or ameliorating an autoimmune or inflammatory disorder or one or more symptoms thereof comprising administering to a subject in need thereof one or more CD2 antagonists and at least one other prophylactic or therapeutic agent. The present invention also provides compositions and articles of manufacture for use in preventing, treating or ameliorating one or more symptoms associated with an autoimmune or inflammatory disorder. | 07-23-2009 |
20090186022 | Organic Compounds - The present invention relates to human thymic stromal lymphopoietin (hTSLP) antibodies and especially those which neutralize hTSLP activity. It further relates to methods for using anti-hTSLP antibody molecules in diagnosis or treatment of hTSLP related disorders, such as asthma, atopic dermatitis, allergic rhinitis, fibrosis inflammatory bowel disease, and Hodgkin's lymphoma. | 07-23-2009 |
20090186023 | ANTIBODIES DIRECTED AGAINST HEPATITIS C VIRUS E1E2 COMPLEX, COMPOSITIONS OF HCV PARTICLES, AND PHARMACEUTICAL COMPOSITIONS - New conformational antibodies are directed against HCV and more particularly to monoclonal antibodies. Described compositions of particles are liable to be recognized by the antibodies, as are pharmaceutical compositions containing them. Also described are HCV enveloped subviral particles or purified HCV enveloped complete viral particles, and the processes for preparing them. | 07-23-2009 |
20090191190 | Anti-ABeta Globulomer Antibodies, Antigen-Binding Moieties Thereof, Corresponding Hybridomas, Nucleic Acids, Vectors, Host Cells, Methods of Producing Said Antibodies, Compositions Comprising Said Antibodies, Uses Of Said Antibodies And Methods Of Using Said Antibodies - Anti-Aβ globulomer antibodies, antigen-binding moieties thereof, corresponding hybridomas, nucleic acids, vectors, host cells, methods of producing said antibodies, compositions comprising said antibodies, uses of said antibodies and methods of using said antibodies. | 07-30-2009 |
20090191191 | Methods for the Modulation of IL-13 - The present invention is drawn to methods for modulating IL-13 expression and/or activity in a mammal comprising administering an effective amount of an agent which modulates the expression and/or activity of IL-9. | 07-30-2009 |
20090191192 | HUMANIZED ANTI-CCR2 ANTIBODIES AND METHODS OF USE THEREFOR - The present invention relates to a humanized antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 2 (CCR2) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a cell bearing mammalian CCR2 with a ligand thereof, and to use of the antibodies and fragments in therapeutic, prophylactic and diagnostic methods. | 07-30-2009 |
20090191193 | Aryl Vinyl Sulfides, Sulfones, Sulfoxides and Sulfonamides, Derivatives Thereof and Therapeutic Uses Thereof - Compounds useful as antiproliferative agents, including, for example, anticancer agents, according to formula I: | 07-30-2009 |
20090191194 | INHIBITION OF PROTEIN KINASE C ALPHA FOR THE TREATMENT OF CARDIOVASCULAR DISEASES - The invention relates to the use of agents impeding the expression and/or activity of protein kinase C-alpha (PKC-α), especially for treatment of patients with diabetes and complications such as diabetic nephropathy, retinopathy or neuropathy. | 07-30-2009 |
20090191195 | Combination of FcgammaRIIB-Specific Antibodies and CD20-Specific Antibodies and Methods of Use Thereof - The present invention relates to methods of treatment, prevention, management or amelioration of one or more symptoms of diseases or disorders associated with CD20 expression that encompass administration of a combination of: (A) one or more antibodies that specifically bind FcγRIIB, particularly human FcγRIIB, with greater affinity than said antibodies bind FcγRIIA, and (B) one or more antibodies that specifically bind to CD20. Such methods include methods of treating, preventing, managing or ameliorating one or more symptoms of a B cell related disease or disorder or an inflammatory disorder. The invention also provides pharmaceutical compositions comprising an anti-FcγRIIB antibody and an anti-CD20 antibody. | 07-30-2009 |
20090191196 | USE - The invention describes the use of an antibody specific for serum amyloid P component, for the treatment or prophylaxis of amyloidosis, and the use of a compound which depletes serum amyloid P component from the circulation in combination with an antibody specific for serum amyloid P component. | 07-30-2009 |
20090191197 | CANCEROUS DISEASE MODIFYING ANTIBODIES - The present invention relates to a method for producing cancerous disease modifying antibodies using a novel paradigm of screening. By segregating the anti-cancer antibodies using cancer cell cytotoxicity as an end point, the process makes possible the production of anti-cancer antibodies for therapeutic and diagnostic purposes. The antibodies can be used in aid of staging and diagnosis of a cancer, and can be used to treat primary tumors and tumor metastases. The anti-cancer antibodies can be conjugated to toxins, enzymes, radioactive compounds, and hematogenous cells. | 07-30-2009 |
20090191198 | METHODS FOR BLOCKING THE INTERACTION BETWEEN NKP80 AND ITS LIGANDS - The present invention relates to applications based on the findings of the interaction between NKp80 and its ligand AICL. A method of treating or preventing inflammatory diseases in a subject is disclosed, comprising administering a substance blocking the interaction between NKp80 and AICL, in particular for treating autoimmune diseases. Preferably, the substance is selected from the group comprising anti-NKp80-antibodies, anti-AICL-antibodies, soluble NKp80, soluble AICL, or functional fragments thereof. | 07-30-2009 |
20090196869 | ANTITUMOR COMBINATIONS CONTAINING TAXANE DERIVATIVES - The disclosure relates to pharmaceutical combinations comprising acetylcyclopropyl docetaxel and a monoclonal antibody against ErbB2, and to methods of use thereof. | 08-06-2009 |
20090196870 | BINDING CONSTRUCTS AND METHODS FOR USE THEREOF - The invention relates to novel binding domain-immunoglobulin fusion proteins that feature a binding domain for a cognate structure such as an antigen, a counterreceptor or the like, a wild-type IgG1, IGA or IgE hinge-acting region, i.e., IgE CH2, region polypeptide or a mutant IgG1 hinge region polypeptide having either zero, one or two cysteine residues, and immunoglobulin CH2 and CH3 domains, and that are capable of ADCC and/or CDC while occurring predominantly as polypeptides that are compromised in their ability to form disulfide-linked multimers. The fusion proteins can be recombinantly produced at high expression levels. Also provided are related compositions and methods, including cell surface forms of the fusion proteins and immunotherapeutic applications of the fusion proteins and of polynucleotides encoding such fusion proteins. | 08-06-2009 |
20090196871 | USE OF 4-PYRIDYLMETHYLPHTHALAZINES FOR CANCER TREATMENT - Patients suffering from renal carcinoma are treated with a 4-pyridylmethyl-phthalazine anti-angiogenesis agent. Patients having different tumor types, e.g. renal cancer, are treated with a 4-pyridylmethyl-phthalazine anti-angiogenesis agent while undergoing chemotherapy. | 08-06-2009 |
20090202526 | Agonist anti-trkc antibodies and methods using same - The invention concerns agonist anti-trkC antibodies, polypeptides, and polynucleotides encoding the same. The invention further concerns use of such antibodies, polypeptides and/or polynucleotides in the treatment and/or prevention of neuropathies, such as sensory neuropathies, including taxol-induced sensory neuropathy, cisplatin-induced sensory neuropathy, and pyridoxine-induced sensory neuropathy. | 08-13-2009 |
20090202527 | TREATMENT FOR MULTIPLE SCLEROSIS - Methods of treating multiple sclerosis and other disorders are disclosed. | 08-13-2009 |
20090202528 | Surface-Located Streptococcus Pneumoniae Polypeptides - The present invention relates to cell-surface-located polypeptides of | 08-13-2009 |
20090202529 | Use of egfr inhibitors to prevent or treat obesity - Methods of treating or preventing obesity or obesity related disorders in a subject are provided, comprising administering to the subject a treatment effective in reducing one or more activities of an epidermal growth factor receptor (EGFR) in the subject. Methods of screening for compositions that can modulate one or more EGFR activities are also provided. | 08-13-2009 |
20090202530 | Identification of Tumor-Associated Antigens for Diagnosis and Therapy - The invention relates to genetic products the expression of which is associated with cancer diseases. The invention also relates to the therapy and diagnosis of diseases in which the genetic products are expressed or aberrantly expressed, in particular cancer diseases. | 08-13-2009 |
20090202531 | USES OF ANTI-CD40 ANTIBODIES - Methods for treating a human patient for an inflammatory or autoimmune disease that is associated with CD40-expressing cells are provided, where the human patient is heterozygous or homozygous for FcγRIIIa-158F (genotype V/F or F/F). Also provided are methods of inhibiting antibody production by B cells in a human patient who is heterozygous or homozygous for FcγRIIIa-158F (genotype V/F or F/F). The methods comprise administering to the human patient a therapeutically or prophylactically effective amount of an anti-CD40 antibody. Methods and kits for identifying a human patient with an inflammatory or autoimmune disease that is treatable with an anti-CD40 antibody and which is non-responsive or refractory to treatment with rituximab (Rituxan®), as well as methods and kits for selecting an antibody therapy for treatment of a human patient having an inflammatory or autoimmune disease that is non-responsive or refractory to treatment with rituximab (Rituxan®), are also provided. The methods of the present invention find use in treatment of inflammatory diseases and autoimmune diseases that are associated with CD40-expressing cells. These methods are particularly advantageous with respect to inflammatory diseases and autoimmune diseases that are associated with cells expressing both CD40 and CD20, as the methods enable the treatment of patients having an inflammatory or autoimmune disease that is non-responsive or refractory to therapy with other therapeutic agents such as anti-CD20 antibodies. | 08-13-2009 |
20090202532 | High Functional Bispecific Antibody - [Problem]The purpose of the present invention is to provide a bispecific antibody that is structurally stable, and can show alone a sufficient effect without the co-administration of activated lymphocyte (T-LAK).
| 08-13-2009 |
20090202533 | TREATMENT AND PROPHYLAXIS OF TH2 MEDIATED DISORDERS - The present invention provides a method for the treatment or prophylaxis of T-helper type 2 (Th2)-mediated disorders using antagonists of IL-11. | 08-13-2009 |
20090202534 | COMPOSITIONS AND METHODS FOR MODULATING IMMUNE RESPONSES - Disclosed is a newly identified CD28 family member that functions as lymphocyte inhibitory receptor termed pG6b, which is expressed on T cells. Methods and compositions for modulating pG6b-mediated negative signaling and interfering with the interaction of its counter-receptor for therapeutic, diagnostic, and research purposes are also disclosed. | 08-13-2009 |
20090202535 | Method for neutralizing effects of sPLA2 - A compound comprising at least a structural entity which binds secretory phospholipase A2 IIA (sPLA2 IIA) or parts of it and more preferably human sPLA2 IIA and which
| 08-13-2009 |
20090202536 | ANTIBODY-DRUG CONJUGATES AND METHODS - The present invention relates to antibody-drug conjugate compounds of Formula I: | 08-13-2009 |
20090202537 | FcGammaRIIB Specific Antibodies and Methods of Use Thereof - The present invention relates to humanized FcγRIIB antibodies, fragments, and variants thereof that bind human FcγRIIB with a greater affinity than said antibody binds FcγRIIA. The invention encompasses the use of the humanized antibodies of the invention for the treatment of any disease related to loss of balance of Fc receptor mediated signaling, such as cancer (preferably a B-cell malignancy, particularly, B-cell chronic lymphocytic leukemia or non-Hodgkin's lymphoma), autoimmune disease, inflammatory disease or IgE-mediated allergic disorder. The present invention also encompasses the use of a humanized FcγRIIB antibody or an antigen-binding fragment thereof, in combination with other cancer therapies. The invention provides methods of enhancing the therapeutic effect of therapeutic antibodies by administering the humanized antibodies of the invention to enhance the effector function of the therapeutic antibodies. The invention also provides methods of enhancing the efficacy of a vaccine composition by administering the humanized antibodies of the invention with a vaccine composition. | 08-13-2009 |
20090202538 | F11 RECEPTOR (F11R) ANTAGONISTS AS THERAPEUTIC AGENTS - The present invention provides a cell adhesion molecule (CAM), designated F11 receptor (F11R) and its use to inhibit platelet aggregation and platelet adhesion for the treatment and prevention of cardiovascular disorders. Cloned F11R cDNA and full length F11R cDNA and amino acid sequences are provided. F11R-antagonists and methods for the prevention and treatment of thrombosis, atherosclerosis, heart attacks, stroke and other clinical disorders involving thrombus formation are also provided. There are at least two kinds of antagonists that may be employed together. Peptides derived from the extracellular domain of F11R and small molecules and peptidomimetics based on the structure of these peptides, as well as inhibitory antibodies and functional fragments thereof, are shown to inhibit human platelet aggregation and platelet adhesion to endothelial cells, and therefore, inhibit the formation of atherosclerotic plaques. | 08-13-2009 |
20090202539 | METHOD FOR TREATING CANCER USING ANTI-WNT2 MONOCLONAL ANTIBODIES AND siRNA - This invention relates to methods of inhibiting the growth of cells, in particular cancer cells, that overexpress Wnt2. The methods comprise contacting the cell with an agent that binds to Wnt2 mRNA or Wnt2 protein, interferes with Wnt2 signaling or inhibits binding of the Wnt2 protein to another protein, such as a Frizzled receptor. | 08-13-2009 |
20090202540 | SUBSTITUTED OXAZAPHOSPHORINES - The present invention relates to new oxazaphosphorine alkylating agents and/or immuno-suppressive agents, pharmaceutical compositions thereof, and methods of use thereof. | 08-13-2009 |
20090202541 | COMBINATION COMPRISING N-{5-[4-(4-METHYL-PIPERAZINO-METHYL)-BENZOYLAMIDO]-2-METHYLPHENYL)-4-(3-P- YRIDYL)-2PYRIMIDINE-AMINE AND A CHEMOTHERAPEUTIC AGENT - A method of treating a warm-blooded animal, especially a human, having a proliferative disease or acute or chronic transplant rejection comprising administering to the animal a combination which comprises (a) N-{5-[4-(4-methyl-piperazino-methyl)-benzoylamido]-2-methylphenyl}-4-(3-pyridyl)-2-pyrimidine-amine and (b) a chemotherapeutic agent selected from antineoplastic agents, especially as defined herein, and agents effective in treating acute or chronic transplant rejection; a combination comprising (a) and (b) as defined above and optionally at least one pharmaceutically acceptable carrier for simultaneous, separate or sequential use, in particular for the delay of progression or treatment of a proliferative disease, especially a solid tumor disease. | 08-13-2009 |
20090208487 | Prevention and treatment of synucleinopathic and amyloidogenic disease - The invention provides improved agents and methods for treatment of diseases associated with synucleinopathic diseases, including Lewy bodies of alpha-synuclein in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the Lewy body. The methods are particularly useful for prophylactic and therapeutic treatment of Parkinson's disease. | 08-20-2009 |
20090208488 | Regulation of dendritic cell functions by the DCAL-2 receptor - This invention provides antibodies that specifically bind to DCAL-2 and other DCAL-2 reagents that modulate dendritic cell function. Modulators of the receptor, including modulators that alter DCAL-2 associated signals to and from DCs, can be used to alter dendritic cell function and to enhance or inhibit immune responses to cancer antigens, autoantigens, or pathogens. | 08-20-2009 |
20090208489 | Antibodies That Bind OV064 and Methods of Use Therefor - Antibodies and antigen-binding fragments of antibodies that bind OV064 are disclosed. The antibodies bind an extracellular domain of OV064. Some of the antibodies and antigen-binding fragments bind an epitope on OV064 sufficient to induce internalization. In some embodiments, the antibodies are humanized, chimeric or human. Nucleic acids and vectors encoding the antibodies or portions thereof, recombinant cells that contain the nucleic acids, and compositions comprising the antibodies or antigen-binding fragments are also disclosed. The invention also provides therapeutic and diagnostic methods utilizing the antibodies and antigen-binding fragments provided herein. | 08-20-2009 |
20090208490 | Molecules that are able to inhibit the binding between NGF and the Trka receptor as analgesics with prolonged effect - Use of an anti-NGF antibody capable of inhibiting the binding between NGF and TrkA, capable of blocking the biological activity of TrkA for the preparation of a medicament for treating and/or preventing chronic pain. | 08-20-2009 |
20090208491 | Compositions and Methods for Diagnosing and Treating Cancer - Humanized antibodies that specifically binds to a non-ligand binding region of human Notch1 are described. Also described are methods of treating cancer, the methods comprising administering a therapeutically effective amount of a humanized anti-Notch1 antibody. | 08-20-2009 |
20090208492 | Lyophilized Immunoglobulin Formulations and Methods of Preparation - The present invention relates generally to the field of pharmaceutical formulation of immunoglobulins. Specifically, the present invention relates to stable, lyophilized, high concentration immunoglobulin formulations. This invention is exemplified by a stabilized lyophilized formulation of the recombinant humanized anti-alpha-4 integrin antibody natalizumab. | 08-20-2009 |
20090208493 | Compounds and methods for the selective inhibition of ABCB1, ABCC1 and ABCG2 transporters and the treatment of cancers, especially drug resistant cancers and high throughput flow cytometry assay to detect selective inhibitors - Compounds disclosed which inhibit ABCB1 transporter protein are useful for treating diseases in which ABCB1 transporter protein mediates the disease state, including numerous cancers, including hematopoietic cancers, including various leukemias, especially T-lineage acute lymphoblastic leukemia, as well as cancerous tumors, especially forms which exhibit multiple drug resistance. Pharmaceutical compositions which comprise an inhibitor of ABCB1 transporter protein and at least one additional anticancer agent, optionally in combination with a pharmaceutically acceptable carrier, additive or excipient are another aspect of the present invention. A flow cytometry based, high-throughput screening (HST) assay that quantifies ABCB1 efflux is also disclosed. Methods of identifying inhibitors of ABCB1, ABCG2 and ABCC1 transporter proteins are also disclosed. | 08-20-2009 |
20090208494 | HUMANIZED ANTIBODY MOLECULES SPECIFIC FOR IL-31 - The invention provides humanized mouse anti-human IL-31 antibodies and antibody fragments that are capable of binding IL-31 and thereby neutralizing, inhibiting, limiting, or reducing the proinflammatory or pro-pruritic effects of IL-31. | 08-20-2009 |
20090208495 | ANTI-TUMOR EFFECTIVE PARAMYXOVIRUS - Paramyxovirus from the group APMV3, APMV4, APMV5, APMV6, APMV7, APMV8, APMV9, Mapueravirus and Fer-de-Lance virus are described, which can be used for the production of a medicament for the treatment of tumors. The virus has a selectivity to kill human tumor cells but not human normal differentiated and human normal proliferating cells at the same dose. By genetic engineering the virus can be modified in such a way that one or more genes are added or are replaced by the homologous genes of a related paramyxovirus. By that method the anti-tumor activity of the resulting chimeric virus is enhanced compared to the parental virus. | 08-20-2009 |
20090208496 | HUMANIZED ANTI-CD4 ANTIBODY WITH IMMUNOSUPPRESSIVE PROPERTIES - A humanized antibody derived from mouse monoclonal anti-CD4 antibody B-F5 is able to activate CD25+CD4+ regulatory T cells and is useful for preparing immunosuppressive compositions. | 08-20-2009 |
20090208497 | HUMANIZED ANTI-CD4 ANTIBODY WITH IMMUNOSUPPRESSIVE PROPERTIES - A humanized antibody derived from mouse monoclonal anti-CD4 antibody B-F5 is able to activate CD25+CD4+ regulatory T cells and is useful for preparing immunosuppressive compositions. | 08-20-2009 |
20090208498 | Genetic Products Differentially Expressed In Tumors And The Use Thereof - The present technology relates to the identification of genetic products expressed in association with tumors and to coding nucleic acids for the expressed products. An embodiment of the present technology also relates to the therapy and diagnosis of disease in which the genetic products are aberrantly expressed in association with tumors, proteins, polypeptides and peptides which are expressed in association with tumors, and to the nucleic acids coding for the polypeptides, peptides and proteins. | 08-20-2009 |
20090208499 | N-(Phosphonoalkyl)-Amino Acids, Derivatives Thereof and Compositions and Methods of Use - The present invention relates to an N-(phosphonoalkyl)-amino acid, a related compound or a derivative thereof, the N-(phosphonoalkyl)-amino acid, related compound or derivative thereof being in a form as a free acid, salt, partial salt, lactone, amide or ester, or in stereoisomeric or non-stereoisomeric form, other than N-(phosphonomethyl)-glycine or N,N-bis(phosphonomethyl)-glycine. Also included is a composition including an N-(phosphonoalkyl)-amino acid, a related compound or a derivative thereof in a form as a free acid, salt, partial salt, lactone, amide or ester, or in stereoisomeric or non-stereoisomeric form, and a cosmetically or pharmaceutically acceptable vehicle for topical or systemic administration to a mammalian subject, as well as a method of administering an effective amount of such a composition for alleviating or improving a condition, disorder, symptom or syndrome associated with at least one of a nervous, vascular, musculoskeletal or cutaneous system. | 08-20-2009 |
20090214523 | Novel anti-IL13 antibodies and uses thereof - The present invention relates to anti-IL13 antibodies that bind specifically and with high affinity to both glycosylated and non-glycosylated human IL13, does not bind mouse IL13, and neutralize human IL13 activity at an approximate molar ratio of 1:2 (MAb:IL13). The invention also relates to the use of these antibodies in the treatment of IL13-mediated diseases, such as allergic disease, including asthma, allergic asthma, non-allergic (intrinsic) asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis, eczema, urticaria, food allergies, chronic obstructive pulmonary disease, ulcerative colitis, RSV infection, uveitis, scleroderma, and osteoporosis. | 08-27-2009 |
20090214524 | Methods and compositions for regulating cell cycle checkpoints - The invention relates to regulation of cell cycle checkpoints, and the application of such regulation in the treatment of disease, particularly cancer. | 08-27-2009 |
20090214525 | Novel anti-igf-ir antibodies and uses thereof - The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor IGF-IR and/or capable of specifically inhibiting the tyrosine kinase activity of said IGF-IR, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGF-IR. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or anti-VEGF antibodies and/or antibodies directed against other growth factors involved in tumor progression or metastasis and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 08-27-2009 |
20090214526 | Optimized Fc Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 08-27-2009 |
20090214527 | Combination Of Anti-Madcam Antibody And Antifibrotic Caspase Inhibitor To Treat Liver Fibrosis - The invention relates to a new combination of an anti-MAdCAM antibody with an anti-fibrotic agent, such as a protease inhibitor, preferably a caspase inhibitor. The invention also relates to pharmaceutical compositions comprising the combination of the invention, and the use of the combination for the treatment of liver fibrosis. | 08-27-2009 |
20090214528 | HOST CELL LINES FOR PRODUCTION OF ANTIBODY CONSTANT REGION WITH ENHANCED EFFECTOR FUNCTION - Host cell lines for biopharmaceutical production of antibodies, antibody fragments or antibody-derived fusion proteins are selected as having the capability of inducing improved cellular effector functions, e.g., Fc-medicated effector functions. The host cells are derived from the rat myeloma cell line YB2/0 and are adapted to growth in chemically-defined medium. | 08-27-2009 |
20090214529 | KINESIN INHIBITORS - This invention relates to the compounds of formula (I) shown below. Each variable in formula (I) is defined in the specification. These compounds can be used to treat a kinesin Eg5 protein-mediated disorder. | 08-27-2009 |
20090214530 | MODIFIED CpG OLIGODEOXYNUCLEOTIDE WITH IMPROVED IMMUNOREGULATORY FUNCTION - The present invention relates to a modified CpG oligodeoxynucleotide (ODN) which is prepared by coupling a consecutive sequence of deoxyribothymine (dT) to the 3′-terminus of CpG ODN having immunoregularory function, thereby improving immunoactivity of splenocytes, macrophages and peripheral mononuclear cells, and therefore, can be effectively used as a vaccine adjuvant for preventing and treating hepatitis B or an anticancer agent. Since the phosphorothioate CpG ODN having the consecutive sequence of dT at its 3′-terminus shows high activity inducing Th-1 immune response and does not elicit in vivo toxicity with guaranteeing its safety, it can be effectively used as a vaccine adjuvant. | 08-27-2009 |
20090214531 | Methods and Compositions for Treating and Preventing Bacterial Infections - The invention features methods and compositions for treating or preventing Gram-negative bacterial infections. | 08-27-2009 |
20090214532 | ANKTM1, A Cold-Activated TRP-Like Channel Expressed in Nociceptive Neurons - The methods and compositions of the invention are based on a method for measuring nociceptive responses in vertebrates, including humans and other mammals utilizing a newly discovered thermoreceptor belonging to the Transient Receptor Potential (TRP) family of non-selective cation channels that participates in thermosensation and pain. This receptor, designated ANKTM1, is associated with nociceptive pain, such as hyperalgesia. Accordingly, the invention provides isolated polypeptides and polynucleotides associated with nociception as well as methods for identifying or screening agents that modulate nociception. | 08-27-2009 |
20090214533 | METHODS FOR CONVERTING OR INDUCING PROTECTIVE IMMUNITY - The invention is based in part on the finding that suppressing regulatory T cell function is needed in order to convert passive immunity into active antigen-specific immunity. Generally, the methods of the invention comprise at least the combination of: (1) increasing the amount of immune complexes in the subject, wherein the immune complex comprises a target antigen and a immunoglobulin molecule comprising (i) a variable region specific to the target antigen and (ii) a Fc receptor binding region; and (2) inhibiting regulatory T cell function or decreasing/depleting the regulatory T cell population in the subject. | 08-27-2009 |
20090220495 | Cancer Related Genes (PRLR) - This invention is in the field of cancer-associated genes. Specifically it relates to methods for detecting cancer or the likelihood of developing cancer based on the presence or absence of expression of a PRLR gene or protein. The invention also provides methods and molecules for upregulating or downregulating PRLR gene expression and PRLR protein activity. | 09-03-2009 |
20090220496 | NOVEL USES FOR ANTI-IGE THERAPY - The present invention provides methods of treating a mammal having chronic obstructive pulmonary disease (COPD), independent of both smoking status and asthma status/with a therapeutically effective amount of an anti-IgE Ênoiety. In accordance with the invention, COFD patients with an elevated serum IgE level may benefit from the treatment methods disclosed. In certain instances, the methods of the disclosure have been found, to be useful ioÊ the treatment of COPD patients regardless of their skin test results arid/or in vitro reactivity to a perennial aeroalleigen. Anti-EgE moieties, in accordance With the invention, include but are not limited to any IgG antibody that selectively binds to a given mammal iirunuitoglobulln E (e.g., human imntnnoglQbulin E) such as humanized arrti-IgEy hmuanized murine monoclonal antibody, and/or Qmalizumab. | 09-03-2009 |
20090220497 | THERAPEUTIC COMPOSITIONS COMPRISING HYALURONAN AND THERAPEUTIC ANTIBODIES AS WELL AS METHODS OF TREATMENT - The present invention relates generally to treatment and prophylactic protocols for cellular diseases or disorders, such as diseases and disorders associated with abnormal cellular proliferation. More particularly, the present invention provides compositions comprising therapeutic antibodies and hyaluronan and their use in the treatment or prophylaxis of cellular diseases and disorders. | 09-03-2009 |
20090220498 | Method for Discovering Inhibitors of the Epstein-Barr Virus-Induced Gene 3 (EBI3) and Derivatives Thereof for the Treatment of Metastasizing Tumors and Allergic Asthma - The present invention relates to a method for identifying inhibitors of the Epstein Barr virus-induced gene 3 (EBI3), a method for producing a pharmaceutical composition, comprising an inhibitor, a respective pharmaceutical composition and a method for treating a metastasizing tumor disease or allergic asthma, comprising the administration of an effective amount of an inhibitor of EBI3. | 09-03-2009 |
20090220499 | Agents for Suppressing Damage to Transplanted Islets After Islet Transplantation - The present inventors investigated anti-IL-6 receptor antibodies for their effect in suppressing damage to transplanted islets after islet transplantation. As a result, they found that anti-IL-6 receptor antibodies reduced damage to transplanted islets, improved islet survival, and corrected hyperglycemia in recipients. Further, they revealed that administration of the anti-IL-6 receptor antibodies of the present invention suppressed the production of inflammatory cytokines by infiltrating cells after transplantation. Specifically, the present inventors discovered for the first time that damage to transplanted islets after islet transplantation can be suppressed by using anti-IL-6 receptor antibodies according to the present invention. | 09-03-2009 |
20090220500 | AGENTS FOR TREATING CARDIOPATHY - The present inventors investigated the effects of anti-IL-6 receptor antibodies on improving the condition of infarcted areas in myocardial infarction, and on suppressing left ventricular remodeling after myocardial infarction. As a result, the administration of anti-IL-6 receptor antibodies significantly suppressed the increase of MPO activity in the infarcted area and suppressed myocardial MCP-1 expression in both the infarcted area and the non-infarcted area. Furthermore, echocardiography and histological examinations revealed that cardiac hypertrophy is also suppressed. | 09-03-2009 |
20090220501 | Anti-CD19 Antibody, Immunotoxin and Treatment Method - Provided is an immunotoxin including (a) an anti-CD19 antibody lacking an Fc fragment, (b) a modified exotoxin A protein having both Domains II and III, but lacking Domain I, and (c) a peptide linker joining the C-terminal end of the antibody to the N-terminal end of the modified exotoxin A protein. The linker is substantially resistant to extracellular cleavage. The modified exotoxin A protein may be further modified to include a C-terminal KDEL sequence (SEQ ID NO: 6) that promotes transport of the protein to the endoplasmic reticulum of cells that have taken up the immunotoxin. Also provided is an anti-CD19 antibody having enhanced binding activity, antibody-dependent cellular cytotoxicity (ADCC) and methods for using the antibody to treat a disease state associated with B-lineage cells that express CD19. The antibody variable light and variable heavy chains have unique sequences in their J region relative to known anti-CD19 antibody sequences. | 09-03-2009 |
20090220502 | B7 FAMILY MEMBER zB7H6 AND RELATED COMPOSITIONS AND METHODS - Disclosed is a newly identified B7 family member, zB7H6, which functions as a counter-receptor for the NK cell triggering receptor, NKp30. Methods and compositions for modulating NKp30-mediated NK cell activity based on the interaction of zB7H6 with NKp30, as well as related screening methods, are also disclosed. Further disclosed are anti-zB7H6 antibodies as well as antibody-drug conjugates comprising an anti-zB7H6 antibody conjugated to a therapeutic agent, including methods for using such antibodies and antibody-drug conjugates to exert therapeutic effects against zB7H6-expressing cells. | 09-03-2009 |
20090220503 | METHOD FOR TREATING CANCERS WITH INCREASED RAS SIGNALING - Disclosed herein are methods for treating a subject with, or at risk for, developing a tumor which has aberrantly increased Ras signaling. The method involves obtaining a biological sample from the subject, determining whether the biological sample contains cells which have aberrantly increased Ras signaling, and administering an agent that selectively inhibits Protein Kinase C (PKC) delta to the subject upon determination of the aberrantly increased Ras signaling, to thereby inhibit PKC-delta in the cell. The increased Ras signaling may result from expression of activated Ras, e.g. resulting from mutations in codon 12, 13, 59, 61, 63, 116, 117, or 146. Such mutations can be determined by detection of a nucleotide sequence encoding an activated form of Ras protein, or by detection of the activated Ras protein. The increased Ras signaling may result from over-expression of wild-type Ras, over-activation of wild-type Ras, or increased activation of one or more effector pathways downstream of Ras. The tumor cells of the individual may be malignant or non-malignant. The inhibitor(s) of PKC-delta may inhibit PKC-delta gene expression, reduce PKC-delta protein levels, and/or inhibit PKC-delta protein function by inhibiting kinase activity. Appropriate inhibitors are Rottlerin, Balanol, balanol analogs, KAI 9S03, and combinations thereof. Also disclosed are methods for determining the likelihood of effectiveness of administering an agent that selectively inhibits PKC-delta to a subject with a tumor. The methods involve determining the presence or absence of aberrantly increased Ras signaling in the tumor, wherein the presence of aberrantly increased Ras signaling indicates that administration of the PKC-delta inhibitor is likely to be effective. | 09-03-2009 |
20090220504 | COMBINATORIAL THERAPY - The present invention relates to the use of VEGF antagonists and alpha5beta1 antagonists for treating cancer and inhibiting angiogenesis and/or vascular permeability, including inhibiting abnormal angiogenesis in diseases. The present invention also relates to use of a VEGFR agonists and alpha5beta1 agonists to promote angiogenesis and vascular permeability. The present invention also relates to new anti-alpha5beta1 antibodies, compositions and kits comprising them and methods of making and using them. | 09-03-2009 |
20090220505 | METHODS OF INHIBITING AMYLOID TOXICITY - The present invention features methods and compositions for inhibiting amyloidogenic protein toxicity, inhibiting formation of an amyloidogenic protein deposit and/or treating amyloidogenic diseases by administering a pharmaceutically effective amount of one or more agents that bind an integrin or an integrin subunit. | 09-03-2009 |
20090226433 | COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF INFLUENZA - The present invention provides novel human anti-influenza antibodies and related compositions and methods. These antibodies are used in the diagnosis and treatment of influenza infection. | 09-10-2009 |
20090226435 | Engineered fusion molecules immunotherapy in cancer and inflammatory diseases - The field of the present invention relates to genetically engineered fusion molecules, methods of making said fusion molecules, and uses thereof in anti-tumor immunotherapies. More specifically, the present invention relates to engineered fusion molecules consisting of a tumor targeting moiety fused with one or more costimulatory molecules/chemokines/cytokines. | 09-10-2009 |
20090232799 | Antibodies that bind urokinase-type plasminogen activator and epitopes therefor - Anti-uPA antibodies and antigen-binding regions thereof, as well as pharmaceutical compositions comprising such antibodies and antigen-binding regions, are described. Also described are methods of using such antibodies and antigen-binding regions to bind uPA epitopes and activate uPA function, such as inhibition of uPA mediated inflammation. Epitopes that can be used to activate uPA function and anti-inflammation activity are also described, as well as methods of identifying compounds that can bind them. | 09-17-2009 |
20090232800 | E1-MINUS ADENOVIRUSES AND USE THEREOF - The present invention is related to a virus, preferably an adenovirus, characterised in that the virus comprises:
| 09-17-2009 |
20090232801 | Humanized Antibodies Which Bind To AB (1-42) Globulomer And Uses Thereof - The present invention relates to binding proteins and, in particular, humanized antibodies that may be used, for example, in the diagnosis, treatment and prevention of Alzheimer's Disease and related conditions. | 09-17-2009 |
20090232802 | Compositions and methods for the treatment of natural killer cell related diseases - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 09-17-2009 |
20090232803 | ANTIBODIES TO HUMAN IL-1BETA - An IL-1β binding molecule, in particular an antibody to human IL-1β, especially a human antibody to human IL-1β is provided, wherein the CDRs of the heavy and light chains have amino acid sequences as defined, for use in the treatment of an IL-1 mediated disease or disorder, e.g. osteoarthritis, osteoporosis and other inflammatory arthritides. | 09-17-2009 |
20090232804 | HUMANIZED ANTIBODIES SPECIFIC FOR VON WILLEBRAND FACTOR - The present disclosure relates to humanized antibodies or binding fragments thereof specific for human von Willebrand factor (vWF), methods for their preparation and use, including methods for treating vWF mediated diseases or disorders. | 09-17-2009 |
20090232805 | METHODS OF INHIBITING RECEPTOR TYROSINE KINASES WITH AN EXTRACELLULAR ANTAGONIST AND AN INTRACELLULAR ANTAGONIST - The present invention relates to methods of inhibiting receptor tyrosine kinases by utilizing a combination of both an extracellular and an intracellular RTK antagonist. The extracellular RTK antagonist is a biological molecule or a small molecule that inhibits activation of the receptor tyrosine kinase by interacting with the extracellular binding region of the receptor. The intracellular RTK antagonist is a biological molecule or small molecule that inhibits tyrosine kinase activity of the receptor tyrosine kinase by interacting with the receptor's intracellular region bearing a kinase domain or by interacting with an intracellular protein involved in the signaling pathway of the receptor tyrosine kinase. The present invention also provides methods of treating tyrosine kinase dependent diseases, and compositions for use in such methods thereof, by administering a combination of both an extracellular and an intracellular RTK antagonist. | 09-17-2009 |
20090232806 | Anti-CD70 Antibody And Its Use For The Treatment And Prevention Of Cancer And Immune Disorders - Disclosed are CD70 binding agents, such as anti-CD70 antibodies and derivatives, that induce a cytotoxic, cytostatic or immunomodulatory without conjugation to a therapeutic agents as well as pharmaceutical compositions and kits comprising the antibody or derivative. Also disclosed are methods for the treatment and prevention of CD70-expressing cancers and immunological disorders comprising administering the CD70 binding agents to a subject. | 09-17-2009 |
20090238820 | ANTI-MAdCAM ANTIBODY COMPOSITIONS - The present invention relates to anti-MAdCAM antibody compositions comprising a chelating agent, and methods of treating inflammatory disease in a subject. | 09-24-2009 |
20090238821 | HUMANIZED ANTIBODIES THAT SEQUESTER AMYLOID BETA PEPTIDE - A method to treat conditions characterized by formation of amyloid plaques both prophylactically and therapeutically is described. The method employs humanized antibodies which sequester soluble Aβ peptide from human biological fluids or which preferably specifically bind an epitope contained within position 13-28 of the amyloid beta peptide Aβ. | 09-24-2009 |
20090238822 | Chimeric Hepatitis C Virus Antigens For Eliciting an Immune Response - Disclosed herein are chimeric antigens, comprising an hepatitis C virus (HCV) antigen and a Fc fragment of an immunoglobulin for eliciting an immune response against said antigen. The immune response is enhanced by presenting the host immune system with an immune response domain (HCV antigen from HCV core, envelope, or non-structural protein fragments) and a target binding domain (an Fc fragment). By virtue of the target binding domain, antigen presenting cells internalize and process the chimeric antigens for antigen presentation, thereby eliciting both a humoral and cellular immune response. | 09-24-2009 |
20090238823 | Antigen binding proteins capable of binding thymic stromal lymphopoietin - The present disclosure provides compositions and methods relating to antigen binding proteins which bind to human thymic stromal lymphopoietin (TSLP), including antibodies. In particular embodiments, the disclosure provides fully human, humanized and chimeric anti-TSLP antibodies and derivatives of such antibodies. The disclosure further provides nucleic acids encoding such antibodies and antibody fragments and derivatives, and methods of making and using such antibodies including methods of treating and preventing TSLP-related inflammatory and fibrotic disorders. | 09-24-2009 |
20090238824 | BREAST, GASTRIC AND PROSTATE CANCER ASSOCIATED ANTIGENS AND USES THEREFOR - Cancer associated antigens have been identified by autologous antibody screening of libraries of nucleic acids expressed in breast, gastric and prostate cancer cells using antisera from cancer patients. The invention relates to nucleic acids and encoded polypeptides which are cancer associated antigens expressed in patients afflicted with cancer. The invention provides, inter alia, isolated nucleic acid molecules, expression vectors containing those molecules and host cells transfected with those molecules. The invention also provides isolated proteins and peptides, antibodies to those proteins and peptides and cytotoxic T lymphocytes which recognize the proteins and peptides. Fragments of the foregoing including functional fragments and variants also are provided. Kits containing the foregoing molecules additionally are provided. The molecules provided by the invention can be used in the diagnosis, monitoring, research, or treatment of conditions characterized by the expression of one or more cancer associated antigens. | 09-24-2009 |
20090238825 | NOVEL RABBIT ANTIBODY HUMANIZATION METHODS AND HUMANIZED RABBIT ANTIBODIES - The present invention is directed to novel and improved methods for humanizing rabbit heavy and light variable regions. The resulting humanized rabbit heavy and light chains and antibodies and antibody fragments containing are well suited for use in immunotherapy and immunodiagnosis as they retain the antigen binding affinity of the parent antibody and based on their very high level of sequence identity to human antibody sequences should be essentially non-immunogenic in humans. The invention exemplifies the protocol for the manufacture of therapeutic humanized anti-human TNF-alpha and anti-human IL-6 antibodies. | 09-24-2009 |
20090238826 | INHIBITORS OF PLACENTAL GROWTH FACTOR FOR THE TREATMENT OF PATHOLOGICAL ANGIOGENESIS, PATHOLOGICAL ARTERIOGENESIS, INFLAMMATION, TUMOR FORMATION AND/OR VASCULAR LEAKAGE - The present invention relates to the field of pathological angiogenesis and arteriogenesis and, in particular, to a stress-induced phenotype in a transgenic mouse (PIGF | 09-24-2009 |
20090238827 | THERAPEUTIC USE OF ANTI-CS1 ANTIBODIES - The present invention is directed to antagonists of CS1 that bind to and neutralize at least one biological activity of CS1. The invention also includes a pharmaceutical composition comprising such antibodies or antigen-binding fragments thereof. The present invention also provides for a method of preventing or treating disease states, including autoimmune disorders and cancer, in a subject in need thereof, comprising administering into said subject an effective amount of such antagonists. | 09-24-2009 |
20090238828 | Combinations for the Treatment of Diseases involving Cell Proliferation - Disclosed are pharmaceutical compositions for the treatment of diseases which involve cell proliferation. Also disclosed are methods for the treatment of said diseases, comprising co-administration of a compound 1 of Formula (I) | 09-24-2009 |
20090246194 | ERYTHROPOIETIN ANALOG-IgG FUSION PROTEINS - Erythropoietin analog-human IgG fusion protein (EPOa-IgG) fusion protein and methods of making and using the fusion protein. | 10-01-2009 |
20090246195 | ANTI-CD19 ANTIBODY THERAPY FOR TRANSPLANTATION - The invention relates to immunotherapeutic compositions and methods for the treatment and prevention of GVHD, humoral rejection, and post-transplantation lymphoproliferative disorder in human subjects using therapeutic antibodies that bind to the human CD19 antigen and that preferably mediate human ADCC. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG1 or IgG3 human isotype. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG2 or IgG4 human isotype that preferably mediate human ADCC. The present invention also relates to pharmaceutical compositions comprising chimerized anti-CD19 antibodies of the IgG1, IgG2, IgG3, or IgG4 isotype that mediate human ADCC. In preferred embodiments, the present invention relates to pharmaceutical compositions comprising monoclonal human, humanized, or chimeric anti-CD19 antibodies. | 10-01-2009 |
20090246196 | COMBINED TARGETED THERAPY FOR THE TREATMENT OF PROLIFERATIVE DISEASE - A method of treating an individual comprising: evaluating the disease state of said individual through quantitative and/or qualitative assays; administering in amounts sufficient to treat said disease at least three agents wherein at least one agent is an inhibitor of the human epidermal receptor pathway, at least one agent is signal transduction inhibitor and at least one agent is an angiogenesis inhibitor and; reevaluating the disease state of said individual presenting through quantitative and/or qualitative assays. A composition comprising a first agent that is an inhibitor of the human epidermal receptor pathway, a second agent that is an angiogenesis inhibitor and a third agent that is an inhibitor of Akt wherein said first agent, second agent, third agent and combinations thereof are present in amounts that when administered to an individual in a diseased state are sufficient to treat said disease. | 10-01-2009 |
20090246197 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH INCREASED ANTIBODY DEPENDENT CELLULAR CYTOTOXICITY (ADCC) - The present invention is directed to a pharmaceutical composition comprising: (A) a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity (ADCC); and (B) a chemotherapeutic agent selected from the group consisting of: cyclophosphamide, vincristine and doxorubicine. | 10-01-2009 |
20090246198 | MAPK/ERK KINASE INHIBITORS AND METHODS OF USE THEREOF - Compounds of the following formula are provided: | 10-01-2009 |
20090252723 | Remedy for endometriosis - The present invention provides a therapeutic agent for endometriosis comprising an interleukin-5 antagonist as an active ingredient. | 10-08-2009 |
20090252724 | Antibodies Against Amyloid Beta 4 With Glycosylated in the Variable Region - The present invention relates to a purified antibody molecule preparation being characterized in that at least one antigen binding site comprises a glycosylated asparagine (Asn) in the variable region of the heavy chain (V | 10-08-2009 |
20090252725 | Use of CD23 Antibodies to Treat Malignancies in Patients with Poor Prognosis - The invention relates to methods of treating B-cell chronic lymphocytic leukemia, and other CD23 | 10-08-2009 |
20090252726 | ANTIBODIES FOR INHIBITING BLOOD COAGULATION AND METHODS OF USE THEREOF - The invention includes antibodies that provide superior anti-coagulant activity by binding native human TF with high affinity and specificity. Antibodies of the invention can effectively inhibit blood coagulation in vivo. Antibodies of the invention can bind native human TF, either alone or present in a TF:FVIIa complex, effectively preventing factor X or FIX binding to TF or that complex, and thereby reducing blood coagulation. Preferred antibodies of the invention specifically bind a conformational epitope predominant to native human TF, which epitope provides an unexpectedly strong antibody binding site. Also provided are humanized antibodies and fragments thereof that bind to the TF. | 10-08-2009 |
20090252727 | GLUCAGON RECEPTOR ANTAGONISTS - The present invention relates to glucagon receptor polypeptide antagonists which inhibit the binding of the hormone glucagon to its receptor. More particularly, the present invention relates to high affinity glucagon receptor antibodies or Fab fragments thereof that inhibit binding of glucagon to its receptor and their use in the treatment or prevention of type 2 diabetes (NIDDM) and related disorders in mammalian species. | 10-08-2009 |
20090258007 | Anti-Perp Antibody - The present invention provides an antibody which specifically recognizes three-dimensional structure of an extracellular region of a polypeptide encoded by PERP (p53 apoptosis effector related to PMP-22) gene and binds to the extracellular region. The antibody of the present invention is useful for treatment of various diseases which highly expresses a polypeptide encoded by the PERP gene. Also, a polypeptide encoded by the PERP gene or a cell expressing the polypeptide can be specifically detected by an immunological method using the antibody, so that the antibody is useful for diagnosis of various diseases related to PERP. | 10-15-2009 |
20090258008 | Uses of the FcRn Receptor - The invention relates to the field of biochemistry and molecular biology. More specifically the invention relates to the production of (monoclonal) antibodies and even more specifically to the production of therapeutic and diagnostic antibodies. The invention provides a method for producing an antibody or a functional part, derivative and/or analogue thereof in a cell, comprising providing a cell that is capable of producing said antibody with FcRn receptor protein and culturing said cell to allow for production of said antibody. | 10-15-2009 |
20090258009 | PROTOFIBRIL SELECTIVE ANTIBODIES AND THE USE THEREOF - The present invention pertains to the prevention, treatment and diagnosis of neurodegenerative diseases, in particular Alzheimer's disease, and other similar disease. More specifically to high affinity antibodies selective for amyloid beta protein (Aβ) in its protofibril conformation and of IgG class and IgG1 or IgG4 subclass or combinations thereof or mutations thereof, retaining high Fc receptor binding and low C1(CIq) binding, effective in clearance of Aβ protofibrils and with reduce risk of inflammation. | 10-15-2009 |
20090258010 | METHODS, COMPOSITIONS, AND KITS FOR TREATING SHIGA TOXIN ASSOCIATED CONDITIONS - The invention features methods, compositions, and kits for treating a subject having a Shiga toxin associated disease with chimeric anti-Shiga Toxin 1 (cαStx1) and anti-Shiga Toxin 2 (cαStx2) antibodies. | 10-15-2009 |
20090258011 | Antibodies against west nile virus and therapeutic and prophylactic uses thereof - The present invention relates to compositions comprising antibodies or fragments thereof that immunospecifically bind to one or more antigens of a flavivirus, particularly of West Nile Virus (WNV), and methods for preventing, treating or ameliorating symptoms associated with a flavivirus, particularly of West Nile Virus (WNV), infection utilizing said compositions. In particular, the present invention relates to methods for preventing, treating or ameliorating symptoms associated with WNV infection, said methods comprising administering to a human subject an effective amount of one or more antibodies or fragments thereof that immunospecifically bind to a WNV antigen. The present invention also relates to detectable or diagnostic compositions comprising antibodies or fragments thereof that immunospecifically bind to a WNV antigen and methods for detecting or diagnosing WNV infection utilizing said compositions. | 10-15-2009 |
20090258012 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATORY DISORDERS - The invention relates to compositions and methods for treating inflammatory disorders. More specifically, the invention relates to antibody compositions and their use in the treatment of inflammatory disorders. | 10-15-2009 |
20090258013 | NOVEL COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES - The present invention relates to compositions and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 10-15-2009 |
20090258014 | COMBINATION OF HGF INHIBITOR AND EGF INHIBITOR TO TREAT CANCER - The present invention is directed toward a method of treating cancer by administering to a patient an inhibitor of Hepatocyte Growth Factor and an inhibitor of, e.g., Epidermal Growth Factor. | 10-15-2009 |
20090258015 | Modulators of Candida Hyphal Morphogenesis and Uses Thereof - The invention relates to modulation of fungal morphology between yeast-to-hyphal growth transition by controlling muramyl-L-alanine concentration and uses thereof. | 10-15-2009 |
20090258016 | Substituted imidazole derivatives - The present invention relates to new substituted imidazole compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds. The compounds of the invention have the following general formula: | 10-15-2009 |
20090263382 | STABLE AND SOLUBLE ANTIBODIES INHIBITING TNF ALPHA - The present invention relates to particularly stable and soluble scFv antibodies and Fab fragments specific for TNFα, which comprise specific light chain and heavy chain sequences that are optimized for stability, solubility, in vitro and in vivo binding of TNFα, and low immunogenicity. Said antibodies are designed for the diagnosis and/or treatment of TNFα-related disorders. The nucleic acids, vectors and host cells for expression of the recombinant antibodies of the invention, methods for isolating them and the use of said antibodies in medicine are also disclosed. | 10-22-2009 |
20090263383 | Antibodies to angiogenesis inhibiting domains of CD148 - The present invention provides compositions and methods relating to anti-CD148 receptor antibodies. Methods provided include inhibiting angiogenesis and, thereby, vascularization of solid tumors in human patients. The present invention also provides compositions and methods for in vivo imaging of tumors expressing CD148. Compositions of the invention include: anti-CD148 antibodies, antigen binding regions of anti-CD148 antibodies, polynucleotides encoding anti-CD 148 antibodies or binding regions thereof, vectors comprising these polynucleotides, host cells, and pharmaceutical compositions. Methods of making and using each of these compositions is also provided. | 10-22-2009 |
20090263384 | Agents for Suppressing the Induction of Cytotoxic T Cells - The effect of anti-IL-6 receptor antibodies in suppressing cytotoxic T cell induction was examined. The results showed that CTL activity against alloantigens was statistically significantly reduced in mice treated with anti-IL-6 receptor antibodies as compared to mice not treated with antibodies and mice treated with a control antibody. The anti-IL-6 receptor antibody was also administered to recipients of a mouse model for allogenic heart transplantation. As a result, histopathological findings showed that inflammatory cell infiltration into transplanted hearts was suppressed and the survival period of transplanted hearts was significantly prolonged. Thus, the present inventors for the first time discovered that administration of anti-IL-6 receptor antibodies could suppress cytotoxic T cell induction and thereby suppress acute rejection after transplantation. | 10-22-2009 |
20090263385 | Breast carcinoma treatment method - The instant invention is an in-vivo treatment method directed against living epithelial cells in the human breast, and uses a modified ductal lavage technique to infuse a purposely formulated treatment fluid into pre-chosen individual ducts in the human breast for reaction with such epithelial cells as then are present within the ducts. The prepared treatment fluid, at a minimum, comprises: at least one preselected Complement-fixing antibody (or preferably an admixture of different Complement-fixing antibodies) directed at specific antigens, haptens or epitopes which are characteristically present on normal, atypical, or malignant breast epithelial cells in-vivo; the recognized chemical components for activating and fixing Complement in-situ; and a biocompatible fluid carrier. The treatment method can be employed as a therapeutic process in-vivo against a presently existing breast disorder, neoplasm, or carcinoma; but also may be used in-vivo as a preventative procedure performed prophylactically in advance of the patient receiving a clinical diagnosis of breast malignancy (e.g., ductal, medullary, or lobular carcinoma). It can also be used to treat a breast with atypia, premalignancy, carcinoma in-situ, or carcinoma (when not treated with total mastectomy), and can be used as a prophylactic treatment in the contralaterial breast. | 10-22-2009 |
20090263386 | HUMANIZED IMMUNOMODULATORY MONOCLONAL ANTIBODIES FOR THE TREATMENT OF NEOPLASTIC DISEASE OR IMMUNODEFICIENCY - The present invention provides to a humanized monoclonal antibody having immunostimulatory effects. This antibody binds specifically to B lymphoblastoid cells, induces proliferation and activation of peripheral blood lymphocytes, particularly T cells, and is capable of eliciting an anti-tumor effect upon administration to subjects suffering from an immune deficiency. | 10-22-2009 |
20090263387 | Neutralization of GM-CSF for the Treatment of Heart Failure - This invention relates to methods of treating a patient suffering from heart failure, or a patient at risk for heart failure, using a GM-CSF antagonist. | 10-22-2009 |
20090263388 | Methods of preventing or treating cardiovascular, cerebrovascular and thrombotic disorders with tumor necrosis factor antagonists - A method of treating or preventing a cardiovascular and/or a cerebrovascular disorder in an individual is disclosed. Also disclosed is a method for treating and/or preventing a thrombotic disorder in an individual. Further disclosed is a method of decreasing plasma fibrinogen in an individual. | 10-22-2009 |
20090263389 | Use of TGF-Beta Antagonists to Treat or to Prevent Chronic Transplant Rejection - Effective use of a TGF-β antagonist to treat or to prevent loss of transplant function is described herein. Use of a TGF-β antagonist is demonstrated to effectively prevent loss of organ function in a host due to chronic rejection in which TGF-β-mediated fibroproliferation is a characteristic. Expression in situ of a TGF-β antagonist in the form of a recombinant receptor, i.e., TGF-β type III receptor (TGFBIIIR) showed prevention of bronchiolitis obliterans in comparison to untreated controls in a rat lung transplant model. This provides an effective method for preventing or inhibiting chronic rejection of transplant organs such as lung, kidney, liver and heart in vertebrate hosts including human hosts. | 10-22-2009 |
20090263390 | METHOD OF TREATING CANCER BY CO-ADMINISTRATION OF ANTICANCER AGENTS - The present invention relates to a method of treating cancer by co-administration of an effective amount of 1-(2-methoxyethyl)-2-methyl-4,9-dioxo-3-(pyrazin -2-ylmethyl)-4,9-dihydro-1H-naphtho[2,3-d]imidazol-3-ium bromide and an effective amount of one or more anticancer agents selected from the group consisting of carboplatin, cisplatin, paclitaxel, vinorelbine, gemcitabine, irinotecan, docetaxel, doxorubicin, dacarbazine and rituximab, or a retuximab-containing combination therapy selected from R-ICE and R-DHAP. The treatment method of the present invention is useful for the treatment for all solid tumors and lymphomas, preferably skin cancer, bladder cancer, breast cancer, uterine cancer, ovary cancer, prostate cancer, lung cancer, colon cancer, pancreas cancer, renal cancer, gastric cancer and the like. Particularly, they are expected as therapeutic agents for tumor types which show resistance against existing anticancer agents. | 10-22-2009 |
20090263391 | ANTIBODIES THAT BIND TO EPHA2 AND METHODS OF USE THEREOF - Provided herein is disclosure about the development and characterization of an antibody that binds to antigen EphA2 which is present on a variety of human cancers from breast, lung, prostate, and colons. Methods of diagnosing and treating various cancers by using such antibodies directed against this antigen are also disclosed. | 10-22-2009 |
20090269335 | THERAPEUTIC AGENT FOR PROSTATE CANCER - The present inventors investigated the antitumor effects of anti-IL-6 receptor antibodies against prostate cancer. The result showed that the anti-IL-6 receptor antibodies had both in vivo and in vitro antitumor effects against prostate cancer. It was also revealed that the hPM1 antitumor effect is via IL-6 receptor. | 10-29-2009 |
20090269336 | ANTI-VEGF MONOCLONAL ANTIBODY - The present invention provides novel monoclonal antibodies with a high binding affinity to all five isoforms of human VEGF. | 10-29-2009 |
20090269337 | COMPOSITIONS AND METHODS FOR TREATING DIABETES - Compositions and methods for islet neogenesis therapy comprising an EGF and a gastrin in combination with immune suppression, and for treating or preventing early stage diabetes with a gastrin/CCK receptor ligand and an immunosuppressant are provided. | 10-29-2009 |
20090269338 | HUMANIZED ANTI-FACTOR D ANTIBODIES AND USES THEREOF - The invention relates to anti-Factor D antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their production and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 10-29-2009 |
20090269339 | RESPONSES TO IMMUNIZATIONS IN RHEUMATOID ARTHRITIS PATIENTS TREATED WITH A CD20 ANTIBODY - The present invention provides clinical data evaluating the efficacy of responses to immunizations in rheumatoid arthritis (RA) patients treated with a CD20 antibody. | 10-29-2009 |
20090269340 | ANTIBODIES TO ONCOSTATIN M RECEPTOR - The invention provides characterization of the disease and cancer-associated antigen, OSM-R.beta. The invention also provides modulators of OSM-R.beta, including a family of monoclonal antibodies that bind to antigen OSM-R.beta, and methods of diagnosing and treating various human cancers and diseases associated with OSM-R.beta. | 10-29-2009 |
20090274688 | Antibodies to OPGL - Antibodies that interact with osteoprotegerin ligand (OPGL) are described. Methods of treating osteopenic disorders by administering a pharmaceutically effective amount of antibodies to OPGL are described. Methods of detecting the amount of OPGL in a sample using antibodies to OPGL are described. | 11-05-2009 |
20090274689 | Co-Administration of a Thrombolytic and an Anti-CD18 Antibody in Stroke - A method for improving clinical outcome in focal ischemic stroke in a mammal by increasing cerebral blood flow and/or reducing infarct size is described which involves administering an effective amount of an anti-CD18 antibody to the mammal, in the absence of removal of the arterial obstruction. | 11-05-2009 |
20090274690 | Human IgM antibodies, and diagnostic and therapeutic uses thereof particularly in the central nervous system - Antibodies, and particularly human antibodies, are disclosed that demonstrate activity in the treatment of demyelinating diseases as well as other diseases of the central nervous system that are of viral, bacterial or idiopathic origin, including neural dysfunction caused by spinal cord injury. Neuromodulatory agents are set forth that include and comprise a material selected from the group consisting of an antibody capable of binding structures or cells in the central nervous system, a peptide analog, a hapten, active fragments thereof, agonists thereof, mimics thereof, monomers thereof and combinations thereof. The neuromodulatory agent has one or more of the following characteristics: it is capable of inducing remyelination; binding to neural tissue; promoting Ca | 11-05-2009 |
20090274691 | Use of CD25 binding molecules in steroid-resistant patients - A method is provided for treating the diseases autoimmune hepatitis, eczema, vasculitis, temporal arteritis, sarcoid and Crohn's disease, in a steroid-resistant or steroid-sensitive patient. The method comprises administering to the patient an effective amount of a CD25 binding molecule and a steroid. | 11-05-2009 |
20090274692 | CD37 IMMUNOTHERAPEUTIC AND COMBINATION WITH BIFUNCTIONAL CHEMOTHERAPEUTIC THEREOF - The present disclosure provides a humanized anti-CD37 small modular immunopharmaceutical (SMIP) molecule, as well as synergistic combination therapies of CD37-specific binding molecules (such as anti-CD37 SMIP proteins or antibodies) with bifunctional chemotherapeutics (such as bendamustine) that can be administered concurrently or sequentially, for use in treating or preventing B-cell related autoimmune, inflammatory, or hyperproliferative diseases. | 11-05-2009 |
20090274693 | Method of Treating Cancer using a cMet and AXL Inhibitor and an ErbB Inhibitor - The present invention relates to a method of treating cancer in a patient comprising administering to the patient therapeutically effective amounts of: | 11-05-2009 |
20090274694 | CYTOKINE RECEPTOR ZCYTOR17 MULTIMERS - Novel polypeptide combinations, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed for zcytor17-containing multimeric or heterodimer cytokine receptors that may be used as novel cytokine antagonists, and within methods for detecting ligands that stimulate the proliferation and/or development of hematopoietic, lymphoid and myeloid cells in vitro and in vivo. The present invention also includes methods for producing the multimeric or heterodimeric cytokine receptor, uses therefor and antibodies thereto. | 11-05-2009 |
20090280116 | HUMANIZED ANTIBODIES AGAINST TL1A - Disclosed are humanized antibodies that bind specifically to the receptor TNF superfamily member 15 (TNFSF15), also known as TL1A. Methods of making and using the anti-TL1A antibodies are also described. The humanized antibodies may be antagonists and may used to treat or diagnose conditions associated with TL1A function. | 11-12-2009 |
20090280117 | METHODS FOR THE TREATMENT OR PREVENTION OF IMMUNE DISORDERS USING ANTI-CD40 ANTIBODIES - The present invention relates to methods and compositions for the prevention and treatment of cancer, inflammatory diseases and disorders or deficiencies of the immune system. The methods of the invention comprise administering a CD40 binding protein that potentiates the binding of CD40 to CD40 ligand. | 11-12-2009 |
20090280118 | METHODS AND COMPOSITIONS FOR TREATING AND PREVENTING DISEASE ASSOCIATED WITH alphaVbeta5 INTEGRIN - The present invention provides compositions and methods for treating and preventing disease associated with αvβ5 integrin by blocking binding to αvβ5 integrin. | 11-12-2009 |
20090285805 | Binding molecules - The present invention relates to the manufacture of a diverse repertoire of functional heavy chain-only antibodies that undergo affinity maturation, and uses thereof. The invention also relates to the manufacture and use of a diverse repertoire of class-specific heavy chain-only antibodies and to the manufacture and use of multivalent polypeptide complexes with antibody heavy chain functionality, preferably antibody heavy chain binding functionality, constant region effector activity and, optionally, additional effector functions. The present invention also relates to a method of generation of fully functional heavy chain-only antibodies in transgenic mice in response to antigen challenge. In particular, the present invention relates to a method for the generation of human antigen-specific, high affinity, heavy chain-only antibodies of any class, or mixture of classes and the isolation and expression of fully functional VH antigen-binding domains. | 11-19-2009 |
20090285806 | Methods and compositions for improving recombinant protein production - Nucleic acid molecules modified to enhance recombinant protein expression, e.g., that of Aβ peptide binding antibodies, and/or to reduce or eliminate mis-spliced and/or intron read-through (IRT) by-products are disclosed. The invention also provides methods for producing Aβ peptide binding antibodies devoid of mis-spliced and/or intron read-through by-products by expression of such nucleic acid molecules under cell culture conditions suitable for recombinant Aβ peptide binding antibody expression. | 11-19-2009 |
20090285807 | Anti-Met Monoclonal Antibody, Fragments and Vectors Thereof, for the Treatment of Tumors and Corresponding Products - Use of a monoclonal antibody directed against the extracellular domain of hepatocyte growth factor is disclosed for the preparation of a medicament for the treatment of tumors and/or metastases and of a diagnostic tool for detecting neoplastic cells as well as vectors comprising at least a portion of the nucleotide sequence encoding the anti-Met monoclonal antibody, products containing the anti-Met monoclonal antibody and/or at least one fragment thereof and at least one kinase inhibitor. | 11-19-2009 |
20090285808 | ANTI-CD19 ANTIBODIES AND USES IN ONCOLOGY - The invention relates to immunotherapeutic compositions and methods for the treatment of B cell diseases and disorders in human subjects, such as, but not limited to, B cell malignancies, using therapeutic antibodies that bind to the human CD19 antigen and that preferably mediate human ADCC. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG1 or IgG3 human isotype. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG2 or IgG4 human isotype that preferably mediate human ADCC. The present invention also relates to pharmaceutical compositions comprising chimerized anti-CD19 antibodies of the IgG1, IgG2, IgG3, or IgG4 isotype that mediate human ADCC. In preferred embodiments, the present invention relates to pharmaceutical compositions comprising monoclonal human, humanized, or chimeric anti-CD19 antibodies. | 11-19-2009 |
20090285809 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASES - Disclosed are pharmaceutical compositions and methods for preventing or treating a number of amyloid diseases, including Alzheimer's disease, prion diseases, familial amyloid neuropathies and the like. The pharmaceutical compositions include immunologically reactive amounts of amyloid fibril components, particularly fibril-forming peptides or proteins. Also disclosed are therapeutic compositions and methods which use immune reagents that react with such fibril components. | 11-19-2009 |
20090285810 | HUMANIZED ANTI-TGF-BETA ANTIBODIES - Humanized anti-TGF-beta antibodies are provided, as well as methods for their preparation and use, including methods for treating TGF-beta disorders, for example, cancer. Also provided are articles of manufacture designed for various uses that contain the humanized antibodies. | 11-19-2009 |
20090285811 | ANTI-INFLAMMATORY AND IMMUNOSUPPRESSIVE GLUCOCORTICOID STEROIDS - The present invention relates to new glucocorticoid steroid modulators of glucocorticoid receptor, pharmaceutical compositions thereof, and methods of use thereof. | 11-19-2009 |
20090285812 | ANTI-PSGL-1 ANTIBODIES AND METHODS OF IDENTIFICATION AND USE - The present invention is directed to antibodies and binding fragments thereof, which bind with high affinity and specificity to human P-selectin glycoprotein ligand 1 (PSGL-1) and which block both selectin and chemokine binding to PSGL-1 expressed on leukocytes, lymphocytes and endothelial cells and thus which inhibit migration and/or rolling of these cells and to methods for screening for such antibodies and binding fragments thereof and to methods of therapeutic use thereof. | 11-19-2009 |
20090285813 | ANTIBODIES AND METHODS FOR MAKING AND USING THEM - The invention provides antibodies, including chimeric human antibodies, recombinant antibodies, synthetic anti-bodies, and the nucleic acids encoding them, and methods for making and using these immunoglobulins. The invention provides recombinant and synthetic polypeptide and nucleic acid embodiments of these polypeptides and/or antibodies. The invention also provides polypeptides comprising, or consisting of, consensus human framework regions, or “Independently Consensused Frameworks (ICFs)”, nucleic acids encoding them, and libraries and kits comprising these ICFs and/or antibodies of the invention, individually and in combinatorial libraries and combinations. | 11-19-2009 |
20090285814 | CD 40 Binding Molecules and CTL Pepetides for Treating Tumors - Disclosed is a method and composition for treating tumors or infectious diseases, wherein the composition includes CD40 binding molecules together with CTL-activating peptides, e.g., tumor antigens. Such composition is useful for enhancing the anti-tumor effect of a peptide tumor vaccine, or for otherwise activating CTLs so that the activated CTLs can act against tumorous or infected cells. The CD40 binding molecules can include antibody molecules, as well as homologues, analogues and modified or derived forms thereof, including immunoglobulin fragments like Fab, F(ab′) | 11-19-2009 |
20090291076 | STABILIZED ANTIBODY-CONTAINING FORMULATIONS - The present invention relates to antibody-containing lyophilized formulations free from reducing sugars, non-reducing sugars, sugar alcohols or polysaccharides as excipients and including one or more amino acid selected from the group consisting of arginine, histidine, lysine, serine, proline, glycine, alanine and threonine or a salt thereof. | 11-26-2009 |
20090291077 | Antagonists of IL-6 to prevent or treat Cachexia, weakness, fatigue, and/or fever - The present invention is directed to therapeutic methods using antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat cachexia, fever, weakness and/or fatigue in a patient in need thereof. In preferred embodiments these patients will comprise those exhibiting (or at risk of developing) an elevated serum C-reactive protein level. In another preferred embodiment, the patient's survivability or quality of life will preferably be improved. | 11-26-2009 |
20090291078 | GLYCO-ENGINEERED ANTIBODIES - The present invention relates to an antibody preparation comprising modified antibodies of an animal or derivatives or fragments thereof, specific for an antigen, characterized in that • the antibodies or derivatives or fragments thereof comprise an N-glycan structure free of fucose and xylose, and • at least 90%, preferably at least 95%, more preferred at least 99%, most preferred at least 100% of the modified antibodies, derivatives or fragments thereof lack a C-terminal lysine residue. | 11-26-2009 |
20090291079 | TRIAZINE COMPOUNDS AS PI3 KINASE AND MTOR INHIBITORS - Compounds of formula I | 11-26-2009 |
20090297506 | Classification of cancer - The invention discloses a method for classification of cancer in an individual having contracted cancer. The method of classification involves the determination of microsatellite status and a prognostic marker by examining gene expression patterns. The invention also relates to various methods of treatment of cancer. Additionally, the present invention concerns a pharmaceutical composition for treatment of cancer and uses of the present invention. The invention also relates to an assay for classification of cancer. | 12-03-2009 |
20090297507 | ADAM10 in Cancer Diagnosis, Detection and Treatment - This invention is in the field of cancer-related genes. Specifically it relates to methods for detecting cancer or the likelihood of developing cancer based on the presence or absence of the ADAM10 gene or proteins encoded by this gene. The invention also provides methods and molecules for upregulating or downregulating the ADAM10 gene. | 12-03-2009 |
20090297508 | Compositions and methods for treating hemostasis disorders associated with clec-2 signal transduction - The present invention provides a method for screening compounds to identify therapeutic candidates for treating hemostasis disorders, the method includes the steps of contacting a cell that expresses a CLEC-2 receptor with a test compound and a CLEC-2 receptor ligand, under conditions which, but for the presence of the test compound, permit binding of the CLEC-2 receptor to the CLEC-2 receptor ligand; and detecting if any increase or decrease in an indicator of CLEC-2 receptor activity is observed in comparison to a control; wherein an increase or decrease in the indicator in comparison to the control indicates that the test compound is a candidate for modulating hemostasis. | 12-03-2009 |
20090297509 | Treatment of human tumors with radiation and inhibitors of growth factor receptor tyrosine kinases - A method to inhibit the growth of tumors in human patients, comprising treating the human patients with an effective amount of a combination of radiation and a non-radiolabeled protein receptor tyrosine kinase inhibitor, the overexpression of which can lead to tumorigenesis. | 12-03-2009 |
20090297510 | INHIBITION OF CALPAIN REDUCES ALLERGIC INFLAMMATION - The present invention provides for the use of a calpain inhibitor for the treatment of allergy diseases, inflammatory diseases and autoimmune diseases. In particular, it has been found that inhibition of calpain within mast cells decreases the release of chemical mediators into the surrounding environment, resulting in a decreased local inflammatory response. The present invention also provides for a method of decreasing IgE-dependent mast cell degranulation, mast cell mediator release and cytokine production in mast cells, comprising the step of administering to the mast cells an effective amount of a calpain inhibitor. | 12-03-2009 |
20090297511 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASE - The invention provides compositions and methods for treatment of amyloidogenic diseases. Such methods entail administering an agent that induces a beneficial immune response against an amyloid deposit in the patient. The methods are particularly useful for prophylactic and therapeutic treatment of Alzheimer's disease. In such methods, a suitable agent is Aβ peptide, active fragments thereof or an antibody thereto. | 12-03-2009 |
20090297512 | COMPOSITIONS AND METHODS FOR MODULATING VASCULAR DEVELOPMENT - The present invention provides methods of using EGFL7 antagonist to modulate vascular development. Also provided herein are methods of screening for modulators of EGFL7 activity. Furthermore, methods of treatment using EGFL7 antagonists are provided. | 12-03-2009 |
20090297513 | ANTIBODIES TO IL-6 AND USE THEREOF - The present invention is directed to antibodies and fragments thereof and humanized versions thereof having binding specificity for IL-6. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the V | 12-03-2009 |
20090297514 | HUMANIZATION OF ANTIBODIES - The present invention provides methods of re-engineering or re-shaping an antibody from a first species, wherein the re-engineered or re-shaped antibody does not elicit undesired immune response in a second species, and the re-engineered or re-shaped antibody retains substantially the same antigen binding-ability of the antibody from the first species. In accordance with the present invention, a combinatorial library comprising the CDRs of the antibody from the first species fused in frame with framework regions derived from a second species can be constructed and screened for the desired modified antibody. In particular, the present invention provides methods utilizing low homology acceptor antibody frameworks for efficiently humanizing an antibody or a fragment thereof. The present invention also provides antibodies produced by the methods of the invention. | 12-03-2009 |
20090297515 | Use of Caspase-8 Inhibitors for Modulating Hematopoiesis - A method of inhibiting hematopoiesis in a subject is provided. The method is effected by downregulating an expression or activity of caspase-8 in the subject thereby inhibiting hematopoiesis therein. | 12-03-2009 |
20090297516 | ENGINEERED LECTINS FOR VIRAL INACTIVATION - Engineered lectins and methods of using such reagents for both preventing and treating a broad array of viral infections are provided. The lectins of the invention are engineered in two ways, first through the enhancement of the natural mode of action of lectins against viruses through linked multimerization, and second through the creation of a new class of reagents, hereinafter referred to as a “lectibody” or “lectibodies”, that engage host immune function in addition to simply binding glycosylated viral proteins via the combination of a lectin and the Fc region of an antibody in order to drive Fc-mediated effector functions including ADCC (antibody-dependent cell-mediated cytotoxicity), increased half-life, complement-dependent cytotoxicity (CDC), and antibody-dependent cell-mediated phagocytosis (ADCP) in response to a lectin-mediated carbohydrate-binding event. | 12-03-2009 |
20090297517 | METHODS FOR TREATING IL-18 MEDIATED DISORDERS - The invention pertains to methods for treating medical disorders characterized by elevated levels or abnormal expression of IL-18 by administering an IL-18 antagonist, such as soluble IL-18 receptor, a soluble IL-18 binding protein and/or an antibody. | 12-03-2009 |
20090297518 | IMMUNOPOTENTIATIVE COMPOSITION - Compositions for cancer or infection treatment via immunopotentiation caused by inhibition of immunosuppressive signal induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient, screening methods of the substrates for cancer or infection treatment, cell lines used for the screening methods, evaluation methods that select the substrates for cancer treatment, and carcinoma cell transplanted mammals used for the evaluation methods. The compositions of the present invention that inhibits the function of PD-1, PD-L1, or PD-L2 are useful for treatment of cancer or infection. | 12-03-2009 |
20090297519 | ANTINEOPLASTIC COMBINATIONS WITH mTOR INHIBITOR, TRASTUZUMAB, AND/OR HKI-272 - A combination of temsirolimus and trastuzumab in the treatment of cancer is provided. A combination of temsirolimus and HKI-272 is provided. A combination of a trastuzumab and a HKI-272 is also provided. Regimens and kits for treatment of metastatic breast cancer, containing trastuzumab, temsirolimus and/or HKI-272, optionally in combination with other anti-neoplastic agents, or immune modulators are described. | 12-03-2009 |
20090304681 | Methods for the treatment and prevention of infection using anti-selectin agents - Methods for the treatment and prevention of pulmonary infections are disclosed, in particular, methods comprising the administration of one or more anti-selectin agents to a patient diagnosed with a pulmonary infection. Anti-selectin agents that inhibit leukocyte recruitment to the lungs have been found to be beneficial for the treatment of lung infections, including infections associated with chronic bronchitis, chronic obstructive pulmonary disease (COPD), pneumonia, pneumonitis, acute respiratory distress syndrome (ARDS), severe acute respiratory syndrome (SARS), sarcoidosis, cystic fibrosis (CF), emphysema, asthma, smoker's cough, allergy, allergic rhinitis, sinusitis and pulmonary fibrosis. | 12-10-2009 |
20090304682 | Multiple-variable dose regimen for treating TNFa-related disorders - Multiple-variable dose methods for treating TNFα-related disorders, including Crohn's disease and psoriasis, comprising administering TNFα inhibitors, including TNFα antibodies, are described. Multiple-variable dose methods include administration of a TNF-inhibitor in an induction or loading phase followed by administration of the agent in a maintenance or treatment phase, wherein the TNF-inhibitor is administered in a higher dosage during the induction phase. | 12-10-2009 |
20090304683 | Soluble Fragments of The Sars-Cov Spike Glycoprotein - The invention relates to the spike protein from the virus (SARS-CoV) that is etiologically linked to severe acute respiratory syndrome (SARS); polypeptides and peptide fragments of the spike protein; nucleic acid segments and constructs that encode the spike protein, polypeptides and peptide fragments of the spike protein, and coupled proteins that include the spike protein or a portion thereof; peptidomimetics; vaccines; methods for vaccination and treatment of severe acute respiratory syndrome; antibodies; aptamers; and kits containing immunological compositions, or antibodies (or aptamers) that bind to the spike protein. | 12-10-2009 |
20090304684 | METHODS AND COMPOSITIONS FOR NEEDLELESS DELIVERY OF ANTIBODIES - The present invention relates, in part, to methods and compositions for needleless delivery of antibodies to a subject. The present invention also relates, in part, to methods for needleless delivery of fusion proteins comprising a bioactive molecule and an antibody fragment to subject. In one aspect, the methods and compositions involve administering to the subject a delivery construct comprising a carrier construct non-covalently bound to the antibody or fusion protein to be delivered, wherein the carrier construct comprises a receptor-binding domain, a transcytosis domain, and an antibody-binding domain to which the antibody or the antibody fragment of the fusion protein non-covalently binds. | 12-10-2009 |
20090304685 | Anti-Factor Xlla Therapy - A method is disclosed for preventing arterial thrombosis in a subject comprising administering to said subject a therapeutically effective amount of an antibody or epitope-binding fragment or derivative thereof, wherein said antibody, fragment or derivative specifically binds to activated Factor XIIa and prevents the interaction of activated Factor XIIa with its physiological substrates. | 12-10-2009 |
20090304686 | INTERFERING IN ACTIVATION OF AN IMMUNE CELL BY INFLUENCING INTERACTION OF LAIR AND COLLAGEN - The invention provides a method for interfering in activation of an immune cell, comprising providing a substance which specifically interacts in the binding of leukocyte-associated immunoglobulin-like receptor (LAIR) and collagen. The invention in one aspect provides a method for down regulation of activation of an immune cell. In another aspect the invention provides a method for up regulation of activation of an immune cell. The invention further provides pharmaceutical compositions and uses thereof. | 12-10-2009 |
20090304687 | METHODS OF USING CD40 BINDING AGENTS - Provided are methods of using CD40 binding agents for treating a CD40-associated disease. | 12-10-2009 |
20090304688 | Methods and Compositions for Increasing the Efficiency of Therapeutic Antibodies Using Gamma Delta T Cell Activators - The present invention relates to methods and compositions for increasing the efficiency of therapeutic antibodies. More particularly, the invention relates to the use of a therapeutic antibody in combination with a γδ T cell activating compound or activated γδ T cells. thereby allowing a potentiation of γδ T cell cytotoxicity in mammalian subjects in order to enhance the efficiency of the treatment in human subjects, particularly through an increase of the depletion of targeted cells. | 12-10-2009 |
20090304689 | METHODS FOR THE IDENTIFICATION OF POLYPEPTIDE ANTIGENS ASSOCIATED WITH DISORDERS INVOLVING ABERRANT CELL PROLIFERATION AND COMPOSITIONS USEFUL FOR THE TREATMENT OF SUCH DISORDERS - Methods and compositions for the development of effective cancer therapies using mitotic inhibitors which have limited general toxicity to normal, non-cancerous cells and tissues are provided. The methods and compositions utilize cytotoxic compounds comprised of a cell-binding agent (e.g., antibodies) conjugated to an anti-mitotic compound (e.g., maytansinoids). The invention further provides antibodies which are substantially incapable of inducing antibody-dependent cell-mediated cytotoxicity (ADCC) and/or complement dependent cytotoxicity (CDC), thereby ensuring that the therapeutic effect is mediated primarily by the anti-mitotic component of the cytotoxic compound, rather than by indirect cell killing via ADCC and/or CDC. The antibodies of the invention further are capable of differentiating between polypeptide antigens which are more highly expressed on proliferating cancer cells as compared to proliferating non-cancer cells. | 12-10-2009 |
20090304690 | Glycosylation Engineering of Antibodies for Improving Antibody-Dependent Cellular Cytotoxicity - The present invention relates to the field glycosylation engineering of proteins. More particular, the present invention is directed to the glycosylation engineering of proteins to provide proteins with improved therapeutic properties, e.g., antibodies, antibody fragments, or a fusion protein that includes a region equivalent to the Fc region of an immunoglobulin, with enhanced Fc-mediated cellular cytotoxicity. | 12-10-2009 |
20090304691 | ANTAGONISTS OF BMP9, BMP10, ALK1 AND OTHER ALK1 LIGANDS, AND USES THEREOF - In certain aspects, the present disclosure relates to the insight that a polypeptide comprising a ligand-binding portion of the extracellular domain of activin-like kinase I (ALK1) polypeptide may be used to inhibit angiogenesis in vivo, particularly in mammals suffering angiogenesis-related disorders. In certain aspects, the disclosure demonstrates that antagonists of BMP9 and/or BMP10, ligands for ALK1, may also be used to inhibit angiogenesis in vivo. | 12-10-2009 |
20090304692 | TRIAZINE COMPOUNDS AS PI3 KINASE AND MTOR INHIBITORS - Compounds of formula I | 12-10-2009 |
20090304693 | Dual Variable Domain Immunoglobulins and Uses Thereof - The present invention relates to engineered multivalent and multispecific binding proteins, methods of making, and specifically to their uses in the prevention, diagnosis, and/or treatment of disease. | 12-10-2009 |
20090311247 | MOLECULES AND CHIMERIC MOLECULES THEREOF - The present invention relates generally to the fields of proteins, diagnostics, therapeutics and nutrition. More particularly, the present invention provides an isolated protein molecule such as EPO, Flt3-Ligand, Flt3, PDGF-B or VEGF-165 or chimeric molecules thereof comprising at least a portion of the protein molecule, wherein the protein or chimeric molecule has a profile of measurable physiochemical parameters which is indicative of, associated with or forms the basis of, one or more pharmacological traits. The present invention further contemplates the use of the isolated protein or chimeric molecule thereof in a range of diagnostic, prophylactic, therapeutic, nutritional and/or research applications. | 12-17-2009 |
20090311248 | Hepatitis C Virus Neutralizing Antibodies - The invention relates to anti-HCV antibodies and more specifically to neutralizing anti-HCV antibodies and their variable and complementarity determining regions (CDR). In particular, the neutralizing anti-HCV antibodies are neutralizing anti-HCV envelope protein 1 (HCV E1) antibodies. Also subject of the invention are compositions comprising these antibodies, CDRs or variable regions, and compounds comprising at least one of the CDRs or variable regions of said antibodies. Further subject of the invention are the application of any of said antibodies, CDRs, variable regions or compounds in HCV prophylaxis, therapy, and diagnosis, as well as methods for producing the antibodies. | 12-17-2009 |
20090311249 | Capecitabine Combination Therapy - The invention provides the use of a combination of an mTOR inhibitor and capecitabine in the treatment of cancer. | 12-17-2009 |
20090311250 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCER - Methods and compositions are provided for the diagnosis and treatment of colorectal cancers associated with amplification or overexpression of the FGFR2 gene. | 12-17-2009 |
20090311251 | SCFV ANTIBODIES WHICH PASS EPITHELIAL AND/OR ENDOTHELIAL LAYERS - scFv antibodies which specifically bind selected antigens and are obtainable by a method comprising (i) selecting from a pool of soluble and stable antibody frameworks a soluble and stable framework matching best the framework of a non-human antibody against the antigen with a certain binding specificity, (ii) either providing said soluble and stable framework with CDRs that bind specifically to said antigen, or mutating the framework of said non-human antibody towards the sequence of said soluble and stable framework, to generate scFv antibodies, (iii) testing the generated antibody for solubility and stability, and testing the generated antibody for antigen binding, and (iv) selecting an scFV that is soluble, stable and binds to the antigen specifically. Also provided are pharmaceutical compositions comprising said scFv antibody, methods of treatment and diagnosis for diseases related to over expression of antigens that are specifically bound by said antibody. | 12-17-2009 |
20090311252 | Anti-activin antibodies and uses for promoting bone growth - In certain aspects, the present invention provides compositions and methods for promoting bone growth and increasing bone density. | 12-17-2009 |
20090311253 | Dual Variable Domain Immunoglobulins and Uses Thereof - The present invention relates to engineered multivalent and multispecific binding proteins, methods of making, and specifically to their uses in the prevention, diagnosis, and/or treatment of disease. | 12-17-2009 |
20090311254 | CD40 ANTIBODY FORMULATION AND METHODS - The present invention provides a method of treating tumor in a patient comprising administering to said patient a CD40 agonist antibody according to an intermittent dosing schedule. The present invention also provides a method of treating tumor in a patient comprising administering a combination of a CD40 agonist antibody and a DNA replication inhibitor. Also provided is a formulation for use in the treatment. | 12-17-2009 |
20090311255 | PREVENTING AUTOIMMUNE DISEASE - The present application describes a method of preventing an autoimmune disease in an asymptomatic human subject at risk for experiencing one or more symptoms of the autoimmune disease, by administering a CD20 antibody to the subject in an amount to prevent the subject from experiencing one or more symptoms of the autoimmune disease. | 12-17-2009 |
20090317383 | CANCER TREATMENT METHOD - The present invention relates to a method of treating cancer in a mammal by administration of 4-quinazolinamines and at least one additional anti-neoplastic compound. In particular, the method relates to a methods of treating cancers by administration of N-{3-chloro-4-[(3-fluorobenzyl) oxy]phenyl}-6-[5-({[2-(methanesulphonyl) ethyl]amino} methyl)-2-furyl]-4-quinazolinamine and salts and solvates thereof in combination with at least one additional anti-neoplastic compound. | 12-24-2009 |
20090317384 | Methods of using death receptor ligands and cd20 antibodies - Methods for using death receptor ligands, such as Apo-2 ligand/TRAIL polypeptides or death receptor antibodies, and CD20 antibodies to treat conditions such as cancer and immune related diseases are provided. Embodiments of the invention include methods of using Apo2L/TRAIL or death receptor antibodies such as DR5 antibodies and DR4 antibodies in combination with CD20 antibodies. | 12-24-2009 |
20090317385 | Methods Using Immunomodulatory Compounds for Modulating Level of CD59 - Provided herein are methods of treating, preventing or managing disorders associated with low CD59 levels. The methods encompass the administration of an immunomodulatory compound provided herein, such as 3-(4-amino- | 12-24-2009 |
20090317386 | Transcription Infidelity, Detection and Uses Thereof - The present invention relates to the identification of a novel mechanism of transcription infidelity in cells. The invention provides compositions and methods to detect the level of transcript ion infidelity in a sample, as well as the use thereof, e.g., for therapeutic, diagnostic, pharmacogenomic or drug design. As will be disclosed, the invention is particularly suited for detecting, monitoring or treating proliferative cell disorders, for the design and/or screening of drugs, for patient or disease profiling, prediction of disease severity and evaluation of drug efficacy. | 12-24-2009 |
20090317387 | TREATMENT OF METASTATIC BREAST CANCER - The present invention concerns treatment of previously untreated HER2-positive metastatic breast cancer with a combination of a growth inhibitory HER2 antibody, a HER2 dimerization inhibitor antibody and a taxane. In particular, the invention concerns the treatment of HER2-positive metastatic breast cancer in patients who did not receive prior chemotherapy or biologic therapy with a HER2 antibody binding essentially to epitope 2C4, a HER2 antibody binding essentially to epitope 4D5, and a taxane. The invention further comprises extending survival of such patients by the combination therapy of the present invention. In a preferred embodiment, the treatment involves administration of trastuzumab, pertuzumab and docetaxel. | 12-24-2009 |
20090324587 | Cancer Therapies and Pharmaceutical Compositions Used Therein - The invention relates to compositions and methods to inhibit gene expression. In particular, the invention provides co-therapies comprising oligonucleotides plus other therapies to treat cancer. | 12-31-2009 |
20090324588 | Treating Inflammatory Disorders With Antibodies to the Alpha-7 Nicotinic Receptors - An antibody or an antigen binding fragment thereof which binds to mammalian α7 subunit of a nicotinic acetylcholine receptor or its functional variant and which is an agonist of said receptor or variant. Pharmaceutical compositions comprising same. A method of treating a subject suffering from an inflammatory condition comprising administering to said subject an antibody or an antigen-binding fragment as described herein. | 12-31-2009 |
20090324589 | METHODS FOR CONTROLLING BLOOD PHARMACOKINETICS OF ANTIBODIES - The present inventors discovered that the half-life in blood of an IgG antibody which is a polypeptide comprising an FcRn-binding domain can be controlled by controlling the surface charge through modification of residues exposed on the surface among residues in the variable regions of the IgG antibody. Antibodies whose half-life in blood had been controlled by the methods of the present invention were confirmed to actually retain the original activity. The methods of the present invention are widely applicable to polypeptides comprising an FcRn-binding domain, such as IgG antibodies, which are recycled via the FcRn salvage pathway regardless of the type of target antigen. | 12-31-2009 |
20090324590 | MYOSTATIN ANTAGONISTS - An isolated recombinant polypeptide having myostatin antagonist activity, comprising a C-terminally truncated mature myostatin peptide, wherein the C-terminal truncation is at a position at or between amino acids 281 and 329, or a fragment, variant or derivative thereof. | 12-31-2009 |
20090324591 | TREATMENT OF PULMONARY DISEASE CONDITIONS - The present invention relates generally to a method for treating or preventing or otherwise ameliorating the effects of pulmonary diseases characterized by or associated with infiltration of neutrophils and complications arising therefrom. The present invention further provides agents and pharmaceutical compositions comprising agents which inhibit the activity of G-CSF or its receptor, interfere with G-CSF signaling and/or which down-regulate expression of G-CSF or its receptor. | 12-31-2009 |
20090324592 | Compositions and methods for the diagnosis and treatment of tumor - The present invention is directed to compositions of matter useful for the diagnosis and treatment of tumor in mammals and to methods of using those compositions of matter for the same. | 12-31-2009 |
20090324593 | Humanized antibodies against west nile virus and therapeutic and prophylactic uses thereof - The present invention relates to compositions comprising humanized antibodies or fragments thereof that immunospecifically bind to one or more antigens of a flavivirus, particularly of West Nile Virus (WNV) and methods for preventing, treating or ameliorating symptoms associated with a flavivirus, particularly of West Nile Virus (WNV) infection utilizing said compositions. In particular, the present invention relates to methods for preventing, treating or ameliorating symptoms associated with WNV infection, said methods comprising administering to a human subject an effective amount of one or more humanized antibodies or fragments thereof that immunospecifically bind to a WNV antigen. The present invention also relates to detectable or diagnostic compositions comprising humanized antibodies or fragments thereof that immunospecifically bind to a WNV. antigen and methods for detecting or diagnosing WNV infection utilizing said compositions. | 12-31-2009 |
20090324594 | Antibodies With Immune Effector Activity And That Internalize In Folate Receptor Alpha-Positive Cells - This invention relates to the use of monoclonal and polyclonal antibodies that specifically bind to and have the ability in the alternative to become internalized by cells expressing folate receptor alpha (FRA) and to induce an immune effector activity such as antibody-dependent cellular cytotoxicity. The antibodies are useful in specific delivery of pharmacologic agents to FRA-expressing cells as well as in eliciting an immune-effector activity particularly on tumor cells and precursors. The invention is also related to nucleotides encoding the antibodies of the invention, cells expressing the antibodies; methods of detecting cancer cells; and methods of treating cancer using the antibodies. | 12-31-2009 |
20100003241 | Agents for treatment or prevention of an allergic disorder - The present invention relates to agents capable of treating or preventing an allergic disorder in an animal and a method of screening for these agents. In particular, the present invention relates to an isolated nucleic acid molecule comprising (a) an isolated nucleic acid molecule whose expression is modulated in a mammal suffering from or at elevated risk of developing an allergic condition, such that the level of expression of the nucleic acid differs from that in a mammal which is not suffering from or at elevated risk of developing the allergic condition, in which the nucleic acid comprises a sequence selected from the group consisting of sequences identified by probes 243610 at on human chromosome 9q21.13 at locus 138255, 1556097 at on human chromosome 15q25.2 and 242743 at on human chromosome 16p12.1 respectively, or (b) an isolated nucleic acid molecule which is the complement of the nucleic acid of (a), or (c) an isolated nucleic acid molecule which hybridizes under stringent conditions to the nucleic acid of (a) or (b). | 01-07-2010 |
20100003242 | COMPOSITIONS AND METHODS FOR BINDING SPHINGOSINE-1-PHOSPHATE - The present invention relates to anti-S1P agents, for example, humanized monoclonal antibodies, and their uses for detection of S1P or for treatment of diseases and conditions associated with S1P. | 01-07-2010 |
20100003243 | Uses and Compositions for treatment of Psoriasis and Crohn's Disease - The invention provides methods, uses and compositions for the treatment of psoriasis or Crohn's disease. The invention describes methods and uses for treating psoriasis or Crohn's disease, wherein a TNFα inhibitor, such as a human TNFα antibody, or antigen-binding portion thereof, is used to treat psoriasis in a subject. The invention includes methods of improving patient reported outcomes using a human TNFα antibody, or antigen-binding portion thereof, for the treatment of Crohn's or psoriasis. The invention also provides methods of improving fatigue or depression in patients having Crohns'. | 01-07-2010 |
20100003244 | AGENTS WHICH BIND TO EPITOPES OF GLYCOPROTEIN VI - The present invention provides anti-thrombotic agents, methods for screening for said anti-thrombotics agents and methods of treating thrombotic and other cardiovascular disorders. | 01-07-2010 |
20100003245 | Remedy for Renal Disease - When an anti-human BMP antibody was added to cells of an immortalized human mesangial cell line cultured in the presence of human BMP, the anti-human BMP antibody significantly suppressed the production of type IV collagen in mesangial cells. A number of signaling pathways are involved in abnormal proliferation of type IV collagen. It was therefore completely unpredictable whether merely blocking the BMP signal would indeed suppress the abnormal proliferation of type IV collagen. However, for the first time, the present inventors demonstrated that anti-BMP antibodies are very effective in suppressing the abnormal proliferation of type IV collagen. Thus, anti-BMP antibodies can be used as novel therapeutic agents for kidney diseases associated with abnormal proliferation of the mesangial matrix. | 01-07-2010 |
20100003246 | Novel heterocyclic compounds and uses therof - New substituted heterocyclic compounds, compositions containing them, and methods of using them for the inhibition of Raf kinase activity are provided. The new compounds and compositions may be used either alone or in combination with at least one additional agent for the treatment of a Raf kinase mediated disorder, such as cancer. | 01-07-2010 |
20100003247 | ASSAY FOR METASTATIC COLORECTAL CANCER - This invention relates, e.g., to a method for predicting the prognosis, the likelihood of metastasis in, or the desirability of administering an aggressive therapy to, a subject with colorectal cancer, comprising determining, in a sample from the subject, the level of phosphorylation compared to a positive and/or negative reference standard, of one or more of: (a) AKT (S473); (b) BAD (S112); (c) cABL (T735); (d) ERK (T42/44); (e) MARCKS (S152-156); (0 p38MAPK (T180-182): (g) STAT 1 (Y701 ); (h) PTEN (S380); (i) EGFR (Y992); (j) PAK 1/2 (S 1 19/204); or (k) PKC zeta/lambda (T410-403); or the total amount of (1) COX-2 protein; wherein if the level of phosphorylation of one or more of a-i or the total amount of COX-2 protein (1) is elevated compared to the negative reference standard, and/or if the level of phosphorylation of j or k is decreased compared to the positive reference standard, the subject has poor prognosis, is likely to undergo metastasis, and/or is a good candidate for aggressive therapy. Also described are methods for treating subjects likely to develop metastatic colorectal carcinoma, and pharmaceutical compositions and kits for implementing methods of the invention. | 01-07-2010 |
20100003248 | POLYPEPTIDE CONSTRUCTS FOR RECTAL AND/OR VAGINAL ADMINISTRATION - The invention relates to a method suitable for administering protein therapeutic molecules orally, sublingually, topically, intravenously, subcutaneously, nasally, vaginally, rectally or by inhalation so as to avoid inactivation, by using VHH polypeptides derived from Camelidae antibodies. The invention further relates to the said therapeutic molecules. The invention further a method for delivering therapeutic molecules to the interior of cells. The invention further relates to anti-IgE therapeutic molecules. | 01-07-2010 |
20100003249 | POLYPEPTIDE CONSTRUCTS FOR TOPICAL ADMINISTRATION - The invention relates to a method suitable for administering protein therapeutic molecules orally, sublingually, topically, intravenously, subcutaneously, nasally, vaginally, rectally or by inhalation so as to avoid inactivation, by using VHH polypeptides derived from Camelidae antibodies. The invention further relates to the said therapeutic molecules. The invention further a method for delivering therapeutic molecules to the interior of cells. The invention further relates to anti-IgE therapeutic molecules. | 01-07-2010 |
20100003250 | (2-ARYL-7H-PYRROLO[2,3-D]PYRIMIDIN-4-YL)MORPHOLINE COMPOUNDS, THEIR USE AS MTOR KINASE AND PI3 KINASE INHIBITORS, AND THEIR SYNTHESES - The invention relates to 2-aryl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)morpholine compounds of the Formula I: | 01-07-2010 |
20100003251 | Uses of IL-23 Agonists and Antagonists; Related Reagents - Provided are methods of treatment for tumors. In particular, methods are provided for modulating activity of a cytokine molecule and its receptor. | 01-07-2010 |
20100003252 | BLOCKING IMMUNE RESPONSE TO A GRAFT - The present application describes methods for blocking immune response to foreign antigens in a mammal using antagonists which bind to CD20. | 01-07-2010 |
20100008906 | Cripto binding molecules - The invention pertains to humanized forms of an anti-CRIPTO antibody and portions thereof. In one embodiment, the variable regions of these antibodies or polypeptides comprising them (e.g., full-length antibodies or domain deleted antibodies) can be used to treat disorders, such as cancer. | 01-14-2010 |
20100008907 | MUSCLE REGENERATION PROMOTER - The present inventors studied the effects of inhibiting the IL-6 signaling pathway on muscle cell growth. As a result, they discovered that, administering an IL-6 inhibitor can promote the adhesion, proliferation, and differentiation of satellite cells and therefore muscle regeneration. | 01-14-2010 |
20100008908 | Treatment of Heart Failure - The treatment of heart failure by administering a therapeutically effective amount of an agent that inhibits hypoxia-inducible factor (HIF). Such agents include small molecule chemical agents and biological agents. | 01-14-2010 |
20100008909 | VARIABLE REGION SEQUENCES OF IL-31 MONOCLONAL ANTIBODIES AND METHODS OF USE - Novel compositions derived from antigen-binding sites of immunoglobulins having affinity for IL-31 are provided. The compositions exhibit immunological binding properties of antibody molecules capable of binding specifically to a human IL-31. CDR regions derived from same or different immunoglobulin moieties are provided. Also provided are single chain polypeptides wherein VH and VL domains are attached. The sFv molecules can include ancillary polypeptide moieties which can be bioactive, or which provide a site of attachment for other useful moieties. The compositions are useful in specific binding assays, affinity purification schemes, drug or toxin targeting, imaging, and genetic or immunological therapeutics for inflammatory diseases. The invention thus provides novel polypeptides, the DNAs encoding those polypeptides, expression cassettes comprising those DNAs, and methods of inducing the production of the polypeptides. The invention further provides the amino acid sequences of the variable regions of the monoclonal antibodies and use of these monoclonal antibody or antibody fragment in conjunction with an human IgG4 Fc molecule. | 01-14-2010 |
20100008910 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCER - Methods and compositions are provided for the diagnosis and treatment of lung cancers in particular NSCLC associated with amplification or overexpression of the PRO gene, i.e. any of PDGFRA, KIT or KDR. | 01-14-2010 |
20100008911 | USE OF TGF-BETA ANTAGONISTS TO TREAT INFANTS AT RISK OF DEVELOPING BRONCHOPULMONARY DYSPLASIA - The disclosure relates to methods of treating an infant at risk of developing bronchopulmonary dysplasia, including premature infants, by administering a TGF-β antagonist during the perinatal period, including the prenatal period and/or the postnatal period. For administration during the prenatal period, the TGF-β antagonist can be administered either directly to the infant in utero, or indirectly by administration to the mother. | 01-14-2010 |
20100008912 | COMBINATION DRUG - The present invention provides a pharmaceutical agent containing an HER2 inhibitor and a hormonal therapeutic agent or anti-cancer agent in combination. The present invention provides a pharmaceutical agent containing (1) an HER2 inhibitor having a pyrrolopyrimidine skeleton or pyrazolopyrimidine skeleton, and (2) a hormonal therapeutic agent or an anti-cancer agent in combination. | 01-14-2010 |
20100008913 | Methods and compositions for treating platelet-related disorders - Provided are prophylactic and therapeutic methods of treatment of subjects for the purpose of inhibiting vaso-occlusive events, including embolism, by administering agents, including anagrelide and anagrelide derivatives, which reduce the number of circulating platelets to low normal to below normal levels. Methods and pharmaceutical preparations comprising such agents are provided. | 01-14-2010 |
20100008914 | METHODS AND COMPOSITIONS FOR TREATING IL-4 AND IL-13 RELATED FIBROSIS RELATED PATHOLOGIES - The present invention relates to compositions and methods for treating at least one IL-4 or IL-13 fibrosis related condition or pathology, including therapeutic compositions, formulations, methods and devices. | 01-14-2010 |
20100008915 | METHODS FOR TREATING DISEASE USING AN ANTI-IL-21 RECEPTOR ANTIBODY - Monoclonal antibodies to the IL-21 receptor and multimeric complexes comprising the IL-21 receptor; including monoclonal antibodies to the heterodimeric receptor, IL-21/IL-2Rγ; have been prepared. The invention also describes a method of producing said antibodies. And, the invention also describes a method of treatment comprising using said antibodies to suppress an immune response. | 01-14-2010 |
20100008916 | ANTIHUMAN TNF-ALPHA ANTIBODY ACTIVITY LOWERING INHIBITOR - The present invention provides an antihuman TNF-α antibody activity lowering inhibitor comprising a protein source(s) and/or carbohydrate source(s), in the treatment of inflammatory bowel syndrome with repeated administration of anti-TNF-α antibody; and a kit preparation wherein a freeze-dried antihuman TNF-α antibody and the activity lowering inhibitor in the above repeated administration of the anti-TNF-α antibody are separately contained in a plastic container so that they can communicate with each other. According to the present invention, in the drug therapy to the patients with inflammatory bowel syndrome, therapeutic agents which inhibit the inflammation for long periods without accompanying serious side effects can be provided. | 01-14-2010 |
20100015133 | Methods for Producing Polypeptides by Regulating Polypeptide Association - In the course of the present invention, it was discovered that one could regulate association between polypeptides by modifying amino acid residues that form the interface during the association to amino acids carrying the same type of charge. In this context, the present invention enables efficient formation of heterologous molecules. For example, the present invention can be suitably applied to the preparation of bispecific antibodies. | 01-21-2010 |
20100015134 | Therapy With CD4 Binding Peptides and Radiation - The present invention relates to a peptide, such as an antibody, capable of binding to CD4 and use thereof for the mediation of radiation treatment of a clinical condition. The radiation treatment may for instance by treatment with PUVA. | 01-21-2010 |
20100015135 | ANTI-EPHB4 ANTIBODIES AND METHODS USING SAME - The invention provides anti-EphB4 antibodies, and compositions comprising and methods of using these antibodies. | 01-21-2010 |
20100015136 | CAMPTOTHECIN-PEPTIDE CONJUGATES AND PHARMACEUTICAL COMPOSITIONS CONTAINING THE SAME - The present invention relates to a novel compound of use in the improved delivery of therapeutic drug agents into target cells or tissues, composition comprising the same and uses thereof. The compound is more specifically a conjugate of a peptide moiety and a camptothecin, a derivative or analog thereof which provides numerous benefits, including enhancement in terms of aqueous solubility, pharmacokinetics and tissue distribution, enlargement of the therapeutic index, and limitation of the inter-patient metabolic variability, as well as improvement of delivery of the biologically active ingredient to the target cells or tissues. | 01-21-2010 |
20100015137 | RECEPTOR THAT BINDS TRAIL - A protein designated TRAIL receptor binds the protein known as TNF-Related Apoptosis-Inducing Ligand (TRAIL). The TRAIL receptor finds use in purifying TRAIL or inhibiting activities thereof. Isolated DNA sequences encoding TRAIL-R polypeptides are provided, along with expression vectors containing the DNA sequences, and host cells transformed with such recombinant expression vectors. Antibodies that are immunoreactive with TRAIL-R are also provided. | 01-21-2010 |
20100015138 | Crystal structure of Staphylococcus aureus clumping factor a in complex with fibrinogen derived peptide and uses thereof - The present invention discloses crystal structure of | 01-21-2010 |
20100015139 | METHOD OF INHIBITING COMPLEMENT ACTIVATION WITH FACTOR Ba SPECIFIC ANTIBODIES AND USE THEREOF - A method of inhibiting the adverse effects of alternative complement pathway activation products in a subject comprising administering to the subject an amount of anti-factor Ba antibody effective to selectively inhibit formation of an alternative complement pathway activation products C3a, C5a, and C5b-9, and activation of neutrophils, monocytes, and platelets. | 01-21-2010 |
20100015140 | Inhibitor Compounds and Cancer Treatment Methods - A synergistically effective combination of an anti-cancer agent and a therapeutic compound, such as an mTOR-Rictor complex inhibitor, a Serine 473 phosphorylation inhibitor, an AKT2 inhibitor, or a combination thereof, for use in the treatment of cancer, and methods and uses thereof. Also included are methods and uses of a thiosemicarbazone for treating a cancer in a mammal in need thereof characterized by over-expression of RAS, by an EGFR mutation, and/or by over-expression of AKT2. | 01-21-2010 |
20100015141 | 4-PHENOXY-6-ARYL-1H-PYRAZOLO[3,4-D]PYRIMIDINE AND N-ARYL-6-ARYL-1H-PYRAZOLO[3,4-D]PYRIMIDIN-4-AMINE COMPOUNDS, THEIR USE AS MTOR KINASE AND PI3 KINASE INHIBITORS, AND THEIR SYNTHESES - The invention relates to 4,6-disubstituted-1H-pyrazolo[3,4-d]pyrimidin-4-amine compounds, including 4-phenoxy-6-aryl-1H-pyrazolo[3,4-d]pyrimidine and N-aryl-6-aryl-1H-pyrazolo[3,4-d]pyrimidin-4-amine compounds of the Formula I: | 01-21-2010 |
20100015142 | METHODS FOR THE TREATMENT OF LADA AND OTHER ADULT- ONSET AUTOIMMUNE USING IMMUNOSUPPRESSIVE MONOCLONAL ANTIBODIES WITH REDUCED TOXICITY - The present invention provides methods of treating, preventing or ameliorating the symptoms of Latent Autoimmune Diabetes in Adults (LADA) and adult-onset type 1 diabetes through the use of anti-human CD3 antibodies. In particular, in invention provides methods of preventing or delaying insulin requirement in patients diagnosed with LADA. The methods of the invention provide for administration of antibodies that specifically bind the epsilon subunit within the human CD3 complex. Such antibodies modulate the T cell receptor/alloantigen interaction and, thus, regulate the T cell mediated cytotoxicity associated with autoimmune disorders. Additionally, the invention provides for modification of the anti-human CD3 antibodies such that they exhibit reduced or eliminated effector function and T cell activation as compared to non-modified anti-human CD3 antibodies. | 01-21-2010 |
20100021455 | METHODS FOR DIAGNOSIS AND TREATMENT OF CROHN'S DISEASE - The inventors have discovered an elevated serum response to CBir1 flagellin in Crohn's disease patients. The present invention relates to methods for diagnosis and treatment of Crohn's disease and/or subtypes of Crohn's disease. Diagnosis is accomplished by determining the presence of the anti-CBir1 expression or determining the presence of anti-CBir1 expression and detection of the presence of pANCA. Treatment methods include antigen-directed therapy targeting CBir1 flagellin and manipulating the bacteria in the colon and/or small intestine. | 01-28-2010 |
20100021456 | DRUG FOR INHIBITING,PREVENTING OR TREATMENT OF RHEUMATOID ARTHRITIS - The present invention relates to the use of at least one interleukin-17F inhibitor and/or of at least one IL-17 receptor inhibitor, for the manufacture of a medicament for inhibiting, preventing or treating rheumatoid arthritis. | 01-28-2010 |
20100021457 | DETECTION SYSTEM AND USES THEREFOR - A system for the detection of molecular associations, the system comprising: i) a first agent, comprising a first interacting group coupled to a first reporter component; ii) a second agent, comprising a second interacting group coupled to a second reporter component; iii) a third agent, comprising a third interacting group; iv) a modulator; and v) a detector; wherein proximity of the first and second reporter components generates a signal capable of detection by the detector; and wherein the modulator modulates the association of the second interacting group with the third interacting group; such that monitoring the signal generated by proximity of the first and second reporter components by the detector constitutes monitoring the association of the first and third agents. | 01-28-2010 |
20100021458 | POLYCYCLIC AGENTS FOR THE TREATMENT OF RESPIRATORY SYNCYTIAL VIRUS INFECTIONS - The present invention relates to polycyclic antiviral compounds, and salts thereof, methods for their preparation and compositions containing them, and the use of the compounds and composition in the treatment of viral infections. | 01-28-2010 |
20100021459 | POLYPEPTIDE CONSTRUCTS FOR INTRACELLULAR DELIVERY - The invention relates to a method suitable for administering protein therapeutic molecules orally, sublingually, topically, intravenously, subcutaneously, nasally, vaginally, rectally or by inhalation so as to avoid inactivation, by using VHH polypeptides derived from Camelidae antibodies. The invention further relates to the said therapeutic molecules. The invention further a method for delivering therapeutic molecules to the interior of cells. The invention further relates to anti-IgE therapeutic molecules. | 01-28-2010 |
20100021460 | Methods of Treating Autoimmune Diseases Using CD4 Antibodies - Methods of treating autoimmune disorders in mammalian subjects using non-depleting CD4 antibodies, alone or in combination with other compounds, are provided. | 01-28-2010 |
20100021461 | IMMUNOGLOBULIN FORMULATION AND METHOD OF PREPARATION THEREOF - A stable aqueous pharmaceutical formulation comprising a therapeutically effective amount of an antibody, polysorbate 80, a buffer which inhibits polysorbate oxidation is described along with methods of making the preparation. Also described are formulations with high antibody concentrations which maintain fixed volumes and which may be used on patients of variable weight. | 01-28-2010 |
20100028338 | COMBINATIONS OF THERAPEUTIC AGENTS FOR TREATING CANCER - A combination therapy for treating patients suffering from proliferative diseases or diseases associated with persistent angiogenesis is disclosed. The patient is treated with a camptothecin derivative and one or more chemotherapeutic agents selected from a microtubule active agent; an alkylating agent; an anti-neoplastic anti-metabolite; a platin compound; a topoisomerase II inhibitor; a VEGF inhibitor; a tyrosine kinase inhibitor; an EGFR kinase inhibitor; an mTOR kinase inhibitor; an insulin-like growth factor I inhibitor; a Raf kinase inhibitor; a monoclonal antibody; a proteasome inhibitor; a HDAC inhibitor; and ionizing radiation. | 02-04-2010 |
20100028339 | COMPOSITIONS INCLUDING TRICIRIBINE AND TRASTUZUMAB AND METHODS OF USE THEREOF - This application relates to combination therapies including triciribine and related compounds and trastuzumab or a salt thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 02-04-2010 |
20100028340 | ANTIBODIES AGAINST THE RGM A PROTEIN AND USES THEREOF - The subject invention relates to isolated proteins, particularly monoclonal antibodies, which bind and neutralize RGM A protein. Specifically, these antibodies have the ability to inhibit the binding of RGM A to its receptor and/or coreceptors. These antibodies or portions thereof of the invention are useful for detecting RGM A and for inhibiting RGM A activity, for example in a human suffering from a disorder including but nor limited to multiple sclerosis, mammalian brain trauma, spinal cord injury, stroke, neurodegenerative diseases, and schizophrenia. | 02-04-2010 |
20100028341 | AMINO ACID SEQUENCES THAT MODULATE THE INTERACTION BETWEEN CELLS OF THE IMMUNE SYSTEM - The present invention relates to amino acid sequences that block the interaction between (a target on) an antigen presenting cell (APC) and (a target on) a T-cell. More particularly, the present invention relates to amino acid sequences that are directed against (as defined herein) a target on an APC (also referred to herein as “APC target”) or a target on a T-cell (also referred to herein as “T-cell target”). The invention further relates to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences | 02-04-2010 |
20100028342 | INSULIN-LIKE GROWTH FACTOR-1 RECEPTOR ANTAGONISTS FOR MODULATION OF WEIGHT AND LIPOSITY - The invention is directed to the use of insulin-like growth factor receptor antagonists for treatment of obesity. The IGF-IR antagonists are administered alone or in combination with other anti-obesity drugs. | 02-04-2010 |
20100028343 | Il-17 homologous polypeptides and therapeutic uses thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 02-04-2010 |
20100028344 | CONDITIONED CELL IMMUNIZATION - The present invention provides methods and compositions for generating modulators capable of binding to antigens presented by a cell that has been exposed to cellular conditioning. The present invention also includes methods and compositions for the prevention, treatment and diagnosis of disorders using the antigen modulators. The present invention further provides methods for identifying novel molecular targets for the treatment of different disorders. | 02-04-2010 |
20100034811 | THERAPEUTIC AGENTS FOR DISEASES INVOLVING CHOROIDAL NEOVASCULARIZATION - The present inventors focused on the fact that inflammation at the subretinal macular area enhances choroidal neovascularization, and developed pharmaceutical agents that suppress initiation or advancement of neovascularization by angiogenic factors such as VEGF. More specifically, the present inventors revealed that administering anti-IL-6 receptor monoclonal antibodies to mice treated with laser photocoagulation inhibits the development of choroidal neovascularization. | 02-11-2010 |
20100034812 | Antibodies Specific for BET V1 and Use Thereof in the Prevention and Treatment of BET V1- Induced Diseases - The present invention relates to Bet V 1 specific antibodies or fragments thereof and their use in the prevention and treatment of allergen induced diseases, wherein the antibodies block the binding of IgE to Bet V 1. | 02-11-2010 |
20100034813 | SUBSTITUTED PYRAZOLE AND TRIAZOLE COMPOUNDS AS KSP INHIBITORS - Disclosed are new substituted pyrazole and triazole compounds of Formula (I) and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the derivatives together with pharmaceutically acceptable carriers, and uses thereof: | 02-11-2010 |
20100034814 | COMPOSITIONS AND METHODS FOR BINDING LYSOPHOSPHATIDIC ACID - Compositions and methods for making and using anti-LPA agents, for example, monoclonal antibodies, are described. Variable domain and complementarity determining region amino acid sequences of several monoclonal antibodies against LPA are disclosed, as is a consensus anti-LPA monoclonal antibody variable domain sequence. | 02-11-2010 |
20100034815 | METHOD FOR RESTORING DENDRITIC CELL POPULATIONS - The present invention provides methods for restoring and increasing dendritic cell populations in a subject by modulation of the lymphotoxin-β receptor (LTβR) via LTβR agonists. The invention also provides methods for screening for agents capable of restoring or increasing dendritic cell populations. The invention further provides a method for the treatment of immunodeficiency by administration of an LTβR agonist. | 02-11-2010 |
20100034816 | Treatment of Diabetes by at Least One Epidermal Growth Factor Receptor Specific Antibody or a Derivative Thereof - The present invention relates to the use of at least one epidermal growth factor receptor specific antibody or a derivative thereof for the manufacture of a medicament for the treatment of diabetes, in particular of the advanced insulin-dependent stage of diabetes mellitus Type 1 and 2 in humans as well as in animals. | 02-11-2010 |
20100034817 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 02-11-2010 |
20100034818 | Human Anti-NGF Neutralizing Antibodies as Selective NGF Pathway Inhibitors - This invention provides antibodies that interact with or bind to human nerve growth factor (NGF) and neutralize the function of NGF thereby. The invention also provides pharmaceutical compositions of said antibodies and methods for neutralizing NGF function, and particularly for treating NGF-related disorders (e.g., chronic pain) by administering a pharmaceutically effective amount of anti-NGF antibodies. Methods of detecting the amount of NGF in a sample using anti-NGF antibodies are also provided. | 02-11-2010 |
20100040606 | Recombinant polyclonal antibody for treatment of respiratory syncytial virus infections - Disclosed are novel polyclonal antibodies, which target respiratory syncyticilal virus (RSV), and novel high affinity antibody molecules reactive with RSV. The polyclonal antibodies may comprise antibody molecules which are reactive with both RSV protein F and RSV protein G, and preferably the polyclonal antibodies target a variety of epitopes on these proteins. The single antibody molecules of the invention are shown to exhibit affinities which provide for dissociation constants as low as in the picomolar range. Also disclosed are methods of producing the antibodies of the invention as well as methods of their use in treatment for RSV infection. | 02-18-2010 |
20100040607 | Combination Therapy with Inhibitors of HMGB and Caspase for the Treatment of Inflammatory Diseases - Compositions and methods are disclosed for treating a condition characterized by activation of an inflammatory cytokine cascade in a patient. The compositions comprise an agent that inhibits HMGB biological activity and a caspase inhibitor. The methods comprise treating a cell or a patient with sufficient amounts of the composition to inhibit the release of proinflammatory cytokine(s) and/or inhibit the inflammatory cytokine cascade. | 02-18-2010 |
20100040608 | Use of HMGB1 antagonists for the treatment of inflammatory skin conditions - Methods are disclosed for treating an inflammatory skin condition in a subject. The methods comprise administering to a subject an HMGB antagonist, such as a high mobility group box (HMGB) A box or a biologically active fragment thereof, an antibody to HMGB or an antigen-binding fragment thereof, an HMGB small molecule antagonist, an antibody to TLR2 or an antigen-binding fragment thereof, a soluble TLR2 polypeptide, an antibody to RAGE or an antigen-binding fragment thereof, a soluble RAGE polypeptide and a RAGE small molecule antagonist. | 02-18-2010 |
20100040609 | METHODS FOR PREVENTING, POSTPONING OR IMPROVING THE OUTCOME OF INVASIVE SPINAL PROCEDURES - Methods for identifying subjects who could benefit therapeutically from administration of a targeted anti-inflammatory therapy (TAT) are provided. Subjects that are identified include those that are eligible, based on pre-determined criteria, for a spinal surgery procedure, such as a laminectomy or diskectomy. Methods of preventing such procedures or improving the outcome of such procedures are also provided, and include administering a TAT to the subject by any route or regimen of administration, including both known and novel regimens described herein. | 02-18-2010 |
20100040610 | ANTAGONISTS OF PCSK9 - Antagonists of human proprotein convertase subtilisin-kexin type 9 (“PCSK9”) are disclosed. The disclosed antagonists are effective in the inhibition of PCSK9 function and, accordingly, present desirable antagonists for the use in the treatment of conditions associated with PCSK9 activity. The present invention also discloses nucleic acid encoding said antagonists, vectors, host cells, and compositions comprising the antagonists. Methods of making PCSK9-specific antagonists as well as methods of using the antagonists for inhibiting or antagonizing PCSK9 function are also disclosed and form important additional aspects of the present disclosure. | 02-18-2010 |
20100040611 | ANTAGONISTS OF PCSK9 - Antagonists of human proprotein convertase subtilisin-kexin type 9 (“PCSK9”) are disclosed. The disclosed antagonists are effective in the inhibition of PCSK9 function and, accordingly, present desirable antagonists for the use in the treatment of conditions associated with PCSK9 activity. The present invention also discloses nucleic acid encoding said antagonists, vectors, host cells, and compositions comprising the antagonists. Methods of making PCSK9-specific antagonists as well as methods of using the antagonists for inhibiting or antagonizing PCSK9 function are also disclosed and form important additional aspects of the present disclosure. | 02-18-2010 |
20100040612 | METHODS AND COMPOSITIONS FOR REDUCING AMYLOID BETA LEVELS - The present invention provides methods for reducing the level of amyloid beta protein in a cell or tissue, the methods generally involving contacting the cell or tissue with an agent that reduces cystatin C levels and/or activity. The present invention provides methods for treating Alzheimer's disease (AD), and methods for treating cerebral angiopathy, in an individual, the methods generally involving administering to an individual having AD a therapeutically effective amount of an agent that reduces cystatin C levels and/or activity. The present invention further provides methods for identifying an agent that reduces cystatin C levels and/or activity. | 02-18-2010 |
20100040613 | POLYPEPTIDE CONSTRUCTS FOR SUBLINGUAL ADMINISTRATION - The invention relates to a method suitable for administering protein therapeutic molecules orally, sublingually, topically, intravenously, subcutaneously, nasally, vaginally, rectally or by inhalation so as to avoid inactivation, by using VHH polypeptides derived from Camelidae antibodies. The invention further relates to the said therapeutic molecules. The invention further a method for delivering therapeutic molecules to the interior of cells. The invention further relates to anti-IgE therapeutic molecules. | 02-18-2010 |
20100040614 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF INFECTIONS AND TUMORS - PD-1 antagonists are disclosed that can be used to reduce the expression or activity of PD-1 in a subject. An immune response specific to an infectious agent or to tumor cells can be enhanced using these PD-1 antagonists in conjunction with an antigen from the infectious agent or tumor. Thus, subjects with infections, such as persistent infections can be treated using PD-1 antagonists. In addition, subjects with tumors can be treated using the PD-1 antagonists. In several examples, subjects can be treated by transplanting a therapeutically effective amount of activated T cells that recognize an antigen of interest and by administering a therapeutically effective amount of a PD-1 antagonist. | 02-18-2010 |
20100040615 | Digalactolipidic Antigen Exposed on the Surface of Apicomplex Parasites, and Diagnostic and Therapeutic Use Thereof - The invention relates to a digalactolipidic antigen exposed on the surface of apicomplex parasites, in the form of a vegetable-type digalactoglycerolipid, and adapted for inducing the production of specific antibodies capable of inhibiting the proliferation and/or the invasive properties of said parasites; the invention also relates to a derived antibody or functional antibody fragment, and to their diagnostic, immunotherapeutic and vaccine applications in human beings or animals. | 02-18-2010 |
20100040616 | TREATMENT OF AUTOIMMUNE AND INFLAMMATORY DISEASE - The present invention provides novel methods of treatment of multiple sclerosis and other autoimmune diseases or inflammatory disorders, and antagonists, including isolated binding proteins for use in the novel methods. There is provided a method of treating multiple sclerosis comprising the neutralization of the biological activity of IL-7 by binding to CD127 or IL-7. The isolated binding proteins may also neutralize the biological activity of TSLP. | 02-18-2010 |
20100040617 | Method of Using CD100 (or Sema4D) to Mediate Platelet Activation and Inflammatory Responses - This invention relates to methods of treating platelet disorders and/or endothelial cell disorders by modulating sema4D/CD100 activity. Specifically, this invention involves the use of compounds to increase or decrease the level of soluble sema4D/CD100. | 02-18-2010 |
20100040618 | Prevention of tumors with monoclonal antibodies against neu - Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface are disclosed. The methods comprise administering an antibody which specifically binds to p185. Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface in an individual at high risk of developing tumors are disclosed. | 02-18-2010 |
20100040619 | TREATMENT METHODS USING DKK-1 ANTIBODIES - The present invention provides antibodies and immunologically functional fragments thereof that specifically bind Dkk-1 polypeptides. The subject antibodies and fragments bind with high affinity to a conformational epitope located in the carboxy region of the Dkk-1 protein. Methods for preparing such antibodies or fragments thereof as well as physiologically acceptable compositions containing the antibodies or fragments are also provided. Use of the antibodies and fragments to treat various diseases including bone disorders, inflammatory diseases, neurological diseases, ocular diseases, renal diseases, pulmonary diseases and skin diseases are also disclosed. | 02-18-2010 |
20100047234 | TREATING SKIN CANCER - This document provides methods and materials related to treating skin cancer. For example, methods and materials relating to the use of a taxane compound, an alkylating agent, and an anti-VEGF polypeptide antibody to treat skin cancer are provided. | 02-25-2010 |
20100047235 | NOVEL REGIMENS FOR TREATING DISEASES AND DISORDERS - Methods and materials are provided for induction-maintenance regimens of targeted anti-inflammatory therapies (TATs) for treatment of a variety of diseases and disorders. Preferred embodiments include administration of one or more TATs using an induction regimen comprising a lower dose per administration administered by a more invasive and/or more localized route, followed by administration of one or more TATS using a maintenance regimen, comprising a higher dose per administration administered by a less invasive and/or less localized route. | 02-25-2010 |
20100047236 | ANTIBODY VARIANTS - Antibody variants of parent antibodies are disclosed which have one or more amino acids inserted in a hypervariable region of the parent antibody and a binding affinity for a target antigen which is at least about two fold stronger than the binding affinity of the parent antibody for the antigen. | 02-25-2010 |
20100047237 | PREVENTION OF AGGREGATION OF IMMUNOGLOBULIN LIGHT OR HEAVY CHAINS - The present invention provides an inhibitor of the aggregation of immunoglobulin chains (or immunoglobulin V | 02-25-2010 |
20100047238 | HUMANIZED ANTIBODIES AGAINST - Disclosed are humanized antibodies that bind specifically to the receptor CXCR3. The humanized antibodies may be antagonists and may be used to treat or diagnose conditions associated with CXCR3 function. | 02-25-2010 |
20100047239 | Dual variable domain immunoglobulin and uses thereof - The present invention relates to engineered multivalent and multispecific binding proteins, methods of making, and specifically to their uses in the prevention and/or treatment of acute and chronic inflammatory and other diseases. | 02-25-2010 |
20100047240 | Metastasis specific splice variants of mena and uses thereof in diagnosis, prognosis and treatment of tumors - Methods and kits for diagnosis, prognosis and treatment of metastatic tumors are provided where the metastatic tumor is characterized by changes in expression of +++, ++ and/or 11a variants of Mena. | 02-25-2010 |
20100047241 | FUNCTIONAL HEAVY CHAIN ANTIBODIES, FRAGMENTS THEREOF, LIBRARY THEREOF AND METHODS OF PRODUCTION THEREOF - The present invention relates to functional heavy chain antibodies, functional single domain heavy chain antibodies, functional VH domains, or functional fragments thereof comprising an amino acid which is neither a charged amino acid nor a C at position 45, and comprising an amino acid at position 103 independently chosen from the group consisting of R, G, K, S, Q, L, and P, and optionally an amino acid at position 108 independently chosen from the group consisting of Q, L and R, said positions determined according to the Kabat numbering. | 02-25-2010 |
20100047242 | PHARMACEUTICAL COMPOSITIONS CAPABLE OF INDUCING APOPTOSIS IN TUMOUR CELLS, USEFUL FOR DIAGNOSIS AND TREATMENT OF B-CHRONIC LYMPHOCYTIC LEUKAEMIA - The present invention is related to the branch of immunology and particularly with the generation of pharmaceutical compositions comprising a humanized monoclonal antibody recognizing the leukocyte differentiation antigen CD6. Accordingly with that statement, the purpose of this invention is to provide pharmaceutical compositions comprising a humanized anti-CD6 monoclonal antibody for the diagnosis and treatment of Lymphoproliferative Syndromes and particularly the B-Cell Chronic Lymphocytic Leukemia. The essence of the invention consist in the application of a humanized Monoclonal Antibody that recognizes the CD6 antigen, the generation of pharmaceutical compositions comprising that antibody being able to induce apoptosis of malignant cells from B-Cell Chronic Lymphocytic Leukemia patients, reaching a clinical and a histological antitumor efficacy. The field of application of the present invention extends to the Oncology. | 02-25-2010 |
20100047243 | NOVEL ANTIBODIES AGAINST IGF-IR - The present invention relates to antibodies or antigen binding fragments thereof which specifically binds to IGF-1R, specifically hIGF-1R. Also disclosed are antibody preparations comprising antibodies or antigen binding fragments of the invention. Methods of producing such antibodies or antigen binding fragments and uses thereof are also included within the scope of the present invention. | 02-25-2010 |
20100055092 | Preventive or Remedy for Inflammatory Disease - The present inventors obtained, from a phage library of human antibodies, an anti-mouse NR 10 neutralizing antibody-expressing BM095 clone that shows a strong proliferation-suppressing activity in an IL-31-dependent Ba/F3 cell proliferation assay system. When this anti-mouse NR 10 neutralizing antibody was administered to NC/Nga mice, a model of atopic dermatitis which is a mouse model of chronic dermatitis that arises as a result of repeated applications of picryl chloride, a mouse model of rheumatoid arthritis, and a mouse model of osteoarthritis, a significant effect of symptom suppression was observed. This revealed that the anti-NR 10 neutralizing antibody is indeed effective as a therapeutic agent for inflammatory diseases. In addition, the present inventors successfully obtained an anti-human NR 10 neutralizing antibody, providing extremely useful therapeutic agents with practical clinical applications. | 03-04-2010 |
20100055093 | PAN-CELL SURFACE RECEPTOR-SPECIFIC THERAPEUTICS - Provided are pan-cell surface receptor-specific therapeutics, methods for preparing them and methods of treatment using them. Among the pan-cell surface receptor-specific therapeutics are pan-HER-specific therapeutics that interact with at least two different HER receptor ligands and/or dimerize with or interact with two or more HER cell surface receptors. By virtue of these properties, the therapeutics modulate the activity of at least two cell surface receptors and are useful for therapeutic purposes. | 03-04-2010 |
20100055094 | PHARMACEUTICAL COMBINATIONS OF 1-CYCLOPROPYL-3- [3-(5-M0RPHOOLIN-4-YL-METHYL-1H-BENZOIMIDAZOL-2-YL)- LH-1-PYRAZOL-4-YL]- UREA - The invention provides combinations of an ancillary compound and a compound which is a salt of 1-cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea selected from the lactate and citrate salts and mixtures thereof. Also provided are crystalline forms of the salts, methods for making the salts and their uses in treating cancers. The invention further provides combinations of an ancillary compound and a compound of the formula (I) as defined in PCT/GB2004/002824 (WO 2005/002552) or a compound of the formula (I′) | 03-04-2010 |
20100055095 | GENETIC VARIATIONS ASSOCIATED WITH TUMORS - Nucleotide and amino acid variations associated with tumors are provided. Methods for detecting variations and for diagnosing and treating tumors are provided. | 03-04-2010 |
20100055096 | METHODS AND REAGENTS FOR THE ANALYSIS AND PURIFICATION OF POLYSACCHARIDES - The disclosure provides fusion proteins comprising a carbohydrate recognition domain of an innate immunity receptor and a heterologous polypeptide. The fusion proteins of the disclosure may be used, for example, to fingerprint polysaccharide compositions and to purify polysaccharide compositions. Polysaccharide compositions include those isolated from | 03-04-2010 |
20100055097 | STABLE LYOPHILIZED PHARMACEUTICAL FORMULATION OF IGG ANTIBODIES - This invention is directed to a stable lyophilized pharmaceutical formulation prepared by lyophilizing an aqueous formulation comprising a high concentration, e.g. 50 mg/ml or more, of an IgG antibody in about 5-25 mM histidine buffer having pH from about 5.5 to about 6.5, about 0.005%-0.03% polysorbate, sucrose, and optionally serine, and/or mannitol. This lyophilized formulation is stable at room temperature for at least 6 months, and preferably 1 year. This lyophilized formulation has a short reconstitution time of less than 2 minutes, and is suitable for parenteral administration such as intravenous, intramuscular, intraperitoneal, or subcutaneous injection. This invention is exemplified by the anti-IL2 receptor antibody. | 03-04-2010 |
20100055098 | METHOD FOR TREATING MULTIPLE SCLEROSIS PATIENTS WITH ANTI-IL2R ANTIBODIES - Methods are disclosed for using anti-IL-2R antibodies for the treatment of MS patients. In certain embodiments, the patients have neutralizing antibodies to IFN-beta. | 03-04-2010 |
20100055099 | Diagnostics and Treatments for VEGF-Independent Tumors - Methods for identifying or diagnosing VEGF-independent tumors and methods for treating VEGF-independent tumors are provided. | 03-04-2010 |
20100055100 | Monitoring treatment of cancer patients with drugs targeting EGFR pathway using mass spectrometry of patient samples - Methods using mass spectral data analysis and a classification algorithm provide an ability to determine whether a non-small-cell lung cancer patient, head and neck squamous cell carcinoma or colorectal cancer patient has likely developed a non-responsiveness to treatment with a drug targeting an epidermal growth factor receptor pathway. As the methods of this disclosure require only simple blood samples, the methods enable a fast and non-intrusive way of measuring when drugs targeting the EGFR pathway cease to be effective in certain patients. This discovery represents the first known example of true personalized selection of these types of cancer patients for treatment using these classes of drugs not only initially, but during the course of treatment. | 03-04-2010 |
20100061983 | Method of inhibiting leukocytes with human cxc chemokine receptor 3 antibody - The present invention relates to proteins or polypeptides, referred to herein as isolated and/Or recombinant mammalian (e.g., human) IP-10/Mig receptor proteins designated CXC Chemokine Receptor 3 (CXCR3) and variants thereof, including those characterized by selective binding of one or more chemokines (e.g., IP-10 and/or Mig), and/or the ability to induce a cellular response (e.g., chemotaxis, exocytosis). Antibodies reactive with CXCR3 receptors can be produced using the proteins or variants thereof or host cells comprising same as immunogen. | 03-11-2010 |
20100061984 | COMPOSITIONS AND METHODS FOR MODULATION OF SUPPRESSOR T CELL ACTIVATION - Methods of treating autoimmune disorders, coronary artery disease, allergy symptoms, allograft rejection sepsis/toxic shock are disclosed. Some methods comprise administering one or more regulatory compositions to activate the T suppressor cells by increasing the acetylation level and/or protein level of FOXP3 in combination with a T suppressor stimulus and/or an antigen. Some methods comprise administering one or more regulatory compositions to activate the T suppressor cells by increasing the acetylation level and/or protein level of FOXP3. Some methods comprise administering soluble GITR or antibodies that bind to GITR ligand. Methods of treating cancer, infectious diseases, and immune deficiency are also disclosed as are vaccination methods. The methods comprise administering one or more regulatory compositions to inactivate the T suppressor cells by reducing the acetylation level and/or protein level of FOXP3. Improved vaccines and vaccination methods are disclosed. Methods of identifying compounds that are useful to modulate acetylation level and/or protein level of FOXP3 and treat diseases are disclosed. | 03-11-2010 |
20100061985 | ANTAGONISTS OF TWEAK AND OF TWEAK RECEPTOR AND THEIR USE TO TREAT IMMUNOLOGICAL DISORDERS - The present invention relates to reagents which modify the activity of TWEAK and their use as therapeutic agents for the treatment of immunological disorders. | 03-11-2010 |
20100061986 | Chronic Rejection Inhibitor - The present inventors assessed the effect of anti-IL-6 receptor antibodies in suppressing chronic rejection reaction. They assessed the effect of anti-mouse IL-6 receptor antibody (MR16-1) administration in suppressing the chronic rejection reaction using a mouse model for post-heart-transplantation chronic rejection. The result of histopathological analysis of transplanted hearts extirpated 60 days after transplantation revealed that fibrosis of myocardium and vascular stenotic lesions, which are pathological conditions characteristic of the chronic rejection reaction, were significantly suppressed in the MR16-1-treated group as compared to the control group. Thus, MR16-1 administration was demonstrated to have the effect of suppressing chronic rejection reaction. Specifically, the present inventors discovered for the first time that the rejection reaction in the chronic phase after organ transplantation was suppressed by administering an anti-IL-6 receptor antibody. | 03-11-2010 |
20100061987 | High Affinity Antibodies Against HMGB1 and Methods Of Use Thereof - Compositions and methods are disclosed for inhibiting the release of a proinflammatory cytokine from a vertebrate cell, and for inhibiting an inflammatory cytokine cascade in a patient. The compositions comprise, for example, high affinity antibodies that specifically bind HMG1 and antigenic fragments thereof. The high affinity antibodies of the present invention and pharmaceutical compositions comprising the same are useful for many purposes, for example, as therapeutics against a wide range of inflammatory diseases and disorders such as sepsis, rheumatoid arthritis, peritonitis, Crohn's disease, reperfusion injury, septicemia, endotoxic shock, cystic fibrosis, endocarditis, psoriasis, psoriatic arthritis, arthritis, anaphylactic shock, organ ischemia, reperfusion injury, and allograft rejection. In addition, the high affinity antibodies of the present inventions are useful as diagnostic antibodies. | 03-11-2010 |
20100061988 | Monoclonal antibodies - The invention provides heterochimeric antibodies and/or fragments thereof comprising (i) hypervariable region sequences wholly or substantially corresponding to sequences found in antibodies from a donor species; (ii) constant region sequences wholly or substantially corresponding to sequences found in antibodies from a target species which is different from the donor species; and (iii) heavy and/or light chain variable framework sequences which contain at least three non-CDR residues corresponding to sequences found in antibodies from a target species and at least three contiguous non-CDR residues corresponding to sequences found in antibodies from a donor species. The invention further provides antibody to canine or feline or equine antigens, e.g., CD20 or CD52, and methods of making and using antibodies as described. | 03-11-2010 |
20100068203 | 17-Oxymacbecin Derivatives and Their Use in the Treatment of Cancer and/or B-Cell Malignancies - The present invention relates to 17-oxymacbecin analogues that are useful, e.g. in the treatment of cancer, B-cell malignancies, malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases and/or as a prophylactic pretreatment for cancer. The present invention also provides methods for the production of these compounds and their use in medicine, in particular in the treatment and/or prophylaxis of cancer or B-cell malignancies. | 03-18-2010 |
20100068204 | 4-ARYLOXYQUINOLIN-2(1H)-ONES AS MTOR KINASE AND PI3 KINASE INHIBITORS, FOR USE AS ANTI-CANCER AGENTS - Compounds of the formula I | 03-18-2010 |
20100068205 | Methionine Sulfoxide Antibodies - Antibodies specific for methionine sulfoxide residues on proteins are provided. The antibodies are prepared using methionine-rich zein proteins, which are oxidized, as antigens. | 03-18-2010 |
20100068206 | METHODS USING 3-(4-AMINO-1-OXO-1,3-DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE FOR TREATMENT OF MANTLE CELL LYMPHOMAS - Methods of treating, preventing or managing mantle cell lymphomas are disclosed. The methods encompass the administration of an immunomodulatory compound of the invention known as Revlimid® or lenalidomide. The invention further relates to methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods of the invention are also disclosed. | 03-18-2010 |
20100074892 | Monoclonal Antibodies That Neutralize Anthrax Protective Antigen (PA) Toxin - The present invention relates to monoclonal antibodies that bind or neutralize anthrax protective antigen (PA) toxin. The invention provides such antibodies, fragments of such antibodies retaining anthrax PA toxin-binding ability, fully human or humanized antibodies retaining anthrax PA toxin-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 03-25-2010 |
20100074893 | ECM-Complex Antibody Compositions and Methods of Use - The invention provides isolated anti-ECM-complex antibodies that bind to ECM-complexes. The invention also encompasses compositions comprising an anti-ECM-complex antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-ECM-complex antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-ECM-complex antibodies. The invention encompasses a method of producing the anti-ECM-complex antibodies. Other aspects of the invention are a method of detecting an ECM-complex expressing cancer, a method of inhibiting growth of an ECM-complex-expressing tumor, and a method of alleviating or treating an ECM-complex-expressing cancer in a mammal, comprising administering a therapeutically effective amount of the anti-ECM-complex antibody to the mammal. | 03-25-2010 |
20100074894 | PHARMACEUTICAL COMPOSITION CONTAINING ANTIBODIES DIRECTED AGAINST THE HERV-W ENVELOPE - A pharmaceutical composition that contains, as an active ingredient, at least one antibody directed against the HERV-W envelope protein, except for any antibody specifically directed against the binding site between said env protein and the hASCT1 or hASCT2 receptor. | 03-25-2010 |
20100074895 | METHOD FOR DETECTING AND CONTROLLING CANCER - Methods are provided for treating cancer metastasis by administering a therapeutic composition targeting a kinase substrate cascade. | 03-25-2010 |
20100074896 | ANTAGONISTS OF PGE2 EP3 RECEPTORS - PGE2 EP3 receptors affect injury size following cerebral ischemia and induced excitotoxicity. Treatment with selective EP3 antagonists decreases infarct size. In addition, such antagonists can reduce lesions caused by N-methyl-D-aspartic acid-induced acute excitotoxicity. Similarly, genetic deletion of EP3 provides protection against N-methyl-D-aspartic acid-induced toxicity. PGE2, by stimulating EP3 receptors, can contribute to the toxicity associated with cyclooxygenase and that antagonizing this receptor can be used therapeutically to protect against stroke- and excitotoxicity-induced brain damage. | 03-25-2010 |
20100074897 | Methods and Compositions related to HIF-1 alpha - Disclosed are compositions and methods related to HIF-1α. | 03-25-2010 |
20100074898 | AMINO NICOTINIC AND ISONICOTINIC ACID DERIVATIVES AS DHODH INHIBITORS - The present disclosure relates to compounds of formula (I): | 03-25-2010 |
20100074899 | METHODS FOR TREATING CONDITIONS ASSOCIATED WITH MASP-2 DEPENDENT COMPLEMENT ACTIVATION - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 03-25-2010 |
20100080800 | Humanized antibody - The present invention is related to chimeric and humanized antibody and to methods and compositions for the therapeutic and diagnostic use in the treatment of amyloidosis, a group of disorders and abnormalities associated with amyloid protein such as Alzheimer's disease. | 04-01-2010 |
20100086544 | COMPOSITIONS AND METHODS FOR TREATING A NEOPLASM - The present invention relates to compositions and methods for treating neoplasms, including refractory or relapsed neoplasms, using VEGF antagonists. Furthermore, the present invention provides therapy regimens for treating those diseases. | 04-08-2010 |
20100086545 | Prevention and Treatment of Synucleinopathic and Amyloidogenic Disease - The invention provides improved agents and methods for treatment of diseases associated with synucleinopathic diseases, including Lewy bodies of alpha-synuclein in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the Lewy body. The methods are particularly useful for prophylactic and therapeutic treatment of Parkinson's disease. | 04-08-2010 |
20100086546 | Toll-LIke Receptor 4 Deficiency and Downstream Effectors Cause Pulmonary Emphysema - The present invention provides compositions and methods for the detection, treatment, and prevention of emphysema/COPD. Compositions of the present invention comprise TLR4 activators, Nox3 inhibitors, and Cathepsin E inhibitors useful in the treatment or prevention of emphysema/COPD. Cathepsin E is a downstream effector of TLR4, wherein when cathepsin E is overexpressed in lung of an individual, the individual is at higher risk of developing emphysema/COPD. Cathepsin E is further identified as a biomarker useful in the identification of an individual with, or at-risk of developing emphysema/COPD. | 04-08-2010 |
20100086547 | METHODS FOR ADMINISTERING ANTI-IL-5 ANTIBODIES - The present invention relates generally to the methods for the treatment and diagnosis of conditions mediated by IL-5 and excess eosinophil production, and more specifically to mAbs, Fabs, chimeric and humanized antibodies. More particularly, methods are provided for reducing eosinophils in a human in need thereof, which method comprises administering to said human a composition comprising at least one anti-IL-5 antibody, wherein at least one anti-IL-5 antibody provides a mean maximum plasma concentration of said anti-IL-5 antibody of at least about 1.03±0.21 μg/mL, an Area Under the Curve value of at least about 15.5±2.7 μg/day/mL and a serum half-life of about 16.2±2.1 days to about 21.7±2.8 days. | 04-08-2010 |
20100092464 | M-CSF-Specific Monoclonal Antibody and Uses Thereof - M-CSF-specific RX1-based or RX-I derived antibodies are provided, along with pharmaceutical compositions containing such antibody, kits containing a pharmaceutical composition, and methods of preventing and treating bone loss in or remodeling in a subject afflicted with an osteoblastic or osteolytic disease. | 04-15-2010 |
20100092465 | TREATMENT OF GRAFT-VERSUS-HOST DISEASE - Methods for treating graft-versus-host disease, methods for reducing symptoms of graft-versus-host disease, and methods of reducing the severity of graft-versus-host disease in a patient are disclosed. The methods comprise administering to the patient a therapeutically effective amount of an IL-27 antagonist in combination with a pharmaceutically acceptable vehicle. IL-27 antagonists include soluble IL-27RA proteins and antagonists that comprise an antigen-binding site of an antibody. | 04-15-2010 |
20100092466 | COMBINATION OF ZD6474 AND BEVACIZUMAB FOR CANCER THERAPY - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of ZD6474 in combination with bevacizumab; to a pharmaceutical composition comprising ZD6474 and bevacizumab; to a combination product comprising ZD6474 and bevacizumab for use in a method of treatment of a human or animal body by therapy; to a kit comprising ZD6474 and bevacizumab; to the use of ZD6474 and bevacizumab in the manufacture of a medicament for use in the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation. | 04-15-2010 |
20100092467 | PREVENTION OF TISSUE ISCHEMIA, RELATED METHODS AND COMPOSITIONS - Provided herein are compositions and methods for preventing, ameliorating, and/or reducing tissue ischemia and/or tissue damage due to ischemia, increasing blood vessel diameter, blood flow and tissue perfusion in the presence of vascular disease including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke and influencing other conditions, by suppressing CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows for control of blood vessel diameter and blood flow, and permits modification of blood pressure and cardiac function. Under conditions of decreased blood flow, for instance through injury or atherosclerosis, blocking TSP1-CD47 interaction allows blood vessels to dilate and increases blood flow, tissue perfusion and tissue survival. This in turn reduces or prevents tissue necrosis and death. The therapeutics identified herein allow for precise regulation of blood flow to tissues and organs which need it, while substantially avoiding systemic complications. Methods and compositions described herein can be used to increase tissue survival under conditions of trauma and surgery, as well as conditions of chronic vascular disease. Also disclosed are methods for the treatment of elderly subjects using agents that affect TSP1 and CD47 and thereby affect tissue perfusion. Additionally, provided herein are compositions and methods for influencing blood coagulation, allowing for controlled increased or decreased blood clotting. Additionally, provided herein are compositions and methods for decreasing blood flow, as in the case of cancer through mimicking the effects of TSP1 and CD47 on blood vessel diameter and blood flow. | 04-15-2010 |
20100092468 | METHOD FOR PREDICTING THERAPEUTIC RESPONSIVENESS TO TNF-ALPHA BLOCKING AGENTS - The present invention relates to a method for predicting the responsiveness of a patient to a treatment with a TNF-alpha blocking agent, said method comprising determining the presence or absence of a guanine at position −238, a guanine at position −308, and a cytosine at position −857 of the TNF-alpha gene of said patient, wherein the simultaneous presence of a guanine at position −238, a guanine at position −308, and a cytosine at position −857 of the TNF-alpha gene in both copies of said TNF-alpha gene of said patient is indicative of a lessened likelihood of responsiveness of said patient to a treatment with a TNF-alpha blocking agent with respect to standard responsiveness. | 04-15-2010 |
20100092469 | ANTAGONISTS OF A NON-SELECTIVE CATION CHANNEL IN NEURAL CELLS - The present invention is directed to a combination of therapeutic compounds and treatment methods and kits using the combination. In particular, one of the combination affects the NCca-ATP channel of neural tissue, including neurons, glia and blood vessels within the nervous system. Exemplary SUR1 and/or TRPM4 antagonists that inhibit the NCca-ATP channel may be employed in the combination. The combination therapy also employs one or more of a non-selective cation channel blocker and/or an antagonist of VEFG, NOS, MMP, or thrombin. Exemplary indications for the combination therapy includes the prevention, diminution, and/or treatment of injured or diseased neural tissue, including astrocytes, neurons and capillary endothelial cells, that is due to ischemia, tissue trauma, brain swelling and increased tissue pressure, or other forms of brain or spinal cord disease or injury, for example. In other embodiments, there are methods and compositions directed to antagonists of TRPM4, including at least for therapeutic treatment of traumatic brain injury, cerebral ischemia, central nervous system (CNS) damage, peripheral nervous system (PNS) damage, cerebral hypoxia, or edema, for example. | 04-15-2010 |
20100092470 | ANTIBODIES, ANALOGS AND USES THEREOF - Camelid and shark heavy chain only antibodies and their analogs are disclosed. Methods of making such antibodies and their analogs are also provided. Also provided are kits, and methods of using such antibodies and their analogs in diagnostics, prognostics, therapy, and simultaneous diagnosis and therapy. | 04-15-2010 |
20100098689 | 4-1 bb ligand in inflammatory diseases - The invention provides 4-IBBL blocking agents, as well as pharmaceutical compositions and articles of manufacture comprising such blocking agents as new therapeutic interventions for sustained inflammation. Thus, the invention also provides methods for reducing sustained production of tumor necrosis factor. | 04-22-2010 |
20100098690 | PHARMACEUTICAL COMPOSITION - The present invention provides a pharmaceutical composition comprising a combination of an Hsp 90 family protein inhibitor and at least one compound, the said pharmaceutical composition wherein the Hsp 90 family protein inhibitor is a benozoyl compound represented by formula (I): | 04-22-2010 |
20100098691 | COMBINATION OF BENZIMIDAZOLE ANTI-CANCER AGENT AND A SECOND ANTI-CANCER AGENT - The present invention relates to a pharmaceutical composition for the treatment of cancer as well as methods of treatment of cancer that are based on the finding that certain benzimidazole based anti-cancer agents can be used in combination with a second anti-cancer agent to achieve desirable therapeutic outcomes. More specifically the present invention relates to a pharmaceutical composition including a benzimidazole based anti-cancer agent and a second anti-cancer agent. The invention also relates to methods of treatment of cancer including administration of a benzimidazole based anti-cancer agent and a second anti-cancer agent to a patient in need thereof. | 04-22-2010 |
20100098692 | Humanized Endoglin Antibodies - The present application relates to compositions of humanized anti-endoglin antibodies and antigen-binding fragments thereof. One aspect relates to antibodies having one or more modifications in at least one amino acid residue of at least one of the framework regions of the variable heavy chain, the variable light chain or both. Another aspect relates to antibodies which bind endoglin and inhibit angiogenesis. Another aspect relates to the use of humanized antibodies which bind endoglin for the detection, diagnosis or treatment of a disease or condition associated with endoglin, angiogenesis or a combination thereof. | 04-22-2010 |
20100098693 | COMPOSITIONS AND METHODS FOR BLOOD-BRAIN BARRIER DELIVERY OF ORGANOPHOSPHATASES - Provided herein are compositions and related methods for delivering an organophosphatase to the CNS. The methods include systemic administration of a bifunctional fusion antibody comprising an antibody to a receptor expressed on the surface of the blood-brain barrier (BBB receptor) and an organophosphatase. In some embodiments, the compositions described herein are used to treat a subject suffering from or at high risk of exposure to an organophosphate (e.g., a nerve gas). | 04-22-2010 |
20100098694 | ANTIBODIES TO CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 04-22-2010 |
20100104563 | ANTIBODIES THAT BIND IL-18 AND METHODS OF INHIBITING IL-18 ACTIVITY - Antibodies that bind human interleukin-18 (hIL-18) are provided, in particular antibodies that bind epitope(s) of human IL-18. The antibodies can be, for example, entirely human antibodies, recombinant antibodies, or monoclonal antibodies. Preferred antibodies have high affinity for hIL-18 and neutralize hIL-18 activity in vitro and in vivo. An antibody of the invention can be a full-length antibody or an antigen-binding portion thereof. Method of making and method of using the antibodies of the invention are also provided. The antibodies, or antibody portions, of the invention are useful for detecting hIL-18 and for inhibiting hIL-18 activity, e.g., in a human subject suffering from a disorder in which hIL-18 activity is detrimental. | 04-29-2010 |
20100104564 | Altered Antibody Fc Regions and Uses Thereof - The present invention relates to altered antibody Fc regions and uses thereof. | 04-29-2010 |
20100104565 | COMBINATIONS COMPRISING DMXAA FOR THE TREATMENT OF CANCER - The present invention relates to combinations of the xanthenone acetic acids class such as 5,6-dimethylxanthenone-4-acetic acid (DMXAA) and EGFR signalling pathway inhibitors. More particularly, the invention is concerned with the use of such combinations in the treatment of cancer and pharmaceutical compositions containing such combinations. | 04-29-2010 |
20100104566 | ANTITUMOR COMBINATION COMPRISING A MORPHOLINYL ANTHRACYCLINE AND AN ANTIBODY - The present invention provides the combined use of a morpholinyl anthracycline derivative of formula (I) or a pharmaceutically acceptable salt thereof, such as nemorubicin hydrochloride, and an antibody inhibiting a growth factor or its receptor, in the treatment of tumors. Also provided is the use of the said combinations in the treatment or prevention of metastasis or in the treatment of tumors by inhibition of angiogenesis. | 04-29-2010 |
20100104567 | PHARMACEUTICAL COMPOSITION - The present invention provides a pharmaceutical composition comprising a combination of an Flt-3 inhibitor and at least one compound, the said pharmaceutical composition wherein an Flt-3 inhibitor is an indazole derivative represented by Formula (I) | 04-29-2010 |
20100104568 | AMINO ACID SEQUENCES DIRECTED AGAINST RANK-L AND POLYPEPTIDES COMPRISING THE SAME FOR THE TREATMENT OF BONE DISEASES AND DISORDERS - The present invention relates to amino acid sequences that are directed against RANK-L, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. The invention also relates to nucleic acids encoding such amino acid sequences and polypeptides; to methods for preparing such amino acid sequences and polypeptides; to host cells expressing or capable of expressing such amino acid sequences or polypeptides; to compositions, and in particular to pharmaceutical compositions, that comprise such amino acid sequences, polypeptides, nucleic acids and/or host cells; and to uses of such amino acid sequences or polypeptides, nucleic acids, host cells and/or compositions, in particular for prophylactic, therapeutic or diagnostic purposes. | 04-29-2010 |
20100104569 | HUMANIZED ANTIBODIES TO INTERFERON ALPHA RECEPTOR-1 (IFNAR-1) - Humanized monoclonal antibodies which bind to IFNAR-1, and related antibody-based compositions and molecules, are disclosed. Also disclosed are pharmaceutical compositions comprising the humanized antibodies and therapeutic and diagnostic methods for using the humanized antibodies. | 04-29-2010 |
20100104570 | Semaphorin 7A Plays a Critical Role in TGF-Beta1-Induced Pulmonary Fibrosis and Alveolar Destruction - The present invention provides methods of treating a subject diagnosed with, or at risk for developing, pathogenic fibrosis, particularly pulmonary fibrosis. The method of the invention comprises administering to the subject a compound or composition which inhibits semaphorin (SEMA) 7A, SEMA 7A receptors, or downstream effectors. A SEMA 7A inhibitor comprises an antibody, a soluble SEMA 7A receptor, an siRNA, a ribozyme, an antisense, an aptamer, a peptidomimetic, a small molecule, a soluble receptor, or any combinations thereof. | 04-29-2010 |
20100104571 | Antibody-mediated modulation of allergy - The present invention is drawn to antibody-mediated modulation of allergy. In this regard, the present invention discloses a monoclonal antibody, antigen-binding fragment or mimic thereof directed against Group 1 pollen allergens or homologues thereof. Also disclosed herein is the mechanism by which the disclosed monoclonal antibody, antigen binding fragment or mimic thereof will improve immunotherapy of allergic reactions in an individual. It is contemplated that herein that such a monoclonal antibody, antigen binding fragment or mimic thereof may also be useful in treatment of several microbial infections. | 04-29-2010 |
20100111938 | Compositions and methods for biological remodeling with frozen particle compositions - Certain embodiments disclosed herein relate to compositions, methods, devices, systems, and products regarding frozen particles. In certain embodiments, the frozen particles include materials at low temperatures. In certain embodiments, the frozen particles provide vehicles for delivery of particular agents. In certain embodiments, the frozen particles are administered to at least one biological tissue. | 05-06-2010 |
20100111939 | MONOCLONAL ANTIBODY AND USE THEREOF - The purpose of the invention is to provide an antibody which recognizes OPN N-half but does not recognize the full-length OPN, and its use. A monoclonal antibody which is characterized in that it recognizes a protein or polypeptide in which the C-terminal amino acid sequence is YGLR (SEQ ID NO: 1) and it substantially does not recognize a protein or polypeptide which has an amino acid sequence of YGLR outside of the C-terminal, as well as a method for measuring OPN N-half utilizing the said antibody, a method for diagnosing diseases relating to OPN N-half, a method for judging the severity of said disease, and a method for treating said diseases, are provided. | 05-06-2010 |
20100111940 | COMPOSITIONS CONTAINING ALPHA-1-ANTITRYPSIN AND METHODS FOR USE - Methods and compositions for treating patients (e.g., patients who are insulin resistant, patients who have diabetes, or are at risk for developing diabetes) are disclosed herein. The methods can include administration of an a1 antitrypsin (AAT) polypeptide or an agent, such as a nucleic acid molecule or organic compound, that promotes the expression or activity of a1-antitrypsin. | 05-06-2010 |
20100111941 | METHODS FOR TREATING CANCER - The invention relates to the treatment of abnormal or undesirable cell proliferation, particularly endothelial cell proliferation related to tumor growth. The compositions comprise anti-metastatic agents in combination with one or more anti-cancer agent. | 05-06-2010 |
20100111942 | COMBINATION THERAPY FOR THE TREATMENT OF OCULAR NEOVASCULAR DISORDERS - The invention features methods for treating a patient diagnosed with, or at risk of developing, a neovascular disorder by administering a PDGF antagonist and a VEGF antagonist to the patient. The invention also features a pharmaceutical composition containing a PDGF antagonist and a VEGF antagonist for the treatment or prevention of a neovascular disorder. | 05-06-2010 |
20100111943 | COMPOSITIONS AND METHODS FOR INHIBITING CANCER METASTASIS - It has been discovered that antagonists of acetylated heat shock proteins can inhibit or reduce tumor cell invasion or metastasis. Compositions and methods for inhibiting tumor cell invasion or metastasis are provided. One embodiment provides a pharmaceutical composition including a heat shock protein antagonist in an amount effective to inhibit or reduce tumor cell invasion or metastasis. Another embodiment provides a pharmaceutical composition including a heat shock protein deacetylase in an amount effective to inhibit or reduce secretion of heat shock proteins. Representative target heat shock proteins include, but are not limited to hsp90α and hsp70. Methods of treating cancer or inhibiting tumor cell invasion and metastasis are also provided. | 05-06-2010 |
20100111944 | METHOD OF DIAGNOSING, CLASSIFYING AND TREATING ENDOMETRIAL CANCER AND PRECANCER - Diagnostic and therapeutic applications for endometrial cancer are described. The diagnostic and therapeutic applications are based on certain activation mutations in the FGFR2 gene and its expression products. The present invention is directed to nucleotide sequences, amino acid sequences, probes, and primers related to FGFR2 activation mutants and kits comprising these mutants to diagnosis and classify endometrial cancer in a subject. | 05-06-2010 |
20100111945 | NOVEL USES - The present invention relates generally to the use of human IL-18 combinations in the treatment of cancers. In particular, the present invention relates to combination of human IL-18 and an anti-CD20 antibody. | 05-06-2010 |
20100111946 | INHIBITING ACTIVATION WITH HUMAN ANTI-FACTOR C3 ANTIBODIES AND USE THEREOF - A method of inhibiting complement activation mediated by C3b inhibitors in a subject includes administering a C3B inhibitor to the subject to inhibit at least one of C3b binding to factors B and properdin, inhibit C3 cleavage, inhibit the activation of neutrophils, monocytes, platelets, and endothelium; or inhibit the formation of C3a, C5a, and MAC. | 05-06-2010 |
20100111947 | PHARMACEUTICAL COMPOSITION COMPRISING ANTIBODY COMPOSITION WHICH SPECIFICALLY BINDS TO GANGLIOSIDE GM2 - The present invention provides a pharmaceutical composition which is effective for treating multiple myeloma. The present invention relates to a pharmaceutical composition comprising a combination of an antibody composition which specifically binds to ganglioside GM2 or an antibody fragment thereof and at least one agent. | 05-06-2010 |
20100111948 | ANTI-IL-22RA ANTIBODIES AND BINDING PARTNERS AND METHODS OF USING IN INFLAMMATION - The present invention relates to blocking, inhibiting, reducing, antagonizing or neutralizing the activity of IL-22, IL-20, or both IL-20 and IL-22 polypeptide molecules. IL-20 and IL-22 are cytokines that are involved in inflammatory processes and human disease. IL-22RA (zcytor11) is a common receptor for IL-20 and IL-22. The present invention includes anti-IL-22RA antibodies and binding partners, as well as methods for antagonizing IL-22 or both IL-20 and IL-22 using such antibodies and binding partners. | 05-06-2010 |
20100111949 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF PROLIFERATIVE DISEASES - The invention features peptides containing domain 4 of the | 05-06-2010 |
20100111950 | USE OF IL-23 AND IL-17 ANTAGONISTS TO TREAT AUTOIMMUNE OCULAR INFLAMMATORY DISEASE - Novel methods and drug products for treating autoimmune ocular inflammatory disease are disclosed, which involve administration of agents that antagonize one or both of IL-17 and IL-23 activity. | 05-06-2010 |
20100111951 | ADAM-9 Modulators - The invention provides the identification and characterization of a disease and cancer-associated antigen, KID24. The invention also provides modulators of KID24, including a family of monoclonal antibodies that bind to antigen KID24, and methods of diagnosing and treating various human cancers and diseases with KID24. | 05-06-2010 |
20100119506 | Effectors of PAR-2 Activation and Their Use in the Modulation of Inflammation - The present invention relates to the recognition that PAR-2 receptors amplify the inflammatory response and that effectors of PAR-2 activation can thus be used to modulate the inflammatory response and thereby impart therapeutic benefit to patients. The invention is particularly directed to the use of PAR-2 effectors in the treatment of inflammation and nociception (pain) caused by inflammation, cancer and injury. The invention is particularly directed to negative effectors of PAR-2 activation, and more particularly to anti-PAR-2 antibodies that are negative effectors of PAR-2 activation. | 05-13-2010 |
20100119507 | STREPTOCOCCUS PYOGENES ANTIGENS AND CORRESPONDING DNA FRAGMENTS - The present invention relates to antigens, more particularly antigenS of | 05-13-2010 |
20100119508 | PHENYLACETIC ACID INHIBITORS OF CYCLOOXYGENASE - The present invention relates to new phenylacetic acid inhibitors of cyclooxygenase activity, pharmaceutical compositions thereof, and methods of use thereof. | 05-13-2010 |
20100119509 | POLYNUCLEOTIDES AND POLYPEPTIDES ASSOCIATED WITH THE DEVELOPMENT OF RHEUMATOID ARTHRITIS - The present invention is directed to polynucleotides encoding polypeptides associated with the development of rheumatoid arthritis and homologs thereof. The invention further relates to diagnostic and therapeutic methods for utilizing these polynucleotides and polypeptides in the diagnosis, treatment, and/or prevention of rheumatoid arthritis and related disease states. The invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention, and compounds identified thereby. | 05-13-2010 |
20100119510 | LACTAM-CONTAINING COMPOUNDS AND DERIVATIVES THEREOF AS FACTOR XA INHIBITORS - The present application describes lactam-containing compounds and derivatives thereof of Formula I: | 05-13-2010 |
20100124550 | AMIDE INHIBITORS OF RENIN - The present invention relates to new amide inhibitors of renin, pharmaceutical compositions thereof, and methods of use thereof | 05-20-2010 |
20100129353 | COMBINATION AND TREATMENT FOR MULTIPLE SCLEROSIS - This invention is directed towards treatments for multiple sclerosis comprising administering to a patient in need thereof a first agent, such as 2-chloro-2′-deoxyadenosine (2-CdA), that reduces the number of lymphocytes in combination with a second agent, such as an anti-alpha-4 integrin antibody, that blocks the adhesion of monocytes and leukocytes to endothelial cells. The use of 2-CdA combined with an anti-alpha-4 integrin antibody may be more effective than either treatment alone for MS. Furthermore, the combination treatment may allow for a lowering or altering the dose of one or more of the agents in order to limit any adverse effects associated with the individual agents, but maintaining the same therapeutic efficacy. | 05-27-2010 |
20100129354 | INTRANASAL DELIVERY OF POLYPEPTIDES AND PROTEINS - The present invention relates to the intranasal delivery of therapeutic polypeptides and proteins comprising a Nanobody®, a domain antibody, a single domain antibody or a “dAb”. The present invention provides compositions comprising a therapeutically effective amount of such polypeptide or protein and further comprising a pharmaceutically acceptable nasal carrier. The invention also relates to methods for the treatment of a subject comprising the delivery of said polypeptides and proteins to said subject by the nasal route. | 05-27-2010 |
20100129355 | THERAPEUTIC AGENTS FOR OCULAR INFLAMMATORY DISEASE COMPRISING INTERLEUKIN 6 RECEPTOR INHIBITOR AS ACTIVE INGREDIENT - The present invention relates to therapeutic and/or prophylactic agents for ocular inflammatory disease, which comprise an interleukin 6 (IL-6) receptor inhibitor as an active ingredient. | 05-27-2010 |
20100129356 | COMPOSITIONS AND METHODS FOR MODULATING VASCULAR DEVELOPMENT - The present invention provides methods of using a DLL4 modulator to modulate vascular development. Furthermore, methods of treatment using DLL4 modulators, such as DLL4 antagonists, are provided. | 05-27-2010 |
20100129357 | ANTIBODIES TO IL-6 AND USE THEREOF - The present invention is directed to therapeutic methods using IL-6 antagonists such as an Ab1 antibody or antibody fragment having binding specificity for IL-6 to prevent or treat disease or to improve survivability or quality of life of a patient in need thereof. In preferred embodiments these patients will comprise those exhibiting (or at risk of developing) an elevated serum C-reactive protein level, reduced serum albumin level, elevated D-dimer or other cogulation cascade related protein(s), cachexia, fever, weakness and/or fatigue prior to treatment. The subject therapies also may include the administration of other actives such as chemotherapeutics, anti-coagulants, statins, and others. | 05-27-2010 |
20100129358 | METHOD OF DETECTING OCULAR DISEASES AND PATHOLOGIC CONDITIONS AND TREATMENT OF SAME - Ocular diseases affecting the macula or the vasculature of the eye affect a wide variety of individuals. In particular, Age-related macular degeneration (AMD) is the most common cause of irreversible vision loss in the developed world and has a significant genetic predisposition. Methods of analyzing one or more mutations in the HtrA1 gene in order to identify individuals with a presusceptability to development of an ocular disease and a pathologic condition of the eye and diagnose those currently suffering from an ocular disease or a pathologic condition of the eye are provided. The methods of the present invention may further include analysis of the CFH gene in order to identify individuals with a presusceptability to development of an ocular disease and a pathologic condition of the eye and diagnose those currently suffering from an ocular disease or a pathologic condition of the eye. Compositions and methods for treating ocular disease and pathologic conditions of the eye are also provided. | 05-27-2010 |
20100129359 | Methods to facilitate transmission of large molecules across the blood-brain, blood-eye, and blood-nerve barriers - A method for delivering a biologic to a human, comprising administering said biologic parenterally into the perispinal space of said human without direct intrathecal injection and positioning said human in a Trendelenburg position. | 05-27-2010 |
20100129360 | ANTIBODIES AGAINST HUMAN INTERLEUKIN-13 AND USES THEREFOR - This application relates to antibodies, e.g., humanized antibodies, and antigen-binding fragments thereof, that bind to interleukin-13 (IL-13), in particular, human IL-13, and their uses in regulating immune responses mediated by IL-13. The antibodies disclosed herein are useful in diagnosing, preventing, and/or treating a subject, e.g., a human patient, one or more IL-13-associated disorders, e.g., respiratory disorders (e.g., asthma); atopic disorders (e.g., allergic rhinitis); inflammatory and/or autoimmune conditions of the skin (e.g., atopic dermatitis), and gastrointestinal organs (e.g., inflammatory bowel diseases (IBD)), as well as fibrotic and cancerous disorders. | 05-27-2010 |
20100129361 | IMMUNOSUPPRESSION WITH ANTIBODY AGAINST ITM2A - The invention relates to methods of T cell immune system modulation and the treatment of immune system related diseases and disorders. In particularly, embodiments of the invention provides immunotherapeutics in the form of antibodies, bioengmeered antibodies and recombinant proteins for the treatment of autoimmune diseases and disorders, organ transplantation rejection, graft-versus-host tissue diseases, and T-cell based lymphoma and leukemia. | 05-27-2010 |
20100129362 | TREATMENT OF PSORIATIC ARTHRITIS WITH ANTI-CD70 ANTIBODY - Disclosed are CD70 binding agents, such as anti-CD70 antibodies and derivatives, that induce a cytotoxic, cytostatic or immunomodulatory without conjugation to a therapeutic agents as well as pharmaceutical compositions and kits comprising the antibody or derivative. Also disclosed are methods for the treatment of psoriatic arthritis comprising administering the CD70 binding agents to a subject. | 05-27-2010 |
20100129363 | METHODS AND COMPOSITIONS USING PDE4 INHIBITORS FOR THE TREATMENT AND MANAGEMENT OF CANCERS - Methods of treating, preventing and/or managing hematological cancers are disclosed. Specific methods encompass the administration of a PDE4 inhibitor alone or in combination with a second active agent. The invention further relates to methods of treating leukemias and lymphomas which comprise the administration of a PDE4 inhibitor. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 05-27-2010 |
20100129364 | COMBINATION THERAPY FOR THE TREATMENT OF OCULAR NEOVASCULAR DISORDERS - The invention features methods for treating a patient diagnosed with, or at risk of developing, a neovascular disorder by administering a PDGF antagonist and a VEGF antagonist to the patient. The invention also features a pharmaceutical composition containing a PDGF antagonist and a VEGF antagonist for the treatment or prevention of a neovascular disorder. | 05-27-2010 |
20100135992 | Prolongation of Survival of an Allograft by Inhibiting Complement Activity - Methods of prolonging survival of allotransplanted cells, tissues or organs are presented. These methods are directed to administering to the allograft recipient an inhibitor of complement activity together with one or more immunosuppressants and/or immunosuppressive methods. The inhibitor of complement activity is administered chronically. These methods have been determined to aid in preventing chronic rejection of allografts. These methods can additionally be used in cases in which the recipient has been presensitized to the allograft or in which there is an ABO mismatch between the allograft and the recipient. | 06-03-2010 |
20100135993 | METHOD OF TREATING MALIGNANT MESOTHELIOMA - The present invention relates to a therapeutic agent for malignant mesothelioma comprising a substance which inhibits binding of CD26 to extracellular matrix such as an siRNA targeting CD26 cDNA or an anti-CD26 antibody. The present invention also relates to a method of treating malignant mesothelioma, which comprises administering the substance to a patient in need thereof. | 06-03-2010 |
20100135994 | HIV VACCINE BASED ON TARGETING MAXIMIZED GAG AND NEF TO DENDRITIC CELLS - The present invention includes compositions and methods for making and using a vaccine that includes a DC-specific antibody or fragment thereof to which an engineered Gag antigen is attached to form an antibody-antigen complex, wherein the Gag antigen is less susceptible to proteolytic degradation by eliminating one or more proteolytic sites or a DC-specific antibody or fragment thereof to which an engineered Nef antigen is attached to form an antibody-antigen complex, wherein the Nef antigen comprises one or more codon usage optimization that increase antibody-antigen complex secretion, or both, wherein the vaccine is able to elicit an HIV-specific T cell immune response to Gag p17, Gag p24, Nef and/or Cyclin D1. | 06-03-2010 |
20100135995 | METHODS OF MODULATING ANGIOGENESIS - The present inventors discovered that PKCε is necessary for VEGF signaling through PI3K/Akt-dependent pathways and is involved in MAPK-dependent pathways, thus regulating eNOS activity and DNA synthesis, respectively. Thus differential manipulation of PKCε activity can be used to modify VEGF effects in conditions in which modulation of angiogenesis is desirable (e.g., for treatment of diabetic proliferative retinopathy or to enhance angiogenesis for treatment of peripheral and myocardial ischemia). | 06-03-2010 |
20100135996 | MONOCLONAL ANTIBODIES AND FRAGMENT THEREOF DIRECTED AGAINST THE HUMAN ANTI-MULLERIAN HORMONE TYPE II RECEPTOR (AMHR-II) - The present invention relates to monoclonal antibodies and fragment thereof directed against the human Anti-Müllerian Hormone type II receptor (AMHR-II) and their use for treating and diagnosing cancer diseases, such as ovarian cancers. | 06-03-2010 |
20100135997 | POLYPEPTIDE MONOMERS AND DIMERS CONTAINING MUTATED ILT - The present invention provides monomeric and dimeric polypeptide fusions comprising mutated human ILT molecules and immunoglobulin Fc segments. Such compostions are useful, either alone or associated with a therapeutic agent, for targeting cells expressing Class I pMHC molecules. | 06-03-2010 |
20100135998 | COMBINATION THERAPY FOR TREATMENT OF IMMUNE DISORDERS - Methods and compositions are provided for the treatment of immune disorders, such as autoimmune diseases, or cancers, involving combination therapy with agents that inhibit the development or maintenance of Th17 cells. Treatment regimens are provided in which an antagonist of a pro-inflammatory cytokine is administered for a time sufficient to alleviate signs and symptoms of an acute phase flare-up of the autoimmune disease, or cancer, and treatment with an antagonist of IL-23 is continued for a longer time to prevent recurrence of the acute event. Antagonists of PGE2 and CD161 are also disclosed for use in treatment of autoimmune, inflammatory and proliferative disorders. | 06-03-2010 |
20100135999 | QUINOLINE-CARBOXAMIDE DERIVATIVES AS P2Y12 ANTAGONISTS - The present invention relates to compounds of the formula I, | 06-03-2010 |
20100136000 | TREATMENT OF FOLLICULAR LYMPHOMAS USING INHIBITORS OF THE LT PATHWAY - Therapeutic uses of inhibitors of the lymphotoxin pathway to treat tumors, specifically to treat follicular lymphomas. | 06-03-2010 |
20100136001 | Methods and compositions for the treatment and diagnosis of vascular inflammatory disorders or endothelial cell disorders - Disclosed herein are methods for treating a vascular inflammatory disorder or endothelial cell disorder using inhibitor compounds that inhibit the expression or biological activity of Tie-1, Tie-1 endodomain, thrombin, VEGFR2, VEGFR2 endodomain, EphA2, and any of the cytokines or kinases that are upregulated by activation of Tie-1 or thrombin, as provided herein. Also disclosed are the use of combinations of inhibitor compounds or the use of an eNOS activator compound in combination with any one or more of the inhibitor compounds. Also disclosed are methods for inhibiting the pro-coagulant activity of thrombin using a Tie-1 or Tie-1 endodomain inhibitor compound or an EphA2 inhibitor compound. Methods for diagnosing and monitoring vascular inflammatory disorders or endothelial cell disorders that include the measurement of any of the polypeptides or nucleic acid molecules of the invention are also disclosed. | 06-03-2010 |
20100136002 | METHODS FOR TREATING AND PREVENTING MULTIPLE SCLEROSIS - We have discovered that LRG-47 (also called p47 GTPase), plays a central role in the pathogenesis of multiple sclerosis, and that inhibition of LRG-47 activity by anti-LRG-47 antibodies or of LRG-47 expression by siRNA dramatically reduce the pathology and symptoms of multiple sclerosis. Certain embodiments of the invention are directed to the therapeutic use of anti-LRG-47 antibodies (mouse or rabbit or other antibodies that are humanized or human antibodies to LRG-47, preferably antibodies made against human LRG-47) or siRNA or antisense nucleotides that specifically hybridize with the gene or mRNA or cDNA encoding human LRG-47 to treat or prevent multiple sclerosis and other autoimmune diseases that are T-cell-mediated. Other embodiments are directed to methods for the diagnosis of multiple sclerosis or to determining the aggressiveness of multiple sclerosis by determining the amount of human LRG-47 or LRG-47 mRNA in a biological sample from the patient. | 06-03-2010 |
20100136003 | USES OF MAMMALIAN CYTOKINE; RELATED REAGENTS - Provided are methods of modulating dendritic cell activity using agonists or antagonists of a mammalian cytokine. Also provided are methods of treating immune disorders. | 06-03-2010 |
20100136004 | COMPOSITIONS AND METHODS FOR TREATING NEUROLOGICAL DISORDERS - Methods and compositions for modulating GABA release in a subject are provided. A preferred embodiment provides a composition containing an effective amount of an ErbB4 ligand to enhance or promote GABA release, i.e., GABAergic transmission. The ErbB4 ligand can be an agonist ligand or an antagonist ligand depending on the disorder to be treated. Methods for treating neurological disorders are also provided. Representative disorders that can be treated include, but are not limited to schizophrenia, epilepsy, depression and anxiety, insomnia, stroke, pain, bipolar, autism, or a combination thereof. By increasing GABA release a sedative effective can be induced in the subject. Methods for inducing a stimulatory effect in a subject are also provided. In these methods, an effective amount of an ErbB4 antagonist ligand is administered to the subject to reduce or inhibit GABA release in the subject. | 06-03-2010 |
20100136005 | Method of Treatment Using Humanized Anti-CD11a Antibodies - Humanized anti-CD11 | 06-03-2010 |
20100143341 | THIENOPYRIMIDINES FOR PHARMACEUTICAL COMPOSITIONS - The present invention relates to novel pharmaceutical compositions of general formula (I) comprising thienopyrimidine compounds. Moreover, the present invention relates to the use of the thienopyrimidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof. | 06-10-2010 |
20100143342 | BISPECIFIC MOLECULE BINDING TLR9 AND CD32 AND COMPRISING A T CELL EPITOPE FOR TREATMENT OF ALLERGIES - A molecule or molecule complex capable of binding to TLR9 and to CD32 comprising at least one epitope of at least one antigen, its production and its use a medicament, especially for the treatment of allergies. | 06-10-2010 |
20100143343 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF ANTIBODY MEDIATED NEUROPATHIES - The use of a therapeutic capable of inhibiting complement, e.g., an anti-C5 antibody, to treat antibody mediated neuropathies is disclosed. | 06-10-2010 |
20100143344 | COMPLEMENT INHIBITION FOR IMPROVED NERVE REGENERATION - The present invention relates to methods and medicaments used for treating conditions that require axonal regeneration, e.g. in mammals affected by injury or disease of the central or peripheral nervous system. The medicaments used in these methods facilitate axonal regeneration by inhibition of the complement system. Conditions requiring axonal regeneration that may be treated in accordance with the invention include physical injuries as well as neurodegenerative disorders of the peripheral or central nervous system. | 06-10-2010 |
20100143345 | EPHA2 AGONISTIC MONOCLONAL ANTIBODIES AND METHODS OF USE THEREOF - The present invention relates to methods and compositions designed for the treatment, management, or prevention of cancer, particularly, metastatic cancer. The methods of the invention comprise the administration of an effective amount of one or more antibodies that bind to and agonize EphA2, thereby increasing EphA2 phosphorylation and decreasing EphA2 levels in cells which EphA2 has been agonized. The invention also encompasses antibodies that preferentially bind an EphA2 epitope exposed on cancer cells but not non-cancer cells. The invention also provides pharmaceutical compositions comprising one or more EphA2 antibodies of the invention either alone or in combination with one or more other agents useful for cancer therapy. | 06-10-2010 |
20100143346 | Treatment of Macular Degeneration - An agent having progesterone antagonist properties may be used to treat eye conditions associated with pathological blood vessel formation, for example age-related macular degeneration, choroidal neovascularisation, retinal neovascularisation or corneal neovascularisation. The agent may be mifepristone. | 06-10-2010 |
20100143347 | TARGETING NCCA-ATP CHANNEL FOR ORGAN PROTECTION FOLLOWING ISCHEMIC EPISODE - The present invention concerns protection of an organ or tissue following an ischemic episode In particular aspects, the invention concerns organ preservation for transplantation, angina pectoris, kidney reperfusion injury, and so forth In specific embodiments, the organ is subjected to an inhibitor of an NCCa-ATP channel that is regulated by SUR1 Exemplary inhibitors include sulfonylurea compounds, such as glibenclamide, for example | 06-10-2010 |
20100143348 | OVR115 Antibody Compositions and Methods of Use - The invention encompasses a method of inhibiting growth of tumor cells in vivo, comprising contacting the cells with an anti-Ovr1 15 antibody, or antigen binding fragment thereof. This invention also encompasses a method of alleviating an Ovr1 15-expressing cancer in a mammal, comprising administering a therapeutically effective amount of an anti-Ovr1 15 antibody, or antigen binding fragment thereof, to the mammal. | 06-10-2010 |
20100143349 | HUMANIZED ANTI-RAGE ANTIBODY - Compositions comprising antigen binding polypeptides that bind specifically to Receptor For Advanced Glycation End-product (RAGE) and comprises: one or more complementarity determining regions (CDRs) with improved binding efficiency over a parental monoclonal antibody to RAGE are described. Antibodies containing the CDR's and methods of treating a RAGE-related disease or disorder comprising administering to the subject a therapeutically effective amount of the compositions of the invention are also provided. | 06-10-2010 |
20100143350 | COMBINATION OF A PURINE-BASED CDK INHIBITOR WITH A TYROSINE KINASE INHIBITOR AND USE THEREOF IN THE TREATMENT OF PROLIFERATIVE DISORDERS - The present invention relates to combination comprising (i) an ErbB inhibitor; and (ii) a CDK inhibitor, or a pharmaceutically acceptable salt thereof, selected from: (a) roscovitine; (b) 3-{9-isopropyl-6-[(pyridin-3-ylmethyl)-amino]-9H-purin-2-ylamino}-2-methyl-pentan-2-ol; (c) 3-{9-isopropyl-6-[(pyridin-3-ylmethyl)-amino]-9H-purin-2-ylamino}-pentan-2-ol; and (d) (2R,3S-3-(6-((4,6-dimethylpyridin-3-ylmethylamino)-9-isopropyl-9H-purin-2-ylamino)pentan-2-ol. | 06-10-2010 |
20100143351 | Anti-Angiogenesis Therapy for the Treatment of Breast Cancer - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human subjects susceptible to or diagnosed with breast cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents. | 06-10-2010 |
20100143352 | COMBINATION THERAPY FOR B CELL DISORDERS - The invention provides methods of treating B cell based malignancies and B-cell regulated autoimmune disorders using a combination therapy of anti-CD20 antibody with a BLyS antagonist. | 06-10-2010 |
20100143353 | POLYPEPTIDES COMPRISING Fc FRAGMENTS OF IMMUNOGLOBULIN G (lgG) AND METHODS OF USING THE SAME - Polypeptides comprising at least a first and second Fc fragment of IgG that can be used to induce a stimulated cell to produce the anti-inflammatory cytokine Interleukin-10 and methods of using the same are disclosed herein. | 06-10-2010 |
20100143354 | TRIAZINE DNA MODIFIERS - The present invention relates to new triazine DNA modifiers, pharmaceutical compositions thereof, and methods of use thereof | 06-10-2010 |
20100143355 | METHODS FOR TREATING PAIN BY ADMINISTERING A NERVE GROWTH FACTOR ANTAGONIST AND AN NSAID AND COMPOSITIONS CONTAINING THE SAME - The present invention features methods for treating or preventing pain comprising administering an amount of a nerve growth factor antagonist (such as an anti-NGF antibody) and an amount of an NSAID such that together they provide effective pain relief. The invention also features compositions comprising a nerve growth factor antagonist and an NSAID and kits containing the same. | 06-10-2010 |
20100143356 | THERAPEUTIC AND DIAGNOSTIC ANTI-HSP70 ANTIBODIES - Methods and compositions for the detection, prevention and treatment of infectious diseases, primary and metastatic neoplastic diseases, including, but not limited to human sarcomas and carcinomas are described. In particular, specific antibodies are provided, which are capable of binding an epitope of Hsp70 that is extracellularly localized on diseased tissue and cells, in particular on tumor cells and infected cells. | 06-10-2010 |
20100143357 | Uses of Mammalian Cytokine; Related Reagents - Provided are methods of treatment for inflammatory and autoimmune disorders of the central nervous system and gastrointestinal tract. Also provided are methods of diagnosis. | 06-10-2010 |
20100150905 | KIM-1 ANTIBODIES FOR TREATMENT OF TH2-MEDIATED CONDITIONS - Compositions and methods for treating Th2- and ThI-mediated disease are provided. | 06-17-2010 |
20100150906 | ANTIBODIES - The present invention is related to methods and compositions for the therapeutic and diagnostic use in the treatment of diseases and disorders which are caused by or associated with amyloid or amyloid-like proteins including amyloidosis, a group of disorders and abnormalities associated with amyloid protein such as Alzheimer's disease. The present invention provides novel methods and compositions comprising highly specific and highly effective antibodies having the ability to specifically recognize and bind to specific epitopes from a range of j3-amyloid proteins. The antibodies enabled by the teaching of the present invention are particularly useful for the treatment of diseases and disorders which are caused by or associated with amyloid or amyloid-like proteins including amyloidosis, a group of diseases and disorders associated with amyloid plaque formation including secondary amyloidosis and age-related amyloidosis including, but not limited to, neurological disorders such as Alzheimer's Disease (AD). | 06-17-2010 |
20100150907 | PRO115 ANTIBODY COMPOSITIONS AND METHODS OF USE - The invention provides isolated anti-Pro115 antibodies that bind to Pro115. The invention also encompasses compositions comprising an anti-Pro115 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-Pro115 antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-Pro115 antibodies. The invention encompasses a method of producing the anti-Pro115 antibodies. Other aspects of the invention are a method of killing an Pro115-expressing cancer cell, comprising contacting the cancer cell with an anti-Pro115 antibody and a method of alleviating or treating an Pro115-expressing cancer in a mammal, comprising administering a therapeutically effective amount of the anti-Pro115 antibody to the mammal. | 06-17-2010 |
20100150908 | Affinity matured CRIg variants - The present invention concerns affinity matured CRIg variants. In particular, the invention concerns CRIg variants having increased binding affinity to C3b and retaining selective binding to C3b over C3. | 06-17-2010 |
20100150909 | PTHrP-DERIVED MODULATORS OF SMOOTH MUSCLE PROLIFERATION - The present invention relates to the use of mutants of parathyroid hormone-related protein, to treat disorders associated with smooth muscle cells, and to inhibit the cellular activation and proliferation thereof. The method can be employed in diverse tissues to effect therapeutic and prophylactic relief for disorders and diseases manifested by activation of smooth muscle that can lead to excessive smooth muscle proliferation. For example, where employed in the vasculature, the inventive method can be used to treat restenosis following angioplasty. | 06-17-2010 |
20100150910 | USE OF MONOCLONAL ANTIBODIES SPECIFIC TO THE O-ACETYLATED FORM OF GD2 GANGLIOSIDE FOR TREATMENT OF CERTAIN CANCERS - The invention relates to the use of monoclonal antibodies that only recognise the O-acetylated form of the GD2 ganglioside, or fragments of said antibody, for the diagnosis and the treatment of cancers in which the cells express the O-acetylated GD2, said antibody or said fragment recognising the O-acetylated GD2 molecules expressed by the tumoral cells and not recognising the GD2 molecules expressed at the surface of the peripheral nerves, in order to increase the specificity of the diagnosis and reduce the toxicity of the treatments. The invention also relates to artificially modified antibodies advantageously used for treating and diagnosing cancers in which the cells express the O-acetylated GD2. | 06-17-2010 |
20100150911 | METHODS AND SYSTEMS OF TREATING AGE-RELATED MACULAR-DEGENERATION - A method of treating CNV secondary to AMD, comprising administering a medicament in combination with i-MP treatment where the i-MP treatment includes a control method comprising the following steps: determining and/or inputting at least one dosage parameter dependent on patient-related data; determining and/or inputting at least one application parameter dependent on patient-related data; providing instructions to administer ICG to the patient; and providing instructions to apply an output of an application device to a treatment area of the patient; where at least one of the steps is a computer-implemented step. | 06-17-2010 |
20100150912 | BLOCKING INTERACTION BETWEEN PATHOGEN FACTORS AND FACTOR H TO INHIBIT HEMORRHAGIC SYNDROMES - If pathogen factors such as meningococcal NMB 1870 or flaviviral NS1 are able to sequester factor H in the blood then its inhibitory effect on complement may be disturbed, thereby permitting C3 to initiate a dramatic attack on host endothelial tissue. In combination with a strong inflammatory response, this attack can result in sever damage to the endothelium, with resulting hemorrhagic syndrome. Blocking the interaction between pathogen factors and factor H may thus be used to treat and/or prevent these pathogen-induced hemorrhagic syndromes. The interaction may, for instance, be blocked by antibodies, either delivered endogenously (passive immunisation) or produced by a patient's immune system (active immunisation). | 06-17-2010 |
20100150913 | ORGANIC COMPOUNDS - The present invention relates to compounds and compositions useful for inhibiting and/or reducing platelet deposition, adhesion and/or aggregation. The present invention also relates to methods for screening compounds and compositions useful for inhibiting or reducing platelet deposition, adhesion and/or aggregation. The present invention further relates to methods for the treatment or prophylaxis of thrombotic disorders, including stroke, myocardial infarction, unstable angina, peripheral vascular disease, abrupt closure following angioplasty or stent placement and thrombosis as a result of vascular surgery. | 06-17-2010 |
20100150914 | AGONIST TRKB ANTIBODIES AND USES THEREOF - TrkB agonist antibodies and methods of their use are provided. | 06-17-2010 |
20100150915 | METHODS OF TREATING MULTIPLE SCLEROSIS BY ADMINISTRATION OF ALPHA-FETOPROTEIN IN COMBINATION WITH AN INTEGRIN ANTAGONIST - The present invention relates to methods for treating multiple sclerosis by administering therapeutically effective amounts of an alpha-fetoprotein polypeptide (or a biologically active fragment, derivative, or analog thereof) and an integrin antagonist (e.g., natalizumab) to a patient in need thereof. Also disclosed are compositions and kits that comprise therapeutically effective amounts of an alpha-fetoprotein polypeptide (or a biologically active fragment, derivative, or analog thereof) and an integrin antagonist (e.g., natalizumab). | 06-17-2010 |
20100150916 | huTNFR1 Selective Antagonists - The present invention relates to a ligand which specifically binds to the human tumor necrosis factor type 1 receptor (huTNFR1), the ligand comprising one or more amino acid sequences of human origin capable of reducing the immunogenic response of the ligand in human beings and one or more amino acid sequences capable of selectively binding to huTNFR1. The present invention further relates to a nucleic acid encoding said ligand and to a pharmaceutical composition for the treatment of disorders connected to huTNFR1. | 06-17-2010 |
20100150917 | Method of Depleting Regulatory T Cell - The present invention relates to the method for depleting in vivo regulatory T cell, the method for suppressing IL-10 producing activity of regulatory T cell, the method for treating diseases in which pathologic conditions are deteriorated by regulatory T cell and the method for enhancing tumor immunity which comprises administering to a patient a monoclonal antibody which specifically binds to human CC chemokine 4 (CCR4) or the antibody fragment thereof. | 06-17-2010 |
20100150918 | CROSS-SPECIES-SPECIFIC BINDING DOMAIN - The present invention relates to a polypeptide comprising a human binding domain capable of binding to an epitope of human and non-chimpanzee primate CD3 (epsilon) chain as well as to a process for the production of the mentioned polypeptide. The invention further relates to nucleic acids encoding for the polypeptide, to vectors comprising the same and to host cells comprising the vector. In another aspect, the invention provides for a pharmaceutical composition comprising the mentioned polypeptide and medical uses of the polypeptide. In a further aspect the invention provides a method for the identification of polypeptides comprising a cross-species specific binding domain capable of binding to an epitope of human and non-chimpanzee primate CD3ε (CD3 epsilon). | 06-17-2010 |
20100150919 | CRYSTAL STRUCTURES OF NEUROPILIN FRAGMENTS AND NEUROPILIN-ANTIBODY COMPLEXES - The invention provides crystal structures of neuropilin 1 (Nrp1) and neuropilin 2 (Nrp2) fragments alone and in complex with anti-neuropilin antibodies, and method for their use. The invention further provides anti-Nrp antibodies and methods for their therapeutic applications. | 06-17-2010 |
20100150920 | System and Method for Identifying Biomarkers in Ocular Fluid That Are Indicative of Ocular Disease - A system and method for testing ocular fluid, such as vitreous fluid. The testing can be used to both determine if an ocular disease is present and to quantify the effectiveness of a treatment for that ocular disease. A sample of ocular fluid is drawn from a patient and tested for the presence of targeted biomarkers and for the level of those biomarkers. The level of the biomarkers in the patients sample is compared to the normal range. If the level of the targeted biomarker falls outside the normal range, an abnormal condition is recognized. The effectiveness of any treatment can be analyzed by repeating the testing process. After a treatment, ocular fluid is again drawn. The biomarker levels can be identified and compared to those taken before treatment began. If the level of the targeted biomarkers trends toward normal, the treatment is known to be effective. | 06-17-2010 |
20100150921 | KID31 And Antibodies That Bind Thereto - The invention provides the identification and characterization of a disease and cancer-associated antigen, KID31. The invention also provides modulators of KID31, including a family of monoclonal antibodies that bind to antigen KID31, and methods of diagnosing and treating various human cancers and diseases with KID31. | 06-17-2010 |
20100150922 | Use of TNF-alpha Inhibitors for Treating a Nerve Disorder Mediated by Nucleus Pulposus - The present invention relates to a method and a pharmaceutical composition for treatment of nerve disorders comprising administration of a therapeutically effective dosage of at least two substances selected from the group consisting of TNF inhibitors, IL-1 inhibitors, IL-6 inhibitors, IL-8 inhibitors, FAS inhibitors, FAS ligand inhibitors, and IFN-gamma inhibitors. Preferably, at least one of the substances is a TNF inhibitor. | 06-17-2010 |
20100158900 | ANTI-MARINOBUFAGENIN ANTIBODIES AND METHODS FOR THEIR USE - Described herein are deposited hybridoma cell lines and the monoclonal antibodies produced by these hybridomas, and antigen binding fragments thereof. These monoclonal antibodies and antigen binding fragments specifically bind marinobufagenin. The disclosure also encompasses the use of these monoclonal antibodies or antigen binding fragments in a method for detecting the presence of marinobufagenin in a biological sample. Also provided are methods for the use of these monoclonal antibodies or antigen binding fragments as prophylactic, therapeutic, and diagnostic agents for the detection, inhibition and treatment of a cardiovascular disease, for example, essential hypertension, hypertension associated with preeclampsia, eclampsia, or renal failure, or myocardial fibrosis in a subject. | 06-24-2010 |
20100158901 | ANTI-CD19 ANTIBODY THERAPY FOR AUTOIMMUNE DISEASE - The invention relates to immunotherapeutic compositions and methods for the treatment of autoimmune diseases and disorders in human subjects using therapeutic antibodies that bind to the human CD19 antigen and that preferably mediate human ADCC. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG1 or IgG3 human isotype. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG2 or IgG4 human isotype that preferably mediate human ADCC. The present invention also relates to pharmaceutical compositions comprising chimerized anti-CD19 antibodies of the IgG1, IgG2, IgG3, or IgG4 isotype that mediate human ADCC. In preferred embodiments, the present invention relates to pharmaceutical compositions comprising monoclonal human, humanized, or chimeric anti-CD19 antibodies. | 06-24-2010 |
20100158902 | MONOCLONAL ANTIBODIES AGAINST STROMAL DERIVED FACTOR-1 (SDF-1) - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to SDF-1 with high affinity. Nucleic acid molecules encoding SDF-1 antibodies, expression vectors, host cells and methods for expressing the SDF-1 antibodies are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the SDF-1 antibodies are also provided. Methods for detecting SDF-1, as well as methods for treating various B cell malignancies, including breast cancer, multiple myeloma and non-Hodgkin's lymphoma, and autoimmune disorders are disclosed. | 06-24-2010 |
20100158903 | METHODS FOR TREATING PROGRESSIVE MULTIPLE SCLEROSIS - The present invention concerns methods for treating progressive multiple sclerosis (MS) in a patient, and an article of manufacture with instructions for such use. | 06-24-2010 |
20100158904 | TREATMENT WITH ANTI-ALPHA2 INTEGRIN ANTIBODIES - The invention relates to treatment of cancer. More specifically the invention relates to methods of treating cancer selected from the group consisting of squamous cell cancer, lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer, as well as B-cell lymphoma including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's Macroglobulinemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema such as that associated with brain tumors, Meigs' syndrome, melanoma, mesothelioma, multiple myeloma, fibrosarcoma, osteosarcoma and epidermoid carcinoma, by administering antibodies directed to α2β1 integrin. | 06-24-2010 |
20100158905 | COMBINATION THERAPY OF ARTHRITIS WITH TRANILAST - Combination therapy is disclosed herein for the treatment an arthritic condition (e.g. rheumatoid arthritis, osteoarthritis or psoriatic arthritis). The therapies disclosed herein comprise administering tranilast or an analogous compound in combination with a pharmaceutical agent, such as a non-steroidal anti-inflammatory drug, a disease-modifying drug, a COX-2 inhibitor, an antibiotic, an analgesic or combination thereof. | 06-24-2010 |
20100158906 | METHODS FOR AUGMENTING AN IMMUNE RESPONSE USING ANTI-CD40 ANTIBODIES - The present invention relates to methods and compositions for the prevention and treatment of cancer, inflammatory diseases and disorders or deficiencies of the immune system. The methods of the invention comprise administering a CD40 binding protein that potentiates the binding of CD40 to CD40 ligand. | 06-24-2010 |
20100158907 | CONNECTIVE TISSUE GROWTH FACTOR FRAGMENTS AND METHODS AND USES THEREOF - The present invention is directed to CTGF fragments comprising at least exon 4 or exon 5 of CTGF and having mitogenic activity. The present invention is further directed to methods using said CTGF fragments to identify compositions which modulate the mitogenic activity of said CTGF fragments and to the compositions so identified. | 06-24-2010 |
20100158908 | Stable Polypeptide Formulations - The invention provides a formulation including a buffer having a pH less than 6.0, a divalent cation between about 5-200 mM, an excipient comprising a sugar or polyol and an effective amount of a therapeutic polypeptide. Also provided is a method of stabilizing a polypeptide. The method includes contacting a therapeutic polypeptide with a concentration of divalent cation between about 5-150 150 mM in a buffer having a pH less than 6.0 and an excipient comprising a sugar or polyol. | 06-24-2010 |
20100166740 | Anti-OX40L antibodies - This invention relates to anti-OX40L antibodies and, in particular, to anti-OX40L antibodies and variants thereof that contain a Fc part derived from human origin and do not bind complement factor C1q. These antibodies have new and inventive properties causing a benefit for a patient suffering from inflammatory diseases. | 07-01-2010 |
20100166741 | ALTERED BR-3 BINDING POLYPEPTIDES - The present invention relates to novel BR3 binding antibodies having altered Fc effector function and/or having a mature core carbohydrate structure in the Fc region which lacks fiicose. The present invention also relates to the use of those BR3 binding antibodies and polypeptides in, e.g., methods of treatment, screening methods, diagnostic methods, assays and protein purification methods. | 07-01-2010 |
20100166742 | METHOD FOR PROMOTING IMMUNOTHERAPIES - The present invention relates to an ex vivo method for increasing the effectiveness of antibodies and Fcγ receptor-binding active ingredients, comprising the steps of: a) preparing a blood sample of a patient; b) subjecting the blood sample to an immunoapheresis; c) administering a therapeutically effective antibody or an Fcγ receptor-binding active ingredient to the patient. | 07-01-2010 |
20100166743 | METHOD OF DETECTING OCULAR DISEASES AND PATHOLOGIC CONDITIONS AND TREATMENT OF SAME - Methods of detecting and treating diseases and pathological conditions of the eye are disclosed. In particular a genetic variant of the HtrA1 gene is correlated to age related macular degeneration (AMD). In addition, biologically active agents capable of inhibiting HtrA1 activity are provided, and methods of treating diseases and pathological conditions of the eye are additionally disclosed. | 07-01-2010 |
20100166744 | USE OF ANTI-EGFR ANTIBODIES IN TREATMENT OF EGFR MUTANT MEDIATED DISEASE - The present invention relates to the treatment of EGFR-mediated disease, particularly cancer, which is resistant to tyrosine kinase inhibitor therapies. Methods for treatment of cancer and reduction of tumor growth in individuals with secondary EGFR mutations, particularly tyrosine kinase domain mutations, resistant to standard therapy are provided. The invention provides methods for the treatment of tyrosine kinase inhibitor resistant cancers with anti-EGFR antibodies. Methods for treatment of recurrent lung cancer, including non-small cell lung carcinoma which is resistant to tyrosine kinase inhibitors, with the antibody anti-EGFR mAb806 are described. | 07-01-2010 |
20100166745 | TRANSFERRIN RECEPTOR ANTIBODIES - The invention provides further characterization of the disease and cancer-associated antigen, transferrin receptor. The invention also provides a novel family of antibodies that bind to the transferrin receptor, methods of diagnosing and treating various human cancers and diseases that express transferrin receptor. | 07-01-2010 |
20100166746 | HIGH POTENCY RECOMBINANT ANTIBODIES, METHODS FOR PRODUCING THEM AND USE IN CANCER THERAPY - The present invention contemplates improved recombinant anti-tumor antibodies having faster Kon and faster Koff rates, resulting in a uniform tumor penetrance, as compared to the same recombinant anti-tumor antibody without said faster Kon and faster Koff rates, and methods of improving the same. | 07-01-2010 |
20100166747 | METHODS AND COMPOSITIONS FOR TREATING TUMOR DISEASES - The present invention provides, in part, methods for treating a tumor in a human subject comprising inhibiting IGF-1 receptor signaling, methods of determining whether a tumor is more or less likely to respond to such treatment, and compositions for practicing such methods. In particular embodiments, the invention provides fully human, humanized, or chimeric anti-IGF-1R antibodies that bind human IGF-1R, IGF-1R-binding fragments and derivatives of such antibodies, and IGF-1R-binding polypeptides comprising such fragments. Other embodiments provide nucleic acids encoding such antibodies, antibody fragments and derivatives and polypeptides, cells comprising such polynucleotides, methods of making such antibodies, antibody fragments and derivatives and polypeptides, and methods of using such antibodies, antibody fragments and derivatives and polypeptides, including methods of treating or diagnosing subjects having IGF-1R-related disorders or conditions. | 07-01-2010 |
20100166748 | C5 Antigens and Uses Thereof - The present invention pertains to the use of a complement inhibitor in methods of treatment of ocular disorders and the use of a complement inhibitor in the manufacture of a medicament in the treatment of an ocular disorder. | 07-01-2010 |
20100166749 | Polypeptide variants with altered effector function - The present invention concerns polypeptides comprising a variant Fc region. More particularly, the present invention concerns Fc region-containing polypeptides that have altered effector function as a consequence of one or more amino acid modifications in the Fc region thereof. | 07-01-2010 |
20100166750 | Indications for Anti-IL-1 Beta Therapy - This invention relates to a novel use of IL-1β-ligand/IL-1 receptor disrupting compounds (herein referred to as “IL-1beta Compounds”); such as small molecular compounds disrupting IL-1β ligand-IL-1 receptor interaction, IL-1β antibodies or IL-1 receptor antibodies, e.g. IL-1β binding molecules described herein, e.g. antibodies disclosed herein, e.g. IL-1β binding compounds or IL-1 receptor binding compounds, and/or RNA compounds decreasing either IL-1β ligands or IL-1 receptor protein levels, in the treatment and/or prevention of auto-inflammatory syndromes, e.g. Juvenile rheumatoid arthritis or adult rheumatoid arthritis syndrome and to methods of treating and/or preventing auto-inflammatory syndromes, e.g. Juvenile rheumatoid arthritis or adult rheumatoid arthritis syndrome, in mammals, particularly humans. | 07-01-2010 |
20100166751 | CANCER THERAPY USING WHOLE GLUCAN PARTICLES AND ANTIBODIES - The present invention relates to methods of using whole glucan particles and complement activating antibodies for antitumor therapy. Whole glucan particles enhance the tumoricidal activity of the innate immune system by binding to the C3 complement protein receptor CR3. This binding enhances innate immune system cytotoxicity, as well as stimulating the release of activating cytokines. | 07-01-2010 |
20100166752 | Anti A Beta Antibody Formulation - The present invention provides formulations for maintaining the stability of Aβ binding polypeptides, for example, Aβ antibodies. Exemplary formulations include a tonicity agent such as mannitol and a buffering agent or amino acid such as histidine. Other exemplary formulations include an antioxidant in a sufficient amount as to inhibit by-product formation, for example, the formation of high molecular weight polypeptide aggregates, low molecular weight polypeptide degradation fragments, and mixtures thereof. The formulations of the invention optionally comprise a tonicity agent, such as mannitol, and a buffering agent or amino acid such as histidine. The formulations are suitable for several different routes of administration. | 07-01-2010 |
20100166753 | HUMANIZED MONOCLONAL ANTIBODIES THAT PROTECT AGAINST SHIGA TOXIN INDUCED DISEASE - The present invention describes the preparation and use of biologically and immunologically active humanized monoclonal antibodies to Shiga toxin, a toxin associated with HC and the potentially life-threatening sequela HUS transmitted by strains of pathogenic bacteria. The present invention describes how these humanized antibodies may be used in the treatment or prevention of Shiga toxin induced diseases. One aspect of the invention is the humanized monoclonal antibody which binds Shiga toxin where the constant regions are IgG1-kappa and the variable regions are murine in origin. Yet another aspect of the invention is expression vectors and host cells transformed with such vectors which express the humanized monoclonal antibodies of the present invention. | 07-01-2010 |
20100166754 | Methods and Compositions For Treating Autoimmune Diseases or Conditions - The present invention relates to methods of treating immune disorders, particularly autoimmune and inflammatory disorders such as rheumatoid arthritis, and methods of producing antibodies for use in therapeutic strategies for treating such disorders. Generally, the present methods involve the use of antibodies that specifically bind to NKG2D receptors present on the surface of cells underlying the disorders. | 07-01-2010 |
20100166755 | ANTI-EGFR ANTIBODIES - The present invention encompasses EGFR specific monoclonal antibodies, or antigen-binding portions thereof. These antibodies, or antigen-binding portions thereof, have high affinity for EGFR, inhibit the activation of EGFR, and are useful for the treatment of EGFR mediated cancers. | 07-01-2010 |
20100172900 | Human Monoclonal Antibodies to BTLA And Methods of Use - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies that specifically bind to BTLA with high affinity. Nucleic acid molecules encoding the antibodies of the disclosure, expression vectors, host cells and methods for expressing the antibodies of the disclosure are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of the disclosure are also provided. The disclosure also provides methods for detecting BTLA, as well as methods for treating various diseases, including cancer and infectious diseases, using anti-BTLA antibodies. | 07-08-2010 |
20100172901 | Polymorphisms in the EGFR Pathway as Markers for Cancer Treatment - The invention provides compositions and methods for identifying patients for single agent anti-EGFR therapy. The methods comprise determining the genomic polymorphism present in a predetermined region of a gene of interest and correlating the polymorphism to the predictive response. Patients identified as responsive are then treated with the appropriate therapy. | 07-08-2010 |
20100172902 | METHOD FOR TREATING A VCAM-1 MEDIATED DISEASE - A method for treating a VCAM-1 mediated disease comprising administering a therapeutically effective amount of a monoclonal antibody to a patient in need thereof. The monoclonal antibody specifically binds to both human and mouse vascular cell adhesion molecule-1 (VCAM-1). The monoclonal antibody comprises(a) a light chain CDR 1 region defined by SEQ ID NO:5, a light chain CDR 2 region defined by SEQ ID NO:6, and a light chain CDR 3 region defined by SEQ ID NO:7, and (b) a heavy chain CDR 1 region defined by SEQ ID NO:8, a heavy chain CDR 2 region defined by SEQ ID NO:.9 or 11, and a heavy chain CDR 3 region defined by SEQ ID NO:10 or 12. | 07-08-2010 |
20100172903 | Combination of an Anti-Ep-CAM Antibody with a Chemotherapeutic Agent - A combination of an anti-Ep-CAM antibody with a chemotherapeutic agent that is capable of arresting Ep-CAM antigen expressing cells in S or G | 07-08-2010 |
20100178290 | Methods for reducing viral load in HIV-1 infected patients - This invention provides a method of reducing viral load in an HIV-1-infected human subject which comprises administering to the subject an effective HIV-1 viral load reducing dose of a CCR5 receptor antagonist, such as a humanized antibody designated PRO 140 or an anti-CCR5 receptor monoclonal antibody, wherein the viral load reducing dose achieves an average maximum decrease of viral load in the subject of at least 1.83 log | 07-15-2010 |
20100178291 | Pyrrolidinone, Pyrrolidine-2, 5-Dione, Pyrrolidine and Thiosuccinimide Derivatives, Compositions and Methods for Treatment of Cancer - The present invention relates to pyrrolidin-2-one, pyrrolidin-2,5-dione, pyrrolidine and thiosucciniroide compounds of formulae (I)-(IV), and methods of preparation of these compounds. The present invention also relates to pharmaceutical compositions comprising pyrrolidin-2-one, pyrrolidin-2,5-dione, pyrrolidine and thiosuccinimide compounds. The present invention provides methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of a compound of pyrrolidin-2-one, pyrrolidin-2,5-dione, pyrrolidine and thiosuccinimide compound of the present invention. | 07-15-2010 |
20100178292 | CRYPTIC GLYCAN MARKERS AND APPLICATIONS THEREOF - The present invention relates to a novel glycan marker of cancer and monoclonal antibodies against it. Furthermore, novel glycan markers and their use in the detection and monitoring of cancerous cells and cancer-associated or specific antibody signatures are described. | 07-15-2010 |
20100183590 | LSA-5 liver stage and blood stage antigen of Plasmodium falciparum, immunogenic composition comprising said antigen, and vaccines against malaria - The present invention pertains to the protection against malaria. More particularly, the invention is based on the characterization of a novel liver and sporozoite-stage | 07-22-2010 |
20100183591 | MODULATION OF NKG2D - The present invention relates to methods and compositions for treating and/or preventing inflammation associated with viral infection and solid organ transplant rejection. In particular, the present invention provides therapeutics for impairing the expansion and function of autoreactive T cells, NK cells and/or NKT cells, by modulating NKG2D. | 07-22-2010 |
20100183592 | HUMAN EPO RECEPTOR AGONISTS, COMPOSITIONS, METHODS AND USES FOR PREVENTING OR TREATING GLUCOSE INTOLERANCE RELATED CONDITIONS - The present invention relates to at least one human EPO receptor agonist methods for preventing or treating glucose intolerance and/or renal disease associated anemia, including therapeutic compositions, methods and devices. | 07-22-2010 |
20100183593 | Gene Polymorphisms Predictive for Dual TKI Therapy - The invention provides compositions and methods for determining the likelihood of successful treatment with dual therapy such as lapatinib. The methods comprise determining the genomic polymorphism or expression level of a gene present in a predetermined region of a gene of interest and correlating the polymorphism or expression level to the predictive response. Patients identified as likely responsive are then treated with the appropriate therapy. | 07-22-2010 |
20100183594 | STEROID-SPARING METHODS OF TREATING BRAIN EDEMA - The present invention relates to therapeutic regimens or protocols designed for the treatment, management or prevention of edema. In particular, the invention pertains to methods of treating or managing edema associated with brain tumors involving the administration of a therapeutically effective amount of corticorelin acetate that achieves a steroid-sparing effect. | 07-22-2010 |
20100183595 | Antibody against secreted N-terminal peptide of GPC3 present in blood or C-terminal peptide of GPC3 - Disclosed is an antibody against a secreted form of GPC3 capable of detecting a secreted form of glypican 3 (GPC3) in a test sample. It is possible to determine whether a subject suffers from cancer, in particular hepatoma. Also disclosed is an antibody against GPC as well as a cell disrupting agent and an anti-cancer agent comprising the same, which can disrupt cells, in particular cancer cells. | 07-22-2010 |
20100183596 | Virulence Factors of Streptoccus Pnuemoniae - The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of | 07-22-2010 |
20100183597 | DRAK2 EXPRESSION IS ASSOCIATED WITH DIABETES - Drak2 is a member of the death-associated protein family and a serine threonine kinase. In this study, we investigated its role in beta-cell survival and diabetes. Drak2 mRNA and protein were rapidly induced in islet beta-cells after stimulation by inflammatory cytokines known to be present in type 1 diabetes. Drak2 upregulation was accompanied by increased beta-cell apoptosis, beta-cell apoptosis caused by the said stimuli was inhibited by Drak2 knockdown using siRNA. Conversely, transgenic (Tg) Drak2 overexpression led to aggravated beta-cell apoptosis triggered by the stimuli. Further in vivo experiments demonstrated that Drak2 overexpressed in Tg islets is responsible for type 1 diabetes-prone phenotype. Purified Drak2 could phosphorylate ribosomal protein S6 (p70S6) kinase in an in vitro kinase assay. Drak2 overexpression in NIT-1 cells led to enhanced p70S6 kinase phosphorylation, while Drak2 knockdown in these cells reduced it. These mechanistic studies proved that p70S6 kinase was a bona fide Drak2 substrate in vitro and in vivo. | 07-22-2010 |
20100183598 | METHODS OF TREATING CARDIOVASCULAR DISORDERS - Disclosed herein, in certain embodiments, is a method for treating a cardiovascular disorder. In some embodiments, the method comprises co-administering an inhibitor of inflammation and an agent used to treat a cardiovascular disorder. | 07-22-2010 |
20100183599 | Methods of treating multiple myeloma and myeloma-induced bone resorption using integrin antagonists - Antagonists of α4 integrin/α4 integrin ligand adhesion, which inhibit the biological effects of such adhesion are described and methods for their use are detailed. Such antagonists are useful in suppressing bone destruction associated with multiple myeloma. The homing of multiple myeloma cells to bone marrow and their α4 integrin-dependent release of bone-resorbing factors, resulting in bone destruction in patients with multiple myeloma, is inhibited. | 07-22-2010 |
20100183600 | RAF Inhibitors and Their Uses - The present invention provides imidazooxazole and imidazothiazole compounds and their syntheses. The compounds of the present invention are capable of inhibiting the activity of RAF kinase, such as B-RAF | 07-22-2010 |
20100183601 | Combination of Aurora Kinase Inhibitors and Anti-CD20 Antibodies - The present invention relates to methods for the treatment of hematological malignancies. In particular, the invention provides methods for treatment of hematological malignancies by administering Aurora kinase inhibitors in combination with anti-CD20 antibodies. | 07-22-2010 |
20100183602 | Induction of Tolerogenic Phenotype in Mature Dendritic Cells - The present invention relates to the use of a CD45 binding molecule to modulate the function of Dendritic cells. In particular the present invention relates to the use of a CD45 binding molecule to induce tolerogenic dendritic cells, useful in the treatment of diseases or disorders such as autoimmune diseases, transplant rejection. | 07-22-2010 |
20100183603 | Compositions and Methods for the Treatment of Cancer - The present invention relates to pyrrolidine-2,5-dione compounds, and methods of preparation of these compounds. The present invention also relates to pharmaceutical compositions comprising pyrrolidine-2,5-dione compounds. The present invention provides methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of a compound or pyrrolidine-2,5-dione compound of the present invention. (Ia) (Ib) (IIa) (IIIb) Where U is independently selected from: (I) or (II) | 07-22-2010 |
20100183604 | PREVENTIVE/REMEDY FOR CANCER - The present invention provides an agent for preventing or treating a trastuzumab-resistant cancer, which contains one or more medicaments selected from a cofilin inhibitor, a PAK1 inhibitor, a LIMK inhibitor, a RHO inhibitor, a ROCK1 inhibitor and a ROCK2 inhibitor. | 07-22-2010 |
20100183605 | TES7 AND ANTIBODIES THAT BIND THERETO - The invention provides the identification and characterization of a disease and cancer-associated antigen, TES7. The invention also provides a family of monoclonal antibodies that bind to antigen TES7, methods of diagnosing and treating various human cancers and diseases with TES7. | 07-22-2010 |
20100183606 | MONOCYCLIC HETEROCYCLES AS KINASE INHIBITORS - The present invention is directed to compounds having the formula | 07-22-2010 |
20100183607 | RISK MARKERS FOR CARDIOVASCULAR DISEASE - Provided herein methods for determining whether a subject, particularly a human subject, is at risk of developing, having, or experiencing a complication of cardiovascular disease, and methods of treating subjects who are identified by the current methods of being at risk for cardiovascular disease. In one embodiment, the method comprises determining levels of one or more oxidized apolipoprotein A-I related biomolecules in a bodily sample from the subject. Also, provided are kits and reagents for use in the present methods. Also provided are methods for monitoring the status of cardiovascular disease in a subject or the effects of therapeutic agents on subjects with cardiovascular disease. Such method comprising determining levels of one or more oxidized apolipoprotein A-I related molecules in bodily samples taken from the subject over time or before and after therapy. | 07-22-2010 |
20100189714 | POLYPEPTIDES WITH ENHANCED ANTI-INFLAMMATORY AND DECREASED CYTOTOXIC PROPERTIES AND RELATING METHODS - The invention provides a polypeptide containing at least one IgG Fc region, wherein said at least one IgG Fc region is glycosylated with at least one galactose moiety connected to a respective terminal sialic acid moiety by a α 2, 6 linkage, and wherein said polypeptide having a higher anti-inflammatory activity as compared to an unpurified antibody. | 07-29-2010 |
20100189715 | HUMANIZED MONOCLONAL ANTIBODIES THAT PROTECT AGAINST SHIGA TOXIN INDUCED DISEASE - The present invention describes the preparation and use of biologically and immunologically active humanized monoclonal antibodies to Shiga toxin, a toxin associated with HC and the potentially life-threatening sequela HUS transmitted by strains of pathogenic bacteria. The present invention describes how these humanized antibodies may be used in the treatment or prevention of Shiga toxin induced diseases. One aspect of the invention is the humanized monoclonal antibody which binds Shiga toxin where the constant regions are IgG1-kappa and the variable regions are murine in origin. Yet another aspect of the invention is expression vectors and host cells transformed with such vectors which express the humanized monoclonal antibodies of the present invention. | 07-29-2010 |
20100189716 | TREATMENT OF HODGKINS LYMPHOMA - Compositions comprising CD80 antagonists and methods using these compositions are provided for the treatment of Hodgkins lymphoma. More particularly, the disclosed CD80 antagonists may be used to induce apoptosis or lysis of Hodgkins Reed-Sternberg (HRS) cells, or to inhibit HRS cell activities that promote tumor development or progression. | 07-29-2010 |
20100189717 | Plant Recombinant Human CTLA4IG and a Method for Producing the Same - The present invention provides a recombinant vector pBI-3D-hGalT or pBI-35S-hGalT containing a human β1,4-galactosyltransferase gene; a cell line transformed with a recombinant vector pMYN414 containing a cytotoxic T-lymphocyte anti-gen A-immunoglobulin (CTLA4Ig) fusion protein gene and the recombinant vector pBI-3D-hGalT or pBI-355-hGalT; and a method for producing a plant-derived recombinant human CTLA4Ig (CTLA4Igp) fusion protein with a human glycan structure using the same. The plant cell-derived recombinant human CTLA4Ig fusion protein (CTLA4Igp), which has a human glycan structure and is produced according to the present invention, exhibits an improved in vivo half life as compared to conventional plant-derived proteins, due to the presence of a human-like glycan structure. Consequently, the present invention using the plant expression system enables low-cost mass production of a CTLA4Igp fusion protein having an immunosuppressive activity comparable to that of the CTLA4IgM fusion protein expressed in conventional animal cell expression systems. | 07-29-2010 |
20100189718 | MOLECULES WITH EXTENDED HALF-LIVES, COMPOSITIONS AND USES THEREOF - The present invention provides molecules, including IgGs, non-IgG immunoglobulins, proteins and non-protein agents, that have increased in vivo half-lives due to the presence of an IgG constant domain, or a portion thereof that binds the FcRn, having one or more amino acid modifications that increase the affinity of the constant domain or fragment for FcRn. Such proteins and molecules with increased half-lives have the advantage that smaller amounts and or less frequent dosing is required in the therapeutic, prophylactic or diagnostic use of such molecules. | 07-29-2010 |
20100189719 | ANTI-VEGF ANTIBODIES - Anti-VEGF antibodies and variants thereof, including those having high affinity for binding to VEGF, are disclosed. Also provided are methods of using phage display technology with naïve libraries to generate and select the anti-VEGF antibodies with desired binding and other biological activities. Further contemplated are uses of the antibodies in research, diagnostic and therapeutic applications. | 07-29-2010 |
20100196358 | METHOD AND KIT TO PROFILE TUMORS BY BIOMARKER ANALYSES INCLUDING TRANSCRIPTIONAL FACTOR ASSAYS - The present invention is related to a method and kit (or device) for the detection and/or the quantification of biomarkers related to tumorigenesis. Said method is advantageously used to propose or adapt an anti-tumoral therapeutic protocol to be administered to a subject. Furthermore, said method and kit (or device) are a technical platform for the identification of new compounds, which are preferably used at (a) specific step(s) of an anti-tumoral therapeutic protocol. | 08-05-2010 |
20100196359 | Human Monoclonal Antibody Human CD134 (Ox40) and Methods of Making and Using Same - The invention provides antibodies that specifically bind to OX40 (CD134), referred to as OX40 antibodies, anti-OX40 or anti-OX40 antibodies. Invention antibodies that specifically bind to OX40 include mammalian (human, primate, etc.), humanized and chimeric anti-OX40 antibodies. Invention antibodies and antibody subsequences (fragments) that specifically bind to OX40 include purified and isolated antibodies, as well as pharmaceutical formulations thereof, are useful in various methods including treatment, screening and detection methods. | 08-05-2010 |
20100196360 | NEUTROKINE-ALPHA AND NEUTROKINE-ALPHA SPLICE VARIANT - The present invention relates to nucleic acid molecules encoding Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides, including soluble forms of the extracellular domain. Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to antibodies or portions thereof that specifically bind Neutrokine-alpha and/or Neutrokine-alphaSV and diagnostic and therapeutic methods using these antibodies. Also provided are diagnostic methods for detecting immune system-related disorders and therapeutic methods for treating immune system-related disorders using the compositions of the invention. | 08-05-2010 |
20100196361 | Method of inhibition of vascular development using an antibody - Tie1 and Tie2 are receptor tyrosine kinase proteins that include a transmembrane domain. Tie1 and Tie2 are present on endothelial cells. This disclosure describes agents, such as antibodies, that bind to Tie1, Tie2, and Ang, including ones that inhibit endothelial cell activity and angiogenesis. The agents can be used to treat angiogenesis-associated disorders. | 08-05-2010 |
20100196362 | Engineering Fc Antibody Regions to Confer Effector Function - The present invention relates to molecules having a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region. These modified molecules confer an effector function to a molecule, where the parent molecule does not detectably exhibit this effector function. In particular, the molecules of the invention have an increased effector cell function mediated by a FcγR, such as, but not limited to, ADCC. In one embodiment, the variant Fc region binds FcγRIIIA and/or FcγRIIA with a greater affinity, relative to a comparable molecule comprising the wild-type Fc region. The molecules of the invention have particular utility in treatment, prevention or management of a disease or disorder, such as cancer, in a sub-population of patients, wherein the target antigen is expressed at low levels in the target cell population, in particular, in patients refractory to treatment with an existing therapeutic antibody due to the low level of target antigen expression on the cancer or associated cells. | 08-05-2010 |
20100196363 | CANCER TREATMENT COMBINATION THERAPY COMPRISING VINFLUNINE AND TRASTUZUMAB - The present invention relates to a therapeutic method for the treatment of cancer that comprises the use of a combination comprising vinflunine and trastuzumab. | 08-05-2010 |
20100196364 | MONOCLONAL ANTIBODIES TO FIBROBLAST GROWTH FACTOR RECEPTOR 2 - The present invention is directed toward a monoclonal antibody to fibroblast growth factor receptor 2, a pharmaceutical composition comprising same, and methods of treatment comprising administering such a pharmaceutical composition to a patient. | 08-05-2010 |
20100196365 | USE OF IMIDAZOQUINOLINES FOR THE TREATMENT OF EGFR DEPENDENT DISEASES OR DISEASES THAT HAVE ACQUIRED RESISTANCE TO AGENTS THAT TARGET EGFR FAMILY MEMBERS - The present invention relates to the use of compounds of formula (I) | 08-05-2010 |
20100196366 | Gefitnib Sensitivity-Related Gene Expression and Products and Methods Related Thereto - Disclosed is the identification, provision and use of a panel of biomarkers that predict sensitivity or resistance to EGFR inhibitors, and products and processes related thereto. In one embodiment, a method is described for selecting a cancer patient who is predicted to benefit from therapeutic administration of an EGFR inhibitor, an agonist thereof, or a drug having substantially similar biological activity as EGFR inhibitor. Also described is a method to identify molecules that interact with the EGFR pathway to allow or enhance responsiveness to EGFR inhibitors, as well as a plurality of polynucleotides or antibodies for detection of the expression of genes that are indicative of sensitivity or resistance to EGFR inhibitors, an agonist thereof, or a drug having substantially similar biological activity as EGFR inhibitors. A method to identify a compound with the potential to enhance the efficacy of EGFR inhibitors is also described. | 08-05-2010 |
20100196367 | Methods For Screening Candidate Agents For Modulating Prorenin And Renin, Assays for Detecting Prorenin And Antibodies - The present invention relates to antibodies that bind to prorenin. In particular, the invention relates to monoclonal antibodies that bind to prorenin and inhibit the activation of prorenin. The antibodies of the invention are useful for screening for candidate agents that inhibit the activation of prorenin and candidate agents the modulate the activity of renin. The antibodies are also useful as diagnostics and for treating disease states. | 08-05-2010 |
20100196368 | SUBSTITUTED BENZ-AZOLES AND METHODS OF THEIR USE AS INHIBITORS OF RAF KINASE - New substituted benz-azole compounds, compositions and methods of inhibition of Raf kinase activity in a human or animal subject are provided. The new compounds compositions may be used either alone or in combination with at least one additional agent for the treatment of a Raf kinase mediated disorder, such as cancer. | 08-05-2010 |
20100196369 | METHODS FOR TREATMENT OF FOLLICULAR LYMPHOMA USING 3-(4-AMINO-1-OXO-1,3-DIHYDROISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE - Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 08-05-2010 |
20100203040 | Genetic Products Which are Differentially Expressed in Tumors and Use Thereof - The invention relates to the identification of genetic products expressed in association with tumours and to coding nucleic acids for said products. The invention also relates to the therapy and diagnosis of diseases in which the genetic products are aberrantly expressed in association with tumours, proteins, polypeptides and peptides which are expressed in association with tumours and to the coding nucleic acids for said proteins, polypeptides and peptides. | 08-12-2010 |
20100203041 | ANTIBODIES TO EGFL7 AND METHODS FOR THEIR USE - The invention provides anti-EGFL7 antibodies, and compositions comprising and methods of using these antibodies. | 08-12-2010 |
20100203042 | RECOMBINANT ANTI-VLA4 ANTIBODY MOLECULES - The present invention disclosed recombinant anti-VLA-4 antibody molecules, including humanized recombinant anti-VLA-4 antibody molecules. These antibodies are useful in the treatment of specific and non-specific inflammation, including asthma and inflammatory bowel disease. In addition, the humanized recombinant anti-VLA-4 antibodies disclosed can be useful in methods of diagnosing and localizing sites of inflammation. | 08-12-2010 |
20100203043 | TREATMENT AND DIAGNOSIS OF METASTATIC PROSTATE CANCER WITH INHIBITORS OF EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) - The present invention relates to a method for the treatment, prevention and/or diagnosis of metastatic prostate cancer. More specifically inhibitors of Epidermal Growth Factor Receptor (EGFR) are used in the preparation of a pharmaceutical composition for treating or preventing metastatic prostate cancer. The EGFR inhibitors can for instance be EGFR inhibitors, EGFR signaling inhibitors and/or inhibitors of kinases downstream of EGFR kinases. The EGFR inhibitors can also be used in detection, screening, prediction and treatment monitoring methods for metastatic prostate cancer. | 08-12-2010 |
20100203044 | DR6 ANTAGONISTS AND USES THEREOF IN TREATING NEUROLOGICAL DISORDERS - Methods and compositions comprising DR6 antagonists for use in treating neurological disorders, including Alzheimer's disease, are provided. The DR6 antagonists include anti-APP antibodies, anti-DR6 antibodies, DR6 immunoadhesins and DR6 variants (and fusion proteins thereof) which enhance growth, regeneration or survival of mammalian neuronal cells or tissue. | 08-12-2010 |
20100203045 | EPH RECEPTOR Fc VARIANTS WITH ENHANCED ANTIBODY DEPENDENT CELL-MEDIATED CYTOTOXICITY ACTIVITY - The present invention relates to novel Fc variants that immuno-specifically bind to an Eph receptor. The Fc variants comprise a binding region that immunospecifically binds to an Eph receptor and an Fc region that further comprises at least one novel amino acid residue which may provide for enhanced effector function. More specifically, this invention provides Fc variants that have modified binding affinity to one or more Fc ligand (e.g., FcγR, C1q). Additionally, the Fc variants have altered antibody-dependent cell-mediated cytotoxicity (ADCC) and/or complement dependent cytotoxicity (CDC) activity. The invention further provides methods and protocols for the application of said Fc variants that immunospecifically bind to an Eph receptor, particularly for therapeutic purposes. | 08-12-2010 |
20100203046 | FC GAMMA RECEPTOR-BINDING POLYPEPTIDE VARIANTS AND METHODS RELATED THERETO - The compositions and methods of the present invention are based, in part, on our discovery that an effector function mediated by an Fc-containing polypeptide can be altered by modifying one or more amino acid residues within the polypeptide (by, for example, electrostatic optimization). The polypeptides that can be generated according to the methods of the invention are highly variable, and they can include antibodies and fusion proteins that contain an Fc region or a biologically active portion thereof. | 08-12-2010 |
20100203047 | Novel Compositions And Methods For Stimulating Erythropoiesis In A Mammal - The present invention relates to compositions comprising an agent which activates herpes virus entry mediator (HVEM). The present invention also relates to compositions comprising an agonist of HVEM. The present invention also relates to methods of stimulating erythropoiesis in a mammal, comprising administering to a mammal a composition comprising an agent which activates HVEM, or is an agonist of HVEM. The present invention also relates to methods for treating an anemic disorder, comprising administering to a mammal suffering therefrom an agent which activates HVEM. | 08-12-2010 |
20100203048 | METHODS OF USING CORTICOTROPIN-RELEASING FACTOR FOR THE USE OF THE TREATMENT OF CANCER - Provided herein is a method for treating cancer in a human by administering a high dose of corticotropin-releasing factor (CRF). | 08-12-2010 |
20100203049 | Interleukin-10 Antibodies - The methods and compositions provided herein relate generally to IL-10 specific antibodies and uses thereof. More specifically, compositions of humanized IL-10 specific antibodies and methods to use such antibodies in modulating the biological activity of IL-10, particularly in autoimmune disorders and pathogen-mediated immunopathology. | 08-12-2010 |
20100209417 | Antibody Treatment of Alzheimer's and Related Diseases - Provided is an antibody that selectively binds to an epitope formed by residues 1-11 of Aβ in an Aβ oligomer, a method comprising using the antibody to treat a disease characterized by such an Aβ amyloid deposit in a patient, and kits comprising same. | 08-19-2010 |
20100209419 | Method and formulation for treating adverse biological conditions - A method for treatment of adverse biological conditions is provided, wherein a biologically active agent such as a macromolecular biomolecule, e.g., a nucleic acid or a peptidic compound, is administered to a subject in need of such treatment in a formulation containing a transport enhancer having the structure of formula (I) | 08-19-2010 |
20100209420 | METHODS OF TREATING CANCER USING PYRIDOPYRIMIDINONE INHIBITORS OF P13K ALPHA - The present invention provides methods of treating cancer by administering a compound of Formula I, optionally as a pharmaceutically acceptable salt, solvate and/or hydrate thereof, in combination with other cancer treatments. | 08-19-2010 |
20100209421 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the certain embodiments, the method of inhibiting expression of PAX2 is to administrate the subject a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 or by increasing expression of DEFB1 is also provided. | 08-19-2010 |
20100209422 | ANTIBODIES SPECIFIC FOR THE PROTOFIBRIL FORM OF BETA-AMYLOID PROTEIN - Isolated antibodies have been characterized which show specific affinity to a repeating conformational epitope of a protofibril form of the human β-amyloid peptide as compare to low molecular weight forms of β-amyloid peptide. These isolated antibodies and related pharmaceutically effective compositions may be useful in the therapeutic and/or prophylactic treatment of Alzheimer's disease by effectively blocking the ability of the protofibril form of β-amyloid peptide to form fibril forms linked with complications associated with Alzheimer's disease. The isolated antibodies of the present invention are also useful in various diagnostic assays and associated kits. | 08-19-2010 |
20100215648 | Detecting Agent and Therapeutic Agent for Highly Malignant Breast Cancer - The detection agent for high malignancy breast cancer of the present invention includes an antibody against collagen XIV, or a variant or derivative or fragment of the antibody. The therapeutic agent for high malignancy breast cancer of the present invention includes a conjugate of an anticancer drug and an antibody against that protein, or a variant or derivative or fragment thereof. According to the present invention, it is possible to easily and accurately detect and diagnose high malignancy breast cancer. | 08-26-2010 |
20100215649 | ANTIBODIES FOR NOROVIRUS - Norovirus antigen peptides are described having an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-16, or fragments thereof. Such peptides can be used in the preparation of antiviral therapies such as vaccines, methods of preparing antibodies to the antigen peptides, methods of using the peptides or the corresponding antibodies for detection of norovirus, and compositions of the peptides, DNA and/or antibodies. A kit for the detection of norovirus is also provided. | 08-26-2010 |
20100215650 | METHODS OF TREATING DEMENTIA USING A GM-CSF ANTAGONIST - The invention is based on the discovery that GM-CSF antagonists can be used for the treatment of a patient that has Alzheimer's disease or vascular dementia, or is at risk for developing Alzheimer's disease. Accordingly, the invention provides methods of administering a GM-CSF antagonist, e.g., a GM-CSF antibody and pharmaceutical compositions comprising such antagonists. | 08-26-2010 |
20100215651 | Humanized antibodies that bind to CD19 and their uses - The present invention relates to humanized antibodies or fragments thereof that bind to human CD19. More specifically, the present invention relates to a humanized antibody or fragment thereof that binds to human CD19 comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 27, and/or a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 29; and/or comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 31 and/or a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32. | 08-26-2010 |
20100215652 | NICOTINAMIDE DERIVATES USEFUL AS P38 INHIBITORS - Compounds of formula (I): | 08-26-2010 |
20100215653 | METHODS OF TREATING NEOPLASTIC, AUTOIMMUNE AND INFLAMMATORY DISEASES - Methods of treating cancer and autoimmune and inflammatory diseases are provided. | 08-26-2010 |
20100215654 | Methods of treating Osteoarthritis with IL-6 Antagonists - The present invention provides for methods of treating osteoarthritis with IL-6 antagonists such as IL-6 antibodies. | 08-26-2010 |
20100215655 | ANGIOGENESIS-INHIBITING CHIMERIC PROTEINS AND THE USE - The present invention is directed to DNA sequence encoding angionenesis-inhibiting recombinant chimeric protein, the chimeric protein per se, the pharmaceutical use of the chimeric protein, and to the pharmaceutical composition containing the recombinant protein and the formulation thereof. | 08-26-2010 |
20100221243 | METHODS AND COMPOSITIONS FOR THE TREATMENT AND DIAGNOSIS OF DISEASES CHARACTERIZED BY VASCULAR LEAK, HYPOTENSION, OR A PROCOAGULANT STATE - Disclosed herein are methods for treating a vascular leak disorder, hypotension, or a procoagulant state using angiopoietin-2 (Ang-2) antagonist compounds. Also disclosed are methods for treating a vascular leak disorder associated with high dose IL-2 therapy using angiopoietin-2 antagonist compounds. Methods for diagnosing and monitoring vascular leak disorders, hypotension, or a procoagulant state that include the measurement of Ang-2 polypeptide or nucleic acid levels are also disclosed. Methods for inducing a vascular leak using an Ang-2 agonist are also disclosed. | 09-02-2010 |
20100221244 | ANTAGONIZING SIGNAL TRANSDUCTION IN DORSAL ROOT GANGLION CELLS IN A SUBJECT WITH IL-31 ANTAGONISTS - Use of antagonists to IL-31 are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 09-02-2010 |
20100221245 | TOPICAL SKIN CARE COMPOSITION - The present invention is directed to a topical skin care composition. The composition has the unique ability to treat acne without drying out the user's skin. In particular, the composition includes a base, an antibacterial agent, at least one anti-inflammatory agent, and at least one antioxidant. The antibacterial agent may be benzoyl peroxide. | 09-02-2010 |
20100221246 | METHODS AND COMPOSITIONS FOR TREATING CANCER - The present invention provides methods of treating cancer using 2-amino-6-trifluoromethoxybenzothiazole (riluzole). In one aspect, the present invention provides methods of reducing cancer cell growth. In another aspect, the present invention provides a method of inducing apoptosis in a cancer cell. In another aspect, the present invention provides a method of reducing the growth of a glutamate-releasing tumor. | 09-02-2010 |
20100221247 | AGENTS AND METHODS FOR TREATMENT OF CANCER - The present application describes compositions that are useful for the treatment, prevention and/or amelioration of cancer. | 09-02-2010 |
20100221248 | Directed Engagement of Activating Fc Receptors - The present invention features engineered proteins that include a first polypeptide that specifically binds a first target (e.g., a cellular target, such as a cell-surface antigen) and a second polypeptide that selectively binds an activating FcR. | 09-02-2010 |
20100221249 | WISP POLYPEPTIDES AND NUCLEIC ACIDS ENCODING SAME - Wnt-1-Induced Secreted Proteins (WISPs) are provided, whose genes are induced at least by Wnt-1. Also provided are nucleic acid molecules encoding those polypeptides, as well as vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides, and methods for producing the polypeptides. | 09-02-2010 |
20100221250 | METHODS OF TREATING BRAIN TUMORS WITH ANTIBODIES - The application is directed toward a method of treating a brain tumor in a patient comprising systemically administering a monoclonal antibody. | 09-02-2010 |
20100221251 | Compositions and Methods for Treatment of Cancer - The present invention relates to pyrroloquinolinyl-pyrrole-2,5-dione compounds and pyrroloquinolinyl-pyrrolidine-2,5-dione compounds, and methods of preparation of these compounds. The present invention also relates to pharmaceutical compositions comprising pyrroloquinolinyl-pyrrole-2,5-dione compounds and pyrroloquinolinyl-pyrrolidine-2,5-dione compounds. The present invention provides methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of a pyrroloquinolinyl-pyrrole-2,5-dione compound or pyrroloquinolinyl-pyrrolidine-2,5-dione compound of the present invention. | 09-02-2010 |
20100226915 | AGER-Peptides and Use Thereof - The present invention relates to the identification, functionality and use of domains from the N terminus of the receptor for Advanced Glycation End Products (AGER). These domains, called receptor mulitimerization epitope (RME), are highly conserved in all AGER protein sequences. They represent the mediators for AGER self-association and heteromerization with other proteins. The invention likewise relates to the identification, functionality and use of peptides derived from the C domain of AGER (AGER-CDP). The AGER RMEs and AGER-CDPs of the invention are suitable as target for identifying AGER ligands which modulate the natural ligand interaction; as immunogen for active or passive immunization of individuals, as diagnostic means for identifying immunogenic reactions, and as peptide ligands for modulating protein-protein interactions involving AGER. | 09-09-2010 |
20100226916 | COMPOSITIONS AND METHODS FOR TREATING OCULAR DISEASES AND CONDITIONS - The present invention relates to compositions and methods for prevention and treatment of diseases and conditions, particularly ocular diseases and conditions, characterized by aberrant fibrogenesis or scarring, inflammation, and/or aberrant neovascularization or angiogenesis. The compositions and methods of the invention utilize immune-derived moieties that are specifically reactive against the bioactive lipid, sphingosine-1-phosphate, and its variants, which moieties are capable of decreasing the effective concentration of bioactive lipid being targeted. In one embodiment, the immune-derived moiety is a humanized monoclonal antibody that is reactive against sphingosine-1-phosphate. | 09-09-2010 |
20100226917 | METHODS FOR THE TREATMENT OF HEMATOLOGIC MALIGNANCIES - The present invention discloses, in part, therapies for treating hematologic malignancies, including B cell lymphomas and leukemias or B cell related tumors comprising the administration of a CHK1 inhibitor in combination with a B cell depleting antibody. The present invention further includes treating hematologic malignancies, including B cell lymphomas and leukemias, or B cell related tumors, which are resistant to cancer treatment comprising the administration of a CHK1 inhibitor. | 09-09-2010 |
20100226918 | PYRROLE DERIVATIVES AS P2Y12 ANTAGONISTS - The present invention relates to compounds of the formula I, | 09-09-2010 |
20100226919 | Antitumoral Treatments - The present invention relates to combinations of PM02734 with EGFR tyrosine kinase inhibitors, and the use of these combinations in the treatment of cancer. | 09-09-2010 |
20100233159 | METHODS OF TREATING STROKE - Methods and compositions for treating stroke are disclosed. | 09-16-2010 |
20100233160 | Monoclonal Anti-Annexin A3 Antibodies for the Detection of Prostate Carcinoma - The present invention relates to a method for the diagnosis of prostate carcinoma comprising the determination of annexin A3, particularly of extracellular annexin A3 with highly specific antibodies, particularly with monoclonal antibodies. The present invention further refers to a test reagent comprising such antibodies. | 09-16-2010 |
20100233161 | NOVEL MULTIFUNCTIONAL COMPOUNDS FOR PHARMACEUTICAL PURPOSES - The invention relates to a synthetic bifunctional non-antibody compound comprising one or more effector moieties and one or more binder moieties, wherein the effector moieties are operably linked to the binder moieties via a linker, the effector moieties are ligands to at least one pathogen pattern recognition receptor (PRR) and the binder moieties bind to a marker of a tumor cell. | 09-16-2010 |
20100233162 | LOCAL ADMINISTRATION OF CHICKEN YOLK IMMUNE GLOBULINS (IgY) TO TREAT AND PREVENT FUNGAL INFECTIONS - The present invention relates to a composition comprising IgY antibodies against at least two different fungi, the use of the composition for the preparation of a pharmaceutical especially for prophylaxis and/or therapy of all kinds of fungal infections, such as conditions caused by organisms belonging to the | 09-16-2010 |
20100233164 | COMBINATIONS OF PHOSPHOINOSITIDE 3-KINASE INHIBITOR COMPOUNDS AND CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF HEMATOPOIETIC MALIGNANCIES - Combinations of PI3K inhibitor compounds having Formula I and chemotherapeutic agents, including stereoisomers, geometric isomers, tautomers, metabolites and pharmaceutically acceptable salts thereof, are useful for treating hematopoietic malignancies. Methods of using such combinations for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions, are disclosed. | 09-16-2010 |
20100233165 | INTERNALIZING HUMAN MONOCLONAL ANTIBODIES TARGETING PROSTATE CANCER CELLS IN SITU - This invention provides a method that allows selection of antibodies against cells (e.g., tumor cells) in situ using laser capture microdissection. By restricting antibody selection to binders of internalizing epitopes, a panel of phage antibodies was generated that targets clinically represented prostate cancer antigens. | 09-16-2010 |
20100233166 | NOVEL IDO INHIBITORS AND METHODS OF USE - Compounds, compositions and methods for the treatment of malignancy are disclosed. | 09-16-2010 |
20100239571 | CD30 Binding Agents and Uses Thereof - This invention relates to CD30 binding agents and methods of using such binding agents for treating disease characterized by expression of CD30 antigen. | 09-23-2010 |
20100239572 | METHODS FOR TREATING AND PREVENTING GI SYNDROME AND GRAFT VERSUS HOST DISEASE - We have discovered that administering anti-ceramide antibody treats and prevents an array of diseases mediated by cytolytic T lymphocyte (CTLs)-induced killing and by damage to endothelial microvasculture, including radiation-induced GI syndrome, Graft vs. Host diseases, inflammatory diseases and autoimmune diseases. We have also discovered new anti-ceramide monoclonal antibodies, that have therapeutic use preferably in humanized form to treat or prevent these diseases. | 09-23-2010 |
20100239573 | METHOD OF INHIBITING COMPLEMENT ACTIVATION WITH FACTOR Bb SPECIFIC ANTIBODIES - A process of inhibiting the adverse effects of alternative complement pathway activation products in a subject includes administering to the subject an amount of anti-factor Bb antibody effective to selectively inhibit formation of an alternative complement pathway activation products C3a, C5a, and C5b-9, and activation of neutrophils, monocytes, and platelets. | 09-23-2010 |
20100239574 | HIGH POTENCY RECOMBINANT ANTIBODIES AND METHOD FOR PRODUCING THEM - High potency antibodies, including immunologically active fragments thereof, having high kinetic association rate constants and optional high affinities are disclosed, along with methods for producing such antibodies. The high potency antibodies disclosed herein are of either the neutralizing or non-neutralizing type and have specificity for antigens displayed by microorganisms, especially viruses, as well as antigenic sites present on cancer cells and on various types of toxins, and the products of toxins. Processes for producing high potency neutralizing antibodies and increasing the potency of already existing neutralizing antibodies are also described. Methods of using said antibodies in the prevention and/or treatment of diseases, especially diseases induced or caused by viruses, are disclosed. | 09-23-2010 |
20100239575 | ANTI-CD40 ANTIBODIES AND USES THEREOF - The present invention includes compositions and methods for the expression, secretion and use of novel compositions for use as, e.g., vaccines and antigen delivery vectors, to delivery antigens to antigen presenting cells. In one embodiment, the vector is an anti-CD40 antibody, or fragments thereof, and one or more antigenic peptides linked to the anti-CD40 antibody or fragments thereof, including humanized antibodies. | 09-23-2010 |
20100239576 | AMINO ESTER DERIVATIVES, SAILTS THEREOF AND METHODS OF USE - The present invention provides amino ester compounds, salts, and pharmaceutical formulations thereof useful in modulating the protein tyrosine kinase activity, and in modulating inter- and/or intra-cellular signaling. The invention also provides pharmaceutically acceptable compositions comprising such compounds and methods of using the compositions in the treatment of hyperproliferative disorders in mammals, especially humans. | 09-23-2010 |
20100239577 | ANTI-GLYPICAN-3 ANTIBODY HAVING IMPROVED KINETICS IN PLASMA - A method of modulating the plasma half-life of anti-glypican 3 antibody, a pharmaceutical composition comprising as an active ingredient the anti-glypican 3 antibody that has a plasma half-life that has been modulated, a method of preparing the anti-glypican 3 antibody and a pharmaceutical composition comprising the anti-glypican 3 antibody as an active ingredient are provided. Disclosed is a method of modulating the plasma half-life of anti-glypican 3 antibody by modifying an amino acid residue that is exposed on the surface of the anti-glypican 3 antibody; and anti-glypican 3 antibody that has a plasma half-life that has been modulated by amino acid residue modification, a pharmaceutical composition comprising as an active ingredient the anti-glypican 3 antibody, and a method of preparing the anti-glypican 3 antibody and producing a pharmaceutical composition comprising the anti-glypican 3 antibody as an active ingredient. | 09-23-2010 |
20100247523 | Subtypes of humanized antibody against interleuken-6 receptor - As a subtype of humanized PM-1 antibody against interleukin-6 receptor (IL-6R), there is provided antibody sub-type (1) whose one heavy chain C terminus consists of Pro-NH | 09-30-2010 |
20100247524 | Methods for treating Chronic Obstructive Pulmonary Disease - The present invention provides methods of treating a mammal having chronic obstructive pulmonary disease (COPD), independent of both smoking status and asthma status/with a therapeutically effective amount of an anti-IgE Ênoiety. In accordance with the invention, COFD patients with an elevated serum IgE level may benefit from the treatment methods disclosed. In certain instances, the methods of the disclosure have been found, to be useful ioÊ the treatment of COPD patients regardless of their skin test results arid/or in vitro reactivity to a perennial aeroalleigen. Anti-EgE moieties, in accordance With the invention, include but are not limited to any IgG antibody that selectively binds to a given mammal iirunuitoglobulln E (e.g., human imntnnoglQbulin E) such as humanized arrti-IgEy hmuanized murine monoclonal antibody, and/or Qmalizumab. | 09-30-2010 |
20100247525 | COMPOSITIONS AND METHODS FOR TREATING ANTHRAX LETHALITY - The present invention provides compositions and methods for preventing and inhibiting anthrax lethality. The present invention relates to protect a subject from anthrax lethality by presensitizing a subject prior to anthrax infection. The present invention further provides compositions and methods for enhancing the innate system to inhibit anthrax-associated lethality. The invention further provides compositions and methods for preventing and inhibiting lethality due to infection regulated via a TNF-α pathway. | 09-30-2010 |
20100247526 | Anti-NKG2A Antibodies and Uses Thereof - Described herein are anti-NKG2A antibodies suitable for human therapy, including humanized versions of murine anti-NKG2A antibody Z270, as well as related methods and materials for producing and using such antibodies. Exemplary complementarity-determining regions (CDRs) sequences and sites for optional amino acid back-substitutions in framework region (FR) and/or CDRs of such antibodies are also described. | 09-30-2010 |
20100247527 | COMPOSITION AND METHOD FOR TREATMENT OF AUTOIMMUNE DISEASE - The present invention provides compositions and methods for the treatment of autoimmune diseases, in particular rheumatoid arthritis. Compounds which function as antagonists of Toll-like Receptor 2 are shown to suppress the immune response which result in the onset and progression of autoimmune disease. In particular monoclonal antibodies which have a binding specificity to Toll-like receptor 2 are disclosed for use in methods for the treatment and/or prophylaxis of autoimmune disease. | 09-30-2010 |
20100247528 | ARRAYS, KITS AND CANCER CHARACTERIZATION METHODS - The invention provides an array comprising a substrate and a set of addressable elements, wherein each addressable element comprises (i) a polynucleotide that specifically binds to a target molecule, (ii) a polypeptide that specifically binds to target molecule, or (iii) a combination of (i) and (ii), wherein the target molecule is selected from the group of cancer-related target molecules as defined herein. Related kits, methods, and uses as described herein are further provided by the invention. | 09-30-2010 |
20100247529 | COOPERATIVE AND DYNAMIC ASSEMBLY OF AFFINITY COMPLEXES - The invention generally relates to the field of immunochemistry including antibody therapy, diagnostics, and basic research and specifically relates to the area of alternatives to natural antibodies including artificial antibodies or antibody mimics. The invention relates particularly to the cooperative assembly of stable affinity complexes. | 09-30-2010 |
20100247530 | COMPOSITIONS AND METHODS FOR PREVENTING AND TREATING PRESBYCUSIS - The present invention provides compositions and methods for preventing and treating presbycusis. In particular, the present invention provides compositions and methods for preventing and treating presbycusis by inhibiting Bak. | 09-30-2010 |
20100247531 | ANTI-FGFR3 ANTIBODIES AND METHODS USING SAME - The invention provides FGFR3 antibodies, and compositions comprising and methods of using these antibodies. | 09-30-2010 |
20100247532 | HUMANIZED ANTI-VENEZUELAN EQUINE ENCEPHALITIS VIRUS RECOMBINANT ANTIBODIES - A CDR grafted humanized recombinant antibody against infection from Venezuelan equine encephalitis virus (VEEV) comprises a human Ig framework having CDRs from murine mAb 1A4A1 VH and VL. DNA sequences, expression vectors incorporating such sequences and transformed host cells are also provided. Also provided are pharmaceutical compositions and methods of prophylaxis and treatment against VEEV infection using the humanized recombinant antibodies of the invention. | 09-30-2010 |
20100247533 | TREATMENT WITH A HUMANIZED ANTI-EGFR IgG1 ANTIBODY AND IRINOTECAN - The present invention provides a humanized anti-EGFR IgG1 antibody and irinotecan for combined use in treating cancer, with or without additional agents or treatments, such as other anti-cancer drugs or radiation therapy. The invention also encompasses a pharmaceutical composition that is comprised of a combination of a humanized anti-EGFR IgG1 antibody and irinotecan in a pharmaceutically acceptable carrier, and methods for the treatment of cancer comprising administering both irinotecan and a humanized anti-EGFR IgG1 antibody. | 09-30-2010 |
20100247534 | FUSED HETEROCYCLIC COMPOUNDS AS INHIBITORS OF POTASSIUM CHANNEL FUNCTION - A compound of formula I | 09-30-2010 |
20100254977 | ENGINEERED ANTI-ALPHA V-INTEGRIN HYBRID ANTIBODIES - The invention relates to engineered antibodies which specifically bind to integrin receptors, especially the alpha V integrin receptor subunit. The antibodies comprise the antigen binding sites (CDRs) of a known mouse anti-integrin antibody, as well as hybrid light chain variable sequences, mutated heavy chain variable sequences (Frs) and modified heavy chain constant sequences. The novel antibodies have improved immunogenic and expression properties and elicit excellent anti-angiogenic as well as anti-tumor activities in humans in monotherapy but also and above all in combination with other angiogenesis and tumor inhibiting agents. | 10-07-2010 |
20100254978 | ANTIBODY MOLECULES HAVING SPECIFICITY FOR HUMAN OX40 - The invention relates to antibody molecules having specificity for antigenic determinants of human OX40, therapeutic uses of the antibody molecules and methods for producing said antibody molecules. | 10-07-2010 |
20100254979 | Humanized PAI-1 Antibodies and Uses Thereof - The present application relates to compositions of humanized anti-PAI-1 antibodies and antigen-binding fragments thereof which convert PAI-1 to its latent form. One aspect relates to antibodies having one or more modifications in at least one amino acid residue of at least one of the framework regions of the variable heavy chain, the variable light chain or both. Another aspect relates to antibodies which bind and neutralize PAI-1 by converting PAI-1 to its latent form or increasing proteolytic cleavage. Another aspect relates to the use of humanized antibodies which inhibit or neutralize PAI-1 for the detection, diagnosis or treatment of a disease or condition associated with PAI-1 or a combination thereof. | 10-07-2010 |
20100254980 | MOLECULES AND METHODS FOR MODULATING LOW-DENSITY-LIPOPROTEIN RECEPTOR-RELATED PROTEIN 6 (LRP6) - The invention discloses LRP6 agonizing or antagonizing binding molecules (e.g., antibodies or a Fab fragments), and their use to facilitate or inhibit Wnt pathway signaling, respectively. Said LRP6 agonizing or antagonizing binding molecules can be used to e.g., diagnose, ameliorate the symptoms of, protect against, and treat Wnt signaling disorders associated with aberrantly low or aberrantly high levels of Wnt pathway signaling, respectively. Non-limiting examples of disorders which can be treated associated with aberrant upregulation of Wnt signaling is cancer (e.g., colon cancer). Non-limiting examples of disorders which can be diagnosed, protected against, and treated include cancers, bone disorders (e.g., osteoporosis and osteoarthritis), diabetes, neurodegenerative diseases such as Alzheimer's disease, and fibrotic disorders. | 10-07-2010 |
20100254981 | Secreted/Cell Bound Poxvirus Proteins and Methods of Use Thereof as Vaccines and Anti-Viral Agents - Compositions and methods for the treatment and prevention of pox virus infections are disclosed. | 10-07-2010 |
20100260749 | Modulators of EphA2 and Ephrin-A1 for the treatment of fibrosis-related disease - The present invention relates to methods and compositions designed for the treatment, management, prevention and/or amelioration of non-neoplastic hyperproliferative epithelial and/or endothelial cell disorders, including but not limited to disorders associated with increased deposition of extracellular matrix components (e.g., collagen, proteoglycans, tenascin and fibronectin) and/or aberrant angiogenesis. Non-limiting examples of such disorders include cirrhosis, fibrosis (e.g., fibrosis of the liver, kidney, lungs, heart, retina and other viscera), asthma, ischemia, atherosclerosis, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, macular degeneration, rheumatoid arthritis, osteoarthritis, infantile hemangioma, verruca vulgaris, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, ankylosing spondylitis, systemic lupus, Reiter's syndrome, Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis, coronary artery disease, psoriatic arthropathy and psoriasis. The methods of the invention comprise the administration of an effective amount of one or more agents that are modulators of EphA2 and/or its endogenous ligand, EphrinA1. The invention also provides pharmaceutical compositions comprising one or more EphA2/EphrinA1 Modulators of the invention either alone or in combination with one or more other agents useful for therapy for such non-neoplastic hyperproliferative epithelial and/or endothelial disorders. Diagnostic methods and methods for screening for EphA2/EphrinA1 Modulators are also provided. | 10-14-2010 |
20100260750 | Novel serotonin reuptake inhibitors as drugs having peripheral-system-restricted activity - Novel serotonin reuptake inhibitor compounds which are designed to exert serotonin uptake inhibitory activity in the peripheral system while being devoid of CNS activity, and a process of preparing same are disclosed. Further disclosed are pharmaceutical compositions containing same and uses thereof in the treatment of medical conditions associated with peripheral serotonin levels and/or activity, and/or platelet aggregation. | 10-14-2010 |
20100260751 | Methods and Structural Conformations of Antibody Preparations with Increased Resistance to Proteases - Antibody preparations with reduced hydrophobic interactions between Fc side chains and sugar residues of the oligosaccharide backbone present in the CH2 regions of the Fc and/or increased hydrophilic reactions between Fc side chains and sugar residues in the CH2 regions of the Fc-containing protein compared to a wild-type antibody, are prepared by enzymatic treatment, expression under certain conditions, use of particular host cells, and contact with serum. These antibody preparations resist cleavage by proteases, such as papain, ficin, bromolein, pepsin, a matrix metalloproteinase, such as MMP-7, neutrophil elastase (HNE), stromelysin (MMP-3) and macrophage elastase (MMP-12), and glycosylation modification enzymes. | 10-14-2010 |
20100260752 | OPSONIC AND PROTECTIVE ANTIBODIES SPECIFIC FOR LIPOTEICHOIC ACID OF GRAM POSITIVE BACTERIA - This invention provides binding molecules with improved binding affinity to lipoteichoic acids exposed on the surface of the bacteria, useful in the prevention and treatment of infections caused by Gram positive bacteria. | 10-14-2010 |
20100260753 | AMINOFLAVONE (NSC 686288) AND COMBINATIONS THEREOF FOR TREATING BREAST CANCER - Disclosed are methods of treating breast cancer by administering to a mammal aminoflavone, and optionally one or more additional anti-cancer agents. According to example embodiments, the methods include methods of treating cancers resistant to endocrine therapy. | 10-14-2010 |
20100260754 | DKK-1 ANTIBODIES - The invention provides human engineered antibodies, antigen-binding fragments thereof, that bind to, and inhibit the activity of, human DKK-1, and which are effective in treating diseases in which pathogenesis is mediated by DKK-1. | 10-14-2010 |
20100260755 | IBUDILAST AND IMMUNOMODULATORS COMBINATION - The invention contemplates methods and compositions for treating multiple sclerosis including the administration of a PDE inhibitor and at least one immunomodulator comprising mitoxantrone, natalizumab, fingolimod, laquinimod, cladribine, dimethylfumarate or a mixture comprising synthetic polypeptide analogs of myelin basic protein, including alanine, glutamic acid, lysine, and tyrosine amino acid residues, in a therapeutically effective amount. A preferred PDE inhibitor includes ibudilast. | 10-14-2010 |
20100260756 | ANTIBODIES AND RELATED MOLECULES THAT BIND TO 161P2F10B PROTEINS - Antibodies and molecules derived therefrom that bind to 161P2F10B protein and variants thereof, are described wherein 161P2F10B exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 161P2F10B provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 161P2F10B gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 161P2F10B can be used in active or passive immunization. | 10-14-2010 |
20100260757 | USE OF PLP WITH PEG-rMETase IN VIVO FOR ENHANCED EFFICACY - This invention relates to methods of modifying pyridoxal 5′ phosphate (PLP) dependent enzymes to extend the serum half-life of the enzyme, extend the in vivo period of methionine depletion in a host, and decrease the immunogenicity of the enzyme. A preferred PLP-dependent enzyme to be modified is a methioninase, preferably a recombinant methioninase (rMETase). The invention further relates to compositions comprising a modified PLP-dependent enzyme and methods of using the same. | 10-14-2010 |
20100266582 | INHIBITION OF IL-17 PRODUCTION - The invention concerns inhibition of the production of proinflammatory cytokine interleukin-17 (IL-17) by T cells, using an antagonist of interleukin-23 (IL-23). The invention further concerns the use of IL-23 antagonists in the treatment of inflammatory diseases characterized by the presence of elevated levels of IL-17. IL-23 antagonists include, without limitation, antibodies specifically binding to a subunit or IL-17 or an IL-17 receptor. The invention additionally concerns induction of IL-7 production by using an IL-23 agonist. | 10-21-2010 |
20100266583 | INHIBITION OF IL-17 PRODUCTION - The invention concerns inhibition of the production of proinflammatory cytokine interleukin-17 (IL-17) by T cells, using an antagonist of interleukin-23 (IL-23). The invention further concerns the use of IL-23 antagonists in the treatment of inflammatory diseases characterized by the presence of elevated levels of IL-17. IL-23 antagonists include, without limitation, antibodies specifically binding to a subunit or IL-17 or an IL-17 receptor. The invention additionally concerns induction of IL-7 production by using an IL-23 agonist. | 10-21-2010 |
20100266584 | ANTIBODIES AGAINST THE ECTODOMAIN OF ERBB3 AND USES THEREOF - The present invention provides a novel class of antibodies and antigen binding fragments thereof that bind the extracellular domain of ErbB3 receptor and inhibit various ErbB3 functions. For example, the antibodies and antigen binding fragments described herein are capable of binding to the receptor designated ErbB3 and inhibiting EGF-like ligand mediated phosphorylation of the receptor. Such antibodies and antigen binding fragments thereof have the useful characteristic of inhibiting the proliferation of cancer cells expressing ErbB3. | 10-21-2010 |
20100266585 | Monoclonal Antibodies Specific to Hemagglutinin and Neuraminidase from Influenza Virus H5-Subtype or N1-Subtype and Uses Thereof - Monoclonal antibodies and related binding proteins that bind specifically to the envelope glycoprotein of H5 subtypes or neuraminidase glycoprotein of N1 subtypes of avian influenza virus (AIV) are provided. The monoclonal antibodies and related binding proteins are useful for the detection of H5 and N1 subtypes of AIV, including H5N1 subtypes and provide means for the diagnosis, surveillance and treatment of dangerous viral infections. | 10-21-2010 |
20100266586 | VARIABLE ANTIBODIES - The present invention discloses inhibitory antibodies against Factor VIII with modified glycosylation, either by enzymatic deglycosylation or by site directed mutagenesis. Said antibodies with modified glycosylation have equal affinity for FVIII but show different inhibiting properties. The use of one or a mixture of said antibodies allow modulation of the inhibition of factor VIII to levels between 40 and 95%. The present invention further discloses pharmaceutical compositions comprising inhibitory antibodies against Factor VIII with modified glycosylation, combinations of these antibodies and methods for treating haemostasis disorders using said antibodies and antibody mixtures. | 10-21-2010 |
20100266587 | Compositions and Methods to Treat Acute Myelogenous Leukemia - Compositions and methods for treating or preventing a hematologic malignancy, such as AML, using an anti-alpha4 antibody are described. | 10-21-2010 |
20100266588 | Breast Cancer Susceptibility Gene GT198 and Uses Thereof - It has been discovered that the human GT198 gene (gene symbol PSMC3IP) at chromosome 17q21 acts as a tumor suppressor. The mutation of the GT198 gene causes the increased dominant negative splice variant activity and leads to the loss of wild type GT198 function, and in turn, induces breast and ovarian cancers. One embodiment provides compositions and methods for treating or alleviating one or more symptoms associated with cancer due to the GT198 gene mutations. Another embodiment provides methods and compositions for detecting cancer due to the mutation of the GT198 gene. Still another embodiment provides methods for identifying compounds, antibodies and natural product molecules that are useful for treating cancer due to the mutations of the GT198 gene. Preferably the disclosed compositions antagonize or interfere with the biological activity of splice variants of GT198. | 10-21-2010 |
20100266589 | ADJUVANT CANCER THERAPY - Disclosed herein are methods and compostions comprising anti-VEGF antibodies for use in adjuvant cancer therapy. | 10-21-2010 |
20100272716 | Antibodies to VLA-1 - Antibodies that specifically bind to VLA-1 integrin and methods of using these antibodies to treat immunological disorders in a subject. Also included are crystal structures of complexes formed by VLA-1 antibodies and their ligands, and VLA-1 antagonists and agonists identified by using the structure coordinates of these structures. | 10-28-2010 |
20100272717 | COMBINATIONS OF THERAPEUTIC AGENTS FOR TREATING CANCER - The invention relates to a combination comprising vascular disrupting agent (VDA), such as 5,6-dimethylxanthenone-4-acetic acid or a pharmaceutically acceptable salt, ester or prodrug thereof; and one or more pharmaceutically active agents; pharmaceutical compositions comprising said combination; methods of treatment comprising said combination; processes for making said combination; and a commercial package comprising said combination. | 10-28-2010 |
20100272718 | Antibodies Against Human NKG2D and Uses Thereof - The present invention provides isolated anti-human NKG2D monoclonal antibodies useful for therapeutic applications in humans. Typically, the antibodies are fully human or humanized to minimize the risk for immune responses against the antibodies when administered to a patient. Preferred antibodies include human monoclonal antibodies MS and 21F2. As described herein, other antigen-binding molecules such as, e.g., antigen-binding antibody fragments, antibody derivatives, and multi-specific molecules, can be designed or derived from such antibodies. | 10-28-2010 |
20100278813 | Methods of treating and preventing RSV, hMPV, and PIV using anti-RSV, anti-hMPV, and anti-PIV antibodies - The present invention relates to methods for broad spectrum prevention and treatment of viral respiratory infection. In particular, the present invention relates to methods for preventing, treating or ameliorating symptoms associated with respiratory syncytial virus (RSV), parainfluenza virus (PIV), and/or human metapneumovirus (hMPV) infection, the methods comprising administering to a subject an effective amount of one or more anti-RSV-antigen antibodies or antigen-binding fragments thereof, one or more anti-hMPV-antigen antibodies or antigen-binding fragments thereof, and/or one or more anti-PIV-antigen antibodies or antigen-binding fragments thereof. In certain embodiments, a certain serum titer of the anti-RSV-antigen antibodies, anti-PIV-antigen antibodies, and/or anti-hMPV-antigen antibodies or antigen-binding fragments thereof is achieved in said subject. In certain specific embodiments, the subject is human and, preferably, the anti-RSV-antigen antibody, anti-PIV-antigen antibody, and/or anti-hMPV-antigen antibodies are human or humanized. The present invention relates further to compositions comprising the anti-RSV-antigen is antibodies, anti-PIV-antigen antibodies, and/or anti-hMPV-antigen antibodies or antigen-binding fragments thereof. The present invention also relates to detectable or diagnostic compositions comprising the one or more anti-RSV-antigen antibodies, anti-PIV-antigen antibodies, and/or anti-hMPV-antigen antibodies or antigen-binding fragments thereof and methods for detecting or diagnosing RSV, PIV and/or hMPV infection utilizing the compositions. | 11-04-2010 |
20100278814 | Prevention and treatment of synucleinopathic and amyloidogenic disease - The invention provides improved agents and methods for treatment of diseases associated with synucleinopathic diseases, including Lewy bodies of alpha-synuclein in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the Lewy body. The methods are particularly useful for prophylactic and therapeutic treatment of Parkinson's disease. | 11-04-2010 |
20100278815 | Humanized Monoclonal Antibodies to Hepatocyte Growth Factor - The present invention is directed toward a humanized neutralizing monoclonal antibody to hepatocyte growth factor, a pharmaceutical composition comprising same, and methods of treatment comprising administering such a pharmaceutical composition to a patient. | 11-04-2010 |
20100278816 | B7-DC BINDING ANTIBODY - An antibody capable of potentiating immune responses and modifying existing states of immune responsiveness is described, as is the sequence of the antibody. Also described are compositions containing the antibody, as well as methods for using the antibody and the compositions to enhance immune responses, to enhance DC function, to modify an existing state of immune responsiveness, to immunize individuals, or to treat or inhibit conditions such as allergic asthma. | 11-04-2010 |
20100278817 | COMPOUNDS AND METHODS FOR THE TREATMENT OF RENAL DISEASE - The present invention provides compounds and methods for the treatment and prophylaxis of renal disease and inflammation. In particular the invention provides methods for the treatment of kidney disease and failure through the administration of compounds which function as inhibitors of TLR2 function and expression. | 11-04-2010 |
20100278818 | Antibody specific for the Tn antigen for the treatment of cancer - The instant application provides a pharmaceutical composition comprising an antibody, directed against Tn antigen which comprises CDRs derived from 83D4 monoclonal antibody or an immunoconjugate of said antibody, said pharmaceutical composition being intended for the treatment of cancer. | 11-04-2010 |
20100278819 | STREPTOCOCCUS PNEUMONIAE VACCINES - is a major cause of pneumoniae, meningitis, and major cause of morbidity and mortality throughout the world by bacterial otitis media, pneumoniae, meningitis, and bacteraemia. It is an important agent of disease in man especially among infants, the elderly and immunocompromised persons. The present invention provides a solution to this problem by providing a substantially pure or isolated disease related antigen selected from the group consisting of the isolated, recombinant or synthetic | 11-04-2010 |
20100278820 | REAGENTS THAT BIND CCX-CKR2 - Antibodies that bind to CCX-CKR2 and methods of their use are provided. | 11-04-2010 |
20100278821 | N-CADHERIN: TARGET FOR CANCER DIAGNOSIS AND THERAPY - The present invention provides methods of diagnosis, providing a prognosis and a therapeutic target for the treatment of cancers according to their expression of N-cadherin, including prostrate and bladder cancers. | 11-04-2010 |
20100278822 | STABLE HIGH PROTEIN CONCENTRATION FORMULATIONS OF HUMAN ANTI-TNF-ALPHA-ANTIBODIES - The invention provides a liquid pharmaceutical formulation which does not include NaCl and comprises more than 20 mg of a polyol and at least about 100 mg/mL of a human anti-TNF-alpha antibody, or antigen-binding portion thereof. The invention provides a high concentration antibody formulation having long-term stability and advantageous characteristics for subcutaneous administration. | 11-04-2010 |
20100278823 | TREATMENT OF TYPE 1 DIABETES BEFORE AND AFTER EXPRESSION OF PREDISPOSITION MARKERS - The present invention relates generally to the use of compounds, compositions, combinations, kits, and methods for the effective endocytic presentation of immunosuppressive factors for the down regulation of diabetogenic T cells for the treatment of type 1 diabetes. | 11-04-2010 |
20100278824 | COMBINATIONS COMPRISING GEMCITABINE AND TYROSINE KINASE INHIBITORS FOR THE TREATMENT OF PANCREATIC CANCER - The invention relates to a method of treating a warm-blooded animal having pancreatic cancer, in particular it relates
| 11-04-2010 |
20100278825 | Mammalian Receptor Proteins; Related Reagents and Methods - Nucleic acids encoding mammalian, e.g., primate, receptors, purified receptor proteins and fragments thereof. Antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are described. | 11-04-2010 |
20100285004 | Anti-CD38 human antibodies and uses thereof - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for CD38, which plays an integral role in various disorders or conditions. These antibodies, accordingly, can be used to treat, for example, hematological malignancies such as multiple myeloma. Antibodies of the invention also can be used in the diagnostics field, as well as for investigating the role of CD38 in the progression of disorders associated with malignancies. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. The invention also provides isolated novel epitopes of CD38 and methods of use therefore | 11-11-2010 |
20100285005 | ANTI-CXCR4 ANTIBODIES - The present invention provides antibodies that bind human CXCR4 and are characterized as having high affinity and strong neutralizing properties. The antibodies of the invention are useful in the treatment of tumorigenesis, including tumor growth, invasion, angiogenesis, or metastasis. | 11-11-2010 |
20100285006 | Compositions of Kinase Inhibitors and Their Use for Treatment of Cancer and Other Diseases Related to Kinases - The present invention relates to novel thiazole-substituted indolin-2-ones as inhibitors of CSCPK and related kinases; to methods of inhibiting cancer stem cells by using a kinase inhibitor; to pharmaceutical compositions containing such compounds; and to methods of using such compounds in the treatment of a protein kinase related disorder in a mammal; and to processes of making such compounds and intermediates thereof. | 11-11-2010 |
20100285007 | DIFFERENTIAL DIAGNOSIS OF B-CELL CHRONIC LYMPHOCYTIC LEUKEMIA - Provided are methods of diagnosing in a subject a type of B-cell chronic lymphocytic leukemia (B-CLL). Also provided are antibodies, including monoclonal antibodies, that specifically bind FCRL2, FCRL3 or FCRL5 and methods of treating B-CLL using the antibodies. | 11-11-2010 |
20100285008 | BENZOQUINONE DERIVATIVE E3330 IN COMBINATION WITH CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF CANCER AND ANGIOGENESIS - Disclosed are novel methods for the therapeutic treatment of cancer and angiogenesis. The enzyme Ape1/Ref-1, via its redox function, enhances the DNA binding activity of transcription factors that are associated with the progression of cancer. The present invention describes the use of agents to selectively inhibit the redox function of Ape1/Ref-1 and thereby reduce tumor cell growth, survival, migration and metastasis. In addition, Ape1/Ref-1 inhibitory activity is shown to augment the therapeutic effects of other therapeutics and protect normal cells against toxicity. Further, Ape1/Ref-1 inhibition is shown to decrease angiogenesis, for use in the treatment of cancer as well other pathologic conditions of which altered angiogenesis is a component. | 11-11-2010 |
20100285009 | HUMANIZED ANTI-EGFL7 ANTIBODIES AND METHODS USING SAME - The present invention concerns antibodies to EGFL7 and the uses of same. | 11-11-2010 |
20100285010 | TUMOR THERAPY WITH AN ANTI-VEGF ANTIBODY - The present invention provides a method of treating a patient suffering from relapsed HER2 positive cancer with an anti-VEGF antibody during or after treatment with an anti-HER2 antibody. The invention also provides a kit comprising an anti-VEGF antibody. | 11-11-2010 |
20100285011 | HIGH CONCENTRATION ANTIBODY-CONTAINING LIQUID FORMULATION - The problem to be solved is to provide an antibody-containing formulation which is stable and suited for subcutaneous administration, wherein dimerization and deamidation is prevented during long-term storage. The present application is directed to a stable antibody-containing liquid formulation characterized by containing arginine and methionine. | 11-11-2010 |
20100285012 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCERS AND PATHOGENIC INFECTIONS - The subject application provides small compounds that are able to suppress autophagy in various cells. These compounds are useful in augmenting the existing treatments of various cancers and microbial/parasitic infections. Thus, the subject application also provides methods of treating various types of cancers and microbial/parasitic infections. Also provided by the subject application are methods of suppressing the expansion of autophagosomes within cells or individuals and inhibiting the lipidation of autophagy-related protein 8 (Atg8). | 11-11-2010 |
20100285013 | PD-1 ANTIBODIES IN COMBINATION WITH A CYTOKINE-SECRETING CELL AND METHODS OF USE THEREOF - The present invention relates to a method of enhancing the anti-tumor response in a mammal. More particularly, the invention is concerned with combinations comprising a cytokine-secreting cell and an anti-PD-1 antibody, and methods of administering the combination for enhanced immune response to tumor cells in a patient with a cancer. | 11-11-2010 |
20100291071 | Antibody Specific Binding to A-Beta Oligomer and the Use - The present inventors successfully produced monoclonal antibodies that are specific to only soluble Aβ oligomers, but do not recognize soluble Aβ monomers, which are physiological molecules. It was demonstrated that the antibodies are useful as diagnostic/therapeutic monoclonal antibodies for Alzheimer's disease. | 11-18-2010 |
20100291072 | ANTIBODY VARIANTS WITH FASTER ANTIGEN ASSOCIATION RATES - Antibody variants with faster antigen association rates are disclosed. The antibody variants have one or more amino acid alteration(s) in or adjacent to at least one hypervariable region thereof which increase charge complementarity between the antibody variant and an antigen to which it binds. | 11-18-2010 |
20100291073 | METHODS OF REDUCING EOSINOPHIL LEVELS - The present invention relates to a method of reducing the numbers of eosinophils in a human subject comprising administration to a subject an IL-5R binding molecule that comprises (a) a region that specifically binds to the IL-5R and (b) an immunoglobulin Fc region. In a specific embodiment, a method of the invention reduces the number of eosinophils in blood, bone marrow, gastrointestinal tract (e g, esophagus, stomach, small intestine and colon), or lung. | 11-18-2010 |
20100291074 | CYCLOPHILIN D-AMYLOID BETA INTERACTION POTENTIATES MITOCHONDRIAL DYSFUNCTION IN A TRANSGENIC MOUSE MODEL OF ALZHEIMER'S DISEASE - The present invention is directed to methods for treating or preventing Alzheimer's disease by administering therapeutically effective amounts of an agent that reduces Cyclophilin D expression in a patient, or that reduce Cyclophilin D activity or its ability to form a complex with Amyloid beta. Such agents include antisense nucleotides and small interfering RNAs, antibodies that selectively bind to Cyclophilin D, and cyclosporine A and D. | 11-18-2010 |
20100291075 | Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) Neutralizing Antibodies - The invention provides a GM-CSF neutralizing human monoclonal antibody, 1783J22, as well as methods of making and use thereof. The monoclonal antibody is further characterized by its ability to bind epitopes from GM-CSF proteins of multiple species. | 11-18-2010 |
20100291076 | ANTIBODIES SPECIFIC FOR DKK-1 AND THEIR USES - The present invention provides antibodies and fragments thereof that bind to Dkk-1 and, in particular, to humanized antibodies and fragments thereof that bind to Dkk-1 and, even more particularly to fully humanized antibodies and immunologically functional fragments that bind to Dkk-1. Also provided are antibodies and fragments thereof which compete with the binding of an anti-mouse Dkk-1 monoclonal antibody for binding to Dkk-1 | 11-18-2010 |
20100291077 | Methods and Compositions for Modulating ERBB2 Activity - Modulating the interaction between ErbB2 and Erbin is an effective method for treating one or more symptoms of ErbB2-mediated disorders. It has been discovered that Erbin stabilizes ErbB2 in vivo and inhibiting the formation of heterodimers between Erbin and ErbB2 reduces or inhibits the biological activity of ErbB2 relative to control levels. Reducing the biological activity of ErbB2 is useful in the treatment of conditions characterized by the overexpression or misregulation of ErbB2. These conditions include, but are not limited to breast cancer and prostate cancer. Alternatively, agonist of Erbin that promote or enhance the interaction of Erbin with ErbB2 can be useful in the treatment of certain neurological disorders. It has also been discovered that Erbin plays a role in the myelination of neurons of the peripheral nervous system. | 11-18-2010 |
20100291078 | Proteinaceous binding molecules comprising purification tags or inert variable domains - The present invention provides proteinaceous binding molecules, in particular antibodies, having at least two variable domains. One variable domain binds to a target molecule of interest. At least one other variable domain comprises a purification tag suitable for purification of said proteinaceous binding molecule. The purification tag enables the convenient purification of the proteinaceous binding molecule with monovalent binding properties against the target molecule. | 11-18-2010 |
20100297111 | Nanobodies against tumor necrosis factor-alpha - The present invention relates to improved Nanobodies™ against Tumor Necrosis Factor-alpha (TNF-alpha), as well as to polypeptides comprising or essentially consisting of one or more of such Nanobodies. The invention also relates to nucleic acids encoding such Nanobodies and polypeptides; to methods for preparing such Nanobodies and polypeptides; to host cells expressing or capable of expressing such Nanobodies or polypeptides; to compositions comprising such Nanobodies, polypeptides, nucleic acids or host cells; and to uses of such Nanobodies, such polypeptides, such nucleic acids, such host cells or such compositions, in particular for prophylactic, therapeutic or diagnostic purposes, such as the prophylactic, therapeutic or diagnostic purposes. | 11-25-2010 |
20100297112 | COMBINATIONS COMPRISING DMXAA FOR THE TREATMENT OF CANCER - The present invention relates to combinations of compounds such as compounds of the xanthenone acetic acid class such as 5,6-dimethylxanthenone-4-acetic acid (DMXAA) and vascular endothelial growth factor binders, in particular the monoclonal antibody Avastin™ (bevacizumab). More particularly, the invention is concerned with the use of such combinations in the treatment of cancer and pharmaceutical formulations containing such combinations. | 11-25-2010 |
20100297113 | QUINONE DERIVATIVES, PHARMACEUTICAL COMPOSITIONS, AND USES THEREOF - This application describes quinone derivatives which target the redox site of Ape1/Ref1. Also included in the invention are pharmaceutical formulations containing the derivatives and therapeutic uses of the derivatives. | 11-25-2010 |
20100297114 | ANTIGEN PRESENTING CELL TARGETED VACCINES - The present invention includes compositions and methods for the expression, secretion and use of novel compositions for use as, e.g., vaccines and antigen delivery vectors, to delivery antigens to antigen presenting cells. In one embodiment, the vector is an anti-CD40 antibody, or fragments thereof, and one or more antigenic peptides linked to the anti-CD40 antibody or fragments thereof, including humanized antibodies. | 11-25-2010 |
20100297115 | USE OF TRKB ANTIBODIES FOR THE TREATMENT OF RESPIRATORY DISORDERS - The invention discloses TrkB antibodies for the development of new therapeutics to treat, prevent or ameliorate respiratory disorders. The invention also relates to methods to treat, prevent or ameliorate said conditions and pharmaceutical compositions therefor, as well as to a method to identify compounds with therapeutic usefulness to treat conditions associated with respiratory disorders. | 11-25-2010 |
20100297116 | USES OF A GLYCOPROTEIN VI (GPVI) INHIBITOR - The present invention describes a method for reducing reperfusion injury and/or infarction by using an inhibitor of platelet GPVI. This method may be used to treat patients during or after a heart attack or elective cardiac surgery. | 11-25-2010 |
20100297117 | AQUEOUS FORMULATION OF ERYTHROPOIESIS STIMULATING PROTEIN STABILISED BY ANTIOXIDANTS FOR PARENTERAL ADMINISTRATION - The present invention relates to stable aqueous protein formulations. In particular, disclosed herein are therapeutic protein formulations suitable for parenteral administration having one or more antioxidants. | 11-25-2010 |
20100297118 | Therapeutic Cancer Treatments - Provided are methods for treating non-small cell lung cancer by administering a therapeutically effective amount of a hedgehog inhibitor. | 11-25-2010 |
20100303807 | METHODS FOR THE TREATMENT OF IL-1BETA RELATED DISEASES - Disclosed are methods for the treatment and/or prevention of Type 2 diabetes, insulin resistance and disease states and conditions characterized by insulin resistance, obesity, hyperglycemia, hyperinsulinemia and Type 1 diabetes, comprising administering to a subject an effective amount of anti-IL-1β antibody or fragment thereof. | 12-02-2010 |
20100303808 | HUMANIZED ANTI-CD20 ANTIBODIES AND METHODS OF USE - Humanized anti-CD20 antibodies are provided that may be used for the treatment of diseases and conditions associated with CD20-expressing cells. Also provided are nucleic acids enoding such antibodies, methods of making such antibodies, and compositions comprising such antibodies. | 12-02-2010 |
20100303809 | METHODS FOR THE DETECTION AND QUANTITATION OF PTEN - The present disclosure provides methods for determining if PTEN is elevated or reduced in one or more tumor cells relative to one or more normal cells in the same biological sample by obtaining a biological sample comprising one or more tumor cells and one or more normal cells; assaying the biological sample for expression of PTEN; quantitating an amount of PTEN expression in the one or more tumor cells and an amount of PTEN expression in the one or more normal cells; comparing the amount of PTEN expression in the tumor cells to the amount of PTEN expression in the normal cells; and determining that PTEN is elevated in the tumor cells where the amount of expression of PTEN is greater in the tumor cells as compared to the normal cells or determining that PTEN is reduced in the tumor cells where the amount of expression of PTEN is less in the tumor cells than in the normal cells. Such methods may be used to predict whether a patient will be responsive to treatment with one or more receptor tyrosine kinase inhibitors and/or may be used to select subjects for inclusion/exclusion in a clinical trial. | 12-02-2010 |
20100303810 | METHOD FOR TREATING LUPUS - A method of treating lupus in a subject eligible for treatment is provided involving administering an effective amount of an antibody that binds to a B-cell surface marker to the subject to provide an initial exposure and a subsequent exposure to the antibody within certain dosing regimens and an article of manufacture therefor. | 12-02-2010 |
20100310553 | Compositions and Methods for Controlling Hepatitis C Virus Infection - Disclosed herein are methods and compositions for the treatment and prevention of Hepatitis C Virus (HCV) infection and methods of screening for antiviral agents against HCV infection and/or production. A method of using compositions of certain apolipoprotein-specific monoclonal or polyclonal antibodies to inhibit HCV infectivity is disclosed. Further, methods of using small interfering RNAs (siRNAs) specific to apolipoproteins for treating and/or preventing HCV infection are disclosed. Also disclosed are methods of using siRNAs specific and/or small molecule inhibitors to certain lipoprotein biosynthetic genes and of using recombinant apolipoprotein E and/or their forms of lipoproteins to treat and/or prevent HCV infections. Screening methods for anti-HCV agents include assessing the effect of a candidate agent on apolipoprotein E and/or apolipoprotein C-I gene expression, assembly, and/or secretion and assessing the effect of a candidate agent on the blockage of the interaction and/or incorporation of HCV nonstructural proteins and/or their fusion forms with reporter proteins into HCV virions. | 12-09-2010 |
20100310554 | Methods for Reversing Multiple Resistance in Animal Cells - The present invention is related to the use of a virus, preferably an adenovirus for reversing resistance in cells. | 12-09-2010 |
20100310555 | COMPOSITIONS WITH HEMATOPOIETIC AND IMMUNE ACTIVITY - The present invention provides methods of using Bv8 and EG-VEGF polypeptides and nucleic acids to promote hematopoiesis. Also provided herein are methods of screening for modulators of Bv8 and EG-VEGF activity. Furthermore, methods of treatment using Bv8 and EG-VEGF polypeptides or Bv8 and EG-VEGF antagonists are provided. | 12-09-2010 |
20100310556 | THERAPEUTIC AGENT FOR PRURITUS - The present inventors isolated clone BM095 from a human antibody phage library, which had a strong growth inhibitory activity in the IL-31-dependent Ba/F3 cell growth assay system. When administered to pruritus model mice, the anti-mouse NR10 neutralizing antibody exhibited a marked symptom-suppressing effect. Thus, it was revealed that anti-NR10 neutralizing antibodies are useful as therapeutic agents for pruritus. | 12-09-2010 |
20100310557 | ANTIBODIES IMMUNOREACTIVE WITH HEREGULIN-COUPLED HER3 - Antibodies which specifically bind heregulin-coupled HER3, at a site distinct from the heregulin binding site, are described. These antibodies are particularly useful in treating cancer. | 12-09-2010 |
20100310558 | Method for Linking Sequences of Interest - Multiplex overlap-extension RT-PCR provides an efficient method of linking two or more nucleotide sequences encoding for domains or subunits of a heteromeric protein, in a single reaction. Especially, the linkage of variable region encoding sequences from e.g. immunoglobulins, T cell receptors or B cell receptors is eased with the method of the present invention. This allows for a more efficient way of generating libraries of variable region encoding sequences. The capability to perform the multiplex overlap-extension RT-PCR using template derived from an isolated single cell enables the generation of cognate pair libraries in a high-throughput format. | 12-09-2010 |
20100310559 | RECOMBINANT MONOCLONAL ANTIBODIES AND CORRESPONDING ANTIGENS FOR COLON AND PANCREATIC CANCERS - The present invention provides for purified or highly pure recombinant monoclonal antibodies that bind to human colorectal and pancreatic carcinoma-associated antigens (CPAA), along with nucleic acid sequences encoding the antibody chains, and the amino acid sequences corresponding to said nucleic acids and uses for said sequences. | 12-09-2010 |
20100316631 | Water Soluble Curcumin-Based Compounds - The present disclosure describes the design and synthesis of a novel class of water soluble curcumin-based compounds. These water soluble curcumin-based compounds are shown to provide superior cell killing activity and exhibit increased and cell internalization solubility in aqueous solutions as compared to the free (unconjugated) curcumin. The present disclosure provides compositions for the treatment or prevention of a variety of disease states or conditions, such as but not limited to, cancer, other cell hyperproliferative disorders and chronic inflammatory conditions, said compositions comprising a water soluble curcumin-based compound. | 12-16-2010 |
20100316632 | MEANS AND METHODS FOR ENHANCING DIFFERENTIATION OF HAEMATOPOIETIC PROGENITOR CELLS - The invention provides means and method for stimulating the production of differentiated haematopoietic cells in a culture comprising haematopoietic progenitor cells, lymphocytes (preferably T-cells) and monocytes/macrophages and/or dendritic cells. The methods involve among others culturing said cells or precursors thereof in the presence of a binding molecule specific for a co-stimulatory molecule expressed on said monocytes/macrophages and/or dendritic cells or said lymphocytes (preferably T-cells). | 12-16-2010 |
20100316633 | INHIBITION OF ANGIOGENESIS - The present invention relates generally to the inhibition of inflammatory cell-mediated angiogenesis. In particular, the invention concerns the prevention or treatment of tumor angiogenesis, and the inhibition of tumor development, using Bv8 antagonists, such as anti-Bv8 antibodies. | 12-16-2010 |
20100316634 | RECOMBINANT IL-5 ANTAGONISTS USEFUL IN TREATMENT OF IL-5 MEDIATED DISORDERS - Chimeric, humanized and other IL-5 mAbs, derived from high affinity neutralizing mAbs, pharmaceutical compositions containing same, methods of treatment and diagnostics are provided. | 12-16-2010 |
20100316635 | KIT FOR DIAGNOSIS OF BREAST CANCER USING HERCEPTIN, A COMPOSITION COMPRISING HERCEPTIN AND A METHOD FOR DETECTING HERCEPTIN-SENSITIVE HER2 OVEREXPRESSED CELL USING THE SAME - A kit and a composition comprising Herceptin, an antibody binding specifically to HER2, based on detecting Herceptin-sensitive HER2-overexpressing cells are provided for diagnosing cancer. A method of detecting Herceptin-sensitive HER2-overexpressing cells using the same is also provided. | 12-16-2010 |
20100316636 | Method of Treating Rheumatoid Arthritis with an IL-6R Antibody - The present invention provides methods of preventing or treating rheumatoid arthritis using a fully human antibody or antigen-binding fragment thereof that specifically binds human interleukin-6 receptor (hIL-6R). The methods of the present invention may include administration of a second therapeutic agent, such as one or more of a non-steroidal anti-inflammatory drug (NSAID), a glucocorticoid, a disease-modifying anti-rheumatic drug (DMARD), or a TNF-alpha antagonist, T-cell blocker, anti-CD20 antibody, an IL-1, JAK or IL-17 antagonist, or any combination thereof. | 12-16-2010 |
20100316637 | Compositions and Methods for Diagnosing and Treating Cancer - An isolated antibody that specifically binds to an extracellular domain of human DLL4 and affects growth of a tumor comprising cancer stem cells is described. Also described is a method of treating cancer comprising administering a therapeutically effective amount of an anti-DLL4 antibody. | 12-16-2010 |
20100316638 | Antibody Formulations and Use Thereof - The present invention is directed to combination formulations of monoclonal antibodies with anti-inflammatory agents, related methods and uses thereof. | 12-16-2010 |
20100316639 | BIOMARKERS FOR IGF-1R INHIBITOR THERAPY - The invention concerns the identification and validation of certain biomarkers for selecting patients for therapy with an IGF-1R inhibitor, particularly for breast and colorectal cancer. | 12-16-2010 |
20100316640 | POLYSACCHARIDE COMPOSITIONS AND METHODS OF USE FOR THE TREATMENT AND PREVENTION OF DISORDERS ASSOCIATED WITH PROGENITOR CELL MOBILIZATION - Polysaccharide preparations lacking substantial anticoagulant activity are provided herein. Methods of making and using such preparations are provided. | 12-16-2010 |
20100316641 | ENGINEERED ANTIBODY CONSTANT DOMAIN MOLECULES - Described herein are engineered antibody constant domain molecules, such as CH2 or CH3 domain molecules, comprising at least one mutation, or comprising at least one complementarity determining region (CDR), or a functional fragment thereof, engrafted in a loop region of the CH2 domain. The CH2 domain molecules described herein are small, stable, soluble, exhibit little to no toxicity and are capable of binding antigen. | 12-16-2010 |
20100322920 | Human monoclonal antibodies against CD30 - Isolated human monoclonal antibodies which bind to CD30 (e.g., human CD30) are disclosed. The human antibodies can be produced in a non-human transgenic animal, e.g., a transgenic mouse, capable of producing multiple isotypes of human monoclonal antibodies by undergoing V-D-J recombination and isotype switching. Also disclosed are derivatives of the human antibodies (e.g., bispecific antibodies and immunoconjugates), pharmaceutical compositions comprising the human antibodies, non-human transgenic animals and hybridomas which produce the human antibodies, and therapeutic and diagnostic methods for using the human antibodies. | 12-23-2010 |
20100322921 | METHOD OF INHIBITING COAGULATION ACTIVATION WITH HUMAN ANTI-FACTOR Va ANTIBODIES AND USE THEREOF - The present invention also discloses the novel use of factor Va inhibitors in the treatment of various disorders caused by the formation of blood clots. | 12-23-2010 |
20100322922 | Neutralization of CD95 Activity Blocks Invasion of glioblastoma Cells In Vivo - The present invention relates to methods for treating an individual with high grade glioblastoma multiforme by preventing or disrupting the binding of CD95 to its ligand, CD95L, in vivo, whereupon that neutralization of CD95 activity reduces undesirable glial cell migration and invasion into body tissue. | 12-23-2010 |
20100322923 | Medical Uses of Glucans - The invention relates to a glucan having a beta-(1,3)-backbone with one or more beta-(1,3)-side chains linked thereto for use in the treatment of asthma and related diseases of abnormal pulmonary function in an animal. Also described is a method of treating asthma and related diseases of abnormal pulmonary function in an animal comprising administering to said animal an effective amount of a glucan having a beta-(1,3)-backbone with one or more beta-(1,3)-side chains linked thereto. | 12-23-2010 |
20100322924 | Humanized Fc gamma RIIB-Specific Antibodies And Methods Of Use Thereof - The present invention relates to humanized FcγRIIB antibodies, fragments, and variants thereof that bind human FcγRIIB with a greater affinity than said antibody binds FcγRIIA. The invention encompasses the use of the humanized antibodies of the invention for the treatment of any disease related to loss of balance of Fc receptor mediated signaling, such as cancer, autoimmune and inflammatory disease. The invention provides methods of enhancing the therapeutic effect of therapeutic antibodies by administering the humanized antibodies of the invention to enhance the effector function of the therapeutic antibodies. The invention also provides methods of enhancing the efficacy of a vaccine composition by administering the humanized antibodies of the invention. The invention encompasses methods for treating an autoimmune disease and methods for elimination of cancer cells that express FcγRIIB. | 12-23-2010 |
20100322925 | ALK7 AND MYOSTATIN INHIBITORS AND USES THEREOF - The invention relates to ALK7 soluble receptors and their uses as antagonists of the function of certain ligands such as GDF-8 (Myostatin) and GDF-11. The ALK7 soluble receptor of the invention is useful as antagonists of GDF-8 and GDF-11 in the treatment of neuronal diseases or conditions such as stroke, spinal cord injury, and all peripheral nerve diseases. The ALK7 soluble receptor of the invention is also useful as GH (growth hormone) equivalent, and for increasing muscle mass. | 12-23-2010 |
20100322926 | METHODS OF USING CADHERIN 11 (CDH11) ANTAGONISTS - The present invention provides novel methods of inhibiting or preventing epithelial-mesenchymal transition (EMT) or endothelial-mesenchymal transition (EnMT), such as EMT or EnMT, associated with fibrosis and chronic tissue rejection. The present invention also provides methods for diagnosing or assessing whether a subject has or is at risk of developing a disease associated with CDH11 expression, as well as methods for determining the prognosis of a subject diagnosed with a CDH11-associated condition. The invention employs CDH11 antagonists to downmodulate CDH11 activity, thereby inhibiting EMT or EnMT. | 12-23-2010 |
20100322927 | GLYCOSYLATED ANTIBODIES - The invention provides an antibody comprising human IgG1 or IgG3 heavy chain constant domains that are glycosylated with a sugar chain at Asn297, said antibody being characterized in that the amount of fucose within said sugar chain is at least 99%, and in addition the amount of NGNA is 1% or less and/or the amount of N-terminal alpha 1,3 galactose is 1% or less, and uses thereof. | 12-23-2010 |
20100330077 | 1-ACETIC ACID-INDOLE DERIVATIVES WITH PGD2 ANTAGONIST ACTIVITY - Compounds of general formula (I) | 12-30-2010 |
20100330078 | ALPHA 5 - BETA 1 ANTIBODIES AND THEIR USES - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies, or antigen binding portions thereof, that specifically bind to integrin α5β1 with high affinity. Nucleic acid molecules encoding the antibodies of the disclosure, expression vectors, host cells and methods for expressing the antibodies of the disclosure are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies or antigen binding portions thereof are also provided. The disclosure also provides methods for treating various cancers using the anti-α5β1 antibodies or antigen binding portions thereof described herein. | 12-30-2010 |
20100330079 | BIOMARKDER COMBINATIONS FOR COLORECTAL CANCER - The present invention relates to methods and kits for the detection of predetermined biomarkers for early diagnosis and management of cancer, and in particular, colorectal cancer. | 12-30-2010 |
20100330080 | ANTIGEN BINDING POLYPEPTIDES - The invention relates to a platform technology for production of antigen binding polypeptides having specificity for a desired target antigen which is based on the conventional antibody repertoire of species in the family Camelidae, and to antigen binding polypeptides obtained using this technology platform. In particular, the invention provides an antigen binding polypeptide comprising a VH domain and a VL domain, wherein at least one hypervariable loop or complementarity determining region (CDR) in the VH domain or the VL domain is obtained from a VH or VL domain of a species in the family Camelidae. | 12-30-2010 |
20100330081 | CRIPTO BINDING MOLECULES - The invention pertains to humanized forms of an anti-CRIPTO antibody and portions thereof and their use in treating disorders, such as cancer either alone or in combination with other agents. | 12-30-2010 |
20100330082 | NLRR-1 ANTAGONISTS AND USES THEREOF - NLRR-1 antagonists and methods of their use in treating cancer and other disorders are provided. | 12-30-2010 |
20100330083 | PLASMINOGEN ACTIVATOR VARIANT FORMULATIONS - A solution is provided comprising about 0.01-0.05 mg/mL of tenecteplase in sterile water for injection or bacteriostatic water for injection and normal saline. Such solution is useful for delivery from a catheter and for treating a thrombotic disorder by exposing fibrin-rich fluid from the disorder to an effective amount thereof, as well as in kits. In a preferred embodiment, peripheral thrombosis is treated in a mammal comprising delivering to the mammal via a catheter an effective amount of this solution. | 12-30-2010 |
20100330084 | SINGLE DOMAIN VHH ANTIBODIES AGAINST VON WILLEBRAND FACTOR - The present invention relates to improved Nanobodies™ against von Willebrand Factor (vWF), as well as to polypeptides comprising or essentially consisting of one or more of such Nanobodies. The invention also relates to nucleic acids encoding such Nanobodies and polypeptides; to methods for preparing such Nanobodies and polypeptides; to host cells expressing or capable of expressing such Nanobodies or polypeptides; to compositions comprising such Nanobodies, polypeptides, nucleic acids or host cells; and to uses of such Nanobodies, such polypeptides, such nucleic acids, such host cells or such compositions, in particular for prophylactic, therapeutic or diagnostic purposes, such as the prophylactic, therapeutic or diagnostic purposes. | 12-30-2010 |
20100330085 | METHOD OF TREATMENT, PROPHYLAXIS AND DIAGNOSIS OF PATHOLOGIES OF THE BONE - The present invention relates generally to the fields of treatment, prophylaxis and diagnosis. More particularly, the present invention identifies genes and gene products associated with bone morphogenesis and pathologies of the bone. Even more particularly, the present invention contemplates the regulation of expression of these genes or the activity of the gene products in the treatment, prophylaxis and diagnosis of bone pathologies. Cell-based therapies and manipulation of cells in in vitro culture also form part of the present invention. | 12-30-2010 |
20100330086 | CATIONIC STEROID ANTIMICROBIAL COMPOSITIONS AND METHODS OF USE - The invention provides methods for decreasing or inhibiting herpesviridae (HV) infection or pathogenesis of a cell in vitro, ex vivo or in vivo, a symptom or pathology associated with a herpesviridae (HV) infection or pathogenesis in vitro, ex vivo or in vivo, or an adverse side effect of herpesviridae (HV) infection or pathogenesis in vitro, ex vivo or in vivo. In one embodiment, a method of the invention includes treating a subject with an invention compound (e.g., cationic steroid antimicrobial or CSA). | 12-30-2010 |
20100330087 | METHODS FOR TREATING CANCER USING COMBINATION THERAPY - The invention relates to methods for treating a subject by manipulating HER-2 on a cell as well as related products. The methods include methods of treating cancer using fatty acid oxidation inhibitors and HER-2 binding molecules such as antibodies and fragments thereof. | 12-30-2010 |
20110002916 | Plasmodium falciparum antigens and their vaccine and diagnostic applications - The invention concerns novel | 01-06-2011 |
20110002917 | Antibody constant domain regions and uses thereof - The invention provides recombinant protein (e.g., a recombinant antibody or soluble receptor) having (i) a binding domain capable of specific binding to an epitope (for example an antibody variable domains, a receptor, a growth factor, a cytokine, or a fragment of any of the foregoing which is capable of specifically binding the desired epitope) and (ii) an effector domain comprising a constant domain region which is derived from immunoglobulin of a first species which is a companion mammal, e.g. dog, cat, or horse, having engineered substitutions at one or more positions and having an altered interaction with one or more FcRs or other ligands, and optionally enhanced effector function, relative to the parent constant domain region. | 01-06-2011 |
20110002918 | METHODS OF TREATING DISEASED TISSUE - Treatment protocols for severe psoriasis include administering biologics, stopping all administration of the biologics after the severity of the psoriasis has reduced and has reached an equilibrium, mildness and/or a tolerable state of remission, and administering UV phototherapy. The biologics may include, for example, the biologics found in Amevive®, Enbrel®, Humira®, Raptiva®, and Remicade® and/or alefacept, etanercept, adalimumab, efalizumab, infliximab, and ustekinumab. The UV phototherapy may be repeated, for example daily, weekly, monthly, yearly, to keep the psoriasis in a mild state or in a tolerable state of substantial remission. Parameters for administering UV phototherapy may be determined based on skin tone, Fitzpatrick skin phenotype, the severity of the psoriasis, the area of exposure, and/or the MED. | 01-06-2011 |
20110002919 | ANTAGONISTS OF NEUROPILIN RECEPTOR FUNCTION AND USE THEREOF - The present invention relates to antagonists of neuropilin receptor fuction and use thereof in the treatment of cancer, particularly metastatic cancer, and angiogenic diseases. | 01-06-2011 |
20110002920 | COMBINATION CANCER IMMUNOTHERAPY WITH CO-STIMULATORY MOLECULES - Provided are methods of reducing the size of a tumor or inhibiting the growth of cancer cells in an individual or inhibiting the development of metastatic cancer by administering an effective amount of a soluble form of a co-stimulatory molecule from an antigen presenting cell and by reducing the activity of immunoregulatory T cells in the individual. Methods of reduction in the activity of immunoregulatory T cells involve removing them ex vivo or depleting or inactivating them in vivo. Also provided are cancer therapeutic compositions comprising a soluble form of a co-stimulatory molecule from an antigen presenting cell and an antibody specific for an intracellular antigen. | 01-06-2011 |
20110002921 | COMBINATION CANCER IMMUNOTHERAPY WITH CO-STIMULATORY MOLECULES - Provided are methods of reducing the size of a tumor or inhibiting the growth of cancer cells in an individual or inhibiting the development of metastatic cancer by administering an effective amount of a soluble form of a co-stimulatory molecule from an antigen presenting cell and by reducing the activity of immunoregulatory T cells in the individual. Methods of reduction in the activity of immunoregulatory T cells involve removing them ex vivo or depleting or inactivating them in vivo. Also provided are cancer therapeutic compositions comprising a soluble form of a co-stimulatory molecule from an antigen presenting cell and an antibody specific for an intracellular antigen. | 01-06-2011 |
20110002922 | CELL GROWTH INHIBITORS CONTAINING ANTI-GLYPICAN 3 ANTIBODY - Provided is a cell growth inhibitor that can be used for treating diseases based on abnormal cell proliferation, and in particular cancer. The cell growth inhibitor contains an anti-glypican 3 antibody as an active ingredient. | 01-06-2011 |
20110002923 | METHODS OF INHIBITING TUMOR GROWTH USING TTK ANTAGONISTS - The present invention relates to methods for treating TTK positive breast cancers or soft-tissue sarcomas in a mammalian subject by administering a therapeutically effective amount of a TTK antagonist. The invention also provides compositions comprising a TTK antagonist and a HER-2 antagonist, as well as methods of diagnosing a basal-like breast cancer and methods of determining the prognosis of a subject having a cancer by assessing expression of TTK in a tumor sample from a subject. | 01-06-2011 |
20110008327 | COMPOSITIONS INCLUDING TRICIRIBINE AND EPIDERMAL GROWTH FACTOR RECEPTOR INHIBITOR COMPOUNDS OR SALTS THEREOF AND METHODS OF USE THEREOF - This application relates to combination therapies including triciribine compounds and epidermal growth factor receptor inhibitor compounds, particularly erlotinib-like compounds and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 01-13-2011 |
20110008328 | METHOD FOR CONTROLLING GLUCOSE UPTAKE AND INSULIN SENSITIVITY - The invention provides methods for treating diabetes and related disorders, such as metabolic syndromes (which includes insulin resistance), by administering an inhibitor of osteopontin (OPN), which includes an antibody, antibody fragment, siRNA, and aptamer. Also disclosed are methods for increasing glucose uptake by cells in a subject, by administering an inhibitor of OPN. | 01-13-2011 |
20110008329 | Methods of Treating RSV Infections And Related Conditions - The present invention provides methods for managing, treating and/or ameliorating a respiratory syncytial virus (RSV) infection (e.g., acute RSV disease, or a RSV upper respiratory tract infection (URI) and/or lower respiratory tract infection (LRI)), and/or a symptom or a long-term respiratory condition relating thereto (e.g., asthma, wheezing, reactive airway disease (RAD), or chronic obstructive pulmonary disease (COPD)) in a subject, comprising administering to said human an effective amount of one or more antibodies that immunospecifically bind to one or more RSV antigens with a high affinity and/or high avidity and further comprise a modified IgG constant domain, or FcRn-binding fragment thereof, to not only decrease RSV infection, but also decrease the pro-inflammatory epithelial cell immune responses in order to mitigate the later development of asthma and/or wheezing and/or COPD in said patient. | 01-13-2011 |
20110008330 | Compositions and methods of tolerizing a primate to an antigen - Inducing tolerance in a primate by use of a compound, or a combination of at least two compounds, that has certain characteristics when tested in vitro. The compound, alone or in combination, is preferably TRX1 antibody and the compound or combination is preferably used in accordance with a specified dosing regimen. | 01-13-2011 |
20110008331 | USE OF RECOMBINANT LAG-3 OR THE DERIVATIVES THEREOF FOR ELICITING MONOCYTE IMMUNE RESPONSE - The present disclosure relates to the use of a recombinant LAG-3 or derivatives thereof in order to boost a monocyte-mediated immune response, in particular to elicit an increase in the number of monocytes in blood. This finds use in the development of novel therapeutic agents for the treatment of an infectious disease or cancer. | 01-13-2011 |
20110008332 | Combination Therapy to Treat Persistent Viral Infections - The present invention pres ides combination therapies to treat persistent viral infections. In particular, combinations of vaccines and IL-10 or IL-10 receptor (IL-10R) antagonists to clear such infections are provided. | 01-13-2011 |
20110008333 | METHODS OF INHIBITING UNWANTED CELL PROLIFERATION USING HEDGEHOG ANTAGONISTS - The present application is directed to compositions and methods for inhibiting angiogenesis and treating or preventing unwanted cell proliferation, including tumors, by inhibiting the hedgehog pathway, e.g., with an antagonist of the hedgehog pathway such as those disclosed herein. | 01-13-2011 |
20110008334 | NOGO-A BINDING WITH ENHANCED AFFINITY AND PHARMACEUTICAL USE THEREOF - The present invention provides a binding molecule which is capable of binding to the human NogoA polypeptide or human NiG or human NiG-D20 or human NogoA_342-357 with a dissociation constant, 1000 nM, a polynucleotide encoding such binding molecule; an expression vector comprising said polynucleotide capable of producing a binding molecule; an isolated host cell which comprises an expression system as defined above; the use of such binding molecule as a pharmaceutical, especially in the treatment of a nerve repair, a pharmaceutical composition comprising said binding molecule; and a method of treatment of nerve repair; a pharmaceutical composition comprising said binding molecule; and a method of treatment of diseases associated with nerve repair. | 01-13-2011 |
20110008335 | Methods and Compositions for Increasing the Efficiency of Therapeutic Antibodies Using NK Cell Potentiating Compounds - The present invention relates, generally, to methods and compositions for increasing the efficiency of therapeutic antibodies. Their efficiency is enhanced through the increase of the ADCC mechanism. More particularly, the invention relates to the use of a therapeutic antibody in combination with compounds that block an inhibitory receptor or stimulate an activating receptor of an NK cell in order to enhance the efficiency of the treatment with therapeutic antibodies in human subjects. | 01-13-2011 |
20110008336 | Treatment of Autoimmune Diseases - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 01-13-2011 |
20110008337 | Treatment of Autoimmune Diseases - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 01-13-2011 |
20110008338 | Treatment of Autoimmune Diseases - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 01-13-2011 |
20110008339 | MONOCLONAL ANTIBODY AND USE THEREOF - An antibody capable of recognizing amyloid β while not recognizing amyloid β precursor proteins, and a method for using the same. | 01-13-2011 |
20110008340 | ANTI-PROPERDIN ANTIBODIES - A method of inhibiting alternative complement pathway activation in a mammal includes administering an amount of an antibody and/or fragment thereof that specifically binds to an epitope of the N terminus end of properdin effective to the inhibit alternative complement pathway in the subject. | 01-13-2011 |
20110014188 | TNFalpha antagonists and methotrexate in the treatment of TNF-mediated disease - Methods for treating and/or preventing a TNF-mediated disease in an individual are disclosed. Also disclosed is a composition comprising methotrexate and an anti-tumor necrosis factor antibody. TNF-mediated diseases include rheumatoid arthritis, Crohn's disease, and acute and chronic immune diseases associated with transplantation. | 01-20-2011 |
20110014189 | Stable pharmaceutical composition comprising at least one monoclonal antibody and at least one amphiphilic polysaccharide comprising hydrophobic substituents - A stable pharmaceutical composition with at least one monoclonal antibody and at least one amphiphilic polysaccharide chosen from the group of amphiphilic polysaccharides comprising carboxylate functional groups partly substituted with at least one hydrophobic substituent is disclosed. | 01-20-2011 |
20110014190 | USE OF B LYMPHOCYTE STIMULATOR PROTEIN ANTAGONISTS TO PROMOTE TRANSPLANTATION TOLERANCE - The invention relates to methods of preventing, treating, ameliorating and otherwise inhibiting organ or transplant rejection in a patient by administering B Lymphocyte Stimulator antagonists. In addition, therapeutic treatment regimens are provided to promote transplant tolerance in a patient following the administration of B Lymphocyte Stimulatorantagonists. | 01-20-2011 |
20110014191 | BREAST CANCER EXPRESSION PROFILING - The present invention relates to a method for analyzing cancer. e.g., breast cancer including detection of differential expression of at least one of the 16 genes encoding serine/threonine kinases listed in Table 1, or of the 16 genes, and to a polynucleotide library including at least one the 16 genes. This finds use in the development of novel applications, in particular in the development of prognosis or diagnostic of breast cancer or for monitoring the treatment of a patient with a breast cancer. | 01-20-2011 |
20110014192 | SUPPRESSION OF CANCER GROWTH AND METASTASIS USING NORDIHYDROGUAIARETIC ACID DERIVATIVES WITH METABOLIC MODULATORS - Disclosed is a composition comprising a derivative of NDGA and at least one metabolic modulator. The composition can be in a unit dose form or kit. The composition can comprise at least two metabolic modulators. Also disclosed are methods for achieving cytotoxicity, particularly of rapidly dividing cells such as cancer, by administering a composition of the invention. In various embodiments of the invention subjects with cancer achieve prolonged survival and/or diminution in the size of their malignancies and cancer metastasis. | 01-20-2011 |
20110014193 | HUMANIZED ANTI-HUMAN ALPHA 9-INTEGRIN ANTIBODY - The present invention provides a humanized anti-human α9 integrin antibody having improved activity and/or property as compared to donor mouse anti-human α9 integrin antibody, namely, a humanized anti-human α9 integrin antibody comprising a heavy-chain variable region consisting of the amino acid sequence shown by SEQ ID NO: 1 or the amino acid sequence shown by SEQ ID NO: 1 wherein one or several amino acids are substituted, deleted, inserted and/or added and a light-chain variable region consisting of the amino acid sequence shown by SEQ ID NO: 61 or the amino acid sequence shown by SEQ ID NO: 61 wherein one or several amino acids are substituted, deleted, inserted and/or added, as well as a means for preventing or treating various diseases involving human α9 integrin in their pathogenesis, which uses the antibody. | 01-20-2011 |
20110014194 | METHODS FOR INHIBITING ANGIOGENESIS USING EGFL8 ANTAGONISTS - The present invention provides methods of using EGFL8 antagonists to inhibit vascular development and to treat related disorders. | 01-20-2011 |
20110014195 | USE OF THERAPEUTIC PEPTIDES FOR THE TREATMENT AND PREVENTION OF CANCER - MUC1 (DF3, CD227, episialin, PEM) is a heavily O-glycosylated heterodimeric protein of >300 kDa, normally expressed abundantly on the apical surface of glandular epithelia. MUC1 mimetic peptides are selectively retained in mammary gland tumors, colon and skin after systemic administration. Moreover, MUC1 mimetic peptides reduce tumor initiation. In addition, MUC1 mimetic peptides can be used in conjunction with other anti-EGFR treatments in the adjuvant context, i.e., after surgery. | 01-20-2011 |
20110020327 | Purification of proteins - The present invention relates to a bimodal polymer such as a soluble polymer capable of irreversibly binding to insoluble particulates and a subset of soluble impurities and also capable of reversibly binding to one or more desired biomolecules in an unclarified biological material containing stream and the methods of using such a material to purify one or more desired biomolecules from such a stream without the need for prior clarification. Such a polymer comprises domains of charged pendant groups such as primary, secondary, tertiary or quaternary amines, (first mode) and is rendered insoluble and precipitates out of solution simply upon complexing with oppositely charged solid particulates and a fraction of the soluble impurities in an amount sufficient to form an aggregate that can no longer be held in solution. The polymer further comprises other domains of pendant groups that are charged or uncharged, hydrophilic or hydrophobic or have a ligand that is selective for the biomolecule of interest depending on the process conditions such as pH, ionic strength, salts, and the like (second mode). When present in one mode, such as the uncharged form, said pendant groups are capable of binding to one or more desired biomolecules within the stream (protein, polypeptide, etc) in an unclarified cell broth. The precipitate can then be removed from the stream, such as by being filtered out from the remainder of the stream and the desired biomolecule is recovered such as by selective elution. | 01-27-2011 |
20110020328 | ANTIBODY FORMULATIONS - This invention relates to a shear and temperature stable antibody formulations that are more stable than compared to a standard formulation (such as 30 mM citrate, 100 mM NaCl, pH 6.5). The present invention's shear and temperature stable antibody formulations show reduced precipitation when subjected to stress conditions but the standard formulation had aggregated. This result was unpredictable because thermodynamically the two formulations are similar as seen by their DSC (differential scanning calorimeter) profiles. | 01-27-2011 |
20110020329 | CONJUGATES OF ANTI-RG-1 ANTIBODIES - Anti-RG-1 antibodies, antibody fragments, or antibody mimetics conjugated to partner molecules, such as drugs, radioisotopes, and cytotoxins, wherein the partner molecule exerts its effect regardless of whether the RG-1 bound conjugate is internalized within a targeted cell, are useful for treating cancers. | 01-27-2011 |
20110020330 | ANTIBODY INHIBITORS OF GDF-8 AND USES THEREOF - The disclosure provides novel antibodies against growth and differentiation factor-8 (GDF-8), including antibody fragments, which inhibit GDF-8 activity in vitro and in vivo. The disclosure also provides methods for diagnosing, preventing, or treating degenerative disorders of muscle, bone, or insulin metabolism. | 01-27-2011 |
20110020331 | N-GLYCOSYLATED ANTIBODY - The invention relates to a monoclonal antibody or derivative or fragment thereof that is derived from a parental monoclonal antibody, that recognizes the Lewis Y antigen, characterized in that the Fc region or region equivalent to the Fc region of said antibody or derivative or fragment thereof carries a bi-sected hybrid type N-glycosylation pattern and that said antibody shows at least 10 fold increased ADCC and at least 10% reduced CDC activity. | 01-27-2011 |
20110020332 | Prevention of tumors with monoclonal antibodies against neu - Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface are disclosed. The methods comprise administering an antibody which specifically binds to p185. Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface in an individual at high risk of developing tumors are disclosed. | 01-27-2011 |
20110020333 | Angiogenesis Pathway Gene Polymorphisms for Therapy Selection - A method for determining whether a patient in need thereof will respond to anti-VEGF antibody based chemotherapy by screening a suitable cell or tissue sample isolated from the patient for at least one genomic polymorphism or genotype selected from (i) IL-8(−251); (ii) VEGF(936); or (iii) AM (3′ CA repeats), wherein the patient is suitably treated if the corresponding genotype is (i) (T/T) for IL-8(−251); (ii) (T/T or C/T) for VEGF(936); or (iii) at least one AM allele having 14 or more 3′ CA repeats. | 01-27-2011 |
20110020334 | METHODS FOR TREATING AND PREVENTING BRAIN TUMORS BASED ON BONE MORPHOGENETIC PROTEINS - The present invention is concerned with the therapy of neuroblastoma and related diseases. Specifically, the present invention relates to a method for treating or preventing neuroblastoma comprising administering to a subject a therapeutically effective amount of bone morphogenetic protein 4 (BMP4). Preferably, said BMP4 is applied together with chemotherapy and/or radiation therapy. | 01-27-2011 |
20110020335 | Treatment of Cancers Expressing p95 ErbB2 - The truncated ErbB2 receptor (p95 | 01-27-2011 |
20110020336 | Combination Of A Beta-Glucan And An EGF Receptor Antagonist For The Treatment Of Cancer And Infection - The present invention encompasses a therapeutic combination composition of a β-glucan EGF receptor antagonist. This therapeutic combination composition is useful for the treatment of diseases including proliferative disorders and immune dysfunction. | 01-27-2011 |
20110020337 | METHODS FOR TREATING CONDITIONS ASSOCIATED WITH MASP-2 DEPENDENT COMPLEMENT ACTIVATION - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 01-27-2011 |
20110020338 | 5Imidazoquinolines and Pyrimidine Derivatives as Potent Modulators of VEGF-Driven Angiogenic Processes - The invention relates to the use of compounds of formula (I) or (II) | 01-27-2011 |
20110020339 | METHODS OF TREATMENT - The present invention relates generally to the methods for the treatment and diagnosis of conditions mediated by IL-5 and excess eosinophil production, and more specifically to mAbs, Fabs, chimeric and humanized antibodies. More particularly, the present invention relates generally to the treatment of eosinophilic bronchitis with an anti-IL-5 antibody or fragment thereof. | 01-27-2011 |
20110027265 | Methods and Compositions Related to Immunizing Against Staphylococcal Lung Diseases and Conditions - Embodiments of the invention include methods and compositions useful in a vaccination strategy capable of neutralizing HIa to provide immunoprotection against | 02-03-2011 |
20110027266 | Humanized anti-CXCR5 antibodies, derivatives thereof and their use - The present invention relates to humanized antibodies that specifically bind to CXCR5 and can, for example, inhibit CXCR5 function. The invention also includes uses of the antibodies to treat or prevent CXCR5 related diseases or disorders. | 02-03-2011 |
20110027267 | Fusion Proteins of Mannose Binding Lectins for Treatment of Disease - Fusion proteins having sequences that target specific moieties such as carbohydrates, lipids, and/or proteins that are associated with certain cell types and/or pathogens; and a sequence that induces effector function are provided. The disclosure also provides nucleic acids encoding the fusion proteins, as well as pharmaceutical compositions, methods of use, and methods of treating conditions or diseases such as infectious diseases, cancers, immune related disorders and other ailments, that include the fusions proteins described herein. | 02-03-2011 |
20110027268 | ANTI-MESOTHELIN ANTIBODIES AND USES THEREOF - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for the membrane-anchored, 4O.kDa mesothelin polypeptide, which is overexpressed in several tumors, such as pancreatic and ovarian tumors, mesothelioma and lung cancer cells. These antibodies, accordingly, can be used to treat these and other disorders and conditions. Antibodies of the invention also can be used in the diagnostics field, as well as for further investigating the role of mesothelin in the progression of disorders associated with cancer. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. | 02-03-2011 |
20110027269 | 14-3-3 Antagonists for the Prevention and Treatment of Arthritis - Methods for treating arthritis comprising 14-3-3 antagonists that are capable of specifically binding to extracellularly localized 14-3-3 eta and/or 14-3-3 gamma protein isoforms are provided. In preferred embodiments, the 14-3-3 antagonist is an inhibitory peptide or an anti-14-3-3 antibody. The 14-3-3 antagonists are also formulated in a pharmaceutical composition and used in a method for reducing matrix metalloprotease (MMP) expression in the synovial fluid of a patient, wherein the MMP is MMP-1 or MMP-3. | 02-03-2011 |
20110027270 | MONOCLONAL ANTIBODIES AGAINST INFLUENZA VIRUS GENERATED BY CYCLICAL ADMINISTRATION AND USES THEREOF - Provided herein are methods of producing neutralizing monoclonal antibodies, by cyclical immunization, that cross-react with strains of Influenza virus of the same subtype or different subtypes. Also provided herein are compositions comprising such antibodies and methods of using such antibodies to diagnose, prevent or treat Influenza virus disease. | 02-03-2011 |
20110027271 | ANTIBODY COMPOSITION EXHIBITING CELLULAR CYTOTOXICTY DUE TO GLYCOSYLATION - The present invention relates to a cell for the production of an antibody molecule such as an antibody useful for various diseases having high antibody-dependent cell-mediated cytotoxic activity, a fragment of the antibody and a fusion protein having the Fc region of the antibody or the like, a method for producing an antibody composition using the cell, the antibody composition and use thereof. | 02-03-2011 |
20110027272 | STABILIZED LIQUID ANTI-RSV ANTIBODY FORMULATIONS - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 02-03-2011 |
20110027273 | IMMUNOTHERAPY OF AUTOIMMUNE DISORDERS - Compositions and methods for treating autoimmune diseases are described. In particular, the use of B cell depleting agents and cytotoxic drug/B cell depleting agent conjugates with a drug loading significantly higher than in previously reported procedures and with decreased aggregation and low conjugate fraction (LCF) in treating autoimmune diseases is described. Combination therapies and compositions for treating autoimmune diseases, including the B cell depleting agents, conjugates and/or anti-cytokine agents, are also described. | 02-03-2011 |
20110027274 | ANTIPROLIFERATIVE COMPOUNDS, CONJUGATES THEREOF, METHODS THEREFOR, AND USES THEREOF - Antiproliferative compounds having a structure represented by formula (II), where n, R | 02-03-2011 |
20110027275 | INHIBITION OF TUMOR METASTASIS - The present invention relates generally to the inhibition of angiogenesis and tumor metastasis. In particular, the invention concerns the prevention or treatment of tumor metastasis using G-CSF antagonists, such as G-CSF antibodies and Bv8 antagonists, such as anti-Bv8 antibodies and anti-PKR1 antibodies. | 02-03-2011 |
20110027276 | Optimized CD40 Antibodies and Methods of Using the Same - The present invention describes humanized antibodies that target CD40, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 02-03-2011 |
20110027277 | PREDICTIVE MARKER FOR TOPOISOMERASE I INHIBITORS - The present invention generally relates to the fields of cancer therapy and cancer prevention. More particularly, the present invention generally relates to a diagnostic marker for predicting the efficacy of topoisomerase I (topo I) inhibitors in the treatment of cancers. More specifically, the present invention relates to methods, machines, computer systems, computable readable media and kits which can be used to identify and determine the effectiveness of topoisomerase I (topo I) inhibitors in the treatment of cancers, and in some embodiments, the level of sensitivity or resistance of a tumor cell to a topoisomerase I inhibitor, such as camptothecin (CPT), or CTP analogues such as topotecan and irinotecan and derivatives thereof. More specifically, the present invention related to methods, machines, computer systems, computable readable media and kits which can be used to determine the presence of phosphorylation of topoisomerase I polypeptide, in some embodiments phosphorylation at residue serine 10 (S10) of a topoisomerase I polypeptide, wherein the presence of phosphorylation, in particular the phosphorylation at serine 10 of a topoI polypeptide indicates a cancer is likely to be unresponsive to a topo I inhibitor, whereas the absence of phosphorylation, in particular, the absence of phosphorylation at residue serine 10 (S10) identifies a cancer is likely to be responsive to a topo I inhibitor. Other aspect of the present invention relate to phospho-serine 10 topoisomerase I antibodies and other protein binding moieties, and uses thereof. | 02-03-2011 |
20110033446 | Treatment of HIV-1-infected individuals to reduce risk of coronary artery disease and suppress virus replication - The present invention provides novel methods for treating and preventing coronary artery disease in HIV-1-infected individuals by interfering with Nef-mediated effect on ABCA1. The invention further provides novel methods for suppressing HIV infection by stimulating cholesterol efflux from cells by stimulating expression of ABCA1 in HIV-1-infected individuals. These methods take advantage of the finding that Nef, a regulatory protein of HIV-1, (1) diminishes expression of ATP-binding cassette transporter A1 (ABCA1), the main transporter of cholesterol from cells to extracellular acceptors; and (2) impairs cholesterol efflux from HIV-1-infected macrophages leading to cholesterol accumulation and formation of foam cells, which is a characteristic feature of atherosclerosis. | 02-10-2011 |
20110033447 | Methods for Treating Osteoarthritis Pain By Administering a Nerve Growth Factor Antagonist and Compositions Containing the Same - The invention concerns anti-NGF antibodies (such as anti-NGF antagonist antibodies), and polynucleotides encoding the same. The invention further concerns use of such antibodies and/or polynucleotides in the treatment and/or prevention of pain, including post-surgical pain, rheumatoid arthritis pain, and osteoarthritis pain. | 02-10-2011 |
20110033448 | Inhibitors of LL-37 Mediated Immune Reactivity to Self Nucleic Acids - Methods and compositions for treating disease are provided. More particularly, methods and compositions of inhibiting pathogenic interferon production are prevented, which may be useful in the treatment of various diseases. In other embodiments, therapeutic compounds and methods for the treatment of autoimmune diseases and chronic inflammatory diseases are provided. One such method is a method for inhibiting pathogenic interferon production or inhibiting activation of plasmacytoid dendritic cells or treating an autoimmune or chronic inflammatory disease, which comprises inhibiting one or more of LL-37 and hCAP18. | 02-10-2011 |
20110033449 | Human immune therapies using a CD27 agonist alone or in combination with other immune modulators - Methods of inducing T cell proliferation and expansion in vivo for treating conditions wherein antigen-specific T cell immune response are therapeutically desirable such as cancer, infection, inflammation, allergy and autoimmunity and for enhancing the efficacy of vaccines are provided. These methods comprise the administration of at least one CD27 agonist, preferably an agonistic CD27 antibody, alone or in association with another moiety such as immune stimulant or immune modulator such as an anti-CD40, OX-40, 4-IBB, or CTLA-4 antibody or an agent that depletes regulatory cells, or a cytokine. These mono and combination therapies may also optionally include the administration of a desired antigen such as a tumor antigen, an allergen, an autoantigen, or an antigen specific to an infectious agent or pathogen against which a T cell response (often CD8+) is desirably elicited. | 02-10-2011 |
20110033450 | Antibody Against Anthrax Toxins - The invention relates to an anti PA antibody, in which the variable region of the heavy chain has an amino acid sequence represented by SEQ ID N°1 and in which the variable sequence of the light chain has an amino acid sequence represented by SEQ ID N°2, that is modified in order to improve its affinity and its tolerance in human beings. | 02-10-2011 |
20110033451 | INTERLEUKIN-17F ANTIBODIES AND OTHER IL-17F SIGNALING ANTAGONISTS AND USES THEREFOR - The present invention provides isolated and purified polynucleotides and polypeptides related to the IL-17F signaling pathway. The invention also provides antibodies to IL-17F homodimers and IL-17A/IL-17F heterodimers, and methods of isolating and purifying members of the IL-17 family, including IL-17A/IL-17F heterodimers, from a natural source. The present invention also is directed to novel methods for diagnosing, prognosing, monitoring the progress of, and treating and/or preventing disorders related to IL-17F signaling, i.e., IL-17F-associated disorders, including, but not limited to, inflammatory disorders, such as autoimmune diseases (e.g., arthritis (including rheumatoid arthritis), psoriasis, systemic lupus erythematosus, and multiple sclerosis), respiratory diseases (e.g., COPD, cystic fibrosis, asthma, allergy), transplant rejection (including solid organ transplant rejection), and inflammatory bowel diseases or disorders (IBDs, e.g., ulcerative colitis, Crohn's disease). The present invention is further directed to novel therapeutics and therapeutic targets, and to methods of screening and assessing test compounds for the intervention (treatment) and prevention of disorders related to IL-17F signaling. | 02-10-2011 |
20110033452 | Anti-Glypican 3 Antibody Having Modified Sugar Chain - An anti-glypican 3 antibody with modified sugar chains, more specifically, an anti-glypican 3 antibody lacking fucose is provided. The anti-glypican 3 antibody with modified sugar chains of the present invention may be produced by a process comprising introducing a nucleic acid encoding an anti-glypican 3 antibody into host cells with reduced fucose addition capability, such as YB2/0 cells and cells lacking a fucose transporter. The anti-glypican 3 antibody with modified sugar chains of the present invention has a high level of cytotoxic activity and therefore is useful as a cell growth inhibitor such as an anticancer agent. | 02-10-2011 |
20110033453 | USE OF PYRIMIDINE DERIVATIVES FOR THE TREATMENT OF EGFR DEPENDENT DISEASES OR DISEASES THAT HAVE ACQUIRED RESISTANCE TO AGENTS THAT TARGET EGFR FAMILY MEMBERS - The present invention relates to the use of compounds of formula (I) | 02-10-2011 |
20110033454 | Methods For Treating Diseases Using Antibodies to Aminophospolipids - Disclosed are surprising discoveries concerning the role of anionic phospholipids and aminophospholipids in tumor vasculature and in viral entry and spread, and compositions and methods for utilizing these findings in the treatment of cancer and viral infections. Also disclosed are advantageous antibody, immunoconjugate and duramycin-based compositions and combinations that bind and inhibit anionic phospholipids and aminophospholipids, for use in the safe and effective treatment of cancer, viral infections and related diseases. | 02-10-2011 |
20110033455 | Methods For Inhibiting The Binding Of Endosialin To Ligands - The invention provides methods for inhibiting the interaction of endosialin with endosialin ligands. The inhibition is effectuated on the genetic level, by inhibiting endosialin gene expression, and on the protein level, by blocking the interaction of cell-surface expressed endosialin with ligands such as fibronectin and collagen. The invention provides methods for identifying inhibitors of the interaction of endosialin with endosialin ligands. Also provided are methods for inhibiting angiogenesis and neovascularization in vivo and in vitro. | 02-10-2011 |
20110033456 | METHODS OF THERAPY FOR B-CELL MALIGNANCIES USING ANTAGONIST ANTI-CD40 ANTIBODIES - Methods of therapy for B-cell malignancies are provided. The methods comprise administering a therapeutically effective amount of an antagonist anti-CD40 antibody or antigen-binding fragment thereof to a patient in need thereof. The antagonist anti-CD40 antibody or antigen-binding fragment thereof is free of significant agonist activity when the antibody binds a CD40 antigen on a normal human B cell, exhibits antagonist activity when the antibody binds a CD40 antigen on a malignant human B cell, and can exhibit antagonist activity when the antibody binds a CD40 antigen on a normal human B cell. Antagonist activity of the anti-CD40 antibody or antigen-binding fragment thereof beneficially inhibits proliferation and/or differentiation of malignant human B cells. | 02-10-2011 |
20110033457 | COMBINATION OF EPOTHILONE ANALOGS AND CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF PROLIFERATIVE DISEASES - Compositions and methods are disclosed which are useful of the treatment and prevention of proliferative disorders. | 02-10-2011 |
20110033458 | COMBINATIONS COMPRISING EPOTHILONES AND PHARMACEUTICAL USES THEREOF - The invention relates to a pharmaceutical combination which comprises (a) a HER-1 or a HER-2 antibody or (b) at least one antineoplastic agent selected from the group consisting of aromatase inhibitors, antiestrogens, topoisomerase I inhibitors, topoisomerase II inhibitors, microtubule active agents, protein kinase C inhibitors, anti-angiogenic compounds, gonadorelin agonists, anti-androgens, histone deacetylase inhibitors and S-adenosylmethionine decarboxylase inhibitors; and (c) an epothilone derivative of formula I | 02-10-2011 |
20110033459 | COMBINATION THERAPY WITH A COMPOUND ACTING AS A PLATELET ADP RECEPTOR INHIBITOR - The present invention is directed to pharmaceutical compositions and methods of using combination therapies containing [4-(6-fluoro-7-methylamino-2,4-dioxo-1,4-dihydro-2H-quinazolin-3-yl)-phenyl]-5-chloro-thiophen-2-yl-sulfonylurea, or a pharmaceutically acceptable salt thereof, for the treatment of thrombosis diseases. | 02-10-2011 |
20110033460 | ANTI-ErbB2 ANTIBODIES - Anti-ErbB2 antibodies are described which bind to an epitope in Domain 1 of ErbB2 and induce cell death via apoptosis. Various uses for these antibodies are also described. | 02-10-2011 |
20110033461 | Combination Therapy for the Treatment of Cancer - Compositions which act synergistically to inhibit the growth of cancer cells and methods of use thereof are disclosed. | 02-10-2011 |
20110033462 | HUMANIZED MONOCLONAL ANTIBODIES THAT SPECIFICALLY BIND AND/OR NEUTRALIZE JAPANESE ENCEPHALITIS VIRUS (JEV) AND THEIR USE - Disclosed herein are isolated humanized monoclonal antibodies that specifically bind Japanese encephalitis virus (JEV) with a binding affinity of about 1.0 nM or less. Nucleic acids encoding these antibodies, expression vectors including these nucleic acid molecules, and isolated host cells that express the nucleic acid molecules are also disclosed. Methods of treating, preventing, and/or ameliorating JEV infection in a subject with JEV also are disclosed. Additionally, the antibodies can be used to detect JEV in a sample, and methods of diagnosing JEV infection, or confirming a diagnosis of JEV infection in a subject, are disclosed herein that utilize these antibodies. | 02-10-2011 |
20110038854 | STRATEGY FOR HOMO- OR HETERO-DIMERIZATION OF VARIOUS PROTEINS IN SOLUTION AND IN CELL - The present invention describes a chimeric polypeptide comprising a first portion comprising a receptor domain, wherein the receptor domain comprises an intracellular region and a transmembrane region; and a second portion comprising a dimerization domain. The present invention also describes a chimeric polypeptide comprising a first portion comprising a receptor domain, wherein the receptor domain comprises a receptor extracellular region; and a second portion comprising a dimerization domain, wherein the dimerization domain comprises an antibody heavy chain region of a Fab fragment or an antibody light chain region. Polynucleotides encoding the chimeric polypeptides and methods of use of the chimeric polypeptides are also described. | 02-17-2011 |
20110038855 | TRAIL AND METHODS OF MODULATING T CELL ACTIVITY AND ADAPTIVE IMMUNE RESPONSES USING TRAIL - Methods of modulating a T cell response are provided. Methods include, among other things, contacting a T cell that expresses TNF-related apoptosis-inducing ligand (TRAIL, Apo-2L) or TRAIL receptor (DR4 or DR5) with a molecule that binds to TRAIL (Apo-2L), a molecule that binds to TRAIL receptor (DR4 or DR5), or with a soluble TRAIL (Apo-2L) reagent. | 02-17-2011 |
20110038856 | METHODS OF TREATING NEOPLASTIC, AUTOIMMUNE AND INFLAMMATORY DISEASES - Methods of treating cancer and autoimmune and inflammatory diseases are provided. | 02-17-2011 |
20110038857 | NOVEL AZA-BICYCLIC COMPOUNDS AND THEIR USE AS STIMULATORS OF SOLUBLE GUANYLATE CYCLASE - The present application relates to novel azabicyclic compounds, processes for their preparation, their use alone or in combinations for the treatment and/or prevention of diseases, and their use for producing medicaments for the treatment and/or prevention of diseases, especially for the treatment and/or prevention of cardiovascular disorders. | 02-17-2011 |
20110038858 | METHODS OF TREATING HEMATOLOGIC CANCERS USING PNP INHIBITORS SUCH AS FORODESINE IN COMBINATION WITH ALKYLATING AGENTS OR ANTI-CD20 AGENTS - The present application relates to treatment of hematologic cancers, which treatments can include, e.g., administration of a purine nucleoside phosphorylase (PNP) inhibitor, an alkylating agent and/or an anti-CD20 agent, and related compositions and kits. | 02-17-2011 |
20110038859 | METHODS FOR THE TREATMENT OF IL-1BETA RELATED DISEASES - Disclosed are methods for the treatment and/or prevention of Type 2 diabetes, insulin resistance and disease states and conditions characterized by insulin resistance, obesity, hyperglycemia, hyperinsulinemia and Type 1 diabetes, comprising administering to a subject an effective amount of anti-IL-1β antibody or fragment thereof. | 02-17-2011 |
20110038860 | METHODS FOR INHIBITION OF POLYCLONAL B CELL ACTIVATION AND IMMUNOGLOBULIN CLASS SWITCHING TO PATHOGENIC AUTOANTIBODIES BY BLOCKING CD1-MEDIATED INTERACTIONS - Pathogenic polyclonal B cell activation and immunoglobulin class switching to pathogenic autoantibodies is inhibited by binding molecules that specifically interfere with CD1 antigen, but do not activate signaling (blocking agents), or by molecules that bind to the T cell antigen receptor on T cells that recognize CD1. When CD1 mediated signaling is thus blocked, the T cell response is diminished, resulting in reduced polyclonal B cell activation and reduced immunoglobulin class switching to pathogenic autoantibodies. | 02-17-2011 |
20110038861 | Methods of Treating Alzheimer's Disease Using Antibodies Directed Against Amyloid Beta Peptide and Compositions Thereof - Monoclonal antibodies directed against amyloid beta peptide and methods of using same for treatment and prevention of Alzheimer's disease and Down's syndrome are described. | 02-17-2011 |
20110038862 | METHOD AND KIT FOR THE DETECTION OF GENES ASSOCIATED WITH PIK3CA MUTATION AND INVOLVED IN PI3K/AKT PATHWAY ACTIVATION IN THE ER-POSTITIVE AND HER2-POSITIVE SUBTYPES WITH CLINICAL IMPLICATIONS - A method to determine the clinical outcome of breast tumour affecting a patient if treated with an antitumoural agent against breast tumour. The method includes the step of assaying a sample of a breast tumour from the patient for an expression level of selected genes, by contacting mRNA sequences from the cells of this breast tumour with a set of more than 3 nucleotide sequences related to human mutated PIK3CA. | 02-17-2011 |
20110038863 | METHODS AND COMPOSITIONS FOR IMPROVING RECOMBINANT PROTEIN PRODUCTION - Nucleic acid molecules modified to enhance recombinant protein, e.g., antibody, expression and/or reduce or eliminate mis-spliced and/or intron read-through (IRT) by-products are disclosed. The invention also provides methods for producing proteins devoid of mis-spliced and/or intron read-through by-products by the use of such vectors in host cells under cell culture conditions suitable for recombinant protein expression. | 02-17-2011 |
20110038864 | Antibodies Against Cancer Antigen TMEFF2 and Uses Thereof - Described herein are methods and compositions that can be used for diagnosis and treatment of cancer. | 02-17-2011 |
20110044975 | TREATMENT OF PRION PROTEIN RELATED DISEASES - According to the present invention, treatment of prion protein related diseases, and in particular cancer tumours, is effected by providing to a subject in need thereof a therapeutically effective amount of an agent capable of modulating binding of a prion protein and/or a prion-like protein to a disease related GAG and/or HSPG. | 02-24-2011 |
20110044976 | HUMANIZED ANTIBODIES - Humanized antibodies that bind ICAM-1 are provided. Antibodies include those selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI). Subsequences of the humanized antibodies capable of binding an ICAM-1 epitope are also provided. Methods of inhibiting pathogen infection (e.g., HRV) of a cell employing humanized antibodies capable of binding an ICAM-1 epitope are further provided. | 02-24-2011 |
20110044977 | Subcutaneous anti-HER2 antibody formulations and uses thereof - The present invention relates to a highly concentrated, stable pharmaceutical formulation of a pharmaceutically active anti-HER2 antibody, such as e.g. Trastuzumab (HERCEPTIN™), Pertuzumab or T-DM1, or a mixture of such antibody molecules for subcutaneous injection. In particular, the present invention relates to formulations comprising, in addition to a suitable amount of the anti-HER2 antibody, an effective amount of at least one hyaluronidase enzyme as a combined formulation or for use in form of a co-formulation. The formulations comprise additionally at least one buffering agent, such as e.g. a histidine buffer, a stabilizer or a mixture of two or more stabilizers (e.g. a saccharide, such as e.g. α,α-trehalose dihydrate or sucrose, and optionally methionine as a second stabilizer), a nonionic surfactant and an effective amount of at least one hyaluronidase enzyme. Methods for preparing such formulations and their uses thereof are also provided. | 02-24-2011 |
20110044978 | METHOD FOR TREATING BONE FRACTURE - The invention provides a method of enhancing bone fracture healing involving administering a sclerostin inhibitor. In one aspect, the invention includes use of a therapeutically effective amount of sclerostin binding agent to treat a bone fracture, wherein one or more administrations of the sclerostin binding agent are administered over a treatment period lasting at least two weeks and beginning within two weeks of the fracture. | 02-24-2011 |
20110044979 | DOMAIN ANTIBODY CONSTRUCT - The present invention provides a domain antibody construct which binds to human TNF-α, with the construct comprising:
| 02-24-2011 |
20110044980 | Dual Variable Domain Immunoglobulins and Uses Thereof - The present invention relates to engineered multivalent and multispecific binding proteins, methods of making, and specifically to their uses in the prevention, diagnosis, and/or treatment of disease. | 02-24-2011 |
20110044981 | METHODS AND COMPOSITIONS FOR TREATMENT OF PULMONARY FIBROTIC DISORDERS - Disclosed herein are methods and compositions for preventing and treating pulmonary fibrotic disorders, and for reducing or reversing the symptoms of pulmonary fibrotic disorders, such as idiopathic pulmonary fibrosis. The compositions include inhibitors of the LOXL2 protein, and the methods include methods for making and using the inhibitors. | 02-24-2011 |
20110044982 | MULTIFUNCTIONAL LINKER PROTEIN CONTAINING AN ANTIBODY AGAINST HEMAGGLUTININ, A CONSERVED INFLUENZA ANTIGEN AND AN IMMUNOSTIMULATING CARRIER BINDING DOMAIN - The invention relates to the field of immunology and vaccines. In particular, it relates to proteinaceous substances and the uses thereof in vaccines against infections caused by respiratory pathogens. | 02-24-2011 |
20110052570 | METHOD TO PROGNOSE RESPONSE TO ANTI-EGFR THERAPEUTICS - The present invention provides methods to determine the likelihood of effectiveness of an EGFR targeting treatment in a subject affected with a tumor based on the expression of EGFR of endothelial cells associated with the tumor. The present invention also provides methods of treating a subject affected with, or at risk for developing cancer with an EGFR targeting treatment and methods to screen for an EGFR targeting treatment. | 03-03-2011 |
20110052571 | METHOD FOR TREATING IDIOPATHIC THROMBOCYTOPENIC PURPURA USING MONOCLONAL ANTIBODIES - The invention concerns a method for obtaining and selecting monoclonal antibodies by an ADDC-type test, said antibodies capable of activating type III Fcγ receptors and having a particular glycan structure. The inventive anti-D antibodies can be used for preventing Rhesus isoimmunisation in Rh negative persons, in particular for haemolytic disease in a new-born baby or for uses such as idiopathic thrombocytopenic purpura (ITP). | 03-03-2011 |
20110052572 | REGULATORS OF MMP-9 AND USES THEROF - A method of regulating an activity of metalloproteinase 9 (MMP-9) is disclosed. The method comprises contacting the MMP-9 with an agent which specifically interacts with an OG domain of the MMP-9. Molecules capable of specifically interacting with the OG domain, methods of identifying same, pharmaceutical compositions comprising same and uses thereof are also disclosed. | 03-03-2011 |
20110052573 | 14-3-3 ETA Antibodies and Uses Thereof for the Diagnosis and Treatment of Arthritis - The invention provides anti-14-3-3 eta antibodies that specifically bind to the human 14-3-3 eta protein isoform in its natural configuration while exhibiting selectivity over human 14-3-3 alpha, beta, delta, epsilon, gamma, tau, and zeta protein isoforms. Methods, kits and pharmaceutical compositions comprising said specific anti-14-3-3 eta antibodies are further provided for the diagnosis and treatment of arthritis. | 03-03-2011 |
20110052574 | METHOD OF INHIBITION OF LEUKEMIC STEM CELLS - A method for inhibition of leukemic stem cells expressing IL-3Rα; (CD 123), comprises contacting the cells with an antigen binding molecule comprising a Fc region or a modified Fc region having enhanced Fc effector function, wherein the antigen binding molecule binds selectively to IL-3Rα (CD123). The invention includes the treatment of a hematologic cancer condition in a patient by administration to the patient of an effective amount of the antigen binding molecule. | 03-03-2011 |
20110052575 | ANTI-VEGF ANTIBODIES - Humanized and variant anti-VEGF antibodies and various uses therefor are disclosed. The anti-VEGF antibodies have strong binding affinities for VEGF; inhibit VEGF-induced proliferation of endothelial cells in vitro; and inhibit tumor growth in vivo. | 03-03-2011 |
20110052576 | VEGF-SPECIFIC ANTAGONISTS FOR ADJUVANT AND NEOADJUVANT THERAPY AND THE TREATMENT OF EARLY STAGE TUMORS - Disclosed herein are methods of treating benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating a subject at risk of developing benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating or preventing recurrence of a tumor using an anti-VEGF-specific antagonist as well as use of VEGF-specific antagonists in neoadjuvant and adjuvant cancer therapy. | 03-03-2011 |
20110052577 | Antibodies - The use of an ScFv Ab (ScFv Ab) capable of recognising a disease associated molecule (DAM) in the manufacture of a medicament for the prevention and/or treatment of a disease condition associated with a DAM is described. The ScFv Ab has therapeutic, diagnostic and prognostic applications. | 03-03-2011 |
20110052578 | Compounds and Compositions as Protein Kinase Inhibitors - The present invention provides compounds of Formula I or II: | 03-03-2011 |
20110052579 | Ligands of the Natural Killer (NK) Cell Surface Marker CD27 and Therapeutic Uses Thereof, - The present invention relates to the modulation of Natural Killer (NK) cells in vitro or in vivo through the use of activating or inhibiting ligands of CD27, such as antibodies, for a regulation of the immune response against several different diseases, such as viral infections, cancer, bacterial infections, sepsis as well as immunological diseases. In a preferred embodiment, the inventors were able to improve the host resistance against Influenza virus and cancer through the application of anti-CD27 antibodies. In a different setting the inventors were able to prevent the onset of a lethal bacterial sepsis by preventing the activation of NK cells via CD27. The invention furthermore relates to screening assays for ligands of the surface marker CD27. | 03-03-2011 |
20110052580 | USE OF PICOPLATIN AND BEVACIZUMAB TO TREAT COLORECTAL CANCER - The invention provides a method of treatment of metastatic colorectal cancer by administration of the anti-cancer platinum drug picoplatin in conjunction with bevacizumab (Avastin®) and optionally, with 5-FU and leucovorin in a variety of treatment regimens. The invention also provides a use of picoplatin in conjunction with bevacizumab and, optionally, 5-FU and leucovorin, for the treatment of metastatic colorectal cancer. | 03-03-2011 |
20110052581 | USE OF PICOPLATIN AND CETUXIMAB TO TREAT COLORECTAL CANCER - The invention provides a method of treatment of metastatic colorectal cancer by administration of the anti-cancer platinum drug picoplatin in conjunction with cetuximab, 5-FU, and leucovorin in a variety of treatment regimens. The invention also provides a use of picoplatin in conjunction with cetuximab, 5-FU, and leucovorin for treatment of metastatic colorectal cancer. The invention further provides kits adapted for administration of picoplatin in conjunction with cetuximab. Also, methods for determining dosage regimens for patients afflicted with a cancer comprising EGFR are provided. | 03-03-2011 |
20110052582 | Humanized Anti-CDCP1 Antibodies - The present invention relates to humanized antibodies against human CDCP1 (anti-CDCP1 antibody), methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof. | 03-03-2011 |
20110052583 | PYRIDINONE COMPOUNDS - The invention is directed to pyridinone compounds useful for modulating Met kinase, having the following structure: | 03-03-2011 |
20110052584 | METHOD OF ENHANCEMENT OF CYTOTOXICITY IN ANTIBODY MEDIATED IMMUNE RESPONSES - The present invention is related to enhancing the function of anti-tumor antibodies by regulating FcγRIIB-mediated activity. In particular, disrupting SHIP activation by FcγRIIB enhances cytotoxicity elicited by a therapeutic antibody in vivo in a human. The invention further provides an antibody, e.g., an anti-tumor antibody, with a variant Fc region that results in binding of the antibody to FcγRIIB with reduced affinity. A variety of transgenic mouse models demonstrate that the inhibiting FcγRIIB molecule is a potent regulator of cytotoxicity in vivo. | 03-03-2011 |
20110059069 | Gapr-1 Methods - Methods of treatment, diagnosis and screening related to GAPR-1 are disclosed. | 03-10-2011 |
20110059070 | Combination therapy for tumoral desease treatment - The invention provides a method of treating cancer by administering to a subject in need thereof, the subject being treated with an anti-cancer antibody therapy, a therapeutically effective amount of a delocalized lipophilic cation (DLC) compound such as MKT-077 which is capable of binding mortalin as an adjuvant for the anti-cancer antibody therapy. Also provided are pharmaceutical compositions and article of manufacturer for treating cancer which comprise the DLC compound as an adjuvant for anti-cancer antibody therapy. | 03-10-2011 |
20110059071 | USE OF CD28-SPECIFIC MONOCLONAL ANTIBODIES FOR PRODUCING A PHARMACEUTICAL COMPOSITION FOR TREATING VIRUS INFECTIONS - The invention relates to the use of monoclonal antibodies which are specific for CD28 and activate the T lymphocytes of several up to all subgroups without the occupation of an antigen receptor of the T lymphocytes and which therefor activate said lymphocytes in an antigen unspecific manner or the invention relates to the use of an analogue thereof for producing a pharmaceutical composition in the form of a preparation or a preparation packet for treating virus infections in humans or lower warm-blooded animals having infected T lymphocytes. The pharmaceutical composition additionally contains a virus inhibitor. The invention also relates to a corresponding pharmaceutical composition and a treatment plan including the pharmaceutical composition. | 03-10-2011 |
20110059072 | METHOD FOR TREATING CANCER USING MONOCLONAL ANTIBODIES - The invention concerns a method for obtaining and selecting monoclonal antibodies by an ADDC-type test, said antibodies capable of activating type III Fcγ receptors and having a particular glycan structure. The inventive anti-D antibodies can be used for preventing Rhesus isoimmunisation in Rh negative persons, in particular for haemolytic disease in a new-born baby or for uses such as idiopathic thrombocytopenic purpura (ITP). | 03-10-2011 |
20110059073 | METHOD FOR TREATING INFECTIOUS DISEASE USING MONOCLONAL ANTIBODIES - The invention concerns a method for obtaining and selecting monoclonal antibodies by an ADDC-type test, said antibodies capable of activating type III Fcγ receptors and having a particular glycan structure. The inventive anti-D antibodies can be used for preventing Rhesus isoimmunisation in Rh negative persons, in particular for haemolytic disease in a new-born baby or for uses such as idiopathic thrombocytopenic purpura (ITP). | 03-10-2011 |
20110059074 | Knowledge-Based Proliferation Signatures and Methods of Use - The present invention provides methods and compositions for predicting patient responses to cancer treatment using a proliferation gene signature. These methods can comprise measuring in a biological sample from a patient the levels of gene expression of a group of the genes designated herein. The present invention also provides for microarrays that can detect expression from a group of genes. | 03-10-2011 |
20110059075 | AGLYCOSYLATED IMMUNOGLOBULIN MUTANTS - The present invention is based, in part, on our discovery of immunoglobulins (e.g., immunoglobulin G (IgG)) polypeptides (e.g., murine or human IgG, such as human IgG1) that are aglycosylated yet retain the ability to bind to an Fc receptor, such as an activating Fc receptor (e.g., Fcy RIIA and/or FcyRIIIA). | 03-10-2011 |
20110059076 | HUMAN SERUM ALBUMIN LINKERS AND CONJUGATES THEREOF - Disclosed is a human serum albumin (HSA) linker and HSA linker with binding, diagnostic, and therapeutic agents conjugated thereto. Also disclosed is a conjugate in which the HSA linker is covalently bonded to amino and carboxy terminal binding moieties that are first and second single-chain Fv molecules (scFvs). Exemplified conjugates are useful, e.g., in reducing tumor cell proliferation, e.g., for therapeutic therapeutic applications. Also disclosed are methods and kits for the diagnostic and therapeutic application of an HSA linker conjugate. | 03-10-2011 |
20110059077 | HUMANIZED ANTI-HUMAN ALPHA 9-INTEGRIN ANTIBODY - The present invention provides a humanized anti-human α9 integrin antibody having improved activity and/or property as compared to a donor mouse anti-human α9 integrin antibody, namely, a humanized anti-human α9 integrin antibody containing a heavy-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:11 and a light-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:17, a humanized anti-human α9 integrin antibody containing a heavy-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:13 and a light-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:17, a humanized anti-human α9 integrin antibody containing a heavy-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:15 and a light-chain variable region consisting of the amino acid sequence shown by SEQ ID NO:9, and a means for the prophylaxis or treatment of various diseases involving human α9 integrin in the pathogenesis, which uses the antibody. | 03-10-2011 |
20110059078 | ANTI-IFNAR1 ANTIBODIES WITH REDUCED FC LIGAND AFFINITY - The invention provides anti-IFNAR1 antibodies with reduced affinity for Fc receptors and/or ligands and methods of making and using such antibodies. | 03-10-2011 |
20110059079 | Antibody Coformulations - This invention relates to stable formulations of multiple antibodies comprising a plurality of antibodies and an effective amount of a succinate buffer wherein the pH of the formulation is between about 4.5 and about 7.0. | 03-10-2011 |
20110059080 | USE OF AN ANTI-IL6 ANTIBODY TO DECREASE HEPCIDIN IN CANCER PATIENTS - A method of reducing serum hepcidin in a patent having a malignancy or lymphoproliferative disorder by administering an IL-6 neutralizing antibody. | 03-10-2011 |
20110059081 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF RECEPTOR TYROSINE KINASE MEDIATED DISEASES OR DISORDERS - The present disclosure provides methods and compositions for treating a disease or disorder in a subject, the method comprising, administering to the subject a therapeutically effective amount of one or more receptor tyrosine kinase inhibitors and a therapeutically effective amount of one or more inhibitors of the dihydrofolate reductase (DHFR) pathway including, for example, methyltransferase inhibitors. | 03-10-2011 |
20110059082 | AGENT FOR TREATING DISEASE - The present invention provides a pharmaceutical composition for treating an autoimmune disease comprising a pharmaceutically acceptable carrier and an agent capable of activating CD4+CD25+ regulatory T cells, wherein the composition is to be administered to a subject in a dose of the agent from 10 mg to 200 mg. | 03-10-2011 |
20110059083 | AGENT FOR TREATING DISEASE - The present invention provides pharmaceutical composition for treating an autoimmune disease comprising a pharmaceutically acceptable carrier and an agent capable of activating CD4+CD25+ regulatory T cells, wherein the composition is to be administered to a subject at most every 3 days. | 03-10-2011 |
20110059084 | AGENT FOR TREATING DISEASE - The present invention provides a pharmaceutical composition for treating an autoimmune disease comprising a pharmaceutically acceptable carrier and an agent capable of activating CD4+CD25+ regulatory T cells, wherein the composition is to be administered to a subject in a dose of the agent from 0.2 mg to 30 mg. | 03-10-2011 |
20110059085 | Staphylococcus aureus-specific antibody preparations - A new antibody-based strategy for treating or preventing | 03-10-2011 |
20110064727 | Immunoglobulin Variants Outside the Fc Region - The present invention relates to antibody variants outside the Fc region that alter binding affinity to one or more effector ligands, methods for their generation, and their therapeutic application. | 03-17-2011 |
20110064728 | IL-17 Homologous Polypeptides and Therapeutic Uses Thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 03-17-2011 |
20110064729 | ADMINISTRATION OF AGENTS FOR THE TREATMENT OF INFLAMMATION - A method of chronically reducing a patient's pathological inflammation via the administration of an agent that specifically binds to an alpha-4 integrin or a dimer comprising an alpha-4 integrin is disclosed. The agent provided must have a binding affinity such that administration is sufficient to suppress pathological inflammation, and the agent is administered chronically to provide long-term suppression of pathological inflammation. | 03-17-2011 |
20110064730 | METHOD OF MODULATING ANGIOGENESIS - A method for the identification of a nucleic acid molecule differentially expressed in an in vitro model of a biological system, comprising the steps of: (1) harvesting cells from the model system at predetermined time points; (2) obtaining total RNA from the cells harvested at each time point; (3) preparing cDNA from the total RNA from each time point to provide a plurality of pools of cDNA; (4) performing a suppression subtractive hybridization (SSH) on the cDNA pools from each time point sequentially so as to progressively amplify cDNAs derived from nucleic acid molecules differentially expressed from one time period to the next. | 03-17-2011 |
20110064731 | Use of IL-20 Antagonists for Treating Rheumatoid Arthritis and Osteoporosis - The invention features methods and compositions for preventing or treating rheumatoid arthritis and osteoporosis by administering an antagonist of IL-20. The IL-20 antagonist may be an anti-IL-20 antibody, such as mAB 7E, that is capable of binding human IL-20 and blocking IL-20 interaction with its receptors. | 03-17-2011 |
20110064732 | METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS - Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer. | 03-17-2011 |
20110064733 | CA6 ANTIGEN-SPECIFIC CYTOTOXIC CONJUGATE AND METHODS OF USING THE SAME - Cytotoxic conjugates comprising a cell binding agent and a cytotoxic agent, therapeutic compositions comprising the conjugate, methods for using the conjugates in the inhibition of cell growth and the treatment of disease, and a kit comprising the cytotoxic conjugate are disclosed are all embodiments of the invention. In particular, the cell binding agent is a monoclonal antibody, and epitope-binding fragments thereof, that recognizes and binds the CA6 glycotope. The present invention is also directed to humanized or resurfaced versions of DS6, an anti-CA6 murine monoclonal antibody, and epitope-binding fragments thereof. | 03-17-2011 |
20110064734 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASE - Disclosed are pharmaceutical compositions and methods for preventing or treating a number of amyloid diseases, including Alzheimer's disease, prion diseases, familial amyloid neuropathies and the like. The pharmaceutical compositions include immunologically reactive amounts of amyloid fibril components, particularly fibril-forming peptides or proteins. Also disclosed are therapeutic compositions and methods which use immune reagents that react with such fibril components. | 03-17-2011 |
20110064735 | METHODS FOR TREATING LYMPHOMAS IN CERTAIN PATIENT POPULATIONS AND SCREENING PATIENTS FOR SAID THERAPY - Methods for predicting a response of a patient having a lymphoma to a therapy regimen of 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione using prognostic factors of a patient's disease burden, absolute lymphocyte count or time since last rituximab therapy are disclosed. Specific methods of treating a lymphoma encompass the administration of 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione to a patient who has one or more of the favorable profiles, alone or in combination with immunosuppressive agents such as rituximab. | 03-17-2011 |
20110064736 | TUMOR THERAPY WITH AN ANTIBODY FOR VASCULAR ENDOTHELIAL GROWTH FACTOR AND AN ANTIBODY FOR HUMAN EPITHELIAL GROWTH FACTOR RECEPTOR TYPE 2 - The present invention provides a method of treating a breast cancer disease in a patient who has failed prior treatment with an anti-VEGF antibody, comprising administering to the patient a therapeutically effective amount of an anti-HER2 antibody while continuing said anti-VEGF antibody therapy. The invention also provides corresponding pharmaceutical kits and pharmaceutical compositions. | 03-17-2011 |
20110064737 | ErbB ANTAGONISTS FOR PAIN THERAPY - The present application describes the use of ErbB antagonist, especially ErbB2 antibodies such as rhuMAb 2C4, for treating pain. | 03-17-2011 |
20110070225 | Beta antibody parenteral formulation - The present invention relates to a stable pharmaceutical parenteral formulation of an antibody, antibody molecule, a mixture of antibodies and/or a mixture of antibody molecules against the amyloid-beta peptide (Abeta) and a process for the preparation. Furthermore, corresponding uses are described. | 03-24-2011 |
20110070226 | VARIABLE ANTIBODIES - The present invention discloses inhibitory antibodies against Factor VIII with modified glycosylation, either by enzymatic deglycosylation or by site directed mutagenesis. Said antibodies with modified glycosylation have equal affinity for FVIII but show different inhibiting properties. The use of one or a mixture of said antibodies allow modulation of the inhibition of factor VIII to levels between 40 and 95%. The present invention further discloses pharmaceutical compositions comprising inhibitory antibodies against Factor VIII with modified glycosylation, combinations of these antibodies and methods for treating haemostasis disorders using said antibodies and antibody mixtures. | 03-24-2011 |
20110070227 | Treatment of Autoimmune and Inflammatory Diseases - The invention relates to the treatment of autoimmune or inflammatory disorders with antibodies to CD22. In particular, the invention relates to the treatment of autoimmune or inflammatory disorders with epratuzumab with a new dosing regimen. More particularly, the invention relates to the treatment of SLE. | 03-24-2011 |
20110070228 | METHOD AND APPARATUS FOR AUTOMATED CELL TRANSFER THERAPY AND HAIR TRANSPLANTATION - Methods and apparatuses that selectively capture therapeutic cells associated with hair growth or development and their delivery to regions of hair loss. Cell capture and delivery is accomplished in part through the use of antibodies having binding sites specific to cell surface moieties characteristic of the therapeutic cells and having magnetic or paramagnetic features, which facilitates their immobilization to magnetizable rods that can be used to pierce the skin of the subject being treated for hair loss and the subsequent release of therapeutic cells to targeted sites beneath the epidermis. | 03-24-2011 |
20110070229 | Method of selecting a monoclonal antibody for administration - Methods, compositions, and kits relating to selecting a prophylactic or therapeutic antibody less likely to induce or aggravate an anti-antibody response in a subject administered the antibody. An antibody for administration to a subject may be selected to match, or at least more closely resemble, the allotypic phenotype of the subject's endogenous antibodies. | 03-24-2011 |
20110070230 | Method and devices for identifying and treating a subject who has developed an anti-antibody response - Methods, compositions, and kits relating to selecting a prophylactic or therapeutic antibody less likely to induce or aggravate an anti-antibody response in a subject administered the antibody. An antibody for administration to a subject may be selected to match, or at least more closely resemble, the allotypic phenotype of the subject's endogenous antibodies. | 03-24-2011 |
20110070231 | STABLE LIQUID PHARMACEUTICAL FORMULATION OF IGG ANTIBODIES - This invention is directed to a stable liquid pharmaceutical formulation comprising a high concentration, e.g. 50 mg/ml or more, of antibody in about 20-60 mM succinate buffer or 30-70 mM histidine buffer, having pH from about pH 5.5 to about pH 6.5, about 0.01-0.1% polysorbate, and a tonicity modifier that contributes to the isotonicity of the formulation. This liquid formulation is stable at refrigerated temperature (2-8° C.) for at least 1 year, and preferably 2 years. This liquid formulation is suitable for subcutaneous injection. The preferred antibodies include Daclizumab, a humanized anti-IL-2 receptor monoclonal antibody; HAIL-12, a humanized anti-IL-12 monoclonal antibody; HuEP5C7, a humanized anti-L selectin monoclonal antibody; and Flintozumab, a humanized anti-gamma interferon monoclonal antibody. | 03-24-2011 |
20110070232 | Combination Therapy with an Antitumor Alkaloid - The present invention relates to combinations of PM00104 with other anticancer drugs, and the use of these combinations in the treatment of cancer. | 03-24-2011 |
20110076266 | SYNERGISTIC PHARMACEUTICAL COMPOSITION USEFUL FOR INHIBITING CORNEAL AND RETINAL NEOVASCULARIZATION (ANGIOGENESIS), AND IN OTHER ORGANS, IN A HUMAN BEING OR ANIMALS - A synergistic pharmaceutical composition useful for inhibiting corneal and retinal neovasculization (angiogenesis) and in other organs, in a human being or animal, characterized in comprising, in a pharmaceutically acceptable vehicle or carrier: 60 to 90 weight % Suramine, or the equivalent of one of the pharmaceutically acceptable salts thereof; and 40 to 10 weight % Bevacizumab; wherein said percentages are relative to the addition of weight of both active principals. Said synergistic pharmaceutical composition is under the form of an injectable composition by intravenous, intravitrea or subconjuntival means or under the form for topical administration. | 03-31-2011 |
20110076267 | HUMANIZED ANTIBODY COMPOSITIONS AND METHODS FOR BINDING LYSOPHOSPHATIDIC ACID - Compositions and methods for making and using humanized anti-LPA monoclonal antibodies, and fragments and derivatives thereof, are described. | 03-31-2011 |
20110076268 | Antibodies against human respiratory syncytial virus (RSV) and methods of use - Provided herein are antibodies or antigen-binding fragments thereof that immunospecifically bind to the fusion (F) protein of Respiratory Syncytial Virus (RSV). Also provided are methods for of prevention, treatment and diagnosis of viral infection and/or the treatment of one more symptoms of RSV-mediated disease. Methods of generating antibodies that immunospecifically bind RSV F protein also are provided. | 03-31-2011 |
20110076269 | METHODS OF INCREASING NEURONAL DIFFERENTIATION USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID - Methods are provided for increasing neuronal differentiation of neuronal stem cells using antibodies that bind lysophosphatidic acid (LPA). Particularly preferred antibodies to LPA are monoclonal antibodies, including humanized monoclonal antibodies to LPA. Such antibodies, and derivatives and variants thereof, can be used in increasing neuronal differentiation, and in treatment and/or prevention of injuries, diseases, or conditions associated with insufficient neuronal differentiation and/or with elevated LPA levels in neural tissues. | 03-31-2011 |
20110076270 | Therapeutic Binding Molecules - A molecule comprising at least one antigen binding site, comprising in sequence the hypervariable regions CDR1, CDR2 and CDR3, said CDR1 having the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH), said CDR2 having the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 having the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT); e.g. further comprising in sequence the hypervariable regions CDR1′, CDR2′ and CDR3′, CDR1′ having the amino acid sequence Arg-Ala-Ser-Gln-Asn-Ile-Gly-Thr-Ser-Ile-Gln (RASQNIGTSIQ), CDR2′ having the amino acid sequence Ser-Ser-Ser-Glu-Ser-Ile-Ser (SSSESIS) and CDR3′ having the amino acid sequence Gln-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT), e.g. a chimeric or humanised antibody, useful as a pharmaceutical. | 03-31-2011 |
20110076271 | DIAGNOSTIC METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER - Disclosed herein are methods and compositions useful for the diagnosis and treatment of angiogenic disorders, including, e.g., cancer. | 03-31-2011 |
20110076272 | THERAPEUTIC METHODS AND COMPOSITIONS - Disclosed herein are methods for modulating the environment of a tumor, by inhibiting the activity of the extracellular enzyme lysyl oxidase-like 2 (LOXL2). The methods disclosed herein are effective in reducing tumor growth, reducing recruitment of cells to the tumor, reducing fibroblast activation, reducing desmoplasia, reducing vasculogenesis, reducing the number of TAFs, reducing growth factor production, inhibiting collagen deposition, and increasing necrosis and pyknosis in the tumor. Exemplary inhibitors of LOXL2 activity are antibodies and siRNAs. | 03-31-2011 |
20110076273 | Highly Concentrated Pharmaceutical Formulations - The present invention relates to a highly concentrated, stable pharmaceutical formulation of a pharmaceutically active anti-CD20 antibody, such as e.g. Rituximab, Ocrelizumab, or HuMab, or a mixture of such antibody molecules for subcutaneous injection. In particular, the present invention relates to formulations comprising, in addition to a suitable amount of the anti-CD20 antibody, an effective amount of at least one hyaluronidase enzyme as a combined formulation or for use in form of a co-formulation. The said formulations comprise additionally at least one buffering agent, such as e.g. a histidine buffer, a stabilizer or a mixture of two or more stabilizers (e.g. a saccharide, such as e.g. α,α-trehalose dihydrate or sucrose, and optionally methionine as a second stabilizer), a nonionic surfactant and an effective amount of at least one hyaluronidase enzyme. Methods for preparing such formulations and their uses thereof are also provided. | 03-31-2011 |
20110076274 | MATERIALS AND METHODS RELATING TO A G-PROTEIN COUPLED RECEPTOR - The present inventors demonstrate that the G-protein coupled receptor 55 (GPR55) is highly expressed in human aggressive breast cancer cells, and that the expression level may be correlated with the invasiveness and metastatic potential of these cells (for example metastasis to bone). In various aspects of the invention there are disclosed diagnostic tools or biomarkers that relate to the metastatic profile of breast cancer tumours. The invention also relates to pharmacological agents targeting this receptor for the purposes of inhibiting progression and spread of breast cancer. | 03-31-2011 |
20110081338 | METABOLICALLY INERT ANTIFOLATES FOR TREATING DISORDERS OF ABNORMAL CELLULAR PROLIFERATION AND INFLAMMATION - The present invention provides compositions and methods for the treatment of disorders of abnormal cell proliferation and/or inflammation, such as psoriasis and inflammatory bowel disease, in a human or other host animals. | 04-07-2011 |
20110081339 | METHODS OF USING IL-17 RECEPTOR A ANTIBODIES - The present invention relates to IL-17 Receptor A antigen binding proteins, such as antibodies, and methods for diagnosing and treating diseases mediated by IL-17 Receptor A activation. | 04-07-2011 |
20110081340 | METHODS FOR TREATING DISEASE USING AN ANTI-IL-21 RECEPTOR ANTIBODY - Monoclonal antibodies to the IL-21 receptor and multimeric complexes comprising the IL-21 receptor; including monoclonal antibodies to the heterodimeric receptor, IL-21/IL-2Rγ; have been prepared. The invention also describes a method of producing said antibodies. And, the invention also describes a method of treatment comprising using said antibodies to suppress an immune response. | 04-07-2011 |
20110081341 | IMMUNOPOTENTIATIVE COMPOSITION - Compositions for cancer or infection treatment via immunopotentiation caused by inhibition of immunosuppressive signal induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient, screening methods of the substrates for cancer or infection treatment, cell lines used for the screening methods, evaluation methods that select the substrates for cancer treatment, and carcinoma cell transplanted mammals used for the evaluation methods. The compositions of the present invention that inhibits the function of PD-1, PD-L1, or PD-L2 are useful for treatment of cancer or infection. | 04-07-2011 |
20110081342 | ANTI-VEGF ANTIBODIES - Humanized and variant anti-VEGF antibodies and various uses therefor are disclosed. The anti-VEGF antibodies have strong binding affinities for VEGF; inhibit VEGF-induced proliferation of endothelial cells in vitro; and inhibit tumor growth in vivo. | 04-07-2011 |
20110086024 | USE OF ANTAGONISTS OF THE INTERACTION BETWEEN HIV GP120 AND A4B7 INTEGRIN - Methods are provided for the treatment of a HIV infection. The methods can include administering to a subject with an HIV infection a therapeutically effective amount of an agent that interferes with the interaction of gp120 and α4 integrin, such as a α4β1 or α4β7 integrin antagonist, thereby treating the HIV infection. In several examples, the α4 integrin antagonist is a monoclonal antibody that specifically binds to a α4, β1 or β7 integrin subunit or a cyclic hexapeptide with the amino acid sequence of CWLDVC. Methods are also provided to reduce HIV replication or infection. The methods include contacting a cell with an effective amount of an agent that interferes with the interaction of gp120 and α4 integrin, such as a α4β1 or α4β7 integrin antagonist. Moreover, methods are provided for determining if an agent is useful to treat HIV. | 04-14-2011 |
20110086025 | Combination Therapy of a Type II Anti-CD20 Antibody with an Anti-BCL-2 Active Agent - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and an anti-Bcl-2 active agent for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. | 04-14-2011 |
20110086026 | ANTIBODIES AGAINST IL-13 RECEPTOR ALPHA 1 AND USES THEREOF - An antibody binding to IL-13Rα1, inhibiting IL-13 bioactivity and comprising a variable heavy and a variable light chain, characterized in that the variable heavy chain amino acid sequence CDR3 of said antibody is selected from the group consisting of the heavy chain CDR3 sequences of SEQ ID NO: 1, 3, 5, 7 or 9 is useful in the treatment of asthma and allergic diseases. | 04-14-2011 |
20110086027 | ANTI-CXCR4 ANTIBODIES - The present invention provides antibodies that bind human CXCR4 and are characterized as having high affinity and strong neutralizing properties. The antibodies of the invention are useful in the treatment of tumorigenesis, including tumor growth, invasion, angiogenesis, or metastasis. | 04-14-2011 |
20110091451 | Methods for preventing and treating cancer metastasis and bone loss associated with cancer metastasis - M-CSF antagonists are used to prepare compositions, including pharmaceutical compositions, for preventing or treating cancer metastasis and/or bone loss associated with cancer metastasis in a mammal. | 04-21-2011 |
20110091452 | 4,5-Dihydromacbecin Derivatives and Their Use in the Treatment of Cancer or B-Cell Malignancies - The present invention relates to 4,5-dihydromacbecin analogues to the formula (IA) or (IB), or a pharmaceutically acceptable salt there of: wherein: R | 04-21-2011 |
20110091453 | METHODS OF ADMINISTERING/DOSING CD2 ANTAGONISTS FOR THE PREVENTION AND TREATMENT OF AUTOIMMUNE DISORDERS OR INFLAMMATORY DISEASES - The present invention provides compositions for the prevention or treatment of an autoimmune disorder or an inflammatory disorder in a subject comprising one or more CD2 antagonists. In particular, the invention provides methods for preventing or treating an autoimmune disorder or an inflammatory disorder in a subject comprising administering one or more CD2 binding molecules to said subject. The present invention provides doses of CD2 binding molecules and methods of administration that result in improved efficacy, while avoiding or reducing the adverse or unwanted side effects associated with the administration of an agent that induces the depletion of peripheral blood lymphocytes. | 04-21-2011 |
20110091454 | METHODS AND SYSTEMS FOR ANNOTATING BIOMOLECULAR SEQUENCES - Polypeptide sequences and polynucleotide sequences are provided. Also provided are annotative information concerning such sequences and uses for these sequences. | 04-21-2011 |
20110091455 | ANTIBODIES TO MYOSTATIN - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that bind to myostatin, and that function to inhibit myostatin. The invention also relates to human anti-myostatin antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-myostatin antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-myostatin antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-myostatin antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 04-21-2011 |
20110091456 | TREATMENT OF NEUROLOGICAL CONDITIONS - The present invention is directed to a method for treating an inflammatory neurodegenerative condition of the CNS in a subject comprising administering to said subject a G-CSF or G-CSFR inhibiting agent selected from the group consisting of an antibody specific for G-CSF or G-CSFR, a soluble G-CSFR or a G-CSF-binding portion thereof and a 20 to 30 nucleotide sense or antisense molecule targeted to a nucleic acid molecule encoding G-CSF. | 04-21-2011 |
20110091457 | METHOD FOR PROGNOSTICATING THE CLINICAL RESPONSE OF A PATIENT TO B-LYMPHOCYTE INHIBITING OR DEPLETING THERAPY - The invention relates to methods for predicting a clinical response to B-lymphocyte inhibiting or depleting therapies (BCIDT) using expression levels of genes of the Type I INF pathway. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with B-lymphocyte inhibiting or depleting therapy. More in particular, the invention relates to a method for prognosticating the clinical response of a patient to treatment with a soluble BCID or TCID agent, said method comprising the steps of obtaining at least two samples from said patient wherein a first sample has not been exposed to a soluble BCID or TCID agent and wherein at least a second sample has been exposed to a soluble BCID or TCID agent, determining the level of an IFN-I type response in said at least two samples, comparing the level of the IFN-I type response in said first sample with the level of the IFN-1 type response in said at least second sample and prognosticating said clinical response from said comparison. | 04-21-2011 |
20110091458 | ANTI-IL 13 HUMAN ANTIBODIES - The present invention relates to human anti-IL-13 binding molecules, particularly antibodies, and to methods for using anti-IL-13 antibody molecules in diagnosis or treatment of IL-13 related disorders, such as asthma, atopic dermatitis, allergic rhinitis, fibrosis, inflammatory bowel disease and Hodgkin's lymphoma. | 04-21-2011 |
20110097320 | 4-AMINOQUINAZOLINE DERIVATIVES AND METHODS OF USE THEREOF - This invention relates to novel 4-aminoquinazolines, their derivatives, pharmaceutically acceptable salts, solvates, and hydrates thereof. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering inhibitors of the EGFR and HER-2. | 04-28-2011 |
20110097321 | COMBINATION OF ANGIOPOIETIN-2 ANTAGONIST AND OF VEGF-A, KDR AND/OR FLT1 ANTAGONIST FOR TREATING CANCER - The invention relates to agents which possess anti-angiogenic activity and are accordingly useful in methods of treatment of disease states associated with angiogenesis in the animal or human body. More specifically the invention concerns a combination of an antagonist of the biological activity of Angiopoietin-2 and an antagonist of the biological activity of VEGF-A, and/or KDR, and/or Flt1, and uses of such antagonists. | 04-28-2011 |
20110097322 | PARTIALLY LOADED ANTIBODIES AND METHODS OF THEIR CONJUGATION - A protein containing one or more activatable groups, e.g., an antibody, is subjected to partial or complete reduction of one or more such bonds to form reactive groups; the resulting protein is reacted with a drug which is reactive with some of the reactive groups, such as certain radiometals, chelating agents, and toxins, so as to form a conjugate useful in, e.g., in vitro diagnosis, in vivo imaging, and therapy. | 04-28-2011 |
20110097323 | Her2/neu-Specific Antibodies and Methods of Using Same - This invention relates to antibodies that specifically bind HER2/neu, and particularly chimeric 4D5 antibodies to HER2/neu, which have reduced glycosylation as compared to known 4D5 antibodies. The invention also relates to methods of using the 4D5 antibodies and compositions comprising them in the diagnosis, prognosis and therapy of diseases such as cancer, autoimmune diseases, inflammatory disorders, and infectious disease. | 04-28-2011 |
20110104146 | ANTITHROMBOTIC AGENTS AND METHODS OF USE THEREOF - The instant invention provides methods and compositions for the treatment, prevention and diagnosis of for example, platelet aggregation or clot formation in a subject. The invention inhibits the activity of decreases the amount of neutrophils in the subject by inhibiting the activity or production of IL-6, interferon-gamma, STAT1, or cathepsin D. The invention addresses decreasing the amount of neutrophils in an attempt to treat subjects that have or are at risk of developing a vascular occlusive disease, an ischemia or reperfusion injury, an acute or chronic inflammatory state, autoimmune disease, myelodysplastic syndrome, tissue injury from surgery or accidental trauma, acute bacterial or viral infection, has undergone a microvascular surgical reconstructive procedure, is receiving granulocyte colony stimulating factor therapy, receiving stem cell therapy, or has sickle cell anemia. | 05-05-2011 |
20110104147 | Identification of Tumor-Associated Markers for Diagnosis and Therapy - The present technology relates to genetic products the expression of which is associated with cancer diseases. The present technology also relates to the therapy and diagnosis of diseases in which the genetic products are expressed or aberrantly expressed, in particular cancer diseases. | 05-05-2011 |
20110104148 | Antibodies to Carcinoembryonic Antigen (CEA), Methods of Making Same, and Uses Thereof - The present invention relates to antigen binding molecules (ABMs). In particular embodiments, the present invention relates to recombinant monoclonal antibodies, including chimeric, primatized or humanized antibodies or variants thereof specific for cell surface or membrane bound human CEA. In addition, the present invention relates to nucleic acid molecules encoding such ABMs, and vectors and host cells comprising such nucleic acid molecules. The invention further relates to methods for producing the ABMs of the invention, and to methods of using these ABMs in treatment of disease. In addition, the present invention relates to ABMs with modified glycosylation having improved therapeutic properties, including antibodies with increased Fc receptor binding and increased effector function. | 05-05-2011 |
20110104149 | SingleC-9 Binding Agents - The present invention relates to agents capable of binding sialic acid-binding immunoglobulin-like lectin-9 (Siglec-9) and their use in the treatment of cell proliferation and differentiation disorders. Furthermore, the present invention provides associated pharmaceutical formulations and methods. | 05-05-2011 |
20110104150 | ANTI-CD19 ANTIBODIES AND USES IN B CELL DISORDERS - The invention relates to immunotherapeutic compositions and methods for the treatment of B cell diseases and disorders in human subjects, such as, but not limited to, B cell malignancies and autoimmune diseases and disorders, using therapeutic antibodies that bind to the human CD19 antigen and that preferably mediate human ADCC. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG1 or IgG3 human isotype. The present invention relates to pharmaceutical compositions comprising human or humanized anti-CD19 antibodies of the IgG2 or IgG4 human isotype that preferably mediate human ADCC. The present invention also relates to pharmaceutical compositions comprising chimerized anti-CD19 antibodies of the IgG1, IgG2, IgG3, or IgG4 isotype that mediate human ADCC. In preferred embodiments, the present invention relates to pharmaceutical compositions comprising monoclonal human, humanized, or chimeric anti-CD19 antibodies. | 05-05-2011 |
20110104151 | MICROPARTICLE COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION - Disclosed herein are pharmaceutical compositions comprising microparticles that are useful for treating or preventing age-related macular degeneration. Also disclosed herein are microparticles that can be used to treat or prevent macular angiogenesis. Further disclosed are methods of making the microparticles and compositions and methods for treating or preventing macular degeneration and diseases, illnesses, or conditions relating to increased or abnormal macular angiogenesis. | 05-05-2011 |
20110104152 | CHIMERIC FIBROBLAST GROWTH FACTORS WITH ALTERED RECEPTOR SPECIFICITY - The present invention is directed to novel chimeric fibroblast growth factor (FGF) polypeptides, novel DNA encoding chimeric FGF polypeptides, and to the recombinant production of chimeric FGF polypeptides, and to methods, compositions and assays utilizing chimeric FGF polypeptides for the therapeutic treatment of metabolic-related disorders and other conditions, and for producing pharmaceutically active compositions including chimeric FGF polypeptides, the compositions having therapeutic and pharmacologic properties including those associated with the treatment of metabolic-related disorders and other conditions. | 05-05-2011 |
20110104153 | USE OF IMMUNOREGULATORY NK CELL POPULATIONS FOR PREDICTING THE EFFICACY OF ANTI-IL-2R ANTIBODIES IN MULTIPLE SCLEROSIS PATIENTS - The use of CD56bright NK cell counts and IL-2 receptor protein expression as predictive biomarkers for the efficacy of anti-IL-2R antibody treatment in patients diagnosed with multiple sclerosis. | 05-05-2011 |
20110104154 | SINGLE NUCLEOTIDE POLYMORPHISMS AND GENES ASSOCIATED WITH AGE-RELATED MACULAR DEGENERATION - The invention provides genes and polymorphisms associated with AMD, and methods for diagnosing an increased risk of AMD in a patient who has at least one of the AMD-associated polymorphisms as provided. | 05-05-2011 |
20110104155 | DRUG DELIVERY TO THE ANTERIOR AND POSTERIOR SEGMENTS OF THE EYE USING EYE DROPS - A method and means for delivery of drugs to the chorio-retina and the optic nerve head which comprises contacting the surface of the eye with an effective amount of drug for treatment of chorio-retina and optic nerve head and a physiologically acceptable adrenergic agent for enhancing delivery of the drug to these tissues in an ophtalmologically acceptable carrier, said adrenergic agent being selected from the group consisting of alpha adrenergic agonist agents, derivatives of the alpha adrenergic agonist agents, beta-blocking agents, derivatives of the beta-blocking agents and mixtures thereof. | 05-05-2011 |
20110104156 | Methods and materials for treating autoimmune and/or complement mediated diseases and conditions - Disclosed are methods for treating an autoimmune and/or complement mediated disease or condition in a subject. The methods include administering to the subject a compound which inhibits the subject's classical complement pathway. The methods include administering to the subject a compound which inhibits the subject's classical complement pathway. Compositions which include inhibitors of C1q, C1r, C1s, C2 or C4 and a pharmaceutically acceptable excipient are also described. | 05-05-2011 |
20110104157 | LIVER CANCER DRUG - A novel pharmaceutical composition for treating or preventing hepatocellular carcinoma and a method of treatment are provided. A pharmaceutical composition for treating or preventing liver cancer is obtained by combining a chemotherapeutic agent with an anti-glypican 3 antibody. Also disclosed is a pharmaceutical composition for treating or preventing liver cancer which comprises as an active ingredient an anti-glypican 3 antibody for use in combination with a chemotherapeutic agent, or which comprises as an active ingredient a chemotherapeutic agent for use in combination with an anti-glypican 3 antibody. Using the chemotherapeutic agent and the anti-glypican 3 antibody in combination yields better therapeutic effects than using the chemotherapeutic agent alone, and mitigates side effects that arise from liver cancer treatment with the chemotherapeutic agent. | 05-05-2011 |
20110104158 | DEUTERIUM BEARING ANALOGS OF ANASTROZOLE AS AROMATASE INHIBITORS FOR THE TREATMENT OF BREAST CANCER - This invention relates to novel, substituted aralkyl heterocyclic compounds according to formula I, their derivatives, pharmaceutically acceptable salts thereof. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering aromatase inhibitors. Formula (I), or a pharmaceutically acceptable salt thereof, wherein: each R | 05-05-2011 |
20110104159 | COMPOSITIONS AND METHODS FOR TREATING, CONTROLLING, REDUCING, AMELIORATING, OR PREVENTING ALLERGY - A composition for treating, controlling, reducing, ameliorating, or preventing allergy comprises a dissociated glucocorticoid receptor agonist (“DIGRA”), a prodrug thereof, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable ester thereof. The composition can comprise an anti-allergic medicament and/or an additional anti-inflammatory agent and can be formulated for topical application, injection, or implantation. The anti-allergic medicament can comprise an antihistamine, a mast-cell stabilizer, a leukotriene inhibitor, an immunomodulator, an anti-IgE agent, or a combination thereof. | 05-05-2011 |
20110104160 | MEDICAMENT FOR TREATING CANCER - A medicament for treating cancer for use in combination therapy with an anti-HER2 antibody, which comprises amrubicin or a pharmaceutically acceptable salt thereof as an active ingredient. | 05-05-2011 |
20110104161 | COMBINATIONS VEGF(R) INHIBITORS AND HEPATOCYTE GROWTH FACTOR (C-MET) INHIBITORS FOR THE TREATMENT OF CANCER - This invention is in the field of pharmaceutical agents and specifically relates to compounds, compositions, uses and methods for treating cancer, by—combining VEGF(R) inhibitors and inhibitors of HGF/SF:c-Met. | 05-05-2011 |
20110104162 | Compounds which can be used for the Treatment of Cancers - The present invention relates to a compound of general formula (I): and also to the pharmaceutically acceptable salts thereof, to the isomers or isomer mixtures thereof in all proportions, in particular to an enantiomer mixture, and especially to a racemic mixture. The present invention also relates to the use of these compounds as a medicament, and in particular for the treatment of cancer, and also to the compositions containing them. | 05-05-2011 |
20110110930 | Mitogen-Activated Protein Kinase Kinase Kinase 14 (MAP3K14) Polymorphisms As Indicators of Subject Outcome in Critically Ill Subjects - The present application provides methods, uses, commercial packages, and kits for obtaining a prognosis for a subject having or at risk of developing an inflammatory condition and for identifying subjects having a greater benefit from treatment with an anti-inflammatory agent or an anti-coagulant agent. The method generally includes determining the genotype at position rs7222094 or a polymorphic site in linkage disequilibrium thereto for a subject for a polymorphisms in the these genes. The application also provides for methods of identifying potential subjects having an inflammatory condition who are more likely to benefit from treatment with an anti-inflammatory agent or anti-coagulant agent and to recover from the inflammatory condition. The invention also provides for methods of treating such subjects with an anti-inflammatory agent or anti-coagulant agent based on the subject's genotype. | 05-12-2011 |
20110110931 | Methods for Detecting and Monitoring Circulating Cancer Stem Cells - Provided herein are compositions, methods, and kits useful for detecting whether a subject has or is likely to develop a cancer and for monitoring, staging and examining a cancer patient. Also provide herein are methods for screening compounds. | 05-12-2011 |
20110110932 | COMBINATION TREATMENT FOR OCULAR DISEASES - The invention provides compositions and methods for treating ocular disorders, such as angiogenesis-associated disorders, by administering a combination of an inhibitor of VEGF activity and an inhibitor of α | 05-12-2011 |
20110110933 | ECTOPIC PREGNANCY TREATMENT - The invention pertains to methods for treating ectopic pregnancy. More particularly, the present invention relates to methods for treating unruptured ectopic pregnancy using a non-surgical method comprising the administration of an EGFR inhibitor alone or in combination with an anti-metabolite e.g. methotrexate (MTX). The methodology is potentially applicable to treatment of unruptured ectopic pregnancies of all sizes. | 05-12-2011 |
20110110934 | TREATMENT OF UVEITIS - The present invention relates generally to the use of antagonists of G-CSF, and/or its receptor (G-CSFR) in the treatment of uveitis. The present invention contemplates, therefore, the inhibition of G-CSF or G-CSFR systemically or locally and/or the down-regulation of expression of a G-CSF or G-CSFR in the treatment of uveitis. | 05-12-2011 |
20110110935 | Methods and Compositions for Increasing Iduronate 2-Sulfatase Activity in the CNS - Provided herein are methods and compositions for treating a subject suffering from a deficiency in iduronate 2-sulfatase in the CNS. The methods include systemic administration of a bifunctional fusion antibody comprising an antibody that crosses the blood brain barrier (BBB) and an iduronate 2-sulfatase. | 05-12-2011 |
20110110936 | ANTI-GCC ANTIBODY MOLECULES AND RELATED COMPOSITIONS AND METHODS - Antibodies and antigen-binding fragments of antibodies that bind GCC are disclosed. The antibodies bind an extracellular domain of GCC and can be internalized. In some embodiments, the antibodies are humanized, chimeric or human. Nucleic acids and vectors encoding the antibodies or portions thereof, recombinant cells that contain the nucleic acids, and compositions comprising the antibodies or antigen-binding fragments are also disclosed. The invention also provides therapeutic and diagnostic methods utilizing the antibodies and antigen-binding fragments provided herein. | 05-12-2011 |
20110110937 | COMPOSITION AND METHOD FOR INTRODUCTION OF RNA INTERFERENCE SEQUENCES INTO TARGETED CELLS AND TISSUES - A composition and method are provided by which double-stranded RNA containing small interfering RNA nucleotide sequences is introduced into specific cells and tissues for the purpose of inhibiting gene expression and protein production in those cells and tissues. Intracellular introduction of the small interfering RNA nucleotide sequences is accomplished by the internalization of a target cell specific ligand bonded to a RNA binding protein to which a double-stranded RNA containing a small interfering RNA nucleotide sequence is adsorbed. The ligand is specific to a unique target cell surface antigen. The ligand is internalized after binding to the cell surface antigen or by the incorporation of a peptide into the structure of the ligand or RNA binding protein or attachment of such a peptide to the ligand or RNA binding protein. The composition and method are practiced in whole living mammals, as well as cells living in tissue culture. | 05-12-2011 |
20110110938 | Compositions and methods for the treatment of immune related diseases - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 05-12-2011 |
20110110939 | METHODS AND COMPOSITIONS FOR THE TREATMENT AND DIAGNOSIS OF SYSTEMIC ANTHRAX INFECTION - The present invention features methods and kits that utilize Ang-2 antagonists for the treatment, inhibition, and prevention of a systemic anthrax infection. The invention described herein also features methods for the diagnosis of a systemic anthrax infection by detecting elevated levels of Ang-2 in the serum of a subject. | 05-12-2011 |
20110110940 | Methods for Enhancing the Efficacy of Vascular Disrupting Agents - This invention relates to methods for treating, preventing and/or managing cancer in a subject including enhancing the efficacy of a Vascular Disrupting Agent (e.g., a combretastatin or derivative thereof) by administering to the subject an α4β1 integrin antagonist sequentially or simultaneously in combination with said Vascular Disrupting Agent. | 05-12-2011 |
20110110941 | Wortmannin Analogs and Methods of Using Same in Combination with Chemotherapeutic Agents - Novel wortmannin analogs and their use in inhibiting PI-3-kinase activity in mammals and the treatment or prevention of cancer and tumor formation in a subject are described herein. Preferably, the wortmannin analogs may be administered with other chemotherapeutic agents in the treatment of cancer. | 05-12-2011 |
20110110942 | METHOD OF PROMOTING DENDRITIC SPINE DENSITY - The invention relates to methods of increasing density of dendritic spines as a means to retain or improve cognition and to treat disorders associated with decreased dendritic spine morphology and a psychiatric disorder such as addiction and schizophrenia or a disorder associated with impaired cognition such as autism, Lett Syndrome, Tourette Syndrome, and Fragile-X Syndrome. | 05-12-2011 |
20110110943 | SOLUBLE RECEPTOR BR43X2 AND METHODS OF USING - Soluble, secreted tumor necrosis factor receptor polypeptides, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed. The polypeptides comprise one cysteine-rich repeat that is homologous to other tumor necrosis factor receptors, such as transmembrane activator and CAML-interactor (TACI). The polypeptides may be used for detecting ligands, agonists and antagonists. The polypeptides may also be used in methods that modulate B cell activation. | 05-12-2011 |
20110110944 | ANTI-ALK1 ANTIBODIES AND USES THEREOF - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for AIk1, which plays an integral role in various disorders or conditions, such as cancer and macular degeneration. These antibodies, accordingly, can be used to treat these and other disorders and conditions. Antibodies of the invention also can be used in the diagnostics field, as well as for further investigating the role of AIk1 in the progression of disorders associated with pathogenic angiogenesis. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. | 05-12-2011 |
20110117082 | Soluble Tumor Necrosis Factor Receptor Mutant - A soluble tumor necrosis factor receptor 2 (TNFRII) mutant has an amino acid substitution at position 92Glu compared with the wild TNFRII. The mutant improves the cytotoxicity capacity of neutralizing TNFalpha and lymphotoxin. The mutant and fusion protein comprising it are useful for the treatment of TNFalpha and lymphotoxin related diseases. | 05-19-2011 |
20110117083 | BIOLOGICAL MARKERS FOR MONITORING PATIENT RESPONSE TO VEGF ANTAGONISTS - The invention provides methods and compositions to detect expression of one or more biomarkers for monitoring the effectiveness of treatment of with VEGF antagonists. The invention also provides methods for identifying and treating patients who are likely to be responsive to VEGF antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods. | 05-19-2011 |
20110117084 | VANDETANIB DERIVATIVES - This invention relates to novel quinazoline derivatives and their acceptable acid addition salts. The invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions beneficially treated by inhibitory activity against the VEGF receptor tyrosine kinase. | 05-19-2011 |
20110117085 | MONOCLONAL ANTIBODIES FOR TUMOR TREATMENT - The present invention relates to methods for inhibiting tumor growth, increasing survival of a subject having a tumor and inducing protection against tumor recurrence in a mammal. The methods comprise administering a humanized monoclonal antibody comprising CDR regions derived from the murine monoclonal antibody designated mBAT-1, in combination with at least one chemotherapeutic agent. | 05-19-2011 |
20110117086 | MONOCLONAL ANTIBODIES TO PROGASTRIN AND THEIR USES - The present disclosure is directed to progastrin monoclonal antibodies, fragments thereof, compositions comprising progastrin monoclonal antibodies, and methods of making and using progastrin monoclonal antibodies and compositions thereof. The present disclosure is directed to methods of treating colorectal cancer with progastrin monoclonal antibodies and compositions comprising progastrin monoclonal antibodies or fragments thereof. The present disclosure is further directed to methods comprising detection of progastrin, including methods of diagnosing colorectal cancer and methods of monitoring efficacy of anti-cancer therapy in subjects suffering from colorectal cancer. | 05-19-2011 |
20110117087 | METHOD FOR THE PRODUCTION OF A GLYCOSYLATED IMMUNOGLOBULIN - Herein is reported a method for the production of an immunoglobulin comprising the following steps: a) providing a eukaryotic cell comprising a nucleic acid encoding the immunoglobulin, b) cultivating the eukaryotic cell in a cultivation medium wherein the amount of glucose available in the cultivation medium per time unit is kept constant and limited to less than 80% of the amount that could maximally be utilized by the cells in the cultivation medium per time unit, and c) recovering the immunoglobulin from the culture. | 05-19-2011 |
20110117088 | COMPOSITION AND METHOD FOR INTRODUCTION OF RNA INTERFERENCE SEQUENCES INTO TARGETED CELLS AND TISSUES - A composition and method are provided by which double-stranded RNA containing small interfering RNA nucleotide sequences is introduced into specific cells and tissues for the purpose of inhibiting gene expression and protein production in those cells and tissues. Intracellular introduction of the small interfering RNA nucleotide sequences is accomplished by internalization of a target cell specific ligand to which the double-stranded RNA containing a small interfering RNA nucleotide sequence is conjugated. The ligand is specific to a unique target cell surface antigen. The ligand is either spontaneously internalized after binding to the cell surface antigen. Internalization is also facilitated by the binding of an RNA binding protein to the double-stranded RNA. If the unique cell surface antigen is not naturally internalized after binding to its ligand, internalization is promoted by the incorporation of a peptide into the structure of the ligand or attachment of such a peptide to the ligand. | 05-19-2011 |
20110117089 | BCR-Complex-Specific Antibodies And Methods Of Using Same - This invention relates to chimeric and humanized antibodies that specifically bind the BCR complex, and particularly chimeric and humanized antibodies to the BCR complex. The invention also relates to methods of using the antibodies and compositions comprising them in the diagnosis, prognosis and therapy of diseases such as cancer, autoimmune diseases, inflammatory disorders, and infectious disease. | 05-19-2011 |
20110117090 | ADAM-15 ANTIBODIES AND IMMUNOGENIC PEPTIDES - The present invention relates to antibodies and antigen-binding fragments thereof, immunogenic peptide(s), and siRNA molecules which are capable of inhibiting neovascularization and/or angiogenesis and endothelial cell proliferation. The invention relates to antibodies and antigen-binding fragments thereof with specificity towards the metalloprotease domain of ADAM 15 and to immunogenic peptide(s) that elicits such antibodies. The invention also relates to compositions and kits comprising the antibodies and immunogenic peptide(s) of the invention, as well as methods and uses of the antibodies and antigen-binding fragments thereof and immunogenic peptide(s), as well as siRNA molecules. | 05-19-2011 |
20110117091 | HUMANIZATION OF RABBIT ANTIBODIES USING A UNIVERSAL ANTIBODY FRAMEWORK - The present invention relates to an universal antibody acceptor framework and to methods for grafting non-human antibodies, e.g., rabbit antibodies, using a universal antibody acceptor framework. Antibodies generated by the methods of the invention are useful in a variety of diagnostic and therapeutic applications. | 05-19-2011 |
20110123522 | METHODS OF TREATING CANCER USING ANTI CD24 ANTIBODIES - Anti-CD24 antibodies and adjuvant combinations thereof with chemotherapeutic agents or toxins, which can be used to inhibit growth of CD24-expressing cancer cells and prevent and treat cancer are provided. | 05-26-2011 |
20110123523 | ANTIBODIES AGAINST ERBB3 AND USES THEREOF - The present invention provides a novel class of monoclonal antibodies which bind ErbB3 receptor and inhibits various ErbB3 functions. For example, the antibodies described herein are capable of binding to ErbB3 and inhibiting EGF-like ligand mediated phosphorylation of the receptor. | 05-26-2011 |
20110123524 | METHODS FOR TREATING HEMATOPOIETIC MALIGNANCIES - The present invention relates to methods for treating neoplasias in a mammalian subject. In particular, the invention provides methods for treating lymphomas, including forms of non- Hodgkin lymphoma. In one embodiment, these methods involve reducing tumor necrosis factor signaling. | 05-26-2011 |
20110123525 | ANTI-ANGIOGENIC THERAPY - The present invention provides novel monoclonal antibodies directed to PlGF and fragments and derivatives thereof, more particularly to humanized antibodies and fragments thereof for use in the treatment and/or prevention of pathological angiogenesis. | 05-26-2011 |
20110123526 | METHODS AND COMPOSITIONS FOR PREVENTING ADHESION - This invention provides methods and compositions for preventing post-surgical adhesion formation based on use of an interleukin-16 (IL-16) antagonist, including an IL-16 antagonist peptide and/or an IL-16 antagonist antibody. | 05-26-2011 |
20110123527 | METHOD OF GENERATING SINGLE VL DOMAIN ANTIBODIES IN TRANSGENIC ANIMALS - The present invention describes methods of generating single VL domain antibodies, including chimeric single chain antibodies that comprise of a variable region of a human immunoglobulin κ or λ light chain and a non-human constant region. The non-human constant region is devoid of a first constant domain CH1, and the variable region is devoid of a heavy chain variable domain. | 05-26-2011 |
20110123528 | HUMANIZED ANTI-FACTOR D ANTIBODIES AND USES THEREOF - The invention relates to humanized anti-human Factor D monoclonal antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 05-26-2011 |
20110123529 | SINGLE DOMAIN ANTIBODIES DIRECTED AGAINST EPIDERMAL GROWTH FACTOR RECEPTOR AND USES THEREFOR - The present invention relates to polypeptides derived from single domain heavy chain antibodies directed to Epidermal Growth Factor Receptor. It further relates to single domain antibodies that are Camelidae VHHs. It further relates to methods of administering said polypeptides orally, sublingually, topically, intravenously, subcutaneously, nasally, vaginally, rectally or by inhalation. It further relates to protocols for screening for agents that modulate the Epidermal Growth Factor Receptor, and the agents resulting from said screening. The invention further a method for delivering therapeutic molecules to the interior of cells. | 05-26-2011 |
20110129458 | BINDING MOLECULES WITH MULTIPLE BINDING SITES, COMPOSITIONS COMPRISING THE SAME AND USES THEREOF - The present invention relates to binding molecules, such as amino acid sequences with multiple antigen binding sites. In particular, the binding molecules of the present invention have at least two antigen binding sites that partially or fully overlap with each other and that are directed against at least two different naturally occurring binding molecules. The invention further relates to uses of such binders, for example in methods for inhibiting and/or blocking of the interaction between said at least two naturally occurring binding molecules and a third naturally occurring binding molecule. | 06-02-2011 |
20110129459 | ANTI-NR10 ANTIBODY AND USE THEREOF - The present inventors successfully obtained anti-NR10 antibodies having an effective neutralizing activity against NR10. The anti-NR10 antibodies provided by the present invention are useful as, for example, pharmaceuticals for treating or preventing inflammatory diseases. | 06-02-2011 |
20110129460 | Combination Antibodies For The Treatment And Prevention Of Disease Caused By Bacillus Anthracis And Related Bacteria And Their Toxins - The invention relates to methods and compositions for the prevention and treatment of disease caused by | 06-02-2011 |
20110129461 | Mat II Beta Subunit RNAi and Therapeutic Methods Using Same - The presently disclosed subject matter generally relates to methods and compositions for modulating MAT II activity. More particularly, the presently disclosed subject matter relates to methods and compositions for inhibiting the expression of MAT II β subunit in a subject via RNAi by administering siRNA or shRNA molecules directed to MAT II β subunit. In some embodiments, the methods and compositions of the presently disclosed subject matter generally relates to the treatment of cancer. More particularly, the methods and compositions of the presently disclosed subject matter relates to the inhibition of MAT II β subunit for the treatment of leukemia. | 06-02-2011 |
20110129462 | INTRANASAL ADMINISTRATION OF ACTIVE AGENTS TO THE CENTRAL NERVOUS SYSTEM - Pharmaceutical compositions and methods for delivering a polypeptide to the central nervous system of a mammal via intranasal administration are provided. The polypeptide can be a catalytically active protein or an antibody, antibody fragment or antibody fragment fusion protein. The polypeptides are formulated with one or more specific agents. | 06-02-2011 |
20110129463 | Quinazolin-4(3A)-One Derivatives and Methods of Use Thereof - Provided are quinazolin-4(3A)-one derivatives, which are inhibitors of the ubiquitin ligase activity of a human polypeptide, particularly to POSH inhibitors, and to compositions and methods for the treatment RING E3 ubiquitin ligase related diseases. | 06-02-2011 |
20110129464 | HUMANIZED ANTI-ERBB2 ANTIBODIES AND TREATMENT WITH ANTI-ERBB2 ANTIBODIES - The present application describes humanized anti-ErbB2 antibodies and methods for treating cancer with anti-ErbB2 antibodies, such as humanized anti-ErbB2 antibodies. | 06-02-2011 |
20110129465 | Mammalian Receptor Proteins; Related Reagents and Methods - Nucleic acids encoding mammalian, e.g., primate, receptors, purified receptor proteins and fragments thereof. Antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are described. | 06-02-2011 |
20110129466 | METHODS OF TREATING CANCER BY ADMINISTERING ANTIBODIES TO CD200 - Methods and compositions for regulating immunity are disclosed. For enhancing an immune response, agents that inhibit OX-2 are administered. Such methods are useful in treating cancer. For suppressing an immune response, an OX-2 protein or a nucleic acid encoding an OX-2 protein is administered. Such methods are useful in preventing graft rejection, fetal loss, autoimmune disease, allergies and in inducing tumor cell growth. | 06-02-2011 |
20110129467 | THERAPEUTIC COMBINATION COMPRISING AN AURORA KINASE INHIBITOR AND ANTIPROLIFERATIVE AGENTS - The present invention provides a combination comprising a compound 1 of formula (A) and one or more antineo-plastic agents selected from the group consisting of an antibody inhibiting a growth factor or a receptor of the growth factor, a proteasome inhibitor or a derivative or prodrug thereof, and a kinase inhibitor or a derivative or prodrug thereof useful in the treatment of tumors. | 06-02-2011 |
20110135634 | METHODS OF INHIBITING INFECTION BY DIVERSE SUBTYPES OF DRUG-RESISTANT HIV-1 - This invention provides methods of inhibiting HIV-1 infection of a susceptible cell by an HIV-1 virus that is, or has become, resistant to one or more HIV protease inhibitors, one or more HIV reverse transcriptase inhibitors, or one or more HIV protease inhibitors and one or more HIV reverse transcriptase inhibitors, which comprises subjecting the susceptible cell to an effective HIV-1 infection inhibiting dose of a humanized antibody designated PRO 140, or of an anti-CCR5 receptor monoclonal antibody, wherein the effective HIV-1 infection inhibiting dose comprises from 0.1 mg per kg to 25 mg per kg of the subject's body weight, so as to thereby inhibit the infection of the susceptible cell by HIV-1 that is, or has become, resistant to one or more HIV protease inhibitors, one or more HIV reverse transcriptase inhibitors, or one or more HIV protease inhibitors and one or more HTV reverse transcriptase inhibitors. | 06-09-2011 |
20110135635 | ANTI-ALPHA2 INTEGRIN ANTIBODIES AND THEIR USES - The invention relates to anti-α2 integrin antibodies and their uses. Humanized antibodies are disclosed that bind to the I domain of α2 integrin and inhibit the interaction of α2β1 integrin with collagen. Also disclosed are therapeutic uses of anti-α2 integrin antibodies in treating α2β1-mediated disorders, including anti-α2 integrin antibodies that bind to α2 integrin without activating platelets. | 06-09-2011 |
20110135636 | Recombinant Anti-Epidermal Growth Factor Receptor Antibody Compositions - The invention relates to the field of recombinant antibodies for use in human cancer therapy. More specifically the invention provides compositions or mixtures of antibodies capable of binding human EGFR. Antibody compositions with 3 or more antibodies shown synergy in reduction of proliferation of representative cancer cell lines. Advantageous results have also been obtained with a composition comprising two different chimeric anti-hEGFR antibodies which show a new mechanism of action based on rapid and efficient receptor internalisation, induction of terminal differentiation and subsequent tumour eradication in an animal model. The antibodies of the invention can be manufactured in one bioreactor as a polyclonal antibody. | 06-09-2011 |
20110135637 | TRIMODAL CANCER THERAPY - Cancers are treated with three types of agents: a chemotherapeutic agent which induces lymphopenia; an inhibitory antibody to a surface marker on Treg cells; and an anti-cancer vaccine. This combination may lead to enhanced immune responses despite lymphodepletion. | 06-09-2011 |
20110135638 | ACTRIIB PROTEINS AND VARIANTS AND USES THEREFORE RELATING TO UTROPHIN INDUCTION FOR MUSCULAR DYSTROPHY THERAPY - In certain aspects, the present invention provides compositions and methods for inducing utrophin expression in muscle with an ActRIIB protein as therapy for muscular dystrophy. The present invention also provides methods of screening compounds that modulate activity of an ActRIIB protein and/or an ActRIIB ligand. | 06-09-2011 |
20110135639 | B LYMPHOCYTE STIMULATOR ASSAYS - The present invention relates to nucleic acid molecules encoding Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides, including soluble forms of the extracellular domain. Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to antibodies or portions thereof that specifically bind Neutrokine-alpha and/or Neutrokine-alphaSV and diagnostic and therapeutic methods using these antibodies. Also provided are diagnostic methods for detecting immune system-related disorders and therapeutic methods for treating immune system-related disorders using the compositions of the invention. | 06-09-2011 |
20110135640 | IDENTIFICATION OF TUMOUR-ASSOCIATED CELL SURFACE ANTIGENS FOR DIAGNOSIS AND THERAPY - The present invention provides agents with tumor-inhibiting activity, and which are selective for cells expressing or abnormally expressing a tumor-associated antigen. Said tumor-associated antigen has a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence selected from the specific sequences set forth herein, or a 6-50 contiguous nucleotide residue portion thereof; (b) a nucleotide sequence of a nucleic acid which hybridizes with a nucleic acid having the nucleotide sequence of (a) under stringent conditions; (c) a nucleotide sequence which is degenerate with respect to the nucleotide sequence of (a) or (b); and (d) a nucleotide sequence which is complementary to the nucleotide sequence of (a), (b) or (c). Pharmaceutical compositions and kits comprising the agents are also provided, as well as methods treating, diagnosing or monitoring a disease characterized by expression or abnormal expression of the tumor-associated antigen. | 06-09-2011 |
20110135641 | RADIOPROTECTANTS TARGETING THROMBOSPONDIN-1 AND CD47 - Described herein is the discovery that cell and tissue survival can be dramatically increased following radiation exposure through inhibition of the interaction between TSP-1 and CD47. This effect is shown using antisense molecules, peptides, and antibodies, which can now be used as radioprotectant agents. These agents find application in minimizing, reducing and/or preventing tissue damage following intentional and accidental radiation exposure, as well as increasing the therapeutic efficacy of radiation therapies by protecting non-target tissue from incidental radiation damage and by increasing tumor ablation following radiation treatment. | 06-09-2011 |
20110135642 | Pharmaceutical Compositions Comprising Antibodies Binding To EBV (Ebstein-Barr Virus) Protein BARF1 - The invention relates to pharmaceutical and vaccine compositions comprising an antibody binding specifically to selected peptides of EBV protein BARF1. | 06-09-2011 |
20110142822 | Crystal of egfr extracellular domain and cetuximab fab fragment, and uses thereof - The present invention relates to co-crystals of cetuximab Fab in a complex with extracellular domain of EGFR, and structure coordinates obtained from such crystal. Such coordinates are useful for identifying mimetics that bind to the extracellular domain of EGFR. Such mimetics may for example inhibit binding of ligand to EGFR, inhibit activation of EGFR, and/or reduce proliferation of tumor cells. | 06-16-2011 |
20110142823 | Humanized antibodies that recognize beta amyloid peptide - The invention provides improved agents and methods for treatment of diseases associated with amyloid deposits of Aβ in the brain of a patient. Preferred agents include humanized antibodies. | 06-16-2011 |
20110142824 | Antibodies Against Amyloid-Beta Peptide - Antibodies that bind human β-amyloid peptide, methods of treating diseases or disorders characterised by elevated β-amyloid levels or β-amyloid deposits with said antibodies, pharmaceutical compositions comprising said antibodies and methods of manufacture. | 06-16-2011 |
20110142825 | Glycosylation Engineering of Antibodies for Improving Antibody-Dependent Cellular Cytotoxicity - The present invention relates to the field glycosylation engineering of proteins. More particular, the present invention is directed to the glycosylation engineering of proteins to provide proteins with improved therapeutic properties, e.g., antibodies, antibody fragments, or a fusion protein that includes a region equivalent to the Fc region of an immunoglobulin, with enhanced Fc-mediated cellular cytotoxicity. | 06-16-2011 |
20110142826 | AZAINDOLIZINES AND METHODS OF USE - The invention relates to azaindolizines of formula I-a or I-b with anti-cancer and/or anti-inflammatory activity and more specifically to azaindolizines which inhibit MEK kinase activity. The invention provides compositions and methods useful for inhibiting abnormal cell growth or treating a hyperproliferative disorder, or treating an inflammatory disease in a mammal. The invention also relates to methods of using the compounds for in vitro, in situ, and in vivo diagnosis or treatment of mammalian cells, or associated pathological conditions. | 06-16-2011 |
20110142827 | TREATMENT OF CANCER WITH A COMBINATION OF AN AGENT THAT PERTURBS THE EGF SIGNALING PATHWAY AND AN OLIGONUCLEOTIDE THAT REDUCES CLUSTERIN LEVELS - Agents that perturb the EGF signaling pathway and that are known to be useful in the treatment of cancer are found also to result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. This is overcome using a combination of an agent that has known therapeutic efficacy against the cancer to be treated by perturbation of the EGF signaling pathway and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. For example, the agent may be an antibody specific for HER-2, a small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. | 06-16-2011 |
20110142828 | TREATMENT PREDICTION INVOLVING HMGCR - The present invention provides a method for determining whether a mammalian subject having a breast cancer is likely to benefit from an endocrine treatment, comprising the steps of: providing a sample earlier obtained from said subject; evaluating the amount of HMGCR protein or HMGCR mRNA present in at least part of said sample, and determining a sample value corresponding to said amount; comparing the sample value obtained in step b) with a reference value; and, if said sample value is higher than said reference value, concluding that the subject is likely to benefit from an endocrine treatment. Further, a corresponding method of treatment is provided as well as further methods uses and means which may be employed in connection with breast cancer treatment or treatment prediction. | 06-16-2011 |
20110142829 | ANTI-TUMOUR COMPOSITIONS AND METHODS - A method for the prophylaxis and/or treatment of a tumour in a subject is provided. The method comprises the steps of administering a therapeutically effective amount of a composition comprising an anti-tumour agent and a therapeutically effective amount of a composition comprising 5-[2-pyrazinyl]-4-methyl-1,2-3-thione, or an analogue, derivative, metabolite, prodrug, solvate or pharmaceutically acceptable salt thereof to the subject. Examples of anti-tumour agents for use in the method of the invention are platinum-based agents, such as cisplatin, and monoclonal antibodies, such Cetuximab. Also provided are compositions comprising an anti-tumour agent and 5-[2-pyrazinyl]-4-methyl-1,2-3-thione, or an analogue, derivative, metabolite, prodrug, solvate or pharmaceutically acceptable salt thereof. | 06-16-2011 |
20110142830 | MODULATION OF THE TRPV: VPS10P RECEPTOR SYSTEM FOR THE TREATMENT OF PAIN - This invention relates to the use of an agent capable of binding and thus inhibit formation of a binary Vps10p-domain receptor:TrpV receptor complex, and/or formation of a further ternary Vps10p-domain receptor:TrkA:TrpV receptor complex for the preparation of a medicament for the inhibition of pain and pain signalling through said complex(es). The invention is thus beneficial in the preparation of a medicament for the treatment and/or prevention of neuropathic pain, chronic pain and acute pain. The invention furthermore relates to the identification of such agents and animal models for screening for such agents. | 06-16-2011 |
20110142831 | USE OF IL-23 AND IL-17 ANTAGONISTS TO TREAT AUTOIMMUNE OCULAR INFLAMMATORY DISEASE - Novel methods and drug products for treating autoimmune ocular inflammatory disease are disclosed, which involve administration of agents that antagonize one or both of IL-17 and IL-23 activity. | 06-16-2011 |
20110142832 | SOLUBLE TUMOR NECROSIS FACTOR RECEPTOR TREATMENT OF MEDICAL DISORDERS - The invention pertains to methods and compositions for treating medical disorders characterized by elevated levels or abnormal expression of TNFα by administering a TNFα antagonist, such as recombinant TNFR:Fc. | 06-16-2011 |
20110142833 | METHODS FOR TREATING AND PREVENTING FIBROSIS - The present invention provides methods of screening for compositions useful for treating, ameliorating, or preventing fibrosis and/or fibrosis-associated conditions by measuring changes in the level(s) of IL-21 and/or IL-21 receptor (IL-21R) (e.g., the level of expression of IL-21 and/or IL-21R protein and/or mRNA, the level of activity of IL-21 and/or IL-21R, the level of interaction of IL-21 with IL-21R). The invention further provides antagonists of IL-21 or IL-21R for the treatment of fibrosis and/or fibrosis-associated conditions. Further provided herein are methods of diagnosing, prognosing, and monitoring the progress (e.g., the course of treatment) of fibrosis and/or fibrosis-associated conditions by measuring the level of IL-21 and/or IL-21R (i.e., the level of activity of IL-21 and/or IL-21R, the level of expression of IL-21 and/or IL-21R (e.g., the level of IL-21 and/or IL-21R gene products), and/or the level of interaction of IL-21 with IL-21R). | 06-16-2011 |
20110150866 | Compositions and Methods for Increasing Bone Mineralization - A novel class or family of TGF-β binding proteins is disclosed. Also disclosed are assays for selecting molecules for increasing bone mineralization and methods for utilizing such molecules. | 06-23-2011 |
20110150867 | POLYPEPTIDES WITH ENHANCED ANTI-INFLAMMATORY AND DECREASED CYTOTOXIC PROPERTIES AND RELATING METHODS - The invention provides a polypeptide containing at least one IgG Fc region, wherein said at least one IgG Fc region is glycosylated with at least one galactose moiety connected to a respective terminal sialic acid moiety by a α 2,6 linkage, and wherein said polypeptide having a higher anti-inflammatory activity as compared to an unpurified antibody. | 06-23-2011 |
20110150868 | DIAGNOSTIC AND THERAPEUTIC METHODS AND COMPOSITIONS INVOLVING PTEN AND BREAST CANCER - Patients with ErbB2-overexpressing cancers can be given an ErbB2 targeting agent as a therapeutic regimen but not all patients are responsive. The present invention concerns the diagnostic, prognostic and therapeutic methods and compositions for evaluating potential efficacy of an ErbB2 targeting agent in an ErbB2-overexpressing cancers by evaluating PTEN expression, which is predictive of responsiveness or resistance to ErbB2 targeting agents such as trastuzumab. Low PTEN expression is predictive of a patient who will respond poorly to trastuzumab. | 06-23-2011 |
20110150869 | Neuroinvasion Inhibitor - The present inventors discovered that neural invasion is suppressed by inhibiting IL-6 in a model for neural invasion of pancreatic cancer, and completed the present invention. The present inventors also demonstrated that: an IL-6 receptor is expressed in cells of human pancreatic cancer cell lines; and IL-6 enhances the chemotactic and migratory activities and intracellular signaling of pancreatic cancer cells; and thus pancreatic cancer can be treated by inhibiting IL-6. Furthermore, the present inventors found that neural invasion of human pancreatic cancer can be suppressed, from the results of administering IL-6 inhibitors to neural invasion model mice. | 06-23-2011 |
20110150870 | FULLY HUMAN ANTI-HUMAN NKG2D MONOCLONAL ANTIBODIES - The invention relates to isolated fully human monoclonal antibodies having specificity for human NKG2D and compositions thereof. The invention further relates to methods for using such antibodies in treating diseases or conditions such as cancer, autoimmune disease, or infectious disease. | 06-23-2011 |
20110150871 | TREATMENT OF AN AUTOIMMUNE DISEASE USING IL-18 ANTAGONISTS - The present invention relates to the field of autoimmune diseases, including rheumatoid arthritis (RA) and inflammatory bowel disease (IBD). Specifically, the invention relates to methods of treating autoimmune diseases in patients that are non-responsive or refractory over time to treatment with TNF-α antagonists and/or T-cell co-stimulation antagonists with an IL-18 antagonist. | 06-23-2011 |
20110158982 | COMPOSITIONS AND METHODS FOR INHIBITING MAdCAM - The present invention relates to therapeutic targets for multiple sclerosis and neuroinflammatory diseases and injuries. In particular, the present invention relates to targeting MAdCAM in the treatment of such disorders. | 06-30-2011 |
20110158983 | COMPOSITIONS AND METHODS FOR MUCOSITIS AND ONCOLOGY THERAPIES - In alternative embodiments, this invention provides compositions and methods for treating cancer or any condition caused by dysfunctional cells, side effects from treatments for cancer or any condition caused by dysfunctional cells, e.g., mucositis therapies (e.g., for oral mucositis; digestive mucositis; esophageal mucositis; intestinal mucositis). In alternative embodiments, the invention provides cytoprotection products that may be used either alone or in combination with other medical therapies such as cancer chemotherapies and radiation therapies. | 06-30-2011 |
20110158984 | ANTI-ORTHOPOXVIRUS RECOMBINANT POLYCLONAL ANTIBODY - Disclosed is an anti-orthopoxvirus recombinant polyclonal antibody comprising distinct members which in union are capable of binding at least three orthopoxvirus related antigens, a pharmaceutical composition comprising the antibody, and a method for its production. Also disclosed is a polyclonal cell line capable of producing the recombinant polyclonal antibody as therapeutic methods utilizing the polyclonal antibody. Finally, the invention also pertains to a method for screening for useful V | 06-30-2011 |
20110158985 | METHODS OF PREVENTING AND TREATING RSV INFECTIONS AND RELATED CONDITIONS - The present invention provides methods for preventing, managing, treating and/or ameliorating a Respiratory Syncytial Virus (RSV) infection (e.g., acute RSV disease, or a RSV upper respiratory tract infection (URI) and/or lower respiratory tract infection (LRI)), otitis media (preferably, stemming from, caused by or associated with a RSV infection, such as a RSV URI and/or LRI), and/or a symptom or respiratory condition relating thereto (e.g., asthma, wheezing, and/or reactive airway disease (RAD)) in a subject, comprising administering to said human an effective amount of one or more antibodies that immunospecifically bind to one or more RSV antigens with a high affinity and/or high avidity. In some embodiments, one or more antibodies comprise a modified IgG constant domain, or FcRn-binding fragment thereof resulting in longer in vivo serum half-life. In particular embodiments the methods of the invention comprising administering to subject an effective amount of one or more modified antibodies that immunospecifically bind to one or more RSV antigens with an association rate (k | 06-30-2011 |
20110158986 | HUMANIZED ANTIBODIES THAT SEQUESTER AMYLOID BETA PEPTIDE - A method to treat conditions characterized by formation of amyloid plaques both prophylactically and therapeutically is described. The method employs humanized antibodies which sequester soluble Aβ peptide from human biological fluids or which preferably specifically bind an epitope contained within position 13-28 of the amyloid beta peptide Aβ. | 06-30-2011 |
20110158987 | NOVEL ANTIBODY FORMULATION - This invention relates to a pharmaceutical formulation of an antibody against Epidermal Growth Factor Receptor (EGFR), a process for the preparation and uses of the formulation. | 06-30-2011 |
20110158988 | ANTIBODIES AGAINST EXTRACELLULAR DOMAINS 2 AND 3 OR HER2 - The present invention relates to an affinity ligand capable of selective interaction with a subset consisting of 37 consecutive amino acid residues or less from extracellular domains 2 and 3 of HER2, wherein the subset comprises the amino acid sequence LQVF and/or ESFDGD1 and to polypeptides consisting of such subsets. | 06-30-2011 |
20110158989 | Poly (ADP-Ribose) Polymerase (PARP) INHIBITORS - Disclosed are compounds of the following formula: | 06-30-2011 |
20110158990 | 5-ANILINOIMIDAZOPYRIDINES AND METHODS OF USE - The invention relates to a method of inhibiting abnormal cell growth or treating a hyperproliferative disorder in a mammal comprising administering to said mammal a therapeutically effective amount of an imidazopyridine of formula I with anti-hyperproliferative activity. | 06-30-2011 |
20110158991 | CYTOTOXIC AGENTS COMPRISING NEW MAYTANSINOIDS - New thiol and disulfide-containing maytansinoids bearing a mono or di-alkyl substitution on the α-carbon atom bearing the sulfur atom are disclosed. Also disclosed are methods for the synthesis of these new maytansinoids and methods for the linkage of these new maytansinoids to cell-binding agents. The maytansinoid-cell-binding agent conjugates are useful as therapeutic agents, which are delivered specifically to target cells and are cytotoxic. These conjugates display vastly improved therapeutic efficacy in animal tumor models compared to the previously described agents. | 06-30-2011 |
20110158992 | Engineered Anti-IL-23R Antibodies - Antibodies to human IL-23R are provided, as well as uses thereof, e.g. in treatment of inflammatory, autoimmune, and proliferative disorders. | 06-30-2011 |
20110165150 | Isolated organ perfusion combination therapy of cancer - The invention relates to a combination therapy for the treatment of tumors and tumor metastases comprising administration of integrin ligands, preferably integrin antagonists, together with co-therapeutic agents or therapy forms that have synergistic efficacy when administered together with said ligands, such as chemotherapeutic agents and/or radiation therapy, in isolated organ perfusion. The therapy results in a synergistic potential increase of the inhibition effect of each individual therapeutic on tumor cell proliferation, yielding more effective treatment than found by administering an individual component alone. | 07-07-2011 |
20110165151 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH BENDAMUSTINE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with bendamustine for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and bendamustine. | 07-07-2011 |
20110165152 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH FLUDARABINE AND/OR MITOXANTRONE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with fludarabine and/or mitoxantrone for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody with fludarabine and/or mitoxantrone. | 07-07-2011 |
20110165153 | ANTI CD37 ANTIBODIES - Chimeric and humanized anti-CD37 antibodies and pharmaceutical compositions containing them are useful for the treatment of B cell malignancies and autoimmune and inflammatory diseases that involve B cells in their pathology. | 07-07-2011 |
20110165154 | COMPOSITIONS AND METHODS USING ANTI-CS1 ANTIBODIES TO TREAT MULTIPLE MYELOMA - Compositions and methods for treating MM are provided herein. | 07-07-2011 |
20110165155 | METHODS OF TREATING METASTATIC BREAST CANCER WITH TRASTUZUMAB-MCC-DM1 - Methods of treating patients having metastatic or unresectable locally advanced HER2 positive cancer, e.g., breast cancer, with the antibody-drug conjugate trastuzumab-MCC-DM1 are provided, wherein the patients have received extensive prior treatment, e.g., with an anthracycline, a taxane, capecitabine, lapatinib, and trastuzumab. | 07-07-2011 |
20110165156 | ANTIBODIES AGAINST HUMAN CSF-1R AND USES THEREOF - The present invention relates to antibodies against human CSF-1R (anti-CSF-1R antibody), methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof. | 07-07-2011 |
20110165157 | EXTENDING TIME TO DISEASE PROGRESSION OR SURVIVAL IN CANCER PATIENTS - The present application describes extending time to disease progression or survival in a cancer patient, where the patient's cancer displays HER activation, by treating the patient with a HER dimerization inhibitor, such as pertuzumab. | 07-07-2011 |
20110165158 | METHODS FOR THE THERAPY OF INFLAMMATORY BOWEL DISEASE USING A TYPE-1 INTERFERON ANTAGONIST - Compositions and methods for the therapy of Inflammatory Bowel Disease (IBD), including Celiac Disease, Crohn's Disease, and Ulcerative Colitis, are disclosed. Illustrative compositions comprise one or more anti-type 1 interferon antagonists, such as anti-type 1 interferon receptor antibody antagonists and fragments thereof, as well as polypeptides and small molecules that inhibit the interaction of type 1 interferon with its receptor (IFNAR). | 07-07-2011 |
20110165159 | USE OF CHIMERIC ANTI-CD20 ANTIBODY AS IN VITRO OR IN VIVO PURGING AGENT IN PATIENTS RECEIVING BMT OR PBSC TRANSPLANT - The use of anti-CD20 antibodies as in vivo purging agents for patients receiving bone marrow or peripheral blood stem cell transplant during treatment of B-cell-related diseases, e.g., B-cell lymphomas or leukemias, is disclosed. Such purging may enhance engraftment and/or prevent disease relapse in such patients. | 07-07-2011 |
20110171208 | CD37 IMMUNOTHERAPEUTIC AND COMBINATION WITH BIFUNCTIONAL CHEMOTHERAPEUTIC THEREOF - The present disclosure provides a humanized anti-CD37 small modular immunopharmaceutical (SMIP) molecule, as well as synergistic combination therapies of CD37-specific binding molecules (such as anti-CD37 SMIP proteins or antibodies) with bifunctional chemotherapeutics (such as bendamustine) that can be administered concurrently or sequentially, for use in treating or preventing B cell related autoimmune, inflammatory, or hyperproliferative diseases. | 07-14-2011 |
20110171209 | Potentiation of Autoimmune and Inflammatory Disease Treatments by Immune Regulatory Oligonucleotide (IRO) Antagonists of TLR7 and TLR9 - The invention provides the use of immune regulatory oligonucleotides (IRO) as antagonist of TLRs and potentiators of anti-inflammatory agents that inhibit TNF for the prevention and treatment of inflammatory and autoimmune diseases. | 07-14-2011 |
20110171210 | HUMANIZED MONOCLONAL ANTIBODIES AND METHODS OF USE - The present invention comprises a humanized monoclonal antibody that binds to the chemokine receptor CCR4. This antibody is derived from Mab 1567 and recognizes the same epitope. Binding of the invented antibody to CCR4 inhibits ligand-mediated activities and is used to treat symptoms of cancer. Moreover, the antibody is used in combination with vaccines to suppress the activity of regulatory T cells. | 07-14-2011 |
20110171211 | HEAT SHOCK PROTEIN GP96 VACCINATION AND METHODS OF USING SAME - The invention provides a tumor cell genetically modified to express a nucleic acid encoding a secreted form of a heat shock protein (hsp) gp96 polypeptide. The invention also provides a method of stimulating an immune response to a tumor by administering a tumor cell genetically modified to express a nucleic acid encoding a secreted form of a gp96 polypeptide. | 07-14-2011 |
20110171212 | METHODS AND COMPOSITIONS FOR PREVENTING RADIATION-INDUCED PNEUMONITIS - Disclosed are methods of minimizing the risk for a patient of developing pneumonitis during radiotherapy for a thorax-associated neoplasm and compositions for use in such methods. A preferred composition comprises a CD95/CD95L inhibitor. Further disclosed is a method of increasing the radiation dose administered to a patient during radiotherapy for a thorax-associated neoplasm. | 07-14-2011 |
20110171213 | METHODS FOR TREATING PANCREATIC CANCER - The present disclosure is directed to methods of treating pancreatic cancer in subject using cancer with antibodies that specifically bind to progastrin. | 07-14-2011 |
20110171214 | EFFICIENT WELL BEING ASSESSMENT AND IMPROVED TREATMENT PROTOCOL - Methods to appraise general health and to assess the effectiveness of therapeutic agents are disclosed. These methods can be performed on blood samples or other bodily fluids and comprise effecting cell death of endothelial cells, staining the dead cells and observing them microscopically. In addition, the invention is directed to combination treatments for neoplastic diseases or other conditions characterized by unwanted angiogenesis by administering an antiangiogenesis agent while maintaining nontoxic levels of ethanol and/or DMSO in the blood. | 07-14-2011 |
20110171215 | PD-1 SPECIFIC ANTIBODIES AND USES THEREOF - One aspect of the present disclosure provides antibodies that can act as agonists of PD-1, thereby modulating immune responses regulated by PD-1. Another aspect of the disclosure provides compositions comprising PD-1 specific antibodies and their use in methods of down regulating the immune response. These methods can be practiced on any subject, including humans or animals. Anti-PD-1 antibodies disclosed herein may be used, in another aspect of the invention, to detect PD-1 or its fragments in a biological sample. The amount of PD-1 detected may be correlated with the expression level of PD-1, and associated with the activation status of immune cells (e.g., activated T cells, B cells, and/or monocytes) in the subject. | 07-14-2011 |
20110171216 | MONOCLONAL ANTIBODIES SPECIFIC FOR PANCREATIC NEOPLASIA CELLS - Isolated monoclonal antibodies are disclosed herein that specifically bind a cell surface antigen expressed on the human pancreatic cancer cells or precancerous pancreatic cancer cells. Humanized forms of these antibodies, functional fragments of these antibodies, and hybridomas producing these antibodies are also disclosed. The antibodies can be conjugated to an effector molecule, such as a detectable marker, a therapeutic agent, or a toxin. The antibodies can be used for in vitro or in vivo pancreatic cancer diagnosis or disease monitoring via detection of pancreatic cancer cells or the pancreatic cancer cell surface antigen. Methods of treating a pancreatic cancer by administration of the antibodies are also disclosed. | 07-14-2011 |
20110171217 | STABLE LIQUID ANTIBODY FORMULATION - The present invention relates generally to the field of pharmaceutical formulations of antibodies. Specifically, the present invention relates to a stable liquid antibody formulation and its pharmaceutical preparation and use. This invention is exemplified by a liquid formulation of a humanised anti-NGF antibody. | 07-14-2011 |
20110177061 | METHODS OF TREATING AND PREVENTING NEUROLOGICAL DISORDERS USING DOCOSAHEXAENOIC ACID - The disclosure relates to methods of treating or preventing neurological disorders using docosahexaenoic acid. | 07-21-2011 |
20110177062 | METHODS FOR TREATING BREAST CANCER - The present disclosure is directed to methods of treating and preventing breast cancer or recurrence of breast cancer with compositions comprising anti-progastrin antibodies. | 07-21-2011 |
20110177063 | METHODS FOR TREATING COLORECTAL CANCER - The present disclosure is directed to methods of treating and preventing colorectal cancer metastasis or recurrence of colorectal cancer with compositions comprising anti-progastrin antibodies. | 07-21-2011 |
20110177064 | Compositions and Methods for Treatment of Ovarian Cancer - The present invention relates to surprisingly effective anti-cancer drug combinations, pharmaceutical compositions comprising the same, and uses thereof in the treatment of ovarian cancer. In particular, the present invention is based on the discovery that the administration of a CD56 antibody linked to a cytotoxic compound (e.g.,, an immunoconjugate) in combination with at least two chemotherapeutic agents (in particular a taxane compound and a platinum compound), improves the therapeutic index in the treatment of ovarian cancer over and above the additive effects of the anticancer agents used alone. In one embodiment of the invention, combinations of the CD56 antibody, or fragment thereof, linked to a cytotoxic compound plus additional chemotherapeutic agents have a synergistic effect in the ovarian cancer therapeutic index. The present invention also provides methods of modulating the growth of selected cell populations, such as ovarian cancer cells, by administering a therapeutically effective amount of such combinations. | 07-21-2011 |
20110177065 | METHODS OF TREATING/PREVENTING INFLAMMATION USING COMBINATION OF IL-1 ANTAGONIST AND IL-18 BINDING PROTEIN - The invention relates to the combined use of an IL-1 antagonist/inhibitor and IL-18 binding protein in inflammatory diseases. | 07-21-2011 |
20110177066 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASES - Passive immunotherapy methods for treating a patient having AL amyloidosis characterized by the presence of amyloid light chain-type protein fibrils. | 07-21-2011 |
20110177067 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH INCREASED ANTIBODY DEPENDENT CELLULAR CYTOTOXICITY (ADCC) - The present invention is directed to a pharmaceutical composition comprising: (A) a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity (ADCC); and (B) a chemotherapeutic agent selected from the group consisting of: cyclophosphamide, vincristine and doxorubicine. The present invention is also directed to a method for the treatment of a CD20 expressing cancer, comprising administering to a patient in need of such treatment (i) an effective first amount of a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity; and (ii) an effective second amount of one or more chemotherapeutic agents selected from the group consisting of cyclophosphamide, vincristine and doxorubicine. | 07-21-2011 |
20110177068 | PHARMACEUTICAL PREPARATION COMPRISING AN ANTIBODY AGAINST THE EGF RECEPTOR - The invention relates to an aqueous pharmaceutical preparation comprising an antibody against endothelial growth factor receptor (EGF receptor). The preparation has increased storage stability, even at elevated temperatures, and can be used for the treatment of tumours. | 07-21-2011 |
20110182886 | COMPOSITIONS AND METHODS FOR INHIBITING TUMOR PROGRESSION - Compositions and methods are provided for the classification, diagnosis, treatment, and prevention of tumors characterized by loss of REST function, expression of β2, and/or activation of Notch. Further compositions and methods are provided for modulation of cellular processes such as EMT, cell migration, and apoptosis. | 07-28-2011 |
20110182887 | HUMANIZED ANTI-CD22 ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY, TRANSPLANTATION AND AUTOIMMUNE DISEASE - The present invention provides chimeric and humanized versions of anti-CD22 mouse monoclonal antibody, HB22.7. The anti-CD22 antibodies of the invention comprise four human or humanized framework regions of the immunoglobulin heavy chain variable region (“VH”) and four human or humanized framework regions of the immunoglobulin light chain variable region (“VK”). The invention further comprises heavy and/or light chain FW regions that contain one or more backmutations in which a human FW residue is exchanged for the corresponding residue present in the parental mouse heavy or light chain. Human or humanized VH framework regions of antibodies of the invention may comprise one or more of the following residues: a valine (V) at position 24 of framework region 1, a glycine (G) at position 49 of framework region 2, and an asparagine (N) at position 73 of framework region 3, numbered according to Kabat. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human CD22 antigen and that preferably mediate human ADCC, CDC, and/or apoptosis for: the treatment of B cell diseases and disorders in human subjects, such as, but not limited to, B cell malignancies, for the treatment and prevention of autoimmune disease, and for the treatment and prevention of graft-versus-host disease (GVHD), humoral rejection, and post-transplantation lymphoproliferative disorder in human transplant recipients. | 07-28-2011 |
20110182888 | Administration of an Inhibitor of HDAC, an Inhibitor of HER-2, and a Selective Estrogen Receptor Modulator - Methods of treating patients with an HDAC inhibitor and a HER-2 inhibitor are provided herein. In some embodiments, a SERM is also administered. | 07-28-2011 |
20110182889 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF NATURAL KILLER CELL RELATED DISEASES - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 07-28-2011 |
20110182890 | ANTI-PLEIOTROPHIN ANTIBODIES AND METHODS OF USE THEREOF - The present invention concerns antibodies that neutralize at least one biological activity of pleiotrophin. The antibodies can inhibit cancer cell growth and angiogenesis in vitro or in vivo. The present invention provides for methods of inhibiting cancer cell growth or angiogenesis in a subject comprising administering to said subject an effective amount of the antibodies described herein. The present invention also provides for methods of making the neutralizing antibodies described herein. | 07-28-2011 |
20110182891 | PHARMACEUTICAL DOSAGE FORM COMPRISING POLYMERIC CARRIER COMPOSITION - A pharmaceutical dosage form comprises a solid dispersion product of at least one active ingredient dispersed in a polymeric binder composition, the polymeric carrier composition comprising a) a vinylpyrrolidone homopolymer, wherein at least 95% by weight of the vinylpyrrolidone homopolymer has a molecular weight distribution within the range of from 1000 to 13 000; and b) a vinylpyrrolidone copolymer having a weight-average molecular weight of from 5000 to 1 500 000. The dosage form is preferably prepared by a melt extrusion process. The polymeric carrier composition exhibits a high drug dissolution power and allows a reduction of the viscosity of the melt without deteriorating the mechanical properties and storage stability of the dosage form. | 07-28-2011 |
20110182892 | Methods to identify responsive patients - The present invention provides methods and kits for improving the progression-free survival of a patient suffering from gastrointestinal cancer and for assessing the sensitivity or responsiveness of the patient to treatment comprising bevacizumab. | 07-28-2011 |
20110182893 | PREVENTION AND TREATMENT OF AMYLOIDOGENIC DISEASES - Passive immunotherapy methods for treating a patient having atherosclerosis. | 07-28-2011 |
20110182894 | Methods of treating diabetes using IL-1beta antibodies - An IL-1β binding molecule, in particular an antibody to human IL-1β, especially a human antibody to human IL-1β is provided, wherein the CDRs of the heavy and light chains have amino acid sequences as defined, for use in the treatment of an IL-1 mediated disease or disorder, e.g. osteoarthritis, osteoporosis and other inflammatory arthritides. | 07-28-2011 |
20110182895 | ANTIBODY VARIANTS - Antibody variants of parent antibodies are disclosed which have one or more amino acids inserted in a hypervariable region of the parent antibody and a binding affinity for a target antigen which is at least about two fold stronger than the binding affinity of the parent antibody for the antigen. | 07-28-2011 |
20110189167 | Methods and Compositions for the Treatment of Myeloproliferative Diseases and other Proliferative Diseases - Methods of modulating a kinase activity of a wild-type kinase species, oncogenic forms thereof, aberrant fusion proteins thereof and polymorphs of any of the foregoing, are provided which employ compounds of the formula Ia: | 08-04-2011 |
20110189168 | ANTIBODY-INDUCED APOPTOSIS - Anti-Her2 antibodies which induce apoptosis in Her2 expressing cells are disclosed. The antibodies are used to “tag” Her2 overexpressing tumors for elimination by the host immune system. Also disclosed are hybridoma cell lines producing the antibodies, methods for treating cancer using the antibodies, and pharmaceutical compositions. | 08-04-2011 |
20110189169 | COMBINATION OF HGF INHIBITOR AND PTEN AGONIST TO TREAT CANCER - The present invention is directed toward a method of treating cancer by administering to a patient an inhibitor of Hepatocyte Growth Factor and an agonist of PTEN. | 08-04-2011 |
20110189170 | Chimeric Anti-VEGF-D Antibodies and Humanized Anti-VEGF-D Antibodies and Methods of Using the Same - The present invention relates to materials and methods for modulating angiogenesis and lymphangiogenesis. The compositions of the invention provide chimeric and/or humanized VEGF-D antibody substances, antibodies, polypeptides and fragments thereof useful for modulating angiogenesis and lymphangiogenesis in a subject. | 08-04-2011 |
20110189171 | RECOMBINANT ANTIBODIES FOR TREATMENT OF RESPIRATORY SYNCYTIAL VIRUS INFECTIONS - Disclosed are novel polyclonal antibodies, which target respiratory syncytial virus (RSV), as well as novel high affinity antibody molecules reactive with RSV. The polyclonal antibodies may comprise antibody molecules which are reactive with both RSV protein F and RSV protein G, and preferably the polyclonal antibodies target a variety of epitopes on these proteins. The antibody molecules of the invention have shown superior efficacy in vitro and/or in vivo. Also disclosed are methods of producing the antibodies of the invention as well as methods of their use in treatment or prevention of RSV infection. | 08-04-2011 |
20110189172 | METHODS FOR THE TREATMENT OF RHEUMATOID ARTHRITIS - Disclosed are compositions and methods for the treatment and/or prevention of rheumatoid arthritis, comprising administering to a subject an effective amount of anti-IL-1β antibody or fragment thereof. | 08-04-2011 |
20110189173 | PHOSPHORYLATED C-ErbB2 AS A SUPERIOR PREDICTIVE THERANOSTIC MARKER FOR THE DIAGNOSIS AND TREATMENT OF CANCER - The present invention provides reliable methods to identify subsets of subjects with a cancer of epithelial origin characterized by a high level of phosphorylated c-erbB2 which does not correlate with the over-expression of total c-erbB2 as measured by IHC or FISH, for selection and inclusion for c-erbB2-direct treatment and therapy. Furthermore, the present invention provides a reliable method to determine whether a subject with a cancer of epithelial origin who has been determined to be c-erbB2 positive by IHC and by FISH should be excluded from c-erbB2-direct treatment because of a non-significant level of phosphorylated c-erbB2 in epithelial tumor tissue. | 08-04-2011 |
20110189174 | COMPOSITIONS AND METHODS FOR TREATING, REDUCING, AMELIORATING, ALLEVIATING, OR INHIBITING PROGRESSION OF, PATHOGENIC OCULAR NEOVASCULARIZATION - A composition for treating, reducing, ameliorating, alleviating, or inhibiting the progression of, pathological ocular neovascularization comprises an integrin or vitronectin receptor antagonist having any one of Formulae I-XI, as defined herein. The composition can further comprise a VEGF inhibitor. Such composition is administered to an ocular environment by a method such as topical application, periocular injection, intravitreal injection, or intravitreal implantation. The composition can be administered alone or in combination with another procedure chosen to enhance the outcome of the treatment. | 08-04-2011 |
20110189175 | CHRONIC LYMPHOCYTIC LEUKEMIA PROGNOSIS AND TREATMENT - Provided herein are methods for identifying a subject afflicted with chronic lymphocytic leukemia who is responsive to treatment with a chemotherapeutic agent by detecting the presence or absence of at least one APOE4 allele in the subject, the presence of an APOE4 allele identifying the subject as responsive to the treatment. Also provided are methods of treating a subject afflicted with chronic lymphocytic leukemia, including administering an estrogenic agent, an androgen withdrawal agent, an apoE4 peptide or mimetic thereof, and/or a chemotherapeutic agent in an amount effective to treat said chronic lymphocytic leukemia. Methods of determining a prognosis for a patient diagnosed with chronic lymphocytic leukemia are also provided. In addition, methods for stratifying a subject into a subgroup of a clinical trial and methods for identifying a patient in a clinical trial of a treatment for chronic lymphocytic leukemia are herein provided. | 08-04-2011 |
20110189176 | METHODS OF TREATING DISEASES WITH DLL4 ANTAGONISTS - The present invention provides methods of preventing, treating or ameliorating diabetes by administering to a subject in need thereof a therapeutically effective amount of Dll4 antagonists that block Dll4-Notch signal pathways. As observed in a mouse model of diabetes, Dll4 antagonists exhibit protective effects on pancreatic islets, lower blood glucose levels, and block the production of auto-antibodies, including those against insulin and glutamic acid decarboxylase 65 (GAD65), via the expansion of regulatory T cells (Tregs). Thus, the present invention further provides methods of lowering the levels of blood glucose, and/or reducing or blocking the production of auto-antibodies, by administering to a subject in need thereof a therapeutically effective amount of Dll4 antagonists. Suitable Dll4 antagonists for the invention include antibodies or antibody fragments that specifically bind Dll4 and block Dll4-Notch interactions, the extracellular domain of Dll4, and the like. | 08-04-2011 |
20110189177 | ANTIBODIES TO VLA-1 - Antibodies that specifically bind to VLA-1 integrin and methods of using these antibodies to treat immunological disorders in a subject. Also included are crystal structures of complexes formed by VLA-1 antibodies and their ligands, and VLA-1 antagonists and agonists identified by using the structure coordinates of these structures. | 08-04-2011 |
20110189178 | Immunoprotection of Therapeutic Moieties Using Enhanced Fc Regions - The present application relates to therapeutic moieties displaying reduced immunogen response, particularly for therapeutic purposes. | 08-04-2011 |
20110189179 | Identification of Tumor-Associated Antigens for Diagnosis and Therapy - The invention relates to genetic products the expression of which is associated with cancer diseases. The invention also relates to the therapy and diagnosis of diseases in which the genetic products are expressed or aberrantly expressed, in particular cancer diseases. | 08-04-2011 |
20110195063 | Methods of Treating Ankylosing Spondylitis Using Anti-TNF Antibodies and Peptides of Human Tumor Necrosis Factor - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, including ankylosing spondylitis, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 08-11-2011 |
20110195064 | SURVIVAL PREDICTOR FOR DIFFUSE LARGE B CELL LYMPHOMA - The invention provides methods and materials related to a gene expression-based survival predictor for diffuse large B cell lymphoma (DLBCL) patients. | 08-11-2011 |
20110195065 | Compositions and Methods for Diagnosing and Treating Cancer - The present invention relates to compositions and methods for characterizing, diagnosing, and treating cancer. In particular the invention provides the means and methods for the diagnosis, characterization, prognosis and treatment of cancer and specifically targeting cancer stem cells. The present invention provides an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor and inhibits growth of tumor cells. The present invention further provides a method of treating cancer, the method comprising administering a therapeutically effective amount of an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor protein and inhibits growth of tumor cells. | 08-11-2011 |
20110195066 | QUINOLINE INHIBITORS OF TYROSINE KINASE - The present invention relates to new quinoline inhibitors of tyrosine kinases, pharmaceutical compositions thereof, and methods of use thereof. | 08-11-2011 |
20110195067 | POLYMERIC IMMUNOGLOBULIN FUSION PROTEINS THAT TARGET LOW AFFINITY FCy RECEPTORS - The present invention concerns a family of nucleic acids, polypeptides and cloning vectors which direct expression of fusion proteins that can mimic aggregated IgG (AIG) and immune complex function with respect to their interactions with FcγR and which allow for the inclusion and targeting of a second protein domain to cells expressing FcγR. This was accomplished by expressing multiple linear copies of the hinge and CH2 domains (HCH2) of human IgG | 08-11-2011 |
20110195068 | PD-1 ANTAGONISTS AND METHODS OF USE THEREOF - Compositions and methods for enhancing and/or prolonging the activation of T cells (i.e., increasing antigen-specific proliferation of T cells, enhancing cytokine production by T cells, stimulating differentiation ad effector functions of T cells and/or promoting T cell survival) or overcoming T cell exhaustion and/or anergy are provided. Suitable compositions include PD-1 receptor antagonists that bind to and block the endogenous PD-1 receptor without triggering inhibitory signals from PD-1, or bind to and block PD-1 receptor ligands and preventing them from interacting with PD-1 receptors. Methods for using the PD-1 receptor antagonists to enhance immune responses in subjects in need thereof are provided. | 08-11-2011 |
20110195069 | INHIBITORS OF COMPLEMENT ACTIVATION - The invention relates to factor D inhibitors, which bind to factor D and block the functional activity of factor D in complement activation. The inhibitors include antibody molecules, as well as homologues, analogues and modified or derived forms thereof, including immunoglobulin fragments like Fab, F(ab′) | 08-11-2011 |
20110200590 | Antibodies Directed Against the Myelin Basic Protein Recognising an Epitope of CD64 and Their Use as Immunosuppressants - It is described an antibody, recombinant or synthetic fragments thereof able to recognise and bind at least one epitope of the myelin basic protein. The antibody is also able to recognise also an epitope of the protein of the class of Fc receptors (FcR), namely CD64. Therapeutic applications are also disclosed. | 08-18-2011 |
20110200591 | PRODUCTS AND METHODS TO PREVENT INFECTIONS - The present invention relates to products and methods for preventing, ameliorating and/or treating infections and other diseases. In one aspect, the products of the present invention relates to compositions comprising germ free colostrum. In another aspect, the products of the present invention relates to compositions comprising synthetically multimerised immunoglobulins. In a third aspect, the products of the present invention relates to compositions comprising germ free colostrum enriched with synthetically multimerised immunoglobulins. The invention also relates to use of said compositions as a pharmaceutical e.g. for prophylactic or ameliorating treatment of infections and other diseases. In addition the invention comprises methods for production of said compositions. | 08-18-2011 |
20110200592 | Methods For Reducing Viral Load in HIV-1 Infected Patients - This method provides a method for reducing HIV-1 viral load in an HIV-1-infected human subject which comprises administering to the subject at a predefined interval effective HIV-1 viral load-reducing doses of (a) a humanized antibody designated PRO 140, or of (b) an anti-CCR5 receptor monoclonal antibody. This invention also provides a method for inhibiting in a human subject the onset or progression of an HIV-1-associated disorder, the inhibition of which is effected by inhibiting fusion of HIV-1 to CCR5 | 08-18-2011 |
20110200593 | Combination Therapy for the Treatment of Ocular Neovascular Disorders - The invention features methods for treating a patient diagnosed with, or at risk of developing, a neovascular disorder by administering a PDGF antagonist and a VEGF antagonist to the patient. The invention also features a pharmaceutical composition containing a PDGF antagonist and a VEGF antagonist for the treatment or prevention of a neovascular disorder. | 08-18-2011 |
20110200594 | FUNCTIONALIZED POLYPEPTIDES - The invention provides functionalized polypeptides, especially therapeutic polypeptides (e.g., scFv), comprising a linker sequence that can be rapidly and specifically functionalized by the addition of one or functional moieties (e.g., PEG) or binding specificities (e.g., an amino acid sequence with a particular binding specificity). Such functionalized polypeptides are advantageous in that they have improved pharmacokinetic properties (e.g., improved in vivo half-life, tissue penetration and tissue residency time) over non-functionalized polypeptides. Methods for the rapid and reproducible generation of functionalized polypeptides are also provided. | 08-18-2011 |
20110200595 | TREATMENT WITH A HUMANIZED IgG CLASS ANTI EGFR ANTIBODY AND AN ANTIBODY AGAINST INSULIN LIKE GROWTH FACTOR 1 RECEPTOR - The present invention provides a humanized IgG-class anti-EGFR antibody and an anti-IGF-1R antibody for combined use in treating cancer, with or without additional agents or treatments, such as other anti-cancer drugs or radiation therapy. The invention also encompasses a pharmaceutical composition that is comprised of a combination of a humanized IgG-class anti-EGFR antibody and an anti-IGF-1R antibody in a pharmaceutically acceptable carrier. | 08-18-2011 |
20110200596 | MONOVALENT ANTIBODY FRAGMENTS USEFUL AS THERAPEUTICS - The invention provides methods and compositions comprising a novel stabilized monovalent antibody fragment. | 08-18-2011 |
20110200597 | SIGNAL PATHWAY ALTERATIONS AND DRUG TARGET ELEVATIONS IN PRIMARY METACHRONOUS METASTATIC COLORECTAL CANCER COMPARED TO NON-METASTATIC DISEASE - The present invention relates to the identification and diagnostic use of biomarkers in primary colorectal cancer tumors whose activation level are predictive of the likelihood of the onset of metastatic disease. These biomarkers may be used to determine the suitability of a patient for aggressive and/or targeted treatments. Kits and compositions of the invention are also provided. | 08-18-2011 |
20110200598 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH A PROTEASOME INHIBITOR - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and a proteasome inhibitor for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and a proteasome inhibitor. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and a proteasome inhibitor. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and a proteasome inhibitor. | 08-18-2011 |
20110200599 | SUSTAINED DRUG DELIVERY SYSTEM - A drug composition comprising a charged moiety coupled to a therapeutic compound is disclosed. The charged moiety is configured to interact with at least one type of component of opposite charge in a biological tissue to create an in situ depot for prolonged drug delivery. The biological tissue may be eye tissue or any tissue containing charged components. Further, a method of treating the human body is disclosed. The method is for introducing into a human body a drug composition comprising a charged moiety coupled to a therapeutic compound. Introduction may be through injection. A method of manufacturing a drug composition comprising a charged moiety coupled to a therapeutic compound is also disclosed. | 08-18-2011 |
20110206658 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF TUMOR OF HEMATOPOIETIC ORIGIN - The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same. | 08-25-2011 |
20110206659 | METHODS AND TREATMENT FOR ALLERGIES AND INFLAMMATION ASSOCIATED WITH GASTROINTESTINAL DISEASES - Methods of the prophylaxis of the development of allergy in a patient at risk of sensitization to an antigen(s) or allergen(s) due to impaired gastrointestinal functions include administering a mast cell inhibitor, e.g., ketotifen, e.g., ketotifen fumarate. Methods for prophylactically treating, reducing, delaying or controlling gastrointestinal disorders include administering a mast cell stabilizer, e.g., ketotifen to a patient in need thereof. Pharmaceutical preparation, composition for use in methods described, are also disclosed. Also disclosed are methods of prophylaxis or treating gastrointestinal and esophageal inflammation, and methods for the prophylaxis of the development of additional allergies to a newly introduced substance in a patient with a preexisting allergy. Such methods include delivery of a mast cell stabilizer, e.g., ketotifen. Oral and topical administration are contemplated within the scope of the methods. | 08-25-2011 |
20110206660 | AMINO ACID SEQUENCES DIRECTED AGAINST CXCR4 AND OTHER GPCRS AND COMPOUNDS COMPRISING THE SAME - The present invention relates to amino acid sequences that are directed against (as defined herein) G-protein coupled receptors (GPCRs) and in particular to CXCR4 and CXCR7, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences (also referred to herein as “amino acid sequences of the invention”, “compounds of the invention”, and “polypeptides of the invention”, respectively). Furthermore, the invention provides a new method of making amino acid sequences that are directed against transmembrane protein, and in particular for multiple spanning transmembrane proteins for which the native conformation cannot be reproduced in other “in vitro” system (e.g. GPCRs in general). | 08-25-2011 |
20110206661 | TRIMETHOXYPHENYL INHIBITORS OF TYROSINE KINASE - The present invention relates to new trimethoxyphenyl inhibitors of tyrosine kinase, pharmaceutical compositions thereof, and methods of use thereof. | 08-25-2011 |
20110206662 | ANTI-ANGIOGENESIS THERAPY FOR THE TREATMENT OF OVARIAN CANCER - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents for the treatment of ovarian cancer. | 08-25-2011 |
20110206663 | Anti-Interferon-Alpha Antibodies - The present invention relates generally to the generation and characterization of neutralizing anti-IFN-α monoclonal antibodies with broad reactivity against various IFN-α subtypes. The invention further relates to the use of such anti-IFN-α antibodies in the diagnosis and treatment of disorders associated with increased expression of IFN-α, in particular, autoimmune disorders such as insulin-dependent diabetes mellitus (IDDM) and systemic lupus erythematosus (SLE). | 08-25-2011 |
20110206664 | Therapeutic agent for chronic arthritides diseases of childhood-related diseases - A therapeutic agent for chronic arthritides diseases of childhood-related diseases, for example chronic arthritides diseases of childhood, Still's disease and the like, comprising an interleukin-6 (IL-6) antagonist as an active ingredient. | 08-25-2011 |
20110206665 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 08-25-2011 |
20110206666 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 08-25-2011 |
20110206667 | POLYMORPHISM IN THE APO(A) GENE PREDICT RESPONSIVENESS TO ACETYLSALICYLIC ACID TREATMENT - This invention relates to nucleotide polymorphisms in the human Apo(a) gene and to the use of Apo(a) nucleotide polymorphisms in identifying whether a human subject will respond or not to treatment with acetylsalicylic acid. | 08-25-2011 |
20110212086 | GITR Antibodies For The Treatment of Cancer - The present invention provides compositions and methods for inhibiting the growth of a GITR-expressing cancer cell which cells may include, but are not limited to cells of epithelial origin such as NSCLC, prostate cancer, breast cancer, colon cancer and ovarian cancer and to treat or ameliorate the symptoms associated with the presence of these cells in a subject. Suitable compositions for use in these methods are antibodies that selectively recognize and bind to GITR (Glucocorticoid-induced TNFR-related protein) present on these cancer cells. The antibodies can be either polyclonal or monoclonal antibodies. | 09-01-2011 |
20110212087 | Antibody Fc Mutants with Ablated Effector Functions - Antibody and other Fc-containing molecules with variations in the Fc region reduce binding to Fc gamma receptors and resulting activity and can be used in the treatment of various diseases and disorders. | 09-01-2011 |
20110212088 | ANTI-PAF ANTIBODIES - Monoclonal antibodies to platelet activating factor (PAF) are described, along with methods for their production and use. Such antibodies can be formulated and used for therapeutic purposes, as well as for diagnosis and detection. | 09-01-2011 |
20110212089 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-01-2011 |
20110212090 | Combinatorial Analysis and Repair - A method for the repair of a unit, by specific diagnosis of the undesired state, and its appropriate repair, using said specific diagnosis as a means to repair in an appropriate way said unit. The diagnosis and repair processes may involve chemical, physical, or mechanical means. The units being diagnosed and repaired include live matter (e.g. human beings, animals, plants) as well as non-live matter (e.g. buildings, electronic equipment, polymer materials). | 09-01-2011 |
20110212091 | MATERIALS AND METHODS FOR INHIBITING CANCER CELL INVASION - The invention provides an isolated antibody or antibody fragment thereof that binds an extracellular epitope of a fibroblast growth factor receptor-4 (FGFR4) that is expressed by mammalian cells and inhibits cancer cell invasion. Optionally, the antibody or fragment thereof binds an epitope of FGFR4 that is bound by monoclonal antibody F90-10C5, or comprises complementarity determining regions identical to those of monoclonal antibody F90-10C5. Also provided are methods of using the antibody or fragment thereof to modulate invasion, ingrowth, or metastasis of cancer cells and treat cancer in a subject. The invention additionally provides a method of identifying an antibody or antibody fragment that inhibits invasiveness. | 09-01-2011 |
20110212092 | GLUCAGON RECEPTOR ANTAGONISTS - The present invention relates to glucagon receptor polypeptide antagonists which inhibit the binding of the hormone glucagon to its receptor. More particularly, the present invention relates to high affinity glucagon receptor antibodies or Fab fragments thereof that inhibit binding of glucagon to its receptor and their use in the treatment or prevention of type 2 diabetes (NIDDM) and related disorders in mammalian species. | 09-01-2011 |
20110217292 | MONOCLONAL ANTIBODIES AGAINST HMGB1 - In various embodiments, the present invention is drawn to antibodies or antigen-binding fragments thereof that bind to a vertebrate high mobility group box (HMGB) polypeptide, methods of detecting and/or identifying an agent that binds to an HMGB polypeptide, methods of treating a condition in a subject characterized by activation of an inflammatory cytokine cascade and methods of detecting an HMGB polypeptide in a sample. | 09-08-2011 |
20110217293 | Uses of morelloflavone - Provided herein are methods of treating postangiplasty, in-stent restenosis or atherosclerosis in an individual in need of such treatment, comprising the step of administering to said individual an effective dose of morelloflavone with or with a effective dose of one or more of an HMG-CoA reductase inhibitor or a hypolipidemic agent or lipid-lowering agent or other lipid agent or lipid modulating agent or anti-atherosclerotic agent. Also provided are pharmaceutical compositions comprising a morelloflavone or pharmaceutical combinations comprising a morelloflavone and one of an HMG-CoA reductase inhibitor or a hypolipidemic agent or lipid-lowering agent or other lipid agent or lipid modulating agent or anti-atherosclerotic agent. | 09-08-2011 |
20110217294 | COMBINATION OF HGF INHIBITOR AND HEDGEHOG INHIBITOR TO TREAT CANCER - The present invention is directed toward a method of treating cancer by administering to a patient an inhibitor of Hepatocyte Growth Factor and an inhibitor of the Hedgehog signaling pathway. | 09-08-2011 |
20110217295 | TREATMENT OF LUPUS ARTHRITIS USING LAQUINIMOD - This invention provides a method of treating a subject afflicted with active lupus arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with active lupus arthritis. This invention further provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof for use in treating a subject afflicted with lupus arthritis. | 09-08-2011 |
20110217296 | METHOD FOR SELECTING PATIENTS FOR TREATMENT WITH AN EGFR INHIBITOR - The present invention relates to cancer diagnostics and therapies and to the detection of alterations in cancer cells that are diagnostic, prognostic or predictive. In particular, the present invention provides a method for detecting and analyzing whether a patient suffering from a cancer is responsive to the treatment with an EGFR inhibitor. In the method, a tissue section from a cancer sample is subjected to assays based on immunohistochemistry and enzymatic metallography. | 09-08-2011 |
20110217297 | METHODS FOR CLASSIFYING AND TREATING BREAST CANCERS - The present invention relates to methods of treating a breast cancer in a subject, methods of identifying a subject with a breast cancer as a candidate for a therapy having efficacy for treating a breast cancer molecular subtype, and methods of selecting a therapy for a subject with a breast cancer. The methods comprise determining the molecular subtype of the breast cancer in the subject. In some embodiments, the methods further comprise administering to the subject a therapy that is effective for treating the molecular subtype of the breast cancer. | 09-08-2011 |
20110217298 | MONOCLONAL ANTIBODIES DIRECTED TO CD20 - The invention provides antibody to canine or feline or equine antigens. Specifically, antibodies directed to canine CD20 which have been caninized or felinized are provided. Also provided are methods for preparing high affinity antibodies to canine and feline CD20 as well as methods for treating B cell disorders in companion animals. | 09-08-2011 |
20110217299 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-08-2011 |
20110217300 | Quinazolinone Compounds and Methods of Use Thereof - The present invention relates to quinazolinone compounds, and methods of preparation of these compounds. The present invention also relates to pharmaceutical compositions comprising the quinazolinone compounds. The present invention provides methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of a quinazolinone compound of the present invention | 09-08-2011 |
20110217301 | METHODS FOR TREATING OR SCREENING FOR COMPOUNDS FOR THE TREATMENT OF SEPSIS - The present invention relates to a method for treating and screening for compounds for the treatment of sepsis. More specifically, the treatment and screening methods are based on the discovery that granzyme B containing platelets (GzmB-platelet) causes apoptosis by direct contact with cells. | 09-08-2011 |
20110223154 | COMPOSITIONS INCLUDING TRICIRIBINE AND METHODS OF USE THEREOF - This invention encompasses combination therapies including TCN, TCN-P, TCN-PM and/or related compounds and one or more additional anti-cancer agents, for example, taxanes a molecule that modulates the HER2/neu (erbB2) receptor, anthracyclin compounds, epidermal growth factor receptor inhibitor compounds, one or more platinum compounds and bortezomib and derivatives thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 09-15-2011 |
20110223155 | ANTAGONIST ANTI-NOTCH3 ANTIBODIES AND THEIR USE IN THE PREVENTION AND TREATMENT OF NOTCH3-RELATED DISEASES - The present invention relates to antagonist antibodies that specifically bind to Notch 3 and inhibit its activation. The present invention includes antibodies binding to a conformational epitope comprising the first Lin12 domain and the second dimerization domain. The present invention also includes uses of these antibodies to treat or prevent Notch 3 related diseases or disorders. | 09-15-2011 |
20110223156 | REVERSIBLE GEL PROTEIN FORMULATION - Reversible gel protein formulations, including pharmaceutical formulations, that inhibit protein aggregate formation are described, along with containers, e.g., a vial, ampoule or bottle; or an apparatus or device, e.g., a syringe, comprising such formulations. Also described are methods for inhibiting protein aggregation in a protein-containing sample and methods for inhibiting particle formation in a protein-containing sample. | 09-15-2011 |
20110223157 | METHODS FOR THE TREATMENT OF NON-HODGKIN'S LYMPHOMAS USING LENALIDOMIDE, AND GENE AND PROTEIN BIOMARKERS AS A PREDICTOR - Methods of treating or managing specific cancers, including non-Hodgkin's lymphoma, by the administration of 3-(4-amino- | 09-15-2011 |
20110223158 | ASSOCIATION OF LEVELS OF HDL-CHOLESTEROL APOLIPOPROTEIN CIII WITH THE RISK OF CORONARY HEART DISEASE AND CARDIOVASCULAR EVENTS - Presented herein are methods of diagnosing, assessing, and treating an individual at increased risk if developing coronary heart disease or cardiovascular event, based on the individual's level of high density lipoprotein cholesterol apoCIII (HDL-C apoCIII). | 09-15-2011 |
20110223159 | TUMOR THERAPY WITH AN ANTI-VEGF ANTIBODY - The present invention provides a method of treating a patient suffering from relapsed HER2 positive cancer with an anti-VEGF antibody during or after treatment with an anti-HER2 antibody. The invention also provides a kit comprising an anti-VEGF antibody. | 09-15-2011 |
20110223160 | COMPOSITIONS AND METHODS RELATING TO GLUCAGON RECEPTOR ANTIBODIES - The present disclosure provides compositions and methods relating to antigen binding proteins, in particular, antibodies which specifically bind to the human glucagon receptor. The disclosure provides nucleic acids encoding such antigen binding proteins and antibodies and methods of making and using such antibodies including methods of treating and preventing type 2 diabetes and related disorders by administering such antibodies to a subject in need of such treatment. | 09-15-2011 |
20110223161 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-15-2011 |
20110223162 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB 1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-15-2011 |
20110223163 | MONOCLONAL ANTIBODIES THAT REACT WITH THE CAPSULE OF BACILLUS ANTHRACIS - The present disclosure relates to monoclonal antibodies that bind poly-γ-D-glutamic acid (γDPGA), which is present on the surface of | 09-15-2011 |
20110229459 | ANTI-NR10 ANTIBODY AND USE THEREOF - The present inventors successfully obtained anti-NR10 antibodies having an effective neutralizing activity against NR10. The anti-NR10 antibodies provided by the present invention are useful as, for example, pharmaceuticals for treating or preventing inflammatory diseases. | 09-22-2011 |
20110229460 | ANTI-CD137 ANTIBODY AS AN AGENT IN THE TREATMENT OF INFLAMMATORY CONDITIONS - The present invention relates to the treatment of inflammatory conditions including atherosclerosis and sepsis. In particular, the invention relates to treatment of these conditions using antibodies. | 09-22-2011 |
20110229461 | PD-1 Antibodies - A humanised agonistic antibody which binds human PD-1 comprising a heavy chain and a light chain wherein the variable domain of the heavy chain comprises the sequence given in SEQ ID NO:1 for CDR-H1, the sequence given in SEQ ID NO:2 for CDR-H2 and the sequence given in SEQ ID NO:3 for CDR-H3 and the variable domain of the light chain comprises the sequence given in SEQ ID NO:4 for CDR-L1, the sequence given in SEQ ID NO:5 for CDR-L2 and the sequence given in SEQ ID NO:7 for CDR-L3. The invention also extends to therapeutic uses of the antibody molecules, compositions and methods for producing said antibody molecules. | 09-22-2011 |
20110229462 | Hepatocyte Growth Factor (HGF) Binding Proteins - The present invention provides a family of binding proteins that bind and neutralize the activity of hepatocyte growth factor (HGF), in particular human HGF. The binding proteins can be used as diagnostic and/or therapeutic agents. With regard to their therapeutic activity, the binding proteins can be used to treat certain HGF responsive disorders, for example, certain HGF responsive tumors. | 09-22-2011 |
20110229463 | RECOMBINANT ANTI-EPIDERMAL GROWTH FACTOR RECEPTOR ANTIBODY COMPOSITIONS - The invention relates to the field of recombinant antibodies for use in human cancer therapy. More specifically the invention provides the use of an antibody composition with two distinct non-overlapping binding specificities to human EGFR. The antibody composition is effecting in treating cancer following treatment with other anti-EGFR antibodies, whether the cancer shows progression during or following the prior treatment or not. The antibody composition can also be used for repeated treatment of recurrent tumours following first-line therapy with the antibody composition of the invention, as the composition does not lead to selection of resistant tumours. A further therapeutic use is the use of an antibody composition of the invention for treatment of cancer that is resistant to known anti-EGFR antibodies. | 09-22-2011 |
20110229464 | PHARMACEUTICAL COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION WITH MELATONIN ANALOGUES - Pharmaceutical compositions and methods for treating and/or preventing age-related macular degeneration with melatonin analogues are provided. | 09-22-2011 |
20110229465 | COMPOSITION FOR TREATING DISEASE - The present invention provides pharmaceutical compositions and kits comprising an agent capable of activating CD4+CD25+ regulatory T cells and methotrexate, and methods of treatment and medical uses utilising the same. | 09-22-2011 |
20110229466 | VASCULAR ENDOTHELIAL GROWTH FACTOR 2 - Disclosed are human VEGF-2 antibodies, antibody fragments, or variants thereof. Also provided are processes for producing such antibodies. The present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder comprising administering to an animal, preferably a human, an effective amount of one or more VEGF-2 antibodies or fragments or variants thereof. | 09-22-2011 |
20110229467 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-22-2011 |
20110229468 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 09-22-2011 |
20110229469 | METHODS FOR THE TREATMENT OF CANCER - Methods for treating cancer with at least one HGF-Met inhibitor and at least one EGFR inhibitor are provided | 09-22-2011 |
20110229470 | METHODS AND COMPOSITIONS FOR DIAGNOSIS AND TREATMENT OF AUTOIMMUNE DISEASE SECONDARY TO MULTIPLE SCLEROSIS - The invention provides methods of diagnosing multiple sclerosis (MS) patients, including methods of identifying multiple sclerosis patients who are at increased risk of developing a secondary autoimmune disease following lymphocyte depletion, caused, e.g., by treatment with an anti-CD52 antibody. Also embraced are methods of selecting treatment regimens for MS patients, and reagents useful in the above methods. | 09-22-2011 |
20110229471 | METHODS OF DETERMINING RESPONSIVENESS TO ANTI-TNF ALPHA THERAPY IN INFLAMMATORY BOWEL DISEASE - The present invention relates to methods of prognosing responsiveness to anti-TNFα therapy by determining the presence or absence of risk factors in the individual. In one embodiment, the risk factors are genetic markers, serological markers and/or clinical phenotypes associated with non-responsiveness to treatment with anti-TNFα therapy in an individual diagnosed with IBD. | 09-22-2011 |
20110236374 | GENETICALLY RECOMBINANT ANTIBODY COMPOSITION CAPABLE OF BINDING SPECIFICALLY TO GANGLIOSIDE GM2 - The present invention relates to a genetically recombinant antibody composition which specifically binds to ganglioside GM2, which has higher complement-dependent cytotoxic activity than a human IgG1 antibody and a human IgG3 antibody, wherein a polypeptide comprising a CH2 domain in the Fc region of a human IgG1 antibody is replaced by a polypeptide comprising an amino acid sequence which corresponds to the same position of a human IgG3 antibody indicated by the EU index as in Kabat, et al.; a DNA encoding the antibody molecule or a heavy chain constant region of the antibody molecule contained in the recombinant antibody composition; a transformant obtainable by introducing the recombinant vector into a host cell; a process for producing the recombinant antibody composition using the transformant; and a medicament comprising the recombinant antibody composition as an active ingredient. | 09-29-2011 |
20110236375 | ANTIBODY VARIANTS WITH ENHANCED COMPLEMENT ACTIVITY - The present invention relates to novel Fc variants that comprise at least one novel amino acid residue which may provide for enhanced effector function. More specifically, this invention provides Fc variants that have modified binding affinity to one or more Fc receptor or ligand (e.g., Fc gamma R, C1q). Additionally, the Fc variants have altered complement dependent cytotoxicity (CDC) activity and/or antibody-dependent cell-mediated cytotoxicity (ADCC). The invention further provides methods and protocols for the application of said Fc variants, particularly for therapeutic purposes. | 09-29-2011 |
20110236376 | NON-NEUTRALIZING IMMUNITY TO INFLUENZA TO PREVENT SECONDARY BACTERIAL PNEUMONIA - The prevention and treatment of secondary bacterial pneumonia is described, by using passive immunization with antibodies (e.g. polyclonal, monoclonal, etc.) to one or more conserved influenza proteins. Both antibodies and fragments thereof are contemplated, raised against conserved proteins such as nucleoproteins. | 09-29-2011 |
20110236377 | Hepatocyte Growth Factor (HGF) Binding Proteins - The present invention provides a family of binding proteins that bind and neutralize the activity of hepatocyte growth factor (HGF), in particular human HGF. The binding proteins can be used as diagnostic and/or therapeutic agents. With regard to their therapeutic activity, the binding proteins can be used to treat certain HGF responsive disorders, for example, certain HGF responsive tumors. | 09-29-2011 |
20110236378 | NON-HUMAN MAMMALS FOR THE PRODUCTION OF CHIMERIC ANTIBODIES - The invention provides knock-in non-human cells and mammals having a genome encoding chimeric antibodies and methods of producing knock-in cells and mammals. Certain aspects of the invention include chimeric antibodies, humanized antibodies, pharmaceutical compositions and kits. Certain aspects of the invention also relate to diagnostic and treatment methods using the antibodies of the invention. | 09-29-2011 |
20110236379 | PHARMACEUTICAL COMBINATIONS COMPRISING A PYRIDO [4,3-D] PYRIMIDINE DERIVED HSP90-INHIBITOR AND A HER2 INHIBITOR - A pharmaceutical combination comprising an Hsp90 inhibitor and an HER2 inhibitor, and methods of using the combination to treat proliferative disorders. | 09-29-2011 |
20110236380 | LIGANDS THAT BIND IL-13 - Disclosed are ligands that have binding specificity for interleukin-13 (IL-13), or for IL-4 and IL-13. Also disclosed are methods of using these ligands. In particular, the use of these ligands for treating IL-13-mediated conditions, such as lung conditions, eg allergic asthma, is described. The ligands have potent IL-13 binding kinetics. Ligands are described that are cross-reactive between human IL-13 and one or more primate IL-13. Ligands are well expressed in prokaryotic cells. | 09-29-2011 |
20110236381 | INHIBITION OF INTER-ALPHA TRYPSIN INHIBITOR FOR THE TREATMENT OF AIRWAY DISEASE - It is disclosed herein that blockade of inter-alpha-trypsin inhibitor (IaI) prevents the development of airway hyperresponsiveness in animal models of asthma and chronic obstructive pulmonary disease. Provided herein are methods of treating an airway disease or disorder in a subject by administering to the subject a therapeutically effective amount of an inhibitor of IaI. Also provided is a method of preventing or reducing airway hyperresponsiveness in a subject by administering to the subject a therapeutically effective amount of an inhibitor of IaI. The IaI inhibitor can be any compound that inhibits the expression or activity of IaI or a gene encoding an IaI polypeptide. In some embodiments, the IaI inhibitor is administered locally to the airway of the subject in need of treatment. For example, the inhibitor can be administered by aerosol delivery, such as by using an inhaler or nebulizer. | 09-29-2011 |
20110236382 | IMMUNOSUPPRESSIVE COMBINATION AND ITS USE IN THE TREATMENT OR PROPHYLAXIS OF INSULIN-PRODUCING CELL GRAFT REJECTION - A pharmaceutical combination comprising an accelerated lymphocyte homing agent in free form or in pharmaceutically acceptable salt form, and one or more compounds selected from the group consisting of an antibody to the IL-2 receptor, an immunosuppressive macrocyclic lactone and a soluble human complement inhibitor is used to treat or prevent insulin-producing cell graft rejection. | 09-29-2011 |
20110236383 | Protein Formulation - A stable lyophilized protein formulation is described which can be reconstituted with a suitable diluent to generate a high protein concentration reconstituted formulation which is suitable for subcutaneous administration. For example, anti-IgE and anti-HER2 antibody formulations have been prepared by lyophilizing these antibodies in the presence of a lyoprotectant. The lyophilized mixture thus formed is reconstituted to a high protein concentration without apparent loss of stability of the protein. | 09-29-2011 |
20110243925 | Gene Expression Profiles Being Predictive for the Response of Tumors to Pharmaceutically Effective Compounds - The present invention relates to a method for providing a gene expression profile being predictive for the specific response of an individual tumor to a pharmaceutically effective compound, the use thereof, a microarray wherein the nucleotide sequences attached to the substrate consist of nucleotide sequences corresponding to the predictive genes of said gene expression profile, and a diagnostic kit containing said microarray. | 10-06-2011 |
20110243926 | ANTI-P-SELECTIN ANTIBODIES AND METHODS OF USING THE SAME TO TREAT INFLAMMATORY DISEASES - The invention features antibodies, e.g., chimeric and humanized antibodies, that recognize (i.e., bind) P-selectin. The P-selectin antibodies prevent P-selectin from binding to its cognate receptor. The P-selectin antibodies can be used to treat inflammatory and thrombotic conditions, e.g., sickle cell disease, pain crisis associated with sickle cell disease, deep vein thrombosis, asthma, rheumatoid arthritis, psoriasis, and ischemia reperfusion injury in a patient in need thereof. | 10-06-2011 |
20110243927 | METHODS OF INHIBITING TUMOR GROWTH USING BETA 5 INTEGRIN ANTAGONISTS - The present invention relates to methods for treating cancer by administering to a mammalian subject a therapeutically effective amount of a selective β | 10-06-2011 |
20110243928 | CHIMERIC AND HUMANISED MONOCLONAL ANTIBODIES AGAINST INTERLEUKIN-13 - The present invention concerns immunoglobulins, particularly antibodies which specifically bind human Interleukin 13 (hIL-13). Antibodies of the invention may be used in the treatment of a variety of diseases or disorders responsive to modulation of the interaction between hIL-13 and the human IL-13 receptor. Such diseases include severe asthma, atopic dermatitis, COPD and various fibrotic diseases. Pharmaceutical compositions comprising said antibodies and methods of manufacture are also disclosed. | 10-06-2011 |
20110243929 | ANTI-ICOS ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY, TRANSPLANTATION AND AUTOIMMUNE DISEASE - The present invention provides anti-human ICOS antibodies with increased effector function. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human ICOS antigen and that may mediate ADCC, CDC, and/or antibody-dependent phagocytosis (opsonisation) for the treatment and prevention of T cell-mediated diseases and disorders, such as, but not limited to, chronic infection, autoimmune disease or disorder, inflammatory disease or disorder, graft-versus-host disease (GVHD), transplant rejection, and T cell proliferative disorder. | 10-06-2011 |
20110243930 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES - The present invention relates to compositions containing novel proteins and methods of using those compositions for the diagnosis and treatment of immune related diseases. | 10-06-2011 |
20110243931 | COMBINATION THERAPY WITH TYPE I AND TYPE II ANTI-CD20 ANTIBODIES - The present application is directed to the combination therapy of a type I and a type II anti-CD20 antibody for the treatment of cancer, especially of CD20 expressing cancer. | 10-06-2011 |
20110243932 | ANTI-CD40 ANTIBODIES - The present invention relates to new humanized antagonistic anti-CD40 antibodies and therapeutic and diagnostic methods and compositions for using the same. | 10-06-2011 |
20110243933 | Perifosine and Capecitabine as a Combined Treatment for Cancer - Treatment regimens comprising co-treatment of cancer with perifosine and capecitabine are disclosed herein, as well as pharmaceutical compositions and unit dosage forms thereof formulated to be suitable for use in said treatment regimens. | 10-06-2011 |
20110243934 | EPHA3 ANTIBODIES FOR THE TREATMENT OF MULTIPLE MYELOMA - The invention provides methods and compositions comprising anti-EphA3 antibodies for the treatment of multiple myeloma. | 10-06-2011 |
20110243935 | Compositions and Methods for Immunotherapy - The invention relates to immunotherapeutic compounds, compositions that include such compounds, and methods of using the compounds, for example, to treat an individual having, at risk for, or previously treated for a cancer. | 10-06-2011 |
20110243936 | TNFalpha-NEUTRALIZING ANTIBODIES - The invention provides monoclonal antibodies that neutralize TNFα activity. The monoclonal antibodies may be rabbit monoclonal antibodies or monoclonal antibodies having CDR regions derived from those rabbit monoclonal antibodies. In certain embodiments, the monoclonal antibodies may be humanized. Methods of using the subject antibodies to inhibit TNFα activity, methods of treatment using those antibodies and kits containing the same are also provided. The invention finds use in a variety of research and medical applications. | 10-06-2011 |
20110243937 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 10-06-2011 |
20110243938 | Methods to Reduce B-Helper T Cells to Treat Autoimmune Diseases - The present invention includes compositions and methods for the treatment of autoimmune diseases by administering to a subject having an autoimmune disorder an effective amount of a therapeutic composition comprising a pharmaceutically acceptable carrier and at least one IL-12 inhibitor, e.g., a blocking anti-IL-12 antibody or fragment thereof. | 10-06-2011 |
20110243939 | MODIFICATION OF NUCLEIC ACID VECTORS WITH POLYMERS COMPRISING CHARGED QUATERNARY AMINO GROUPS - The present invention provides a polymer modified nucleic acid vector in which the nucleic acid vector is covalently linked to a polymer, which polymer comprises one or more positively charged quaternary amino groups, wherein the nucleic acid vector is a micro-organism selected from the group consisting of a virus, a bacteria or a bacteriophage, a fungus, a spore, a eukaryotic cell nucleus or other micro-organism fragment or a component containing genetic information, and wherein (a) the polymer and/or the linkages between it and the nucleic acid vector are hydrolytically, reducibly or enzymatically degradable; and/or (b) wherein each of the positively charged quaternary amino groups is linked to the polymer backbone via one or more degradable or biodegradable linkages. | 10-06-2011 |
20110243940 | BICYCLIC PYRANONE DERIVATIVES AND METHODS OF USE THEREOF - The present invention relates to Bicyclic Pyranone Derivatives, their compositions and uses for treating or preventing a metabolic disorder, dyslipidemia, a cardiovascular disease, a neurological disorder, a hematological disease, cancer, inflammation, a respiratory disease, a gastroenterological disease, diabetes, a diabetic complication, obesity, an obesity-related disorder or non-alcoholic fatty liver disease. Formula (I). Y is —C— when an optional and additional bond is present and Y is —CH— when an optional and additional bond is not present; Z is —O—, —NH— or —N(alkyl)- when the optional and additional bond between Y and Z Is absent, and Z Is —N— when the optional and additional bond between Y and Z is present; R | 10-06-2011 |
20110243941 | Identification and Engineering of Antibodies with Variant Fc Regions and Methods of Using Same - The present invention relates to molecules, particularly polypeptides, more particularly immunoglobulins (e.g., antibodies), comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, which variant Fc region binds FcγRIIIA and/or FcγRIIA with a greater affinity, relative to a comparable molecule comprising the wild-type Fc region. The molecules of the invention are particularly useful in preventing, treating, or ameliorating one or more symptoms associated with a disease, disorder, or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder where an enhanced efficacy of effector cell function (e.g., ADCC) mediated by FcγR is desired, e.g., cancer, infectious disease, and in enhancing the therapeutic efficacy of therapeutic antibodies the effect of which is mediated by ADCC. | 10-06-2011 |
20110250194 | Treatment with Anti-ErbB2 Antibodies - The present invention concerns the treatment of disorders characterized by the overexpression of ErbB2. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer overexpressing ErbB2 with a combination of an anti-ErbB2 antibody and a chemotherapeutic agent other than an anthracycline, e.g. doxorubicin or epirubicin. The invention further provides a method of treating cancer in a human patient comprising administering effective amounts of an anti-ErbB2 antibody and a cardioprotectant to the patient. | 10-13-2011 |
20110250195 | Antibodies Against IL-25 - The present invention relates to IL-25 antibody VH domains and target binding members (e.g., antibodies) that comprise such antibody VH domains and bind IL-25. The invention also relates to compositions comprising target binding members {e.g., antibodies) that bind IL-25, methods of producing such target binding members, and uses of such target binding members for the treatment or prevention of diseases and conditions (e.g., asthma, inflammatory bowel disease). | 10-13-2011 |
20110250196 | PHARMACEUTICAL COMPOSITION USING GONADOTROPIN - RELEASING HORMONE (GNRH) COMBINED VARIANTS AS IMMUNOGEN - A pharmaceutical composition using natural gonadotropin-releasing hormone (GnRH), and/or some of its mimetic peptides, indistinctly bound by its amino or carboxyl extremes to a carrier molecule; in one case by its carboxyl extreme and in the other case by the amino terminal extreme, thus eliciting a faster and more potent immunological response against the endogenous GnRH hormone. This finally leads to the ablation of the GnRH and consequently of the rest of the involved hormones in the stream GnRH/LH-FSH/Testosterone-(estrogens). An advantage of this formulation consists on facilitating the exposition to the immune system of a greater number of epitopes of the GnRH or its mimetics, minimizing thus the steric hindrance produced by the carriers. This invention has a direct application in the castration of pets and animals of economic interest, in the control of human fertility as well as in the treatment of hormone-sensitive tumors, such as that of the prostate, the breast, ovary, the endometry, testicles, hypophysis, salivary glands and other kinds of human tumors. | 10-13-2011 |
20110250197 | PHARMACEUTICAL COMBINATION - This invention relates to a combination product or medicament comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixture thereof. Also provided herein are the pharmaceutical compositions comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixture thereof and optionally together with at least one pharmaceutically acceptable carrier, and methods for the treatment or prophylaxis of cardiovascular diseases, Alzheimer's disease, obesity, diabetes or inflammatory diseases comprising administering to a mammal in need thereof therapeutically effective amounts of combination pharmaceutical composition comprising at least one novel substituted pyrrole derivative and one or more dyslipidemic agents, antiobesity agents, antihyperglycaemic agents, anti-inflammatory agents or mixtures thereof. | 10-13-2011 |
20110256124 | METHODS FOR IMPROVING THE BIOACTIVITY OF THERAPEUTIC IgE ANTIBODIES FOR THE TREATMENT OF DISEASE - The invention provides a method for increasing the bioactivity (e.g. the biosafety and efficacy) of a therapeutic IgE antibody of the invention in the treatment of a patient. Methods of the invention include: i) administering to the patient a therapeutic IgE antibody in combination with at least one bioactivity-enhancing agent, ii) strategic treatment regimens and protocols for the dosing and administration of a therapeutic IgE antibody of the invention, and iii) the use of a therapeutic IgE antibody having a variable region comprising at least one antigen binding region specific for binding an epitope of an antigen wherein the epitope is not highly repetitive or is non-repetitive. | 10-20-2011 |
20110256125 | MATERIALS AND METHODS FOR IMPROVED IMMUNOGLYCOPROTEINS - Immunoglycoproteins, including antibodies, with improved ADCC and altered glycosylation patterns are provided. Also provided are cell culturing methods and media for producing such immunoglycoproteins, and therapeutic uses of such immunoglycoproteins. | 10-20-2011 |
20110256126 | IL-17A/F Heterologous Polypeptides and Therapeutic Uses Thereof - The present invention is directed to a novel naturally occurring human cytokine that is comprised of a heterodimer of interleukin-17 and interleukin-17F designated herein as interleukin 17A/F (IL-17A/F). Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, specific antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 10-20-2011 |
20110256127 | ANTI-LRP6 ANTIBODIES - The invention provides anti-LRP6 antibodies and methods of using the same. A particular aspect of the invention provides for bispecific anti-LRP6 antibodies that inhibit signaling by multiple Wnt isoforms. | 10-20-2011 |
20110256128 | TRIAZOLE COMPOUNDS AS KSP INHIBITORS - The present invention provides triazole compounds of Formula I: | 10-20-2011 |
20110256129 | APOPTOSIS PROMOTERS - Disclosed are compounds which inhibit the activity of anti-apoptotic protein family members, compositions containing the compounds and uses of the compounds for preparing medicaments for treating diseases during which occurs expression one or more than one of an anti-apoptotic protein family member. | 10-20-2011 |
20110256130 | METHODS OF TREATING INFLAMMATORY DISORDERS - Disclosed herein, in certain embodiments, are methods and compositions for treating inflammatory disorders. In some embodiments, the methods comprise co-administering synergistic combinations of modulators of inflammation. | 10-20-2011 |
20110256131 | BLOCKERS OF LIGHT, LTalpha1beta2 AND LTalpha2beta1 OR ITS RECEPTOR LTbetaR FOR THE PREVENTION AND TREATMENT OF CHRONIC HEPATITIS AND OTHER LIVER DISEASES - The present invention relates to a method of preventing and treating chronic hepatitis and other liver diseases comprising administering a blocker of Light, LTα1β2, LTα2β1 or LTβR, and the use of such blockers in said prevention and treatment and in the manufacture of medicaments for preventing and treating chronic hepatitis and other liver diseases. | 10-20-2011 |
20110256132 | MYOSTATIN BINDING PROTEINS - Description of antigen binding proteins, such as antibodies, which bind to myostatin, polynucleotides encoding such antigen binding proteins, pharmaceutical compositions comprising said antigen binding proteins and methods of manufacture. Furthermore, description of the use of such antigen binding proteins in the treatment or prophylaxis of diseases associated with anyone or a combination of decreased muscle mass, muscle strength and muscle function. | 10-20-2011 |
20110262430 | NOVEL ANTIBODIES - The present invention relates to antibodies or antigen binding fragments thereof which specifically binds to IGF-IR, specifically hIGF-1R. Also disclosed are antibody preparations comprising antibodies or antigen binding fragments of the invention. Methods of producing such antibodies or antigen binding fragments and uses thereof are also included within the scope of the present invention. | 10-27-2011 |
20110262431 | PHARMACEUTICAL COMPOSITION COMPRISING ANTIBODY COMPOSITION WHICH SPECIFICALLY BINDS TO CCR4 - A pharmaceutical composition, comprising an antibody composition which specifically binds to human CC chemokine receptor 4 (hereinafter also referred to as CCR4) and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament are required. The present invention can provide a pharmaceutical composition comprising a recombinant antibody against CCR4 and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament. | 10-27-2011 |
20110262432 | MUTATED NETRIN 4 PROTEINS, FRAGMENTS THEREOF AND THEIR USES AS DRUGS - A mutated protein includes the sequence of wild type netrin 4, represented by SEQ ID NO: 2, wherein at least one amino acid of the amino acids at position (13, 68, 183, 205, 234, 331, 332, 353, 472, 515, 589, 625, 626, 627) and (628) is mutated enabling thus to confer 1 to 15 mutations to the wild type protein, or, truncated protein derived from the mutated protein, wherein the 19 first contiguous, or the 31 first contiguous amino acids at the N-terminus part of the mutated protein are deleted; and/or the mutated protein being deleted of all amino acids located after the amino acid in position (477) or of all amino acids located after the amino acid in position (515). | 10-27-2011 |
20110262433 | METHOD FOR INHIBITING BONE RESORPTION - The invention is directed to a method of inhibiting bone resorption. The method comprises administering to a human an amount of sclerostin inhibitor that reduces a bone resorption marker level for at least 2 weeks. The invention also provides a method of monitoring anti-sclerostin therapy comprising measuring one or more bone resorption marker levels, administering a sclerostin binding agent, then measuring the bone resorption marker levels. Also provided is a method of increasing bone mineral density; a method of ameliorating the effects of an osteoclast-related disorder; a method of treating a bone-related disorder by maintaining bone density; and a method of treating a bone-related disorder in a human suffering from or at risk of hypocalcemia or hypercalcemia, a human in which treatment with a parathyroid hormone or analog thereof is contraindicated, or a human in which treatment with a bisphosphonate is contraindicated. | 10-27-2011 |
20110262434 | Methods to Expand the Eligible Patient Population for HER2-Directed Targeted Therapies - The present disclosure provides improved methods for identifying breast cancer patients that receive an increased benefit from the addition of a HER | 10-27-2011 |
20110262435 | IL-13 BINDING AGENTS - Agents (e.g., antibodies and fragments thereof) that bind specifically to IL 13 and modulate the ability of IL-13 to interact with IL-13 receptors and signaling mediators are disclosed. | 10-27-2011 |
20110262436 | TREATMENT METHOD - The present invention relates generally to the fields of molecular biology and growth factor regulation. More specifically, the invention relates to therapies for the treatment of pathological conditions, such as cancer. | 10-27-2011 |
20110262437 | USE OF ERBB4 AS A PROGNOSTIC AND THERAPEUTIC MARKER FOR MELANOMA - It is disclosed herein that members of the protein tyrosine kinase (PTK) family are highly mutated in patients with melanoma. Described herein are novel somatic mutations in the ERBB4 gene that result in increased kinase activity, transformation ability and anchorage-independent growth. These ERBB4 mutations contribute to the tumorogenicity of melanoma. Thus, provided herein is a method of predicting the prognosis of a patient with melanoma by detecting the presence or absence of a mutation in the ERBB4 gene. In some examples, the ERBB4 mutation is selected from G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbering based on SEQ ID NO: 1). Also provided are methods of selecting a patient as a candidate for treatment with an ERBB4 and/or PI3K/AKT pathway inhibitor, and a method of identifying a therapeutic agent for the treatment of a subject diagnosed with melanoma. Oligonucleotides that specifically hybridize with an ERBB4 nucleic acid molecule comprising a novel mutation, and arrays comprising such oligonucleotides, are also provided. | 10-27-2011 |
20110268726 | Anti-CD38 human antibodies and uses thereof - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for CD38, which plays an integral role in various disorders or conditions. These antibodies, accordingly, can be used to treat, for example, hematological malignancies such as multiple myeloma. Antibodies of the invention also can be used in the diagnostics field, as well as for investigating the role of CD38 in the progression of disorders associated with malignancies. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. The invention also provides isolated novel epitopes of CD38 and methods of use therefore | 11-03-2011 |
20110268727 | ANTI-INTERFERON-ALPHA ANTIBODIES - The present invention relates generally to the generation and characterization of neutralizing anti-IFN-α monoclonal antibodies with broad reactivity against various IFN-α subtypes. The invention further relates to the use of such anti-IFN-α antibodies in the diagnosis and treatment of disorders associated with increased expression of IFN-α, in particular, autoimmune disorders such as insulin-dependent diabetes mellitus (IDDM) and systemic lupus erythematosus (SLE). | 11-03-2011 |
20110268728 | SOLUBILITY OPTIMIZATION OF IMMUNOBINDERS - The invention provides methods of using sequence based analysis and rational strategies to improve the solubility of immunobinders, and in particular of single chain antibodies (scFvs). The invention provides methods of engineering immunobinders, and in particular scFvs, by performing one or more substitutions with hydrophilic residues identified by analysis of a database of selected, stable scFv sequences. The invention also provides immunobinders with optimized solubility prepared according to the engineering methods of the invention. | 11-03-2011 |
20110268729 | TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS BY NOGO-A-ANTAGONIST - The invention relates to methods for the treatment or prophylaxis of amyotrophic lateral sclerosis, comprising administering to a patient in need thereof a therapeutically effective amount of a Nogo-A antagonist. | 11-03-2011 |
20110268730 | METHOD FOR INHIBITING BONE RESORPTION - The invention is directed to a method of inhibiting bone resorption. The method comprises administering to a human an amount of sclerostin inhibitor that reduces a bone resorption marker level for at least 2 weeks. The invention also provides a method of monitoring anti-sclerostin therapy comprising measuring one or more bone resorption marker levels, administering a sclerostin binding agent, then measuring the bone resorption marker levels. Also provided is a method of increasing bone mineral density; a method of ameliorating the effects of an osteoclast-related disorder; a method of treating a bone-related disorder by maintaining bone density; and a method of treating a bone-related disorder in a human suffering from or at risk of hypocalcemia or hypercalcemia, a human in which treatment with a parathyroid hormone or analog thereof is contraindicated, or a human in which treatment with a bisphosphonate is contraindicated. | 11-03-2011 |
20110268731 | METHODS OF TREATING AUTOIMMUNE DISORDERS AND/OR INFLAMMATORY DISORDERS - The present invention relates to dendrimer compositions configured for treating inflammatory disorders and autoimmune disorders, and related methods of synthesis. Specifically, the present invention relates to methods for treating rheumatoid arthritis with PAMAM dendrimers having functional ligands configured for treating rheumatoid arthritis (e.g., therapeutic agents, pro-drugs, targeting agents, trigger agents, imaging agents) (e.g., methotrexate). | 11-03-2011 |
20110268732 | METHODS OF IDENTIFYING CRITICALLY ILL PATIENTS AT INCREASED RISK OF DEVELOPMENT OF ORGAN FAILURE AND COMPOUNDS FOR THE TREATMENT HEREOF - The present invention relates to compounds for treatment that protects the endothelium, prevent pathologic thrombus formation in the microcirculation and preserve platelet number and function and thus may be related to minimizing or preventing development of organ failure, including multiple organ failure (MOF), and, hence, death in critically ill patients by administration of agent(s) limiting the platelets ability to aggregate and form clots and/or by agents modulating/preserving endothelial integrity and/or by agent(s) increasing the rate of thrombus lysis, and Another aspect of the invention related to by a cell-based whole blood viscoelastical haemostatic assay identifying critically ill patients at increased risk of development of organ failure, including multiple organ failure (MOF) and death. | 11-03-2011 |
20110268733 | ANTI-Siglec-15 ANTIBODY - Provided is a pharmaceutical composition for treating and/or preventing abnormal bone metabolism targeting a protein encoded by a gene strongly expressed in osteoclasts. Specifically provided is a pharmaceutical composition containing an antibody which specifically recognizes human Siglec-15 and has an activity of inhibiting osteoclast formation, and the like. | 11-03-2011 |
20110268734 | PREVENTIVE OR THERAPEUTIC AGENT FOR PSORIATIC ARTHRITIS COMPRISING IL-6 ANTAGONIST AS ACTIVE INGREDIENT - A method for treating psoriatic arthritis comprising an interleukin-6 (IL-6) antagonist such as, for example, an antibody against IL-6 receptor. | 11-03-2011 |
20110274685 | ANTIBODIES THAT BIND HUMAN CD27 AND USES THEREOF - Isolated monoclonal antibodies which bind to human CD27 and related antibody-based compositions and molecules are disclosed. Also disclosed are therapeutic and diagnostic methods for using the antibodies. | 11-10-2011 |
20110274686 | ANTITUMOR COMBINATIONS CONTAINING ANTIBODIES RECOGNIZING SPECIFICALLY CD38 AND MELPHALAN - Pharmaceutical composition comprising an antibody specifically recognizing CD38 and melphalan. | 11-10-2011 |
20110274687 | METHODS OF TREATING TSLP-RELATED INFLAMMATORY DISORDERS - The present disclosure provides compositions and methods relating to antigen binding proteins which bind to human thymic stromal lymphopoietin (TSLP), including antibodies. In particular embodiments, the disclosure provides fully human, humanized and chimeric anti-TSLP antibodies and derivatives of such antibodies. The disclosure further provides nucleic acids encoding such antibodies and antibody fragments and derivatives, and methods of making and using such antibodies including methods of treating and preventing TSLP-related inflammatory and fibrotic disorders. | 11-10-2011 |
20110274688 | PREVENTION OF TUMORS WITH MONOCLONAL ANTIBODIES AGAINST NEU - Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface are disclosed. The methods comprise administering an antibody which specifically binds to p185. Methods of preventing the transformation of a normal cell into a tumor cell that has p185 on its surface in an individual at high risk of developing tumors are disclosed. | 11-10-2011 |
20110280868 | METHODS OF PREVENTING OR TREATING T CELL MALIGNANCIES BY ADMINISTERING ANTI-CD2 ANTAGONISTS - The present invention encompasses the use of a CD2 antagonist, preferably MEDI-507, an analog, derivative or an antigen-binding fragment thereof as a single agent therapy for the prevention, treatment, management, or amelioration of cancer, particularly a T-cell malignancy, or one or more symptoms thereof. The present invention also encompasses the use of a CD2 antagonist, preferably MEDI-507, an analog, derivative or an antigen-binding fragment thereof in combination with other cancer therapies. The present invention provides pharmaceutical compositions comprising a CD2 antagonist, preferably MEDI-507, an analog, derivative or an antigen-binding fragment thereof in amounts effective to prevent, treat, manage, or ameliorate cancer, particularly a T-cell malignancy, or one or more symptoms thereof. | 11-17-2011 |
20110280869 | METHODS OF PREVENTING OR TREATING INFLAMMATORY OR AUTOIMMUNE DISORDERS BY ADMINISTERING CD2 ANTAGONISTS IN COMBINATION WITH OTHER PROPHYLACTIC OR THERAPEUTIC AGENTS - The present invention provides to methods of preventing, treating or ameliorating an autoimmune or inflammatory disorder or one or more symptoms thereof utilizing combinatorial therapy. In particular, the present invention provides methods of preventing, treating, or ameliorating an autoimmune or inflammatory disorder or one or more symptoms thereof comprising administering to a subject in need thereof one or more CD2 antagonists and at least one other prophylactic or therapeutic agent. The present invention also provides compositions and articles of manufacture for use in preventing, treating or ameliorating one or more symptoms associated with an autoimmune or inflammatory disorder. | 11-17-2011 |
20110280870 | HEPATOCYTE GROWTH FACTOR RECEPTOR ANTAGONISTS AND USES THEREOF - Hepatocyte growth factor (HGF) receptor antagonists are provided. The HGF receptor antagonists include HGF receptor antibodies and fragments thereof. The HGF receptor antagonists can be employed to block binding of HGF to HGF receptors or substantially inhibit HGF receptor activation. The HGF receptor antagonists may be included in pharmaceutical compositions, articles of manufacture, or kits. Methods of treating cancer using the HGF receptor antagonists are also provided. | 11-17-2011 |
20110280871 | METHODS FOR PREVENTION AND TREATMENT OF INFLAMMATION USING ANTI-CHEMOKINE ANTIBODIES - It is possible to inhibit inflammatory processes by administration of antibodies to chemokines. Identification of chemokines which are over-produced makes it possible to block specific chemokine activity using antibodies to the over-expressed chemokines. | 11-17-2011 |
20110280872 | METHODS FOR PREVENTION AND TREATMENT OF INFLAMMATION USING ANTI-CHEMOKINE ANTIBODIES - It is possible to inhibit inflammatory processes by administration of antibodies to chemokines. Identification of chemokines which are over-produced makes it possible to block specific chemokine activity using antibodies to the over-expressed chemokines. | 11-17-2011 |
20110280873 | MCP1-Ig FUSION VARIANTS - The present invention provides, in part, MCP1-Ig fusion polypeptides exhibiting surprisingly beneficial properties as well as methods for treating various diseases (e.g., inflammatory diseases) by administering any of such fusions. | 11-17-2011 |
20110280874 | MODULATING ANGIOGENESIS - Hemangioblasts in adult bone marrow participate in new blood vessel formation. By modulating the differentiation of hemangioblasts into blood vessel cells, angiogenesis in a particular tissue can be increased or decreased. The present invention features compositions and methods for reducing tumor vasculogenesis, treating leukemia, and/or treating or preventing leukemia relapse. In particular, the invention provides an SDF-1 binding agent (e.g., antibody, antisense, ribozyme) for the treatment or prevention of a neoplasia, such as leukemia. Intravitreal injection of antibodies that block SDF-1 activity inhibited induced retinal neovascularization mediated by hemangioblasts. Anti-SDF-1 ribozymes and SDF-1 anti-sense RNA expression constructs significantly reduced migration of cells that create new vessels in the eye. | 11-17-2011 |
20110280875 | ANTIBODIES WHICH BIND HUMAN CXCR3 - Antibodies and antigen-binding fragments of antibodies that bind human CXCR3 are disclosed. In preferred embodiments, the antibodies are human. Nucleic acids and vectors encoding the antibodies or portions thereof, recombinant cells that contain the nucleic acids, and compositions comprising the antibodies or antigen-binding fragments are also disclosed. The invention also provides therapeutic and diagnostic methods which employ the antibodies and antigen-binding fragments. | 11-17-2011 |
20110280876 | MUTATED NETRIN - 4, FRAGMENTS THEREOF AND THEIR USE AS MEDICINES - A peptide fragment of the netrin-4 protein and nucleic acids coding for the peptide are described. The peptide can inhibit endothelial cell proliferation and cell migration, as well as activate the proliferation and migration of pericytes and smooth muscle cells. Pharmaceutical formulations containing the peptide and/or the nucleic acids can be used to treat a variety of tumoral and non-tumoral pathologies. | 11-17-2011 |
20110287000 | TREATMENT OF AUTOIMMUNE AND INFLAMMATORY DISEASE - The present invention provides novel methods of treatment of multiple sclerosis and other autoimmune diseases or inflammatory disorders, and antagonists, including isolated binding proteins for use in the novel methods. There is provided a method of treating multiple sclerosis comprising the neutralization of the biological activity of IL-7 by binding to CD127 or IL-7. The isolated binding proteins may also neutralize the biological activity of TSLP. | 11-24-2011 |
20110287001 | METHOD OF TREATMENT - The invention provides methods for inducing apoptosis, comprising treatment of a patient with a TNFα inhibitor as well as with an IAP inhibitor and a TRAIL receptor agonist. The methods ameliorate the risk of unwanted effects, thereby resulting in an improved therapeutic index for IAP inhibitors in combination with a TRAIL receptor agonist. | 11-24-2011 |
20110287002 | ANTIBODIES AGAINST EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) AND USES THEREOF - Anti-EGFR antibodies, therapeutic compositions comprising combinations of anti-EGFR antibodies, as well as methods for using such antibodies and compositions to treat EGFR-related disorders (e.g., cancers), are disclosed. | 11-24-2011 |
20110287003 | TREATMENT METHODS - The present invention relates generally to the fields of molecular biology and growth factor regulation. More specifically, the invention relates to therapies for the treatment of pathological conditions, such as cancer. | 11-24-2011 |
20110287004 | MG53 COMPOSITIONS AND METHODS OF USE - Disclosed herein are nucleic acid sequences that encode novel polypeptides. Also disclosed are polypeptides encoded by these nucleic acid sequences, and antibodies, which immunospecifically-bind to the polypeptide, as well as derivatives, variants, mutants, or fragments of the aforementioned polypeptide, polynucleotide, or antibody. The invention further discloses therapeutic, diagnostic and research methods for diagnosis, treatment, and prevention of disorders involving any one of these novel human nucleic acids and proteins. | 11-24-2011 |
20110287005 | MONOCLONAL ANTIBODIES AGAINST AMYLOID BETA PROTEIN AND USES THEREOF - The subject invention relates to monoclonal antibodies (e.g., 8F5 and 8C5) that may be used, for example, in the prevention, treatment and diagnosis of Alzheimer's Disease or other neurodegenerative disorders. | 11-24-2011 |
20110287006 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH AN ANTI-BCL-2 ACTIVE AGENT - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and an anti-Bcl-2 active agent for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and an anti-Bcl-2 active agent. | 11-24-2011 |
20110287007 | Treatment and Prevention of Chronic Asthma Using Antagonists of Integrin AlphavBeta6 - The present invention relates to methods of asthma treatment and prevention using α | 11-24-2011 |
20110293601 | COMPOSITION AND METHOD FOR TREATMENT OF REPERFUSION INJURY AND TISSUE DAMAGE - The present invention provides compounds and methods for the treatment and prophylaxis of ischemia reperfusion injury. In particular the invention provides compounds which function to suppress Toll-like Receptor 2 biological function or expression. | 12-01-2011 |
20110293602 | VEGF-LIKE FACTOR ANTIBODIES AND METHODS OF USE THEREOF - A novel human gene having a significant homology with a VEGF-C gene, a member of the VEGF family, has been isolated by the PCR method using primers designed based on the sequence of EST that is assumed to be homologous with the C-terminal region of the VEGF-C gene. Mouse and rat genes have been isolated based on the human gene isolated as above. A protein encoded by the above human gene has been isolated by introducing the gene into | 12-01-2011 |
20110293603 | AMINO ACID SEQUENCES DIRECTED AGAINST MULTITARGET SCAVENGER RECEPTORS AND POLYPEPTIDES - The present invention relates to amino acid sequences that are directed against (as defined herein) multitarget scavenger receptors such as e.g. Lox-1, RAGE, CD36, SR-A1, SR-B1, galectin-1, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences (also referred to herein as “amino acid sequences of the invention”, “compounds of the invention”, and “polypeptides of the invention”, respectively). | 12-01-2011 |
20110293604 | POLYNUCLEOTIDES AND POLYPEPTIDE SEQUENCES INVOLVED IN THE PROCESS OF BONE REMODELING - This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling; variants and derivatives of the polynucleotides and corresponding polypeptides; uses of the polynucleotides, polypeptides, variants and derivatives; and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are, the isolation and identification of polynucleotides, polypeptides, variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes. | 12-01-2011 |
20110293605 | ANTIBODY FORMULATION - Herein described are liquid formulations of antibodies and biologically active fragments thereof that specifically bind to a human ICOS polypeptide, exhibit increased in vivo ADCC activity and undergo reversible self-association in solution. | 12-01-2011 |
20110293606 | ANTITUMOR COMBINATIONS CONTAINING ANTIBODIES RECOGNIZING SPECIFICALLY CD38 AND VINCRISTINE - Pharmaceutical composition comprising an antibody specifically recognizing CD38 and vincristine. | 12-01-2011 |
20110293607 | Antibody Variants Having Modifications In The Constant Region - The present invention relates to positions in the constant region of antibodies, in particular the CH3 region of IgG4, which affect the strength of CH3-CH3 interactions. Mutations that either stabilize or destabilize this interaction are disclosed. | 12-01-2011 |
20110293608 | ANNEXIN A2 AS IMMUNOLOGICAL TARGET - AnnexinA2 (ANXA2), a member of the Annexin family of calcium-dependent, phospholipid binding proteins, is one of a panel of identified antigens recognized by the post-vaccination sera of patients who demonstrated prolonged disease-free survival following multiple vaccinations. AnnexinA2 is abundantly expressed in pancreatic adenocarcinomas and cell surface/membrane AnnexinA2 increases with the progression from premalignant lesions to invasive pancreatic adenocarcinomas. The cytoplasmic to cell surface translocation of AnnexinA2 expression is critical for pancreatic cancer cell invasion. In addition, phosphorylation of AnnexinA2 at Tyrosine 23 is important for its localization to the cell surface and for the invasion of pancreatic cancer cells. Finally, loss of AnnexinA2 leads to the loss of the Epithelial-Mesenchymal Transition. | 12-01-2011 |
20110293609 | Antibody Glycosylation Variants Having Increased Antibody-Dependent Cellular Cytotoxicity - The present invention relates to the field of glycosylation engineering of proteins. More particularly, the present invention relates to glycosylation engineering to generate proteins with improved therapeutic properties, including antibodies with increased antibody-dependent cellular cytotoxicity. | 12-01-2011 |
20110293610 | ANTIBODIES THAT IMMUNOSPECIFICALLY BIND TO B LYMPHOCYTE STIMULATOR PROTEIN - The present invention relates to antibodies and related molecules that immunospecifically bind to B Lymphocyte Stimulator. The present invention also relates to methods and compositions for detecting or diagnosing a disease or disorder associated with aberrant B Lymphocyte Stimulator expression or inappropriate function of B Lymphocyte Stimulator comprising antibodies or fragments or variants thereof or related molecules that immunospecifically bind to B Lymphocyte Stimulator. The present invention further relates to methods and compositions for preventing, treating or ameliorating a disease or disorder associated with aberrant B Lymphocyte Stimulator expression or inappropriate B Lymphocyte Stimulator function comprising administering to an animal an effective amount of one or more antibodies or fragments or variants thereof or related molecules that immunospecifically bind to B Lymphocyte Stimulator. | 12-01-2011 |
20110300130 | IMPAIRED WOUND HEALING COMPOSITIONS AND TREATMENTS - Methods, compounds, compositions, kits and articles of manufacture comprising one or more gap junction modulating agents for treatment of wounds that do not heal at expected rates, including chronic wounds, delayed healing wounds, incompletely healing wounds, and dehiscent wounds in a subject in need thereof. | 12-08-2011 |
20110300131 | DETECTION AND TREATMENT OF PANCREATIC, OVARIAN AND OTHER CANCERS - The application provides methods of diagnosis, prognosis, prophylaxis and treatment of ovarian, pancreatic and other cancers using antibodies that specifically bind to denatured CD70. | 12-08-2011 |
20110300132 | 4-AMINOQUINAZOLINE PRODRUGS - This invention relates to prodrugs of 4-aminoquinazoline compounds, and to pharmaceutically acceptable salts thereof. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering inhibitors of the EGFR and HER2. | 12-08-2011 |
20110300133 | CHIMERIC AND HUMANIZED ANTIBODIES TO ALPHA5BETA1 INTEGRIN THAT MODULATE ANGIOGENESIS - The present invention provides chimeric and humanized antibodies that specifically recognize α5β1 integrin, and methods for using the antibodies for reducing or inhibiting angiogenesis in a tissue. Also provided are methods of determining therapeutically acceptable doses of the antibodies and pharmaceutical compositions including the same. | 12-08-2011 |
20110300134 | REVERSE AMIDE COMPOUNDS AS PROTEIN DEACETYLASE INHIBITORS AND METHODS OF USE THEREOF - The present invention relates to novel “reverse amide” compounds comprising a zinc chelator group, and the use of such compounds in the inhibition of HDAC6 and in the treatment of various diseases, disorders or conditions related to HDAC6. | 12-08-2011 |
20110300135 | METHOD AND FORMULATION FOR REDUCING AGGREGATION OF A MACROMOLECULE UNDER PHYSIOLOGICAL CONDITIONS - The invention provides a method for reducing aggregation and inhibiting flocculation of a macromolecule, such as a protein, under physiological conditions, by the addition of 5% to 20% polyvinylpyrrolidone (PVP) with a molecular weight range of 2000 to 54,000 daltons. The invention further provides a method to minimize inflammation at the injection site during subcutaneous administration of a macromolecule. In further aspects, the invention provides pharmaceutical formulations for subcutaneous administration of a macromolecule, and methods of treating a CD20 positive cancer or an autoimmune disease, comprising administering a humanized anti-CD20 antibody in a pharmaceutical formulation of the invention. The invention further provides an in vitro dialysis method to evaluate the ability of an excipient to reduce aggregation of an antibody or other macromolecule under physiological conditions. | 12-08-2011 |
20110300136 | THERAPY OF AUTOIMMUNE DISEASE IN A PATIENT WITH AN INADEQUATE RESPONSE TO A TNF-ALPHA INHIBITOR - The present application describes therapy with antagonists which bind to B cell surface markers, such as CD20. In particular, the application describes the use of such antagonists to treat autoimmune disease in a mammal who experiences an inadequate response to a TNFα-inhibitor. | 12-08-2011 |
20110300137 | Use of lumefantrine and related compounds in the treatment of cancer - The present application discloses the use of the anti-malarial drug lumefantrine and related compounds in the treatment of cancer. | 12-08-2011 |
20110300138 | HUMAN ANTI TSHR ANTIBODIES - According to one aspect there is provided an isolated human antibody molecule which binds to the TSHR and which reduces ligand-induced stimulation of the TSHR but has no effect on TSHR constitutive activity, wherein the isolated human antibody molecule has the characteristic of patient serum TSHR autoantibodies of inhibiting TSH and M22 binding to the TSHR. | 12-08-2011 |
20110300139 | GENERATION, EXPRESSION AND CHARACTERIZATION OF THE HUMANIZED K33N MONOCLONAL ANTIBODY - The present invention provides humanized antibodies that immunospecifically recognize human 9 integrin. Some of these antibodies inhibit the biological functions of the 9 integrin, thereby exhibiting therapeutic effects on various disorders or diseases that are associated with 9 integrin, including cancer, e.g., the growth and metastasis of a cancer cell, and inflammatory diseases, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and so forth. | 12-08-2011 |
20110300140 | ANTIGEN BINDING POLYPEPTIDES - The invention relates to a platform technology for production of antigen binding polypeptides having specificity for a desired target antigen which is based on the conventional antibody repertoire of species in the family Camelidae, and to antigen binding polypeptides obtained using this technology platform. In particular, the invention provides an antigen binding polypeptide comprising a VH domain and a VL domain, wherein at least one hypervariable loop or complementarity determining region (CDR) in the VH domain or the VL domain is obtained from a VH or VL domain of a species in the family Camelidae. | 12-08-2011 |
20110305686 | THERAPIES FOR CHRONIC RENAL FAILURE USING ONE OR MORE INTEGRIN ANTAGONISTS - The present invention provides methods for the treatment, and pharmaceuticals for use in the treatment, of mammalian subjects in, or at risk of chronic renal failure, or at risk of a need for renal replacement therapy. The methods involve the administration of certain integrin antagonists. | 12-15-2011 |
20110305687 | ANTI-FGFR2 ANTIBODIES - Monoclonal antibodies that bind and inhibit biological activities of human FGFR2 are disclosed. The antibodies can be used to treat cell proliferative diseases and disorders, including certain forms of cancer, associated with activation or overexpression of FGFR2. | 12-15-2011 |
20110305688 | NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE - The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of | 12-15-2011 |
20110305689 | TREATMENT OF CHRONIC INFLAMMATORY RESPIRATORY DISORDERS - This invention relates, e.g., to a method for treating a subject having a chronic inflammatory respiratory disorder, comprising administering to the subject an effective amount of an inhibitor of the expression of and/or the activity of VEGF-A and/or VEGFR1 and/or VEGFR2 and/or NP1, or a combination thereof. Also described are screeing assays for agents for treating a subject having a chronic inflammatory respiratory disorder, and kits for performing one of the methods of the invention. | 12-15-2011 |
20110305690 | ANTITUMOR COMBINATIONS CONTAINING ANTIBODIES RECOGNIZING SPECIFICALLY CD38 AND CYCLOPHOSPHAMIDE - Pharmaceutical composition comprising an antibody specifically recognizing CD38 and cyclophosphamide. | 12-15-2011 |
20110305691 | MODIFIED POLYPEPTIDES STABILIZED IN A DESIRED CONFORMATION AND METHODS FOR PRODUCING SAME - The present invention provides a method for stabilizing a protein in a desired conformation by introducing at least one disulfide bond into the polypeptide. Computational design is used to identify positions where crysteine residues can be introduced to form a disulfide bond in only one protein conformation, and therefore lock the protein in a given conformation. Accordingly, antibody and small molecule therapeutics are selected that are specific for the desired protein conformation. | 12-15-2011 |
20110305692 | ANTIGEN-BINDING CONTRUCTS - The invention relates to combinations of RANKL antagonists with TNF-alpha antagonists and provides antigen-binding constructs which bind to RANKL comprising a protein scaffold which are linked to one or more epitope-binding domains wherein the antigen-binding construct has at least two antigen binding sites at least one of which is from an epitope binding domain and at least one of which is from a paired VH/VL domain, methods of making such constructs and uses thereof. | 12-15-2011 |
20110305693 | ANITIGEN-BINDING CONSTRUCTS - The invention relates to combinations of RANKL antagonists with TNF-alpha antagonists and provides antigen-binding constructs which bind to RANKL comprising a protein scaffold which are linked to one or more epitope-binding domains wherein the antigen-binding construct has at least two antigen binding sites at least one of which is from an epitope binding domain and at least one of which is from a paired VHNL domain, methods of making such constructs and uses thereof. | 12-15-2011 |
20110305694 | MULTIVALENT AND/OR MULTISPECIFIC RANKL-BINDING CONSTRUCTS - The invention relates to a combination of RANKL antagonists with OSM antagonists, and provides antigen-binding constructs which bind to RANKL comprising a protein scaffold which are linked to one or more epitope-binding domains wherein the antigen-binding construct has at least two antigen binding sites at least one of which is from an epitope binding domain and at least one of which is from a paired VH/VL domain, methods of making such constructs and uses thereof | 12-15-2011 |
20110311522 | MONOCLONAL ANTIBODIES BINDING TO AVIAN INFLUENZA VIRUS SUBTYPE H5 HAEMAGGLUTININ AND USES THEREOF - The present invention provides monoclonal antibodies that bind specifically to H5 subtype avian influenza virus hemagglutinin (HA) proteins, and can block the binding activity of at least 50% of the known monoclonal antibodies to the H5 subtype avian influenza virus hemagglutinin (HA) protein. The monoclonal antibodies can be used for the detection, diagnosis, prevention, and treatment of avian influenza viruses, especially the H5 subtype of avian influenza viruses. The present invention also provides the related hybridoma cell lines, isolated nucleic acid molecules and short peptides, as well as medical composition and medical diagnostic equipment and kit containing the monoclonal antibody. | 12-22-2011 |
20110311523 | PLATELET DERIVED GROWTH FACTOR RECEPTOR SUPPORTS CYTOMEGALOVIRUS INFECTIVITY - The disclosure relates generally to compositions and methods useful for inhibiting the infection and propagation of viral particles, particularly members of the Herpesviridae family, and more particularly to cytomegalovirus (CMV). | 12-22-2011 |
20110311524 | Inhibitors of Angiopoietin-Like 4 Protein, Combinations, and Their Use - Modulators of angiopoietin-like 4 protein are provided along with methods for their use in the treatment of diseases and pathological conditions. Combinations of ANGPTL4 antagonists and other therapeutics, e.g., anti-cancer agents, and methods of their use in the treatment of mammals susceptible to or diagnosed with cancer, or with relapse tumor growth or relapse cancer cell growth are also provided. | 12-22-2011 |
20110311525 | DELIVERY OF A CD40 AGONIST TO A TUMOR DRAINING LYMPH NODE OF A SUBJECT - The invention relates to the use of a CD40 agonist for treating cancer, a pre-malignant disorder or an infectious disease, wherein a CD40 agonist is locally administered and targeted to a tumor draining lymph node of a subject. Optionally, a CD40 agonist is formulated in a slow-release formulation. Optionally, a CTL-activating peptide is further administered. | 12-22-2011 |
20110311526 | POLYNUCLEOTIDE AND POLYPEPTIDE SEQUENCES INVOLVED IN THE PROCESS OF BONE REMODELING - This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling, variants and derivatives of the polynucleotides and corresponding polypeptides, uses of the polynucleotides, polypeptides, variants and derivatives, and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are the isolation and identification of polynucleotides, polypeptides variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes. | 12-22-2011 |
20110311527 | IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS - Disclosed herein is a method of treating certain ocular and other diseases with an anti-IL-23p19 antibody. | 12-22-2011 |
20110311528 | USE OF 2,5-DIHYDROXYBENZENE COMPOUNDS AND DERIVATIVES FOR THE TREATMENT OF PSORIASIS - The present invention relates to the use of a 2,5-dihydroxybenzene derivative of formula (I) or a pharmaceutically acceptable salt, solvate, isomer, or prodrug thereof for the treatment and/or prophylaxis of, inter alia, psoriasis. | 12-22-2011 |
20110311529 | METHOD FOR TREATING A RHEUMATIC DISEASE USING A SOLUBLE TLA4 MOLECULE - The present invention relates to compositions and methods for treating rheumatic diseases, such as psoriasis arthropathica, by administering to a subject a CTLA4 molecule that block endogenous B7 molecules from binding their ligands. | 12-22-2011 |
20110311530 | TRUNCATED BAFF RECEPTORS - The disclosure provides a non-naturally occurring BAFF-R glycoprotein having a deletion in the extracellular domain which results in an altered 0-linked glycosylation pattern. The disclosure also provides methods and pharmaceutical compositions for treating B-cell- and T-cell-mediated disorders. | 12-22-2011 |
20110311531 | IMMUNOTHERAPY OF AUTOIMMUNE DISORDERS USING ANTIBODIES WHICH TARGET B-CELLS - Antibodies that bind with a B-cell antigen provide an effective means to treat autoimmune disorders. Antibodies and fragments, which may be conjugated or naked, are used alone or in multimodal therapies. The antibodies may be bispecific antibodies which may be produced recombinantly as fusion proteins, or as hybrid, polyspecific antibodies. | 12-22-2011 |
20110318334 | TAXANE ANALOGS FOR THE TREATMENT OF BRAIN CANCER - Provided herein are compounds and methods for the treatment of brain cancer in a mammal, wherein the method comprises the administration to the mammal a compound that stabilizes tubulin dimers or microtubles at G2-M interface during mitosis but is not a substrate for MDR protein. In particular, the present application relates to the use of an orally effective abeo-taxane, alone or in combination with temozolomide or bevacizumab, for the treatment of brain cancer. | 12-29-2011 |
20110318335 | METHODS AND PRODUCTS FOR TREATING PROLIFERATIVE DISEASES - Methods and products for treating proliferative diseases, and wounds, using as a pharmacon an autophagy inhibitor, a glycolytic inhibitor, and/or an agent able to alter cellular production of reactive oxygen, or combination thereof, optionally in combination with one or more chemotherapeutic agents. In some embodiments, the invention combines a 4-aminoquinoline, exemplified by chloroquine, with a glycolytic inhibitor, exemplified by 2-deoxy-D-glucose and anti-VEGF antibodies. The systems and methods of the invention may be used to treat drug-resistant or multi-drug resistant cancers. | 12-29-2011 |
20110318336 | Identification and Treatment of Aggressive Lung Cancer Tumors - This invention relates to the identification and treatment of aggressive lung cancer tumors in patients. More particularly, it provides a method of identifying patients with non-small cell lung carcinoma (NSCLC) who have an aggressive node-negative (N0) tumor and a likelihood of a poor overall survival. The method comprises the step of determining if one or more of certain identified proteins are activated in tumor cells obtained from the patient's tumor, wherein the activation of one or more of the proteins indicates that the patient has an aggressive N0 tumor and is likely to have a poor overall-survival. The invention also provides a method for selecting a treatment for an NSCLC patient with an N0 tumor and a method for treating such patients. It further provides a kit for identifying an NSCLC patient with an aggressive N0 tumor and a likelihood of a poor overall survival and a pharmaceutical composition for treating such patients. | 12-29-2011 |
20110318337 | HUMANEERED ANTI-FACTOR B ANTIBODY - This invention relates to humaneered anti-factor B antibodies and antigen-binding fragments thereof with reduced immunogenicity. The humaneered anti-factor B antibodies and antigen-binding fragments thereof are derived from murine monoclonal antibody 1379, which binds factor B in the third short consensus repeat (“SCR”) domain and selectively inhibits activation of the alternative complement pathway by preventing formation of the C3bBb complex. The invention also relates to methods of treating diseases or disorders in which activation of the alternative complement pathway plays a role, and methods of selectively inhibiting activation of the alternative complement pathway in an individual in need thereof. | 12-29-2011 |
20110318338 | TARGETING PAX2 FOR THE TREATMENT OF BREAST CANCER - The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject. | 12-29-2011 |
20110318339 | ANTI-DLL4 ANTIBODIES AND USES THEREOF - Provided herein are anti-DLL4 antibodies and methods of using anti-DLL4 antibodies as therapeutic agents in diseases or disorders associated with DLL4. | 12-29-2011 |
20110318340 | DEGLYCOSYLATED ANTIBODIES - The present invention provides an antibody, or antibody fragment, with modified glycosylation for use in treating or preventing a disease or condition, where the antibody or fragment: (a) suppresses an inflammatory condition forming part of the disease or condition to be treated or prevented; and/or (b) displays increased efficacy and/or decreased side effects in comparision to treatment or prevention with the corresponding antibody with unmodified glycosylation. | 12-29-2011 |
20110318341 | FRIZZLED-BINDING AGENTS AND USES THEREOF - Novel anti-cancer agents, including, but not limited to, antibodies, that bind to human frizzled receptors are provided. Novel epitopes within the human frizzled receptors which are suitable as targets for anti-cancer agents are also identified. Methods of using the agents or antibodies, such as methods of using the agents or antibodies to inhibit Wnt signaling and/or inhibit tumor growth are further provided. | 12-29-2011 |
20110318342 | METHODS OF USING IL-1 ANTAGONISTS TO TREAT AUTOINFLAMMATORY DISEASE - Methods of treating, inhibiting, or ameliorating an autoinflammatory disorder, disease, or condition in a subject in need thereof, comprising administering to a subject in need a therapeutic amount of an interleukin 1 (IL-1) antagonist, wherein the autoinflammatory disorder, disease, or condition is treated, inhibited, or ameliorated. The IL-1 antagonist is a molecule capable of binding and inhibiting IL-1. The therapeutic methods are useful for treating a human adult or child suffering from Neonatal Onset Multisystem Inflammatory Disorder (NOMID/CINCA), Muckle-Wells Syndrome (MWS), Familial Cold Autoinflammatory Syndrome (FCAS), familial mediterranean fever (FMF), tumor necrosis factor receptor-associated periodic fever syndrome (TRAPS), or systemic onset juvenile idiopathic arthritis (Still's Disease). | 12-29-2011 |
20110318343 | Stable Liquid Pharmaceutical Formulation Of IgG Antibodies - This invention is directed to a stable liquid pharmaceutical formulation comprising a high concentration, e.g. 50 mg/ml or more, of antibody in about 20-60 mM succinate buffer or 30-70 mM histidine buffer, having pH from about pH 5.5 to about pH 6.5, about 0.01-0.1% polysorbate, and a tonicity modifier that contributes to the isotonicity of the formulation. This liquid formulation is stable at refrigerated temperature (2-8° C.) for at least 1 year, and preferably 2 years. This liquid formulation is suitable for subcutaneous injection. The preferred antibodies include Daclizumab, a humanized anti-IL-2 receptor monoclonal antibody; HAIL-12, a humanized anti-IL-12 monoclonal antibody; HuEP5C7, a humanized anti-L selectin monoclonal antibody; and Flintozumab, a humanized anti-gamma interferon monoclonal antibody. | 12-29-2011 |
20110318344 | Tumor Treatment - The patent discloses the use of Hepatocellular Carcinoma Related Protein 1 (HCRP1) as a marker for the efficiency of an anti-EGFR antibody treatment of a tumour patient. If a tumour biopsy sample of the tumour patient reveals an HCRP1 protein or mRNA amount equal to or above the amount in normal, non-tumour tissue, then the tumour patient is eligible for the treatment with an anti-EGFR antibody. | 12-29-2011 |
20120003208 | COMPOSITIONS AND METHODS FOR MODULATING VASCULAR DEVELOPMENT - The present invention provides methods of using EGFL7 antagonist to modulate vascular development. Also provided herein are methods of screening for modulators of EGFL7 activity. Furthermore, methods of treatment using EGFL7 antagonists are provided. | 01-05-2012 |
20120003209 | METHODS AND KITS USED IN IDENTIFYING GLIOBLASTOMA - The invention encompasses methods and kits used in the identification of invasive glioblastoma based upon the expression of Akt1, Akt2, and Akt3. The methods and kits also allow prediction of disease outcome and staging of patients with regard to therapy. | 01-05-2012 |
20120003210 | NEONATAL Fc RECEPTOR (FcRn)- BINDING POLYPEPTIDE VARIANTS, DIMERIC Fc BINDING PROTEINS AND METHODS RELATED THERETO - The compositions and methods of the present invention are based, in part, on our discovery that an effector function mediated by an Fc-containing polypeptide can be altered by modifying one or more amino acid residues within the polypeptide (by, for example, electrostatic optimization). The polypeptides that can be generated according to the methods of the invention are highly variable, and they can include antibodies and fusion proteins that contain an Fc region or a biologically active portion thereof. | 01-05-2012 |
20120003211 | IMMUNOGLOBULINS WITH REDUCED AGGREGATION - The present disclosure relates to immunoglobulins with reduced aggregation and compositions, methods of generating such immunoglobulins with computational tools and methods of using such immunoglobulins particularly in the treatment and prevention of disease. | 01-05-2012 |
20120003212 | ANTAGONIST ANTIBODIES AGAINST GDF-8 AND USES IN TREATMENT OF ALS AND OTHER GDF-8 ASSOCIATED DISORDERS - The disclosure provides novel molecules related to growth and differentiation factor-8 (GDF-8), in particular mouse and humanized antibodies, and antibody fragments, including those that inhibit GDF-8 activity and signaling in vitro and/or in vivo. The disclosure also provides methods for diagnosing, treating, ameliorating, preventing, prognosing, or monitoring degenerative orders of muscle, bone, and insulin metabolism, etc., in particular amyotrophic lateral sclerosis (ALS). In addition, the disclosure provides pharmaceutical compositions for the treatment of such disorders by using the antibodies, polypeptides, polynucleotides, and vectors of the invention. | 01-05-2012 |
20120003213 | Methods Of Enhancing Antibody-Dependent Cellular Cytotoxicity - The application relates to method of increasing antibody-dependent cellular cytotoxicity in a subject receiving therapeutic monoclonal antibody treatment. In some embodiments, methods are provided for administering to subject to a subject in need thereof a therapeutic antibody in conjunction with an ADCC enhancer molecule. | 01-05-2012 |
20120003214 | Binding Moieties Based On Shark IgNAR Domains - The present invention relates to immunoglobulin new antigen receptors (IgNARs) from fish and uses thereof. In particular, the present invention relates to modified IgNAR variable domains and to domains from members of the immunoglobulin superfamily that have been modified to include structural features derived from IgNAR variable domains. | 01-05-2012 |
20120003215 | PYRAZOLO[1,5-A]PYRIMIDINES FOR ANTIVIRAL TREATMENT - The invention provides compounds of Formula I or Formula II: | 01-05-2012 |
20120003216 | FGF21 MUTANTS AND USES THEREOF - The invention provides nucleic acid molecules encoding FGF21 mutant polypeptides, FGF21 mutant polypeptides, pharmaceutical compositions comprising FGF21 mutant polypeptides, and methods for treating metabolic disorders using such nucleic acids, polypeptides, or pharmaceutical compositions. | 01-05-2012 |
20120003217 | HERCEPTIN.RTM. ADUVANT THERAPY - The present application describes adjuvant therapy of nonmetastatic breast cancer using HERCEPTIN®. | 01-05-2012 |
20120003218 | ANTAGONISTS OF ACTRIIB AND USES FOR INCREASING RED BLOOD CELL LEVELS - In certain aspects, the present invention provides compositions and methods for increasing red blood cell and/or hemoglobin levels in vertebrates, including rodents and primates, and particularly in humans. | 01-05-2012 |
20120003219 | Compositions and Methods to Treat Bone Related Disorders - The present invention relates to the use of modulators of the sclerostin:sclerostin-binding-partner interaction for the treatment, amelioration, and diagnosis of sclerostin-related disorders, e.g., osteoporosis and sclerosteosis, and sclerostin-related disorders, e.g., cancers and cardiovascular disorders. The invention also relates to the use of sclerostin-binding-partner mimetics for the treatment, amelioration, and diagnosis of sclerostin-related disorders. Assays for the identification of modulators of the sclerostin:sclerostin-binding-partner interaction, as well as the resulting signaling, are also provided. | 01-05-2012 |
20120003220 | B7-DC Variants - Variant costimulatory polypeptides, nucleic acids encoding such polypeptides, and methods for using the polypeptides and nucleic acids to enhance a T cell response are provided herein. | 01-05-2012 |
20120009179 | ANTI-A OLIGOMER HUMANIZED ANTIBODY - An anti-Aβ oligomer humanized antibody which does not bind to Aβ monomers and specifically binds only to Aβ oligomers; an anti-cognitive dysfunction agent, an agent for treating Alzheimer's disease, an agent for suppressing formation of neuritic plaque and an inhibitor of formation of Aβ amyloid fiber comprising the antibody as an active ingredient; a method for at least one of preventing and treating cognitive dysfunction or Alzheimer's disease, comprising the step of administering the antibody; and a method for suppressing progression of Alzheimer's disease, comprising the step of administering the antibody. | 01-12-2012 |
20120009180 | ANTI-ABETA OLIGOMER HUMANIZED ANTIBODY - An anti-cognitive dysfunction agent comprising a humanized antibody which does not bind to Aβ monomers and specifically binds only to Aβ oligomers and a fragment thereof as an active ingredient, and an therapeutic antibody which can be treat Alzheimer's disease by specifically binding amyloid β protein oligomer (Aβ oligomer) which is considered to be a cause of Alzheimer's disease are required. The present invention can provide an anti-Aβ oligomer humanized antibody and a method for treating Alzheimer's disease using the humanized antibody. An agent for treating Alzheimer's disease; an agent for suppressing formation of neuritic plaque; an inhibitor of formation of Aβ amyloid fiber; a method for at least one of preventing and treating cognitive dysfunction or Alzheimer's disease, comprising the step of administering the humanized antibody; and a method for suppressing progression of Alzheimer's disease, comprising the step of administering the humanized antibody. | 01-12-2012 |
20120009181 | Folate Receptor 1 Antibodies and Immunoconjugates and Uses Thereof - Novel anti-cancer agents, including, but not limited to, antibodies and immunoconjugates, that bind to human folate receptor 1 are provided. Methods of using the agents, antibodies, or immunoconjugates, such as methods of inhibiting tumor growth are further provided. | 01-12-2012 |
20120009182 | IMMUNOGLOBULIN VARIANTS WITH ALTERED BINDING TO PROTEIN A - Variant immunoglobulins with one or more amino acid modifications in the VH region that have altered binding to | 01-12-2012 |
20120009183 | METHOD FOR TREATMENT OF PANCREATITIS - A method for treating acute or chronic pancreatitis in a subject comprises administering to the subject a therapeutically effective amount of an ACE2 inhibitor. | 01-12-2012 |
20120009184 | Anti-C5 Alpha Antibodies - The present invention refers to recombinant antibodies of human origin specific for the C5 component of the activated complement and characterised by the ability to inhibit the conversion of the C5 alpha chain to C5a and C5b. Moreover the present invention refers to the nucleotide sequences coding for such antibodies and to the therapeutic use of both polypeptide and nucleotide sequences, in particular for the therapy of diseases involving tissue damage deriving from uncontrolled activation of the complement system. | 01-12-2012 |
20120009185 | METHOD FOR TREATING AGE-RELATED MACULAR DEGENERATION - A method is provided for administering to a mammal suffering from, or at risk for, age-related macular degeneration. | 01-12-2012 |
20120009186 | FcGammaRIIB Specific Antibodies and Methods of Use Thereof - The present invention relates to antibodies or fragments thereof that specifically bind FcγRIIB, particularly human FcγRIIB, with greater affinity than said antibodies or fragments thereof bind FcγRIIA, particularly human FcγRIIA. The invention provides methods of enhancing the therapeutic effect of therapeutic antibodies by administering the antibodies of the invention to enhance the effector function of the therapeutic antibodies. The invention also provides methods of enhancing efficacy of a vaccine composition by administering the antibodies of the invention. | 01-12-2012 |
20120009187 | CLONING AND RECOMBINANT PRODUCTIONS OF VESPULA VENOM PROTEASE AND METHODS OF USE THEREOF - The invention relates to nucleic acids encoding a novel | 01-12-2012 |
20120009188 | OPTIMIZED FC VARIANTS - A variant of a parent polypeptide including an Fc region, which variant exhibits increased binding to FcRn as compared to the parent polypeptide and includes at least one amino acid modification in the Fc region. | 01-12-2012 |
20120009189 | ANTIBODY COMPOSITION WITH ALTERED FAB SIALYLATION - The present invention relates to a population of antibodies enriched from an antibody preparation, wherein the enriched population of antibodies has an altered amount of sialylation in the Fab region of the antibodies as compared to the antibody preparation prior to enrichment. Furthermore, the present invention relates to a method of enriching a population of antibodies from an antibody preparation, wherein the enriched population of antibodies has an altered amount of sialylation in the Fab region of the antibodies as compared to the antibody preparation prior to enrichment. The present invention also relates to the population of antibodies of the invention for use in medicine, a pharmaceutical composition comprising the populations of antibodies of the invention and the use of the population of antibodies of the invention in the prevention and/or treatment of atherosclerosis, cancer and infections such as bacterial, viral or fungal infections. | 01-12-2012 |
20120014941 | ANTI-BV8 ANTIBODIES AND USES THEREOF - The present invention concerns antibodies to Bv8 and the uses of same. | 01-19-2012 |
20120014942 | METHOD FOR THE DIAGNOSIS AND PROGNOSIS OF MALIGNANT DISEASES - Methods for the treatment of tumors and cancer by exploiting the surface expression of the usually nuclear-localized protein, nucleolin. | 01-19-2012 |
20120014943 | Optimized Anti-CD30 Antibodies - An antibody that targets CD30, wherein the antibody comprises at least one modification relative to a parent antibody and the antibody binds with altered affinity to an FcγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the anti-CD30 antibody. | 01-19-2012 |
20120014944 | PREVENTION AND TREATMENT OF PAIN USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID - Methods for preventing or treating pain are provided. Such methods comprise administering to a subject (e.g., a human subject) an antibody or antibody fragment that binds LPA. The antibody may be a humanized monoclonal antibody. | 01-19-2012 |
20120014945 | Anti-Dengue Virus Antibodies - Provided herein are monoclonal antibodies specific to dengue virus as well as their antigen-binding fragments, and functional variants. Also disclosed are uses thereof for treating or diagnosing dengue virus infection. | 01-19-2012 |
20120014946 | PREVENTION AND TREATMENT OF PAIN USING MONOCLONAL ANTIBODIES AND ANTIBODY FRAGMENTS TO LYSOPHOSPHATIDIC ACID - Methods for preventing and treating pain are provided. These methods involve administering to a subject, including a human subject, an antibody or antibody fragment that binds LPA. Preferably, antibody is a humanized anti-LPA monoclonal antibody, or an antigen-binding fragment derived from such an antibody. | 01-19-2012 |
20120014947 | METHODS AND COMPOSITIONS TO REDUCE LIVER DAMAGE ASSOCIATED WITH CONDITIONS OR THERAPIES THAT AFFECT THE IMMUNE SYSTEM - One side-effect arising from the use of antibodies against TNF receptor family members as therapeutics can be liver damage which precludes the completion of clinical trial. A novel LT-dependent pathway is described that mediates liver cell injury in several disease models. | 01-19-2012 |
20120014948 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND USE THEREOF - The invention relates to the identification of genetic products that are expressed in association with a tumor and the nucleic acid coding therefor. The invention relates to the therapy and diagnosis of diseases in which the genetic products that are expressed in association with a tumor are expressed in an aberrant manner. The invention also relates to proteins, polypeptides, and peptides which are expressed in association with a tumor and the nucleic acids coding therefor. | 01-19-2012 |
20120014949 | Serum Biomarkers For Early Detection Of Acute Cellular Rejection - The present invention provides an improved method of diagnosing a subject having received an organ transplant with Acute Cellular Rejection (ACR). The method comprises obtaining a biological sample from the subject, detecting an amount of at least one protein indicative of ACR in the sample, and comparing the amount of the protein in the sample to a control, wherein a difference between the amount of the protein in the sample relative to the control indicates the subject has or is developing ACR. The difference can be an increase or a decrease. In one version the biological sample comprises a serum sample, and the transplanted organ is selected from a heart, kidney, liver, bone marrow, pancreas, eye, lung or skin. Methods of treating a subject having an organ transplant for ACR are also provided. | 01-19-2012 |
20120014950 | Antibodies That Specifically Bind to DR3 - The present invention relates to antibodies, antibody fragments, and related molecules that specifically bind to DR3 receptors. Such antibodies have uses, for example, in the prevention, detection, diagnosis, treatment or amelioration of a disease or disorder, especially inflammatory and autoimmune diseases and other immune system disorders, such as Crohn's disease, colitis, Inflammatory Bowel Disease, arthritis, asthma, Multiple Sclerosis, atherosclerosis, and allergic disorders. The invention also relates to nucleic acid molecules encoding anti-DR3 receptor antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder, especially inflammatory or autoimmune disorders, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to DR3 receptor. | 01-19-2012 |
20120014951 | PCSK9 ANTAGONISTS - The present invention provides antagonizing antibodies, antigen-binding portions thereof, and aptamers that bind to proprotein convertase subtilisin kexin type 9 (PCSK9). Also provided are antibodies directed to peptides, in which the antibodies bind to PCSK9. The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acid. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof to reduce LDL-cholesterol levels and/or for the treatment and/or prevention of cardiovascular disease, including treatment of hypercholesterolemia. | 01-19-2012 |
20120020956 | ACTIVATION OF SODIUM POTASSIUM ATPASE - Activation sites on the alpha subunit of sodium potassium ATPase have been discovered. It has also been discovered that certain antibodies that bind to the alpha subunit of sodium potassium ATPase dramatically increase enzyme activity. There has never before been a report of precise activation sites or drug interaction sites for sodium potassium ATPase. Certain methods have also been discovered for treating or preventing diseases associated with low sodium potassium ATPase activity by administering antibodies, antibody fragments and small molecules that bind to the activation sites on the alpha subunit of sodium potassium ATPase. | 01-26-2012 |
20120020957 | DENGUE VIRUS NEUTRALIZING ANTIBODIES AND USE THEREOF - The invention relates to antibodies and antigen binding fragments thereof and to cocktails of antibodies and antigen binding fragments that neutralize dengue virus infection without contributing to antibody-dependent enhancement of dengue virus infection. The invention also relates to immortalized B cells that produce, and to epitopes that bind to, such antibodies and antigen binding fragments. In addition, the invention relates to the use of the antibodies, antigen binding fragments, and epitopes in screening methods as well as in the diagnosis and therapy of dengue virus infection. | 01-26-2012 |
20120020958 | FIBCD1 FOR THE PREVENTION AND TREATMENT OF DISEASES - The present invention relates to methods and compositions for the treatment and/or prevention of diseases such as allergic diseases and inflammatory bowel diseases comprising one or more FIBCD1 binding molecules or pharmaceutically acceptable salts, esters, and amides thereof and optionally one or more non-FIBCD1 binding molecules or pharmaceutically acceptable salts, esters, and amides thereof; as well as the use of such pharmaceutical composition for the prevention and/or treatment of diseases such as allergic diseases and inflammatory bowel diseases. FIBCD1 is herein defined as either a transmembrane receptor, the corresponding DNA or the corresponding mRNA as defined by SEQ ID No. 1, 2 and 3 as well as homologous thereof. | 01-26-2012 |
20120020959 | USE OF THE SPARC MICROENVIRONMENT SIGNATURE IN THE TREATMENT OF CANCER - The invention provides multiparametric anti-SPARC antibody-based techniques for predicting the response to chemotherapy. | 01-26-2012 |
20120020960 | Thymic Stromal Lymphopoietin (TSLP) and OX40 Ligand in Cancer - Compositions and methods for an immunotherapeutic approach for human breast cancer is provided herein. Any antagonist of thymic stromal lymphopoietin (TSLP) and/or OX40L to inhibit tumor development and IL-13 secretion by blocking the upregulation of OX40L by DCs exposed to breast cancer, thereby blocking their capacity to generate inflammatory IL-13 | 01-26-2012 |
20120020961 | METHODS AND COMPOSITIONS FOR LIVER CANCER THERAPY - The present disclosure provides methods of treating liver cancer and preventing liver cancer recurrence with anti-progastrin antibodies, methods of monitoring treatment efficacy of anti-progastrin therapy for liver cancer, and compositions useful therefore. | 01-26-2012 |
20120020962 | METHOD OF DEPLETING REGULATORY T CELL - The present invention relates to the method for depleting in vivo regulatory T cell, the method for suppressing IL-10 producing activity of regulatory T cell, the method for treating diseases in which pathologic conditions are deteriorated by regulatory T cell and the method for enhancing tumor immunity which comprises administering to a patient a monoclonal antibody which specifically binds to human CC chemokine 4 (CCR4) or the antibody fragment thereof. | 01-26-2012 |
20120020963 | ANTI-INTEFERON ALPHA MONOCLONAL ANTIBODIES AND METHODS FOR USE - The present invention includes compositions and methods that include antibodies that selectively neutralize a bioactivity of at least two interferon alpha (“IFNα”) protein subtypes for the protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA, but does not neutralize at least one bioactivity of IFNα protein subtype D. Examples of bioactivity for measurement include activation of the MxA promoter or antiviral activity and variants, derivatives and fragments thereof. The invention also includes host cells, hybridomas and plasmacytomas that produce antibodies. Because of their unique selectivity and affinity, the antibodies of the present invention are useful to detect IFNα subtypes in sample or tissue and/or for therapeutic applications that include, but are not limited to the treatment and/or amelioration of an IFNα related disorder such as SLE, lupus, type I diabetes, psoriasis, AIDS and Graft versus Host Disease. | 01-26-2012 |
20120020964 | Antibodies for Norovirus - Norovirus antigen peptides are described having an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-16, or fragments thereof. Such peptides can be used in the preparation of antiviral therapies such as vaccines, methods of preparing antibodies to the antigen peptides, methods of using the peptides or the corresponding antibodies for detection of norovirus, and compositions of the peptides, DNA and/or antibodies. A kit for the detection of norovirus is also provided. | 01-26-2012 |
20120027748 | IMMUNOLOGICAL RECONSTITUTION PROMOTER OR PROPHYLACTIC AGENT FOR INFECTIONS EACH OF WHICH MAINTAINS GRAFT-VERSUS-TUMOR EFFECT - The object of the invention is to provide an immunological reconstitution promoter or a prophylactic agent for infections for use in allogeneic hematopoietic stem cell transplantation therapy for tumors. The promoter or prophylactic agent enables the amelioration of delayed immune reconstitution or the prevention of infection following transplantation, while maintaining the GVT effect of allogeneic hematopoietic stem cell transplantation. Specifically, in a transplant patient in whom immune reconstitution is delayed, such reconstitution can be promoted by administering, at an early stage following transplantation, a substance capable of depleting CD4 | 02-02-2012 |
20120027749 | Method - The present invention provides a method for detecting a 5T4-positive cancer in a subject, which comprises the following steps: (i) identifying and/or isolating exosomes in a sample from the subject; and (ii) detecting exosome-associated 5T4. | 02-02-2012 |
20120027750 | METHOD AND COMPOSITIONS FOR CANCER PROGNOSIS - Methods are provided to determine the cancer prognosis of subjects and/or to adapt the treatment protocol of subjects having or susceptible to cancer. Embodiments include the steps of determining in vitro the genotype of said subject at a polymorphism in the C3-ITGAM axis, making a cancer prognosis of the subject based on said genotype and selecting an anti-cancer treatment for the subject. | 02-02-2012 |
20120027751 | ANTAGONISTS OF TWEAK AND OF TWEAK RECEPTOR AND THEIR USE TO TREAT IMMUNOLOGICAL DISORDERS - The present invention relates to reagents which modify the activity of TWEAK and their use as therapeutic agents for the treatment of immunological disorders. | 02-02-2012 |
20120027752 | METHODS AND COMPOUNDS FOR TREATING PARAMYXOVIRIDAE VIRUS INFECTIONS - Provided are methods for treating Paramyxoviridae virus infections by administering ribosides, riboside phosphates and prodrugs thereof, of Formula I: | 02-02-2012 |
20120027753 | MicroRNAs in Never-Smokers and Related Materials and Methods - The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of lung cancer in never-smokers. The invention also provides methods of identifying anti-lung cancer agents. | 02-02-2012 |
20120027754 | Treatment and Prevention of Chronic Asthma Using Antagonists of Integrin AlphavBeta6 - The present invention relates to methods of asthma treatment and prevention using α | 02-02-2012 |
20120027755 | PREVENTION AND TREATMENT OF ALZHEIMER'S DISEASE - The invention relates to a purified antibody or fragment thereof that specifically binds an Aβ protofibril. The invention further relates to a composition that includes such antibodies. The invention also relates to using such antibodies and compositions for treating a patient having of suspected of having Alzheimer's disease. | 02-02-2012 |
20120027756 | METHODS AND COMPOSITIONS FOR TREATING ALLERGIC DISEASES - Disclosed in the present invention are antibodies that specifically recognize and antagonize human TSLP receptor, and methods of employing these antibodies to treat or ameliorate diseases or disorder mediated by TSLP signaling. | 02-02-2012 |
20120027757 | COMPOSITIONS AND METHODS FOR TREATING CANCER - A method of treating a cancer with an mTOR inhibitor and an anti-IGF-1 R antibody is disclosed. | 02-02-2012 |
20120027758 | USE OF ANTI-CD100 ANTIBODIES - The invention relates to the use a BD16 and/or BB18 anti-CD100 antibody or of a chimeric or humanized or human form thereof, or a fragment thereof, for the therapy or diagnosis of a central nervous system disorder, more particularly a myelin disorder or a disease that affects oligodendrocytes, such as multiple sclerosis or HTLV-1 associated myelopathy or peripheral myelinating cells. | 02-02-2012 |
20120034208 | Treating Breast Cancer with Anti-IL-19 Antibody - Use of an anti-IL-19 antibody for treating breast cancer, either alone or in combination with an anti-IL-20 and/or anti-IL-20R1 antibody. | 02-09-2012 |
20120034209 | Treatment - The present invention provides a specific binding molecule which binds to Annexin-1 (Anx-A1) for use in the treatment of T cell-mediated disease. | 02-09-2012 |
20120034210 | COMPOSITIONS FOR POTENTIATING APOPOSIS SIGNALS IN TUMOUR CELLS - The present invention concerns a composition for potentiating formation of DISC (Death Inducing Signaling Complex) macro-complex and for inducing apoptotic signal mediated by death receptors in tumour cells comprising a therapeutically effective amount of an active agent selected among a hypocalcemia-inducing agent, a calcium channel inhibitor and a calcium chelator in association with a therapeutically effective amount of an anticancer agent inducing an apoptotic signal via death receptors Fas, TNF-R1, DR4 and/or DR5. | 02-09-2012 |
20120034211 | EGFR antibodies comprising modular recognition domains - Antibodies containing one or more modular recognition domains (MRDs) that can be used to target the antibodies to specific sites are described. The use of antibodies containing one or more modular recognition domains to treat disease, and methods of making antibodies containing one or more modular recognition domains are also described. | 02-09-2012 |
20120034212 | Human Anti-IL-6 Antibodies With Extended In Vivo Half-Life And Their Use In Treatment Of Oncology, Autoimmune Diseases And Inflammatory Diseases - The present invention provides human anti-IL-6 antibodies with extended in vivo half-life. The invention further relates to pharmaceutical compositions, therapeutic compositions, and methods using therapeutic antibodies that bind to IL-6 and that has an extended in vivo half-life for the treatment and prevention of IL-6 mediated diseases and disorders, such as, but not limited to, inflammatory diseases and disorders, autoimmune diseases and disorders and tumors. | 02-09-2012 |
20120034213 | TREATMENT WITH ANTI-ErbB2 ANTIBODIES - The present invention concerns the treatment of disorders characterized by the overexpression of ErbB2. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer overexpressing ErbB2 with a combination of an anti-ErbB2 antibody and a chemotherapeutic agent other than an anthracycline, e.g. doxorubicin or epirubicin. The invention further provides a method of treating cancer in a human patient comprising administering effective amounts of an anti-ErbB2 antibody and a cardioprotectant to the patient. | 02-09-2012 |
20120034214 | METHODS AND KITS FOR DETERMINING THE PROGNOSIS OF PULMONARY SARCOIDOSIS - The invention provides a method for determining the prognosis of pulmonary sarcoidosis in an individual subject, comprising conducting gene expression analysis on a sample from the subject. The sample is obtained by bronchoscopy under procedural methods not requiring general anaesthesia. | 02-09-2012 |
20120034215 | ANTI-MST1R ANTIBODIES AND USES THEREOF - The present disclosure provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for MST1R, which plays an integral role in various disorders or conditions, such as cancer. These antibodies, accordingly, can be used to treat these and other disorders and conditions. Antibodies of the disclosure also can be used in the diagnostics field, as well as for further investigating the role of MST1R in the progression of disorders associated with tumors. The disclosure also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. | 02-09-2012 |
20120034216 | SPIROKETALS - The present invention relates to spiroketal compounds that are useful in methods of treating or preventing protozoal infections, parasitic infections, bacterial infections, cell proliferative disorders and anti inflammatory disorders. The spiroketal compounds are also useful as immunosuppressive agents, and also in methods of controlling pests. | 02-09-2012 |
20120034217 | ANTI-NEOPLASTIC COMPOSITIONS COMPRISING EXTRACTS OF BLACK COHOSH - The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided. | 02-09-2012 |
20120034218 | RBM3 in Colorectal Cancer Prognostics - The present invention provides means, such as a method, for determining whether a mammalian subject having a colorectal cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group. The method comprises the steps of: evaluating an amount of RBM3 protein or RBM3 mRNA molecule in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; comparing said sample value with a predetermined reference value; and | 02-09-2012 |
20120034219 | USES OF IL-23 AGONISTS AND ANTAGONISTS; RELATED REAGENTS - Provided are methods of treatment for tumors. In particular, methods are provided for modulating activity of a cytokine molecule and its receptor. | 02-09-2012 |
20120034220 | Mucin Fusion Polypeptide Vaccines, Compositions And Methods Of Use Thereof - The present invention provides compositions and methods for augmenting vaccine immunogenicity using mucin-immunoglobulin fusion proteins. | 02-09-2012 |
20120034221 | T-Cell Receptor Antibodies And Methods of Use Thereof - The present invention is directed to the production and use of monoclonal antibodies, or antigen binding fragments thereof, that specifically bind the T cell antigen receptor (TCR) and their use for immunomodulation. In preferred embodiments, the antibody or antigen binding fragment of the invention specifically binds the constant region of the α chain of the TCR, or otherwise specifically binds the α chain regardless of TCR clonal origin (i.e., is pan specific for TCR). The antibodies of the invention may be used, for example, in immunosuppressive therapies for transplant maintenance and the treatment of autoimmune diseases, and/or as targeting molecules for use in the treatment of T-cell malignancies. | 02-09-2012 |
20120034222 | Nitric Oxide Generating Medical Devices - Medical devices having a catalyst capable of catalyzing the generation of nitric oxide in vivo and methods of treating a vascular condition using the devices are provided. | 02-09-2012 |
20120039869 | METHODS OF USING MOLECULAR CONJUGATES COMPRISING MONOCLONAL ANTIBODIES TO DENDRITIC CELLS - The present invention provides novel methods for targeting an antigen to a dendritic cell using an antibody linked to the antigen. The present invention further provides methods of inducing or enhancing an immune response and methods of immunization using an antibody linked to the antigen. | 02-16-2012 |
20120039870 | BINDING MOLECULES WITH MULTIPLE BINDING SITES, COMPOSITIONS COMPRISING THE SAME AND USES THEREOF - The present invention relates to binding molecules, such as amino acid sequences with multiple antigen binding sites. In particular, the binding molecules of the present invention have at least two antigen binding sites that partially or fully overlap with each other and that are directed against at least two different naturally occurring binding molecules. The invention further relates to uses of such binders, for example in methods for inhibiting and/or blocking of the interaction between said at least two naturally occurring binding molecules and a third naturally occurring binding molecule. | 02-16-2012 |
20120039871 | METHODS AND COMPOSITIONS FOR ANTIBODY THERAPY - Methods and materials are provided for selecting and/or treating a subject based on a FcγRIIA polymorphism, or a FcγRIIB polymorphism, or both an FcγRIIA polymorphism and a FcγRIIB polymorphism, for treatment with a therapy including an antibody therapy such as rituximab. Methods are also provided for designing, making, screening, testing and/or administering antibodies as well as for optimizing antibody therapies based upon a subject's FcγRIIA polymorphism, or FcγRIIB polymorphism, or both the FcγRIIA polymorphism and the FcγRIIB polymorphism. | 02-16-2012 |
20120039872 | IL-3 INHIBITORS IN USE FOR TREATMENT OF RHEUMATOID ARTHRITIS IN AN EARLY STAGE - The use of an IL-3 inhibitor for prophylactic treatment of rheumatoid arthritis, for treatment of rheumatoid arthritis in an early stage, during early phases of exacerbation, or as maintenance therapy to prevent disease flares or disease progression in a subject is described. | 02-16-2012 |
20120039873 | ANTIBODIES AGAINST MONOCYTE CHEMOTACTIC PROTEINS - The invention provides antibodies that bind to a plurality of β-chemokines, particularly monocyte chemotactic proteins MCP-1, MCP-2 and MCP-3. The invention also provides cells producing the antibodies, and methods of making and using the same. | 02-16-2012 |
20120039874 | HUMAN MONOCLONAL ANTIBODY AGAINST A COSTIMULATORY SIGNAL TRANSDUCTION MOLECULE AILIM AND PHARMACEUTICAL USE THEREOF - Immunization of human antibody-producing transgenic mice, which have been created using genetic engineering techniques, with AILIM molecule as an antigen resulted in various human monoclonal antibodies capable of binding to AILIM and capable of controlling a variety of biological reactions (for example, cell proliferation, cytokine production, immune cytolysis, cell death, induction of ADCC, etc.) associated with AILIM-mediated costimulatory signal (secondary signal) transduction. Furthermore, it has been revealed that the human monoclonal antibody is effective to treat and prevent various diseases associated with AILIM-mediated costimulatory signal transduction, being capable of inhibiting the onset and/or advancement of the diseases. | 02-16-2012 |
20120039875 | DIAGNOSTIC AND THERAPEUTIC METHODS AND COMPOSITIONS INVOLVING PTEN AND BREAST CANCER - Patients with ErbB2-overexpressing cancers can be given an ErbB2 targeting agent as a therapeutic regimen but not all patients are responsive. The present invention concerns the diagnostic, prognostic and therapeutic methods and compositions for evaluating potential efficacy of an ErbB2 targeting agent in an ErbB2-overexpressing cancers by evaluating PTEN expression, which is predictive of responsiveness or resistance to ErbB2 targeting agents such as trastuzumab. Low PTEN expression is predictive of a patient who will respond poorly to trastuzumab. | 02-16-2012 |
20120039876 | STABILIZED LIQUID ANTI-RSV ANTIBODY FORMULATIONS - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 02-16-2012 |
20120039877 | E1-MINUS ADENOVIRUSES AND USE THEREOF - The present invention is related to a virus, preferably an adenovirus, characterised in that the virus comprises:
| 02-16-2012 |
20120039878 | TREATMENT AND PROPHYLAXIS OF AMYLOIDOSIS - Methods useful for effecting prophylaxis or treatment of amyloidosis, including AA Amyloidosis and AL amyloidosis, by administering peptides comprising neoepitopes, such as AA fragments from a C-terminal region of AA, and antibodies specific for neoepitopes of aggregated amyloid proteins, for example, antibodies specific for the C-terminal region of AA fibrils. Antibodies for inhibition of formation and/or increasing clearance of amyloid deposits in a patient thus effecting prophylaxis or treating amyloid disease. | 02-16-2012 |
20120039879 | STREPTAVIDIN HAVING LOW IMMUNOGENICITY AND USE THEREOF - It is an object of the present invention to provide a mutant streptavidin wherein the immunogenicity (antigenicity) in mammals of a streptavidin is reduced. The present invention provides a mutant streptavidin, which comprises an amino acid sequence in which (a) the arginine residue at position 72 is substituted with another amino acid residue, and (b) any one or more of the tyrosine residue at position 10, the tyrosine residue at position 71, the glutamic acid residue at position 89, the arginine residue at position 91, and the glutamic acid residue at position 104 are substituted with other amino acid residues, with respect to the amino acid sequence of a core streptavidin as shown in SEQ ID NO: 2, and which has decreased immunogenicity as compared with that of a wild-type streptavidin. | 02-16-2012 |
20120039880 | FRAGMENTATION RESISTANT IgG1 Fc-CONJUGATES - The present invention provides compositions and methods relating to human IgG1 and IgG3 Fc-conjugates which are resistant to free-radical mediated fragmentation and aggregation. The present invention also provides compositions and methods for making the Fc-conjugates of the invention. | 02-16-2012 |
20120039881 | COMPOSITIONS AND METHODS FOR TREATING NEUROLOGICAL DISORDERS - Methods and compositions for modulating GABA release in a subject are provided. A preferred embodiment provides a composition containing an effective amount of an ErbB4 ligand to enhance or promote GABA release, i.e., GABAergic transmission. The ErbB4 ligand can be an agonist ligand or an antagonist ligand depending on the disorder to be treated. Methods for treating neurological disorders are also provided. Representative disorders that can be treated include, but are not limited to schizophrenia, epilepsy, depression and anxiety, insomnia, stroke, pain, bipolar, autism, or a combination thereof. By increasing GABA release a sedative effective can be induced in the subject. Methods for inducing a stimulatory effect in a subject are also provided. In these methods, an effective amount of an ErbB4 antagonist ligand is administered to the subject to reduce or inhibit GABA release in the subject. | 02-16-2012 |
20120039882 | Vascular Disease Therapies - The present invention relates to methods and agents for treating impaired vascular and cardiac function. Methods and agents for treating various physiological and pathological features associated with vascular dysfunction and cardiac dysfunction are also provided. | 02-16-2012 |
20120045432 | B LYMPHOCYTE STIMULATOR ASSAYS - The present invention relates to nucleic acid molecules encoding Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides, including soluble forms of the extracellular domain. Neutrokine-alpha and/or Neutrokine-alphaSV polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to antibodies or portions thereof that specifically bind Neutrokine-alpha and/or Neutrokine-alphaSV and diagnostic and therapeutic methods using these antibodies. Also provided are diagnostic methods for detecting immune system-related disorders and therapeutic methods for treating immune system-related disorders using the compositions of the invention. | 02-23-2012 |
20120045433 | COMBINATION THERAPY - The present invention relates to a combination therapy of propane-1-sulfonic acid {3-[5-(4-chlorophenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide, or a pharmaceutically acceptable salt thereof, and an topoisomerase inhibitor for treating a patient suffering from a proliferative disorder, in particular a solid tumor, for example, colorectal cancer, melanoma, and thyroid cancer. In particular, the present invention relates to such a therapy wherein the topoisomerase inhibitor is irinotecan, or a pharmaceutically acceptable salt thereof, and the disorder is colorectal cancer involving a tumor comprising b-Raf having the V600E mutation. | 02-23-2012 |
20120045434 | COMBINATION THERAPY - The present invention relates to a combination therapy of propane-1-sulfonic acid {3-[5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide, or a pharmaceutically acceptable salt thereof, and an EGFR inhibitor for treating a patient suffering from a proliferative disorder, in particular a solid tumor, for example, colorectal cancer, melanoma, and thyroid cancer. | 02-23-2012 |
20120045435 | COMPOSITIONS AND METHODS TO INHIBIT STEM CELL AND PROGENITOR CELL BINDING TO LYMPHOID TISSUE AND FOR REGENERATING GERMINAL CENTERS IN LYMPHATIC TISSUES - The present invention relates to compositions and methods of inhibiting stem cell binding to organs and tissues, including the blocking of stem cell binding to germinal centers present in lymph tissue. Disclosed are compositions and methods for regenerating germinal centers in lymphatic tissue. Included in the compositions are adjuvants, agonists to CD40, CD28 and the IL-21 receptor, and antagonist to CD20. | 02-23-2012 |
20120045436 | Humanized Anti-CD70 Binding Agents and Uses Thereof - Disclosed are CD70 binding agents, such as humanized anti-CD70 antibodies and fragments and derivatives, that exert a cytotoxic, cytostatic or immunomodulatory on CD70 expressing cells, as well as pharmaceutical compositions and kits comprising the antibody, fragment or derivative. Also disclosed are methods for the treatment of CD70-expressing cancers and immunological disorders, comprising administering to a subject the CD70 binding agents or pharmaceutical compositions. | 02-23-2012 |
20120058109 | REELIN RESCUES COGNITIVE FUNCTION - Disclosed are methods of influencing, and enhancing, cognitive function by increasing, and/or preventing interference with, Reelin levels as well as Reelin signaling. Cognitive function is improved, in a subject in need thereof, by administering a therapeutically effective amount of Reelin, a Reelin-specific modulator or an agonist of a lipoprotein receptor to the subject. The lipoprotein receptor can be selected from candidates such as ApoER2 and VLDLR. As disclosed herein, agonists of the lipoprotein receptor for use with the inventive method include APC, Sep and Fc-RAP. In addition to administering exogenous Reelin, a Reelin-specific modulator, such as a recombinant Reelin fragment, can be used to increase Reelin levels and/or signaling. | 03-08-2012 |
20120058110 | Method for Predicting the Responsiveness to an Anti-TNF Alpha Antibody Treatment - The present invention relates to a method for predicting the responsiveness of a patient to an anti-TNFα antibody treatment. | 03-08-2012 |
20120058111 | Sialylated antigen-specific antibodies for treatment or prophylaxis of unwanted inflammatory immune reactions and methods of producing them - The present invention is directed to a sialylated isolated antibody specific for an antigen selected from autoimmune antigens, allergens, MHC molecules or Rhesus factor D antigen, comprising an Fc-portion of IgG type, and exhibiting a sialic acid residue at the Fc-portion for use in treatment and/or prophylaxis of autoimmune disease, allergy, transplant rejection or Rhesus factor D reactivity and to methods of producing such an antibody. | 03-08-2012 |
20120058112 | ANTIBODIES - The combination of an IGF-1R antagonist such as a humanized antibody and an anti-proliferative drug is described. In a preferred embodiment, the present invention describes the combination of an IGF-1R antibody and an anti-proliferative drug belonging to the EGFR-inhibitor class, which is preferably erlotinib. The combination according to the present invention is useful for the treatment of tumours, including IGF-1R and/or EGFR mediated or dependent tumours. | 03-08-2012 |
20120058113 | CANCER TREATMENT METHOD - A method of treating cancer is described including administration of a 4-quinazolineamine and at least one other anti-neoplastic agent as well as a pharmaceutical combination including the 4-quinazolineamines. | 03-08-2012 |
20120064065 | Safe and functional humanized antibodies - The present invention is related to safe and functional antibodies for the therapeutic and diagnostic use in the treatment of an amyloidosis, a group of disorders and abnormalities associated with amyloid protein, such as Alzheimer's disease. | 03-15-2012 |
20120064066 | Monoclonal Antibodies to Hepatocyte Growth Factor - The present invention is directed toward a neutralizing monoclonal antibody to hepatocyte growth factor, a pharmaceutical composition comprising same, and methods of treatment comprising administering such a pharmaceutical composition to a patient. | 03-15-2012 |
20120064067 | THERAPEUTIC USE OF ANTI-CS1 ANTIBODIES - The present invention is directed to antagonists of CS1 that bind to and neutralize at least one biological activity of CS1. The invention also includes a pharmaceutical composition comprising such antibodies or antigen-binding fragments thereof. The present invention also provides for a method of preventing or treating disease states, including autoimmune disorders and cancer, in a subject in need thereof, comprising administering into said subject an effective amount of such antagonists. | 03-15-2012 |
20120064068 | THERAPEUTIC USE OF ANTI-CS1 ANTIBODIES - The present invention is directed to antagonists of CS1 that bind to and neutralize at least one biological activity of CS1. The invention also includes a pharmaceutical composition comprising such antibodies or antigen-binding fragments thereof. The present invention also provides for a method of preventing or treating disease states, including autoimmune disorders and cancer, in a subject in need thereof, comprising administering into said subject an effective amount of such antagonists. | 03-15-2012 |
20120064069 | THERAPEUTIC USE OF ANTI-CS1 ANTIBODIES - The present invention is directed to antagonists of CS1 that bind to and neutralize at least one biological activity of CS1. The invention also includes a pharmaceutical composition comprising such antibodies or antigen-binding fragments thereof. The present invention also provides for a method of preventing or treating disease states, including autoimmune disorders and cancer, in a subject in need thereof, comprising administering into said subject an effective amount of such antagonists. | 03-15-2012 |
20120064070 | MODULATION OF NKG2D - The present invention relates to methods and compositions for treating and/or preventing autoimmune and/or inflammatory disease. In particular, the present invention provides therapeutics for impairing the expansion and function of autoreactive T cells, NK cells and/or NKT cells, by modulating NKG2D. | 03-15-2012 |
20120064071 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 03-15-2012 |
20120064072 | Combination Cancer Therapy Comprising Administration of an EGFR Inhibitor and an IGF-1R Inhibitor - A method of treating cancer comprising: (a) identifying a patient having cancer that initially responded to IRS1 agent therapy and that has resumed progression; (b) administering an effective regimen comprising the same or a different IRS1 agent and an IGF-1 R inhibitor administered together or sequentially. | 03-15-2012 |
20120064073 | IL-17 HOMOLOGOUS POLYPEPTIDES AND THERAPEUTIC USES THEREOF - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 03-15-2012 |
20120064074 | ANTIGEN BINDING DOMAINS - A process for the production of an antigen specific antigen binding domain using a transformed host containing an expressible DNA sequence encoding the antigen specific antigen binding domain, wherein the antigen specific antigen binding domain is derived from a variable region of the immunoglobulin isotype NAR found in fish. | 03-15-2012 |
20120070428 | TREATMENT OF VASCULARIZED PIGMENT EPITHELIAL DETACHMENT WITH ANTI-VEGF THERAPY - Methods for treating vascularized pigment epithelial detachment using anti-VEGF agents are disclosed. | 03-22-2012 |
20120070429 | HUMANIZED ANTIBODIES AGAINST WEST NILE VIRUS AND THERAPEUTIC AND PROPHYLACTIC USES THEREOF - The present invention relates to compositions comprising humanized antibodies or fragments thereof that immunospecifically bind to one or more antigens of a flavivirus, particularly of West Nile Virus (WNV) and methods for preventing, treating or ameliorating symptoms associated with a flavivirus, particularly of West Nile Virus (WNV) infection utilizing said compositions. In particular, the present invention relates to methods for preventing, treating or ameliorating symptoms associated with WNV infection, said methods comprising administering to a human subject an effective amount of one or more humanized antibodies or fragments thereof that immunospecifically bind to a WNV antigen. The present invention also relates to detectable or diagnostic compositions comprising humanized antibodies or fragments thereof that immunospecifically bind to a WNV antigen and methods for detecting or diagnosing WNV infection utilizing said compositions. | 03-22-2012 |
20120070430 | IDENTIFICATION OF TUMOR-ASSOCIATED MARKERS FOR DIAGNOSIS AND THERAPY - The invention relates to genetic products the expression of which is associated with cancer diseases. The invention also relates to the therapy and diagnosis of diseases in which the genetic products are expressed or aberrantly expressed, in particular cancer diseases. | 03-22-2012 |
20120070431 | METHODS FOR TREATING CHRONIC OBSTRUCTIVE PULMONARY DISEASE - The present invention provides methods of treating a mammal having chronic obstructive pulmonary disease (COPD), independent of both smoking status and asthma status, with a therapeutically effective amount of an anti-IgE moiety. In accordance with the invention, COPD patients with an elevated serum IgE level may benefit from the treatment methods disclosed. In certain instances, the methods of the disclosure have been found to be useful for the treatment of COPD patients regardless of their skin test results and/or in vitro reactivity to a perennial aeroallergen. Anti-IgE moieties, in accordance with the invention, include but are not limited to any IgG antibody that selectively binds to a given mammal immunoglobulin E (e.g., human immunoglobulin E) such as humanized anti-IgE, humanized murine monoclonal antibody, and/or Omalizumab. | 03-22-2012 |
20120070432 | TREATMENT OF PANCREATIC CANCER USING A DR5 AGONIST IN COMBINATION WITH GEMCITABINE - Methods and compositions for treatment of exocrine pancreatic cancer in a human patient comprising administering a therapeutically effective amount of a DR5 agonist and gemcitabine. Methods and compositions for treating a patient by identifying the alleleic variant of FcγRIIIA. | 03-22-2012 |
20120070433 | FLAVONOID HYDROGEL - There is provided methods for producing a hydrogel comprising conjugates of a hydrogel forming agent and a flavonoid including a method for producing a hydrogel that is capable of adhesion of cells and which comprises enzymatically cross-linked conjugates of a hydrogel forming agent and a flavonoid. There is also provided a method for producing a hydrogel comprising conjugates of a hydrogel forming agent and a flavonoid without the addition of an exogenous peroxide or peroxidase or without the addition of an exogenous peroxide. Hydrogels produced by such methods and methods of using the hydrogels are also described herein. | 03-22-2012 |
20120076775 | Combination of HGF Inhibitor and EGF Inhibitor to Treat Cancer - The present invention is directed toward a method of treating cancer by administering to a patient an inhibitor of Hepatocyte Growth Factor and an inhibitor of, e.g., Epidermal Growth Factor. | 03-29-2012 |
20120076776 | METHOD FOR TREATING INFLAMATION BY LYMPHOCYTE DEPLETION OR SEQUESTERING - A method for preventing inflammation, comprising administering to a subject a lymphocyte sequestrating or depletion agent before the onset of inflammation. A method for treating inflammation caused by an injury or an infection, comprising depleting immune lymphocyte of a subject by administering to said subject a lymphocyte sequestrating or depletion agent during or after said event. A method for preventing or treating abdominal adhesion comprising administering to a subject a lymphocyte sequestering or a lymphocyte depletion agent. | 03-29-2012 |
20120076777 | ANTI-FIBROBLASTIC FLUOROCHEMICAL EMULSION THERAPIES - The present invention is directed to compositions and methods targeting tissue resident cells, such as fibroblasts, in a subject harboring conditions or at risk for conditions that would benefit from anti-fibroblastic therapy. The present invention relates to the use of fluorochemical compositions and methods of delivery that result in retention of the fluorochemical composition and any bioactive agent delivered in combination with the fluorochemical composition. | 03-29-2012 |
20120076778 | Antibodies Against Insulin-Like Growth Factor I Receptor and Uses Thereof - An antibody binding to IGF-IR and being glycosylated with a sugar chain at Asn297, said antibody being characterized in that the amount of fucose within said sugar chain is between 20% and 50%, has improved properties in antitumor therapy. | 03-29-2012 |
20120076779 | STABILIZATION OF IMMUNOGLOBULINS AND OTHER PROTEINS THROUGH AQUEOUS FORMULATIONS WITH SODIUM CHLORIDE AT WEAK ACIDIC TO NEUTRAL ph - The present invention provides, among other aspects, storage stabile aqueous formulations of labile proteins at a mildly acidic to neutral pH. The present invention also provides methods for stabilizing a labile therapeutic protein composition at a mildly acidic to neutral pH. Advantageously, the methods and formulations provided herein allow stabile aqueous compositions of labile proteins at mildly acidic to neutral pH useful for parenteral administration. | 03-29-2012 |
20120076780 | RECOMBINANT FUSION PROTEIN AND POLYNUCLEOTIDE CONSTRUCT FOR IMMUNOTOXIN PRODUCTION - The present invention relates to a polynucleotide construct encoding a fusion protein consisting of a domain which binds the immunoglobulin Fc region, genetically fused to a truncated form of | 03-29-2012 |
20120076781 | METHODS OF TREATING CANCERS WITH HER3 ANTISENSE OLIGONUCLEOTIDES - One aspect of the invention provides methods for treating cancers which are resistant to treatment with a protein tyrosine kinase inhibitor by co-treatment with the protein tyrosine kinase inhibitor and one or more antisense oligomers that reduce the expression of HER3 and/or HER2 and/or EGFR. Another aspect of the invention provides methods for treating cancers by co-treatment with an inhibitor of HER2 and one or more antisense oligomers that reduce the expression of HER3. | 03-29-2012 |
20120076782 | GENERATION AND PROFILING OF FULLY HUMAN HUCAL GOLD.RTM.-DERIVED THERAPEUTIC ANTIBODIES SPECIFIC FOR HUMAN CD38 - The present invention provides novel methods for using recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for CD38, which plays an integral role in various disorders or conditions. These methods take advantage of newly discovered antibodies and surprising properties of such antibodies, such as the ability to bind CD38 of minipig origin and the ability to induce, by cross-linking, specific killing of cells that express CD38. These antibodies as well as the novel methods for using those antibodies can be used to treat, for example, hematological malignancies such as multiple myeloma. | 03-29-2012 |
20120076783 | REDUCED-VISCOSITY CONCENTRATED PROTEIN FORMULATIONS - The present application concerns concentrated protein formulations with reduced viscosity, which are particularly suitable for subcutaneous administration. The application further concerns a method for reducing the viscosity of concentrated protein formulations. | 03-29-2012 |
20120076784 | HIGHLY CONCENTRATED, LIQUID FORMULATIONS OF ANTI-EGFR ANTIBODIES - The invention relates to processes for the preparation of highly concentrated, liquid formulations comprising at least one anti-EGFR antibody and/or one of its variants and/or fragments, in particular monoclonal antibodies against the EGF receptor, particularly preferably of Mab C225 (cetuximab) and Mab h425 (EMD 72000), by ultrafiltration. The invention furthermore relates to highly concentrated, liquid formulations of anti-EGFR antibodies, in particular of monoclonal antibodies against the EGF receptor, particularly preferably Mab C225 (cetuximab) and Mab h425 (EMD 72000) and/or variants and/or fragments thereof, characterised in that the highly concentrated, liquid formulations have a content of anti-EGFR antibodies of 10-250, preferably 50-180 mg/ml, particularly preferably of 100-150 mg/ml, and to the use thereof. | 03-29-2012 |
20120082662 | ANTI-CMET ANTAGONISTS - The invention provides therapeutic anti-c-met antibodies, and compositions comprising and methods of using these antibodies. | 04-05-2012 |
20120082663 | ANTI-CMET ANTAGONISTS - The invention provides therapeutic anti-c-met antibodies, and compositions comprising and methods of using these antibodies. | 04-05-2012 |
20120082664 | OPTIMIZED ANTIBODIES THAT TARGET CD19 - The present invention describes antibodies that target CD19, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 04-05-2012 |
20120082665 | PREVENTION AND TREATMENT OF PAIN USING ANTIBODIES TO SPHINGOSINE-1-PHOSPHATE - The present invention relates to use of anti-S1P agents, for example, humanized monoclonal antibodies, for prevention and/or treatment of pain, including neuropathic pain, hyperalgesia, allodynia, and chemotherapy-induced pain. | 04-05-2012 |
20120082666 | ANTIBODY COMPOSITIONS AND METHODS OF USE - The invention provides compositions comprising anti-gH antibodies and anti-Complex I antibodies as well as methods of using the same. | 04-05-2012 |
20120082667 | Antibodies That Specifically Bind To A Beta Oligomers And Use Thereof - The present inventors successfully produced monoclonal antibodies that are specific to only soluble A beta oligomers, but do not recognize soluble A beta monomers, which are physiological molecules. It was demonstrated that the antibodies are useful as diagnostic/therapeutic monoclonal antibodies for Alzheimer's disease. | 04-05-2012 |
20120087913 | INDUCTION OF TUMOR HYPOXIA FOR CANCER THERAPY - Methods and compositions for enhancing the ability of hypoxia-activated bioreductive agents to kill tumor cells within solid tumors are provided. Local regions of hypoxia are created within a tumor, or within a region containing a tumor, resulting in enhanced activation of hypoxia-activated bioreductive agents (e.g. tirapazamine) within the local region. The activated hypoxia-activated bioreductive agents kill tumor cells in the hypoxic region by catalyzing DNA stand breakage within the tumor cells. Because the activity is localized, side effects that typically occur as a result of systemic administration of bioreductive agents are reduced. | 04-12-2012 |
20120087914 | INHIBITION OF TRIM62 ACTIVITY REDUCES CANCER CELL PROLIFERATION - The present invention provides methods to treat cancers using inhibitors of the TRIM62 protein and methods to identify inhibitors and other modulators of the TRIM62 protein. Pharmaceutical compositions that contain an inhibitor of a TRIM62 protein are also provided. | 04-12-2012 |
20120087915 | USE OF INHIBITORS OF BRUTON'S TYROSINE KINASE (BTK) - Disclosed herein are methods for treating a cancer comprising: a. administering a Btk inhibitor to a subject sufficient to result in an increase or appearance in the blood of a subpopulation of lymphocytes defined by immunophenotyping; b. determining the expression profile of one or more biomarkers from one or more subpopulation of lymphocytes; and c. administering a second agent based on the determined expression profile. | 04-12-2012 |
20120087916 | ANTI-ICAM-1 ANTIBODY, USES AND METHODS - The present invention relates to an antibody or an antigen-binding fragment thereof with binding specificity for ICAM-1, and to the use thereof in medicine for the treatment of cancers, such as multiple myeloma. | 04-12-2012 |
20120087917 | LOX AND LOXL2 INHIBITORS AND USES THEREOF - The present application relates to anti-LOX and anti-LOXL2 antibodies and their use in purification, diagnostic and therapeutic methods. Antibodies include monoclonal antibodies, humanized antibodies and functional fragments thereof. Anti-LOX and anti-LOXL2 antibodies can be used to identify and treat conditions such as a fibrotic condition, angiogenesis, or to prevent a transition from an epithelial cell state to a mesenchymal cell state. | 04-12-2012 |
20120087918 | METHODS AND COMPOSITIONS FOR INHIBITING THE GROWTH OF HEMATOPOIETIC MALIGNANT CELLS - Disclosed herein are compositions and methods for reducing the growth of hematopoietic malignant cells (e.g., B-cell leukemia cells). The methods involve reducing the growth of hematopoietic malignant cells by contacting hematopoietic malignant cells with GP88 antagonists. GP88 is an 88 KDa autocrine growth factor that promotes the growth of hematopoietic malignant cells. Antagonists to GP88 are provided which inhibit its expression or biological activity. The antagonists include antisense oligonucleotides and antibodies. Also provided are methods for determining if a patient is responding or is responsive to anti-cancer therapy (e.g., glucocorticoid therapy). Increased levels of GP88 in hematopoietic cells indicates a patient is not responding or responsive to anti-cancer therapy. | 04-12-2012 |
20120093805 | ANTI-CD27 HUMANIZED MONOCLONAL ANTIBODY - The present invention provides a monoclonal antibody which specifically recognizes CD27 containing an O-linked sugar chain to which galactose is not bound and binds to its extracellular region, or a method for using the same. The present invention can provide a monoclonal antibody or an antibody fragment thereof, which specifically recognizes a polypeptide encoded by CD27 gene containing an O-linked sugar chain to which galactose is not bound, and binds to its extracellular region; a hybridoma which produces the antibody; a DNA which encodes the antibody; a vector which comprises the DNA; a transformant obtainable by transforming the vector; a process for producing an antibody or an antibody fragment thereof using the hybridoma or the transformant; and a diagnostic agent or a therapeutic agent comprising the antibody or the antibody fragment thereof as an active ingredient. | 04-19-2012 |
20120093806 | ANTITUMOR COMBINATIONS CONTAINING ANTIBODIES RECOGNIZING SPECIFICALLY CD38 AND CYTARABINE - Pharmaceutical composition comprising an antibody specifically recognizing CD38 and cytarabine. | 04-19-2012 |
20120093807 | ROR ALPHA PROMOTING THE INDUCTION OF BMALL - An object of the present invention is to clarify unelucidated aspects in the control mechanism of circadian rhythms. The present inventors have newly found that RORα (retinoic acid binding-receptor alpha; the same shall apply hereinafter) stimulates an induction of Bmal1 expression and also that the induction of Bmal1 expression is promoted under hypoxia. These findings strongly suggest the existence of a control mechanism of circadian rhythms that, when RORα expression is promoted under hypoxia or the like, an induction of Bmal1 expression is stimulated and, when the induction of Bmal1 expression is stimulated, binding between BMAL1 and CLOCK is stimulated and an induction of Per gene or Cry gene expression is stimulated. The present invention, therefore, has applicability as jet-lag regulating agents and anticancer agents. | 04-19-2012 |
20120093808 | HUMANIZED PCRV ANTIBODY HAVING ANTI-PSEUDOMONAL ACTIVITY - Provided are a humanized monoclonal antibody against PcrV or a part thereof, and a pharmaceutical composition containing the same as an active ingredient, as an effective means for therapy of infection, particularly infection with | 04-19-2012 |
20120093809 | USE OF ALKANOYL L-CARNITINE IN COMBINATION WITH CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF NEOPLASMS - The present invention relates to the use of an alkanoyl L-carnitine selected from the group consisting of acetyl, propionyl, valeryl, isovaleryl and butirryl L-carnitine; in combination with one or more chemotherapeutic agent selected from the group consisting of: a camptothecin derivative; an alkylating agent; an anti-neoplastic anti-metabolite; a platin compound; a topoisomerase inhibitor; a VEGF inhibitor; a tyrosine kinase inhibitor; an EGFR kinase inhibitor; an mTOR kinase inhibitor; an insulin-like growth factor I inhibitor; a Raf kinase inhibitor; a monoclonal antibody; a proteasome inhibitor; a HDAC inhibitor; toxins; and imides; for the treatment of neoplasms. | 04-19-2012 |
20120093810 | MONOCLONAL ANTIBODY CAPABLE OF BINDING TO SPECIFIC DISCONTINUOUS EPITOPE OCCURRING IN AD1 REGION OF HUMAN CYTOMEGALOVIRUS GB GLYCOPROTEIN, AND ANTIGEN-BINDING FRAGMENT THEREOF - The present invention provides a pharmaceutical composition for human cytomegalovirus HCMV causative of various disease states, the composition comprising a monoclonal antibody and an antigen-binding fragment thereof that specifically binds to the AD1 region of glycoprotein gB and that has excellent neutralizing capacity. The present invention provides: a monoclonal antibody and an antigen-binding fragment thereof having an excellent neutralizing capacity and cell-to-cell infection blocking capacity and specifically binding to a discontinuous sequence occurring in the HCMV AD1 region; a pharmaceutical composition comprising the antibody or the fragment thereof; and the like. | 04-19-2012 |
20120093811 | ANTI-VEGF-D ANTIBODIES - The invention relates to an isolated antibody that specifically binds vascular endothelial growth factor-D (VEGF-D) and to a humanized antibody that specifically binds VEGF-D. | 04-19-2012 |
20120093812 | Method of Treating Degenerative Disorders of the Nervous System - The invention herein related to methods and compositions for treating nervous system disorders. The methods comprise administration of antibodies directed towards peptides that bind to receptors important in disease progression, thus attenuating the disease. | 04-19-2012 |
20120093813 | ANTI NOTCH-1 ANTIBODIES - This invention is directed toward monoclonal antibodies that bind specifically to Notch1. In one embodiment, the antibodies binds to at least a first epitope and a second epitope, wherein the first epitope resides with the LinA domain of the Notch1 negative regulatory region (NRR), and the second epitope resides within the HD-C domain of the Notch1 NRR. | 04-19-2012 |
20120100132 | HUMANIZED ANTI-HUMAN TUMOR NECROSIS FACTOR ALPHA MONOCLONAL ANTIBODY AND SEQUENCE THEREOF - An amino acid sequence of a humanized monoclonal antibody includes an amino acid sequence of a light chain variable region, which includes SEQ ID. NO.: 1; and an amino acid sequence of a heavy chain variable region, which comprises SEQ ID. NO.: 2, wherein SEQ ID. NO.: 1 and SEQ ID. NO.: 2 have at least one amino acid substitution which is selected from a group consisting of isoleucine at position 10 of SEQ ID. NO.: 1, being substituted with threonine, lysine at position 18 of SEQ ID. NO.: 1, being substituted with arginine, lysine at position 2 of SEQ ID. NO.: 2, being substituted with glutamine, tryptophan at position 10 of SEQ ID. NO.: 2, being substituted with leucine, lysine at position 18 of SEQ ID. NO.: 2, being substituted with arginine and glutamic acid at position 41 of SEQ ID. NO.: 2, being substituted with glycine. | 04-26-2012 |
20120100133 | USE OF ANTI-CD20 ANTIBODY FOR TREATING PRIMARY INTRAOCULAR LYMPHOMA - An embodiment relates to a monoclonal antibody directed against the CD20 antgen, in which the variable region of each of the light chains is coded by murine nucleic acid sequence SEQ ID NO:1, the variable region of each of the heavy chains is coded by murine nucleic acid sequence SEQ ID NO: 2, and the constant regions of the light chains and of the heavy chains originate from a non-murine species, said antibody being used for treating primary intraocular lymphoma. | 04-26-2012 |
20120100134 | GENETIC VARIANTS IN ANGIOGENESIS PATHWAY ASSOCIATED WITH CLINICAL OUTCOME - The invention provides methods for determining the clinical outcomes for treatment with various treatment regimens available to cancer patients based on genotypes of the patients for genetic polymorphism markers. The invention also provides kits for making the determination. | 04-26-2012 |
20120100135 | GENETIC POLYMORPHISMS ASSOCIATED WITH CLINICAL OUTCOMES OF TOPOISOMERASE INHIBITOR THERAPY FOR CANCER - The invention provides compositions and methods for determining the likelihood of response or survival of cancer patients treated with topoisomerase inhibitor therapy or anti-EGFR and topoisomerase inhibitor therapy combination therapy. After determining if a patient is likely to be successfully treated, the invention also provides methods for treating the patients. | 04-26-2012 |
20120100136 | METHODS FOR TREATING OR PREVENTING OPHTHALMOLOGICAL DISEASES - This invention relates to methods and compositions useful for the treatment or prevention of an ophthalmological disease, comprising administration of an effective amount of a PDGF antagonist and a VEGF antagonist to a mammal in need thereof. | 04-26-2012 |
20120100137 | IMMUNOGLOBULINS - The present invention discloses humanised anti-IL-18 antibodies, methods of manufacture, and methods of treatment with said antibodies. Further disclosed are screening methods using for example surface plasmon resonance to identify antibodies with therapeutic potential. | 04-26-2012 |
20120100138 | THE USE OF INHIBITORS OF BRUTON'S TYROSINE KINASE (BTK) - Disclosed herein are methods for treating a cancer comprising: a. administering a Btk inhibitor to a subject sufficient to result in an increase or appearance in the blood of a subpopulation of lymphocytes defined by immunophenotyping; b. determining the expression profile of one or more biomarkers from one or more subpopulation of lymphocytes; and c. administering a second agent based on the determined expression profile. | 04-26-2012 |
20120107302 | COMBINATIONS OF AN ANTI-HER2 ANTIBODY-DRUG CONJUGATE AND CHEMOTHERAPEUTIC AGENTS, AND METHODS OF USE - Combinations of the antibody-drug conjugate trastuzumab-MCC-DM1 and chemotherapeutic agents, including stereoisomers, geometric isomers, tautomers, solvates, metabolites and pharmaceutically acceptable salts thereof, are useful for inhibiting tumor cell growth, and for treating disorders such as cancer mediated by HER2 and KDR (VEGFR receptor 1). Methods of using such combinations for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions, are disclosed. | 05-03-2012 |
20120107303 | SYNERGISTIC TREATMENT OF CANCER USING IMMUNOMERS IN CONJUNCTION WITH CHEMOTHERAPEUTIC AGENTS - The invention relates to the therapeutic use of immunostimulatory oligonucleotides and/or immunomers in combination with chemotherapeutic agents to provide a synergistic therapeutic effect. | 05-03-2012 |
20120107304 | Combination therapy in treatment of oncological and fibrotic diseases - The invention relates to new methods for the treatment of oncological and fibrotic disease comprising the combined administration of a cell signalling and/or angiogenesis inhibitor in conjunction with an Aurora kinase inhibitor. | 05-03-2012 |
20120107305 | Combination Therapy - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of ZD6474 in combination with bevacizumab; to a pharmaceutical composition comprising ZD6474 and bevacizumab; to a combination product comprising ZD6474 and bevacizumab for use in a method of treatment of a human or animal body by therapy; to a kit comprising ZD6474 and bevacizumab; to the use of ZD6474 and bevacizumab in the manufacture of a medicament for use in the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation. | 05-03-2012 |
20120107306 | ANTIBODIES FOR EPIDERMAL GROWTH FACTOR RECEPTOR 3 (HER3) - The present invention relates to antibodies or fragments thereof that target a conformational epitope of a HER receptor. In particular, the invention relates to antibodies or fragments thereof that target a conformational epitope of HER3 receptor and compositions and methods of use thereof. | 05-03-2012 |
20120107307 | DIHYDROPYRIDIN SULFONAMIDES AND DIHYDROPYRIDIN SULFAMIDES AS MEK INHIBITORS - This invention concerns N-(ortho phenylamino dihydropyridyl)sulfonamides and N-(ortho phenylamino dihydropyridyl), N′-alkyl sulfamides which are inhibitors of MEK and are useful in the treatment of cancer and other hyperproliferative diseases. | 05-03-2012 |
20120107308 | GENE EXPRESSION LEVELS OF EGFR, VEGFR2, AND ERCC1 ASSOCIATED WITH CLINICAL OUTCOMES OF CHEMOTHERAPY - The invention provides compositions and methods for identifying a cancer patient suitable for anti-VEGF therapy. After determining if a patient is likely to be successfully treated, the invention also provides methods for treating the patients. | 05-03-2012 |
20120107309 | POLYMORPHISM IN K-RAS 3' UNTRANSLATED REGION ASSOCIATED WITH CLINICAL OUTCOMES OF CANCER TREATMENTS INDEPENDENT OF K-RAS MUTATION STATUS - The invention provides compositions and methods for determining the likelihood of response or survival of cancer patients treated with anti-EGFR therapy, topoisomerase inhibitor therapy or anti-EGFR therapy/topoisomerase inhibitor therapy combination therapy. After determining if a patient is likely to be successfully treated, the invention also provides methods for treating the patients. | 05-03-2012 |
20120107310 | METHODS OF ANTAGONIZING SIGNAL TRANSDUCTION IN SPINAL CORD CELLS - Use of antagonists to IL-31 are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 05-03-2012 |
20120107311 | TARGETED IDENTIFICATION OF IMMUNOGENIC PEPTIDES - This invention relates generally to identifying peptide sequences involved in antibody binding to any protein for synthesis of vaccine treatments. This novel method allows for a more manageable vaccine peptide discovery and specific generation of unique immunogenic peptides from self-tumor associated proteins and/or foreign proteins from infectious organisms for specific and/or enhanced expression only in the presence of the antibody. | 05-03-2012 |
20120107312 | Combinations for the Treatment of Diseases involving Cell Proliferation - Disclosed are pharmaceutical compositions for the treatment of diseases which involve cell proliferation. Also disclosed are methods for the treatment of said diseases, comprising co-administration of a compound 1 of Formula (I) | 05-03-2012 |
20120107313 | MAMMALIAN RECEPTOR PROTEINS; RELATED REAGENTS AND METHODS - Nucleic acids encoding mammalian, e.g., primate, receptors, purified receptor proteins and fragments thereof. Antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are described. | 05-03-2012 |
20120114636 | LOW MOLECULAR WEIGHT CYCLIN E (LMW-E) AS A BIOMARKER FOR PERSONALIZATION OF CANCER THERAPIES - Methods are disclosed for predicting a patient response to anti-Her2 therapy or anti-aromatase therapy. In certain embodiments, the methods involve the identification of low molecular weight cyclin E (LMW-E) in cancers, such as breast cancer cells, as a predictive and prognostic marker. In further embodiments, LMW-E expression by a cancerous or pre-cancerous cell may be used to predict response to an aromatase inhibitor and/or CDK2 inhibitor, and determination of LMW-E expression may be used in the personalization of cancer therapies. | 05-10-2012 |
20120114637 | MTOR PATHWAY INHIBITORS FOR TREATING OCULAR DISORDERS - Diseases and conditions associated with tissues of the body, including but not limited to tissues in the eye, can be effectively treated, prevented, inhibited, onset delayed, or regression caused by administering therapeutic agents to those tissues. Described herein are ophthalmic formulations that deliver a variety of therapeutic agents, including but not limited to rapamycin (sirolimus), analogs thereof (rapalogs) or other mTOR inhibitors, to a subject for an extended period of time. The ophthalmic formulations may be placed in an aqueous medium of a subject, including but not limited to intraocular or periocular administration, or placement proximate to a site of a disease or condition to be treated in a subject. A method may be used to administer a therapeutic agent to treat or prevent age-related macular degeneration, macular edema, diabetic retinopathy, uveitis, dry eye, or a hyperpermeability disease in a subject. | 05-10-2012 |
20120114638 | COMBINATION THERAPY - The present invention relates to a combination therapy of 2,2-dimethyl-N-((S)-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-N′-(2,2,3,3,3-pentafluoro-propyl)-malonamide, or a pharmaceutically-acceptable salt thereof, and bevacizumab for treating a patient suffering from a proliferative disorder, in particular a solid tumor, for example a brain tumor. | 05-10-2012 |
20120114639 | COMPOSITIONS AND METHODS FOR INHIBITING VIRAL AND/OR BACTERIAL INFECTIONS - We describe herein compositions and methods related to inferring with microbial infection. Generally, the compositions include an infection antagonist that inhibits formation of a heparin sulfonated proteoglycan (HSPG)-containing infection complex. Generally, the methods include administering to a subject an amount of a composition as described herein effective to inhibit infection by a microorganism that that infects a host through interactions that involve HSPG. | 05-10-2012 |
20120114640 | MODULATION OF THE TGF- AND PI3K/AKT PATHWAYS IN THE DIAGNOSIS AND TREATMENT OF SQUAMOUS CELL CARCINOMA - Described herein is the finding that the PI3K/Akt and TGF-β pathways act cooperatively to promote squamous cell carcinoma (SCC), such as head and neck squamous cell carcinoma (HNSCC). In particular, it was found that conditional deletion of transforming growth factor-β receptor type I (TGFBR1) and phosphatase and tensin homolog (PTEN) in head and neck epithelia of mice led to spontaneous development of SCC in the mice with complete penetrance. Accordingly, provided herein are methods of treating a subject diagnosed with SCC by administering to the subject a therapeutically effective amount of an inhibitor of the PI3K/Akt pathway and a therapeutically effective amount of a modulator of the TGF-β pathway. Also provided is a method of diagnosing a subject as having SCC, or being susceptible to developing SCC, by detecting the presence or absence of at least one tumor-associated mutation in the TGFBR1 gene and at least one tumor-associated mutation in the PTEN gene. Further provided is a method of diagnosing a subject as having SCC, or being susceptible to developing SCC, by detecting expression of TGFBR1 and PTEN in a sample obtained from the subject. Pharmaceutical compositions that include an inhibitor of the PI3K/Akt pathway and a modulator of the TGF-β pathway, and the use of such pharmaceutical compositions for the treatment of SCC, are also provided herein. | 05-10-2012 |
20120114641 | THERAPEUTIC COMBINATION COMPRISING A PLK1 INHIBITOR AND AN ANTINEOPLASTIC AGENT - The present invention provides a combination comprising (a) a compound of formula (I) and (b) one or more antineoplastic agents selected from the group consisting of an antimetabolite agent, analkylating or alkylating-like agent, an intercalating agent, a topoisomerase I or II inhibitor, an antimitotic agent, a kinase inhibitor, a proteasome inhibitor and an antibody inhibiting a growth factor or its receptor, wherein active ingredients of the combination are present in each case in free form or in the form of a pharmaceutically acceptable salt or any hydrate or solvate thereof, useful in the treatment of tumors. | 05-10-2012 |
20120114642 | TARGETING VEGF-B REGULATION OF FATTY ACID TRANSPORTERS TO MODULATE HUMAN DISEASES - The present invention provides materials and methods for modulating FATP expression and/or activity in vivo. The materials and methods have numerous diagnostic, prophylactic, and therapeutic applications for various diseases and conditions that are influenced by FATPs, or characterized by excessive or inadequate FATP expression or activity. | 05-10-2012 |
20120114643 | 4-PYRIDINONE COMPOUNDS AND THEIR USE FOR CANCER - Disclosed are compounds of Formula (I): | 05-10-2012 |
20120114644 | ANTAGONIST ANTI-NOTCH3 ANTIBODIES AND THEIR USE IN THE PREVENTION AND TREATMENT OF NOTCH3-RELATED DISEASES - The present invention relates to antagonist antibodies that specifically bind to Notch 3 and inhibit its activation. The present invention includes antibodies binding to a conformational epitope comprising the first Lin12 domain and the second dimerization domain. The present invention also includes uses of these antibodies to treat or prevent Notch 3 related diseases or disorders. | 05-10-2012 |
20120121581 | Anti-Botulism Antibody Coformulations - This invention relates to stable formulations of multiple antibodies comprising a plurality of anti-botulism antibodies and an effective amount of a succinate buffer, an effective amount of arginine, wherein the antibodies are present in substantially equal concentrations and the pH of the formulation is between about 5 and about 6.5. | 05-17-2012 |
20120121582 | Modulators Of EphA2 And Ephrina1 For The Treatment Of Fibrosis-Related Disease - The present invention relates to methods and compositions designed for the treatment, management, prevention and/or amelioration of non-neoplastic hyperproliferative epithelial and/or endothelial cell disorders, including but not limited to disorders associated with increased deposition of extracellular matrix components (e.g., collagen, proteoglycans, tenascin and fibronectin) and/or aberrant angiogenesis. Non-limiting examples of such disorders include cirrhosis, fibrosis (e.g., fibrosis of the liver, kidney, lungs, heart, retina and other viscera), asthma, ischemia, atherosclerosis, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, macular degeneration, rheumatoid arthritis, osteoarthritis, infantile hemangioma, verruca vulgaris, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, ankylosing spondylitis, systemic lupus, Reiter's syndrome, Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis, coronary artery disease, psoriatic arthropathy and psoriasis. The methods of the invention comprise the administration of an effective amount of one or more agents that are modulators of EphA2 and/or its endogenous ligand, EphrinA1. The invention also provides pharmaceutical compositions comprising one or more EphA2/EphrinA1 Modulators of the invention either alone or in combination with one or more other agents useful for therapy for such non-neoplastic hyperproliferative epithelial and/or endothelial disorders. Diagnostic methods and methods for screening for EphA2/EphrinA1 Modulators are also provided. | 05-17-2012 |
20120121583 | ANTIBODIES AGAINST HUMAN TWEAK AND USES THEREOF - The invention provides antibodies binding to TWEAK, including anti-TWEAK antibodies comprising a heavy chain variable domain CDR3 (CDR3H) selected from the group consisting of SEQ ID NO: 8, 16 or 24. The invention provides anti-TWEAK antibodies which are useful for the treatment of cancer, autoimmune diseases, rheumatoid arthritis, psoratic arthritis, muscle diseases, e.g. muscular dystrophy, multiple sclerosis, chronic kidney diseases, bone diseases, e.g. bone degeneration in multiple myeloma, systemic lupus erythematosus, lupus nephritis, and vascular injury. | 05-17-2012 |
20120121584 | Monoclonal Antibodies Against Extracellular Loops of C5aR - The present invention relates to antibodies which bind to C5aR and which are useful in diagnostic and therapeutic methods. The antibodies of the present invention are reactive with an extracellular loop of C5aR other than the N-terminal domain and are capable of substantially reducing or inhibiting the binding of C5a to C5aR and functional consequences of neutrophil chemoattractant receptor activation. | 05-17-2012 |
20120121585 | SILENT Fc VARIANTS OF ANTI-CD40 ANTIBODIES - The present invention relates to silent Fc variants of anti-CD40 antibodies and compositions and methods of use of said antibodies for treating pathological disorders such as autoimmune and inflammatory disorders and/or for preventing or reducing the risk of graft rejection in transplantation. | 05-17-2012 |
20120121586 | MODULATORS FOR HER2 SIGNALING IN HER2 EXPRESSING PATIENTS WITH GASTRIC CANCER - The present invention relates to means and methods for the identification of responders for or a patient sensitive to a modulator of the HER2/neu (ErbB2) signaling pathway. Also described herein are corresponding methods of treatment of a group of patients determined and defined in accordance with the identification method of the present invention, whereby said group of patients is known or suspected to suffer from or being prone to suffer from gastric cancer in particular invasive gastric cancer. | 05-17-2012 |
20120121587 | ANTI-AXL ANTIBODY - An objective of the present invention is to decrease the immunogenicity of mouse-derived anti-AXL antibodies in humans by humanizing them. The present invention provides antibodies that can bind to a specific region in Anexelekto (AXL) and humanized antibodies that are produced based on such antibodies. The anti-AXL antibodies of the present invention have high antitumor activity, and are useful as agents for decreasing the AXL expression level, antitumor agents, and diagnostic agents for cancer. | 05-17-2012 |
20120121588 | MODULATION OF PILR RECEPTORS TO TREAT SEPSIS - The present invention provides methods of using agonists and antagonists of PILRα and PILRβ, respectively, to treat immune mediated sepsis. Also provided are methods of prophylactically treating with agonists and antagonists of PILRα and PILRβ respectively, to prevent the development of sepsis. | 05-17-2012 |
20120121589 | MODIFIED EGFR ECTODOMAIN - A protein that attenuates EGFR and/or EGFR family members comprises a modified EGFR ectodomain. The protein inhibits signaling via the EGFR and/or EGFR family members. The protein includes a portion of the EGFR (or EGFR family member) and the “U” region epitope of EGFR related protein (ERRP), wherein the portion of the EGFR is operable to bind a ligand of EGFR. Also included are nucleic acids encoding such proteins. Attenuating EGFR signaling can include inhibiting the EGFR and/or EGFR family members and to provide antiproliferative activity. The present proteins and expression of nucleic acids encoding these proteins can regulate cellular growth and can be used to treat tumors and cancerous cells that express one or more of the EGFR and EGFR family members. | 05-17-2012 |
20120128661 | POLYNUCLEOTIDE AND POLYPEPTIDE SEQUENCES INVOLVED IN CANCER - The present invention relates to polynucleotide and polypeptide sequences which are differentially expressed in cancer cells compared to normal cells. The present invention more particularly relates to the use of these sequences in the diagnosis, prognosis or treatment of cancer and in the detection of cancer cells. | 05-24-2012 |
20120128662 | SUBSTITUTED IMIDAZOQUINOXALINES - The present invention relates to substituted imidazoquinoxaline compounds of general formula (I) as inhibitors of Mps-1 Kinase or TTK, and being active against inflammation and cancer. | 05-24-2012 |
20120128663 | Fc VARIANTS THAT EXTEND ANTIBODY HALF-LIFE - The invention relates generally to compositions and methods for altering the serum half-life in vivo of an antibody. | 05-24-2012 |
20120128664 | GLYCOSYLATED ANTIBODIES - The invention provides an antibody comprising human IgG1 or IgG3 heavy chain constant domains that are glycosylated with a sugar chain at Asn297, said antibody being characterized in that the amount of fucose within said sugar chain is at least 99%, and in addition the amount of NGNA is 1% or less and/or the amount of N-terminal alpha 1,3 galactose is 1% or less, and uses thereof. | 05-24-2012 |
20120128665 | PRESELECTION OF SUBJECTS FOR THERAPEUTIC TREATMENT BASED ON HYPOXIC STATUS - The present invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of hypoxia in cancerous cells in the subject. In one embodiment, the invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of lactate dehydrogenase (LDH) in a cell, e.g., a cancerous cell. The invention also provides methods for treating cancer in a subject by administering an effective amount of an agent to the subject, wherein the subject has been selected based on a modulated level of hypoxia. The invention further provides kits to practice the methods of the invention. | 05-24-2012 |
20120128666 | METHODS OF INCREASING NEURONAL DIFFERENTIATION USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID - Methods are provided for increasing neuronal differentiation of neuronal stem cells using antibodies that bind lysophosphatidic acid (LPA). Particularly preferred antibodies to LPA are monoclonal antibodies, including humanized monoclonal antibodies to LPA. Such antibodies, and derivatives and variants thereof, can be used in increasing neuronal differentiation, and in treatment and/or prevention of injuries, diseases, or conditions associated with insufficient neuronal differentiation and/or with elevated LPA levels in neural tissues. | 05-24-2012 |
20120128667 | PENTAMIDINE COMBINATIONS FOR TREATING CANCER - The present invention relates to the treatment of cancer, e.g., ovarian cancer, breast cancer, pancreatic cancer or colon cancer, with pentamidine and (a) oxaliplatin, (b) gemcitabine, (c) taxol, (d) 5-fluorouracil or (e) CPT 11. | 05-24-2012 |
20120128668 | METHOD OF PROMOTING BONE GROWTH BY AN ANTI-ACTIVIN ANTIBODY - In certain aspects, the present invention provides compositions and methods for promoting bone growth and increasing bone density. | 05-24-2012 |
20120128669 | MONOVALENT, BIVALENT AND TRIVALENT ANTI HUMAN RESPIRATORY SYNCYTIAL VIRUS (HRSV) NANOBODY CONSTRUCTS FOR THE PREVENTION AND/OR TREATMENT OF RESPIRATORY TRACT INFECTIONS - Amino acid sequences are provided that are directed against and/or that can specifically bind protein F of hRSV, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. The amino acid sequences, polypeptides and therapeutic compounds and compositions provided by the invention show an improved stability, less immunogenicity and/or improved affinity and/or avidity for protein F of hRSV. The invention also relates to the uses of such amino acid sequences, polypeptides, compounds or constructs for prophylactic and/or therapeutic purposes. | 05-24-2012 |
20120128670 | mTOR INHIBITOR AND ANGIOGENESIS INHIBITOR COMBINATION THERAPY - Cancer therapy comprising treatment with an mTOR inhibitor, such as a dual mTORC1/mTORC2 inhibitor, such as OSI-027, in combination with an angiogenesis inhibitor. | 05-24-2012 |
20120134986 | Methods of Prognosis for Non-Hodgkin Lymphoma - Measurement of a single gene expressed by tumor cells (LMO2) and a single gene expressed by the immune microenvironment (TNFRSF9), which determination may be referred to herein as a two gene score (TGS), powerfully predicts overall survival in patients with NHL, particularly overall survival in the context of anthracycline-based chemotherapy or co-treatment with anthracycline-based chemotherapy and anti-CD20 immunotherapy. It is shown herein that increased levels of LMO2 and TNFRSF9 correlate with a positive patient response and improved prognosis. | 05-31-2012 |
20120134987 | KINASE INHIBITORS AND METHODS OF THEIR USE - New compounds, compositions and methods of inhibition of Provirus Integration of Maloney Kinase (PIM kinase) activity associated with tumorigenesis in a human or animal subject are provided. In certain embodiments, the compounds and compositions are effective to inhibit the activity of at least one PIM kinase. The new compounds and compositions may be used either alone or in combination with at least one additional agent for the treatment of a serine/threonine kinase- or receptor tyrosine kinase-mediated disorder, such as cancer. | 05-31-2012 |
20120134988 | POLYPEPTIDES WITH ENHANCED ANTI-INFLAMMATORY AND DECREASED CYTOTOXIC PROPERTIES AND RELATING METHODS - The invention provides methods of altering properties of Fc-containing molecule, comprising altering the sialylation of the oligosaccharides in the Fc region. Proteins having Fc regions having altered sialylation patterns are also provided. | 05-31-2012 |
20120134989 | ANTIBODY FORMULATIONS - Formulations of VLA-4 binding antibody are described. | 05-31-2012 |
20120134990 | COMBINATION THERAPY WITH TYPE I AND TYPE II ANTI-CD20 ANTIBODIES - The present invention is directed to a combination therapy involving a type I anti-CD20 antibody and a type II anti-CD20 antibody for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Another aspect of the invention is a kit comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type I anti-CD20 antibody and a type II anti-CD20 antibody. | 05-31-2012 |
20120141464 | BINDING MEMBER FOR GM-CSF RECEPTOR - Binding members are provided for alpha chain of receptor for granulocyte macrophage colony stimulating factor (GM-CSFRα), especially antibody molecules. Use of the binding members in treating inflammatory and autoimmune diseases, e.g. rheumatoid leukaemia and atherosclerosis is also provided. | 06-07-2012 |
20120141465 | VIRUS VACCINATION AND TREATMENT METHODS WITH OX40 AGONIST COMPOSITIONS - The invention relates to compositions and methods that employ OX40 (CD134), a TNFR superfamily protein, agonists. The invention includes among other things administering an OX40 agonist alone or in combination with a viral antigen, or live or attenuated virus, to treat a viral infection, or for vaccination or immunization. | 06-07-2012 |
20120141466 | COMPOSITION AND METHOD FOR TREATMENT OF REPERFUSION INJURY AND TISSUE DAMAGE - The present invention provides compounds and methods for the treatment and prophylaxis of ischemia reperfusion injury. In particular the invention provides compounds which function to suppress Toll-like Receptor 2 biological function or expression. | 06-07-2012 |
20120141467 | Ascorbic acid to treat chronic obstructive lung diseases and non-Hodgkin's lymphoma - Provided herein is a method for treating a tracheo-bronchial-alveolar tract disease in a subject in need thereof, the method comprising the step of administering to a subject in need of such treatment a pharmaceutical composition comprising a therapeutically effective amount of ascorbate or a derivative thereof. Also provided is a method for treating non-Hodgkin's lymphoma in a subject in need thereof, the method comprising the step of administering to the subject in need of such treatment a pharmaceutical composition comprising a therapeutically effective amount of ascorbate or a derivative thereof. | 06-07-2012 |
20120141468 | MAINTENANCE OF PLATELET INHIBITION DURING ANTIPLATELET THERAPY - A method for reducing or maintaining platelet inhibition in a patient by administering cangrelor prior to an invasive procedure is described. The method of this invention can be used for patients in need of antiplatelet therapy or at risk of thrombosis. The method can further be used in patients who were previously treated with long-acting platelet inhibitors without increasing the risk of excessive bleeding. | 06-07-2012 |
20120141469 | CRIPTO ANTAGONISM OF ACTIVIN AND TGF-B SIGNALING - Cripto, a developmental oncoprotein, antagonizes activin and TGF-b signaling by forming a complex with activin and TGF-b and their type II receptors. This complex precludes the formation of a functional activin/TGF-b•type II•type I complex, thereby blocking the signaling of activin and TGF-b. Cripto may be generally capable of blocking antiproliferative Smad2/3 signals and provides a novel mechanism of oncogenic action with multiple therapeutic implications. Inhibiting the formation of Cripto and activin/TGF-b complex may enhance antiproliferative effects of activin and TGF-b. | 06-07-2012 |
20120141470 | T CELL INHIBITORY RECEPTOR COMPOSITIONS AND USES THEREOF - The invention relates to compositions which bind T cell inhibitory receptor molecules and modulate T cell activity, and methods of using such compositions. Such compositions include biliary glycoprotein binding agents. Methods for modulating killer T cell activities, including cytotoxicity and proliferation also are provided. | 06-07-2012 |
20120141471 | Methods of Inhibiting Metastasis from Cancer - The present invention includes compositions that are useful in preventing or treating metastasis in a subject diagnosed with cancer. The present invention also includes methods of preventing or treating metastasis in a subject diagnosed with cancer, wherein the method comprises administering to the subject in need thereof an effective amount of a pharmaceutical formulation comprising at least one pharmaceutically acceptable carrier and at least one CX | 06-07-2012 |
20120141472 | METHODS OF SCORING GENE COPY NUMBER IN A BIOLOGICAL SAMPLE USING IN SITU HYBRIDIZATION - Disclosed herein are methods of predicting prognosis of a neoplastic disease (such as lung cancer, for example NSCLC), including determining the IGF1R gene copy number in a biological sample from a patient having a neoplastic disease; wherein an increase in IGF1R copy number predicts a good prognosis of the neoplastic disease in the patient. Also disclosed herein are methods of scoring copy number of a gene of interest in a biological sample. The method includes identifying individual cells in the sample having highest number of signals for the gene of interest detected by in situ hybridization, counting the number of signals for the gene of interest in the identified individual cells and determining an average number of signals per cell. | 06-07-2012 |
20120141473 | COMPOSITIONS AND METHODS FOR TREATING OSTEOLYTIC DISORDERS COMPRISING MMP-14 BINDING PROTEINS - Provided are methods and compositions for using MMP-14 or MMP-9 binding proteins alone or in combination with other therapeutic agents to treat osteolytic disorders such as osteotropic cancer and osteoporosis. | 06-07-2012 |
20120141474 | TNF-alpha Antagonists and Methotrexate in the Treatment of TNF-Mediated Disease - Methods for treating and/or preventing a TNF-mediated disease in an individual are disclosed. Also disclosed is a composition comprising methotrexate and an anti-tumor necrosis factor antibody. TNF-mediated diseases include rheumatoid arthritis, Crohn's disease, and acute and chronic immune diseases associated with transplantation. | 06-07-2012 |
20120141475 | TNF-alpha Antagonists and Methotrexate in the Treatment of TNF-Mediated Disease - Methods for treating and/or preventing a TNF-mediated disease in an individual are disclosed. Also disclosed is a composition comprising methotrexate and an anti-tumor necrosis factor antibody. TNF-mediated diseases include rheumatoid arthritis, Crohn's disease, and acute and chronic immune diseases associated with transplantation. | 06-07-2012 |
20120141476 | FcGammaRIIB Specific Antibodies and Methods of Use Thereof - The present invention relates to antibodies or fragments thereof that bind FcγRIIB with greater affinity than said antibodies or fragments binds FcγRIIA. The invention encompasses the use of such antibodies or fragments for the treatment of diseases related to loss of balance of Fc receptor mediated signaling, such as cancer, autoimmune diseases, inflammatory diseases or IgE-mediated allergic disorders. The present invention also encompasses the use of such antibodies and fragments in combination with other cancer therapies, methods of enhancing the therapeutic effect of therapeutic antibodies, and methods of enhancing efficacy of vaccine compositions. | 06-07-2012 |
20120141477 | Antibodies That Specifically Bind to ABeta Oligomers and Uses Thereof - The present inventors successfully produced monoclonal antibodies that are specific to only soluble Aβ oligomers, but do not recognize soluble Aβ monomers, which are physiological molecules. It was demonstrated that the antibodies are useful as diagnostic/therapeutic monoclonal antibodies for Alzheimer's disease. | 06-07-2012 |
20120148572 | NOVEL ANTIBODIES - The present invention relates to the use of VEGF antagonists and a novel anti-α5β1 antibody for treating cancer and inhibiting angiogenesis and/or vascular permeability, including inhibiting abnormal angiogenesis in diseases. The present invention also relates to compositions and kits comprising novel anti-α5β1 antibodies and methods of making and using them. | 06-14-2012 |
20120148573 | COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF IMMUNE DISORDERS - The present invention relates to methods and compositions for the treatment and diagnosis of immune disorders, especially T helper lymphocyte-related disorders. In particular, the invention describes a gene known in the art, alternatively, as ST2, T1 and Fit-1, and referred to herein as the 103 gene. The 103 gene is disclosed herein to be differentially expressed in TH2 cells and not in TH1 cells. Further, the 103 gene product is demonstrated herein to be an important modulator of TH2 and TH2-like immune response both in vitro and in vivo. Thus, the 103 gene, its gene products and antibodies that specifically bind thereto can be used diagnostically or as targets for therapeutic intervention in the treatment of a variety of immune disorders. | 06-14-2012 |
20120148574 | Diagnostic Markers for Ankylosing Spondylitis - The present invention discloses methods and agents for diagnosing the presence or risk of development of ankylosing spondylitis (AS) in mammals, which are based on the detection of polymorphisms within any one or more of the ARTS-1 gene, the IL-23R gene, the TNFR1 gene locus, the TRADD gene locus, the IL-1R1 gene locus, the IL-1R2 gene locus, the CD74 gene locus and the chromosome loci 2P15, 2Q31.3 and 4Q13.1. The present invention also features methods for the treatment or prevention of AS based on the diagnostic methods. | 06-14-2012 |
20120148575 | Methods Of Reducing Eosinophil Levels - The present invention relates to a method of reducing the numbers of eosinophils in a human subject comprising administration to a subject an IL-5R binding molecule that comprises (a) a region that specifically binds to the IL-5R and (b) an immunoglobulin Fc region. In a specific embodiment, a method of the invention reduces the number of eosinophils in blood, bone marrow, gastrointestinal tract (e.g. esophagus, stomach, small intestine and colon), or lung. | 06-14-2012 |
20120148576 | HUMANIZED ANTI-CD 19 ANTIBODY FORMULATIONS - The present invention provides stable liquid formulations comprising chimeric and humanized versions of anti-CD 19 mouse monoclonal antibodies that may mediate ADCC, CDC, and/or apoptosis for the treatment of B cell diseases and disorders. | 06-14-2012 |
20120148577 | USE OF HIGH-DOSE, POST-TRANSPLANTATION OXAZAPHOSPHORINE DRUGS FOR REDUCTION OF TRANSPLANT REJECTION - A lymphocytotoxic, but hematopoietic stem cell-sparing, high-dose amount of an oxazaphosphorine drug such as, for example, cyclophosphamide, administered post-transplantation can be used to reduce transplant rejection, including graft-versus-host-disease (GVHD). In some embodiments, the transplants are bone marrow transplants or hematopoietic stem cell transplants carried out for the treatment of hematologic disorders, including hematologic malignancies and non-malignant hematologic disorders. In some embodiments, the transplants are carried out for the treatment of hereditary hemoglobinopathies, such as sickle cell anemia and thalassemia. | 06-14-2012 |
20120148578 | METHODS AND COMPOSITIONS FOR INHIBITING CD32B EXPRESSING CELLS - The present invention relates to immunoglobulins that bind FcγRIIb+ cells and coengage the antigen on the cell's surface and an FcγRIIb on the cell's surface, methods for their generation, and methods for using the immunoglobulins. | 06-14-2012 |
20120148579 | ANTIBODIES TO OX-2/CD200 AND USES THEREOF - This application provides methods and compositions for modulating and/or depleting CD200 positive cells. | 06-14-2012 |
20120148580 | METHODS FOR IDENTIFICATION OF SITES FOR IGG CONJUGATION - The present disclosure relates to immunoglobulins and immunoglobulin conjugates with reduced oligomerization and efficient labeling and compositions, methods of generating such immunoglobulins and immunoglobulin conjugates and methods of using such immunoglobulin conjugates particularly in the treatment and prevention of disease. | 06-14-2012 |
20120148581 | USE OF NKG2D INHIBITORS FOR TREATING CARDIOVASCULAR AND METABOLIC DISEASES, SUCH AS TYPE 2 DIABETES - The present invention provides methods, compositions and kits for treating and detecting type 2 diabetes and/or conditions that may be regulated or normalised via inhibition of NKG2D, such as cardiovascular diseases. | 06-14-2012 |
20120148582 | ENGINEERED ANTI-IL-23R ANTIBODIES - Antibodies to human IL-23R are provided, as well as uses thereof, e.g. in treatment of inflammatory, autoimmune, and proliferative disorders. | 06-14-2012 |
20120148583 | CYTOKINE ANTAGONISTS FOR NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDERS - A method for delivering a biologic pharmaceutical, comprising: administering an effective amount of a biologic pharmaceutical to a patient in need thereof by perispinal injection, without direct intrathecal or direct epidural injection. | 06-14-2012 |
20120148584 | VEGF-SPECIFIC ANTAGONISTS FOR ADJUVANT AND NEOADJUVANT THERAPY AND THE THREATMENT OF EARLY STAGE TUMORS - Disclosed herein are methods of treating benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating a subject at risk of developing benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating or preventing recurrence of a tumor using an anti-VEGF-specific antagonist as well as use of VEGF-specific antagonists in neoadjuvant and adjuvant cancer therapy. | 06-14-2012 |
20120156195 | Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus - This invention relates to a human antibody which contains the one CDR from each variable heavy and variable light chain of at least one murine monoclonal antibody, against respiratory syncytial virus which is MAb1129 and the use thereof for the prevention and/or treatment of RSV infection. | 06-21-2012 |
20120156196 | ANTI-ANTHRAX ANTIBODY, FORMULATIONS THEREOF, AND METHODS OF USE - The present invention provides an antibody which binds to | 06-21-2012 |
20120156197 | COMBINATION THERAPY WITH MDM2 AND EFGR INHIBITORS - Provided is a method of treating a proliferative disease, condition, or disorder in a subject by administering a combination of an inhibitor of p53 and MDM2 binding and an EGFR inhibitor. Various embodiments of the disclosed methods provide a synergistic anti-proliferative or anti-apoptotic effect compared to administration of one agent alone. | 06-21-2012 |
20120156198 | Antibodies against IL-18R1 and uses thereof - The invention provides anti-IL-18R1 antibodies and methods of using the same. | 06-21-2012 |
20120156199 | USE OF PICOPLATIN TO TREAT COLORECTAL CANCER - The invention provides a method of treatment of colorectal cancer by administration of the anti-cancer platinum drug picoplatin in conjunction with 5-FU and leucovorin in a variety of treatment regimens. | 06-21-2012 |
20120156200 | METHOD OF TREATING CANCER - Methods are provided of treating a human for cancer comprising administering at least one dose of lapatinib, or a pharmaceutically acceptable salt or composition thereof, to a patient, wherein said patient does not have one or more allelic polymorphisms selected from the group of: HLA-DQA1*0201, HLA-DQB1*0202, and HLA-DRB1*0701. Patients may also be free of genotypes in TNXB; rs12153855 and/or rs17207923. | 06-21-2012 |
20120156201 | HUMANIZED ANTIBODIES SPECIFIC FOR HSP65-DERIVED PEPTIDE-6 METHODS AND USES THEREOF - The present invention relates to humanized antibodies that specifically bind a polypeptide comprising peptide-6 as denoted by SEQ ID NO. 15, that is an HSP65 derived peptide. More specifically, the invention relates to humanized anti-peptide-6 antibodies, compositions, methods and uses thereof for the treatment of immune-related disorders, specifically, inflammatory disorders such as arthritis, IBD, psoriasis, diabetes and MS. The invention further provides combined compositions and kit combining the humanized antibodies of the invention and at least one anti-inflammatory agent, as well as uses of the humanized antibodies in diagnostic kits and methods. | 06-21-2012 |
20120164137 | ANTI-FOLATE RECEPTOR ALPHA ANTIBODY GLYCOFORMS - The invention provides anti-FRA antibodies with novel N-linked neutral glycan profiles in that the relative amounts of one or more neutral glycans are increased or decreased compared to anti-FRA antibodies produced under reference cell culture conditions. The invention further provides anti-FRA antibodies with altered binding to FRA, altered antibody-dependent cellular cytotoxicity (ADCC) and/or altered rate and/or efficiency of internalization in a cell expressing FRA. In related aspects, the invention provides cell cultures comprising an anti-FRA antibody of the invention, a cell isolated from such a culture, kits and compositions comprising an anti-FRA antibody of the invention, methods of producing an anti-FRA antibody of the invention and diagnostic and therapeutic uses of an anti-FRA antibody of the invention. | 06-28-2012 |
20120164138 | USE OF ANTI-CD1 ANTIBODIES FOR THE MODULATION OF IMMUNE RESPONSES - The invention provides methods for the administration of an anti-CD1 antibody for the treatment or prevention of a variety of disorders, such as autoimmune disease, viral infection, bacterial infection, parasitic infection, infection by a eukaryotic pathogen, allergy, asthma, inflammatory condition, graft versus host disease, graft rejection, immunodeficiency disease, spontaneous abortion, pregnancy, and cancer. | 06-28-2012 |
20120164139 | Dopamine 3 receptor agonist and antagonist treatment of gastrointestinal motility disorders - Provided herein are methods of treating gastrointestinal motility disorders by targeting the dopamine 3 receptor (D3R). A D3R agonist is administered to a subject to decrease gastrointestinal motility to treat the disorder. A D3R antagonist is administered to a subject to decrease gastrointestinal motility to treat the disorder. | 06-28-2012 |
20120171195 | ANTI-HLA-E ANTIBODIES, THERAPEUTIC IMMUNOMODULATORY ANTIBODIES TO HUMAN HLA-E HEAVY CHAIN, USEFUL AS IVIG MIMETICS AND METHODS OF THEIR USE - Provided herein are compositions comprising antibodies immunoreactive to human leukocyte antigen E (HLA-E) and HLA Ia alleles, methods of their use, for example, as therapeutic IVIg mimetics, methods of their preparation and methods of their immunomodulatory benefits and applications. In particular embodiments provided herein are compositions and methods for treating an inflammatory condition or graft rejection. | 07-05-2012 |
20120171196 | MONOCLONAL ANTIBODIES THAT NEUTRALIZE ANTHRAX TOXINS - The present invention relates to monoclonal antibodies that bind or neutralize anthrax lethal factor (LF), edema factor (EF), and/or protective antigen (PA). The invention provides such antibodies, fragments of such antibodies retaining anthrax toxin-binding ability, fully human or humanized antibodies retaining anthrax toxin-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 07-05-2012 |
20120171197 | Binding members for interleukin-4 receptor alpha (IL-4Ra) - 173 - Binding members, especially antibody molecules, for interleukin (IL)-4 receptor alpha (IL-4Rα), and their therapeutic use e.g. in treating or preventing disorders associated with IL-4Rα, IL-4 and/or IL-13, examples of which are asthma and COPD. | 07-05-2012 |
20120171198 | USE OF IGG1 IMMUNOGLOBULINS AND/OR LIGANDS OF THE CD32 RECEPTOR FOR TREATING INFLAMMATORY DISEASES AND MANIFESTATIONS VIA THE MUCOSAL ROUTE - The present invention concerns the use of immunoglobulins of IgG | 07-05-2012 |
20120171199 | TRICYCLIC PI3K INHIBITOR COMPOUNDS AND METHODS OF USE - Tricyclic PI3k inhibitor compounds of Formula I with anti-cancer activity, anti-inflammatory activity, or immunoregulatory properties, and more specifically with PI3 kinase modulating or inhibitory activity are described. Methods are described for using the tricyclic PI3K inhibitor compounds of Formula I for in vitro, in situ, and in vivo diagnosis or treatment of mammalian cells, organisms, or associated pathological conditions. | 07-05-2012 |
20120171200 | Antibodies With Immune Effector Activity And That Internalize In Folate Receptor Alpha-Positive Cells - This invention relates to the use of monoclonal and polyclonal antibodies that specifically bind to and have the ability in the alternative to become internalized by cells expressing folate receptor alpha (FRA) and to induce an immune effector activity such as antibody-dependent cellular cytotoxicity. The antibodies are useful in specific delivery of pharmacologic agents to FRA-expressing cells as well as in eliciting an immune-effector activity particularly on tumor cells and precursors. The invention is also related to nucleotides encoding the antibodies of the invention, cells expressing the antibodies; methods of detecting cancer cells; and methods of treating cancer using the antibodies. | 07-05-2012 |
20120171201 | METHODS OF TREATING HER2 POSITIVE CANCER WITH HER2 RECEPTOR ANTAGONIST IN COMBINATION WITH MULTI-ARM POLYMERIC CONJUGATES OF 7-ETHYL-10-HYDROXYCAMPTOTHECIN - The present invention relates to methods of treating a HER2 positive cancer in mammals. The present invention includes administering a HER2 antagonist in combination with a polymeric prodrug of 7-ethyl-10-hydroxycamptothecin to the mammals in need thereof. | 07-05-2012 |
20120177637 | Method for selecting a single cell expressing a heterogeneous combination of antibodies - The present invention provides combinations of specific binding proteins, such as immunoglobulins, that are designed to be true combinations, essentially all components of the combination being functional and compatible with each other. The invention further provides a method for producing a composition comprising at least two different proteinaceous molecules comprising paired variable regions, the at least two proteinaceous molecules having different binding specificities, comprising paired variable regions, at least two proteinaceous molecules having different binding specificities, comprising contacting at least three different variable regions under conditions allowing for pairing of variable regions and harvesting essentially all proteinaceous molecules having binding specificities resulting from the pairing. | 07-12-2012 |
20120177638 | ANTIBODIES TO VLA-1 - Antibodies that specifically bind to VLA-1 integrin and methods of using these antibodies to treat immunological disorders in a subject. Also included are crystal structures of complexes formed by VLA-1 antibodies and their ligands, and VLA-1 antagonists and agonists identified by using the structure coordinates of these structures. | 07-12-2012 |
20120177639 | HUMANIZED ANTIBODIES SPECIFIC TO THE PROTOFIBRILLAR FORM OF THE BETA-AMYLOID PEPTIDE - The present application relates to humanized antibodies specific to the protofibrillar form of the beta-amyloid peptide, and to the use of said antibodies in the field of Alzheimer's disease. | 07-12-2012 |
20120177640 | OPTIMIZING THE PRODUCTION OF ANTIBODIES - A general method is provided for the production of purified antibodies by separation of an antibody molecule from an antibody variant by chromatographic methods, e.g. to enhance therapeutic efficacy, by for example choosing a specific harvesting time point and/or a specific purification scheme. The current invention thus reports a method for producing an antibody composition comprising an antibody molecule and a variant thereof, comprising the following steps: providing a sample comprising the antibody molecule and a variant thereof, determining the presence of the antibody molecule and/or a variant thereof and/or the ratio of the amount of the antibody molecule or variant thereof to the sum of the amounts of the antibody molecule and the variant thereof, in an aliquot of said sample, determining a subsequent harvesting time point and/or antibody purification scheme on basis of the data obtained before, thereby producing an antibody composition comprising the antibody molecule and a variant thereof. | 07-12-2012 |
20120177641 | Gefitnib Sensitivity-Related Gene Expression and Products and Methods Related Thereto - Disclosed is the identification, provision and use of a panel of biomarkers that predict sensitivity or resistance to EGFR inhibitors, and products and processes related thereto. In one embodiment, a method is described for selecting a cancer patient who is predicted to benefit from therapeutic administration of an EGFR inhibitor, an agonist thereof, or a drug having substantially similar biological activity as EGFR inhibitor. Also described is a method to identify molecules that interact with the EGFR pathway to allow or enhance responsiveness to EGFR inhibitors, as well as a plurality of polynucleotides or antibodies for detection of the expression of genes that are indicative of sensitivity or resistance to EGFR inhibitors, an agonist thereof, or a drug having substantially similar biological activity as EGFR inhibitors. A method to identify a compound with the potential to enhance the efficacy of EGFR inhibitors is also described. | 07-12-2012 |
20120177642 | METHODS OF TREATING INFLAMMATORY AND AUTOIMMUNE DISEASES WITH NATALIZUMAB - Natalizumab is a safe and efficacious treatment for inflammatory and autoimmune diseases, such as multiple sclerosis, Crohn's Disease, and rheumatoid arthritis. Chain swapping between natalizumab and IgG4 molecules acts to reduce the level of bivalent natalizumab present following administration of natalizumab, and thus to lower the activity of natalizumab in the patient. Differences in IgG4 levels across patients or within a single patient across time may change the pharmacokinetic profile of natalizumab. Patients with lower levels of IgG4 may experience higher nadir levels of natalizumab during a dosing period. Monitoring IgG4 and/or bivalent natalizumab levels, and determining a dose or dosage period based on the monitoring may improve the safety and/or efficacy of natalizumab therapy. | 07-12-2012 |
20120177643 | HUMAN CDR-GRAFTED ANTIBODY AND ANTIBODY FRAGMENT THEREOF - A human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of human CC chemokine receptor 4 (CCR4) but does not react with a human blood platelet; a human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of CCR4 and has a cytotoxic activity against a CCR4-expressing cell; and a medicament, a therapeutic agent or a diagnostic agent comprising at least one of the antibodies and the antibody fragments thereof as an active ingredient. | 07-12-2012 |
20120183533 | MIMOTOPES OF HIV ENV - The invention provides methods, compositions and kits for treating and or preventing an HIV infection. For example, HIV envelope-like polypeptides (wild-type HIV polypeptides and mimotopes) may be administered to an individual so as to induce a protective immune response to HIV. Alternatively, antibodies directed to the HIV envelope-like polypeptides may be administered to an individual to treat or prevent an HIV infection and/or one or more symptoms associated with the infection (e.g., AIDS). | 07-19-2012 |
20120183534 | METHODS, COMPOSITIONS AND APPARATUSES FOR FACILITATING REGENERATION - Apparatuses, compositions and methods for removing cells which interfere with regenerative processes. The apparatuses, compositions and methods selectively kill partially functional and/or non-functional cells versus functional cells while protecting functional proliferative cells to the extent that, upon removal of the killed cells by disintegration or scavenging, functional cells replace the partially- or non-functional cells. | 07-19-2012 |
20120183535 | USE OF INHIBITORS OF BRUTON'S TYROSINE KINASE (BTK) - Disclosed herein are methods for treating a cancer comprising: a. administering a Btk inhibitor to a subject sufficient to result in an increase or appearance in the blood of a subpopulation of lymphocytes defined by immunophenotyping; b. determining the expression profile of one or more biomarkers from one or more subpopulation of lymphocytes; and c. administering a second agent based on the determined expression profile. | 07-19-2012 |
20120183536 | METHODS OF USING CORTICOTROPIN-RELEASING FACTOR FOR THE TREATMENT OF CANCER - Provided herein is are methods of treating cancer in a human by administering CRF, optionally in combination with a second agent, such as an angiogenesis inhibitor. | 07-19-2012 |
20120183537 | 1,2,4-THIAZOLOIDIN-3-ONE DERIVATIVES AND THEIR USE IN THE TREATMENT OF CANCER - According to the invention there is provided a compound of formula (I) wherein: A represents C(═N—W-D) or S; B represents S or C(—NH—W-D); when: A represents C(═N—W-D) and B represents S then the bond between B and the NH atom is a single bond; or A represents S and B represents C(—NH—W-D) then the bond between B and the NH atom is a double bond; X represents -Q-[CR | 07-19-2012 |
20120183538 | SPARC ANTISENSE COMPOSITIONS AND USES THEREOF - The invention provides SPARC antisense oligonucleotides and methods of their use in proliferative diseases such as cancer and hepatic fibrosis. | 07-19-2012 |
20120183539 | Cancer Metastasis Inhibitor - The present inventors used a model of intrasplenically induced liver metastasis to determine whether or not NF-κB activation in the liver is involved in the onset of metastatic tumors. When IKKβ was deleted from both liver cells and hematopoietically-derived cells, the onset of tumors was reduced remarkably. Tumor cells activated neighboring bone marrow cells (Kupffer cells) and produced mitogens such as interleukin (IL)-6, and this promoted angiogenesis and growth of tumors. The mitogen production depended on NF-κB in hematopoietically-derived Kupffer cells. Furthermore, treatment with an anti-IL-6 receptor antibody decreased the degree of metastatic tumor development. That is, the present inventors showed that tumor metastasis depends on inflammation, and proinflammatory intervention that targets Kupffer cells is useful for chemical prevention of metastatic tumors. Furthermore, it was shown that inhibition of the IKKβ/NF-κB signal transduction pathway, in particular IL-6 inhibition, can be utilized for anti-metastasis agents. | 07-19-2012 |
20120183540 | METHODS OF PROMOTING FAT LOSS COMPRISING ADMINISTERING AN ALK7 INHIBITOR - The invention relates to ALK7 soluble receptors and their uses as antagonists of the function of certain ligands such as GDF-8 (Myostatin) and GDF-11. The ALK7 soluble receptor of the invention is useful as antagonists of GDF-8 and GDF-11 in the treatment of neuronal diseases or conditions such as stroke, spinal cord injury, and all peripheral nerve diseases. The ALK7 soluble receptor of the invention is also useful as GH (growth hormone) equivalent, and for increasing muscle mass. | 07-19-2012 |
20120183541 | HAIR GROWTH METHODS USING FGFR4 EXTRACELLULAR DOMAINS - The present invention relates to a method of promoting hair growth comprising administering a fibroblast growth factor receptor 4 (FGFR4) extracellular domain (ECD), including native FGFR4 ECDs, variants, fragments, and fusion molecules, to a subject in an amount sufficient to promote hair growth. | 07-19-2012 |
20120189617 | ANTI-TIM-3 ANTIBODY - The present invention provides an anti-human TIM-3 antibody which binds to the amino acid sequence of the extracellular region of TIM-3 or its three-dimensional structure thereof and exhibits higher effector activity such as an antibody-dependent cellular cytotoxicity (ADCC activity) for diseases relating to a human TIM-3 expressing cell. The present invention provides a monoclonal antibody or antibody fragment thereof which binds to the amino acid sequence of the extracellular region of TIM-3 or its three-dimensional structure and exhibits ADCC activity; a hybridoma which produces the antibody; a DNA encoding the antibody; a vector comprising the DNA; a transformant which is obtainable by introducing the vector; a method for producing the antibody or the antibody fragment thereof which comprises using the hybridoma or the transformant; a therapeutic agent and a diagnostic agent comprising the antibody or the antibody fragment thereof as an active ingredient. In addition, the present invention provides an anti-human TIM-3 antibody having high ADCC activity by screening an anti-human TIM-3 antibody which competes with the monoclonal antibody or the antibody fragment thereof. | 07-26-2012 |
20120189618 | SUPERIOR EFFICACY OF CD37 ANTIBODIES IN CLL BLOOD SAMPLES - The present invention describes CD37 antibodies, especially A2 and B2, for the treatment of patients with CLL, especially of patients belonging to a “high risk” or “ultra-high risk” group of patients. Those patients are either patients who are refractory to fludarabine treatment or patients who carry a genetic marker which is indicative for poor prognosis or increased risk of treatment failure, e.g. patients with TP53 dysfunction or deletion of chromosome 17p13, or patients after failure to previous anti-CD20 treatment. The ability of A2 and B2 to deplete CLL cells is high both in patient samples derived from patients with normal risk and with increased risk (“high risk” patients) and clearly superior to that of rituximab and alemtuzumab. | 07-26-2012 |
20120189619 | METHODS FOR TREATING A SPINAL DISORDER OR OSTEOARTHRITIS USING DOMINANT NEGATIVE TISSUE NECROSIS FACTOR - Effective methods of treating a spinal disorder or osteoarthritis associated with a proinflammatory agent in a patient in need of such treatment, the method comprising administering an effective amount of DN-TNF (e.g., XPro®-1595) to a target tissue site at or near the spine or osteoarthritic joint to reduce pain and/or inflammation. | 07-26-2012 |
20120189620 | METHODS FOR TREATING NON-FUNCTIONING PITUITARY ADENOMA - The disclosure is directed to methods for treating non-functioning pituitary adenomas with alpha-folate receptor (“FR-α”) and compositions. In some embodiments, the disclosure is directed to a method for treating a pituitary adenoma that includes administering farletuzumab to a subject diagnosed with a non-functioning pituitary adenoma. | 07-26-2012 |
20120189621 | Combination Therapies and Methods Using Anti-CD3 Modulating Agents and Anti-IL-6 Antagonists - This invention relates generally to compositions that contain multiple modulating agents, e.g., multiple modulating agents that target CD3 on T cells and neutralize one or more biological activities of interleukin-6 (IL-6), such as CD3 modulators including anti-CD3 antibodies and anti-IL-6 antagonists including anti-IL-6 antibodies, anti-IL-6R antagonists including anti-IL-6R antibodies, and/or anti-IL-6/IL-6R complex antagonists including anti-IL-6/IL-6R binding antibodies, and methods of using these compositions in the treatment, amelioration and/or prevention of relapse of an autoimmune disease. | 07-26-2012 |
20120189622 | ANTI-CD38 HUMAN ANTIBODIES AND USES THEREOF - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for CD38, which plays an integral role in various disorders or conditions. These antibodies, accordingly, can be used to treat, for example, hematological malignancies such as multiple myeloma. Antibodies of the invention also can be used in the diagnostics field, as well as for investigating the role of CD38 in the progression of disorders associated with malignancies. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. The invention also provides isolated novel epitopes of CD38 and methods of use therefore. | 07-26-2012 |
20120189623 | CYCLIZED DERIVATIVES AS EG-5 INHIBITORS - The present invention relates to new substituted imidazole compounds have the following Formula (I) and to the pharmaceutically acceptable salts, esters, or prodrugs thereof, to compositions of the compounds together with pharmaceutically acceptable carriers, and to uses of the compounds: | 07-26-2012 |
20120195884 | METHODS AND PRODUCTS FOR EVALUATING AN IMMUNE RESPONSE TO A THERAPEUTIC PROTEIN - The invention relates to methods and products for the identification of a clinically significant immune response in subjects treated with a therapeutic protein. Aspects of the invention relate to methods and compositions for identifying a clinically significant immune response in patients treated with therapeutic amounts of a VLA4 binding antibody (e.g., natalizumab). A second aspect of the invention concerns the chronological details of sample collection for determining the titre of antibodies against the therapeutic protein, e.g. the collection of at least two samples at two different time points. A third aspect of the invention relates to the selection of the critical threshold level, which corresponds to the antibody titre of untreated patients increased by the double of the standard deviation of this control antibody titre. | 08-02-2012 |
20120195885 | COMPOSITIONS CONTAINING GLYCOSYLATED ANTIBODIES AND USES THEREOF - The present invention provides compositions of antibodies, e.g., human antibodies, of varying glycosylation structures that serve to achieve desired rates of serum clearance. The invention also provides methods for modulating the pharmacokinetics of antibodies, e.g., human antibodies, and therapeutic compositions containing such antibodies. These methods rely on varying the glycosylation structures of the antibodies, e.g., human antibodies, to achieve desired rates of serum clearance. | 08-02-2012 |
20120195886 | SODIUM PUMP ANTIBODY AGONISTS AND METHODS OF TREATING HEART DISEASE USING THE SAME - Antibodies that are agonists of sodium pump (Na | 08-02-2012 |
20120195887 | Inhibitor Compounds and Cancer Treatment Methods - A synergistically effective combination of an anti-cancer agent and a therapeutic compound, such as an mTOR-Rictor complex inhibitor, a Serine 473 phosphorylation inhibitor, an AKT2 inhibitor, or a combination thereof, for use in the treatment of cancer, and methods and uses thereof. Also included are methods and uses of a thiosemicarbazone for treating a cancer in a mammal in need thereof characterized by over-expression of RAS, by an EGFR mutation, and/or by over-expression of AKT2. | 08-02-2012 |
20120195888 | Humanized Antibodies Against Human Interferon-Alpha - The present invention provides humanized anti-human IFN-α monoclonal antibodies useful for therapeutic applications in humans. Preferred antibodies are humanized versions of murine antibodies ACO-1 and ACO-2, as well as variants thereof. | 08-02-2012 |
20120195889 | BIOMARKERS AND METHODS FOR DETERMINING SENSITIVITY TO EPIDERMAL GROWTH FACTOR RECEPTOR MODULATORS - EGFR biomarkers useful in a method for predicting the likelihood that a mammal that will respond therapeutically to a method of treating cancer comprising administering an EGFR modulator, wherein the method comprises (a) measuring in the mammal the level of at least one biomarker selected from epiregulin and amphiregulin, (b) exposing a biological sample from the mammal to the EGFR modulator, and (c) following the exposing of step (b), measuring in the biological sample the level of the at least one biomarker, wherein an increase in the level of the at least one biomarker measured in step (c) compared to the level of the at least one biomarker measured in step (a) indicates an increased likelihood that the mammal will respond therapeutically to the method of treating cancer. | 08-02-2012 |
20120195890 | OLIGONUCLEOTIDES INHIBITING CELLULAR MIGRATION - Oligonucleotides inhibiting cellular migration, and the use of at least one inhibitor of protein expression, which inhibits the expression of TSP1 protein, or a protein, which controls the expression of TSP1 or mediates the activity of TSP1, or one inhibitor of protein activity, this inhibitor inhibiting the activity of the TSP1 protein, in particular the activity responsible for the stimulation of cell migration, or one protein which controls the expression or mediates the activity of TSP1 for the manufacture of a drug for the prevention or the treatment of primary tumors or invasive or metastatic tumors. | 08-02-2012 |
20120195891 | METHODS, COMPOSITIONS, AND KITS FOR TREATING SHIGA TOXIN ASSOCIATED CONDITIONS - The invention features methods, compositions, and kits for treating a subject having a Shiga toxin associated disease with chimeric anti-Shiga Toxin 1 (cαStx1) and anti-Shiga Toxin 2 (cαStx2) antibodies. | 08-02-2012 |
20120195892 | IMMUNOGLOBULIN MOLECULES WITH IMPROVED CHARACTERISTICS - The present invention provides for IgG1 molecules with improved characteristics. In particular, substitution mutations are provided that, in combination, facilitate improved placental transfer, improved serum half-life and improved FcRn binding. Substitution mutations are also provided, that in combination, can be used to block FcRn function and thereby increase the clearance rates of other (endogenous or exogenous) IgGs, block placental transport of IgGs and have increased affinity/reduced pH dependence for FcRn binding. | 08-02-2012 |
20120201809 | MULTIFUNCTIONAL ANTIBODY CONJUGATES - The present invention relates to Multifunctional Antibody Conjugates, comprising an antibody or antigen binding portion thereof, comprising at least a fragment of a light chain constant kappa region (CLκ) comprising K | 08-09-2012 |
20120201810 | Use of Anti-DKK-1 Monoclonal Antibodies for the Treatment of Liver Cancer - The invention provides a method of treating liver cancer comprising administering anti-DKK1 monoclonal antibody to a subject in need thereof. Anti-DKK1 monoclonal antibody can also be administered for preventing or ameliorating cancer metastasis and for neutralizing serum and tissue DKK1 in liver cancer patients. The use of anti-DKK1 monoclonal antibodies is based on the discovery of the upregulation of DKK1 in human liver cancer. | 08-09-2012 |
20120201811 | GENERATION AND USE OF FAB, SCFV, AND RELATED BINDING MOLECULES SPECIFIC FOR HIV-1 REV - Described herein is the identification, though phage display, of a chimeric rabbit/human anti-Rev Fab (SJS-R1) that readily solubilized polymeric HIV-1 Rev. The Fab binds with very high affinity to a conformational epitope in the N-terminal half of HIV-1 Rev. The corresponding single chain antibody (scFv) was also prepared and characterized. Methods of making and using SJS-R1 Fab and SJS-R1 scFv, and antibodies and antibody fragments that share at least one CDR with SJS-R1 Fab, are provided. Specific described methods include methods of preventing or reversing polymerization of HIV Rev, methods of preventing or inhibiting replication of a lentivirus in a cell, methods of reducing infectivity of replication of a lentivirus, inhibiting Rev function in a cell infected with a lentivirus, and methods of treating a disease or symptom associated with Rev expression in an animal. | 08-09-2012 |
20120201812 | STABLE FORMULATIONS OF POLYPEPTIDES AND USES THEREOF - Stable formulations are provided that contain immunoglobulin single variable domains at a high concentration. The formulations are useful as pharmaceutical formulation and suitable for subcutaneous administration. The formulations can be transported and stored under various stress conditions. The invention further relates to containers and pharmaceutical units comprising such formulations and to methods for preparing and prophylactic and therapeutic uses of the formulations and pharmaceutical units of the invention. | 08-09-2012 |
20120201813 | POLYPEPTIDE VARIANTS WITH ALTERED EFFECTOR FUNCTION - The present invention concerns polypeptides comprising a variant Fc region. More particularly, the present invention concerns Fc region-containing polypeptides that have altered effector function as a consequence of one or more amino acid modifications in the Fc region thereof. | 08-09-2012 |
20120201814 | COMPOSITIONS MONOVALENT FOR CD28 BINDING AND METHODS OF USE - Disclosed are domain antibodies that monovalently bind CD28. Domain antibodies that are monovalent for binding of CD28 can inhibit CD28 activity. In one aspect, a domain antibody consists of or comprises a single immunoglobulin variable domain that specifically binds and antagonizes the activity of CD28, in an aspect, without substantially agonizing CD28 activity. In another aspect, the domain antibody is a human domain antibody. The disclosure further encompasses methods of antagonizing CD80 and/or CD86 interactions with CD28 in an individual and methods of treating diseases or disorders involving CD80 and/or CD86 interactions with CD28, the methods involving administering a domain antibody to the individual. | 08-09-2012 |
20120201815 | METHODS OF ALTERING BONE GROWTH BY ADMINISTRATION OF SOST OR WISE ANTAGONIST OR AGONIST - The present invention provides a method of promoting local bone growth by administering a therapeutic amount of a Sost antagonist to a mammalian patient in need thereof. Preferably, the Sost antagonist is an antibody or FAB fragment selectively recognizing any one of SEQ ID NOS: 1-23. The Sost antagonist may be coadministered together or sequentially with a matrix conducive to anchoring new bone growth. Orthopedic and Periodontal devices comprising an implantable portion adapted to be permanently implanted within a mammalian body and bearing an external coating of a Sost antagonist are also disclosed, as it a method of increasing bone density by administering to a mammalian patient a therapeutic amount of a Sost antagonist together with an antiresorptive drug. | 08-09-2012 |
20120201816 | LACTAM-CONTAINING COMPOUNDS AND DERIVATIVES THEREOF AS FACTOR XA INHIBITORS - The present application describes lactam-containing compounds and derivatives thereof of Formula I: | 08-09-2012 |
20120201817 | METHODS OF INHIBITING RECEPTOR TYROSINE KINASES WITH AN EXTRACELLULAR ANTAGONIST AND AN INTRACELLULAR ANTAGONIST - The present invention relates to methods of inhibiting receptor tyrosine kinases by utilizing a combination of both an extracellular and an intracellular RTK antagonist. The extracellular RTK antagonist is a biological molecule or a small molecule that inhibits activation of the receptor tyrosine kinase by interacting with the extracellular binding region of the receptor. The intracellular RTK antagonist is a biological molecule or small molecule that inhibits tyrosine kinase activity of the receptor tyrosine kinase by interacting with the receptor's intracellular region bearing a kinase domain or by interacting with an intracellular protein involved in the signaling pathway of the receptor tyrosine kinase. The present invention also provides methods of treating tyrosine kinase-dependent diseases, and compositions for use in such methods thereof, by administering a combination of both an extracellular and an intracellular RTK antagonist. | 08-09-2012 |
20120201818 | TREATMENT OF MULTIPLE SCLEROSIS - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 08-09-2012 |
20120207747 | ANTI-EPHB4 ANTIBODIES AND METHODS USING SAME - The invention provides anti-EphB4 antibodies, and compositions comprising and methods of using these antibodies. | 08-16-2012 |
20120207748 | T-140 PEPTIDE ANALOGS HAVING CXCR4 SUPER-AGONIST ACTIVITY FOR CANCER THERAPY - The present invention is directed to novel therapeutic uses of T-140 analog peptides and compositions comprising same. Specifically, the invention provides compositions and methods useful in cancer therapy. | 08-16-2012 |
20120207749 | DOSING REGIMEN - The present invention relates to a dosing regimen for use in the treatment of stroke. More particularly, the invention relates to the administration of two doses of anti-MAG antibodies for the treatment of ischemic and/or haemorrhagic stroke. | 08-16-2012 |
20120207750 | ANTIBODIES AGAINST HUMAN TWEAK AND USES THEREOF - An antibody binding to TWEAK comprising as heavy chain variable domain a CDR3H selected from the group consisting of SEQ ID NO: 8, 16 or 24. | 08-16-2012 |
20120207751 | Imidazoquinolines as lipid kinase inhibitors - The invention relates to a combination comprising compounds of formula (I) | 08-16-2012 |
20120207752 | METHODS FOR MODULATING IL-33 ACTIVITY - Provided herein are methods of modulating IL-33 activity, e.g., for the purpose of treating immune diseases and conditions, as well as methods of screening for compounds capable antagonizing IL-33 signaling. | 08-16-2012 |
20120213770 | COMPOSTIONS AND METHODS FOR IDENTIFYING RESPONSE TARGETS AND TREATING FLAVIVIRUS INFECTION RESPONSES - Cellular receptors are identified that induce plasma leakage and other negative effects when infected with flaviviruses, such as dengue virus or Japanese encephamyelitis virus. Using fusion proteins disclosed herein, the receptors to which a pathogen, such as flavivirus, binds via glycan binding are determined. Once the receptors are determined, the effect of binding to a particular receptor may be determined, wherein targeting of the receptors causing a particular symptom may be targeted by agents that interrupt binding of the pathogen to the receptor. Accordingly, in the case of dengue virus and Japanese encephamyelitis virus, TNF-α is released when the pathogen binds to the DLVR1/CLEC5A receptor. Interrupting the DLVR1/CLEC5A receptor with monoclonal antibodies reduced TNF-α secretion without affecting secretion of cytokines responsible for viral clearance thereby increasing survival rates in infected mice from nil to around 50%. | 08-23-2012 |
20120213771 | ANTIBODIES THAT BIND HUMAN CD27 AND USES THEREOF - Isolated monoclonal antibodies which bind to human CD27 and related antibody-based compositions and molecules are disclosed. Also disclosed are therapeutic and diagnostic methods for using the antibodies. | 08-23-2012 |
20120213772 | Metabolic biomarkers of Crohn's Disease - The invention provides for a method for identifying a biomarker in a fecal sample of a subject in need of such identification comprising: determining whether a fecal sample collected from a subject comprises a biomarker. | 08-23-2012 |
20120213773 | BINDING DOMAIN-IMMUNOGLOBULIN FUSION PROTEINS - The invention relates to novel binding domain-immunoglobulin fusion proteins that feature a binding domain for a cognate structure such as an antigen, a counterreceptor or the like, a wild-type IgG1, IGA or IgE hinge region polypeptide or a mutant IgG1 hinge region polypeptide having either zero, one or two cysteine residues, and immunoglobulin CH2 and CH3 domains, and that are capable of ADCC and/or CDC while occurring predominantly as polypeptides that are compromised in their ability to form disulfide-linked multimers. The fusion proteins can be recombinantly produced at high express levels. Also provided are related compositions and methods, including cell surface forms of the fusion proteins and immunotherapeutic applications of the fusion proteins and of polynucleotides encoding such fusion proteins. | 08-23-2012 |
20120213774 | Antibodies against human IL33R and uses thereof - An antibody binding to IL33R characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:1, a CDR2 region of SEQ ID NO:2 and a CDR1 region of SEQ ID NO:3 and in that the light chain variable domain comprises a CDR3 region of SEQ ID NO:4, a CDR2 region of SEQ ID NO:5 and a CDR1 region of SEQ ID NO:6 or a chimeric, humanized or T cell epitope depleted antibody variant thereof has advantageous properties for the treatment of inflammatory diseases. | 08-23-2012 |
20120213775 | TREATMENT OF RENAL DISEASES - Compositions for the treatment of renal diseases and disorders utilize agents which inhibit alphaV integrin molecules in vivo. Methods of treatment include use of these agents in the prevention and treatment of proteinuria, progressive glomerular disease and glomerular disease amongst others. | 08-23-2012 |
20120213776 | ANTIBODIES TO GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR - The current invention relates to high-affinity antibodies to Granulocyte-Macrophage Colony-Stimulating Factor that have reduced immunogenicity when administered to a human to treat diseases and method of using such antibodies. | 08-23-2012 |
20120213777 | VASCULAR ENDOTHELIAL GROWTH FACTOR 2 - Disclosed are human VEGF-2 antibodies, antibody fragments, or variants thereof. Also provided are processes for producing such antibodies. The present invention relates to methods and compositions for preventing, treating or ameliorating a disease or disorder comprising administering to an animal, preferably a human, an effective amount of one or more VEGF-2 antibodies or fragments or variants thereof. | 08-23-2012 |
20120213778 | METHOD OF DETECTING AND TREATING TUBEROUS SCLEROSIS COMPLEX ASSOCIATED DISORDERS - Disclosed are methods of detecting and treating tuberous sclerosis complex associated disorders. Also disclosed are methods of identifying agents for treating tuberous sclerosis complex associated disorders. | 08-23-2012 |
20120213779 | FGF21 MUTANTS AND USES THEREOF - The invention provides nucleic acid molecules encoding FGF21 mutant polypeptides, FGF21 mutant polypeptides, pharmaceutical compositions comprising FGF21 mutant polypeptides, and methods for treating metabolic disorders using such nucleic acids, polypeptides, or pharmaceutical compositions. | 08-23-2012 |
20120219545 | MATERIALS AND METHODS FOR DIAGNOSING AND TREATING SHELLFISH ALLERGY - The disclosure provides materials and methods for diagnosing, treating and preventing shellfish allergic reactions, including allergic reactions to shrimp. The technology involves one or more shellfish-specific proteins selected from the group of myosin light chain, sarcoplasmic calcium-binding protein, hemocyanin, fatty acid binding protein, and troponin C, for example from shrimp, as well as encoding polynucleotides, vectors host cells, and specific binding partners for such proteins, e.g., antibodies. In compositions comprising a plurality of shellfish allergens, any of the aforementioned proteins may be included, as may arginine kinase and tropomyosin. The methods according to the disclosure include methods of making the specific binding partners such as antibodies as well as methods of using the materials of the disclosure to diagnose, treat or prevent an allergic reaction to shellfish, e.g., shrimp. | 08-30-2012 |
20120219546 | METHODS FOR TREATING CONDITIONS MEDIATED BY THE INFLAMMATORY CYTOKINE CASCADE USING GAPDH INHIBITORS - The present invention is directed to a method of treating a subject at risk for or having a condition mediated by an inflammatory cytokine cascade comprising administering to the subject an amount of a GAPDH inhibitor effective to treat the subject at risk for or having a condition mediated by an inflammatory cytokine cascade. | 08-30-2012 |
20120219547 | Humanized Anti-TNFalpha Antibodies - The present invention provides a humanized anti-TNF monoclonal antibody and the use thereof. The humanized anti-TNF monoclonal antibody significantly reduces the immunogenicity of murine-antibody while retaining the ability of antibody to recognize antigen, compared with conservative mouse chimeric antibody. Therefore, safety of the antibody in clinical applications has been improved. | 08-30-2012 |
20120219548 | PODXL Protein in Colorectal Cancer - The present disclosure provides a method for determining whether a mammalian subject having a colorectal cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of: a) evaluating an amount of PODXL protein in at least part of a sample earlier obtained from the subject, and determining a sample value corresponding to the evaluated amount; b) comparing said sample value from step a) with a predetermined reference value; and if said sample value is higher than said reference value, c1) concluding that the subject belongs to said second group; and if said sample value is lower than or equal to said reference value, c2) concluding that the subject belongs to said first group. Related uses, means and a method of treatment are also provided. | 08-30-2012 |
20120219549 | Combination therapy of a type II anti-CD20 antibody with a proteasome inhibitor - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and a proteasome inhibitor for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and a proteasome inhibitor. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and a proteasome inhibitor. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and a proteasome inhibitor. | 08-30-2012 |
20120219550 | PHARMACEUTICAL COMBINATIONS COMPRISING A PYRIDO [4,3-D] PYRIMIDINE DERIVED HSP90-INHIBITOR AND A HER2 INHIBITOR - A pharmaceutical combination comprising an Hsp90 inhibitor and an HER2 inhibitor, and methods of using the combination to treat proliferative disorders. | 08-30-2012 |
20120219551 | Fc Region-Containing Polypeptides That Exhibit Improved Effector Function Due To Alterations Of The Extent Of Fucosylation, And Methods For Their Use - The present invention relates to Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and to methods of using such polypeptides for treating or preventing cancer and other diseases. The Fc region-containing polypeptides of the present invention are preferably immunoglobulins (e.g., antibodies), in which the Fc region comprises at least one amino acid substitution relative to the corresponding amino acid sequence of a wild type Fc region, and which is sufficient to attenuate post-translational fucosylation and mediate improved binding to an activating Fc receptor and reduced binding to an inhibitory Fc receptor. The methods of the invention are particularly useful in preventing, treating, or ameliorating one or more symptoms associated with a disease, disorder, or infection where either an enhanced efficacy of effector cell function mediated by FcγR is desired (e.g., cancer, infectious disease) or an inhibited effector cell response mediated by FcγR is desired (e.g., inflammation, autoimmune disease). | 08-30-2012 |
20120219552 | ANTIBODY RECOGNIZING TURN STRUCTURE IN AMYLOID BETA - Provided is a therapeutic method exclusively targeting an amyloid β protein (Aβ) having a specific turn structure of Aβ. Specifically provided is an antibody which specifically recognizes an amyloid β having a turn structure at amino acids positions 22 and 23. Also provided are a medicinal composition comprising, as the active ingredient, an antibody specifically recognizing a toxic conformer of amyloid β, an assay kit for a toxic conformer of amyloid β, a diagnostic for Alzheimer's disease, etc. | 08-30-2012 |
20120225055 | ANTIGEN BINDING PROTEINS - The present invention relates to antigen binding proteins, such as antibodies, which bind to serum amyloid P component (SAP), polynucleotides encoding such antigen binding proteins, pharmaceutical compositions comprising said antigen binding proteins and methods of manufacture. The present invention also concerns the use of such antigen binding proteins in the treatment or prophylaxis of diseases associated with amyloid deposition including systemic amyloidosis, local amyloidosis, Alzheimer's disease, and type 2 diabetes. | 09-06-2012 |
20120225056 | METHODS AND COMPOSITIONS FOR TREATING COMPLEMENT-ASSOCIATED DISORDERS - The present disclosure relates to, inter alia, compositions containing an inhibitor of human complement and use of the compositions in methods for treating or preventing complement-associated disorders. In some embodiments, the inhibitor is chronically administered to patients. In some embodiments, the inhibitor is administered to a patient in an amount and with a frequency to maintain systemic complement inhibition and prevent breakthrough. In some embodiments, the compositions contain an antibody, or antigen-binding fragment thereof, that binds to a human complement component C5 protein or a fragment of the protein such as C5a or C5b. | 09-06-2012 |
20120225057 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF MYELOPROLIFERATIVE DISEASES AND OTHER PROLIFERATIVE DISEASES - Compounds of the present invention, alone and in combination with other active agents, find utility in the treatment of hyperproliferative diseases, mammalian cancers and especially human cancers including but not limited to for example malignant melanomas, myeloproliferative diseases, chronic myelogenous leukemia, acute lymphocytic leukemia, a disease caused by c-ABL kinase, oncogenic forms thereof, aberrant fusion proteins thereof and polymorphs thereof. | 09-06-2012 |
20120225058 | NOVEL IMMUNOGLOBULIN INSERTIONS, DELETIONS, AND SUBSTITUTIONS - An Fc variant of a parent Fc polypeptide, wherein said Fc variant exhibits altered binding to one or more FcγRs, wherein said Fc variant comprises at least one amino acid insertion in the Fc region of said parent Fc polypeptide. | 09-06-2012 |
20120225059 | Novel Agents and Uses Thereof - The present invention provides agents comprising or consisting of a binding moiety with specificity for interleukin-1 receptor accessory protein (IL1RAP) for use in inducing cell death and/or inhibiting the growth and/or proliferation of pathological stem cells and/or progenitor cells associated with a neoplastic hematologic disorder, wherein the cells express IL1RAP. A related aspect of the invention provides agents comprising or consisting of a binding moiety with specificity for interleukin-1 receptor accessory protein (IL1RAP) for use in detecting pathological stem cells and/or progenitor cells associated with a neoplastic hematologic disorder, wherein the cells express IL1RAP. Further provided are pharmacological compositions comprising the agents of the invention and methods of using the same. | 09-06-2012 |
20120225060 | ANTI-IL-6 RECEPTOR ANTIBODIES AND METHODS OF USE - The present invention provides anti-IL-6R monoclonal antibodies and related compositions, which may be used in any of a variety of therapeutic methods for the treatment of rheumatoid arthritis and other diseases. | 09-06-2012 |
20120225061 | TETRASUBSTITUTED CYCLOHEXYL COMPOUNDS AS KINASE INHIBITORS - The present invention provides a compound of formula (I): | 09-06-2012 |
20120225062 | NOVEL KINASE INHIBITORS - The present invention provides compounds of Formula I: | 09-06-2012 |
20120225063 | TREATMENT RESPONSE TO ANTI-ANGIOGENIC THERAPIES - Methods are provided for selecting and treating patients with an anti-angiogenic agent and methods for reducing the risk of adverse events in patients from treatment with an anti-angiogenic agent, comprising the steps: obtaining a sample of tumor and normal tissues from a patient; determining the miRNA or protein expression in said samples; comparing the miRNA or protein expression in said tumor sample to the miRNA or protein expression in normal tissue; determining whether said tumor miRNA or protein expression is higher or lower than said normal miRNA or protein expression, wherein if said miRNA or protein expression indicates that the expression of at least one angiogenic gene is upregulated, the patient is scheduled for treatment with an anti-angiogenic agent. Preferably the anti-angiogenic agent is a VEGF-targeting agent or a tyrosine kinase inhibitor. In preferred embodiments, the VEGF-targeting agent is bevacizumab. | 09-06-2012 |
20120225064 | Sphingosine 1-Phosphate Antagonism - Materials and Method for treating cancer and screening for anti-neoplastic agents are provided. These materials and methods can include sphingosine 1-phosphate antagonists that bind to sphingosine-1 phosphate receptor subtype 3. Antibodies and aptamers that selectively bind to an epitope in the extracellular loop between transmembrane domains two and three of sphingosine-1-phosphate receptor subtype 3 are provided. | 09-06-2012 |
20120225065 | ANTI-HUMAN IL-21 MONOCLONAL ANTIBODIES - Human anti-human IL-21 monoclonal antibodies and the hybridomas that produce them are presented. Certain of these antibodies have the ability to bind native human IL-21, a mutant recombinant IL-21 protein and/or peptide regions of human IL-21. These human anti-IL-21 antibodies are useful in therapeutic treatment of autoimmune and inflammatory diseases, particularly diseases mediated by T follicular helper cells, B cells T | 09-06-2012 |
20120230980 | OPTIMIZED Fc VARIANTS AND METHODS FOR THEIR GENERATION - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 09-13-2012 |
20120230981 | CH2 Domain Template Molecules Derived From Rational Grafting Of Donor Loops Onto CH2 Scaffolds - Novel CH2 domain template molecules wherein donor loops from a database of domains are transferred to a CH2 domain scaffold. At least one or up to three loops from a donor are transferred to the CH2 domain. The donor loops may be chosen based on length, e.g., the donor loop may have a length that is similar to that of a structural loop in the CH2 domain scaffold. | 09-13-2012 |
20120230982 | HIGH CONCENTRATION ANTIBODY FORMULATIONS - The present disclosure relates to, inter alia, stable aqueous solutions comprising a high concentration of an antibody that binds to human complement component C5 and methods for preparing the solutions. The disclosure also provides methods for treating or preventing complement-associated disorders (for example, age-related macular degeneration or rheumatoid arthritis) using the solutions. Also featured are therapeutic kits containing one or more of the solutions and a means for administering the solutions to a patient in need such a treatment. | 09-13-2012 |
20120230983 | METHODS OF TREATING CANCER USING 3-(5-AMINO-2-METHYL-4-OXO-4H-QUINAZOLIN-3-YL)-PIPERIDINE-2,6-DIONE - Provided herein are methods of treating, preventing and/or managing cancers, which comprise administering to a patient 3-(5-amino-2-methyl-4-oxo-4H-quinazolin-3-yl)-piperidine-2,6-dione, or an enantiomer or a mixture of enantiomers thereof, or a pharmaceutically acceptable salt, solvate, hydrate, co-crystal, clathrate, or polymorph thereof. | 09-13-2012 |
20120230984 | Methods of Treating or Preventing Autoimmune Diseases With 2,4-Pyrimidinediamine Compounds - The present invention provides methods of treating or preventing autoimmune diseases with 2,4-pyrimidinediamine compounds, as well as methods of treating, preventing or ameliorating symptoms associated with such diseases. Specific examples of autoimmune diseases that can be treated or prevented with the compounds include rheumatoid arthritis and/or its associated symptoms, systemic lups erythematosis and/or its associated symptoms and multiple sclerosis and/or its associated symptoms. | 09-13-2012 |
20120230985 | HUMANIZED ANTI-FACTOR D ANTIBODIES AND USES THEREOF - The invention relates to humanized anti-human Factor D monoclonal antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 09-13-2012 |
20120230986 | Agent and Methods for Reducing Inflammatory Markers - A method for treating an autism spectrum condition includes administering an effective dose of a TNF-α inhibiting agent to a person having an autism spectrum condition or pervasive development disorder and at least one of elevated TNF-α in the cerebrospinal fluid or elevated TNF-α in the serum, as compared to normal conditions; and lowering at least one of the elevated TNF-α in the cerebrospinal fluid or elevated TNF-α in the serum. A TNF-α inhibiting agent includes at least one of Lenalinomide; Thalidomide; L-Carnosine; Infliximab; Etanercept; a stem cell preparation; derivatives thereof, isomers thereof, or pharmaceutically acceptable salts thereof. | 09-13-2012 |
20120230987 | METHODS FOR TREATING CONDITIONS ASSOCIATED WITH C-FMS - Antigen binding proteins that bind to human c-fms protein are provided. Nucleic acids encoding the antigen binding protein, vectors, and cells encoding the same are also provided. The antigen binding proteins can inhibit binding of c-fms to CSF-1, reduce monocyte migration into tumors, and reduce the accumulation of tumor-associated macrophages. | 09-13-2012 |
20120230988 | ANTIBODY TARGETING OSTEOCLAST-RELATED PROTEIN SIGLEC-15 - To provide a method of detecting abnormal bone metabolism by using a gene strongly expressed in an osteoclast; a method of screening a compound having a therapeutic and/or preventive effect on abnormal bone metabolism; and a pharmaceutical composition for treating and/or preventing abnormal bone metabolism. Provision of a method of detecting abnormal bone metabolism by using the expression of human Siglec-15 gene as an index; a pharmaceutical composition containing an antibody which specifically recognizes human Siglec-15 and has an activity of inhibiting osteoclast formation; and the like. | 09-13-2012 |
20120230989 | METHODS AND MATERIALS FOR TREATING RENAL CELL CARCINOMA - This document provides methods and materials related to treating renal cell carcinoma. For example, methods and materials for assessing a cancer patient (e.g., a renal cell carcinoma patient) for tumor or peritumoral tissue containing CD14 | 09-13-2012 |
20120230990 | HUMANIZED ANTIBODIES AGAINST HUMAN IL-22RA - The invention relates to humanized antibodies against human IL-22RA and to their use in the treatment of psoriasis and other immune-mediated diseases such as psoriatic arthritis and atopic dermatitis. | 09-13-2012 |
20120237502 | METHOD FOR TREATING BREAST CANCER AND OVARIAN CANCER - The present invention relates to a method for the prevention or treatment of certain breast cancers or ovarian cancer comprising administering to a patient in need thereof of a therapeutically effective amount of a 17,20-lyase inhibitor, wherein the breast cancer or ovarian cancer is estrogen receptor (ER) negative. | 09-20-2012 |
20120237503 | Screening Method and Therapy with Agonists of DDAH I - The present invention derives from the finding that decreased levels of DDAH I are associated with increased portal pressure and that by increasing DDAH I levels in vivo, portal pressure may be reduced. Accordingly, the invention provides methods for reducing portal blood pressure comprising administering to a subject in need thereof an agonist of DDAH I. | 09-20-2012 |
20120237504 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATION AND FIBROSIS - The present invention features compositions featuring agents that bind to denatured collagen and methods of using such agents to treat or prevent fibrosis or inflammation in a subject. | 09-20-2012 |
20120237505 | TARGETING OF CD8+ T-LYMPHOCYTES TO TREAT NEURODEGENERATIVE DISEASES - Methods and therapeutic agents are disclosed for treating neurodegenerative disorders by depletion of CD8 positive T cells by using antibodies, FAb fragments of antibodies or similar agents that sequester, neutralize or deplete the CD8+ cytotoxic T cells. | 09-20-2012 |
20120237506 | Antigen Binding Proteins - The present invention relates to antigen binding proteins comprising two Fc parts, methods for their production, pharmaceutical compositions containing said antigen binding proteins, and uses thereof. | 09-20-2012 |
20120237507 | Monovalent Antigen Binding Proteins - The present invention relates to monovalent antigen binding proteins with a CH1-CL domain exchange, methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof. | 09-20-2012 |
20120237508 | FUSED AMINO PYRIDINE AS HSP90 INHIBITORS - The present invention relates to HSP90 inhibitors containing fused amino pyridine core that are useful as inhibitors of HSP90 and their use in the treatment of HSP90 related diseases and disorders such as cancer, an autoimmune disease, or a neurodegenerative disease. | 09-20-2012 |
20120237509 | Anti-Mesothelin Antibodies - This invention relates to the use of monoclonal and polyclonal antibodies that specifically bind to and become internalized by mesothelin-positive cells and also induce an immune effector activity such as antibody dependent cellular cytotoxicity. The antibodies are useful in specific delivery of pharmacologic agents to mesothelin expressing cells as well as eliciting an immune-effector activity particularly on tumor cells and precursors. The invention is also related to cells expressing the monoclonal antibodies, polyclonal antibodies, antibody derivatives, such as human, humanized, and chimeric monoclonal antibodies, antibody fragments, mammalian cells expressing the monoclonal antibodies, derivatives and fragments, and methods of treating cancer using the antibodies, derivatives and fragments. | 09-20-2012 |
20120237510 | Anti-NKG2A Antibodies and Uses Thereof - Described herein are anti-NKG2A antibodies suitable for human therapy, including humanized versions of murine anti-NKG2A antibody Z270, as well as related methods and materials for producing and using such antibodies. Exemplary complementarity-determining regions (CDRs) sequences and sites for optional amino acid back-substitutions in framework region (FR) and/or CDRs of such antibodies are also described. | 09-20-2012 |
20120244144 | PERTUSSIS ANTIBODIES AND USES THEREOF - Compositions and methods are provided that are useful to treat respiratory diseases such as whooping cough. Further, compositions and methods of immunizing are provided. | 09-27-2012 |
20120244145 | ENHANCED IMMUNOLOGICAL RESPONSES - Cancers and other diseases can be treated with two or three types of agents: an agent which induces lymphodepletion or lymphopenia; an inhibitory antibody to a surface marker on Treg cells; and optionally a specific antigen. This combination may lead to enhanced immune responses despite lymphodepletion or lymphopenia. | 09-27-2012 |
20120244146 | TREATMENT OF TAUOPATHIES - The invention is directed to methods of treatment of Alzheimer's disease and other tauopathies, via the administration of antibodies having specificity to abnormal forms of tau protein, the antibodies showing no binding and/or reactivity to a normal tau protein and being administered under conditions and in amounts effective to prevent or treat Alzheimer's disease or other tauopathies. In certain embodiments, the antibodies are selective for soluble truncated tau protein truncated at (i) its C-terminus after the glutamic acid residue Glu391, or (ii) at the aspartic acid residue Asp421, or (iii) at its N-terminus at the aspartic acid residue Asp13, or (iv) a combination of (i)-(iii). Further aspects of the invention are directed to the administration of an immunogen comprising an abnormal tau, preferably a soluble truncated tau. | 09-27-2012 |
20120244147 | COMBINATION THERAPY OF CANCER WITH ANTI-ENDOGLIN ANTIBODIES AND ANTI-VEGF AGENTS - The present application relates to compositions of chimeric anti-endoglin antibodies and anti-VEGF agents. Another aspect relates to the use of chimeric anti-endoglin antibodies and Bevacizumab. Another aspect relates to the use of the compositions to inhibit VEGF induced sprouting. Another aspect relates to the use of the compositions to inhibit angiogenesis. | 09-27-2012 |
20120244148 | ANTI-INTERFERON-ALPHA ANTIBODIES - The present invention relates generally to the generation and characterization of neutralizing anti-IFN-α monoclonal antibodies with broad reactivity against various IFN-α subtypes. The invention further relates to the use of such anti-IFN-α antibodies in the diagnosis and treatment of disorders associated with increased expression of IFN-α, in particular, autoimmune disorders such as insulin-dependent diabetes mellitus (IDDM) and systemic lupus erythematosus (SLE). | 09-27-2012 |
20120244149 | BENZOXAZEPIN PI3K INHIBITOR COMPOUNDS AND METHODS OF USE - Benzoxazepin compounds of Formula I, including stereoisomers, geometric isomers, tautomers, solvates, metabolites and pharmaceutically acceptable salts thereof, wherein: Z | 09-27-2012 |
20120244150 | ANTI-VEEV HUMANIZED ANTIBODY - The present disclosure relates to an anti-VEEV humanised antibody or a fragment thereof comprising a framework 1, 2, 3, 4, S or 6 CDR regions independently selected from SEQ ID Nos: 2, 3, 4, 5, 6 or 7 characterised in that the antibody or fragment comprises in the framework at least one amino acid, that positively influences the binding/activity of the antibody, from the original murine antibody 1A3B7, pharmaceutical composition comprising same, methods of preparing the antibody or fragment and use of the antibody or fragment in treatment or prophylaxis, in particular the treatment or prophylaxis of VEEV infection. | 09-27-2012 |
20120244151 | Treatment of Cancer Involving Mutated KRAS or BRAF Genes - The present invention provides a method of treating cancer in a subject wherein the cancer comprises mutated KRAS or BRAF genes. The method comprises administering to the subject an effective amount of an antibody or antigen binding fragment thereof wherein the antibody or antigen binding fragment thereof competes with SC104 for binding to the human colon cancer cell line Colo205. | 09-27-2012 |
20120244152 | NOVEL ANTAGONIST ANTIBODIES AND THEIR FAB FRAGMENTS AGAINST GPVI AND USES THEREOF - The present invention discloses novel antibodies that specifically bind to the human platelet membrane protein Glycoprotein VI (GPVI) and their monovalent fragments or derivatives. The antibodies of the invention are antibodies from hybridoma clone 390 and fragment antibodies thereof able to induce a GPVI depletion pheno-type. These antibodies and Fab fragments are able to block collagen binding and thus preventing platelet activation by collagen. The invention also relates to hybridoma clones and expression plasmids for the production of disclosed antibodies and Fab fragments. The present invention further refers to the uses of monovalent antibody fragments to manufacture research, diagnostic and immunotherapeutic agents for the treatment of thrombosis and other vascular diseases. The invention also concerns a Fab bearing a molecule at the C-terminal extremity, as well as method for prevention of recognition of Fab by antibodies using such modified Fab. The invention concerns a method for prevention of platelet activation when an anti-GP VI Fab is used. | 09-27-2012 |
20120251528 | Non-Human Mammal Model Of Human Hematopoietic Cancer - The present invention describes Photolabile Compounds methods for use of the compounds. The Photolabile Compounds have a photoreleasable ligand, which can be biologically active, and which is photoreleased from the compound upon exposure to light. In some embodiments, the Photolabile Compounds comprise a light antenna, such as a labeling molecule or an active derivative thereof. In one embodiment, the light is visible light, which is not detrimental to the viability of biological samples, such as cells and tissues, in which the released organic molecule is bioactive and can have a therapeutic effect. In another embodiment, the photoreleasable ligand can be a labeling molecule, such as a fluorescent molecule. | 10-04-2012 |
20120251529 | ANTI-CEA ANTIBODIES - The present invention provides antigen binding molecules (ABMs) which bind membrane-bound CEA, including ABMs with improved therapeutic properties, and methods of using the same. | 10-04-2012 |
20120251530 | COMBINATION THERAPY OF HER EXPRESSING TUMORS - The invention relates to tumors expressing HER2 and EGFR, using HER2-dimerization inhibitors (HDIs) and EGFR inhibitors. | 10-04-2012 |
20120251531 | ANTIBODY Fc VARIANTS - The invention relates to engineered polypeptides comprising Fc variants and their uses. More specifically, Fc variants are described exhibiting reduced effector function. These variants cause a benefit for a patient suffering from a disease which could be treated with an antibody for which it is desirable to reduce the effector function elicited by antibodies. | 10-04-2012 |
20120251532 | ANTI-ALPHA V BETA 6 ANTIBODIES - Monoclonal antibodies that specifically bind to M.96. Also included are methods of using these antibodies to treat mammals having or at risk of having 006-mediated diseases, or to diagnose % Qmediated diseases. | 10-04-2012 |
20120251533 | MONOCLONAL ANTIBODIES AGAINST CD30 LACKING IN FUCOSYL RESIDUES - The invention pertains to anti-CD30 antibodies that lack fucosyl residues. The antibodies of the invention exhibit increased antibody-dependent cellular cytotoxicity (ADCC) activity, including the ability to lyse CD30-expressing cell lines that are not lysed by the fucosylated form of the antibodies. The invention also provides host cells that express the anti-CD30 antibodies that lack fucosyl residues, wherein the host cells are deficient for a fucosyl transferase. Methods of using the antibodies to inhibit the growth of CD30+ cells, such as tumor cells, are also provided. | 10-04-2012 |
20120251534 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODY - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 10-04-2012 |
20120251535 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODY - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 10-04-2012 |
20120258091 | GENETIC PRODUCTS DIFFERENTIALLY EXPRESSED IN TUMORS AND THE USE THEREOF - The invention relates to the identification of genetic products expressed in association with tumors and to coding nucleic acids for the expressed products. An embodiment of the invention also relates to the therapy and diagnosis of disease in which the genetic products are aberrantly expressed in association with tumors, proteins, polypeptides and peptides which are expressed in association with tumors, and to the nucleic acids coding for the polypeptides, peptides and proteins. | 10-11-2012 |
20120258092 | Optimized Fc Variants - The present invention relates to optimized CD20 antibodies having Fc variants, methods for their generation, and method for their application, such as methods of enhancing macrophage activation, particularly for therapeutic purposes. | 10-11-2012 |
20120258093 | VLA-4 AS A BIOMARKER FOR PROGNOSIS AND TARGET FOR THERAPY IN DUCHENNE MUSCULAR DYSTROPHY - The invention relates to methods for the treatment of Duchenne muscular dystrophy and to methods for determining the prognosis of a subject affected with Duchenne Muscular Dystrophy. More particularly, the present invention relates to a VLA-4 antagonist for use in the treatment of Duchenne Muscular Dystrophy. The present invention also relates to a method for determining the prognosis of a subject affected with Duchenne Muscular Dystrophy wherein said method comprising a step consisting of determining the level of VLA-4 high T cells in a blood sample obtained from said subject. | 10-11-2012 |
20120258094 | METHOD FOR TREATING A RHEUMATIC DISEASE USING A SOLUBLE CTLA4 MOLECULE - The present invention relates to compositions and methods for treating autoimmune diseases, such as diabetes, by administering to a subject a CTLA4 molecule that block endogenous B7 molecules from binding their ligands. | 10-11-2012 |
20120258095 | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 10-11-2012 |
20120258096 | ANTI-D MONOCLONAL ANTIBODIES - The invention concerns a method for obtaining and selecting monoclonal antibodies by an ADDC-type test, said antibodies capable of activating type III Fcγ receptors and having a particular glycan structure. The inventive anti-D antibodies can be used for preventing Rhesus isoimmunisation in Rh negative persons, in particular for haemolytic disease in a new-born baby or for uses such as idiopathic thrombocytopenic purpura (ITP). | 10-11-2012 |
20120258097 | METHODS OF USING BTL-II PROTEINS - The invention provides isolated BTL-II proteins, nucleic acids, antibodies, antagonists, and agonists and methods of making and using the same. Diagnostic, screening, and therapeutic methods using the compositions of the invention are provided. For example, the compositions of the invention can be used for diagnosis and treatment of inflammatory bowel diseases and for enhancing a mucosal immune response to an antigen. | 10-11-2012 |
20120258098 | Method of Treating Rheumatoid Arthritis with an Anti-IL-6R Antibody - The present invention provides methods of preventing or treating rheumatoid arthritis using a fully human antibody or antigen-binding fragment thereof that specifically binds human interleukin-6 receptor (hIL-6R). The methods of the present invention may include administration of a second therapeutic agent, such as one or more of a non-steroidal anti-inflammatory drug (NSAID), a glucocorticoid, a disease-modifying anti-rheumatic drug (DMARD), or a TNF-alpha antagonist, T-cell blocker, anti-CD20 antibody, an IL-1, JAK or IL-17 antagonist, or any combination thereof. | 10-11-2012 |
20120258099 | INHIBITORS OF GUANINE EXCHANGE FACTORS AND THEIR USE AS ANTICANCER DRUGS - A peptide including the amino acids sequence X | 10-11-2012 |
20120258100 | CHIMERIC ANTI-RICIN ANTIBODY - A chimeric monoclonal antibody targeted at ricin, in which the light chain and heavy chain are such that:
| 10-11-2012 |
20120258101 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODY - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 10-11-2012 |
20120258102 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODIES - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 10-11-2012 |
20120258103 | COMPOUNDS AND METHODS FOR THE TREATMENT OF RENAL DISEASE - The present invention provides compounds and methods for the treatment and prophylaxis of renal disease and inflammation. In particular the invention provides methods for the treatment of kidney disease and failure through the administration of compounds which function as inhibitors of TLR2 function and expression. | 10-11-2012 |
20120263707 | Broad Spectrum ErbB Ligand Binding Molecules and Methods for Preparing and Using Them - Chimeric ErbB ligand binding molecules having detectable binding activity for more ErbB ligands than any one of native ErbB 1, ErbB3 or ErbB4 are disclosed. Preferably, the binding molecules bind a broad spectrum and, more preferably, the full spectrum of ErbB ligands. The chimeric ErbB ligand binding molecules generally have a subunit LI derived from one of ErbB1, 3, or 4 and a subunit LII derived from another distinct ErbB receptor type. The sub-domain, SI, which joins LI and LII can be from either one of the receptor types or can have portions from both. Pharmaceutical compositions that contain the molecules and methods for the treatment of ErbB sensitive diseases are also disclosed. | 10-18-2012 |
20120263708 | SUBSTITUTED AMINOQUINOXALINES AS TYROSINE THREONINE KINASE INHIBITORS - The present invention relates to substituted aminoquinoxaline compounds of general formula (I) in which (II), R | 10-18-2012 |
20120263709 | USE OF IL-33 ANTAGONISTS TO TREAT FIBROTIC DISEASES - Methods for treating fibrotic disease, such as idiopathic pulmonary fibrosis and scleroderma, with antagonists of IL-33 are disclosed. | 10-18-2012 |
20120263710 | ADMINISTERING ANTI-PLACENTAL GROWTH FACTOR ANTIBODIES - The present invention relates to the field of pathological angiogenesis and arteriogenesis and, in particular, to a stress-induced phenotype in a transgenic mouse (PIGF | 10-18-2012 |
20120263711 | Engineering Fc Antibody Regions to Confer Effector Function - The present invention relates to molecules having a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region. These modified molecules confer an effector function to a molecule, where the parent molecule does not detectably exhibit this effector function. In one embodiment, the variant Fc region binds FcγRIIIA and/or FcγRIIA with a greater affinity, relative to a comparable molecule comprising the wild-type Fc region. The molecules of the invention have particular utility in treatment, prevention or management of a disease or disorder, in a sub-population of patients, wherein the target antigen is expressed at low levels in the target cell population. | 10-18-2012 |
20120263712 | PYRROLIDINE-1,2-DICARBOXAMIDE DERIVATIVES - The present invention relates to a compound of formula (I) | 10-18-2012 |
20120263713 | Combination therapy of an afucosylated CD20 antibody with fludarabine and/or mitoxantrone - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with fludarabine and/or mitoxantrone for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody with fludarabine and/or mitoxantrone. | 10-18-2012 |
20120263714 | SUBSTITUTED HALOPHENOXYBENZAMIDE DERIVATIVES - The present invention relates to substituted halophenoxybenzamide derivative compounds of general formula (I) in which R | 10-18-2012 |
20120263715 | Topical Methods Of Treating RSV Infections And Related Conditions - The present invention provides methods for preventing, managing, treating and/or ameliorating a respiratory syncytial virus (RSV) infection (e.g., acute RSV disease, or a RSV upper respiratory tract infection (URI) and/or lower respiratory tract infection (LRI)), and/or a symptom or a long-term respiratory condition relating thereto (e.g., asthma, wheezing, reactive airway disease (RAD), or chronic obstructive pulmonary disease (COPD)) in a human subject, comprising topically administering to said human an effective amount of one or more antibodies that immunospecifically bind to one or more RSV antigens with a high affinity and/or high avidity and further comprise a modified IgG constant domain, or FcRn-binding fragment thereof, to not only decrease RSV infection, but also decrease the pro-inflammatory epithelial cell immune responses in order to mitigate the later development of asthma and/or wheezing and/or COPD in said patient. | 10-18-2012 |
20120263716 | METHOD OF TREATING CANCERS AND A PHARMACEUTICAL COMPOSITION THAT MAY BE USED IN PRACTICING SAID METHOD - The method of treating a person having a cancer selected from carcinoma, sarcoma or hematopoietic cancer by administering (a) an effective amount of at least one anti-cancer drug selected from the group consisting of an epidermal growth factor receptor (EGFR) inhibitor, a vascular endothelial growth factor receptor (VEGFR) inhibitor and a Raf kinase inhibitor and (b) an effective amount of 5-(4-(6-(4-amino-3,5-dimethyl-phenoxy)-1-methyl-1H-benzimidazol-2-ylmethoxy)-benzyl)-thiazolidine-2,4-dione.dihydrochloride provided that said carcinoma is not lung cancer when an EGFR inhibitor is erlotinib. The invention also provides a pharmaceutical composition that may be used in practicing said method. | 10-18-2012 |
20120263717 | HUMANIZED ANTI-FGF19 ANTAGONISTS AND METHODS USING SAME - The present invention concerns antagonists of the FGF19/FGFR4 pathways, and the uses of same. | 10-18-2012 |
20120269800 | Anti-neoplastic compositions comprising extracts of black cohosh - A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na | 10-25-2012 |
20120269801 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF PROLIFERATIVE AND PATHOGENIC DISEASES - The invention features proteins including an antibody, or functional derivatives thereof, that bind hCD59 and have the activity of domain 4 of the | 10-25-2012 |
20120269802 | Treatment And Prognosis With Thalidomide In Multiple Myeloma Based on Karyotyping And Gene Expression Profiling - The present invention provides a method treating a myeloma patient by administering one or more of thalidomide, a Total Therapy 2 regimen, an interleukin-6 signaling suppressor, an interleukin-6R signaling suppressor, an IGF1 signaling suppressor, an IGF1 R signaling suppressor, shRNA or other modulators of gene expression. Also, provided are methods for predicting outcome of a treatment for an individual having a cancer, e.g., myeloma, by performing one or more of karyotyping or expression profiling of chromosomes 1 and 13 or expression level measurement of IL-6R. | 10-25-2012 |
20120269803 | SUBSTITUTED BENZOSULPHONAMIDES - The present invention relates to substituted benzosulphonamide compounds of general formula (I): in which R1, R2, R3, R4, R5 and A are as defined in the claims, to methods of preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of a hyper-proliferative and/or angiogenesis disorder, as a sole agent or in combination with other active ingredients. | 10-25-2012 |
20120269804 | SUBSTITUTED BENZOSULPHONAMIDES - The present invention relates to substituted benzosulphonamide compounds of general formula (I): in which R1, R2, R3, R4, R5 and A are as defined in the claims, to methods of preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of a hyper-proliferative and/or angiogenesis disorder, as a sole agent or in combination with other active ingredients. | 10-25-2012 |
20120269805 | ANTIBODIES DIRECTED AGAINST AMYLOID-BETA PEPTIDE AND METHODS USING SAME - Monoclonal antibody 9TL and antibodies derived from 9TL directed against amyloid-beta peptide and methods of using same for diagnosing and treatment of Alzheimer's disease and Aβ peptide associated diseases are described. Methods of using antibodies directed against amyloid-beta peptide having impaired effector function for treatment of Alzheimer's disease and Aβ peptide associated diseases are also described. | 10-25-2012 |
20120276083 | METHODS FOR INHIBITING OCULAR ANGIOGENESIS - The present invention provides methods of using TSPAN12 and Norrin antagonists to inhibit ocular vascular development and to treat related disorders. | 11-01-2012 |
20120276084 | Predicting Risk of Age-Related Macular Degeneration - This invention relates to methods for predicting risk of developing age-related macular degeneration (AMD), based on detecting the presence of certain genetic variants on chromosome 16 that are associated with increased incidence of AMD. | 11-01-2012 |
20120276085 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH AN ANTI-BCL-2 ACTIVE AGENT - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and an anti-Bcl-2 active agent for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and an anti-Bcl-2 active agent. | 11-01-2012 |
20120276086 | MONOCLONAL ANTIBODIES AGAINST CD30 LACKING IN FUCOSYL AND XYLOSYL RESIDUES - The invention pertains to anti-CD30 antibodies that lack fucosyl and xylosyl residues. The antibodies of the invention exhibit increased antibody-dependent cellular cytotoxicity (ADCC) activity, including the ability to lyse CD30-expressing cell lines that are not lysed by the fucosylated and xylosylated form of the antibodies. The invention also provides host cells that express the anti-CD30 antibodies that lack fucosyl and xylosyl residues, wherein the host cells are deficient for a fucosyltransferase and a xylosyltransferase. Methods of using the antibodies to inhibit the grown of CD30 | 11-01-2012 |
20120276087 | METHODS AND COMPOSITIONS USING PDE4 INHIBITORS FOR THE TREATMENT AND MANAGEMENT OF AUTOIMMUNE AND INFLAMMATORY DISEASES - Methods of treating, preventing, or managing autoimmune inflammatory diseases and disorders including but not limited to spondylitis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, osteoarthritis, ankylosing spondylitis, and rheumatoid arthritis by the administration of phosphodiesterase 4 (PDE4) inhibitors in combination with other therapeutics are disclosed. Pharmaceutical compositions, dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 11-01-2012 |
20120276088 | SMALL MOLECULE TRAIL GENE INDUCTION BY NORMAL AND TUMOR CELLS AS AN ANTICANCER THERAPY - Methods and compositions relating to TIC10 are described according to aspects of the present invention. The compositions and methods have utility in treating disease, particularly cancer in a subject in need thereof, including a human subject as well as subjects of other species. The compositions have utility in treating brain cancer in a subject in need thereof. | 11-01-2012 |
20120276089 | Antibodies That Inhibit WNT Signaling And Methods Of Using The Same - The present invention is directed to monoclonal antibodies and fragments thereof directed to LRP5/6 that find use in the prevention and treatment of cardiac remodeling and cancer. Also disclosed are methods for using such monoclonal antibodies in the prevention and treatment of such diseases. | 11-01-2012 |
20120276090 | GENE RECOMBINANT ANTIBODY AND ANTIBODY FRAGMENT THEREOF - A recombinant antibody or the antibody fragment thereof which specifically reacts with an extracellular domain of human CCR4; a DNA which encodes the recombinant antibody or the antibody fragment thereof; a method for producing the recombinant antibody or the antibody fragment thereof; a method for immunologically detecting CCR4, a method for immunologically detecting a cell which expressed CCR4 on the cell surface, a method for depleting a cell which expresses CCR4 on the cell surface, and a method for inhibiting production of Th2 cytokine, which comprise using the recombinant antibody according or antibody fragment thereof; a therapeutic or diagnostic agent for Th2-mediated immune diseases; and a therapeutic or diagnostic agent for a blood cancer. | 11-01-2012 |
20120276091 | Human Recombinant Monoclonal Antibody That Specifically Binds to VCAM-1 and Inhibits Adhesion and Transmigration Between Leukocytes and Endothelial Cells - The present invention relates to a human recombinant monoclonal antibody that specifically binds to human Vascular Cell Adhesion Molecule-1 (VCAM-1) to inhibit adhesion between leukocytes and activated endothelial cells and transmigration of leukocytes through the activated endothelial cells, and a prophylactic and therapeutic composition for inflammatory disease or cancer comprising the same. The human recombinant monoclonal antibody according to the present invention shows a strong affinity to VCAM-1 expressed on human endothelial cell, and effectively inhibits VCAM-1-mediated adhesion between leukocytes and activated endothelial cells and transmigration of leukocytes through the activated endothelial cells, thereby being used for the prevention and treatment of inflammatory disease such as asthma and arthritis, transplant rejection, cardiovascular disease, and cancer. | 11-01-2012 |
20120276092 | Antibody Glycosylation Variants - Antibody and other Fc-containing molecules with glycosylation variations in the Fc region show increased resistance to proteases, such as pepsin, plasmin, trypsin, chymotrypsin, a matrix metalloproteinase, a serine endopeptidase, and a cysteine protease. The Fc-containing molecules are useful in the treatment of various diseases and disorders. | 11-01-2012 |
20120276093 | THERAPEUTIC COMBINATION COMPRISING A CDC7 INHIBITOR AND AN ANTI-NEOPLASTIC AGENT - The present invention provides a therapeutic combination comprising (a) a compound of formula (I) as set forth in the specification and (b) one or more antineoplastic agents selected from the group consisting of an alkylating or alkylating-like agent, an antimetabolite agent, a topoisomerase I inhibitor, a topoisomerase 11 inhibitor, an inhibitor of a growth factor or of a growth factor receptor, an antimitotic agent, a proteasome inhibitor, an inhibitor of an anti-apoptotic protein and an antibody directed against a cell surface protein, wherein the active ingredients are present in each case in lice form or in the form of a pharmaceutically acceptable salt or any hydrate thereof. | 11-01-2012 |
20120276094 | Identification and Engineering of Antibodies with Variant Fc Regions and Methods of Using Same - The present invention relates to molecules comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, which variant Fc region binds FcγRIIIA and/or FcγRIIA with a greater affinity relative to a comparable molecule comprising the wild-type Fc region. The molecules of the invention are useful in preventing, treating, or ameliorating symptoms associated with a disease, disorder, or infection. The molecules of the invention are particularly useful for the treatment or prevention of a disease or disorder where an enhanced efficacy of effector cell function mediated by FcγR is desired, and in enhancing the therapeutic efficacy of therapeutic antibodies the effect of which is mediated by ADCC. | 11-01-2012 |
20120282248 | PREVENTION AND TREATMENT OF CEREBRAL AMYLOID ANGIOPATHY - The invention provides improved agents and methods for treatment of cerebral amyloid angiopathy (CAA) and methods to effect prophylaxis of CAA. The methods can treat CAA concurrently with Alzheimer's disease or separately. The methods can effect prophylaxis of CAA concurrently with Alzheimer's disease or separately. The methods involve administering antibody that is specific for the N-terminus of Aβ or an agent that can induce such an antibody. | 11-08-2012 |
20120282249 | FORMULATION FOR ANTI-ALPHA4BETA7 ANTIBODY - Antibody formulations are described comprising a mixture of a non-reducing sugar, an anti-α4β7 antibody and at least one amino acid. The disclosed formulations have improved stability, reduced aggregate formation, and may retard degradation of the anti-α4β7 antibody therein or exhibit any combinations thereof. The present invention further provides a safe dosing regimen of these antibody formulations that is easy to follow, and which results in a therapeutically effective amount of the anti-α4β7 antibody in vivo. | 11-08-2012 |
20120282250 | IL-21 ANTAGONISTS - Monoclonal antibodies are identified that bind the IL-21 protein. These antibodies are used to identify regions of the IL-21 protein to where binding neutralizes IL-21 activity. Hybridomas and methods of producing anti-IL-21 monoclonal antibodies are described. The monoclonal antibodies are useful in treating IL-21-mediated diseases, which may include autoimmune and inflammatory diseases such as pancreatitis, type I diabetes (IDDM), Graves Disease, inflammatory bowel disease (IBD), Crohn's Disease, ulcerative colitis, irritable bowel syndrome, multiple sclerosis, rheumatoid arthritis, diverticulosis, systemic lupus erythematosus, psoriasis, ankylosing spondylitis, scleroderma, systemic sclerosis, psoriatic arthritis, osteoarthritis, atopic dermatitis, vitiligo, graft vs. host disease (GVHD), cutaneous T cell lymphoma (CTCL), Sjogren's syndrome, glomerulonephritis, IgA nephropathy, graft versous host disease, transplant rejection, atopic dermatitis, anti-phospholipid syndrome, and asthma, and other autoimmune diseases. | 11-08-2012 |
20120282251 | ANTI-CLUSTERIN ANTIBODIES AND ANTIGEN BINDING FRAGMENTS AND THEIR USE TO REDUCE TUMOR VOLUME - Novel antibodies and antigen binding fragments that specifically bind to clusterin are described. In some embodiments, the antibodies block the biological activity of clusterin and are useful in composition in certain cancers, more particularly in cancers, such as endometrial carcinoma, breast carcinoma, hepatocellular carcinoma, prostate carcinoma, a renal cell carcinoma, ovarian carcinoma, pancreatic carcinoma, and colorectal carcinoma. The invention also relates to cells expressing the humanized or hybrid antibodies. Additionally, methods of detecting and treating cancer using the antibodies and fragments are also disclosed. | 11-08-2012 |
20120282252 | 5Imidazoquinolines and Pyrimidine Derivatives as Potent Modulators of VEGF-Driven Angiogenic Processes - The invention relates to the use of compounds of formula (I) or (II) | 11-08-2012 |
20120282253 | INTERLEUKIN-10 ANTIBODIES - The methods and compositions provided herein relate generally to IL-10 specific antibodies and uses thereof. More specifically, compositions of humanized IL-10 specific antibodies and methods to use such antibodies in modulating the biological activity of IL-10, particularly in autoimmune disorders and pathogen-mediated immunopathology. | 11-08-2012 |
20120282254 | CD127 BINDING PROTEINS - Antigen binding proteins which bind to human IL-7 receptor (CD127) are provided. The antigen binding proteins are typically antibodies, and are useful in the treatment of diseases or disorders in humans, particularly autoimmune diseases such as multiple sclerosis. | 11-08-2012 |
20120288494 | Anti-IL-12/IL-23 antibodies and uses thereof - The present invention provides antibodies, and antigen-binding portions thereof, that bind to epitopes comprising at least one amino acid residues from residues 1-197 of the p40 subunit of IL-12 and/or IL-23. The invention further provides nucleic acids encoding the antibodies, compositions, vectors and host cells comprising the antibodies, and methods of making and using the same. | 11-15-2012 |
20120288495 | THERAPEUTIC COMPOSITIONS AND METHODS - Methods relating to treating conditions that do not respond well to EGF-r antagonist therapies are disclosed. Generally, the methods include administering to a subject a composition that includes a β-glucan and, as either a second composition or a second component of the composition, either antibody that binds to at least one antigen specific to the KRAS-mutated cells and/or an EGF-r antagonist. | 11-15-2012 |
20120288496 | Notch-Binding Agents and Antagonists and Methods of Use Thereof - The present invention relates to Notch-binding agents and Notch antagonists and methods of using the agents and/or antagonists for treating diseases such as cancer. The present invention provides antibodies that specifically bind to a non-ligand binding region of the extracellular domain of one or more human Notch receptor, such as Notch2 and/or Notch3, and inhibit tumor growth. The present invention further provides methods of treating cancer, the methods comprising administering a therapeutically effective amount of an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human Notch receptor protein and inhibits tumor growth. | 11-15-2012 |
20120288497 | COMBINATION OF ANGIOPOIETIN-2 ANTAGONIST AND OF VEGF-A, KDR AND/OR FLT1 ANTAGONIST FOR TREATING CANCER - The invention relates to agents which possess anti-angiogenic activity and are accordingly useful in methods of treatment of disease states associated with angiogenesis in the animal or human body. More specifically the invention concerns a combination of an antagonist of the biological activity of Angiopoietin-2 and an antagonist of the biological activity of VEGF-A, and/or KDR, and/or Flt1, and uses of such antagonists. | 11-15-2012 |
20120288498 | POLYNUCLEOTIDES AND POLYPEPTIDE SEQUENCES INVOLVED IN CANCER - The present invention relates to polynucleotide and polypeptide sequences which are differentially expressed in cancer cells compared to normal cells. The present invention more particularly relates to the use of these sequences in the diagnosis, prognosis or treatment of cancer and in the detection of cancer cells. | 11-15-2012 |
20120288499 | METHODS FOR DIAGNOSIS AND TREATMENT OF CUTANEOUS T CELL LYMPHOMAS - The present invention relates to a method for diagnosing a cutaneous T cell lymphoma (CTCL) in a patient, detecting the abnormal expression of NKp46 receptor on malignant T cells and to a kit for diagnosing a CTCL in a patient, said kit comprising an antibody capable of detecting NKp46 receptor and an antibody capable of detecting T cells. Furthermore, the invention refers to an anti-NKp46 antibody for use in the treatment of CTCL and a pharmaceutical composition for the treatment of CTCL comprising said anti-NKp46 antibody. | 11-15-2012 |
20120288500 | HUMAN MONOCLONAL ANTIBODIES TO BTLA AND METHODS OF USE - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies that specifically bind to BTLA with high affinity. Nucleic acid molecules encoding the antibodies of the disclosure, expression vectors, host cells and methods for expressing the antibodies of the disclosure are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of the disclosure are also provided. The disclosure also provides methods for detecting BTLA, as well as methods for treating various diseases, including cancer and infectious diseases, using anti-BTLA antibodies. | 11-15-2012 |
20120288501 | SUBSTITUTED BENZAZOLES AND METHODS OF THEIR USE AS INHIBITORS OF RAF KINASE - New substituted benz-azole compounds, compositions and methods of inhibition of Raf kinase activity in a human or animal subject are provided. The new compounds compositions may be used either alone or in combination with at least one additional agent for the treatment of a Raf kinase mediated disorder, such as cancer. | 11-15-2012 |
20120288502 | COMPOSITIONS AND METHODS FOR IMPROVING POTENCY AND BREADTH OF HIV ANTIBODIES - Embodiments of the present invention are directed to compositions and methods for anti-HIV (anti-CD4 binding site) antibodies having improved potency and breadth. | 11-15-2012 |
20120294851 | Cancer Therapies and Pharmaceutical Compositions Used Therein - The invention relates to compositions and methods to inhibit gene expression. In particular, the invention provides co-therapies comprising oligonucleotides plus other therapies to treat cancer. | 11-22-2012 |
20120294852 | ANTAGONISTS OF IL-6 TO RAISE ALBUMIN AND/OR LOWER CRP - The present invention is directed to therapeutic methods using antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat cachexia, fever, weakness and/or fatigue in a patient in need thereof. In preferred embodiments, the anti-IL-6 antibodies will be humanized and/or will be aglycosylated. Also, in preferred embodiments these patients will comprise those exhibiting (or at risk of developing) an elevated serum C-reactive protein level. In another preferred embodiment, the patient's survivability or quality of life will preferably be improved. | 11-22-2012 |
20120294853 | CD19 Binding Agents and Uses Thereof - This invention, inter alia, relates to CD19 binding agents and methods of using such CD19 binding agents for treating disease. | 11-22-2012 |
20120294854 | AMINO NICOTINIC AND ISONICOTINIC ACID DERIVATIVES AS DHODH INHIBITORS - The present disclosure relates to compounds of formula (I): | 11-22-2012 |
20120301458 | CYCLOPROPYL MODULATORS OF P2Y12 RECEPTOR - The present invention relates to new cyclopropyl modulators of P2Y12 receptor activity, pharmaceutical compositions thereof, and methods of use thereof | 11-29-2012 |
20120301459 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH INCREASED ANTIBODY DEPENDENT CELLULAR CYTOTOXICITY (ADCC) - The present invention is directed to a pharmaceutical composition comprising: (A) a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity (ADCC); and (B) a chemotherapeutic agent selected from the group consisting of: cyclophosphamide, vincristine and doxorubicine. The present invention is also directed to a method for the treatment of a CD20 expressing cancer, comprising administering to a patient in need of such treatment (i) an effective first amount of a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity; and (ii) an effective second amount of one or more chemotherapeutic agents selected from the group consisting of cyclophosphamide, vincristine and doxorubicine. | 11-29-2012 |
20120301460 | SUBCUTANEOUSLY ADMINISTERED ANTI-IL-6 RECEPTOR ANTIBODY - The present application discloses methods for treating an IL-6-mediated disorder such as rheumatoid arthritis (RA), juvenile idiopathic arthritis (JIA), systemic JIA (sJIA), polyarticular course JIA (pcJIA), systemic sclerosis, or giant cell arteritis (GCA), with subcutaneously administered antibody that binds interleukin-6 receptor (anti-IL-6R antibody). In particular, it relates to identification of a fixed dose of anti-IL-6R antibody, e.g. tocilizumab, which is safe and effective for subcutaneous administration in patients with IL-6-mediated disorders. In addition, formulations and devices useful for subcutaneous administration of an anti-IL-6R antibody are disclosed. | 11-29-2012 |
20120301461 | 1D05 PCSK9 ANTAGONISTS - Antagonists of human proprotein convertase subtilisin-kexin type 9 (“PCSK9”) are disclosed. The disclosed antagonists are effective in the inhibition of PCSK9 function and, accordingly, present desirable antagonists for use in the treatment of conditions associated with PCSK9 activity. The present invention also discloses nucleic acid encoding said antagonists, vectors, host cells, and compositions comprising the antagonists. Methods of making PCSK9-specific antagonists as well as methods of using the antagonists for inhibiting or antagonizing PCSK9 function are also disclosed and form important additional aspects of the present disclosure. | 11-29-2012 |
20120301462 | Compounds - Binding members, e.g. human antibody molecules, which bind interleukin-6 (IL-6) and neutralise its biological effects. Use of binding members for IL-6 in medical treatment e.g. for treating inflammatory diseases and tumours associated with IL-6. | 11-29-2012 |
20120301463 | Methods for Modulation of Autophagy Through the Modulation of Autophagy-Enhancing Gene Products - The present disclosure relates to methods for the modulation of autophagy and the treatment of autophagy-related diseases, including cancer, neurodegenerative diseases and pancreatitis. | 11-29-2012 |
20120301464 | JANUS KINASE INHIBITORS FOR TREATMENT OF DRY EYE AND OTHER EYE RELATED DISEASES - Methods, kits, and compositions for treating dry eye disorders and other related eye diseases are provided, wherein the methods, kits, and compositions utilize a JAK inhibitor. | 11-29-2012 |
20120308558 | Methods of Using Antibodies That Bind The Glutamate Ligand Binding Region of Notch1 - Isolated antibodies that specifically binds to an extracellular conserved ligand binding region of a human Notch receptor and inhibits growth of a tumor are described. Also described are methods of treating cancer, the method comprising administering an anti-Notch antibody in an amount effective to inhibit tumor growth. | 12-06-2012 |
20120308559 | METHOD OF TREATING HEMOLYTIC DISEASE - Paroxysmal nocturnal hemoglobinuria or other hemolytic diseases are treated using a compound which binds to or otherwise blocks the generation and/or the activity of one or more complement components, such as, for example, a complement-inhibiting antibody. | 12-06-2012 |
20120308560 | Antineoplastic Combinations with mTOR Inhibitor, Trastuzumab and/or HKI-272 - A combination of temsirolimus and trastuzumab in the treatment of cancer is provided. A combination of temsirolimus and HKI-272 is provided. A combination of a trastuzumab and a HKI-272 is also provided. Regimens and kits for treatment of metastatic breast cancer, containing trastuzumab, temsirolimus and/or HKI-272, optionally in combination with other anti-neoplastic agents, or immune modulators are described. | 12-06-2012 |
20120308561 | POLYNUCLEOTIDES AND POLYPEPTIDE SEQUENCES INVOLVED IN THE PROCESS OF BONE REMODELING - This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling; variants and derivatives of the polynucleotides and corresponding polypeptides; uses of the polynucleotides, polypeptides, variants and derivatives; and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are, the isolation and identification of polynucleotides, polypeptides, variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes. | 12-06-2012 |
20120308562 | METHODS OF TREATING MESOTHELIOMA WITH A PI3K INHIBITOR COMPOUND - Methods are provided for treating mesothelioma patients with a dual PI3K/mTOR inhibitor, GDC-0980: (S)-1-(4-((2-(2-aminopyrimidin-5-yl)-7-methyl-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)piperazin- | 12-06-2012 |
20120308563 | REGULATORY B CELLS (TBREGS) AND THEIR USE - Regulatory B cells (tBreg) are disclosed herein. These regulatory B cells express CD25 (CD25 | 12-06-2012 |
20120308564 | TREATMENT OF A METABOLIC DISORDER - The present disclosure relates to the field of metabolic disorders, including type II diabetes and obesity. Specifically, the disclosure relates to methods of treating and/or preventing a metabolic disorder with an IL-18 antagonist, in particular an anti-IL-18 antigen binding protein, in particular an anti-IL-18 antibody. | 12-06-2012 |
20120315268 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH BENDAMUSTINE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with bendamustine for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Lyl antibody and bendamustine. | 12-13-2012 |
20120315269 | IMMUNOGLOBULIN-LIKE TRANSCRIPT (ILT) RECEPTORS AS CD8 ANTAGONISTS - Compositions and methods for inhibiting effector CD8 | 12-13-2012 |
20120315270 | RSV IMMUNOGENS, ANTIBODIES AND COMPOSITIONS THEREOF - The present invention provides immunogens that protect against RSV infection. The present invention also provides antibody proteins that protect against RSV infection. Such immunogens and antibody proteins are produced based on three-dimensional models also included in the invention. One model is of a complex between motavizumab and its antibody-binding domain on RSV fusion (F) protein. A second model is of a complex between 10 IF antibody and its antibody-binding domain on RSV F protein. The immunogens disclosed herein have been modified to elicit a humoral response against RSV F protein without eliciting a significant cell-mediated response against RSV. Such immunogens can comprise a scaffold into which RSV contact residues are embedded. The present invention also includes methods that utilize the disclosed three-dimensional models to produce immunogens and antibody proteins of the present invention. Also disclosed are methods of using the disclosed immunogens, for example to protect individuals from RSV infection. Also disclosed are methods of using the disclosed antibody proteins, for example to protect individuals from RSV infection. | 12-13-2012 |
20120315271 | METHODS FOR TREATING BONE CANCER BY ADMINISTERING A NERVE GROWTH FACTOR ANTAGONIST ANTIBODY - The invention features methods and compositions for preventing or treating bone cancer pain including cancer pain associated with bone metastasis by administering an antagonist of nerve growth factor (NGF). The NGF antagonist may be an anti-NGF (such as anti-hNGF) antibody that is capable of binding hNGF. | 12-13-2012 |
20120315272 | METHODS FOR PREVENTION AND TREATMENT OF INFLAMMATION USING ANTI-CHEMOKINE ANTIBODIES - It is possible to inhibit inflammatory processes by administration of antibodies to chemokines. Identification of chemokines which are over-produced makes it possible to block specific chemokine activity using antibodies to the over-expressed chemokines. | 12-13-2012 |
20120315273 | TREATING SKIN CANCER - This document provides methods and materials related to treating skin cancer. For example, methods and materials relating to the use of a taxane compound, an alkylating agent, and an anti-VEGF polypeptide antibody to treat skin cancer are provided. | 12-13-2012 |
20120321614 | ANTIBODIES TO C-MET - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to c-Met, preferably human c-Met, and that function to inhibit c-Met. The invention also relates to human anti-c-Met antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-c-Met antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-c-Met antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-c-Met antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 12-20-2012 |
20120321615 | Assay for Metastatic Colorectal Cancer - Disclosed herein is a method for predicting the prognosis, the likelihood of metastasis in, or the desirability of administering an aggressive therapy to, a subject with colorectal cancer, comprising determining, in a sample from the subject, the level of phosphorylation of one or more of certain proteins compared to a positive and/or negative reference standard; or the total amount of COX-2 protein compared to a positive and/or negative reference standard. Also described are methods for treating subjects likely to develop metastatic colorectal carcinoma, and pharmaceutical compositions and kits for implementing the methods of the invention. | 12-20-2012 |
20120321616 | STABILIZED LIQUID ANTI-RSV ANTIBODY FORMULATIONS - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 12-20-2012 |
20120321617 | HUMANIZED ANTI-IL 10 ANTIBODIES FOR THE TREATMENT OF SYSTEMIC LUPUS ERYTHEMATOSUS (SLE) - Provided is a humanized or chimeric antibody or fragment thereof capable of binding to interleukin-10 (IL-10), wherein said antibody or fragment thereof: (i) binds to the same region of IL-10 as the 1L-10 receptor α (IL-I10Ra) and is not capable of binding IL-10 when the IL-10 is bound to the IL-10 receptor; and (ii) binds to IL-10 in homodimeric form by binding a discontinuous epitope comprising residues of both monomers. Further provided are related products and methods involving the use of the antibody or fragment thereof. | 12-20-2012 |
20120321618 | HUMANIZED ANTI-IL 10 ANTIBODIES FOR THE TREATMENT OF SYSTEMIC LUPUS ERYTHEMATOSUS (SLE) - Provided is a humanized or chimeric antibody or fragment thereof capable of binding to interleukin-10 (Th-10), wherein said antibody or fragment thereof is capable of being administered to a subject in the absence of an intolerable increase in the level of pro-inflammatory cytokines. Further provided are methods of treatment involving the use of the antibody or fragment thereof. | 12-20-2012 |
20120321619 | ANTI-C4.4A ANTIBODIES AND USES THEREOF - The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for the membrane-anchored, 29 kDa C4.4a polypeptide, which is over expressed in several tumors, e.g. lung, colorectal, pancreas, prostate, renal and breast cancer. These antibodies, accordingly, can be used to treat these and other disorders and conditions. Antibodies of the invention also can be used in the diagnostics field, as well as for further investigating the role of C4.4a in the progression of disorders associated with cancer. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. | 12-20-2012 |
20120321620 | METHODS AND COMPOSITIONS FOR INHIBITING CD32B EXPRESSING CELLS - The present invention relates to immunoglobulins that bind FcγRIIb+ cells and coengage the antigen on the cell's surface and an FcγRIIb on the cell's surface, methods for their generation, and methods for using the immunoglobulins. | 12-20-2012 |
20120321621 | INHIBITION OF FcyR-MEDIATED PHAGOCYTOSIS WITH REDUCED IMMUNOGLOBULIN PREPARATIONS - The invention relates to pharmaceutical compositions for inhibiting FcγR-mediated phagocytosis that include a reduced immunoglobulin inhibitor of FcγR-mediated phagocytosis, such as anti-D, in combination with a pharmaceutically acceptable carrier. The invention also relates to methods for treating or preventing an autoimmune or alloimmune disease that include administering to a subject in need thereof a therapeutically effective amount of a reduced immunoglobulin inhibitor of FcγR-mediated phagocytosis. | 12-20-2012 |
20120321622 | Compositions of Kinase Inhibitors and Their Use for Treatment of Cancer and Other Diseases Related to Kinases - The present invention relates to novel thiazole-substituted indolin-2-ones as inhibitors of CSCPK and related kinases; to methods of inhibiting cancer stem cells by using a kinase inhibitor; to pharmaceutical compositions containing such compounds; and to methods of using such compounds in the treatment of a protein kinase related disorder in a mammal; and to processes of making such compounds and intermediates thereof. | 12-20-2012 |
20120328603 | ASSAYS AND METHODS USING BIOMARKERS - Methods and assays examining expression of one or more biomarkers in a mammalian tissue or cell sample are provided. According to the disclosed methods and assays, detection of the expression of one or more such biomarkers is predictive or indicative that the tissue or cell sample will be sensitive to apoptosis-inducing agents such as Apo2L/TRAIL and anti-DR5 agonist antibodies. Certain biomarkers which may be examined include fucosyltransferases, in particular fucosyltransferase 3 (FUT3) and/or fucosyltransferase 6 (FUT6), as well as sialyl Lewis A and/or X antigens. Kits and articles of manufacture are also provided. | 12-27-2012 |
20120328604 | METHODS AND COMPOSITIONS FOR TREATING AND PREVENTING DISEASE ASSOCIATED WITH AVB5 INTEGRIN - The present invention provides compositions and methods for treating and preventing disease associated with αvβ5 integrin by blocking binding to αvβ5 integrin. In particular, antibodies specific for αvβ5 integrin are useful for preventing, treating, and reversing sepsis. | 12-27-2012 |
20120328605 | COMPOSITIONS AND USES - The invention provides a TLR agonist and an antibody which binds to an antigen such as a β-amyloid antigen for use in stimulating an immune response to the antigen in an individual. The TLR agonist can be delivered at the same time as the antibody, less than 48 hours before the antibody or after the antibody. The compositions and methods provided are useful for prevention or treatment of Alzheimer's disease. | 12-27-2012 |
20120328606 | Methods Of Diagnosing And Treating Pulmonary Diseases Or Disorders - The present disclosure provides methods of diagnosing a subject as having a pulmonary disease or disorder, e.g., an eosinophilic disease or disorder based on the determination of white blood cell ratios. The disclosure also provides white blood cell ratio-based methods of treating, prognosing, or monitoring a pulmonary disease or disorder, as well as methods of methods of predicting a dosage regimen, identifying a candidate therapeutic agent, identifying a patient as a candidate for a therapeutic agent, and methods of designing a personalized therapy. | 12-27-2012 |
20120328607 | GENETIC MARKERS INDICATIVE OF A CANCER PATIENT RESPONSE TO TRASTUZUMAB (HERCEPTIN) - The invention relates to the fields of therapeutics and identifying candidates for therapy, in particular to a method of identifying candidates for trastuzumab (Herceptin®) therapy in a patient presenting with breast cancer based on the presence or absence of specific genetic markers in a tumor sample from said patient. | 12-27-2012 |
20120328608 | METHODS OF TREATING CANCER USING NOTCH ANTAGONISTS - The present invention relates to methods of treating cancer in general, and leukemia in particular, using Notch1 and Notch3 antagonists singly or in combination. Compositions and methods for the treatment and diagnosis of Notch-associated cancers are also provided. | 12-27-2012 |
20120328609 | Modulation of Axon Degeneration - The invention relates generally to treatment of neurological disorders and nervous system injuries. The invention specifically provides methods of using modulators of particular target proteins to modulate degeneration of neurons or portions thereof, such as axons. | 12-27-2012 |
20120328610 | TRIAZOLOPYRIDINES - The present invention relates to triazolopyridine compounds of general formula (I) which are Monopolar Spindle 1 kinase (Mps-1 or TTK) inhibitors: Formula (I), in which R | 12-27-2012 |
20120328611 | SUBSTITUTED TRIAZOLOPYRIDINES - The present invention relates to triazolopyridine compounds of general formula (I) which are Monopolar Spindle 1 kinase (Mps-1 or TTK) inhibitors: Formula (I), in which R | 12-27-2012 |
20120328612 | ANTI-FLT3 ANTIBODIES AND METHODS OF USING THE SAME - The present invention relates to anti-FLT3 antibodies with a modified Fc region comprising the amino acid substitutions 239D and 332E to enhance antibody-dependent cell cytotoxicity (ADCC) of these antibodies. The invention further relates to pharmaceutical compositions containing these antibodies, nucleic acids encoding these antibodies as well as methods of using such antibodies. | 12-27-2012 |
20120328613 | HUMANIZED ANTI-FACTOR D ANTIBODIES AND USES THEREOF - The invention relates to anti-Factor D antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their production and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 12-27-2012 |
20120328614 | Immunoglobulin Formulation and Method of Preparation Thereof - A stable aqueous pharmaceutical formulation comprising a therapeutically effective amount of an antibody, polysorbate 80, a buffer which inhibits polysorbate oxidation is described along with methods of making the preparation. Also described are formulations with high antibody concentrations which maintain fixed volumes and which may be used on patients of variable weight. | 12-27-2012 |
20130004481 | ANTICANCER THERAPY - The invention describes anti-cancer therapies comprising using dual Aurora kinase/MEK inhibitors as described herein. | 01-03-2013 |
20130004482 | Methods of Treating Breast Cancer with Anthracycline Therapy - The application describes methods for screening subjects with breast cancer to determine if the breast cancer will be responsive to a breast cancer therapy including an anthracycline. The application also describes methods for treating subjects with breast cancer by screening them for the likelihood of the effectiveness of treating the cancer with a therapy including anthracycline and administering the therapy in subjects when it is found that anthracycline is likely to be effective. | 01-03-2013 |
20130004483 | MEDICAL METHODS AND AGENTS FOR USE THEREIN - The present invention provides an immunomodulatory agent for use in the local treatment of tumours, wherein the treatment comprises patient-specific optimisation of the dose of the immunomodulatory agent to identify the maximum therapeutic dose that does not induce an increase in the number of local regulatory T cells (Treg cells) in the patient The invention further provides methods for the local treatment of tumours as well as methods for optimising treatments for the same | 01-03-2013 |
20130004484 | ANTI-C-MET ANTIBODY FORMULATIONS - Provided herein are pharmaceutical formulations comprising a one-armed, anti-c-met antibody and uses of the same. | 01-03-2013 |
20130004485 | HUMANIZED AND CHIMERIC ANTI-PROPERDIN ANTIBODIES - An isolated anti-properdin antibody or antigen binding portion thereof includes a heavy chain variable domain including the 3CDRs in SEQ ID NO: 1 and light chain variable domain including the 3 CDRS in SEQ ID NO: 9. | 01-03-2013 |
20130004486 | TREATMENT OF VASCULARIZED PIGMENT EPITHELIAL DETACHMENT WITH ANTI-VEGF THERAPY - Methods for treating vascularized pigment epithelial detachment using anti-VEGF agents are disclosed. | 01-03-2013 |
20130004487 | SCD40L AND PLACENTAL GROWTH FACTOR (PIGF) AS BIOCHEMICAL MARKER COMBINATIONS IN CARDIOVASCULAR DISEASES - The invention relates to novel markers of vascular inflammation and combinations thereof as diagnostic and prognostic tools in patients with cardiovascular diseases. The markers also act as tools that facilitate the selection of active ingredients for the treatment of such diseases, and finally act as starting points for the treatment of cardiovascular diseases. Furthermore, the invention relates to the creation of an individual risk profile of negative events that are associated with the progression of arteriosclerosis. | 01-03-2013 |
20130004488 | ANTI-CANCER AGENT DELIVERY VEHICLES CAPABLE OF IMPROVED LOADING - There is provided a conjugate of a delivery agent containing a chemical moiety and at least one flavonoid. The flavonoid exists in a monomeric form or dimeric form before conjugation and remains in the monomeric form or dimeric form after conjugation. Preferably, the conjugate comprises two flavonoids. The delivery agent is conjugated at the C6 and/or the C8 position of the A ring of the flavonoid. An anti-cancer agent delivery vehicle comprising an anti-cancer agent and the conjugate is also provided. | 01-03-2013 |
20130011389 | COMPOSITIONS AND METHODS FOR TREATING COAGULATION RELATED DISORDERS - Disclosed are methods for preventing or treating sepsis, a sepsis-related condition or an inflammatory disease in a mammal. In one embodiment, the method includes administering to the mammal a therapeutically effective amount of at least one humanized antibody, chimeric antibody, or fragment thereof that binds specifically to tissue factor (TF) to form a complex in which factor X or factor IX binding to the complex is inhibited and the administration is sufficient to prevent or treat the sepsis in the mammal. The invention has a wide spectrum of useful applications including treating sepsis, disorders related to sepsis, and inflammatory diseases such as arthritis. | 01-10-2013 |
20130011390 | METHODS OF TREATING CENTRAL NERVOUS SYSTEM ISCHEMIC OR HEMORRHAGIC INJURY USING ANTI ALPHA4 INTEGRIN ANTAGONISTS - Methods of, and compositions for, treating central nervous system injury with an antagonist of an alpha4 subunit containing integrin are described. | 01-10-2013 |
20130011391 | ANTI-PSGL-1 ANTIBODIES AND USES THEREOF - Provided herein, in one aspect, are antibodies that immunospecifically bind to PSGL-1, polynucleotides comprising nucleotide sequences encoding such antibodies, and expression vectors and host cells for producing such antibodies. Also provided herein are kits and pharmaceutical compositions comprising antibodies that specifically bind to PSGL-1, as well as methods of treating a disorder or disease caused by or associated with increased proliferation and/or numbers of activated T cells using the antibodies described herein. | 01-10-2013 |
20130011392 | METHOD FOR ASSESSING THE ABILITY OF A PATIENT TO RESPOND TO OR BE SAFELY TREATED BY A NUCLEOSIDE ANALOG BASED-CHEMOTHERAPY - The invention relates to an in vitro method for determining the ability of a patient with cancer to respond to a monochemotherapy or to a polychemotherapy involving the administration of at least one chemotherapeutic agent the liver elimination of which involves cytidine deaminase (CDA), or to be treated by at least one such chemotherapeutic agent, which method comprises determining the CDA activity in a biological sample of the patient, wherein a CDA activity above 6 U/mg of serum sample total protein is indicative of the inability of the patient to respond to the chemotherapy, a CDA activity between 1.1 U/mg and 6 U/mg of serum sample total protein is indicative of the ability of the patient to be treated by the chemotherapeutic agent when said agent is administered in the context of a monochemotherapy, and a CDA activity between 1.4 U/mg and 6 U/mg of serum sample total protein is indicative of the ability of the patient to be treated by the chemotherapeutic agent when said agent is administered in the context of a polychemotherapy. | 01-10-2013 |
20130011393 | BAD PATHWAY GENE SIGNATURE - The invention provides materials and methods for prognosing cancer, and predicting an individual's responsiveness to cancer treatments, methods of treating cancer, and materials and methods for obtaining BAD pathway gene expression profiles useful in carrying out the methods of the invention. | 01-10-2013 |
20130011394 | COMPLEXES COMPRISING MHC CLASS I FUSION POLYPEPTIDES AND ANTIGEN-SPECIFIC ANTIBODIES AND METHODS OF USE - The invention comprises a complex comprising as first part an antibody derived part that specifically binds to a target antigen, and as second part a virus-derived peptide linked to a MHC class I protein complex. | 01-10-2013 |
20130011395 | METHODS AND COMPOSITIONS FOR TREATING AUTOIMMUNE DISEASES OR CONDITIONS - The present invention relates to methods of treating immune disorders, particularly autoimmune and inflammatory disorders such as rheumatoid arthritis, and methods of producing antibodies for use in therapeutic strategies for treating such disorders. Generally, the present methods involve the use of antibodies that specifically bind to NKG2D receptors present on the surface of cells underlying the disorders. | 01-10-2013 |
20130011396 | TREATMENT PROTOCOL - Combination treatments with an antiangiogenesis agent and non-toxic blood levels of ethanol and/or DMSO are disclosed. | 01-10-2013 |
20130017192 | Diagnosis and Treatment of Autoantibody-Mediated Heart DiseaseAANM Lipes; Myra A.AACI BrooklineAAST MAAACO USAAGP Lipes; Myra A. Brookline MA USAANM Cornivelli; LizbethAACI MedfordAAST MAAACO USAAGP Cornivelli; Lizbeth Medford MA US - Provided herein are, inter alia, methods of diagnosing and treating autoimmune cardiomyopathy in subjects, based upon the detection of IgG4 autoantibodies to cardiac troponin I (cTnI). | 01-17-2013 |
20130017193 | ANTIBODY FORMULATIONS - Formulations of VLA-4 binding antibody are described. | 01-17-2013 |
20130017194 | FAK INHIBITORS - A compound of the formula (I): | 01-17-2013 |
20130017195 | ANTI-FOLATE RECEPTOR ALPHA ANTIBODIES AND USES THEREOF - Described herein are antibodies, and antigen-binding fragments thereof, that are specific for folate receptor alpha, related polynucleotides, expression vectors, and cells that express the described antibodies. Also provided are methods of using the described antibodies, and antigen-binding fragments thereof, and related kits. Provided herein are also methods for diagnosing cancers, such as breast cancer, thyroid cancer, colorectal cancer, endometrial cancer, fallopian tube cancer, ovarian cancer, or lung cancer, using the described antibodies, and antigen-binding fragments thereof. The methods involve determining the amount of folate receptor alpha in a sample derived from a subject and comparing this level with the level of folate receptor alpha in a control sample or reference sample. | 01-17-2013 |
20130017196 | SUBSTITUTED IMIDAZOLE DERIVATIVES - The present invention relates to new substituted imidazole compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds. The compounds of the invention have the following general formula: | 01-17-2013 |
20130017197 | STABILIZED ANTIBODY PREPARATIONS AND USES THEREOF - The present invention is directed to stabilized intact antibody formulations, related methods and uses thereof. In particular, the invention relates to a method of stabilizing an intact antibody in a liquid carrier. | 01-17-2013 |
20130017198 | MANIPULATION OF CALCIUM CHANNELS TO REGULATE AFTER-DEPOLARIZATION EVENTS IN CARDIAC MYOCYTES - A novel mechanism by which after-depolarization occurs in cardiac myocytes has been discovered, involving calcium influx through the arachidonate-regulated calcium channel (ARCC) and the store-operated calcium channel (SOCC). Because after-depolarization of the myocyte is a major cause of cardiac arrhythmia, this discovery provides new approaches for treating and preventing heart disease. By down-regulating the activity of the ARCC or the SOCC, after-depolarization can be decreased and cardiac arrhythmia can be prevented, reduced, or eliminated. This can be accomplished using pharmaceuticals containing inhibitors of the ARCC or the SOCC, or by genetically modifying cells to reduce ARCC or SOCC activity. In addition, assays are disclosed using the ARCC or SOCC to discover potential anti-arrhythmic agents. Cellular and animal models of arrhythmia are disclosed in which the activity of the ARCC or SOCC is increased to promote after-depolarization and induce arrhythmia. | 01-17-2013 |
20130022594 | SELECTIVE FAK INHIBITORS - A compound of the formula (I): | 01-24-2013 |
20130022595 | VARIANTS OF HUMANIZED IMMUNOMODULATORY MONOCLONAL ANTIBODIES - The present invention relates to humanized monoclonal antibodies, pharmaceutical compositions that include the same, and use thereof for the treatment of a variety of indications, particularly cancer and immunodeficiency disorders. In particular, the present invention provides modified antibodies or fragments thereof having specific amino acid modifications compared to the humanized monoclonal immunomodulatory antibody termed hBAT-1. | 01-24-2013 |
20130022596 | METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS - Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer. | 01-24-2013 |
20130028888 | Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease - The present invention provides chimeric and humanized versions of anti-CD22 mouse monoclonal antibody, HB22.7. The anti-CD22 antibodies of the invention comprise four human or humanized framework regions of the immunoglobulin heavy chain variable region (“VH”) and four human or humanized framework regions of the immunoglobulin light chain variable region (“VK”). The invention further comprises heavy and/or light chain FW regions that contain one or more backmutations in which a human FW residue is exchanged for the corresponding residue present in the parental mouse heavy or light chain. Human or humanized VH framework regions of antibodies of the invention may comprise one or more of the following residues: a valine (V) at position 24 of framework region 1, a glycine (G) at position 49 of framework region 2, and an asparagine (N) at position 73 of framework region 3, numbered according to Kabat. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human CD22 antigen and that preferably mediate human ADCC, CDC, and/or apoptosis for: the treatment of B cell diseases and disorders in human subjects, such as, but not limited to, B cell malignancies, for the treatment and prevention of autoimmune disease, and for the treatment and prevention of graft-versus-host disease (GVHD), humoral rejection, and post-transplantation lymphoproliferative disorder in human transplant recipients. | 01-31-2013 |
20130028889 | DOSING REGIMENS FOR TREATING AND PREVENTING OCULAR DISORDERS USING C-RAF ANTISENSE - The present invention provides methods and dosing regimens for treating and preventing ocular disorders using c-raf antisense oligonucleotides, alone or in combination with other agents. | 01-31-2013 |
20130028890 | METHOD FOR DETECTING REGULATORY T CELLS USING EXPRESSION OF FOLATE RECEPTOR 4 AS INDICATOR, METHOD FOR TREATING DISEASES USING THE DETECTION METHOD, PHARMACEUTICAL COMPOSITION FOR IMMUNOSTIMULATION, AND METHOD FOR TREATING DISEASES USING THE COMPOSITION - An object of the present invention is to provide a technique to distinguish between T | 01-31-2013 |
20130028891 | Unconjugated Anti-TfR Antibodies and Compositions Thereof for the Treatment of Cancer - Disclosed herein are methods and compositions for treating cancer. In particular, the in vivo efficacy of unconjugated anti-TfR antibodies, such as ch128.1, are disclosed herein. | 01-31-2013 |
20130028892 | METHOD OF TREATING OSTEOARTHRITIS WITH AN ANTIBODY TO NGF - Methods are disclosed for treating osteoarthritis in a human subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-human NGF antibody, or antigen-binding fragment thereof, wherein at least one symptom associated with osteoarthritis is prevented, ameliorated or improved. | 01-31-2013 |
20130034544 | METHODS FOR TREATING, DIAGNOSING, AND MONITORING LUPUS - Methods of identifying, diagnosing, and prognosing lupus, including certain subphenotypes of lupus, are provided, as well as methods of treating lupus, including certain subpopulations of patients. The methods provided are based on a set of alleles associated with systemic lupus erythematosus (SLE) risk loci including BLK, TNIP1, PRDM1, JAZF1, UHRF1BP1, IL1 O, IFIH1, CFB, CEC16A, IL12B and SH2B3 that contribute to SLE risk. Also provided are methods for identifying effective lupus therapeutic agents and predicting responsiveness to lupus therapeutic agents. | 02-07-2013 |
20130034545 | TREATMENT OF TRAUMATIC BRAIN INJURY USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID - Methods are provided for treating traumatic brain injury (TBI) using antibodies that bind lysophosphatidic acid (LPA). Particularly preferred antibodies to LPA are monoclonal antibodies, including humanized monoclonal antibodies. In particular, the TBI may be blast-induced TBI (bTBI) such as commonly occurs in battlefield injuries. The treatment may include functional locomotor recovery. | 02-07-2013 |
20130034546 | Analyzing Copy Number Variation in the Detection of Cancer - The invention provides a method for determining copy number variations (CNV) of a sequence of interest in a test sample that comprises a mixture of nucleic acids that are known or are suspected to differ in the amount of one or more sequence of interest. The method comprises a statistical approach that accounts for accrued variability stemming from process-related, interchromosomal and inter-sequencing variability. The method is applicable to determining CNV of any fetal aneuploidy, and CNVs known or suspected to be associated with a variety of medical conditions. CNV that can be determined according to the method include trisomies and monosomies of any one or more of chromosomes 1-22, X and Y, other chromosomal polysomies, and deletions and/or duplications of segments of any one or more of the chromosomes, which can be detected by sequencing only once the nucleic acids of a test sample. | 02-07-2013 |
20130034547 | RELIABLE STABILIZATION OF N-LINKED POLYPEPTIDE NATIVE STATES WITH ENHANCED AROMATIC SEQUONS LOCATED IN POLYPEPTIDE TIGHT TURNS - A chimeric therapeutic polypeptide of a pre-existing therapeutic polypeptide is disclosed, as are a method of enhancing folded stabilization and a pharmaceutical composition of the glycosylated chimer. The pre-existing and chimeric polypeptides have substantially the same length, substantially the same amino acid residue sequence, and exhibit at least one tight turn containing a sequence of four to about seven amino acid residues in which at least two amino acid side chains extend on the same side of the tight turn and are within less than about 7 Å of each other. The chimeric therapeutic polypeptide has the sequon Aro-(Xxx)n-(Zzz)p-Asn-Yyy-Thr/Ser (SEQ ID NO:001) within that tight turn sequence such that the side chains of the Aro, Asn and Thr/Ser amino acid residues project on the same side of the turn and are within less than about 7 Å of each other. That sequon is absent from the pre-existing therapeutic polypeptide. | 02-07-2013 |
20130034548 | USE OF ERBB3 INHIBITORS IN THE TREATMENT OF TRIPLE NEGATIVE AND BASAL-LIKE BREAST CANCERS - Provided are methods of suppressing growth of triple negative breast tumors and basal-like breast tumors by contacting tumor cells with an ErbB3 inhibitor, e.g., an anti-ErbB3 antibody. Also provided are methods for treating triple negative breast cancer or basal-like breast cancer in a patient by administering to the patient an ErbB3 inhibitor, e.g., an anti-ErbB3 antibody. The treatment methods can further comprise selecting a patient having a triple negative breast cancer or basal-like breast cancer and then administering an ErbB3 inhibitor to the patient. The treatment methods also can further comprise administering at least one additional anti-cancer agent to the patient in combination with the ErbB3 inhibitor. | 02-07-2013 |
20130034549 | COMBINATION THERAPY FOR TREATING BREAST CANCER - The invention provides compositions and methods for treating breast cancer. Specifically, the invention relates to administering a Transforming Growth Factor beta (TGFβ) antagonist in combination with capecitabine and ixabepilone to treat breast cancer. | 02-07-2013 |
20130034550 | Sustained release drug delivery systems comprising a water soluble therapeutic agent and a release modifier - A biocompatible, sustained release intraocular drug delivery system comprising a protein or polynucleotide therapeutic agent, a polymeric carrier for the therapeutic agent and a long chain fatty alcohol release modifier. The biocompatible, sustained release intraocular drug delivery system can be used to treat an ocular condition. | 02-07-2013 |
20130039904 | GAMBOGIC ACID CYCLIZATION ANALOGUES, THEIR PREPARATION METHOD AND APPLICATION THEREOF - The present invention discloses a gamboge acid cyclization analogs, their preparation methods and applications by semi-synthesis with the following structural formula I-III: | 02-14-2013 |
20130039905 | Diazoxide For Use In The Treatment Or Prevention Of A Central Nervous System (CNS) Autoimmune Demyelinating Disease - The invention relates to the use of diazoxide or a pharmaceutically acceptable salt thereof at low doses to treat a CNS autoimmune demyelinating disease selected from selected from multiple sclerosis (MS), clinically isolated syndrome (CIS), tumefactive (tumor-like) M S, Marburg's acute M S, Balós's concentric sclerosis, acute disseminated encephalomyelitis (ADEM), post-vaccinal encephalitis (PVE), post-infectious encephalomyelitis (PIE) and neuromyelitis optica (NMO). | 02-14-2013 |
20130039906 | PYRAZOLO[3,4-c]PYRIDINE COMPOUNDS AND METHODS OF USE - Pyrazolo[3,4-c]pyridine compounds of Formula I, including stereoisomers, geometric isomers, tautomers, and pharmaceutically acceptable salts thereof, wherein R | 02-14-2013 |
20130039907 | METHODS OF TREATING HEMATOLOGICAL PROLIFERATIVE DISORDERS BY TARGETING EPHA3 EXPRESSED ON ABERRANT VASCULATURE IN BONE MARROW - The invention provides diagnostic and therapeutic methods for the treatment of hematological proliferative disorders. | 02-14-2013 |
20130039908 | PROGNOSTIC MARKERS AND METHODS FOR PROSTATE CANCER - The present invention relates to methods and compositions for the diagnosis, prognosis and treatment of neoplastic disorders. Some embodiments include methods, compositions, and kits for the prognosis and treatment of prostate cancer. | 02-14-2013 |
20130039909 | PREDICTING RESPONSE TO A HER INHIBITOR - The present application describes the use of low HER3 as a selection criterion for treating patients with a HER inhibitor, such as pertuzumab. | 02-14-2013 |
20130045200 | METHODS OF USING ANTI-PD-L1 ANTIBODIES AND THEIR USE TO TREAT INFECTION RESULTING FROM T-CELL DYSFUNCTION - The present application relates to methods of using anti-PD-L1 antibodies to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, including infection (e.g., acute and chronic) and tumor immunity. | 02-21-2013 |
20130045201 | METHODS OF USING ANTI-PD-L1 ANTIBODIES AND THEIR USE TO ENHANCE T-CELL FUNCTION TO TREAT TUMOR IMMUNITY - The present application relates to methods of using anti-PD-L1 antibodies to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, including infection (e.g., acute and chronic) and tumor immunity. | 02-21-2013 |
20130045202 | ANTI-PD-L1 ANTIBODIES AND ARTICLES OF MANUFACTURE - The present application relates to anti-PD-L1 antibodies, which have therapeutic use to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, including infection (e.g., acute and chronic) and tumor immunity. | 02-21-2013 |
20130045203 | Uses of Noscapine and Derivatives in Subjects Diagnosed with FAP - This disclosure relates to methods of treating or preventing cancer comprising administering a pharmaceutical composition comprising noscapine or noscapine derivatives to a subject diagnosed with a mutated adenomatous polyposis coli (APC) gene. | 02-21-2013 |
20130045204 | FLUORINATED BISPHENOL ETHER COMPOUNDS AND METHODS FOR THEIR USE - Compounds having a structure of Formula I: | 02-21-2013 |
20130052190 | CRTH2 Antagonists for Treatment of Eosinophilic Diseases and Conditions - The present invention provides a method for the treatment of allergic and inflammatory diseases or conditions by administering a compound of Formula (I). The invention provides a method of treatment that is particularly suited for patients with a high degree of airway eosinophilia in contrast to those with a lower degree of airway eosinophilia. The invention also provides a method of treatment that is particularly suited for patients with a high atopic status in contrast to those patients with a lower atopic status. | 02-28-2013 |
20130052191 | ANTI-ALPHA2 INTEGRIN ANTIBODIES AND THEIR USES - The invention relates to antibodies directed to α2β1 integrin and their uses, including humanized anti-alpha 2 (α2) integrin antibodies and methods of treatment with anti-α2integrin antibodies. More specifically the present invention relates to humanized anti-α2 integrin antibodies comprising a heavy chain variable region, a light chain variable region, a human light chain constant region and a variant human IgG1 heavy chain constant region which exhibit altered effector function. | 02-28-2013 |
20130058919 | Optimized Fc Variants and Methods for their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 03-07-2013 |
20130058920 | METHODS FOR IMPROVING THE BIOACTIVITY OF THERAPEUTIC IgE ANTIBODIES FOR THE TREATMENT OF DISEASE - The invention provides a method for increasing the bioactivity (e.g. the biosafety and efficacy) of a therapeutic IgE antibody of the invention in the treatment of a patient. Methods of the invention include: i) administering to the patient a therapeutic IgE antibody in combination with at least one bioactivity-enhancing agent, ii) strategic treatment regimens and protocols for the dosing and administration of a therapeutic IgE antibody of the invention, and iii) the use of a therapeutic IgE antibody having a variable region comprising at least one antigen binding region specific for binding an epitope of an antigen wherein the epitope is not highly repetitive or is non-repetitive. | 03-07-2013 |
20130058921 | USE OF AUTOLOGOUS EFFECTOR CELLS AND ANTIBODIES FOR TREATMENT OF MULTIPLE MYELOMA - The present disclosure provides methods for treating multiple myeloma using a combination of autologous expanded and activated NK cells from the patient and an antibody that targets an antigen on myeloma cells and/or an antibody that targets the KIR antigen on NK cells, wherein the antibodies elicit ADCC toward myeloma cells. The present disclosure provides methods for treating multiple myeloma using a combination of autologous NK cells and the anti-CS1 antibody elotuzumab. | 03-07-2013 |
20130058922 | PHARMACEUTICAL COMPOSITION CONTAINING CHOLINE - The invention relates to pharmaceutical compositions, in particular for intravenous administration, containing choline or pharmaceutically acceptable salts or analogues thereof. | 03-07-2013 |
20130058923 | BIOMOLECULAR INTERACTIONS AND INTERACTION PRODUCTS AS BIOMARKERS FOR DETECTION, DIAGNOSIS, PROGNOSIS AND PREDICTING THERAPEUTIC RESPONSES OF HUMAN DISEASES - Included in the disclosure is description of a method of determining a presence, and/or aggressiveness level, and/or response to therapy of a human disease in a subject. The method involves determining size of nanoparticles upon being exposed to a biological sample or a component of biological sample or pretreated biological sample from the subject to form an assay solution, wherein the average particle size of the assay solution is correlative to the presence, and/or aggressiveness level, and/or response to therapy of disease in said subject | 03-07-2013 |
20130058924 | HYPOXIA-RELATED GENE SIGNATURES FOR CANCER CLASSIFICATION - Biomarkers, particularly hypoxia-related genes, and methods using the biomarkers for molecular detection and classification of disease are provided. | 03-07-2013 |
20130058925 | EPITHELIAL BIOMARKERS FOR CANCER PROGNOSIS - Methods, systems and compositions for the prognosis and classification of cancer, especially bladder cancer, are provided. For example, in certain aspects methods for cancer prognosis using expression analysis of selected biomarkers such as miR-200 and TGFalpha are described. | 03-07-2013 |
20130058926 | METHOD FOR ALLEVIATING AND/OR PREVENTING SKIN REDDENING - A method of alleviating and/or preventing skin reddening for a subject in need thereof by means of inhibiting angiogenesis at the site of the reddened skin, is provided. | 03-07-2013 |
20130058927 | ANTI-VEGF ANTIBODIES - Humanized and variant anti-VEGF antibodies and various uses therefor are disclosed. The anti-VEGF antibodies have strong binding affinities for VEGF; inhibit VEGF-induced proliferation of endothelial cells in vitro; and inhibit tumor growth in vivo. | 03-07-2013 |
20130064811 | Methods to Enhance Cancer Treatment - Herein are provided methods for reducing or eliminating cancer in a patient in need of cancer treatment, by providing cholesterol deprivation therapy (CDT) in conjunction with antibodies directed against cholesterol-deprived tumor cells. Further provided are methods of enhancing the efficacy of other cancer treatments, by administering CDT and antibodies directed against cholesterol-deprived tumor cells, in combination with additional anti-cancer therapies. | 03-14-2013 |
20130064812 | COMBINATION THERAPIES FOR HEMATOLOGIC MALIGNANCIES - The invention provides methods that relate to a novel therapeutic strategy for the treatment of hematological malignancies and inflammatory diseases. In particular, the method comprises administration of a compound of formula A, | 03-14-2013 |
20130064813 | Protein Belonging to the TNF Superfamily Involved in Signal Transduction, Nucleic Acids Encoding Same and Methods of Use Thereof - A method of modulating immune response in an animal is disclosed. Such a method interacting the immature dendritic cells from the animal with an antigen ex vivo so that the immature dendritic cells present the antigen on their surfaces, inducing maturation of the immature dendritic cells ex vivo, and contacting the mature dendritic cells ex vivo with a modulator comprising TRANCE, conservative variants thereof, fragments thereof, analogs or derivatives thereof, or a fusion protein comprising the amino acid sequence of TRANCE, conservative variants thereof, or fragments thereof. After contacting the modulator ex vivo, the mature dendritic cells are introduced into the animal. As a result, immune response in the animal towards the antigen is modulated relative to the immune response against the antigen in an animal in which dendritic cells did not interact with the antigen ex vivo, and did not contact a modulator ex vivo. Preferably, the method of the present invention results in increasing immune response towards the antigen in the animal. | 03-14-2013 |
20130064814 | ANTAGONISTS OF PRODUCTS OF THE HS.459642 UNIGENE CLUSTER FOR THE INHIBITION OF PROLIFERATION, DEVELOPMENT OR DIFFERENTIATION OF STEM CELLS INCLUDING CANCER STEM CELLS - The present disclosure provides methods and compositions for inhibiting the proliferation, differentiation, or development of stem cells and cancer stem cells in a patient in need thereof. The methods involve administering to a patient a therapeutically effective amount of an antagonist of an Hs.459642 Unigene Cluster product, such as an inhibitor of CACNA1H. The compositions include an antagonist of an Hs.459642 Unigene Cluster product, such as an inhibitor of CACNA1H. Specific antagonists such as antibodies and antisense oligonucleotides, and combination therapy with one or more additional anti-cancer agents, are also provided by this disclosure. Such methods, antagonists, and compositions can be useful, for example, in the treatment of cancer. | 03-14-2013 |
20130064815 | INDUCING APOPTOSIS IN QUIESCENT CELLS - Compositions comprising an autophagy inhibitor and at least one of an NADPH modulator or a glutathione inhibitor are provided. Methods of inhibiting or killing a quiescent cell are provided. Methods of treating cancer are provided. Methods of identifying compositions that inhibit or kill quiescent cells are provided. Methods of identifying compositions that inhibit or kill quiescent cells are provided. Methods of inducing apoptosis are provided. Methods of sensitizing quiescent cells to proteasome inhibitors are provided. | 03-14-2013 |
20130064816 | TNF-alpha ANTAGONISTS AND METHOTREXATE IN THE TREATMENT OF TNF-MEDIATED DISEASE - Methods for treating and/or preventing a TNF-mediated disease in an individual are disclosed. Also disclosed is a composition comprising methotrexate and an anti-tumor necrosis factor antibody. TNF-mediated diseases include rheumatoid arthritis, Crohn's disease, and acute and chronic immune diseases associated with transplantation. | 03-14-2013 |
20130064817 | ENGINEERED ANTI-IL-23R ANTIBODIES - Antibodies to human IL-23R are provided, as well as uses thereof, e.g. in treatment of inflammatory, autoimmune, and proliferative disorders. | 03-14-2013 |
20130071379 | 1B20 PCSK9 ANTAGONISTS - Antagonists of human proprotein convertase subtilisin-kexin type 9 (“PCSK9”) are disclosed. The disclosed antagonists are effective in the inhibition of PCSK9 function and, accordingly, present desirable antagonists for use in the treatment of conditions associated with PCSK9 activity. The present invention also discloses nucleic acid encoding said antagonists, vectors, host cells, and compositions comprising the antagonists. Methods of making PCSK9-specific antagonists as well as methods of using the antagonists for inhibiting or antagonizing PCSK9 function are also disclosed and form important additional aspects of the present disclosure. | 03-21-2013 |
20130071380 | MODULATION OF PILR TO TREAT IMMUNE DISORDERS - The present invention provides methods of using PILRα agonists, or PILRβ antagonists, to treat immune disorders, such as autoimmune and inflammatory disorders, including CNS, joint and gut inflammation. | 03-21-2013 |
20130071381 | HUMANIZED ANTI-CCR2 ANTIBODIES AND METHODS OF USE THEREFOR - The present invention relates to a humanized antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 2 (CCR2) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a cell bearing mammalian CCR2 with a ligand thereof, and to use of the antibodies and fragments in therapeutic, prophylactic and diagnostic methods. | 03-21-2013 |
20130071382 | EGFR MUTATIONS - The present invention relates to mutations in Epidermal Growth Factor Receptor (EGFR) and methods of detecting such mutations as well as prognostic methods method for identifying a tumors that are susceptible to anticancer therapy such as chemotherapy and/or kinase inhibitor treatment. The methods involve determining the presence of a mutated EGFR gene or mutated EGFR protein in a tumor sample whereby the presence of a mutated EGFR gene or protein indicates the tumor is susceptible to treatment. | 03-21-2013 |
20130071383 | SELECTIVE MODIFICATION OF PROTEINS - A method of selectively introducing a substituent into a protein proximal to a binding site on the protein for a homing peptide, comprising: (a) contacting the protein with a compound comprising a homing peptide having the ability to bind to the binding site of the protein; and (b) allowing a moiety on the protein proximal to the binding site to react with the compound comprising the homing peptide, thereby to transfer the substituent G onto the protein. | 03-21-2013 |
20130071384 | ANTIBODY FORMULATIONS - The present application describes antibody formulations, including monoclonal antibodies formulated in histidine-acetate buffer, as well as a formulation comprising an antibody that binds to domain II of HER2 (for example, Pertuzumab), and a formulation comprising an antibody that binds to DR5 (for example, Apomab). | 03-21-2013 |
20130071385 | MONOCLONAL ANTIBODIES - The invention provides heterochimeric antibodies and/or fragments thereof comprising (i) hypervariable region sequences wholly or substantially corresponding to sequences found in antibodies from a donor species; (ii) constant region sequences wholly or substantially corresponding to sequences found in antibodies from a target species which is different from the donor species; and (iii) heavy and/or light chain variable framework sequences which contain at least three non-CDR residues corresponding to sequences found in antibodies from a target species and at least three contiguous non-CDR residues corresponding to sequences found in antibodies from a donor species. The invention further provides antibody to canine or feline or equine antigens, e.g., CD20 or CD52, and methods of making and using antibodies as described. | 03-21-2013 |
20130071386 | Immunoglobulin Formulation and Method of Preparation Thereof - A stable aqueous pharmaceutical formulation comprising a therapeutically effective amount of an antibody, polysorbate 80, a buffer which inhibits polysorbate oxidation is described along with methods of making the preparation. Also described are formulations with high antibody concentrations which maintain fixed volumes and which may be used on patients of variable weight. | 03-21-2013 |
20130071387 | PHARMACEUTICAL FORMULATIONS - A method of stabilizing an aqueous protein or antibody formulation is disclosed herein. Additionally, stable pharmaceutical formulations are contemplated which comprise a biologically active protein, a destabilizing concentration of preservative and a stabilizing concentration of osmolyte. | 03-21-2013 |
20130071388 | METHOD FOR TREATING PSORIASIS - Methods and compositions are provided for the creation and screening of non-human animal models having many of the histologic characteristics of human psoriasis. Immunocompromised host animals are injected with a purified population of CD45Rb positive cells, which are tolerant of the host major histocompatibility antigens, but are mismatched at one or more minor antigens. The injected cells are stimulated with a pro-inflammatory cytokine, e.g. IL-12, and a polyclonal activating agent. The injected animals develop a chronic skin disorder that includes histological features observed in human psoriasis, e.g. rete pegs, severe acanthosis and infiltration of Th1 cells into the dermis. | 03-21-2013 |
20130071389 | METHODS FOR TREATMENT OF INFLAMMATORY DISEASES - The present invention provides methods of treating inflammatory diseases in a subject comprising administering to the subject a therapeutically effective amount of an agent that inhibits pigment epithelium-derived factor (PEDF) and methods of screening for agents that inhibit PEDF. | 03-21-2013 |
20130071390 | METHOD FOR PREPARING ANTIBODIES HAVING IMPROVED PROPERTIES - The present invention is directed to methods and compositions for the production of Fc-containing polypeptides having improved properties and comprising mutations at positions 243 and 264 of the Fc region. | 03-21-2013 |
20130078235 | NEUREGULIN BASED COMPOSITIONS AND USES THEREOF FOR PREVENTING, TREATING OR DELAYING THE MYOCARDIAL ISCHEMIA-REPERFUSION INJURY - The present invention elates to the applications of neuregulin in the preparation of drugs for preventing, treating or delaying the ischemia-reperfusion injury (IRI) in mammals, particularly in humans. In particular, the present invention provides the neuregulin based compositions and methods for preventing, treating or delaying the myocardial ischemia-reperfusion injury. Specifically, although it has been shown in cytological experiments, animal studies and clinical trials that neuregulin can improve the cytoskeleton structure of myocytes and cardiac function, it is still unknown whether neuregulin has effects on the myocardial ischemia-reperfusion injury. The present invention proves that neuregulin reduces the infarction size in the rat IRI model, which indicates that neuregulin can be used for preventing, treating or delaying the myocardial ischemia-reperfusion injury | 03-28-2013 |
20130078236 | Anti-CD28 humanized Antibodies - The invention relates to humanized antibodies directed against the human lymphocyte receptor CD28. When used in a monovalent form these antibodies are antagonists, i.e. capable of blocking of the CD28/B7 interaction, without activating CD28. These antibodies can be used in particular as therapeutic agents for blocking T cell activation through the CD28 receptor. | 03-28-2013 |
20130078237 | CD27L ANTIGEN BINDING PROTEINS - The present invention relates to CD27L antigen binding proteins, such an antibodies, polynucleotides encoding said CD27l antigen binding proteins, antibody drug conjugate compositions, and methods for diagnosing and treating diseases associated with CD27L expression. | 03-28-2013 |
20130078238 | Methods and Compositions for Treating Hepatitis with Anti-CD3 Immune Molecule Therapy - A method or composition comprising an anti-CD3 immune molecule for treatment of hepatitis in a subject. | 03-28-2013 |
20130078239 | HUMAN DIACYLGLYCEROL ACYLTRANSFERASE 2 (DGAT2) FAMILY MEMBERS AND USES THEREFOR - The present invention relates to compositions and methods for the diagnosis and treatment of obesity and related metabolic disorders. The invention provides isolated nucleic acids molecules, designated DGAT2 family member nucleic acid molecules, which encode diacylglycerol acyltransferase family members. The invention also provides recombinant expression vectors containing DGAT2 family member nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in which a DGAT2 family member gene has been introduced or disrupted. The invention still further provides isolated DGAT2 family member proteins, fusion proteins, antigenic peptides and anti-DGAT2 family member antibodies. Methods of use of the provided DGAT2 family member compositions for screening, diagnostic and therapeutic methods in connection with obesity disorders are also disclosed. | 03-28-2013 |
20130078240 | 4-1BB BINDING MOLECULES - The present disclosure provides isolated binding molecules that bind to human 4-1BB, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions. | 03-28-2013 |
20130078241 | ANTI-CD33 ANTIBODIES AND METHODS FOR TREATMENT OF ACUTE MYELOID LEUKEMIA USING THE SAME - The present invention relates to antibodies that bind CD33. More particularly, the invention relates to anti-CD33 antibodies, fragments and homologues of these antibodies, humanized and resurfaced versions of these antibodies, functional equivalents and improved versions of these antibodies, immunoconjugates and compositions comprising these antibodies, and the uses of same in diagnostic, research and therapeutic applications. The invention also relates to a polynucleotide encoding these antibodies, vectors comprising the polynucleotides, host cells transformed with polynucleotides and methods of producing these antibodies. | 03-28-2013 |
20130078242 | Antibodies With Immune Effector Activity And That Internalize In Endosialin-Positive Cells - This invention relates to the use of monoclonal and polyclonal antibodies that specifically bind to and have the ability in the alternative to become internalized by cells expressing endosialin and to induce an immune effector activity such as antibody-dependent cellular cytotoxicity. The antibodies are useful in specific delivery of pharmacologic agents to endosialin-expressing cells as well as in eliciting an immune-effector activity particularly on tumor and neovascular cells and precursors. The invention is also related to nucleotides encoding the antibodies of the invention, cells expressing the antibodies; methods of detecting cancer and neovascular cells; and methods of treating cancer and neovascular disease using the antibodies, derivatives and fragments. | 03-28-2013 |
20130084279 | COMPOSITIONS INCLUDING TRICIRIBINE AND TRASTUZUMAB AND METHODS OF USE THEREOF - This application relates to combination therapies including triciribine and related compounds and trastuzumab or a salt thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 04-04-2013 |
20130084280 | COMPOSITIONS INCLUDING TRICIRIBINE AND METHODS OF USE THEREOF - This invention encompasses combination therapies including TCN, TCN-P, TCN-PM and/or related compounds and one or more additional anti-cancer agents, for example, taxanes a molecule that modulates the HER2/neu (erbB2) receptor, anthracyclin compounds, epidermal growth factor receptor inhibitor compounds, one or more platinum compounds and bortezomib and derivatives thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 04-04-2013 |
20130084281 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER, TUMORS, AND TUMOR-RELATED DISORDERS - Described herein are compositions and methods for using these compositions in the treatment of cancer, tumors, and tumor-related disorders in a subject. | 04-04-2013 |
20130084282 | COMPOSITIONS AND METHODS FOR TARGETING TYPE 1 INTERFERON PRODUCING CELLS - The present disclosure provides a method for treating lupus, Sjörgen's syndrome or scleroderma, the method comprising administering to the mammal an immunoglobulin which binds an interleukin 3 receptor α (IL-3Rα) chain and which depletes or at least partly eliminates plasmacytoid dendritic cells (p DCs) and basophils to which it binds. | 04-04-2013 |
20130084283 | OLIGOMER-SPECIFIC AMYLOID BETA EPITOPE AND ANTIBODIES - A novel constrained peptide epitope derived from Aβ, wherein the eptitope comprises the amino acid sequence SNK, related antibody compositions and methods of use. An isolated antibody that specifically binds to a cyclic peptide comprising the conformational epitope which comprises the amino acid sequence SNK and corresponding to a solvent-exposed, antibody accessible knuckle region of oligomeric Aβ is described. An antigenic peptide comprising an epitope having a constrained cyclic configuration, which comprises the amino acid sequence SNK and corresponding to a solvent-exposed, antibody accessible knuckle region of oligomeric Aβ is also described. Methods of treating, preventing and diagnosing Alzheimer's disease are also described. | 04-04-2013 |
20130084284 | Antigen Binding Molecules That Bind EGFR, Vectors Encoding Same, and Uses Thereof - The present invention relates to antigen binding molecules (ABMs). In particular embodiments, the present invention relates to recombinant monoclonal antibodies, including chimeric, primatized or humanized antibodies specific for human EGFR. In addition, the present invention relates to nucleic acid molecules encoding such ABMs, and vectors and host cells comprising such nucleic acid molecules. The invention further relates to methods for producing the ABMs of the invention, and to methods of using these ABMs in treatment of disease. In addition, the present invention relates to ABMs with modified glycosylation having improved therapeutic properties, including antibodies with increased Fc receptor binding and increased effector function. | 04-04-2013 |
20130084285 | TREATMENT WITH ANTI-ALPHA2 INTEGRIN ANTIBODIES - The invention relates to a formulation of an anti-α2 integrin antibody for administration to a patient, which is suitable for the treatment of cancer. | 04-04-2013 |
20130084286 | DIAGNOSTIC MARKERS - The present invention provides methods of predicting response to a cancer therapy based on the methylation status of the ERBB2 gene. One aspect of the invention provides a method of predicting response to an EGFR inhibitor therapy based on the methylation status of the ERBB2 gene. | 04-04-2013 |
20130084287 | DIAGNOSTIC MARKERS - The present invention provides methods for determining epithelial and mesenchymal phenotype of tumors and predicting whether tumor growth will be sensitive or resistant to treatment with an EGFR inhibitor. | 04-04-2013 |
20130084288 | ANTAGONIST ANTI-NOTCH3 ANTIBODIES AND THEIR USE IN THE PREVENTION AND TREATMENT OF NOTCH3-RELATED DISEASES - The present invention relates to antagonist antibodies that specifically bind to Notch 3 and inhibit its activation. The present invention includes antibodies binding to a conformational epitope comprising the first Lin12 domain and the second dimerization domain. The present invention also includes uses of these antibodies to treat or prevent Notch 3 related diseases or disorders. | 04-04-2013 |
20130084289 | TREATMENT OF MULTIPLE SCLEROSIS - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 04-04-2013 |
20130084290 | Antibodies to Thymic Stromal Lymphopoietin (TSLP) Receptor Molecules and Uses Thereof - The present invention provides Thymic Stromal Lymphopoietin Receptor (TSLPR) polypeptides and nucleic acid molecules encoding the same. The invention also provides selective binding agents, vectors, host cells, and methods for producing TSLPR polypeptides. The invention further provides pharmaceutical compositions and methods for the diagnosis, treatment, amelioration, and/or prevention of diseases, disorders, and conditions associated with TSLPR polypeptides. | 04-04-2013 |
20130089540 | New Humanized Anti-CD20 Monoclonal Antibody - The present invention discloses methods of design and preparation for a new humanized anti-CD20 monoclonal antibody, related genes, protein sequence, and the use of said antibody. Comparing to murine-derived antibodies and human-mouse chimeric antibodies, said humanized anti-CD20 antibody maintains or improves high binding activity of the variable regions, meanwhile reduces the immunogenicity of chimeric antibodies, consequently achieves the effect of reducing medicine side effects and improving clinical treatment. The antibody disclosed by the present invention is efficiently expressed in animal cells, can be used for industrial production. It could be used in treating B cell lymphoma, leukaemia, or B cell-associated autoimmune disease with a wide application prospect. | 04-11-2013 |
20130089541 | Antibodies with Enhanced or Suppressed Effector Function - Rationally designed antibodies and polypeptides that comprise multiple Fc region amino acid substitutions that synergistically provide enhanced selectivity and binding affinity to a target Fc receptor are provided. The polypeptides are mutated at multiple positions to make them more effective when incorporated in antibody therapeutics than those having wild-type Fc components. | 04-11-2013 |
20130089542 | ANTI C-MET ANTIBODY AND USES THEREOF - An anti c-Met antibody or antibody fragment and pharmaceutical composition comprising same, as well as a method for preventing and treating cancer by administering the antibody to a subject. | 04-11-2013 |
20130089543 | MONOCLONAL ANTIBODIES THAT BIND OR NEUTRALIZE DENGUE VIRUS - The present invention relates to monoclonal antibodies that bind or neutralize dengue type 1, 2, 3, and/or 4 virus. The invention provides such antibodies, fragments of such antibodies retaining dengue virus-binding ability, fully human or humanized antibodies retaining dengue virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 04-11-2013 |
20130089544 | Antibodies Directed to ERBB2 - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to ErbB2, preferably human ErbB2. In another embodiment, the antibodies or antigen-binding portions thereof inhibit ErbB2. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins or portions thereof derived from human anti-ErbB2 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-ErbB2 antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention | 04-11-2013 |
20130095095 | METHOD FOR TREATING THROMBOTIC DISORDERS USING QUERCETIN-CONTAINING COMPOSITIONS - A method for treating thrombotic disorders using a composition containing quercetin, together with one or more of vitamin B | 04-18-2013 |
20130095096 | NOVEL ANTI- ALPHA5BETA1 ANTIBODIES AND USES THEREOF - The present invention provides new anti-α5β1 antibodies, compositions and kits comprising the antibodies, and methods of making and using the antibodies. | 04-18-2013 |
20130095097 | Polypeptide Heterodimers and Uses Thereof - The present disclosure provides polypeptide heterodimers formed between two different single chain fusion polypeptides via natural heterodimerization of an immunoglobulin CH1 region and an immunoglobulin light chain constant region (CL). One chain of a heterodimer comprises a binding domain that specifically binds a target (e.g., a receptor). In addition, both chains of a heterodimer further comprise an Fc region portion. The present disclosure also provides nucleic acids, vectors, host cells and methods for making polypeptide heterodimers as well as methods for using such polypeptide heterodimers, such as in reducing T cell activation, inhibiting solid malignancy growth, and treating autoimmune or inflammatory conditions. | 04-18-2013 |
20130095098 | PD-1 ANTIBODY - A humanised agonistic antibody which binds human PD-1 comprising a heavy chain wherein the variable domain of the heavy chain comprises the sequence given in SEQ ID NO:1 for CDR-H1, the sequence given in SEQ ID NO: 2 for CDR-H2 and the sequence given in SEQ ID NO: 3 for CDR-H3 and the heavy chain framework region is derived from human sub-group sequence VH4 3-1 4-30.4+JH4 (SEQ ID NO: 33). The disclosure also extends to therapeutic uses of the antibody molecules, compositions and methods for producing said antibody molecules. | 04-18-2013 |
20130095099 | GENES AND GENES COMBINATIONS PREDICTIVE OF EARLY RESPONSE OR NON RESPONSE OF SUBJECTS SUFFERING FROM INFLAMMATORY DISEASE TO CYTOKINE TARGETING DRUGS (CYTD) - The invention concerns methods for the in vitro diagnosis/prognosis of a CyTD responsive or non-responsive phenotype, comprising: (a) determining from a subject biological sample an expression profile comprising the gene MAPK14; or the genes MAPK14 and S100A9; or the genes MAPK14 and GNLY; or the 6 genes of Table 2, or the gene S100A9; or the genes S100A9, IL2RB, and CASP5; or the genes S100A9, IL2RB, KLRK1, HCK, and GNLY; or the genes S100A9, IL2RB, KLRK1, HCK, GNLY, CTSZ, ARF5, and UTP14C, or Equivalent Expression Profile of anyone of the expression profiles of (i) and (ii), and optionally one or more housekeeping gene(s), (b) comparing the obtained expression profile with at least one reference expression profile, and (c) determining the responsive or non-responsive phenotype from said comparison. The present invention also relates to kits and nucleic acid microarrays for performing said method, and methods of treatment of inflammatory disease-suffering patients. | 04-18-2013 |
20130095100 | HETEROCYCLIC KINASE INHIBITORS - This invention relates to novel 2-{6-[4-(2-hydroxy-ethyl)-piperazin-1-yl]-2-methyl-pyrimidin-4-ylamino}-thiazole-5-carboxylic acid (2-chloro-6-methyl-phenyl)-amide derivatives, and pharmaceutically acceptable acid addition salts thereof. The invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions beneficially treated by the inhibition of kinases including Src-kinase and Bcr-Abl kinase. | 04-18-2013 |
20130095101 | METHODS AND COMPOSITIONS FOR TREATMENT AND DIAGNOSIS OF FIBROSIS, TUMOR INVASION, ANGIOGENESIS, AND METASTASIS - Provided are methodology, compositions and kits to prevent and treat diseases associated with abnormal cell proliferation, angiogenesis and fibrosis, using processed lysyl oxidase or lysyl oxidase-like protein inhibitors, LOX inhibitors and LOXL inhibitors, or synergistic combinations of such inhibitors with therapeutic agents. Provided are methods for selecting tumor invasion, angiogenesis and metastasis inhibiting agents, by contacting cells in EMT states with candidate agents and detecting changes in such states; and methods, compositions, and kits for diagnosing or monitoring diseases associated with abnormal cell proliferation, angiogenesis and fibrosis, using molecules or agents specifically recognizing processed LOX or LOXL. Provided are methods, compositions, medical devices, systems and kits for preventing or treating diseases and conditions associated with fibrosis, including pathological cardiovascular conditions and diseases, e.g., hypertension, hypertensive heart disease, myocardial infarction, atherosclerosis, restenosis, liver fibrosis, kidney fibrosis, lung fibrosis, dermal scaring, keloid formation, and Alzheimer's disease, with LOX or LOXL inhibitors. | 04-18-2013 |
20130101581 | ANTIBODY CONSTANT REGION VARIANT - The present inventors carried out dedicated research to generate antibody constant regions with reduced Fcγ receptor-binding activity by altering amino acid sequences in the antibody constant region. As a result, the present inventors successfully identified novel constant region sequences with reduced Fcγ receptor-binding activity compared to conventional antibody constant regions. | 04-25-2013 |
20130101582 | Tiki1 and Tiki2, Wnt Inhibitors - This invention relates to Tiki1 and Tiki2 proteins and nucleic acids, cells expressing the same, and methods for identifying compounds that modulate Tiki1/2 activity for use in the treatment of osteoporosis or cellular proliferative disorders. | 04-25-2013 |
20130108620 | METHODS OF TREATMENT USING ANTI-ERBB ANTIBODY-MAYTANSINOID CONJUGATES | 05-02-2013 |
20130108621 | ANTI-CD154 ANTIBODIES HAVING IMPAIRED FcR BINDING AND/OR COMPLEMENT BINDING PROPERTIES AND THE USE THEREOF IN IMMUNE THERAPIES | 05-02-2013 |
20130108622 | DISULFIDE STABILIZED ANTIBODIES AND FRAGMENTS THEREOF | 05-02-2013 |
20130108623 | Antibodies with Enhanced or Suppressed Effector Function | 05-02-2013 |
20130108624 | CRYPTIC GLYCAN MARKERS AND APPLICATIONS THEREOF | 05-02-2013 |
20130108625 | TREATMENT OF MULTIPLE SCLEROSIS (MS) | 05-02-2013 |
20130108626 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF PANCREATIC CANCER | 05-02-2013 |
20130108627 | HUMANIZED PCRV ANTIBODY HAVING ANTI-PSEUDOMONAL ACTIVITY | 05-02-2013 |
20130115206 | Compositions and Methods for Treating and Diagnosing Cancer - The present invention relates to compositions and methods for characterizing, diagnosing and treating cancer. In particular, the present invention identifies LGR5 as a protein over-expressed in solid tumor stem cell. The present invention further identifies an interaction between RSPO1 and LGR5 as an alternative pathway for the activation of beta-catenin signaling. In certain embodiments, the present invention provides biomolecules that disrupt functional signaling via a LGR protein, including, in certain embodiments, molecules that inhibit the interaction between one or more RSPO proteins and one or more LGR proteins, such as LGR5. In certain embodiments, the present invention provides methods of treating cancer comprising disrupting functional LGR signaling and inhibiting growth of a solid tumor comprising solid tumor stem cells. | 05-09-2013 |
20130115207 | METHODS FOR THE TREATMENT OF AUTOIMMUNE DISEASES - The invention provides methods of treating a mammal (e.g., a human) having or at risk of having an autoimmune disease by administering a composition that includes all or a portion of a viral polypeptide or a nucleic acid encoding a viral peptide (e.g., a live, killed, attenuated, or inactivated virus) or a composition that includes an immunosuppressive agent (e.g., an anti-CD3 antibody), and compositions for use in treating an autoimmune disease in the mammal. | 05-09-2013 |
20130115208 | HETERODIMERIC PROTEINS AND METHODS FOR PRODUCING AND PURIFYING THEM - The present invention relates to engineered heteromultimeric proteins, and more specifically, to methods for producing and purifying heterodimeric proteins, such as bispecific antibodies and other heterodimeric proteins comprising immunoglobulin-like hinge sequences. Methods for producing and purifying such engineered heterodimeric proteins and their use in diagnostics and therapeutics are also provided. | 05-09-2013 |
20130115209 | PROTECTIVE VACCINE BASED ON STAPHYLOCOCCUS AUREUS PROTEIN SA2412 - The present invention relates to methods of inducing an immune response to | 05-09-2013 |
20130115210 | Peptide for Use in the Treatment of Breast Cancer and/or Bone Metastases - The invention relates to the use of the Peptide of the formula Cyclo-(Arg-Gly-Asp-DPhe-NMe-Val) and/or the pharmaceutically acceptable dervatives, solvates and/or salts thereof, for the manufacture of a medicament for the treatment of breast cancer and/or bone metastases in humans, wherein the medicament is optionally to be used in combination with one or more cancer cotherapeutic agents, preferably selected from a) hormone modulating agents, b) osteoclast activity modulating agents, c) cancer chemotherapeutic agents, and/or d) radiotherapy, alone, concurrently or not in the dosage regime of the present invention. | 05-09-2013 |
20130121993 | Compositions and Methods for Treating and Diagnosing Cancer - The present invention relates to compositions and methods for characterizing, diagnosing and treating cancer. In particular, the present invention identifies LGR5 as a protein over-expressed in solid tumor stem cells. The present invention further identifies an interaction between RSPO1 and LGR5 as an alternative pathway for the activation of beta-catenin signaling. In certain embodiments, the present invention provides biomolecules that disrupt functional signaling via a LGR protein, including, in certain embodiments, molecules that inhibit the interaction between one or more RSPO proteins and one or more LGR proteins, such as LGR5. In certain embodiments, the present invention provides methods of treating cancer comprising disrupting functional LGR signaling and inhibiting growth of a solid tumor comprising solid tumor stem cells. | 05-16-2013 |
20130121994 | TRIAZOLOPYRIDINE DERIVATIVES - The present invention relates to triazolopyridine compounds of general formula (I) which are Monopolar Spindle 1 kinase (Mps-1 or TTK) inhibitors in which R | 05-16-2013 |
20130121995 | Compositions and Methods for Increasing Bone Mineralization - A novel class or family of TGF-β binding proteins is disclosed. Also disclosed are assays for selecting molecules for increasing bone mineralization and methods for utilizing such molecules. | 05-16-2013 |
20130121996 | Novel Complex Mutations in the Epidermal Growth Factor Receptor Kinase Domain - Six new mutations were found in exon 19 of the EGFR gene, the exon that is often mutated in tumors. The invention comprises methods of detecting the mutations, methods of prognosis and methods of predicting response to treatment based on the presence of absence of the mutations. | 05-16-2013 |
20130121997 | BINDING AGENTS - Compositions and methods relating to epitopes of sclerostin protein, and sclerostin binding agents, such as antibodies capable of binding to sclerostin, are provided. | 05-16-2013 |
20130121998 | Diagnosis of Myocardial Autoimmunity in Heart Disease - Provided herein are, inter alia, methods of diagnosing myocardial autoimmunity in subjects by detecting the presence of autoantibodies to cardiac antigens in the subjects. | 05-16-2013 |
20130121999 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF BREAST CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer, by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the progression-free survival of the patient. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels in patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. | 05-16-2013 |
20130122000 | ANTIBODIES IMMUNOREACTIVE WITH HEREGULIN-COUPLED HER3 - Antibodies which specifically bind heregulin-coupled HERS, at a site distinct from the heregulin binding site, are described. These antibodies are particularly useful in treating cancer. | 05-16-2013 |
20130122001 | ANTIBODY VARIANTS WITH ENHANCED COMPLEMENT ACTIVITY - The present invention relates to novel Fc variants that comprise at least one novel amino acid residue which may provide for enhanced effector function. More specifically, this invention provides Fc variants that have modified binding affinity to one or more Fc receptor or ligand (e.g., Fc gamma R, C1q). Additionally, the Fc variants have altered complement dependent cytotoxicity (CDC) activity and/or antibody-dependent cell-mediated cytotoxicity (ADCC). The invention further provides methods and protocols for the application of said Fc variants, particularly for therapeutic purposes. | 05-16-2013 |
20130122002 | METHODS FOR CANCER MANAGEMENT TARGETING CO-029 - The present disclosure relates to a Co-029 inhibitor for inhibiting the migration of cancer cells which express Co-029. The disclosure relates to a Co-029 inhibitor for the treatment of cancer and/or the prevention of cancer metastasis and pharmaceutical compositions comprising said inhibitor and provides Co-029 antibodies. The disclosure provides a method for predicting the response of a patient afflicted with or susceptible to be afflicted with cancer to a medical treatment with a Co-029 inhibitor, a method for diagnosing a cancer in a patient and a method for predicting the survival in a cancer patient. | 05-16-2013 |
20130129716 | System and method for determining compatibility of bioactive agents and formulations provided therefrom - A method for determining compatibility of bioactive agents (i.e. supplement formulation components, pharmacological agents, etc.), comprising (i) determining compatibility by and between components contained in a supplement formulation, i.e. vitamins and/or minerals, (ii) determining compatibility by and between the formulation components and the body, and (iii) determining compatibility by and between the formulation components and pharmacological agents, i.e. prescribed and over-the-counter medications, and formulations derived therefrom. | 05-23-2013 |
20130129717 | Monoclonal Antibodies Against Extracellular Loops of C5aR - The present invention relates to antibodies which bind to C5aR and which are useful in diagnostic and therapeutic methods. The antibodies of the present invention are reactive with an extracellular loop of C5aR other than the N-terminal domain and are capable of substantially reducing or inhibiting the binding of C5a to C5aR and functional consequences of neutrophil chemoattractant receptor activation. | 05-23-2013 |
20130129718 | PURIFICATION OF ANTI-C-MET ANTIBODIES - Provided herein are methods of purifying anti-c-met antibodies, compositions and pharmaceutical formulations comprising purified anti-c-met antibodies, and methods of using the same. | 05-23-2013 |
20130129719 | HER2 NUCLEIC ACID APTAMERS - The present invention relates to optimized HER2 aptamers and methods of using these aptamers. | 05-23-2013 |
20130129720 | Combination Cancer Therapies with Wortmannin Analogs - Provided herein are combination therapies for the treatment of certain cancers in a subject by administering a combination of a therapeutic and a wortmannin analog to that subject. | 05-23-2013 |
20130129721 | Humanized Anti-C5aR Antibodies - The present invention is directed to humanized antibodies which bind the human C5a receptor and their use as therapeutic and diagnostic agents. The present invention is further directed toward nucleic acid sequences which encode said humanized antibodies, and their expression in recombinant host cells. In particular, the present invention is directed towards humanized antibodies derived from murine antibody 7F3 which specifically binds to the human C5a receptor. | 05-23-2013 |
20130129722 | Methods for Treating Cancer by Administering an Anti-Ang-2 Antibody - The present invention provides antibodies that bind to angiopoietin-2 (Ang-2) and methods of using same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human Ang-2. The antibodies of the invention are useful, inter alia, for the treatment of diseases and disorders associated with one or more Ang-2 biological activities including angiogenesis. | 05-23-2013 |
20130136734 | ANTI-CD154 ANTIBODIES HAVING IMPAIRED FcR BINDING AND/OR COMPLEMENT BINDING PROPERTIES AND RELATED THERAPIES - Improved anti-CD154 antibodies are provided herein which have ablated FcR binding and/or complement binding/activation. The use of these antibodies for inducing tolerance and treating immune diseases including autoimmunity, inflammation and allergic disorders is disclosed herein. | 05-30-2013 |
20130136735 | HUMANIZED ANTIBODIES TO iNKT - Methods of treatment to suppress an immune response are provided. The method comprises administering to a subject in need of treatment a naked blocking antibody that binds selectively iNKT cells in an amount effective to suppress the subject's iNKT cell function. Compositions comprising, an isolated, humanized antibody that binds selectively iNKT cells are also provided. | 05-30-2013 |
20130136736 | Single Domain VHH Antibodies Against Von Willebrand Factor - The present invention relates to improved Nanobodies™ against von Willebrand Factor (vWF), as well as to polypeptides comprising or essentially consisting of one or more of such Nanobodies. The invention also relates to nucleic acids encoding such Nanobodies and polypeptides; to methods for preparing such Nanobodies and polypeptides; to host cells expressing or capable of expressing such Nanobodies or polypeptides; to compositions comprising such Nanobodies, polypeptides, nucleic acids or host cells; and to uses of such Nanobodies, such polypeptides, such nucleic acids, such host cells or such compositions, in particular for prophylactic, therapeutic or diagnostic purposes, such as the prophylactic, therapeutic or diagnostic purposes. | 05-30-2013 |
20130136737 | Uses of NOGO-A Inhibitors and Related Methods - The present invention is directed to Nogo-A antagonists useful for the control of blood glucose or blood insulin levels in a subject and related use and formulation thereof. In particular, the invention is directed to Nogo-A antagonists useful for the prevention, repression or treatment insulin secretion deficiency and related methods and pharmaceutical formulations. In particular, the invention relates to Nogo-A antagonists useful in the treatment of diabetes mellitus. | 05-30-2013 |
20130142783 | ANTI-ICOS ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY, TRANSPLANTATION AND AUTOIMMUNE DISEASE - The present invention provides anti-human ICOS antibodies with increased effector function. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human ICOS antigen and that may mediate ADCC, CDC, and/or antibody-dependent phagocytosis (opsonisation) for the treatment and prevention of T cell-mediated diseases and disorders, such as, but not limited to, chronic infection, autoimmune disease or disorder, inflammatory disease or disorder, graft-versus-host disease (GVHD), transplant rejection, and T cell proliferative disorder. | 06-06-2013 |
20130142784 | METHOD OF TREATING TUMOR RESISTANT TO HERCEPTIN OR PACLITAXEL USING FOXM1 INHIBITORS AND DETECTING SAME - The invention provides methods of treating cancer, especially breast cancer, and in particular HER2/ErbB2 positive breast cancer using a FoxM1 inhibitor in conjunction with trastuzumab and/or paclitaxel. Pharmaceutical compositions comprising a FoxM1 inhibitor in the presence of trastuzumab and/or paclitaxel are also provided. The invention further provides methods of identifying and treating trastuzumab resistant and/or paclitaxel resistant cancer. Also provided are methods of promoting breast tumor cell differentiation. | 06-06-2013 |
20130142785 | HER2 Targeting Agent Treatment in Non-HER2-Amplified Cancers having HER2 Expressing Cancer Stem Cells - The present invention relates to compositions, methods, and kits for treating cancers with HER2 targeting agents and preventing resistance thereto. In particular embodiments, non-HER2-amplified cancers are treated with HER2 targeting agents, wherein the cancer stem cells in the cancer express HER2 and/or HER2 indicator marker. The present invention also relates to compositions, methods, and kits for detecting expression of HER2 and/or a HER2 indicator marker in non-HER2-amplified cancer samples from a subject, and identifying the subject as responsive to treatment with a HER2 targeting agent and/or treating the subject with a HER2 targeting agent. | 06-06-2013 |
20130142786 | HUMANIZED AND CHIMERIC MONOCLONAL ANTIBODIES TO CD47 - Humanized or chimeric anti-CD47 monoclonal antibodies are provided. The antibodies bind to and neutralize human CD47, and find use in various therapeutic methods. Preferred are non-activating antibodies. Embodiments of the invention include isolated antibodies and derivatives and fragments thereof, pharmaceutical formulations comprising one or more of the humanized or chimeric anti-CD47 monoclonal antibodies; and cell lines that produce these monoclonal antibodies. Also provided are amino acid sequences of the antibodies. | 06-06-2013 |
20130142787 | Therapeutic Use of Anti-CD22 Antibodies for Inducing Trogocytosis - Disclosed are methods and compositions of anti-B cell antibodies, preferably anti-CD22 antibodies, for diagnosis, prognosis and therapy of B-cell associated diseases, such as B-cell malignancies, autoimmune disease and immune dysfunction disease. In certain embodiments, trogocytosis induced by anti-B cell antibodies may determine antibody efficacy, disease responsiveness and prognosis of therapeutic intervention. In other embodiments, optimal dosages of therapeutic antibody may be selected by monitoring the degree of trogocytosis induced by anti-B cell antibodies. Other characteristics of anti-B-cell antibodies that may be monitored include inducing phosphorylation of CD22, CD79a and CD79b; inducing translocation of CD22, CD79a and CD79b to lipid rafts; inducing caspase-dependent apoptosis; increasing pLyn, pERKs and pJNKs; decreasing constitutively-active p38; or inducing mitochondrial membrane depolarization, generation of reactive oxygen species, upregulation of pro-apoptotic Bax and downregulation of anti-apoptotic Bcl-xl, Mcl-1 and Bcl-2. | 06-06-2013 |
20130142788 | HUMANISED ANTIGEN BINDING PROTEINS TO MYOSTATIN6 - The present invention relates to humanised antigen binding proteins, such as antibodies, which bind to myostatin, polynucleotides encoding such antigen binding proteins, pharmaceutical compositions comprising said antigen binding proteins and methods of manufacture. The present invention also concerns the use of such humanised antigen binding proteins in the treatment or prophylaxis of diseases associated with any one or a combination of decreased muscle mass, muscle strength and muscle function. | 06-06-2013 |
20130142789 | HUMAN MONOCLONAL ANTIBODIES TO FUCOSYL-GM1 AND METHODS FOR USING ANTI-FUCOSYL-GM1 ANTIBODIES - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies that specifically bind to Fucosyl-GM1 with high affinity. Nucleic acid molecules encoding the antibodies of this disclosure, expression vectors, host cells and methods for expressing the antibodies of this disclosure are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of this disclosure are also provided. This disclosure also provides methods for detecting Fucosyl-GM1, as well as methods for treating various diseases, including cancer, using anti-Fucosyl-GM1 antibodies. | 06-06-2013 |
20130142790 | Method of Treating Cancer Using a cMET and AXL Inhibitor and an ErbB Inhibitor - The present invention relates to a method of treating cancer in a patient comprising administering to the patient therapeutically effective amounts of:
| 06-06-2013 |
20130142791 | CYCLODEXTRIN NANOTECHNOLOGY FOR OPHTHALMIC DRUG DELIVERY - The invention provides an ophthalmic composition which is an aqueous suspension comprising drug, cyclodextrin and water, the composition having an aqueous phase of from about 0.1% (w/v) to about 90% (w/v) of the drug in solution, as dissolved free drug and as dissolved drug/cyclodextrin complex(es), and a solid phase of from about 10% (w/v) to about 99.9% (w/v) of the drug as solid drug/cyclodextrin particles, suspended in the aqueous phase; the size of the solid particles being from about 10 nm to about 1 mm, the drug/cyclodextrin particles being capable of dissolving in aqueous tear fluid within 24 hours of application to the eye surface. The aqueous eye suspension can be in the form of eye drops, eye gel or eye mist. Further, the invention provides a method for treating a condition of the posterior segment and/or anterior segment of the eye comprising applying to the eye surface, in an amount which delivers to said segment or segments a therapeutically effective amount of a drug suitable for treating said condition, an ophthalmic composition which is as defined above. Nasal compositions and methods and ophthalmic and nasal compositions in powder form are also provided. | 06-06-2013 |
20130149298 | Compositions and Methods for the Treatment of Tumor of Hematopoietic Origin - The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same. | 06-13-2013 |
20130149299 | DOSAGES FOR TREATMENT WITH ANTI-EGFR ANTIBODIES - The present invention concerns dosages for treatment of human cancer patients with an anti-Epidermal Growth Factor Receptor (EGFR) antibody. | 06-13-2013 |
20130149300 | MONOCLONAL ANTIBODIES WITH ALTERED AFFINITIES FOR HUMAN FCyRI, FCyRIIIa, AND C1q PROTEINS - Disclosed herein are GNGN and G1/G2 antibodies that recognize and bind various FcRs and C1 | 06-13-2013 |
20130149301 | ANTI-CD137 ANTIBODY AS AN AGENT IN THE TREATMENT OF INFLAMMATORY CONDITIONS - The present invention relates to the treatment of inflammatory conditions including atherosclerosis and sepsis. In particular, the invention relates to treatment of these conditions using antibodies. | 06-13-2013 |
20130149302 | THERAPEUTIC AGENTS FOR PANCREATIC CANCER - We achieved the present invention on the basis of the finding that an excellent therapeutic effect against pancreatic cancer can be obtained by administering an XL-6 inhibitor and an antimetabolite to pancreatic cancer patients. We also found that metastatic lesions from human pancreatic cancer can be reduced and ascites can be eliminated. | 06-13-2013 |
20130149303 | IMMUNOTHERAPEUTIC METHOD INVOLVING CD123 (IL-3Ra) ANTIBODIES AND IMMUNOSTIMULATING COMPLEX - A method for the treatment of a condition which is characterized by CD 123-expressing cells in a patient comprises administering to the patient (i) an antibody or antibody fragment which binds selectively to IL- | 06-13-2013 |
20130156755 | CANCER THERAPY USING A COMBINATION OF A HSP90 INHIBITORY COMPOUNDS AND A VEGF INHIBITOR - A pharmaceutical combination comprising a VEGF inhibitor, and an Hsp90 inhibitor according to the following formulae (I) or (Ia) a tautomer, or a pharmaceutically acceptable salt thereof, wherein the variables in the structural formulae are defined herein. Also provided are methods for treating a proliferative disorder in a subject in need thereof, using pharmaceutical combinations described herein. | 06-20-2013 |
20130156756 | Substituted Triazolopyridines - The present invention relates to substituted triazolopyridine compounds of general formula (I): in which R | 06-20-2013 |
20130156757 | TARGETING VEGF-B REGULATION OF FATTY ACID TRANSPORTERS TO MODULATE HUMAN DISEASES - The present invention provides materials and methods for modulating FATP expression and/or activity in vivo. The materials and methods have numerous diagnostic, prophylactic, and therapeutic applications for various diseases and conditions that are influenced by FATPs, or characterized by excessive or inadequate FATP expression or activity. | 06-20-2013 |
20130156758 | Optimized Fc Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 06-20-2013 |
20130156759 | METHODS OF TREATING DEMENTIA USING A GM-CSF ANTAGONIST - The invention is based on the discovery that GM-CSF antagonists can be used for the treatment of a patient that has Alzheimer's disease or vascular dementia, or is at risk for developing Alzheimer's disease. Accordingly, the invention provides methods of administering a GM-CSF antagonist, e.g., a GM-CSF antibody and pharmaceutical compositions comprising such antagonists. | 06-20-2013 |
20130156760 | Protein Formulations and Methods of Making Same - The invention provides an aqueous formulation comprising water and a protein, and methods of making the same. The aqueous formulation of the invention may be a high protein formulation and/or may have low levels of conductity resulting from the low levels of ionic excipients. Also included in the invention are formulations comprising water and proteins having low osmolality. | 06-20-2013 |
20130156761 | Compounds Useful for Inhibiting Metastasis from Cancer and Methods Using Same - The present invention includes compositions that are useful in preventing or treating metastasis in a subject diagnosed with cancer. The present invention also includes methods of preventing or treating metastasis in a subject diagnosed with cancer, wherein the method comprises administering to the subject in need thereof an effective amount of a pharmaceutical formulation comprising at least one pharmaceutically acceptable carrier and at least one CX | 06-20-2013 |
20130156762 | Mechanically-Activated Cation Channels - Methods of screening for agents that modulate the activity of a mechanically-activated cation channel are provided. Also provided are compositions and methods for ameliorating pain by antagonizing or inhibiting mechanically-activated cation channels. | 06-20-2013 |
20130164278 | HUMANIZED ANTIBODY - The present invention is related to chimeric and humanized antibody and to methods and compositions for the therapeutic and diagnostic use in the treatment of amyloidosis, a group of disorders and abnormalities associated with amyloid protein such as Alzheimer's disease. | 06-27-2013 |
20130164279 | Micro RNA-148A as a Biomarker for Advanced Colorectal Cancer - The present invention includes methods of detection, diagnosis, prognosis, and treatment of a patient suspected of having a colorectal cancer comprising obtaining one or more samples of the patient, determining a level of expression of miR-148a or the level of methylation of a miR-148a promoter, and predicting a response to a cytotoxic chemotherapy cancer treatment. | 06-27-2013 |
20130164280 | PYRAZOLO[1,5-A]PYRIMIDINES AS ANTIVIRAL AGENTS - The invention provides compounds and pharmaceutically acceptable salts and esters and compositions thereof, for treating viral infections. The compounds and compositions are useful for treating Pneumovirinae virus infection including Human respiratory syncytial virus infections. | 06-27-2013 |
20130164281 | DEIMMUNIZED ANTI C-MET HUMANIZED ANTIBODIES AND USES THEREOF - A deimmunized anti c-Met humanized antibody and a pharmaceutical composition including the same, and method for the prevention and treatment of cancer. | 06-27-2013 |
20130164282 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 06-27-2013 |
20130164283 | Antibody induced cell membrane wounding - Compositions and methods for inducing cell membrane wounding, cell permeabilization and cell killing are provided. The composition comprises a polyvalent agent that binds to a highly expressed cell surface antigen present on the surface of a cell. Preferably, the cell surface antigen is associated with the cytoskeleton of the cell. A preferred polyvalent agent is an IgM, and enhanced cell wounding and killing can be provided by the addition of a crosslinking agent. At sublethal concentrations in vivo, the cell wounding antibodies permeabilize cells and dramatically enhance response to chemotherapeutic agents, even in patients refractory to the chemotherapeutic agents. | 06-27-2013 |
20130164284 | COMPOSITIONS AND METHODS TO TREAT BONE RELATED DISORDERS - The present invention relates to the use of modulators of the sclerostin: sclerostin-binding-partner interaction for the treatment, amelioration, and diagnosis of sclerostin-related disorders, e.g., osteoporosis and sclerosteosis, and sclerostin-related disorders, e.g., cancers and cardiovascular disorders. The invention also relates to the use of sclerostin-binding-partner mimetics for the treatment, amelioration, and diagnosis of sclerostin-related disorders. Assays for the identification of modulators of the sclerostin: sclerostin-binding-partner interaction, as well as the resulting signaling, are also provided. | 06-27-2013 |
20130164285 | Water-in-Oil Type Emulsion for Treating a Disease of the Eye - The invention relates to a composition for administering with a sustained release kinetic a therapeutically effective amount of a therapeutic agent to a subject in need thereof for treating diseases or conditions of the eye, wherein the composition is an water-in-oil type emulsion comprising an oil phase, a lipophilic surfactant dissolved in the oil phase, an aqueous phase dispersed in the oil phase, a hydrophilic therapeutic agent dissolved in the aqueous dispersed phase, and wherein the composition is intraocularly injectable, wherein the composition has a density lower than 1. The invention also relates to a pharmaceutical composition or to a medicament comprising the composition of the invention, and to a method for treating a condition or disease of the eye comprising administering a therapeutic amount of the composition of the invention. The invention also relates to a device comprising the composition of the invention. | 06-27-2013 |
20130171130 | SOLUBLE INTERLEUKIN-20 RECEPTOR - A soluble receptor to IL-20 having two polypeptide subunits, IL-20RA (formerly called ZcytoR7) and IL-20RB (formerly called DIRS1). The two subunits are preferably linked together. In one embodiment one subunit is fused to the constant region of the light chain of an immunoglobulin, and the other subunit is fused to the constant region of the heavy chain of the immunoglobulin. The light chain and the heavy chain are connected via a disulfide bond. | 07-04-2013 |
20130171131 | Soluble Forms of Hendra and Nipah Virus G Glycoprotein - This invention relates to soluble forms of G glycoprotein from Hendra and Nipah virus. In particular, this invention relates to compositions comprising soluble forms of G glycoprotein from Hendra and Nipah virus and also to diagnostic and therapeutic methods using the soluble forms of G glycoprotein from Hendra and Nipah virus. Further, the invention relates to therapeutic antibodies including neutralizing antibodies, and vaccines for the prevention and treatment of infection by Hendra and Nipah viruses. | 07-04-2013 |
20130171132 | Soluble Forms of Hendra and Nipah Virus G Glycoprotein - This invention relates to soluble forms of G glycoprotein from Hendra and Nipah virus. In particular, this invention relates to compositions comprising soluble forms of G glycoprotein from Hendra and Nipah virus and also to diagnostic and therapeutic methods using the soluble forms of G glycoprotein from Hendra and Nipah virus. Further, the invention relates to therapeutic antibodies including neutralizing antibodies, and vaccines for the prevention and treatment of infection by Hendra and Nipah viruses. | 07-04-2013 |
20130171133 | CANCER METHODS - A method of treating a patient having a cancer in which HER2, HER4, FGFR1, EPHA2 and/or FGFR3 is upregulated and/or in which HER2, HER4, FGFR1, EPHA2 and/or FGFR3 mediated-signaling is upregulated, the method comprising administering to the patient a compound comprising or consisting of an OPCML polypeptide (SEQ ID NO: 1), or a fragment thereof which comprises at least one Ig domain of OPCML, or a variant thereof having at least 90% sequence identity with the OPCML polypeptide or the fragment thereof, or a nucleic acid molecule which encodes the OPCML polypeptide or fragment or variant thereof. | 07-04-2013 |
20130171134 | NEUROPILIN AS A BIOMARKER FOR BEVACIZUMAB COMBINATION THERAPIES - The present invention provides methods for improving treatment effect in a patient suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”), by treatment with bevacizumab (Avastin®) in combination with a chemotherapy regimen by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). The improved treatment effect may be improved overall survival or improved progression free survival. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). | 07-04-2013 |
20130171135 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 07-04-2013 |
20130171136 | Methods of Treating Giant Cell Arteritis With Anti-TNF Alpha Antibodies - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 07-04-2013 |
20130171137 | METHODS OF TREATING AUTOIMMUNE DISEASES WITH ANTI-FCERI ANTIBODIES - Methods of using anti-FceRI or anti-IgE antibodies for treating an autoimmune disease are disclosed. Also disclosed is a composition comprising an anti-FceRI antibody or anti-IgE antibody for use in treating an autoimmune disease. Also disclosed are non-antibody compounds that specifically activate basophils and/or mast cells, either by cross-linking IgE or FceRI, or by activating the cells through an FceRI-independent pathway and methods of using the same to treat autoimmune diseases. | 07-04-2013 |
20130177550 | THERAPEUTIC AGENT PREPARATIONS FOR DELIVERY INTO A LUMEN OF THE INTESTINAL TRACT USING A SWALLOWABLE DRUG DELIVERY DEVICE - Embodiments of the invention provide swallowable devices, preparations and methods for delivering drugs and other therapeutic agents within the GI tract. Many embodiments provide a swallowable device for delivering the agents. Particular embodiments provide a swallowable device such as a capsule for delivering drugs into the intestinal wall or other GI lumen. Embodiments also provide various drug preparations that are configured to be contained within the capsule, advanced from the capsule into the intestinal wall and degrade to release the drug into the bloodstream to produce a therapeutic effect. The preparation can be operably coupled to delivery means having a first configuration where the preparation is contained in the capsule and a second configuration where the preparation is advanced out of the capsule into the intestinal wall. Embodiments of the invention are particularly useful for the delivery of drugs which are poorly absorbed, tolerated and/or degraded within the GI tract. | 07-11-2013 |
20130177551 | RISK MARKERS FOR CARDIOVASCULAR DISEASE - Provided herein methods for determining whether a subject, particularly a human subject, is at risk of developing, having, or experiencing a complication of cardiovascular disease, and methods of treating subjects who are identified by the current methods of being at risk for cardiovascular disease. In one embodiment, the method comprises determining levels of one or more oxidized apolipoprotien A-I related biomolecules in a bodily sample from the subject. Also, provided are kits and reagents for use in the present methods. Also provided are methods for monitoring the status of cardiovascular disease in a subject or the effects of therapeutic agents on subjects with cardiovascular disease. Such method comprising determining levels of one or more oxidized apolipoprotein A-I related molecules in bodily samples taken from the subject over time or before and after therapy. | 07-11-2013 |
20130177552 | METHODS AND COMPOSITIONS FOR MODULATING OCULAR DAMAGE - Methods for modulating eye damage associated with a disease or disorder, and/or damage incident to trauma including but not limited to trauma associated with ocular surgery are provided. In some embodiments, the methods include administering an effective amount of a modulator of a migration inhibitory factor (MIF) polypeptide biological activity to a subject. Also provided are methods for modulating the severity of delaying the onset of and/or inhibiting and/or preventing the development of an ocular disease, and methods for modulating the severity of delaying the onset of and/or inhibiting and/or preventing the development of scarring and/or other consequence of wound healing incident to ocular surgery, as well as modulating the survival, function, and/or differentiation of engrafted cells that can be employed as part of tissue engineering procedures to correct structural, functional, and/or cellular defects of the eye. | 07-11-2013 |
20130177553 | Novel Compositions and Methods for Treating IgE-Mediated Disorders - The present invention relates to immunoglobulins that bind IgE and FcγRIIb with high affinity, said compositions being capable of inhibiting cells that express membrane-anchored IgE. Such compositions are useful for treating IgE-mediated disorders, including allergies and asthma. | 07-11-2013 |
20130177554 | NEUROPILIN AS A BIOMARKER FOR BEVACIZUMAB COMBINATION THERAPIES - The present invention provides methods for improving treatment effect in a patient suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”), by treatment with bevacizumab (Avastin®) in combination with a chemotherapy regimen by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). The improved treatment effect may be improved overall survival or improved progression free survival. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). | 07-11-2013 |
20130177555 | Monomeric Polypeptides Comprising Variant FC Regions And Methods Of Use - Provided are monomeric polypeptides comprising variant Fc regions and methods of using them. In certain embodiments, monomeric polypeptides of the invention are fusion proteins. In certain embodiments, monomeric polypeptides of the invention are antibodies. | 07-11-2013 |
20130177556 | EGFR APTAMER INHIBITOR FOR USE IN THERAPY AND DIAGNOSIS - The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit. | 07-11-2013 |
20130183288 | NON-FUCOSYLATED ANTIBODIES - The present invention provides non-fucosylated therapeutic antibodies. More particularly, the invention provides non-fucosylated anti-CD20, anti-CD23 and anti-CD80 antibodies, which show enhanced antibody effector functions. Also provided are cells expressing the non-fucosylated antibodies and therapeutic methods using the non-fucosylated antibodies. | 07-18-2013 |
20130183289 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF PROGRESSIVE MULTIFOCAL LEUKOENCEPHALOPATHY (PML) - The invention relates to compositions, methods, and kits for treating subjects infected by or at risk of infection with a DNA virus (e.g., a JC Virus or a BK virus). Aspects of the invention are useful to prevent or treat DNA virus associated conditions (e.g., PML) in subjects that are immunocompromised. Compositions are provided that inhibit intracellular replication of DNA viruses. | 07-18-2013 |
20130183290 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH AN ANTI-VEGF ANTIBODY - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with an anti-VEGF antibody for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly | 07-18-2013 |
20130183291 | CANINE THYMIC STROMAL LYMPHOPOIETIN PROTEIN AND USES THEREOF - The present invention discloses a canine TSLP protein and a nucleic acid that encodes that protein. Peptide fragments of the protein that comprise specific epitopes of the canine TSLP protein are also disclosed. The canine TSLP protein and related peptide fragments may be used as an antigen for immunological assays, as well as for vaccines that induce anti-TSLP antibodies. The present invention further discloses methods of making and using the canine TSLP gene, the canine TSLP protein, and the related peptide fragments. | 07-18-2013 |
20130183292 | TUMOR THERAPY WITH AN ANTI-VEGF ANTIBODY - The present invention provides a method of treating a patient suffering from relapsed HER2 positive cancer with an anti-VEGF antibody during or after treatment with an anti-HER2 antibody. The invention also provides a kit comprising an anti-VEGF antibody. | 07-18-2013 |
20130183293 | ANTAGONISTS OF IL-6 TO PREVENT OR TREAT CACHEXIA, WEAKNESS, FATIGUE , AND/OR FEVER - The present invention is directed to therapeutic methods using antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat cachexia, fever, weakness and/or fatigue in a patient in need thereof. In preferred embodiments, the anti-IL-6 antibodies will be humanized and/or will be aglycosylated. Also, in preferred embodiments these patients will comprise those exhibiting (or at risk of developing) an elevated serum C-reactive protein level. In another preferred embodiment, the patient's survivability or quality of life will preferably be improved. | 07-18-2013 |
20130183294 | METHODS OF USING FGF19 MODULATORS - Provided herein are methods of using FGF19 modulators and/or bile acid metabolism biomarkers. | 07-18-2013 |
20130183295 | THERAPY-ENHANCING GLUCAN - This invention provides a method for introducing substances into cells comprising contacting a composition comprising orally administered beta-glucan with said cells. This invention also provides a method for introducing substances into a subject comprising administering to the subject an effective amount of the above compositions. The substance which could be delivered orally includes but is not limited to peptides, proteins, RNAs, DNAs, chemotherapeutic agents, biologically active agents, plasmids, and other small molecules and compounds. Finally, this invention provides a composition comprising orally administered beta-glucan capable of enhancing efficacy of IgM and different uses of the said composition. | 07-18-2013 |
20130183296 | Targeted Identification of Immunogenic Peptides - This invention relates generally to identifying peptide sequences involved in antibody binding to any protein for synthesis of vaccine treatments. This novel method allows for a more manageable vaccine peptide discovery and specific generation of unique immunogenic peptides from self-tumor as at proteins and/or foreign proteins from infectious organisms for specific and/or enhanced expression only in the presence of the antibody. | 07-18-2013 |
20130183297 | METHOD OF TREATING CANCERS AND A PHARMACEUTICAL COMPOSITION THAT MAY BE USED IN PRACTICING SAID METHOD - The method of treating a person having a cancer selected from carcinoma, sarcoma or hematopoietic cancer by administering (a) an effective amount of at least one anti-cancer drug selected from the group consisting of an epidermal growth factor receptor (EGFR) inhibitor, a vascular endothelial growth factor receptor (VEGFR) inhibitor and a Raf kinase inhibitor and (b) an effective amount of 5-(4-(6-(4-amino-3,5-dimethyl-phenoxy)-1-methyl-1H-benzimidazol-2-ylmethoxy)-benzyl)-thiazolidine-2,4-dione.dihydrochloride provided that said carcinoma is not lung cancer when an EGFR inhibitor is erlotinib. The invention also provides a pharmaceutical composition that may be used in practicing said method. | 07-18-2013 |
20130183298 | Methods of Treating Hepatitis With Anti-TNF alpha Antibodies - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 07-18-2013 |
20130183299 | ANTI-FOLATE RECEPTOR ALPHA ANTIBODIES AND USES THEREOF - Described herein are antibodies, and antigen-binding fragments thereof, that are specific for folate receptor alpha, related polynucleotides, expression vectors, and cells that express the described antibodies. Also provided are methods of using the described antibodies, and antigen-binding fragments thereof, and related kits. Provided herein are also methods for diagnosing cancers, such as breast cancer, thyroid cancer, colorectal cancer, endometrial cancer, fallopian tube cancer, ovarian cancer, or lung cancer, using the described antibodies, and antigen-binding fragments thereof. The methods involve determining the amount of folate receptor alpha in a sample derived from a subject and comparing this level with the level of folate receptor alpha in a control sample or reference sample. | 07-18-2013 |
20130183300 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 07-18-2013 |
20130183301 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF PANCREATIC CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from pancreatic cancer, in particular metastatic pancreatic cancer by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the overall survival and/or progression-free survival of the patient. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels in patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. | 07-18-2013 |
20130183302 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF BREAST CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer, by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the progression-free survival of the patient. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels in patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. | 07-18-2013 |
20130183303 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF BREAST CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer, by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the progression-free survival of the patient. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels in patients diagnosed with breast cancer, in particular locally advanced, recurrent or metastatic HER-2 negative breast cancer. | 07-18-2013 |
20130183304 | NEUROPILIN AS A BIOMARKER FOR BEVACIZUMAB COMBINATION THERAPIES - The present invention provides methods for improving treatment effect in a patient suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”), by treatment with bevacizumab (Avastin®) in combination with a chemotherapy regimen by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). The improved treatment effect may be improved overall survival or improved progression free survival. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level of neuropilin relative to a control level determined in patients suffering from gastric cancer, in particular, adenocarcinoma of the stomach or gastro-esophageal junction (“GEJ”). | 07-18-2013 |
20130183305 | CANCER THERAPY USING CLDN6 TARGET-DIRECTED ANTIBODIES IN VIVO - The invention relates to the treatment and/or prevention of tumor diseases associated with cells expressing CLD-N6, in particular cancer and cancer metastasis using antibodies which bind to CLDN6. The present application demonstrates that the binding of antibodies to CLDN6 on the surface of tumor cells is sufficient to inhibit growth of the tumor and to prolong survival and extend the lifespan of tumor patients. Furthermore, binding of antibodies to CLDN6 is efficient in inhibiting growth of CLDN6 positive germ cell tumors such as teratocarcinomas or embryonal carcinomas, in particular germ cell tumors of the testis. | 07-18-2013 |
20130183306 | ANTI-CD19 ANTIBODY HAVING ADCC FUNCTION WITH IMPROVED GLYCOSYLATION PROFILE - The present invention relates to an anti-CD19 antibody having a variant Fc region having some specific amino acid modifications relative to a wild-type Fc region which confer one or several useful effector functions. The present invention relates in particular to chimeric, humanized or full human anti-CD19 antibodies comprising such a variant Fc region. It relates advantageously to antibodies with an interesting and valuable glycosylation profile, especially a low fucose level and/or a high oligomannose level and low level of sialic acid, high ADCC function and no CDC. The present invention also relates to the use of these antibodies in the treatment, prevention or management of diseases or disorders, such as cancer, especially a B-cell malignancy and auto-immune disease. | 07-18-2013 |
20130189246 | TREATMENT OF OPHTHALMIC CONDITIONS WITH FLUORENONE DERIVATIVES - Provided are compositions and methods for treatment of ophthalmic conditions, such as retinal detachment and age-related macular degeneration. Various fluorenone derivatives described herein can stimulate fluid removal from the subretinal space and down-regulate reactive gliosis. Administration of compounds described herein can provide an alternative or an adjunct to an invasive procedure to reattach the retina. | 07-25-2013 |
20130189247 | Multimeric Proteins Comprising Immunoglobulin Constant Domains - The present invention relate to small binding proteins comprising two or more protein domains derived from a CH2 domain or CH2-like domain of an immunoglobulin in which the CH2 domains have been altered to recognize one or more target proteins and, in some embodiments, retain, or have modified, certain secondary effector functions. | 07-25-2013 |
20130189248 | EGFR INHIBITOR AND ANTIVIRAL AGENT FOR SIMULTANEOUS, SEPARATE OR SEQUENTIAL USE IN THE TREATMENT AND/OR PREVENTION AND/OR PALLIATION OF CANCER - The application relates to a combination of biologically active compounds comprising at least one antiviral agent and at least one EGFR antagonist, for simultaneous, separate or sequential use in the treatment and/or prevention and/or palliation of malignant or pre-malignant neoplasms, preferably of solid malignant or pre-malignant neoplasms. | 07-25-2013 |
20130189249 | METHODS AND COMPOSITIONS RELATED TO IMMUNIZING AGAINST STAPHYLOCOCCAL LUNG DISEASES AND CONDITIONS - Embodiments of the invention include methods and compositions useful in a vaccination strategy capable of neutralizing Hla to provide immunoprotection against | 07-25-2013 |
20130189250 | Human Tissue Factor Antibody and Uses Thereof - The invention relates to a humanized form of an antibody capable of preventing tissue factor (coagulation factor F3) signaling but which does not interfere with Factor VII binding or FX binding to tissue factor and does not prolong coagulation time. The antibody of the invention is useful in treating conditions, such as tumor progression, in which the associated cells express tissue factor and tissue factor signaling occurs. | 07-25-2013 |
20130189251 | HUMANIZED ANTIBODIES TARGETING THE EC1 DOMAIN OF CADHERIN-11 AND RELATED COMPOSITIONS AND METHODS - The present invention relates to humanized antibodies that specifically bind an EC1 domain of a mammalian Cadherin-11 protein and compositions (e.g., pharmaceutical compositions) comprising such antibodies. The invention also relates to methods for treating Cadherin-11-mediated disorders in a mammalian subject by administering a therapeutically effective amount of a humanized antibody of the invention. Cadherin-11-mediated disorders suitable for treatment by the methods of the invention include inflammatory disorders (e.g., inflammatory joint disorders, such as rheumatoid arthritis), fibrosis and cancer. | 07-25-2013 |
20130189252 | ANTIBODIES TO RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS (RAGE) AND USES THEREOF - The present application relates to antibodies, such as monoclonal antibodies, and in particular CDR grafted, humanized versions thereof, for the treatment and diagnosis of pain and other neuroinflammatory conditions associated with the Receptor for Advanced Glycation End Products (RAGE). | 07-25-2013 |
20130195844 | ANTIBODIES AGAINST HUMAN IL17 AND USES THEREOF - An antibody binding to IL-17 characterized by binding to the same IL-17 epitope to which monoclonal antibody 3C1 binds, and being of human IgG1 isotype modified in the hinge region at amino acid position 216-240, preferably at amino acid position 220-240, between C | 08-01-2013 |
20130195845 | ANTI-ERBB2 ANTIBODIES - Anti-ErbB2 antibodies are described which bind to an epitope in Domain 1 of ErbB2 and induce cell death via apoptosis. Various uses for these antibodies are also described. | 08-01-2013 |
20130195846 | COMBINATION THERAPY WITH TYPE I AND TYPE II ANTI-CD20 ANTIBODIES - The present invention is directed to a combination therapy involving a type I anti-CD20 antibody and a type II anti-CD20 antibody for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Another aspect of the invention is a kit comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type I anti-CD20 antibody and a type II anti-CD20 antibody. | 08-01-2013 |
20130195847 | TREATMENT WITH ANTI-VEGF ANTIBODIES - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents. | 08-01-2013 |
20130195848 | IMIDAZOPYRAZINES - The present invention relates to imidazopyrazine compounds of general Formula (I): in which X, R | 08-01-2013 |
20130195849 | Stable Heterodimeric Antibody Design with Mutations in the Fc Domain - The provided scaffolds have heavy chains that are asymmetric in the various domains (e.g. CH2 and CH3) to accomplish selectivity between the various Fc receptors involved in modulating effector function, beyond those achievable with a natural homodimeric (symmetric) Fc molecule, and increased stability and purity of the resulting variant Fc heterodimers. These novel molecules comprise complexes of heterogeneous components designed to alter the natural way antibodies behave and that find use in therapeutics. | 08-01-2013 |
20130195850 | CD3 IMMUNOTHERAPEUTICS AND USES THEREOF - The present disclosure provides a humanized anti-CD37 small modular immunopharmaceutical (SMIP) molecule, as well as synergistic combination therapies of CD37-specific binding molecules (such as anti-CD37 SMIP proteins or antibodies) with bifunctional chemotherapeutics (such as bendamustine) that can be administered concurrently or sequentially, for use in treating or preventing B cell related autoimmune, inflammatory, or hyperproliferative diseases. | 08-01-2013 |
20130195851 | ARTICLES OF MANUFACTURE AND METHODS FOR CO-ADMINISTRATION OF ANTIBODIES - The present invention relates to articles of manufacture and methods for co-administration of antibodies and/or antibody-like molecules, and further concerns methods for intravenous administration of more than one antibody and/or antibody-like molecule to a subject in need from a stable mixture contained in the same article of manufacture, such as an intravenous infusion bag (IV bag). | 08-01-2013 |
20130195852 | USE OF INHIBITORS OF BRUTON'S TYROSINE KINASE (BTK) - Disclosed herein are methods for treating a cancer comprising: a. administering a Btk inhibitor to a subject sufficient to result in an increase or appearance in the blood of a subpopulation of lymphocytes defined by immunophenotyping; b. determining the expression profile of one or more biomarkers from one or more subpopulation of lymphocytes; and c. administering a second agent based on the determined expression profile. | 08-01-2013 |
20130195853 | MODULATORS OF CANDIDA HYPHAL MORPHOGENESIS AND USES THEREOF - The invention relates to modulation of fungal morphology between yeast-to-hyphal growth transition by controlling muramyl-L-alanine concentration and uses thereof. | 08-01-2013 |
20130195854 | PREDICTIVE BIOMARKER FOR CANCER TREATMENT WITH ADCC-ENHANCED ANTIBODIES - The present invention is directed to methods for identifying which patients diagnosed with cancer will most benefit from treatment with an anti-cancer therapy comprising an ADCC-enhanced antibody. | 08-01-2013 |
20130195855 | METHODS OF ANTAGONIZING SIGNAL TRANSDUCTION IN DORSAL ROOT GANGLION CELLS - Use of antagonists to IL-31Ra and OSMRb are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include soluble receptors, antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 08-01-2013 |
20130195856 | METHODS OF ALTERING BONE GROWTH BY ADMINISTRATION OF SOST OR WISE ANTAGONIST OR AGONIST - The present invention provides a method of promoting local bone growth by administering a therapeutic amount of a Sost antagonist to a mammalian patient in need thereof. Preferably, the Sost antagonist is an antibody or FAB fragment selectively recognizing any one of SEQ ID NOS: 1-23. The Sost antagonist may be coadministered together or sequentially with a matrix conducive to anchoring new bone growth. Orthopedic and Periodontal devices comprising an implantable portion adapted to be permanently implanted within a mammalian body and bearing an external coating of a Sost antagonist are also disclosed, as it a method of increasing bone density by administering to a mammalian patient a therapeutic amount of a Sost antagonist together with an antiresorptive drug. | 08-01-2013 |
20130195857 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF PANCREATIC CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from pancreatic cancer, in particular metastatic pancreatic cancer by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the overall and/or progression-free survival of the patient. The present invention further provides methods for assessing the sensitivity or responsiveness of a pancreatic cancer patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, using similar methods. | 08-01-2013 |
20130195858 | TREATMENT OF B-CELL LYMPHOMA WITH MICRORNA - The invention relates to microRNA-34a and related microRNAs for use in the treatment of B-cell lymphoma. Likewise it relates to microRNA-34a for use in the preparation of a medicament for the treatment of B-cell lymphoma, and for a method of treatment of B-cell lymphoma comprising administering microRNA-34a. These claims are based on the observation that microRNA-34a shows strong anti-proliferative effects when overexpressed in diffuse large B-cell lymphoma (gDLBCL) cell lines, or when delivered intratumorally or systemically in xenograft models of DLBCL. | 08-01-2013 |
20130202586 | STEM CELL THERAPY USING INHIBITORS OF LYSOPHOSPHATIDIC ACID - Methods are provided for stem cell therapy using inhibitors of lysophosphatidic acid (LPA). Inhibition of LPA may be direct or indirect; particularly preferred direct inhibitors of LPA are antibodies to LPA, including humanized monoclonal antibodies to LPA. Such inhibitors are used in combination with stem cells for the treatment of injuries, diseases, or conditions amenable to treatment by stem cell therapy. | 08-08-2013 |
20130202587 | IDENTIFICATION OF GENETIC VARIANTS - The present disclosure provides a method for identifying whether a subject is more or less likely to be responsive to VEGF-based therapy, comprising screening a nucleic acid sample obtained from the subject to provide output information which identifies the presence or absence of an allelic variant, wherein the presence or absence of an allelic variant indicates whether the subject is more or less likely to be responsive to VEGF-based therapy. | 08-08-2013 |
20130202588 | Antitumor T Cell Response Enhancer - An objective of the present invention is to provide novel therapeutic agents for cancer, which have an excellent antitumor effect in cancer patients by enhancing their immune function. The present inventors discovered that the administration of at IL-6 inhibitor and/or gemcitabine or a salt thereof to tumor-bearing organisms yields an excellent antitumor T cell response-enhancing effect, and completed the present invention. In addition, the present inventors discovered that the T cell response-enhancing effect produces an excellent antitumor effect. | 08-08-2013 |
20130202589 | DIAGNOSIS AND TREATMENT OF AUTOANTIBODY-MEDIATED HEART DISEASE - Provided herein are, inter alia, methods of diagnosing and treating autoimmune cardiomyopathy in subjects, based upon the detection of IgG4 antibodies to cardiac autoantigens. | 08-08-2013 |
20130202590 | METHODS OF TREATING MYELODYSPLASTIC SYNDROMES WITH A COMBINATION THERAPY USING LENALIDOMIDE AND AZACITIDINE - Methods of treating, preventing and/or managing myelodysplastic syndromes are disclosed. Specific methods encompass the administrations of 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidin-2,6-dione in combination with 5-azacytidine. | 08-08-2013 |
20130202591 | ANTIBODIES DIRECTED AGAINST IL-17 - The disclosure relates to an isolated IL-17-binding agent which comprises an immunoglobulin heavy chain polypeptide comprising SEQ ID NO: 1 and optionally an immunoglobulin light chain polypeptide comprising SEQ ID NO: 23, except that one or more specific of residues of SEQ ID NO: 1 and SEQ ID NO: 23 are replaced with a different residue. The disclosure also provides vectors, compositions, and methods of using the IL-17-binding agent to treat an IL-17-mediated disease. | 08-08-2013 |
20130209449 | ANTI-PSGL-1 ANTIBODIES AND USES THEREOF - Provided herein, in one aspect, are antibodies that immunospecifically bind to PSGL-1, polynucleotides comprising nucleotide sequences encoding such antibodies, and expression vectors and host cells for producing such antibodies. Also provided herein are kits and pharmaceutical compositions comprising antibodies that specifically bind to PSGL-1, as well as methods of treating a disorder or disease caused by or associated with increased proliferation and/or numbers of activated T cells using the antibodies described herein. | 08-15-2013 |
20130209450 | Compositions and Methods for Treating Glioblastoma GBM - Methods of treating a malignant glioma in a subject are disclosed. The methods comprise administering to the subject a therapeutically effective amount of a viral vector comprising: (i) a first polynucleotide sequence encoding a Fas-chimera (Fas-c), said first polynucleotide sequence comprising SEQ ID NOs: 2 and 3; and (ii) a second polynucleotide sequence encoding an endothelial cell-specific promoter or a periendothelial cell-specific promoter. | 08-15-2013 |
20130209451 | Treatments for Cancer - The present invention provides methods for reducing tumor survival, expansion, and metastasis. In particular, the invention provides methods for reducing pancreatic tumor survival, expansion, and metastasis. The invention also provides agents for use in the methods, particularly agents that reduce the level or activity of connective tissue growth factor (CTGF), and methods for identifying such agents. | 08-15-2013 |
20130209452 | GENE DEFECTS AND MUTANT ALK KINASE IN HUMAN SOLID TUMORS - Novel gene deletions and translocations involving chromosome 2 resulting in fusion proteins combining part of Anaplastic Lymphoma Kinase (ALK) kinase with part of a secondary protein have been identified herein in human solid tumors, e.g. non-small cell lung carcinoma (NSCLC). Secondary proteins include Echinoderm Microtubule-Associated Protein-Like 4 (EML-4) and TRK-Fusion Gene (TFG). The EML4-ALK fusion protein, which retains ALK tyrosine kinase activity, was confirmed to drive the proliferation and survival of NSCLC characterized by this mutation. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ALK kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of this new fusion protein enables methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides. | 08-15-2013 |
20130209453 | USE OF TAU TO MONITOR IMMUNOTHERAPY - The invention provides methods of immunotherapy of Alzheimer's and similar diseases in which the regime administered is monitored by measuring levels of tau. | 08-15-2013 |
20130209454 | ANTI-HIV ANTIBODIES HAVING INCREASED POTENCY AND BREADTH - Embodiments of the present invention are directed to compositions and methods for anti-HIV (anti-CD4 binding site) antibodies having improved potency and breadth. | 08-15-2013 |
20130209455 | Humanized Anti-CDCP1 Antibodies - The present invention relates to humanized antibodies against human CDCP1 (anti-CDCP1 antibody), methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof. | 08-15-2013 |
20130209456 | SUBTYPES OF HUMANIZED ANTIBODY AGAINST INTERLEUKIN-6 RECEPTOR - An antibody subtype (1) which is a subtype of the humanized PM-1 antibody against interleukin-6 receptor (IL-6R) and in which one C-terminal of the heavy chain is Pro-NH | 08-15-2013 |
20130209457 | Optimized Fc Variants - The present invention relates to a variant Fc region comprising an amino acid substitution at position 238 of the Fc region as compared to a human parent Fc region, wherein the variant Fc region comprises a 238D substitution, wherein the variant Fc region binds FcγRIIb with increased binding affinity compared to a human parent Fc region. | 08-15-2013 |
20130209458 | FAB-GLYCOSYLATED ANTIBODIES - The present invention pertains to a method for controlling the circulation half-life of antibodies by adjusting the amount of sialic acid in the carbohydrates attached to the Fab part of the antibodies. Furthermore, the present invention provides antibodies having an increased circulation half-life. | 08-15-2013 |
20130209459 | TREATMENT WITH ANTI-ErbB2 ANTIBODIES - The present invention concerns the treatment of disorders characterized by the overexpression of ErbB2. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer overexpressing ErbB2 with a combination of an anti-ErbB2 antibody and a chemotherapeutic agent other than an anthracycline, e.g. doxorubicin or epirubicin. The invention further provides a method of treating cancer in a human patient comprising administering effective amounts of an anti-ErbB2 antibody and a cardioprotectant to the patient. | 08-15-2013 |
20130209460 | METHODS AND KITS USED IN IDENTIFYING GLIOBLASTOMA - The invention encompasses methods and kits used in the identification of invasive glioblastoma based upon the expression of TROY. The methods and kits also allow prediction of disease outcome as well as therapeutic outcome. | 08-15-2013 |
20130209461 | Use of 2-carboxamide cycloamino urea derivatives in the treatment of EGFR dependent diseases or diseases that have acquired resistance to agents that target EGFR family members - A method for treating an Epidermal Growth Factor Receptor (EGFR) dependent diseases or diseases that have acquired resistance to agents that target EGFR family members comprising administering a therapeutically effective amount of a compound of formula (I) | 08-15-2013 |
20130216523 | Methods for Facilitating Diagnosis, Prognosis and Treatment of Cancer by Detecting HER1 Expression - Methods are provided for facilitating the diagnosis of subjects with HER1-activated cancers. In addition, method of treating subjects with a cancer characterized as having high levels of activated HER1 are provided. Also provided are methods for determining or otherwise assessing the prognosis of an subject with a HER1-activated cancer. The methods include the analysis of samples for the presence or the absence of activated HER1 markers as indicated by HER1-HER1 homodimers, HER1 phosphorylation at position 1173, pan-phosphorylation of HER1 or associated molecules, or HER1-HER2 heterodimers. Activated HER1 measurements can be used to track a subject's response to a treatment regimen, predict the success of using a particular treatment regimen, determine the effects of a treatment regimen, or for categorizing a subject in order to create a homogenous group for a clinical trial. | 08-22-2013 |
20130216524 | Predictors for Cancer Treatment - The present invention provides methods of predicting a response to a cancer treatment by determining CD68 level or PSMB1 (P11A) polymorphism in a biological sample and the presence or quantity of a second biomarker in the patient. The invention also provides kits and methods for treating cancer. | 08-22-2013 |
20130216525 | CONCENTRATED PROTEIN FORMULATIONS AND USES THEREOF - Described are low viscosity, hypotonic formulations containing one or more proteins, e.g., antibodies, at high concentration, uses of the formulations, and articles of manufacture. In particular, the formulations are useful and beneficial for the subcutaneous administration or delivery of a high concentration of a protein drug, such as an antibody, to a subject who is afflicted with a disease or condition that is treatable by the protein drug. | 08-22-2013 |
20130216526 | METHODS FOR REDUCING VIRAL LOAD IN HIV-1 INFECTED PATIENTS - This invention provides a method of reducing viral load in an HIV-1-infected human subject which comprises administering to the subject an effective HIV-1 viral load reducing dose of a CCR5 receptor antagonist, such as a humanized antibody designated PRO 140 or an anti-CCR5 receptor monoclonal antibody, wherein the viral load reducing dose achieves an average maximum decrease of viral load in the subject of at least 1.83 log | 08-22-2013 |
20130216527 | NOVEL ANTI-CMET ANTIBODY - The present invention relates to a novel divalent antibody capable of binding specifically to the human c-Met receptor and/or capable of specifically inhibiting the tyrosine kinase activity of said receptor, preferably both in a ligand-dependent and in a ligand-independent manner as well as the amino acid and nucleic acid sequences coding for said antibody. More preferably said antibody comprises a modified hinge region and exhibits an improved antagonistic activity. More particularly, the antibody according to the invention is capable of inhibiting the c-Met dimerization. The invention likewise comprises the use of said antibody as a medicament for the prophylactic and/or therapeutic treatment of cancers, preferably for cancer characterized by a ligand-independent activation of c-Met, or any pathology connected with the over expression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the over-expression of c-Met. The invention finally comprises products and/or compositions comprising such an antibody in combination with other antibodies and/or chemical compounds directed against other growth factors involved in tumor progression or metastasis and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 08-22-2013 |
20130216528 | Anti-GD2 Antibodies - In this application are described chimeric, humanized, affinity matured, stability enhanced, and bispecific Anti-GD2 antibodies and fragments thereof. Also provided are methods of using individual antibodies or compositions thereof for the detection, prevention, and/or therapeutical treatment of GD2-related diseases, in particular, neuroblastoma. | 08-22-2013 |
20130216529 | HUMANEERED ANTI-FACTOR B ANTIBODY - This invention relates to humaneered anti-factor B antibodies and antigen-binding fragments thereof with reduced immunogenicity. The humaneered anti-factor B antibodies and antigen-binding fragments thereof are derived from murine monoclonal antibody 1379, which binds factor B in the third short consensus repeat (“SCR”) domain and selectively inhibits activation of the alternative complement pathway by preventing formation of the C3bBb complex. The invention also relates to methods of treating diseases or disorders in which activation of the alternative complement pathway plays a role, and methods of selectively inhibiting activation of the alternative complement pathway in an individual in need thereof. | 08-22-2013 |
20130216530 | Methods for optimizing biological response modifier therapy using therapeutic drug monitoring of immunosuppressants - The invention provides methods for treating humans in need of combined immunosuppressant and biological response modifier therapy. | 08-22-2013 |
20130216531 | ANTI-CXCR4 AS A SENSITIZER TO CANCER THERAPEUTICS - Inhibition of CXCR4 can inhibit tumor growth and metastasis during certain therapeutic windows. Disclosed are novel methods for treating and preventing cancer in a subject related to administration of CXCR4 inhibitors during a therapeutic window following treatment with another anti-tumor therapy. | 08-22-2013 |
20130216532 | Subcutaneous anti-HER2 Antibody Formulations and Uses Thereof - The present invention relates to a highly concentrated, stable pharmaceutical formulation of a pharmaceutically active anti-HER2 antibody, such as e.g. Trastuzumab (HERCEPTIN™), Pertuzumab or T-DM1, or a mixture of such antibody molecules for subcutaneous injection. In particular, the present invention relates to formulations comprising, in addition to a suitable amount of the anti-HER2 antibody, an effective amount of at least one hyaluronidase enzyme as a combined formulation or for use in form of a co-formulation. The formulations comprise additionally at least one buffering agent, such as e.g. a histidine buffer, a stabilizer or a mixture of two or more stabilizers (e.g. a saccharide, such as e.g. α,α-trehalose dihydrate or sucrose, and optionally methionine as a second stabilizer), a nonionic surfactant and an effective amount of at least one hyaluronidase enzyme. Methods for preparing such formulations and their uses thereof are also provided. | 08-22-2013 |
20130216533 | BIOLOGICAL MARKERS FOR IDENTIFYING PATIENTS FOR TREATMENT WITH VEGF ANTAGONISTS - The invention provides methods and compositions to detect expression of one or more biomarkers for identifying and treating patients who are likely to be responsive to VEGF antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods. | 08-22-2013 |
20130216534 | USE OF IL-20 ANTAGONISTS FOR TREATING RHEUMATOID ARTHRITIS AND OSTEOPOROSIS - The invention features methods and compositions for preventing or treating rheumatoid arthritis and osteoporosis by administering an antagonist of IL-20. The IL-20 antagonist may be an anti-IL-20 antibody, such as mAB 7E, that is capable of binding human IL-20 and blocking IL-20 interaction with its receptors. | 08-22-2013 |
20130216535 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 08-22-2013 |
20130216536 | INHIBITORS OF EXTRACELLULAR HSP90 - The present invention describes inhibitors of extracellular Hsp90. The inhibition of extracellular Hsp90 leads to a reduction of the invasiveness of the tumor cells. Furthermore, the invention relates to the use of molecules inhibiting extracellular Hsp90 function for the manufacture of a medicament for the treatment or prevention of invasion and/or metastatic potential of cancer cells. | 08-22-2013 |
20130224185 | PROTEIN FORMULATION - A stable lyophilized protein formulation is described which can be reconstituted with a suitable diluent to generate a high protein concentration reconstituted formulation which is suitable for subcutaneous administration. For example, anti-IgE and anti-HER2 antibody formulations have been prepared by lyophilizing these antibodies in the presence of a lyoprotectant. The lyophilized mixture thus formed is reconstituted to a high protein concentration without apparent loss of stability of the protein. | 08-29-2013 |
20130224186 | OXAZOLE AND THIAZOLE COMPOUNDS AS KSP INHIBITORS - Disclosed are new substituted oxazole and thiazole compounds of Formula (I) and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the derivatives together with pharmaceutically acceptable carriers, and uses thereof: | 08-29-2013 |
20130224187 | ANTI-C5a ANTIBODIES AND METHODS FOR USING THE ANTIBODIES - The present disclosure relates to, inter alia, antibodies, or antigen-binding fragments thereof, that bind to C5a and to use of the antibodies in methods for treating or preventing complement-associated disorders such as, but not limited to, atypical hemolytic uremic syndrome, age-related macular degeneration, rheumatoid arthritis, sepsis, severe burn, antiphospho lipid syndrome, asthma, lupus nephritis, Goodpasture's syndrome, and chronic obstructive pulmonary disease. | 08-29-2013 |
20130224188 | CD47 Antibodies and Methods of Use Thereof - This invention relates generally to monoclonal antibodies that recognize CD47, more specifically to CD47 antibodies that do not cause a significant level of agglutination of cells, to methods of generating these antibodies, and to methods of using these monoclonal antibodies as therapeutics. | 08-29-2013 |
20130224189 | TWEAK RECEPTOR - The present invention provides the TWEAK receptor and methods for identifying and using agonists and antagonists of the TWEAK receptor. In particular, the invention provides methods of screening for agonists and antagonists and for treating diseases or conditions mediated by angiogenesis, such as solid tumors and vascular deficiencies of cardiac or peripheral tissue. | 08-29-2013 |
20130224190 | ANTI-CD19 ANTIBODY HAVING ADCC AND CDC FUNCTIONS AND IMPROVED GLYCOSYLATION PROFILE - The present invention relates to an anti-CD19 antibody having a variant Fc region having some specific amino acid modifications relative to a wild-type Fc region which confer one or several useful effector functions. The present invention relates in particular to chimeric, humanized or full human anti-CD19 antibodies comprising such a variant Fc region. It relates advantageously to antibodies with an interesting and valuable glycosylation profile, especially a low fucose level and/or a high oligomannose level and low level of sialylated glycoform. The present invention also relates to the use of these antibodies in the treatment, prevention or management of disease or disorder, such as cancer, especially a B-cell malignancy, and auto-immune disease. | 08-29-2013 |
20130224191 | NOTUM PROTEIN MODULATORS AND METHODS OF USE - Novel modulators, including antibodies and derivatives thereof, and methods of using such modulators to treat hyperproliferative disorders are provided. | 08-29-2013 |
20130224192 | METHOD FOR THE PROGNOSIS OF THE PROGRESSION OF CANCER - The present invention relates to methods for the prognosis of the progression of cancer in a patient, and more particularly methods for the prediction of the occurrence of metastasis in one or more tissue or organ of patients affected with a cancer, in particular with a breast cancer, a lung cancer or other primary cancer, said methods comprising the step of detecting a higher expression level of FERMT1 gene in a tumour sample compared to a control reference values. The invention further relates to inhibitors of FERMT1 expression and their uses in the treatment of cancer or metastasis. | 08-29-2013 |
20130224193 | METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS - Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer. | 08-29-2013 |
20130224194 | METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS - Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer. | 08-29-2013 |
20130224195 | SUBSTITUTED BENZAZOLES AND METHODS OF THEIR USE AS INHIBITORS OF RAF KINASE - New substituted benzazole compounds, compositions and methods of inhibition of Raf kinase activity in a human or animal subject are provided. The new compounds compositions may be used either alone or in combination with at least one additional agent for the treatment of a Raf kinase mediated disorder, such as cancer. | 08-29-2013 |
20130230510 | METHOD OF INHIBITION OF LEUKEMIC STEM CELLS - A method for inhibition of leukemic stem cells expressing IL-3R.alpha.; (CD 123), comprises contacting the cells with an antigen binding molecule comprising a Fc region or a modified Fc region having enhanced Fc effector function, wherein the antigen binding molecule binds selectively to IL-3R.alpha. (CD123). The invention includes the treatment of a hematologic cancer condition in a patient by administration to the patient of an effective amount of the antigen binding molecule. | 09-05-2013 |
20130230511 | BIOMARKERS FOR RESPONSE TO TYROSINE KINASE PATHWAY INHIBITORS IN CANCER - Copy number gains detected in tumors and associated with drug sensitivity and resistance in vivo and in vitro can be used as biomarkers to select, predict and monitor drug treatment outcomes in cancer patients treated with tyrosine kinase inhibitors. Methods to identify patients with NSCLC or other malignancies who are more likely to benefit from tyrosine kinase inhibitors such as VEGF or VEGFR inhibitors when used either as monotherapy or in combination with other therapies such as chemotherapy or EGFR inhibitors, and who are in the advanced stages of disease and/or who have undergone adjuvant therapy are also provided herein. | 09-05-2013 |
20130230512 | INHIBITORS OF THE ATB(0,+) TRANSPORTER AND USES THEREOF - The present invention includes inhibitors of the amino acid transporter ATB | 09-05-2013 |
20130230513 | Assay Method for Alzheimer's Disease - A diagnostic test for preclinical and clinical Alzheimer's disease is based on plasma levels of Aβ | 09-05-2013 |
20130236448 | CONCENTRATED POLYPEPTIDE FORMULATIONS WITH REDUCED VISCOSITY - The present invention relates to polypeptide formulations with reduced viscosity and methods of making and using polypeptide formulations with reduced viscosity. | 09-12-2013 |
20130236449 | METHODS OF ENHANCING ANTIBODY-DEPENDENT CELLULAR CYTOTOXICITY - The application relates to method of increasing antibody-dependent cellular cytotoxicity in a subject receiving therapeutic monoclonal antibody treatment. In some embodiments, methods are provided for administering to subject to a subject in need thereof a therapeutic antibody in conjunction with an ADCC enhancer molecule. | 09-12-2013 |
20130236450 | Methods Using Lipoprotein-Associated Phospholipase A2 in an Acute Care Setting - This invention relates to methods for using Lipoprotein-associated Phospholipase A2 (Lp-PLA2) to care for subjects in an acute care setting. Specifically, Lp-PLA2 can be used determine if a subject having a vascular event, such as a stroke or heart attack, will benefit from therapy in the acute care setting. Moreover, it relates to methods of assessing risk and severity of a stroke by evaluating Lp-PLA2 levels alone or in combination with other assessments. In addition the invention relates to methods of using Lp-PLA2 to assess the functional outcome in a subject having a vascular event such as a stroke or heart attack. | 09-12-2013 |
20130236451 | ANTIBODIES DIRECTED AGAINST AMYLOID-BETA PEPTIDE AND METHODS USING SAME - Antibodies directed to the C-terminal side of β-amyloid peptide and methods of using these antibodies for diagnosing and treatment of Alzheimer's disease and Aβ peptide associated diseases are described. | 09-12-2013 |
20130236452 | ANTIBODIES SPECIFIC FOR SOLUBLE AMYLOID BETA PEPTIDE PROTOFIBRILS AND USES THEREOF - The invention relates to an isolated monoclonal antibody or antigen-binding fragment thereof that (a) binds (i) wild-type Aβ 42/40 protofibril comprising N-terminal truncated Aβ forms and (ii) Aβ 42/40 Arc protofibril comprising N-terminal truncated Aβ forms and (b) has no or little cross-reactivity to Aβ 42/40 monomers. The invention further relates to a method of using such an antibody to treat Alzheimer's disease. | 09-12-2013 |
20130236453 | Methods and Compositions for Modulating Acute Graft-versus-Host Disease using miR-155 Specific Inhibitors - Methods and compositions for treating or preventing acute graft-versus-host disease (aGVHD) in a subject using miR-155 specific inhibitors are described. | 09-12-2013 |
20130236454 | SUPERIOR EFFICACY OF CD37 ANTIBODIES IN CLL BLOOD SAMPLES - The present invention describes CD37 antibodies, especially A2 and B2, for the treatment of patients with CLL, especially of patients belonging to a “high risk” or “ultra-high risk” group of patients. Those patients are either patients who are refractory to fludarabine treatment or patients who carry a genetic marker which is indicative for poor prognosis or increased risk of treatment failure, e.g. patients with TP53 dysfunction or deletion of chromosome 17p13, or patients after failure to previous anti-CD20 treatment. The ability of A2 and B2 to deplete CLL cells is high both in patient samples derived from patients with normal risk and with increased risk (“high risk” patients) and clearly superior to that of rituximab and alemtuzumab. | 09-12-2013 |
20130243751 | GLYCOCONJUGATES AND THEIR USE AS POTENTIAL VACCINES AGAINST INFECTION BY SHIGELLA FLEXNERI - A conjugate molecule comprising an oligo- or polysaccharide covalently bound to a carrier and its use as potential vaccine against infection by | 09-19-2013 |
20130243752 | RECOMBINANTLY PRODUCED ANTIBODY - An antibody capable of potentiating immune responses and modifying existing states of immune responsiveness is described, as is the sequence of the antibody. Also described are compositions containing the antibody, as well as methods for using the antibody and the compositions to enhance immune responses, to enhance DC function, to modify an existing state of immune responsiveness, to immunize individuals, or to treat or inhibit conditions such as allergic asthma. | 09-19-2013 |
20130243753 | ANTI-AXL ANTIBODIES AND METHODS OF USE - The invention provides anti-Axl antibodies and methods of using the same. | 09-19-2013 |
20130243754 | HETEROCYCLIC COMPOUNDS AND METHODS OF USE - Heterocyclic compounds derived from benzotriazine, triazines, triazoles and oxadiazoles are disclosed. The methods of synthesis and of use of such heterocyclic compounds are also provided. | 09-19-2013 |
20130243755 | NOVEL HUMAN ULIP/CRMP PROTEIN AND USE THEREOF IN DIAGNOSIS AND TREATMENT OF CANCERS AND PARANEOPLASTIC NEUROLOGICAL SYNDROMES - A purified polypeptide, designated ULIP6, comprising the amino acid sequence SED ID No. 2 or an epitopic fragment of said polypeptide, comprising the sequence SEQ ID No. 4, is provided along with its nucleic acid sequences. In addition, antibodies to the polypeptide and methods of diagnosing paraneoplastic neurological syndromes and/or for the early diagnosis of the formation of cancerous tumors are also provided. | 09-19-2013 |
20130243756 | Methods for Treating Diseases and HSV Using Antibodies to Aminophospholipids - Disclosed are surprising discoveries concerning the role of anionic phospholipids and aminophospholipids in tumor vasculature and in viral entry and spread, and compositions and methods for utilizing these findings in the treatment of cancer and viral infections. Also disclosed are advantageous antibody, immunoconjugate and duramycin-based compositions and combinations that bind and inhibit anionic phospholipids and aminophospholipids, for use in the safe and effective treatment of cancer, viral infections and related diseases. | 09-19-2013 |
20130243757 | METHOD FOR CANCER DETECTION - The present invention relates to the diagnosis and treatment of cancer, and specifically to a method of diagnosing the presence, status or metastasis of cancer by detecting plasma Hsp90α having the amino acid sequence of SEQ ID NO:1 as a tumor marker. In addition, the present invention also relates to a method for the treatment of cancer and metastasis. | 09-19-2013 |
20130243758 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 09-19-2013 |
20130243759 | Transgenic Animals - The present invention relates inter alia to fertile non-human vertebrates such as mice and rats useful for producing antibodies bearing human variable regions, in which endogenous antibody chain expression has been inactivated. | 09-19-2013 |
20130243760 | MONOCLONAL ANTIBODIES AGAINST HER2 ANTIGENS, AND USES THEREFOR - The present invention provides and includes monoclonal antibodies (mAbs) preferentially selective for HER2 antigens, hybridoma lines that secrete these HER2 antibodies or antibody fragments, and the use of such antibodies and antibody fragments to detect HER2 antigens, particularly those expressed by cancer cells. The present invention also includes antibodies that are specific for or show preferential binding to a soluble or secreted form of HER2. The present invention also includes an antibody or antibody fragment that is capable of reducing the activity of HER2 in at least one form, including a soluble form or a secreted form. The present invention further includes chimeric antibodies, processes for producing monoclonal and chimeric antibodies or monoclonal or chimeric antibodies, and their therapeutic uses, particularly in the detection of cancer most preferentially in human breast, stomach, and colon. The present invention further includes methods and kits for the immunodetection and immunotherapy of cells for samples which express HER2 antigens. | 09-19-2013 |
20130243761 | METHODS FOR PREVENTION AND TREATMENT OF INFLAMMATION USING ANTI-CHEMOKINE ANTIBODIES - The present invention provides a means of inhibiting the growth and metastasis of cancer cells by administering anti-chemokine antibodies. It is possible to identify the particular chemokines which are over-expressed in the tumor using methods of the invention and administer antibodies against that over-expressed chemokine. | 09-19-2013 |
20130243762 | Optimized Fc Variants and Methods for Their Generation - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 09-19-2013 |
20130243763 | TREATMENT OF HIDRADENITIS SUPPURATIVA (HS) USING TNFalpha ANTIBODIES - Methods of treating TNFα-related disorders comprising administering TNFα inhibitors, including TNFα antibodies are described. | 09-19-2013 |
20130243764 | ANTIGEN-BINDING PROTEINS WITH INCREASED FCRN BINDING - The present invention provides antigen binding proteins which bind specifically to TNF-alpha. For example novel variants of anti-TNF antibodies such as adalimumab which show increased binding to the FcRn receptor or increased half life compared to adalimumab. Also provided are compositions comprising the antigen binding proteins and uses of such compositions in treatment of disorders and disease. | 09-19-2013 |
20130251703 | ANTIBODIES FOR EPIDERMAL GROWTH FACTOR RECEPTOR 3 (HER3) DIRECTED TO DOMAIN III AND DOMAIN IV OF HER3 - The present invention relates to antibodies or fragments thereof that bind to a non-linear epitope within domain 3 of the HER3 receptor and inhibit both ligand-dependent and ligand-independent signal transduction. The invention also relates antibodies or fragments thereof that bind to amino acid residues within domains 3-4 of HER3 and inhibit both ligand-dependent and ligand-independent signal transduction; and compositions and methods of use of such antibodies or fragments thereof. | 09-26-2013 |
20130251704 | MONOCLONAL ANTIBODIES AGAINST ORTHOPOXVIRUSES - The present invention relates to monoclonal antibodies that bind or neutralize Orthopoxviruses. The invention provides such antibodies, fragments of such antibodies retaining B5 or A33 binding ability, fully human antibodies retaining B5 or A33 binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 09-26-2013 |
20130251705 | COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING CANCER - The present invention relates to compositions and methods for characterizing, diagnosing, and treating cancer. In particular the invention provides the means and methods for the diagnosis, characterization, prognosis and treatment of cancer and specifically targeting cancer stem cells. The present invention provides an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor and inhibits growth of tumor cells. The present invention further provides a method of treating cancer, the method comprising administering a therapeutically effective amount of an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor protein and inhibits growth of tumor cells. | 09-26-2013 |
20130251706 | COMBINED USE OF FC GAMMA RIIB (CD32B) AND CD20 - SPECIFIC ANTIBODIES - The invention provides a method of treating a patient having target cells that express FcyRIIb, the method comprising administering (i) an antibody molecule that specifically binds a surface antigen of the target cell, which antibody molecule has an Fc domain capable of binding FcyRIIb; in combination with (ii) an agent that prevents or reduces binding between the Fc domain of the antibody molecule and FcyRIIb; characterized in that the patient is selected on the basis that their target cells express an elevated level of FcyRIIb. | 09-26-2013 |
20130251707 | ANTI-huTNFR1 ANTIBODY - The disclosure to an anti-huTNFR1 antibody of the IgG1 type, which has a modified Fc region deficient in mediating effector function, a pharmaceutical preparation comprising such antibody, and an anti-huTNFR1 antibody of the IgG1 type for use as a TNF antagonist without forming an agonistic TNFR1 signalling complex, as an alternative to treatment with an anti-TNF therapeutic. | 09-26-2013 |
20130251708 | ANTI-PSGL-1 ANTIBODIES AND USES THEREOF - Provided herein, in one aspect, are antibodies that immunospecifically bind to PSGL-1, polynucleotides comprising nucleotide sequences encoding such antibodies, and expression vectors and host cells for producing such antibodies. Also provided herein are kits and pharmaceutical compositions comprising antibodies that specifically bind to PSGL-1, as well as methods of treating a disorder or disease caused by or associated with increased proliferation and/or numbers of activated T cells using the antibodies described herein. | 09-26-2013 |
20130251709 | METHODS USING 3-(4-AMINO-1-OXO-1,3-DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE FOR TREATMENT OF ACUTE MYELOGENOUS LEUKEMIA - Methods of treating, preventing or managing leukemias are disclosed. The methods encompass the administration of an immunomodulatory compound of the invention known as Revlimid® or lenalidomide. The invention further relates to methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods of the invention are also disclosed. | 09-26-2013 |
20130251710 | Methods to Expand the Eligible Patient Population for HER2-Directed Targeted Therapies - The present disclosure provides improved methods for identifying breast cancer patients that receive an increased benefit from the addition of a HER2-targeted therapy, for example adjuvant trastuzumab, to chemotherapy. | 09-26-2013 |
20130251711 | NK CELL MODULATING TREATMENTS AND METHODS FOR TREATMENT OF HEMATOLOGICAL MALIGNANCIES - Compositions comprising compounds that neutralize NK cell inhibitory receptors and methods of using such compositions in the treatment of hematological malignancies are provided. | 09-26-2013 |
20130251712 | COVALENTLY DIMERIZED BIVALENT BINDING AGENTS - The present invention addresses limitations of prior art receptor-based traps through a methodology called the clamp/click/cleave (CCC) approach. Two fusion proteins each comprising a binding domain fused to a coiled-coil are non-covalently dimerized through the coiled-coil (clamp), and the dimer so formed is stabilized by a covalent disulphide bond (click) between cysteine residues located on the fusion proteins between the binding domains and coiled-coils. Once the disulphide bond has formed, the coiled-coils are subsequently removed (cleave) by cleaving the fusions proteins at cleavage sites located between the cysteine residues and the coiled-coils to provide the covalently dimerized bivalent binding agent of the present invention. Such binding agents are useful in the treatment and diagnosis of disease states characterized by production and/or overexpression of a ligand to which the binding domains bind. The invention is particularly useful for covalently dimerized receptor-based ligand traps where the binding domains are receptor ligand-binding domains, such as those of TGF-β receptors. | 09-26-2013 |
20130259858 | Signature for Predicting Clinical Outcome in Human HER2+ Breast Cancer - A method of predicting outcome in a subject with for example Her2+ (ERα | 10-03-2013 |
20130259859 | ANG2-BINDING MOLECULES - Ang2-binding molecules, preferably Ang2-binding immunoglobulin single variable domains like VHHs and domain antibodies, pharmaceutical compositions containing same and their use in the treatment of diseases that are associated with Ang2-mediated effects on angiogenesis. Nucleic acids encoding Ang2-binding molecules, host cells and methods for preparing same. | 10-03-2013 |
20130259860 | Humanized Antibodies To LIV-1 And Use Of Same To Treat Cancer - The invention provides humanized antibodies that specifically bind to LIV-1. The antibodies are useful for treatment and diagnoses of various cancers as well as detecting LIV-1. | 10-03-2013 |
20130266558 | Humanized Anti-CD22 Antibodies And Their Use In Treatment Of Oncology, Transplantation And Autoimmune Disease - Provided herein are chimeric and humanized versions of anti-CD22 mouse monoclonal antibody, HB22.7, which comprise human or humanized framework regions of the immunoglobulin heavy chain variable region (“VH”) and light chain variable region (“VK”). The FW regions may contain one or more backmutations in which a human FW residue is exchanged for the corresponding residue present in the parental mouse heavy or light chain. The human or humanized VH framework regions may comprise one or more of the following residues: a valine at position 24 of FW1, a glycine at position 49 of FW2, and an asparagine at position 73 of FW3, numbered according to Kabat. Further provided are pharmaceutical and immunotherapeutic compositions, and methods using anti-CD22 antibodies that preferably mediate human ADCC, CDC, and/or apoptosis for: the treatment of B cell diseases in humans, including B cell malignancies, autoimmune disease, GVHD, humoral rejection, and post-transplantation lymphoproliferative disorder. | 10-10-2013 |
20130266559 | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 10-10-2013 |
20130266560 | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 10-10-2013 |
20130266561 | B-CELL REDUCTION USING CD37-SPECIFIC AND CD20-SPECIFIC BINDING MOLECULES - The present invention generally provides methods for B-cell reduction in an individual using CD37-specific binding molecules. In particular, the invention provides methods for B-cell reduction using CD37-specific binding molecules alone, or a combination of CD37-specific binding molecules and CD20-specific binding molecules, in some instances a synergistic combination. The invention further provides materials and methods for treatment of diseases involving aberrant B-cell activity. In addition, the invention provides humanized CD37-specific binding molecules. | 10-10-2013 |
20130266562 | VARIABLE REGION SEQUENCES OF IL-31 MONOCLONAL ANTIBODIES AND METHODS OF USE - Novel compositions derived from antigen-binding sites of immunoglobulins having affinity for IL-31 are provided. The compositions exhibit immunological binding properties of antibody molecules capable of binding specifically to a human IL-31. CDR regions derived from same or different immunoglobulin moieties are provided. Also provided are single chain polypeptides wherein V | 10-10-2013 |
20130266563 | SUBSTITUTED 4-(SELENOPHEN-2(OR-3)-YLAMINO)PYRIMIDINE COMPOUNDS AND METHODS OF USE THEREOF - Selenophene compounds of formula (I) are described herein. In the compounds of Formula (I), ring A is a 6-membered aromatic fused ring, optionally containing one, two or three nitrogen atoms; a 5-membered heteroaromatic fused ring; or a mono- or bicyclic saturated heterocyclic fused ring having at least one ring member selected from the group consisting of N, O, S, SO and SO | 10-10-2013 |
20130266564 | ANTIBODIES SELECTIVE FOR CELLS PRESENTING ErbB2 AT HIGH DENSITY - An erbB2 antibody is provided that binds preferentially to disease cells having an erbB2 density greater than a normal erbB2 density. The erbB2 antibody comprises a heavy chain and a light chain. Each chain has a constant region and a variable region. Each variable region comprises framework regions and complementarity determining regions (CDRs), wherein the CDRs have an amino acid sequence set forth below: For the heavy chain: CDR1 GFNIKDTYIH (SEQ ID No. 1) CDR2 RIYPTNGY | 10-10-2013 |
20130273029 | ANTIBODIES FOR EPIDERMAL GROWTH FACTOR RECEPTOR 3 (HER3) DIRECTED TO DOMAIN II OF HER3 - The present invention relates to antibodies or fragments thereof that target an epitope of a HER3 receptor residing in domain 2 of the HER3 receptor to block both ligand-dependent and ligand-independent signal transduction and tumor growth; and compositions and methods of use thereof. | 10-17-2013 |
20130273030 | USE OF INHIBITORS OF BRUTON'S TYROSINE KINASE (BTK) - Disclosed herein are methods for treating a cancer comprising: a. administering a Btk inhibitor to a subject sufficient to result in an increase or appearance in the blood of a subpopulation of lymphocytes defined by immunophenotyping; b. determining the expression profile of one or more biomarkers from one or more subpopulation of lymphocytes; and c. administering a second agent based on the determined expression profile. | 10-17-2013 |
20130273031 | NOVEL ANTI-IGF-IR ANTIBODIES AND USES THEREOF - The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor IGF-IR and/or capable of specifically inhibiting the tyrosine kinase activity of said IGF-IR receptor, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGF-IR receptor. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 10-17-2013 |
20130273032 | PREDICTIVE BIOMARKER FOR CANCER TREATMENT WITH ADCC-ENHANCED ANTIBODIES - The present invention is directed to methods for identifying which patients diagnosed with cancer will most benefit from treatment with an anti-cancer therapy comprising an ADCC-enhanced antibody. | 10-17-2013 |
20130273033 | HUMANIZED EGFR ANTIBODIES - The present invention pertains to humanized anti-EGFR antibodies having antigen binding properties similar to those of the murine or chimeric anti-EGFR antibody from which they are derived. In particular, the present invention is directed to humanized anti-EGFR antibodies which are useful in the treatment of cancer. | 10-17-2013 |
20130273034 | NOVEL COMPOUNDS AND COMPOSITIONS FOR THE INHIBITION OF NAMPT - The present invention relates to compounds and compositions for the inhibition of NAMPT, their synthesis, applications and antidotes. An illustrative compound of the invention is shown below: | 10-17-2013 |
20130273035 | Methods and Compositions for Reducing Amyloid Beta Levels - The present invention provides methods for reducing the level of amyloid beta protein in a cell or tissue, the methods generally involving contacting the cell or tissue with an agent that reduces cystatin C levels and/or activity. The present invention provides methods for treating Alzheimer's disease (AD), and methods for treating cerebral angiopathy, in an individual, the methods generally involving administering to an individual having AD a therapeutically effective amount of an agent that reduces cystatin C levels and/or activity. The present invention further provides methods for identifying an agent that reduces cystatin C levels and/or activity. | 10-17-2013 |
20130273036 | Fn14 Binding Proteins and Uses Thereof - The present disclosure provides proteins comprising antibody antigen binding domains that bind to Fn14 and uses thereof. The present disclosure also provides methods for treating wasting disorders, such as cachexia. | 10-17-2013 |
20130273037 | COMPOUNDS AND METHODS FOR ANTIVIRAL TREATMENT - Compounds and pharmaceutically acceptable salts and esters and compositions thereof, for treating viral infections are provided. The compounds and compositions are useful for treating Pneumovirinae virus infections. The compounds, compositions, and methods provided are particularly useful for the treatment of Human respiratory syncytial virus infections. | 10-17-2013 |
20130273038 | HUMAN CDR-GRAFTED ANTIBODY AND ANTIBODY FRAGMENT THEREOF - A human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of human CC chemokine receptor 4 (CCR4) but does not react with a human blood platelet; a human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of CCR4 and has a cytotoxic activity against a CCR4-expressing cell; and a medicament, a therapeutic agent or a diagnostic agent comprising at least one of the antibodies and the antibody fragments thereof as an active ingredient. | 10-17-2013 |
20130273039 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODY - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 10-17-2013 |
20130273040 | POLYPEPTIDES WITH ENHANCED ANTI-INFLAMMATORY AND DECREASED CYTOTOXIC PROPERTIES AND RELATING METHODS - The invention provides a polypeptide containing at least one IgG Fc region, wherein said at least one IgG Fc region is glycosylated with at least one galactose moiety connected to a respective terminal sialic acid moiety by a α2,6 linkage, and wherein said polypeptide having a higher anti-inflammatory activity as compared to an unpurified antibody. | 10-17-2013 |
20130273041 | USE OF CHIMERIC ANTI-CD20 ANTIBODY AS IN VITRO OR IN VIVO PURGING AGENT IN PATIENTS RECEIVING BMT OR PBSC TRANSPLANT - The use of anti-CD20 antibodies as in vivo purging agents for patients receiving bone marrow or peripheral blood stem cell transplant during treatment of B-cell-related diseases, e.g., B-cell lymphomas or leukemias, is disclosed. Such purging may enhance engraftment and/or prevent disease relapse in such patients. | 10-17-2013 |
20130273042 | TREATMENT OF MULTIPLE SCLEROSIS - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 10-17-2013 |
20130273043 | Optimized Fc Variants - The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants. | 10-17-2013 |
20130280242 | METHOD OF PLSCR INHIBITION FOR CANCER THERAPY - The present invention relates to a method of using inhibitors of phospholipid scramblases (PLSCRs) for the prophylactic or therapeutic treatment of cancers. The PLSCR-inhibitors of the invention comprise compounds PLSCR-specific monoclonal antibodies, antagonists or nucleic acids, which have ability to decrease the level and/or biological activity of PLSCRs in cancer cells. | 10-24-2013 |
20130280243 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH A mTOR INHIBITOR - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with a mTOR inhibitor for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and a mTOR inhibitor such as Temsirolimus or Everolimus. | 10-24-2013 |
20130280244 | COMPOSITIONS AND METHODS FOR TREATING NEOPLASIA - The invention provides therapeutic methods featuring the use of chimeric human/mouse antibodies for the treatment of neoplasia. | 10-24-2013 |
20130280245 | 3-Aryl-6-aryl-[1,2,4]triazolo[4,3-alpha]pyridines as Inhibitors of Cell Proliferation and the Use Thereof - Disclosed are 3-aryl-6-aryl-[1,2,4]triazolo[4,3-α]pyridines thereof, represented by the Formula (I) wherein Ar | 10-24-2013 |
20130280246 | Humanized Antibodies with Anti-Tumor Activity - The present invention provides humanised antibodies and binding domains thereof with anti-tumour activity. In particular the humanised antibodies have specific binding to and direct killing of human colon tumour cells and display potent immune-mediated cytotoxic activity against human colon cancer cells in vitro using antibody-dependent cell-mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) assays and in vivo using mouse tumour models. | 10-24-2013 |
20130280247 | REGULATORS OF MMP-9 AND USES THEREOF - A method of regulating an activity of metalloproteinase 9 (MMP-9) is disclosed. The method comprises contacting the MMP-9 with an agent which specifically interacts with an OG domain of the MMP-9. Molecules capable of specifically interacting with the OG domain, methods of identifying same, pharmaceutical compositions comprising same and uses thereof are also disclosed. | 10-24-2013 |
20130280248 | METHOD OF STABILIZING ANTIBODY AND STABILIZED SOLUTION-TYPE ANTIBODY PREPARATION - The present invention provides a method of suppressing the formation of a soluble association of an antibody in a solution; a method of suppressing the formation of a chemically degraded product of an antibody in a solution; and a method of stabilizing an antibody in a solution. The present invention also provides a solution-type antibody preparation in which the formation of a soluble association is suppressed; a solution-type antibody preparation in which the formation of a chemically degraded product is suppressed; a solution-type antibody preparation in which the formation of a soluble association, the formation of a chemically degraded product and the formation of an insoluble aggregate are suppressed; an agent for suppressing the formation of a soluble association of an antibody; an agent for suppressing the formation of a chemically degraded product of an antibody; and a stabilizing agent for an antibody. | 10-24-2013 |
20130287762 | NEUTRALIZING ANTIBODIES AGAINST GDF-8 AND USES THEREFOR - The disclosure provides novel antibodies against growth and differentiation factor-8 (GDF-8), in particular human antibodies, and antibody fragments, including those that inhibit GDF-8 activity in vitro and/or in vivo. The disclosure also provides methods for diagnosing, preventing, or treating degenerative disorders of muscle or bone, or disorders of insulin metabolism. | 10-31-2013 |
20130287763 | COMBINATION THERAPY FOR TREATING CANCER COMPRISING AN IGF-1R INHIBITOR AND AN AKT INHIBITOR - The present invention relates to a method of treating cancer by administering an IGF-1R specific antibody in combination with an anti-cancer agent exemplified by an Akt pathway inhibitor. The first and second amounts together comprise a therapeutically effective amount. | 10-31-2013 |
20130287764 | METHOD FOR INHIBITING BONE RESORPTION - The invention is directed to a method of inhibiting bone resorption. The method comprises administering to a human an amount of sclerostin inhibitor that reduces a bone resorption marker level for at least 2 weeks. The invention also provides a method of monitoring anti-sclerostin therapy comprising measuring one or more bone resorption marker levels, administering a sclerostin binding agent, then measuring the bone resorption marker levels. Also provided is a method of increasing bone mineral density; a method of ameliorating the effects of an osteoclast-related disorder; a method of treating a bone-related disorder by maintaining bone density; and a method of treating a bone-related disorder in a human suffering from or at risk of hypocalcemia or hypercalcemia, a human in which treatment with a parathyroid hormone or analog thereof is contraindicated, or a human in which treatment with a bisphosphonate is contraindicated. | 10-31-2013 |
20130287765 | FSH AND FSH RECEPTOR MODULATOR COMPOSITIONS AND METHODS FOR INHIBITING OSTEOCLASTIC BONE RESORPTION AND BONE LOSS IN OSTEOPOROSIS - The invention discloses compositions and methods for decreasing osteoclast which are useful for the treatment of a variety of bone loss disorders. | 10-31-2013 |
20130287766 | ANTIBODIES AND METHODS FOR MAKING AND USING THEM - The invention provides antibodies, including chimeric human antibodies, recombinant antibodies, synthetic anti-bodies, and the nucleic acids encoding them, and methods for making and using these immunoglobulins. The invention provides recombinant and synthetic polypeptide and nucleic acid embodiments of these polypeptides and/or antibodies. The invention also provides polypeptides comprising, or consisting of, consensus human framework regions, or “Independently Consensused Frameworks (ICFs)”, nucleic acids encoding them, and libraries and kits comprising these ICFs and/or antibodies of the invention, individually and in combinatorial libraries and combinations. | 10-31-2013 |
20130287767 | SUBSTITUTED 4-(ARYLAMINO) SELENOPHENOPYRIMIDINE COMPOUNDS AND METHODS OF USE THEREOF - The invention discloses 4-(arylamino)selenophenopyrimidine derivatives of formula (I), hydrates, solvates, isomers, or pharmaceutically acceptable salts thereof; process for their preparation and methods of treating or inhibiting or controlling a cell proliferative disorders, particularly cancer using said compounds. Pharmaceutical compositions comprising 4-(arylamino)selenophenopyrimidine derivatives of formula (I) are useful for the treatment, inhibition, or control of cancer. | 10-31-2013 |
20130287768 | PHARMACEUTICAL COMPOSITION COMPRISING ANTIBODY COMPOSITION WHICH SPECIFICALLY BINDS TO CCR4 - A pharmaceutical composition, comprising an antibody composition which specifically binds to human CC chemokine receptor 4 (hereinafter also referred to as CCR4) and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament are required. The present invention can provide a pharmaceutical composition comprising a recombinant antibody against CCR4 and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament. | 10-31-2013 |
20130287769 | TREATMENT OF SOLID TUMORS WITH RAPAMYCIN DERIVATIVES - The present invention is directed to the use of rapamycin derivatives for use in treating solid tumors, optionally in combination with a chemotherapeutic agent. | 10-31-2013 |
20130287770 | HUMAN ANTI-KIR ANITBODIES - Compositions and methods for regulating an immune response in a subject are described. More particularly, described are human antibodies that regulate the activity of NK cells and allow a potentiation of NK cell cytotoxicity in mammalian subjects, and antibodies having antigen-binding properties similar to those of human monoclonal antibody 1-7F9 or 1-4F1. Described also are also fragments and derivatives of such antibodies, as well as pharmaceutical compositions comprising the same and their uses, particularly for use in therapy, to increase NK cell activity or cytotoxicity in subjects. | 10-31-2013 |
20130287771 | Isolation and Purification of Anti-IL-13 Antibodies Using Protein A Affinity Chromatography - Disclosed herein are methods for the isolation and purification of anti-IL-13 antibodies wherein the use of an affinity chromatographic step results in an antibody composition sufficiently pure for pharmaceutical uses. The methods described herein comprise pH viral reduction/inactivation, ultrafiltration/diafiltration, affinity chromatography (e.g., Protein A affinity chromatography), ion exchange chromatography, and hydrophobic chromatography. Further, the present invention is directed toward pharmaceutical compositions comprising one or more antibodies of the present invention. | 10-31-2013 |
20130295082 | ANTIBODY FORMULATIONS AND METHODS - Antibody formulations and methods useful for prophylaxis or treatment of amyloidosis, including AA amyloidosis and AL amyloidosis. | 11-07-2013 |
20130295083 | 2a-Methyl-19-nor-(20S)-1a,25-dihydroxyvitamin D3 (2AMD) or 2 methylene-19-nor-(20S)-1a,25-dihydroxyvitamin D3 (2MD) Support Survival and Function of Transplanted Islet Cells In Type 1 Diabetes - A method of treating islet cell transplant patients is described herein. The method comprises the steps of a) identifying an islet cell transplant patient, b) treating the patient with 2AMD or 2AMD analog and c) observing a prolonged period of normal glycemia is disclosed. A composition for treatment of islet cell transplant patient is disclosed as well, wherein the composition comprises 50-400 ng/day of 2AMD or 2AMD analog. | 11-07-2013 |
20130295084 | BINDING PROTEINS HAVING TETHERED LIGHT CHAINS - The present invention relates to binding proteins having tethered light chains and methods of making and using them. | 11-07-2013 |
20130295085 | ANTI-CD154 ANTIBODIES HAVING IMPAIRED FcR BINDING AND/OR COMPLEMENT BINDING PROPERTIES AND USE IN THERAPY - Improved anti-CD154 antibodies are provided herein which have ablated FcR binding and/or complement binding/activation. The use of these antibodies for inducing tolerance and treating immune diseases including autoimmunity, inflammation and allergic disorders is disclosed herein. | 11-07-2013 |
20130295086 | ANTIBODIES SELECTIVE FOR CELLS PRESENTING EGFR AT HIGH DENSITY - Herein described are antibodies to epidermal growth factor receptor (EGFR) having an EGFR binding affinity that is sufficient to kill disease cells presenting EGFR at high density, but is insufficient for binding to normal cells. A therapeutic effect is thus achieved while avoiding adverse events that result from unintended binding to normal cells. | 11-07-2013 |
20130295087 | METHODS OF TREATING CHRONIC PAIN - The invention relates to an anti-CGRP antibody for use in the prevention and/or treatment of chronic pain and/or symptoms of chronic pain, and to a method of treating and/or preventing chronic pain and/or symptoms of chronic pain using an anti-CGRP antibody. | 11-07-2013 |
20130295088 | METHODS OF TREATING INFLAMMATORY PAIN - The invention relates to an anti-CGRP antibody for use in the prevention and/or treatment of inflammatory pain and/or symptoms of inflammatory pain, and to a method of treating and/or preventing inflammatory pain and/or symptoms of inflammatory pain using an anti-CGRP antibody. | 11-07-2013 |
20130295089 | METHOD OF PROMOTING BONE GROWTH BY AN ANTI-ACTRIIA ANTIBODY - In certain aspects, the present invention provides compositions and methods for promoting bone growth and increasing bone density. | 11-07-2013 |
20130295090 | HUMANIZED MONOCLONAL ANTIBODIES THAT SPECIFICALLY BIND AND/OR NEUTRALIZE JAPANESE ENCEPHALITIS VIRUS (JEV) AND THEIR USE - Disclosed herein are isolated humanized monoclonal antibodies that specifically bind Japanese encephalitis virus (JEV) with a binding affinity of about 1.0 nM or less. Nucleic acids encoding these antibodies, expression vectors including these nucleic acid molecules, and isolated host cells that express the nucleic acid molecules are also disclosed. Methods of treating, preventing, and/or ameliorating JEV infection in a subject with JEV also are disclosed. Additionally, the antibodies can be used to detect JEV in a sample, and methods of diagnosing JEV infection, or confirming a diagnosis of JEV infection in a subject, are disclosed herein that utilize these antibodies. | 11-07-2013 |
20130295091 | COMBINATION THERAPY INCLUDING TUMOR ASSOCIATED ANTIGEN BINDING ANTIBODIES - The present invention relates to a combination therapy including tumor associated antigen binding antibodies. | 11-07-2013 |
20130302316 | ANTAGONIST ANTIBODY FOR THE TREATMENT OF CANCER - Antibodies, humanized antibodies, resurfaced antibodies, antibody fragments, derivatized antibodies, and conjugates of same with cytotoxic agents, which specifically bind to, and inhibit A class of Eph receptors, antagonize the effects of growth factors on the growth and survival of tumor cells, and which have minimal agonistic activity or are preferentially devoid of agonist activity. Said antibodies and fragments thereof may be used in the treatment of tumors that express elevated levels of A class of Eph receptors, such as breast cancer, colon cancer, lung cancer, ovarian carcinoma, synovial sarcoma and pancreatic cancer, and said derivatized antibodies may be used in the diagnosis and imaging of tumors that express elevated levels of A class of Eph receptors. Also provided are cytotoxic conjugates comprising a cell binding agent and a cytotoxic agent, therapeutic compositions comprising the conjugate, methods for using the conjugates in the inhibition of cell growth and the treatment of disease, and a kit comprising the cytotoxic conjugate are disclosed are all embodiments of the invention. In particular, the cell binding agent is a monoclonal antibody, and epitope-binding fragments thereof, that recognizes and binds the A class of Eph receptors. | 11-14-2013 |
20130302317 | Siglec-9 Binding Agents - The present invention relates to agents capable of binding sialic acid-binding immunoglobulin-like lectin-9 (Siglec-9) and their use in the treatment of cell proliferation and differentiation disorders. Furthermore, the present invention provides associated pharmaceutical formulations and methods. | 11-14-2013 |
20130302318 | Anti-CD38 Antibody and Lenalidomide or Bortezomib for the Treatment of Multipe Myeloma and NHL - The present disclosure describes a pharmaceutical combination of an anti-CD38 antibody and lenalidomide and a pharmaceutical combination of an anti-CD38 antibody and bortezomib. | 11-14-2013 |
20130302319 | ZEAXANTHIN FOR TUMOR TREATMENT - A composition comprising a pharmaceutically effective amount of zeaxanthin or its derivative for use in treating a malignant tumor and a method of using a pharmaceutically effective amount of zeaxanthin or its derivative either alone or together with one or more pharmaceutical agents for treating a malignant tumor. The tumor may be, but is not limited to breast cancer, cervix cancer, colon cancer, cutaneous melanoma, cutaneous squamous carcinoma, hepatocellular carcinoma, lung cancer, osteosarcoma, prostate cancer, and uveal melanoma. The pharmaceutically effective amount of zeaxanthin is generally above about 0.5 mg/kg/d to about 20 mg/kg/d. | 11-14-2013 |
20130302320 | Use of Semaphorin-4D Binding Molecules to Promote Neurogenesis Following Stroke - Provided herein are methods for promoting neurogenesis in neural tissue of a patient exhibiting at least one symptom of a central nervous system disorder, the method comprising administering to a subject in need thereof an effective amount of an isolated binding molecule which specifically binds to semaphorin-4D (SEMA4D). | 11-14-2013 |
20130302321 | Methods and Means for Typing a Sample Comprising Cancer Cells Based on Oncogenic Signal Transduction Pathways - The invention is related to a method of determining whether an individual suffering from cancer is likely to respond to anti-EGFR and/or EGFR pathway therapy. In one aspect, the invention utilizes the expression level of a set of genes for determining said response. In a further aspect, the invention relates to a method of assigning treatment to an individual suffering from cancer. | 11-14-2013 |
20130302322 | METHODS OF TREATING CONDITIONS WITH ANTIBODIES THAT BIND COLONY STIMULATING FACTOR 1 RECEPTOR (CSF1R) - Methods of treating conditions with antibodies that bind colony stimulating factor 1 receptor (CSF1R) are provided. Such methods include, but are not limited to, methods of treating rheumatoid arthritis and associated conditions, methods of treating systemic lupus erythematosus and associated conditions, and methods of treating multiple sclerosis. | 11-14-2013 |
20130302323 | METHODS FOR TREATING DIFFUSE LARGE B-CELL LYMPHOMA WITH 3-(4-AMINO-1-OXO-1,3-DIHYDROISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE IN COMBINATION WITH SECOND ACTIVE AGENTS - Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed. | 11-14-2013 |
20130302324 | Methods for treating retinopathy with extended therapeutic effect - Methods for treating and preventing retinopathic conditions by administering a glucocorticoid to the vitreous chamber of a patient at risk of, or suffering from, the retinopathy. | 11-14-2013 |
20130302325 | METHODS FOR TREATING OSTEOARTHRITIS PAIN BY ADMINISTERING A NERVE GROWTH FACTOR ANTAGONIST AND COMPOSITIONS CONTAINING THE SAME - The invention concerns anti-NGF antibodies (such as anti-NGF antagonist antibodies), and polynucleotides encoding the same. The invention further concerns use of such antibodies and/or polynucleotides in the treatment and/or prevention of pain, including post-surgical pain, rheumatoid arthritis pain, and osteoarthritis pain. | 11-14-2013 |
20130302326 | PYRO-GLUTAMATE ABETA TARGETING AGENTS - A method of inhibiting amyloid beta aggregation in a mammal includes administering an amount of a pyro-Glu-(3-40/42)-Aβ targeting agent and/or fragment thereof that specifically binds to an epitope of the N terminus end of a pyro-Glu-(3-40/42)-Aβ effective to inhibit amyloid beta aggregation in the subject. | 11-14-2013 |
20130302327 | MARKER FOR DETERMINATION OF SENSITIVITY TO TRIPLET COMBINATION ANTI-CANCER AGENT - To provide a marker for determining sensitivity of a patient to an anti-cancer agent, which marker can determine whether or not the patient has a therapeutic response to the anti-cancer agent, and novel cancer therapeutic means employing the marker. | 11-14-2013 |
20130302328 | TRUNCATED HER2 SRM/MRM ASSAY - This disclosure provides ten (10) specific peptides, and particular peptide characteristics, from the cell membrane-bound Her2 protein and a diagnostic assay useful for determining the presence and amount of full length and truncated versions of the full-length Her2 protein in cells derived from formalin fixed paraffin embedded tissue. | 11-14-2013 |
20130309222 | AFFINITY PEPTIDES TOWARD INFLIXIMAB - We have disclosed affinity peptides toward infliximab. More specifically we have disclosed an affinity biomatrix where the affinity peptide is covalently attached to a biocompatible, biodegradable polymer. The affinity biomatrix is useful in preparing controlled release devices for infliximab. | 11-21-2013 |
20130309223 | CD33 Antibodies And Use Of Same To Treat Cancer - The invention provides murine, chimeric, and humanized antibodies that specifically bind to CD33. The antibodies are useful for treatment and diagnoses of various cancers as well as detecting CD33. | 11-21-2013 |
20130309224 | COMBINATION OF CD37 ANTIBODIES WITH RITUXIMAB - The present invention relates to immunotherapies that are based on depletion of CD37-positive cells such as B-cells. The present invention provides methods for reduction of CD37-positive cells such as B-cells in an individual/patient using a combination of CD37 antibody/antibodies and bendamustine. The combination of CD37 antibodies, CD20 antibodies and bendamustine is shown to have a synergistic effect. The application further provides materials and methods for treatment of diseases involving aberrant B-cell activity. | 11-21-2013 |
20130309225 | COMBINATION OF CD37 ANTIBODIES WITH ICE - The present invention relates to immunotherapies that are based on depletion of CD37-positive cells such as B-cells. The present invention provides methods for reduction of CD37-positive cells such as B-cells in an individual/patient using a combination of CD37 antibody/antibodies and ICE. The combination of CD37 antibodies and ICE is shown to have improved anti-tumor efficacy compared to single agent treatment. The application further provides materials and methods for treatment of diseases involving aberrant B-cell activity. | 11-21-2013 |
20130309226 | HIGH-CONCENTRATION MONOCLONAL ANTIBODY FORMULATIONS - The present application discloses high-concentration monoclonal antibody formulations suitable for subcutaneous administration, e.g. via a pre-filled syringe. In particular, it discloses a formulation comprising a spray dried monoclonal antibody at a concentration of about 200 mg/mL or more suspended in a non-aqueous suspension vehicle where the viscosity of the suspension vehicle is less than about 20 centipoise. Also disclosed are: a subcutaneous administration device with the formulation therein, a method of making the formulation, a method of making an article of manufacture comprising the suspension formulation, use of the formulation in the preparation of a medicament, and a method of treating a patient with the formulation. | 11-21-2013 |
20130309227 | METHODS FOR TARGETING PULMONARY DISEASES WITH AGENTS THAT BIND A TARGET IN PULMONARY TISSUE - Disclosed is the use of an agent (e.g., antibody fragment, antagonist, ligand, dAb monomer) that binds a target in pulmonary tissue for the manufacture of a long action or long therapeutic window formulation for local delivery to pulmonary tissue, and methods for administering an agent that binds a target in pulmonary tissue to a subject to produce a long therapeutic window in pulmonary tissue. The formulation is for, and the method comprises, administering locally to pulmonary tissue. Also disclosed is the use of antagonists of TNFR1 for the manufacture of a formulation or medicament for treating, preventing or suppressing lung inflammation or a respiratory disease, and methods of treating such diseases. Also disclosed are the use of agents a for the manufacture of a delivery device (e.g., inhaler, intranasal delivery device) for the treatment or prevention of lung inflammation or a respiratory disease, and a delivery device for the treatment or prevention of lung inflammation or a respiratory disease that contains an agent as described herein. | 11-21-2013 |
20130309228 | PYRIMIDINEDIAMINE KINASE INHIBITORS - Disclosed embodiments provide pyrimidinediamine compounds useful for inhibiting kinase activity, including the activity of polo-like kinase 1 (PLK1). Also disclosed are pharmaceutical compositions comprising these compounds and methods of treating diseases associated with kinase activity, in particular enhanced PLK1 catalytic activity, such as diseases associated with abnormal cell proliferation, including neoplastic disorders. | 11-21-2013 |
20130309229 | RECOMBINANT T CELL LIGANDS AND ANTIBODIES THAT BIND B CELLS FOR THE TREATMENT OF AUTOIMMUNE DISEASES - Methods are disclosed for treating or inhibiting an autoimmune disease in a subject. In some embodiments, the disclosed methods include administering to the subject a therapeutically effective amount of one or more Major Histocompatibility Complex (MHC) molecules including covalently linked first, second and third domains; wherein the first domain is an MHC class II β1 domain and the second domain is an MHC class II α1 domain, wherein the amino terminus of the α1 domain is covalently linked to the carboxy terminus of the β1 domain; or wherein the first domain is an MHC class I α1 domain and the second domain is an MHC class I α2 domain, wherein the amino terminus of the α2 domain is covalently linked to the carboxy terminus of the α1 domain; and wherein the third domain is covalently linked to the first domain and comprises an antigen associated with the autoimmune disorder. The method also includes administering a therapeutically effective amount of one or more antibodies that bind to B cells, for example an antibody that specifically binds CD20. In specific non-limiting examples, the autoimmune disease is multiple sclerosis or rheumatoid arthritis. | 11-21-2013 |
20130315893 | HUMANIZED ANTI-IL-20 ANTIBODY AND USES THEREOF - The present disclosure provides humanized antibodies specific to human interleukin 20 (IL-20) and uses thereof in treating diseases associated with the IL-20 signaling pathway, e.g., osteoporosis, inflammatory disease (e.g., rheumatoid arthritis), cancer, stroke, and renal failure. | 11-28-2013 |
20130315894 | GENETIC POLYMORPHISMS ASSOCIATED WITH RHEUMATOID ARTHRITIS, METODS OF DETECTION AND USES THEREOF - The present invention provides compositions and methods based on genetic polymorphisms that are associated with autoimmune disease, particularly rheumatoid arthritis. For example, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by these nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and variant proteins, and methods of using the nucleic acid molecules and proteins as well as methods of using reagents for their detection. | 11-28-2013 |
20130315895 | COMBINATION OF A cMET INHIBITOR AND AN ANTIBODY TO HGF AND/OR cMET - Methods for treating a disease state for which HGF/cMET possesses activity that contributes to the pathology and/or symptomology of the disease state, as well as kits and articles of manufacture for use in practicing these methods. | 11-28-2013 |
20130315896 | Cytotoxicity Mediation of Cells Evidencing Surface Expression of CD44 - This invention relates to the diagnosis and treatment of cancerous diseases, particularly to the mediation of cytotoxicity of primary and metastatic human tumor cells; and most particularly to the use of an isolated monoclonal antibody or cancerous disease modifying antibodies (CDMAB) thereof, optionally in combination with one or more chemotherapeutic agents, as a means for initiating the cytotoxic response in such human tumors, e.g. any primary or metastatic tumor sites which arise from hepatocytes. The invention further relates to binding assays which utilize the CDMAB of the instant invention. | 11-28-2013 |
20130315897 | Combination Anticoagulant Therapy With A Compound That Acts As A Factor Xa Inhibitor - The present invention is directed to methods of using combination therapies containing [2-({4-[(dimethylamino)iminomethyl]phenyl}carbonylamino)-5-methoxyphenyl]-N-(5-chloro(2-pyridyl))carboxamide for the treatment of thrombotic disease(s) and pharmaceutical compositions thereof. | 11-28-2013 |
20130315898 | BIOMARKERS FOR ASTHMA - The present invention provides methods, kits, and compositions related to testing a sample for the level of a biomarker related to asthma, wherein the biomarker is selected from: taurine, maltose, maltotriose, adenosine 5′-monophosphate, phosphoethanolamine, glycerophosphorylcholine, arachidonate, heptanoate, pelargonate, and nicotinamide. In certain embodiments, the level of the biomarker is used to identify therapy effective for treating asthma. In other embodiments, the level of the biomarker is used to identify the presence, severity, or risk of exacerbation of asthma. In further embodiments, the level of the biomarker is used to monitor the response to on-going therapy (e.g., adjust the dosage of the asthma therapy). | 11-28-2013 |
20130315899 | METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS - Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer. | 11-28-2013 |
20130315900 | HUMANIZED ANTI-CD40 ANTIBODIES CONJUGATED TO THERAPEUTIC AGENTS - Provided are humanized anti-CD40 antibodies and antigen-binding fragments and methods for treating disease characterized by expression of CD40 antigen. | 11-28-2013 |
20130315901 | NOVEL USES - A method of treating, arresting or preventing a disease responsive to treatment with an anti-CD20 antibody in a patient suffering therefrom, comprising administering to the patient at least one sub-depleting dose of antiCD20 antibody is disclosed. | 11-28-2013 |
20130315902 | ANTITUMOR PEPTIDE DERIVED FROM A COMPLEMENTARITY DETERMINING REGION OF A HUMANIZED MONOCLONAL ANTIBODY TO NAP12B TRANSPORTER - Described herein is novel isolated or synthetic peptides derived from a complementarity determining region hypervariable domain amino acid sequence of a humanized monoclonal antibody to NaPi2B transporter, as well as derivatives thereof, and a pharmaceutical composition and a method for inhibiting tumor growth or treating a tumor or cancer treating using the antitumor peptides and derivatives thereof. | 11-28-2013 |
20130315903 | ARYLSULFONAMIDE DERIVATIVES FOR THE PREVENTION OR TREATMENT OF SPECIFIC OPHTHALMOLOGIC DISORDERS - The invention is directed to the therapeutic use of arylsulfonamide derivatives. | 11-28-2013 |
20130323232 | METHODS FOR THE IDENTIFICATION AND TREATMENT OF PATIENTS SENSITIVE TO ANTI IGF-1R INHBITION THERAPY - Disclosed herein are methods of stratifying a patient population into an IGF-1R inhibitor responder or resistant population comprising assaying a sample of cells derived from a patient to determine if a cell from the patient sample is sensitive to treatment with an IGF-1R inhibitor and selecting a patient for treatment with an IGF-1R inhibitor if the cells from the patient are determined to be sensitive. The determination is based upon either the expression levels of wild type LKB1 in the patient sample wherein a low level of expression of the protein or the gene encoding the biomarker protein is predictive of a favorable outcome to an IGF-1R targeted therapy or detecting the presence of a loss of function mutant LKB1 in the sample, wherein presence of the mutant is predictive of a favorable outcome. The presence of the mutant may be accompanied by determining the expression level of IGF-1R in the same sample, wherein a concomitant increase in the level of expression of IGF-1R in addition to detecting the presence of the mutant protein also predicts a favorable outcome to an IGF-1R targeted therapy. Methods of treating a patient are also provided. | 12-05-2013 |
20130323233 | MATERIALS AND METHODS FOR IMPROVED IMMUNOGLYCOPROTEINS - Immunoglycoproteins, including antibodies, with improved ADCC and altered glycosylation patterns are provided. Also provided are cell culturing methods and media for producing such immunoglycoproteins, and therapeutic uses of such immunoglycoproteins. | 12-05-2013 |
20130323234 | MUTANT ANTIBODIES AND CONJUGATION THEREOF - The present invention relates to a polypeptide comprising 7 β-strands A, B, C, D, E, F, and G sequentially connected together by connecting chains of amino acids, and a first α-helix sequentially located on the EF chain between β-strands E and F, wherein the β-strands are arranged so as to form a first β-sheet comprising β-strands A, B, D, and E, and a second β-sheet comprising β-strands C, F and G, said first and second β-sheets being covalently bonded together so as to form a first Ig domain; wherein the EF chain between β-strands E and F comprises the sequence X | 12-05-2013 |
20130323235 | Soluble heavy-chain only antibodies - The present invention provides a high affinity, antigen-specific, soluble heavy chain-only antibody which: lacks hallmark camelid-related amino acid substitutions and has FR2 substitutions which are not found in antibodies which comprise heavy and light chain; shows increased net hydrophobicity within CDR1 and an increased number of charged amino acids present in CDR3; and comprises one or more amino acid substitutions within the framework β-pleated sheet leading to increased net hydrophobicity within FR1 and increased number of charged amino acids present in FR3. Also provided are VH domains having the same properties, gene segments for their production, methods for their production, transgenic animals and uses of the antibody of the VH domains in therapy. | 12-05-2013 |
20130323236 | Antibodies of the Class IGG4 - The present invention provides an antibody of the class IgG4 comprising at least one heavy chain which comprises a C | 12-05-2013 |
20130323237 | ORGANIC COMPOUNDS - The present invention relates to human thymic stromal lymphopoietin (hTSLP) antibodies and especially those which neutralize hTSLP activity. It further relates to methods for using anti-hTSLP antibody molecules in diagnosis or treatment of hTSLP related disorders, such as asthma, atopic dermatitis, allergic rhinitis, fibrosis, inflammatory bowel disease and Hodgkin's lymphoma. | 12-05-2013 |
20130323238 | ANTAGONISTS OF IL-6 TO RAISE ALBUMIN AND/OR LOWER CRIP - The present invention is directed to therapeutic methods using IL-6 antagonists such as antibodies and fragments thereof having binding specificity for IL-6 to improve survivability or quality of life of a patient in need thereof. In preferred embodiments these patients will comprise those exhibiting (or at risk of developing) an elevated serum C-reactive protein level or a reduced serum albumin level prior to treatment. In another preferred embodiment, the patient's Glasgow Prognostic Score will be increased and survivability will preferably be improved. | 12-05-2013 |
20130323239 | MODULATION OF PILR RECEPTORS TO TREAT SEPSIS - The present invention provides methods of using agonists and antagonists of PILRα and PILRβ, respectively, to treat immune mediated sepsis. Also provided are methods of prophylactically treating with agonists and antagonists of PILRα and PILRβ, respectively, to prevent the development of sepsis. | 12-05-2013 |
20130323240 | HUMANIZED ANTIBODIES AGAINST LIGHT AND USES THEREOF - The present invention is directed to antigen-binding polypeptides, or variants or derivatives thereof which specifically bind the LIGHT polypeptide. The invention is also directed to methods of making and using such antibodies specifically in the treatment or diagnosis of immune, inflammatory and malignant diseases or conditions (e.g. inflammatory bowel disease; Crohn's disease, ulcerative colitis, multiple sclerosis, rheumatoid arthritis and transplantation). | 12-05-2013 |
20130323241 | TREATMENT OF ANGIOGENESIS DISORDERS - This invention concerns pathological angiogenesis and cancer, related treatment methods, and related compositions. Also disclosed are related diagnosis kits and methods. | 12-05-2013 |
20130330324 | ANTIBODIES FOR EPIDERMAL GROWTH FACTOR RECEPTOR 3 (HER3) - This invention relates to antibodies or fragments thereof which interact with HER family of receptors, e.g., HER3 receptor. In particular, it relates to antibodies or fragments thereof that recognize a conformational epitope of HER3 receptor comprising residues from both domains 2 and 4 resulting in inhibition of both ligand-dependent and ligand-independent signal transduction; and allow ligand binding (e.g., neuregulin), whilst preventing ligand-induced activation of signal transduction. These antibodies or fragments can be used to treat a number of diseases or disorders characterized by increased levels of HER3 expression (e.g., esophageal cancer). These antibodies or fragments can be used to treat a number of diseases or disorders characterized by the antibodys or fragments ability to decrease tissue weight (e.g., prostate or uterine weights) or to induce atrophy of tissue (e.g., atrophy of male breast). | 12-12-2013 |
20130330325 | MEANS AND METHODS FOR THE PREDICTION OF TREATMENT RESPONSE OF A CANCER PATIENT - The present invention relates to the field of treatment efficacy prediction in patients with malignant diseases. More precisely, this invention relates to the prediction of the efficacy of a treatment in cancer patients, based on the precise quantification of several biological markers that are related to the innate and adaptive immune response of said patient against said cancer. | 12-12-2013 |
20130330326 | METHODS OF TREATING CANCER - Described are methods and compositions for treating epithelial tumors with a folate-vinca conjugate in combination with at least one other chemotherapeutic agent in which the tumors include ovarian, endometrial or non-small cell lung cancer tumors, including platinum-resistant ovarian tumors and platinum-sensitive ovarian tumors. | 12-12-2013 |
20130330327 | ALKOXY-SUBSTITUTED 2,3-DIHYDROIMIDAZO[1,2-C]QUINAZOLINES - The present invention relates to alkoxy-substituted 2,3-dihydroimidazo[1,2-c]quinazoline compounds of general formula (I) in which R1, R2 and R3 are as defined in the claims, to methods of preparing said compounds, to intermediates for the preparation of said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of a hyper-proliferative and/or angiogenesis disorder, as a sole agent or in combination with other active ingredients. | 12-12-2013 |
20130330328 | Combination Therapy For B Cell Lymphomas - The present disclosure provides methods for treating B cell lymphomas using a combination of anti-CD19 and anti-CD20 antibodies. Such methods provide therapeutic advantages over single antibody therapies, including prolonged anti-tumor activity and/or reduced dosages. | 12-12-2013 |
20130330329 | B7-H7 ANTIBODIES AND METHOD OF USE - The invention provides novel polypeptides useful for co-stimulating T cells, isolated nucleic acid molecules encoding them, vectors containing the nucleic acid molecules, and cells containing the vectors. Also included are methods of making and using these co-stimulatory polypeptides. | 12-12-2013 |
20130330330 | ANTI-IL-TIF ANTIBODIES - The present invention relates to blocking the activity of IL-TIF polypeptide molecules. IL-TIF is a cytokine involved in inflammatory processes and human disease. The present invention includes anti-IL-TIF antibodies and binding partners, as well as methods for antagonizing IL-TIF using such antibodies and binding partners in IL-TIF-related human inflammatory diseases, amongst other uses disclosed. | 12-12-2013 |
20130330331 | Method of Treating Degenerative Disorders of the Nervous System - The invention herein related to methods and compositions for treating nervous system disorders. The methods comprise administration of antibodies directed towards peptides that bind to receptors important in disease progression, thus attenuating the disease. | 12-12-2013 |
20130330332 | TREATMENT OF PEMPHIGUS - The present invention concerns treatment of pemphigus with an antibody which binds to CD20. | 12-12-2013 |
20130330333 | TREATMENT OF ANGIOGENESIS DISORDERS - This invention concerns pathological angiogenesis and cancer, related treatment methods, and related compositions. Also disclosed are related diagnosis kits and methods. | 12-12-2013 |
20130330334 | ANTI CD4 ANTIBODIES TO PREVENT IN PARTICULAR GRAFT-VERSUS-HOST-DISEASE (GVHD) - The present invention relates to, among others, an in vitro method of modifying a cell graft containing immune cells comprising the steps of incubating a cell graft containing immune cells with an anti CD4 antibody wherein said incubating is carried out for from 1 minute to 7 days, b) removing unbound antibody from said graft; as well as to corresponding modified grafts and uses. The invention further relates to the modification of antibodies reactive to the CD4 human leukocyte antigen to provide anti-CD4 antibodies that have a reduced number of potential T-cell epitopes but retain the ability to bind to CD4, such as to an anti human CD4-antibody comprising a heavy chain immunoglobulin variable domain (VH) and a light chain immunoglobulin variable domain (VL), wherein at least one T cell epitope located outside the CDRs of said immunoglobulin variable domains is removed from said immunoglobulin variable domains. Preferably, the specificity and mode of action of the anti-CD4 antibodies are not affected by the modification(s). | 12-12-2013 |
20130336959 | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 12-19-2013 |
20130336960 | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 12-19-2013 |
20130336961 | B Cell Depletion for Central Nervous System Injuries and Methods and Uses Thereof - Therapeutic B lymphocyte (B cell) depleting antibodies and methods and uses thereof in the treatment of patients having central nervous system injuries are described. | 12-19-2013 |
20130336962 | AZIRIDINE BISPHENOL ETHERS AND RELATED COMPOUNDS AND METHODS FOR THEIR USE - Compounds having a structure of Formula I: | 12-19-2013 |
20130336963 | ANTIGEN-BINDING MOLECULE CAPABLE OF BINDING TO TWO OR MORE ANTIGEN MOLECULES REPEATEDLY - The present inventors discovered that antibodies having weaker antigen-binding activity at the early endosomal pH in comparison with that at the pH of plasma are capable of binding to multiple antigen molecules with a single antibody molecule, have long half-lives in plasma, and have improved durations of time in which they can bind to antigen. | 12-19-2013 |
20130336964 | ANTI-TRKA ANTIBODIES, DERIVATIVES AND USES THEREOF - The present invention relates to an antibody, recombinant or synthetic antigen-binding fragments thereof able to recognise and bind an epitope comprised in the TrkA amino acid sequence, medical uses thereof and a pharmaceutical composition comprising at least one of the above antibody, recombinant or synthetic antigen-binding fragments thereof. | 12-19-2013 |
20130336965 | NOVEL RING-SUBSTITUTED N-PYRIDINYL AMIDES AS KINASE INHIBITORS - The present invention provides a compound of formula (A): | 12-19-2013 |
20130336966 | CORONIN 1 MODULATORS FOR THE TREATMENT OF AUTOIMMUNE AND LYMPHOPROLIFERATIVE DISORDERS AND MYCOBACTERIAL INFECTIONS - The invention relates to the treatment of mycobacterial infections, autoimmune disorders, lymphoproliferative disorders and induction of immunosuppression following transplantation using coronin 1 and modulators of coronin 1. Particular modulators of coronin 1 are compounds which inhibit the production of coronin 1 or the formation of active coronin 1 from a coronin 1 precursor, partly or entirely inactivate coronin 1, inhibit concentration of coronin 1 at the site of T cell activation, or inhibit the coronin 1 mediated signaling pathway downstream of the T cell receptor. Examples of such modulators are antibody or antibody fragments, coronin 1 peptide fragments or corresponding phosphopeptides, or anti-sense oligonucleotides, e.g. siRNA or shRNA. The invention further relates to a method of screening for a compound effective in the treatment of mycobacterial infections, autoimmune disorders, lymphoproliferative disorders and induction of immunosuppression following transplantation comprising contacting a candidate compound with coronin 1 or coronin 1 expressing cells, and selecting appropriate compounds. | 12-19-2013 |
20130336967 | ANTI-BST2 ANTIBODY - BST2 antibodies were selected by using as an indicator the binding between BST2 antibodies and various splicing variants of human BST2 antigen. As a result, the present inventors successfully obtained BST2 antibodies that specifically recognize BST2D, which has been reported to be expressed at high levels in cancer cells. The antibodies of the present invention specifically bind to cells expressing BST2D. Non-specific antibody binding to non-target tissues, which results in the decrease of antibody concentration in blood, can be prevented by using the antibodies of the present invention therapeutically. Alternatively, the present invention provides diagnostic agents comprising an antibody of the present invention, which specifically detect tissues expressing BST2D. | 12-19-2013 |
20130336968 | PHARMACEUTICAL FORMULATION COMPRISING A BIOPHARMACEUTICAL DRUG - The present invention is related to a pharmaceutical formulation comprising a biopharmaceutical drug, said composition further comprising at least one mono- or dicarboxylic acid with a backbone of 2-6 C-Atoms, or at least one salt thereof. | 12-19-2013 |
20130336969 | USE OF OLFACTOMEDIN-4 PROTEIN (OLFM4) IN COLORECTAL CANCER DIAGNOSIS - The present invention provides a method for diagnosing KRAS mutations in colorectal cancers by measuring the level of OLFM4. In another aspect, the present invention relates a method of predicting the responds to a chemotherapeutic agent of a subject suffering from a colorectal cancer: according to the present invention, the by determining the OLFM4 levels. According to the present invention, the response can be predicted by determining the OLFM4 levels. This result in turn permits the design or the adaptation of a treatment of the said subject with the said chemotherapeutic agent. | 12-19-2013 |
20130344058 | MONOCLONAL ANTIBODIES AGAINST DENGUE AND OTHER VIRUSES WITH DELETION IN FC REGION - The present invention relates to a variant of a parent polypeptide comprising an Fc region, which variant binds an Fc gamma receptor (FcγR) with lower affinity than the parent polypeptide and comprises a deletion of at least one amino acid in about position 100 to about position 150 in the Fc region and related nucleic acids, vectors, host cells and methods of producing the variant and methods for preventing or treating a disorder in a mammal. | 12-26-2013 |
20130344059 | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 12-26-2013 |
20130344060 | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 12-26-2013 |
20130344061 | TREATMENT OF LUPUS, FIBROTIC CONDITIONS, AND INFLAMMATORY MYOPATHIES AND OTHER DISORDERS USING PI3 KINASE INHIBITORS - Provided herein are methods, kits, and pharmaceutical compositions that include a PI3 kinase inhibitor for treating lupus, a fibrotic condition, or inflammatory myopathies and other conditions (e.g., skin conditions). | 12-26-2013 |
20130344062 | Identification and Treatment of Aggressive Lung Cancer Tumors - This invention relates to the identification and treatment of aggressive lung cancer tumors in patients. More particularly, it provides a method of identifying patients with non-small cell lung carcinoma (NSCLC) who have an aggressive node-negative (N0) tumor and a likelihood of a poor overall survival. The method comprises the step of determining if one or more of certain identified proteins are activated in tumor cells obtained from the patient's tumor, wherein the activation of one or more of the proteins indicates that the patient has an aggressive N0 tumor and is likely to have a poor overall-survival. The invention also provides a method for selecting a treatment for an NSCLC patient with an N0 tumor and a method for treating such patients. It further provides a kit for identifying an NSCLC patient with an aggressive N0 tumor and a likelihood of a poor overall survival and a pharmaceutical composition for treating such patients. | 12-26-2013 |
20130344063 | Diagnosing and Monitoring CNS Malignancies Using MicroRNA - The use of specific microRNAs (miRNAs) present in CSF as biomarkers for particular brain malignancies and disease activity. | 12-26-2013 |
20130344064 | ANTI-TRKA ANTIBODIES WITH ENHANCED INHIBITORY PROPERTIES AND DERIVATIVES THEREOF - The present invention relates to antibodies directed against TrkA receptor and their uses, including humanized anti-TrkA antibodies. More specifically, the present invention relates to humanized anti-TrkA antibodies with enhanced inhibitory properties comprising a heavy chain variable region, a light chain, variable region, a human light chain constant region and a variant human IgG4 heavy chain constant region which exhibit altered exchange properties. | 12-26-2013 |
20130344065 | Combination Treatment with VEGF-C Antagonists - The invention relates to a method and kit for treating cancer in a human subject, the method comprising administering to the subject in combination therapeutically effective amounts of a VEGF-C antagonist and an anti-neoplastic composition, and the kit comprising a VEGF-C antagonist for administering to the subject in combination with an anti-neoplastic composition. The invention further relates to methods for: increasing the duration of survival of, increasing the progression-free survival of, increasing the duration of response of, or treating, a subject or a group of human subjects susceptible to or diagnosed as having a cancer; or treating a human subject or a group of human subjects having metastatic colorectal cancer, prostate cancer, pancreatic cancer or glioblastoma, the methods comprising administering to the subject or subjects in the group in combination effective amounts of a VEGF-C antagonist and an anti-neoplastic composition. | 12-26-2013 |
20140004103 | Method of treating malignant mesothelioma | 01-02-2014 |
20140004104 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH AN ANTI-BCL-2 ACTIVE AGENT | 01-02-2014 |
20140004105 | AGE-RELATED MACULAR DEGENERATION DIAGNOSTICS | 01-02-2014 |
20140004106 | STABLE IGG4 BASED BINDING AGENT FORMULATIONS | 01-02-2014 |
20140004107 | ST2 ANTIGEN BINDING PROTEINS | 01-02-2014 |
20140004108 | Methods for Modulation of Autophagy Through the Modulation of Autophagy-Enhancing Gene Products | 01-02-2014 |
20140004109 | Methods Of Reducing Eosinophil Levels | 01-02-2014 |
20140004110 | ANTI CD37 ANTIBODIES | 01-02-2014 |
20140004111 | POLYCYCLIC AGENTS FOR THE TREATMENT OF RESPIRATORY SYNCYTIAL VIRUS INFECTIONS | 01-02-2014 |
20140004112 | Therapeutic Peptides | 01-02-2014 |
20140010806 | Treatment of Ocular Diseases - The invention relates to methods to use 17α-ethynylandrost-5-ene-3β,7β,17β-triol to treat ocular diseases or conditions such as dry eye, uveitis or retinitis. The compound can be administered topically to the eye, by intravitreal injection or systemically, e.g., orally. | 01-09-2014 |
20140010807 | NOVEL COMPOUNDS - The present invention relates to an antibody which has multiple specificities. In particular the antibody of the present invention binds to (cross react with) human IL-8, Gro-alpha, Gro-beta, Gro-gamma, and ENA-78. | 01-09-2014 |
20140010808 | ANTI CD37 ANTIBODIES - Chimeric and humanized anti-CD37 antibodies and pharmaceutical compositions containing them are useful for the treatment of B cell malignancies and autoimmune and inflammatory diseases that involve B cells in their pathology. | 01-09-2014 |
20140017230 | CHRONIC LYMPHOCYTIC LEUKEMIA (CLL) BIOMARKERS - The present application describes chronic lymphocytic leukemia (CLL) biomarkers. In particular, the invention concerns miRNA151 3p, miRNA409 3p, PTK2, and/or PI3K as biomarkers for patient selection in CLL, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, and methods of advertising related thereto. | 01-16-2014 |
20140017231 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 01-16-2014 |
20140017232 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 01-16-2014 |
20140017233 | BIOLOGICAL MARKERS FOR IDENTIFYING PATIENTS FOR TREATMENT WITH VEGF ANTAGONISTS - The invention provides methods and compositions to detect expression of one or more biomarkers for identifying and treating patients who are likely to be responsive to VEGF antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods. | 01-16-2014 |
20140017234 | ANTIBODIES TARGETING HIV ESCAPE MUTANTS - Embodiments of the present invention are directed to compositions and methods for anti-HIV (anti-CD4 binding site) broadly neutralizing antibodies having improved potency and breadth for neutralizing a range of HIV strains. Combinations of broadly neutralizing antibodies can also improve potency over a single antibody composition. | 01-16-2014 |
20140017235 | METHODS FOR TREATING OSTEOARTHRITIS PAIN BY ADMINISTERING A NERVE GROWTH FACTOR ANTAGONIST AND COMPOSITIONS CONTAINING THE SAME - The invention concerns anti-NGF antibodies (such as anti-NGF antagonist antibodies), and polynucleotides encoding the same. The invention further concerns use of such antibodies and/or polynucleotides in the treatment and/or prevention of pain, including post-surgical pain, rheumatoid arthritis pain, and osteoarthritis pain. | 01-16-2014 |
20140017236 | METHODS FOR TREATING INTERLEUKIN-6 RELATED DISEASES - A pharmaceutical composition for the treatment of interleukin-6 (IL-6) related diseases, comprising an interleukin-6 antagonist (IL-6 antagonist) and immunosuppressants. The IL-6 antagonist is preferably an antibody to an interleukin-6 receptor (IL-6R). | 01-16-2014 |
20140017237 | BCR-Complex-Specific Antibodies and Methods of Using Same - This invention relates to chimeric and humanized antibodies that specifically bind the BCR complex, and particularly chimeric and humanized antibodies to the BCR complex. The invention also relates to methods of using the antibodies and compositions comprising them in the diagnosis, prognosis and therapy of diseases such as cancer, autoimmune diseases, inflammatory disorders, and infectious disease. | 01-16-2014 |
20140017238 | Methods of Modifying Eukaryotic Cells - A method for engineering and utilizing large DNA vectors to target, via homologous recombination, and modify, in any desirable fashion, endogenous genes and chromosomal loci in eukaryotic cells. These large DNA targeting vectors for eukaryotic cells, termed LTVECs, are derived from fragments of cloned genomic DNA larger than those typically used by other approaches intended to perform homologous targeting in eukaryotic cells. Also provided is a rapid and convenient method of detecting eukaryotic cells in which the LTVEC has correctly targeted and modified the desired endogenous gene(s) or chromosomal locus (loci) as well as the use of these cells to generate organisms bearing the genetic modification. | 01-16-2014 |
20140023638 | ANTIBODY TO GDF8 AND USES THEREOF - The disclosure provides novel molecules related to growth and differentiation factor 8 (GDF8), in particular epitopes specific to GDF8 and other specific antagonists of GDF8 in particular anti GDF8 antibodies or antigen binding protein or fragment thereof which may inhibit GDF8 activity and signal in vitro and/or in vivo. The disclosure also provides for an immunoassay used to detect and quantitate GDF8. The disclosure also provides methods for diagnosing, preventing, ameliorating, and treating GDF8 associated disorders, e.g., degenerative orders of muscle, bone, and insulin metabolism. Finally, the disclosure provides pharmaceuticals for the treatment of such disorders by using the antibodies, polypeptides, polynucleotides, and vectors of the invention. | 01-23-2014 |
20140023639 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 01-23-2014 |
20140023640 | METHOD TO IDENTIFY A PATEINT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 01-23-2014 |
20140023641 | ANTIBODY WITH SPECIFICITY FOR GM-CSF (I) - The present invention relates to antibodies with specificity for granulocyte-macrophage colony stimulating factor (GM-CSF). More particularly, the invention relates to humanized monoclonal antibodies that bind specifically to human GM-CSF with high affinity. The invention also relates to nucleic acids encoding the antibodies, vectors for expression of these nucleic acids, and host cells for producing said antibodies. Further, the invention relates to the use of said antibodies in the diagnosis or treatment of autoimmune or inflammatory diseases. | 01-23-2014 |
20140023642 | 1-(Arylmethyl)quinazoline-2,4(1H,3H)-diones as PARP Inhibitors and the Use Thereof - Disclosed are 1-(arylmethyl)quinazoline-2,4(1H,3H)-diones thereof, represented by the Formula (I) wherein Ar, R | 01-23-2014 |
20140023643 | N4-PHENYL-QUINAZOLINE-4-AMINE DERIVATIVES AND RELATED COMPOUNDS AS ERBB TYPE I RECEPTOR TYROSINE KINASE INHIBITORS FOR THE TREATMENT OF HYPERPROLIFERATIVE DISEASES - This invention provides compounds of Formula I | 01-23-2014 |
20140023644 | Antibodies Specific for TGF-Beta - The present disclosure relates, in general, to materials and methods for antibodies specific for transforming growth factor beta (TGFβ), including TGFβ1, TGFβ2 and TGFβ3, and uses of these antibodies in the treatment of subjects having cancer, an eye disease, condition or disorder, fibrosis, including ophthalmic fibrosis or fibrosis of the eye, and other conditions or disorders related to TGFβ expression. | 01-23-2014 |
20140023645 | ENGINEERED ANTIBODY CONSTANT DOMAIN MOLECULES - Described herein are engineered antibody constant domain molecules, such as CH2 or CH3 domain molecules, comprising at least one mutation, or comprising at least one complementarity determining region (CDR), or a functional fragment thereof, engrafted in a loop region of the CH2 domain. The CH2 domain molecules described herein are small, stable, soluble, exhibit little to no toxicity and are capable of binding antigen. | 01-23-2014 |
20140023646 | Compositions and Methods for Treating Viral Infection - Described are methods of treating viral disease using compounds that block inhibitory NK cell receptors, thereby reducing their inhibition of NK cell cytotoxicity in killing infected target cells. In one embodiment, the compound is an antibody binding, for example, one or more of the human KIR2DL1, KIR2DL2, and KIR2DL3 receptors. In another embodiment, the method further comprises administering a therapeutic antibody or fusion protein which binds an antigen expressed on cells infected with the virus. | 01-23-2014 |
20140030253 | HUMANIZED FORMS OF MONOCLONAL ANTIBODIES TO HUMAN GnRH RECEPTOR - Humanized forms of murine GHR106 monoclonal antibodies and methods of using them are described. Humanized GHR106 monoclonal antibodies have high affinity and specificity to the corresponding tumor-associated antigen, gonadotropin-releasing hormone (GnRH) receptor comparable to murine GHR106. | 01-30-2014 |
20140030254 | SIGNAL PATHWAY ALTERATIONS AND DRUG TARGET ELEVATIONS IN PRIMARY METACHRONOUS METASTATIC COLORECTAL CANCER COMPARED TO NON-METASTATIC DISEASE - The present invention relates to the identification and diagnostic use of biomarkers in primary colorectal cancer tumors whose activation level are predictive of the likelihood of the onset of metastatic disease. These biomarkers may be used to determine the suitability of a patient for aggressive and/or targeted treatments. Kits and compositions of the invention are also provided. | 01-30-2014 |
20140030255 | METHODS OF PREDICTING CANCER CELL RESPONSE TO THERAPEUTIC AGENTS - In one aspect, methods, markers, and expression signatures are disclosed for assessing the degree to which a cell sample has epithelial cell-like properties or mesenchymal cell-like properties. In another aspect, methods are provided for predicting whether a subject with cancer will respond to treatment with an agent, based on whether the cancer is classified as having a high or low EMT Signature Score. | 01-30-2014 |
20140030256 | BENZOXAZOLE KINASE INHIBITORS AND METHODS OF USE - The present invention provides chemical entities or compounds and pharmaceutical compositions thereof that are capable of modulating certain protein kinases such as mTor, tyrosine kinases, and/or lipid kinases such as PI3 kinase. Also provided in the present invention are methods of using these compositions to modulate activities of one or more of these kinases, especially for therapeutic applications. | 01-30-2014 |
20140030257 | AGTR1 AS A MARKER FOR BEVACIZUMAB COMBINATION THERAPIES - The present invention provides methods for assessing the responsiveness or sensitivity of a patient to bevacizumab, compositions comprising bevacizumab and methods of treating patients with bevacizumab. | 01-30-2014 |
20140030258 | THERAPEUTIC TREATMENTS BASED ON ADMINISTRATION OF SMALL RNA FRAGMENTS - This invention provides therapeutic treatments that prevent or ameliorate thrombocytopenia based on administration of small RNA fragments. More specifically, this invention provides an improved chemotherapeutic regimen that prevents or ameliorates bone marrow suppression and thrombocytopenia induced by anti-cancer drugs, wherein the chemotherapeutic regimen incorporates administration of small RNA fragments. Further, the present invention provides a therapeutic treatment for thrombocytopenia associated with immune disorders known as Immune Thrombocytopenic Purpura based on administration of small RNA fragments. | 01-30-2014 |
20140030259 | METHODS OF TREATING FGFR3 RELATED CONDITIONS - Provided herein are biomarkers and therapies for the treatment of pathological conditions, such as cancer, and method of using FGFR3 antagonists. In particular, provided is FGFR3 as a biomarker for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto. | 01-30-2014 |
20140030260 | METHODS AND COMPOSITIONS TO ELIMINATE CHRONIC LYMPHOCYTIC LEUKEMIA AND OTHER HEMATOLOGIC MALIGNANT CELLS IN STROMAL MICROENVIRONMENT FOR CANCER THERAPY - The present invention regards compositions and methods for treating chronic lymphocytic leukemia in the in vivo tissue environment using selenium-containing compositions. In particular aspects, a selenium-comprising compound is administered to an individual wherein the CLL cells are in a stromal cell environment, wherein stromal factors modulate the selenium comprising compound to enhance its activity. | 01-30-2014 |
20140030261 | METHOD FOR PROGNOSTICATING THE CLINICAL RESPONSE OF A PATIENT TO B-LYMPHOCYTE INHIBITING OR DEPLETING THERAPY IN INTERFERON-DRIVEN DISEASES SUCH AS SLE - Described are methods for predicting a clinical response to B-lymphocyte inhibiting or depleting therapies (BCIDT) using expression levels of genes of the Type I INF pathway. In another aspect, the disclosure relates to a method for evaluating a pharmacological effect of a treatment with B-lymphocyte inhibiting or depleting therapy. More in particular, it relates to a method for prognosticating the clinical response of a patient to treatment with a soluble BCID or TCID agent, the method comprising the steps of obtaining at least two samples from the patient wherein a first sample has not been exposed to a soluble BCID or TCID agent and wherein at least a second sample has been exposed to a soluble BCID or TCID agent, determining the level of an IFN (preferably type I) response in the at least two samples, comparing the level of the IFN (preferably type I) response in the first sample with the level of the IFN (e.g., type I) response in the at least second sample and prognosticating the clinical response from the comparison. | 01-30-2014 |
20140030262 | MATERIALS AND METHODS FOR EVALUATING AND TREATING NEUROMYELITIS OPTICA (NMO) - The invention provides prognostic methods for evaluating the severity of NMO and NMO-associated diseases as well as methods of treating NMO and NMO-associated diseases. | 01-30-2014 |
20140030263 | TREATMENT OF DIFFUSE LARGE-CELL LYMPHOMA WITH ANTI-CD20 ANTIBODY - The present invention concerns methods for the treatment of diffuse large cell lymphoma by administration of an anti-CD20 antibody and chemotherapy. Particular embodiments include the administration of anti-CD20 antibody in combination with chemotherapy comprising CHOP (cyclophosphamide, hydroxydaunorubicin/doxorubicin, vincristine, and prednisone/prednisolone) and/or in combination with a transplantation regimen. | 01-30-2014 |
20140037617 | KINASE MODULATION, AND INDICATIONS THEREFOR - The present disclosure provides methods of using protein kinase inhibitors for treating diseases and conditions, including diseases and conditions associated with activity of any protein kinase selected from Fms protein kinase including any mutations thereof, Kit protein kinase any mutations thereof, Flt-3 protein kinase any mutations thereof and combinations thereof. | 02-06-2014 |
20140037618 | METHOD OF TREATING AUTOIMMUNE INFLAMMATORY DISORDERS USING IL-23R LOSS-OF-FUNCTION MUTANTS - The present invention relates to compositions and methods of diagnosing and treating autoimmune and inflammatory disorders that are characterized by IL-23R loss-of-function mutations. | 02-06-2014 |
20140037619 | MIMOTOPES OF HIV ENV - The invention provides methods, compositions and kits for treating and or preventing an HIV infection. For example, HIV envelope-like polypeptides (wild-type HIV polypeptides and mimotopes) may be administered to an individual so as to induce a protective immune response to HIV. Alternatively, antibodies directed to the HIV envelope-like polypeptides may be administered to an individual to treat or prevent an HIV infection and/or one or more symptoms associated with the infection (e.g., AIDS). | 02-06-2014 |
20140037620 | Methods of Treating Breast Cancer with Gemcitabine Therapy - The application describes methods for predicting overall survival in subjects with breast cancer. The application also describes for screening subjects with breast cancer to determine if the breast cancer will be responsive to a breast cancer therapy including gemcitabine. The application further describes methods for treating subjects with breast cancer by screening them for the likelihood of the effectiveness of treating the cancer with a therapy including gemcitabine and administering the therapy in subjects when it is found that gemcitabine is likely to be effective. | 02-06-2014 |
20140037621 | ANTIBODIES OR FUSION PROTEINS MULTIMERIZED VIA CYSTEINE MUTATION AND A MU TAILPIECE - The invention provides constant regions incorporating a cysteine mutation and linked to a μ tailpiece and antibodies or fusion proteins incorporating the same. The constant regions include at least CH2 and CH3 regions of an IgG heavy chain constant region including a cysteine mutation and μ tailpiece. Antibodies or fusion proteins incorporating the constant regions gains the ability to form multivalent complexes, e.g., pentameric or hexameric structures. Antibodies or fusion proteins incorporating the constant regions also retain IgG properties including specific binding to protein G, which facilitates purification and may exhibit pH-dependent FcRn binding, which is associated with a relatively long in vivo half-life. Depending on the isotype and subtype, the nature of the antigen and presence of an additional IgG hinge domain, such antibodies or fusion proteins may also have properties of specific binding to protein A, and effector functions such as ADCC, CDC and opsonization. | 02-06-2014 |
20140037622 | HUMAN PAPILLOMA VIRUS AS PREDICTOR OF CANCER PROGNOSIS - Methods of treating a head and neck cancer are disclosed. | 02-06-2014 |
20140037623 | Pharmaceutical Compositions Comprising Antibodies Binding To EBV (Ebstein-Barr Virus) Protein BARF1 - The invention relates to pharmaceutical and vaccine compositions comprising an antibody binding specifically to selected peptides of EBV protein BARF1. | 02-06-2014 |
20140037624 | ANTI-FGFR4 ANTIBODIES AND METHODS OF USE - The invention provides anti-FGFR4 antibodies and methods of using the same. | 02-06-2014 |
20140037625 | BIOMARKERS AND METHODS OF TREATMENT - The present invention concerns cancer biomarkers. In particular, the invention concerns c-met as biomarkers for patient selection and patient prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto. | 02-06-2014 |
20140044703 | HUMAN MONOCLONAL ANTIBODY HUMAN CD134 (OX40) AND METHODS OF MAKING AND USING SAME - The invention provides antibodies that specifically bind to OX40 (CD134), referred to as OX40 antibodies, anti-OX40 or anti-OX40 antibodies. Invention antibodies that specifically bind to OX40 include mammalian (human, primate, etc.), humanized and chimeric anti-OX40 antibodies. Invention antibodies and antibody subsequences (fragments) that specifically bind to OX40 include purified and isolated antibodies, as well as pharmaceutical formulations thereof, are useful in various methods including treatment, screening and detection methods. | 02-13-2014 |
20140044704 | TREATMENT OF METASTATIC BREAST CANCER - The present invention concerns treatment of previously untreated HER2-positive metastatic breast cancer with a combination of a growth inhibitory HER2 antibody, a HER2 dimerization inhibitor antibody and a taxane. In particular, the invention concerns the treatment of HER2-positive metastatic breast cancer in patients who did not receive prior chemotherapy or biologic therapy with a HER2 antibody binding essentially to epitope 2C4, a HER2 antibody binding essentially to epitope 4D5, and a taxane. The invention further comprises extending survival of such patients by the combination therapy of the present invention. In a preferred embodiment, the treatment involves administration of trastuzumab, pertuzumab and docetaxel. | 02-13-2014 |
20140044705 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH BENDAMUSTINE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with bendamustine for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and bendamustine. | 02-13-2014 |
20140044706 | MUTANT SELECTIVITY AND COMBINATIONS OF A PHOSPHOINOSITIDE 3-KINASE INHIBITOR COMPOUND AND CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF CANCER - Methods and compositions are provided for treating hyperproliferative disorders in patients with a PI3K inhibitor, GDC-0032 as a single agent or in combination with chemotherapeutic agents. | 02-13-2014 |
20140044707 | ANTIBODIES THAT BIND HUMAN PROTEIN TYROSINE PHOSPHATASE beta (HPTPbeta) AND USES TEHREOF - Antibodies and antigen binding fragments thereof that bind to human protein tyrosine phosphatase beta (HPTPβ), and uses thereof. | 02-13-2014 |
20140044708 | Process for lowering the viscosity of highly concentrated protein solutions - A process of lowering the viscosity of a solution includes preparing a solution comprising a compound of formula I, at a concentration in the final formulation of between 10 and 250 mM, and a protein having at least one antibody fragment whose concentration is between 50 and 350 mg/mL and whose pH is between 5 and 8. | 02-13-2014 |
20140044709 | TREATMENT OF HER2-POSITIVE CANCER WITH PACLITAXEL AND TRASTUZUMAB-MCC-DM1 - The present invention relates to combination therapy with paclitaxel, trastuzumab-MCC-DM1 and optionally, pertuzumab. | 02-13-2014 |
20140044710 | VON WILLEBRAND FACTOR SPECIFIC BINDERS AND METHODS OF USE THEREFOR - The invention provides new uses for specific binders to the A1 domain of the von Willebrand Factor (vWF), in particular the use in patients with stable angina undergoing elective percutaneous coronary intervention. Furthermore, dosing schedules and use of suitable assays such as RIPA and RICO in the particular disease settings are provided. | 02-13-2014 |
20140050719 | ANTIBODIES - Antibodies that bind human β-amyloid peptide, methods of treating diseases or disorders characterised by elevated β-amyloid levels or β-amyloid deposits with said antibodies, pharmaceutical compositions comprising said antibodies and methods of manufacture. | 02-20-2014 |
20140050720 | ULTRALONG COMPLEMENTARITY DETERMINING REGIONS AND USES THEREOF - Disclosed herein are immunoglobulin constructs comprising at least one immunoglobulin domain or fragment thereof; and a therapeutic polypeptide or derivative or variant thereof attached to or inserted into said immunoglobulin domain. Also provided are immunoglobulin constructs comprising a mammalian immunoglobulin heavy chain comprising at least a portion of a knob domain in the complementarity-determining region 3 (CDR3H) or fragment thereof; and a therapeutic polypeptide attached to or inserted into said knob domain of the CDR3H. Also provided are immunoglobulin constructs comprising a mammalian immunoglobulin heavy chain comprising at least a portion of a stalk domain in the complementarity-determining region 3 (CDR3H) or fragment thereof; and a therapeutic polypeptide attached to or inserted into said stalk domain of the CDR3H. Also described herein are methods and compositions comprising the immunoglobulin constructs described herein for treatment and prevention of a disease or condition in a subject. | 02-20-2014 |
20140050721 | Antineoplastic Combinations with mTOR Inhibitor, Trastuzumab and/or HKI-272 - A combination of temsirolimus and trastuzumab in the treatment of cancer is provided. A combination of temsirolimus and HKI-272 is provided. A combination of a trastuzumab and a HKI-272 is also provided. Regimens and kits for treatment of metastatic breast cancer, containing trastuzumab, temsirolimus and/or HKI-272, optionally in combination with other anti-neoplastic agents, or immune modulators are described. | 02-20-2014 |
20140050722 | CHIMERIC ANTI-RICIN ANTIBODY - A chimeric monoclonal antibody targeted to ricin is presented. The light chain and heavy chain constant regions are respectively made up of the light chain and heavy chain constant regions of human immunoglobulin, and the light chain and heavy chain variable regions respectively include the light chain and heavy chain variable regions of macaque immunoglobulin. The antibody does not substantially induce any immune response against chimeric antibodies. | 02-20-2014 |
20140050723 | Cell-Penetrating Anti-DNA Antibodies and Uses Thereof Inhibit DNA Repair - Antibodies that penetrate cell nuclei and inhibit DNA repair or interfere with DNA metabolism are provided for treatment of cancer (both directly and by sensitizing cancer cells to DNA-damaging treatments) or inhibiting or preventing viral infection, proliferation or metabolism. The method involves treating cells with a composition containing cell-penetrating anti-DNA antibodies or derivatives thereof, alone or in combination with treatment that induces DNA damage such as DNA-damaging chemotherapy or radiation. The impact of the cell-penetrating anti-DNA antibodies or derivatives thereof is potentiated in cancer cells that are deficient in DNA repair, and the cell-penetrating anti-DNA antibodies or derivatives thereof are synthetically lethal to cancer cells with DNA repair deficiencies. | 02-20-2014 |
20140050724 | Compositions and Methods - Compositions comprising polyethylene glycol (PEG) are disclosed for the prophylaxis and/or treatment of head and neck squamous cell carcinomas (HNSCC). Methods for the prophylaxis and/or treatment of HNSCC comprising administering an effective amount of PEG are also disclosed. Also disclosed are methods and compositions for suppressing the surface expression of EGFR using PEG. | 02-20-2014 |
20140056872 | ANTAGONISTS OF NEUROPILIN RECEPTOR FUNCTION AND USE THEREOF - The present invention relates to antagonists of neuropilin receptor function and use thereof in the treatment of cancer, particularly metastatic cancer, and angiogenic diseases. | 02-27-2014 |
20140056873 | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 02-27-2014 |
20140056874 | METHOD TO IDENTIFY A PATEINT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 02-27-2014 |
20140056875 | METHOD TO IDENTIFY A PATEINT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 02-27-2014 |
20140056876 | METHOD TO IDENTIFY A PATEINT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 02-27-2014 |
20140056877 | Stabilized Liquid Anti-RSV Antibody Formulations - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 02-27-2014 |
20140056878 | HUMANIZED ANTIBODIES DIRECTED AGAINST COMPLEMENT PROTEIN C5 - The invention relates to an isolated immunoglobulin heavy chain polypeptide and an isolated immunoglobulin light chain polypeptide that binds to complement protein C5. The invention provides a C5-binding agent that comprises the aforementioned immunoglobulin heavy chain polypeptide and immunoglobulin light chain polypeptide. The invention provides an isolated complement protein C5 epitope. The invention also provides related vectors, compositions, and methods of using the C5-binding agent to treat an C5-mediated disease. | 02-27-2014 |
20140056879 | FC VARIANTS THAT EXTEND ANTIBODY HALF-LIFE - The invention relates generally to compositions and methods for altering the serum half-life in vivo of an antibody. | 02-27-2014 |
20140056880 | TRIAZOLE COMPOUNDS AS KSP INHIBITORS - The present invention provides triazole compounds of Formula I: | 02-27-2014 |
20140056881 | METHOD AND KIT FOR THE DETECTION OF GENES ASSOCIATED WITH PIK3CA MUTATION AND INVOLVED IN PI3K/AKT PATHWAY ACTIVATION IN THE ER-POSTITIVE AND HER2-POSITIVE SUBTYPES WITH CLINICAL IMPLICATIONS - A method to determine the clinical outcome of breast tumour affecting a patient if treated with an antitumoural agent against breast tumour, the said method comprising the step of assaying a sample of a breast tumour from said patient for an expression level of selected genes, by contacting mRNA sequences from the cells of this breast tumour with a set of more than 3 nucleotide sequences related to human mutated PIK3CA. | 02-27-2014 |
20140056882 | TREATMENT OF PULMONARY DISEASE CONDITIONS - The present invention relates generally to a method for treating or preventing or otherwise ameliorating the effects of pulmonary diseases characterized by or associated with infiltration of neutrophils and complications arising therefrom. The present invention further provides agents and pharmaceutical compositions comprising agents which inhibit the activity of G-CSF or its receptor, interfere with G-CSF signaling and/or which down-regulate expression of G-CSF or its receptor. | 02-27-2014 |
20140056883 | SUBCUTANEOUSLY ADMINISTERED ANTI-IL-6 RECEPTOR ANTIBODY - The present application discloses methods for treating an IL-6-mediated disorder such as rheumatoid arthritis (RA), juvenile idiopathic arthritis (JIA), systemic JIA (sJIA), polyarticular course JIA (pcJIA), systemic sclerosis, or giant cell arteritis (GCA), with subcutaneously administered antibody that binds interleukin-6 receptor (anti-IL-6R antibody). In particular, it relates to identification of a fixed dose of anti-IL-6R antibody, e.g. tocilizumab, which is safe and effective for subcutaneous administration in patients with IL-6-mediated disorders. In addition, formulations and devices useful for subcutaneous administration of an anti-IL-6R antibody are disclosed. | 02-27-2014 |
20140056884 | SUBCUTANEOUSLY ADMINISTERED ANTI-IL-6 RECEPTOR ANTIBODY - The present application discloses methods for treating an IL-6-mediated disorder such as rheumatoid arthritis (RA), juvenile idiopathic arthritis (JIA), systemic JIA (sJIA), polyarticular course JIA (pcJIA), systemic sclerosis, or giant cell arteritis (GCA), with subcutaneously administered antibody that binds interleukin-6 receptor (anti-IL-6R antibody). In particular, it relates to identification of a fixed dose of anti-IL-6R antibody, e.g. tocilizumab, which is safe and effective for subcutaneous administration in patients with IL-6-mediated disorders. In addition, formulations and devices useful for subcutaneous administration of an anti-IL-6R antibody are disclosed. | 02-27-2014 |
20140056885 | SUBCUTANEOUSLY ADMINISTERED ANTI-IL-6 RECEPTOR ANTIBODY - The present application discloses methods for treating an IL-6-mediated disorder such as rheumatoid arthritis (RA), juvenile idiopathic arthritis (JIA), systemic JIA (sJIA), polyarticular course JIA (pcJIA), systemic sclerosis, or giant cell arteritis (GCA), with subcutaneously administered antibody that binds interleukin-6 receptor (anti-IL-6R antibody). In particular, it relates to identification of a fixed dose of anti-IL-6R antibody, e.g. tocilizumab, which is safe and effective for subcutaneous administration in patients with IL-6-mediated disorders. In addition, formulations and devices useful for subcutaneous administration of an anti-IL-6R antibody are disclosed. | 02-27-2014 |
20140056886 | Humanized Anti-IL-20 Antibody And Uses Thereof - Humanized antibodies specific to human interleukin 20 (IL-20) and uses thereof in treating diseases associated with the IL-20 signaling pathway, e.g., osteoporosis, inflammatory disease (e.g., rheumatoid arthritis), cancer, stroke, and renal failure. | 02-27-2014 |
20140056887 | COMBINATION THERAPIES FOR B-CELL LYMPHOMAS COMPRISING ADMINISTRATION OF ANTI-CD20 ANTIBODY - New combined therapeutic regimens for treatment of B-cell lymphomas are disclosed which comprise, in particular, administration of anti-CD20 antibodies to patients having low-, intermediate- or high-grade non-Hodgkin's lymphomas. | 02-27-2014 |
20140056888 | HIGH CONCENTRATION ANTIBODY FORMULATIONS - The present disclosure relates to, inter alia, stable aqueous solutions comprising a high concentration of an antibody that binds to human complement component C5 and methods for preparing the solutions. The disclosure also provides methods for treating or preventing complement-associated disorders (for example, age-related macular degeneration or rheumatoid arthritis) using the solutions. Also featured are therapeutic kits containing one or more of the solutions and a means for administering the solutions to a patient in need such a treatment. | 02-27-2014 |
20140056889 | COMPOSITIONS AND METHOD FOR TREATING AUTOIMMUNE DISEASES - The invention provides methods and compositions for treating various autoimmune diseases (such as systemic lupus erythematousu) with an interferon inhibitor (such as an anti-intereron-alpha monoclonal antibody). More specifically, the invention provides a method of diagnosing, monitoring and adjusting the treatment of such a patient by way of an interferon signature metric (interferon response gene measurement value), a certain anti-dsDNA antibody titre or being ENA− (levels of extractable nuclear antigens lower than a healthy level). Furthermore, the invention provides articles of manufacture associated with such a diagnosis. | 02-27-2014 |
20140065134 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH INCREASED ANTIBODY DEPENDENT CELLULAR CYTOTOXITY (ADCC) - The present invention is directed to a pharmaceutical composition comprising: (A) a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity (ADCC); and (B) a chemotherapeutic agent selected from the group consisting of: cyclophosphamide, vincristine and doxorubicine. The present invention is also directed to a method for the treatment of a CD20 expressing cancer, comprising administering to a patient in need of such treatment (i) an effective first amount of a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity; and (ii) an effective second amount of one or more chemotherapeutic agents selected from the group consisting of cyclophosphamide, vincristine and doxorubicine. | 03-06-2014 |
20140065135 | METHODS OF USING ANTI-PD-L1 ANTIBODIES AND THEIR USE TO ENHANCE T-CELL FUNCTION TO TREAT TUMOR IMMUNITY - The present application relates to methods of using anti-PD-L1 antibodies to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, including infection (e.g., acute and chronic) and tumor immunity. | 03-06-2014 |
20140065136 | DIOXINO- AND OXAZIN-[2,3-D]PYRIMIDINE PI3K INHIBITOR COMPOUNDS AND METHODS OF USE - Dioxino- and oxazin-[2,3-d]pyrimidine PI3K inhibitor compounds of Formula I with anti-cancer activity, anti-inflammatory activity, or immunoregulatory properties, and more specifically with PI3 kinase modulating or inhibitory activity are described. Methods are described for using the tricyclic PI3K inhibitor compounds of Formula I for in vitro, in situ, and in vivo diagnosis or treatment of mammalian cells, organisms, or associated pathological conditions. | 03-06-2014 |
20140065137 | HUMANIZED ANTI-FACTOR D ANTIBODIES AND USES THEREOF - The invention relates to anti-Factor D antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their production and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 03-06-2014 |
20140065138 | ANTI-N3pGlu AMYLOID BETA PEPTIDE ANTIBODIES AND USES THEREOF - The present invention provides anti-N3pGlu Aβ antibodies or antigen-binding fragment thereof. In addition, the present invention provides the use of the anti-N3pGlu Aβ antibodies or antigen-binding fragment thereof for the treatment of Alzheimer's disease. | 03-06-2014 |
20140065139 | Induction of Tumor Hypoxia for Cancer Therapy - Methods and compositions for enhancing the ability of hypoxia-activated bioreductive agents to kill tumor cells within solid tumors are provided. Local regions of hypoxia are created within a tumor, or within a region containing a tumor, resulting in enhanced activation of hypoxia-activated bioreductive agents (e.g. tirapazamine) within the local region. The activated hypoxia-activated bioreductive agents kill tumor cells in the hypoxic region by catalyzing DNA stand breakage within the tumor cells. Because the activity is localized, side effects that typically occur as a result of systemic administration of bioreductive agents are reduced. | 03-06-2014 |
20140065140 | CANCER TREATMENT USING VIRUSES AND CAMPTOTHECINS - Mammalian subjects having a neoplasm are treated with a virus and a camptothecin compound, for example irinotecan or topotecan. The virus is selected from the group consisting of a Newcastle disease virus, a measles virus, a vesicular stomatitis virus, an influenza virus, a Sindbis virus, a picornavirus, and a myxoma virus. The treatment can also include administration of a monoclonal antibody against epidermal growth factor receptor, for example cetuximab. | 03-06-2014 |
20140065141 | CSF-1R INHIBITORS FOR TREATMENT OF BRAIN TUMORS - The present invention provides a compound of formula I; | 03-06-2014 |
20140072551 | Anti-P-Selectin Antibodies and Methods of Using The Same to Treat Inflammatory Diseases - The invention features antibodies, e.g., chimeric and humanized antibodies, that recognize (i.e., bind) P-selectin. The P-selectin antibodies prevent P-selectin from binding to its cognate receptor. The P-selectin antibodies can be used to treat inflammatory and thrombotic conditions, e.g., sickle cell disease, pain crisis associated with sickle cell disease, deep vein thrombosis, asthma, rheumatoid arthritis, psoriasis, and ischemia reperfusion injury in a patient in need thereof. | 03-13-2014 |
20140072552 | COMPOSITION OF ANTI-ENDO180 ANTIBODIES AND METHODS OF USE FOR THE TREATMENT OF CANCER AND FIBROTIC DISEASES - The present invention provides antibodies or antigen-binding fragments thereof that specifically bind the ENDO180 polypeptide and are internalized thereby, to conjugates comprising the molecules, to compositions comprising the antibodies and conjugates and to methods of using the same for delivery of therapeutic agents to cells that express the ENDO180 polypeptide on the surface of the cell for treating cell proliferative diseases or disorders and fibrosis, and for controlling (modulating) tumor progression. | 03-13-2014 |
20140072553 | High Affinity Antibodies That Neutralize Staphylococcus Enterotoxin B - Provided herein are antibodies that specifically bind and neutralize | 03-13-2014 |
20140072554 | PYRAZOLO[1,5-A]PYRIMIDINES FOR ANTIVIRAL TREATMENT - The invention provides compounds of Formula I or Formula II: | 03-13-2014 |
20140072555 | Inhibitor Compounds and Cancer Treatment Methods - A synergistically effective combination of an anti-cancer agent and a therapeutic compound, such as an mTOR-Rictor complex inhibitor, a Serine 473 phosphorylation inhibitor, an AKT2 inhibitor, or a combination thereof, for use in the treatment of cancer, and methods and uses thereof. Also included are methods and uses of a thiosemicarbazone for treating a cancer in a mammal in need thereof characterized by over-expression of RAS, by an EGFR mutation, and/or by over-expression of AKT2. | 03-13-2014 |
20140072556 | PROTEINS AND NUCLEIC ACIDS USEFUL IN VACCINES TARGETING STAPHYLOCOCCUS AUREUS - Disclosed are novel immunogenic proteins derived from | 03-13-2014 |
20140079689 | Fc VARIANTS AND METHODS FOR THEIR PRODUCTION - Described herein are Fc variants and methods for the efficient production of antibodies and other multimeric protein complexes (collectively referred to herein as heteromultimeric proteins). Heteromultimeric proteins may be capable of specifically binding to more than one target. The targets may be, for example, different epitopes on a single molecule or located on different molecules. The methods combine efficient, high gene expression level, appropriate assembly, and ease of purification for the heteromultimeric proteins. The invention also provides methods of using these heteromultimeric proteins, and compositions, kits and articles of manufacture comprising these antibodies. | 03-20-2014 |
20140079690 | INHIBITORS OF BRUTON'S TYROSINE KINASE FOR THE TREATMENT OF SOLID TUMORS - Described herein are irreversible Btk inhibitor compounds, and methods for using such irreversible inhibitors in the treatment of diseases and disorders characterized by the presence or development of solid tumors. | 03-20-2014 |
20140079691 | THERMOSTABLE ANTIBODY FRAMEWORK REGIONS - The invention provides isolated amino acid sequences comprising the framework regions of an immunoglobulin heavy chain or light chain polypeptide, wherein certain amino acid residues of the framework regions are replaced with different amino acid residues that confer increased thermostability in vitro or in vivo. The invention also provides an isolated amino acid sequence of the constant region of an immunoglobulin heavy chain polypeptide wherein certain amino acid residues of the constant region are replaced with different amino acid residues that confer increased thermostability in vitro or in vivo. | 03-20-2014 |
20140079692 | DOSAGES FOR TREATMENT WITH ANTI-EGFR ANTIBODIES - The present invention concerns dosages for treatment of human cancer patients with an anti-Epidermal Growth Factor Receptor (EGFR) antibody. | 03-20-2014 |
20140079693 | KINASE INHIBITORS AND METHODS OF THEIR USE - New compounds, compositions and methods of inhibition of Provirus Integration of Maloney Kinase (PIM kinase) activity associated with tumorigenesis in a human or animal subject are provided. In certain embodiments, the compounds and compositions are effective to inhibit the activity of at least one PIM kinase. The new compounds and compositions may be used either alone or in combination with at least one additional agent for the treatment of a serine/threonine kinase- or receptor tyrosine kinase-mediated disorder, such as cancer. | 03-20-2014 |
20140079694 | CAI-BASED SYSTEMS AND METHODS FOR THE LOCALIZED TREATMENT OF OCULAR AND OTHER DISEASES - The subject invention provides CAI compounds and formulations thereof, and methods for their use in the localized treatment of non-life threatening diseases. Formulations of CAI compounds of the subject invention include CAI free base and CAI prodrug microcrystallines, microparticles, emulsions, and the like. The subject invention further provides methods for treating non-life threatening diseases using the CAI compounds of the invention (i.e., novel delivery systems and combination therapies), that are effective and are associated with little or no adverse side effects. | 03-20-2014 |
20140079695 | PREVENTIVE AGENT FOR VASCULITIS - To provide a preventive and/or therapeutic agent for vasculitis such as polyarteritis nodosa, the aortitis syndrome, and a vasculitis that is associated with immunological abnormalities, said agent comprising an interleukin-6 (IL-6) antagonist as an active ingredient. | 03-20-2014 |
20140086903 | CD37 IMMUNOTHERAPEUTIC AND COMBINATION WITH BIFUNCTIONAL CHEMOTHERAPEUTIC THEREOF - The present disclosure provides a humanized anti-CD37 small modular immunopharmaceutical (SMIP) molecule, as well as synergistic combination therapies of CD37-specific binding molecules (such as anti-CD37 SMIP proteins or antibodies) with bifunctional chemotherapeutics (such as bendamustine) that can be administered concurrently or sequentially, for use in treating or preventing B-cell related autoimmune, inflammatory, or hyperproliferative diseases. | 03-27-2014 |
20140086904 | Humanized Anti-TNF-alpha Antibody and Antigen-Binding Fragment (Fab) Thereof and Use of the Same - The present invention discloses a humanized anti-human tumor necrosis factor-α antibody and antigen-binding fragment (Fab) thereof. The present invention also discloses a composition comprising the said antibody or antigen-binding fragment (Fab) thereof, and the use of the said antibody or antigen-binding fragment (Fab) thereof in treating the diseases associated with tumor necrosis factor-α. | 03-27-2014 |
20140086905 | IMMUNOLOGICAL COMPOSITIONS AS CANCER THERAPEUTICS - The present invention concerns antibodies that react immunologically with an epitope comprising VDKSRWQQG (SEQ ID NO: 1), including those that bind to cancer cells, and methods relating thereto. In particular, the antibodies that react immunologically with a particular epitope found in anti-tumor antigen antibodies are not only indicative of favorable therapy using the anti-tumor antigen antibodies, but are therapeutic in and of themselves. | 03-27-2014 |
20140086906 | Optimized Antibodies That Target CD19 - The present invention describes antibodies that target CD19, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcgγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 03-27-2014 |
20140086907 | MULTIMODAL TRAIL MOLECULES AND USES IN CELLULAR THERAPIES - Described herein are novel compositions comprising multimodal TRAIL agents and cells engineered to express such multimodal TRAIL agents, including cells encapsulated in a scaffold or matrix, for use in the treatment of disorders such as cancer. | 03-27-2014 |
20140086908 | ANTI-ALPHA-V INTEGRIN ANTIBODY FOR THE TREATMENT OF PROSTATE CANCER - The invention is directed to the treatment of prostate cancer by means of antibodies. Above all, the invention relates to the administration of an anti-alpha-v integrin (receptor) antibody to patients suffering from prostate cancer, especially castration-resistant prostate cancer (CRPC), optionally accompanied by lymph node and bone tissue metastases (mCRPC). In particular, the invention relates to the therapy of said patients by means of the anti-angiogenic antibody DI17E6 and structural mutants thereof. | 03-27-2014 |
20140086909 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF PROLIFERATIVE DISORDERS - The invention features methods of treating a proliferative disorder characterized by elevated Pin1 marker levels and/or reduced Pin1 Ser71 phosphorylation in a subject by administering a retinoic acid compound. Additionally, the invention features methods of treating proliferative disorders (e.g., proliferative disorders characterized by elevated Pin1 marker levels) by administering a retinoic acid compound in combination with another anti-proliferative compound. Finally, the invention also features methods including high-throughput screens for discovering and validating Pin1 inhibitors. | 03-27-2014 |
20140086910 | METHODS OF TREATING OR PREVENTING ALZHEIMER'S DISEASE USING INDANE ACETIC ACID DERIVATIVES - The present invention provides indane acetic acid and their derivatives and methods for the treating and/or preventing of Alzheimer's diseases. | 03-27-2014 |
20140086911 | Methods and Products for Predicting CMTC Class and Prognosis in Breast Cancer Patients - Provided herein are products, uses and method classifying a subject afflicted with breast cancer according to a ClinicoMolecular Triad Classification (CMTC)-1, CMTC-2 or CMTC-3 class. The method involves:
| 03-27-2014 |
20140086912 | HUMANIZED ANTI-INTERLEUKIN 3 RECEPTOR ALPHA CHAIN ANTIBODIES - The present disclosure provides antibodies that bind to interleukin-3 receptor alpha chain and uses thereof. | 03-27-2014 |
20140086913 | ANTI-DDR1 ANTIBODIES - Provided are antibodies, including functional antibody fragments, that specifically bind to discoidin domain receptors (DDRs), and in particular to DDR1 proteins, as well as uses and method of using such antibodies, including in the detection, diagnosis and treatment of diseases and conditions associated with DDR1. | 03-27-2014 |
20140086914 | TREATMENT METHODS USING c-MET ANTIBODIES - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to c-Met, preferably human c-Met, and that function to inhibit c-Met. The invention also relates to human anti-c-Met antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-c-Met antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-c-Met antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-c-Met antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 03-27-2014 |
20140086915 | AGENTS AND METHODS FOR MODULATING MACROPHAGE INHIBITORY CYTOKINE (MIC-1) ACTIVITY - The invention relates to a method and novel types of agents for modulating appetite and/or body weight in a subject. Moreover, the invention relates to a method of screening for agents which interact and modulate the activity of the receptor complex for macrophage inhibitory cytokine-1 (MIC-1). | 03-27-2014 |
20140086916 | METHOD FOR PREPARING Fc CONTAINING POLYPEPTIDES HAVING IMPROVED PROPERTIES - The present invention is directed to methods and compositions for the production of Fc-containing polypeptides comprising mutations at positions 243, 264, 267 and 328 of the Fc region. | 03-27-2014 |
20140086917 | COMBINATIONS OF ANTI ErbB ANTIBODIES FOR THE TREATMENT OF CANCER - An article-of-manufacture is provided. The article-of-manufacture comprises a packaging material identified for treating cancer, packaging:
| 03-27-2014 |
20140093492 | METHOD FOR PREVENTING AND TREATING CANCER METASTASIS AND BONE LOSS ASSOCIATED WITH CANCER METASTASIS - M-CSF antagonists are used to prepare compositions, including pharmaceutical compositions, for preventing or treating cancer metastasis and/or bone loss associated with cancer metastasis in a mammal. | 04-03-2014 |
20140093493 | METHOD AND FORMULATION FOR REDUCING AGGREGATION OF A MACROMOLECULE UNDER PHYSIOLOGICAL CONDITIONS - The invention provides a method for reducing aggregation and inhibiting flocculation of a macromolecule, such as a protein, under physiological conditions, by the addition of certain cyclodextrins (CDs). The invention also provides a method to minimize inflammation at the injection site during subcutaneous administration of a macromolecule and pharmaceutical formulations for such administration. Further the invention provides methods of treating a CD20 positive cancer or an autoimmune disease, comprising administering a humanized anti-CD20 antibody in a pharmaceutical formulation of the invention. The invention further provides an in vitro dialysis method to evaluate the ability of an excipient to reduce aggregation of an antibody or other macromolecule under physiological conditions. | 04-03-2014 |
20140093494 | ALPHA SYNUCLEIN TOXICITY - It is demonstrated that alpha synculein toxicity such as α-synuclein mediated cell death, and alpha synuclein induced reactive oxygen species (ROS) in a cell requires proapoptotic endonuclease G and that the deletion of the endonuclease G or suppressing of the endonuclease G apoptotic pathway attenuates or counteracts such alpha synuclein toxicity. In view of these observations, compositions and methods for inhibition of α-synuclein toxicity are provided. The inhibiting α-synuclein toxicity can be used in methods for the treatment of synucleinopathies, such as Parkinsons disease (PD), dementia with Lewy bodies (DLB), pure autonomic failure (PAF), and multiple system atroypy (MSA) and the manufacture of medicaments for such treatment. In particular, pharmaceutical compositions containing inhibitors of endonuclease G, and their use in the treatment of synucleinopathies such as Parkinson's disease, dementia with Lew bodies, pure autonomic failure, and multiple system atrophy and the manufacture of medicaments for such treatment are presented. In addition, methods for the identification of compounds for attenuating the synuclein toxicity are also provided. | 04-03-2014 |
20140093495 | NOVEL MODULATORS AND METHODS OF USE - Novel modulators, including antibodies and derivatives thereof, and methods of such modulators to treat hyperproliferative disorders are provided. | 04-03-2014 |
20140093496 | Fc-gamma-RIIb-SPECIFIC Fc ANTIBODY - An objective of the present invention is to provide a polypeptide containing an Fc region having maintained or decreased binding activities towards both allotypes of FcγRIIa, types H and R, and having enhanced FcγRIIb-binding activity in comparison with a parent polypeptide; a pharmaceutical composition containing the polypeptide; an agent for treating or preventing immunological inflammatory diseases that includes the pharmaceutical composition; a production method thereof; and a method for maintaining or decreasing binding activities towards both allotypes of FcγRIIa and enhancing the FcγRIIb-binding activity. Specifically, it is found that a polypeptide containing an antibody Fc region that has an alteration of substituting Pro at position 238 (EU numbering) with Asp or Leu at position 328 (EU numbering) with Glu enhances FcγRIIb-binding activity, and maintains or decreases binding activities towards both allotypes of FcγRIIa, types H and R. It is also found that a polypeptide containing an antibody Fc region that contains an alteration of substituting Pro at position 238 (EU numbering) with Asp and several other alterations, enhances FcγRIIb-binding activity, and maintains or decreases binding activities towards both allotypes of FcγRIIa, types H and R. | 04-03-2014 |
20140093497 | ANTI-CD40 ANTIBODIES AND USES THEREOF - The present invention relates to antibodies specific for a particular epitope on CD40 and antibodies that bind CD40 and have particular functional characteristics. The present invention also relates to fragments of these antibodies, uses of the antibodies for reduction or treatment of transplant rejection and graft-versus-host disease, and methods for making the antibodies. | 04-03-2014 |
20140093498 | PHARMACEUTICAL COMBINATIONS COMPRISING DUAL ANGIOPOIETIN-2 / DLL4 BINDERS AND ANTI-VEGF-R AGENTS - The present invention relates to pharmaceutical combinations comprising dual Angiopoietin-2/DII4 binders and anti-VEGF-R agents for use in treating diseases like cancer and ocular diseases. | 04-03-2014 |
20140093499 | PHARMACEUTICAL COMBINATIONS COMPRISING DUAL ANGIOPOIETIN-2 / DLL4 BINDERS AND ANTI-VEGF AGENTS - The present invention relates to pharmaceutical combinations comprising dual Angiopoietin-2/Dll4 binders and anti-VEGF agents for use in treating diseases like cancer and ocular diseases. | 04-03-2014 |
20140093500 | RSV SPECIFIC BINDING MOLECULE - The invention provides antibodies and functional equivalents thereof which are capable of specifically binding RSV. Nucleic acid sequences encoding said antibody, as well as antibody producing cells and methods for producing said antibody are also provided. | 04-03-2014 |
20140093501 | Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus - This invention relates to a human antibody which contains the one CDR from each variable heavy and variable light chain of at least one murine monoclonal antibody, against respiratory syncytial virus which is MAb1129 and the use thereof for the prevention and/or treatment of RSV infection. | 04-03-2014 |
20140093502 | Immunosuppressive Combination and Its Use in the Treatment or Prophylaxis of Insulin-producing Cell Graft Rejection - A pharmaceutical combination comprising an accelerated lymphocyte homing agent in free form or in pharmaceutically acceptable salt form, and one or more compounds selected from the group consisting of an antibody to the IL-2 receptor, an immunosuppressive macrocyclic lactone and a soluble human complement inhibitor is used to treat or prevent insulin-producing cell graft rejection. | 04-03-2014 |
20140093503 | Taxane and Abeo-Taxane Analogs - The present application discloses new taxane analogs, intermediates and methods for producing them. The present application is also directed to pharmaceutical formulations comprising abeo-taxanes and methods of treating cancer with the abeo-taxanes. | 04-03-2014 |
20140093504 | Anti-Ricin Antibodies And Uses Thereof - The present invention relates to anti-ricin antibodies and uses thereof. More specifically, the invention relates to anti-ricin antibodies and fragments thereof as well as their use in therapy or prophylaxis. | 04-03-2014 |
20140093505 | Pyridonaphthyridine PI3K/MTOR Dual Inhibitors and Preparation and Use Thereof - The present invention relates to a pyridonaphthyridine compound as represented by general formula (I), which has a dual PI3K and mTOR inhibition effect, and its pharmaceutically acceptable salt, stereoisomer and deuteride thereof, wherein R | 04-03-2014 |
20140099299 | Methods and Compositions for Cytomegalovirus IL-10 Protein - The present invention provides methods and compositions for treating and/or preventing a cytomegalovirus infection in a subject, comprising administering to the subject an effective amount of a cytomegalovirus IL-10 protein modified to have reduced functional activity while retaining immunogenicity. The present invention further provides nucleic acid molecules encoding a cytomegalovirus IL-10 protein or fragment thereof of this invention as well as vectors comprising such nucleic acids. Also provided herein are neutralizing antibodies that specifically bind cmvIL-10. | 04-10-2014 |
20140099300 | METHODS FOR PREDICTING AND IMPROVING THE SURVIVAL OF GASTRIC CANCER PATIENTS - The present invention provides assays and methods for predicting the post-operative survival of a subject having an early stage gastric cancer after tumor surgery. The present invention also provides methods for treating a subject having an early stage gastric cancer by administering a combination therapy tailored to the signal transduction biomarkers that are activated in the cancer. In particular embodiments, the methods of the invention rely on the detection of the activation state or level of a specific combination of signal transducer analytes in a cancer cell obtained from the subject. Thus, the methods of the invention are particularly useful for predicting the survival or prognosis of a subject having an early stage gastric cancer and for guiding both pre- and post-operative treatment decisions by identifying subjects who would benefit from combination therapy as opposed to monotherapy. | 04-10-2014 |
20140099301 | ANTIBODY FORMULATION - The invention provides a stable aqueous pharmaceutical formulation comprising a therapeutically effective amount of an antibody, optionally, not subjected to prior lyophilization, a buffer maintaining the pH in the range from about 4.0 to about 6.0, and an optional surfactant, methods for making such a formulation, and methods of using such a formulation. | 04-10-2014 |
20140099302 | METHODS TO IDENTIFY RESPONSIVE PATIENTS - The present invention provides methods and kits for improving the progression-free survival of a patient suffering from gastrointestinal cancer and for assessing the sensitivity or responsiveness of the patient to treatment comprising bevacizumab. | 04-10-2014 |
20140099303 | Methods of Treating a Tauopathy - The present disclosure provides methods of treating a tauopathy, involving administering an anti-Tau antibody. The present disclosure also provides anti-Tau antibodies, and formulations comprising same, for use in the methods. | 04-10-2014 |
20140099304 | Methods of Treating a Tauopathy - The present disclosure provides methods of treating a tauopathy, involving administering an anti-Tau antibody. The present disclosure also provides anti-Tau antibodies, and formulations comprising same, for use in the methods. | 04-10-2014 |
20140105885 | Method for Inhibiting Scavenger Receptor-A and Increasing Immune Response to Antigens - Provided is a method for enhancing an immune response to a desired antigen in an individual. The method is performed by administering to the individual an agent capable of inhibiting class A macrophage scavenger receptor (SR-A) and optionally administering the desired antigen. Also provided is a method for enhancing an immune response to an antigen by administering to an individual a composition containing antigen presenting cells that are characterized by specifically inhibited SR-A. Substantially purified populations of mammalian dendritic cells characterized by specifically inhibited SR-A are also provided. | 04-17-2014 |
20140105886 | ASSOCIATION OF BIOMARKERS WITH PATIENT OUTCOME - Glioblastoma multiforme (GBM) is an aggressive form of brain cancer. Biomarkers for GBM that provide prognostic and predictive information are useful because they provide the physician valuable information regarding treatment options for GBM. The present invention provides a method to quantify such biomarkers. Thus, the method relates to the quantification of GSK3β, S6, CREB, PTEN, AKT and mTOR biomarkers and the use of AQUA® analysis to estimate a patient's risk and benefit to treatment using an inhibitor of the AGC-family kinase. Unlike traditional IHC, the AQUA® system is objective and produces quantitative in situ protein expression data on a continuous scale. The present invention uses the AQUA system to provide a robust and standardized diagnostic assay that can be used in a clinical setting to provide prognostic and predictive information. | 04-17-2014 |
20140105887 | METHODS FOR MODULATING IL-33 ACTIVITY - Provided herein are methods of modulating IL-33 activity, e.g., for the purpose of treating immune diseases and conditions, as well as methods of screening for compounds capable antagonizing IL-33 signaling. | 04-17-2014 |
20140105888 | NOVEL MODULATORS AND METHODS OF USE - Novel modulators, including antibodies and derivatives thereof, and methods of using such modulators to treat hyperproliferative disorders are provided. | 04-17-2014 |
20140105889 | METHOD FOR ALTERING PLASMA RETENTION AND IMMUNOGENICITY OF ANTIGEN-BINDING MOLECULE - The present invention demonstrated that the modification of the Fc region of an antigen-binding molecule into an Fc region that does not form in a neutral pH range a heterotetramer complex containing two molecules of FcRn and an active Fcγ receptor improved the pharmacokinetics of the antigen-binding molecule and reduced the immune response to the antigen-binding molecule. The present invention also revealed methods for producing antigen-binding molecules having the properties described above, and successfully demonstrated that pharmaceutical compositions containing as an active ingredient such an antigen-binding molecule or an antigen-binding molecule produced by a production method of the present invention have excellent features over conventional antigen-binding molecules in that when administered, they exhibit improved pharmacokinetics and reduced in vivo immune response. | 04-17-2014 |
20140105890 | HUMANIZED ANTIBODIES SPECIFIC TO THE PROTOFIBRILLAR FORM OF THE BETA-AMYLOID PEPTIDE - The present application relates to humanized antibodies specific to the protofibrillar form of the beta-amyloid peptide, and to the use of said antibodies in the field of Alzheimer's disease. | 04-17-2014 |
20140105891 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 04-17-2014 |
20140105892 | HIGH CONCENTRATION ANTIBODY AND PROTEIN FORMULATIONS - Provided are salt-free antibody and other protein formulations that are substantially isosmotic and of low viscosity. Also provided are methods for the treatment of diseases using the disclosed formulations. | 04-17-2014 |
20140105893 | METHOD FOR SELECTING CHEMOTHERAPY FOR GASTRIC CANCER PATIENT USING COMBINATION DRUG OF TEGAFUR, GIMERACIL AND OTERACIL POTASSIUM AND EGFR INHIBITOR - A method for predicting a therapeutic effect of chemotherapy with a combination drug containing tegafur, gimeracil, and oteracil potassium in a gastric cancer patient by:
| 04-17-2014 |
20140105894 | HUMANIZED ANTI-IL-18 ANTIBODIES - The present invention discloses humanised anti-IL-18 antibodies, methods of manufacture, and methods of treatment with said antibodies. Further disclosed are screening methods using for example surface plasmon resonance to identify antibodies with therapeutic potential. | 04-17-2014 |
20140105895 | TREATMENT OF SOLID TUMORS WITH RAPAMYCIN DERIVATIVES - The present invention is directed to the use of rapamycin derivatives for use in treating solid tumors, optionally in combination with a chemotherapeutic agent. | 04-17-2014 |
20140112911 | NOVEL ANTI-CMET ANTIBODY - The present invention relates to a novel divalent antibody capable of binding specifically to the human c-Met receptor and/or capable of specifically inhibiting the tyrosine kinase activity of said receptor, preferably both in a ligand-dependent and in a ligand-independent manner as well as the amino acid and nucleic acid sequences coding for said antibody. More preferably said antibody comprises a modified hinge region and exhibits an improved antagonistic activity. More particularly, the antibody according to the invention is capable of inhibiting the c-Met dimerization. The invention likewise comprises the use of said antibody as a medicament for the prophylactic and/or therapeutic treatment of cancers, preferably for cancer characterized by a ligand-independent activation of c-Met, or any pathology connected with the over expression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the over-expression of c-Met. The invention finally comprises products and/or compositions comprising such an antibody in combination with other antibodies and/or chemical compounds directed against other growth factors involved in tumor progression or metastasis and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 04-24-2014 |
20140112912 | DIAGNOSIS AND TREATMENT OF AUTOANTIBODY-MEDIATED HEART DISEASE - Provided herein are, inter alia, methods of diagnosing and treating autoimmune cardiomyopathy in subjects, based upon the detection of IgG4 antibodies to cardiac autoantigens. | 04-24-2014 |
20140112913 | METHODS OF PROGNOSING AND ADMINISTERING TREATMENT FOR INFLAMMATORY DISORDERS - The present invention provides methods for determining responsiveness to an IL-6 inhibitor JAK/STAT pathway inhibitor in a subject. The present invention also provides methods for treating disease with an IL-6 inhibitor or a JAK/STAT pathway inhibitor. | 04-24-2014 |
20140112914 | CYTOTOXICITY-INDUCING THERAPEUTIC AGENT - By replacing the antigen-binding domain, the present inventors discovered novel polypeptide complexes that retain BiTE's strong anti-tumor activity and excellent safety properties, as well as have long half-life in blood and can damage various different target cells. | 04-24-2014 |
20140112915 | IL-18 binding molecules - IL-18 participates in both innate and acquired immunity. The bioactivity of IL-18 is negatively regulated by the IL-18 binding protein (IL18BP), a naturally occurring and highly specific inhibitor. This soluble protein forms a complex with free IL-18 preventing its interaction with the IL-18 receptor, thus neutralizing and inhibiting its biological activity. The present invention discloses binding molecules, in particular antibodies or fragments thereof, which bind IL-18 and do not bind IL-18 bound to IL-18BP (IL-18/IL-18BP complex). Apart from its physiological role, IL-18 has been shown to mediate a variety of autoimmune and inflammatory diseases. The binding molecules of the inventions may be used as therapeutic molecules for treating IL-18-related autoimmune and inflammatory diseases or as diagnostic tools for characterizing, detecting and/or measuring IL-18 not bound to IL-18BP as component of the total IL-18 pool. | 04-24-2014 |
20140112916 | Optimized Antibodies That Target CD19 - The present invention describes antibodies that target CD19, wherein the antibodies comprise at least one modification relative to a parent antibody, wherein the modification alters affinity to an FcgγR or alters effector function as compared to the parent antibody. Also disclosed are methods of using the antibodies of the invention. | 04-24-2014 |
20140112917 | DIAGNOSTIC AND THERAPEUTIC METHODS AND COMPOSITIONS INVOLVING PTEN AND BREAST CANCER - Patients with ErbB2-overexpressing cancers can be given an ErbB2 targeting agent as a therapeutic regimen but not all patients are responsive. The present invention concerns the diagnostic, prognostic and therapeutic methods and compositions for evaluating potential efficacy of an ErbB2 targeting agent in an ErbB2-overexpressing cancers by evaluating PTEN expression, which is predictive of responsiveness or resistance to ErbB2 targeting agents such as trastuzumab. Low PTEN expression is predictive of a patient who will respond poorly to trastuzumab. | 04-24-2014 |
20140112918 | SYNERGISTIC PHARMACEUTICAL COMBINATION FOR THE TREATMENT OF SQUAMOUS CELL CARCINOMA OF HEAD AND NECK - The present invention relates to a pharmaceutical combination for use in the treatment of squamous cell carcinoma, comprising a CDK inhibitor selected from the compounds of formula (I); | 04-24-2014 |
20140112919 | INTERLEUKIN-10 ANTIBODIES - The methods and compositions provided herein relate generally to IL-10 specific antibodies and uses thereof. More specifically, compositions of humanized IL-10 specific antibodies and methods to use such antibodies in modulating the biological activity of IL-10, particularly in autoimmune disorders and pathogen-mediated immunopathology. | 04-24-2014 |
20140112920 | METHODS USING 3-(4-AMINO-1-OXO-1,3-DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE FOR TREATMENT OF CERTAIN LEUKEMIAS - Methods of treating, preventing or managing leukemias are disclosed. The methods encompass the administration of an immunomodulatory compound of the invention known as Revlimid® or lenalidomide. The invention further relates to methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods of the invention are also disclosed. | 04-24-2014 |
20140120082 | MODULATION OF NKG2D - The present invention relates to methods and compositions for treating and/or preventing autoimmune and/or inflammatory disease. In particular, the present invention provides therapeutics for impairing the expansion and function of autoreactive T cells, NK cells and/or NKT cells, by modulating NKG2D. | 05-01-2014 |
20140120083 | TREATMENT OF CANCERS USING PI3 KINASE ISOFORM MODULATORS - Provided herein are methods, kits, and pharmaceutical compositions that include a PI3 kinase inhibitor for treating cancers or hematologic disorders. | 05-01-2014 |
20140120084 | METHODS OF ADMINISTERING BETA7 INTEGRIN ANTAGONISTS - Methods of treating gastrointestinal inflammatory disorders such as inflammatory bowel diseases including ulcerative colitis and Crohn's disease are provided. Also provided are methods of administering integrin beta7 antagonists, such as anti-beta7 antibodies. In addition, particular dosing regimens, including dosing regimens comprising subcutaneous administration and administration using self-inject devices are provided. | 05-01-2014 |
20140120085 | Identification of Surface-Associated Antigens for Tumor Diagnosis and Therapy - An isolated truncated desmoglein 4 (DSG4) polypeptide splice variant of the invention is characterized by an amino acid sequence that lacks a region encoded before exon 9 or beyond exon 10 of the DSG4 gene having the polynucleotide sequence of SEQ ID NO: 75. Also disclosed is a method of diagnosing a cancer, or monitoring the course thereof, in a patient. The method comprises detecting in a tissue sample of a patient the expression of a tumor-associated antigen comprising the extracellular domain of a DSG4 polypeptide encoded by a DSG4 gene having the polynucleotide sequence of SEQ ID NO: 75, or a truncated DSG4 polypeptide splice variant characterized by an amino acid sequence that lacks a region encoded before exon 9 or beyond exon 10 of the DSG4 gene. | 05-01-2014 |
20140120086 | METHOD FOR PREPARATION OF A HIGH CONCENTRATION LIQUID FORMULATION OF AN ANTIBODY - The present invention provides a method for preparation of a high concentration liquid formulation (HCLF) of an antibody or a fragment thereof. The present invention also relates to a method for stabilizing an anti-CD20 antibody or a fragment thereof in a liquid pharmaceutical formulation. Furthermore, the present invention relates to a liquid pharmaceutical formulation of a veltuzumab antibody or a fragment thereof comprising at least 155 mg/mL of a veltuzumab antibody or a fragment thereof. | 05-01-2014 |
20140120087 | TRIAZOLOPYRIDINES - The present invention relates to triazolopyridine compounds of general formula (I): in which R | 05-01-2014 |
20140120088 | AGENTS FOR THE TREATMENT OF TUMORS - The invention relates to the treatment of patients with a brain tumor or neoplastic meningitis, by the use of an agonist of the TLR9 receptor in combination with an anti-angiogenic product. | 05-01-2014 |
20140120089 | ANTIBODIES TO INSULIN-LIKE GROWTH FACTOR I RECEPTOR - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to insulin-like growth factor I receptor (IGF-IR), which is preferably human IGF-IR. The invention also relates to human anti-IGF-IR antibodies, including chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulin molecules derived from anti-IGF-IR antibodies and nucleic acid molecules encoding such molecules. The present invention also relates to methods of making anti-IGF-IR antibodies, pharmaceutical compositions comprising these antibodies and methods of using the antibodies and compositions thereof for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-IGF-IR antibodies. The invention also relates to gene therapy methods and transgenic animals comprising nucleic acid molecules of the present invention. | 05-01-2014 |
20140127190 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF SYSTEMIC INFLAMMATORY RESPONSE SYNDROMES - Described herein are peptides from secretory phospholipase A | 05-08-2014 |
20140127191 | ANTI-ABETA GLOBULOMER ANTIBODIES, ANTIGEN-BINDING MOIETIES THEREOF, CORRESPONDING HYBRIDOMAS, NUCLEIC ACIDS, VECTORS, HOST CELLS, METHODS OF PRODUCING SAID ANTIBODIES, COMPOSITIONS COMPRISING SAID ANTIBODIES, USES OF SAID ANTIBODIES AND METHODS OF USING SAID ANTIBODIES - Anti-Aβ globulomer antibodies, antigen-binding moieties thereof, corresponding hybridomas, nucleic acids, vectors, host cells, methods of producing said antibodies, compositions comprising said antibodies, uses of said antibodies and methods of using said antibodies. | 05-08-2014 |
20140127192 | METHOD FOR TREATING OSTEOPOROSIS - The invention is directed to a method for increasing bone mineral density (BMD) in a postmenopausal woman. The method comprises administering to a postmenopausal woman having a lumbar vertebrae T-score of less than or equal to −2 an anti-sclerostin antibody in an amount and for a time effective to increase lumbar vertebrae BMD at least about 9% from pretreatment baseline at twelve months following initial anti-sclerostin antibody administration. The invention also is directed to a method for treating osteoporosis. The method comprising administering to a postmenopausal woman with osteoporosis an anti-sclerostin antibody in an amount of about 70 mg to about 210 mg at once a month, optionally for about three to about 18 months. Alternatively, the method comprises administering an anti-sclerostin antibody in an amount of about 140 mg to about 210 mg every three months, optionally about six to about 18 months. | 05-08-2014 |
20140127193 | METHODS OF DEVELOPING A PROGNOSIS FOR PANCREATIC CANCER AND PREDICTING RESPONSIVENESS TO CANCER THERAPEUTICS - Methods of predicting responsiveness of a cancer in a subject to a cancer therapy including a VEGF targeting agent are provided herein. The methods include detecting the expression level of at least one biomarker selected from ANG-2, SDF-1 and VEGF-D in a sample from the subject and using the expression levels to determine whether the VEGF targeting agent will be effective to treat the cancer in the subject. The predictions may be used to develop treatment plans for the subjects. Methods of developing a prognosis for a subject with pancreatic cancer are also provided. These methods include determining the expression level of IGFBP-1, PDGF-AA and at least one of IL-6 or CRP in a sample from a subject with pancreatic cancer. | 05-08-2014 |
20140127194 | COMBINED PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF TUMORS - The invention relates to the use deuterium depleted water (DDW) for the preparation of combined pharmaceutical compositions for the prevention or treatment of tumorous diseases, where the composition comprises DDW with deuterium content of 0.01 to 135 ppm and one or more antineoplastic agent(s), optionally together with one or more usual pharmaceutical auxiliary material(s). Further, the invention relates to pharmaceutical compositions for adjuvant treatment of tumorous diseases, where the composition comprises DDW with deuterium content of 0.01 to 135 ppm and one or more antineoplastic agent(s), optionally together with one or more usual pharmaceutical auxiliary material(s). The invention also relates to aqueous pharmaceutical compositions usually applied in curing where the aqueous component is DDW with deuterium content of 0.01 to 135 ppm. | 05-08-2014 |
20140127195 | METHODS OF TREATING CENTRAL NERVOUS SYSTEM ISCHEMIC OR HEMORRHAGIC INJURY USING ANTI ALPHA4 INTEGRIN ANTAGONISTS - Methods of, and compositions for, treating central nervous system injury with an antagonist of an alpha4 subunit containing integrin are described. | 05-08-2014 |
20140127196 | Anti-Complement C1s Antibodies and Uses Thereof - The present disclosure provides antibodies that bind complement C1s protein; and nucleic acid molecules that encode such antibodies. The present disclosure also provides compositions comprising such antibodies, and methods to produce and use such antibodies, nucleic acid molecules, and compositions. | 05-08-2014 |
20140134157 | ANTIBODIES TO OPGL - Antibodies that interact with osteoprotegerin ligand (OPGL) are described. Methods of treating osteopenic disorders by administering a pharmaceutically effective amount of antibodies to OPGL are described. Methods of detecting the amount of OPGL in a sample using antibodies to OPGL are described. | 05-15-2014 |
20140134158 | KRAS MUTATIONS AND RESISTANCE TO ANTI-EGFR TREATMENT - The disclosure provides compositions and methods for detecting and predicting acquired resistance to anti-EGFR treatment in colorectal cancers. Also provided are compositions and methods of preventing, reversing or delaying the acquired resistance. The present disclosure also provides kits for use in the methods described herein. | 05-15-2014 |
20140134159 | METHODS OF TREATING NEUROENDOCRINE TUMORS USING FRIZZLED-BINDING AGENTS - Novel methods of treating neuroendocrine tumors are provided. In one embodiment, the method comprises administering to a subject in need thereof a therapeutically effective dose of a Wnt antagonist. In one embodiment, the Wnt antagonist is an anti-FZD antibody. In another embodiment, the Wnt antagonist is a soluble FZD receptor polypeptide. In a further embodiment, the Wnt antagonist is an anti-Wnt antibody. | 05-15-2014 |
20140134160 | GEMCITABINE PRODRUGS AND USES THEREOF - The present invention provides compounds according to formula I: | 05-15-2014 |
20140134161 | EGFR TARGETED THERAPY - The present invention relates to compositions and methods for treatment of neurological disorders. In particular, the present invention relates to EGFR as a clinical target for treatment of neurological disorders. | 05-15-2014 |
20140134162 | Methods for the Treatment of Disease Using Immunoglobulins Having Fc Regions with Altered Affinities for FcgammaRactivating and FcgammaRinhibiting - The present invention relates to methods of treating or preventing cancer and other diseases using molecules, particularly polypeptides, more particularly immunoglobulins (e.g., antibodies), comprising a variant Fc region, wherein said variant Fc region comprises at least one amino acid modification relative to a wild-type Fc region, which variant Fc region binds an FcγR that activates a cellular effector (“FcγR | 05-15-2014 |
20140134163 | COMBINATION THERAPY WITH MDM2 AND EFGR INHIBITORS - Provided is a method of treating a proliferative disease, condition, or disorder in a subject by administering a combination of an inhibitor of p53 and MDM2 binding and an EGFR inhibitor. Various embodiments of the disclosed methods provide a synergistic anti-proliferative or anti-apoptotic effect compared to administration of one agent alone. | 05-15-2014 |
20140134164 | TREATMENT OF MULTIPLE SCLEROSIS - The present invention concerns treatment of autoimmune diseases with antagonists which bind to B cell surface markers, such as CD19 or CD20. | 05-15-2014 |
20140134165 | Identification of Tumor-Associated Markers for Diagnosis and Therapy - The present technology relates to genetic products the expression of which is associated with cancer diseases. The present technology also relates to the therapy and diagnosis of diseases in which the genetic products are expressed or aberrantly expressed, in particular cancer diseases. | 05-15-2014 |
20140134166 | HYPOXIA-RELATED GENE SIGNATURES FOR CANCER CLASSIFICATION - Biomarkers, particularly hypoxia-related genes, and methods using the biomarkers for molecular detection and classification of disease are provided. | 05-15-2014 |
20140140988 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH A MDM2 INHIBITOR - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with a MDM2 inhibitor for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and a MDM2 inhibitor. | 05-22-2014 |
20140140989 | Non-Platelet Depleting and Non-Red Blood Cell Depleting CD47 Antibodies and Methods of Use Thereof - This invention relates generally to monoclonal antibodies that recognize CD47, more specifically to CD47 antibodies that do not cause a significant level of agglutination of cells, red blood cell depletion, amenia, and/or platelet depletion, to methods of generating these antibodies, and to methods of using these monoclonal antibodies as therapeutics. | 05-22-2014 |
20140140990 | ANTIBODIES AGAINST KIDNEY ASSOCIATED ANTIGEN 1 AND ANTIGEN BINDING FRAGMENTS THEREOF - Novel antibodies and antigen binding fragments that specifically bind to KAAG1 and which may be used in the treatment, detection and diagnosis of cancer comprising KAAG1-expressing cells are disclosed herein. Cells expressing the antibodies and antigen binding fragments as well as methods of detecting and treating cancer using the antibodies and fragments are also disclosed. Cancer indications which may benefit from such treatment or detection include ovarian cancer, renal cancer, lung cancer, colorectal cancer, breast cancer, brain cancer, and prostate cancer, as well as melanomas. | 05-22-2014 |
20140140991 | METHODS OF TREATING A DISEASE OR DISORDER ASSOCIATED WITH BRUTON'S TYROSINE KINASE - The present invention provides methods of treating, stabilizing or lessening the severity or progression of a disease or disorder associated with BTK. | 05-22-2014 |
20140140992 | Sustained Release Formulations for Delivery of Proteins to the Eye and Methods of Preparing Same - The present invention provides for injectable pharmaceutical sustained release formulations for delivery of active agents, particularly therapeutic proteins, to the eye. The formulations are biocompatible, biodegradable sustained release formulations comprising low-solubility liquid excipients and relatively small amounts (less than about 10%) of biocompatible, biodegradable polymer such as PLA or PLGA polymers. A unit dose of 5 μL to 100 μL of the formulation provides for sustained release of the agent for at least 14 days. | 05-22-2014 |
20140140993 | COMBINATIONS OF AN ANTI-HER2 ANTIBODY-DRUG CONJUGATE AND CHEMOTHERAPEUTIC AGENTS, AND METHODS OF USE - Combinations of the antibody-drug conjugate trastuzumab-MCC-DM1 and chemotherapeutic agents, including stereoisomers, geometric isomers, tautomers, solvates, metabolites and pharmaceutically acceptable salts thereof, are useful for inhibiting tumor cell growth, and for treating disorders such as cancer mediated by HER2 and KDR (VEGFR receptor 1). Methods of using such combinations for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions, are disclosed. | 05-22-2014 |
20140147435 | NOGO-A Neutralizing Immunoglobulins for the Treatment of Neurological Diseases - The present invention relates to antibodies to NOGO, pharmaceutical formulations containing them and to the use of such antibodies in the treatment and/or prophylaxis of neurological diseases/disorders. | 05-29-2014 |
20140147436 | POLYPEPTIDE VARIANTS WITH ALTERED EFFECTOR FUNCTION - The present invention concerns polypeptides comprising a variant Fc region. More particularly, the present invention concerns Fc region-containing polypeptides that have altered effector function as a consequence of one or more amino acid modifications in the Fc region thereof. | 05-29-2014 |
20140147437 | METHODS TO ENHANCE CELL-MEDIATED IMMUNITY - This disclosure provides a method for enhancing cell-mediated immunity in individuals with disorders such as cancer or infection that involves administering an inhibitor of GOLPH2 to the individuals. For example, inhibition of GOLPH2 increases the endogenous production of IL-12. | 05-29-2014 |
20140147438 | METHODS OF TREATING VASOMOTOR SYMPTOMS USING ANTIBODIES - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 05-29-2014 |
20140147439 | ANTI-NERVE GROWTH FACTOR ANTIBODIES AND METHODS OF PREPARING AND USING THE SAME - A method of preparing an antibody suitable for use in a feline is provided. Also provided are chimeric and felinised antibodies which specifically bind to feline neuronal growth factor (NGF) and neutralise the ability of feline NGF to bind to the p75 or TrkA feline NGF receptor. The invention extends to nucleic acids encoding same and to methods of treating pain and arthritis in a feline using said antibodies and/or nucleic acids. | 05-29-2014 |
20140147440 | USES OF NANOG INHIBITORS AND RELATED METHODS - The present invention relates to substances and compositions thereof useful in the control of cancer stem cell persistence and concomitant tumor recurrence and/or control of tumor growth. In particular, the invention relates to substances and compositions useful in the treatment of cancers and/or tumors linked to cancer stem cells, preferably brain cancers and/or tumors, in a subject. | 05-29-2014 |
20140154239 | Anti-interferon alpha monoclonal antibodies and methods for use - The present invention includes compositions and methods that include antibodies that selectively neutralize a bioactivity of at least two interferon alpha (“IFNα”) protein subtypes for the protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA, but does not neutralize at least one bioactivity of IFNα protein subtype D. Examples of bioactivity for measurement include activation of the MxA promoter or antiviral activity and variants, derivatives and fragments thereof. The invention also includes host cells, hybridomas and plasmacytomas that produce antibodies. Because of their unique selectivity and affinity, the antibodies of the present invention are useful to detect IFNα subtypes in sample or tissue and/or for therapeutic applications that include, but are not limited to the treatment and/or amelioration of an IFNα related disorder such as SLE, lupus, type I diabetes, psoriasis, AIDS and Graft versus Host Disease. | 06-05-2014 |
20140154240 | PYRAZOLO[1,5-A]PYRIMIDINES FOR ANTIVIRAL TREATMENT - The invention provides compounds of Formula I or Formula II: | 06-05-2014 |
20140154241 | BINDING PEPTIDES I - A modified igNAR peptide sequence derived from a wild-type igNAR peptide sequence is diversified by mutating the amino acid sequence at 50% or more of the amino acids in the CDR3 loop region and optionally at 50% or more of the amino acids in the CDR3 loop region. The modified igNAR peptide may have the sequence of SEQ ID NO: 8, 10 or 50 to 85. The modified igNAR peptides have binding activity against albumin protein sequences, such as human serum albumin. These modified igNAR peptides may have utility in extending the in vivo half-life of biological molecules e.g. therapeutic agents, and so may be used in medicine. | 06-05-2014 |
20140154242 | IMMUNOGLOBULIN VARIANTS AND USES THEREOF - The invention provides humanized and chimeric anti-CD20 antibodies for treatment of CD20 positive malignancies and autoimmune diseases. | 06-05-2014 |
20140154243 | SPECIFIC BINDING AGENTS TO HEPATOCYTE GROWTH FACTOR - Specific binding agents that interact with hepatocyte growth factor (HGF) are described. Methods of treating cancer by administering a pharmaceutically effective amount of a specific binding agent to HGF are described. Methods of detecting the amount of HGF in a sample using a specific binding agent to HGF are described. | 06-05-2014 |
20140154244 | Methods of Treating Primary Brain Tumors by Administering Letrozole - The present disclosure relates to the field of cancer treatment, and more specifically to the field of treatment of primary malignant brain tumors. Provided herein are methods of treating primary brain tumors, including gliomas, by administering to a patient in need thereof a therapeutically effective amount of the aromatase inhibitor letrozole. | 06-05-2014 |
20140154245 | HUMANIZED ANTI-EMAP II ANTIBODY AND USE THEREOF - The present invention provides a humanized anti-EMAP II antibody, the use of the humanized antibody, and pharmaceutical compositions containing the humanized antibody. The humanized anti-EMAP II antibody shows reduced immunogenicity and increased half-life while having similar or improved antigen binding capacity compared to the parent monoclonal antibody. Thus, the humanized anti-EMAP II antibody of the present invention can be more effectively used as a diagnostic reagent for EMAP II and a therapeutic agent for diseases that are mediated by EMAP II. | 06-05-2014 |
20140154246 | CAI-BASED SYSTEMS AND METHODS FOR THE LOCALIZED TREATMENT OF OCULAR AND OTHER DISEASES - The subject invention provides CAI compounds and formulations thereof, and methods for their use in the localized treatment of non-life threatening diseases. Formulations of CAI compounds of the subject invention include CAI free base and CAI prodrug microcrystallines, microparticles, emulsions, and the like. The subject invention further provides methods for treating non-life threatening diseases using the CAI compounds of the invention (i.e., novel delivery systems and combination therapies), that are effective and are associated with little or no adverse side effects. | 06-05-2014 |
20140161793 | GLYCOCONJUGATES AND THEIR USE AS POTENTIAL VACCINES AGAINST INFECTION BY SHIGELLA FLEXNERI - A conjugate molecule comprising an oligo- or polysaccharide covalently bound to a carrier and its use as potential vaccine against infection by | 06-12-2014 |
20140161794 | ANTI-VLA-4 ANTIBODIES - This invention relates to alpha-4 binding antibodies, and fragments thereof. | 06-12-2014 |
20140161795 | METHOD FOR TREATING A DISEASE CHARACTERIZED BY INCREASED APPETITE - Insl5 has been found to be orexigenic, i.e. it increases appetite. Insl5, or a derivative or fragment thereof that retains the ability to bind to the GPR100 receptor, or an Insl5 antibody, are useful in therapy, in particular to treat anorexia nervosa, bulimia, cachexia or wasting disease. | 06-12-2014 |
20140161796 | SINGLE CHAIN PROTEINS WITH C-TERMINAL MODIFICATIONS - The invention pertains to an isolated V | 06-12-2014 |
20140161797 | Injectable Non-Aqueous Suspension - The present invention relates generally to compositions and methods for administering a biologically active agent, and more specifically to injectable non-aqueous suspensions. | 06-12-2014 |
20140161798 | ANTI-PCSK9 AND METHODS FOR TREATING LIPID AND CHOLESTEROL DISORDERS - The present invention provides compositions and methods for treating disorders of cholesterol and lipid metabolism by administration of an anti-PCSK9 antibody or a peptide inhibitor of PCSK9. | 06-12-2014 |
20140161799 | Therapeutic CD47 Antibodies - Provided are monoclonal antibodies and antigen-binding fragments thereof that bind to, and inhibit the activity of, CD47, as well as monoclonal antibodies and antigen binding fragments thereof that compete with the former for binding to CD47. Also provided are combinations of any of the foregoing. Such antibody compounds are variously effective in 1) treating tissue ischemia and ischemia-reperfusion injury (IRI) in the setting of organ preservation and transplantation, pulmonary hypertension, sickle cell disease, myocardial infarction, stroke, and other instances of surgery and/or trauma in which IRI is a component of pathogenesis; 2) in treating autoimmune and inflammatory diseases; and 3) as anti-cancer agents that are toxic to susceptible cancer cells, promoting their phagocytic uptake and clearance, or directly killing such cells. | 06-12-2014 |
20140161800 | Prostate-Specific Membrane Antigen Binding Proteins and Related Compositions and Methods - The present invention relates to mono-specific and multi-specific polypeptide therapeutics that specifically target cells expressing prostate-specific membrane antigen (PSMA) and are useful for the treatment of prostate cancer (e.g., castrate-resistant prostate cancer), tumor-related angiogenesis or benign prostatic hyperplasia (BPH). In one embodiment, the multi-specific polypeptide therapeutics bind both PSMA-expressing cells and the T-cell receptor complex on T cells to induce target-dependent T-cell cytotoxicity, activation and proliferation. | 06-12-2014 |
20140161801 | QUINAZOLINE DERIVATIVE AS TYROSINE-KINASE INHIBITOR, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF - The invention relates to a quinazoline derivative represented by the general formula (I), a pharmaceutical acceptable salt and a stereoisomer thereof as tyrosine kinase inhibitor, wherein R | 06-12-2014 |
20140161802 | SELECTIVE ELIMINATION OF EROSIVE CELLS - The current invention relates to the treatment of diseases characterized by cartilage destruction and/or bone erosion. In particular the present invention relates to the treatment of osteoarthritis, osteoporosis, psoriatic arthritis or rheumatic arthritis with an anti-NKG2A antibody. | 06-12-2014 |
20140161803 | CONSTITUTIVELY ACTIVE UPAR VARIANTS AND THEIR USE FOR THE GENERATION AND ISOLATION OF INHIBITORY ANTIBODIES - The invention relates to variants of the urokinase plasminogen activator receptor (uPAR) that display remarkably increased vitronectin (VN) binding activity, possibly caused by a more efficient exposure of the VN binding site. The present invention also refers to antibodies raised against said uPAR variants, able to bind to the VN binding site of uPAR and then acting as inhibitors of uPAR functions, acting as functional antagonists of VN activated-uPAR functions. In the present invention such antibodies are monoclonal, polyclonal, synthetic or recombinant derivatives thereof, as synthetic antibodies (scFv) from phage-display libraries. Antibodies of the invention act as competitive antagonists. | 06-12-2014 |
20140170135 | EGFR EXPRESSION IS ASSOCIATED WITH DECREASED BENEFIT FROM TRASTUZUMAB IN THE NCCTG N9831 TRIAL - The subject invention provides a method for treating a patient having a tumor associated with HER2+ breast cancer comprising: measuring in a sample of the patient's tumor a level of expression of epidermal growth factor receptor protein by using an antibody that detects the cytoplasmic domain of epidermal growth factor receptor; and comparing the level of expression of epidermal growth factor receptor protein in the patient's tumor so measured with a reference value; wherein if the level of expression of epidermal growth factor receptor measured is higher than the reference value, treating the patient with a therapy other than trastuzumab. | 06-19-2014 |
20140170136 | ANTI-NERVE GROWTH FACTOR ANTIBODIES AND METHODS OF PREPARING AND USING THE SAME - A method of preparing an antibody suitable for use in an equine is provided. Also provided are equinised antibodies which specifically bind to equine neuronal growth factor (NGF) and neutralise the ability of equine NGF to bind to the p75 or TrkA equine NGF receptor. The invention extends to nucleic acids encoding same and to methods of treating pain and arthritis in an equine using said antibodies and/or nucleic acids. | 06-19-2014 |
20140170137 | THERAPEUTIC CANINE IMMUNOGLOBULINS AND METHODS OF USING SAME - A method of preparing a canine antibody suitable for use in the therapeutic treatment of a canine is provided. In particular, there is provided immunoglobulins which can be selected for the characteristic of whether they mediate downstream complement mediated immune activation when bound to a target antigen. Canine derived antibodies comprising specific heavy chain isotypes are provided. The invention extends to the use of the immunoglobulins of the invention in methods of treating conditions such as pain, inflammatory conditions and cancerous conditions in a canine. | 06-19-2014 |
20140170138 | HUMANIZED ANTIBODIES SPECIFIC FOR HSP65-DERIVED PEPTIDE-6, METHODS AND USES THEREOF - The present invention relates to humanized antibodies that specifically bind a polypeptide comprising peptide-6 as denoted by SEQ ID NO. 15, that is an HSP65 derived peptide. More specifically, the invention relates to humanized anti-peptide-6 antibodies, compositions, methods and uses thereof for the treatment of immune-related disorders, specifically, inflammatory disorders such as arthritis, IBD, psoriasis, diabetes and MS. The invention further provides combined compositions and kit combining the humanized antibodies of the invention and at least one anti-inflammatory agent, as well as uses of the humanized antibodies in diagnostic kits and methods. | 06-19-2014 |
20140170139 | HYPOXIA-RELATED GENE SIGNATURES FOR CANCER CLASSIFICATION - Biomarkers, particularly hypoxia-related genes, and methods using the biomarkers for molecular detection and classification of disease are provided. | 06-19-2014 |
20140178363 | VEGF-SPECIFIC ANTAGONISTS FOR ADJUVANT AND NEOADJUVANT THERAPY AND THE TREATMENT OF EARLY STAGE TUMORS - Disclosed herein are methods of treating benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating a subject at risk of developing benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating or preventing recurrence of a tumor using an anti-VEGF-specific antagonist as well as use of VEGF-specific antagonists in neoadjuvant and adjuvant cancer therapy. | 06-26-2014 |
20140178364 | COMPOSITIONS AND METHODS FOR TARGETING TYPE 1 INTERFERON PRODUCING CELLS - The present disclosure provides a method for treating lupus, Sjörgen's syndrome or scleroderma, the method comprising administering to the mammal an immunoglobulin which binds an interleukin 3 receptor α (IL-3Rα) chain and which depletes or at least partly eliminates plasmacytoid dendritic cells (p DCs) and basophils to which it binds. | 06-26-2014 |
20140178365 | GLYCAN-INTERACTING COMPOUNDS - The present invention provides glycan-interacting antibodies useful in the treatment and prevention of human disease, including cancer. Such glycan-interacting antibodies include monoclonal antibodies, derivatives and fragments thereof as well as compositions and kits comprising them. | 06-26-2014 |
20140178366 | PRESELECTION OF SUBJECTS FOR THERAPEUTIC TREATMENT BASED ON HYPOXIC STATUS - The present invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of hypoxia in cancerous cells in the subject. In one embodiment, the invention provides methods for the preselection of a subject for therapeutic treatment with an agent based on modulated levels of lactate dehydrogenase (LDH) in a cell, e.g., a cancerous cell. The invention also provides methods for treating cancer in a subject by administering an effective amount of an agent to the subject, wherein the subject has been selected based on a modulated level of hypoxia. The invention further provides kits to practice the methods of the invention. | 06-26-2014 |
20140178367 | Methods of Treating Inflammatory Diseases by Targeting the Chemoattractant Cytokine Receptor 2 (CCR2) or Chemokine (C-C motif) Ligand 2 (CCL2) - Methods of treating inflammatory diseases, e.g., diseases associated with inflammatory CD14+/CD16− monocytes, e.g., amyotrophic lateral sclerosis (ALS), stroke, and glaucoma, using compounds such as small molecules and antibodies that target CCR2 or CCL2. | 06-26-2014 |
20140178368 | COMBINATIONS OF ANTI-4-1BB ANTIBODIES AND ADCC-INDUCING ANTIBODIES FOR THE TREATMENT OF CANCER - Methods for treating cancer in a patient in need thereof, with a therapeutically effective amount of an anti-4-1BB antibody in combination with a therapeutically effective amount of an ADCC-inducing antibody, are disclosed. | 06-26-2014 |
20140178369 | TREATMENT WITH ANTI-VEGF ANTIBODIES - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents. | 06-26-2014 |
20140178370 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF PERSISTENT INFECTIONS AND CANCER BY INHIBITING THE PROGRAMMED CELL DEATH 1 (PD-1) PATHWAY - The present invention provides methods and compositions for the treatment, prevention, or reduction of persistent infections, such as chronic infections, latent infections, and slow infections and cancer. The methods and compositions of the invention are also useful for the alleviation of one or more symptoms associated with such infections and cancer. | 06-26-2014 |
20140178371 | ANTI-ANGIOGENESIS THERAPY FOR THE TREATMENT OF OVARIAN CANCER - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents for the treatment of ovarian cancer. | 06-26-2014 |
20140178372 | METHODS OF TREATING HEMATOLOGIC CANCERS - The present application relates to treatment of hematologic cancers, which treatments can include, e.g., administration of a purine nucleoside phosphorylase (PNP) inhibitor, an alkylating agent and/or an anti-CD20 agent, and related compositions and kits. | 06-26-2014 |
20140178373 | PHARMACEUTICAL COMPOSITION FOR TREATMENT AND/OR PROPHYLAXIS OF CANCER - An object of the present invention is to prepare an antibody that targets CAPRIN-1 specifically expressed on the surface of cancer cells and is superior in antitumor activity to conventional antibodies and to provide use of the antibody as a therapeutic and/or preventive agent for cancer. The present invention provides use of an antibody targeting an identified cancer antigenic protein specifically expressed on the surface of cancer cells as a therapeutic and/or preventive agent for cancer, specifically, a pharmaceutical composition for treatment and/or prevention of cancer, comprising as an active ingredient an antibody or a fragment thereof which has immunological reactivity with a CAPRIN-1 protein, the antibody or the fragment thereof comprising a heavy chain variable region comprising amino acid sequences represented by SEQ ID NOs: 5, 6, and 7 and a light chain variable region comprising amino acid sequences represented by SEQ ID NOs: 9, 10, and 11. | 06-26-2014 |
20140178374 | BAX AGONIST, COMPOSITIONS, AND METHODS RELATED THERETO - The disclosure relates to BAX activators and therapeutic uses relates thereto. In certain embodiments, the disclosure relates to methods of treating or preventing cancer, such as lung cancer, comprising administering a therapeutically effective amount of a pharmaceutical composition comprising a compound disclosed herein or pharmaceutically acceptable salt to a subject in need thereof. | 06-26-2014 |
20140186336 | METHODS OF TREATING PTERYGIUM - Methods for treating pterygium recurrence following pterygiectomy, and for treating keloid recurrence, following surgical removal of the keloid, are disclosed. The methods include administering an anti-VEGF agent (e.g., antibody (e.g., bevacizumab) or small molecule inhibitor of VEGF signaling), or a combination therapy that includes co-administering an anti-VEGF agent, with an anti-inflammatory steroid and/or a non-steroidal anti-inflammatory drug (NSAID) to a subject. | 07-03-2014 |
20140186337 | Antitumors Combinations Containing Antibodies Recognizing Specifically CD38 And Bortezomib - Pharmaceutical composition comprising an antibody specifically recognizing CD38 and bortezomib. | 07-03-2014 |
20140186338 | Genetic Products Differentially Expressed In Tumors And The Use Thereof - The present technology relates to the identification of genetic products expressed in association with tumors and to coding nucleic acids for the expressed products. An embodiment of the present technology also relates to the therapy and diagnosis of disease in which the genetic products are aberrantly expressed in association with tumors, proteins, polypeptides and peptides which are expressed in association with tumors, and to the nucleic acids coding for the polypeptides, peptides and proteins. | 07-03-2014 |
20140186339 | COMPOSITIONS AND METHODS FOR TREATING OCULAR DISEASES AND CONDITIONS - The present invention relates to compositions and methods for prevention and treatment of ocular diseases and conditions, particularly glaucoma and ocular hypertension. The compositions and methods of the invention utilize immune-derived moieties that are specifically reactive against the bioactive lipid, sphingosine-1-phosphate, and its variants, which moieties are capable of decreasing the effective concentration of bioactive lipid being targeted. In one embodiment, the immune-derived moiety is a humanized monoclonal antibody that is reactive against sphingosine-1-phosphate. | 07-03-2014 |
20140186340 | Methods and Compositions for Normalization of Tumor Vasculature by Inhibition of LOXL2 - Disclosed herein are methods and compositions for increasing perfusion, reducing hypoxia, reducing permeability and increasing the integrity of vasculature; e.g., in a tumor. The compositions include inhibitors of the LOXL2 enzyme. In certain of the methods, a LOXL2 inhibitor is used in combination with, and facilitates the therapeutic activity of, an anti-neoplastic agent. | 07-03-2014 |
20140186341 | METHODS FOR IMPROVING DRUG EFFICACY - The present disclosure provides methods for improving drug efficacy in a patient having an obstructed airway in a lung. Such methods modulate nerve activity in the autonomic nervous system of a patient to reduce obstruction of an airway in a lung of the patient prior to administering a drug to the patient. These methods are especially useful in improving efficacies of bronchodilators in treating obstructive lung diseases, such as chronic obstructive pulmonary disease. | 07-03-2014 |
20140186342 | Compositions and Methods for Diagnosing and Treating Cancer - An isolated antibody that specifically binds to an extracellular domain of human DDR2 and has a therapeutic effect on a solid tumor is described. Also described is a method of treating cancer, the method comprising administering to a patient having a solid tumor an antibody of the present disclosure in a therapeutically effective amount. | 07-03-2014 |
20140186343 | COMPOSITION COMPRISING ANTIBODY THAT BINDS TO DOMAIN II OF HER2 AND ACIDIC VARIANTS THEREOF - A composition comprising a main species HER2 antibody that binds to domain II of HER2 and acidic variants thereof is described. Pharmaceutical formulations comprising the composition, and therapeutic uses for the composition are also disclosed. | 07-03-2014 |
20140186344 | ROLES FOR DUAL ENDOTHELIN-1/ANGIOTENSIN II RECEPTOR (DEAR) IN HYPERTENSION AND ANGIOGENESIS - The present application is directed to the identification of mutations and/or polymorphisms in the Dual Endothelin-1/Angiotensin II Receptor (Dear) that indicate susceptibility to, or show current affliction with, hypertension. Additionally, the present invention discloses methods for the modulation of angiogenesis via the regulation of Dear. | 07-03-2014 |
20140186345 | METHOD OF ADMINISTERING AN ANTIBODY - Disclosed is a method for treating a human having a disease associated with leukocyte infiltration of mucosal tissues, comprising administering to said human an effective amount of a human or humanized immunoglobulin or antigen-binding fragment thereof having binding specificity for α4β7 integrin. Preferably, no more than about 8 mg immunoglobulin or fragment per kg body weight are administered during a period of about one month. | 07-03-2014 |
20140186346 | METHODS OF TREATING PAIN USING AN IL-31RA OR OSMR-B ANTAGONIST - Use of antagonists to IL-31Ra and OSMRb are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include soluble receptors, antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 07-03-2014 |
20140186347 | EXTENDING TIME TO DISEASE PROGRESSION OR SURVIVAL IN CANCER PATIENTS - The present application describes extending time to disease progression or survival in a cancer patient, where the patient's cancer displays HER activation, by treating the patient with a HER dimerization inhibitor, such as pertuzumab. | 07-03-2014 |
20140186348 | HUMANIZED AND CHIMERIC ANTI-PROPERDIN ANTIBODIES - An isolated anti-properdin antibody or antigen binding portion thereof includes a heavy chain variable domain including the 3CDRs in SEQ ID NO: 1 and light chain variable domain including the 3CDRS in SEQ ID NO: 9. | 07-03-2014 |
20140186349 | HUMAN CDR-GRAFTED ANTIBODY AND ANTIBODY FRAGMENT THEREOF - A human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of human CC chemokine receptor 4 (CCR4) but does not react with a human blood platelet; a human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of CCR4 and has a cytotoxic activity against a CCR4-expressing cell; and a medicament, a therapeutic agent or a diagnostic agent comprising at least one of the antibodies and the antibody fragments thereof as an active ingredient. | 07-03-2014 |
20140193397 | METHOD TO IDENTIFY A PATIENT WITH AN INCREASED LIKELIHOOD OF RESPONDING TO AN ANTI-CANCER THERAPY - The invention provides methods for identifying patient who may benefit from treatment with an anti-cancer therapy comprising a VEGF antagonist. The invention also provides methods for monitoring a patients' response to the anti-cancer therapy. The invention also provides kits and articles of manufacture for use in the methods. | 07-10-2014 |
20140193398 | POLYMALIC ACID-BASED NANOBIOPOLYMER COMPOSITIONS - Nanobiopolymeric conjugates based on biodegradable, non-toxic and non-immunogenic poly (β-L-malic acid) PMLA covalently linked to molecular modules that include morpholino antisense oligonucleotides (AONa), an siRNA or an antibody specific for an oncogenic protein in a cancer cell, and an antibody specific for a transferrin receptor protein, are provided. Methods for treating a cancer in subject with nanobiopolymeric conjugates are described. | 07-10-2014 |
20140193399 | Anti-CD3 Antibodies And Methods Of Use Thereof - The present invention is related to antibodies directed to the antigen CD3 and uses of such antibodies. In particular, the present invention provides fully human monoclonal antibodies directed to CD3. Nucleotide sequences encoding, and amino acid sequences comprising, heavy and light chain immunoglobulin molecules, particularly sequences corresponding to contiguous heavy and light chain sequences spanning the framework regions and/or complementarity determining regions (CDR's), specifically from FR1 through FR4 or CDR1 through CDR3, are provided. Hybridomas or other cell lines expressing such immunoglobulin molecules and monoclonal antibodies are also provided. | 07-10-2014 |
20140193400 | STABLE AND SOLUBLE ANTIBODIES INHIBITING TNF ALPHA - The present invention relates to particularly stable and soluble scFv antibodies and Fab fragments specific for TNF, which comprise specific light chain and heavy chain sequences that are optimized for stability, solubility, in vitro and in vivo binding of TNF, and low immunogenicity. Said antibodies are designed for the diagnosis and/or treatment of TNF-mediated disorders. The nucleic acids, vectors and host cells for expression of the recombinant antibodies of the invention, methods for isolating them and the use of said antibodies in medicine are also disclosed. | 07-10-2014 |
20140193401 | PERTUSSIS ANTIBODIES AND USES THEREOF - Compositions and methods are provided that are useful to treat respiratory diseases such as whooping cough. Further, compositions and methods of immunizing are provided. | 07-10-2014 |
20140193402 | ANTI-PDGFR-beta ANTIBODIES AND USES THEREOF - The present invention provides antibodies that bind to platelet derived growth factor receptor beta (PDGFR-beta) and methods of using the same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human PDGFR-beta with high affinity. The antibodies of the invention are useful for the treatment of diseases and disorders associated with PDGFR-beta signaling and/or PDGFR-beta cellular expression, such as ocular diseases, fibrotic diseases, vascular diseases and cancer. | 07-10-2014 |
20140193403 | Epitopes of IL-17A and IL-17F and Antibodies Specific Thereto - The present invention relates neutralising epitopes of IL-17A and IL-17F and antibodies which bind those epitopes. The present invention also relates to the therapeutic uses of the antibody molecules and methods for producing them. | 07-10-2014 |
20140193404 | GLYCOSYLATED ANTIBODIES - The invention provides an antibody comprising human IgG1 or IgG3 heavy chain constant domains that are glycosylated with a sugar chain at Asn297, said antibody being characterized in that the amount of fucose within said sugar chain is at least 99%, and in addition the amount of NGNA is 1% or less and/or the amount of N-terminal alpha 1,3 galactose is 1% or less, and uses thereof. | 07-10-2014 |
20140193405 | HUMANIZED ANTI-CD40 ANTIBODIES - Provided are humanized anti-CD40 antibodies and antigen-binding fragments and methods for treating disease characterized by expression of CD40 antigen. | 07-10-2014 |
20140193406 | METHODS USED IN IDENTIFYING GLIOBLASTOMA - The invention encompasses methods and kits used in the identification of invasive glioblastoma based upon the expression of Akt1, Akt2, and Akt3. The methods and kits also allow prediction of disease outcome and staging of patients with regard to therapy. | 07-10-2014 |
20140199291 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF PROGRESSIVE MULTIFOCAL LEUKOENCEPHALOPATHY (PML) - The invention relates to compositions, methods, and kits for treating subjects infected by or at risk of infection with a DNA virus (e.g., a JC Virus or a BK virus). Aspects of the invention are useful to prevent or treat DNA virus associated conditions (e.g., PML) in subjects that are immunocompromised. Compositions are provided that inhibit intracellular replication of DNA viruses. | 07-17-2014 |
20140199292 | COMPOSITIONS AND METHODS FOR INHIBITING TUMOR DEVELOPMENT CAUSED BY CHEMOTHERAPY INDUCED SENESCENCE - The present invention relates to products and compositions containing (i) a chemotherapeutic agent and (ii) at least an active compound chosen from CCL2 inhibitors, CCR2 inhibitors, NF-κB inhibitors, PARP-1 inhibitors and ATM inhibitors, as a combined preparation for simultaneous, separate or sequential use for inhibiting tumor development caused by tumor cell senescence induced by said chemotherapeutic agent. The invention also refers to a method for monitoring the response to a chemotherapeutic agent of a patient suffering from a cancer, and to a method for predicting the tumor size evolution and/or the onset of metastasis in a patient suffering from a cancer. | 07-17-2014 |
20140199293 | HUMANIZED ANTIBODY COMPOSITIONS AND METHODS FOR BINDING LYSOPHOSPHATIDIC ACID - Compositions and methods for making and using humanized anti-LPA monoclonal antibodies, and fragments and derivatives thereof, are described. | 07-17-2014 |
20140199294 | HETERODIMERIZED POLYPEPTIDE - The present inventors produced a heterodimerized polypeptide having an Fc region formed from two polypeptides with different amino acid sequences (a first polypeptide and a second polypeptide), and succeeded in producing a heterodimerized polypeptide containing an Fc region with improved Fc region function compared to that of a homodimer in which the Fc region is composed of only the first polypeptide or only the second polypeptide by conventional technology. | 07-17-2014 |
20140199295 | TECHNIQUES FOR PREDICTING, DETECTING AND REDUCING ASPECIFIC PROTEIN INTERFERENCE IN ASSAYS INVOLVING IMMUNOGLOBULIN SINGLE VARIABLE DOMAINS - This invention provides, and in certain specific but non-limiting aspects relates to: assays that can be used to predict whether a given ISV will be subject to protein interference as described herein and/or give rise to an (aspecific) signal in such an assay (such as for example in an ADA immunoassay). Such predictive assays could for example be used to test whether a given ISV could have a tendency to give rise to such protein interference and/or such a signal; to select ISV's that are not or less prone to such protein interference or to giving such a signal; as an assay or test that can be used to test whether certain modification(s) to an ISV will (fully or partially) reduce its tendency to give rise to such interference or such a signal; and/or as an assay or test that can be used to guide modification or improvement of an ISV so as to reduce its tendency to give rise to such protein interference or signal; —methods for modifying and/or improving ISV's to as to remove or reduce their tendency to give rise to such protein interference or such a signal; —modifications that can be introduced into an ISV that remove or reduce its tendency to give rise to such protein interference or such a signal; ISV's that have been specifically selected (for example, using the assay(s) described herein) to have no or low(er)/reduced tendency to give rise to such protein interference or such a signal; modified and/or improved ISV's that have no or a low(er)/reduced tendency to give rise to such protein interference or such a signal. | 07-17-2014 |
20140199296 | Cancer Drug and Uses - A pharmaceutical composition comprising a cancer therapeutic that is capable of inhibiting and/or reducing the ability of a cancer cell to take up and utilize glucose or other energy source, a lipid or other building block of a cell membrane or organelle, and/or cholesterol. The pharmaceutical composition can comprise one or more cancer therapeutics that can be administered individually or in combination to an individual. | 07-17-2014 |
20140199297 | TRITERPENE GLYCOSIDE AND TRITERPENE COMPOSITIONS AND METHODS OF USING SAME - In the present invention, different strategies are used to improve the bioavailability of triterpene glycosides and triterpenes including, for example, (a) a covalent approach involving modification with polyethylene glycol and (b) a formulation approach involving non-covalent encapsulation in antibody targeted pol(DL-lactic acid) nanoparticles. | 07-17-2014 |
20140199298 | COMBINATION TREATMENT OF CANCER COMPRISING EGFR/HER2 INHIBITORS - The invention relates to a therapy of cancer comprising co-administration to a person in need of such treatment and/or co-treatment of a person in need of such treatment with effective amounts of:
| 07-17-2014 |
20140199299 | Combination Therapies and Methods Using Anti-CD3 Modulating Agents and Anti-IL-6 Antagonists - This invention relates generally to compositions that contain multiple modulating agents, e.g., multiple modulating agents that target CD3 on T cells and neutralize one or more biological activities of interleukin-6 (IL-6), such as CD3 modulators including anti-CD3 antibodies and anti-IL-6 antagonists including anti-IL-6 antibodies, anti-IL-6R antagonists including anti-IL-6R antibodies, and/or anti-IL-6/IL-6R complex antagonists including anti-IL-6/IL-6R binding antibodies, and methods of using these compositions in the treatment, amelioration and/or prevention of relapse of an autoimmune disease. | 07-17-2014 |
20140199300 | COMBINATION THERAPY FOR THE TREATMENT OF CD19+ B-CELL MALIGNANCIES SYMPTOMS COMPRISING AN ANTI-CD1 MAYTANSINOID IMMUNOCONJUGATE AND RITUZIMAB - A combination of an anti-CD19 maytansinoid immunoconjugate and rituximab is used for treating CD19+CD20+ B-cell malignancies symptom, in particular Non-Hodgkin's lymphoma. | 07-17-2014 |
20140205593 | MONOVALENT ANTIBODY FRAGMENTS USEFUL AS THERAPEUTICS - The invention provides methods and compositions comprising a novel stabilized monovalent antibody fragment. | 07-24-2014 |
20140205594 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 07-24-2014 |
20140205595 | COMPOUNDS AND METHODS OF PROPHYLAXIS AND TREATMENT REGARDING NICOTINIC RECEPTOR ANTAGONISTS - It is an object of the present invention that the novel nicotinic receptor antagonists disclosed herein may be used in a broad array of clinical or medicinal facets. For example, it is a contemplated use of the present invention that the novel nicotinic receptor antagonists be used to inhibit the growth cycle of non-small cell lung cancer cells. Without being bound by theory, it is an object of the present invention that the nicotinic receptor antagonists disclosed herein are believed to possess reversible binding properties. Moreover, the compounds of the present invention are selective for 0.7 nAChR. For example, the compounds of the present invention are not believed to bind to 0.4 (32 nAChR neuromuscular receptors. It is also contemplated that the nicotinic receptor antagonists of the present invention will be used as a counter measure to treat exposure, or potential exposure, to a wide array of potential neurotoxins. | 07-24-2014 |
20140205596 | ORGANIC COMPOUNDS - The invention relates to compounds and methods of treatment relating to nicotinic receptor antagonists. For example, the compounds and methods of treatment function block the activity of certain acetylcholine receptors and subtypes therein, and are useful treating diseases and conditions mediated by nicotinic receptor stimulation, e.g., small cell lung cancer. | 07-24-2014 |
20140205597 | TECHNIQUES FOR PREDICTING, DETECTING AND REDUCING ASPECIFIC PROTEIN INTERFERENCE IN ASSAYS INVOLVING IMMUNOGLOBULIN SINGLE VARIABLE DOMAINS - This invention provides, and in certain specific but non-limiting aspects relates to: assays that can be used to predict whether a given ISV will be subject to protein interference as described herein and/or give rise to an (aspecific) signal in such an assay (such as for example in an ADA immunoassay). Such predictive assays could for example be used to test whether a given ISV could have a tendency to give rise to such protein interference and/or such a signal; to select ISV's that are not or less prone to such protein interference or to giving such a signal; as an assay or test that can be used to test whether certain modification(s) to an ISV will (fully or partially) reduce its tendency to give rise to such interference or such a signal; and/or as an assay or test that can be used to guide modification or improvement of an ISV so as to reduce its tendency to give rise to such protein interference or signal; methods for modifying and/or improving ISV's to as to remove or reduce their tendency to give rise to such protein interference or such a signal; modifications that can be introduced into an ISV that remove or reduce its tendency to give rise to such protein interference or such a signal; ISV's that have been specifically selected (for example, using the assay(s) described herein) to have no or low(er)/reduced tendency to give rise to such protein interference or such a signal; modified and/or improved ISV's that have no or a low(er)/reduced tendency to give rise to such protein interference or such a signal. | 07-24-2014 |
20140205598 | Methods for Treating Disseminated Intravascular Coagulation by Inhibiting MASP-2 Dependent Complement Activation - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. In one embodiment, the invention provides methods of treating a subject suffering from a complement mediated coagulation disorder, such as disseminated intravascular coagulation. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 07-24-2014 |
20140212409 | METHOD FOR INCREASING DEPOSITION OF COMPLEMENT C3b ON BACTERIAL SURFACE AND PHAGOCYTOSIS BY PHAGOCYTE AND A THERAPEUTIC METHOD AND A THERAPEUTIC AGENT FOR BACTERIAL INFECTIONS - The present invention relates to a method for increasing deposition of complement C3b on the bacterial surface and phagocytosis by phagocytes, a therapeutic method and a therapeutic agent for bacterial infections, using an antibody binding to a molecule on the bacterial surface, in which the antibody is modified by substituting at least one amino acid residue with other amino acid so as to show more enhanced complement-dependent cytotoxicity (CDC) than the antibody before substitution of the amino acid residue. | 07-31-2014 |
20140212410 | CO-ADMINISTRATION OF ERIBULIN AND FARLETUZUMAB FOR THE TREATMENT OF BREAST CANCER - A method for transmission network control, the transmission network being configured for use in providing electricity from a generator to an end user, the method including receiving a sensitivity parameter, identifying a switchable set of switches within the transmission network using the sensitivity parameter, determining a candidate switch from the switchable set to change a corresponding state, wherein the state can be changed from open to closed and closed to open, determining a proposed change of state of the candidate switch, updating an optimal power flow (OPF) problem as a function of the candidate switch and the proposed change of state, determining and storing in a memory a solution to the updated OPF problem, generating an updated sensitivity parameter based on the stored solution to the updated OPF problem, and determining, using the updated sensitivity parameter, if the stored solution to the updated OPF problem meets a predetermined criterion. | 07-31-2014 |
20140212411 | METHODS OF TREATMENT USING ANTI-ERBB ANTIBODY-MAYTANSINOID CONJUGATES - The application concerns methods of treatment using anti-ErbB receptor antibody-maytansinoid conjugates, and articles of manufacture suitable for use in such methods. In particular, the invention concerns ErbB receptor-directed cancer therapies, using anti-ErbB receptor antibody-maytansinoid conjugates. | 07-31-2014 |
20140212412 | USE OF IL-33 ANTAGONISTS TO TREAT FIBROTIC DISEASE - Methods for treating fibrotic disease, such as idiopathic pulmonary fibrosis and scleroderma, with antagonists of IL-33 are disclosed. | 07-31-2014 |
20140212413 | Methods of Treating TNF-alpha-Mediated Diseases Using Chimeric TNF-alpha Antibodies - Anti-TNF antibodies, fragments and regions thereof which are specific for human tumor necrosis factor-α (TNFα) and are useful in vivo diagnosis and therapy of a number of TNFα-mediated pathologies and conditions, as well as polynucleotides coding for murine and chimeric antibodies, methods of producing the antibody, methods of use of the anti-TNF antibody, or fragment, region or derivative thereof, in immunoassays and immunotherapeutic approaches are provided. | 07-31-2014 |
20140212414 | COMBINATION THERAPY USING P53 ACTIVATOR AND C-MET INHIBITOR - A method of preventing and/or treating a cancer comprising co-administering a p53 activator and a c-Met inhibitor to a patient in need thereof. | 07-31-2014 |
20140212415 | HYPOXIA-RELATED GENE SIGNATURES FOR CANCER CLASSIFICATION - Biomarkers, particularly hypoxia-related genes, and methods using the biomarkers for molecular classification of disease are provided. | 07-31-2014 |
20140212416 | Manipulation of Immunoglobulin Gene Diversity and Multi-Antibody Therapeutics - The invention provides improved non-human vertebrates and non-vertebrate cells capable of expressing antibodies comprising human variable region sequences. The present invention is directed to the provision of long HCDR3s from non-human vertebrates and cells. The present invention is also directed to the provision of novel V, D and J pairings in immunoglobulin heavy and light chain loci. Novel, biased antibody diversities and potentially expanded diversities are provided. The invention also provides for novel and potentially expanded diversity or diversity that is biased towards variable gene usage common to antibodies useful for treating and/or preventing certain diseases or conditions, such as infectious diseases. The invention also provides methods of generating antibodies using such vertebrates, as well as the antibodies per se, therapeutic compositions thereof and uses. | 07-31-2014 |
20140212417 | PROLONGED INHIBITION OF INTERLEUKIN-6 MEDIATED SIGNALING - Polypeptides are provided directed against IL-6R at specific dose ranges and dosing schedules that result in a prolonged effect on IL-6 mediated signaling. In particular, the invention provides pharmacologically active agents, compositions, methods and/or dosing schedules that have certain advantages compared to the agents, compositions, methods and/or dosing schedules that are currently used and/or known in the art, including the ability to dose less frequently or to administer lower doses to obtain equivalent effects in inhibiting IL-6 mediated signaling. | 07-31-2014 |
20140219999 | TREATMENT OF COLON CANCER USING COMPLEMENT INHIBITORS - Methods for treating, preventing or delaying onset of polyp formation and subsequent colon cancer are disclosed. The methods involve administration of a complement inhibitor to inhibit C5a receptor signaling in the tumorigenic or pre-tumorigenic tissue. | 08-07-2014 |
20140220000 | MHC ENGAGEMENT AND CLIP MODULATION FOR THE TREATMENT OF DISEASE - The invention relates to methods for treating disorders by targeting CLIP molecules and MHC. The methods are useful for treating, inhibiting the development of, or otherwise dealing with diseases such as HIV, blood vessel proliferative disorder, cancer and fibrosis. | 08-07-2014 |
20140220001 | Methods and Monitoring of Treatment with a DLL4 Antagonist - Methods for treating diseases such as cancer comprising administering a DLL4 antagonist, either alone or in combination with other anti-cancer agents, and monitoring for cardiovascular side effects and/or toxicity. | 08-07-2014 |
20140220002 | COMBINATION THERAPIES EMPLOYING GITR BINDING MOLECULES - The present invention provides combination therapies that employ a GITR binding molecule in combination with one or more additional agents. | 08-07-2014 |
20140220003 | THERAPEUTIC METHOD FOR MESOTHELIOMA - The present invention relates to a therapeutic method and a diagnostic method using an antibody that binds to a ganglioside GM2 antigen, and a therapeutic agent and a diagnostic agent comprising as an active ingredient an antibody that binds to a ganglioside GM2 antigen. According to the present invention, the prognosis of GM2 positive mesothelioma patients can be improved by diagnosing and treating GM2 positive mesothelioma patients with a diagnostic agent and a therapeutic agent that comprise an anti-ganglioside GM2 antibody as an active ingredient. | 08-07-2014 |
20140220004 | COMPOSITIONS AND METHODS FOR TREATING PAIN - Provided herein are compositions containing an antibody or antigen-binding antibody fragment that specifically binds to metallothionein 2 (MT2) protein, and compositions containing an agent that binds to or neutralizes a function of MT2 protein and/or an oligonucleotide that decreases the expression of MT2 mRNA in a mammalian cell, and optionally, one or more anti-inflammatory agents and/or analgesics. Also provided are methods of decreasing pain in a mammal that include administering to the mammal an agent that binds to or neutralizes a function of MT2 protein and/or an oligonucleotide that decreases the expression of MT2 mRNA in a mammalian cell, in an amount sufficient to decrease the level of extracellular MT2 protein or neutralize a function of extracellular MT2 protein in the mammal, thereby decreasing pain in the mammal. | 08-07-2014 |
20140220005 | N-Cadherin: Target for Cancer Diagnosis and Therapy - The present invention provides methods of diagnosis, providing a prognosis and a therapeutic target for the treatment of cancers that express N-cadherin, including prostrate and bladder cancers. | 08-07-2014 |
20140220006 | LUNG CANCER BIOMARKERS - The present invention relates to methods of diagnosing lung cancer in a patient, as well as methods of monitoring the progression of lung cancer and/or methods of monitoring a treatment protocol of a therapeutic agent or a therapeutic regimen. The invention also relates to assay methods used in connection with the diagnostic methods described herein. | 08-07-2014 |
20140220007 | LUPUS BIOMARKERS - The present invention relates to methods of diagnosing lupus in a patient, as well as methods of monitoring the progression of lupus and/or methods of monitoring a treatment protocol of a therapeutic agent or a therapeutic regimen. The invention also relates to assay methods used in connection with the diagnostic methods described herein. | 08-07-2014 |
20140220008 | Humanized Anti-CD4 Antibody With Immunosuppressive Properties - A humanized antibody derived from mouse monoclonal anti-CD4 antibody B-F5 is able to activate CD25+CD4+ regulatory T cells and is useful for preparing immunosuppressive compositions. | 08-07-2014 |
20140220009 | Compositions and Methods for Treating Cocaine-Related Disorders - A method of treating a cocaine-related disorder in an individual is provided, the method including administering to the individual a therapeutic amount of an antibody comprising a human immunoglobulin gamma heavy chain and a murine lambda light chain. In a specific embodiment, the antibody is a monoclonal antibody comprising a murine lambda light chain variable region, a human gamma heavy chain variable region, and a human kappa or lambda light chain constant region. | 08-07-2014 |
20140220010 | VARIANTS OF HUMANIZED IMMUNOMODULATORY MONOCLONAL ANTIBODIES - The present invention relates to humanized monoclonal antibodies, pharmaceutical compositions that include the same, and use thereof for the treatment of a variety of indications, particularly cancer and immunodeficiency disorders. In particular, the present invention provides modified antibodies or fragments thereof having specific amino acid modifications compared to the humanized monoclonal immunomodulatory antibody termed hBAT-1. | 08-07-2014 |
20140234295 | ISOFLAVONOID COMPOUNDS AND METHODS FOR THE TREATMENT OF CANCER - Provided herein is a pharmaceutical composition comprising at least one isoflavonoid. Also provided herein are methods of treating cancer, sensitizing cancer cells, and inducing apoptosis in cancer cells by administering such compositions. | 08-21-2014 |
20140234296 | STABLE FORMULATIONS OF ANTIBODIES TO HUMAN PROGRAMMED DEATH RECEPTOR PD-1 AND RELATED TREATMENTS - The present invention relates to stable formulations of antibodies against human programmed death receptor PD-1, or antigen binding fragments thereof. The present invention further provides methods for treating various cancers and chronic infections with stable formulations of antibodies against human programmed death receptor PD-1, or antigen binding fragments thereof. | 08-21-2014 |
20140234297 | ANTIBODY CONSTANT DOMAIN REGIONS AND USES THEREOF - The invention provides recombinant protein (e.g., a recombinant antibody or soluble receptor) having (i) a binding domain capable of specific binding to an epitope (for example an antibody variable domains, a receptor, a growth factor, a cytokine, or a fragment of any of the foregoing which is capable of specifically binding the desired epitope) and (ii) an effector domain comprising a constant domain region which is derived from immunoglobulin of a first species which is a companion mammal, e.g. dog, cat, or horse, having engineered substitutions at one or more positions and having an altered interaction with one or more FcRs or other ligands, and optionally enhanced effector function, relative to the parent constant domain region. | 08-21-2014 |
20140234298 | THERAPEUTIC COMBINATIONS OF ANTI-CD20 AND ANTI-GM-CSF ANTIBODIES AND USES THEREOF - The present disclosure describes a pharmaceutical combination of an anti-CD20 antibody and an anti-GM-CSF antibody. Said combinations are highly efficacious in the treatment of B cell malignancies and inflammatory disorders. | 08-21-2014 |
20140234299 | THERAPIES FOR CHRONIC RENAL FAILURE USING ONE OR MORE INTEGRIN ANTAGONISTS - The present invention provides methods for the treatment, and pharmaceuticals for use in the treatment, of mammalian subjects in, or at risk of chronic renal failure, or at risk of a need for renal replacement therapy. The methods involve the administration of certain integrin antagonists. | 08-21-2014 |
20140234300 | METHOD OF MODULATING THE ACTIVITY OF FUNCTIONAL IMMUNE MOLECULES - The invention relates to a method for controlling the activity of an immunologically functional molecule, such as an antibody, a protein, a peptide or the like, an agent of promoting the activity of an immunologically functional molecule, and an immunologically functional molecule having the promoted activity. | 08-21-2014 |
20140234301 | Modulation of PILR to Treat Immune Disorders - The present invention provides methods of using PILRα agonists, or PILRβ antagonists, to treat immune disorders, such as autoimmune and inflammatory disorders, including CNS, joint and gut inflammation. | 08-21-2014 |
20140234302 | Methods and Compositions for Reducing Amyloid Beta Levels - The present invention provides methods for reducing the level of amyloid beta protein in a cell or tissue, the methods generally involving contacting the cell or tissue with an agent that reduces cystatin C levels and/or activity. The present invention provides methods for treating Alzheimer's disease (AD), and methods for treating cerebral angiopathy, in an individual, the methods generally involving administering to an individual having AD a therapeutically effective amount of an agent that reduces cystatin C levels and/or activity. The present invention further provides methods for identifying an agent that reduces cystatin C levels and/or activity. | 08-21-2014 |
20140234303 | TREATMENT OF NEUROLOGICAL CONDITIONS - The present invention is directed to a method for treating an inflammatory neurodegenerative condition of the CNS in a subject comprising administering to said subject a G-CSF or G-CSFR inhibiting agent selected from the group consisting of an antibody specific for G-CSF, a soluble G-CSFR or a G-CSF-binding portion thereof and a 20 to 30 nucleotide sense or antisense molecule targeted to a nucleic acid molecule encoding G-CSF. | 08-21-2014 |
20140234304 | HUMAN TISSUE FACTOR ANTIBODY AND USES THEREOF - The invention relates to a humanized form of an antibody capable of preventing tissue factor (coagulation factor F3) signaling but which does not interfere with Factor VII binding or FX binding to tissue factor and does not prolong coagulation time. The antibody of the invention is useful in treating conditions, such as tumor progression, in which the associated cells express tissue factor and tissue factor signaling occurs. | 08-21-2014 |
20140234305 | METHODS OF TREATMENT USING BEVACIZUMAB - Methods for treating pterygium recurrence following pterygiectomy, and for treating keloid recurrence, following surgical removal of the keloid, are disclosed. The methods include administering an anti-VEGF agent (e.g., antibody (e.g., bevacizumab) or small molecule inhibitor of VEGF signaling), or a combination therapy that includes co-administering an anti-VEGF agent, with an anti-inflammatory steroid and/or a non-steroidal anti-inflammatory drug (NSAID) to a subject. | 08-21-2014 |
20140234306 | Agent and Method for Reducing Inflammatory Markers - A method for treating an autism spectrum condition includes administering an effective dose of a TNF-α inhibiting agent to a person having an autism spectrum condition or pervasive development disorder and at least one of elevated TNF-α in the cerebrospinal fluid or elevated TNF-α in the serum, as compared to normal conditions; and lowering at least one of the elevated TNF-α in the cerebrospinal fluid or elevated TNF-α in the serum. A TNF-α inhibiting agent includes at least one of Lenalinomide; Thalidomide; L-Carnosine; Infliximab; Etanercept; a stem cell preparation; derivatives thereof, isomers thereof, or pharmaceutically acceptable salts thereof. | 08-21-2014 |
20140234307 | METHOD OF TREATING MULTIPLE SCLEROSIS BY INTRATHECAL DEPLETION OF B CELLS AND BIOMARKERS TO SELECT PATIENTS WITH PROGRESSIVE MULTIPLE SCLEROSIS - Described herein are methods of treating multiple sclerosis (MS), such as secondary progressive MS (SPMS), by intrathecally administering a B cell depleting agent, such as rituximab, alone or in combination with intravenous administration of a B cell depleting agent. Also described is the use of IL-12p40, CXCL13, or both as CSF biomarkers for selecting a patient with progressive MS as a candidate for treatment with an intrathecal immunomodulatory therapy, and for identifying a progressive MS patient as having meningeal inflammation. The present disclosure also describes a method of evaluating the effectiveness of a therapy for treating progressive MS by measuring the level of IL-12p40, CXCL13, or both in the CSF of the patient before and after treatment. A decrease in the level of IL-12p40, CXCL13, or both after treatment indicates the therapy is effective for treating progressive MS. | 08-21-2014 |
20140234308 | TREATMENT OF BREAST CANCER WITH COMPANION DIAGNOSTIC - Despite advances in therapy, breast cancer remains the most common malignancy in women. Of particular concern is the aggressive triple negative subtype that lacks the BRCA1 mutation, estrogen receptor, and epidermal growth factor type 2 receptor (Her-2/neu), which accounts for approximately half of all breast cancer deaths. Provided herein are compositions and methods for treating breast cancer, including the triple negative subtype. | 08-21-2014 |
20140242069 | KRT19 Stabilizing HER2 and Use thereof - Provided is a method of decreasing the stability of HER2 (human epidermal growth factor receptor 2) in a cell or individual comprising administering an effective amount of an expression or activity inhibitor of KRT19 (cytokeratin 19) to the cell or individual. | 08-28-2014 |
20140242070 | FRIZZLED 2 AS A TARGET FOR THERAPEUTIC ANTIBODIES IN THE TREATMENT OF CANCER - Disclosed herein are methods of treating cancer in a subject, and methods for inhibiting growth, migration and/or invasion of a cancer cell in the subject, comprising administering to the subject a therapeutically effective amount of an antibody or antigen binding fragment thereof that downmodulates Fzd2. The antibody may specifically bind Fzd2, and may promote internalization of the Fzd2 receptor by the cancer cells and/or prevent ligand binding to Fzd2. Specific antibodies, and also specific portions of the Fzd2 molecule for antibody binding are disclosed. In one embodiment the antibody specifically binds to the epitope HGAEQICVGQNHSEDGAPAL (SEQ ID NO: 1). Specific cancers (e.g. late stage hepatocellular carcinoma), intended for treatment are provided, and include cancers that exhibit overexpression of Fzd2, and/or Wnt5a. | 08-28-2014 |
20140242071 | M-CSF SPECIFIC MONOCLONAL ANTIBODY AND USES THEREOF - M-CSF-specific RX1-based or RX-1 derived antibodies are provided, along with pharmaceutical compositions containing such antibody, kits containing a pharmaceutical composition, and methods of preventing and treating bone loss in a subject afflicted with an osteolytic disease. | 08-28-2014 |
20140242072 | ANTI-ICAM-1 ANTIBODIES TO TREAT MULTIPLE-MYELOMA RELATED DISORDERS - The invention relates to the use of an antibody or an antigen-binding fragment thereof with binding specificity for ICAM-1, or a variant, fusion or derivative of said antibody or an antigen-binding fragment with binding specificity for ICAM-1, for the treatment of a multiple-myeloma-related disorder. The invention also relates to methods for the administration of such antibodies, fragments, variants, fusion and derivatives thereof. | 08-28-2014 |
20140248262 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH A SELECTIVE BCL-2 INHIBITOR - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and a selective Bcl-2 inhibitor for the treatment of a patient suffering from cancer, particularly, a CD20-expressing cancer. | 09-04-2014 |
20140248263 | BISPHENOL COMPOUNDS AND METHODS FOR THEIR USE - Compounds having a structure of Formula I: wherein G, a, Q, L | 09-04-2014 |
20140248264 | SMALL MOLECULE TRAIL GENE INDUCTION BY NORMAL AND TUMOR CELLS AS AN ANTICANCER THERAPY - Methods and compositions relating to TIC10 are described according to aspects of the present invention. The compositions and methods have utility in treating disease, particularly cancer in a subject in need thereof, including a human subject as well as subjects of other species. The compositions have utility in treating brain cancer in a subject in need thereof. | 09-04-2014 |
20140248265 | THERAPEUTIC ANTIBODIES BINDING IL 12RBETA1 - The present invention relates to antibodies that specifically bind to IL12Rβ1, the non-signal transducing chain of the heterodimeric IL12 receptor (together with IL12Rβ2 chain) as well as IL23 receptor (together with IL23Rα chain). The invention more specifically relates to specific antibodies that are IL12 and IL23 receptor antagonists capable of inhibiting IL12/IL18 induced IFNy production of T cells and compositions and methods of use for said antibodies to treat pathological disorders that can be treated by inhibiting IFNy production, such as rheumatoid arthritis, psoriasis or inflammatory bowel diseases or other autoimmune and inflammatory disorders. | 09-04-2014 |
20140248266 | ANTI-CD40 ANTIBODY MUTANTS - A mutant of a potentially therapeutic anti-CD40 antibody is provided which mutant has reduced ADCC and CDC activities designed to be optimized as a pharmaceutical agent. A mutant of an agonistic anti-CD40 antibody, comprising mutation and/or substitution of at least one amino acid in the constant region to reduce the ADCC and/or CDC activities therein, and a mutant of an antagonistic anti-CD40 antibody, comprising at least one mutation or substitution in the constant region to reduce the ADCC and/or CDC activities therein, both mutants having at least a hinge region derived from a human IgG2. | 09-04-2014 |
20140248267 | ANTI-CD33 ANTIBODIES AND METHODS FOR TREATMENT OF ACUTE MYELOID LEUKEMIA USING THE SAME - The present invention relates to antibodies that bind CD33. More particularly, the invention relates to anti-CD33 antibodies, fragments and homologues of these antibodies, humanized and resurfaced versions of these antibodies, functional equivalents and improved versions of these antibodies, immunoconjugates and compositions comprising these antibodies, and the uses of same in diagnostic, research and therapeutic applications. The invention also relates to a polynucleotide encoding these antibodies, vectors comprising the polynucleotides, host cells transformed with polynucleotides and methods of producing these antibodies. | 09-04-2014 |
20140248268 | Rab7 GTPase Inhibitors and Related Methods of Treatment - This invention relates to compounds and their use as inhibitors or activators of Rab7 GTPase to treat or prevent the onset of Rab 7 GTPase-associated disorders such as neuropathies, cancer, metabolic diseases of bone and lipid storage. The invention is also applicable to infectious diseases where Rab7 is inactivated or its protein-protein interactions are modulated to facilitate intracellular survival of pathogens. The compound described acts as a competitive inhibitor of nucleotide binding and as such also has utility as a scaffold for targeting other small GTPases. In one aspect, methods of treatment of the invention are used to treat or prevent the onset of hereditary sensory neuropathies such as Charcot-Marie-Tooth type 2B disease. Related pharmaceutical compositions, assays, and drug screens are also provided. | 09-04-2014 |
20140255388 | TOLL LIKE RECEPTOR 3 ANTAGONISTS, METHODS AND USES - Toll Like Receptor 3 (TLR3) antagonists, polynucleotides encoding TLR3 antagonists or fragments, and methods of making and using the foregoing are disclosed. | 09-11-2014 |
20140255389 | POLYPEPTIDES AND POLYNUCLEOTIDES, AND USES THEREOF AS A DRUG TARGET FOR PRODUCING DRUGS AND BIOLOGICS - This invention relates to a novel target for production of immune and non-immune based therapeutics and for disease diagnosis. More particularly, the invention provides therapeutic antibodies against VSIG1, ILDR1, LOC253012, AI216611, C1ORF32 or FXYD3 antigens, which are predicted co-stimulatory family members and which are differentially expressed in cancers including, lung cancer, ovarian cancer, and colon cancer, and diagnostic and therapeutic usages. The use of these antibodies for modulating B7 costimulation and related therapies such as the treatment of autoimmunity are also provided. This invention further relates to the discovery of extracellular domains of VSIG1 and its variants, FXYD3 and its variants, ILDR1 and its variants, LOC253012 and its variants, AI216611 and its variants, and C1ORF32 and its variants which are suitable targets for immunotherapy, cancer therapy, and drug development. | 09-11-2014 |
20140255390 | Method of Treating Rheumatoid Arthritis With An Anti-IL-6R Antibody - The present invention provides methods of preventing or treating rheumatoid arthritis using a fully human antibody or antigen-binding fragment thereof that specifically binds human interleukin-6 receptor (hIL-6R). The methods of the present invention may include administration of a second therapeutic agent, such as one or more of a non-steroidal anti-inflammatory drug (NSAID), a glucocorticoid, a disease-modifying anti-rheumatic drug (DMARD), or a TNF-alpha antagonist, T-cell blocker, anti-CD20 antibody, an IL-1, JAK or IL-17 antagonist, or any combination thereof. | 09-11-2014 |
20140255391 | METHODS FOR THE TREATMENT OF IL-1BETA RELATED DISEASES - Disclosed are methods for the treatment and/or prevention of Type 2 diabetes, insulin resistance and disease states and conditions characterized by insulin resistance, obesity, hyperglycemia, hyperinsulinemia and Type 1 diabetes, comprising administering to a subject an effective amount of anti-IL-1β antibody or fragment thereof. | 09-11-2014 |
20140255392 | SUBSTITUTED IMIDAZOPYRIDINES AND INTERMEDIATES THEREOF - The present invention relates to substituted imidazopyridine compounds of general formula (I) in which R | 09-11-2014 |
20140255393 | COMPOSITIONS AND METHODS FOR AUTOIMMUNE DISEASE - Methods and compositions are described for categorizing and treating autoimmune disease, using single cell network profiling (SCNP), where activation levels of one or more activatable elements are determined in single cells, with or without modulation, to categorize or determine treatment for the autoimmune disease. | 09-11-2014 |
20140255394 | Method of Treating Colorectal Cancer - The present invention relates to the use of certain platinum compounds including [PtCl | 09-11-2014 |
20140255395 | COMPLEMENT INHIBITION FOR IMPROVED NERVE REGENERATION - The present invention relates to methods and medicaments used for treating conditions that require axonal regeneration, e.g. in mammals affected by injury or disease of the central or peripheral nervous system. The medicaments used in these methods facilitate axonal regeneration by inhibition of the complement system. Conditions requiring axonal regeneration that may be treated in accordance with the invention include physical injuries as well as neurodegenerative disorders of the peripheral or central nervous system. | 09-11-2014 |
20140255396 | MULTIPLE-VARIABLE DOSE REGIMEN FOR TREATING TNFALPHA-RELATED DISORDERS - Multiple-variable dose methods for treating TNFα-related disorders, including Crohn's disease and psoriasis, comprising administering TNFα inhibitors, including TNFα antibodies, are described. Multiple-variable dose methods include administration of a TNF-inhibitor in an induction or loading phase followed by administration of the agent in a maintenance or treatment phase, wherein the TNF-inhibitor is administered in a higher dosage during the induction phase. | 09-11-2014 |
20140255397 | METHODS AND COMPOSITIONS FOR MODULATION OF BLOOD-NEURAL BARRIER - Methods and compositions for modulating blood-neural barrier (BNB) for the treatment of CNS conditions such as edema, and for increased drug delivery efficacy across the BNB. The present invention further relates to improved tPA treatment of ischemic cerebrovascular and related diseases in combination with antagonism of the PDGF signaling pathway. The inventive method and composition is particularly suitable for conjunctive therapy of ischemic stroke using tPA and an anti-PDGF-C antagonist or an anti-PDGFR-α antagonist. | 09-11-2014 |
20140255398 | ANTIGEN-BINDING MOLECULE INDUCING IMMUNE RESPONSE TO TARGET ANTIGEN - The present inventors have discovered that in living organisms that have received an antigen-binding molecule containing an antigen-binding domain whose binding activity to an antigen changes depending on ion concentration conditions and containing an FcRn-binding domain having FcRn-binding activity in a neutral pH range, immune responses to the antigen are induced. Furthermore, the present inventors have discovered that in living organisms that have received an antigen-binding molecule containing an antigen-binding domain whose binding activity to an antigen changes depending on ion concentration conditions and containing an FcRn-binding domain having FcRn-binding activity in a neutral pH range, immune responses to the antigen are induced, and also the antigen-binding molecule has cytotoxicity or antiproliferative action against cancer cells, foreign biological species, or such that express the antigen to which the antigen-binding molecule binds. | 09-11-2014 |
20140255399 | SEPARATION METHOD FOR FUCOSYLATED ANTIBODIES - The present invention relates to a method for the separation of antibodies, specifically antibodies having different degrees of fucosylation. The method is based on binding affinity of antibodies to Fc receptors. The invention further relates to the use of Fc receptors for the separation of antibodies having different degrees of fucosylation. | 09-11-2014 |
20140271619 | CD20 CONFORMATIONAL ISOMERS AND METHODS OF USING - Described herein are methods of screening for compounds that bind to conformational isomers of CD20 polypeptides. Also described are antibodies that bind to conformational isomers of CD20 polypeptides. | 09-18-2014 |
20140271620 | MODIFIED HYALURONAN AND USES THEREOF IN CANCER TREATMENT - Uses of depolymerized hyaluronan (e.g., prepared by sonicating high molecular weight hyaluronan such as naturally-occurring hyaluronan) or anti-Hyal-2 antibody in cancer treatment. Also described herein are methods for preparing depolymerized and crosslinked hyaluronan by sonication and the hyaluronan composition thus obtained. | 09-18-2014 |
20140271621 | METHODS OF PROGNOSIS AND DIAGNOSIS OF PANCREATIC CANCER - Disclosed herein are methods of diagnosing pancreatic cancer in a patient by detecting the presence and/or amount of at least three biomarkers of pancreatic cancer in a sample from the patient. The methods and biomarkers may be used to develop an accurate prognosis for a patient having cancer or suspected of having pancreatic cancer, or to accurately diagnose a patient having, or suspected of having pancreatic cancer. The methods and biomarkers may be used to identify and/or classify a patient as a candidate for a cancer therapy. | 09-18-2014 |
20140271622 | METHODS OF CELL CULTURE - Polypeptide preparations having target levels of glycans, and methods of producing such polypeptide preparations using copper, are described. | 09-18-2014 |
20140271623 | MODULATION OF COMPLEMENT-DEPENDENT CYTOTOXICITY THROUGH MODIFICATIONS OF THE C-TERMINUS OF ANTIBODY HEAVY CHAINS - Antibody variants having decreased or increased ability to mediate CDC due to modifications at the C-terminus of their heavy chains are described. Methods of generating such antibodies, as well as nucleotide constructs and host cells suitable for the production of said antibodies are also described. | 09-18-2014 |
20140271624 | ANTI-NOTCH NRR ANTIBODIES AND METHODS USING SAME - The invention provides anti-Notch1 NRR antibodies, and compositions comprising and methods of using these antibodies. | 09-18-2014 |
20140271625 | METHODS FOR TREATING BLEEDING DISORDERS - Disclosed are methods for treating bleeding disorders, such as hemophilia, in subjects in need thereof by administering an antibody that specifically binds CD73. The methods reduce production of adenosine, increase platelet activation and/or enhance the level of coagulation on the platelet surface to reduce and/or stop bleeding. In some embodiments, the methods can further include co-administering Factor VIII to treat the bleeding disorder. | 09-18-2014 |
20140271626 | MUTATED ANTI-TNFa ANTIBODIES AND METHODS OF THEIR USE - The present invention is directed to modified antibodies, including anti-TNFα antibodies, in which C-terminal amino acids of heavy chain sequences are modified from a native sequence of proline-glycine-lysine (“PGK”) to one that includes a proline positioned between the glycine and lysine, resulting in a C-terminal sequence of proline-glycine-proline-lycine (“PGPK”). The invention further provides methods of producing and using such antibodies. | 09-18-2014 |
20140271627 | HUMANIZED, ANTI-N2 ANTIBODIES - The present invention encompasses humanized antibodies that specifically bind N2 peptide, methods for the preparation thereof and methods for the use thereof. | 09-18-2014 |
20140271628 | HUMANIZED, ANTI-N2 ANTIBODIES - The present invention encompasses humanized antibodies that specifically bind N2 peptide, methods for the preparation thereof and methods for the use thereof. | 09-18-2014 |
20140271629 | CHRDL-1 ANTIGEN BINDING PROTEINS AND METHODS OF TREATMENT - The present invention provides compositions and methods relating to or derived from antigen binding proteins to CHRDL-1. Human, humanized, and chimeric antibodies, as well as fragments and derivatives thereof are further contemplated. Other embodiments include nucleic acids encoding such antigen binding proteins, and fragments and derivatives thereof, as well as polypeptides, cells, methods of making and using antigen binding proteins, fragments and derivatives thereof. | 09-18-2014 |
20140271630 | RITUXIMAB INDUCTION THERAPY FOLLOWED BY GLATIRAMER ACETATE THERAPY - The present invention provides a method of treating a subject afflicted with a form of multiple sclerosis or presenting a clinically isolated syndrome comprising periodic administration of an amount of rituximab at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject, wherein the amounts are effective to treat the subject. The present invention also provides a method of treating a subject afflicted with an immune disease, comprising periodic administration of an amount of rituximab at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject wherein the amounts are effective to treat the subject, and wherein the immune disease is an autoimmune disease, an arthritic condition, a demyelinating disease, an inflammatory disease, multiple sclerosis, relapsing-remitting multiple sclerosis, diabetes mellitus, psoriasis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, or systemic lupus erythematosus. | 09-18-2014 |
20140271631 | ASSAY FOR PREDICTIVE BIOMARKERS - The present invention provides assays for detecting presence or quantity of multiple biomarkers in one biological sample. | 09-18-2014 |
20140271632 | METHODS FOR MODULATING PROTEIN GLYCOSYLATION PROFILES OF RECOMBINANT PROTEIN THERAPEUTICS USING MONOSACCHARIDES AND OLIGOSACCHARIDES - The present invention relates to the field of protein production, and in particular to methods and compositions for modulating glycosylation of proteins expressed in host cells. | 09-18-2014 |
20140271633 | MAMMALIAN CELL CULTURE PERFORMANCE THROUGH SURFACTANT SUPPLEMENTATION OF FEED MEDIA - The present invention provides methods for increasing cell culture performance through the use of chemically defined feed media (CDFM). In particular, the present invention provides methods for the use of surfactants as supplements to CDFM to allow for higher concentrations of media components and thereby result in increased cell culture performance. | 09-18-2014 |
20140271634 | COMBINATIONS OF A MEK INHIBITOR COMPOUND WITH AN HER3/EGFR INHIBITOR COMPOUND AND METHODS OF USE - The invention provides combinations comprising a MEK inhibitor (such as GDC-0973 or GDC-0623), or a pharmaceutically acceptable salt thereof and a HER3/EGFR inhibitor (such as MEHD7945A). The combinations are particularly useful for treating hyperproliferative disorders, such as cancer. | 09-18-2014 |
20140271635 | TREATMENT OF CANCER USING HUMANIZED ANTI-CD19 CHIMERIC ANTIGEN RECEPTOR - The invention provides compositions and methods for treating diseases associated with expression of CD19. The invention also relates to chimeric antigen receptor (CAR) specific to CD19, vectors encoding the same, and recombinant T cells comprising the CD19 CAR. The invention also includes methods of administering a genetically modified T cell expressing a CAR that comprises a CD19 binding domain. | 09-18-2014 |
20140271636 | FORMULATION OF AN ANTIBODY AND USE THEREOF - The present invention provides a method for preparation of a lyophilized formulation of an anti-CD 20 antibody as well as to a lyophilized formulation of an anti-CD 20 antibody, comprising an anti-CD 20 antibody and having a residual moisture content in the range of 1% to 10%. The present invention also relates to the reconstituted formulation obtained by the method described herein, the use of said antibody formulation as a medicament, the use of the lyophilized formulation for the preparation of a medicament and a method of treating a patient. | 09-18-2014 |
20140271637 | METHODS OF ADMINISTERING ANTI-TNFALPHA ANTIBODIES - Methods of treating disorders in which TNFα activity is detrimental via biweekly, subcutaneous administration of human antibodies, preferably recombinant human antibodies, that specifically bind to human tumor necrosis factor α (hTNFα) are disclosed. The antibody may be administered with or without methotrexate. These antibodies have high affinity for hTNFα (e.g., K | 09-18-2014 |
20140271638 | METHODS USING 3-(4-AMINO-1-OXO-1,3-DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE FOR TREATMENT OF MANTLE CELL LYMPHOMAS - Methods of treating, preventing or managing mantle cell lymphomas are disclosed. The methods encompass the administration of an immunomodulatory compound of the invention known as Revlimid® or lenalidomide. The invention further relates to methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods of the invention are also disclosed. | 09-18-2014 |
20140271639 | Semaphorin 7a Induced Lung Fibrogenesis Occurs in a CD-4-Dependent, Macrophage Dependent Manner - The present invention provides methods of treating a mammal diagnosed with, or at risk for developing, pathogenic fibrosis, particularly pulmonary fibrosis. The method of the invention comprises administering to the mammal a compound or composition which modulates a target, such as Cofilin-1 and/or Plexin C1. The method of the invention also comprises administering to the mammal a compound or composition which inhibits a lymphocyte that expresses Sema 7a. | 09-18-2014 |
20140286933 | STABLE IGG4 BASED BINDING AGENT FORMULATIONS - The present invention provides stable pharmaceutical antibody formulations, including liquid drug product formulations and lyophilized drug product formulations, comprising an IgG4 binding agent and a citrate buffer, wherein the pH of the formulation is at or below both pH 6 and the pI of the binding agent. The formulations can be used in the treatment of chronic bowel diseases or rheumatoid arthritis. | 09-25-2014 |
20140286934 | HUMANIZED ANTIBODIES THAT BIND TO CD19 AND THEIR USES - The present invention relates to humanized antibodies or fragments thereof that bind to human CD19. More specifically, the present invention relates to a humanized antibody or fragment thereof that binds to human CD19 comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 27, and/or a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 29; and/or comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 31 and/or a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32. | 09-25-2014 |
20140286935 | ANTIGEN BINDING PROTEINS - This application discloses antigen binding proteins that bind Lymphocyte Activation Gene 3 (LAG-3), and more particularly to antigen binding proteins that cause depletion of LAG-3+ activated T cells. | 09-25-2014 |
20140286936 | ANTI-HUMAN CXCR4 ANTIBODIES - The present invention provides novel antibodies to human CXCR4 with high affinity to the target and the ability to act potently as antagonists. The antibodies disclosed herein bind to a diverse range of epitopes. | 09-25-2014 |
20140286937 | ANTIBODIES BINDING TO AN INTRACELLULAR PRL-1 OR PRL-3 POLYPEPTIDE - We provide an antibody capable of binding to an intracellular PRL-I or PRL-3 polypeptide, in which the antibody is capable of binding to an epitope bound by antibody 269, antibody 223 or antibody 318. Such anti-PRL antibodies may be capable of binding to intracellular PRL-I or PRL-3. They may be suitable for use as therapies against cancer or metastasis thereof, or in clinical diagnosis to identify PRL-3 or PRL-I positive patients. | 09-25-2014 |
20140286938 | SPIROKETALS - The present invention relates to spiroketal compounds that are useful in methods of treating or preventing protozoal infections, parasitic infections, bacterial infections, cell proliferative disorders and anti inflammatory disorders. The spiroketal compounds are also useful as immunosuppressive agents, and also in methods of controlling pests. | 09-25-2014 |
20140286939 | TREATMENT OF TNFALPHA RELATED DISORDERS - Methods of treating TNFα-related disorders comprising administering TNFα inhibitors, including TNFα antibodies are described. | 09-25-2014 |
20140286940 | TREATMENT OF TNFALPHA RELATED DISORDERS - Methods of treating TNFα-related disorders comprising administering TNFα inhibitors, including TNFα antibodies are described. | 09-25-2014 |
20140286941 | TREATMENT OF TNFALPHA RELATED DISORDERS - Methods of treating TNFα-related disorders comprising administering TNFα inhibitors, including TNFα antibodies are described. | 09-25-2014 |
20140286942 | METHODS FOR TREATING CHRONIC OBSTRUCTIVE PULMONARY DISEASE - The present invention provides methods of treating a mammal having chronic obstructive pulmonary disease (COPD), independent of both smoking status and asthma status, with a therapeutically effective amount of an anti-IgE moiety. In accordance with the invention, COPD patients with an elevated serum IgE level may benefit from the treatment methods disclosed. In certain instances, the methods of the disclosure have been found to be useful for the treatment of COPD patients regardless of their skin test results and/or in vitro reactivity to a perennial aeroallergen. Anti-IgE moieties, in accordance with the invention, include but are not limited to any IgG antibody that selectively binds to a given mammal immunoglobulin E (e.g., human immunoglobulin E) such as humanized anti-IgE, humanized murine monoclonal antibody, and/or Omalizumab. | 09-25-2014 |
20140286943 | CYCLOPROPYL MODULATORS OF P2Y12 RECEPTOR - The present invention relates to new cyclopropyl modulators of P2Y12 receptor activity, pharmaceutical compositions thereof, and methods of use thereof. | 09-25-2014 |
20140286944 | Methods of Treating Cardiovascular Diseases and Predicting the Efficacy of Exercise Therapy - Methods of treating a subject having a cardiovascular disease, selecting a therapy for a subject having a cardiovascular disease, identifying a subject having a cardiovascular disease that will benefit or not benefit from exercise therapy, determining whether a subject having a cardiovascular disease should begin, continue, not begin, discontinue, or avoid exercise therapy, determining whether a subject having a cardiovascular disease should continue, discontinue, or avoid exercise therapy, reducing the risk of an adverse outcome (e.g., death) in a subject having a cardiovascular disease, and predicting the efficacy of exercise therapy in a subject having a cardiovascular disease. These methods include determining a level of soluble ST2 in a subject. | 09-25-2014 |
20140286945 | ENZYME INHIBITOR FOR CANCER TREATMENT - Disclosed herein is a new and improved therapy for the treatment of diseases including cancer, which comprises the step of altering cell membrane lipid composition by treating a cancer cell with an enzyme inhibitor which inhibits enzymes regulating the cholesterol biosynthetic pathway. The method may also be employed in combination with existing chemotherapeutic agents to combat the drug resistance and enhance the therapeutic efficacy of conventional therapy. | 09-25-2014 |
20140286946 | METHOD FOR PREPARING ANTIBODIES HAVING IMPROVED PROPERTIES - The present invention is directed to methods and compositions for the production of Fc-containing polypeptides having improved properties. | 09-25-2014 |
20140294805 | NOVEL COMPOUNDS AND COMPOSITIONS FOR THE INHIBITION OF NAMPT - The present invention relates to compounds and compositions for the inhibition of NAMPT, their synthesis, applications and antidotes. An illustrative compound of the invention is shown below: | 10-02-2014 |
20140294806 | Methods and compositions for treating cancers having acquired resitance to prior chemotherapeutic and targeted drugs using carboxyamidotriazole orotate - This invention provides methods and compositions useful for treating early and late stage metastatic cancer to prevent or treat acquired resistance due to gene amplification or mutation in response to chemotherapeutic and/or targeted drugs. In particular, the methods and compositions include carboxiamidotriazole orotate (CTO) alone or in combination with specific regimens of chemotherapeutic and/or targeted drugs designed to overcome the genomic resistance raised to prior therapy. | 10-02-2014 |
20140294807 | COMBINATION THERAPY WITH TYPE I AND TYPE II ANTI-CD20 ANTIBODIES - The present invention is directed to a combination therapy involving a type I anti-CD20 antibody and a type II anti-CD20 antibody for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Another aspect of the invention is a kit comprising a type I anti-CD20 antibody and a type II anti-CD20 antibody. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type I anti-CD20 antibody and a type II anti-CD20 antibody. | 10-02-2014 |
20140294808 | TREATING CANCER WITH HSP90 INHIBITORY COMPOUNDS - Methods of treating cancer with a compound of formulae (I) or (Ia) are disclosed. Also provided are methods of treating a cancer with a mutation in ALK or a c-MET mutation with a compound of formulae (I) or (Ia). Further provided are methods of treating non-small cell lung cancer with a mutation in ALK with a compound of formulae (I) or (Ia); a tautomer, or a pharmaceutically acceptable salt thereof, wherein the variables structural formulae are defined herein. | 10-02-2014 |
20140294809 | Anti-Alpha(v)Beta(6) Antibodies and Uses Thereof - The present invention is in the fields of cell biology, immunology and oncology. The invention provides humanized antibodies that recognize α | 10-02-2014 |
20140294810 | IMMUNOGLOBULIN VARIANTS AND USES THEREOF - Variant immunoglobulins with one or more amino acid modifications in the Fc region that have increased in vivo half-lives, and methods of using the same are provided. | 10-02-2014 |
20140294811 | METHOD FOR PREDICTING RISK OF HYPERTENSION ASSOCIATED WITH ANTI-ANGIOGENESIS THERAPY - The invention is concerned with a method of predicting a patient's susceptibility to developing hypertension associated with an anti-angiogenesis treatment, such as bevacizumab, by determining the genotype of KDR gene and/or EGF gene. The invention further relates to a pharmaceutical composition comprising an angiogenesis inhibitor, such as bevacizumab, for the treatment of a patient suffering from cancer based on the genotype of KDR gene and/or EGF. The invention further relates to a method for reducing the risk of hypertension associated with an anti-angiogenesis therapy, such as bevacizumab, in a patient suffering from cancer by determining the genotype of KDR gene and/or EGF gene. | 10-02-2014 |
20140294812 | FC VARIANTS THAT IMPROVE FCRN BINDING AND/OR INCREASE ANTIBODY HALF-LIFE - The present invention discloses the generation of novel variants of Fc domains, including those found in antibodies, Fc fusions, and immuno-adhesions, which have an increased binding to the FcRn receptor and/or increased serum half-life. | 10-02-2014 |
20140294813 | TNF Binding Proteins - Provided are TNF binding proteins and methods of treatment using the same. Also provided are nucleic acids encoding the binding proteins and recombinant expression vectors and host cells for making such binding proteins. | 10-02-2014 |
20140294814 | HUMANIZED AND AFFINITY-MATURED ANTI-C-MET ANTIBODY AND USES THEREOF - Provided is a humanized and affinity-matured anti-c-Met antibody, a pharmaceutical composition including the antibody, and a method of preventing and/or treating c-Met-related disease using the antibody. | 10-02-2014 |
20140294815 | CANINISED TUMOUR NECROSIS FACTOR ANTIBODIES AND METHODS OF USING THE SAME - Caninised and chimeric antibodies and antigen binding fragments thereof which bind specifically to canine tumour necrosis factor and inhibit the ability of canine TNF to bind to the TNFR1 receptor are provided. The invention further extends to nucleic acids encoding same and to methods of treating chronic inflammatory disease such as arthritis in a canine using said antibodies and/or nucleic acids. | 10-02-2014 |
20140294816 | COMBINATION THERAPY FOR THE TREATMENT OF OCULAR NEOVASCULAR DISORDERS - The invention features methods for treating a patient diagnosed with, or at risk of developing, a neovascular disorder by administering a PDGF antagonist and a VEGF antagonist to the patient. The invention also features a pharmaceutical composition containing a PDGF antagonist and a VEGF antagonist for the treatment or prevention of a neovascular disorder. | 10-02-2014 |
20140294817 | POLYPEPTIDES COMPRISING Fc FRAGMENTS OF IMMUNOGLOBULIN G (IgG) AND METHODS OF USING THE SAME - Polypeptides comprising at least a first and second Fc fragment of IgG that can be used to induce a stimulated cell to produce the anti-inflammatory cytokine Interleukin-10 and methods of using the same are disclosed herein. | 10-02-2014 |
20140294818 | PGAM1 INHIBITORS AND METHODS RELATED THERETO - In certain embodiments, the disclosure relates to methods of treating or preventing a PGAM1 mediated condition such as cancer or tumor growth comprising administering an effective amount of PGAM1 inhibitor, for example, an anthracene-9,10-dione derivative to a subject in need thereof. In certain embodiments, the disclosure relates to methods of treating or preventing cancer, such as lung cancer, head and neck cancer, and leukemia, comprising administering a therapeutically effective amount of a pharmaceutical composition comprising a compound disclosed herein or pharmaceutically acceptable salt to a subject in need thereof. | 10-02-2014 |
20140294819 | CANINE/FELINE CD20 BINDING EPITOPE AND COMPOSITIONS FOR BINDING THERETO - The present invention provides acyclic polypeptide fragment of CD20 comprising (i) a contiguous amino acid sequence consisting of amino acid residues SEKNS (SEQ ID NO:67); (ii) a first cysteine residue which is present at a region N-terminal to the contiguous amino acid sequence and (iii) a second cysteine residue which is present at a region C-terminal to the contiguous amino acid sequence, wherein the cyclic polypeptide is oxidised by the presence of a disulphide bond formed between the first and second cysteine residues. Also described is the use of the cyclic peptide fragment to generate antibodies which bind specifically to CD20. Antibodies which bind specifically to the cyclic peptide fragment for use in treatment of B-cell mediated conditions in felines and canines are also described. | 10-02-2014 |
20140302009 | Medicinal Agent for Prevention or Treatment of Diseases Associated with Intraocular Neovascularization and/or Intraocular Vascular Hyperpermeability - A pharmaceutical for preventing or treating a disorder accompanied by ocular angiogenesis and/or increased ocular vascular permeability, composed of a combination of an anti-VEGF agent, and a pyrrolo[1,2-a]pyrazine derivative represented by a general formula (I): | 10-09-2014 |
20140302010 | SUBSTITUTED BENZIMIDAZOLES - The present invention relates to substituted benzimidazole compounds of general formula (I) in which R | 10-09-2014 |
20140302011 | COMPOSITIONS INCLUDING TRICIRIBINE AND TRASTUZUMAB AND METHODS OF USE THEREOF - This application relates to combination therapies including triciribine and related compounds and trastuzumab or a salt thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 10-09-2014 |
20140302012 | Combination Therapies for Treating Hematologic Malignancies Using Pyridopyrimidinone Inhibitors of PI3K/mTOR with Bendamustine and/or Rituximab - The invention provides a method for treating cancers including hematologic malignancies comprising administering a compound of Formula (I): in combination with one or both of bendamustine and rituximab. | 10-09-2014 |
20140302013 | PREDICTING AND DIAGNOSING PATIENTS WITH SYSTEMIC LUPUS ERYTHEMATOSUS - The present invention provides methods for the prediction and diagnosis of Systemic Lupus Erythematosus using single nucleotide polymorphisms in IRF8. | 10-09-2014 |
20140302014 | METHODS FOR THE TREATMENT OF CANCER USING COENZYME Q10 COMBINATION THERAPIES - Presented herein are methods for the treatment of oncological disorders by the co-administration of CoQ10 formulations and chemotherapeutic agents and/or surgery. The CoQ10 formulations may be at least one of intravenous, topical, or by inhalation. The chemotherapeutic agents may be at least one of antimetabolites or anthracyclines. Co-administration of the CoQ10 formulations may be prior to, concurrent or substantially concurrent with, intermittent with or subsequent to the administration of the chemotherapy. | 10-09-2014 |
20140302015 | ANTIBODIES AGAINST HUMAN IL33R AND USES THEREOF - An antibody binding to IL33R characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:1, a CDR2 region of SEQ ID NO:2 and a CDR1 region of SEQ ID NO:3 and in that the light chain variable domain comprises a CDR3 region of SEQ ID NO:4, a CDR2 region of SEQ ID NO:5 and a CDR1 region of SEQ ID NO:6 or a a chimeric, humanized or T cell epitope depleted antibody variant thereof has advantageous properties for the treatment of inflammatory diseases. | 10-09-2014 |
20140302016 | BINDING PROTEINS, INCLUDING ANTIBODIES, ANTIBODY DERIVATIVES AND ANTIBODY FRAGMENTS, THAT SPECIFICALLY BIND CD154 AND USES THEREOF - This invention provides binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind a CD154 (CD40L) protein. This invention also provides a chimeric, humanized or fully human antibody, antibody derivative or antibody fragment that specifically binds to an epitope to which a humanized Fab fragment comprising a variable heavy chain sequence according to SEQ ID NO: 1 and comprising a variable light chain sequence according to SEQ ID NO: 2 specifically binds. CD154 binding proteins of this invention may elicit reduced effector function relative to a second anti-CD154 antibody. CD154 binding proteins of this invention are useful in diagnostic and therapeutic methods, such as in the treatment and prevention of diseases including those that involve undesirable immune responses that are mediated by CD154-CD40 interactions. | 10-09-2014 |
20140302017 | TREATING SKIN CANCER - This document provides methods and materials related to treating skin cancer. For example, methods and materials relating to the use of a taxane compound, an alkylating agent, and an anti-VEGF polypeptide antibody to treat skin cancer are provided. | 10-09-2014 |
20140302018 | TREATMENT OF DIFFUSE LARGE-CELL LYMPHOMA WITH ANTI-CD20 ANTIBODY - The present invention concerns methods for the treatment of diffuse large cell lymphoma by administration of an anti-CD20 antibody and chemotherapy. Particular embodiments include the administration of anti-CD20 antibody in combination with chemotherapy comprising CHOP (cyclophosphamide, hydroxydaunorubicin/doxorubicin, vincristine, and prednisone/prednisolone) and/or in combination with a transplantation regimen. | 10-09-2014 |
20140302019 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF PANCREATIC CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from pancreatic cancer, in particular metastatic pancreatic cancer by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the overall survival and/or progression-free survival of the patient. The present invention further provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels in patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. | 10-09-2014 |
20140302020 | ANTI-CLUSTERIN ANTIBODIES AND ANTIGEN BINDING FRAGMENTS AND THEIR USE TO REDUCE TUMOR VOLUME - Novel antibodies and antigen binding fragments that specifically bind to clusterin are described. In some embodiments, the antibodies block the biological activity of clusterin and are useful in composition in certain cancers, more particularly in cancers, such as endometrial carcinoma, breast carcinoma, hepatocellular carcinoma, prostate carcinoma, a renal cell carcinoma, ovarian carcinoma, pancreatic carcinoma, and colorectal carcinoma. The invention also relates to cells expressing the humanized or hybrid antibodies. Additionally, methods of detecting and treating cancer using the antibodies and fragments are also disclosed. | 10-09-2014 |
20140302021 | ANTIBODY FORMULATIONS AND METHODS - Antibody formulations and methods useful for prophylaxis or treatment of amyloidosis, including AA amyloidosis and AL amyloidosis. | 10-09-2014 |
20140302022 | 2-CARBOXAMIDE CLYCLOAMINO UREA DERIVATIVES FOR USE IN TREATING VEGF-DEPENDENT DISEASES - The invention relates to the use of compounds of formula (I) | 10-09-2014 |
20140302023 | USE OF RANK/RANKL ANTAGONISTS FOR TREATING NEUROMUSCULAR DISORDERS, GENETIC MYOPATHIES AND/OR NON GENETIC MYOPATHIES AND/OR FOR REGULATING SKELETAL AND CARDIAC MUSCLE DISUSE, DISEASES AND AGING - A pharmaceutical composition includes one or more RANK/RANKL antagonists and a pharmaceutically acceptable carrier. The composition can be used for treating neuromuscular disorders, non-genetic myopathies, or genetic myopathies; maintaining and/or preserving the excitation:contraction:relaxation coupling; reducing loss of muscle strength associated with neuromuscular disorders, non-genetic myopathies or genetic myopathies; reducing the loss of muscular strength associated with skeletal or cardiac muscle disuse, diseases and aging; or regulating skeletal or cardiac muscle disuse, diseases and/or aging in a patient in need thereof. Methods are used to identify candidate compounds. | 10-09-2014 |
20140308269 | HUMANIZED ANTIBODIES - Humanized antibodies that bind ICAM-1 are provided. Antibodies include those selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI). Subsequences of the humanized antibodies capable of finding an ICAM-1 epitope are also provided. Methods of inhibiting pathogen infection (e.g., HRV) of a cell employing humanized antibodies capable of finding an ICAM-1 epitope are further provided. | 10-16-2014 |
20140308270 | METHOD AND FORMULATION FOR REDUCING AGGREGATION OF A MACROMOLECULE UNDER PHYSIOLOGICAL CONDITIONS - The invention provides a method for reducing aggregation and inhibiting flocculation of a macromolecule, such as a protein, under physiological conditions, by the addition of 5% to 20% polyvinylpyrrolidone (PVP) with a molecular weight range of 2000 to 54,000 daltons. The invention further provides a method to minimize inflammation at the injection site during subcutaneous administration of a macromolecule. In further aspects, the invention provides pharmaceutical formulations for subcutaneous administration of a macromolecule, and methods of treating a CD20 positive cancer or an autoimmune disease, comprising administering a humanized anti-CD20 antibody in a pharmaceutical formulation of the invention. The invention further provides an in vitro dialysis method to evaluate the ability of an excipient to reduce aggregation of an antibody or other macromolecule under physiological conditions. | 10-16-2014 |
20140308271 | ANTIBODIES THAT BIND TO TL1A AND THEIR USES - The present invention relates to antibodies or fragments thereof that bind to TL1A. More specifically, the present invention relates to an antibody or fragment thereof that binds to TL1A comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 51, and/or a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 52, and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 53; and/or comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 54, and/or a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 55 and/or a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 56. | 10-16-2014 |
20140308272 | TREATMENT OF PRION PROTEIN RELATED DISEASES - According to the present invention, treatment of prion protein related diseases, and in particular cancer tumours, is effected by providing to a subject in need thereof a therapeutically effective amount of an agent capable of modulating binding of a prion protein and/or a prion-like protein to a disease related GAG and/or HSPG. | 10-16-2014 |
20140308273 | CELL CULTURE MEDIA AND METHODS OF ANTIBODY PRODUCTION - Cell culture media are provided herein as are methods of using the media for cell culture and antibody production from cells. Compositions comprising antibodies and fragments thereof, produced by the methods herein are also provided. | 10-16-2014 |
20140308274 | COMBINATION CANCER TREATMENTS UTILIZING SYNTHETIC OLIGONUCLEOTIDES AND EGFR-TKI INHIBITORS - The disclosure provides methods and compositions for treating cancer cells, including cancer cells in a subject, whereby two or more therapeutic agents are used, one being an EGFR-TKI agent and the other being a synthetic oligonucleotide. | 10-16-2014 |
20140308275 | METHODS FOR DIAGNOSING AND TREATING MYHRE SYNDROME - The present invention relates to methods for diagnosing and treating Myhre Syndrome. The invention provides a method for diagnosing or predicting Myhre Syndrome, or a risk of Myhre Syndrome, in a subject, which method comprises detecting a mutation in SMAD4 gene, as compared to a control population, wherein the presence of said mutation is indicative of Myhre Syndrome or of a risk of Myhre Syndrome. The present invention also relates to an inhibitor of the SMAD4-mediated TGFβ/BMP signalling pathway for use in the treatment of Myhre Syndrome. | 10-16-2014 |
20140308276 | ANTI-OX40 ANTIBODIES AND METHODS OF USING THE SAME - Human antibodies, preferably recombinant human antibodies, both humanized and chimeric, which specifically bind to human OX40 are disclosed. Preferred antibodies have high affinity for OX40 receptor and activate the receptor in vitro and in vivo. The antibody can be a full-length antibody or an antigen-binding portion thereof. The antibodies, or antibody portions, are useful for modulating receptor activity, e.g., in a human subject suffering from a disorder in which OX40 activity is detrimental. Nucleic acids, vectors and host cells for expressing the recombinant human antibodies are provided, and methods of synthesizing the recombinant human antibodies, are also provided. | 10-16-2014 |
20140308277 | PERTUZUMAB VARIANTS AND EVALUATION THEREOF - The present application discloses variants of Pertuzumab. In particular, it discloses: an unpaired cysteine variant comprising Cys23/Cys88 unpaired cysteines in one or both variable light domains of Pertuzumab, an afucosylated variant of Pertuzumab, a low-molecular-weight-species (LMWS) of Pertuzumab, and a high-molecular-weight-species (HMWS) or Pertuzumab. The application further discloses the isolated variants, compositions, pharmaceutical compositions, and articles of manufacture comprising the variants, as well as methods of making and characterizing the variants and compositions thereof. | 10-16-2014 |
20140308278 | Class I Anti-CEA Antibodies and Uses Thereof - The present invention provides compositions and methods of use of humanized, chimeric or human Class I anti-CEA antibodies or fragments thereof, preferably comprising the light chain variable region CDR sequences SASSRVSYIH (SEQ ID NO:1); GTSTLAS (SEQ ID NO:2); and QQWSYNPPT (SEQ ID NO:3); and the heavy chain variable region CDR sequences DYYMS (SEQ ID NO:4); FIANKANGHTTDYSPSVKG (SEQ ID NO:5); and DMGIRWNFDV (SEQ ID NO:6). The Class I anti-CEA antibodies or fragments are useful for treating diseases, such as cancer, wherein the diseased cells express CEACAM5 and/or CEACAM6 antigens. The Class I anti-CEA antibodies or fragments are also of use for interfering with specific processes, such as metastasis, invasiveness and/or adhesion of cancer cells, or for enhancing sensitivity of cancer cells to cytotoxic agents and have favorable effects on the survival of subjects with cancer. | 10-16-2014 |
20140308279 | Anti-ErbB3 Antibodies and Uses Thereof - The present invention provides antibodies that bind to ErbB3 and methods of using same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human ErbB3. In certain embodiments, the antibodies of the present invention block the interaction of ErbB3 with an ErbB3 ligand such as neuregulin 1. The antibodies of the invention are useful for the treatment of various cancers. | 10-16-2014 |
20140314741 | Human Antibody against Interleukin-20 and Treatment for Inflammatory Diseases - FLB5M5 is a humanized monoclonal antibody with three mutated amino acids in the CDRs relative to its parental mouse anti-IL-20 monoclonal antibody 7E and five mutated amino acids of the light-chain framework region relative to the amino acids of the light-chain framework region of human Vκ2. FLB5M5 not only retains binding specificity toward IL-20 but also has a better binding affinity than 7E for IL-20. FLB5M5 is also less immunogenic than 7E to the human host in clinical application. A mutation in the light chain CDR to tyrosine increases binding affinity to IL-20. A method for treating rheumatoid arthritis using FLB5M5 is also disclosed. | 10-23-2014 |
20140314742 | ENDOGLIN ANTIBODIES - The present application relates to compositions of humanized and humanized/deimmunized anti-endoglin antibodies and antigen-binding fragments thereof. One aspect relates to antibodies having one or more modifications in at least one amino acid residue of at least one of the framework regions of the variable heavy chain, the variable light chain or both. Another aspect relates to antibodies which bind endoglin and inhibit angiogenesis. Another aspect relates to the deimmunization of humanized antibodies to reduce immunogenicity. Another aspect relates to the use of humanized and humanized/deimmunized antibodies which bind endoglin for the detection, diagnosis or treatment of a disease or condition associated with endoglin, angiogenesis or a combination thereof. | 10-23-2014 |
20140314743 | AMINO ACID SEQUENCES DIRECTED AGAINST IL-17A, IL-17F AND/OR IL17-A/F AND POLYPEPTIDES COMPRISING THE SAME - The present disclosure relates to amino acid sequences that are directed against (as defined herein) any of IL-17A, IL-17F and/or IL-17A/F including combinations thereof, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. | 10-23-2014 |
20140314744 | MCAM ANTAGONISTS AND METHODS OF TREATMENT - Described herein are MCAM antagonists, including MCAM antagonist antibodies capable of inhibiting the interaction between MCAM and it ligand, a laminin α4 chain, e.g., an α4 chain of laminin 411. These MCAM antagonists, e.g., anti-MCAM antibodies, may be useful to treat neuroinflammatory conditions, for example, multiple sclerosis and Parkinson's disease, by inhibiting the infiltration of MCAM-expressing cells into the central nervous system (CNS), e.g., extravasation of TH17 cells into the CNS. | 10-23-2014 |
20140314745 | METHODS TO CONTROL PROTEIN HETEROGENEITY - The instant invention relates to the field of protein production and in particular to controlled protein heterogeneity compositions and processes for controlling the heterogeneity of proteins expressed in host cells. | 10-23-2014 |
20140314746 | METHODS FOR TREATING OR PREVENTING FIBROSIS IN SUBJECTS AFFLICTED WITH SCLERODERMA - The invention includes novel methods of treating or preventing fibrosis in a subject afflicted with scleroderma, comprising administering to the subject a therapeutically effective amount of an agent that inhibits formation of at least one inflammasome signaling product in the subject. | 10-23-2014 |
20140314747 | PREDICTING RESPONSE TO EGFR INHIBITORS - Methods of predicting whether a cancer will respond to an EGFR inhibitor are provided. | 10-23-2014 |
20140314748 | ANTIBODY FORMULATIONS - The invention provides stable aqueous pharmaceutical formulations comprising a therapeutic antibody, trehalose, a buffer, and optional surfactant, and having a pH in the range of about 5.5 to about 7.0. The invention also provides methods for making such formulations and methods of using such formulations. | 10-23-2014 |
20140314749 | COMPOSITIONS AND METHODS FOR DIAGNOSIS AND TREATMENT OF HEPATIC CANCERS - The present invention relates to methods of treating liver cancer using a Notch signaling inhibitor. Compositions and methods for the treatment of liver cancers are also provided. | 10-23-2014 |
20140314750 | Six-Gene Biomarker of Survival and Response to Platinum Based Chemotherapy in Serious Ovarian Cancer Patients - Described herein are methods of predicting the risk of developing ovarian cancer recurrence of a subject comprising the steps of detecting the expression levels of at least four of the six genes selected from the group consisting of AKT2, KRAS, RAC1, CALM3, RPS6KA2 and YWHAB or the gene products thereof, wherein the presence of increased expression levels of the genes or the gene products is predictive of the increased risk of developing ovarian cancer recurrence in the subject. Kits for practicing the methods are also disclosed. | 10-23-2014 |
20140314751 | METHODS FOR TREATING CANCER USING TOR KINASE INHIBITOR COMBINATION THERAPY - Provided herein are methods for treating or preventing a cancer, comprising administering an effective amount of a TOR kinase inhibitor and an effective amount of N-(3-(5-fluoro-2-(4-(2-methoxyethoxy)phenylamino)pyrimidin-4-ylamino)phenyl)acrylamide to a patient having a cancer. | 10-23-2014 |
20140314752 | METHODS FOR TREATING CANCER USING TOR KINASE INHIBITOR COMBINATION THERAPY - Provided herein are methods for treating or preventing a cancer, comprising administering an effective amount of a TOR kinase inhibitor and an effective amount of an IMiD® immunomodulatory drug to a patient having a cancer. | 10-23-2014 |
20140314753 | METHODS FOR TREATING CANCER USING TOR KINASE INHIBITOR COMBINATION THERAPY - Provided herein are methods for treating or preventing a cancer, comprising administering an effective amount of a TOR kinase inhibitor and an effective amount of a 5-Substituted Quinazolinone Compound to a patient having a cancer. | 10-23-2014 |
20140314754 | Humanized Neuraminidase Antibody and Methods of Use Thereof - Antibodies against influenza neuraminidase, compositions containing the antibodies, and methods of using the antibodies are provided herein. | 10-23-2014 |
20140314755 | ANTIBODY PRODUCING NON-HUMAN MAMMALS - Described are transgenic, non-human animals comprising a nucleic acid encoding an immunoglobulin light chain, whereby the immunoglobulin light chain is human, human-like, or humanized. The nucleic acid is provided with a means that renders it resistant to DNA rearrangements and/or somatic hypermutations. In one embodiment, the nucleic acid comprises an expression cassette for the expression of a desired molecule in cells during a certain stage of development in cells developing into mature B cells. Further provided is methods for producing an immunoglobulin from the transgenic, non-human animal. | 10-23-2014 |
20140314756 | METHOD FOR TREATING PSORIASIS - Methods of treating a patient suffering from psoriasis are disclosed, comprising administration of an antibody binding to interleukin-12 (IL-12). | 10-23-2014 |
20140314757 | PHYTOCANNABINOIDS FOR USE IN THE TREATMENT OF BREAST CANCER - The present invention relates to phytocannabinoids for use in the treatment of a breast cancer. In a first embodiment the invention relates to an oral presentation of tetrahydrocannabinol (THC) for use in the treatment of aggressive breast cancer, characterised by overexpression of the Her2 gene. In a second embodiment the invention relates to the phytocannabinoid cannabidiol (CBD) for use in the treatment of aggressive breast cancer, characterised by overexpression of the Her2 gene. In a third embodiment the invention relates to the combination of the phytocannabinoids tetrahydrocannabinol (THC) and cannabidiol (CBD) for use in the treatment of breast cancer or to treat, prevent or to reduce the risk of a cancer metastasising. | 10-23-2014 |
20140314758 | IMMUNOGENIC TUMOR ASSOCIATED STROMAL CELL ANTIGEN PEPTIDES AND METHODS OF THEIR USE - Immunogenic peptides from tumor associated stromal cell antigens, including combinations of such peptides, are disclosed herein. In some examples the peptides are useful for methods of eliciting an immune response. In additional examples the peptides are useful for methods of treating cancer. Methods for decreasing vascularization of a tumor using a Protein Delta Homolog 1 (DLK1) protein or a nucleic acid encoding the protein are also disclosed. | 10-23-2014 |
20140322200 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH AN ANTI-VEGF ANTIBODY - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with an anti-VEGF antibody for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and an anti-VEGF antibody. | 10-30-2014 |
20140322201 | METHODS OF TREATING MULTIPLE MYELOMA USING COMBINATION THERAPIES BASED ON ANTI-CS1 ANTIBODIES - Compositions and methods for treating MM are provided herein. | 10-30-2014 |
20140322202 | TREATMENT WITH ANTI ErbB2 ANTIBODIES - The present invention concerns the treatment of cancer with anti-ErbB2 antibodies. | 10-30-2014 |
20140322203 | FORMULATIONS WITH REDUCED OXIDATION - The invention provides formulations comprising a protein in combination with a compound that prevents oxidation of the protein. The invention also provides methods for making such formulations and methods of using such formulations. The invention further provides methods of screening for compounds that prevent oxidation of a protein in a protein composition and methods of preventing oxidation of a protein in a formulation. | 10-30-2014 |
20140322204 | TREATMENT AND PREVENTION OF VIRAL INFECTIONS - Disclosed is polynucleotide encoding a polypeptide comprising an antibody binding site, the polypeptide being able to bind to HCV E2 samples representative of each of HCV genotypes 1-6, as well as polypeptides having such properties and uses of such polypeptides in detecting and treating HCV infection. | 10-30-2014 |
20140322205 | RTEF-1 VARIANTS AND THE USE THEREOF FOR INHIBITION OF ANGIOGENESIS - Dominant negative (DN) variants of transcriptional enhancer factor 1-related (RTEF-1) are described. DN RTEF-1 polypeptides may be directly targeted to cells or delivered in nucleic acid expression vectors to alter cellular transcription. Methods for inhibiting VEGF production and thereby treating angiogenic disorders such as cancer are described. For example, in certain aspects, DN RTEF-1 may be used to treat angiogenic disorders of the eye such as age related macular degeneration (AMD). | 10-30-2014 |
20140322206 | METHOD FOR TREATING ATROPHIC AGE RELATED MACULAR DEGENERATION - Compositions and methods for treating dry age related macular degeneration (dry AMO) by administration to an intraocular location of an anti-neovascular agent (such as bevacizumab) in either a liquid or solid polymeric vehicle (or both), such as a biodegradable hyaluronic acid or PLGA (or PLA). | 10-30-2014 |
20140322207 | METHODS OF IDENTIFYING CRITICALLY ILL PATIENTS AT INCREASED RISK OF DEVELOPMENT OF ORGAN FAILURE AND COMPOUNDS FOR THE TREATMENT HEREOF - The present invention relates to compounds for treatment that protects the endothelium, prevents pathologic thrombus formation in the microcirculation and preserves platelet number and function and thus may be related to minimizing or preventing development of organ failure, including multiple organ failure (MOF), and, hence, death in critically ill patients by administration of agent(s) limiting the platelets ability to aggregate and form clots and/or by agents modulating/preserving endothelial integrity and/or by agent(s) increasing the rate of thrombus lysis, and Another aspect of the invention related to by a cell-based whole blood viscoelastical haemostatic assay identifying critically ill patients at increased risk of development of organ failure, including multiple organ failure (MOF) and death. | 10-30-2014 |
20140322208 | TREATMENT OF HEMATOLOGIC MALIGNANCIES WITH AN ANTI-CXCR4 ANTIBODY - The present disclosure provides human monoclonal antibodies that bind specifically to CXCR4 with high affinity. This disclosure also provides a method for treating a subject afflicted with a CXCR4-expressing cancer, in particular a hematological malignancy such as multiple myeloma, acute myeloid leukemia, or non-Hodgkin's lymphoma, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising an anti-CXCR4 antibody of the disclosure. The disclosure further provides a kit for treating a cancer in a subject comprising a dose of an anti-CXCR4 antibody and instructions for using the anti-CXCR4 antibody in the therapeutic methods of the disclosure. | 10-30-2014 |
20140322209 | ADMINISTRATION OF ALPHA4BETA7 HETERO- DIMER-SPECIFIC ANTIBODY - There is provided a method of treating a subject afflicted with a condition that is associated with inappropriate trafficking of cells expressing alpha4beta7 to the gastrointestinal tract, comprising administering to the subject an alpha4beta7 heterodimer specific antibody in an amount and at an interval sufficient to ameliorate the condition. | 10-30-2014 |
20140322210 | ANTIBODIES USEFUL IN PASSIVE INFLUENZA IMMUNIZATION - Specific monoclonal antibodies and fragments including bispecific antibodies thereof that are crossreactive with multiple clades of influenza virus including both Group 1 and Group 2 representatives are disclosed. These antibodies are useful in controlling influenza epidemics and pandemics as well as in providing prophylactic or therapeutic protection against seasonal influenza. | 10-30-2014 |
20140322211 | TENASCIN-C AND USE THEREOF IN RHEUMATOID ARTHRITIS - The present invention provides a method of determining the rheumatoid arthritis status of a subject, or the progression of rheumatoid arthritis, or the appropriate treatment for a subject with rheumatoid arthritis, comprising the steps of (a) determining the level of tenascin-C in a sample from said subject; and (b) comparing the level of tenascin-C determined in step (a) with one or more reference values. Preferably the rheumatoid arthritis referred to is erosive rheumatoid arthritis. The be accompanied when published by FIG. | 10-30-2014 |
20140328828 | USE OF THERAPEUTIC COMPOSITIONS COMPRISING HYALURONAN AND THERAPEUTIC ANTIBODIES - The present invention relates generally to treatment and prophylactic protocols for cellular disease or disorders, such as diseases and disorders associated with abnormal cellular proliferation. More particularly, the present invention provides uses of compositions comprising therapeutic antibodies and hyaluronan in the treatment or prophylaxis of cellular diseases and disorders. | 11-06-2014 |
20140328829 | AGR2 BLOCKING ANTIBODY AND USE THEREOF - Disclosed is an AGR2 blocking monoclonal antibody, and in particular, a humanized monoclonal antibody for blocking AGR2. Also disclosed is a pharmaceutical composition containing the antibody and a method for preparing the same, and a use of the antibody in blocking tumor growth and metastasis. | 11-06-2014 |
20140328830 | ANTI-INTEGRIN BETA-1 ANTIBODY COMPOSITIONS AND METHODS OF USE THEREOF - The current invention provides human variable chain framework regions and humanized antibodies comprising the framework regions, the antibodies being specific for integrin β1. The invention also provides methods for utilizing the antibodies, for example to treat diseases such as cancer. | 11-06-2014 |
20140328831 | SINGLE DOMAIN TDF-RELATED COMPOUNDS AND ANALOGS THEREOF - The present invention relates generally to tissue differentiation factor (TDF) analogs. More specifically, the invention relates to structure-based methods and compositions useful in designing, identifying, and producing molecules which act as functional modulators of TDF-like receptors. The invention further relates to methods of detecting, preventing, and treating TDF-associated disorders. | 11-06-2014 |
20140328832 | METHODS FOR TREATING CANCER USING COMBINATION THERAPY - Provided herein are methods for treating or preventing a cancer, comprising administering an effective amount of a substituted quinazolinone compound and an effective amount of N-(3-(5-fluoro-2-(4-(2-methoxyethoxy)phenylamino)pyrimidin-4-ylamino)phenyl)acrylamide to a patient having a cancer. | 11-06-2014 |
20140328833 | METHODS FOR TREATING CANCER USING ANTI-PD-1 ANTIBODIES - The present invention provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to PD-1 with high affinity. Nucleic acid molecules encoding the antibodies of the invention, expression vectors, host cells and methods for expressing the antibodies of the invention are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of the invention are also provided. The invention also provides methods for detecting PD-1, as well as methods for treating various diseases, including cancer and infectious diseases, using anti-PD-1 antibodies. The present invention further provides methods for using a combination immunotherapy, such as the combination of anti-CTLA-4 and anti-PD-1 antibodies, to treat hyperproliferative disease, such as cancer. The invention also provides methods for altering adverse events related to treatment with such antibodies individually. | 11-06-2014 |
20140328834 | PHARMACEUTICAL COMBINATIONS COMPRISING A PYRIDO [4,3-D] PYRIMIDINE DERIVED HSP90-INHIBITOR AND A HER2 INHIBITOR - A pharmaceutical combination comprising an Hsp90 inhibitor and an HER2 inhibitor, and methods of using the combination to treat proliferative disorders. | 11-06-2014 |
20140328835 | METHODS FOR TREATING RETINOPATHY WITH EXTENDED THERAPEUTIC EFFECT - Methods for treating and preventing retinopathic conditions by administering an anti-VEGF compound to the vitreous chamber of a patient at risk of, or suffering from, the retinopathy. | 11-06-2014 |
20140328836 | HER2/neu-Specific Antibodies and Methods of Using Same - This invention relates to antibodies that specifically bind HER2/neu, and particularly chimeric 4D5 antibodies to HER2/neu, which have reduced glycosylation as compared to known 4D5 antibodies. The invention also relates to methods of using the 4D5 antibodies and compositions comprising them in the diagnosis, prognosis and therapy of diseases such as cancer, autoimmune diseases, inflammatory disorders, and infectious disease. | 11-06-2014 |
20140328837 | Affinity Peptides Toward Infliximab - We have disclosed affinity peptides toward infliximab. More specifically we have disclosed an affinity biomatrix where the affinity peptide is covalently attached to a biocompatible, biodegradable polymer. The affinity biomatrix is useful in preparing controlled release devices for infliximab. | 11-06-2014 |
20140328838 | CANINISED ANTIBODIES AND METHOD FOR PRODUCTION OF SAME - A method of producing a non-immunogenic immunoglobulin for administration to a target species is provided wherein the method comprises substituting amino acid residues in framework regions of a donor immunoglobulin with amino acid residues present at a corresponding position in framework regions of at least one immunoglobulin derived from the target species. Also provided are antibodies produced by the method of the invention, including novel humanised and caninised anti-NGF antibodies. The invention extends to nucleic acids encoding same and to methods of treating pain and arthritis in a human or dog using said antibodies and/or nucleic acids. | 11-06-2014 |
20140328839 | Methods For Reducing The Frequency And Severity Of Acute Exacerbations Of Asthma - Provided herein is are methods of reducing the number and severity of acute exacerbations of asthma in an asthma patient, comprising administering to a patient with a history of acute exacerbations of asthma an effective amount of an anti-interleukin-5 receptor (IL-5R) antibody or antigen-binding fragment thereof, for example, an anti-IL-5Rα antibody or antigen-binding fragment thereof, e.g., benralizumab. | 11-06-2014 |
20140328840 | MARKER AND TARGET FOR RESPONSIVENESS AND RESISTANCE TO CANCER AGENTS - An assay of identifying the responsiveness of a HER2-positive cancer in a patient to a HER2 targeted drug, the method comprising the step of comparing a level of NeuromedinU in a biological sample obtained from the patient with a reference level of NeuromedinU, wherein detection of a level of NeuromedinU that is increased compared to the reference level of NeuromedinU indicates that the HER2-positive cancer has reduced responsiveness to a HER2 targeted drug. | 11-06-2014 |
20140328841 | ANTI-CEACAM1 RECOMBINANT ANTIBODIES FOR CANCER THERAPY - Provided herein are recombinant monoclonal antibodies and antigen-binding portions thereof useful in inhibiting CEACAM1 in tumor cells, and methods of their use in anti-tumor proliferation and invasiveness therapies, such as the treatment of cancer, particularly pancreatic cancer. | 11-06-2014 |
20140328842 | Predicting Responsiveness to Antibody Maintenance Therapy - Methods, reagents and kits are provided for predicting whether an individual suffering from an antibody dependent cell-mediated cytotoxicity (ADCC)-treatable disease is responsive to an antibody maintenance therapy. The methods, reagents, and kits find a number of uses, including, for selecting individuals who will be responsive for treatment with an antibody maintenance therapy, for determining the appropriate maintenance therapy for an individual suffering from an ADCC-treatable disease, for determining the optimal regimen for antibody maintenance therapy, and for treating an individual with an antibody maintenance therapy based on stratification into responsive groups. | 11-06-2014 |
20140335075 | IMMUNOGLOBULIN CONSTANT REGION FC RECEPTOR BINDING AGENTS - IVIG replacement compounds are derived from recombinant and/or biochemical creation of immunologically active biomimetic(s). These replacement compounds are then screened in vitro to assess each replacements compound's efficiency at modulating immune function. Particular replacement compounds are selected for further in vivo validation and dosage/administration optimization. Finally, the replacement compounds are used to treat a wide range of diseases, including inflammatory and autoimmune diseases. | 11-13-2014 |
20140335076 | Humanized Monoclonal Antibodies to Hepatocyte Growth Factor - The present invention is directed toward a humanized neutralizing monoclonal antibody to hepatocyte growth factor, a pharmaceutical composition comprising same, and methods of treatment comprising administering such a pharmaceutical composition to a patient. | 11-13-2014 |
20140335077 | Compositions and Methods for the Treatment of Cancer Using IGF-IR Antagonists and MAPK/ERK Inhibitors - The present invention relates generally to the field of cancer therapy. More specifically the present invention relates a combination therapy where IGF-1R antagonists are combined with MAPK/ERK pathway inhibitors. The present invention relates to a therapeutic combination comprising an IGF-1R antagonist and a MAPK/ERK pathway inhibitor, and to methods for the production of an anti-cancer effect in a patient. The present invention relates to: a therapeutic combination comprising an IGF-1R antagonist and a MAPK/ERK pathway inhibitor; a combination product comprising an IGF-1R antagonist and a MAPK/ERK pathway inhibitor, a kit of parts comprising an IGF-1R antagonist and a MAPK/ERK pathway inhibitor; use of a therapeutic combination, combination product or kit of parts in the treatment of cancer; a method of treating cancer comprising administering the therapeutic combination, combination product or kit of parts to a patient. | 11-13-2014 |
20140335078 | Use Of Complement Inhibitors To Treat Ocular Diseases - The present invention relates to the treatment of ocular diseases and conditions by administering a complement pathway inhibitor, particularly an alternative pathway inhibitor. Ocular diseases include age-related macular degeneration, diabetic retinopathy, and ocular angiogenesis. One embodiment comprises the administration of an anti-Factor D antibody in the form of a whole antibody, a Fab fragment or a single domain antibody. Other complement component inhibitors that may be useful in the present method include Factor H or inhibitors that block the action of properdin, factor B, factor Ba, factor Bb, C2, C2a, C3a, C5, C5a, C5, C6, C7, C8, C9, or C5b-9. | 11-13-2014 |
20140335079 | SOLENOPSIN AND DERIVATIVES, THERAPEUTIC COMPOSITIONS, AND METHODS RELATED THERETO - This disclosure relates to solenopsin derivatives, pharmaceutical compositions, and therapeutic uses related thereto. In certain embodiments, the disclosure relates to compounds of the following formula: | 11-13-2014 |
20140335080 | ESTER DERIVATIVES OF ANDROGEN RECEPTOR MODULATORS AND METHODS FOR THEIR USE - Compounds having a structure of Structure I: | 11-13-2014 |
20140335081 | Treatment For Rheumatoid Arthritis - Treatment of rheumatoid arthritis (RA) to provide clinical benefit in patients, including decrease in DAS28-CRP by more than 1.2 and/or improvement determined by ACR20, ACR50 or ACR70, comprising administering therapeutic antibody mavrilimumab or other inhibitor targeted to Tyr-Leu-Asp-Phe-Gln motif of granulocyte/macrophage colony stimulating factor receptor alpha (GM-CSFRα). Use of GM-CSFRα inhibitors such as mavrilimumab to enhance clinical benefit in RA patients receiving stable dose of DMARDs, particularly methotrexate. | 11-13-2014 |
20140335082 | COMBINATION THERAPY COMPRISING AN MMP-14 BINDING PROTEIN - Proteins that bind to matrix metalloproteinase 14, combination therapies with such proteins and methods of using such proteins are described. | 11-13-2014 |
20140335083 | METHODS OF TREATMENT AND PREVENTION OF EYE DISEASES - The present invention provides compositions and methods useful for treating and preventing neovascular AMD by inhibition of CCR3. The compositions and methods are useful for treating and preventing diseases and disorders such as but not limited to, neovascular AMD | 11-13-2014 |
20140335084 | ANTIBODY FORMULATION - The present invention relates to an anti-CD44 monoclonal antibody formulation, a process for the preparation of said formulation and uses thereof. | 11-13-2014 |
20140341884 | Novel Complex Mutations in the Epidermal Growth Factor Receptor Kinase Domain - New mutations were found in exon 19 of the EGFR gene, the exon that is often mutated in tumors. The invention comprises methods of detecting the mutations, methods of prognosis and methods of predicting response to treatment based on the presence of absence of the mutations. | 11-20-2014 |
20140341885 | FORMULATION FOR ANTI-ALPHA4BETA7 ANTIBODY - Antibody formulations are described comprising a mixture of an anti-α4β7 antibody, an antioxidant or chelator, and at least one free amino acid. The disclosed formulations may have improved stability, reduced aggregate formation, or both. The present invention further provides a safe dosing regimen of these antibody formulations that is easy to follow, and which results in a therapeutically effective amount of the anti-α4β7 antibody in vivo. | 11-20-2014 |
20140341886 | TREATMENT WITH ANTI ErbB2 ANTIBODIES - The present invention concerns the treatment of disorders characterized by the overexpression of ErbB2. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer overexpressing ErbB2 with a combination of an anti-ErbB2 antibody and a chemotherapeutic agent other than an anthracycline, e.g. doxorubicin or epirubicin. The invention further provides a method of treating cancer in a human patient comprising administering effective amounts of an anti-ErbB2 antibody and a cardioprotectant to the patient. | 11-20-2014 |
20140341887 | METHODS FOR TREATING, DIAGNOSING, AND MONITORING RHEUMATOID ARTHRITIS - Methods of identifying, diagnosing, and prognosing rheumatoid arthritis are provided, as well as methods of treating rheumatoid arthritis. Also provided are methods for identifying effective rheumatoid arthritis therapeutic agents and predicting responsiveness to rheumatoid arthritis therapeutic agents. | 11-20-2014 |
20140341888 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, FORTEO® (recombinant human teriparatide), DULAGLUTIDE® (LY2189265), recombinant insulin glargine, RAMUCIRUMAB® (IMC-1121B), SOLANEZUMAB® (LY2062430), IXEKIZUMAB® (LY2439821), TABALUMAB® (LY2127399), NECITUMUMAB® (IMC-11F8), or CIXUTUMUMAB® (IMC-A12). | 11-20-2014 |
20140341889 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, Prolia® (denosumab), Xgeva® (denosumab), Aranesp® (darbepoetin alfa), AMG-145, romosozumab (AMG-785), ganitumab (AMG-479), trebananib (AMG-386), brodalumab (AMG-827), and rilotumumab (AMG-102). | 11-20-2014 |
20140341890 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, LUCENTIS® (ranibizumab), BEXSERO® (meningococcal group B vaccine [rDNA, component, adsorbed]), AIN457 (secukinumab) or RELAXIN® (serelaxin). | 11-20-2014 |
20140341891 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, LYXUMIA (lixisenatide), LEMTRADA (alemtuzumab), REGN727/SAR236553 (alirocumab), SAR2405550/BSI-201 (iniparib), OTAMIXABAN (otamixaban), SARILUMAB (sarilumab), LANTUS and LYXUMIA (insulin glargine and lixisenatide) or VISAMERIN/MULSEVO (semuloparin sodium). | 11-20-2014 |
20140341892 | ANTI-ALPHA2 INTEGRIN ANTIBODIES AND THEIR USES - The invention relates to anti-α2 integrin antibodies and their uses. Humanized antibodies are disclosed that bind to the I domain of α2 integrin and inhibit the interaction of α2β1 integrin with collagen. Also disclosed are therapeutic uses of anti-α2 integrin antibodies in treating α2β1-mediated disorders, including anti-α2 integrin antibodies that bind to α2 integrin without activating platelets. | 11-20-2014 |
20140341893 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF BREAST CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from HER2 positive breast cancer, in particular locally recurrent or metastatic HER2 positive breast cancer, by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of VEGFA and/or VEGFR2 relative to control levels of patients diagnosed with HER2 positive breast cancer, in particular locally recurrent or metastatic HER2 positive breast cancer. The present invention also provides for methods for assessing the sensitivity or responsiveness of a patient to bevacizumab (Avastin®) in combination with a chemotherapy regimen, by determining the expression level, in particular the blood plasma expression level, of VEGFA and/or VEGFR2 relative to control levels in patients diagnosed with HER2 positive breast cancer, in particular locally recurrent or metastatic HER2 positive breast cancer. | 11-20-2014 |
20140341894 | CERTAIN CHEMICAL ENTITIES, COMPOSITIONS AND METHODS - Chemical entities that modulate PI3 kinase activity, pharmaceutical compositions containing the chemical entities, and methods of using these chemical entities for treating diseases and conditions associated with P13 kinase activity are described herein. | 11-20-2014 |
20140341895 | PSEUDOMONAS AERUGINOSA OprM EPITOPES FOR USE IN DIAGNOSTICS AND THERAPEUTICS - The present invention relates to a peptide antigens derived from | 11-20-2014 |
20140341896 | HUMANIZED ANTI-HUMAN NKG2A MONOCLONAL ANTIBODY - The present invention relates to agents that are non-competitive antagonists of the CD94/NKG2A receptor such as certain anti-NKG2A antibodies, in particular humanized versions of murine anti-NKG2A antibody Z199, as well as methods of producing and using such agents and antibodies. | 11-20-2014 |
20140341897 | ANTI-FOLATE RECEPTOR ALPHA ANTIBODIES AND USES THEREOF - Described herein are antibodies, and antigen-binding fragments thereof, that are specific for folate receptor alpha, related polynucleotides, expression vectors, and cells that express the described antibodies. Also provided are methods of using the described antibodies, and antigen-binding fragments thereof, and related kits. Provided herein are also methods for diagnosing cancers, such as breast cancer, thyroid cancer, colorectal cancer, endometrial cancer, fallopian tube cancer, ovarian cancer, or lung cancer, using the described antibodies, and antigen-binding fragments thereof. The methods involve determining the amount of folate receptor alpha in a sample derived from a subject and comparing this level with the level of folate receptor alpha in a control sample or reference sample. | 11-20-2014 |
20140341898 | SILENT Fc VARIANTS OF ANTI-CD40 ANTIBODIES - The present invention relates to silent Fc variants of anti-CD40 antibodies and compositions and methods of use of said antibodies for treating pathological disorders such as autoimmune and inflammatory disorders and/or for preventing or reducing the risk of graft rejection in transplantation. | 11-20-2014 |
20140348819 | Methods of Treating Cancer - The present invention provides methods of treating cancer. | 11-27-2014 |
20140348820 | IMMUNOGLOBULINS WITH REDUCED AGGREGATION - The present disclosure relates to immunoglobulins with reduced aggregation and compositions, methods of generating such immunoglobulins with computational tools and methods of using such immunoglobulins particularly in the treatment and prevention of disease. | 11-27-2014 |
20140348821 | Defective Mismatch Repair and Benefit from Bevacizumab for Colon Cancer - Methods of testing to identify and to treat a subset of colon cancer patients exhibiting dMMR tumor tissue, who derive significant clinical benefit from the addition of bevacizumab to standard adjuvant chemotherapy. The presence of a V600E BRAF mutation is also of significance. | 11-27-2014 |
20140348822 | Methods and Compositions to Treat and Detect Misfolded-SOD1 Mediated DIseases - The invention provides a method for treating a medical condition, disease, or disorder mediated by a misfolded form of superoxide dismutase (SOD) in a subject in need of treatment. The method optionally comprises administering to the subject a composition comprising a pharmaceutically acceptable vehicle and an agent selected from (1) an exogenous antibody or fragment thereof that binds selectively to the misfolded form of SOD, and/or (2) an immunogen that elicits production of an endogenous antibody that binds selectively to the misfolded form of SOD, and/or (3) a nucleic acid sequence encoding (1) or (2). In certain embodiments, the invention provides methods of treating diseases such as Alzheimer's Disease, Parkinson's Disease or amyotrophic lateral sclerosis using amyotrophic disease-specific epitopes, and compositions including these epitopes. The invention also provides antibodies that bind to monomeric or misfolded SOD1, and not on the molecular surface of native homodimeric SOD1. In addition, the invention includes methods of diagnosing Alzheimer's Disease, Parkinson's Disease or amyotrophic lateral sclerosis in a subject. Also, the invention provides methods of identifying substances for the treatment or prevention of Alzheimer's Disease, Parkinson's Disease or amyotrophic lateral sclerosis and kits using the binding proteins of the invention. | 11-27-2014 |
20140348823 | Histone Deacetylase (HDAC) Inhibitors for the Treatment of Cancer - The present invention relates generally to methods for treating cancer. In one respect, the present invention relates to a method of treating a hematological cancer (e.g., multiple myeloma, leukemia, lymphoma) comprising administering to a patient in need thereof a therapeutically effective amount of a histone deacetylase inhibitor, for example, a histone deacetylase (HDAC) inhibitor as described herein, for example, PXD-101. In another respect, the present invention relates to a method of treating cancer (e.g., solid tumour cancer, e.g., rectal cancer, colon cancer, ovarian cancer, hematological cancer, e.g., multiple myeloma, leukemia, lymphoma) comprising administering to a patient in need thereof, a first amount of a histone deacetylase (HDAC) inhibitor, for example, a histone deacetylase inhibitor as described herein, for example, PXD-101, and a second amount of another chemotherapeutic agent, for example, another chemotherapeutic agent selected from: an antibody against VEGF, AVASTIN® (bevacizumab), an antibody against CD20, rituximab, bortezomib, thalidomide, dexamethasone, vincristine, doxorubicin, and melphalan, wherein the first and second amounts together comprise a therapeutically effective amount. | 11-27-2014 |
20140356349 | BIOMARKERS OF RESISTANCE TO HER2 INHIBITORS - Provided is a method of suppressing resistance to an anticancer drug, comprising administering an inhibitor of expression or activity of ECM 1 (Extracellular Matrix Protein 1) to a cancer cell or an individual with cancer. | 12-04-2014 |
20140356350 | COMBINATION THERAPY TO PREVENT DCIS FORMATION AND PROGRESSION TO BREAST CANCER - A method of treating a ductal carcinoma in situ (DCIS) lesion in a subject in need thereof is disclosed. The method comprises administering to the subject a therapeutically effective amount of a first agent capable of down-regulating activity and/or expression of at least one component participating in a NOTCH pathway, and a second agent capable of down-regulating an activity and/or expression of HER2, thereby treating the DCIS lesion. | 12-04-2014 |
20140356351 | METHODS OF TREATING PROGRESSIVE FORMS OF MULTIPLE SCLEROSIS - The present disclosure relates to methods of treating individuals suffering from progressive forms of multiple sclerosis. | 12-04-2014 |
20140356352 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH A CD79b ANTIBODY-DRUG CONJUGATE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with a CD79b antibody-drug conjugate for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and a CD79b antibody-drug conjugate. | 12-04-2014 |
20140356353 | TARGETED BINDING AGENTS AGAINST B7-H1 - Human monoclonal antibodies directed against B7-H1 and uses of these antibodies in diagnostics and for the treatment of diseases associated with the activity and/or expression of B7-H1 are disclosed. Additionally, hybridomas or other cell lines expressing such antibodies are disclosed. | 12-04-2014 |
20140356354 | THERAPY FOR FILOVIRUS INFECTION - The present invention addresses a need for improved treatments for filovirus infections. | 12-04-2014 |
20140356355 | IL-17 RECEPTOR A ANTIGEN BINDING PROTEINS - The present invention relates to IL-17 Receptor A (IL-17RA or IL-17R) antigen binding proteins, such as antibodies, polynucleotide sequences encoding said antigen binding proteins, and compositions and methods for diagnosing and treating diseases mediated by IL-17 Receptor A activation by one or more IL-17 ligands. The present invention relates to the identification of neutralizing determinants on IL-17 Receptor A (IL-17RA or IL-17R) and antibodies that bind thereto. Aspects of the invention also include antibodies that compete for binding with the IL-17RA neutralizing antibodies described herein. | 12-04-2014 |
20140356356 | Use of IL-1 beta Binding Antibodies - The present invention relates to an IL-1β binding antibody or a functional fragment thereof for use in preventing or reducing risk of experiencing a recurrent cardiovascular (CV) event or a cerebrovascular event in a patient that has suffered of a qualifying CV event. | 12-04-2014 |
20140356357 | COMPOUNDS AND METHODS FOR TREATING INFLAMMATORY DISEASES - A monoclonal secretory IgA antibody, which binds to and neutralizes human TNFα. The secretory antibody is useful in treating a variety of inflammatory conditions in humans. | 12-04-2014 |
20140356358 | VARIANT FC-POLYPEPTIDES WITH ENHANCED BINDING TO THE NEONATAL FC RECEPTOR - Described herein are variant Fc-fragments that contain an insertion within or adjacent to a loop that bind to the neonatal Fc receptor (FcRn) with higher affinity and/or higher binding activity at pH 5-6 and approximately the same or lower affinity at a physiologic pH as compared to a control Fc-fragment, that is, little or no binding activity at a physiologic pH. Also described are variant Fc-polypeptides that comprise these variant Fc-fragments. Further described are methods of making and identifying such Fc-fragments and methods for making and using such Fc-polypeptides. | 12-04-2014 |
20140356359 | HUMAN GROWTH HORMONE RECEPTOR ANTAGONIST ANTIBODIES AND METHODS OF USE THEREOF - The present invention provides antagonizing antibodies that bind to growth hormone receptor (GHR). The invention further relates to therapeutic methods for use of these antibodies to reduce IGF-1 levels and/or for the treatment and/or prevention of diseases associated with excessive IGF-1, including treatment of acromegaly, gigantism, cancer, diabetic nephropathy, arthritis, and lung inflammation. | 12-04-2014 |
20140356360 | PIPERAZINYL DERIVATIVES FOR THE TREATMENT OF CANCER - The present invention relates to piperazinyl derivatives of formula (I) and the use thereof as a drug, particularly for the treatment of cancer, the pharmaceutical compositions containing said derivatives, and the method for synthesising same. | 12-04-2014 |
20140363423 | PEPTIDE COMPOUNDS FOR INHIBITION OF PLATELET AGGREGATION - The invention relates to a peptide compound and its pharmaceutical composition for inhibiting platelet aggregation and preventing/treating thrombogenic diseases. The invention develops pentapeptides and hexapeptides derived from snake venom C-type lectin-like proteins (CLPs) fragments, which can inhibit platelet aggregation and have antithrombotic activity without hemorrhagic tendency. Accordingly, they can be used as potential agents for the prevention and therapy of thrombogenic diseases. | 12-11-2014 |
20140363424 | USE OF CHIMERIC ANTI-CD20 ANTIBODY AS IN VITRO OR IN VIVO PURGING AGENT IN PATIENTS RECEIVING BMT OR PBSC TRANSPLANT - The use of anti-CD | 12-11-2014 |
20140363425 | SYSTEMS AND METHODS FOR IDENTIFYING CANCERS HAVING ACTIVATED PROGESTERONE RECEPTORS - Systems and methods for identifying tumors having activated progesterone receptors are provided. Patients suspected of having a tumor susceptible to growth inhibition by anti-progestins can be treated with an anti-progestin. | 12-11-2014 |
20140363426 | HETERODIMERIC PROTEINS - In one aspect, the present invention provides heterodimeric antibodies comprising a first monomer comprising a first heavy chain constant domain comprising a first variant Fc domain and a first antigen binding domain and a second monomer comprising a second heavy chain constant domain comprising a second variant Fc domain and a second antigen binding domain. In an additional aspect the heterodimeric antibody comprises a first monomer comprising a heavy chain comprising a first Fc domain and a single chain Fv region (scFv) that binds a first antigen, wherein the scFv comprises a charged scFv linker. The heterodimeric antibody further comprises a second monomer comprising a first heavy chain comprising a second Fc domain and a first variable heavy chain and a first light chain. | 12-11-2014 |
20140363427 | ANTI-HUMAN RESPIRATORY SYNCYTIAL VIRUS (RSV) ANTIBODIES AND METHODS OF USE - Provided herein are antibodies or antigen-binding fragments thereof that immunospecifically bind to the fusion (F) protein of Respiratory Syncytial Virus (RSV). Also provided are methods for of prevention, treatment and diagnosis of viral infection and/or the treatment of one more symptoms of RSV-mediated disease. Methods of generating antibodies that immunospecifically bind RSV F protein also are provided. | 12-11-2014 |
20140363428 | THERAPEUTIC ANTIGEN-BINDING MOLECULE WITH A FcRn-BINDING DOMAIN THAT PROMOTES ANTIGEN CLEARANCE - The present invention provides: a modified FcRn-binding domain having an enhanced affinity for the Fc Receptor neonatal (FcRn) at neutral pH; an antigen-binding molecule comprising said FcRn-binding domain, which has low immunogenicity, high stability and form only a few aggregates; a modified antigen-binding molecule having an increased FcRn-binding activity at neutral or acidic pH without an increased binding activity at neutral pH for a pre-existing anti-drug antibody; use of the antigen-binding molecules for improving antigen-binding molecule-mediated antigen uptake into cells; use of the antigen-binding molecules for reducing the plasma concentration of a specific antigen; use of the modified FcRn-binding domain for increasing the total number of antigens to which a single antigen-binding molecule can bind before its degradation; use of the modified FcRn-binding domain for improving pharmacokinetics of an antigen-binding molecule; methods for decreasing the binding activity for a pre-existing anti-drug antibody; and methods for producing said antigen-binding molecules. | 12-11-2014 |
20140363429 | BINDING MOLECULES SPECIFIC FOR HER3 AND USES THEREOF - The present invention relates to antibodies and antigen binding fragments thereof that bind the extracellular domain of the HER3 receptor and inhibit various HER3 receptor related functions via ligand-dependent and/or ligand-independent mechanisms. Also provided are compositions with increased half-life. In addition, the invention provides compositions and methods for diagnosing and treating diseases associated with HER3 mediated signal transduction. | 12-11-2014 |
20140370001 | IgE ANTIBODIES FOR THE INHIBITION OF TUMOR METASTASIS - The present invention provides novel IgE antibodies useful for inhibiting or preventing metastatic cancer. Also provided are methods to inhibit tumor metastasis by modulating the activity of at least one non-tumor cell, treating a patient to inhibit or prevent tumor metastases of a primary solid tumor, treating metastatic carcinoma, reducing metastasis of carcinoma cells, and reducing the growth kinetics of a primary solid tumor or a metastasized cell or tumor. | 12-18-2014 |
20140370002 | METHODS FOR THE TREATMENT OF GOUT - Disclosed are methods for the treatment and/or prevention of gout, comprising administering to a subject an effective amount of anti-IL-1β antibody or fragment thereof. | 12-18-2014 |
20140370003 | PROCESS FOR CONCENTRATION OF ANTIBODIES AND THERAPEUTIC PRODUCTS THEREOF - The present disclosure provides a process for concentrating proteins including an ultrafiltering, a diafiltering, and a second ultrafiltering sequence, at elevated temperatures, such as above about 30° C. The disclosure also includes a process for preparing highly concentrated antibody compositions, and highly concentrated antibody products. | 12-18-2014 |
20140370004 | METHOD OF BOOSTING THE IMMUNE RESPONSE IN NEONATES - In an aspect, a method of augmenting an immune response in a subject in need thereof, comprising identifying the subject, and treating the subject to inhibit the immune suppressive effect of CD71 | 12-18-2014 |
20140370005 | COMPOUNDS AND COMPOSITIONS FOR USE IN PHOTOTHERAPY AND IN TREATMENT OF OCULAR NEOVASCULAR DISEASE AND CANCERS - The invention relates generally to anti-angiogenesis agents and related methods of using to anti-angiogenesis agents for biomedical applications including direct monotherapy and combination therapy for treatment of an angiogenesis related condition. In an embodiment, the invention provides a class of opioid compounds and structurally related opioid derivatives exhibiting anti-VEGF activity for use in therapeutic procedures, including phototherapy. Opioid compounds and structurally related opioid derivatives of the invention may be administered alone or in combination with administration of a phototherapy agent and/or other therapeutic agent. | 12-18-2014 |
20140370006 | COMPOUNDS AND COMPOSITIONS FOR USE IN PHOTOTHERAPY AND IN TREATMENT OF OCULAR NEOVASCULAR DISEASE AND CANCERS - The invention relates generally to anti-angiogenesis agents and related methods of using to anti-angiogenesis agents for biomedical applications including direct monotherapy and combination therapy for treatment of an angiogenesis related condition. In an embodiment, the invention provides a class of opioid compounds and structurally related opioid derivatives exhibiting anti-VEGF activity for use in therapeutic procedures, including phototherapy. Opioid compounds and structurally related opioid derivatives of the invention may be administered alone or in combination with administration of a phototherapy agent and/or other therapeutic agent. | 12-18-2014 |
20140370007 | METHOD OF DIRECTED DIFFERENTIATION PRODUCING CORNEAL ENDOTHELIAL CELLS, COMPOSITIONS THEREOF, AND USES THEREOF - This disclosure generally relates to cell-based therapies for treatment of visual disorders, including disorders of the cornea. Methods are exemplified for directed differentiation of corneal cells from stem cells. Compositions of corneal endothelial cells and uses thereof are also provided. Exemplary compositions exhibit improved cell density and/or more “youthful” gene expression relative to cells obtained from donated tissue. | 12-18-2014 |
20140370008 | THROMBIN-BINDING ANTIBODY MOLECULES AND USES THEREOF - This invention relates to isolated antibodies which recognise the exosite 1 epitope of thrombin and selectively inhibit thrombin without promoting bleeding. These antibody molecules may be useful in the treatment and prevention of thrombosis, embolism and other conditions mediated by thrombin. | 12-18-2014 |
20140370009 | THERAPEUTIC NANOPARTICLES AND METHODS OF USE THEREOF - Provided herein are therapeutic nanoparticles having a diameter of between 10 nm to 30 nm, and containing a polymer coating, and a nucleic acid containing a sequence complementary to a sequence within a micro-RNA identified as having a role in cancer cell metastasis or anti-apoptotic activity in a cancer cell (e.g., miR-10b) or a sequence within an mRNA encoding a pro-apoptotic protein that is covalently linked to the nanoparticle. Also provided are pharmaceutical compositions containing these therapeutic nanoparticles. Also provided herein are methods of decreasing cancer cell invasion or metastasis in a subject having a cancer and methods of treating a metastatic cancer in a lymph node in a subject that require the administration of these therapeutic nanoparticles to a subject. | 12-18-2014 |
20140370010 | TREATMENT OF LEUKEMIAS AND CHRONIC MYELOPROLIFERATIVE DISEASES WITH ANTIBODIES TO EPHA3 - The invention provides methods and compositions comprising anti-EphA3 antibodies for the treatment of myeloproliferative disorders. | 12-18-2014 |
20140370011 | METHODS OF TREATING OR PREVENTING COGNITIVE IMPAIRMENT USING INDANE ACETIC ACID DERIVATIVES - The present invention provides indane acetic acid and their derivatives and methods for the treating and/or preventing of cognitive disorders. | 12-18-2014 |
20140377251 | FORMULATION FOR ANTI-ALPHA4BETA7 ANTIBODY - Antibody formulations are described comprising a mixture of a non-reducing sugar, an anti-α4β7 antibody and at least one amino acid. The disclosed formulations have improved stability, reduced aggregate formation, and may retard degradation of the anti-α4β7 antibody therein or exhibit any combinations thereof. The present invention further provides a safe dosing regimen of these antibody formulations that is easy to follow, and which results in a therapeutically effective amount of the anti-α4β7 anti body in vivo. | 12-25-2014 |
20140377252 | METHOD FOR PREDICTING THE RESPONSE TO TREATMENT WITH AN HER2-BLOCKING AGENT - The invention relates in particular to an in vitro or ex vivo method for predicting the response of a patient to treatment with at least one HER2-blocking agent, said method including the steps of: i) identifying the nucleotide at the rs3746083 polymorphic site, for at least one allele, in particular the two alleles of the gene coding the tristetraprolin protein, in a biological sample from said patient; and/or ii) determining the concentration of the tristetraprolin protein in a biological sample from said patient, wherein said patient is suffering from HER2-positive cancer. | 12-25-2014 |
20140377253 | FC VARIANTS - The present disclosure relates to polypeptide variants having modified Fc domains with altered affinity to Fc receptors. | 12-25-2014 |
20140377254 | SUBTYPES OF HUMANIZED ANTIBODY AGAINST INTERLEUKIN-6 RECEPTOR - An antibody subtype (1) which is a subtype of the humanized PM-1 antibody against interleukin-6 receptor (IL-6R) and in which one C-terminal of the heavy chain is Pro-NH | 12-25-2014 |
20140377255 | 4-1BB BINDING MOLECULES - The present disclosure provides isolated binding molecules that bind to human 4-1BB, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions. | 12-25-2014 |
20140377256 | OPTIMIZED FC VARIANTS AND METHODS FOR THEIR GENERATION - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 12-25-2014 |
20140377257 | COMBINATION THERAPY FOR B CELL DISORDERS - The invention provides methods of treating B cell based malignancies and B-cell regulated autoimmune disorders using a combination therapy of anti-CD20 antibody with a BLyS antagonist. | 12-25-2014 |
20140377258 | Treatment Of Cancers Using PI3 Kinase Isoform Modulators - Provided herein are methods, kits, and pharmaceutical compositions that include a PI3 kinase inhibitor for treating cancers or hematologic disorders. | 12-25-2014 |
20140377259 | METHODS FOR INHIBITING HIV-1 REPLICATION INVOLVING THE ADMINISTRATION OF AN ANTI-CCR5 RECEPTOR MONOCLONAL ANTIBODY AND SMALL MOLECULE CCR5 RECEPTOR ANTAGONIST - This method provides a method for reducing HIV-1 viral load in an HIV-1-infected human subject which comprises administering to the subject at a predefined interval effective HIV-1 viral load-reducing doses of (a) a humanized antibody designated PRO 140, or of (b) an anti-CCR5 receptor monoclonal antibody. This invention also provides a method for inhibiting in a human subject the onset or progression of an HIV-1-associated disorder, the inhibition of which is effected by inhibiting fusion of HIV-1 to CCR5 | 12-25-2014 |
20140377260 | PROTECTIVE VACCINE BASED ON STAPHYLOCOCCUS AUREUS SA2074 PROTEIN - The present invention relates to methods of inducing an immune response to | 12-25-2014 |
20140377261 | VACCINES AGAINST ANTIGENS INVOLVED IN THERAPY RESISTANCE AND METHODS OF USING SAME - Methods of reducing the likelihood of a cancer or precancer developing resistance to a cancer therapeutic or prevention agent are provided herein. The methods include administering the cancer therapeutic or prevention agent and a vaccine comprising a polynucleotide encoding a polypeptide whose expression or activation is correlated with development of resistance of the cancer or precancer to the cancer therapeutic or prevention agent to a subject. The vaccine may include a polynucleotide encoding a HER3 polypeptide. Methods of using the vaccine including the polynucleotide encoding the HER3 polypeptide to treat a cancer or precancer are also provided. | 12-25-2014 |
20140377262 | HUMAN MONOCLONAL ANTIBODIES BROADLY PROTECTIVE AGAINST INFLUENZA B VIRUS AND METHODS OF USING THE SAME - Materials and methods are provided for treating influenza B infections in humans. Anti-human influenza virus monoclonal antibodies and antigen-binding fragments thereof having a neutralization activity against a human influenza B virus are provided. Methods for producing anti-human influenza B virus monoclonal antibodies are also provided. The antibodies and antigen-binding fragments thereof can be effective against a wide range of influenza B viral strains. Methods of inhibiting or treating a human influenza B infection are provided. The anti-influenza B therapeutics can also be used to manufacture medicaments effective against influenza B infections, to detect human influenza B in a human subject, for use in pharmaceutical compositions, and for use in kits for at least one of the prevention, the treatment, and the detection of human influenza B in a human subject. | 12-25-2014 |
20150010536 | Humanized PAI-1 Antibodies and Uses Thereof - The present application relates to compositions of humanized anti-PAI-1 antibodies and antigen-binding fragments thereof which convert PAI-1 to its latent form. One aspect relates to antibodies having one or more modifications in at least one amino acid residue of at least one of the framework regions of the variable heavy chain, the variable light chain or both. Another aspect relates to antibodies which bind and neutralize PAI-1 by converting PAI-1 to its latent form or increasing proteolytic cleavage. Another aspect relates to the use of humanized antibodies which inhibit or neutralize PAI-1 for the detection, diagnosis or treatment of a disease or condition associated with PAI-1 or a combination thereof. | 01-08-2015 |
20150010537 | GENETIC VARIATIONS ASSOCIATED WITH TUMORS - Nucleotide and amino acid variations associated with tumors are provided. Methods for detecting variations and for diagnosing and treating tumors are provided. | 01-08-2015 |
20150010538 | ANTI-CD25 ANTIBODIES AND THEIR USES - The present disclosure relates to antibodies directed to CD25 and uses of such antibodies, for example to suppress organ transplant rejection or to treat multiple sclerosis. | 01-08-2015 |
20150010539 | ANTI-CD25 ANTIBODIES AND THEIR USES - The present disclosure relates to antibodies directed to CD25 and uses of such antibodies, for example to suppress organ transplant rejection or to treat multiple sclerosis. | 01-08-2015 |
20150010540 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH A CD22 ANTIBODY-DRUG CONJUGATE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with a CD22 antibody-drug conjugate for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and a CD22 antibody-drug conjugate. | 01-08-2015 |
20150010541 | Macrocyclic Compounds Useful as Inhibitors of Histone Deacetylases - The present invention provides a novel macrocyclic compound of general Formula (I) having histone deacetylase (HDAC) inhibitory activity, a pharmaceutical composition comprising the compound, and a method useful to treat diseases using the compound. | 01-08-2015 |
20150010542 | ANTIBODIES TO TOSO - The present invention provides methods and compositions for modulating Toso activity and treating diseases and disorders in which Toso is implicated. Such methods and compositions include the use of one or more antibodies that bind to a Toso protein or to a ligand of a Toso protein. | 01-08-2015 |
20150010543 | OPTIMIZED Fc VARIANTS - The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants. | 01-08-2015 |
20150010544 | COMPOUNDS AND METHODS FOR TREATING INFLAMMATORY DISEASES - A monoclonal secretory IgA antibody, which binds to and neutralizes human p40 (the p40 subunit of IL-12 and IL-23). The secretory antibody is useful in treating a variety of inflammatory conditions in humans. | 01-08-2015 |
20150010545 | METHODS FOR TREATMENT OF BREAST CANCER NONRESPONSIVE TO TRASTUZUMAB - The present invention provides a method of treating breast cancer that is nonresponsive to treatment with trastuzumab, comprising administering to a subject in need of such treatment a therapeutically effective amount of compound N-(3,4-dichloro-2-fluorophenyl)-7-({[(3aR,6aS)-2-methyloctahydrocyclopenta[c]pyrrol-5-yl]methyl}oxy)-6-(methyloxy)quinazolin-4-amine, or a pharmaceutically acceptable salt thereof. | 01-08-2015 |
20150010546 | SEQUENCES DIRECTED AGAINST HEPATOCYTE GROWTH FACTOR (HFG) AND POLYPEPTIDES COMPRISING THE SAME FOR THE TREATMENT OF CANCERS AND/OR TUMORS - The present invention relates to biological materials against HGF and more in particular to polypeptides, nucleic acids encoding such polypeptides; to methods for preparing such polypeptides; to host cells expressing or capable of expressing such polypeptides; to compositions and in particular to pharmaceutical compositions that comprise such polypeptides, for prophylactic, therapeutic or diagnostic purposes. In particular, the biological materials of the present invention inhibit binding of HGF to its receptor c-Met. | 01-08-2015 |
20150010547 | TREATMENT OF ALLERGIC DISEASES WITH RECOMBINANT ANTIBODIES - Recombinant antibodies (including binding fragments thereof) that bind IgE are described, along with compositions and methods of using the same in the treatment of subjects in need thereof, including subjects afflicted with atopic dermatitis, allergic rhinitis, allergic conjunctivitis, urticaria, gastro-intestinal inflammation, or oral-pharyngeal inflammation. In some embodiments, the antibody is a single chain variable fragment (scFv) or a disulfide linked variable fragment (sdFv). In some embodiments, the subject is a dog, cat, or horse. | 01-08-2015 |
20150010548 | Stabilized Aqueous Antibody Compositions - The present invention provides an aqueous solution comprising an antibody protein at a concentration of at least about 10 mg/mL and an oligomer of ethyleneimine, wherein the number of repeating units of ethyleneimine (n) in the oligomer is in the range n=2-12. | 01-08-2015 |
20150010549 | Methods of Treating Amyotrophic Lateral Sclerosis - The present invention relates to use of DHA analogs and their pharmaceutical compositions for treating ALS, by administering these compounds or pharmaceutical compositions to subjects in need thereof. | 01-08-2015 |
20150010550 | OPTIMIZED Fc VARIANTS - The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants. | 01-08-2015 |
20150010551 | Compositions and Methods of Treating Tumors - Methods of treating an individual who has an erbB protein mediated tumor is disclosed. Methods of preventing erbB protein mediated tumors in an individual are disclosed. The methods comprise administering to the individual a nucleic acid molecule that encodes a protein that dimerizes with an erbB protein and that is deficient in tyrosine kinase activity. Composition that comprise such nucleic acid molecules including pharmaceutical compositions are disclosed. | 01-08-2015 |
20150010552 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATION AND FIBROSIS - The present invention features compositions featuring agents that bind to denatured collagen and methods of using such agents to treat or prevent fibrosis or inflammation in a subject. | 01-08-2015 |
20150010553 | METHODS OF TREATING INFLAMMATORY DISEASES USING ANTIBODIES THAT BIND BOTH IL-17A AND IL-17F - The present invention relates to blocking, inhibiting, reduceing, antagonizing or neutralizing the activity of IL-17A and IL-17F. IL-17A and IL-17F are cytokines that are involved in inflammatory processes and human disease. The present invention includes antibodies that bind both IL-17A and IL-17F, hybridomas that produce the antibodies, and methods of using the same in inflammation. | 01-08-2015 |
20150010554 | METHODS FOR TREATING INTERLEUKIN-6 RELATED DISEASES - A pharmaceutical composition for the treatment of interleukin-6 (IL-6) related diseases, comprising an interleukin-6 antagonist (IL-6 antagonist) and immunosuppressants. The IL-6 antagonist is preferably an antibody to an interleukin-6 receptor (IL-6R). | 01-08-2015 |
20150017153 | MONOCLONAL ANTIBODIES THAT NEUTRALIZE ANTHRAX TOXINS - The present invention relates to monoclonal antibodies that bind or neutralize anthrax lethal factor (LF), edema factor (EF), and/or protective antigen (PA). The invention provides such antibodies, fragments of such antibodies retaining anthrax toxin-binding ability, fully human or humanized antibodies retaining anthrax toxin-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 01-15-2015 |
20150017154 | ANTI-NERVE GROWTH FACTOR ANTIBODIES AND METHODS OF PREPARING AND USING THE SAME - A method of preparing an antibody suitable for use in a canine is provided. Also provided are caninised antibodies which specifically bind to canine neuronal growth factor (NGF) and neutralise the ability of canine NGF to bind to the p75 or TrkA canine NGF receptor. The invention extends to nucleic acids encoding same and to methods of treating pain and arthritis in a canine using said antibodies and/or nucleic acids. | 01-15-2015 |
20150017155 | AGLYCOSYL ANTI-CD154 (CD40 LIGAND) ANTIBODIES AND USES THEREOF - The invention relates to aglycosyl anti-CD154 antibodies or antibody derivatives, characterized by a modification at the conserved N-linked site in the C | 01-15-2015 |
20150017156 | ESX-MEDIATED TRANSCRIPTION MODULATORS AND RELATED METHODS - The present invention relates to gene regulation. In particular, the present invention provides small compounds capable of modulating ESX-mediated transcription and related methods of therapeutic and research use. In addition, the present invention provides methods for treating conditions associated with aberrant EGFR expression with ESX-mediated transcription modulators (e.g., ESX-mediated transcription inhibitors). | 01-15-2015 |
20150017157 | METHODS FOR TREATING ACNE - The present disclosure relates to methods and materials for treating acne in a subject including, for example, moderate and/or severe acne, using anti-IL-1β binding molecules such as an anti-IL-1β antibody or binding fragment thereof. | 01-15-2015 |
20150017158 | TETRAHYDROFOLATES IN COMBINATION WITH EGFR-INHIBITORS - The present invention relates a pharmaceutical composition comprising an EGFR inhibitor and methylene-tetrahydrofolate, tetrahydrofolate or methyl-tetrahydrofolate, for use in the treatment of cancer. The methylene-tetrahydrofolate, tetrahydrofolate or methyl-tetrahydrofolate enhances the anticancer efficacy of the EGFR inhibitor. The cancers that may be treated include breast cancer, gastric cancer, gastrointestinal cancer, gall bladder cancer, bile duct cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, head and neck cancer, esophageal cancer, mesothelioma cancer, lung cancer including non-small-cell lung cancer, ovarian cancer, endometrial cancer, cervical cancer, peripheral T-cell lymphoma (PTCL), melanoma, brain tumors, adenocarcinoma, esophageal cancer, and osteosarcoma | 01-15-2015 |
20150017159 | MONOCYTE BIOMARKERS FOR CANCER DETECTION - The disclosure relates to the field of biomarkers to diagnose a disease, more particularly to the field of biomarkers to diagnose cancer, and most particularly to colorectal cancer. Specifically, these biomarkers are expressed in monocytes of a subject, particularly circulating monocytes, as can be isolated from peripheral blood. The markers are particularly useful for early detection of cancer. | 01-15-2015 |
20150017160 | COMBINATIONS AND USES THEREOF - The present disclosure describes a pharmaceutical combination of an anti-CD38 antibody and lenalidomide and a pharmaceutical combination of an anti-CD38 antibody and bortezomib. | 01-15-2015 |
20150023951 | ANTI-VEGF ANTIBODIES - Humanized and variant anti-VEGF antibodies and various uses therefor are disclosed. The anti-VEGF antibodies have strong binding affinities for VEGF; inhibit VEGF-induced proliferation of endothelial cells in vitro; and inhibit tumor growth in vivo. | 01-22-2015 |
20150023952 | ANTI-ADDL MONOCLONAL ANTIBODY AND USES THEREOF - The present invention relates to antibodies that bind amyloid β-derived diffusible ligands, also known as ADDLs. The antibodies of the invention are selective for ADDLs, can penetrate the brain, and are useful in methods of detecting ADDLs and diagnosing Alzheimer's disease. The present antibodies also block binding of ADDLs to neurons, assembly of ADDLS, and tau phosphorylation and are there useful in methods for the preventing and treating diseases associated with ADDLs. | 01-22-2015 |
20150023953 | METHOD OF TREATING CANCER - Methods are provided for treating cancer in a patient in need thereof with a HER2 inhibitor, where such patients have certain polymorphisms in VEGFA, VEGFR or IGF1R. | 01-22-2015 |
20150023954 | POTENTIATING ANTIBODY-INDUCED COMPLEMENT-MEDIATED CYTOTOXICITY VIA PI3K INHIBITION - Methodologies and technologies for potentiating antibody-based cancer treatments by increasing complement-mediated cell cytotoxicity are disclosed. Further provided are methodologies and technologies for overcoming ineffective treatments correlated with and/or caused by sub-lytic levels of complement-activating monoclonal antibodies (“mAb”) against cancer antigens or cancer antigens with low tumor cell density. While detectable levels of passively administered or vaccine-induced mAb against some antigens are able to delay or prevent tumor growth, low levels of mAb induce sublytic levels of complement activation and accelerate tumor growth. This complement-mediated accelerated tumor growth initiated by low mAb levels results in activation of the PI3K/AKT survival pathway. Methodologies and technologies relating to administration of PI3K inhibitors to overcome low dose mAb-initiated, complement-mediated PI3K activation and accelerated tumor growth are disclosed. | 01-22-2015 |
20150023955 | Treatment and Diagnosis of Melanoma - The present invention discloses novel agents and methods for diagnosis and treatment of melanoma. Also disclosed are related arrays, kits, and screening methods. | 01-22-2015 |
20150030585 | COMPOSITIONS INCLUDING TRICIRIBINE AND ONE OR MORE PLATINUM COMPOUNDS AND METHODS OF USE THEREOF - This application encompasses combination therapies including triciribine and related compounds and one or more platinum compounds and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 01-29-2015 |
20150030586 | COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF CANCER - Compositions and methods for the therapy and diagnosis of cancer are disclosed. For example, illustrative compositions comprise one or more cancer-associated antibodies, polypeptides, polynucleotides, antigen presenting cells, and the like. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly cancer. | 01-29-2015 |
20150030587 | HUMAN PAPILLOMA VIRUS AS PREDICTOR OF CANCER PROGNOSIS - Methods of treating a head and neck cancer are disclosed. | 01-29-2015 |
20150030588 | COMBINATION OF KINASE INHIBITORS AND USES THEREOF - The present invention provides for a method for treating a disease condition associated with PI3-kinase a and/or a receptor tyrosine kinase (RTK) in a subject. In another aspect, the invention provides for a method for treating a disease condition associated with PI3-kinase α and/or an RTK in a subject. In yet another aspect, a method of inhibiting phosphorylation of Akt (S473) in a cell is set forth. | 01-29-2015 |
20150030589 | ABETA ANTIBODY FORMULATION - The present invention relates to a pharmaceutical formulation comprising about 50 mg/ml-200 mg/ml of an Abeta antibody, about 0.01%-0.1% poloxamer, about 5 mM-50 mM of a buffer, about 100 mM-300 mM of a stabilizer at a pH of about 4.5-7.0. | 01-29-2015 |
20150030590 | TREATMENT OF SEVERE MULTIPLE SCLEROSIS - Methods of treating multiple sclerosis are disclosed. | 01-29-2015 |
20150030591 | HIGH CONCENTRATION ANTIBODY AND PROTEIN FORMULATIONS - Provided are salt-free antibody and other protein formulations that are substantially isosmotic and of low viscosity. Also provided are methods for the treatment of diseases using the disclosed formulations. | 01-29-2015 |
20150030592 | OPTIMIZED Fc VARIANTS - The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants. | 01-29-2015 |
20150037319 | METHOD FOR PREPARING A COMPOSITION COMPRISING HIGHLY CONCENTRATED ANTIBODIES BY ULTRAFILTRATION - The present invention provides a method for preparing a composition comprising highly concentrated antibodies by ultrafiltration in batch concentration mode having a first constant feed rate step and a second controlled feed rate step. | 02-05-2015 |
20150037320 | TREATMENT OF MACROPHAGE-RELATED DISORDERS - The present invention provides a method of treating a macrophage related disease comprising administering to a subject in need thereof an effective amount of an oxidative agent or an immunosuppressive agent. The present invention also provides a method of modulating macrophage accumulation or activation comprising administering to a subject in need thereof an effective amount of an oxidative agent or an immunosuppressive agent. The oxidative agent can be chlorite or a chlorite containing compound. | 02-05-2015 |
20150037321 | METHODS AND COMPOSITIONS FOR INHIBITING CD32B EXPRESSING CELLS - The present invention relates to immunoglobulins that bind FcγRIIb+ cells and coengage the antigen on the cell's surface and an FcγRIIb on the cell's surface, methods for their generation, and methods for using the immunoglobulins. | 02-05-2015 |
20150037322 | METHODS AND COMPOSITIONS FOR INHIBITING CD32B EXPRESSING CELLS - The present invention relates to immunoglobulins that bind FcγRIIb+ cells and coengage the antigen on the cell's surface and an FcγRIIb on the cell's surface, methods for their generation, and methods for using the immunoglobulins. | 02-05-2015 |
20150037323 | HUMANIZED AXL ANTIBODIES - The present invention refers to monoclonal humanized antibodies, which bind to the extracellular domain of the AXL receptor tyrosine kinase and which at least partially inhibit AXL activity. | 02-05-2015 |
20150037324 | ANTIBODIES AND METHODS OF TREATING CANCER - Described herein are antibodies against GPR49 and uses of such antibodies. Various aspects relate to monoclonal, humanized, or fully human antibodies against GPR49, hybridomas or other cell lines expressing such antibodies, nucleic acids and vectors comprising nucleic acids encoding for such antibodies, and methods of treating cancer with such antibodies. | 02-05-2015 |
20150037325 | SLIT-ROBO SIGNALING FOR DIAGNOSIS AND TREATMENT OF KIDNEY DISEASE - Provided herein are methods for the treatment of chronic kidney disease and proteinuria and for the diagnosis of chronic kidney disease and monitoring the effects of treatment on the progression of chronic kidney disease and proteinuria based on unexpected roles for the SLIT-ROBO signaling pathway in the regulation of podocyte F-actin cytoskeleton and foot process structure in the kidney. | 02-05-2015 |
20150037326 | Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen - The present invention is directed to a pharmaceutical composition including (eg for use as an adjuvant) a polymeric carrier cargo complex, comprising as a carrier a polymeric carrier formed by disulfide-crosslinked cationic components and as a cargo at least one nucleic acid (molecule) and at least one antigen associated with a tumour or cancer disease selected from; an idiotype immunoglobulin (e.g. an idiotype antibody or an idiotype B cell receptor); or at least one idiotype T cell receptor, or in each case a fragment, variant and/or derivative thereof. The inventive pharmaceutical composition allows for efficient induction of an adaptive immune response directed against the idiotype immunoglobulin or T cell receptor, particularly of a Th1-shiftet immune response. The present invention furthermore provides kits or kits of parts comprising the components of the inventive pharmaceutical composition, as well as the use of the inventive pharmaceutical composition or the inventive kit as a vaccine, particularly in the therapy of a tumour or cancer disease such as lymphoma, particularly B cell or T cell lymphoma. | 02-05-2015 |
20150037327 | miRNA based treatment monitoring in multiple sclerosis - The present invention relates to methods of determining whether a patient responds to a therapeutic treatment of multiple sclerosis (MS), of monitoring the course of multiple sclerosis (MS) in a patient, of determining the risk for a relapse of multiple sclerosis (MS) in a patient, and of adjusting the dose of a therapeutic drug applied for therapeutic treatment of multiple sclerosis in a patient. Said methods are based on the determination of the level of at least one miRNA in a test sample isolated from the patient. The present invention also relates to a method of identifying a compound suitable for the treatment of multiple sclerosis in a patient. Further, the present invention relates to the use of a polynucleotide or a polynucleotide set for detecting a miRNA to determine whether a patient responds to a therapeutic treatment of multiple sclerosis, to monitor the course of multiple sclerosis in a patient, to determine the risk of a relapse of multiple sclerosis in a patient, to adjust the dose of a therapeutic drug applied for therapeutic treatment of multiple sclerosis in a patient, and to identify a compound suitable for the treatment of multiple sclerosis in a patient. Furthermore, the present invention relates to a kit for determining whether a patient responds to a therapeutic treatment of multiple sclerosis, for monitoring the course of multiple sclerosis in a patient, for determining the risk of a relapse of multiple sclerosis in a patient, for adjusting the dose of a therapeutic drug applied for therapeutic treatment of multiple sclerosis in a patient, or for identifying a compound suitable for the treatment of multiple sclerosis in a patient comprising means for determining the level of at least one miRNA in a test sample isolated from a patient. | 02-05-2015 |
20150037328 | ANTI-CXCR4 ANTIBODIES AND ANTIBODY-DRUG CONJUGATES - The present invention provides antibodies and related molecules that bind to chemokine receptor 4 (CXCR4). The invention further provides antibody-drug conjugates comprising such antibodies, antibody encoding nucleic acids, and methods of obtaining such antibodies. The invention further relates to therapeutic methods for use of these antibodies and anti-CXCR4 antibody-drug conjugates for the treatment of a disorder associated with CXCR4 function or expression (e.g., cancer), such as colon, RCC, esophageal, gastric, head and neck, lung, ovarian, pancreatic cancer or hematological cancers. | 02-05-2015 |
20150037329 | METHOD OF REDUCING TITERS OF ANTIBODIES SPECIFIC FOR A THERAPEUTIC AGENT - The present invention relates, in general, to a method of treating patients undergoing enzyme replacement therapy (ERT) or other therapy involving the administration of a proteinaceous therapeutic agent as well gene replacement therapy with non-viral or viral vectors, or other therapeutic modality or modalities, used alone or in combination, which involve the administration of exogenous substances for potential therapeutic benefit, including, but not limited to DNA vaccines, siRNA, splice-site switching oligomers (SSOs) as well as RNA-based nanoparticles (RNPs) and nanovaccines. The invention further relates to compounds and compositions suitable for use in such methods. | 02-05-2015 |
20150037330 | HISTAMINE-RELEASING FACTOR (HRF), HRF-RECEPTOR AND METHODS OF MODULATING INFLAMMATION - Methods of treating a food allergy, allergic reactions, hypersensitivity, inflammatory responses, inflammation are provided. In one method, histamine releasing factor (HRF)/translationally controlled tumor protein (TCTP) is contacted with a compound that inhibits or reduces binding of HRF/TCTP to an immunoglobulin in order to treat the food allergy, allergic reaction, hypersensitivity, inflammatory response, or inflammation. Methods of reducing or decreasing the probability, severity, frequency, duration or preventing a subject from having an acute or chronic food allergy, allergic reaction, hypersensitivity, an inflammatory response or inflammation, are also provided. In one method, histamine releasing factor (HRF)/translationally controlled tumor protein (TCTP) is contacted with a compound that inhibits or reduces binding of HRF/TCTP to an immunoglobulin in order to reduce or decrease the probability, severity, frequency, duration or prevent a subject from having an acute or chronic food allergy, allergic reaction, hypersensitivity, an inflammatory response or inflammation. | 02-05-2015 |
20150037331 | IL-31 MONOCLONAL ANTIBODIES - The present invention relates to methods of treating pruritic diseases, including but not limited to Contact dermatitis, Atopic Dermatitis, Drug induced delayed type cutaneous allergic reactions, Toxic epidermal necrolysis, Cutaneous T cell Lymphoma, Bullous pemphigoid, Alopecia wereata, Vitiligo, Acne Rosacea, Prurigo nodularis, Scleroderma, Herpes simplex virus, or combination thereof by administering IL-31 monoclonal antibodies. The invention provides the hybridomas that generate the monoclonal antibodies and the amino acid sequences of the variable regions of the monoclonal antibodies and chimeric antibodies comprising the amino acid sequences of the light and heavy chain variable regions. | 02-05-2015 |
20150037332 | TREATMENT OF METASTIC BREAST CANCER - The present invention concerns treatment of previously untreated HER2-positive metastatic breast cancer with a combination of a growth inhibitory HER2 antibody, a HER2 dimerization inhibitor antibody and a taxane. In particular, the invention concerns the treatment of HER2-positive metastatic breast cancer in patients who did not receive prior chemotherapy or biologic therapy with a HER2 antibody binding essentially to epitope 2C4, a HER2 antibody binding essentially to epitope 4D5, and a taxane. The invention further comprises extending survival of such patients by the combination therapy of the present invention. In a preferred embodiment, the treatment involves administration of trastuzumab, pertuzumab and docetaxel. | 02-05-2015 |
20150044197 | ANTIBODIES THAT SPECIFICALLY BIND TO THE EPHA2 RECEPTOR - The present disclosure relates to an antibody or an epitope-binding fragment thereof that specifically binds to an EphA2 receptor. It further relates to a conjugate comprising a cytotoxic agent which is covalently bound to the antibody and a method for preparing such a conjugate. | 02-12-2015 |
20150044198 | REDUCED-VISCOSITY CONCENTRATED PROTEIN FORMULATIONS - The present application concerns concentrated protein formulations with reduced viscosity, which are particularly suitable for subcutaneous administration. The application further concerns a method for reducing the viscosity of concentrated protein formulations. | 02-12-2015 |
20150044199 | COMPOSITIONS AND METHODS FOR TREATING TUMORS, FIBROSIS, AND PULMONARY ALVEOLAR PROTEINOSIS - The present disclosure provides pharmaceutical compositions and methods useful for modulating angiogenesis and for inhibiting metastasis, tumors, pulmonary alveolar proteinosis, and fibrosis in a mammalian tissue. Pharmaceutical compositions and methods include inhibitors of LOXL2 expression and activity, such as shRNA targeting LOXL2. | 02-12-2015 |
20150044200 | TREATMENT OF TINNITUS THROUGH MODULATION OF CHLORIDE CO-TRANSPORTER NKCC1 IN THE AUDITORY SYSTEM - The present invention relates to the treatment or prevention of tinnitus. More precisely, the present invention relates to a compound modulating chloride co-transporter NKCC1 (chloride co-transporter modulator) for use in the treatment of tinnitus. In addition, the present invention concerns pharmaceutical compositions comprising such an NKCC1 chloride co-transporter modulator as an active agent, a method for the treatment or prevention of tinnitus by administering such a chloride co-transporter modulator, and a screening method for the identification and characterization of compounds capable of modulating chloride co-transporter NKCC1. | 02-12-2015 |
20150044201 | CYCLON EXPRESSION FOR THE IDENTIFICATION AND CONTROL OF CANCER CELLS - The present disclosure concerns a method for the identification of the presence or absence of cancer cells in a biological sample, more particularly a method for the identification of the susceptibility or resistance to a treatment with CD20 agonists of cancer cells in a biological sample, the methods including determining the level of expression of the gene Cyclon in the cells and comparing the level of expression to the level of expression in a non-cancer cell, wherein a level of expression higher than the level of expression in a non-cancer cell is an indication of the presence of a cancer cell, more particularly an indication of cancer cells with a resistance to treatment with antagonists. Kits for the determination of a level of expression of the Cyclon gene in a biological sample, a method for the identification of Cyclon expression antagonists, and methods for treating patients are provided. | 02-12-2015 |
20150044202 | METHODS FOR REDUCING EXACERBATION RATES OF ASTHMA USING BENRALIZUMAB - Provided herein is are methods of reducing exacerbations of asthma in an asthma patient, comprising administering to the patient an effective amount of the anti-interleukin-5 receptor (IL-5R) antibody benralizumab or an antigen-binding fragment thereof. | 02-12-2015 |
20150044203 | Methods For Increasing Forced Expiratory Volume In Asthmatics Using Benralizumab - Provided herein is are methods of increasing forced expiratory volume in one second (FEV | 02-12-2015 |
20150044204 | METHODS FOR IMPROVING ASTHMA SYMPTOMS USING BENRALIZUMAB - Provided herein are methods of improving asthma symptoms, e.g., as measured by an asthma control questionnaire, comprising administering to the patient an effective amount of benralizumab or an antigen-binding fragment thereof. | 02-12-2015 |
20150044205 | COMPOSITIONS AND METHOD FOR TREATING COMPLIMENT-ASSOCIATED CONDITIONS - The invention provides methods and compositions for treating various degenerative diseases (e.g., AMD) with a factor D inhibitor (e.g., anti-factor D antibody or antigen-binding fragment thereof). Also provided are methods of selecting or identifying patients for treatment with a factor D inhibitor. Methods include the use of prognostic and/or predictive biomarkers. | 02-12-2015 |
20150044206 | IMMUNOGLOBULIN FORMULATION AND METHOD OF PREPARATION THEREOF - A stable aqueous pharmaceutical formulation comprising a therapeutically effective amount of an antibody, polysorbate 80, a buffer which inhibits polysorbate oxidation is described along with methods of making the preparation. Also described are formulations with high antibody concentrations which maintain fixed volumes and which may be used on patients of variable weight. | 02-12-2015 |
20150050266 | TECHNIQUES FOR PREDICTING, DETECTING AND REDUCING ASPECIFIC PROTEIN INTERFERENCE IN ASSAYS INVOLVING IMMUNOGLOBULIN SINGLE VARIABLE DOMAINS - This invention provides, and in certain specific but non-limiting aspects relates to: assays that can be used to predict whether a given ISV will be subject to protein interference as described herein and/or give rise to an (aspecific) signal in such an assay (such as for example in an ADA immunoassay). Such predictive assays could for example be used to test whether a given ISV could have a tendency to give rise to such protein interference and/or such a signal; to select ISV's that are not or less prone to such protein interference or to giving such a signal; as an assay or test that can be used to test whether certain modification(s) to an ISV will (fully or partially) reduce its tendency to give rise to such interference or such a signal; and/or as an assay or test that can be used to guide modification or improvement of an ISV so as to reduce its tendency to give rise to such protein interference or signal; methods for modifying and/or improving ISV's to as to remove or reduce their tendency to give rise to such protein interference or such a signal; modifications that can be introduced into an ISV that remove or reduce its tendency to give rise to such protein interference or such a signal; ISV's that have been specifically selected (for example, using the assay(s) described herein) to have no or low(er)/reduced tendency to give rise to such protein interference or such a signal; modified and/or improved ISV's that have no or a low(er)/reduced tendency to give rise to such protein interference or such a signal. | 02-19-2015 |
20150050267 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 02-19-2015 |
20150050268 | PROLONGED INHIBITION OF INTERLEUKIN-6 MEDIATED SIGNALING - Polypeptides are provided directed against IL-6R at specific dose ranges and dosing schedules that result in a prolonged effect on IL-6 mediated signaling. In particular, the invention provides pharmacologically active agents, compositions, methods and/or dosing schedules that have certain advantages compared to the agents, compositions, methods and/or dosing schedules that are currently used and/or known in the art, including the ability to dose less frequently or to administer lower doses to obtain equivalent effects in inhibiting IL-6 mediated signaling. | 02-19-2015 |
20150050269 | ANTIGEN-BINDING MOLECULE PROMOTING DISAPPEARANCE OF ANTIGENS HAVING PLURALITY OF BIOLOGICAL ACTIVITIES - The present inventors newly discovered that even if an antigen-binding molecule inhibits in vitro some of the physiological activities of an antigen having two or more physiological activities without inhibiting the remaining physiological activities, the molecule can promote elimination of the antigen from blood (from serum or plasma) and as a result reduce the physiological activities in vivo, when the antigen-binding molecule is conferred with the properties: (i) of binding to human FcRn under an acidic pH range condition; (ii) of binding under a neutral pH range condition to human Fc receptor stronger than native human IgG, and (iii) that its antigen-binding activity alters according to the ion concentration. | 02-19-2015 |
20150050270 | ANTIBODIES TO BRADYKININ B1 RECEPTOR LIGANDS - The invention provides antibodies that specifically bind to Kallidin or des-Arg10-Kallidin. The invention also provides pharmaceutical compositions, as well as nucleic acids encoding anti-Kallidin or des-Arg10-Kallidin antibodies, recombinant expression vectors and host cells for making such antibodies, or fragments thereof. Methods of using antibodies of the invention to modulate Kallidin or des-Arg10-Kallidin activity or detect Kallidin or des-Arg10-Kallidin or, either in vitro or in vivo, are also provided by the invention. The invention further provides methods of making antibodies that specifically bind to des-Arg | 02-19-2015 |
20150050271 | JCV NEUTRALIZING ANTIBODIES - In one aspect, the disclosure provides neutralizing antibodies against JCV and methods for the treatment of PML. In some embodiments, aspects of the invention relate to an isolated JC-vims neutralizing monoclonal antibody against JCV capsid protein VPI (JCV-VP1). In some embodiments, the antibody suppresses infectivity of the JC-vims. In some embodiments, the antibody binds the sialic acid binding pocket of JCV-VP1. | 02-19-2015 |
20150050272 | METHOD OF DYNAMIC SPECTROSCOPY UNDER PHYSIOLOGICAL CONDITIONS - The present invention relates to the field of dynamic spectroscopy and more precisely to a method involving dynamic molecules spectroscopy technology designed to determine transitional changes in molecules conformation and assemblies both in physiologic and pathologic conditions. The method comprises in vitro fingerprints of a sample taken under highly controlled temperature in order to obtain precise images of either one or an ensemble of molecular dynamics. Due to its precise information, the method according to the invention allows shortening of the drug discovery stage. | 02-19-2015 |
20150050273 | AFUCOSYLATED ANTI-FGFR2IIIB ANTIBODIES - The present invention provides antibodies that bind FGFR2IIIb, wherein the antibodies are afucosylated. The present invention provides compositions comprising antibodies that bind FGFR2IIIb, wherein at least 95% of the antibodies in the composition are afucosylated. In some embodiments, methods of treating cancer comprising administering afucosylated anti-FGFR2IIIb antibodies are provided. | 02-19-2015 |
20150050274 | METHODS AND BIOMARKERS FOR DETECTION AND TREATMENT OF MATURE T-CELL LEUKEMIA - The present invention relates to methods and biomarkers for detection and characterization of mature T-cell neoplasias/leukemias (e.g., T-cell prolymphocytic leukemia, Sezary syndrome) in biological samples (e.g., tissue samples, blood samples, plasma samples, cell samples, serum samples). | 02-19-2015 |
20150050275 | PURIFICATION OF ANTI-C-MET ANTIBODIES - Provided herein are methods of purifying anti-c-met antibodies, compositions and pharmaceutical formulations comprising purified anti-c-met antibodies, and methods of using the same. | 02-19-2015 |
20150050276 | High Affinity Antibodies That Neutralize Staphylococcus Enterotoxin B - Provided herein are antibodies that specifically bind and neutralize | 02-19-2015 |
20150056183 | THERAPEUTIC CANINE IMMUNOGLOBULINS AND METHODS OF USING SAME - A method of preparing a canine antibody suitable for use in the therapeutic treatment of a canine is provided. In particular, there is provided immunoglobulins which can be selected for the characteristic of whether they mediate downstream complement mediated immune activation when bound to a target antigen. Canine derived antibodies comprising specific heavy chain isotypes are provided. The invention extends to the use of the immunoglobulins of the invention in methods of treating conditions such as pain, inflammatory conditions and cancerous conditions in a canine. | 02-26-2015 |
20150056184 | Protein Belonging to the TNF Superfamily Involved in Signal Transduction, Nucleic Acids Encoding Same and Methods of Use Thereof - A method of modulating immune response in an animal is disclosed. Such a method interacting the immature dendritic cells from the animal with an antigen ex vivo so that the immature dendritic cells present the antigen on their surfaces, inducing maturation of the immature dendritic cells ex vivo, and contacting the mature dendritic cells ex vivo with a modulator comprising TRANCE, conservative variants thereof, fragments thereof, analogs or derivatives thereof, or a fusion protein comprising the amino acid sequence of TRANCE, conservative variants thereof, or fragments thereof. After contacting the modulator ex vivo, the mature dendritic cells are introduced into the animal. As a result, immune response in the animal towards the antigen is modulated relative to the immune response against the antigen in an animal in which dendritic cells did not interact with the antigen ex vivo, and did not contact a modulator ex vivo. Preferably, the method of the present invention results in increasing immune response towards the antigen in the animal. | 02-26-2015 |
20150056185 | IMMUNOGLOBULIN CONSTANT REGION FC RECEPTOR BINDING AGENTS - IVIG replacement compounds are derived from recombinant and/or biochemical creation of immunologically active biomimetic(s). These replacement compounds are then screened in vitro to assess each replacements compound's efficiency at modulating immune function. Particular replacement compounds are selected for further in vivo validation and dosage/administration optimization. Finally, the replacement compounds are used to treat a wide range of diseases, including inflammatory and autoimmune diseases. | 02-26-2015 |
20150056186 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH AN ANTI-BCL-2 ACTIVE AGENT - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and an anti-Bcl-2 active agent for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and an anti-Bcl-2 active agent. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and an anti-Bcl-2 active agent. | 02-26-2015 |
20150056187 | Humanized Antibodies That Recognize Alpha-Synuclein - The present application discloses humanized 1H7 antibodies. The antibodies bind to human alpha synuclein and can be used for treatment and diagnosis of Lewy body disease. | 02-26-2015 |
20150056188 | JCV NEUTRALIZING ANTIBODIES - In one aspect, the disclosure provides neutralizing antibodies against JCV and methods for the treatment of PML. In some embodiments, aspects of the invention relate to an isolated JC-virus neutralizing monoclonal antibody against JCV capsid protein VPI (JCV-VP1). In some embodiments, the antibody suppresses infectivity of the JC-virus. In some embodiments, the antibody binds the sialic acid binding pocket of JCV-VPI. In some embodiments, the antibody binds JCV-VP 1 comprising one or more of the following mutations: S269F, S269Y, S267F, N265D, Q271 H, D66H, K60E, K60N and L55F. | 02-26-2015 |
20150056189 | CDR-MODIFIED ANTI-SIGLEC-15 ANTIBODY - Provided is a pharmaceutical composition for the treatment and/or prophylaxis of abnormal bone metabolism targeting a protein encoded by a gene strongly expressed in osteoclasts. Specifically provided is a pharmaceutical composition containing an antibody which specifically recognizes human Siglec-15 and has an activity of inhibiting osteoclast formation, and the like. | 02-26-2015 |
20150056190 | DIAGNOSTIC METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER - The invention provides methods and compositions to detect expression of one or more biomarkers for identifying and treating patients who are likely to be responsive to VEGF antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods. | 02-26-2015 |
20150056191 | IGF1 BIOMARKER FOR IGF1R INHIBITOR THERAPY - The present invention provides, inter alia, methods for treating tumors that are sensitive to an IGF1R inhibitor. The tumor are determined to be sensitive if the level of IGF1 mRNA expression in the tumor cells, relative to one or more reference genes, reaches a certain threshold level. Methods for evaluating patients as candidates for receipt of the IGF1R inhibitor therapy are also provided as well along with in vitro assay methods and kits for performing any of the methods. | 02-26-2015 |
20150056192 | NOVEL COMPOSITIONS OF COMBINATIONS OF NON-COVALENT DNA BINDING AGENTS AND ANTI-CANCER AND/OR ANTI-INFLAMMATORY AGENTS AND THEIR USE IN DISEASE TREATMENT - The invention provides for compositions for treating a cancer or an inflammatory disorder comprising a combination of agents in a pharmaceutically acceptable carrier, wherein said agents comprise: (i) a non-covalent DNA binding agent; and (ii) an anti-cancer or anti-inflammatory agent. | 02-26-2015 |
20150056193 | EGFR AND ROS1 KINASE IN CANCER - The present disclosure provides methods of that include detecting in a biological sample from a patient having or suspected of having cancer the presence of a polypeptide having ROS1 kinase activity or a polynucleotide encoding the same and detecting in the biological sample the presence of a mutant EGFR polypeptide or a polynucleotide encoding the same. In some aspects, the disclosure provides methods of treating a patient for cancer that include determining that a biological sample from a tumor in the patient includes a polypeptide having ROS1 kinase activity or a polynucleotide encoding the same and a mutant EGFR polypeptide or a polynucleotide encoding the same and administering to the patient a therapeutically effective amount of a ROS1 inhibitor and an EGFR inhibitor, thereby treating the patient for cancer. | 02-26-2015 |
20150056194 | MODIFIED GREEN TEA POLYPHENOLS AND METHODS THEREOF FOR TREATING LIVER DISEASE - Methods of treating liver disease in a subject, including administering to the subject an effective amount of one or more modified green tea polyphenols to reduce, decrease, limit or prevent one or more symptoms of liver disease relative to an untreated control subject are provided. In a preferred embodiment the one or more modified green tea polyphenols are administered at a dose of 400 mg/kg body weight five times weekly. In some embodiments the disclosed methods further include administering to the subject one or more additional pharmaceutically active agents. In one embodiment the one or more additional pharmaceutically active agents is a chemotherapeutic agent. | 02-26-2015 |
20150056195 | COMPOSITIONS AND METHODS FOR INIHIBITING TUMORIGENICITY OF SENESCENT CANCER CELLS INDUCED BY CHEMOTHERAPY - The invention relates to the field of oncology and to chemotherapy resistance and relapse. Thus the invention provides compositions and methods for inhibiting tumorigenicity of senescent cancer cells induced by a chemotherapeutic agent. The invention also provides compositions and methods for inhibiting conversion of non-stem cancer cells (non-CSCs) into tumor initiating cancer stem cells (CSCs) induced by a chemotherapeutic agent. | 02-26-2015 |
20150056196 | ANTIBODY PURIFICATION BY CATION EXCHANGE CHROMATOGRAPHY - A method for purifying an antibody by cation exchange chromatography is described in which a high pH wash step is used to remove of contaminants prior to eluting the desired antibody using an elution buffer with increased conductivity. | 02-26-2015 |
20150064171 | COMBINATIONS OF AKT INHIBITOR COMPOUNDS AND CHEMOTHERAEPTUC AGENTS, AND METHODS OF USE - The invention provides combinations comprising a) compound of formula (I) or a pharmaceutically acceptable salt thereof wherein R | 03-05-2015 |
20150064172 | METHODS OF TREATING A DISEASE OR DISORDER ASSOCIATED WITH BRUTON'S TYROSINE KINASE - The present invention provides methods of treating, stabilizing or lessening the severity or progression of a disease or disorder associated with BTK. | 03-05-2015 |
20150064173 | METHODS OF TREATING A DISEASE OR DISORDER ASSOCIATED WITH BRUTON'S TYROSINE KINASE - The present invention provides methods of treating, stabilizing or lessening the severity or progression of a disease or disorder associated with BTK. | 03-05-2015 |
20150064174 | NEUTRALIZING ANTIBODY FOR EPSTEIN BARR VIRUS-ASSOCIATED DISEASE - Described herein are compositions, methods, and uses relating to an EBV-neutralizing antibody. | 03-05-2015 |
20150064175 | PFKFB3 INHIBITOR AND METHODS OF USE AS AN ANTI-CANCER THERAPEUTIC - A novel compound, (E)-1-(pyridyn-4-yl)-3-(7-(trifluoromethyl)quinolin-2-yl)-prop-2-en-1-one, is provided herein. (E)-1-(pyridyn-4-yl)-3-(7-(trifluoromethyl)quinolin-2-yl)-prop-2-en-1-one is an inhibitor of 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3) with surprisingly superior efficacy and pharmacodynamic properties in vitro and in vivo. Also provided are pharmaceutical compositions including the compound and methods of use of the compound in treating cancer and tumors in vivo, as well as inhibiting glycolytic flux and PFKFB3 enzymatic activity in cells. | 03-05-2015 |
20150064176 | METHODS FOR TREATING CONDITIONS ASSOCIATED WITH MASP-2 DEPENDENT COMPLEMENT ACTIVATION - In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. The methods comprise the step of administering, to a subject in need thereof, an amount of a MASP-2 inhibitory agent effective to inhibit MASP-2-dependent complement activation. In some embodiments, the MASP-2 inhibitory agent inhibits cellular injury associated with MASP-2-mediated alternative complement pathway activation, while leaving the classical (C1q-dependent) pathway component of the immune system intact. In another aspect, the invention provides compositions for inhibiting the effects of lectin-dependent complement activation, comprising a therapeutically effective amount of a MASP-2 inhibitory agent and a pharmaceutically acceptable carrier. | 03-05-2015 |
20150064177 | THERAPEUTIC USES OF HUMANIZED ANTIBODIES AGAINST ALPHA-4 INTEGRIN - The invention provides methods of treatment using humanized immunoglobulins that specifically bind to alpha-4 integrin. The methods are useful for treatment of asthma, atherosclerosis, AIDS dementia, diabetes, inflammatory bowel disease, rheumatoid arthritis, transplant rejection, graft versus host disease, tumor metastasis, nephritis, atopic dermatitis, psoriasis, myocardial ischemia, and acute leukocyte mediated lung injury. | 03-05-2015 |
20150064178 | DIAGNOSTIC METHODS AND COMPOSITIONS FOR TREATMENT OF GLIOBLASTOMA - The invention provides methods and compositions to detect expression of one or more biomarkers for identifying and treating patients having glioblastomas who are likely to be responsive to VEGF antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods. | 03-05-2015 |
20150064179 | HUMANIZED ANTI-IL 10 ANTIBODIES FOR THE TREATMENT OF SYSTEMIC LUPUS ERYTHEMATOSUS (SLE) - Provided is a humanized or chimeric antibody or fragment thereof capable of binding to interleukin-10 (1L-10), wherein said antibody or fragment thereof is capable of being administered to a subject in the absence of an intolerable increase in the level of pro-inflammatory cytokines. Further provided are methods of treatment involving the use of the antibody or fragment thereof. | 03-05-2015 |
20150064180 | COMBINATION THERAPY WITH CD4 LYMPHOCYTE DEPLETION AND MTOR INHIBITORS - The invention provides methods for treating a malignant neoplastic cell proliferative disorder or disease, comprising administering to a subject in need thereof an effective amount of an mTOR inhibitor and an effective amount of a CD4 lymphocyte depleting agent. Such methods find utility in the treatment of certain subsets of malignant neoplastic cell proliferative disorders or diseases, e.g. renal cell carcinoma and melanoma. The invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of an mTOR inhibitor and an effective amount of a CD4 lymphocyte depleting agent in a pharmaceutically acceptable carrier. | 03-05-2015 |
20150071910 | BIOMARKERS AND METHODS OF TREATING PD-1 AND PD-L1 RELATED CONDITIONS - Provided herein are biomarkers for the treatment of pathological conditions, such as cancer, and method of using PD-1/PD-L1 pathway antagonists. In particular, provided are biomarkers for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto. | 03-12-2015 |
20150071911 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH A mTOR INHIBITOR - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with a mTOR inhibitor for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and a mTOR inhibitor such as Temsirolimus or Everolimus. | 03-12-2015 |
20150071912 | PROPHYLAXIS OF COLORECTAL AND GASTROINTESTINAL CANCER - The present disclosure provides methods and compositions useful for preventing gastrointestinal and/or colorectal cancer in animals, including humans, having pre-cancerous adenomatous polyps. The present disclosure provides compositions comprising anti-PG antibodies suitable for use in the methods of the disclosure. The present disclosure also provides methods and compositions useful for monitoring the efficacy of anti-PG treatment in subjects with pre-cancerous polyps. | 03-12-2015 |
20150071913 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, PERJETA (pertuzumab), ACTEMRA (tocilizumab), KADCYLA (trastuzumab emtansine), MetMAb (onartuzumab), obinutuzumab, ocrelizumab or lebrikizumab. | 03-12-2015 |
20150071914 | METHODS OF TREATMENT USING CTLA4 MUTANT MOLECULES - The present invention provides soluble CTLA4 mutant molecules which bind with greater avidity to the CD80 and/or CD86 antigen than wild type CTLA4 or non-mutated CTLA4Ig. The soluble CTLA4 molecules have a first amino acid sequence comprising the extracellular domain of CTLA4, where certain amino acid residues within the S25-R33 region and M97-G107 region are mutated. The mutant molecules of the invention may also include a second amino acid sequence which increases the solubility of the mutant molecule. | 03-12-2015 |
20150071915 | MONOCLONAL ANTIBODIES AGAINST AMYLOID BETA PROTEIN AND USES THEREOF - The subject invention relates to monoclonal antibodies (e.g., 8F5 and 8C5) that may be used, for example, in the prevention, treatment and diagnosis of Alzheimer's Disease or other neurodegenerative disorders. | 03-12-2015 |
20150071916 | Anti-CD28 Humanized Antibodies - The invention relates to humanized antibodies directed against the human lymphocyte receptor CD28. When used in a monovalent form these antibodies are antagonists, i.e. capable of blocking of the CD28/B7 interaction, without activating CD28. These antibodies can be used in particular as therapeutic agents for blocking T cell activation through the CD28 receptor. | 03-12-2015 |
20150071917 | METHODS AND PRODUCTS FOR EVALUATING AN IMMUNE RESPONSE TO A THERAPEUTIC PROTEIN - The invention relates to methods and products for the identification of a clinically significant immune response in subjects treated with a therapeutic protein. A first aspect of the invention relates to methods and compositions for identifying a clinically significant immune response in patients treated with therapeutic amounts of VLA4 binding antibody (e.g., natalizumab). A second aspect of the invention concerns the chronological details of sample collection for determining the titre of antibodies against the therapeutic protein, e.g. the collection of at least two samples at two different time points. A third aspect of the invention relates to the selection of the critical threshold level, which corresponds to the antibody titre of untreated patients increased by the double of the standard deviation of this control antibody titre. | 03-12-2015 |
20150071918 | PEPTIDES FOR THE TREATMENT OF CANCER - The invention relates to novel cyclic compounds (cyclic peptides), linkers useful as beta-turn promoters in cyclic peptides, and methods for treatment of malignant cells in vitro or in vivo using one or more linear and cyclic peptides. The peptides can act as integrin interaction inhibitors and may be used in the treatment of cancers as monotherapies or in combination with other anti-cancer agents, such as proteasome inhibitors, inhibitors of autophagy, alkylating agents, MEK inhibitors, FAK/PYK2 inhibitors, and EGFR inhibitors. The invention further concerns a method of predicting the binding of a cyclic or linear HYD1 peptide to a cancer cell by assessing overexpression of biomarkers such as CD44, VLA-4 integrin, basigin, CD138 (syndecan 1), NCAM, ICAM1, ICAM3, and CD59. The invention further concerns a method of detecting one or more members of a complex comprising CD44, VLA-4 integrin, basigin, CD138 (syndecan 1), NCAM, ICAM1, ICAM3, and CD59, using a linear or cyclic HYD1 peptide bearing a detectable moiety. | 03-12-2015 |
20150071919 | CANCER THERAPY - The present application relates to compositions and methods for treating a proliferative disorder by administering to a subject a pharmaceutical composition of a dual kinase inhibitor. Catecholic butanes cane serve as dual kinase inhibitors for purposes of methods described herein. Patients to be treated include those that have been treated with Tarceva or other therapeutic compounds and relapsed or are resistant to treatment. The compounds described herein may exhibit a synergistic effect when administered with another agent. | 03-12-2015 |
20150071920 | LIQUID PROTEIN FORMULATIONS CONTAINING WATER SOLUBLE ORGANIC DYES - Concentrated, low-viscosity, low-volume liquid pharmaceutical formulations of proteins have been developed. Such formulations can be rapidly and conveniently administered by subcutaneous or intramuscular injection, rather than by lengthy intravenous infusion. These formulations include low-molecular-weight and/or high-molecular-weight proteins, such as mAbs, and viscosity-lowering water soluble organic dyes. | 03-12-2015 |
20150071921 | LIQUID PROTEIN FORMULATIONS CONTAINING ORGANOPHOSPHATES - Concentrated, low-viscosity, low-volume liquid pharmaceutical formulations of proteins have been developed. Such formulations can be rapidly and conveniently administered by subcutaneous (SC) or intramuscular (IM) injection, rather than by lengthy intravenous infusion. These formulations include low-molecular-weight and/or high-molecular-weight proteins, such as mAbs, and organophosphates. The viscosity of the formulation is significantly reduced by the addition of one or more organophosphates. | 03-12-2015 |
20150071922 | LIQUID PROTEIN FORMULATIONS CONTAINING IONIC LIQUIDS - Concentrated, low-viscosity, low-volume liquid pharmaceutical formulations of proteins have been developed. Such formulations can be rapidly and conveniently administered by subcutaneous or intramuscular injection, rather than by lengthy intravenous infusion. These formulations include low-molecular-weight and/or high-molecular-weight proteins, such as mAbs, and viscosity-reducing ionic liquids. | 03-12-2015 |
20150071923 | MODIFIED ANTI-EPIDERMAL GROWTH FACTOR RECEPTOR ANTIBODIES AND METHODS OF USE THEREOF - Provided herein are modified anti-EGFR antibodies and nucleic acid molecules encoding modified anti-EGFR antibodies. Also provided are methods of treatment and uses using modified anti-EGFR antibodies. | 03-12-2015 |
20150071924 | Anti-Angiogenesis Therapy for the Treatment of Previously Treated Breast Cancer - This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, in combination with one or more additional anti-tumor therapeutic agents in previously treated metastatic breast cancer. | 03-12-2015 |
20150079071 | NON-CATALYTIC DOMAIN TARGETS IN MATRIX METALLOPROTEASE PROTEINS FOR CANCER THERAPIES - The present invention provides compositions and methods for inhibiting MMPs, especially MMP-3, MMP-9 and MMP-14. The invention relates to the field of diagnostic and prognostic methods of human cancers, especially breast cancer and the field of matrix metalloproteases, as targets for diagnostics and therapeutics. | 03-19-2015 |
20150079072 | Assays to Monitor Bleeding Disorders - The present invention provides methods of dosing Factor VIII or Factor IX chimeric and hybrid polypeptides. The present invention further provides high-sensitivity methods of quantifying an amount of activated FIX protein in a test sample | 03-19-2015 |
20150079073 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH FLUDARABINE AND/OR MITOXANTRONE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with fludarabine and/or mitoxantrone for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody with fludarabine and/or mitoxantrone. | 03-19-2015 |
20150079074 | Antibody Formulations And Methods - The invention provides antibody formulations and methods useful for prophylaxis or treatment of synucleinopathies, including Parkinson's disease. | 03-19-2015 |
20150079075 | Anti-CD11A Antibodies and Uses Thereof - Provided herein are isolated human, chimeric, and humanized antibodies and antigen-binding fragments thereof that specifically bind to CD11a. Also provided are methods of treating human immunodeficiency virus (e.g., reducing the risk of developing or preventing the development of HIV infection or AIDS) in a subject that has an HIV infection or AIDS that include administering at least one of the antibodies or antigen-binding fragments to the subject. Also provided are methods of crosslinking CD11a on the surface of a cell that include contacting the cell with at least one of the antibodies or antigen-binding fragments. Also provided are compositions (e.g., pharmaceutical compositions) containing at least one of the antibodies or antigen-binding fragments. | 03-19-2015 |
20150079076 | IDENTIFICATION OF NON-RESPONDERS TO HER2 INHIBITORS - The present invention relates to means and methods for the identification of non-responders to a HER2 inhibitor, whereby one or more mutations in exon 9 of Phosphoinositol-3 kinase (PIK3CA) indicate non-responsiveness. | 03-19-2015 |
20150079077 | METHODS AND COMPOSITIONS FOR THERAPEUTIC AGENTS - The present disclosure provides inter alia compositions that comprise therapeutic agents (e.g., live attenuated viral antigens, therapeutic proteins, etc.) and a lipid component. The lipid component may comprise or consist of different types of lipid or lipids as described herein. In some embodiments the therapeutic agents are thermolabile. The present disclosure also provides methods for preparing compositions, including the aforementioned compositions (e.g., melt methods and spray injection methods among others). | 03-19-2015 |
20150079078 | BIOMARKERS FOR TRIPLE NEGATIVE BREAST CANCER - The present invention relates to biomarkers that are useful in the prognosis of triple negative breast cancer patients. The biomarkers may be used to select treatment and to determine whether a treatment is effective or not. The biomarkers may also be used to select novel treatments and to screen for new potential compounds that may treat the triple negative breast cancer. | 03-19-2015 |
20150079079 | Methods and Compositions for Treatment of Chlamydial Infection and Related Diseases and Disorders - The present invention provides compositions and methods of use in the treatment/prevention of chlamydial infection and/or diseases and disorders associated with chlamydial infection in a subject. | 03-19-2015 |
20150079080 | NOVEL ANTI-IGF-IR ANTIBODIES AND USES THEREOF - The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor IGF-IR and/or capable of specifically inhibiting the tyrosine kinase activity of said IGF-IR receptor, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGF-IR receptor. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 03-19-2015 |
20150079081 | TRICYCLIC P13K INHIBITOR COMPOUNDS AND METHODS OF USE - Tricyclic PI3k inhibitor compounds of Formula I with anti-cancer activity, anti-inflammatory activity, or immunoregulatory properties, and more specifically with PI3 kinase modulating or inhibitory activity are described. Methods are described for using the tricyclic PI3K inhibitor compounds of Formula I for in vitro, in situ, and in vivo diagnosis or treatment of mammalian cells, organisms, or associated pathological conditions. | 03-19-2015 |
20150079082 | OPTIMIZED Fc VARIANTS AND METHODS FOR THEIR GENERATION - The present invention relates to optimized Fc variants, methods for their generation, and antibodies and Fc fusions comprising optimized Fc variants. | 03-19-2015 |
20150086537 | HIGHLY CONCENTRATED PHARMACEUTICAL FORMULATIONS - The present invention relates to a highly concentrated, stable pharmaceutical formulation of a pharmaceutically active anti-CD20 antibody, such as e.g. Rituximab, Ocrelizumab, or HuMab, or a mixture of such antibody molecules for subcutaneous injection. In particular, the present invention relates to formulations comprising, in addition to a suitable amount of the anti-CD20 antibody, an effective amount of at least one hyaluronidase enzyme as a combined formulation or for use in form of a co-formulation. The said formulations comprise additionally at least one buffering agent, such as e.g. a histidine buffer, a stabilizer or a mixture of two or more stabilizers (e.g. a saccharide, such as e.g. α,α-trehalose dihydrate or sucrose, and optionally methionine as a second stabilizer), a nonionic surfactant and an effective amount of at least one hyaluronidase enzyme. Methods for preparing such formulations and their uses thereof are also provided. | 03-26-2015 |
20150086538 | ANTIBODY LIGHT CHAINS - The present invention relates to methods for improving biophysical properties, including the stability of antibody lambda light chains, to antibody lambda light chains with improved biophysical properties, including stability, nucleic acid and vectors encoding such antibody lambda light chains, and to uses of such antibody lambda light chains, nucleic acid and vectors. | 03-26-2015 |
20150086539 | CROSS-REACTIVE STAPHYLOCOCCUS AUREUS ANTIBODY - The subject relates to a cross-neutralizing antibody comprising at least one polyspecific binding site that binds to alpha-toxin (Hla) and at least one of the bi-component toxins of | 03-26-2015 |
20150086540 | Methods of using an antibody to inhibit WNT-mediated cardiac remodeling - The present invention is directed to monoclonal antibodies and fragments thereof directed to LRP5/6 that find use in the prevention and treatment of cardiac remodeling and cancer. Also disclosed are methods for using such monoclonal antibodies in the prevention and treatment of such diseases. | 03-26-2015 |
20150086541 | Methods of Cytotoxic Gene Therapy To Treat Tumors - A method is disclosed for decreasing or retarding an increase in the size of a localized or metastatic tumor by using a combination of an immune stimulating cytotoxic gene therapy and immune-checkpoint modulating agent, in conjunction with other therapies, including radiation therapy, chemotherapy, surgery, and immunotherapies. | 03-26-2015 |
20150086542 | COMPOSITIONS AND METHODS FOR THE PREVENTION OF MICROBIAL INFECTIONS - This disclosure provides methods and compositions to inhibit or prevent infection of a cell by a bacteria that exports DNABII proteins by administering to a tissue infected with the bacteria an effective amount of an antibody that specifically recognizes and binds the DNABII proteins, thereby inhibiting or preventing infection of the bacteria. Treatment methods, screens and kits are further provided. | 03-26-2015 |
20150086543 | DIAGNOTIC MARKERS - The present invention provides methods of predicting response to a cancer therapy based on the methylation status of the ERBB2 gene. One aspect of the invention provides a method of predicting response to an EGFR inhibitor therapy based on the methylation status of the ERBB2 gene. | 03-26-2015 |
20150086544 | STABILIZED LIQUID ANTI-RSV ANTIBODY FORMULATIONS - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulations exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulations are substantially free of surfactant, inorganic salts, and/or other common excipients. Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 03-26-2015 |
20150086545 | COMBINATION THERAPY OF HER EXPRESSING TUMORS - The invention relates to tumors expressing HER2 and EGFR, using HER2-dimerization inhibitors (HDIs) and EGFR inhibitors. | 03-26-2015 |
20150086546 | HUMANIZED ANTI-CCR2 ANTIBODIES AND METHODS OF USE THEREFOR - The present invention relates to a humanized antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 2 (CCR2) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a cell bearing mammalian CCR2 with a ligand thereof, and to use of the antibodies and fragments in therapeutic, prophylactic and diagnostic methods. | 03-26-2015 |
20150086547 | COMBINATION THERAPY FOR TREATING BREAST CANCER - The invention provides compositions and methods for treating breast cancer. Specifically, the invention relates to administering a Transforming Growth Factor beta (TGFβ) antagonist in combination with capecitabine and ixabepilone to treat breast cancer. | 03-26-2015 |
20150093375 | METHODS FOR INHIBITING OCULAR ANGIOGENESIS - The present invention provides methods of using TSPAN12 and Norrin antagonists to inhibit ocular vascular development and to treat related disorders. | 04-02-2015 |
20150093376 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH BENDAMUSTINE - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with bendamustine for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and bendamustine. | 04-02-2015 |
20150093377 | Amino acid sequences directed against the Angiopoietin/Tie system and polypeptides comprising the same for the treatment of diseases and disorders related to angiogenesis - The present invention relates to amino acid sequences that are directed against proteins from the group of the Angiopoietin/Tie family such as Tie1, Tie2, Ang1, Ang2, Ang3, Ang4, Angptl1, Angptl2, Angptl3, Angptl4, Angptl5, Angptl6, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more of such amino acid sequences. | 04-02-2015 |
20150093378 | Goodpasture Antigen Binding Protein Detection and Inhibition and its Use in Diabetes - Disclosed herein are methods for treating type 2 diabetes, limiting development of type 2 diabetes, and treating a pre-diabetic state by administering to a subject in need thereof a GPBP inhibitor. Also disclosed herein are methods for diagnosing a pre-diabetic state and for diagnosing a propensity to develop type 2 diabetes by determining an amount of GPBP in a sample from a subject and comparing to control. | 04-02-2015 |
20150093379 | NOVEL COMPOSITIONS AND METHODS FOR TREATING IgE-MEDIATED DISORDERS - The present invention relates to immunoglobulins that bind IgE and FcγRIIb with high affinity, said compositions being capable of inhibiting cells that express membrane-anchored IgE. Such compositions are useful for treating IgE-mediated disorders, including allergies and asthma. | 04-02-2015 |
20150093380 | IMMUNOPOTENTIATIVE COMPOSITION - Compositions for cancer or infection treatment via immunopotentiation caused by inhibition of immunosuppressive signal induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient, screening methods of the substrates for cancer or infection treatment, cell lines used for the screening methods, evaluation methods that selects the substrates for cancer treatment, and carcinoma cell transplanted mammals used for the evaluation methods. | 04-02-2015 |
20150093381 | FIXED DOSING OF HER ANTIBODIES - The present invention concerns fixed dosing of HER antibodies, such as Pertuzumab. | 04-02-2015 |
20150098937 | IDENTIFICATION OF GENETIC VARIANTS - The present disclosure provides a method for identifying whether a subject is more or less likely to be responsive to VEGF-based therapy, comprising screening a nucleic acid sample obtained from the subject to provide output information which identifies the presence or absence of an allelic variant, wherein the presence or absence of an allelic variant indicates whether the subject is more or less likely to be responsive to VEGF-based therapy. | 04-09-2015 |
20150098938 | Modulators of ACYL-COA Lysocardiolipin Acyltransferase 1 (ALCAT1) and Uses Thereof - Compositions of modulators of acyl-CoA lysocardiolipin acyf transferase 1 (ALCAT1) expression, function or activity are provided. In particular, inhibitors of ALCAT1 are useful in treating metabolic diseases, cardiac diseases and, in general diseases associated with mitochondrial dysfunction. Assays for identification of novel ALCAT1 modulators are provided. | 04-09-2015 |
20150098939 | NOVEL ANTAGONIST ANTIBODIES AND THEIR FAB FRAGMENTS AGAINST GPVI AND USES THEREOF - The present invention discloses novel antibodies that specifically bind to the human platelet membrane protein Glycoprotein VI (GPVI) and their monovalent fragments or derivatives. The antibodies of the invention are antibodies from hybridoma clone 390 and fragment antibodies thereof able to induce a GPVI depletion phenotype. These antibodies and Fab fragments are able to block collagen binding and thus preventing platelet activation by collagen. The invention also relates to hybridoma clones and expression plasmids for the production of disclosed antibodies and Fab fragments. The present invention further refers to the uses of monovalent antibody fragments to manufacture research, diagnostic and immunotherapeutic agents for the treatment of thrombosis and other vascular diseases. The invention also concerns a Fab bearing a molecule at the C-terminal extremity, as well as method for prevention of recognition of Fab by antibodies using such modified Fab. The invention concerns a method for prevention of platelet activation when an anti-GP VI Fab is used. | 04-09-2015 |
20150098940 | Biomarkers for Systemic Lupus Erythematosus Disease Activity, and Intensity and Flare - The present invention involves the identification of biomarkers that are predictive of impeding systemic lupus erythematosus (SLE) disease flare. Methods for treating patients so identified are also provided. | 04-09-2015 |
20150098941 | Anti-Glypican-3 Antibody - An anti-glypican-3 antibody comprising one or more amino acid substitutions introduced in the Fc region is disclosed. Preferably, in the anti-glypican-3 antibody, one or more of the amino acid residues at the positions 239, 298, 326, 330 and 332 in the Fc region are substituted with other amino acid residues. Since the Fc-modified anti-glypican-3 antibody of the invention exhibit enhanced ADCC activity, it is useful in treating cancers, such as hepatic cancer. Also disclosed are an anticancer agent comprising the anti-glypican-3 antibody of the invention and a pharmaceutically acceptable carrier, as well as a method of treating a patient with cancer comprising administering to the patient the anticancer agent of the invention. | 04-09-2015 |
20150104442 | PHOSPHOCOFILIN: COFILIN CO-LOCALIZATION INTENSITY AS A PREDICTOR OF METASTATIC RECURRENCE - Methods and products are provided for determining if a subject having a tumor is at risk of metastasis of the tumor. Specifically, the methods comprise detecting phosphorylated cofilin, and both phosphorylated and non-phosphorylated cofilin; quantifying the phosphorylated cofilin, and the total of phosphorylated and nonphosphorylated cofilin; and determining if a subject having the tumor is likely to experience metastasis of the tumor, based on the ratio of the amount of detected phosphorylated cofilin: total amount of phosphorylated and non-phosphorylated cofilin detected. Further disclosed are the types of tumor metastases that can be determined using the methods provided. | 04-16-2015 |
20150104443 | ANTI-ERBB2 ANTIBODY VARIANTS - The present invention relates to anti-ErbB2 antibody variants or antigen-binding fragments thereof, nucleic acid molecules encoding them, and their uses. The antibody variants of the present invention are capable of binding to ErbB2 with high affinity. Therefore, the antibody variants are ability to effectively prevent or treat various cancers with a low amount. | 04-16-2015 |
20150104444 | METHODS RELATED TO TRASTUZUMAB - The present invention relates to the characterization and production of trastuzumab. The present disclosure provides, in part, methods for evaluating, identifying, and/or producing (e.g., manufacturing) trastuzumab. In some instances, methods herein allow highly resolved evaluation of trastuzumab useful for, inter alia, manufacturing trastuzumab, characterizing trastuzumab, identifying and/or confirming trastuzumab, monitoring the structure of trastuzumab, comparing trastuzumab preparations made over time or made under different conditions, and/or controlling the structure of trastuzumab. | 04-16-2015 |
20150104445 | METHODS OF INHIBITING THE ALTERNATIVE PATHWAY OF COMPLEMENT IMMUNE SYSTEM ACTIVATION AND COMPOSITIONS USED THEREIN - Methods and compositions are provided for treating diseases implicating alternative pathway complement immune system activation. | 04-16-2015 |
20150104446 | GENETIC AND ENVIRONMENTAL MARKERS TO IDENTIFY INFANTS AT RISK FOR SEVERE LUNG DISEASE - Provided herein are methods and compositions for determining the susceptibility of infants to severe respiratory syncytial virus (RSV) infections. Also provide are methods of treating said subjects prophylactically to reduce the incidence of such infections. | 04-16-2015 |
20150104447 | METHODS FOR TREATING CHRONIC OBSTRUCTIVE PULMONARY DISEASE USING BENRALIZUMAB - Provided herein is are methods of treating Chronic Obstructive Pulmonary Disease (COPD) in a patient, comprising administering to the patient an effective amount of benralizumab or an antigen-binding fragment thereof. | 04-16-2015 |
20150104448 | Anti-Complement C1s Antibodies and Uses Thereof - The present disclosure provides antibodies that bind complement C1s protein; and nucleic acid molecules that encode such antibodies. The present disclosure also provides compositions comprising such antibodies, and methods to produce and use such antibodies, nucleic acid molecules, and compositions. | 04-16-2015 |
20150104449 | Variant Immunoglobulins with Improved Manufacturability - This invention relates to the modification of the amino acid sequence of an immunoglobulin molecule at certain key positions within regions of the VH and VL FR and CDR3 domains and/or the CH1 domain which are prone to aggregation. Immunoglobulins modified as described may display improved manufacturability, for example, reduced aggregation propensity and/or increased production levels. | 04-16-2015 |
20150110775 | MODULATED LYSINE VARIANT SPECIES COMPOSITIONS AND METHODS FOR PRODUCING AND USING THE SAME - The instant invention relates to modulated lysine variant species compositions comprising a protein, e.g., an antibody, or antigen-binding portion thereof, and methods, e.g., cell culture and/or protein purification methods, for producing such modulated lysine variant species compositions. Methods for using such compositions to treat a disorder, e.g., a disorder in which TNFα is detrimental, are also provided. | 04-23-2015 |
20150110776 | ANTIBODIES THAT RECOGNIZE IAPP - The invention provides monoclonal antibody 3H6 and related antibodies. The 3H6 antibody binds to an epitope within residues 28-36 of IAPP. The antibodies of the invention are useful, for example, for treating disorders associated with IAPP accumulation, particularly accumulation of IAPP deposits. Such disorders include type 2 diabetes, metabolic syndrome, impaired insulin tolerance, impaired glucose tolerance, insulinomas, and related conditions. | 04-23-2015 |
20150110777 | ANTIBODIES THAT RECOGNIZE IAPP - The invention provides monoclonal antibody 6B8 and related antibodies. The 6B8 antibody binds to an epitope within residues 3-12 of IAPP. The antibodies of the invention are useful, for example, for treating disorders associated with IAPP accumulation, particularly accumulation of IAPP deposits. Such disorders include type 2 diabetes, metabolic syndrome, impaired insulin tolerance, impaired glucose tolerance, insulinomas, and related conditions. | 04-23-2015 |
20150110778 | COMPOSITIONS COMPRISING MG53 AND METHODS FOR THE TREATMENT AND PREVENTION OF AIRWAY INJURY - Disclosed herein are compositions and methods for the treatment and/or protection of airway cells and/or tissue from damage due to injury to the lungs or complications of underlying respiratory, cardiovascular or infectious diseases, or any combination thereof. | 04-23-2015 |
20150110779 | METHODS FOR PREDICTING GASTROINTESTINAL IMMUNE-RELATED ADVERSE EVENTS (GI-IRAE) IN PATIENTS TREATED WITH MODULATION OF THE CO-STIMULATORY PATHWAY - The invention described herein relates to diagnostic and therapeutic methods and compositions useful for predicting the likelihood a cancer patient will experience a gastrointestinal immune-related adverse event (GI-irAE) after administration of a pharmaceutically acceptable amount of an activator of the immune system. | 04-23-2015 |
20150110780 | TREATMENT OF BRAIN CANCER - Compounds for the treatment of brain cancer are provided herein. Pharmaceutical compositions comprised of those compounds for the treatment of brain cancer are also provided herein. | 04-23-2015 |
20150110781 | COMPOSITIONS AND METHODS RELATED TO THE PREVENTION AND TREATMENT OF RABIES INFECTION - The present disclosure relates generally to anti-rabies antibodies that can bind to and neutralize rabies virus. Antibodies of the present technology are useful alone or in combination with therapies known in the art for the treatment or prevention of rabies infection. | 04-23-2015 |
20150110782 | SINGLE DOMAIN ANTIBODIES DIRECTED AGAINST TUMOR NECROSIS FACTOR-ALPHA AND USES THEREFOR - The present invention relates to polypeptides derived from single domain heavy chain antibodies directed to Tumor Necrosis Factor-alpha. It further relates to single domain antibodies that are | 04-23-2015 |
20150110783 | ANTAGONIST ANTI-CD40 ANTIBODY PHARMACEUTICAL COMPOSITIONS - Stable liquid pharmaceutical compositions comprising an antagonist anti-CD40 antibody as a therapeutically or prophylactically active component and methods useful in their preparation are provided. These compositions comprise the antagonist anti-CD40 antibody, a buffering agent to maintain the pH of the composition between about pH 5.0 and about pH 7.0, and an amount of arginine-HCl sufficient to render the liquid composition near isotonic. The stable liquid antagonist anti-CD40 antibody-containing pharmaceutical compositions of the invention find use in methods for treating proliferative diseases and diseases having an autoimmune and/or inflammatory component. | 04-23-2015 |
20150110784 | THERAPEUTIC COMBINATIONS AND METHODS INCLUDING IRM COMPOUNDS - The present invention provides therapeutic combinations that include an immune response modifier (IRM) component and an anti-inflammatory component. The inventions further provide methods of treating a condition by administering to one having the condition a therapeutic combination that includes an IRM component and an anti-inflammatory component. | 04-23-2015 |
20150110785 | Methods of impairing osteoclast differentiation using antibodies that bind Siglec-15 - This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling, variants and derivatives of the polynucleotides and corresponding polypeptides, uses of the polynucleotides, polypeptides, variants and derivatives, and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are the isolation and identification of polynucleotides, polypeptides, variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes. | 04-23-2015 |
20150118223 | USE OF TAU TO MONITOR IMMUNOTHERAPY - The invention provides methods of immunotherapy of Alzheimer's and similar diseases in which the regime administered is monitored by measuring levels of tau. | 04-30-2015 |
20150118224 | ENDOTHELIAL CELLS ACTIVATION BIOMARKERS CHARACTERIZING ANTIBODY MEDIATED REJECTION AND USES THEREOF - Described herein are methods and kits for the detection of endothelial cell injury and/or activation and to the diagnostic of transplant antibody mediated rejection (ABMR). The invention further relates to methods and kits for diagnosing endothelial to mesenchymal transition (EndMT). In various embodiments, the methods comprise assessing expression of one, two or three biomarkers selected from Fascin1, Vimentin and Hsp47. | 04-30-2015 |
20150118225 | ANTICOAGULANT ANTIDOTES - The present invention relates to antibody molecules against anticoagulants, in particular dabigatran, and their use as antidotes of such anticoagulants. | 04-30-2015 |
20150118226 | ANTIBODIES DIRECTED AGAINST NERVE GROWTH FACTOR (NGF) - The invention relates to an isolated immunoglobulin heavy chain polypeptide and an isolated immunoglobulin light chain polypeptide that binds to Nerve Growth Factor (NGF). The invention provides an NGF-binding agent that comprises the aforementioned immunoglobulin heavy chain polypeptide and immunoglobulin light chain polypeptide. The invention also provides vectors, compositions, and methods of using the NGF-binding agent to treat an NGF-mediated disease. | 04-30-2015 |
20150118227 | Antibody Fc Mutants with Ablated Effector Functions - Antibody and other Fc-containing molecules with variations in the Fc region reduce binding to Fc gamma receptors and resulting activity and can be used in the treatment of various diseases and disorders. | 04-30-2015 |
20150125443 | COMBINED THERAPEUTIC USE OF ANTIBODIES AND ENDOGLYCOSIDASES - The invention relates to compositions comprising therapeutic antibodies, and uses and methods for increasing the potency of therapeutic antibodies. In particular, the invention provides a composition comprising (i) an agent which reduces Fc receptor binding of endogenous serum antibodies, and (ii) a therapeutic antibody, preferably a therapeutic antibody which is resistant to the agent. The therapeutic antibody may be administered to the subject after a set time interval, or the blood of the subject may be treated with the agent prior to administration of the therapeutic antibody. | 05-07-2015 |
20150125444 | Molecules with Reduced Effector Function and Extended Half-Lives, Compositions, and Uses Thereof - Provided are polypeptides comprising a variant IgG Fc domain, wherein the polypeptides exhibit reduced or ablated effector functions (e.g., ADCC and/or CDC) and increased stability and plasma half-life compared to a parent polypeptide. Also provided are compositions, methods of treatment, and methods to diminish Fc-induced effector function in a parent polypeptide. | 05-07-2015 |
20150125445 | COMPOSITIONS AND METHODS FOR TREATING CANCER - The present invention provides compositions for targeting SAS1B positive cancer cells using immunotoxin technology and discloses that kidney and pancreatic cancer cells are SAS1B positive, but not normal kidney and pancreatic cells. The invention discloses that despite being expressed only in growing oocytes in females among normal tissues SAS1B is expressed in cancers of both men and women. | 05-07-2015 |
20150125446 | COMBINATION THERAPY OF AN ANTI CD20 ANTIBODY WITH A BTK INHIBITOR - The present invention is directed to the combination therapy of an anti-CD20 antibody with a BTK inhibitor for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with a type I anti-CD20 antibody or an afucosylated humanized B-Ly1 antibody and a BTK inhibitor. | 05-07-2015 |
20150125447 | PHARMACEUTICAL COMBINATIONS COMPRISING CD33 ANTIBODIES AND DE-METHYLATING AGENTS - The present invention relates to pharmaceutical combinations CD33 antibodies and de-methylating agents for use in treating diseases like MDS and cancer, especially AML. | 05-07-2015 |
20150125448 | METHOD FOR PREDICTING THE RESPONSE TO HER2-DIRECTED THERAPY - This invention provides methods for determining or predicting response to HER2-directed therapy in an individual. | 05-07-2015 |
20150132288 | ANTI-CD134 (OX40) ANTIBODIES AND USES THEREOF - The invention provides antibodies that specifically bind to human CD134. Invention anti-human CD134 antibodies specifically bind to the extracellular domain of human CD134, including non-OX40 ligand (OX40L) binding domains on human CD134, which is expressed on e.g. activated human conventional effector CD4 and/or CD8 T lymphocytes (Teffs) and on activated human suppressive regulatory CD4 T lymphocytes (Tregs). Invention anti-human CD134 antibodies are useful (e.g. to empower Teffs anti-cancer effector function and/or to inhibit Tregs suppressive function) for cancer treatment. | 05-14-2015 |
20150132289 | METHODS AND COMPOSITIONS FOR TREATING PSC (PRIMARY SCLEROSING CHOLANGITIS) OR PBC (PRIMARY BILIARY CIRRHOSIS) WITH ANTI-CD3 IMMUNE MOLECULE THERAPY - A method or composition comprising an anti-CD3 immune molecule for treatment of PSC (primary sclerosing cholangitis) or PBC (primary biliary cirrhosis) in a subject. | 05-14-2015 |
20150132290 | Methods and Compositions for Infusion of Transiently Engrafting, Selected Populations of Allogeneic Lymphocytes to Treat Cancer - The invention provides methods and compositions for administration of allogeneic lymphocytes as an an exogenous source of CD4+ T cell help for endogenous, tumor-reactive CD8+ T cells. Depletion of CD8+ T cells from the donor lymphocyte infusion reduces the risk of sustained engraftment and graft-versus-host disease. Removal of regulatory T cells from the infused population may augment the ability of non-regulatory T cells to provide help for endogenous effectors of anti-tumor immunity. Allogeneic T cell therapy is typically given in the context of allogeneic stem cell transplantation, in which the patient receives highly immunosuppressive conditioning followed by an infusion of a stem cell graft containing unselected populations of mature T cells. In the treatment described here, the graft is engineered to minimize the possibility of sustained donor cell engraftment, and the anti-tumor effector T cells derive from the host. | 05-14-2015 |
20150132291 | METHODS FOR TREATMENT OF GASTRIC CANCER - The application provides methods of detection, diagnosis, prognosis, prophylaxis and treatment of folate receptor-alpha-expressing gastric cancer using antibodies that specifically bind to folate receptor alpha. | 05-14-2015 |
20150132292 | USE OF ERBB3 INHIBITORS IN THE TREATMENT OF TRIPLE NEGATIVE AND BASAL-LIKE BREAST CANCERS - Provided are methods of suppressing growth of triple negative breast tumors and basal-like breast tumors by contacting tumor cells with an ErbB3 inhibitor, e.g., an anti-ErbB3 antibody. Also provided are methods for treating triple negative breast cancer or basal-like breast cancer in a patient by administering to the patient an ErbB3 inhibitor, e.g., an anti-ErbB3 antibody. The treatment methods can further comprise selecting a patient having a triple negative breast cancer or basal-like breast cancer and then administering an ErbB3 inhibitor to the patient. The treatment methods also can further comprise administering at least one additional anti-cancer agent to the patient in combination with the ErbB3 inhibitor. | 05-14-2015 |
20150132293 | IMMUNOSTIMULATORY SEQUENCE OLIGONUCLEOTIDES AND METHODS OF USING THE SAME - The invention provides immunomodulatory polynucleotides and methods for immunomodulation of individuals using the immunomodulatory polynucleotides. | 05-14-2015 |
20150132294 | COMPOSITIONS AND METHODS FOR CHARACTERIZING, REGULATING, DIAGNOSING, AND TREATING CANCER - The present invention relates to compositions and methods for characterizing, regulating, diagnosing, and treating cancer. For example, the present invention provides compositions and methods for inhibiting tumorigenesis of certain classes of cancer cells, including breast cancer cells and preventing metastasis. The present invention also provides systems and methods for identifying compounds that regulate tumorigenesis. | 05-14-2015 |
20150132295 | METHODS AND COMPOSITIONS FOR DIAGNOSING, PROGNOSING, AND TREATING ENDOMETRIOSIS - This document provides methods and materials related to genetic variations associated with endometriosis. For example, this document provides methods for using such genetic variations to assess risk of, or susceptibility of developing or diagnosing endometriosis. | 05-14-2015 |
20150132296 | COMPOSITIONS AND METHODS USEFUL FOR THE TREATMENT OF NEUROMYELITIS OPTICA SPECTRUM DISORDERS - Compositions and methods useful for the treatment of neuromyelitis optica (NMO) or neuromyelitis optica spectrum disorder (NMOSD) are disclosed. | 05-14-2015 |
20150132297 | SURVIVAL PREDICTOR FOR DIFFUSE LARGE B CELL LYMPHOMA - The invention provides methods and materials related to a gene expression-based survival predictor for DLBCL patients. | 05-14-2015 |
20150132298 | GEMCITABINE PRODRUGS AND USES THEREOF - The present invention provides compounds according to formula I: | 05-14-2015 |
20150132299 | METHODS OF TREATING NEURONAL INFLAMMATION USING AN IL-31 MONOCLONAL ANTIBODY - Use of antagonists to IL-31 are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 05-14-2015 |
20150132300 | METHODS OF ANTAGONIZING SIGNAL TRANSDUCTION IN SPINAL CORD CELLS USING AN IL-31RA OR OSMR-B ANTAGONIST - Use of antagonists to IL-31Ra and OSMRb are used to treat inflammation and pain by inhibiting, preventing, reducing, minimizing, limiting or minimizing stimulation in neuronal tissues. Such antagonists include soluble receptors, antibodies and fragments, derivative, or variants thereof. Symptoms such as pain, tingle, sensitization, tickle associated with neuropathies are ameliorated. | 05-14-2015 |
20150139979 | METHODS OF TREATING A DISEASE OR DISORDER ASSOCIATED WITH BRUTON'S TYROSINE KINASE - The present invention provides methods of treating, stabilizing or lessening the severity or progression of a disease or disorder associated with BTK. | 05-21-2015 |
20150139980 | DETECTORS OF SERUM BIOMARKERS FOR PREDICTING OVARIAN CANCER RECURRENCE - Polypeptide marker antigens for detecting the presence of autoantibody biomarkers associated with ovarian cancer recurrence, each of the polypeptide marker antigens binding specifically to at least one autoantibody marker. An antibody binding assay for detecting the presence of autoantibody biomarkers associated with ovarian cancer recurrence, and methods for performing the assay. Methods for determining ovarian cancer recurrence in an ovarian cancer patient. A method for isolating antibodies specific for ovarian cancer by their affinity to the polypeptide marker antigens, and antibodies isolated by that method. | 05-21-2015 |
20150139981 | ENZYMATIC MODIFICATION OF ANTI-AQP4 AUTOANTIBODY FOR MODULATING NEUROMYELITIS OPTICA - Provided herein is a method of treating neuromyelitis optica (NMO) in an animal or human subject comprising administering to the subject a composition comprising a therapeutically effective amount of an Fc region modified anli-AQP4 antibody, thereby treating the NMO in the subject, in some embodiments, the Fc region modified anti-AQP4 antibody is an anti-AQP4 antibody deglycosylated at the amino acid position Asn297. In other embodiments, the Fc region modified anti-AQP4 antibody is an anii-AQP4 antibody F(ab′) | 05-21-2015 |
20150139982 | ANTI-SIGLEC-15 ANTIBODIES - Antibodies and antigen binding fragments that specifically binds to Siglec-15 are described herein. These antibodies or antigen binding fragments may have the ability of inhibiting differentiation of osteoclasts and/or the ability of inhibiting the bone resorption activity of osteoclasts. Compositions and cells expressing anti-Siglec-15 antibodies or antigen binding fragments are also disclosed herewith. Anti-Siglec-15 antibodies may also be useful for the treatment of bone loss, or bone diseases. Methods for the detection or diagnosis of bone loss or bone-related diseases are also described. | 05-21-2015 |
20150139983 | USE OF BLOCKING AGENTS OF BONE MORPHOGENIC PROTEIN (BMP) SIGNALLING FOR THE TREATMENT OF NEUROINFLAMMATORY AND NEURODEGENERATIVE DISEASES - The invention provides pharmaceutical compositions for the treatment of neuroinflammatory or neurodegenerative diseases comprising a single or a combination of several blocking agent(s) of Bone Morphogenic Protein (BMP) signaling. The invention further provides methods of treatment of neuroinflammatory or neurodegenerative diseases comprising administering to a patient in need thereof the pharmaceutical compositions of the invention. | 05-21-2015 |
20150139984 | ACTIVE PROTEASE-RESISTANT ANTIBODY FC MUTANTS - The present invention relates to modified Fc-containing molecules including modified antibodies characterized by increased resistance to host and pathogen-derived proteases, ability to interact with FcγR receptors except with FcγRI, and lack of induction of IL-10 secretion by macrophages, and methods of using and making them. | 05-21-2015 |
20150139985 | NOVEL COMPOSITIONS AND METHODS FOR TREATING IgE-MEDIATED DISORDERS - The present invention relates to immunoglobulins that bind IgE and FcγRIIb with high affinity, said compositions being capable of inhibiting cells that express membrane-anchored IgE. Such compositions are useful for treating IgE-mediated disorders, including allergies and asthma. | 05-21-2015 |
20150139986 | ILT3 BINDING MOLECULES AND USES THEREFOR - The present invention provides binding molecules that specifically bind to ILT3, e.g., human ILT3 (hILT3), on antigen presenting cells, such as for example, monocytes, macrophages and dendritic cells (DC), e.g., monocyte-derived dendritic cells (MDDC). The binding molecules of the invention are characterized by binding to hILT3 with high affinity and downmodulating immune responses in vitro, e.g., downmodulating alloimmune responses; the production of inflammatory cytokines by dendritic cells, e.g., monocyte-derived dendritic cells (MDDC); the upregulation of costimulatory molecules by DC, e.g., MDDC; and/or calcium flux in monocytes. In addition, the binding molecules upregulate the expression of inhibitory receptors on dendritic cells, e.g., immature dendritic cells. Surprisingly, these same binding molecules which downmodulate immune responses in vitro, are immunostimulatory in vivo. | 05-21-2015 |
20150139987 | TREATMENT OF HOMOZYGOUS FAMILIAL HYPERCHOLESTEROLEMIA - Treatment of homozygous familial hypercholesterolemia by administration of (R)-2-(4-((2-ethoxy-3-(4-(trifluoromethyl)phenoxy)propyl)thio)-2-methylphenoxy)acetic acid or a salt thereof, optionally in combination with an MTP inhibitor, an apoB-100 synthesis inhibitor, or a PCSK9 inhibitor. | 05-21-2015 |
20150139988 | GLYCOENGINEERED BINDING PROTEIN COMPOSITIONS - Provided are glycoengineered populations of Fc domain-containing binding proteins with a reduced anti-drug immune response (ADA). Also provided are methods of treating disease using such compositions, and methods and host for making such compositions. | 05-21-2015 |
20150139989 | ANTIBODY RECOGNIZING HUMAN LEUKEMIA INHIBITORY FACTOR (LIF) AND USE OF ANTI-LIF ANTIBODIES IN THE TREATMENT OF DISEASES ASSOCIATED WITH UNWANTED CELL PROLIFERATION - The invention relates to antibodies directed against human Leukemia Inhibitory Factor (LIF) and to a hybridoma cell line producing said antibodies. The invention also relates to a method for blocking/inhibiting the proliferation of stem cells, and to an in vitro method for the diagnosis of diseases associated with unwanted cell proliferation in a subject or for determining the predisposition of a subject to suffer from said disease associated with unwanted cell proliferation, or for prognosis of average life expectancy of a subject suffering from said disease. The therapeutic potential of said antibodies is based on observing that the inhibition of LIF can be used in therapeutic compositions for the treatment of diseases associated with unwanted proliferation. | 05-21-2015 |
20150139990 | HUMAN MONOCLONAL ANTIBODY - The invention provides a method for the prophylaxis, improvement, or treatment of inflammatory bowel disease, multiple sclerosis, and psoriasis by administering to a subject an effective amount of an isolated anti-human CD81 antibody capable of binding to a peptide region consisting of the amino acid sequence of amino acid numbers 80 to 175 of SEQ ID NO:22. | 05-21-2015 |
20150147315 | COMPOSITIONS AND METHODS OF USE - The present invention relates to a derivative bacterial strain of an avirulent, non-pathogenic | 05-28-2015 |
20150147316 | CD33 ANTIBODIES AND USE OF SAME TO TREAT CANCER - The invention provides murine, chimeric, and humanized antibodies that specifically bind to CD33. The antibodies are useful for treatment and diagnoses of various cancers as well as detecting CD33. | 05-28-2015 |
20150147317 | METHODS RELATED TO BEVACIZUMAB - The present invention relates to the characterization and production of bevacizumab. | 05-28-2015 |
20150147318 | CANINIZED ANTI-NGF ANTIBODIES AND METHODS THEREOF - The invention provides novel caninized anti-NGF antibodies (such as caninized anti-NGF antagonist antibodies and antigen binding proteins), and polynucleotides encoding the same. The invention further provides use of said antibodies or antigen binding proteins and/or nucleotides in the treatment and/or prevention of NGF related disorders, particularly pain. | 05-28-2015 |
20150147319 | METHODS OF TREATING ANTIBODY-MEDIATED REJECTION IN ORGAN TRANSPLANT PATIENTS WITH C1-ESTERASE INHIBITOR - A method and composition for treating or preventing antibody-mediated rejection (AMR) of a transplanted organ are provided. | 05-28-2015 |
20150147320 | Ophthalmic Drug Delivery System Containing Phospholipid and Cholesterol - An ophthalmic drug delivery system that contains phospholipid and cholesterol for prolonging drug lifetime in the eyes. | 05-28-2015 |
20150147321 | PHARMACEUTICAL COMPOSITION COMPRISING ANTIBODY COMPOSITION WHICH SPECIFICALLY BINDS TO CCR4 - A pharmaceutical composition, comprising an antibody composition which specifically binds to human CC chemokine receptor 4 (hereinafter also referred to as CCR4) and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament are required. The present invention can provide a pharmaceutical composition comprising a recombinant antibody against CCR4 and at least one medicament; and a pharmaceutical composition for administering in combination of a recombinant antibody against CCR4 and at least one medicament. | 05-28-2015 |
20150147322 | COMPOSITIONS AND METHODS FOR TARGETING TYPE 1 INTERFERON PRODUCING CELLS - The present disclosure provides a method for treating lupus, Sjörgen's syndrome or scleroderma, the method comprising administering to the mammal an immunoglobulin which binds an interleukin 3 receptor α (IL-3Rα) chain and which depletes or at least partly eliminates plasmacytoid dendritic cells (p DCs) and basophils to which it binds. | 05-28-2015 |
20150290168 | CLASS IIA HDAC INHIBITORS FOR THE TREATMENT OF INFECTION - In some aspects, methods for treating a bacterial infection in a mammalian subject are provided. In some embodiments, a class IIa HDAC inhibitor such as, e.g., a HDAC4 inhibitor, may be used to treat a bacterial infection such as, e.g., anthrax, pertussis, tuberculosis, or cholera. | 10-15-2015 |
20150290228 | ORAL FORMULATIONS OF CYTIDINE ANALOGS AND METHODS OF USE THEREOF - The present disclosure provides pharmaceutical compositions comprising cytidine analogs for oral administration, wherein the compositions release the cytidine analog substantially in the stomach. Also provided are methods of diffuse large B-cell lymphoma, follicular lymphoma, or mantel cell lymphoma, which comprises administering to a human having diffuse large B-cell lymphoma, follicular lymphoma, or mantel cell lymphoma a therapeutically effective amount of 5-azacytidine, or a pharmaceutically acceptable salt, solvate or hydrate thereof, and optionally administering therapeutically effective amounts of one or more additional active agents. | 10-15-2015 |
20150290317 | Combination of Anti-CD20 Antibody and PI3 Kinase Selective Inhibitor - Highly effective combinations of a compound of formula A (a PI3Kδ selective inhibitor) and anti-CD20 antibodies are provided herein for the treatment and amelioration of PI3Kδ and/or CD20 mediated diseases and disorders. In particular, the combination can be used to treat cancers and autoimmune diseases. More particularly, the invention provided for a combination of a compound of formula A, or stereoisomers thereof, and ublituximab for the treatment and/or amerioration of hematological malignancies such as leukemia and lymphoma. | 10-15-2015 |
20150291685 | ANTIBODIES TO S. AUREUS SURFACE DETERMINANTS - Antibodies and antigen binding fragments thereof directed against | 10-15-2015 |
20150291686 | AGLYCOSYLATED HUMAN ANTIBODY AND FUSION PROTEIN AND USES THEREOF - The invention is a method for reducing the effector functions of a therapeutic neutralizing antibody by administering to the afflicted subject an effective amount of an engineered aglycosylated human monoclonal antibody containing an engineered Fc region, wherein aglycosylation of the Fc region prevents therapeutic antibody-mediated cell activation, inflammation, Clq binding to the antibody and antibody triggered classical pathway activation. | 10-15-2015 |
20150291688 | Methods For Treating Tweak-Related Conditions - The present invention provides methods and agents for the treatment of TWEAK-related conditions, including cardiac, liver, kidney, lung, adipose, skeletal, muscle, neuronal, bone and cartilage conditions. The invention also provides methods for identifying TWEAK agonists or antagonists for the treatment of TWEAK-related conditions. Additionally, the invention provides transgenic animals that express an exogenous DNA encoding a TWEAK polypeptide, or fragments, analogs, or muteins thereof, and methods for using such animals to identify TWEAK agonists or antagonists. The invention further provides methods for diagnosing a disease based on TWEAK expression. The invention also provides methods for affecting cellular differentiation of progenitor cells using TWEAK polypeptides, agonists, or antagonists. | 10-15-2015 |
20150291690 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 10-15-2015 |
20150291696 | ANTI-cMET ANTIBODY - Antibody capable of binding specifically to the human c-Met receptor and/or capable of specifically inhibiting the tyrosine kinase activity of said receptor, with an improved antagonistic activity, said antibody comprising a modified hinge region. A composition comprising such an antibody antagonist to c-Met and its use as a medicament for treating cancer. | 10-15-2015 |
20150293123 | CATHELICIDIN AS NOVEL INFLAMMATORY BOWEL DISEASE MARKER AND THERAPY FOR COLITIS-ASSOCIATED INTESTINAL FIBROSIS - Method of diagnosing and treating inflammatory bowel disease are disclosed herein. Inflammatory bowel disease can be treated and diagnosed using cathelicidin peptides and detection agents thereof. Specifically, method of treating and diagnosing Crohn's disease and ulcerative colitis are disclosed herein. | 10-15-2015 |
20150297540 | Uses and Methods for the Treatment of Liver Diseases or Conditions - The present application relates methods and uses of oral diamidines or pharmaceutically acceptable salts thereof for the treatment of liver diseases or conditions. | 10-22-2015 |
20150299307 | ANTI-VEGF ANTIBODIES AND THEIR USES - The present disclosure relates to antibodies directed to vascular endothelial growth factor (“VEGF”) and uses of such antibodies, for example to treat diseases associated with the activity and/or overproduction of VEGF. | 10-22-2015 |
20150299319 | Methods and Compositions for Increasing the Efficiency of Therapeutic Antibodies Using NK Cell Potentiating Compounds - The present invention relates, generally, to methods and compositions for increasing the efficiency of therapeutic antibodies. Their efficiency is enhanced through the increase of the ADCC mechanism. More particularly, the invention relates to the use of a therapeutic antibody in combination with compounds that block an inhibitory receptor or stimulate an activating receptor of an NK cell in order to enhance the efficiency of the treatment with therapeutic antibodies in human subjects. | 10-22-2015 |
20150299323 | ANTIBODIES TO VLA-1 - Antibodies that specifically bind to VLA-1 integrin and methods of using these antibodies to treat immunological disorders in a subject. Also included are crystal structures of complexes formed by VLA-1 antibodies and their ligands, and VLA-1 antagonists and agonists identified by using the structure coordinates of these structures. | 10-22-2015 |
20150299327 | AMINO ACID SEQUENCES DIRECTED AGAINST CELLULAR RECEPTORS FOR VIRUSES AND BACTERIA - The present invention relates to amino acid sequences that are directed against (as defined herein) human cellular receptors for viruses and/or bacteria such as e.g. Nanobodies specifically recognizing hCD4, hCXCR4, hCCR5, hTLR4, human alphaV integrin, human beta3 integrin, human beta1 integrin, human alpha2 integrin, hCD81, hSR-BI, hClaudin-1, hClaudin-6 and hClaudin-9, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. Said amino acid sequences may be used to prevent human cell entry of HIV, HCV, adenoviruses, hantavirus, herpesvirus, echo-virus 1 and others. | 10-22-2015 |
20150299802 | Biomarker Combinations for Colorectal Tumors - The present invention relates to methods and kits for the detection of predetermined biomarkers for early diagnosis and management of cancer, and in particular, colorectal tumors. | 10-22-2015 |
20150301070 | LIPID BIOMARKERS FOR STABLE AND UNSTABLE HEART DISEASE - The present invention relates generally to the field of diagnostic and prognostic assays for heart disease. More particular, the present invention provides an assay for diagnosing the presence or extent of development of heart disease or its classification or state thereof. The assay of the present invention is also useful in the stratification of a subject with respect to a risk of developing heart disease. The assay of the present invention is also capable of integration into pathology architecture to provide a diagnostic and reporting system. | 10-22-2015 |
20150306082 | SOLENOPSIN AND DERIVATIVES, THERAPEUTIC COMPOSITIONS, AND METHODS RELATED THERETO - This disclosure relates to solenopsin derivatives, pharmaceutical compositions, and therapeutic uses related thereto. In certain embodiments, the disclosure relates to compounds of the following formula: | 10-29-2015 |
20150306095 | An Indolinone Derivative As Tyrosine Kinase Inhibitor - The present invention relates to a compound represented by general formula (I), a method for preparing said compound, a pharmaceutical formulation containing said compound, and the use of said compound in manufacture of a medicament for treating or preventing the fibrous degeneration disease and treating the excessive proliferation disease: | 10-29-2015 |
20150306106 | INHIBITORS OF BRUTON'S TYROSINE KINASE - Described herein are irreversible kinase inhibitor compounds, methods for synthesizing such irreversible inhibitors, and methods for using such irreversible inhibitors in the treatment of diseases. Further described herein are methods, assays and systems for determining an appropriate irreversible inhibitor of a protein, including a kinase. | 10-29-2015 |
20150307500 | INHIBITORS OF BRUTON'S TYROSINE KINASE - Described herein are irreversible kinase inhibitor compounds, methods for synthesizing such irreversible inhibitors, and methods for using such irreversible inhibitors in the treatment of diseases. Further described herein are methods, assays and systems for determining an appropriate irreversible inhibitor of a protein, including a kinase. | 10-29-2015 |
20150307601 | ANTIBODIES SPECIFIC FOR SOLUBLE AMYLOID BETA PEPTIDE PROTOFIBRILS AND USES THEREOF - The invention relates to an isolated monoclonal antibody or antigen-binding fragment thereof that (a) binds (i) wild-type Aβ 42/40 protofibril comprising N-terminal truncated Aβ forms and (ii) Aβ 42/40 Arc protofibril comprising N-terminal truncated Aβ forms and (b) has no or little cross-reactivity to Aβ 42/40 monomers. The invention further relates to a method of using such an antibody to treat Alzheimer's disease. | 10-29-2015 |
20150307607 | METHODS OF TREATING CHRONIC PAIN - The invention relates to an anti-CGRP antibody for use in the prevention and/or treatment of chronic pain and/or symptoms of chronic pain, and to a method of treating and/or preventing chronic pain and/or symptoms of chronic pain using an anti-CGRP antibody. | 10-29-2015 |
20150307610 | ANTIBODIES TO RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS (RAGE) AND USES THEREOF - The present application relates to antibodies, such as monoclonal antibodies, and in particular CDR grafted, humanized versions thereof, for the treatment and diagnosis of pain and other neuroinflammatory conditions associated with the Receptor for Advanced Glycation End Products (RAGE). | 10-29-2015 |
20150307611 | METHODS FOR DIAGNOSING AND TREATING INFLAMMATORY BOWEL DISEASE - Biomarkers predictive of responsiveness to integrin beta7 antagonists, including anti-beta7 integrin subunit antibodies, and methods of using such biomarkers are provided. In addition, methods of treating gastrointestinal inflammatory disorders such as inflammatory bowel diseases including ulcerative colitis and Crohn's disease are provided. Also provided are methods of using such predictive biomarkers for the treatment of inflammatory bowel diseases including ulcerative colitis and Crohn's disease. | 10-29-2015 |
20150307613 | NOVEL ANTI-cMET ANTIBODY - The invention relates to a novel antibody capable of binding specifically to the human c-Met receptor and/or capable of specifically inhibiting the tyrosine kinase activity of said receptor both is a ligand-dependent and in a ligand-independent manner, with an improved antagonistic activity, said antibody comprising a modified hinge region. | 10-29-2015 |
20150307614 | Enhanced immunological responses - Cancers and other diseases can be treated with two or three types of agents: an agent which induces lymphodepletion or lymphopenia; an inhibitory antibody to a surface marker on Treg cells; and optionally a specific antigen. This combination may lead to enhanced immune responses despite lymphodepletion or lymphopenia. | 10-29-2015 |
20150307617 | ANTI-OX40 ANTIBODIES AND METHODS OF USE - The invention provides anti-OX40 antibodies and methods of using the same. | 10-29-2015 |
20150307618 | METHODS FOR TREATING PROGRESSIVE MULTIPLE SCLEROSIS - The present invention concerns methods for treating progressive multiple sclerosis (MS) in a patient, and an article of manufacture with instructions for such use. | 10-29-2015 |
20150307619 | Use of C-C Chemokine Receptor Type 7 (CCR7) Inhibitors - This application discloses ophthalmic formulations and methods for treating dry eye disease with a C-C chemokine receptor type 7 (CCR7) inhibitor. | 10-29-2015 |
20150307622 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF BONE METASTASES - The present disclosure relates to methods and pharmaceutical compositions for the treatment of bone metastases. In particular, the present disclosure relates to an agent selected from the group consisting of an anti-ROB04 antibody, an anti-ROB04 aptamer, a ROB04 decoy polypeptide, an inhibitor of ROB04 expression for use in a method for preventing or treating bone meta-stases in a subject in need thereof. | 10-29-2015 |
20150309033 | PODXL PROTEIN IN COLORECTAL CANCER - The present disclosure provides a method for determining whether a mammalian subject having a colorectal cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of: a) evaluating an amount of PODXL protein in at least part of a sample earlier obtained from the subject, and determining a sample value corresponding to the evaluated amount; b) comparing said sample value from step a) with a predetermined reference value; and if said sample value is higher than said reference value, c1) concluding that the subject belongs to said second group; and if said sample value is lower than or equal to said reference value, c2) concluding that the subject belongs to said first group. Related uses, means and a method of treatment are also provided. | 10-29-2015 |
20150313882 | USE OF MALEIMIDE DERIVATIVES FOR PREVENTING AND TREATING CANCER - The present invention is related to a compound of formula (I) a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, a metabolite thereof or a prodrug thereof; for use in a method for the treatment and/or prevention of cancer, wherein X is selected from the group consisting of N—R | 11-05-2015 |
20150315150 | KINASE INHIBITORS AND METHODS OF THEIR USE - New compounds, compositions and methods of inhibition of Provirus Integration of Maloney Kinase (PIM kinase) activity associated with tumorigenesis in a human or animal subject are provided. In certain embodiments, the compounds and compositions are effective to inhibit the activity of at least one PIM kinase. The new compounds and compositions may be used either alone or in combination with at least one additional agent for the treatment of a serine/threonine kinase- or receptor tyrosine kinase-mediated disorder, such as cancer. | 11-05-2015 |
20150315274 | Anti-PD1 Antibodies and their Use as Therapeutics and Diagnostics - Provided are antibodies that specifically bind to Programmed Death-1 (PD1, Pdcd-1, or CD279) and inhibit PD1-mediated cellular signaling and activities in immune cells, antibodies binding to a set of amino acid residues required for its ligand binding, and uses of these antibodies to treat or diagnose cancer, infectious diseases or other pathological disorders modulated by PD1-mediated functions. | 11-05-2015 |
20150315275 | ANTI-HUMAN B7-H4 ANTIBODIES AND THEIR USES - Anti-human B7-H4 antibody “6H3”, antigen-binding fragments, derivatives, and humanized variants thereof that are capable of immmospecifically binding to B7-H4, and the uses of such molecules in the diagnosis and the treatment of cancer and other diseases are disclosed. In preferred embodiments, the molecules are used to retard or prevent tumor growth, inhibit tumor-mediated suppression, eliminate tumors and/or deplete or block the activity of tumor-associated macrophages (“TAMs”) so as to alter their activity and/or decrease TAM-mediated immune suppression. | 11-05-2015 |
20150315282 | ANTI-CD40 ANTIBODIES - The present invention relates to new humanized antagonistic anti-CD40 antibodies and therapeutic and diagnostic methods and compositions for using the same. | 11-05-2015 |
20150315284 | OPTIMIZED Fc VARIANTS - The present invention relates to a variant Fc region comprising an amino acid substitution at position 238 of the Fc region as compared to a human parent Fc region, wherein the variant Fc region comprises a 238D substitution, wherein the variant Fc region binds FcγRIIb with increased binding affinity compared to a human parent Fc region. | 11-05-2015 |
20150315285 | HUMAN CDR-GRAFTED ANTIBODY AND ANTIBODY FRAGMENT THEREOF - A human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of human CC chemokine receptor 4 (CCR4) but does not react with a human blood platelet; a human CDR-grafted antibody or the antibody fragment thereof which specifically reacts with the extracellular region of CCR4 and has a cytotoxic activity against a CCR4-expressing cell; and a medicament, a therapeutic agent or a diagnostic agent comprising at least one of the antibodies and the antibody fragments thereof as an active ingredient. | 11-05-2015 |
20150315287 | Genetic Products Differentially Expressed in Tumors and the Use Thereof - According to the invention, gene products expressed in a tumor-associated manner and the nucleic acids coding therefor were identified. The invention relates to the therapy and diagnosis of diseases wherein said gene products expressed in a tumor-associated manner are aberrantly expressed. The invention also relates to proteins, polypeptides and peptides which are expressed in a tumor associated manner and to nucleic acids coding therefor. | 11-05-2015 |
20150315291 | HER2DELTA16 PEPTIDES - The present invention provides cyclic peptides comprising a dimer of peptides, each peptide comprising a sequence corresponding to the HER2 splice variant HER2Delta16, wherein the cyclic peptide is cyclized via a disulfide bond between the peptides and via an amino acid linking the peptides. The invention also provides methods of making antibodies that specifically bind to HER2Delta16 homodimers using said cyclic peptides. | 11-05-2015 |
20150315657 | GENE FUSIONS AND GENE VARIANTS ASSOCIATED WITH CANCER - The disclosure provides gene fusions, gene variants, and novel associations with disease states, as well as kits, probes, and methods of using the same. | 11-05-2015 |
20150315659 | CIRCULATING miRNAs AS EARLY DETECTION MARKER AND PROGNOSTIC MARKER - Provided is a novel method for the early detection and/or discrimination of cancer and anti-cancer agents for the prevention or early treatment of cancer. In particular, the method relates to the determination of levels of circulating miRNAs in breast cancer patients, both primary and metastatic. Furthermore, kits, devices, pharmaceutical compositions as well as methods related thereto are described. | 11-05-2015 |
20150320696 | COMBINATION THERAPY FOR CANCER - The present invention relates to a combination therapy for the treatment of cancer, particularly to combinations of terpinen-4-ol and at least one additional anti-cancer therapeutic agent. The combination therapy of the present invention shows enhanced anti-cancerous therapeutic effects compared to the effect of each of the components administered alone. In some embodiments, the combination therapy provide for a synergistic anti-cancer effect. | 11-12-2015 |
20150320706 | FORMULATIONS AND METHODS OF TREATING ALZHEIMER'S DISEASE AND OTHER PROTEINOPATHIES BY COMBINATION THERAPY - Administration of a 1-phenylalkanecarboxylic acid before, after, or a concurrently with a therapeutically effective amount of one or more of the following: (1) β-amyloid peptides level reducers, (2) pathogenic level tau reducers, (3) microtubule stabilizers, (4) agents capable or removing atherosclerotic plaques, (5) agents that lower circulating levels of β-amyloid and tau, (6) modulators of autophagy, (7) neurotransmitter levels regulators, (8) GABA(A) α5 Receptor Antagonists, and (9) additional agents that help maintain and/or restore cognitive function and functional deficits of AD, and/or slow down decline in cognitive functions and functional deficits in AD, is useful for prevention or therapeutical treatment of proteinopathies and/or neurodegenerative diseases. | 11-12-2015 |
20150320785 | METHODS USED TO IDENTIFY AND TREAT GLIOBLASTOMA - The invention encompasses methods and kits used in the identification of invasive glioblastoma based upon the expression of TROY. The methods and kits also allow prediction of disease outcome as well as therapeutic outcome. | 11-12-2015 |
20150320861 | EGFR TARGETED THERAPY OF NEUROLOGICAL DISORDERS AND PAIN - The present invention relates to compositions and methods for treatment of neurological disorders. In particular, the present invention relates to the epidermal growth factor receptor (EGFR) as a clinical target for treatment of neurological disorders, preferably in conjunction with neuropathic pain. The invention relates in more detail to compositions comprising inhibitors of EGFR | 11-12-2015 |
20150322046 | METHODS FOR TREATMENT OF BREAST CANCER NONRESPONSIVE TO TRASTUZUMAB - The present invention provides a method of treating breast cancer that is nonresponsive to treatment with trastuzumab, comprising administering to a subject in need of such treatment a therapeutically effective amount of compound N-(3,4-dichloro-2-fluorophenyl)-7-({[(3aR,6aS)-2-methyloctahydrocyclopenta[c]pyrrol-5-yl]methyl}oxy)-6-(methyloxy)quinazolin-4-amine, or a pharmaceutically acceptable salt thereof. | 11-12-2015 |
20150322135 | ENGINEERED MONOMERIC ANTIBODY FRAGMENTS - The present invention relates to monomeric polypeptides comprising an engineered monomeric antibody fragment (e.g., monomeric Fc-containing polypeptides) wherein the monomeric Fc comprises one or more engineered N-linked glycosylation sites in the CH3-CH3 dimerization interface. Methods for producing such engineered monomeric antibody fragments and their use in diagnostics and therapeutics are also provided. | 11-12-2015 |
20150322142 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms and/or headaches (e.g., migraine, cluster headache, and tension headache) by administering an anti-CGRP antagonist antibody. Compositions for use in the disclosed methods are also provided. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 11-12-2015 |
20150322153 | ANTI-PD-L1 ANTIBODIES AND ARTICLES OF MANUFACTURE - The present application relates to anti-PD-L1 antibodies, which have therapeutic use to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, including infection (e.g., acute and chronic) and tumor immunity. | 11-12-2015 |
20150322161 | RECOMBINANT HUMAN IgM-ANTIBODY EFFECTIVE AGAINST CANCER CELLS - A recombinant human monoclonal pentameric IgM antibody comprising the capability of oligospecific binding to purified ganglioside epitopes GD3, GM3, GD2 and GM1 and the capability of specific binding to malignant cancer cells selected from the group consisting of melanoma cells, small cell lung cancer cells, glioblastoma cells, and estrogen receptor-negative metastatic breast cancer cells; a cell line producing the IgM antibody; and the use of the IgM antibody as a diagnostic tool and/or as a therapeutic agent. | 11-12-2015 |
20150322430 | TREATMENT OF B-CELL LYMPHOMA WITH MICRORNA - The invention relates to microRNA-34a and related microRNAs for use in the treatment of B-cell lymphoma. Likewise it relates to microRNA-34a for use in the preparation of a medicament for the treatment of B-cell lymphoma, and for a method of treatment of B-cell lymphoma comprising administering microRNA-34a. These claims are based on the observation that microRNA-34a shows strong anti-proliferative effects when overexpressed in diffuse large B-cell lymphoma (gDLBCL) cell lines, or when delivered intratumorally or systemically in xenograft models of DLBCL. | 11-12-2015 |
20150322519 | BIOMARKERS FOR PSORIASIS TREATMENT RESPONSE - Single nucleotide polymorphisms (SNPs) are provided that correlate with responsiveness of psoriasis patients to treatment with a therapeutic antibody that specifically binds to the p19 subunit of IL-23. The SNPs are used as biomarkers to prospectively selecting psoriasis patients likely to benefit from treatment with antagonists of IL-23, such as an antibody that specifically binds to the p19 subunit of IL-23. | 11-12-2015 |
20150322529 | Compositions And Methods For Diagnosis, Prognosis And Treatment Of Hematological Malignanicies - This invention is based, at least in part, on the finding that certain microRNAs (miRNAs) are expressed at higher or lower levels in circulating exosonies or peripheral blood of subjects with hematological malignancies compared to the level of expression in subjects who do not have the hematological malignancy. In addition, this invention is based, at least in part, on the finding that certain miRNAs are differentially expressed at different stages of a hematological malignancy permitting identification of the stage of the hematological malignancy in a subject. The differential expression of miRNAs at different stages of a hematological malignancy also permits determination of the effectiveness of treatments administered to a subject at the particular stage of the hematological malignancy. | 11-12-2015 |
20150322530 | MOLECULAR SIGNATURES OF OVARIAN CANCER - Described herein are gene signatures providing prognostic, diagnostic, treatment and molecular subtype classifications of ovarian cancers through generation of ovarian cancer disease signatures (OCDSs) that account for molecular heterogeneity present in gynecological cancers. An ovarian cancer fixed signature (OCFS) is described which relates to the core programming of disease development, in addition to an ovarian cancer stem cell (OCSC) signature. Development various disease signature, suggests personalized treatment strategies focused on molecular subtypes of gynecological cancers, such as triage tests for patients. | 11-12-2015 |
20150322532 | USE OF MICROVESICLES IN ANALYZING MUTATIONS - Microvesicles are small membrane vesicles that either shed or bud off eukarotic cells. Analysis of the nucleic acid content of microvesicles may be useful in detecting the presence or absence of genetic aberrations. This invention discloses novel methods of diagnosing, prognosing, monitoring, or treating a disease, such as cancer, or other medical condition in a subject involving analyzing one or more nucleic acids contained within an isolated microvesicle for the presence or absence of one or more Kras genetic aberrations. | 11-12-2015 |
20150323546 | BIOMARKERS IN INFLAMMATORY BOWEL DISEASE - The present invention provides a method of determining whether a patient with inflammatory bowel disease (IBD) and who has been treated with anti TNFα therapy is in immunological remission (IR), said method comprising determining the level of a cytokine selected from TNFα, IL-17 and IFN-γ in a G1 mucosal sample from said patient. Also provided are methods of prognosis and treatment using said method of determination, in particular discontinuing treatment if said patient is in IR and continuing treatment if said patient is not in IR. | 11-12-2015 |
20150323547 | METHODS FOR MONITORING CD4+ T-HELPER TYPE 1 RESPONSE IN CANCER AND IMMUNE RESTORATION - A method for diagnosing or treating a mammalian subject having, or at risk of developing cancer, comprising: generating a circulating anti-cancer CD4 | 11-12-2015 |
20150328214 | CELL PERMEABLE INHIBITORS OF ANAPHASE PROMOTING COMPLEX - The disclosure provides compositions and methods for treating cell cycle disorders. Compositions of the disclosure include proTAME, a prodrug analog of TAME and apcin, the combination of which inhibits an activity or function of the anaphase promoting complex (APC) by a synergistic mechanism. | 11-19-2015 |
20150328310 | METHODS AND COMPOSITIONS RELATING TO TREATMENT OF CANCER - Compositions and methods for treating cancer in a subject in need thereof are provided according to aspects of the present disclosure which include both cetuximab and ISC-4, as a combination formulation or as separate formulations. Methods of treating cancer in a subject in need thereof are provided according to aspects of the present disclosure wherein the subject has cancer characterized by wild-type KRAS wherein the methods include administering a combination of cetuximab and ISC-4 as a combination formulation or separately, and wherein administration of the combination of cetuximab and ISC-4 provides a synergistic anti-cancer effect, treating the cancer. | 11-19-2015 |
20150329620 | POLY-N-ACETYL GLUCOSAMINE (PNAG/DPNAG)-BINDING PEPTIDES AND METHODS OF USE THEREOF - The present invention relates to peptides, particularly human monoclonal antibodies, that bind specifically to poly-N-acetyl glucosamine (PNAG), such as Staphylococcal PNAG, in acetylated, partially acetylated and/or fully deacetylated form. The invention further provides methods for using these peptides in the diagnosis, prophylaxis and therapy of infections by bacteria that express PNAG such as but not limited to | 11-19-2015 |
20150329621 | ANTI-EMP2 THERAPY REDUCES CANCER STEM CELLS - Reduction of EMP2 expression and/or anti-EMP2 therapy reduces cancer stem cells in multiple types of cancer. For example, breast cancers stem cells were defined by the presence of HIF-1α, CD44 and ALDH. It is found that anti-EMP2 IgG1 can be used to reduce the numbers of cancer stem cells. | 11-19-2015 |
20150329632 | Solution Formulations of Engineered Anti-IL-23p19 Antibodies - The present invention provides high concentration solution formulations of anti-human interleukin-23 p19 (IL-23p19) antibody hum13B8-b, and their use in treating various disorders. | 11-19-2015 |
20150329647 | Methods of Treating Hematological Proliferative Disorders by Targeting EphA3 Expressed on Aberrant Vasculature in Bone Marrow - The invention provides diagnostic and therapeutic methods for the treatment of hematological proliferative disorders. | 11-19-2015 |
20150335663 | Pharmaceutical Composition Having Synergistic Action Of Direct Catalase Inhibitors And Modulators Of NO Metabolism Or Of Extracellular Superoxide Anion Production Which Lead To Catalase Destruction - The present patent application relates to a pharmaceutical composition, characterized in that it comprises at least one active ingredient which can bring about a singlet oxygen-independent direct catalase inactivation and that the composition further comprises at least one active ingredient that leads to inactivation of catalase as a result of modulation of the nitrogen oxide or superoxide anion metabolism of the cells and subsequent singlet oxygen formation. | 11-26-2015 |
20150335704 | PHARMACEUTICAL COMPOSITIONS COMPRISING GELS AND METHODS FOR FABRICATING THEREOF - Pharmaceutical compositions are described, the compositions comprising a therapeutically effective quantity of an active component and a quantity of a sterile gel. Methods for fabricating the compositions and using them for ophthalmic or burn-treating applications are also described. | 11-26-2015 |
20150335748 | PHARMACEUTICAL COMPOSITIONS - A method of stabilizing an aqueous protein or antibody formulation is disclosed herein. Additionally, stable pharmaceutical formulations are contemplated which comprise a biologically active protein, a destabilizing concentration of preservative and a stabilizing concentration of osmolyte. | 11-26-2015 |
20150336927 | SUBSTITUTED DIOXOPIPERIDINYL PHTHALIMIDE DERIVATIVES - This invention relates to novel substituted dioxopiperidinyl phthalimide derivatives and pharmaceutically acceptable acid addition salts thereof. The invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions beneficially treated by an immunomodulatory agent. | 11-26-2015 |
20150336960 | ARYL-SUBSTITUTED FUSED BICYCLIC PYRIDAZINE COMPOUNDS - The present invention provides a compound of formula (I) as described herein, and pharmaceutically acceptable salts, enantiomers, rotamers, tautomers, or racemates thereof. Also provided are methods of treating a disease or condition mediated by PIM kinase using the compounds of Formula (I), and pharmaceutical compositions comprising such compounds. | 11-26-2015 |
20150337029 | Human Antibodies to Middle East Respiratory Syndrome - Coronavirus Spike Protein - The present invention provides monoclonal antibodies that bind to the Middle East Respiratory Syndrome-Coronavirus (MERS-CoV) spike protein, and methods of use. In various embodiments of the invention, the antibodies are fully human antibodies that bind to MERS-CoV spike protein. In some embodiments, the antibodies of the invention are useful for inhibiting or neutralizing MERS-CoV activity, thus providing a means of treating or preventing MERS infection in humans. In some embodiments, the invention provides for a combination of one or more antibodies that bind to the MERS-CoV spike protein for use in treating MERS infection. In certain embodiments, the one or more antibodies bind to distinct non-competing epitopes comprised in the receptor binding domain of the MERS-CoV spike protein. | 11-26-2015 |
20150337041 | METHODS AND COMPOSITIONS FOR TREATING AUTOIMMUNE DISEASES OR CONDITIONS - The present invention relates to methods of treating immune disorders, particularly autoimmune and inflammatory disorders such as rheumatoid arthritis, and methods of producing antibodies for use in therapeutic strategies for treating such disorders. Generally, the present methods involve the use of antibodies that specifically bind to NKG2D receptors present on the surface of cells underlying the disorders. | 11-26-2015 |
20150337043 | Anti-EGFR Antibodies and Uses Thereof - The present invention provides antibodies that bind to EGFR and methods of using same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human EGFR with high affinity. In certain embodiments, the antibodies of the present invention are capable of inhibiting the growth of tumor cells expressing high levels of EGFR and/or inducing antibody-dependent cell-mediated cytotoxicity (ADCC) of such cells. The antibodies of the invention are useful for the treatment of various cancers as well as other EGFR-related disorders. | 11-26-2015 |
20150337049 | INERT FORMAT - Described herein are, proteins comprising amino acid substitutions in at least one of a first and a second polypeptide chain. Furthermore, is described the uses and methods related to said proteins. | 11-26-2015 |
20150337050 | COMPOSITIONS AND METHODS FOR TREATING AND DIAGNOSING CANCER - The present invention relates to compositions and methods for characterizing, diagnosing and treating cancer. In particular, the present invention identifies LGR5 as a protein over-expressed in solid tumor stem cell. The present invention further identifies an interaction between RSPO1 and LGR5 as an alternative pathway for the activation of beta-catenin signaling. In certain embodiments, the present invention provides biomolecules that disrupt functional signaling via a LGR protein, including, in certain embodiments, molecules that inhibit the interaction between one or more RSPO proteins and one or more LGR proteins, such as LGR5. In certain embodiments, the present invention provides methods of treating cancer comprising disrupting functional LGR signaling and inhibiting growth of a solid tumor comprising solid tumor stem cells. | 11-26-2015 |
20150337052 | Genetic Products Differentially Expressed In Tumors And The Use Thereof - The present technology relates to the identification of genetic products expressed in association with tumors and to coding nucleic acids for the expressed products. An embodiment of the present technology also relates to the therapy and diagnosis of disease in which the genetic products are aberrantly expressed in association with tumors, proteins, polypeptides and peptides which are expressed in association with tumors, and to the nucleic acids coding for the polypeptides, peptides and proteins. | 11-26-2015 |
20150337053 | Antibody Fc Mutants with Ablated Effector Functions - Antibody and other Fc-containing molecules with variations in the Fc region with reduced binding to Fc gamma receptors and resulting activity and can be used in the treatment of various diseases and disorders. | 11-26-2015 |
20150343058 | ANTIBODY FORMULATION - A pharmaceutical formulation is described comprising a therapeutically effective amount of an antibody, an acetate buffer, a lyoprotectant, a bulking agent and a surfactant. | 12-03-2015 |
20150344544 | COMPOSITIONS AND METHODS RELATING TO UNIVERSAL GLYCOFORMS FOR ENHANCED ANTIBODY EFFICACY - The present disclosure relates to glycoproteins, particularly monoclonal antibodies, comprising a glycoengineered Fc region, wherein said Fc region comprises an optimized N-glycan having the structure of Sia | 12-03-2015 |
20150344546 | Monoclonal Antibodies for Ebola and Marburg Viruses - Described herein are a number of Ebola monoclonal antibodies. | 12-03-2015 |
20150344548 | Compositions and Methods for Treating and Preventing Staphylococcus Aureus Infections - Antibodies having Fab regions that specifically bind to | 12-03-2015 |
20150344551 | COMPOSITIONS AND METHODS FOR TREATMENT AND DETECTION OF CANCERS - Pharmaceutical composition comprising antibodies or antigen binding fragments thereof that bind to SSEA-4 are disclosed herein, as well as methods of use thereof. Methods of use include, without limitation, cancer therapies and diagnostics. The antibodies of the disclosure can bind to certain cancer cell surfaces. Exemplary targets of the antibodies disclosed herein can include carcinomas, such as those in brain, lung, breast, mouse, esophagus, stomach, liver, bile duct, pancreas, colon, kidney, cervix, ovary, and/or prostate cancer. | 12-03-2015 |
20150344559 | ANTI-TNF-ALPHA GLYCOANTIBODIES AND USES THEREOF - The present disclosure relates to a novel class of anti-TNFα monoclonal antibodies or antigen binding fragments comprising a homogeneous population of anti-TNFα IgG molecules having the same N-glycan on each of Fc. The antibodies of the invention can be produced from anti-TNFα monoclonal antibodies by Fc glycoengineering. The glycoantibodies of the invention may have improved therapeutic values compared to the corresponding monoclonal antibodies that have not been glycoengineered. | 12-03-2015 |
20150344565 | ANTIBODIES TO GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR - The current invention relates to high-affinity antibodies to Granulocyte-Macrophage Colony-Stimulating Factor that have reduced immunogenicity when administered to a human to treat diseases and method of using such antibodies. | 12-03-2015 |
20150344578 | ANTIBODY TARGETING OSTEOCLAST-RELATED PROTEIN Siglec-15 - To provide a method of detecting abnormal bone metabolism by using a gene strongly expressed in an osteoclast; a method of screening a compound having a therapeutic and/or preventive effect on abnormal bone metabolism; and a pharmaceutical composition for treating and/or preventing abnormal bone metabolism. Provision of a method of detecting abnormal bone metabolism by using the expression of human Siglec-15 gene as an index; a pharmaceutical composition containing an antibody which specifically recognizes human Siglec-15 and has an activity of inhibiting osteoclast formation; and the like. | 12-03-2015 |
20150344582 | HUMAN ANTI TSHR ANTIBODIES - According to one aspect there is provided An isolated human antibody molecule which binds to the TSHR and which reduces ligand-induced stimulation of the TSHR but has no effect on TSHR constitutive activity wherein the isolated human antibody molecule has the characteristic of patient serum TSHR autoantibodies of inhibiting TSH and M22 binding to the TSHR. | 12-03-2015 |
20150344583 | BCMA ANTIGEN BINDING PROTEINS - The present invention relates to BCMA (B-Cell Maturation Antigen) antigen binding proteins, such as antibodies, polynucleotide sequences encoding said antigen binding proteins, and compositions and methods for diagnosing and treating diseases. The present invention also relates to BCMA antibody drug conjugates and uses thereof. | 12-03-2015 |
20150344584 | Modified Antigen Binding Molecules With Altered Cell Signaling Activity - The present invention relates to modified antigen binding molecules (ABMs). In particular embodiments, the present invention relates to recombinant monoclonal antibodies or fragments, including chimeric, primatized or humanized antibodies or fragments, having altered ability to mediate cell signaling activity by a target antigen, and/or altered ability to mediate cross-linking of one or more target antigens. In addition, the present invention relates to nucleic acid molecules encoding such modified ABMs, and vectors and host cells comprising such nucleic acid molecules. The invention further relates to methods for producing the modified ABMs of the invention, and to methods of using these modified ABMs in treatment of disease. In addition, the present invention relates to modified ABMs with modified glycosylation having improved therapeutic properties, including antibodies with increased Fc receptor binding and increased effector function. | 12-03-2015 |
20150344585 | ANTI-CD20 GLYCOANTIBODIES AND USES THEREOF - The present disclosure relates to a novel class of anti-CD20 monoclonal antibodies comprising a homogeneous population of anti-CD20 IgG molecules having the same N-glycan on each of Fc. The antibodies of the invention can be produced from anti-CD20 monoclonal antibodies by Fc glycoengineering. Importantly, the antibodies of the invention have improved therapeutic values with increased ADCC activity and increased Fc receptor binding affinity compared to the corresponding monoclonal antibodies that have not been glycoengineered. | 12-03-2015 |
20150344587 | ANTI-HER2 GLYCOANTIBODIES AND USES THEREOF - The present disclosure relates to a novel class of anti-HER2 monoclonal antibodies comprising a homogeneous population of anti-HER2 IgG molecules having the same N-glycan on each of Fc. The antibodies of the invention can be produced from anti-HER2 monoclonal antibodies by Fc glycoengineering. Importantly, the antibodies of the invention have improved therapeutic values with increased ADCC activity and increased Fc receptor binding affinity compared to the corresponding monoclonal antibodies that have not been glycoengineered. | 12-03-2015 |
20150347679 | PREDICTIVE OUTCOME ASSESSMENT FOR CHEMOTHERAPY WITH NEOADJUVANT BEVACIZUMAB - In a predictive outcome assessment test for predicting whether a patient undergoing a breast cancer treatment regimen will achieve pathological complete response (pCR), differential gene expression level information are generated for an input set of genes belonging to the TGF-β signaling pathway. The differential gene expression level information compares baseline gene expression level information from a baseline sample ( | 12-03-2015 |
20150352135 | GLA Monotherapy for Use in Cancer Treatment - The present disclosure relates generally to compositions and methods for treating cancer with a glucopyranosyl lipid A (GLA) in the absence of antigen. | 12-10-2015 |
20150352193 | SELECTIVE GLYCOSIDASE REGIMEN FOR IMMUNE PROGRAMMING AND TREATMENT OF CANCER - The present invention relates to treatment and prevention of cancer with glycosidase(s). In various aspects the invention relates to the treatment and management of cancer to prevent metastasis or recurrence, or to improve outcome and rate of successful treatment with conventional therapeutic regimens. | 12-10-2015 |
20150352194 | INHIBITION OF TISSUE FACTOR PATHWAY INHIBITOR WITH FACTOR XA DERIVATIVES - The present disclosure relates to compositions and methods for the treatment of bleeding disorders, such as hemophilia A, hemophilia B, von Willebrand (vWF) disease, and factor XII deficiency, by reducing the circulating concentration of tissue factor pathway inhibitor (TFPI), with a factor Xa derivative. | 12-10-2015 |
20150352204 | BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF BREAST CANCER - The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from HER2 positive breast cancer, in particular locally recurrent or metastatic HER2 positive breast cancer, by adding bevacizumab (Avastin®) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of E-selectin, ICAM-1 or VEGFR-3 relative to control levels of patients diagnosed with HER2 positive breast cancer, in particular locally recurrent or metastatic HER2 positive breast cancer. | 12-10-2015 |
20150353638 | HUMANIZED MONOCLONAL ANTIBODIES AGAINST THE EXTRACELLULAR DOMAIN OF HUMAN DEATH RECEPTOR 5 - The present invention provides a humanized monoclonal antibody against extracellular domain of human death receptor 5, comprising a light chain variable region, whose amino acid sequence has at least 90% identity with the amino acid sequence shown as SEQ ID NO: 1, a heavy chain variable region, whose amino acid sequence has at least 90% identity with the amino acid sequence shown as SEQ ID NO: 2, and constant region derived from human antibody. The present invention also provides nucleotide sequence encoding said humanized monoclonal antibody, a recombinant eukaryotic expression vector, a process for preparing the humanized monoclonal antibody, and the composition and use therefore. Said humanized monoclonal antibody of the present invention shows specific apoptosis-inducing activity against various cancer cells both in vivo and in vitro, and thus it can be used alone or in combination with natural ligand of DR5, apoptosis-inducing ligand associated with tumor nerosis factor or other medicaments for the treatment of a variety of cancers as well as other diseases associated with high DR5 expression. | 12-10-2015 |
20150353640 | ANTIBODY FORMULATION - The present invention relates to a pharmaceutical formulation comprising an anti-CD20 antibody. The formulation may additionally comprise a buffer, a surfactant and/or an isotonicity agent. | 12-10-2015 |
20150353644 | RECOMBINANT MONOCLONAL ANTIBODIES AND CORRESPONDING ANTIGENS FOR COLON AND PANCREATIC CANCERS - The present invention provides for purified or highly pure recombinant monoclonal antibodies that bind to human colorectal and pancreatic carcinoma-associated antigens (CPAA), along with nucleic acid sequences encoding the antibody chains, and the amino acid sequences corresponding to said nucleic acids and uses for said sequences. | 12-10-2015 |
20150355181 | METHODS AND COMPOSITIONS FOR HUMAN EPIDIDYMIS PROTEIN-4 (HE4) - The present invention relates to methods, compositions, and diagnostic tests for treating and diagnosing a subject with organ fibrosis or a risk of developing organ fibrosis. The present invention also relates to methods and compositions for treating a subject with a proliferative disease. In particular, the methods and compositions include treatment of organ fibrosis or a proliferative disease using an inhibitor of human epididymis protein-4 (HE4). | 12-10-2015 |
20150359883 | Treatment of Carcinomas with a Combination of EGF-Pathway and Telomerase Inhibitors - A method and kit for inhibiting the proliferation of carcinoma cells are disclosed, based on a combination of an EGF pathway inhibitor and a telomerase inhibitor. When used in cancer therapy, the two compounds in combination enhance the anti-cancer treatment efficacy obtained with the antibody alone or the telomerase inhibitor alone. | 12-17-2015 |
20150361164 | HUMANIZED ANTl-HMGB1 ANTIBODY OR ANTIGEN-BINDING FRAGMENT THEREOF - The present invention provides a humanized anti-HMGB1 antibody which specifically binds to a sequence consisting of the C-terminal 8 amino acid residues (EEEDDDDE) of HMGB1 protein and is effective for treatment or prevention of various inflammatory diseases related to this protein, as well as an antigen-binding fragment thereof. The present invention also provides a pharmaceutical composition comprising such an antibody or antigen-binding fragment thereof. | 12-17-2015 |
20150361170 | PROTEIN FORMULATIONS AND METHODS OF MAKING SAME - The invention provides an aqueous formulation comprising water and a protein, and methods of making the same. The aqueous formulation of the invention may be a high protein formulation and/or may have low levels of conductity resulting from the low levels of ionic excipients. Also included in the invention are formulations comprising water and proteins having low osmolality. | 12-17-2015 |
20150361171 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 12-17-2015 |
20150361172 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 12-17-2015 |
20150361173 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME - The invention features methods for preventing or treating CGRP associated disorders such as vasomotor symptoms, including headaches (e.g., migraine, cluster headache, and tension headache) and hot flushes, by administering an anti-CGRP antagonist antibody. Antagonist antibody G1 and antibodies derived from G1 directed to CGRP are also described. | 12-17-2015 |
20150361184 | METHODS OF MODULATING DLK STABILITY - The invention provides for methods of decreasing dual leucine zipper kinase (DLK) stability in a neuron, or decreasing or inhibiting the phosphorylation of certain amino acid residues of DLK, comprising administering to a neuron, or portion thereof, an agent which decreases or inhibits the phosphorylation of DLK and decreases the stability of DLK as well as methods for inhibiting or preventing neuronal degeneration in a patient by administering to a patient an agent which inhibits phosphorylation of dual leucine zipper kinase (DLK). | 12-17-2015 |
20150361503 | METHODS FOR SELECTING THERAPEUTICS FOR TREATMENT OF HER2+ CANCERS - Described are methods of selecting appropriate therapy for, or optimizing therapeutic efficacy of treatment of, a patient having a cancer using biomarker readings obtained from a biological sample of the cancer from the patient and, based on the readings obtained, treating the patient with MM-111 in combination with trastuzumab and one of the following: a receptor tyrosine kinase inhibitor, a mitogen-activated protein kinase kinase (MEK) inhibitor, and a protein kinase B (AKT) inhibitor. | 12-17-2015 |
20150362495 | METHOD FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF PROSTATE CANCER METASTASIS - The present invention relates to a method for the diagnosis or the prognosis of metastasis in prostate cancer which comprises determining if the c-MAF gene is amplified in a primary tumor sample. Likewise, the invention also relates to a method for the diagnosis or the prognosis of metastasis in prostate cancer, as well as to a method for determining the tendency to develop bone metastasis with respect to metastasis in other organs, which, comprise determining the c-MAF expression level. Finally, the invention relates to the use of a c-MAF inhibitor as therapeutic target for treating the prostate cancer. | 12-17-2015 |
20150368322 | COMPOSITIONS AND METHODS RELATED TO ANTIBODIES THAT NEUTRALIZE COAGULASE ACTIVITY DURING STAPHYLOCOCCUS AUREUS DISEASE - Embodiments concern methods and compositions for treating or preventing a bacterial infection, particularly infection by a | 12-24-2015 |
20150368327 | ANTI-SEMAPHORIN 3A ANTIBODY AND TREATMENT OF ALZHEIMER'S DISEASE AND INFLAMMATORY IMMUNE DISEASES USING SAME - The present invention mainly addresses the problem of providing an antibody against semaphorin 3A protein, said antibody enabling effective prevention and/or treatment of a disease, in which Sema 3A protein participates, such as a neurodegenerative disease, autoimmune disease, inflammatory disease, cancer, infectious disease, etc. or disseminated intravascular coagulation syndrome. An anti-Sema 3A antibody comprising CDRs having specific amino acid sequences (SEQ ID NOS: 1-6, 60-62, 64-66, 68-70, 72-74, 76-78, 80-82, 84-86 and 88-90) enables effective prevention and/or treatment of a disease, in which Sema 3A protein participates, such as a neurodegenerative disease, autoimmune disease, inflammatory disease, cancer, infectious disease, etc. or disseminated intravascular coagulation syndrome and, therefore, remarkably ameliorates symptoms associated with such a disease. | 12-24-2015 |
20150368332 | METHODS FOR INCREASING IMMUNOGLOBULIN A LEVELS - Methods for increasing immunoglobulin A (IgA) levels in a subject having a deficiency thereof are provided herein by administering to the subject an agent that inhibits CXCL13 activity, such as an anti-CXCL13 or an anti-CXCR5 antibody. Further provided are methods for treating an inflammatory disorder in a subject deficient for IgA by administering to the subject an agent that inhibits CXCL13 activity. | 12-24-2015 |
20150368333 | TNF-ALPHA ANTIGEN-BINDING PROTEINS - The present invention provides antigen binding proteins which bind specifically to TNF-alpha. For example novel variants of anti-TNF antibodies such as adalimumab which show increased binding to the FcRn receptor or increased half life compared to adalimumab. Also provided are compositions comprising the antigen binding proteins and uses of such compositions in treatment of disorders and disease. | 12-24-2015 |
20150368334 | HIGHLY GALACTOSYLATED ANTI-TNF-ALPHA ANTIBODIES AND USES THEREOF - In one aspect, the disclosure relates to highly galactosylated anti-TNF-alpha antibodies and compositions thereof. In one aspect, the disclosure relates to populations of anti-TNF-alpha antibodies with a high level of galactosylation, and compositions thereof. In one aspect, the disclosure relates to methods of production and use of highly galactosylated anti-TNF-alpha antibodies and populations of anti-TNF-alpha antibodies with a high level of galactosylation. In some embodiments, the anti-TNF-alpha antibody is adalimumab. | 12-24-2015 |
20150368336 | IL-31 MONOCLONAL ANTIBODIES - The present invention relates to methods of treating pruritic diseases, including but not limited to Contact dermatitis, Atopic Dermatitis, Drug induced delayed type cutaneous allergic reactions, Toxic epidermal necrolysis, Cutaneous T cell Lymphoma, Bullous pemphigoid, Alopecia wereata, Vitiligo, Acne Rosacea, Prurigo nodularis, Scleroderma, Herpes simplex virus, or combination thereof by administering IL-31 monoclonal antibodies. The invention further provides the hybridomas that generate the monoclonal antibodies. | 12-24-2015 |
20150368337 | ANTI-IL-6 ANTIBODIES FOR THE TREATMENT OF ORAL MUCOSITIS - The present invention is directed to therapeutic methods using IL-6 antagonists such as anti-IL-6 antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat mucositis (e.g., oral mucositis) including persons on a treatment regimen with a drug or chemotherapy and/or radiation for cancer (e.g., head and neck cancer) that is associated with increased risk of mucositis, including oral mucositis. | 12-24-2015 |
20150368346 | ANTIBODIES AGAINST EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) AND USES THEREOF - Anti-EGFR antibodies, therapeutic compositions comprising combinations of anti-EGFR antibodies, as well as methods for using such antibodies and compositions to treat EGFR-related disorders (e.g., cancers), are disclosed. | 12-24-2015 |
20150368347 | ANTIBODIES AGAINST EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) AND USES THEREOF - Anti-EGFR antibodies, therapeutic compositions comprising combinations of anti-EGFR antibodies, as well as methods for using such antibodies and compositions to treat EGFR-related disorders (e.g., cancers), are disclosed. | 12-24-2015 |
20150368357 | HIGHLY GALACTOSYLATED ANTI-HER2 ANTIBODIES AND USES THEREOF - In one aspect, the disclosure relates to highly galactosylated anti-HER2 antibodies and compositions thereof. In one aspect, the disclosure relates to populations of anti-HER2 antibodies with a high level of galactosylation, and compositions thereof. In one aspect, the disclosure relates to methods of production and use of highly galactosylated anti-HER2 antibodies and populations of anti-HER2 antibodies with a high level of galactosylation. In some embodiments the anti-HER-2 antibody is trastuzumab. | 12-24-2015 |
20150368358 | KLOTHO BETA - The invention concerns uses of anti-KLβ agents, and detection of KLβ and/or FGF19 and/or FGFR4. | 12-24-2015 |
20150368722 | MAKER FOR DIAGNOSING HER2 INHIBITOR RESISTANT CANCER, DIAGNOSTIC KIT COMPRISING SAME, AND METHOD FOR DIAGNOSING HER2 INHIBITOR RESISTANT CANCER - The present invention relates to a composition for detecting a marker for diagnosing an HER2 inhibitor-resistant cancer, a diagnostic kit including same, and a method for detecting the marker. More particularly, the present invention relates to a composition for detecting a maker for diagnosing an HER2 inhibitor-resistant cancer, a diagnostic kit including same, and a method for detecting the marker, wherein the present invention allows presence and absence of resistance to an HER2 inhibitor, which is typically prescribed to an HER2-positive cancer patient, in an HER2-positive cancer patient to be determined in an easier manner with remarkably high reliability. | 12-24-2015 |
20150374697 | ORGANIC COMPOUNDS - The present invention relates to compounds and compositions useful for inhibiting and/or reducing platelet deposition, adhesion and/or aggregation. The present invention further relates to methods for the treatment or prophylaxis of thrombotic disorders, including stroke, myocardial infarction, unstable angina, peripheral vascular disease, abrupt closure following angioplasty or stent placement and thrombosis as a result of vascular surgery. | 12-31-2015 |
20150376161 | ANTIIFLAMMATORY AND ANTITUMOR 2-OXOTHIAZOLES ABD 2-OXOTHIOPHENES COMPOUNDS - A compound of formula (I) | 12-31-2015 |
20150376265 | ANTIBODY COMPOSITIONS AND METHODS OF USE - The invention provides compositions comprising anti-gH antibodies and anti-Complex I antibodies as well as methods of using the same. | 12-31-2015 |
20150376270 | TREATMENT METHOD FOR LUNG REMODELING DISEASES - The present invention relates to methods and medicaments useful for pre-treatment, treatment, or amelioration of lung remodeling disease. Methods and medicaments for reducing, preventing, or reversing increased lung density, improving lung function, and increasing survivability in subjects having lung remodeling disease are also provided. | 12-31-2015 |
20150376276 | ANTI-NTB-A ANTIBODIES AND RELATED COMPOSITIONS AND METHODS - Disclosed are antibodies, including antibody drug conjugates, that specifically bind to NTB-A. Also disclosed are methods for using the anti-NTB-A antibodies to detect or modulate activity of (e.g., inhibit proliferation of) an NTB-A-expressing cell, as well as for diagnoses or treatment of diseases or disorders (e.g., cancer) associated with NTB-A-expressing cells. Further disclosed is a method of treating multiple myeloma using an anti-NTB-A antibody drug conjugate, which optionally includes an anti-NTB-A antibody as disclosed herein. | 12-31-2015 |
20150376280 | ANTI-INFLAMMATORY POLYPEPTIDES - This invention concerns anti-inflammatory agents, compositions, and methods for treating inflammatory disorders. | 12-31-2015 |
20150376281 | Use of NKG2D Inhibitors for Treating Cardiovascular and Metabolic Diseases, Such as Type 2 Diabetes - The present invention provides methods, compositions and kits for treating and detecting type 2 diabetes and/or conditions that may be regulated or normalised via inhibition of NKG2D, such as cardiovascular diseases. | 12-31-2015 |
20150376282 | ANTIBODY VARIANTS HAVING MODIFICATIONS IN THE CONSTANT REGION - The present invention relates to positions in the constant region of antibodies, in particular the CH3 region of IgG4, which affect the strength of CH3-CH3 interactions. Mutations that either stabilize or destabilize this interaction are disclosed. | 12-31-2015 |
20150376284 | ANTIBODIES AGAINST EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) AND USES THEREOF - Anti-EGFR antibodies, therapeutic compositions comprising combinations of anti-EGFR antibodies, as well as methods for using such antibodies and compositions to treat EGFR-related disorders (e.g., cancers), are disclosed. | 12-31-2015 |
20150376286 | HUMAN CGRP RECEPTOR BINDING PROTEINS - Antigen binding proteins that bind to human CGRP receptor (CGRP R) are provided. Nucleic acids encoding the antigen binding protein, vectors, and cells encoding the same are also provided. The antigen binding proteins can inhibit binding of CGRP R to CGRP, and are useful in a number of CGRP R related disorders, including the treatment and/or prevention of migraine headaches. | 12-31-2015 |
20150376288 | CD47 Targeted Therapies for the Treatment of Infectious Disease - Methods are provided for treating a subject with for an intracellular pathogen infection, by administering an agent that reduces the binding of CD47 on a infected cell to SIRPα on a host phagocytic cell, in an effective dose for increasing the phagocytosis of infected cells. | 12-31-2015 |
20150376289 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCER - Methods and compositions are provided for the diagnosis and treatment of lung cancers in particular NSCLC associated with amplification or overexpression of the PRO gene, i.e. any of PDGFRA, KIT or KDR. | 12-31-2015 |
20150376707 | METHODS OF DIAGNOSING AND TREATING INFLAMMATORY BOWEL DISEASE - The present invention also provides various methods, kits and compositions for diagnosing, prognosing, and treating various conditions including but not limited to inflammatory bowel diseases, such as ulcerative colitis and Crohn's disease. Also, the present invention provides various methods, kits and compositions for determining susceptibility to or a low probability of various conditions including but not limited to inflammatory bowel diseases, such as ulcerative colitis and Crohn's disease. These methods, kits and compositions may involve detecting risk/protective variants or haplotypes, serological markers, increased or decreased gene methylation, and increased or decreased cytokine secretion. | 12-31-2015 |
20150377891 | Methods for Predicting the Survival Time of Patients Suffering from Diffuse Large B-Cell Lymphomas - The present invention relates to methods and kits for predicting the survival time of a patient suffering from a diffuse large B-cell lymphoma (DLBCL). In particular, the present invention relates to a method for predicting the survival time of a patient suffering from a diffuse large B-cell lymphoma (DLBCL) comprising the step of i) determining the level of sPD-L1 in a blood sample obtained from the patient ii) comparing the level determined at step i) with a predetermined reference value and iii) concluding that the patient has a poor prognosis when the level determined at step i) is higher than the predetermined reference value or concluding that the patient has a good prognosis when the level determined at step i) is lower than the predetermined reference value. | 12-31-2015 |
20160000746 | PHARMACEUTICAL COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION WITH MELATONIN ANALOGUES - Pharmaceutical compositions and methods for treating and/or preventing age-related macular degeneration with melatonin analogues are provided. | 01-07-2016 |
20160000787 | INHIBITORS OF CDK8/19 FOR USE IN TREATING ESTROGEN RECEPTOR POSITIVE BREAST CANCER - The invention provides a selective inhibitor of CDK8/19 for use in a method of treating a patient having estrogen receptor positive (ER+) breast cancer, including breast cancer that is resistant to antiestrogen therapy. In some embodiments, the selective inhibitor of CDK8/19 is administered in combination with antiestrogen therapy. In some embodiments, the selective inhibitor of CDK8/19 is administered to ER+HER2+ breast cancer patients in combination with HER2-targeting drugs. | 01-07-2016 |
20160000792 | INHIBITORS OF BRUTON'S TYROSINE KINASE FOR THE TREATMENT OF SOLID TUMORS - Described herein are irreversible Btk inhibitor compounds, and methods for using such irreversible inhibitors in the treatment of diseases and disorders characterized by the presence or development of solid tumors. | 01-07-2016 |
20160000908 | Siglec-9 Binding Agents - The present invention relates to agents capable of binding sialic acid-binding immunoglobulin-like lectin-9 (Siglec-9) and their use in the treatment of cell proliferation and differentiation disorders. Furthermore, the present invention provides associated pharmaceutical formulations and methods. | 01-07-2016 |
20160000911 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH INCREASED ANTIBODY DEPENDENT CELLULAR CYTOTOXITY (ADCC) - The present invention is directed to a pharmaceutical composition comprising: (A) a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity (ADCC); and (B) a chemotherapeutic agent selected from the group consisting of: cyclophosphamide, vincristine and doxorubicine. The present invention is also directed to a method for the treatment of a CD20 expressing cancer, comprising administering to a patient in need of such treatment (i) an effective first amount of a type II anti-CD20 antibody with increased antibody dependent cellular cytotoxicity; and (ii) an effective second amount of one or more chemotherapeutic agents selected from the group consisting of cyclophosphamide, vincristine and doxorubicine. | 01-07-2016 |
20160000912 | COMBINATION THERAPY OF A TYPE II ANTI-CD20 ANTIBODY WITH A PROTEASOME INHIBITOR - The present invention is directed to a combination therapy involving a type II anti-CD20 antibody and a proteasome inhibitor for the treatment of a patient suffering from cancer, particularly a CD20-expressing cancer. An aspect of the invention is a composition comprising a type II anti-CD20 antibody and a proteasome inhibitor. Another aspect of the invention is a kit comprising a type II anti-CD20 antibody and a proteasome inhibitor. Yet another aspect of the invention is a method for the treatment of a patient suffering from cancer comprising co-administering, to a patient in need of such treatment, a type II anti-CD20 antibody and a proteasome inhibitor. | 01-07-2016 |
20160000913 | TARGETED TREATMENT OF ANEROBIC CANCER - The present invention relates to a pharmaceutical cocktail and methods of treatment involving said cocktail, in particular, a combination of effective amounts of a carbonic anhydrase inhibitor, in combination with effective amounts of an angiogenesis inhibitor, including a vascular endothelial growth factor (VEGF) inhibitor such as bevacizumab for the treatment of cancer. In other embodiments, it relates to compositions and methods of treating cancer involving effective amounts of a carbonic anhydrase inhibitor. Pharmaceutical compositions and methods of treating cancer (eliminating the tumor, shrinking the tumor, prolonging the life of the patient, increasing quality of life by decreasing the grade of adverse events seen with other cancer treatments, and/or preventing/reducing the likelihood of the tumor's metastases) are additional aspects of the present invention. In addition, the present invention may be used to favorably impact the therapeutic result of patients who have not responded to alternative, traditional anti-cancer therapy. | 01-07-2016 |
20160000916 | LOW CONCENTRATION ANTIBODY FORMULATIONS - The present invention is directed formulations for low concentrations of therapeutic proteins and methods of making the same. In one aspect the present invention is directed to a formulation for a therapeutic protein comprising: a) the therapeutic protein; and b) a surfactant; wherein the molar ratio of surfactant to therapeutic protein is at least 100. In another aspect the present invention is directed to a formulation for a therapeutic protein comprising: a) the therapeutic protein; and b) an antioxidant, wherein the molar ratio of antioxidant to therapeutic protein is at least 750. | 01-07-2016 |
20160002289 | METHOD OF PURIFYING AN ANTIBODY - A method of purifying an antibody composition comprises application of anion exchange chromatography late in the purification process. An ultrafiltration/diafiltration-purified antibody composition is subjected to anion exchange chromatography (AEX) to form a pharmaceutically-pure antibody composition. | 01-07-2016 |
20160002330 | CETUXIMAB WITH MODIFIED GLYCOSYLATION AND USES THEREOF - In one aspect, the disclosure relates to antibodies with altered glycosylation patterns, methods of production of said antibodies, and methods of use thereof. In some embodiments, the antibody is cetuximab. | 01-07-2016 |
20160002337 | HHLA2 AS A NOVEL INHIBITOR OF HUMAN IMMUNE SYSTEM AND USES THEREOF - Provided are methods of treating an autoimmune disease in a subject, or of suppressing transplant rejection in a subject, or of treating a cancer in a subject, as well as compositions therefor. | 01-07-2016 |
20160002340 | ZCYTOR17 HETERODIMERIC CYTOKINE RECEPTOR MONOCLONAL ANTIBODIES - Novel polypeptide combinations, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed for zcytor17-containing multimeric or heterodimer cytokine receptors that may be used as novel cytokine antagonists, and within methods for detecting ligands that stimulate the proliferation and/or development of hematopoietic, lymphoid and myeloid cells in vitro and in vivo. The present invention also includes methods for producing the multimeric or heterodimeric cytokine receptor, uses therefor and antibodies thereto. | 01-07-2016 |
20160002344 | RSPO BINDING AGENTS AND USES THEREOF - The present invention relates to RSPO-binding agents and methods of using the agents for treating diseases such as cancer. The present invention provides antibodies that specifically bind human RSPO proteins and modulate β-catenin activity. The present invention further provides methods of using agents that modulate the activity of RSPO proteins, such as antibodies that specifically bind RSPO1, RSPO2, and/or RSPO3 and inhibit tumor growth. Also described are methods of treating cancer comprising administering a therapeutically effect amount of an agent or antibody of the present invention to a patient having a tumor or cancer. | 01-07-2016 |
20160002347 | PYRUVATE KINASE M2 NEUTRALIZING ANTIBODIES FOR INHIBITING ANGIOGENESIS - Methods for inhibiting angiogenesis, such as tumor angiogenesis, in a subject are disclosed. Pharmaceutical compositions for use in the disclosed methods are also described. | 01-07-2016 |
20160002350 | CAIX STRATIFICATION BASED ON CANCER TREATMENT - The present invention relates to a carbonic anhydrase IX targeting compound for the use in the treatment of cancer, wherein the use comprises quantifying CAIX expression as well as the determination of a CAIX score based on the CAIX expression. The present invention relates further to a method for diagnosing, predicting and/or classifying a cancer disease comprising quantifying CAIX expression, and the determination of a CAIX score. | 01-07-2016 |
20160002353 | Humanized Anti-Factor D Antibodies And Uses Thereof - The invention relates to humanized anti-human Factor D monoclonal antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 01-07-2016 |
20160002701 | Proximity Assay for In Situ Detection of Targets - A proximity detection method is described that utilizes enzymatic biotinylation to detect targets in a sample, particularly formalin fixed paraffin embedded samples using automated staining platforms. One disclosed embodiment comprises contacting the sample with a first conjugate comprising a biotin ligase and a first specific binding moiety that binds proximally to the first target; contacting the sample with a second conjugate comprising a biotin ligase substrate and a second specific binding moiety that binds proximally to the second target; subjecting the sample to conditions that allow biotinylation of the biotin ligase substrate by the biotin ligase when the first target and the second target have a proximal arrangement; and detecting biotinylation of the biotin ligase substrate. The conditions that allow biotinylation of the substrate include addition of biotin and ATP. The method also may comprise contacting the sample with a streptavidin-enzyme conjugate. Signal amplification also can be used. | 01-07-2016 |
20160008343 | COMPOUNDS AND METHODS OF PROPHYLAXIS AND TREATMENT REGARDING NICOTINIC RECEPTOR ANTAGONISTS | 01-14-2016 |
20160008427 | AFFINITY MATURED CRIg VARIANTS | 01-14-2016 |
20160008429 | Methods for Achieving Therapeutically Effective Doses of anti-CD47 Agents | 01-14-2016 |
20160008464 | Methods Of Treatment Of Pterygium Using An Anti-VEGF Agent | 01-14-2016 |
20160008466 | PARTICLE COMPOSITIONS AND METHODS RELATED THERETO | 01-14-2016 |
20160009801 | SPECIFIC BINDING AGENTS OF GLYCOPROTEIN IB ALPHA AS SELECTIVE ECTODOMAIN SHEDDING INHIBITORS | 01-14-2016 |
20160009806 | ANTIBODIES TO INTEGRIN AVB6 AND USE OF SAME TO TREAT CANCER | 01-14-2016 |
20160009808 | ANTIBODIES WHICH BIND HUMAN CXCR3 | 01-14-2016 |
20160009810 | Methods of Administering IgG1 Antibodies and Methods of Suppressing Angiogenesis | 01-14-2016 |
20160009811 | Endoglin Antibodies | 01-14-2016 |
20160015692 | REGIMEN FOR SUPRESSING ORGAN REJECTION - The present invention relates to a method of suppressing organ rejection in a patient receiving an organ transplant by initiating oral treatment with a once-daily extended release tacrolimus dosage form, for example, at an initial dose of from about 0.15 to about 0.20 mg/kg/day within 24 or 48 hours following transplantation. The once-daily extended release tacrolimus dosage form (i) provides low fluctuation and/or swing of tacrolimus, (ii) provides a significantly lower C | 01-21-2016 |
20160015709 | COMPOSITIONS AND METHODS FOR TREATING CANCER AND DISEASES AND CONDITIONS RESPONSIVE TO CELL GROWTH INHIBITION - In alternative embodiments, the invention provides compositions and methods for overcoming or diminishing or preventing Growth Factor Inhibitor resistance in a cell, or, a method for increasing the growth-inhibiting effectiveness of a Growth Factor inhibitor on a cell, or, a method for re-sensitizing a cell to a Growth Factor Inhibitor, comprising for example, administration of a combination of a TBK1 inhibitor and an RTK inhibitor. In alternative embodiments, the cell is a tumor cell, a cancer cell or a dysfunctional cell. In alternative embodiments, the invention provides compositions and methods for determining: whether an individual or a patient would benefit from or respond to administration of a Growth Factor Inhibitor, or, which individuals or patients would benefit from a combinatorial approach comprising administration of a combination of: at least one growth factor and at least one compound, composition or formulation used to practice a method of the invention, such as an NFKB inhibitor, such as a lenalidomide or a REVLIMID™, or IKK inhibitor; or an inhibitor of Galectin-3. | 01-21-2016 |
20160015809 | M-CSF SPECIFIC MONOCLONAL ANTIBODY AND USES THEROF - M-CSF-specific RX1-based or RX-1 derived antibodies are provided, along with pharmaceutical compositions containing such antibody, kits containing a pharmaceutical composition, and methods of preventing and treating bone loss in a subject afflicted with an osteolytic disease. | 01-21-2016 |
20160016959 | SUBSTITUTED IMIDAZOPYRIDAZINES - The present invention relates to substituted imidazopyridazine compounds, to methods of preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of a hyper-proliferative and/or angiogenesis disorder, as a sole agent or in combination with other active ingredients. | 01-21-2016 |
20160017011 | PHF20 AND JMJD3 COMPOSITIONS AND METHODS OF USE IN CANCER IMMUNOTHERAPY - Pharmaceutical compositions and methods for regulating somatic cell reprogramming in mammals, and in particular, for positively and negatively regulating cell reprogramming in human cells in vivo and in vitro. The invention also provides PHF20-derived compositions and methods useful for cancer immunotherapies, including breast cancer therapies in particular. | 01-21-2016 |
20160017022 | Methods to Protect Against and Treat Multiple Sclerosis - The invention provides epsilon toxin (ETX) produced by | 01-21-2016 |
20160017023 | Engineered Fc Regions For Site-Specific Conjugation - Fc regions useful for site-specific conjugation to a variety of agents are provided. Methods for the design, preparation, screening, selection and use of such Fc regions are also provided. | 01-21-2016 |
20160017024 | FAM150A, FAM150B, AND FAM150 ANTAGONISTS AND USES THEREOF - Methods of identifying and using FAM150A agents, FAM150B agents, and FAM150 antagonists are provided. Methods of identifying and using LTK agonists (including LTK agonist antibodies, FAM150A agents, and FAM150B agents) and FAM150 antagonists are provided. Such methods include, but are not limited to, methods of treating cancer, methods of treating immune disorders such as autoimmune diseases, and methods of treating neurodegenerative diseases. | 01-21-2016 |
20160017026 | ENGINEERED ANTI-TGF-BETA ANTIBODIES AND ANTIGEN-BINDING FRAGMENTS - Antibodies or antigen-binding fragments thereof are engineered to bind Transforming Growth Factor-β (TGFβ). TGFβ-isoform selective antibodies or antigen-binding fragments thereof may selectively bind human TGFβ1, compared to human TGFβ2 and human TGFβ3, or may selectively bind human TGFβ3, compared to human TGFβ1 and human TGFβ2. The design of the antibodies or antigen-binding fragments thereof is facilitated by a co-crystal structure of a recombinant Fab fragment of GC1008 bound to TGFβ2 and by another co-crystal structure of the scFv version of GC1008 bound to TGFβ1. | 01-21-2016 |
20160017033 | COMPOSITIONS AND METHODS FOR DETECTING OR ELIMINATING SENESCENT CELLS TO DIAGNOSE OR TREAT DISEASE - Disclosed are agents (e.g., peptides, polypeptides, proteins, small molecules, antibodies, and antibody fragments that target senescent cells) and methods of their use for imaging senescent cells in vivo and for treating or preventing cancer, age-related disease, tobacco-related disease, or other diseases and disorders related to or caused by cellular senescence in a mammal. The methods include administering one or more of the agents of the invention to a mammal, e.g., a human. The agents, which specifically bind to senescent cells, can be labeled with a radioactive label or a therapeutic label, e.g., a cytotoxic agent. | 01-21-2016 |
20160017041 | TREATMENT AND PREVENTION OF ACUTE KIDNEY INJURY USING ANTI-ALPHA V BETA 5 ANTIBODIES - Methods of using antibodies and antibody fragments that specifically bind αvβ5 or β5 to treat or prevent acute kidney injury and/or its sequelae are disclosed. | 01-21-2016 |
20160017042 | ANTI-ALPHA V BETA 6 ANTIBODIES AND USES THEREOF - Humanized antibodies and antibody fragments thereof that bind to αvβ6 are disclosed. Also disclosed are methods of using these antibodies and antibody fragments to diagnose, treat, and/or prevent αvβ6-mediated diseases such as acute tissue injury, fibrosis, and cancer. | 01-21-2016 |
20160017050 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH AN ANTI-VEGF - The present invention is directed to the combination therapy of an afucosylated anti-CD20 antibody with an anti-VEGF antibody for the treatment of cancer, especially to the combination therapy of CD20 expressing cancers with an afucosylated humanized B-Ly1 antibody and an anti-VEGF antibody. | 01-21-2016 |
20160017052 | Anti-Factor D Antibody Variants and Uses Thereof - The invention relates to anti-Factor D antibody variants, their production and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. | 01-21-2016 |
20160018403 | STABILIZED PEPTIDE FRAGMENTS FROM REDOXIN PROTEINS AS CANCER BIOMARKERS - An embodiment of the invention relates to the use of stabilized cancer peptide fragments derived from “redoxin proteins” selected from the group consisting of thioredoxin; peroxiredoxin-1, 2 and 3; glutaredoxin-3; glutathione peroxidase-4; and nucleoredoxins for the diagnosis of cancers, particularly pancreatic cancer. A method for the detection of cancer, severity of cancer, and/or effectiveness of a therapeutic regimen comprises detecting and/or measuring the amount of redoxin peptide fragments present in the biological sample of a subject. | 01-21-2016 |
20160018414 | SAB as a Biomarker for Degenerative Diseases and Therapeutic Sensitivity in Cancers - The current invention pertains to a method of diagnosing a disease or identifying an increased likelihood of developing the disease in a subject. The method comprises determining the level of Src homology 3 domain binding protein 5 (SH3BP5 or SAB) or the RNA encoding SAB protein in a biological sample obtained from the subject and identifying the subject as having the disease or having an increased likelihood of developing the disease if the biological sample obtained from the subject has an altered level of SAB protein or the RNA encoding SAB protein relative to a control sample. The methods of the current invention can be practiced to diagnose and treat a systemic degenerative disease, a neurodegenerative disease, obesity, diabetes, a cancer, or an aging related disease. The invention also provides a kit for diagnosing a disease or diagnosing an increased likelihood of developing the disease in a subject. | 01-21-2016 |
20160022585 | FORMULATION OF AN ANTIBODY AND USE THEREOF - The present invention provides a method for preparation of a lyophilized formulation of an anti-CD 20 antibody as well as to a lyophilized formulation of an anti-CD 20 antibody, comprising an anti-CD 20 antibody and having a residual moisture content in the range of 1% to 10%. The present invention also relates to the reconstituted formulation obtained by the method described herein, the use of said antibody formulation as a medicament, the use of the lyophilized formulation for the preparation of a medicament and a method of treating a patient. | 01-28-2016 |
20160022684 | BET INHIBITOR AND BRUTON'S TYROSINE KINASE INHIBITOR COMBINATIONS - Disclosed herein are methods, compositions, and kits for treating a B-cell malignancy comprising administering a combination of a BTK inhibitor (e.g., ibrutinib) and a BET inhibitor. Also disclosed herein are methods, compositions, and kits for treating a BTK-resistant B cell malignancy, or a MYC-driven B cell malignancy comprising administering a combination of a BTK inhibitor (e.g., ibrutinib) and a BET inhibitor. Further disclosed herein are methods of evaluating a patient having a B-cell malignancy for treatment with a combination of a BTK inhibitor (e.g., ibrutinib) and a BET inhibitor based on the MYC expression level of the patient. | 01-28-2016 |
20160022811 | RITUXIMAB INDUCTION THERAPY FOLLOWED BY GLATIRAMER ACETATE THERAPY - The present invention provides a method of treating a subject afflicted with a form of multiple sclerosis or presenting a clinically isolated syndrome comprising periodic administration of an amount of an anti-CD20 antibody at least twice to the subject followed by periodic administration of an amount of glatiramer acetate to the subject, wherein the amounts are effective to treat the subject. | 01-28-2016 |
20160022812 | THERAPEUTIC AGENTS FOR PANCREATIC CANCER - We achieved the present invention on the basis of the finding that an excellent therapeutic effect against pancreatic cancer can be obtained by administering an IL-6 inhibitor and an antimetabolite to pancreatic cancer patients. We also found that metastatic lesions from human pancreatic cancer can be reduced and ascites can be eliminated. | 01-28-2016 |
20160024189 | FLAVIVIRUS NEUTRALIZING ANTIBODIES AND METHODS OF USE THEREOF - The present invention provides antibodies that neutralize flavivirus and methods of use thereof. These antibodies are derived from mAb11 which recognizes West Nile virus E protein and is cross-reactive with members of the flavivirus family, including Denge virus. The antibodies of the present invention prevent antibody-dependent enhancement of a viral infection by having a modified Fc region that does not bind to the Fcy receptor. The invented antibody is used to treat flaviviral infections and symptoms thereof. | 01-28-2016 |
20160024194 | Compositions And Methods For Treating Angiogenesis-Related Disorders - Provided herein are anti-angiogenic monoclonal antibodies and antigen-binding antibody fragments that selectively and specifically bind to an epitope in both fibronectin and either fibrinogen or fibrin fragment E, compositions containing these antibodies and antibody fragments, and methods of using these antibodies and antibody fragments. | 01-28-2016 |
20160024197 | ANTIBODIES AGAINST AMYLOID-BETA PEPTIDE - Antibodies that bind human β-amyloid peptide, methods of treating diseases or disorders characterised by elevated β-amyloid levels or β-amyloid deposits with said antibodies, pharmaceutical compositions comprising said antibodies and methods of manufacture. | 01-28-2016 |
20160024210 | ANTI-H7CR ANTIBODIES - Antibodies and humanized variants thereof and their antigen-binding fragments and to other molecules that are capable of immunospecifically binding to the B7-H7 counter-receptor, H7CR, and their uses in enhancing immune responses and the treatment and diagnosis of cancer and other diseases are provided. | 01-28-2016 |
20160024216 | USE OF EGFR BIOMARKERS FOR THE TREATMENT OF GASTRIC CANCER WITH ANTI-EGFR AGENTS - The present invention relates to methods for treating gastric neoplasias, in particular treating patients who have been previously determined to have an EGFR biomarker. Gastric carcinoma (GC) is one of the most common and deadest cancers with −1 million diagnoses and −0.7 million deaths each year worldwide, with high incidence in Eastern Asia. | 01-28-2016 |
20160024585 | METHODS OF PREDICTING RESPONSIVENESS OF A CANCER TO AN AGENT AND METHODS OF DETERMINING A PROGNOSIS FOR A CANCER PATIENT - The present disclosure provides biomarkers, and methods of using such biomarkers, that are predictive for efficacy of and resistance to an EGFR targeting agent, such as cetuximab, or prognostic with respect to cancer survival. | 01-28-2016 |
20160024593 | METHODS AND COMPOSITIONS RELATED TO T-CELL ACTIVITY - Embodiments concern methods and composition related to anergic T-cells in patients, such as cancer patients. T cell anergy is a hyporesponsive state induced by TCR engagement in the absence of costimulation (Schwartz, 2003). Anergy induction was initially observed in vitro using chemically-fixed antigen presenting cells (APCs). Subsequently, it was found that anergy could be induced by immobilized anti-CD3 mAb or calcium ionophores (such as ionomycin) in vitro, and by superantigen and soluble antigenic peptide in vivo. Indirect evidence has suggested that T cell dysfunction in the tumor microenvironment and establishment of transplant tolerance is partially due to T cell anergy (Gajewski et al., 2011). | 01-28-2016 |
20160030439 | METHODS FOR THE TREATMENT OF AUTOIMMUNE DISEASES - The present invention provides a method for inducing CD8 | 02-04-2016 |
20160030479 | MODIFIED T LYMPHOCYTES - Provided herein are cells, e.g., T cells expressing artificial cell death polypeptides that cause death of a cell, e.g., cells (e.g., T lymphocytes) expressing the cell death polypeptide, when the cell death polypeptide is multimerized or dimerized. Also provided herein is use of such cells, e.g., T lymphocytes, to treat diseases such as cancer. | 02-04-2016 |
20160030533 | COMPOSITIONS AND METHODS OF TREATING FUNGAL AND BACTERIAL PATHOGENS - The invention features isolated polypeptides and conjugates including the amino acid sequence of any one of SEQ ID NOs: 3-11, or a variant sequence thereof having up to three substitutions, deletions, or additions to the amino acid sequence of any one of SEQ ID NOs: 3-11, wherein the polypeptide does not include more than 20 contiguous amino acids of SEQ ID NO: 2 or SEQ ID NO: 17. Additional polypeptides includes those of formula (I) [ZNZPVSSBSFSYT] | 02-04-2016 |
20160030534 | COMPOSITIONS AND METHODS FOR TREATING FUNGAL AND BACTERIAL PATHOGENS - The invention features fragments of the | 02-04-2016 |
20160030549 | RECOMBINANT RSV WITH SILENT MUTATIONS, VACCINES, AND METHODS RELATED THERETO - In certain embodiments, the disclosure relates to the polynucleotide sequences of respiratory syncytial virus (RSV). In certain embodiments, the disclosure relates to isolated or recombinant nucleic acids and polypeptides comprising desirable nucleic acid sequences and mutations disclosed herein. In certain embodiments, isolated or recombinant RSV comprising the nucleic acids and polypeptides disclosed herein (e.g., attenuated recombinant RSV) are also provided, as are immunogenic compositions including such nucleic acids, polypeptides, and RSV genomes that are suitable for use as vaccines. Attenuated or killed RSV containing these nucleic acids and mutation in the form of copied nucleic acids (e.g., cDNAs) are also contemplated. | 02-04-2016 |
20160031890 | NOVEL METHODS, COMPOUNDS, AND COMPOSITIONS FOR INHIBITION OF ROS - The present invention relates to a method using some novel compounds and compositions for the inhibition of ROS tyrosine kinase. In particular, the present invention covers a method to treat abnormal cell growth, such as cancer, with ROS | 02-04-2016 |
20160031976 | TAU IMMUNOTHERAPY - The invention provides antibodies to tau. The antibodies inhibit or delay tau-associated pathologies and associated symptomatic deterioration. | 02-04-2016 |
20160031984 | HUMANIZED ANTIBODIES THAT BIND LGR5 - Disclosed herein are humanized anti-LGR5 antibodies for the treatment of cancer. Antibodies disclosed herein may bind LGR5 without disrupting LGR5-RSPO1 binding or signaling, and may disrupt LGR5 signaling through Wnt that is independent of RSPO1. Also disclosed are heavy and light chain polypeptide sequences for the biding of LGR5, for example without disrupting LGR5-RSPO binding or signaling. | 02-04-2016 |
20160031992 | ANTI-ALPHA V BETA 6 ANTIBODIES AND USES THEREOF - Humanized antibodies and antibody fragments thereof that bind to αvβ6 are disclosed. Also disclosed are methods of using these antibodies and antibody fragments to treat or prevent αvβ6-mediated diseases such as fibrosis and cancer. | 02-04-2016 |
20160032001 | ANTI-RANKL ANTIBODIES AND METHODS OF USE - The present invention provides anti-RANKL monoclonal antibodies and related compositions, which may be used in any of a variety of therapeutic methods for the treatment of rheumatoid arthritis and other diseases. | 02-04-2016 |
20160032004 | Dosages of Immunoconjugates of Antibodies and SN-38 for Improved Efficacy and Decreased Toxicity - The present invention relates to therapeutic immunoconjugates comprising SN-38 attached to an antibody or antigen-binding antibody fragment. The antibody may bind to EGP-1 (TROP-2), CEACAM5, CEACAM6, CD74, CD19, CD20, CD22, CSAp, HLA-DR, AFP or MUC5ac and the immunoconjugate may be administered at a dosage of between 4 mg/kg and 16 mg/kg, preferably 4, 6, 8, 9, 10, 12, or 16 mg/kg. When administered at specified dosages and schedules, the immunoconjugate can reduce solid tumors in size, reduce or eliminate metastases and is effective to treat cancers resistant to standard therapies, such as radiation therapy, chemotherapy or immunotherapy. | 02-04-2016 |
20160032011 | HER3 SPECIFIC MONOCLONAL ANTIBODIES FOR DIAGNOSTIC AND THERAPEUTIC USE - Isolated or recombinant anti-HER3 monoclonal antibodies are provided. In some cases, antibodies of the embodiments can be used for the detection, diagnosis and/or therapeutic treatment of human diseases, such as cancer. | 02-04-2016 |
20160032012 | ANTIBODIES CAPABLE OF SPECIFICALLY BINDING TWO EPITOPES ON TISSUE FACTOR PATHWAY INHIBITOR - The application discloses a combination of two monospecific TFPI antibodies, wherein one antibody is capable of specifically binding TFPI (1-181) and the other antibody is capable of specifically binding TFPI (182-276), as well as bispecific anti-TFPI antibodies derived from two such monospecific antibodies. Both the combination of the two monospecific antibodies and the bispecific antibody strongly enhance thrombin generation by neutralising full length TFPIα, even where the concentration of TFPI is abnormally elevated. | 02-04-2016 |
20160032398 | METHODS FOR TREATING CANCER - The disclosure features a method of treating cancer by lowering a patient's two gene score (TGS), particularly by increasing the number of tumor-infiltrating leukocytes. In addition, a TGS animal model and uses thereof are provided. | 02-04-2016 |
20160032403 | DRUG SELECTION FOR NON-SMALL CELL LUNG CANCER THERAPY - The present invention provides methods for selecting a suitable anticancer drug for the treatment of patient with non-small cell lung cancer (NSCLC). The present invention also provides methods for determining drug resistance in NSCLC patients receiving EGFR inhibitor therapy. | 02-04-2016 |
20160033515 | USE OF FACILITATES CHROMATIN TRANSCRIPTION COMPLEX (FACT) IN CANCER - The present invention relates to, inter alia, measuring of at least one component of the facilitates chromatin transcription complex (FACT) for evaluating a tumor, including, for example, determining the aggressiveness of a tumor and directing treatment. | 02-04-2016 |
20160038456 | REGULATION OF CANCER USING NATURAL COMPOUNDS AND/OR DIET - The current invention is directed to a treatment of a proliferative disease comprising administering to a subject in need of such treatment, a composition comprising epigallocatechin-3-gallate (EGCG), curcumin, glucosinolates and, optionally Daikon radish sprout, alone or in combination with providing a ketogenic diet or a modified ketogenic diet to the subject. The invention also provides a composition comprising medium chain triglycerides, epigallocatechin-3-gallate, curcumin, compositions comprising glucosinolates and/or derivatives thereof, such as glucoraphanin and its breakdown product sulforaphane, (SFN) (which are found at high levels in broccoli sprouts or sprouts of other cruciferous vegetables), and, optionally Daikon radish sprout. | 02-11-2016 |
20160038495 | BRUTON'S TYROSINE KINASE INHIBITOR COMBINATIONS AND USES THEREOF - Disclosed herein are methods, compositions, and kits for treating a B-cell malignancy comprising administering a combination of a BTK inhibitor (e.g. ibrutinib) and a PIM inhibitor. Also disclosed herein are methods, compositions, and kits for treating a BTK-resistant B-cell malignancy comprising administering a combination of a BTK inhibitor (e.g. ibrutinib) and a PIM inhibitor. | 02-11-2016 |
20160038516 | COMBINATION CANCER THERAPY USING BISPHOSPHONATES AND ANTI-EGFR AGENTS - The present invention relates to combination therapies for the treatment of EGFR-related diseases, particularly EGFR-related cancers. This invention also relates to a method of enhancing the efficacy of an EGFR family member antagonist and therapeutic methods for subjects who are refractory to treatment with an EGFR family member antagonist. The invention also relates to pharmaceutical compositions useful for treatment of EGFR-related diseases. | 02-11-2016 |
20160038566 | METHODS AND AGENTS FOR TREATING ALZHEIMER'S DISEASE - The present disclosure provides compositions and methods useful for treating or preventing diseases or disorders where beta amyloid accumulation or aggregation contributes to the pathology or symptomology of the disease, for example Alzheimer's disease. | 02-11-2016 |
20160038576 | IMMUNOGENIC COMPOSITIONS FOR INDUCING AN IMMUNE RESPONSE FOR ELIMINATION OF SENESCENT CELLS - Provided herein are immunogenic compositions (vaccines) and methods for immunizing a subject with the immunogenic compositions for inducing an adaptive immune response directed specifically against senescent cells for treatment and prophylaxis of age-related diseases and disorders, and other diseases and disorders associated with or exacerbated by the presence of senescent cells. The immunogenic compositions provided herein comprise at least one or more senescent cell-associated antigens, polynucleotides encoding senescent cell-associated antigens, and recombinant expression vectors comprising the polynucleotides for use in administering to a subject in need thereof. | 02-11-2016 |
20160038588 | Myostatin Antagonism in Human Subjects - Disclosed are methods of treating or modulating cachexia and/or increasing lean body mass and/or increasing lower extremity muscle size in a prostate cancer patient comprising administering a therapeutically effective amount of a myostatin antagonist. Further disclosed is the peptibody sequence of the myostatin antagonist, and the formulation of the peptibody. | 02-11-2016 |
20160039921 | MONOCLONAL ANTIBODY FOR ANTAGONIZING AND INHIBITING BINDING OF VASCULAR ENDOTHELIAL CELL GROWTH FACTOR AND ITS RECEPTOR, AND CODING SEQUENCE AND USE THEREOF - A mouse monoclonal antibody for antagonizing and inhibiting binding of a vascular endothelial cell growth factor (VEGF) and its receptor (VEGF-R), and a heavy chain variable region and light chain variable region amino acid sequence thereof. Also disclosed are a humanized preparation process of the antibody and a heavy chain variable region and light chain variable region amino acid sequence of the humanized antibody. The humanized antibody or its derivative can act as an ingredient of a pharmaceutical composition or be prepared into a suitable pharmaceutical preparation, is administered alone or in combination with a chemotherapy drug or other treatment means, and is used in broad-spectrum treatment of various solid tumors such as colon cancer, breast cancer and rhabdomyosarcoma. | 02-11-2016 |
20160039924 | METHODS FOR MODULATING THE GLYCOSYLATION PROFILE OF RECOMBINANT PROTEINS USING DISSOLVED OXYGEN - The present invention relates to the field of protein production, and in particular to methods and compositions for modulating glycosylation of recombinant proteins expressed in host cells by supplementing the production media with dissolved oxygen. | 02-11-2016 |
20160039941 | IMMUNOTHERAPY OF AUTOIMMUNE DISORDERS USING ANTIBODIES WHICH TARGET B-CELLS - Antibodies that bind with a B-cell antigen provide an effective means to treat autoimmune disorders. Antibodies and fragments, which may be conjugated or naked, are used Mono or in multimodal therapies. The antibodies may be bispecific antibodies which May be produced recombinantly as fusion proteins, or as hybrid, polyspecific antibodies. | 02-11-2016 |
20160045484 | METHODS AND COMPOSITIONS USING 4-AMINO-2-(2,6-DIOXO-PIPERIDINE-3-YL)-ISOINDOLINE-1,3-DIONE FOR TREATMENT AND MANAGEMENT OF CENTRAL NERVOUS SYSTEM CANCERS - Methods and compositions for treating, preventing or managing central nervous system cancers are disclosed. The methods encompass the administration of 4-amino-2-(2,6-dioxo-piperidine-3-yl)-isoindoline-1,3-dione, also known as Pomalidomide. Furthermore, provided herein are methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods provided herein are also disclosed. | 02-18-2016 |
20160045515 | MUTANT SELECTIVITY AND COMBINATIONS OF A PHOSPHOINOSITIDE 3-KINASE INHIBITOR COMPOUND AND CHEMOTHERAPEUTIC AGENTS FOR THE TREATMENT OF CANCER - Methods and compositions are provided for treating hyperproliferative disorders in patients with a PI3K inhibitor, GDC-0032 as a single agent or in combination with chemotherapeutic agents. | 02-18-2016 |
20160046636 | TYPE II RAF KINASE INHIBITORS - The present invention relates to novel compounds which are able to modulate b-raf kinases, and the use of such compounds in the treatment of various diseases, disorders or conditions. | 02-18-2016 |
20160046714 | Methods for the Treatment of Autoimmune Disorders Using Immunosuppressive Monoclonal Antibodies with Reduced Toxicity - The present invention provides methods of treating, preventing, slowing the progression of, or ameliorating the symptoms of T cell mediated immunological diseases, particularly autoimmune diseases (e.g., autoimmune diabetes (i.e. type 1 diabetes or insulin-dependent diabetes mellitus (IDDM)) and multiple sclerosis) through the use of anti-human CD3 antibodies. The antibodies of the invention of the invention are preferably used in low dose dosing regimens, chronic dosing regimens or regimens that involve redosing after a certain period of time. The methods of the invention provide for administration of antibodies that specifically bind the epsilon subunit within the human CD3 complex. Such antibodies modulate the T cell receptor/alloantigen interaction and, thus, regulate the T cell mediated cytotoxicity associated with autoimmune disorders. Additionally, the methods of the invention provide for use of anti-human CD3 antibodies modified such that they exhibit reduced or eliminated effector function and T cell activation as compared to non-modified anti-human CD3 antibodies. | 02-18-2016 |
20160046720 | NOVEL ANTI-HUMAN TSLP RECEPTOR ANTIBODY - [Problem] To provide an anti-human TSLP receptor antibody that specifically binds to human TSLP receptor and inhibits an action of human TSLP through human TSLP receptor. | 02-18-2016 |
20160046729 | CHIMERIC ANTIGEN RECEPTORS WITH AN OPTIMIZED HINGE REGION - The present invention relates to multi-functional proteins which comprise (i) a signal peptide, (ii) a target specific recognition domain, (iii) a linker region, connecting domain (ii) and domain (iv) which comprises a specific modified hinge region of the human CD8 alpha-chain, and (iv) an effector domain. The present invention furthermore relates to nucleic acids encoding the proteins, expression constructs for expressing the protein in a host cell and host cells. The proteins of the invention are chimeric antigen receptors with an optimized linker or hinge region that are suitable for generating target-specific effector cells, for use as a medicament, in particular in the treatment of cancer and in adoptive, target-cell specific immunotherapy. | 02-18-2016 |
20160051500 | Compositions and Methods for Treating Cancer - The present invention provides, in part, compositions and methods for treating cancer using a combination of C6-ceramide and other anti-cancer agents in certain vesicles. | 02-25-2016 |
20160051619 | TREATMENT OF PROTEIN DEGRADATION DISORDERS - The invention relates to methods of treating protein degradation disorders, such cellular proliferative disorders (e.g., cancer) and protein deposition disorders (e.g., neurodegenerative disorders). The invention provides methods and pharmaceutical compositions for treating these diseases using aggresome inhibitors or combinations of aggresome inhibitors and proteasome inhibitors. The invention further relates to methods and pharmaceutical compositions for treating multiple myeloma. New HDAC/TDAC inhibitors and aggresome inhibitors are also provided as well as synthetic methodologies for preparing these compounds. | 02-25-2016 |
20160052977 | NOVEL TOXINS IN TYPE A CLOSTRIDIUM PERFRINGENS - The present disclosure relates to novel pore-forming toxins of Type A | 02-25-2016 |
20160052995 | METHOD FOR ISOLATION OF SOLUBLE POLYPEPTIDES - Polypeptides with desirable biophysical properties such as solubility, stability, high expression, monomericity, binding specificity or non-aggregation, including monomeric human V | 02-25-2016 |
20160052996 | RECOMBINANT HUMAN ANTIBODIES FOR THERAPY AND PREVENTION OF POLYOMAVIRUS-RELATED DISEASES - Provided are novel human-derived antibodies specifically recognizing polyomavirus polypeptides, preferably capable of binding to polyomaviruses of the type of JC virus (JCV) and/or BK virus (BKV) as well as methods related thereto. Furthermore, assays and kits related to antibodies specific for polyomaviruses, polyomavirus VP1 and or polyomavirus VP1 Virus-Like Particles (VLPs), preferably of the type of JCV and/or BKV, are disclosed. The human-derived antibodies as well as binding fragments, derivatives and variants thereof can be used in pharmaceutical and diagnostic compositions for polyomavirus targeted immunotherapy and diagnostics. | 02-25-2016 |
20160053005 | METHODS FOR DIAGNOSING AND TREATMENT OF BREAST CANCER AND PHARMACEUTICAL COMPOSITION AND KIT FOR SAME - Among other findings, the subject matter is based on the identification that p14 peptide is expressed in mammary carcinoma cells harboring MMTV. Thus, provided are methods for diagnosing breast cancer in subjects comprising determining the levels of expression of the peptide or the levels of anti-p14 antibodies produced in the subject to the peptide. Further provided are screening methods of individuals with high probability of having breast cancer as well as to therapeutic methods; pharmaceutical compositions and vaccine making use of the anti-p14 antibodies or p14 peptides or produced thereby. | 02-25-2016 |
20160053011 | ANTIBODY SPECIFICALLY BINDING TO HER2 - The present invention relates to HER2 (Human Epidermal Growth Factor Receptor 2) antibodies to prevent or treat cancers. The antibodies of the invention binds specifically to HER2 over-expressed in cancer cells (particularly, breast cancer and stomach cancer cells), specifically to an epitope on HER2 being different from epitope for trastuzumab. The CDR sequences of the present antibodies exhibit low similarity to CDR sequences of publicly known HER2 antibodies, addressing that the CDR sequences are unique. The antibodies of the present invention in combination with trastuzumab kill cancer cells with significantly enhanced cytotoxicity and therefore very effective in therapy of cancer (particularly, breast cancer and stomach cancer). Without wishing to be bound by theory, the enhanced efficacies of the combined therapy would address that the antibodies of the present invention bind to epitope on HER2 being different from epitope for trastuzumab, and inhibit HER2 in a cooperative manner with trastuzumab. | 02-25-2016 |
20160053016 | COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING CANCER - The present invention relates to compositions and methods for characterizing, diagnosing, and treating cancer. In particular the invention provides the means and methods for the diagnosis, characterization, prognosis and treatment of cancer and specifically targeting cancer stem cells. The present invention provides an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor and inhibits growth of tumor cells. The present invention further provides a method of treating cancer, the method comprising administering a therapeutically effective amount of an antibody that specifically binds to a non-ligand binding region of the extracellular domain of a human NOTCH receptor protein and inhibits growth of tumor cells. | 02-25-2016 |
20160053026 | METHODS FOR TREATING INFECTION BY HPV - We describe herein methods for treating HPV infections and medical conditions caused by HPV infections. Generally, the methods include administering to a subject exhibiting at least one symptom or clinical sign of HPV infection a composition that includes an EGFR signaling inhibitor in an amount effective to ameliorate the at least one symptom or clinical sign of HPV infection. | 02-25-2016 |
20160054323 | SRM/MRM Assay for Subtyping Lung Histology - The current disclosure provides for specific peptides, and derived ionization characteristics of the peptides, from the KRT5, KRT7, NapsinA, TTF1, TP63, and/or MUC1 proteins that are particularly advantageous for quantifying the KRT5, KRT7, NapsinA, TTF1, TP63, and/or MUC1 proteins directly in biological samples that have been fixed in formalin by the method of Selected Reaction Monitoring (SRM) mass spectrometry, or what can also be termed as Multiple Reaction Monitoring (MRM) mass spectrometry. Such biological samples are chemically preserved and fixed wherein said biological sample is selected from tissues and cells treated with formaldehyde containing agents/fixatives including formalin-fixed tissue/cells, formalin-fixed/paraffin embedded (FFPE) tissue/cells, FFPE tissue blocks and cells from those blocks, and tissue culture cells that have been formalin fixed and or paraffin embedded. A protein sample is prepared from said biological sample using the Liquid Tissue™ reagents and protocol and the KRT5, KRT7, NapsinA, TTF1, TP63, and/or MUC1 proteins are quantitated in the Liquid Tissue™ sample by the method of SRM/MRM mass spectrometry by quantitating in the protein sample at least one or more of the peptides described. These peptides can be quantitated if they reside in a modified or an unmodified form. An example of a modified form of a KRT5, KRT7, NapsinA, TTF1, TP63, and MUC1 fragment peptide is phosphorylation of a tyrosine, threonine, serine, and/or other amino acid residues within the peptide sequence. | 02-25-2016 |
20160058850 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATORY DISEASES OF INFECTIOUS AND NON-INFECTIOUS ORIGIN - The present invention is based, in part, on our analysis of C1-INH levels in various patient populations. Accordingly, in a first aspect, the invention features methods for assessing the protective capacity of endogenous C1-INH in a patient who has been diagnosed with ARDS, sepsis or a sepsis-related condition, a burn or a burn-related condition, SJS, CABG-related states and/or other traumatic injuries. The methods can include the steps of: (a) providing a fluid sample from the patient; (b) determining the amount of C1-INH functional activity in the sample; and (c) comparing the amount of C1-INH functional activity to a reference standard. Where the level of C1-INH functional activity is comparable to that within a healthy patient population, the patient's own protective capacity is compromised. | 03-03-2016 |
20160058875 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 03-03-2016 |
20160060328 | COMPOSITIONS AND METHODS FOR BINDING CYSTEINYL LEUKOTRIENES (CYSLTS) FOR TREATMENT OF DISEASE - Methods are provided for using antibodies and antibody fragments that bind one or more cysteinyl leukotrienes (cysLTs) for treatment of diseases, including inflammatory, respiratory and gastrointestinal diseases and conditions associated with aberrant levels of one or more cysLTs. Anti-cysLT antibodies and antigen-binding antibody fragments, and compositions containing such antibodies and antibody fragments, are also provided. | 03-03-2016 |
20160060331 | PREVENTION AND TREATMENT OF SYNUCLEINOPATHIC AND AMYLOIDOGENIC DISEASE - The invention provides improved agents and methods for treatment of diseases associated with synucleinopathic diseases, including Lewy bodies of alpha-synuclein in the brain of a patient. Such methods entail administering agents that induce a beneficial immunogenic response against the Lewy body. The methods are particularly useful prophylactic and therapeutic treatment of Parkinson's disease. | 03-03-2016 |
20160060333 | EARLY MARKER OF PROTEINURIA IN PATIENTS TREATED WITH AN ANTI-VEGF TREATMENT - This document provides methods and materials related to determining whether or not a human receiving a therapy (e.g., an anti-VEGF therapy such as a bevacizumab therapy) has developed or is at risk for developing proteinuria. For example, methods and materials for detecting urinary podocytes to determine whether or not a human receiving anti-VEGF therapy has or is at risk for developing proteinuria or kidney injury are provided. | 03-03-2016 |
20160060340 | ANTI-FOLR1 ANTIBODY - The present invention provides an anti-human FOLR1 antibody against diseases associated with human FOLR1-expressing cells, which specifically recognizes and binds to an amino acid sequence of human FOLR1 or a conformational structure thereof and also has a high effector activity such as antibody-dependent cellular cytotoxicity activity (ADCC activity). The present invention can provide a monoclonal antibody which specifically recognizes and binds to the amino acid sequence of human FOLR1 or the conformational structure thereof and also has ADCC activity and CDC activity, or an antibody fragment thereof, a DNA encoding the antibody, a vector comprising the DNA, a transformant obtained by introducing the vector, a method for producing the antibody or the antibody fragment thereof using the transformant, and a therapeutic agent and a diagnostic agent comprising the antibody or the antibody fragment as an active ingredient. | 03-03-2016 |
20160060342 | Markers of Acute Myeloid Leukemia Stem Cells - Markers of acute myeloid leukemia stem cells (AMLSC) are identified. The markers are differentially expressed in comparison with normal counterpart cells, and are useful as diagnostic and therapeutic targets. | 03-03-2016 |
20160060350 | CYTOTOXIC ANTIBODY DIRECTED AGAINST TYPE B LYMPHOID HEMATOPOIETIC PROLIFERATIONS - The present invention relates to a monoclonal antibody directed against the CD20 antigen, wherein the variable region of each of the light chains thereof is encoded by a sequence which shares at least 70% identity with murine nucleic acid sequence SEQ ID No. 5, the variable region of each of the heavy chains thereof is encoded by a sequence which shares at least 70% identity with murine nucleic acid sequence SEQ ID No. 7, and the constant regions of light and heavy chains thereof are constant regions from a non-murine species, as well as for activation of FcγRIIIA receptors in immune effector cells, and for the manufacture of a drug especially for the treatment of leukaemia or lymphoma. | 03-03-2016 |
20160067269 | Miltefosin Or Perifosin For Use In The Treatment of IBD - Miltefosin or perifosin for use in the treatment or prevention of inflammatory bowel disease (IBD). | 03-10-2016 |
20160067336 | METHODS FOR TREATING A DISEASE OR DISORDER USING ORAL FORMULATIONS OF CYTIDINE ANALOGS IN COMBINATION WITH AN ANTI-PD1 OR ANTI-PDL1 MONOCLONAL ANTIBODY - The present disclosure provides methods of treating diseases or disorders with oral cytidine analogs (e.g., 5-azacytidine) in combination with anti-PD1/anti-PDL1 antibodies (e.g., pembrolizumab or durvalumab). The diseases or disorders include, but are not limited to, relapsed or refractory myelodysplastic syndromes, acute myeloid leukemia, ovarian cancer, or non-small cell lung cancer. | 03-10-2016 |
20160067337 | COMBINATION OF DR5 AGONIST AND ANTI-PD-1 ANTAGONIST AND METHODS OF USE - Provided are methods and compositions for treating cancer using an effective amount of a PD-1 antagonist (e.g., an antibody) in combination with a DR4 or DR5 agonist (e.g., an antibody). | 03-10-2016 |
20160068588 | ANTIBODIES WITH MODIFIED ISOELECTRIC POINTS AND IMMUNOFILTERING - The invention relates generally to compositions and methods for altering the isoelectric point of an antibody, and in some cases, resulting in improved plasma pharmacokinetics, e.g. increased serum half-life in vivo. | 03-10-2016 |
20160068592 | C5 ANTIBODY AND METHOD FOR PREVENTING AND TREATING COMPLEMENT-RELATED DISEASES - The present invention relates to an antibody against C5, and a method for preventing and treating complement-related diseases using the antibody, wherein the antibody against C5 is effectively usable in preventing and treating complement-related diseases by inhibiting complement activation. | 03-10-2016 |
20160068609 | ANTI-CANCER TREATMENTS WITH ANTI-EGFR ANTIBODIES HAVING A LOW FUCOSYLATION - The present invention pertains to the field of cancer therapy using anti-cancer antibodies. The medical use of anti-EGFR antibodies having improved glycosylation characteristics, in particular a reduced fucosylation, is provided which show anti-cancer efficacy and an improved adverse side effect profile. | 03-10-2016 |
20160069902 | MEASURING CIRCULATING THERAPEUTIC ANTIBODY, ANTIGEN AND ANTIGEN/ANTIBODY COMPLEXES USING ELISA ASSAYS - The present invention relates to the field of immunology and hyperproliferative diseases. More specifically, the present invention relates to a method of detecting and monitoring therapeutic antibody:antigen complex, soluble antigen and soluble therapeutic antibody, wherein a patient has undergone at least one course of immunotherapy. Yet further, levels of therapeutic antibody:antigen complexes, soluble antigens or soluble therapeutic antibodies may be measured and used to stage or monitor a hyperproliferative disease. | 03-10-2016 |
20160074468 | COMBINATION ANTI-HER2 CANCER THERAPY USING MUC1 PEPTIDES AND CHEMOTHERAPEUTICS - The invention provides for treatment of HER2+ cancers using a combination of anti-MUC1 therapy and anti-HER2 therapy. In particular, the invention addresses the treatment of trastuzamab-resistant cancers, both primary and acquired, using the same combination of agents. | 03-17-2016 |
20160075768 | ADJUVANT THERAPY FOR STAPHYLOCOCCAL INFECTION WITH ENTEROTOXIN SPECIFIC MABS - Antibodies to SEB, fragments thereof, and compositions comprising such are provided. Therapies for staphylococcal infection are provided, as well as assays for identifying additional agents useful in such therapies. An isolated antibody, or an isolated antigen-binding fragment of an antibody, is provided which antibody or antigen-binding fragment binds to staphylococcal enterotoxin B (SEB) and which antibody or antigen-binding fragment comprises a heavy chain variable CDR3 comprising the sequence RIYYGNNGGVMDY (SEQ ID NO:30); ARTAGLLAPMDY (SEQ ID NO:31); ARDTMRKCYCELKLKPPAEHPGPA (SEQ ID NO:32) or VRDL YGDYVGRY A Y (SEQ ID NO:48). | 03-17-2016 |
20160075771 | Methods for Treating Neoplasia - The invention provides therapeutic methods featuring the use of chimeric human/mouse antibodies for the treatment of neoplasia. | 03-17-2016 |
20160075773 | MONOCLONAL ANTIBODIES AGAINST THE RGM A PROTEIN FOR USE IN THE TREATMENT OF RETINAL NERVE FIBER LAYER DEGENERATION - The present application describes RGM A binding proteins, particularly monoclonal antibodies, and in particular CDR grafted, humanized versions thereof, which have the ability to bind to RGM A and prevent binding of RGM proteins to RGM A receptor and other RGM A binding proteins, and therefore neutralize the function of RGM A, for use in the treatment of retinal nerve fiber layer (RNFL) degeneration as well as methods of therapeutically or prophylactically treating a mammal against RNFL degeneration. | 03-17-2016 |
20160075775 | TREATMENT OF TRAUMATIC BRAIN INJURY USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID - Methods are provided for treating neurotrauma, for example, traumatic brain injury (TBI), using antibodies and antibody fragments that bind lysophosphatidic acid (LPA). Such treatment may result in functional locomotor recovery in subjects so treated, as well as reducing the size of a brain infarct in subjects having or suspected of having sustained neurotrauma such a TBI. | 03-17-2016 |
20160075780 | ANTIBODY AGAINST HUMAN PROSTAGLANDIN E2 RECEPTOR EP4 - It is an object of the present invention to provide an antibody that binds to a human PGE | 03-17-2016 |
20160075783 | ANTIBODIES DIRECTED AGAINST PROGRAMMED DEATH-1 (PD-1) - The invention relates to an isolated immunoglobulin heavy chain polypeptide and an isolated immunoglobulin light chain polypeptide that bind to a programmed death-1 (PD-1) protein. The invention provides a PD-1-binding agent that comprises the aforementioned immunoglobulin heavy chain polypeptide and immunoglobulin light chain polypeptide. The invention also provides related vectors, compositions, and methods of using the PD-1-binding agent to treat a cancer or an infectious disease. | 03-17-2016 |
20160075786 | USE OF ANTAGONISTS OF THE INTERACTION BETWEEN HIV GP120 AND A4B7 INTEGRIN - Methods are provided for the treatment of a HIV infection. The methods can include administering to a subject with an HIV infection a therapeutically effective amount of an agent that interferes with the interaction of gp120 and α4 integrin, such as a α4β1 or α4β7 integrin antagonist, thereby treating the HIV infection. In several examples, the α4 integrin antagonist is a monoclonal antibody that specifically binds to a α4, β1 or β7 integrin subunit or a cyclic hexapeptide with the amino acid sequence of CWLDVC. Methods are also provided to reduce HIV replication or infection. The methods include contacting a cell with an effective amount of an agent that interferes with the interaction of gp120 and α4 integrin, such as a α4β1 or α4β7 integrin antagonist. Moreover, methods are provided for determining if an agent is useful to treat HIV. | 03-17-2016 |
20160075792 | ANTIBODY CONTAINING IGG2 HAVING AMINO ACID MUTATION INTRODUCED THEREIN - The present invention can provide a monoclonal antibody which comprises a heavy chain constant region which is IgG2 wherein valine at position 234, glutamine at position 237 and proline at position 331 are at least substituted with alanine, alanine and serine, respectively (numbering is based on the EU index of Kabat et al); has an agonist activity; and binds to human CD40. | 03-17-2016 |
20160075798 | ISOFORM SPECIFIC ANTI-HER4 ANTIBODIES - Compositions and methods useful for detecting and treating cancers which express the HER4 JM-a isoform are disclosed. | 03-17-2016 |
20160077097 | METHOD OF ISOLATING CIRCULATING TUMOR CELLS - Provided are methods for detecting or isolating circulating tumor cells (CTCs) in a subject. The methods may include detecting the expression of at least one epithelial mesenchymal transition (EMT) biomarker. Further provided are kits for detecting or isolating CTCs. The kits may include antibodies to at least one EMT biomarker. Further provided are methods of predicting the responsiveness of a subject to a cancer drug, methods of targeting delivery of a cancer drug in a subject, methods of providing a cancer prognosis to a subject, and methods for following the progress of cancer in a subject. | 03-17-2016 |
20160078167 | PROGNOSTIC AND PREDICTIVE BREAST CANCER SIGNATURE - Embodiments of the invention are directed to methods of determining the prognosis of a breast cancer patient by evaluating a specified set of genes. Specifically, methods may comprise calculating a prognosis score based on a particular algorithm. Also disclosed are compositions, kits and methods for treating cancer in a subject in need thereof are disclosed involving one or more upstream activators and/or downstream effectors of TET1. | 03-17-2016 |
20160082045 | Engineering and Delivery of Therapeutic Compositions of Freshly Isolated Cells - The present invention relates to the transient modification of cells. In particular embodiments, the cells are immune systems, such as PBMC, PBL, T (CD3+ and/or CD8+) and Natural Killer (NK) cells. The modified cells provide a population of cells that express a genetically engineered chimeric receptor which can be administered to a patient therapeutically. The present invention further relates to methods that deliver mRNA coding for the chimeric receptor to unstimulated resting PBMC, PBL, T (CD3+ and/or CD8+) and NK cells and which delivers the mRNA efficiently to the transfected cells and promotes significant target cell killing. | 03-24-2016 |
20160082082 | USE OF THERAPEUTIC PEPTIDES FOR THE TREATMENT AND PREVENTION OF CANCER - MUC1 (DF3, CD227, episialin, PEM) is a heavily O-glycosylated heterodimeric protein of >300 kDa, normally expressed abundantly on the apical surface of glandular epithelia. MUC1 mimetic peptides are selectively retained in mammary gland tumors, colon and skin after systemic administration. Moreover, MUC1 mimetic peptides reduce tumor initiation. In addition, MUC1 mimetic peptides can be used in conjunction with other anti-EGFR treatments in the adjuvant context, i.e., after surgery. | 03-24-2016 |
20160082113 | ALTERING A B CELL PATHOLOGY USING SELF-DERIVED ANTIGENS IN CONJUNCTION WITH SPECIFIC-BINDING CYTOREDUCTIVE AGENT - A method of treating B cell malignancies or a method for preparing compositions for treating B cell malignancies wherein administration of a specific binding cytoreductive agent is followed by immunization with an autologous Id protein. The two treatments may be sequential, where the administration of the specific binding cytoreductive agent is completed before the administration of the autologous Id protein, or the administration of the specific binding cytoreductive agent and the immunization with an autologous Id protein may occur in an overlapping time course. | 03-24-2016 |
20160082120 | METHODS OF USING ANTI-CD79b IMMUNOCONJUGATES - Provided herein are methods of treating B-cell proliferative disorders in particular Follicular Lymphoma and/or Diffuse Large B-Cell Lymphoma using immunoconjugates comprising anti-CD79b antibodies in combination with additional therapeutic agents. | 03-24-2016 |
20160083459 | Anti-Inflammatory Antibodies and Uses Therefor - The invention provides antibodies that inhibit activation of complement, which may be used to treat various inflammatory diseases or disorders. | 03-24-2016 |
20160083460 | SCLEROSTIN ANTIBODY CRYSTALS AND FORMULATIONS THEREOF - Described herein are anti-sclerostin antibody crystals, methods of making such antibody crystals and formulations comprising the antibody crystals. | 03-24-2016 |
20160083463 | Sodium Pump Antibody Agonists And Methods Of Treating Heart Disease Using The Same - Antibodies that are agonists of sodium pump (Na | 03-24-2016 |
20160083465 | ANTI-GDF15 ANTIBODIES - Monoclonal antibodies that bind and inhibit the activity of human GDF15 are disclosed. The antibodies can be used to treat body weight loss, including cachexia, associated with the over-expression of human GDF15. | 03-24-2016 |
20160083470 | FERROPORTIN ANTIBODIES AND METHODS OF USE - Compositions for treating disorders of iron homeostasis are provided. More particularly, anti-ferroportin antibodies, compositions containing such antibodies, corresponding nucleic acids, vectors and host cells, and methods of making such antibodies are provided. | 03-24-2016 |
20160083474 | Methods for Enhancing Anti-Tumor Antibody Therapy - Methods are provided to enhance the efficacy of antibody therapy directed to tumor cells. | 03-24-2016 |
20160084839 | IMMUNOHISTOCHEMICAL ASSAY FOR DETECTING EXPRESSION OF PROGRAMMED DEATH LIGAND 1 (PD-L1) IN TUMOR TISSUE - The present disclosure provides processes for describing and quantifying the expression of human programmed death ligand-1 (PD-L1) in tumor tissue sections as detected by immunohistochemical assay using an antibody that specifically binds to PD-L1. The results generated using these processes have a variety of experimental, diagnostic and prognostic applications. | 03-24-2016 |
20160084846 | METHODS AND COMPOSITIONS FOR DETERMINING RELAPSE IN INFLAMMATORY BOWEL DISEASE - Described are methods and compositions for evaluating the relapse risk n subjects having an inflammatory bowel disease (IBD). Some embodiments include selecting a treatment for an evaluated IBD relapse risk in a subject. | 03-24-2016 |
20160089435 | PAN-HER ANTIBODY COMPOSITION - The present invention is directed to improved therapeutics against receptors within the EGFR/ErbB/HER family that more broadly interfere with multiple members of the HER family (pan-HER inhibition). More particularly, the invention is directed to the use of antibody compositions for human cancer therapy. In vitro studies have shown that the antibody compositions of the invention targeting multiple HER family receptors are superior to antibody compositions targeting only one HER family receptor. | 03-31-2016 |
20160090377 | AZETIDINE ESTROGEN RECEPTOR MODULATORS AND USES THEREOF - Described herein are compounds that are estrogen receptor modulators. Also described are pharmaceutical compositions and medicaments that include the compounds described herein, as well as methods of using such estrogen receptor modulators, alone and in combination with other compounds, for treating diseases or conditions that are mediated or dependent upon estrogen receptors. | 03-31-2016 |
20160090378 | ESTROGEN RECEPTOR MODULATORS AND USES THEREOF - Described herein are compounds that are estrogen receptor modulators. Also described are pharmaceutical compositions and medicaments that include the compounds described herein, as well as methods of using such estrogen receptor modulators, alone and in combination with other compounds, for treating diseases or conditions that are mediated or dependent upon estrogen receptors. | 03-31-2016 |
20160090409 | METHODS FOR THE TREATMENT OF NEURODEGENERATION - The invention encompasses the discovery that Fc-containing polypeptides that include branched glycans and that are sialylated on the branched glycan (e.g., on an α 1,3 and/or α 1,6 arm in the Fc region's N-linked glycosylation site), with, e.g., a NeuAc-α 2,6-Gal or NeuAc-α 2,3-Gal terminal linkage, are useful in treating neurodegeneration, e.g., in the treatment of neurodegenerative diseases such as Alzheimer's Disease. The present disclosure provides, in part, methods for treating neurodegeneration or neurodegenerative diseases by administering compositions containing such Fc-containing polypeptides as well as methods for evaluating, identifying, and/or producing (e.g., manufacturing) such polypeptides for the treatment of neurodegeneration. | 03-31-2016 |
20160090419 | HIGH CONCENTRATION ANTIBODY-CONTAINING LIQUID FORMULATION - The problem to be solved is to provide an antibody-containing formulation which is stable and suited for subcutaneous administration, wherein dimerization and deamidation is prevented during long-term storage. The present application is directed to a stable antibody-containing liquid formulation characterized by containing arginine and methionine. | 03-31-2016 |
20160090421 | Novel Uses - The present invention relates to the dosing regiment for anti-CD20 antibody to treat various diseases. | 03-31-2016 |
20160095796 | DELAMINATION RESISTANT PHARMACEUTICAL GLASS CONTAINERS CONTAINING ACTIVE PHARMACEUTICAL INGREDIENTS - The present invention is based, at least in part, on the identification of a pharmaceutical container formed, at least in part, of a glass composition which exhibits a reduced propensity to delaminate, i.e., a reduced propensity to shed glass particulates. As a result, the presently claimed containers are particularly suited for storage of pharmaceutical compositions and, specifically, a pharmaceutical solution comprising a pharmaceutically active ingredient, for example, PROCRIT (epoetin alfa), REMICADE (Infliximab) or DORIBAX (doripenem). | 04-07-2016 |
20160095920 | KRAS MUTATIONS AND RESISTANCE TO ANTI-EGFR TREATMENT - The disclosure provides compositions and methods for detecting and predicting acquired resistance to anti-EGFR treatment in colorectal cancers. Also provided are compositions and methods of preventing, reversing or delaying the acquired resistance. The present disclosure also provides kits for use in the methods described herein. | 04-07-2016 |
20160095921 | Combinations and Methods for Treating Inflammatory Bowel Disease Using a Combination Therapy of Small Molecule Inhibitors of C-C Chemokine Receptor 9 (CCR9) and Anti-alpha4beta7 Integrin Blocking Antibodies - Provided herein are compositions, methods and kits for treating inflammatory bowel disease (IBD) such as Crohn's disease and ulcerative colitis in a mammal in need thereof. The method include administering to a subject with IBD a combination therapy containing a therapeutically effective amount of a chemokine receptor 9 (CCR9) inhibitor compound and a therapeutically effective amount of an anti-α4β7 integrin antibody such as vedolizumab. Also provided herein is a kit containing the CCR9 inhibitor compound and anti-α4β7 integrin antibody. | 04-07-2016 |
20160096855 | Method of Treating Colorectal Cancer - The present invention relates to the use of certain platinum compounds including [PtCb(cis-1,4-diaminocyclohexane)], or combinations of these compounds with a variety of other agents for treating and/or preventing the progression of colorectal cancer in mammals. In particular, the invention provides methods of treating and/or preventing oxaliplatin-refractory colorectal cancer in mammals. | 04-07-2016 |
20160096884 | ANTIBODIES DIRECTED AGAINST AMYLOID-BETA PEPTIDE AND METHODS USING SAME - Antibodies directed to the C-terminal side of β-amyloid peptide and methods of using these antibodies for diagnosing and treatment of Alzheimer's disease and Aβ peptide associated diseases are described. | 04-07-2016 |
20160096886 | METHODS FOR ADMINISTERING ANTI-IL-5 ANTIBODIES - The present invention relates generally to the methods for the treatment and diagnosis of conditions mediated by IL-5 and excess eosinophil production, and more specifically to mAbs, Fabs, chimeric and humanized antibodies. More particularly, methods are provided for reducing eosinophils in a human in need thereof, which method comprises administering to said human a composition comprising at least one anti-IL-5 antibody, wherein at least one anti-IL-5 antibody provides a mean maximum plasma concentration of said anti-IL-5 antibody of at least about 1.03±0.21 μg/mL, an Area Under the Curve value of at least about 15.5±2.7 μg/day/mL and a serum half-life of about 16.2±2.1 days to about 21.7±2.8 days. | 04-07-2016 |
20160096893 | ANTI-HER2 ANTIBODIES AND IMMUNOCONJUGATES - The invention provides anti-HER2 antibodies and immunoconjugates and methods of using the same. | 04-07-2016 |
20160096897 | ANTIBODIES TO MASP-2 - The invention relates to antibodies to MASP-2 and functional equivalents thereof. In particular, the invention relates to MASP-2 antibodies capable of inhibiting the function of MASP-2. The invention furthermore discloses MASP-2 epitopes, wherein antibodies recognising said epitopes are in particularly useful for inhibiting MASP-2 activity. The invention also relates to methods of producing said antibodies, methods of inhibiting MASP-2 activity as well as to pharmaceutical compositions comprising the MASP-2 antibodies. | 04-07-2016 |
20160096903 | HUMANIZATION OF RABBIT ANTIBODIES USING A UNIVERSAL ANTIBODY FRAMEWORK - The present invention relates to an universal antibody acceptor framework and to methods for grafting non-human antibodies, e.g., rabbit antibodies, using a universal antibody acceptor framework. Antibodies generated by the methods of the invention are useful in a variety of diagnostic and therapeutic applications. | 04-07-2016 |
20160097102 | SERINE PROTEASES AS BIOMARKERS FOR OVARIAN CANCER - The described invention provides methods for detecting, diagnosing and treating low-grade ovarian cancer and stage I ovarian cancer by comparing results from serum and ovarian tissue samples with normal controls. An increased level of expression of serine protease, wherein the serine protease is at least 2 selected from the group consisting of kallikrein 6 (KLK6), kallikrein 7 (KLK7), and PRSS8, expressed by subject samples compared to the level of expression of serine protease expressed by normal control samples is indicative of possible early stage ovarian cancer in the subject. Once early stage (I/II) ovarian cancer is diagnosed, the subject is treated with a treatment regimen effective to treat the early stage (I/II) ovarian cancer. | 04-07-2016 |
20160101071 | COMBINATION CANCER TREATMENT - Described herein is TRAIL receptor targeting therapy in combination with metformin for treatment of cancer in humans. Using TRAIL receptor targeting therapy such as the TRAIL molecule, agonistic human monoclonal antibodies against TRAIL receptors, or peptides targeting TRAIL receptors in combination with metformin for the treatment of all types of cancer allows to obtain an optimum therapeutical effect at any time of the progression of the disease. | 04-14-2016 |
20160101175 | METHOD FOR EGFR DIRECTED COMBINATION TREATMENT OF CANCER - The present invention relates to a method of treating patients suffering from cancers driven by deregulated Human Epidermal Growth Factor Receptor (HER/Human EGFR), wherein an irreversible tyrosine kinase inhibitor (TKI) is administered according to a continuous regimen based on an average daily dose in the range of 10 to 50 mg and the mAB is co-administered according to a dosing regimen ranging from an average weekly iv dose of 50 to 500 mg/m | 04-14-2016 |
20160101185 | TREATMENT OF CANCER - Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101. | 04-14-2016 |
20160102104 | Ataxia Telengiectasia And Rad3-Related (ATR) Protein Kinase Inhibitors - A macrocyclic compound having the structure of Formula (A), wherein each of R | 04-14-2016 |
20160102135 | HETEROMULTIMERS WITH REDUCED OR SILENCED EFFECTOR FUNCTION - Provided herein are heteromultimer constructs with reduced or silenced effector function. In an embodiment is provided a heteromultimer construct comprising an IgG Fc construct having a first and a second Fc polypeptide, each Fc polypeptide comprising a modified lower hinge region wherein: the modified lower hinge region of said first Fc polypeptide comprises at least one amino acid modification, the modified lower hinge region of said second Fc polypeptide comprises at least one amino acid modification which is different from at least one amino acid modification of said first Fc polypeptide, and the IgG Fc construct displays reduced binding to all Fcγ receptors and to C1q protein as compared to a corresponding parent IgG Fc construct. Also provided are methods of producing such heteromultimer constructs, and methods of reducing ADCC for an antibody construct by reducing effector function. | 04-14-2016 |
20160102141 | CELL CULTURE MEDIA AND METHODS OF ANTIBODY PRODUCTION - Cell culture media are provided herein as are methods of using the media for cell culture and antibody production from cells. Compositions comprising antibodies and fragments thereof, produced by the methods herein are also provided. | 04-14-2016 |
20160102142 | Antibodies Targeting M-CSF - This disclosure generally relates to antibodies or antibody fragments which specifically bind to M-CSF. In particular antibodies and antibody fragments are disclosed which bind to M-CSF and which inhibit binding of M-CSF to the M-CSF receptor with an IC50 of 10 pM or less. The invention also relates to nucleic acids, vectors and host cells capable of expressing the antibodies or fragments thereof of the invention, pharmaceutical compositions comprising the antibodies or fragments thereof and uses of said antibodies or fragments thereof and compositions for treatment of specific diseases. | 04-14-2016 |
20160102144 | Use of Reslizumab To Treat Moderate to Severe Eosinophilic Asthma - Disclosed herein are methods of treating moderate to severe eosinophilic asthma in a patient comprising: 1) identifying a patient having moderate to severe eosinophilic asthma, wherein the patient's symptoms are inadequately controlled with a current asthma therapeutic and wherein the patient's blood eosinophil levels are equal to or greater than 400/μL; and 2) administering to said patient a therapeutically effective dose of reslizumab. | 04-14-2016 |
20160102149 | OPTIMIZING THE PRODUCTION OF ANTIBODIES - A general method is provided for the production of purified antibodies by separation of an antibody molecule from an antibody variant by chromatographic methods, e.g. to enhance therapeutic efficacy, by for example choosing a specific harvesting time point and/or a specific purification scheme. The current invention thus reports a method for producing an antibody composition comprising an antibody molecule and a variant thereof, comprising the following steps: providing a sample comprising the antibody molecule and a variant thereof, determining the presence of the antibody molecule and/or a variant thereof and/or the ratio of the amount of the antibody molecule or variant thereof to the sum of the amounts of the antibody molecule and the variant thereof, in an aliquot of said sample, determining a subsequent harvesting time point and/or antibody purification scheme on basis of the data obtained before, thereby producing an antibody composition comprising the antibody molecule and a variant thereof. | 04-14-2016 |
20160106706 | METHOD OF DELIVERING AN ANTI-CANCER AGENT TO A CELL - There is provided a delivery vehicle comprising an anti-cancer agent together with a conjugate of a delivery agent containing a free aldehyde and a flavonoid, having the delivery agent conjugated at the C6 and/or the C8 position of the A ring of the flavonoid. The resulting delivery vehicles may be used to deliver an anti-cancer agent to a cell. | 04-21-2016 |
20160106835 | COMBINATION THERAPIES FOR CANCER - A novel combination comprising a B-Raf inhibitor, particularly N-{3-[5-(2-Amino-4-pyrimidinyl)-2-(1,1-dimethylethyl)-1,3-thiazol-4-yl]-2-fluorophenyl}-2,6-difluorobenzenesulfonamide or a pharmaceutically acceptable salt thereof, the MEK inhibitor N-{3-[3-cyclopropyl-5-(2-fluoro-4-iodo-phenylamino)6,8-dimethyl; -2,4,7-trioxo-3,4,6,7-tetrahydro-2H-pyrido[4,3-d]pyrimidin-1-yl]phenyl}acetamide, or a pharmaceutically acceptable salt or solvate thereof, and a PD-1 antagonist; pharmaceutical compositions comprising the same and methods of using such combinations and compositions in the treatment of conditions in which the inhibition of MEK and/or B-Raf and/or immune modulation through PD-1 is beneficial, e.g., cancer. | 04-21-2016 |
20160106837 | COMBINATION OF CD37 ANTIBODIES WITH CHLORAMBUCIL - The present invention relates to immunotherapies that are based on depletion of CD37-positive cells such as B-cells. The present invention provides methods for reduction of CD37-positive cells such as B-cells in an individual/patient using a combination of CD37 antibody/antibodies and chlorambucil. The combination of CD37 antibodies and chlorambucilis shown to have a synergistic effect. The application further provides materials and methods for treatment of diseases involving aberrant B-cell activity. | 04-21-2016 |
20160106846 | POLYMERS FOR DELIVERY OF THERAPEUTIC PROTEINS - In some aspects, improved hydrogel copolymers (e.g., comprising itaconic acid and N-vinylpyrrolidone) are provided and may be used, e.g., for oral delivery of a therapeutic protein. In some embodiments, improved methods for loading a therapeutic protein (e.g., a high isoelectric point protein) into a hydrogel copolymer are provided, and may comprise incubating the therapeutic protein and the hydrogel in a reduced ionic strength loading solution. In some embodiments, use of the reduced ionic strength loading solution can result in hydrogel copolymer-therapeutic protein compositions that display improved pharmacokinetic attributes, e.g., improved loading and/or release of a therapeutic protein. | 04-21-2016 |
20160108113 | ANTI-ALPHA-SYNUCLEIN ANTIBODIES AND METHODS OF USE - The present invention relates to anti-alpha-synuclein (anti-α-synuclein) antibodies and methods of using the same. | 04-21-2016 |
20160108115 | ANTI-C5 ANTIBODIES HAVING IMPROVED PHARMACOKINETICS - The disclosure provides antibodies that are useful for, among other things, inhibiting terminal complement (e.g., the assembly and/or activity of the C5b-9 TCC) and C5a anaphylatoxin-mediated inflammation and, thus, treating complement-associated disorders. The antibodies have a number of improved properties relative to eculizumab, including, e.g., increased serum half-life in a human. | 04-21-2016 |
20160108116 | VEGF-SPECIFIC ANTAGONISTS FOR ADJUVANT AND NEOADJUVANT THERAPY AND THE TREATMENT OF EARLY STAGE TUMORS - Disclosed herein are methods of treating benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating a subject at risk of developing benign, pre-cancerous, or non-metastatic tumors using an anti-VEGF-specific antagonist. Also disclosed are methods of treating or preventing recurrence of a tumor using an anti-VEGF-specific antagonist as well as use of VEGF-specific antagonists in neoadjuvant and adjuvant cancer therapy. | 04-21-2016 |
20160108122 | THERAPEUTIC OR PROPHYLACTIC AGENT FOR IMMUNODEFICIENCY VIRUS INFECTION - Disclosed is a novel means that enables complete cure of not only acute and chronic virus infections, but also latent retrovirus infections in which incorporation of the virus into the host chromosome has occurred. In the present invention, by destroying cells containing molecules that act as scaffolds for the virus infection in the patient's body, cells per se that have been already infected with virus are destroyed while inhibiting expansion of the virus infection in the patient's body, so that final complete cure of virus infection can be realized. The treatment of immunodeficiency virus infection may be carried out by administering an antibody or the like having high cytotoxic activity to the patient to destroy at least any of CD4 molecule-containing cells, CCR5 molecule-containing cells, and CXCR4 molecule-containing cells, preferably CD4 molecule-containing cells. | 04-21-2016 |
20160108124 | ANTI-DEspR INHIBITORS AS THERAPEUTICS FOR INHIBITION OF PATHOLOGICAL ANGIOGENESIS AND TUMOR CELL INVASIVENESS AND FOR MOLECULAR IMAGING AND TARGETED DELIVERY - Provided herein are novel compositions comprising anti-DEspR antibodies and fragments thereof, including fully human, composite engineered human, humanized, monoclonal, and polyclonal anto-DEspR antibodies and fragments thereof, and methods of their use in a variety of therapeutic applications. The compositions comprising the anti-DEspR antibodies and fragments thereof described herein are useful in diagnostic and imaging methods, such as DEspR-targeted molecular imaging of angiogenesis, and for companion diagnostic and/or in vivo-non invasive imaging and/or assessments. | 04-21-2016 |
20160108125 | FORMULATIONS WITH REDUCED OXIDATION - The invention provides formulations comprising a protein in combination with a compound that prevents oxidation of the protein. The invention also provides methods for making such formulations and methods of using such formulations. The invention further provides methods of screening for compounds that prevent oxidation of a protein in a protein composition and methods of preventing oxidation of a protein in a formulation. | 04-21-2016 |
20160108126 | CD20 Antibodies and Uses Thereof - CD20 is a transmembrane protein of the tetra-spanin family expressed on the surface of B-cells from peripheral blood as well as lymphoid tissues. CD20 expression persists from the early pre-B cell stage until the plasma cell differentiation stage. In addition to expression in normal B-cells, CD20 is expressed in B-cell derived malignancies such as non-Hodgkin's lymphoma (NHL) and B-cell chronic lymphocytic leukemia (CLL). The present invention includes anti-CD20 antibodies and antigen-binding fragments thereof comprising a light chain variable region and a heavy chain variable region, wherein the CDR-L1, CDR-L2, and CDR-L3 of said light chain variable region comprise the amino acid sequences of SEQ ID NOs: 17-19, respectively, and wherein the CDR-H1, CDR-H2, and CDR-H3 of said heavy chain variable region comprise the amino acid sequences of SEQ ID NOs: 20-22, respectively. | 04-21-2016 |
20160108132 | Antitumor Peptide Derived From A Complementarity Determining Region of a Humanized Monoclonal Antibody to NAP12B Transporter - Described herein is novel isolated or synthetic peptides derived from a complementarity determining region hypervariable domain amino acid sequence of a humanized monoclonal antibody to NaPi2B transporter, as well as derivatives thereof, and a pharmaceutical composition and a method for inhibiting tumor growth or treating a tumor or cancer treating using the antitumor peptides and derivatives thereof. | 04-21-2016 |
20160113924 | METHOD OF TREATING NASOPHARYNGEAL CARCINOMA USING PERILLYL ALCOHOL DERIVATIVE - A method of treating nasopharyngeal carcinoma in a mammal includes delivering to the mammal a therapeutically effective amount of a perillyl alcohol (POH) carbamate which is a perillyl alcohol conjugated with temozolomide (TMZ). | 04-28-2016 |
20160113932 | TREATMENT OF CANCERS USING PI3 KINASE ISOFORM MODULATORS - Provided herein are methods, kits, and pharmaceutical compositions that include a PI3 kinase inhibitor for treating cancers or hematologic disorders. Provided herein are methods, compositions, and kits for treating or preventing cancers or diseases, such as hematologic malignancies, which have a high expression level of one or more isoform (s) of PI3K (e.g., PI3K-δ and/or PI3K-γ). In one embodiment, the methods, compositions, and kits provided herein relate to administering an isoform-selective PI3K modulator. | 04-28-2016 |
20160115226 | SINGLE DOMAIN ANTIBODIES DIRECTED AGAINST TNF-ALPHA - This invention provides compositions and methods to treat a condition or disease without the use of exogenous targeting sequences or chemical compositions. The present invention relates to single-domain antibodies (sdAbs), proteins and polypeptides comprising the sdAbs that are directed against intracellular components that cause a condition or disease. The invention also includes nucleic acids encoding the sdAbs, proteins and polypeptides, and compositions comprising the sdAbs. The invention includes the use of the compositions, sdAbs, and nucleic acids encoding the sdAbs for prophylactic, therapeutic or diagnostic purposes. | 04-28-2016 |
20160115227 | Administration of an Anti-Interleukin 12/23 Antibody for Treatment of Autoimmune Disease - The present invention provides a method for treating or delaying the onset of an autoimmune condition in a human subject. An effective oral dose of ustekinumab is administered to the subject. Oral administration of ustekinumab also is useful in a method of decreasing innate inflammatory cytokines, such as IL-1β and TNF-α, Th1-like cytokines IL-2 and IFN-γ, IL-17 (T | 04-28-2016 |
20160115228 | ANTAGONISTS OF IL-6 TO PREVENT OR TREAT THROMBOSIS - The present invention is directed to therapeutic methods using IL-6 antagonists such as antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat thrombosis in diseases associated with abnormal blood coagulation or fibrinolysis. In preferred embodiments these patients will comprise those exhibiting elevated D-dimer or other coagulation cascade related proteins and optionally will further exhibit elevated C reactive protein prior to treatment. The subject therapies also may include the administration of other actives such as chemotherapeutics, anti-coagulants, statins, et al. | 04-28-2016 |
20160115245 | SINGLE DOMAIN ANTIBODIES AGAINST SOD1 AND THEIR USE IN MEDICINE - The present application relates to the field of single-domain antibodies (also called nanobodies), more particularly single-domain antibodies against SOD1 protein isoforms. It also relates to the use of these nanobodies in medicine. Accordingly, methods to treat a disease using these nanobodies are provided herein. The single-domain antibodies are particularly envisaged for treatment of ALS. | 04-28-2016 |
20160115247 | SINGLE DOMAIN ANTIBODIES DIRECTED AGAINST INTRACELLULAR ANTIGENS - This invention provides compositions and methods to treat a condition or disease without the use of exogenous targeting sequences or chemical compositions. The present invention relates to single-domain antibodies (sdAbs), proteins and polypeptides comprising the sdAbs that are directed against intracellular components that cause a condition or disease. The invention also includes nucleic acids encoding the sdAbs, proteins and polypeptides, and compositions comprising the sdAbs. The invention includes the use of the compositions, sdAbs, and nucleic acids encoding the sdAbs for prophylactic, therapeutic or diagnostic purposes. | 04-28-2016 |
20160115548 | ULCERATIVE COLITIS (UC)-ASSOCIATED COLORECTAL NEOPLASIA MARKERS - Embodiments provide methods and compositions related to detecting neoplasia in ulcerative colitis patients by detection and analysis of the methylation state of miR-1, -9, -124, miR-137 and/or miR-34b/c in samples from UC patients. | 04-28-2016 |
20160116483 | METHOD OF ASSESSING RISK OF PML - The invention relates to methods of assessing a patient's risk of developing Progressive multifocal leukoencephalopathy (PML). | 04-28-2016 |
20160117439 | SUPERIOR BIOINFORMATICS PROCESS FOR IDENTIFYING AT RISK SUBJECT POPULATIONS - A bioinformatics method for determining a risk score that indicates a risk that a subject, in particular a human, will experience a negative clinical event within a certain period of time. The risk score is based on a unique combination of activities of two or more cellular signaling pathways in a subject, wherein the selected cellular signaling pathways are the TGF-β pathway and one or more of a PI3K pathway, a Wnt pathway, an ER pathway, and an HH pathway. The invention includes an apparatus with a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method. The bioinformatics invention allows for more accurate prognosis of specific negative clinical events in a patient with, for example, a tumor or cancer, such as disease progression, recurrence, development of metastasis, or even death. | 04-28-2016 |
20160117443 | BIOINFORMATICS PROCESS FOR IDENTIFYING AT RISK SUBJECT POPULATIONS - A bioinformatics method for determining a risk score that indicates a risk that a subject will experience a negative clinical event within a certain period of time. The risk score is based on a combination of activities of two or more cellular signaling pathways in a subject, such as a human, wherein the specific cellular signaling pathways are the PI3K pathway and one or more of a Wnt pathway, an ER pathway, and an HH pathway. The invention also includes an apparatus with a digital processor configured to perform such a method, to a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and to a computer program comprising program code means for causing a digital processing device to perform such a method. The invention achieves advanced prognosis of negative clinical events, for example, disease progression, recurrence, development of metastasis, or even death. | 04-28-2016 |
20160120849 | CANCER THERAPY USING A COMBINATION OF A HSP90 INHIBITORY COMPOUNDS AND A EGFR INHIBITOR - A pharmaceutical combination comprising an EGFR inhibitor and an Hsp90 inhibitor according to the following formulae | 05-05-2016 |
20160120878 | DERIVATIVES OF BETULIN - The present invention relates to compounds characterized by having a structure according to the following formula I: | 05-05-2016 |
20160120895 | MicroRNAs useful for Treating Ovarian Cancer - Described herein are methods for diagnosing ovarian cancer. In particular, certain microRNAs are useful to the response to chemotherapy of ovarian cancer patients. | 05-05-2016 |
20160120976 | COMBINATION THERAPY WITH ANTI-CD74 AND ANTI-CD20 ANTIBODIES IN PATIENTS WITH RELAPSED AND REFRACTORY B-CELL NON-HODGKIN'S LYMPHOMA - The present invention concerns methods of treating relapsed/resistant non-Hodgkin's lymphoma using combination therapy with an anti-CD20 antibody or fragment and an anti-CD74 antibody or fragment. In preferred embodiments, the antibody combination is administered along with at least one other therapeutic agent. The combination is effective to treat indolent NHL that is resistant to or relapsed from at least one therapy for NHL, including but not limited to rituximab resistant NHL. The antibody combination may be administered to human subjects at specific dosages and dosing schedules, that are effective to treat the disease but do not induce a dose-limiting toxicity. | 05-05-2016 |
20160121001 | METHODS OF INDUCING RESPONSIVENESS TO ANTI-ANGIOGENIC AGENT - The invention provides methods of inducing or improving responsiveness to a VEGF antagonist to a subject or a subject population comprising administering an adenovirus comprising a nucleic acid construct comprising a FAS-chimera gene operably linked to an endothelial cell-specific promoter and administering the VEGF antagonist. | 05-05-2016 |
20160122374 | METHODS FOR TREATING FILOVIRIDAE VIRUS INFECTIONS - Provided are compounds, methods, and pharmaceutical compositions for treating Filoviridae virus infections by administering ribosides, riboside phosphates and prodrugs thereof, of Formula IV: | 05-05-2016 |
20160122390 | A BIOMIMETIC PEPTIDE AND BIODEGRADABLE DELIVERY PLATFORM FOR THE TREATMENT OF ANGIOGENESIS- AND LYMPHANGIOGENESIS-DEPENDENT DISEASES - Mimetic peptides having anti-angiogenic and anti-tumorigenic properties and methods of their use for treating cancer, ocular diseases, such as age-related macular degeneration, and other-angiogenesis-dependent diseases are disclosed. More particularly, an isolated peptide comprising the amino acid sequence LRRFSTAPFAFIDINDVINF, which exhibits anti-angiogenic activity in endothelial cell proliferation, migration, adhesion, and tube formation assays, anti-migratory activity in human breast cancer cells in vitro, anti-angiogenic and anti-tumorigenic activity in vivo in breast cancer xenograft models, and age-related macular degeneration models is disclosed. The isolate peptide also exhibits anti-lymphangiogenic and directly anti-tumorigenic properties. | 05-05-2016 |
20160122421 | METHODS OF TREATING A TAUOPATHY - The present disclosure provides methods of treating a tauopathy, involving administering an anti-Tau antibody. The present disclosure also provides anti-Tau antibodies, and formulations comprising same, for use in the methods. | 05-05-2016 |
20160122431 | B7-DC BINDING ANTIBODY - An antibody capable of potentiating immune responses and modifying existing states of immune responsiveness is described, as is the sequence of the antibody. Also described are compositions containing the antibody, as well as methods for using the antibody and the compositions to enhance immune responses, to enhance DC function, to modify an existing state of immune responsiveness, to immunize individuals, or to treat or inhibit conditions such as allergic asthma. | 05-05-2016 |
20160123964 | METHODS FOR STRATIFYING NON-RESPONDERS TO THERAPIES THAT BLOCK PD1/PDL1 AXIS - A method of analyzing a biological sample from a subject that has a tumor or cancer, comprising: determining, for target cells having a phenotype of interest spatial resolution of the target cells, density of the spatially resolved target cells in the sample; and proximity between spatially resolved target cells of interest in the sample; and determining an overall score based at least in part on the preceding parameters. A method for identifying a patient as a responder to single agent anti-PD-1 or anti-PD-L1 therapy is provided. Similar methods are provided for detecting adaptive immune resistance, the presence of cancer in a patient sample, determining efficacy of cancer therapy, and determining response to and monitoring the efficacy of cancer therapy. | 05-05-2016 |
20160128974 | ANTI-CXCR4 AS A SENSITIZER TO CANCER THERAPEUTICS - Inhibition of CXCR4 can inhibit tumor growth and metastasis during certain therapeutic windows. Disclosed are novel methods for treating and preventing cancer in a subject related to administration of CXCR4 inhibitors during a therapeutic window following treatment with another anti-tumor therapy. | 05-12-2016 |
20160130275 | PYRAZOLO[1,5-A]PYRIMIDINES FOR ANTIVIRAL TREATMENT - The invention provides compounds of Formula I or Formula II: | 05-12-2016 |
20160130330 | MAMMALIAN RECEPTORS AS TARGETS FOR ANTIBODY AND ACTIVE VACCINATION THERAPY AGAINST MOLD INFECTIONS - The present invention provides therapeutic compositions and methods for treating and preventing fungal disease or conditions including mucormycosis. The therapeutic methods and compositions of the invention include antibody, antibody fragments, siRNA and vaccine compositions having or directed against a GRP78 polypeptide or an antigenic fragment of the polypeptide. | 05-12-2016 |
20160130341 | ANTIBODIES TO HUMAN RESISTIN - The present invention relates to the field of pulmonary, cardiac and inflammatory disorders. More specifically, the present invention provides methods and compositions for treating disorders associated with Resistin. In a specific embodiment, the present invention provides an antibody that binds human Resistin. | 05-12-2016 |
20160130349 | MODIFIED ANTIBODIES AND RELATED COMPOUNDS, COMPOSITIONS, AND METHODS OF USE - Provided herein are modified antibodies, compounds used to make them, and intermediates in their synthesis; compositions; formulations and methods, including methods of treating diseases, disorders or conditions, for example, cancer, in humans. | 05-12-2016 |
20160130350 | ANTI-CXCL9, ANTI-CXCL10, ANTI-CXCL11, ANTI-CXCL13, ANTI-CXCR3 AND ANTI-CXCR5 AGENTS FOR INHIBITION OF INFLAMMATION - Methods for preventing or inhibiting inflammation in a subject are disclosed. In one aspect, the method comprises administering to a subject diagnosed with an inflammatory disease an effective amount of an anti-inflammatory agent that (1) inhibits the expression of CXCL9, CXCL10, CXCL11, CXCL13, CXCR3 and/or CXCR5, or (2) inhibits the interaction between CXCR3 and CXCL9, CXCL10 or CXCL11, or between CXCR5 and CXCL13, or (3) inhibits a biological activity of CXCL9, CXCL10, CXCL11, CXCL13, CXCR3 and/or CXCR5, wherein the agent comprises an antibody, antibody fragment, short interfering RNA (siRNA), aptamer, synbody, binding agent, peptide, aptamer-siRNA chimera, single stranded antisense oligonucleotide, triplex forming oligonucleotide, ribozyme, external guide sequence, or an agent-encoding expression vector. | 05-12-2016 |
20160130360 | HER2/neu-Specific Antibodies and Methods of Using Same - This invention relates to antibodies that specifically bind HER2/neu, and particularly chimeric 4D5 antibodies to HER2/neu, which have reduced glycosylation as compared to known 4D5 antibodies. The invention also relates to methods of using the 4D5 antibodies and compositions comprising them in the diagnosis, prognosis and therapy of diseases such as cancer, autoimmune diseases, inflammatory disorders, and infectious disease. | 05-12-2016 |
20160130365 | Methods and compositions for prognosis, diagnosis, and treatment of ADAM8-expressing cancer - The transmembrane metalloproteinase-disintegrin ADAM8 mediates cell adhesion and shedding of ligands, receptors, and extracellular matrix components. ADAM8 is abundantly expressed in breast tumors and derived metastases compared to normal tissue, especially in triple-negative breast cancers (TNBCs). High ADAM8 levels predicted poor patient outcome, and ADAM8 promoted an aggressive phenotype of TNBC cells in culture. Tumors derived from TNBC cells with ADAM8 knockdown failed to grow beyond a palpable size and displayed poor vascularization. Circulating tumor cells and brain metastases were also significantly reduced. ADAM8 stimulated angiogenesis through release of VEGF-A and cell migration through β1-integrin activation. Treatment with anti-ADAM8 antibody in vivo resulted in reduced primary tumor burden and reduced metastases. Furthermore, antibody treatment of established tumors profoundly decreased metastases in a resection model. ADAM8 represents a promising novel target for treatment of TNBCs, which currently lack targeted therapies and frequently progress with fatal dissemination. | 05-12-2016 |
20160136273 | COMPOSITIONS INCLUDING TRICIRIBINE AND TRASTUZUMAB AND METHODS OF USE THEREOF - This application relates to combination therapies including triciribine and related compounds and trastuzumab or a salt thereof and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 05-19-2016 |
20160137652 | IMMUNOREGULATORY AGENTS - Compounds that modulate the oxidoreductase enzyme indoleamine 2,3-dioxygenase, and compositions containing the compounds, are described herein. The use of such compounds and compositions for the treatment and/or prevention of a diverse array of diseases, disorders and conditions, including cancer- and immune-related disorders, that are mediated by indoleamine 2,3-dioxygenase is also provided. | 05-19-2016 |
20160137653 | IMMUNOREGULATORY AGENTS - Compounds that modulate the oxidoreductase enzyme indoleamine 2,3-dioxygenase, and compositions containing the compounds, are described herein. The use of such compounds and compositions for the treatment and/or prevention of a diverse array of diseases, disorders and conditions, including cancer- and immune-related disorders, that are mediated by indoleamine 2,3-dioxygenase is also provided. | 05-19-2016 |
20160137722 | HUMANIZED MONOCLONAL ANTIBODIES THAT SPECIFICALLY BIND AND/OR NEUTRALIZE JAPANESE ENCEPHALITIS VIRUS (JEV) AND THEIR USE - Disclosed herein are isolated humanized monoclonal antibodies that specifically bind Japanese encephalitis virus (JEV) with a binding affinity of about 1.0 nM or less. Nucleic acids encoding these antibodies, expression vectors including these nucleic acid molecules, and isolated host cells that express the nucleic acid molecules are also disclosed. Methods of treating, preventing, and/or ameliorating JEV infection in a subject with JEV also are disclosed. Additionally, the antibodies can be used to detect JEV in a sample, and methods of diagnosing JEV infection, or confirming a diagnosis of JEV infection in a subject, are disclosed herein that utilize these antibodies. | 05-19-2016 |
20160137727 | ANTIBODY FORMULATIONS - The invention provides stable aqueous pharmaceutical formulations comprising a therapeutic antibody, trehalose, a buffer, and optional surfactant, and having a pH in the range of about 5.5 to about 7.0. The invention also provides methods for making such formulations and methods of using such formulations. | 05-19-2016 |
20160137729 | ANTI CD37 ANTIBODIES - Chimeric and humanized anti-CD37 antibodies and pharmaceutical compositions containing them are useful for the treatment of B cell malignancies and autoimmune and inflammatory diseases that involve B cells in their pathology. | 05-19-2016 |
20160137731 | HUMAN ANTI-PD-1, PD-L1, AND PD-L2 ANTIBODIES AND USES THEREFOR - The present invention is based, in part, on the identification of novel human anti-PD-1, PD-L1, and PD-L2 antibodies. Accordingly, the invention relates to compositions and methods for diagnosing, prognosing, and treating conditions that would benefit from modulating PD-1, PD-L1, and/or PD-L2 activity (e.g., persistent infectious diseases, autoimmune diseases, asthma, transplant rejection, inflammatory disorders and tumors) using the novel human anti-PD-1, PD-L1, and PD-L2 antibodies described herein. | 05-19-2016 |
20160137733 | THERAPEUTIC CD47 ANTIBODIES - Provided are monoclonal antibodies and antigen-binding fragments thereof that bind to, and inhibit the activity of, CD47, as well as monoclonal antibodies and antigen binding fragments thereof that compete with the former for binding to CD47. Also provided are combinations of any of the foregoing. Such antibody compounds are variously effective in 1) treating tissue ischemia and ischemia-reperfusion injury (IRI) in the setting of organ preservation and transplantation, pulmonary hypertension, sickle cell disease, myocardial infarction, stroke, and other instances of surgery and/or trauma in which IRI is a component of pathogenesis; 2) in treating autoimmune and inflammatory diseases; and 3) as anti-cancer agents that are toxic to susceptible cancer cells, promoting their phagocytic uptake and clearance, or directly killing such cells. | 05-19-2016 |
20160137734 | THERAPEUTIC CD47 ANTIBODIES - Provided are monoclonal antibodies and antigen-binding fragments thereof that bind to, and inhibit the activity of, CD47, as well as monoclonal antibodies and antigen binding fragments thereof that compete with the former for binding to CD47. Also provided are combinations of any of the foregoing. Such antibody compounds are variously effective in 1) treating tissue ischemia and ischemia-reperfusion injury (IRI) in the setting of organ preservation and transplantation, pulmonary hypertension, sickle cell disease, myocardial infarction, stroke, and other instances of surgery and/or trauma in which IRI is a component of pathogenesis; 2) in treating autoimmune and inflammatory diseases; and 3) as anti-cancer agents that are toxic to susceptible cancer cells, promoting their phagocytic uptake and clearance, or directly killing such cells. | 05-19-2016 |
20160137735 | METHOD OF TREATING MULTIPLE MYELOMA USING COMBINATION THERAPIES BASED ON ANTI-CS1 ANTIBODIES - Compositions and methods for treating MM are provided herein. | 05-19-2016 |
20160137737 | INTEGRIN ALPHA-V BETA8 NEUTRALIZING ANTIBODY - The present invention relates to αvβ8 antagonists, anti-αvβ8 antibodies or immunoconjugates for reducing TGFβ activation in an individual. Further provided are compositions comprising one of the αvβ8 antagonists, anti-αvβ8 antibodies or immunoconjugates, methods for using the compositions, and related subject matter. | 05-19-2016 |
20160137740 | HUMANIZED ANTI-OX40 ANTIBODIES AND USES THEREOF - The disclosure provides humanized anti-OX40 antibodies. Also provided are methods of making such antibodies, and methods of use, e.g., treatment of cancer. | 05-19-2016 |
20160137742 | HIGHLY CONCENTRATED PHARMACEUTICAL FORMULATIONS - The present invention relates to a highly concentrated, stable pharmaceutical formulation of a pharmaceutically active anti-CD20 antibody, such as e.g. Rituximab, Ocrelizumab, or HuMab, or a mixture of such antibody molecules for subcutaneous injection. In particular, the present invention relates to formulations comprising, in addition to a suitable amount of the anti-CD20 antibody, an effective amount of at least one hyaluronidase enzyme as a combined formulation or for use in form of a co-formulation. The said formulations comprise additionally at least one buffering agent, such as e.g. a histidine buffer, a stabilizer or a mixture of two or more stabilizers (e.g. a saccharide, such as e.g. α,α-trehalose dihydrate or sucrose, and optionally methionine as a second stabilizer), a nonionic surfactant and an effective amount of at least one hyaluronidase enzyme. Methods for preparing such formulations and their uses thereof are also provided. | 05-19-2016 |
20160137747 | Antibodies Against Human CD39 and Use Thereof for Inhibiting T Regulatory Cells Activity - The invention relates to antibodies against human CD39 and use thereof for inhibiting T regulatory cells (Treg) activity. More particularly CD39 antibodies may be used for the treatment or prevention of cancers and infectious diseases. | 05-19-2016 |
20160138111 | METHODS AND DEVICES FOR PREDICTING TREATMENT EFFICACY OF FULVESTRANT IN CANCER PATIENTS - The present invention features methods, devices, and kits for predicting the sensitivity of a patient to a compound or medical treatment, such as fulvestrant. | 05-19-2016 |
20160139128 | METHODS AND MATERIALS FOR TREATING RENAL CELL CARCINOMA - This document provides methods and materials related to treating renal cell carcinoma. For example, methods and materials for assessing a cancer patient (e.g., a renal cell carcinoma patient) for tumor or peritumoral tissue containing CD14 | 05-19-2016 |
20160140298 | RISK EVALUATION AND MANAGEMENT STRATEGY INVOLVING PATIENT FOLLOW-UPS RELATING TO THE USE OR DISCONTINUATION OF A COMPLEMENT INHIBITOR - This invention provides, inter alia, a complement-inhibitor-based treatment plan coupled with a risk evaluation and management strategy (“REMS”) and a safety support program (“SSP”) for reinforcing the REMS. The REMS and SPP are implemented using one or more computer devices with software tools programmed to enforce conditions of the REMS and/or prompt follow-ups by registered nurses enrolled in the SSP. The software tool(s) determines whether a prescriber requesting the complement inhibitor has agreed to abide by the REMS, and can prompt a provider of the complement inhibitor to provide updated educational materials to the prescriber at predetermined times or intervals, to monitor the prescriber for compliance with the REMS, and/or to monitor patients for signs of adverse events. Using exemplary embodiments described herein, a risk of adverse events (especially, but not limited to, meningococcal infections) can be managed and an incidence of the adverse events can be reduced. | 05-19-2016 |
20160143866 | Combination Therapy for Administration of Monoclonal Antibodies - A combination therapy is disclosed for the treatment of a patient, such as a human, with a monoclonal antibody. The methods can include administering to a patient a monoclonal antibody, for example, a TNT-alpha inhibitor such as adalimumab, certolizumab pegol, golimumab, and infliximab; and administering to the patient colchicine. The present teachings also provide a therapeutic combination and a kit including the therapeutic combination. | 05-26-2016 |
20160143970 | NOVEL FORMULATIONS OF BOTANICAL EXTRACTS FOR CANCER THERAPY - Novel formulations are disclosed of a therapeutically effrective composition comprising two or more of an extract of | 05-26-2016 |
20160144029 | Anti-ErbB3 Antibodies and Uses Thereof - The present invention provides antibodies that bind to ErbB3 and methods of using same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human ErbB3. In certain embodiments, the antibodies of the present invention block the interaction of ErbB3 with an ErbB3 ligand such as neuregulin 1. The antibodies of the invention are useful for the treatment of various cancers. | 05-26-2016 |
20160145248 | NOVEL SUBSTITUTED BICYCLIC COMPOUNDS AS BROMODOMAIN INHIBITORS - The invention relates to substituted bicyclic compounds, which are useful for inhibition of BET protein function by binding to bromodomains, pharmaceutical compositions comprising these compounds, and use of the compounds and compositions in therapy. | 05-26-2016 |
20160145335 | HUMANIZED ANTI-CD19 ANTIBODIES AND THEIR USE IN TREATMENT OF ONCOLOGY, TRANSPLANTATION AND AUTOIMMUNE DISEASE - The present invention provides chimeric and humanized versions of anti-CD19 mouse monoclonal antibodies. The invention further relates to pharmaceutical compositions, immunotherapeutic compositions, and methods using therapeutic antibodies that bind to the human CD19 antigen and that may mediate ADCC, CDC, and/or apoptosis for the treatment of B cell diseases and disorders, such as, but not limited to, B cell malignancies, for the treatment and prevention of autoimmune disease, and for the treatment and prevention of graft-versus-host disease (GVHD), humoral rejection, and post-transplantation lymphoproliferative disorder in human transplant recipients. | 05-26-2016 |
20160145336 | EFFECTOR-DEFICIENT ANTI-CD32A ANTIBODIES - Effector-deficient anti-CD32a monoclonal antibodies are encompassed, as are method and uses for treating CD32a-mediated diseases and disorders, including, thrombocytopenia, allergy, hemostatic disorders, immune, inflammatory, and autoimmune disorders. | 05-26-2016 |
20160145625 | DNAZYME FOR SILENCING THE EXPRESSION OF EGFR - The invention provides DNAzymes which are capable to silence the expression of EGFR at allele-specific level. These allele-specific DNAzymes against EGFR T790M mutation will knockdown the expression of EGFR T790M mRNA while keeping EGFR wild-type mRNA intact. Hence, these allele-specific DNAzymes against EGFR T790M mutation may overcome T790M-derived TKI resistance accompanied with lower unwanted side effects on normal cells in lung cancer patients. | 05-26-2016 |
20160146822 | METHODS OF DEVELOPING A PROGNOSIS FOR PANCREATIC CANCER AND PREDICTING RESPONSIVENESS TO CANCER THERAPEUTICS - Methods of predicting responsiveness of a cancer in a subject to a cancer therapy including a VEGF targeting agent are provided herein. The methods include detecting the expression level of at least one biomarker selected from ANG-2, SDF-1 and VEGF-D in a sample from the subject and using the expression levels to determine whether the VEGF targeting agent will be effective to treat the cancer in the subject. The predictions may be used to develop treatment plans for the subjects. Methods of developing a prognosis for a subject with pancreatic cancer are also provided. These methods include determining the expression level of IGFBP-1, PDGF-AA and at least one of IL-6 or CRP in a sample from a subject with pancreatic cancer. | 05-26-2016 |
20160146824 | Diagnostic Assays and Kits for Detection of Folate Receptor 1 - The invention generally relates to antibodies that bind to human folate receptor 1 and diagnostic assays for folate receptor 1-based therapies. Methods of using the antibodies to monitor therapy are further provided. | 05-26-2016 |
20160151390 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF PROGRESSIVE MULTIFOCAL LEUKOENCEPHALOPATHY (PML) | 06-02-2016 |
20160151410 | CLEARANCE OF BIOACTIVE LIPIDS FROM MEMBRANE STRUCTURES BY CYCLODEXTRINS | 06-02-2016 |
20160151487 | FCRN-BINDING ABOLISHED ANTI-IGF-1R ANTIBODIES AND THEIR USE IN THE TREATMENT OF VASCULAR EYE DISEASES | 06-02-2016 |
20160151492 | Monoclonal Antibodies for Ebola and Marburg Viruses | 06-02-2016 |
20160152698 | ANTI-NGF ANTIBODIES AND METHODS USING SAME | 06-02-2016 |
20160152709 | COMPOSITIONS AND METHODS FOR TREATMENT OF STROKE | 06-02-2016 |
20160152710 | MILK FAT GLOBULE EPIDERMAL GROWTH FACTOR 8 REGULATES FATTY ACID UPTAKE | 06-02-2016 |
20160152712 | COMPOSITIONS AND METHODS FOR TREATING CANCER RESISTANT TO A TYROSINE KINASE INHIBITOR (TKI) | 06-02-2016 |
20160152714 | SUBTYPES OF HUMANIZED ANTIBODY AGAINST INTERLEUKIN-6 RECEPTOR | 06-02-2016 |
20160152717 | METHODS FOR TREATING DRY EYE DISEASE BY ADMINISTERING AN IL-6R ANTAGONIST | 06-02-2016 |
20160152720 | COMBINATION THERAPY COMPRISING OX40 BINDING AGONISTS AND TIGIT INHIBITORS | 06-02-2016 |
20160152721 | SILENT Fc VARIANTS OF ANTI-CD40 ANTIBODIES | 06-02-2016 |
20160152727 | METHOD FOR INHIBITING CELL GROWTH USING ANTI-ERBB-3 ANTIBODIES | 06-02-2016 |
20160152735 | COMPOSITIONS AND METHODS FOR BINDING LYSOPHOSPHATIDIC ACID | 06-02-2016 |
20160158192 | Combination Therapies for the Treatment of Alzheimer's Disease and Related Disorders - The present invention relates to combination therapies for treating Alzheimer's disease or an amyloidosis-associated pathological condition comprising co-administering a therapeutically effective amount of a first compound, and a therapeutically effective amount of a second compound. In certain embodiments, the first compound or the second compound inhibits AB peptide polymerization; is an anti-inflammatory; improves cognitive function, mood, or social behavior; is associated with Tau or alpha-synuclein; or regulates amyloid peptide washout. | 06-09-2016 |
20160158239 | CERTAIN CHEMICAL ENTITIES, COMPOSITIONS AND METHODS - Chemical entities that modulate PI3 kinase activity, pharmaceutical compositions containing the chemical entities, and methods of using these chemical entities for treating diseases and conditions associated with P13 kinase activity are described herein. | 06-09-2016 |
20160158348 | Adjuvant Combinations of NKT Activator, CD40 Agent, CD40 Agonist, and Optional Antigen, the Use Through Inducing Synergistic Cellular Immunity - Adjuvant combinations comprising at least one NKT activator, such as alpha-galactosylceramide (α-Gal-Cer) or iGb3, a CD40 agonist and optionally an antigen are disclosed. The use of these immune adjuvants for treatment of various chronic diseases such as cancers is also provided. | 06-09-2016 |
20160158355 | IMMUNOPOTENTIATIVE COMPOSITION - Compositions for cancer or infection treatment via immunopotentiation caused by inhibition of immunosuppressive signal induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient, screening methods of the substrates for cancer or infection treatment, cell lines used for the screening methods, evaluation methods that selects the substrates for cancer treatment, and carcinoma cell transplanted mammals used for the evaluation methods. | 06-09-2016 |
20160158356 | IMMUNOPOTENTIATIVE COMPOSITION - Compositions for cancer or infection treatment via immunopotentiation caused by inhibition of immunosuppressive signal induced by PD-1, PD-L1, or PD-L2 and therapies using them, immunopotentiative substrates included as the active ingredient, screening methods of the substrates for cancer or infection treatment, cell lines used for the screening methods, evaluation methods that selects the substrates for cancer treatment, and carcinoma cell transplanted mammals used for the evaluation methods. | 06-09-2016 |
20160158358 | ANTIBODIES FOR EPIDERMAL GROWTH FACTOR RECEPTOR 3 (HER3) - This invention relates to antibodies or fragments thereof which interact with HER family of receptors, e.g., HER3 receptor. In particular, it relates to antibodies or fragments thereof that recognize a conformational epitope of HER3 receptor comprising residues from both domains 2 and 4 resulting in inhibition of both ligand-dependent and ligand-independent signal transduction; and allow ligand binding (e.g., neuregulin), whilst preventing ligand-induced activation of signal transduction. These antibodies or fragments can be used to treat a number of diseases or disorders characterized by increased levels of HER3 expression (e.g., esophageal cancer). These antibodies or fragments can be used to treat a number of diseases or disorders characterized by the antibodys or fragments ability to decrease tissue weight (e.g., prostate or uterine weights) or to induce atrophy of tissue (e.g., atrophy of male breast). | 06-09-2016 |
20160158380 | Anti-Claudin 1 Antibodies for Use in the Treatment of Colorectal Cancer - The present invention relates to anti-claudin 1 antibodies for use in the treatment of colorectal cancer. In particular, the present invention relates to a method of treating a colorectal cancer in a subject in need thereof comprising administering the subject with a therapeutically effective amount of an anti-claudin 1 (CLDN1) antibody. | 06-09-2016 |
20160159731 | Bifunctional AKR1C3 Inhibitors/Androgen Receptor Modulators and Methods of Use Thereof - The invention includes compositions comprising selective AKR1C3 inhibitors. The invention also includes compositions comprising bifunctional AKR1C3 inhibitors and selective androgen receptor modulators. The invention further includes methods of treatment using the compositions of the invention. | 06-09-2016 |
20160159797 | PYRAZOLO[3,4-c]PYRIDINE COMPOUNDS AND METHODS OF USE - Pyrazolo[3,4-c]pyridine compounds of Formula I, including stereoisomers, geometric isomers, tautomers, and pharmaceutically acceptable salts thereof, wherein R | 06-09-2016 |
20160159886 | STABILIZED LIQUID ANTI-RSV ANTIBODY FORMULATIONS - The present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof that immunospecifically bind to a respiratory syncytial virus (RSV) antigen, which formulation exhibit stability, low to undetectable levels of aggregation, and very little to no loss of the biological activities of SYNAGIS® or an antigen-binding fragment thereof, even during long periods of storage. In particular, the present invention provides liquid formulations of SYNAGIS® or an antigen-binding fragment thereof which immunospecifically binds to a RSV antigen, which formulation are substantially free of surfactant, inorganic salts, and/or other common excipients Furthermore, the invention provides method of preventing, treating or ameliorating symptoms associated with RSV infection utilizing liquid formulations of the present invention. | 06-09-2016 |
20160159897 | LOW MANNOSE ADALIMUMAB COMPOSITIONS AND USES THEREOF - The present invention relates to the field of protein production, and in particular to methods and compositions for modulating glycosylation of recombinant proteins expressed in host cells by supplementing the production media with dissolved oxygen. | 06-09-2016 |
20160159904 | CANCER STEM CELL-SPECIFIC MOLECULE - An objective of the present invention is to obtain two types of substantively homogeneous cancer stem cell populations which can be characterized using the cell surface marker Lgr5, and to provide cancer therapeutics using an antibody against a cell membrane molecule specifically expressed in these cancer stem cells by identifying said cell membrane molecule. A further objective is to provide, using an antibody against a cell membrane molecule specifically expressed in cancer stem cells, a reagent for detecting cancer stem cells, and a method for diagnosing and sorting cancer patients. The present inventors discovered that highly pure large intestine cancer stem cells (CSC) can be obtained in a large quantity, and identified the two types of conditions of large intestine CSCs distinguishable through Lgr5 expression. Moreover, the present inventors discovered that an antibody against a cell membrane molecule specifically expressed in said cancer stem cells can damage said cells. | 06-09-2016 |
20160159911 | ANTI-cMET ANTIBODY - Antibody capable of binding specifically to the human c-Met receptor and/or capable of specifically inhibiting the tyrosine kinase activity of said receptor, with an improved antagonistic activity, said antibody comprising a modified hinge region. A composition comprising such an antibody antagonist to c-Met and its use as a medicament for treating cancer. | 06-09-2016 |
20160159912 | COMBINATION THERAPY OF ANTI-HER3 ANTIBODIES - The present invention relates to the combination therapy of anti-HER3 antibodies with certain anti-HER antibodies. | 06-09-2016 |
20160159914 | IL-17 RECEPTOR A IS REQUIRED FOR IL-17C BIOLOGY - The present invention relates to Interleukin-17 ligand and receptor family members and the discovery that IL-17 receptor A and IL-17 receptor E form a heteromeric receptor complex that is biologically active, and that IL-17C activity requires the IL-17RA-IL-17RE heteromeric receptor complex. Antagonists of the IL-17RA-IL-17RE heteromeric receptor complex are disclosed, as well as various methods of use. | 06-09-2016 |
20160159916 | METHOD OF TREATING DIABETES, AND DISEASES ASSOCIATED WITH IMPAIRED GLUCOSE TOLERANCE - The present application provides a method of treating diabetes mellitus, impaired glucose tolerance and obesity associated with diabetes mellitus or impaired glucose tolerance, the method comprising administering to a subject in need thereof a homeopathically potentized form of at least one antibody to the beta-subunit of the insulin receptor. | 06-09-2016 |
20160159918 | METHODS FOR DIAGNOSING AND TREATING IMMUNE DISEASE - Provided are methods and assays relating to the treatment of an immune disease or disorder by administering an inhibitor that binds SLAMF7. Also provided are methods and assays related to the diagnosis of an immune disease or disorder by measuring expression level of SLAMF7 in a biological sample obtained from a subject. | 06-09-2016 |
20160159921 | ANTIBODIES WITH ENHANCED OR SUPPRESSED EFFECTOR FUNCTION - Rationally designed antibodies and polypeptides that comprise multiple Fc region amino acid substitutions that synergistically provide enhanced selectivity and binding affinity to a target Fc receptor are provided. The polypeptides are mutated at multiple positions to make them more effective when incorporated in antibody therapeutics than those having wild-type Fc components. | 06-09-2016 |
20160159923 | ANTIBODIES TO MATRIX METALLOPROTEINASE 9 - The present disclosure provides compositions and methods of use involving binding proteins, e.g., antibodies and antigen-binding fragments thereof, that bind to the matrix metalloproteinase-9 (MMP9) protein (MMP9 is also known as gelatinase-B), wherein the binding proteins comprise an immunoglobulin (Ig) heavy chain (or functional fragment thereof) and an Ig light chain (or functional fragment thereof). | 06-09-2016 |
20160160290 | METHODS AND BIOMARKERS FOR PREDICTING EFFICACY AND EVALUATION OF AN OX40 AGONIST TREATMENT - The present disclosure provides methods for predicting responsiveness of a subject having cancer to an OX40 agonist treatment by measuring the expression level of one or more biomarkers. Also provided are methods for monitoring pharmacodynamic activity of or responsiveness to an OX40 agonist treatment by measuring the expression level of one or more biomarkers. Further provided are methods related thereto for treating or delaying progression of cancer in a subject by administering an effective amount of an OX40 agonist to a subject. Specific biomarkers for all such methods are described herein. | 06-09-2016 |
20160161485 | ASSAYS FOR DETECTING T CELL IMMUNE SUBSETS AND METHODS OF USE THEREOF - The present disclosure provides methods for measuring the number of CD4+ OX40+ Foxp3+ lymphocytes in a sample containing cancer cells and lymphocytes obtained from a subject by labeling lymphocytes that show CD4 expression in the sample, then labeling lymphocytes that show OX40 expression in the sample, then labeling lymphocytes that show Foxp3 expression in the sample, then measuring the number of CD4+ OX40+ Foxp3+ lymphocytes in the sample. Further provided are methods for determining the prognosis of a subject, predicting responsiveness of a subject having cancer to an OX40 agonist treatment, and methods for treating or delaying progression of cancer based on the number of CD4+ OX40+ Foxp3+ lymphocytes in a sample. | 06-09-2016 |
20160166571 | COMBINATION THERAPIES FOR TREATMENT OF CANCER | 06-16-2016 |
20160166685 | COMBINATION THERAPY COMPRISING OX40 BINDING AGONISTS AND PD-1 AXIS BINDING ANTAGONISTS | 06-16-2016 |
20160166688 | COMBINATION THERAPY OF AN AFUCOSYLATED CD20 ANTIBODY WITH BENDAMUSTINE | 06-16-2016 |
20160166689 | Subcutaneous anti-HER2 Antibody Formulations and Uses Thereof | 06-16-2016 |
20160168207 | RESPIRATORY SYNCYTIAL VIRUS (RSV) VACCINE | 06-16-2016 |
20160168234 | HUMANIZED ANTIBODY IGG1 | 06-16-2016 |
20160168237 | METHOD FOR TREATING A COMPLEMENT MEDIATED DISORDER CAUSED BY AN INFECTIOUS AGENT IN A PATIENT | 06-16-2016 |
20160168238 | HUMANIZED, ANTI-N2 ANTIBODIES AND METHODS OF TREATING ISCHEMIA-REPERFUSION INJURY | 06-16-2016 |
20160168239 | Combination Therapies for the Treatment of Alzheimer's Disease and Related Disorders | 06-16-2016 |
20160168240 | USE OF VEGF ANTAGONIST IN TREATING CHORIORETINAL NEOVASCULAR AND PERMEABILITY DISORDERS IN PAEDIATRIC PATIENTS | 06-16-2016 |
20160168244 | ANTAGONIST ANTIBODIES DIRECTED AGAINST CALCITONIN GENE-RELATED PEPTIDE AND METHODS USING SAME | 06-16-2016 |
20160168252 | ANTIBODIES, COMPOUNDS AND DERIVATIVES THEREOF FOR USE IN THE TREATMENT OF MALE INFERTILITY | 06-16-2016 |
20160168266 | MEDICAMENT COMPRISING ANTI-PHOSPHOLIPASE D4 ANTIBODY | 06-16-2016 |
20160168270 | PREVENTION AND TREATMENT OF PAIN USING ANTIBODIES TO LYSOPHOSPHATIDIC ACID | 06-16-2016 |
20160169918 | Methods of Diagnosis and Treatment for Pulmonary Arterial Hypertension | 06-16-2016 |
20160175312 | Use of Inhibitors of Bruton's Tyrosine Kinase (BTK) | 06-23-2016 |
20160175434 | METHODS OF TREATING PRE-ECLAMPSIA OR ECLAMPSIA | 06-23-2016 |
20160175435 | TREATMENT OF PEMPHIGUS | 06-23-2016 |
20160175438 | USES FOR AND ARTICLE OF MANUFACTURE INCLUDING HER2 DIMERIZATION INHIBITOR PERTUZUMAB | 06-23-2016 |
20160176894 | TAXANE AND ABEO-TAXANE ANALOGS | 06-23-2016 |
20160176950 | Polypeptides With Enhanced Anti-Inflammatory And Decreased Cytotoxic Properties And Relating Methods | 06-23-2016 |
20160176953 | Human Antibodies to Influenza Hemagglutinin | 06-23-2016 |
20160176964 | SITE-SPECIFIC ANTIBODY CONJUGATION METHODS AND COMPOSITIONS | 06-23-2016 |
20160176972 | Prion Protein as a Receptor for Amyloid-Beta Oligomers | 06-23-2016 |
20160176974 | METHOD FOR TREATING JOINT DAMAGE | 06-23-2016 |
20160176984 | CYTOTOXIC IMMUNOGLOBULIN | 06-23-2016 |
20160176985 | HUMANIZED MONOCLONAL ANTIBODIES AND METHODS OF USE | 06-23-2016 |
20160177298 | CHANNEL MODULATORS | 06-23-2016 |
20160184428 | TREATMENT OF MULTIPLE SCLEROSIS BY ALEMTUZUMAB INDUCTION FOLLOWED BY LAQUINIMOD THERAPY - This invention provides a method of treating a subject afflicted with multiple sclerosis (MS) or presenting clinically isolated syndrome (CIS) which comprises a) administering to the subject an amount of an anti-CD52 antibody, followed by b) periodically administering to the subject an amount of laquinimod. This invention also provides packages comprising pharmaceutical compositions of laquinimod or an anti-CD52 antibody for treating such a subject wherein laquinimod is to be administered as a maintenance therapy in such a subject who has received an anti-CD52 antibody induction therapy. | 06-30-2016 |
20160185842 | 14-3-3 Antagonists for the Prevention and Treatment of Arthritis - The invention provides compositions and methods for treating arthritis. | 06-30-2016 |
20160185848 | METHODS FOR MODULATING THE GLYCOSYLATION PROFILE OF RECOMBINANT PROTEINS USING SUGARS - The present invention relates to the field of protein production, and in particular to methods and compositions for modulating glycosylation of recombinant proteins expressed in host cells. | 06-30-2016 |
20160185852 | ANTI-NOTCH3 ANTIBODIES - Monoclonal antibodies that bind and inhibit activation of human Notch3 are disclosed. The antibodies can be used to treat cell proliferative diseases and disorders, including certain forms of cancer, associated with activation of Notch3. | 06-30-2016 |
20160185854 | AGENTS TARGETING CD138 AND USES THEREOF - Disclosed is a human murine chimeric antibody which substantially retains the antigen binding region of its murine counterpart and displays improved binding affinities to the antigen and/or more homogenous binding to target cells. | 06-30-2016 |
20160185857 | NOVEL ANTI-FC-GAMMA RECEPTOR IIB ANTIBODIES AND USES THEREOF - The present invention provides an anti-FcyRIIB antibodies which, in comparison to prior art antibodies, markedly increase ITIM phosphorylation of FcyRIIB and can thus be used for the treatment or prophylaxis of autoimmune diseases. | 06-30-2016 |
20160185858 | Humanized Antibodies To LIV-1 And Use Of Same To Treat Cancer - The invention provides humanized antibodies that specifically bind to LIV-1. The antibodies are useful for treatment and diagnoses of various cancers as well as detecting LIV-1. | 06-30-2016 |
20160185864 | METHODS OF TREATING FGFR3 RELATED CONDITIONS - Provided herein are biomarkers and therapies for the treatment of pathological conditions, such as cancer, and method of using FGFR3 antagonists. In particular, provided is FGFR3 as a biomarker for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto. | 06-30-2016 |
20160185868 | OSTEOARTHRITIS TREATMENT - The present invention relates generally to a method for the treatment and/or prophylaxis of osteoarthritis (OA). In accordance with the present invention, an antagonist of GM-CSF can be effective in the treatment of osteoarthritis. An antagonist of GM-CSF includes, but is not limited to, an antibody that is specific for GM-CSF or the GM-CSF receptor. The present invention further provides transgenic animals, such as a GM-CSF knock-out mouse, useful for testing antagonists in certain disease models. | 06-30-2016 |
20160185870 | COMBINING CD27 AGONISTS AND IMMUNE CHECKPOINT INHIBITION FOR IMMUNE STIMULATION - The present invention relates to treatments of conditions ameliorated by stimulation of an immune response, in particular by the stimulation of antigen-specific T-lymphocytes. Treatment of such conditions according to the invention is effected by the combination of an anti-human CD27 agonistic antibody together with a number of immune checkpoint inhibitors. | 06-30-2016 |
20160185875 | ANTIBODY LOCKER FOR THE INACTIVATION OF PROTEIN DRUG - Disclosed herein is a hinge antibody capable of being selectively activated in a target cell or tissue to treat a condition therein. The hinge antibody includes a functional antibody, two inhibitory domains and four cleavable linkers. The functional antibody is capable of treating the condition in an activated state, and has two light chains and two heavy chains. Each inhibitory domain includes a hinge domain of an immunoglobulin and consists of two peptide arms. Each cleavable linker includes a peptide substrate cleavable by an enzyme specifically or highly expressed in the target cell or tissue, and connects one of the peptide arms of the inhibitory domains to the N-terminal of one of the light chains and heavy chains of the functional antibody. Also disclosed herein are methods for preparing and using this hinge antibody. | 06-30-2016 |
20160186228 | METHOD FOR THE PRODUCTION OF A GLYCOSYLATED IMMUNOGLOBULIN - Herein is reported a method for the production of an immunoglobulin comprising the following steps: a) providing a eukaryotic cell comprising a nucleic acid encoding the immunoglobulin, b) cultivating the eukaryotic cell in a cultivation medium wherein the amount of glucose available in the cultivation medium per time unit is kept constant and limited to less than 80% of the amount that could maximally be utilized by the cells in the cultivation medium per time unit, and c) recovering the immunoglobulin from the culture. | 06-30-2016 |
20160193161 | TREATMENT AND PREVENTION OF STROKE AND OTHER NEUROLOGICAL DISORDERS | 07-07-2016 |
20160193212 | CYCLOPROPYL MODULATORS OF P2Y12 RECEPTOR | 07-07-2016 |
20160193241 | ANTITUMOR AGENT AND ANTITUMOR EFFECT ENHANCER | 07-07-2016 |
20160193334 | TREATING CANCER WITH A COMBINATION OF A PD-1 ANTAGONIST AND DINACICLIB | 07-07-2016 |
20160194383 | ANTI-HUMAN RESPIRATORY SYNCYTIAL VIRUS (RSV) ANTIBODIES AND METHODS OF USE | 07-07-2016 |
20160194385 | An Antibody Therapy for Amyloid Beta Disease | 07-07-2016 |
20160194386 | COMPOSITIONS AND METHODS FOR TREATMENT OF HSCT-ASSOCIATED THROMBOTIC MICROANGIOPATHY | 07-07-2016 |
20160194387 | Methods Of Treating Inflammation Associated Airway Diseases And Viral Infections | 07-07-2016 |
20160194398 | Humanized Monoclonal Antibodies and Methods of Use for the Diagnosis and Treatment of Colon and Pancreas Cancer | 07-07-2016 |
20160194401 | THERAPEUTIC AGENT FOR CHRONIC ARTHRITIDES DISEASES OF CHILDHOOD-RELATED DISEASES | 07-07-2016 |
20160194709 | DIAGNOSTIC METHOD FOR PREDICTING RESPONSE TO TNFalpha INHIBITOR | 07-07-2016 |
20160194720 | DIFFERENTIAL GENE EXPRESSION IN PHYSIOLOGICAL AND PATHOLOGICAL ANGIOGENESIS | 07-07-2016 |
20160200805 | Complement Pathway Inhibitors Binding To C5 And C5a Without Preventing The Formation Of C5b | 07-14-2016 |
20160200807 | Anti-Myostatin Antibodies, Polypeptides Containing Variant Fc Regions, and Methods of Use | 07-14-2016 |
20160200817 | Methods Of Identifying Anti-Inflammatory Compounds | 07-14-2016 |
20160200818 | Methods of treating Sporadic Inclusion Body Myositis | 07-14-2016 |
20160200823 | BINDING PROTEINS, INCLUDING ANTIBODIES, ANTIBODY DERIVATIVES AND ANTIBODY FRAGMENTS, THAT SPECIFICALLY BIND CD154 AND USES THEREOF | 07-14-2016 |
20160200825 | CELLS PRODUCING FC-CONTAINING MOLECULES HAVING ALTERED GLYCOSYLATION PATTERNS AND METHODS AND USE THEREOF | 07-14-2016 |
20160200831 | Antibodies to Plasminogen Activator Inhibitor-1 (PAI-1) and Uses Thereof | 07-14-2016 |
20160250208 | TREATING ORGAN-SPECIFIC T CELL MEDIATED AUTOIMMUNE DISEASES | 09-01-2016 |
20160250329 | ANTIBODY COMPOSITION | 09-01-2016 |
20160251412 | RSV-SPECIFIC BINDING MOLECULE | 09-01-2016 |
20160251418 | ANTI-TRANSTHYRETIN ANTIBODIES | 09-01-2016 |
20160251421 | COMBINATION OF ANGIOPOIETIN-2 ANTAGONIST AND OF VEGF-A, KDR AND/OR FLT1 ANTAGONIST FOR TREATING CANCER | 09-01-2016 |
20160251428 | STABLE AND SOLUBLE ANTIBODIES INHIBITING TNF ALPHA | 09-01-2016 |
20160251433 | ANTI-C5 ANTIBODIES HAVING IMPROVED PHARMACOKINETICS | 09-01-2016 |
20160251435 | NON-PLATELET DEPLETING AND NON-RED BLOOD CELL DEPLETING CD47 ANTIBODIES AND METHODS OF USE THEREOF | 09-01-2016 |
20160252511 | METHODS FOR MONITORING CD4+ T-HELPER TYPE 1 RESPONSE IN CANCER AND IMMUNE RESTORATION | 09-01-2016 |
20160375019 | TREATMENT OF CHRONIC GRAFT VERSUS HOST DISEASE WITH SYK INHIBITORS - The present disclosure provides methods of utilizing Syk inhibiting compounds in the treatment for graft versus host disease (GVHD) in a human, including acute graft versus host disease (aGVHD) and chronic graft versus host disease (cGVHD), including the use of compounds selected from the group consisting of the formulas below: | 12-29-2016 |
20160375033 | METHODS OF TREATMENT WITH TASELISIB - Taselisib (GDC-0032) induces the degradation of mutant-p110 alpha protein. Methods for selecting patients with mutant PI3K tumors for treatment with taselisib are described. | 12-29-2016 |
20160375133 | METHODS FOR PRODUCING HIGH CONCENTRATION LYOPHILIZED PHARMACEUTICAL FORMULATIONS - The present invention relates to methods of producing lyophilized pharmaceutical compositions comprising a high concentration of therapeutic protein or antibody prior to lyophilization, wherein the lyophilized formulation can be reconstituted with a diluent in about 15 minutes or less. The invention also relates to the high concentration lyophilized formulations produced by the methods described herein. The lyophilized formulations produced by the methods of the invention are stable and are suitable for veterinary and human medical use and are suitable for modes of administration including oral, pulmonary and parenteral, such as intravenous, intramuscular, intraperitoneal, or subcutaneous injection. Also provided by the invention are high concentration pharmaceutical compositions that have long term stability and can be reconstituted, following lyophilization, in a short period of time, preferably 15 minutes or less. | 12-29-2016 |
20160376347 | ANTI-INFLUENZA ANTIBODY - The present invention relates to an antibody that confers protection against influenza virus infection. More specifically, it relates to an anti-neuraminidase antibody, protecting against highly pathogenic H5N1 influenza strains. The invention relates further to the use of the antibody for prophylactic and/or therapeutic treatment of influenzavirusinfections, and to a pharmaceutical composition comprising the antibody. | 12-29-2016 |
20160376351 | ANTI-TAU ANTIBODIES AND METHODS OF USE - The invention provides anti-Tau antibodies and methods of using the same. | 12-29-2016 |
20160376353 | HUMANIZED, ANTI-N2 ANTIBODIES - The present invention encompasses humanized antibodies that specifically bind N2 peptide, methods for the preparation thereof and methods for the use thereof. | 12-29-2016 |
20160376354 | HUMAN ISLET AMYLOID POLYPEPTIDE (HIAPP) SPECIFIC ANTIBODIES AND USES THEREOF - Provided are novel human islet amyloid polypeptide, also known as amylin and IAPP and proIAPP respectively, specific antibodies as well as fragments, derivatives and variants thereof as well as methods related thereto. Assays, kits, and solid supports related to antibodies specific for IAPP and/or proIAPP are also disclosed. The antibody, immunoglobulin chain(s), as well as binding fragments, derivatives and variants thereof can be used in pharmaceutical and diagnostic compositions for IAPP and/or proIAPP targeted immunotherapy and diagnostics, respectively. | 12-29-2016 |
20160376355 | TREATMENT OF PAROXYSMAL NOCTURNAL HEMOGLOBINURIA PATIENTS BY AN INHIBITOR OF COMPLEMENT - Eculizumab, a humanized monoclonal antibody against C5 that inhibits terminal complement activation, showed activity in a preliminary 12-week open-label trial in a small cohort of patients with paroxysmal nocturnal hemoglobinuria (PNH). The present study examined whether chronic eculizumab therapy could reduce intravascular hemolysis, stabilize hemoglobin levels, reduce transfusion requirements, and improve quality of life in a double-blind, randomized, placebo-controlled, multi-center global Phase III trial. It has been found that eculizumab stabilized hemoglobin levels, decreased the need for transfusions, and improved quality of life in PNH patients via reduced intravascular hemolysis. Chronic eculizumab treatment appears to be a safe and effective therapy for PNH. | 12-29-2016 |
20160376365 | TIGIT-BINDING AGENTS AND USES THEREOF - Agents that specifically bind TIGIT are disclosed. The TIGIT-binding agents may include polypeptides, antibodies, and/or bispecific agents. Also disclosed are methods of using the agents for enhancing the immune response and/or treatment of diseases such as cancer. | 12-29-2016 |
20160376368 | ANTIBODIES TO INTEGRIN AVB6 AND USE OF SAME TO TREAT CANCER - The invention provides antibodies that specifically bind to integrin ανβ6. The antibodies are useful for treatment and diagnoses of various cancers as well as detecting ανβ6. | 12-29-2016 |
20160376371 | ANTIBODIES TO CD40 WITH ENHANCED AGONIST ACTIVITY - Provided herein are agonistic antibodies, or antigen binding portions thereof, that bind to human CD40. Such antibodies optionally comprise Fc regions with enhanced specificity for FcγRIIb. The invention also provides methods of treatment of cancer or chronic infection by administering the antibodies of the invention to a subject in need thereof. | 12-29-2016 |
20160376372 | ANTI-CD20 ANTIBODIES AND METHODS OF USE - Compositions and methods are provided for treating diseases associated with CD20, including lymphomas, autoimmune diseases, and transplant rejections. Compositions include anti-CD20 antibodies capable of binding to a human CD20 antigen located on the surface of a human CD20-expressing cell, wherein the antibody has increased complement-dependent cell-mediated cytotoxicity (CDC) that is achieved by having at least one optimized CDR engineered within the variable region of the antibody. Compositions also include antigen-binding fragments, variants, and derivatives of the monoclonal antibodies, cell lines producing these antibody compositions, and isolated nucleic acid molecules encoding the amino acid sequences of the antibodies. The invention further includes pharmaceutical compositions comprising the anti-CD20 antibodies of the invention, or antigen-binding fragments, variants, or derivatives thereof, in a pharmaceutically acceptable carrier, and methods of use of these anti-CD20 antibodies. | 12-29-2016 |
20160376374 | ANTIBODIES TO CEACAM1 AND KINASE INHIBITORS FOR TREATING BRAF-MUTATED CELLS - Pharmaceutical compositions comprising anti-CEACAM1 antibodies and kinase inhibitors are provided as well as methods for their use in treating cancer. | 12-29-2016 |
20160376661 | A METHOD FOR PREDICTING RESPONSIVENESS TO A TREATMENT WITH AN EGFR INHIBITOR - The present invention relates to a method for predicting whether a patient with a cancer is likely to respond to an epidermal growth factor receptor (EGFR) inhibitor, which method comprises determining the expression level of at least one target gene of hsa-miR-31-3p (SEQ ID NO:1) miRNA in a sample of said patient, wherein said target gene of hsa-miR-31-3p is selected from DBNDD2 and EPB41 L4B. The invention also relates to kits for measuring the expression of DBNDD2 and/or EPB41 L4B and at least one other parameter positively or negatively correlated to response to EGFR inhibitors. The invention also relates to therapeutic uses of an EGFR inhibitor in a patient predicted to respond to said EGFR inhibitor. | 12-29-2016 |
20160377633 | BCL-2-LIKE PROTEIN 11 SRM/MRM ASSAY - Specific peptides, and derived ionization characteristics of those peptides, from the Bcl-2-like protein 11 (BIM) are provided that are particularly advantageous for quantifying the BIM protein directly in biological samples that have been fixed in formalin by the method of Selected Reaction Monitoring (SRM) mass spectrometry, or what can also be termed as Multiple Reaction Monitoring (MRM). Such biological samples are chemically preserved and fixed where the biological sample is selected from tissues and cells treated with formaldehyde containing agents/fixatives including formalin-fixed tissue/cells, formalin-fixed/paraffin embedded (FFPE) tissue/cells, FFPE tissue blocks and cells from those blocks, and tissue culture cells that have been formalin fixed and or paraffin embedded. A protein sample is prepared from the biological sample using the Liquid Tissue™ reagents and protocol, and the BIM protein is quantitated in the Liquid Tissue™ sample by the method of SRM/MRM mass spectrometry by quantitating in the protein sample at least one or more of the peptides described. These peptides can be quantitated if they reside in a modified or an unmodified form. An example of a modified form of a BIM peptide is phosphorylation of a tyrosine, threonine, serine, and/or other amino acid residues within the peptide sequence. | 12-29-2016 |
20170231999 | IDO INHIBITORS | 08-17-2017 |
20170232103 | EXCIPIENT COMPOUNDS FOR BIOPOLYMER FORMULATIONS | 08-17-2017 |
20170233395 | 2,4-DISUBSTITUTED 7H-PYRROLO[2,3-D]PYRIMIDINE DERIVATIVE, PREPARATION METHOD AND MEDICINAL USE THEREOF | 08-17-2017 |
20170233407 | TRICYCLIC P13K INHIBITOR COMPOUNDS AND METHODS OF USE | 08-17-2017 |
20170233460 | Anti-Dengue Virus NS1 Protein Monoclonal Antibodies | 08-17-2017 |
20170233462 | Antibody Against Secreted N-Terminal Peptide of GPC3 Present in Blood or C-Terminal Peptide of GPC3 | 08-17-2017 |
20170233464 | Use of TGF-Beta Antagonists to Treat Infants at Risk of Developing Bronchopulmonary Dysplasia | 08-17-2017 |
20170233466 | Methods for Treating or Preventing Atherosclerosis by Administering an Inhibitor of ANGPTL3 | 08-17-2017 |
20170233469 | PROPHYLAXIS OF COLORECTAL AND GASTROINTESTINAL CANCER | 08-17-2017 |
20170233470 | ANTI-NEUROTENSIN ANTIBODIES AND USES THEREOF | 08-17-2017 |
20170233481 | ANTI-CD25 ANTIBODIES AND THEIR USES | 08-17-2017 |
20170233482 | COMBINATION THERAPY | 08-17-2017 |
20170233483 | ANTI-CD40 ANTIBODIES AND METHODS OF USE | 08-17-2017 |
20170233484 | BCMA ANTIBODIES AND USE OF SAME TO TREAT CANCER AND IMMUNOLOGICAL DISORDERS | 08-17-2017 |
20170233493 | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation | 08-17-2017 |
20170233494 | Methods for Treating Disseminated Intravascular Coagulation by Inhibiting MASP-2 Dependent Complement Activation | 08-17-2017 |
20170233781 | METHODS FOR GENERATING ENGINEERED ENZYMES | 08-17-2017 |
20170233809 | METHODS FOR DIAGNOSING AND TREATING INFLAMMATORY BOWEL DISEASE | 08-17-2017 |
20170233817 | 16S RRNA SALIVA ANALYSIS UNVEILS MICROBIOME BIOMONITORS LINKED TO HUMAN PAPILLOMA VIRUS AND OROPHARYNGEAL SQUAMOUS CELL CARCINOMA | 08-17-2017 |
20180021270 | METHODS FOR THE TREATMENT OF CANCER USING COENZYME Q10 IN COMBINATION WITH IMMUNE CHECKPOINT MODULATORS | 01-25-2018 |
20180021276 | BEZAFIBRATE FOR THE TREATMENT OF CANCER | 01-25-2018 |
20180021429 | ANTICANCER AGENTS OR ANTIMETASTATIC AGENTS USING FSTL1 AND COMBINATION DRUG THEREOF | 01-25-2018 |
20180022799 | METHODS FOR ADMINISTERING ANTI-IL-5 ANTIBODIES | 01-25-2018 |
20180022800 | BIOMARKER | 01-25-2018 |
20180022802 | MONOCLONAL ANTIBODIES TO PROGASTRIN AND THEIR USES | 01-25-2018 |
20180022804 | HUMANIZED MONOCLONAL ANTIBODIES THAT TARGET VE-PTP (HPTP-Beta) | 01-25-2018 |
20180022806 | MARKERS OF ACUTE MYELOID LEUKEMIA STEM CELLS | 01-25-2018 |
20180022808 | ANTIBODY CONSTRUCT | 01-25-2018 |
20180022810 | USE OF CXCR3 INHIBITORS FOR PROTECTING AGAINST FETAL WASTAGE | 01-25-2018 |
20180022824 | COMPLEMENT INHIBITION FOR IMPROVED NERVE REGENERATION | 01-25-2018 |
20180022826 | ADOPTIVE T-CELL THERAPY USING EMPD-SPECIFIC CHIMERIC ANTIGEN RECEPTORS FOR TREATING IgE-MEDIATED ALLERGIC DISEASES | 01-25-2018 |
20180022828 | CHIMERIC ANTIGEN RECEPTORS WITH AN OPTIMIZED HINGE REGION | 01-25-2018 |
20190142722 | METHODS AND COMPOSITIONS FOR PROMOTING OR INDUCING HAIR GROWTH | 05-16-2019 |
20190142790 | ISOFLAVONOID COMPOUNDS AND METHODS FOR THE TREATMENT OF CANCER | 05-16-2019 |
20190142938 | TRIPLE COMBINATION THERAPY FOR TREATING INFLAMMATORY BOWEL DISEASE | 05-16-2019 |
20190144389 | DEUTERATED COMPOUNDS AS IMMUNOMODULATORS | 05-16-2019 |
20190144508 | RESPIRATORY SYNCYTIAL VIRUS (RSV) VACCINE | 05-16-2019 |
20190144527 | Monoclonal Antibodies that Neutralize Anthrax Protective Antigen (PA) Toxin | 05-16-2019 |
20190144529 | AFFINITY ENGINEERED SERUM PROTEIN CARRIER BINDING DOMAIN | 05-16-2019 |
20190144533 | POLYNUCLEOTIDES ENCODING IL-31 MONOCLONAL ANTIBODIES | 05-16-2019 |
20190144534 | ANTI-IL-23 ANTIBODIES | 05-16-2019 |
20190144548 | Depletion of Plasmacytoid Dendritic Cells | 05-16-2019 |
20190144555 | MONOVALENT INHIBITOR OF huTNFR1 INTERACTION | 05-16-2019 |
20190144564 | Antibodies to MASP-2 | 05-16-2019 |
20190144947 | Methods and Compositions for Classifying DLBCL | 05-16-2019 |
20220133746 | METHODS AND COMPOSITIONS RELATED TO GLUCOCORTICOID RECEPTOR ANTAGONISTS AND BREAST CANCER - Embodiments of the invention are directed to methods of determining the prognosis of a breast cancer patient by evaluating the activity of the glucocorticoid receptor in tumor cells. Other embodiment include methods of treating breast cancer cells, particularly, chemo-resistant cells, with a glucocorticoid receptor antagonist and an anticancer agent or compound. | 05-05-2022 |
20220133758 | TREATMENT OF INFLAMMATORY BOWEL DISEASES WITH 2'-FUCOSYLLACTOSE COMPOUNDS - Provided herein are 2′-fucosyllactose compounds and methods of using such for treating inflammatory bowel diseases (IBD) (e.g., Crohn's disease (CD) or ulcerative colitis (UC)) or alleviating or reducing the risk of relapse in IBD. | 05-05-2022 |
20220135661 | Monoclonal Antibodies Against Alpha-Synuclein Fibrils - The present disclosure provides monoclonal antibodies that bind α-Synuclein. In certain aspects, the antibodies preferentially bind to α-Synuclein fibrils over α-Synuclein monomer. In other aspects, the invention comprises a method of treating α-Synucleopathic disease in a subject, comprising administering any of the antibodies of the invention to the subject. In yet other aspects, the invention comprises methods of detecting α-Synuclein fibrils using any of the antibodies of the invention. | 05-05-2022 |
20220135671 | ANTI-SIRP ALPHA ANTIBODIES - The present invention relates to anti-SIRPα antibodies, as well as use of these antibodies in the treatment of diseases such as cancer and infectious disease. | 05-05-2022 |
20220135672 | ANTI-RABBIT CD19 ANTIBODIES AND METHODS OF USE - Herein is reported an antibody binding to rabbit CD19 comprising (a) a HVR-H1 comprising the amino acid sequence of SEQ ID NO: 32 or 33 or 34, (b) a HVR-H2 comprising the amino acid sequence of SEQ ID NO: 35 or 36, (c) a HVR-H3 comprising the amino acid sequence of SEQ ID NO: 37, (d) a HVR-L1 comprising the amino acid sequence of SEQ ID NO: 38, (e) a HVR-L2 comprising the amino acid sequence of SEQ ID NO: 39, and (f) a HVR-L3 comprising the amino acid sequence of SEQ ID NO: 40, as well as methods of using the same, especially in the identification and selection of antibody producing rabbit B-cells. | 05-05-2022 |
20220135677 | ANTI-SIRP ALPHA ANTIBODIES - The present invention relates to anti-SIRPα antibodies, as well as use of these antibodies in the treatment of diseases such as cancer and infectious disease. | 05-05-2022 |
20220135680 | ANTIBODIES BINDING TO HUMAN CD3 AT ACIDIC pH - The invention relates to new anti-hCD3 antibodies that, in contrast to prior art anti-CD3 antibodies, bind specifically to human CD3 at acidic pH, but do not significantly bind to human CD3 at neutral or physiological pH, methods to produce these antibodies and therapeutic uses of these antibodies. These antibodies are able to activate T cells at acidic pH while having significantly reduced activity at neutral or physiological pH. | 05-05-2022 |
20220135697 | CD38 ANTIBODY - The present disclosure provides antibody sequences found in antibodies that bind to human CD38. In particular, the present disclosure provides sequences of anti-human CD38 antibodies. Antibodies and antigen-binding portions thereof including such sequences present features compatible with pharmaceutical manufacturing and development can be provided as fully human antibodies (e.g., fully human monoclonal antibodies or antigen-binding fragments) that can be useful for medical methods and compositions, in particular for treating cancer. | 05-05-2022 |
20220135699 | CHIMERIC ANTIGEN RECEPTOR COMPRISING INTERLEUKIN-15 INTRACELLULAR DOMAIN AND USES THEREOF - Provided herein are chimeric antigen receptors (CARs) comprising an antigen binding domain (e.g., CD19, CD30, GD2, etc.), transmembrane domain (e.g., CD28), and a cytoplasmic domain (e.g., CD27, 4-1BB, etc.). In some aspects, the disclosure relates to use of the CARs in T cells, compositions, kits and methods. | 05-05-2022 |
20220135704 | ANTIBODIES TO OXIDATION-SPECIFIC EPITOPES - The disclosure provides for single chain variable fragments to MAA-oxidized specific epitopes (OSEs). The disclosure also provides single chain variable fragments that bind to MDA-OSEs or MAA-OSEs on oxidized phospholipids and methods of use thereof, including the production of transgenic animal models and the use of the fragments as therapeutic agents. | 05-05-2022 |