THERMOCELLULASES FOR LIGNOCELLULOSIC DEGRADATION

Abstract

Thermostable cellulase enzyme systems comprising at least one each of a thermostable endoglucanase, an exo-processive-endoglucanase, and a β-glucosidase carry out the complete, coordinated hydrolysis of crystalline cellulose to monomeric glucose.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional application of issued U.S. Pat. No. 8,847,031 B2, issued Sep. 30, 2014, and claims the benefit of U.S. Provisional Patent Application Ser. No. 61/079,208 filed on Jul. 9, 2008 and international patent application No. PCT/US2009/050080, filed Jul. 9, 2009, and incorporates said applications by reference into this document as if fully set out at this point.

BACKGROUND OF THE INVENTION

[0003] 1. Field of the Invention

[0004] This invention generally relates to thermostable enzymes capable of degrading (hydrolyzing) cellulose at high temperatures, and the incorporation of nucleic acids coding for one or more of such enzymes into a host, and, more particularly, a host that produces or is composed of cellulosic material.

[0005] 2. Background of the Invention

[0006] Cellulose is a polysaccharide consisting of a linear chain of several hundred to over nine thousand β (1→4) linked D-glucose units [formula (C₆H₁₀O.sub.5)n]. Cellulose is the most abundant organic compound on earth, making up about 33 percent of all plant matter, about 50 percent of wood, and about 90 percent of products such as cotton. In nature, cellulose is present as part of the lignocellulosic biomass of plants, which is composed of cellulose, hemicellulose, and lignin. The carbohydrate polymers (cellulose and hemicelluloses) are tightly bound to the lignin, by hydrogen and covalent bonds.

[0007] Many highly desirable products are derived from lignocellulosic biomass. In particular, much interest has recently been focused on recapturing the saccharide building blocks locked in plant biomass for biofuel production. For example, fermentation of plant biomass to ethanol is an attractive carbon neutral energy option since the combustion of ethanol from biomass produces no net carbon dioxide in the earth's atmosphere. Further, biomass is readily available, and its fermentation provides an attractive way to dispose of many industrial and agricultural waste products. Finally, plant biomass is a highly renewable resource. Many dedicated energy crops can provide high energy biomass, which may be harvested multiple times each year.

[0008] One barrier to the production of products from biomass is that the cellulosic polymer has evolved to resist degradation and to confer hydrolytic stability and structural robustness to the cell walls of plants. This robustness or "recalcitrance" is due largely to extensive intermolecular hydrogen bonding between cellulose polymer chains. Some organisms, notably fungi, bacteria, and protozoans, but also some plants and animals, have evolved the ability to digest cellulose. In vivo cellulose breakdown typically entails the cooperative interaction of several cellulases, enzymes that catalyze the cellulolysis (hydrolysis) of cellulose. Several different kinds of cellulases, which differ structurally and mechanistically, are known, and some of these have been isolated, characterized and used to break down cellulose in vitro. General categories of cellulases include: endo-cellulases (endoglucanases), which randomly hydrolyze internal bonds to disrupt the crystalline structure of cellulose, thereby exposing individual cellulose polysaccharide chains; and exo-cellulases (exo-processive-endoglucanases), which cleave 2-4 units from the ends of the exposed chains produced by endocellulases to produce tetrasaccharides or disaccharides such as cellobiose. Two major types of exo-cellulases are known, one of which works processively from the reducing end, and one of which works processively from the non-reducing end of cellulose. A third major type of cellulase is cellobiase or beta-glucosidase, which hydrolyses exo-cellulase products such as cellobiose into individual glucose monosaccharides.

[0009] Typically, the digestion of cellulose is carried out at temperatures approaching 100° C. because, at high temperatures, intermolecular hydrogen bonds are disrupted and recalcitrant cellulose polymers become accessible to the cellulase enzymes. Therefore, cellulases used commercially in such processes must be able to withstand very high temperatures, preferably for extended periods of time.

[0010] There is an ongoing need to identify, isolate and characterize cellulases, especially thermally stable cellulases, for use in the enzymatic hydrolysis of cellulose. Of particular interest is the development of groups or systems of cellulases that include enzymes with endo-cellulase, exo-cellulase and beta-glucosidase activity, the enzymes in the system acting in concert to carry out the complete hydrolysis of cellulose to glucose at high temperatures.

SUMMARY OF THE INVENTION

[0011] Protein sequences which heretofore were not recognized as having enzymatic activity have been isolated and characterized as thermostable enzymes capable of degrading (hydrolyzing) cellulose at high temperatures. The activity is referred to herein as cellulase or cellulase-like. The enzymes, originating from Archaea and various thermophilic bacteria, include: endoglucanases that randomly hydrolyze internal glycosidic bonds; exo-processive-endoglucanases that split off cellobiose dimers; and β-glucosidases that reduce cellobiose into monomeric glucose molecules. While the β-glucosidase enzymes are technically not "cellulases" because cellobiose (not cellulose) is the substrate they cleave, the three groups of enzymes may be sometimes collectively referred to as "cellulases" herein. The enzymes are optimally catalytically active at temperatures at or above about 85° C. and retain >85% of their enzymatic activity even after a 5 day incubation at elevated temperature, e.g. 90° C. In some embodiments, the enzymes, or enzyme systems or groupings comprising multiple thermostable catalytic activities may advantageously be used to degrade cellulose. Preferably, in the case of systems which have multiple thermostable catalytic activities, such a system comprises at least one endoglucanase, at least one exo processive-endoglucanase, and at least one beta-glucosidase enzyme, and thus can carry out the complete hydrolysis of cellulose to glucose at high temperatures in a sequential, cooperative manner. Catalytic consolidation at high-temperatures using the enzyme systems described herein is not additive but synergistic, accessing recalcitrant cellulose and hydrolyzing beta linkages at temperatures above 85° C. Thus, one aspect of the invention is to employ the enzymes, alone or in a group, in processes to break down cellulosic material by contacting the cellulosic material with the enzymes and elevating the temperature to activate the enzymes to break down the cellulosic material. These processes might be performed, for example, in tanks where the cellulosic material is distributed in a liquid carrier; however, the enzymatic breakdown may be achieved simply through elevating the temperature of the cellulosic material with the enzymes being in contact with the cellulosic material.

[0012] The invention also contemplates the incorporation of nucleic acids coding for one or more of the enzymes into a host (e.g., a plant, fungi, bacterium or animal). In the case where the host produces or is composed of cellulosic material (e.g., plants such as corn, switch grass, sugar cane, sorghum, pinus and eucalyptus), the host can be subjected to breakdown of the cellulosic material, for example, after harvest. That is, in a particular example, corn or switchgass transformed to include nucleic acids coding for the enzymes will express the enzymes internally, and after collection or harvest of the corn or switchgrass, the enzymes can be activated to begin and preferably ultimately to completely degrade the cellulose simply by elevating the temperature of the corn or switchgrass.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIG. 1A-B. Pyrococcus furiosus Termocel 1 endoglucanase. A, nucleotide sequence (903 bp, SEQ ID NO: 1); and B, amino acid sequence (301 aa, SEQ ID NO: 2). Nucleotide sequence is optimized for expression in corn and shown without N-terminal signal peptide encoding sequence.

[0014] FIG. 2A-B. Thermotoga petrophila Termocel 2 endoglucanase. A, nucleotide sequence (825 bp, SEQ ID NO: 3); and B, amino acid sequence (274 aa, SEQ ID NO: 4).

[0015] FIG. 3A-B. Pyrococcus horikoshii Termocel 3 exocellulase. A, nucleotide sequence (1377 bp, SEQ ID NO: 5); and B, amino acid sequence (458 aa, SEQ ID NO: 6).

[0016] FIG. 4A-B. Pyrococcus abyssi Termocel 4 exocellulase. A, nucleotide sequence (1542 bp, SEQ ID NO: 7); and B, amino acid sequence (514 aa, SEQ ID NO: 8). Nucleotide sequence is optimized for expression in rice and shown without stop codon.

[0017] FIG. 5A-B. Thermotoga petrophila Termocel 5 endoglucanase. A, nucleotide sequence (987 bp, SEQ ID NO: 9); and B, amino acid sequence (328 aa, SEQ ID NO: 10).

[0018] FIG. 6A-B. Caldivirga inaquilingenesis Termocel 6 endoglucanase. A, nucleotide sequence (852 bp, SEQ ID NO: 11); and B, amino acid sequence (284 aa, SEQ ID NO: 12). Nucleotide sequence is optimized for expression in corn.

[0019] FIG. 7A-B. Thermotoga petrophila Termocel 7 beta-glucosidase. A, nucleotide sequence (2169 bp, SEQ ID NO: 13); and B, amino acid sequence (722 aa, SEQ ID NO: 14).

[0020] FIG. 8A-B. Thermotoga petrophila Termocel 8 beta-glucosidase. A, nucleotide sequence (1341 bp, SEQ ID NO: 15); and B, amino acid sequence (446 aa, SEQ ID NO: 16).

[0021] FIG. 9. Characteristics of high-temperature operating thermo-stable cellulases. swAvicel=phosphoric acid swollen Avicel; _avCellulose=Avicel; cellulase specific activity is expressed as μM of reducing sugar/mg protein/day at 85° C., pH 6; beta-glucosidase specific activity is expressed as nM p-nitrophenol (pN)/μg protein/minute.

[0022] FIG. 10A-E. Processive exocellulases (cellobiohydrolase). Capillary zone electrophoresis (CZE) of 8-aminonaphthalene-1,3,6 trisulfonic acid (ANTS)-labeled cellopentose breakdown products incubated with Termocel 1 (A), Termocel 2 (B) and Termocel 3 (C). CZE retention times (D) of purified monomer, (DPI) dimer (DP2), trimer (DP3) and the substrate cellopentose (DP5). Sequential predicted cleavage pattern (E) between DP5 and DP4, DP4 and DP3, DP3 and DP2. Assay conditions, Substrate, ANTS-cellopentose (FIG. 9C), buffer sodium phosphate/citrate 50 mM, incubated at 95° C., pH 6.

[0023] FIG. 11A-E. Processive endocellulases (endoglucanase). Capillary zone electrophoresis (CZE) of ANTS-labeled cellopentose breakdown products incubated with Termocel 4 (A), Termocel 5 (B) and Termocel 6 (C). CZE retention times (D) of purified monomer, (DPI) dimer (DP2), trimer (DP3) and the substrate cellopentose (DP5). Predicted cleavage pattern (E) between DP2 ad DP3 and DP3 and DP4. Assay conditions, Substrate, ANTS-cellopentose (FIG. 9C), buffer sodium phosphate 50 mM, incubated at 95° C., pH 6.

[0024] FIG. 12. Temperature optima for high-temperature catalytic cellulases, and activities at 60, 45 and 20° C. _swAvicel=phosphoric acid swollen Avicel; _avCellulose=Avicel; cellulase specific activity is expressed as μM of reducing sugar/mg protein/day at 85° C., pH 6; beta-glucosidase specific activity is expressed as nM p-nitrophenol (pN)/μg protein/minute.

[0025] FIG. 13A-D. Termocel thermostability. Termocels were incubated at 90° C. in phosphate/citrate buffer for the indicated number of hours and CMC or PNPG activity determined. The amount of residual activity is shown. A, Termocels 1 and 2; B, Termocels 3 and 4; C, Termocels 5 and 6; D, Termocels 7 and 8 With the exception of Termocel 3, all cellulases retained >80% of activity after 120 hrs at 90° C. Thus, these enzymes are stable at high temperatures.

[0026] FIG. 14. Flow chart illustrating cellulose treatment steps.

[0027] FIG. 15. Table depicting biomass substrate specificity of particular Termocels.

[0028] FIG. 16A-B. Caldivirga maquilingensis Termocel 9 endoglucanase. A, nucleotide sequence (1230 bp, SEQ ID NO: 29); and B, amino acid sequence (410 aa, SEQ ID NO: 30). Nucleotide sequence is optimized for expression in corn.

[0029] FIG. 17A-B. Pyrococcus horikoshii Termocel 10 endoglucanase. A, nucleotide sequence (2214 bp, SEQ ID NO: 31); and B, amino acid sequence (737 aa, SEQ ID NO: 32).

[0030] FIG. 18A-F. Nucleotide sequences as set forth in SEQ ID NO: 1 (from Pyrococcus furiosus), SEQ ID NO: 3 (from Thermotoga petrophila), SEQ ID NO: 5 (from Pyrococcus horikoshii), SEQ ID NO: 7 (from Pyrococcus abyssi), SEQ ID NO: 9 (from Thermotoga petrophila), SEQ ID NO: 11 (from Caldivirga maquilingenesis), SEQ ID NO: 29 (from Caldivirga maquilingensis), SEQ ID NO: 31 (from Pyrococcus horikoshii), SEQ ID NO: 13 (from Thermotoga petrophila), and SEQ ID NO: 15 (from Thermotoga petrophila).

[0031] FIG. 19A-C. Amino acid sequences as set forth in SEQ ID NO: 2 (from Pyrococcus furiosus), SEQ ID NO: 4 (from Thermotoga petrophila), SEQ ID NO: 6 (from Pyrococcus horikoshii), SEQ ID NO: 8 (from Pyrococcus abyssi), SEQ ID NO: 10 (from Thermotoga petrophila), SEQ ID NO: 12 (from Caldivirga maquilingenesis), SEQ ID NO: 30 (from Caldivirga maquilingensis), SEQ ID NO: 32 (from Pyrococcus horikoshii), SEQ ID NO: 14 (from Thermotoga petrophila), and SEQ ID NO: 16 (from Thermotoga petrophila).

DETAILED DESCRIPTION

[0032] The present invention is based on the identification and characterization of a comprehensive set of thermostable cellulases that work in concert to catalyze the hydrolysis of cellulose to glucose at very high temperatures. The cellulases, originally identified in archeal and bacterial genomes, include endoglucanases that randomly cleave internal glycosidic bonds; exo-processive-endoglucanases that further hydrolyze cellulose fragments into cellobiose dimers; and β-glucosidases that further hydrolyze cellobiose dimers to glucose monomers. While the enzymes may be used individually, in some embodiments of the invention they are grouped to form a cooperative enzyme system. By combining into a group at least one endoglucanase, at least one exo-processive-endoglucanase and at least one β-glucosidase, an enzyme system is formed that is capable of the complete breakdown of cellulose to glucose. Importantly, the enzyme system's various catalytic activities are optimal at temperatures that are high enough to destabilize the hydrogen bonds between crystalline cellulose strands (e.g. at temperatures greater than 80° C.). Destabilization of hydrogen bonds at high temperatures causes disruption of the crystalline structure of cellulose, thereby facilitating access by the first enzyme in the series (endoglucanase) to internal glycosidic bonds of individual cellulose polymer strands, and allowing the step-wise process of cellulose breakdown to begin.

[0033] Exemplary amino acid sequences of the recombinant enzymes of the invention and exemplary nucleotide sequences that encode them are depicted in FIGS. 1-8. However, those of skill in the art will recognize that the invention also encompasses variant proteins comprising amino acid sequences that are based on or derived from the sequences disclosed herein. By an amino acid sequence that is "derived from" or "based on" the sequence disclosed herein, we mean that a derived sequence (or variant sequence) displays at least about 50 to 100% identity to an amino acid sequence disclosed herein, or about 60 to 100% identify, or about 70 to 100% identity, or even from about 80 to 100% identify. In preferred embodiments, a variant sequence displays from about 90 to 100% or about 95 to 100% amino acid identity. In further preferred embodiments, a variant sequence is 95, 96, 97, 98 or 99% identical to at least one sequence disclosed herein. Variations in the sequences may be due to a number of factors and may include, for example: conservative or non-conservative amino acid substitutions; natural variations among different populations as isolated from natural sources; various deletions or insertions (which may be amino terminal, carboxyl terminal, or internal); addition of leader sequences to promote secretion from the cell; addition of targeting sequences to direct the intracellular destination of a polypeptide; etc. Such alterations may be naturally occurring or may be intentionally introduced (e.g. via genetic engineering) for any of a wide variety of reasons, e.g. in order to eliminate or introduce protease cleavage sites, to eliminate or introduce glycosylation sites, in order to improve solubility of the polypeptide, to facilitate polypeptide isolation (e.g. introduction of a histidine or other tag), as a result of a purposeful change in the nucleic acid sequence (see discussion of the nucleic acid sequence below) which results in a non-silent change in one or more codons and thus the translated amino acid, in order to improve thermal stability of the protein, etc. All such variant sequences are encompassed by the present invention, so long as the resulting polypeptide is capable of catalyzing the enzyme activity of the original protein as disclosed herein. For example, the invention includes shorter portions of the sequences that also retain the catalytic activity of the enzyme. The full-length protein sequences and/or active portions thereof are both referred to as polypeptides herein. In addition, the invention also includes chimeric or fusion proteins that include, for example: more than one of the enzymes disclosed herein (or active portions thereof); or one or more of the enzymes disclosed herein (or portions thereof) plus some other useful protein or peptide sequence(s), e.g. signal sequences, spacer or linker sequences, etc.

[0034] The invention also comprehends nucleic acid sequences that encode the proteins and polypeptides of the invention. Several exemplary nucleic acid sequences are provided herein. However, as is well known, due to the degeneracy of the nucleic acid triplet code, many other nucleic acid sequences that would encode an identical polypeptide could also be designed, and the invention also encompasses such nucleic acid sequences. Further, as described above, many useful variant forms of the proteins and peptides of the invention also exist, and nucleic acid sequences encoding such variants are intended to be encompassed by the present invention. In addition, such nucleic acid sequences may be varied for any of a variety of reasons, for example, to facilitate cloning, to facilitate transfer of a clone from one construct to another, to increase transcription or translation in a particular host cell (e.g. the sequences may be optimized for expression in, for example, corn, rice, yeast or other hosts), to add or replace promoter sequences, to add or eliminate a restriction cleavage site, etc. In addition, all genera of nucleic acids (e.g. DNA, RNA, various composite and hybrid nucleic acids, etc.) encoding proteins of the invention (or active portions thereof) are intended to be encompassed by the invention.

[0035] The invention further comprehends vectors, which contain nucleic acid sequences encoding the polypeptides of the invention. Those of skill in the art are familiar with the many types of vectors, which can be useful for such a purpose, for example: plasmids, cosmids, various expression vectors, viral vectors, etc.

[0036] Production of the nucleic acids and proteins of the invention can be accomplished in any of many ways that are known to those of skill in the art. The sequences may be synthesized chemically using methods that are well-known to those of skill in the art. Alternatively, nucleotide sequences may be cloned using, for example, polymerase chain reaction (PCR) and/or other known molecular biology and genetic engineering techniques Recombinant proteins may be made from a plasmid contained within a bacterial host such as Escherichia coli, in insect expression systems, yeast expression systems, plant cell expression systems, etc. Further, the nucleic acid sequences may be optimized for expression in a particular organism or system. To that end, the present invention also encompasses a host cell that has been transformed or otherwise manipulated to contain nucleic acids encoding the proteins and polypeptides of the invention, either as extra-chromosomal elements, or incorporated into the chromosome of the host. In particular, in the practice of the present invention, nucleic acid sequences encoding one or more of the cellulases (e.g. an entire "system" as described herein) may be introduced into plant cells, seeds, etc., to generate recombinant plants that contain the nucleic acids.

[0037] Plant transformation to incorporate one or more nucleic acids coding for one or more cellulase enzymes described herein can be accomplished by a variety of techniques known to those of skill in the art. Plant transformation is the introduction of a foreign piece of DNA, conferring a specific trait, into host plant tissue. Plant transformation can be carried out in a number of different ways; Agrobacterium mediated transformation, particle bombardment, electroporation and viral transformation.

[0038] Suitable examples of plants that may be transformed to include one or more cellulase enzymes or sets of enzymes include but are not limited to rice, corn, various grasses such as switchgrass, sugar cane, sorghum, pinus and eucalyptus, etc. Advantages of genetically engineering plants to contain and express the cellulase genes include but are not limited to the availability of the enzymes within the cell wall tissues (cellulosic fibers) and ready to be activated by high temperatures (e.g., heating to 70 or 80 C or more). Deposition of these enzymes produced by the plant cells and targeted to the apoplast, should largely overcome the recalcitrant nature of biomass.

[0039] The cellulases and/or cellulase enzyme systems of the invention may be used for the breakdown (catalysis) of cellulose in biomass from a wide variety of sources. Biomass comes in many different types, which may be grouped into four main categories: (1) wood residues (including sawmill and paper mill discards); (2) municipal paper waste; (3) agricultural residues (including corn stover and sugarcane bagasse); and (4) dedicated energy crops, which are mostly composed of fast growing tall, woody grasses. Cellulose-containing biomass from any of these or other sources may be acted upon by the enzymes and consolidated enzyme systems of the invention.

[0040] Generally, the breakdown of cellulose will be complete, i.e. the endproduct is glucose. This is especially true when a consolidated enzyme system that includes at least three different types of enzymes (for example, an endoglucanase, an exo-processive-endoglucanases, and a β-glucosidase) are employed. However, this need not always be the case. Depending on the goal of the reaction, only one enzyme may be utilized (e.g. an endoglucanase to generate randomly cleaved cellulose polymers); or only two enzymes may be utilized (e.g. an endoglucanase and an exo-processive-endoglucanases to generate dimeric disaccharides such as cellobiose), etc. Any desired grouping of the enzymes of the invention may be utilized to generate any desired endproduct that the enzymes are capable of producing from a suitable substrate. Further, one or more of the enzymes of the invention may be used in combination with other cellulases, or with enzymes having other types of activities. In one embodiment of the invention, a "system" could further include a yeast or other organism capable of fermenting glucose to e.g. ethanol.

[0041] The cellulases of the invention have very high temperature optima, an optimal temperature being the temperature at which an enzyme is maximally active (e.g. as an endoglucanase, an exo-processive-endoglucanases, or a β-glucosidase), as determined by a standard assay recognized by those of skill in the art. As described in the Examples section below, the lowest temperature optimum for an enzyme of the invention is about 85° C., and the highest temperature optimum is about 102° C. Further, the enzymes of the invention are thermally stable, i.e. they are capable of retaining catalytic activity at high temperatures (e.g. at their temperature maximum, or at temperatures that deviate somewhat from the maximum) for extended periods of time, for example, for at least for several hours (e.g. 1-24 hours), and in many cases, for several days (e.g. from 1-7 days or even longer). By "retain catalytic activity" we mean that the enzyme retains at least about 10, 20, 30, 40 or 50% or more of the activity displayed at the beginning of the extended time period, when measured under standard conditions; and preferably the enzyme retains 60, 65, 70, 75, 80, 85, 90, 95, or even 100% of the activity displayed at the beginning of the extended time period.

[0042] The enzymes of the invention are generally employed in reactions that are carried out at temperatures at or near those which are optimal for their activity. Some enzymes may be used over a wide temperature range (e.g. at a temperature that is about 50, 40, 30, 20, 10, 5 or fewer degrees lower than (below) the temperature optimum, and up to about 5, 10, 15, or more degrees greater than (above) the temperature optimum. For other enzymes, the range may be more restricted, i.e. they may display catalytic activity within a narrow temperature range of only less than about 10, or less than about 5, or fewer degrees of their optimal catalytic temperature. When carrying out a cellulose digestion reaction, the enzymes may be used one at a time sequentially (i.e. one enzyme is added, reaction occurs, and then another enzyme is added, with or without removal of the previous enzyme, and so on), or the reaction mixture may contain two or even all three of the enzymes (an enzyme system) may be added at the same time. When designing groups of enzymes to be included in an enzyme system, those of skill in the art will recognize that a suitable temperature at which all enzymes in the group are active will be selected as the temperature for reaction. Or, conversely, if it is desired to carry out a reaction at a particular temperature, enzymes with optimal activity at or near that temperature would be selected for inclusion in the set. For example, for a reaction to be carried out at 97° C., one might choose a set of enzymes that includes Termocel 5 (endocellulase, optimum=96° C.), plus Termocel 2 (exocellulase, optimum=98° C.), plus Termocel 7 (β-glucosidase, optimum=98° C.); whereas for a reaction that is to be carried out at 90° C., one might choose Termocel 6 (endocellulase, optimum=85° C.), plus Termocel 3 (exocellulase, optimum=94° C.), plus Termocel 7 (β-glucosidase, optimum=92° C.). If an enzyme is used individually, the reaction may be carried out at a temperature near its optimum, or at which the enzyme retains sufficient activity to be useful. In addition, the selection of a reaction temperature may be based on other considerations, e.g. safety or other practical considerations of high temperature operations, or concerns about the cost of keeping a reaction mixture at a high temperature, the temperature used for preparing biomass for the reaction, the temperature of procedures that follow the reaction, etc. Generally, the degradation of cellulose will be carried out at a temperature in the range of from about 70 to about 95° C.

[0043] The invention also provides methods of use of the enzymes disclosed herein. The methods generally involve the used of at least three enzymes of the invention, at least one from each of the three classes endoglucanase, exo-processive-endoglucanases, and β-glucosidase. The three classes of enzymes act in concert to sequentially breakdown cellulose to glucose. The methods of the invention may be carried out for any purpose for which it is desirable to prepare glucose (or other products produced by the enzymes), and further metabolize into other chemicals, such as ethanol, xylitol, butanol, amino acids, glycol etc.

[0044] Generally, such methods are carried out by first pretreating a cellulose-rich feedstock by removing the lignin (usually through ball milling). The production of sugars (saccharification) of the pretreated cellulose is carried out by suspending the pretreated cellulose in a cellulase broth that contains suitable cellulase enzymes such as those disclosed herein. Generally, the reaction will be carried out at a temperature in the range of from about 70 to about 95 C, and the length of time for a reaction will be in the range of from about one hour to about six days. Reactions are carried out in media such as aqueous buffered to a suitable pH, e.g. in the range of from about pH 4 to about pH 9.

[0045] Thereafter, the desired products (e.g. glucose and cellobiose) may be harvested from the broth, or the reaction products may be further processed. For example, for the production of ethanol, fermentation of the glucose in the broth may be carried out by known conventional batch or continuous fermentation processes, usually using yeast. Ethanol may be recovered by known stripping or extractive distillation processes. This process is illustrated schematically in FIG. 14, which shows the steps of pretreating biomass to provide a source of cellulose; contacting the cellulose with one or more cellulase enzymes of the invention to hydrolyze cellulose to glucose, and fermenting the glucose to produce ethanol.

EXAMPLES

Example 1

Isolation and Characterization of Cellulases that Catalyze High-Temperature Thermo-Stable Bio-Consolidated Cellulose Breakdown

Abstract

[0046] Cellulose breakdown entails cooperative interaction of various cellulases by accessing and cleaving the recalcitrant cellulosic polymer. At high temperatures, most of the recalcitrant biomass polymers become enzymatically accessible because of intermolecular hydrogen bond disruption. Here, we describe a high-temperature operating thermo-stable cellulose enzyme system, consisting of endoglucanases, exoprocessive-endoglucanases and beta-glucosidases. Two catalytic types of cellulose cleaving enzymes was found: endoglucanases that randomly hydrolyze internal glycosidic bonds and exo-processive-endoglucanase, which split off cellobiose dimers. Finally, a third activity, βglucosidase, reduces cellobiose into glucose molecules. The consolidated enzyme system operates optimally at temperatures above 85° C. and retains >85% of its enzymatic activity after a 5 day incubation at 90° C. Catalytic consolidation with high-temperatures is not additive but synergistic, accessing recalcitrant cellulose and hydrolyzing beta linkages above 85° C.

Introduction

[0047] Cellulose is an abundant biopolymer component of plant cell walls. Cellulose is a linear biopolymer of D-glucose, linked by β-1,4-glucosyl linkages. Cellulosic enzyme systems completely hydrolyze cellulose rendering glucose molecules. A cellulosic enzymatic system consists of multiple cellulases, endo-β-glucanase, cellobiohydrolase and β-glucosidase, which interact synergistically in producing glucose. Endoglucanases randomly hydrolyze the internal glycosidic bonds to decrease the length of the cellulose chain. Cellobiohydrolases are exo- or endo-processive enzymes that split off cellobiose of the shortened cellulose chains. Cellobiose is hydrolyzed by β-glucosidase to glucose. Native cellulose molecules appear predominantly as crystalline cellulose, which shows a high degree of intermolecular hydrogen bonding explaining its remarkable stability and recalcitrance to enzymes. Thus disrupting crystal intermolecular hydrogen bonds through cellulose swelling and dissolution with high-temperature operating cellulases overcomes recalcitrance and result in enzymatic digestion of native cellulose.

Results

Isolation and Characterization of High-Temperature Operating and Thermostable Cellulases

[0048] A series of ten high-temperature operating and thermo-stable cellulases were identified through bioinformatics driven searches of archeal and bacterial genomes. The corresponding genes were genetically manipulated to adapt expression to a laboratory tractable system (Escherichia coli) by codon optimization and usage controlled promoters. Individual proteins were expressed and isolated (purified) from E. coli crude extracts and analyzed for activity and other physical and chemical properties. Data presented in tabular form in FIG. 9 describes the eight enzymes isolated in this study.

[0049] Termocel 1 and 2, group into a class with similar physical and catalytic properties, they exhibit a molecular weight of 34,005 and 31,930 D, a pI of 4.8 and 4.77 and a net charge at pH 7 of -13.10 and -13.30, respectively. They appear to function through an exo-processive-endoglucanase cleaving pattern with a specific activity on Avicel of 63.4 and 8.1 U and on swollen cellulose of 13.6 and 2.2. U, respectively.

[0050] Termocel 3 and 4 differ slightly with a molecular weight of 51,930 and 59,980 D, a pI of 6.47 and 7.05 and a net charge at pH 7 of -3.60 and 0.30, respectively. These enzymes also seem not to overlap with their predicted mode of operation, one exoprocessive type and the other as a endoglucanase with specific activity on Avicel of 48.5 and 6.8 and on swollen cellulose of 8.4 and 2.2 U, respectively.

[0051] Termocel 5 and 6 fall in a third class with similar physical and catalytic properties. They exhibit a molecular weight of 38,226 and 31,818 D, a pI of 5.58 and 5.66 and a net charge at pH 7 of -6.60 and -5.00, respectively. They appear to function through an internal cleaving pattern (endoglucanase) with a specific activity on Avicel of 34.1 and 20.6 U and on swollen cellulose of 6.8 and 5.1 U respectively.

[0052] Termocel 7 and 8 are β-glucosidases with distinct physical properties but similar catalytic activity. They exhibit a molecular weight of 81,243 and 51,509 D, a pI of 5.38 and 5.84 and a net charge at pH7 of -16.90 and -9.10, respectively. They cleave cellobiose with a specific activity on pNPG of 69.4 and 60.9 U, respectively.

[0053] Termocel 9 and 10 are endocellulases that exhibit a molecular weight of 45,059 and 85,598 D, a pI of 6.16 and 7.80 and a net charge at pH 7 of -2.20 and 4.30, respectively. They have a specific activity on Avicel of 5.2 and 4.9 U and on swollen cellulose of 1.4 and 1.5 U respectively.

Mode of Operation

[0054] FIGS. 10 and 11 describe the mode of operations of all six cellulases. Termocel 1, 2 and 3 are cellulases that function by sequentially cleaving glucose residues of the non-reducing end of a polymeric substrate. FIG. 10 shows the sequential depolymerization breakdown products through capillary zone electrophoresis.

[0055] Termocel 4, 5 and 6 are cellulases that function by internally cleaving a multimeric substrate. FIG. 11 shows trimeric and dimeric breakdown products, indicating internal cleavage of the pentameric substrate.

High-Temperature Catalytic Operation

[0056] FIG. 12 shows the optimum temperature of operation of eight Termocels in tabular form. The highest optimum was found for Termocel 1 with and optimum of 102° C. and the lowest optimum was found to be Termocel 6 with 85° C. At 60° C., all Termocels lost at least 40% of their activity (except Termocel 4) and at 20° C. the Termocels operated with less than 20% of their optimum activity.

[0057] Among the beta-glucosidases, no significant differences between activity and temperature optimum were apparent. However, catalytic inactivation at lower temperatures (45 and 20° C.) to levels below 1% residual activity for Termocel 7 is remarkable.

Thermal Stability

[0058] Thermostability of the Termocels was evaluated to determine the working time frame with useful enzymatic activity at high-temperatures. Enzymes were incubated at 90° C. for up to 5 days and than assayed for CMC (endo-glucanase and exo-cellulase) or PNPG (beta-glucosidase) activity and results are reported as % of residual activity in FIG. 13. With the exception of Termocel 3, all enzymes retained over 80% of their initial enzymatic activity after a 5-day incubation period at 90° C.

Modes of Use

[0059] These high-temperature operating cellulases can be used in all processes in which cellulose degradation at high temperatures is desired. These applications include but are not restricted to food processing, feedstuff preparation, textile finishing and paper pulping. The consolidated enzyme system is useful to hydrolyze fibrous crystalline cellulosic biomass materials, at high temperatures with Termocel 1, 2, 3, 4, 5, 6, 7 and 8 to produce high-sugar containing fermentation broths. In addition the genes of the high-temperature operating enzyme system can be used in producing transgenic organisms capable of expressing one or more high-temperature operating and thermostable plant cell wall degrading enzymes.

Methods

Cloning

[0060] Genomic DNA of Pyrococcus horikoshii OT3 served as the PCR template for the amplification of the PH1171 gene. Likewise, genomic DNA of Thermotoga petrophila RKU-1 served as PCR template for the cloning of the PetroA, PetroB, Tpet_--0898 and Tpet_--0952 genes. Primer sequences are shown in Table 1. Restriction sites were introduced (bold letters). The O-eglA, ZP and E1 genes were synthesized without using a DNA template; the codons of the three genes were also optimized according to the sequences of corn and rice genomes (FIGS. 1A, 4A and 6A). All gene segments generated were cloned into the NcoI and XbaI sites of the pBAD/Myc-His vector (Invitrogen), which carries a fusion sequence (GAACAAAAACTCA TCTCAGAAG AGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATCAT, SEQ ID NO: 17) encoding six histidine residues at the C-terminus of any protein expressed from the vector (EQKLISEEDLNSAVDHHHHHH, SEQ ID NO: 18) The expression plasmids were used to transform Escherichia coli TOP 10F' (Invitrogen). All constructs were verified by DNA sequencing.

TABLE-US-00001 TABLE 1 Oligonucleotide sequences used in this study. SEQ ID Primer Sequence (5'→3')^a NO: Termocel 3 ATATCCATGGAGGGGAATACTATTCTTAAAATCGTACTAAT (Forward) 19 ATGCTCTAGAAACCTGGGAGCCCTTCTTAAG (Reverse) 20 Termocel 5 GAAACGCTCCTCCCTGTAGT (Forward) 21 ATGCTCTAGAAATTCTCTCACCTCCAGATCAATAGAGA (Reverse) 22 Termocel 2 AGGTGGGTAGTTCTTCTGATGG (Forward) 23 ATGCTCTAGAAATTTTACAACTTCGACGAAGAAGTCTTTGA (Reverse) 24 Termocel 7 ATATCCATGGGAAAGATCGATGAAATCCTTTCA (Forward) 25 ATGCTCTAGAAATGGTTTGAATCTCTTCTCTCCC (Reverse) 26 Termocel 8 AACGTGAAAAAGTTCCCTGAAG (Forward) 27 ATGCTCTAGAAAATCTTCCAGACTGTTGCTTTTG (Reverse) 28 ^aBoldface indicates sequences complementary to the primers used to amplify the selectable markers.

Expression and Purification

[0061] An overnight growth of transformed E. coli strain containing the fusion protein vector was inoculated into fresh Luria-Bertani medium containing ampicillin. When the OD⁶⁰⁰ reached 0.5-0.6, L-arabinose was added to a final concentration of 0.2%. The culture was allowed to grow for another 4-5 h at 37° C. and the cells were collected by centrifugation. The pellet was stored at -80° C. prior to further processes. Cells were disrupted by sonication and the cell debris was removed by centrifugation at 10,000×g for 20 min. The protein pool was then heat treated at 95° C. for 5 min, and denatured proteins were removed by centrifugation at 12, 000×g for 20 min. The recombinant protein carrying a His6 tag was then purified by immobilized metal-chelate affinity chromatography (Qiagen). Hydrolysis of cellulose, hemicellulose and starch Hydrolysis of Avicel PH101, carboxymethyl cellulose (CMC), xylan from birch wood, α-cellulose, β-glucan barley, laminarin, lichenan, starch, swollen Avicel PH101, wheat arabinoxylan, xylan from beechwood and xylan from oat-spelt was measured spectrophotometrically by the increase of reducing ends at various temperatures and pH. The amount of reducing sugar ends was determined by the dinitrosalicyclic acid (DNS) method. The assay mix contained 10 μl of diluted enzymes, 30 μl of 100 mm sodium phosphate buffer, pH 6.0, and 20 μl of 0.5% (wt/vol) soluble substrates or 1% slurries (wt/vol) of insoluble substrates for 30 min or 1 hour. The reaction was terminated by adding 60 μl of DNS Solution. The absorbance of assay mix was read at 575 nm after the incubation at 100° C. for 5 min. The activity of enzymes as a function of temperature and pH was measured with CMC. Temperature gradient was achieved using PCR cycler (MJ Research). Phosphate/citrate buffers were used to generate pH gradient (ie., 2, 3, 4, 5, 6, 7, 8, 9.1). For the thermostability assay, each enzyme was incubated at 90° C. An aliquot of enzymes was taken each day. Residual activity was measured with CMC.

Hydrolysis of p-Nitrophenol-β-D-Glucoside

[0062] Activity of β-glucosidase was determined spectrophotometrically by monitoring the release of p-nitrophenol from the substrate p-nitrophenol-β-D-glucoside (Sigma) at various temperatures and pH. The assay mix contained 10 μl of diluted enzymes, 30 μl of 100 mm pH buffer, and 20 μl of 50 mM p-nitrophenol-β-D-glucoside for 10 min. The reaction was terminated by adding 120 μl of 1M Na₂CO₃. The absorbance of assay mix was read at 412 nm. Temperature and pH dependent activities and thermostability were measured as described above except that p-nitrophenol-β-D-glucoside was used as substrate.

Capillary Electrophoresis of Oligosaccharides

[0063] Capillary electrophoresis of oligosaccharides was performed on a BioFocus 2000 (Bio-Rad Laboratories,) with laser-induced fluorescence detection. A fused-silica capillary (TSP050375, Polymicro Technologies) of internal diameter 50 μm and length 31 cm was used as the separation column for oligosaccharides. The samples were injected by application of 4.5 lbin-2 of helium pressure for 0.22 sec. Electrophoresis conditions were 15 kV/70-100 μA with the cathode at the inlet, 0.1 M sodium phosphate, pH 2.5, as running buffer, and a controlled temperature of 20° C. The capillary was rinsed with 1 M NaOH followed by running buffer with adip-cycle to prevent carryover after injection. Oligomers labeled with APTS were excited at 488 nm and emission was collected through a 520-nm band pass filter.

Biomass Substrate Specificity of Termocels

[0064] A table depicting the biomass substrate specificity of Termocels 1-8 is provided as FIG. 15.

[0065] While the invention has been described in terms of its preferred embodiments, those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the appended claims. Accordingly, the present invention should not be limited to the embodiments as described above, but should further include all modifications and equivalents thereof within the spirit and scope of the description provided herein.

Sequence CWU 1

1

321903DNAPyrococcus furiosus 1atgatctatt ttgttgagaa ataccacacc tcagaagaca aatccacaag caatacctcc 60tcaacccccc ctcaaacgac acttagcaca acaaaggttc tcaaaattcg gtatcctgac 120gacggcgaat ggcctggcgc tcccatagac aaagacggcg acggaaatcc tgagttctat 180atcgaaatca acctctggaa catactcaac gcgactggat tcgcagagat gacctataac 240ttgacatctg gcgttctcca ttacgttcaa caactcgata atatcgttct ccgcgatcgc 300tcaaactggg tacatggcta tcctgaaatt ttttacggca ataaaccctg gaacgcgaat 360tatgccaccg acggcccgat ccctctcccc agtaaagttt ccaatctcac agacttttac 420ttgactatct cctacaagct tgaaccaaag aacggactcc ctataaattt tgcaatcgaa 480tcttggctta ctagagaagc atggcgcact actggaatca actccgatga acaggaagta 540atgatctgga tttactatga cggactccaa ccagccggtt ccaaggtgaa agaaatcgtt 600gtacctataa tcgttaatgg caccccagtt aatgctacct tcgaagtgtg gaaagctaat 660atcggatggg aatacgttgc ctttagaatc aagacaccaa ttaaagaagg aaccgtgaca 720atcccctacg gtgcattcat tagcgtagct gctaacattt cttccctccc aaattacaca 780gaactttacc tggaagacgt tgagataggc acagagtttg gaacaccttc aactactagc 840gcacatctcg aatggtggat tactaacatt accctcaccc cacttgatcg tcccctgatc 900tcc 9032301PRTPyrococcus furiosus 2Met Ile Tyr Phe Val Glu Lys Tyr His Thr Ser Glu Asp Lys Ser Thr 1 5 10 15 Ser Asn Thr Ser Ser Thr Pro Pro Gln Thr Thr Leu Ser Thr Thr Lys 20 25 30 Val Leu Lys Ile Arg Tyr Pro Asp Asp Gly Glu Trp Pro Gly Ala Pro 35 40 45 Ile Asp Lys Asp Gly Asp Gly Asn Pro Glu Phe Tyr Ile Glu Ile Asn 50 55 60 Leu Trp Asn Ile Leu Asn Ala Thr Gly Phe Ala Glu Met Thr Tyr Asn 65 70 75 80 Leu Thr Ser Gly Val Leu His Tyr Val Gln Gln Leu Asp Asn Ile Val 85 90 95 Leu Arg Asp Arg Ser Asn Trp Val His Gly Tyr Pro Glu Ile Phe Tyr 100 105 110 Gly Asn Lys Pro Trp Asn Ala Asn Tyr Ala Thr Asp Gly Pro Ile Pro 115 120 125 Leu Pro Ser Lys Val Ser Asn Leu Thr Asp Phe Tyr Leu Thr Ile Ser 130 135 140 Tyr Lys Leu Glu Pro Lys Asn Gly Leu Pro Ile Asn Phe Ala Ile Glu 145 150 155 160 Ser Trp Leu Thr Arg Glu Ala Trp Arg Thr Thr Gly Ile Asn Ser Asp 165 170 175 Glu Gln Glu Val Met Ile Trp Ile Tyr Tyr Asp Gly Leu Gln Pro Ala 180 185 190 Gly Ser Lys Val Lys Glu Ile Val Val Pro Ile Ile Val Asn Gly Thr 195 200 205 Pro Val Asn Ala Thr Phe Glu Val Trp Lys Ala Asn Ile Gly Trp Glu 210 215 220 Tyr Val Ala Phe Arg Ile Lys Thr Pro Ile Lys Glu Gly Thr Val Thr 225 230 235 240 Ile Pro Tyr Gly Ala Phe Ile Ser Val Ala Ala Asn Ile Ser Ser Leu 245 250 255 Pro Asn Tyr Thr Glu Leu Tyr Leu Glu Asp Val Glu Ile Gly Thr Glu 260 265 270 Phe Gly Thr Pro Ser Thr Thr Ser Ala His Leu Glu Trp Trp Ile Thr 275 280 285 Asn Ile Thr Leu Thr Pro Leu Asp Arg Pro Leu Ile Ser 290 295 300 3825DNAThermotoga petrophila 3atgaggtggg tagttcttct gatggtggcg ttttctgctc tgctcttttc ctccgaggtg 60gttctcacga gcgttggcgc agcggatatc tccttcaacg gatttcccgt caccatggag 120ctcaacttct ggaacataaa gtcgtatgag ggagaaacgt ggctcaaatt cgatggagaa 180aaggttgagt tctacgcgga tttgtacaac atcgttcttc agaatccaga cagctgggtg 240catggatatc cggagatcta ctacggttac aagccctggg cgagtcacaa cagcggtgtt 300gaatttcttc ctgtgaaggt gaaagatctt ccggatttct acgtgactct tgattactcg 360atctggtacg aaaacaatct gcctatcaac cttgcaatgg aaacatggat cacgaaaagc 420cccgaccaga cttctgtttc ttcgggtgat gcggagatca tggtttggtt ttacaacaac 480gttctgatgc ccggcggtca gaaagtggat gagttcacca caacagttga gataaacgga 540gtgaagcagg aagcaaaatg ggatgtttac ttcgcaccgt ggagctggga ttaccttgcc 600ttcagactga caacaccgat gaaagaagga aaggtgaagt tcaacgtgaa ggacttcgtt 660cagaaagccg cggaagttgt caaaaagcac tcaacgagaa tagacaattt cgaagagctg 720tatttctgcg tctgggagat cgggacggaa tttggagatc caaacacaac aacggcaaaa 780ttcggctgga ccttcaaaga cttcttcgtc gaagttgtaa aataa 8254274PRTThermotoga petrophila 4Met Arg Trp Val Val Leu Leu Met Val Ala Phe Ser Ala Leu Leu Phe 1 5 10 15 Ser Ser Glu Val Val Leu Thr Ser Val Gly Ala Ala Asp Ile Ser Phe 20 25 30 Asn Gly Phe Pro Val Thr Met Glu Leu Asn Phe Trp Asn Ile Lys Ser 35 40 45 Tyr Glu Gly Glu Thr Trp Leu Lys Phe Asp Gly Glu Lys Val Glu Phe 50 55 60 Tyr Ala Asp Leu Tyr Asn Ile Val Leu Gln Asn Pro Asp Ser Trp Val 65 70 75 80 His Gly Tyr Pro Glu Ile Tyr Tyr Gly Tyr Lys Pro Trp Ala Ser His 85 90 95 Asn Ser Gly Val Glu Phe Leu Pro Val Lys Val Lys Asp Leu Pro Asp 100 105 110 Phe Tyr Val Thr Leu Asp Tyr Ser Ile Trp Tyr Glu Asn Asn Leu Pro 115 120 125 Ile Asn Leu Ala Met Glu Thr Trp Ile Thr Lys Ser Pro Asp Gln Thr 130 135 140 Ser Val Ser Ser Gly Asp Ala Glu Ile Met Val Trp Phe Tyr Asn Asn 145 150 155 160 Val Leu Met Pro Gly Gly Gln Lys Val Asp Glu Phe Thr Thr Thr Val 165 170 175 Glu Ile Asn Gly Val Lys Gln Glu Ala Lys Trp Asp Val Tyr Phe Ala 180 185 190 Pro Trp Ser Trp Asp Tyr Leu Ala Phe Arg Leu Thr Thr Pro Met Lys 195 200 205 Glu Gly Lys Val Lys Phe Asn Val Lys Asp Phe Val Gln Lys Ala Ala 210 215 220 Glu Val Val Lys Lys His Ser Thr Arg Ile Asp Asn Phe Glu Glu Leu 225 230 235 240 Tyr Phe Cys Val Trp Glu Ile Gly Thr Glu Phe Gly Asp Pro Asn Thr 245 250 255 Thr Thr Ala Lys Phe Gly Trp Thr Phe Lys Asp Phe Phe Val Glu Val 260 265 270 Val Lys 51377DNAPyrococcus horikoshii 5atggagggga atactattct taaaatcgta ctaatttgca ctattttagc aggcctattc 60gggcaagtcg tgccagtata tgcagaaaat acaacatatc aaacaccgac tggaatttac 120tacgaagtga gaggagatac gatatacatg attaatgtca ccagtggaga ggaaactccc 180attcatctct ttggtgtaaa ctggtttggc tttgaaacac ctaatcatgt agtgcacgga 240ctttggaaga gaaactggga agacatgctt cttcagatca aaagcttagg cttcaatgca 300ataagacttc ctttctgtac tgagtctgta aaaccaggaa cacaaccaat tggaatagat 360tacagtaaaa atccagatct tcgtggacta gatagcctac agattatgga aaagatcata 420aagaaggccg gagatcttgg tatctttgtc ttactcgact atcataggat aggatgcact 480cacatagaac ccctctggta cacggaagac ttctcagagg aagactttat taacacatgg 540atagaggttg ccaaaaggtt cggtaagtac tggaacgtaa taggggctga tctaaagaat 600gagcctcata gtgttacctc acccccagct gcttatacag atggtaccgg ggctacatgg 660ggtatgggaa accctgcaac cgattggaac ttggcggctg agaggatagg aaaagcgatt 720ctgaaggttg cccctcattg gttgatattc gtggagggga cacaatttac taatccgaag 780actgacagta gttacaaatg gggctacaac gcttggtggg gaggaaatct aatggccgta 840aaggattatc cagttaactt acctaggaat aagctagtat acagccctca cgtatatggg 900ccagatgtct ataatcaacc gtactttggt cccgctaagg gttttccgga taatcttcca 960gatatctggt atcaccactt tggatacgta aaattagaac taggatattc agttgtaata 1020ggagagtttg gaggaaaata tgggcatgga ggcgatccaa gggatgttat atggcaaaat 1080aagctagttg attggatgat agagaataaa ttttgtgatt tcttttactg gagctggaat 1140ccagatagtg gagataccgg agggattcta caggatgatt ggacaacaat atgggaagat 1200aagtataata acctgaagag attgatggat agttgttcca aaagttcttc aagtactcaa 1260tccgttattc ggagtaccac ccctacaaag tcaaatacaa gtaagaagat ttgtggacca 1320gcaattctta tcatcctagc agtattctct cttctcttaa gaagggctcc caggtag 13776458PRTPyrococcus horikoshii 6Met Glu Gly Asn Thr Ile Leu Lys Ile Val Leu Ile Cys Thr Ile Leu 1 5 10 15 Ala Gly Leu Phe Gly Gln Val Val Pro Val Tyr Ala Glu Asn Thr Thr 20 25 30 Tyr Gln Thr Pro Thr Gly Ile Tyr Tyr Glu Val Arg Gly Asp Thr Ile 35 40 45 Tyr Met Ile Asn Val Thr Ser Gly Glu Glu Thr Pro Ile His Leu Phe 50 55 60 Gly Val Asn Trp Phe Gly Phe Glu Thr Pro Asn His Val Val His Gly 65 70 75 80 Leu Trp Lys Arg Asn Trp Glu Asp Met Leu Leu Gln Ile Lys Ser Leu 85 90 95 Gly Phe Asn Ala Ile Arg Leu Pro Phe Cys Thr Glu Ser Val Lys Pro 100 105 110 Gly Thr Gln Pro Ile Gly Ile Asp Tyr Ser Lys Asn Pro Asp Leu Arg 115 120 125 Gly Leu Asp Ser Leu Gln Ile Met Glu Lys Ile Ile Lys Lys Ala Gly 130 135 140 Asp Leu Gly Ile Phe Val Leu Leu Asp Tyr His Arg Ile Gly Cys Thr 145 150 155 160 His Ile Glu Pro Leu Trp Tyr Thr Glu Asp Phe Ser Glu Glu Asp Phe 165 170 175 Ile Asn Thr Trp Ile Glu Val Ala Lys Arg Phe Gly Lys Tyr Trp Asn 180 185 190 Val Ile Gly Ala Asp Leu Lys Asn Glu Pro His Ser Val Thr Ser Pro 195 200 205 Pro Ala Ala Tyr Thr Asp Gly Thr Gly Ala Thr Trp Gly Met Gly Asn 210 215 220 Pro Ala Thr Asp Trp Asn Leu Ala Ala Glu Arg Ile Gly Lys Ala Ile 225 230 235 240 Leu Lys Val Ala Pro His Trp Leu Ile Phe Val Glu Gly Thr Gln Phe 245 250 255 Thr Asn Pro Lys Thr Asp Ser Ser Tyr Lys Trp Gly Tyr Asn Ala Trp 260 265 270 Trp Gly Gly Asn Leu Met Ala Val Lys Asp Tyr Pro Val Asn Leu Pro 275 280 285 Arg Asn Lys Leu Val Tyr Ser Pro His Val Tyr Gly Pro Asp Val Tyr 290 295 300 Asn Gln Pro Tyr Phe Gly Pro Ala Lys Gly Phe Pro Asp Asn Leu Pro 305 310 315 320 Asp Ile Trp Tyr His His Phe Gly Tyr Val Lys Leu Glu Leu Gly Tyr 325 330 335 Ser Val Val Ile Gly Glu Phe Gly Gly Lys Tyr Gly His Gly Gly Asp 340 345 350 Pro Arg Asp Val Ile Trp Gln Asn Lys Leu Val Asp Trp Met Ile Glu 355 360 365 Asn Lys Phe Cys Asp Phe Phe Tyr Trp Ser Trp Asn Pro Asp Ser Gly 370 375 380 Asp Thr Gly Gly Ile Leu Gln Asp Asp Trp Thr Thr Ile Trp Glu Asp 385 390 395 400 Lys Tyr Asn Asn Leu Lys Arg Leu Met Asp Ser Cys Ser Lys Ser Ser 405 410 415 Ser Ser Thr Gln Ser Val Ile Arg Ser Thr Thr Pro Thr Lys Ser Asn 420 425 430 Thr Ser Lys Lys Ile Cys Gly Pro Ala Ile Leu Ile Ile Leu Ala Val 435 440 445 Phe Ser Leu Leu Leu Arg Arg Ala Pro Arg 450 455 71542DNAPyrococcus abyssi 7atggaaatca agctcttctg cgtgtttatc gtgttcatca tcctcttctc ccctttcgtg 60attgcactct cgtatccaga tgttaactat actgccgaga atggtattat cttcgtgcag 120aacgtcacta cgggtgagaa gaagccactt tatcttcacg gagtgtcatg gtttggattc 180gagctgaagg accacgtcgt ctatggcttg gataaacgga actggaaaga tatactcaag 240gatgttaagc gcttgggttt taatgctatc aggcttccct tctgctctga aagcatccgc 300cctgatacgc gcccttcgcc tgagcggata aactacgagt tgaaccccga cttgaagaat 360ctgacttccc tcgaaataat ggagaagatt attgaatacg ccaactcaat cgggctctac 420atactcttgg attatcaccg catcggttgt gaggagatcg aacctctttg gtataccgag 480aattactcag aggagcagta tataaaggat tggatcttcc tcgcaaagcg gttcgggaag 540taccctaacg tgataggagc tgatatcaag aacgagccgc atggtgaagc cgggtggggt 600acgggagatg agcgggattt ccgcctcttt gccgagaagg tcgggcgcga gatactcaag 660gtggccccac actggttgat attcgtcgag ggaacgcaat atacccatgt cccgaatatt 720gatgagatca tcgagaagaa gggctggtgg acattttggg gagagaatct tatgggagtt 780aaggactatc cagtcaggct tccgcgcggc aaggtcgtgt actcaccgca tgtctatgga 840ccatctgtct acatgatgga ctacttcaag tcgccagact ttccgaacaa tatgccgata 900atctgggaaa cacacttcgg atacttgacc gacctgaatt ataccttggt cataggcgag 960tggggtggca actatgaggg ccttgacaag gtgtggcaag acgctttcgt gaagtggctg 1020attaagaaga agatctataa cttcttctac tggtgcctga acccggagtc gggtgacacc 1080ggtggcatct ttctcgacga ctggaaaacc gttaactggg aaaagatgag ggttatttac 1140aggctcatca aggcggcgaa ccccgagttt gaggaacccc tttacatcat tttgaaaact 1200aacgcgacga catctatcct gggcgtgggt gagaggatcc ggatttactg gtacacaaat 1260ggcaaagtta ttgactctaa cttcgcgcat tccagcgaag gcgaaatgaa cattacagtg 1320acgaagtcca tgactctgta catcatcgtg aagaagggca atcagacact gaggaaggaa 1380ctcaaactgt acgttatcgg cggcaattac ggctccaata tctccactac ccagctggtt 1440actcccaaga aaggcggcga aaggattagc accagcctga agctggcaat tagcctgctc 1500ttcattctcc tcttcgtttg gtatctcctc cgggagaagc at 15428514PRTPyrococcus abyssi 8Met Glu Ile Lys Leu Phe Cys Val Phe Ile Val Phe Ile Ile Leu Phe 1 5 10 15 Ser Pro Phe Val Ile Ala Leu Ser Tyr Pro Asp Val Asn Tyr Thr Ala 20 25 30 Glu Asn Gly Ile Ile Phe Val Gln Asn Val Thr Thr Gly Glu Lys Lys 35 40 45 Pro Leu Tyr Leu His Gly Val Ser Trp Phe Gly Phe Glu Leu Lys Asp 50 55 60 His Val Val Tyr Gly Leu Asp Lys Arg Asn Trp Lys Asp Ile Leu Lys 65 70 75 80 Asp Val Lys Arg Leu Gly Phe Asn Ala Ile Arg Leu Pro Phe Cys Ser 85 90 95 Glu Ser Ile Arg Pro Asp Thr Arg Pro Ser Pro Glu Arg Ile Asn Tyr 100 105 110 Glu Leu Asn Pro Asp Leu Lys Asn Leu Thr Ser Leu Glu Ile Met Glu 115 120 125 Lys Ile Ile Glu Tyr Ala Asn Ser Ile Gly Leu Tyr Ile Leu Leu Asp 130 135 140 Tyr His Arg Ile Gly Cys Glu Glu Ile Glu Pro Leu Trp Tyr Thr Glu 145 150 155 160 Asn Tyr Ser Glu Glu Gln Tyr Ile Lys Asp Trp Ile Phe Leu Ala Lys 165 170 175 Arg Phe Gly Lys Tyr Pro Asn Val Ile Gly Ala Asp Ile Lys Asn Glu 180 185 190 Pro His Gly Glu Ala Gly Trp Gly Thr Gly Asp Glu Arg Asp Phe Arg 195 200 205 Leu Phe Ala Glu Lys Val Gly Arg Glu Ile Leu Lys Val Ala Pro His 210 215 220 Trp Leu Ile Phe Val Glu Gly Thr Gln Tyr Thr His Val Pro Asn Ile 225 230 235 240 Asp Glu Ile Ile Glu Lys Lys Gly Trp Trp Thr Phe Trp Gly Glu Asn 245 250 255 Leu Met Gly Val Lys Asp Tyr Pro Val Arg Leu Pro Arg Gly Lys Val 260 265 270 Val Tyr Ser Pro His Val Tyr Gly Pro Ser Val Tyr Met Met Asp Tyr 275 280 285 Phe Lys Ser Pro Asp Phe Pro Asn Asn Met Pro Ile Ile Trp Glu Thr 290 295 300 His Phe Gly Tyr Leu Thr Asp Leu Asn Tyr Thr Leu Val Ile Gly Glu 305 310 315 320 Trp Gly Gly Asn Tyr Glu Gly Leu Asp Lys Val Trp Gln Asp Ala Phe 325 330 335 Val Lys Trp Leu Ile Lys Lys Lys Ile Tyr Asn Phe Phe Tyr Trp Cys 340 345 350 Leu Asn Pro Glu Ser Gly Asp Thr Gly Gly Ile Phe Leu Asp Asp Trp 355 360 365 Lys Thr Val Asn Trp Glu Lys Met Arg Val Ile Tyr Arg Leu Ile Lys 370 375 380 Ala Ala Asn Pro Glu Phe Glu Glu Pro Leu Tyr Ile Ile Leu Lys Thr 385 390 395 400 Asn Ala Thr Thr Ser Ile Leu Gly Val Gly Glu Arg Ile Arg Ile Tyr 405 410 415 Trp Tyr Thr Asn Gly Lys Val Ile Asp Ser Asn Phe Ala His Ser Ser 420 425 430 Glu Gly Glu Met Asn Ile Thr Val Thr Lys Ser Met Thr Leu Tyr Ile 435 440 445 Ile Val Lys Lys Gly Asn Gln Thr Leu Arg Lys Glu Leu Lys Leu Tyr 450 455 460 Val Ile Gly Gly Asn Tyr Gly Ser Asn Ile Ser Thr Thr Gln Leu Val 465 470 475 480 Thr Pro Lys Lys Gly Gly Glu Arg Ile Ser Thr Ser Leu Lys Leu Ala 485 490 495 Ile Ser Leu Leu Phe Ile Leu Leu Phe Val Trp Tyr Leu Leu Arg Glu 500 505

510 Lys His 9987DNAThermotoga petrophila 9atggaaacgc tcctccctgt agtcgtggtc cacgatattg agccagtttc aatgcgtctt 60cagaggtaca agaacaaaaa ttcgataaaa agagaaaagc agggattaat acccctgttt 120ttttattttt gggtgtattt agttctattt gcgaattttc agattttgaa tgtaaacatt 180ttcataataa gatgttttct ggaggtgata atggtggtac tgatgacaaa accgggaaca 240tcggattttg tatggaatgg cattcccctt tccatggagc tgaatctgtg gaacataaag 300gaatactccg gttctgtagc tatgaaattc gacggtgaaa aggtaacttt cgacgcggac 360attcagaatc tttctccaaa agaaccagaa aggtacgttc tcggttatcc cgagttctat 420tacggttata aaccctggga aaagcacacg gcagaaggtt cgaaacttcc agtacctgtt 480tcctctatga aatcattttc cgtcgaagtt tctttcgata ttcaccacga accgtctctg 540cctttgaact ttgccatgga aacatggctc acaagagaaa agtaccagac ggaagcgtcg 600atcggcgatg ttgaaatcat ggtctggttc tatttcaaca atctcacacc agggggcaaa 660aagatagagg agtttacgat tccgttcgtg ctgaacggag agagtgtcga aggcacctgg 720gaactgtggc acgcggagtg gggatgggac tacctcgctt tccgcttgaa ggatcccgtg 780aagaagggaa gggtgaagtt cgacgtgagg cattttcttg atgccgccgg gaaagctctt 840tcgaattcca ctcgtgtgaa agattttgaa aatctttact tcaccgtctg ggaaattgga 900accgagtttg gaagcccgga aacaaagagc gcgcaattcg ggtggaagtt tgaaaacttc 960tctattgatc tggaggtgag agaatga 98710328PRTThermotoga petrophila 10Met Glu Thr Leu Leu Pro Val Val Val Val His Asp Ile Glu Pro Val 1 5 10 15 Ser Met Arg Leu Gln Arg Tyr Lys Asn Lys Asn Ser Ile Lys Arg Glu 20 25 30 Lys Gln Gly Leu Ile Pro Leu Phe Phe Tyr Phe Trp Val Tyr Leu Val 35 40 45 Leu Phe Ala Asn Phe Gln Ile Leu Asn Val Asn Ile Phe Ile Ile Arg 50 55 60 Cys Phe Leu Glu Val Ile Met Val Val Leu Met Thr Lys Pro Gly Thr 65 70 75 80 Ser Asp Phe Val Trp Asn Gly Ile Pro Leu Ser Met Glu Leu Asn Leu 85 90 95 Trp Asn Ile Lys Glu Tyr Ser Gly Ser Val Ala Met Lys Phe Asp Gly 100 105 110 Glu Lys Val Thr Phe Asp Ala Asp Ile Gln Asn Leu Ser Pro Lys Glu 115 120 125 Pro Glu Arg Tyr Val Leu Gly Tyr Pro Glu Phe Tyr Tyr Gly Tyr Lys 130 135 140 Pro Trp Glu Lys His Thr Ala Glu Gly Ser Lys Leu Pro Val Pro Val 145 150 155 160 Ser Ser Met Lys Ser Phe Ser Val Glu Val Ser Phe Asp Ile His His 165 170 175 Glu Pro Ser Leu Pro Leu Asn Phe Ala Met Glu Thr Trp Leu Thr Arg 180 185 190 Glu Lys Tyr Gln Thr Glu Ala Ser Ile Gly Asp Val Glu Ile Met Val 195 200 205 Trp Phe Tyr Phe Asn Asn Leu Thr Pro Gly Gly Lys Lys Ile Glu Glu 210 215 220 Phe Thr Ile Pro Phe Val Leu Asn Gly Glu Ser Val Glu Gly Thr Trp 225 230 235 240 Glu Leu Trp His Ala Glu Trp Gly Trp Asp Tyr Leu Ala Phe Arg Leu 245 250 255 Lys Asp Pro Val Lys Lys Gly Arg Val Lys Phe Asp Val Arg His Phe 260 265 270 Leu Asp Ala Ala Gly Lys Ala Leu Ser Asn Ser Thr Arg Val Lys Asp 275 280 285 Phe Glu Asn Leu Tyr Phe Thr Val Trp Glu Ile Gly Thr Glu Phe Gly 290 295 300 Ser Pro Glu Thr Lys Ser Ala Gln Phe Gly Trp Lys Phe Glu Asn Phe 305 310 315 320 Ser Ile Asp Leu Glu Val Arg Glu 325 11852DNACaldivirga maquilingenesis 11atgttgaaac ttattccact tgttaatggc aattataagt tgattcaatg ggagccactc 60ggcggcgtgc acggagcaga tatcgagtgc atacatgtta ccccaaacgt atggaacata 120gataaatcat cagttggcac tgtacagatc gaatatgagc cccaagttgg ctgtcttcgt 180ttttcaattg atttcccgag gataagtata agacataatg taggcgtagc ggcatattca 240gaagttattt acggacacaa gccgtggggc cccaccactt gcatggaccc tcagttcaag 300ttccctatca aagtcaatga gtcaaaagga ctgtactcgt atgtaaatta taacgttaaa 360tctaggtcac cagatgactc aatctttaat attgcttacg atctctggct tacaacgtcc 420ccaaacctta caaacggacc ccagccagga gacgtagaag ttatgatctg gttgtactac 480cacggacagc gccctgcagg cagactcatc ggggaactcc gcatgccgat tacattgggc 540gatagtgagg cggcacgtga ctttgaagta tgggtggctg acacaggaat aggaatcggt 600gaatgggcgg tagtgacctt cagaatcaag gacccaataa agggcggttt gataggagtt 660aacctcataa actacatcga aagtgctttt aaaacgctcg aagaactcaa cccggtcaag 720tggcggtacg gcgacctgct caacaaatat cttaatggaa ttgaattcgg cagtgagttt 780ggtaatgtct cctcaggaat gataaaactt aattgggaac tctgcggcct gagccttgtg 840aaagactctt ct 85212284PRTThermotoga petrophila 12Met Leu Lys Leu Ile Pro Leu Val Asn Gly Asn Tyr Lys Leu Ile Gln 1 5 10 15 Trp Glu Pro Leu Gly Gly Val His Gly Ala Asp Ile Glu Cys Ile His 20 25 30 Val Thr Pro Asn Val Trp Asn Ile Asp Lys Ser Ser Val Gly Thr Val 35 40 45 Gln Ile Glu Tyr Glu Pro Gln Val Gly Cys Leu Arg Phe Ser Ile Asp 50 55 60 Phe Pro Arg Ile Ser Ile Arg His Asn Val Gly Val Ala Ala Tyr Ser 65 70 75 80 Glu Val Ile Tyr Gly His Lys Pro Trp Gly Pro Thr Thr Cys Met Asp 85 90 95 Pro Gln Phe Lys Phe Pro Ile Lys Val Asn Glu Ser Lys Gly Leu Tyr 100 105 110 Ser Tyr Val Asn Tyr Asn Val Lys Ser Arg Ser Pro Asp Asp Ser Ile 115 120 125 Phe Asn Ile Ala Tyr Asp Leu Trp Leu Thr Thr Ser Pro Asn Leu Thr 130 135 140 Asn Gly Pro Gln Pro Gly Asp Val Glu Val Met Ile Trp Leu Tyr Tyr 145 150 155 160 His Gly Gln Arg Pro Ala Gly Arg Leu Ile Gly Glu Leu Arg Met Pro 165 170 175 Ile Thr Leu Gly Asp Ser Glu Ala Ala Arg Asp Phe Glu Val Trp Val 180 185 190 Ala Asp Thr Gly Ile Gly Ile Gly Glu Trp Ala Val Val Thr Phe Arg 195 200 205 Ile Lys Asp Pro Ile Lys Gly Gly Leu Ile Gly Val Asn Leu Ile Asn 210 215 220 Tyr Ile Glu Ser Ala Phe Lys Thr Leu Glu Glu Leu Asn Pro Val Lys 225 230 235 240 Trp Arg Tyr Gly Asp Leu Leu Asn Lys Tyr Leu Asn Gly Ile Glu Phe 245 250 255 Gly Ser Glu Phe Gly Asn Val Ser Ser Gly Met Ile Lys Leu Asn Trp 260 265 270 Glu Leu Cys Gly Leu Ser Leu Val Lys Asp Ser Ser 275 280 132166DNAThermotoga petrophila 13atgatgggaa agatcgatga aatcctttca cagctgacta ttgaagaaaa agtgaaactt 60gtagtggggg ttggtcttcc aggacttttt ggaaatccac attccagagt ggcaggtgca 120gctggagaaa cgcatcctgt tccgaggctt ggaattcctt ctttcgttct ggccgacggt 180cccgcgggcc tcagaataaa tcccacaaga gagaacgacg aaaacaccta ttacacaaca 240gcgtttcctg ttgaaatcat gctcgcttcc acctggaaca aagatcttct ggaagaagta 300ggaaaagcta tgggagaaga agtcagggaa tacggtgtcg atgtgcttct tgcacctgcg 360atgaacattc acaggaaccc tctttgtgga aggaatttcg agtattattc agaagatcct 420gtcctttccg gtgaaatggc ttcagccttt gtcaagggag ttcaatctca aggggtggga 480gcctgcataa aacactttgt cgcgaacaac caggaaacga acaggatggt agtggacacg 540atcgtgtccg agcgagccct cagagaaata tatctgaaag gttttgaaat tgccgtcaag 600aaagcaagac cctggaccgt gatgagcgct tacaacaaac tgaatggaaa atactgttca 660cagaacgaat ggcttttgaa gaaggttctc agggaagaat ggggatttga cggtttcgtg 720atgagcgact ggtacgcggg agacaaccct gtagaacagc tcaaggccgg aaacgatatg 780atcatgcctg gaaaagcgta tcaggtgaac acggaaagaa gagatgaaat agaagaaatc 840atggaggcgt tgaaggaggg aagactcagt gaggaagtcc tgaacgaatg tgtgagaaac 900atcctcaaag ttcttgtgaa cgcgccttcc tttaaagggt acaggtactc gaacaaaccg 960gacctcgaat ctcacgcgaa agttgcctac gaagcaggtg tggagggtgt tgtccttctt 1020gagaacaacg gtgttcttcc attcgatgaa agtatccatg tcgccgtctt tggcaccggt 1080caaatcgaaa caataaaggg aggaacggga agtggagaca cccatccgag atacacgatc 1140tctatccttg aaggcataaa agaaagaaac atgaagttcg acgaagaact cacctccatc 1200tatgaggatt acatcaaaaa gatgagagaa acagaggaat ataaacccag aactgactcc 1260tggggaacgg ttataaaacc gaaacttcca gagaactttc tctcagaaaa agagataaag 1320aaggctgcga agaaaaacga tgctgcagtt gttgtaatca gtaggatctc cggtgaggga 1380tacgacagaa agccggtgaa aggtgacttc acctctccga tgacgagctg gagctcataa 1440aaacagtctc aagggaattc cacgaacagg gtaagaaggt tgtggttctt ctcaacatcg 1500gaagtcccat tgaagttgca agctggagag atcttgtgga tggaatcctt ctcgtctggc 1560aagcaggaca ggagatggga agaatagtgg ccgatgttct tgtgggaagg gtaaacccct 1620ccggaaaact tccaacgacc ttcccgaagg attactcgga cgttccatcc tggacgttcc 1680caggagagcc aaaggacaat ccgcaaagag tggtgtacga ggaagacatc tacgtgggat 1740acaggtacta cgacaccttt ggtgtggaac ctgcctacga gttcggctac ggcctctctt 1800acacaaagtt tgaatacaaa gatttaaaga tcgctatcga cggagatata ctcagagtgt 1860cgtacacgat cacaaacacc ggggacagag ctggaaagga agtctcacag gtttatgtca 1920aagctccaaa agggaaaata gacaaaccct tccaggagct gaaagcgttc cacaaaacaa 1980aacttttgaa cccgggtgaa tccgaaaaga tctttctgga aattcctctt agagatcttg 2040cgagtttcga tgggaaagaa tggttgtcga gtcaggagaa tacgaggtca gggtcggtgc 2100atcttcgagg gatataggtt gagagatatt tttctggttg agggagagaa gagattcaaa 2160ccatga 216614722PRTThermotoga petrophila 14Met Met Gly Lys Ile Asp Glu Ile Leu Ser Gln Leu Thr Ile Glu Glu 1 5 10 15 Lys Val Lys Leu Val Val Gly Val Gly Leu Pro Gly Leu Phe Gly Asn 20 25 30 Pro His Ser Arg Val Ala Gly Ala Ala Gly Glu Thr His Pro Val Pro 35 40 45 Arg Leu Gly Ile Pro Ser Phe Val Leu Ala Asp Gly Pro Ala Gly Leu 50 55 60 Arg Ile Asn Pro Thr Arg Glu Asn Asp Glu Asn Thr Tyr Tyr Thr Thr 65 70 75 80 Ala Phe Pro Val Glu Ile Met Leu Ala Ser Thr Trp Asn Lys Asp Leu 85 90 95 Leu Glu Glu Val Gly Lys Ala Met Gly Glu Glu Val Arg Glu Tyr Gly 100 105 110 Val Asp Val Leu Leu Ala Pro Ala Met Asn Ile His Arg Asn Pro Leu 115 120 125 Cys Gly Arg Asn Phe Glu Tyr Tyr Ser Glu Asp Pro Val Leu Ser Gly 130 135 140 Glu Met Ala Ser Ala Phe Val Lys Gly Val Gln Ser Gln Gly Val Gly 145 150 155 160 Ala Cys Ile Lys His Phe Val Ala Asn Asn Gln Glu Thr Asn Arg Met 165 170 175 Val Val Asp Thr Ile Val Ser Glu Arg Ala Leu Arg Glu Ile Tyr Leu 180 185 190 Lys Gly Phe Glu Ile Ala Val Lys Lys Ala Arg Pro Trp Thr Val Met 195 200 205 Ser Ala Tyr Asn Lys Leu Asn Gly Lys Tyr Cys Ser Gln Asn Glu Trp 210 215 220 Leu Leu Lys Lys Val Leu Arg Glu Glu Trp Gly Phe Asp Gly Phe Val 225 230 235 240 Met Ser Asp Trp Tyr Ala Gly Asp Asn Pro Val Glu Gln Leu Lys Ala 245 250 255 Gly Asn Asp Met Ile Met Pro Gly Lys Ala Tyr Gln Val Asn Thr Glu 260 265 270 Arg Arg Asp Glu Ile Glu Glu Ile Met Glu Ala Leu Lys Glu Gly Arg 275 280 285 Leu Ser Glu Glu Val Leu Asn Glu Cys Val Arg Asn Ile Leu Lys Val 290 295 300 Leu Val Asn Ala Pro Ser Phe Lys Gly Tyr Arg Tyr Ser Asn Lys Pro 305 310 315 320 Asp Leu Glu Ser His Ala Lys Val Ala Tyr Glu Ala Gly Val Glu Gly 325 330 335 Val Val Leu Leu Glu Asn Asn Gly Val Leu Pro Phe Asp Glu Ser Ile 340 345 350 His Val Ala Val Phe Gly Thr Gly Gln Ile Glu Thr Ile Lys Gly Gly 355 360 365 Thr Gly Ser Gly Asp Thr His Pro Arg Tyr Thr Ile Ser Ile Leu Glu 370 375 380 Gly Ile Lys Glu Arg Asn Met Lys Phe Asp Glu Glu Leu Thr Ser Ile 385 390 395 400 Tyr Glu Asp Tyr Ile Lys Lys Met Arg Glu Thr Glu Glu Tyr Lys Pro 405 410 415 Arg Thr Asp Ser Trp Gly Thr Val Ile Lys Pro Lys Leu Pro Glu Asn 420 425 430 Phe Leu Ser Glu Lys Glu Ile Lys Lys Ala Ala Lys Lys Asn Asp Ala 435 440 445 Ala Val Val Val Ile Ser Arg Ile Ser Gly Glu Gly Tyr Asp Arg Lys 450 455 460 Pro Val Lys Gly Asp Phe Tyr Leu Ser Asp Asp Glu Leu Glu Leu Ile 465 470 475 480 Lys Thr Val Ser Arg Glu Phe His Glu Gln Gly Lys Lys Val Val Val 485 490 495 Leu Leu Asn Ile Gly Ser Pro Ile Glu Val Ala Ser Trp Arg Asp Leu 500 505 510 Val Asp Gly Ile Leu Leu Val Trp Gln Ala Gly Gln Glu Met Gly Arg 515 520 525 Ile Val Ala Asp Val Leu Val Gly Arg Val Asn Pro Ser Gly Lys Leu 530 535 540 Pro Thr Thr Phe Pro Lys Asp Tyr Ser Asp Val Pro Ser Trp Thr Phe 545 550 555 560 Pro Gly Glu Pro Lys Asp Asn Pro Gln Arg Val Val Tyr Glu Glu Asp 565 570 575 Ile Tyr Val Gly Tyr Arg Tyr Tyr Asp Thr Phe Gly Val Glu Pro Ala 580 585 590 Tyr Glu Phe Gly Tyr Gly Leu Ser Tyr Thr Lys Phe Glu Tyr Lys Asp 595 600 605 Leu Lys Ile Ala Ile Asp Gly Asp Ile Leu Arg Val Ser Tyr Thr Ile 610 615 620 Thr Asn Thr Gly Asp Arg Ala Gly Lys Glu Val Ser Gln Val Tyr Val 625 630 635 640 Lys Ala Pro Lys Gly Lys Ile Asp Lys Pro Phe Gln Glu Leu Lys Ala 645 650 655 Phe His Lys Thr Lys Leu Leu Asn Pro Gly Glu Ser Glu Lys Ile Phe 660 665 670 Leu Glu Ile Pro Leu Arg Asp Leu Ala Ser Phe Asp Gly Lys Glu Trp 675 680 685 Val Val Glu Ser Gly Glu Tyr Glu Val Arg Val Gly Ala Ser Ser Arg 690 695 700 Asp Ile Arg Leu Arg Asp Ile Phe Leu Val Glu Gly Glu Lys Arg Phe 705 710 715 720 Lys Pro 151341DNAThermotoga petrophila 15atgaacgtga aaaagttccc tgaaggattc ctctggggtg ttgcaacagc ttcctaccag 60atcgagggtt ctcccctcgc agacggagct ggtatgtcta tctggcacac cttctcccat 120actcctggaa atgtaaagaa cggtgacacg ggagatgtgg cctgcgacca ctacaacaga 180tggaaagagg acattgaaat catagagaaa ctcggagtaa aggcttacag attttcaatc 240agctggccaa gaatacttcc ggaaggaaca ggaagggtga atcagaaagg actggatttt 300tacaacagga tcatagacac cctgctggaa aaaggtatca caccctttgt gaccatctat 360cactgggatc ttcccttcgc tcttcagttg aaaggaggat gggcgaacag agaaatagcg 420gattggttcg cagaatactc aagggttctc tttgaaaatt tcggcgaccg tgtgaagaac 480tggatcacct tgaacgaacc gtgggttgtt gccatagtgg ggcatctgta cggagtccac 540gctcctggaa tgagagatat ttacgtggct ttccgagctg ttcacaatct cttgagggca 600cacgccaaag cggtgaaagt gttcagggaa actgtgaaag atggaaagat cggaatagtt 660ttcaacaatg gatatttcga acctgcgagt gaaaaagagg aggacatcag agcggcgaga 720ttcatgcatc agttcaacaa ctatcctctc tttctcaatc cgatctacag aggagattat 780ccggagctcg ttctggaatt tgccagagag tatctaccgg agaattacaa agatgacatg 840tccgagatac aggaaaagat cgactttgtt ggattgaact attactccgg tcatttggtg 900aagttcgatc cagatgcacc agctaaggtc tctttcgttg aaagggatct tccaaaaaca 960gccatgggat gggagatcgt tccagaagga atctactgga tcctgaagaa ggtgaaagaa 1020gaatacaacc caccagaggt ttacatcaca gagaatgggg ctgcttttga cgacgtagtt 1080agtgaagatg gaagagttca cgatcaaaac agaatcgatt atttgaaggc ccacattggt 1140caggcatgga aggccataca ggagggagtg ccgcttaaag gttacttcgt ctggtcgctc 1200ctcgacaatt tcgaatgggc agagggatat tccaagagat ttggtattgt gtacgtggac 1260tacagtactc aaaaacgcat cataaaagac agtggttact ggtactcgaa cgtggtcaaa 1320agcaacagtc tggaagattg a 134116446PRTThermotoga petrophila 16Met Asn Val Lys Lys Phe Pro Glu Gly Phe Leu Trp Gly Val Ala Thr 1 5 10 15 Ala Ser Tyr Gln Ile Glu Gly Ser Pro Leu Ala Asp Gly Ala Gly Met 20 25 30 Ser Ile Trp His Thr Phe Ser His Thr Pro Gly Asn Val Lys Asn Gly 35 40 45 Asp Thr Gly Asp Val Ala Cys Asp His Tyr Asn Arg Trp Lys Glu Asp 50 55 60 Ile Glu Ile Ile Glu Lys Leu Gly Val Lys Ala Tyr Arg Phe Ser Ile 65 70

75 80 Ser Trp Pro Arg Ile Leu Pro Glu Gly Thr Gly Arg Val Asn Gln Lys 85 90 95 Gly Leu Asp Phe Tyr Asn Arg Ile Ile Asp Thr Leu Leu Glu Lys Gly 100 105 110 Ile Thr Pro Phe Val Thr Ile Tyr His Trp Asp Leu Pro Phe Ala Leu 115 120 125 Gln Leu Lys Gly Gly Trp Ala Asn Arg Glu Ile Ala Asp Trp Phe Ala 130 135 140 Glu Tyr Ser Arg Val Leu Phe Glu Asn Phe Gly Asp Arg Val Lys Asn 145 150 155 160 Trp Ile Thr Leu Asn Glu Pro Trp Val Val Ala Ile Val Gly His Leu 165 170 175 Tyr Gly Val His Ala Pro Gly Met Arg Asp Ile Tyr Val Ala Phe Arg 180 185 190 Ala Val His Asn Leu Leu Arg Ala His Ala Lys Ala Val Lys Val Phe 195 200 205 Arg Glu Thr Val Lys Asp Gly Lys Ile Gly Ile Val Phe Asn Asn Gly 210 215 220 Tyr Phe Glu Pro Ala Ser Glu Lys Glu Glu Asp Ile Arg Ala Ala Arg 225 230 235 240 Phe Met His Gln Phe Asn Asn Tyr Pro Leu Phe Leu Asn Pro Ile Tyr 245 250 255 Arg Gly Asp Tyr Pro Glu Leu Val Leu Glu Phe Ala Arg Glu Tyr Leu 260 265 270 Pro Glu Asn Tyr Lys Asp Asp Met Ser Glu Ile Gln Glu Lys Ile Asp 275 280 285 Phe Val Gly Leu Asn Tyr Tyr Ser Gly His Leu Val Lys Phe Asp Pro 290 295 300 Asp Ala Pro Ala Lys Val Ser Phe Val Glu Arg Asp Leu Pro Lys Thr 305 310 315 320 Ala Met Gly Trp Glu Ile Val Pro Glu Gly Ile Tyr Trp Ile Leu Lys 325 330 335 Lys Val Lys Glu Glu Tyr Asn Pro Pro Glu Val Tyr Ile Thr Glu Asn 340 345 350 Gly Ala Ala Phe Asp Asp Val Val Ser Glu Asp Gly Arg Val His Asp 355 360 365 Gln Asn Arg Ile Asp Tyr Leu Lys Ala His Ile Gly Gln Ala Trp Lys 370 375 380 Ala Ile Gln Glu Gly Val Pro Leu Lys Gly Tyr Phe Val Trp Ser Leu 385 390 395 400 Leu Asp Asn Phe Glu Trp Ala Glu Gly Tyr Ser Lys Arg Phe Gly Ile 405 410 415 Val Tyr Val Asp Tyr Ser Thr Gln Lys Arg Ile Ile Lys Asp Ser Gly 420 425 430 Tyr Trp Tyr Ser Asn Val Val Lys Ser Asn Ser Leu Glu Asp 435 440 445 1766DNAArtificialsynthetic sequence encoding fusion sequence with six histidines 17gaacaaaaac tcatctcaga agaggatctg aatagcgccg tcgaccatca tcatcatcat 60catcat 661821PRTArtificialsynthetic fusion sequence with six histidines 18Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His 1 5 10 15 His His His His His 20 1941DNAArtificialsynthetic oligonucleotide primer 19atatccatgg aggggaatac tattcttaaa atcgtactaa t 412031DNAArtificialsynthetic oligonucleotide primer 20atgctctaga aacctgggag cccttcttaa g 312120DNAArtificialsynthetic oligonucleotide primer 21gaaacgctcc tccctgtagt 202238DNAArtificialsynthetic oligonucleotide primer 22atgctctaga aattctctca cctccagatc aatagaga 382322DNAArtificialsynthetic oligonucleotide primer 23aggtgggtag ttcttctgat gg 222441DNAArtificialsynthetic oligonucleotide primer 24atgctctaga aattttacaa cttcgacgaa gaagtctttg a 412533DNAArtificialsynthetic oligonucleotide primer 25atatccatgg gaaagatcga tgaaatcctt tca 332634DNAArtificialsynthetic oligonucleotide primer 26atgctctaga aatggtttga atctcttctc tccc 342722DNAArtificialsynthetic oligonucleotide primer 27aacgtgaaaa agttccctga ag 222834DNAArtificialsynthetic oligonucleotide primer 28atgctctaga aaatcttcca gactgttgct tttg 34291230DNACaldivirga maquilingensis 29atggactact ctatcaactg ctctatcaac cctataaccc tcatggtcgc gcactcttct 60cccctgaacc catctaacac actcgaactt acacttattc tcgaaaatgg catcaccacc 120acagtaactg tcaccgcgac accacgcaac acttacccta tgatctccct tggctacatt 180aatattaccc ctaacctctg gaaccttaac acagcttcgt catcaggata cgcctctatg 240gtctacgatg catcacaggg tgctctttat attcatgtta atttcacaaa ggtttacctc 300aatcagcaag ttggtgttgc cgcctactct gaattcatct atggctacaa accctggggc 360acgctcacct ccgaggcagg cgggttcaat tttcctgtta agcttaccga actcggttct 420cttctttcgt tcatcaatta ctcactcatt tcatattctc cacaagtcgc tatcttcgat 480tgggcatacg acctttggct cacaacatcc ccaaatctca ccaacggccc tcaacccggc 540gacgtcgagg tcatgatctg gctctattat cacctgcaac aacctgcggg ttttcccgtc 600gctaacgtta cagtgccaat atgggtcaat ggctccctcg ttaacgaaac atttgaggtt 660tggattggtt ctccacagat cgaacccggc acccacgcta tagtctcctt caggccaacg 720aatccaatcc ctagaggcct cgtcggcgta aatgtcacga agttccttca acttgccgtt 780aactatctcg tgacactcta cccctcatac tggaactaca catatctgga gagcaagtac 840ttgaatggca tcgaattcgg atcagaatgg ggcaatccgt ctacatacaa tattacactc 900aattgggtca tttataaagc ttatcttatc aaggtgcctc tggagtcaca gggcaccgtt 960accgtcacat atactacaac tgttacatcc accatgactg ttacctcaat ccttgctacc 1020acatccaccg tcaccactac atctacactt acatctaccg ttaccgccac ttcagtttct 1080acttccaccg tcacgcagac tctcactacc tccatcgtca aaaccgtcat ccctgtctac 1140tatactgcca ccataatcgt ccttcttata atcatcgcag tcgtcattgc acttgcgttc 1200gcccgccgcg gcatccgggt tcgtctctgt 123030410PRTCaldivirga maquilingensis 30Met Asp Tyr Ser Ile Asn Cys Ser Ile Asn Pro Ile Thr Leu Met Val 1 5 10 15 Ala His Ser Ser Pro Leu Asn Pro Ser Asn Thr Leu Glu Leu Thr Leu 20 25 30 Ile Leu Glu Asn Gly Ile Thr Thr Thr Val Thr Val Thr Ala Thr Pro 35 40 45 Arg Asn Thr Tyr Pro Met Ile Ser Leu Gly Tyr Ile Asn Ile Thr Pro 50 55 60 Asn Leu Trp Asn Leu Asn Thr Ala Ser Ser Ser Gly Tyr Ala Ser Met 65 70 75 80 Val Tyr Asp Ala Ser Gln Gly Ala Leu Tyr Ile His Val Asn Phe Thr 85 90 95 Lys Val Tyr Leu Asn Gln Gln Val Gly Val Ala Ala Tyr Ser Glu Phe 100 105 110 Ile Tyr Gly Tyr Lys Pro Trp Gly Thr Leu Thr Ser Glu Ala Gly Gly 115 120 125 Phe Asn Phe Pro Val Lys Leu Thr Glu Leu Gly Ser Leu Leu Ser Phe 130 135 140 Ile Asn Tyr Ser Leu Ile Ser Tyr Ser Pro Gln Val Ala Ile Phe Asp 145 150 155 160 Trp Ala Tyr Asp Leu Trp Leu Thr Thr Ser Pro Asn Leu Thr Asn Gly 165 170 175 Pro Gln Pro Gly Asp Val Glu Val Met Ile Trp Leu Tyr Tyr His Leu 180 185 190 Gln Gln Pro Ala Gly Phe Pro Val Ala Asn Val Thr Val Pro Ile Trp 195 200 205 Val Asn Gly Ser Leu Val Asn Glu Thr Phe Glu Val Trp Ile Gly Ser 210 215 220 Pro Gln Ile Glu Pro Gly Thr His Ala Ile Val Ser Phe Arg Pro Thr 225 230 235 240 Asn Pro Ile Pro Arg Gly Leu Val Gly Val Asn Val Thr Lys Phe Leu 245 250 255 Gln Leu Ala Val Asn Tyr Leu Val Thr Leu Tyr Pro Ser Tyr Trp Asn 260 265 270 Tyr Thr Tyr Leu Glu Ser Lys Tyr Leu Asn Gly Ile Glu Phe Gly Ser 275 280 285 Glu Trp Gly Asn Pro Ser Thr Tyr Asn Ile Thr Leu Asn Trp Val Ile 290 295 300 Tyr Lys Ala Tyr Leu Ile Lys Val Pro Leu Glu Ser Gln Gly Thr Val 305 310 315 320 Thr Val Thr Tyr Thr Thr Thr Val Thr Ser Thr Met Thr Val Thr Ser 325 330 335 Ile Leu Ala Thr Thr Ser Thr Val Thr Thr Thr Ser Thr Leu Thr Ser 340 345 350 Thr Val Thr Ala Thr Ser Val Ser Thr Ser Thr Val Thr Gln Thr Leu 355 360 365 Thr Thr Ser Ile Val Lys Thr Val Ile Pro Val Tyr Tyr Thr Ala Thr 370 375 380 Ile Ile Val Leu Leu Ile Ile Ile Ala Val Val Ile Ala Leu Ala Phe 385 390 395 400 Ala Arg Arg Gly Ile Arg Val Arg Leu Cys 405 410 312214DNAPyrococcus horikoshii 31atgagatttc aattcggatt ctccaaagaa gatgaacagg tgctgggcac aatactaaca 60ctcggaaatg gacaattagg agttagggga gaatttgaac tcgagagatc tccttatgga 120acgatcgtta gcggggtcta tgattacact ccctacttct acagggaatt ggtaaatggt 180cccaggacta tagggatgat aataattata gatggagaac taataaatcc aagctctcaa 240aaagtcaagg aattccagag agagctcgat atagaaaaag gcttattaag aactcactta 300gagattgaaa caaaaaatgg aaataaaatt ttatataaaa gtacaaggat agtccacatg 360aaaagaaaaa acctaatcct tctagatttt gagctaaaag ctagcaaggg aggaatcgca 420gttgtagtta atcccataga attcaatact gcaaatccag ggtttataga cgagataatg 480atcaagcatt atagagtgga ctcgataaaa gagactgagg agggagtata cgctagggtg 540aaaactttag acaataagta cacgttggaa attgcaagta gcttggttcc atcagaatat 600acatcgagga gcacctttag aaccgataat gaaattggag aaatttacat tgttaaactt 660aaaccaggaa aaacgtacaa atttacaaag tacgttacag tatctaaagg agcagcttta 720gaggagttaa aagatgttaa gagattagga tttgaaaagc tatatgaaga gcatataaac 780agctggaaga gaatatggga gaaagtgaaa gtggaaatcg aaggagataa agaccttgaa 840aatgccctaa actttaacat ttttcacttg atccaatccc ttccaccaac agataaagtc 900tcgctaccag caaggggaat acatgggttt gggtataggg gacatatatt ctgggataca 960gagatatatg cattaccttt cttcatattc acgatgccaa aagaggccag gagattgctc 1020ctctatagat gcaacaactt agatgccgct aaagaaaatg caaagatgaa tggatatcaa 1080ggggtccaat ttccctggga gtcggcagat gatggacgcg aggctacccc ctctgagata 1140ccattggata tgttgggaag gaaaatcgtt agaatttaca ccggagagga ggaacatcac 1200ataactgcgg atatagcata tatagttgat ttttattacc aagtctctgg agatctcgaa 1260tttatgaaca ggtgtggcct tgagataatc tttgagacgg cccgattttg ggctagtagg 1320gttgagttcg aggaaggaaa agggtacgtc attaaaaaag taataggacc tgatgaatac 1380catgagcacg ttaacaacaa cttctttaca aacttaatgg ccaagcataa tctcgaactt 1440gcaataagat actttagaga gtcaaagaat agggaaccgt ggaaaaagat tgtcgaaaaa 1500ttaaacataa gagaggagga ggttgaaaaa tgggaagaga tagctaaaaa catgtacatt 1560cccaggaaga tagacggagt ttttgaagag tttgatggtt actttgaatt gatggatttt 1620gaagttgatc ccttcaatat tggagaaaaa acactccccg aggaaatcag gaataacata 1680gggaaaacga aactcgttaa gcaggccgat gtcatcatgg cccaatatct ccttaaggac 1740tacttctctc cagaggaaat aaagagtaac tttaactatt atataaggag aactacccat 1800gcttcatcac tctccatgcc cccatacgcg atcattgcaa cctggatagg ggaggtaaag 1860atagcatatg agtacttcaa gagatgtgca aatatagatc tcaaaaacgt gtacggaaac 1920actgcagagg gatttcactt agcaacggcg ggaggaacct ggcaagtact cgtcagagga 1980ttttgtggcc tcaatgtaaa aggaaacaaa atagagctta atcctaatct tcctgaaaaa 2040tggaagtacg ttaagttcag gatattcttc aaaggttcat ggatagaatt taaaatttct 2100aggaagaaag ttagggctag aatgcttgaa ggatcgagaa aagtcaaaat atctagcttt 2160ggaaaggaag tagatctata tcctggaaaa gaggttgtaa tagtagctaa ttaa 221432737PRTPyrococcus horikoshii 32Met Arg Phe Gln Phe Gly Phe Ser Lys Glu Asp Glu Gln Val Leu Gly 1 5 10 15 Thr Ile Leu Thr Leu Gly Asn Gly Gln Leu Gly Val Arg Gly Glu Phe 20 25 30 Glu Leu Glu Arg Ser Pro Tyr Gly Thr Ile Val Ser Gly Val Tyr Asp 35 40 45 Tyr Thr Pro Tyr Phe Tyr Arg Glu Leu Val Asn Gly Pro Arg Thr Ile 50 55 60 Gly Met Ile Ile Ile Ile Asp Gly Glu Leu Ile Asn Pro Ser Ser Gln 65 70 75 80 Lys Val Lys Glu Phe Gln Arg Glu Leu Asp Ile Glu Lys Gly Leu Leu 85 90 95 Arg Thr His Leu Glu Ile Glu Thr Lys Asn Gly Asn Lys Ile Leu Tyr 100 105 110 Lys Ser Thr Arg Ile Val His Met Lys Arg Lys Asn Leu Ile Leu Leu 115 120 125 Asp Phe Glu Leu Lys Ala Ser Lys Gly Gly Ile Ala Val Val Val Asn 130 135 140 Pro Ile Glu Phe Asn Thr Ala Asn Pro Gly Phe Ile Asp Glu Ile Met 145 150 155 160 Ile Lys His Tyr Arg Val Asp Ser Ile Lys Glu Thr Glu Glu Gly Val 165 170 175 Tyr Ala Arg Val Lys Thr Leu Asp Asn Lys Tyr Thr Leu Glu Ile Ala 180 185 190 Ser Ser Leu Val Pro Ser Glu Tyr Thr Ser Arg Ser Thr Phe Arg Thr 195 200 205 Asp Asn Glu Ile Gly Glu Ile Tyr Ile Val Lys Leu Lys Pro Gly Lys 210 215 220 Thr Tyr Lys Phe Thr Lys Tyr Val Thr Val Ser Lys Gly Ala Ala Leu 225 230 235 240 Glu Glu Leu Lys Asp Val Lys Arg Leu Gly Phe Glu Lys Leu Tyr Glu 245 250 255 Glu His Ile Asn Ser Trp Lys Arg Ile Trp Glu Lys Val Lys Val Glu 260 265 270 Ile Glu Gly Asp Lys Asp Leu Glu Asn Ala Leu Asn Phe Asn Ile Phe 275 280 285 His Leu Ile Gln Ser Leu Pro Pro Thr Asp Lys Val Ser Leu Pro Ala 290 295 300 Arg Gly Ile His Gly Phe Gly Tyr Arg Gly His Ile Phe Trp Asp Thr 305 310 315 320 Glu Ile Tyr Ala Leu Pro Phe Phe Ile Phe Thr Met Pro Lys Glu Ala 325 330 335 Arg Arg Leu Leu Leu Tyr Arg Cys Asn Asn Leu Asp Ala Ala Lys Glu 340 345 350 Asn Ala Lys Met Asn Gly Tyr Gln Gly Val Gln Phe Pro Trp Glu Ser 355 360 365 Ala Asp Asp Gly Arg Glu Ala Thr Pro Ser Glu Ile Pro Leu Asp Met 370 375 380 Leu Gly Arg Lys Ile Val Arg Ile Tyr Thr Gly Glu Glu Glu His His 385 390 395 400 Ile Thr Ala Asp Ile Ala Tyr Ile Val Asp Phe Tyr Tyr Gln Val Ser 405 410 415 Gly Asp Leu Glu Phe Met Asn Arg Cys Gly Leu Glu Ile Ile Phe Glu 420 425 430 Thr Ala Arg Phe Trp Ala Ser Arg Val Glu Phe Glu Glu Gly Lys Gly 435 440 445 Tyr Val Ile Lys Lys Val Ile Gly Pro Asp Glu Tyr His Glu His Val 450 455 460 Asn Asn Asn Phe Phe Thr Asn Leu Met Ala Lys His Asn Leu Glu Leu 465 470 475 480 Ala Ile Arg Tyr Phe Arg Glu Ser Lys Asn Arg Glu Pro Trp Lys Lys 485 490 495 Ile Val Glu Lys Leu Asn Ile Arg Glu Glu Glu Val Glu Lys Trp Glu 500 505 510 Glu Ile Ala Lys Asn Met Tyr Ile Pro Arg Lys Ile Asp Gly Val Phe 515 520 525 Glu Glu Phe Asp Gly Tyr Phe Glu Leu Met Asp Phe Glu Val Asp Pro 530 535 540 Phe Asn Ile Gly Glu Lys Thr Leu Pro Glu Glu Ile Arg Asn Asn Ile 545 550 555 560 Gly Lys Thr Lys Leu Val Lys Gln Ala Asp Val Ile Met Ala Gln Tyr 565 570 575 Leu Leu Lys Asp Tyr Phe Ser Pro Glu Glu Ile Lys Ser Asn Phe Asn 580 585 590 Tyr Tyr Ile Arg Arg Thr Thr His Ala Ser Ser Leu Ser Met Pro Pro 595 600 605 Tyr Ala Ile Ile Ala Thr Trp Ile Gly Glu Val Lys Ile Ala Tyr Glu 610 615 620 Tyr Phe Lys Arg Cys Ala Asn Ile Asp Leu Lys Asn Val Tyr Gly Asn 625 630 635 640 Thr Ala Glu Gly Phe His Leu Ala Thr Ala Gly Gly Thr Trp Gln Val 645 650 655 Leu Val Arg Gly Phe Cys Gly Leu Asn Val Lys Gly Asn Lys Ile Glu 660 665 670 Leu Asn Pro Asn Leu Pro Glu Lys Trp Lys Tyr Val Lys Phe Arg Ile 675 680 685 Phe Phe Lys Gly Ser Trp Ile Glu Phe Lys Ile Ser Arg Lys Lys Val 690 695 700 Arg Ala Arg Met Leu Glu Gly Ser Arg Lys Val Lys Ile Ser Ser Phe 705 710 715 720 Gly Lys Glu Val Asp

Leu Tyr Pro Gly Lys Glu Val Val Ile Val Ala 725 730 735 Asn

Claims

1-5. (canceled)

6. A method of hydrolyzing cellulose, comprising the steps of contacting said cellulose with one or more recombinant cellulase enzymes with an amino acid sequence represented by an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ. ID NO: 30 and SEQ ID NO: 32; and activating said one or more recombinant cellulase enzymes by the application of heat.

7. A method of hydrolyzing cellulose to produce glucose, comprising the step of heating said cellulose to a temperature in the range of 70.degree. C. to 100.degree. C. in the presence of one or more recombinant cellulase enzymes, wherein said one or more recombinant cellulase enzymes includes: at least one recombinant endoglucanase selected from the group consisting of Termocel 3, Termocel4, Termocel 5, Termocel 6, Termocel 9 and Termocel 10; at least one recombinant exoprocessive-endoglucanase selected from the group consisting of Termocel 1 and Termocel 2; and, at least one recombinant beta-glucosidase selected from the group consisting of Termocel 7 and Termocel 8.

8. A method of fermenting glucose to produce ethanol, comprising the steps of providing a source of cellulose; heating said cellulose to a temperature in the range of 80.degree. C. to 100.degree. C. in the presence of at least one recombinant endoglucanase enzyme selected from the group consisting of Termocel 3, Termocel4, Termocel 5, Termocel 6, Termocel 9 and Termocel 10; at least one recombinant exoprocessive-endoglucanase enzyme selected from the group consisting of Termocel 1 and Termocel 2; and at least one recombinant beta-glucosidase enzyme selected from the group consisting of Termocel 7 and Termocel 8; wherein said step of heating is carried out under conditions whereby at least a portion of said cellulose is hydrolyzed to glucose; and fermenting said glucose to produce ethanol.

9. The method of claim 8, wherein said step of fermenting is catalyzed by one or more yeasts.

10. (canceled)

Images