METHODS AND COMPOSITIONS FOR TREATING TUMOR DISEASES

Abstract

vides, in part, methods for treating a tumor in a human subject comprising inhibiting IGF-1 receptor signaling, methods of determining whether a tumor is more or less likely to respond to such treatment, and compositions for practicing such methods. In particular embodiments, the invention provides fully human, humanized, or chimeric anti-IGF-1R antibodies that bind human IGF-1R, IGF-1R-binding fragments and derivatives of such antibodies, and IGF-1R-binding polypeptides comprising such fragments. Other embodiments provide nucleic acids encoding such antibodies, antibody fragments and derivatives and polypeptides, cells comprising such polynucleotides, methods of making such antibodies, antibody fragments and derivatives and polypeptides, and methods of using such antibodies, antibody fragments and derivatives and polypeptides, including methods of treating or diagnosing subjects having IGF-1R-related disorders or conditions.

Description

FIELD OF THE INVENTION

[0001]This application provides methods and compositions relating to the treatment of tumor diseases such as Ewing's sarcoma, other sarcomas, tumors comprising EWS-FLI genetic translocations, tumors comprising activating RAS mutations, carcinoid tumors, and other cancers and proliferative diseases.

BACKGROUND OF THE INVENTION

[0002]Ewing's sarcoma is the most common solid tumor in children and adolescents. The current standard of care comprises aggressive chemotherapy. The side effects of such treatment often include acute toxicity, and can include secondary malignancies, a serious limitation for a young patient population. Moreover, metastatic Ewing's sarcoma is particularly resistant to conventional treatment. Twenty-five percent of Ewing's sarcoma patients have metastases when they are diagnosed; their five year survival rate can be as low as 20%.

[0003]Activating RAS mutations are associated with many different types of cancers and are found in well over 50% of certain types of tumors. As many as 90% of pancreatic cancer tumors contain activating RAS mutations; such tumors are among the deadliest and most intractable tumors known. In spite of intense research efforts, no targeted therapeutic has been found that is effective against tumors containing activating RAS mutations.

BRIEF DESCRIPTION OF THE DRAWINGS

[0004]FIG. 1 provides nucleotide sequences encoding light chain variable domains L1 through L52 and heavy chain variable domains H1 through H52.

[0005]FIG. 2 provides amino acid sequences of light chain variable domains L1 through L52. CDR and FR regions are indicated.

[0006]FIG. 3 provides amino acid sequences of heavy chain variable domains H1 through H52. CDR and FR regions are indicated.

[0007]FIG. 4 provides amino acid sequences of the light chain CDR1 regions of light chain variable domains L1 through L52. Consensus sequences for groups of related CDR sequences are also provided.

[0008]FIG. 5 provides amino acid sequences of the light chain CDR2 regions of light chain variable domains L1 through L52. Consensus sequences for groups of related CDR sequences are also provided.

[0009]FIG. 6 provides amino acid sequences of the light chain CDR3 regions of light chain variable domains L1 through L52. Consensus sequences for groups of related CDR sequences are also provided.

[0010]FIG. 7 provides amino acid sequences of the heavy chain CDR1 regions of heavy chain variable domains H1 through H52. Consensus sequences for groups of related CDR sequences are also provided.

[0011]FIG. 8 provides amino acid sequences of the heavy chain CDR2 regions of heavy chain variable domains H1 through H52. Consensus sequences for groups of related CDR sequences are also provided.

[0012]FIG. 9 provides amino acid sequences of the heavy chain CDR3 regions of heavy chain variable domains H1 through H52. Consensus sequences for groups of related CDR sequences are also provided.

[0013]FIG. 10 provides the amino acid sequence of a human IGF-1R extracellular domain fused to a human IgG1 Fc region (underlined) with an intervening caspace-3 cleavage site (bold).

[0014]FIG. 11 provides the amino acid sequence of a human insulin receptor extracellular domain fused to a human IgG1 Fc region (underlined).

[0015]FIG. 12 provides the protein sequence of a human IGF-1R extracellular domain (including signal peptide) fused at the C-terminus with chicken avidin. The initiating met in the IGF-1R ECD is designated position 1 in this figure.

[0016]FIG. 13 provides the polypeptide sequence of a human kappa light chain antibody constant region and a human IgG1 heavy chain antibody constant region.

[0017]FIG. 14 provides a graph illustrating that four phage-displayed antibodies bind significantly better to an IGF-1R-Fc molecule than they bind to an insulin-receptor-Fc or a murine Fc.

[0018]FIG. 15 provides graphs illustrating the ability of certain antibodies to compete for binding to IGF-1R with IGF-1 and IGF-2.

[0019]FIG. 16 provides graphs illustrating the ability of certain antibodies to inhibit the growth of 32D hu IGF-1R+IRS-1 cells.

[0020]FIG. 17 provides graphs illustrating the ability of certain antibodies to inhibit the growth of Balb/C 3T3 hu IGF-1R cells.

[0021]FIG. 18 provides a graph illustrating the best tumor response achieved for each of twelve human subjects treated with an inhibitor of IGF-1 receptor signaling.

SUMMARY OF THE INVENTION

[0022]In one aspect, the present invention provides a method of treating a tumor in a human subject, comprising administering to said subject a therapeutically effective amount of an inhibitor of IGF-1R signalling, wherein said subject exhibits at least one of the following responses to said treatment: a. stable disease according to RECIST criteria, b. partial response according to RECIST criteria, c. complete response according to RECIST criteria, d. reduction in metabolic activity in said tumor as assayed by PET, e. elimination of metabolic activity in said tumor as assayed by PET, and f. improvement in a symptom associated with said tumor. In one embodiment, said tumor is selected from the group consisting of: a. a sarcoma tumor, b. a Ewing's sarcoma tumor, c. an adenocarcinoma tumor, d. a pancreatic cancer tumor, e. a carcinoid tumor, f. a thymus tumor, g. an adenoid tumor, h. an adenoid R eye tumor, i. a melanoma tumor, j. a colorectal tumor, k. an ovarian tumor, l. a breast tumor, m. a tumor comprising a cell that has an activating RAS mutation, n. a tumor comprising a cell that has an activating KRAS mutation, o. a tumor comprising a cell that has an activating mutation in codon 12 of KRAS, p. a tumor comprising a cell that has a KRAS G12C mutation, q. a tumor comprising a cell that does not have a missense or a nonsense mutation in the PTEN tumor suppressor, r. a tumor comprising a cell that does not have a reduction of expression of PTEN, relative to a non-tumor tissue sample, detectable by immunohistochemistry using an antibody specific for PTEN, s. a tumor that exhibits a complete loss of PTEN expression in 5% or fewer of tumor cells as assessed by immunohistochemical staining of archival formalin fixed paraffin embedded tumor sections, t. a tumor comprising a cell that has an EWS-FLI genetic translocation, u. a tumor that expresses an EWS-FLI hybrid gene, v. a tumor comprising a cell that has an EWS/ets gene rearrangement, w. a tumor that expresses an EWS/ets hybrid gene, and x. a tumor comprising a cell that has a t(11;22)(q24;q12) chromosomal abnormality. In another embodiment, said subject exhibits said response within six months of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said subject exhibits said response within 90 days of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said subject exhibits said response within 60 days of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said subject exhibits said response within 30 days of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said subject exhibits said response within 14 days of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said subject exhibits said response within 8 days of said administration of said inhibitor of IGF-1R signaling. In another embodiment, said symptom is irregular, labored, or difficult breathing. In another embodiment, said symptom is pain. In another embodiment, said symptom is difficulty sleeping. In another embodiment, said symptom is difficulty eating, drinking, or swallowing. In another embodiment, said inhibitor of IGF-1R signaling is administered to said subject in at least one dose. In another embodiment, said inhibitor of IGF-1R signaling is administered to said subject in at least two doses. In another embodiment, said inhibitor of IGF-1R signaling is administered to said subject in at least three doses. In another embodiment, said inhibitor of IGF-1R signaling is administered to said subject in at least four doses. In another embodiment, said inhibitor of IGF-1R signaling is administered to said subject in intermittent doses at least until said response is achieved. In another embodiment, said response is a complete response according to RECIST criteria. In another embodiment, said inhibitor of IGF-1R signaling is selected from the group consisting of: a. an antibody that specifically binds to the IGF-1 receptor, b. an antibody fragment that specifically binds to the IGF-1 receptor, c. an antibody derivative that specifically binds to the IGF-1 receptor, d. a peptibody that specifically binds to the IGF-1 receptor, e. an Avimer® that specifically binds to the IGF-1 receptor, f. an IGF-1 receptor siRNA, and g. a small molecule that binds to the IGF-1 receptor. In another embodiment, said antibody is selected from the group consisting of an antibody comprising a combination of a light chain variable domain and a heavy chain variable domain selected from the group of combinations consisting of: L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52; antibody 1A (DSMZ Deposit No. DSM ACC 2586), antibody 8 (DSMZ Deposit No. DSM ACC 2589), antibody 23 (DSMZ Deposit No. DSM ACC 2588), antibody 18; antibody 2F8, antibody A12, antibody IMC-A12; antibody 7C10, chimaeric antibody C7C10, antibody h7C10, antibody 7H2M, chimaeric antibody *7C10, antibody GM 607, humanized antibody 7C10 version 1, humanized antibody 7C10 version 2, humanized antibody 7C10 version 3, antibody 7H2HM; antibody EM164, resurfaced antibody EM164, humanized antibody EM164, antibody huEM164 v1.0, antibody huEM164 v1.1, antibody huEM164 v1.2, and antibody huEM164 v1.3; antibody CP-751,871, the antibody produced by the hybridoma having the ATCC accession number PTA-2792, the antibody produced by the hybridoma having the ATCC accession number PTA-2788, the antibody produced by the hybridoma having the ATCC accession number PTA-2790, the antibody produced by the hybridoma having the ATCC accession number PTA-2791, the antibody produced by the hybridoma having the ATCC accession number PTA-2789, the antibody produced by the hybridoma having the ATCC accession number PTA-2793; antibody 2.12.1, antibody 2.13.2, antibody 2.14.3, antibody 3.1.1, antibody 4.9.2, and antibody 4.17.3; antibody 19D12, an antibody comprising a heavy chain encoded by a polynucleotide in plasmid 15H12/19D12 HCA (γ4), deposited at the ATCC under number PTA-5214, and a light chain encoded by a polynucleotide in plasmid 15H12/19D12 LCF (κ), deposited at the ATCC under number PTA-5220; antibody PINT-6A1, antibody PINT-7A2, antibody PINT-7A4, antibody PINT-7A5, antibody PINT-7A6, antibody PINT-8A1, antibody PINT-9A2, antibody PINT-11A1, antibody PINT-11A2, antibody PINT-11A3, antibody PINT-11A4, antibody PINT-11A5, antibody PINT-11A7, antibody PINT-11A12, antibody PINT-12A1, antibody PINT-12A2, antibody PINT-12A3, antibody PINT-12A4, antibody PINT-12A5, antibody M13-C06, antibody M14-G11, antibody M14-C03, antibody M14-B01, antibody M12-E01, and antibody M12-G04, and antibodies produced by hybridomas P2A7.3E11, 20C8.3B8, P1A2.2B11, 20D8.24B11, P1E2.3B12, and P1G10.2B8. In another embodiment, said antibody binds to the IGF-1 receptor L2 domain. In another embodiment, said antibody binds to the IGF-1 receptor FnIII 1 domain. In another embodiment, said antibody binds to the IGF-1 receptor FnIII 1 domain. In another embodiment, said antibody binds to the IGF-1 receptor L1 and FnIII 1 domains. In another embodiment, said antibody competes for binding to IGF-1R with antibody L16/H16. In another embodiment, said antibody comprises a light chain variable domain that is at least 90% identical to the light chain L16 and a heavy chain variable domain that is at least 90% identical to the heavy chain H16. In another embodiment, said antibody comprises the light chain variable domain of L16 and the heavy chain variable domain of H16. In another embodiment, said inhibitor of IGF-1R signaling is selected from the group consisting of: a. an antibody, or antibody fragment, that specifically binds to IGF-1, b. an antibody, or antibody fragment, that specifically binds to IGF-2, c. an IGF-1 and/or IGF-2 binding protein, d. a soluble, IGF-1 and/or IGF-2 binding fragment of the IGF-1 receptor, e. a soluble, IGF-2 binding fragment of the IGF-2 receptor, f. a small molecule that binds to IGF-1 and/or IGF-2, g. a small molecule that binds to IRS1, h. a small molecule that binds to SHC, GRB2, or SOS1, and i. a small molecule that binds to PI3K or SHP2. In another embodiment, said human subject is a child. In another embodiment, said child is less than 18 years old. In another embodiment, said human subject is an adolescent. In another embodiment, said tumor is a metastatic tumor. In another embodiment, said metastatic tumor is in a bone. In another embodiment, said metastatic tumor is in a lung. In another embodiment, said inhibitor of IGF-1R signalling inhibits IGF-1 receptor signaling at least 10 times more than it inhibits insulin receptor signaling. In another embodiment, said inhibitor of IGF-1R signalling inhibits IGF-1 receptor signaling at least 100 times more than it inhibits insulin receptor signaling. In another embodiment, said inhibitor of IGF-1R signalling inhibits IGF-1 receptor signaling at least 1000 times more than it inhibits insulin receptor signaling. In another embodiment, said method comprises a combination therapy. In another embodiment, said combination therapy comprises administering to said subject a chemotherapeutic agent. In another embodiment, said combination therapy comprises administering to said subject an inhibitor of CD99. In another embodiment, said combination therapy comprises administering to said subject at least one compound selected from the group consisting of adriamycin, cytoxan, ifosfamide, vincristine, topotecan, taxotere, cyclophosphamide, etoposide, actinomycin D, doxorubicin, busulfan, melphalan, cisplatinum, and gemcitabine. In another embodiment, said combination therapy comprises administering to said subject at least one combination of compounds selected from the group of combinations consisting of: a. adriamycin and cytoxan, b. vincristine, actinomycin D, and cyclophosphamide, c. vincristine, actinomycin D, cyclophosphamide, and doxorubicin, d. vincristine, ifosfamide, doxorubicin, and etoposide, e. vincristine, topotecan, and cyclophosphamide, f. ifosfamide and etoposide, g. busulfan and melphalan, h. ifosfamide and vincristine, and i. topotecan and vincristine. In another embodiment, said combination therapy comprises administering to said subject at least one compound selected from the group consisting of a corticosteroid, an anti-emetic, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, a cancer vaccine, a GM-CSF inhibiting agent, a GM-CSF DNA vaccine, a cell-based vaccine, a dendritic cell vaccine, a recombinant viral vaccine, a heat shock protein (HSP) vaccine, an allogeneic tumor vaccine, an autologous tumor vaccine, an analgesic, ibuprofen, naproxen, choline magnesium trisalicylate, an oxycodone hydrochloride, an anti-angiogenic agent, an anti-vascular agent, bevacizumab, an anti-VEGF antibody, an anti-VEGF receptor antibody, a soluble VEGF receptor fragment, an anti-TWEAK antibody, an anti-TWEAK receptor antibody, a soluble TWEAK receptor fragment, AMG 706, AMG 386, an anti-proliferative agent, a farnesyl protein transferase inhibitor, an αvβ3 inhibitor, an αvβ5 inhibitor, a p53 inhibitor, a Kit receptor inhibitor, a ret receptor inhibitor, a PDGFR inhibitor, a growth hormone secretion inhibitor, an angiopoietin inhibitor, a tumor infiltrating macrophage-inhibiting agent, a c-fms inhibiting agent, an anti-c-fms antibody, an CSF-1 inhibiting agent, an anti-CSF-1 antibody, a soluble c-fms fragment, pegvisomant, gemcitabine, panitumumab, irinothecan, and SN-38. In another embodiment, said method further comprises treating said subject with high-dose chemotherapy and autologous hematopoietic stem cell rescue. In another embodiment, said method further comprises treating said subject with radiation. In another embodiment, said method comprises whole lung irradiation. In another embodiment, said subject receives at least 40 Gy of radiation. In another embodiment, said subject receives between 40 and 60 Gy of radiation. In another embodiment, said subject receives between 40 and 50 Gy of radiation. In another embodiment, said subject receives between 55 and 60 Gy of radiation. In another embodiment, said subject receives no more than 55.8 Gy of radiation. In another embodiment, said subject receives between 45 and 55 Gy of radiation. In another embodiment, said method further comprises surgically removing from said subject at least a portion of said tumor. In another embodiment, said therapeutically effective amount of said inhibitor of IGF-1R signaling has an effect selected from the group consisting of: a. binds to at least 10% of subject's IGF-1 receptors within 24 hours of administration, b. binds to at least 25% of subject's IGF-1 receptors within 24 hours of administration, c. binds to at least 50% of subject's IGF-1 receptors within 24 hours of administration, d. binds to at least 75% of subject's IGF-1 receptors within 24 hours of administration, e. binds to at least 90% of subject's IGF-1 receptors within 24 hours of administration, f. binds to at least 99% of subject's IGF-1 receptors within 24 hours of administration, g. reduces signaling through subject's IGF-1 receptors by at least 10% within 24 hours of administration, h. reduces signaling through subject's IGF-1 receptors by at least 25% within 24 hours of administration, i. reduces signaling through subject's IGF-1 receptors by at least 50% within 24 hours of administration, j. reduces signaling through subject's IGF-1 receptors by at least 75% within 24 hours of administration, k. reduces signaling through subject's IGF-1 receptors by at least 90% within 24 hours of administration, 1. reduces signaling through subject's IGF-1 receptors by at least 99% within 24 hours of administration, m. reduces autophosphorylation of IGF-1 receptor by at least 10% within 24 hours of administration, n. reduces autophosphorylation of IGF-1 receptor by at least 25% within 24 hours of administration, o. reduces autophosphorylation of IGF-1 receptor by at least 50% within 24 hours of administration, p. reduces autophosphorylation of IGF-1 receptor by at least 75% within 24 hours of administration, q. reduces autophosphorylation of IGF-1 receptor by at least 90% within 24 hours of administration, r. reduces autophosphorylation of IGF-1 receptor by at least 99% within 24 hours of administration, s. reduces phosphorylation of IRS-1 by at least 10% within 24 hours of administration, t. reduces phosphorylation of IRS-1 by at least 25% within 24 hours of administration, u. reduces phosphorylation of IRS-1 by at least 50% within 24 hours of administration, v. reduces phosphorylation of IRS-1 by at least 75% within 24 hours of administration, w. reduces phosphorylation of IRS-1 by at least 90% within 24 hours of administration, and x. reduces phosphorylation of IRS-1 by at least 99% within 24 hours of administration.

[0023]In another aspect, the present invention provides a method of treating a tumor in a subject wherein said tumor is of a type selected from the group consisting of ovarian, lung, carcinoid, head and neck, colon, breast, prostate, and gallbladder, comprising administering to said subject a therapeutically effective amount of an inhibitor of IGF-1 receptor signaling and a therapeutically effective amount of gemcitabine.

[0024]In another aspect, the present invention provides a method of determining the relative likelihood that a tumor in a human subject will respond to a treatment comprising administering an inhibitor of IGF-1 receptor signaling to said subject, said method comprising determining whether cells from said tumor comprise a biomarker selected from the group consisting of: a. an activating RAS mutation, wherein presence of said activating RAS mutation indicates that said tumor is more likely to respond to said treatment, b. an activating mutation in codon 12 of a RAS, wherein presence of said activating mutation in codon 12 of said RAS indicates that said tumor is more likely to respond to said treatment, c. an activating KRAS mutation, wherein presence of said activating KRAS mutation indicates that said tumor is more likely to respond to said treatment, d. an activating mutation in codon 12 of KRAS, wherein presence of said activating mutation in codon 12 of said KRAS indicates that said tumor is more likely to respond to said treatment, e. a KRAS G12C mutation, wherein presence of said KRAS G12C mutation indicates that said tumor is more likely to respond to said treatment, f. a wild-type KRAS allele, wherein said treatment further comprises treating said human subject with an inhibitor of EGF receptor, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment, g. a wild-type KRAS allele, wherein said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment, h. a wild-type KRAS allele, wherein said subject previously received panitumumab and/or cetuximab, said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment, i. a wild-type KRAS allele, wherein said tumor is a colorectal tumor, said subject previously received panitumumab and/or cetuximab, said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment, j. a reduced expression of PTEN, wherein presence of said reduced expression of PTEN indicates that said tumor is less likely to respond to said treatment, k. a missense or nonsense mutation in PTEN, wherein presence of said missence or nonsense mutation in PTEN indicates that said tumor is less likely to respond to said treatment, l. an EWS-FLI genetic translocation, wherein presence of said EWS-FLI genetic translocation indicates that said tumor is more likely to respond to said treatment, m. expression of an EWS-FLI hybrid gene, wherein expression of said EWS-FLI hybrid gene indicates that said tumor is more likely to respond to said treatment, n. an EWS/ets gene rearrangement, wherein presence of said EWS/ets gene rearrangement indicates that said tumor is more likely to respond to said treatment, o. expression of an EWS/ets hybrid gene, wherein expression of said EWS/ets hybrid gene indicates that said tumor is more likely to respond to said treatment, and p. a t(11;22)(q24;q12) chromosomal abnormality, wherein presence of said t(11;22)(q24;q12) chromosomal abnormality indicates that said tumor is more likely to respond to said treatment. In one embodiment, wherein said tumor is determined to be more likely to respond to said treatment, said method further comprising the subsequent step of administering said treatment to said subject.

[0025]In another aspect, the present invention provides a composition for treating a tumor disease in a human subject, comprising: between 10 and 150 mg/ml of an antibody, antibody fragment, or antibody derivative that specifically bind to IGF -1 receptor, between 1 and 100 mM acetate, pH between 4.0 and 9.0, between 0.5% and 20.0% w/v sorbitol, and between 0.001% and 0.010% w/v Polysorbate 20. In one embodiment, the compositions comprises: 30 mg/ml of said antibody, antibody fragment, or antibody derivative, 10 mM acetate, pH 5.2, 5% w/v sorbitol, and 0.004% w/v Polysorbate 20.

[0026]In another aspect, the present invention provides an isolated antigen binding protein comprising either: a. a light chain CDR3 comprising a sequence selected from the group consisting of: i. a light chain CDR3 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR3 sequence selected from the group consisting of the light chain CDR3 sequences of L1-L52 as shown in FIG. 6; ii. M X₁ X₂ X₃ X₄ X₅ P X₆ X₇; Q Q X₈ X₉ X₁₀ X₁₁ P X₁₂ T; and iv. Q S Y X₁₃ X₁₄ X₁₅ N X₁₆ X₁₇ X₁₈; b. a heavy chain CDR3 comprising a sequence selected from the group consisting of: i. a heavy chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence selected from the group consisting of the heavy chain CDR3 sequences of H1-H52 as shown in FIG. 9; ii. X₁₉ X₂₀ X₂₁ X₂₂ X₂₃ X₂₄ X₂₅ X₂₆ X₂₇ F D I; iii. X₂₈ X₂₉ X₃₀ X₃₁ X₃₂ X₃₃ X₃₄ X₃₅ X₃₆ X₃₇ X₃₈ M D V; iv. D S S X₃₉; or C. the light chain CDR3 sequence of (a) and the heavy chain CDR3 sequence of (b); wherein X₁ is a glutamine residue or a glutamate residue, X₂ is an alanine residue, a glycine residue, a threonine residue, or a serine residue, X₃ is a leucine residue, a phenylalanine residue, or a threonine residue, X₄ is glutamine residue, a glutamate residue, or a histidine residue, X₅ is a threonine residue, a methionine residue, a tryptophan residue, or a valine residue, X₆ is a glycine residue, an alanine residue, a valine residue, a leucine residue, an isoleucine residue, a proline residue, a phenylalanine residue, a methionine residue, a tryptophan residue, or a cysteine residue, X₇ is threonine residue, an alanine residue, or a serine residue, X₈ is an arginine residue, a serine residue, a leucine residue, or an alanine residue, X₉ is an asparagine residue, a serine residue, or a histidine residue, X₁₀ is an asparagine residue or a serine residue, X₁₁ is a tryptophan residue, a valine residue, a tyrosine residue, a proline residue, or a phenylalanine residue, X₁₂ is a leucine residue, a tyrosine residue, or an isoleucine residue, X₁₃ is an aspartate residue or a glutamine residue, X₁₄ is a serine residue or a proline residue, X₁₅ is a serine residue, a tyrosine residue, an aspartate residue, or an alanine residue, X₁₆ is a glutamine residue, an arginine residue, a valine residue, or a tryptophan residue, X₁₇ is an arginine residue, a valine residue, an isoleucine residue, or no residue, X₁₈ is a valine residue or no residue, X₁₉ is a glutamate residue or no residue, X₂₀ is a tyrosine residue, a glycine residue, a serine residue, or no residue, X₂₁ is a serine residue, an asparagine residue, a tryptophan residue, a glutamate residue, as aspartate residue, or no residue, X₂₂ is a serine residue, an aspartate residue, a tryptophan residue, an alanine residue, an arginine residue, a threonine residue, a glutamine residue, a leucine residue, a glutamate residue, or no residue, X₂₃ is a serine residue, a glycine residue, an asparagine residue, a threonine residue, a tryptophan residue, a valine residue, an alanine residue, or an isoleucine residue, X₂₄ is an arginine residue, a glutamine residue, a tyrosine residue, a valine residue, an alanine residue, a glycine residue, a serine residue, a phenylalanine residue, or a tryptophan residue, X₂₅ is an asparagine residue, a leucine residue, an aspartate residue, a threonine residue, a tryptophan residue, a tyrosine residue, a valine residue, an alanine residue, or a histidine residue, X₂₆ is an aspartate residue, a serine residue, an asparagine residue, or a glutamine residue, X₂₇ is an alanine residue or a proline residue, X₂₈ is an alanine residue or no residue, X₂₉ is a glutamate residue, a tyrosine residue, a glycine residue, or no residue, X₃₀ is an arginine residue, a serine residue, or no residue, X₃₁ is a glycine residue, an aspartate residue, a valine residue, a serine residue, or no residue, X₃₂ is a serine residue, an aspartate residue, a glycine residue, or no residue, X₃₃ is a phenylalanine residue, an aspartate residue, a tyrosine residue, a glycine residue, a serine residue, a histidine residue, a tryptophan residue, or no residue, X₃₄ is a tryptophan residue, an aspartate residue, a tyrosine residue, a serine residue, or no residue, X₃₅ is an aspartate residue, a glutamate residue, an arginine residue, a serine residue, a glycine residue, a tyrosine residue, or a tryptophan residue, X₃₆ is a tyrosine residue, a lysine residue, an isoleucine residue, a leucine residue or a phenylalanine residue, X₃₇ is a tyrosine residue, a serine residue, a phenylalanine residue, an aspartate residue, or a glycine residue, X₃₈ is a glycine residue, an asparagine residue, or a tyrosine residue, X₃₉ is a valine residue, a glycine residue, or a serine residue, and said antigen binding protein binds specifically to human IGF-1R. In one embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR3 sequence of L1-L52 as shown in FIG. 6; c. a heavy chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and d. a heavy chain CDR3 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a heavy chain CDR2 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR2 sequence of H1-H52 as shown in FIG. 8; and c. a heavy chain CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises an amino acid sequence selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR1 sequence of L1-L52 as shown in FIG. 4; and b. a heavy chain CDR2 sequence of H1-H52 as shown in FIG. 8. In another embodiment, the isolated antigen binding protein comprises a CDR1 sequence of L1-L52 as shown in FIG. 4. In another embodiment, the isolated antigen binding protein comprises a sequence selected from the group consisting of: a. a light chain CDR1 sequence selected from the group consisting of: i. RSSQSLLHSNGYNYLD; ii. RASQ(G/S)(I/V)(G/S)X(Y/F)L(A/N); and iii. RSSQS(L/I)XXXXX; b. a light chain CDR2 sequence selected from the group consisting of: i. LGSNRAS; ii. AASTLQS; and iii. EDNXRPS; c. a heavy chain CDR1 sequence selected from the group consisting of: i. SSNWWS; ii. XYYWS; and iii. SYAM(S/H); and d. a heavy chain CDR2 sequence selected from the group consisting of: i. (E/I)(I/V)(Y/N)(H/Y)SGST(N/Y)YNPSLKS; and ii. XIS(G/S)SG(G/S)STYYADSVKG; wherein amino acid residue symbols enclosed in parentheses identify alternative residues for the same position in a sequence, each X is independently any amino acid residue, and each Z is independently a glycine residue, an alanine residue, a valine residue, a leucine residue, an isoleucine residue, a proline residue, a phenylalanine residue, a methionine residue, a tryptophan residue, or a cysteine residue. In another embodiment, the isolated antigen binding protein comprises a heavy chain CDR3 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises a heavy chain CDR3 sequence that differs by no more than a total of one amino acid addition, substitution, or deletion from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises a heavy chain CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises two amino acid sequences selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises three amino acid sequences selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises four amino acid sequences selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in

FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises five amino acid sequences selected from the group consisting of: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises: a. a light chain CDR1 sequence that differs by no more than a total of six amino acid additions, substitutions, and/or deletions from a CDR1 sequence of L1-L52 as shown in FIG. 4; b. a light chain CDR2 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR2 sequence of L1-L52 as shown in FIG. 5; c. a light chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, and/or deletions from a CDR3 sequence of L1-L52 as shown in FIG. 6; d. a heavy chain CDR1 sequence that differs by no more than a total of two amino acid additions, substitutions, and/or deletions from a CDR1 sequence of H1-H52 as shown in FIG. 7; e. a heavy chain CDR2 sequence that differs by no more than a total of five amino acid additions, substitutions, and/or deletions from a CDR2 sequence of H1-H52 as shown in FIG. 8; and f. a heavy chain CDR3 sequence that differs by no more than a total of four amino acid additions, substitutions, and/or deletions from a CDR3 sequence of H1-H52 as shown in FIG. 9. In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain comprising: i. a light chain CDR1 sequence shown in FIG. 4; ii. a light chain CDR2 sequence shown in FIG. 5; and iii. a light chain CDR3 sequence shown in FIG. 6; b. a heavy chain variable domain comprising: i. a heavy chain CDR1 sequence shown in FIG. 7; ii. a heavy chain CDR2 sequence shown in FIG. 8; and iii. a heavy chain CDR3 sequence shown in FIG. 9; or c. the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. light chain CDR1, CDR2, and CDR3 sequences that each is identical to the CDR1, CDR2, and CDR3 sequences, respectively, of the same light chain variable domain sequence selected from the group consisting of L1-L52; b. heavy chain CDR1, CDR2, and CDR3 sequences that each is identical to the CDR1, CDR2, and CDR3 sequences, respectively, of the same heavy chain variable domain sequence selected from the group consisting of H1-H52; or c. the light chain CDR1, CDR2, and CDR3 sequences of (a) and the heavy chain CDR1, CDR2, and CDR3 sequences of (b).

[0027]In another aspect, the present invention provides an isolated antigen binding protein comprising either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 80% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 15 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 80% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and iv. a sequence of amino acids encoded by a polynucleotide sequence that hybridizes under moderately stringent conditions to the complement of a polynucleotide consisting of a light chain variable domain sequence of L1-L52 as shown in FIG. 1; b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 80% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 15 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 80% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; and iv. a sequence of amino acids encoded by a polynucleotide sequence that hybridizes under moderately stringent conditions to the complement of a polynucleotide consisting of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c. the light chain variable domain of (a) and the heavy chain variable domain of (b); wherein said antigen binding protein binds to human IGF-1R. In one embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 85% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 25 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 85% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and iv. a sequence of amino acids encoded by a polynucleotide sequence that hybridizes under highly stringent conditions to the complement of a polynucleotide consisting of a light chain variable domain sequence of L1-L52 as shown in FIG. 1; b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 85% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 25 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 85% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; and iv. a sequence of amino acids encoded by a polynucleotide sequence that hybridizes under highly stringent conditions to the complement of a polynucleotide consisting of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c) the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 90% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 35 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 90% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 90% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 35 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 90% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c) the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 95% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 50 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 95% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 95% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 50 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 95% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c) the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 97% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 75 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 97% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 97% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 75 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 97% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c) the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 99% identical to a light chain variable domain sequence of L1-L52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 90 contiguous amino acid residues of a light chain variable domain sequence of L1-L52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 99% identical to a polynucleotide sequence encoding a light chain variable domain sequence of L1-L52 as shown in FIG. 1; and b. a heavy chain variable domain sequence selected from the group consisting of: i. a sequence of amino acids at least 99% identical to a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; ii. a sequence of amino acids comprising at least 90 contiguous amino acid residues of a heavy chain variable domain sequence of H1-H52 as shown in FIG. 2; and iii. a sequence of amino acids encoded by a polynucleotide sequence that is at least 99% identical to a polynucleotide sequence encoding a heavy chain variable domain sequence of H1-H52 as shown in FIG. 1; or c. the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises either: a. a light chain variable domain sequence selected from the group consisting of L1-L52 as shown in FIG. 2; b. a heavy chain variable domain sequence selected from the group consisting of H1-H52 as shown in FIG. 3; or c. the light chain variable domain of (a) and the heavy chain variable domain of (b). In another embodiment, the isolated antigen binding protein comprises a combination of a light chain variable domain and a heavy chain variable domain selected from the group of combinations consisting of: L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52. In another embodiment, the isolated antigen binding protein further comprises: a. the kappa light chain constant sequence of FIG. 13, b. the IgG1 heavy chain constant sequence of FIG. 13, or c. the kappa light chain constant sequence of FIG. 13 and the IgG1 heavy chain constant sequence of FIG. 13. In another embodiment, the isolated antigen binding protein, when bound to IGF-1R: a. inhibits IGF-1R; b. activates IGF-1R; c. cross-competes with a reference antibody for binding to IGF-1R; d. binds to the same epitope of IGF-1R as said reference antibody; e. binds to IGF-1R with substantially the same Kd as said reference antibody; or f. binds to IGF-1R with substantially the same off rate as said reference antibody; wherein said reference antibody comprises a combination of light chain and heavy chain variable domain sequences selected from the group of combinations consisting of L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29-H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52. In another embodiment, the isolated antigen binding protein, when bound to a human IGF-1R, inhibits binding of IGF-1 and/or IGF-2 to said human IGF-1R. In another embodiment, the isolated antigen binding protein inhibits the growth of a cancer cell by greater than about 80% in the presence of a growth stimulant selected from the group consisting of serum, IGF-1, and IGF-2. In another embodiment, said cancer cell is an MCF-7 human breast cancer cell. In another embodiment, the isolated antigen binding protein binds to human IGF-1R with a selectivity that is at least fifty times greater than its selectivity for human insulin receptor. In another embodiment, the isolated antigen binding protein inhibits tumor growth in vivo. In another embodiment, the isolated antigen binding protein inhibits IGF-1R mediated tyrosine phosphorylation. In another embodiment, the isolated antigen binding protein specifically binds to the IGF-1R of a non-human primate, a cynomologous monkey, a chimpanzee, a non-primate mammal, a rodent, a mouse, a rat, a hamster, a guinea pig, a cat, or a dog. In another embodiment, the isolated antigen binding protein comprises: a. a human antibody; b. a humanized antibody; c. a chimeric antibody; d. a monoclonal antibody; e. a polyclonal antibody; f. a recombinant antibody; g. an antigen-binding antibody fragment; h. a single chain antibody; i. a diabody; j. a triabody; k. a tetrabody; l. a Fab fragment; m. a F(ab')₂ fragment; n. a domain antibody; o. an IgD antibody; p. an IgE antibody; q. an IgM antibody; r. an IgG1 antibody; s. an IgG2 antibody; t. an IgG3 antibody; u. an IgG4 antibody; or v. an IgG4 antibody having at least one mutation in a hinge region that alleviates a tendency to form intra-H chain disulfide bond.

[0028]In another aspect, the present invention provides an isolated polynucleotide comprising a sequence that encodes the light chain, the heavy chain, or both of said antigen binding protein. In one embodiment, said polynucleotide comprises a light chain variable domain nucleic acid sequence of FIG. 1 and/or a heavy chain variable domain nucleic acid sequence of FIG. 1. In another embodiment, a plasmid comprises said isolated polynucleotide. In another embodiment, said plasmid is an expression vector. In another embodiment, an isolated cell comprises said polynucleotide. In another embodiment, a chromosome of said cell comprises said polynucleotide. In another embodiment, said cell is a hybridoma. In another embodiment, an expression vector comprises said polynucleotide. In another embodiment, said cell is a CHO cell. In another embodiment, the present invention provides a method of making an antigen binding protein that binds human IGF-1R, comprising incubating said isolated cell under conditions that allow it to express said antigen binding protein.

[0029]In another aspect, the present invention provides a pharmaceutical composition comprising the antigen binding protein. In one embodiment, the present invention provides a method of treating a condition in a subject comprising administering to said subject said pharmaceutical composition, wherein said condition is treatable by reducing the activity of IGF-1R in said subject. In another embodiment, said subject is a human being. In another embodiment, said condition is multiple myeloma, a liquid tumor, liver cancer, a thymus disorder, a T-cell mediated autoimmune disease, an endocronological disorder, ischemia, or a neurodegenerative disorder. In another embodiment, said liquid tumor is selected from the group consisting of acute lymphocytic leukemia (ALL) and chronic myelogenous leukemia (CML); wherein said liver cancer is selected from the group consisting of hepatoma, hepatocellular carcinoma, cholangiocarcinoma, angiosarcomas, hemangiosarcomas, hepatoblastoma; wherein said thymus disorder is selected from the group consisting of thymoma and thyroiditis, wherein said T-cell mediated autoimmune disease is selected from the group consisting of Multiple Sclerosis, Rheumatoid Arthritis, Systemic Lupus Erythematosus (SLE), Grave's Disease, Hashimoto's Thyroiditis, Myasthenia Gravis, Auto-Immune Thyroiditis, Bechet's Disease, wherein said endocrinological disorder is selected from the group consisting of Type II Diabetes, hyperthyroidism, hypothyroidism, thyroiditis, hyperadrenocorticism, and hypoadrenocorticism; wherein said ischemia is post cardiac infarct ischemia, or wherein said neurodegenerative disorder is Alzheimer's Disease. In another embodiment, said condition is selected from the group consisting of acromegaly, bladder cancer, Wilm's tumor, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, diarrhea associated with metastatic carcinoid, vasoactive intestinal peptide secreting tumors, gigantism, psoriasis, atherosclerosis, smooth muscle restenosis of blood vessels, inappropriate microvascular proliferation, glioblastoma, medulloblastoma, head and neck squamous cell cancer, oral cancer, oral leukoplakia, prostate intraepithelial neoplasia, anal cancer, esophageal cancer, gastric cancer, bone cancer, metastatic cancer, polycythemia rubra vera, a benign condition related to oxidative stress, retinopathy of prematurity, Acute Respiratory Distress Syndrome, an overdose of acetaminophen, bronchopulmonary dysplasia, cystic fibrosis, lung fibrosis, and diabetic retinopathy. In another embodiment, the method further comprising administering to said subject a second treatment. In another embodiment, said second treatment is administered to said subject before and/or simultaneously with and/or after said pharmaceutical composition is administered to said subject. In another embodiment, said second treatment comprises radiation treatment, surgery, or a second pharmaceutical composition. In another embodiment, said second pharmaceutical composition comprises an agent selected from the group consisting of a corticosteroid, an anti-emetic, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, a cancer vaccine, a GM-CSF inhibiting agent, a GM-CSF DNA vaccine, a cell-based vaccine, a dendritic cell vaccine, a recombinant viral vaccine, a heat shock protein (HSP) vaccine, an allogeneic tumor vaccine, an autologous tumor vaccine, an analgesic, ibuprofen, naproxen, choline magnesium trisalicylate, an oxycodone hydrochloride, an anti-angiogenic agent, an anti-vascular agent, bevacizumab, an anti-VEGF antibody, an anti-VEGF receptor antibody, a soluble VEGF receptor fragment, an anti-TWEAK antibody, an anti-TWEAK receptor antibody, a soluble TWEAK receptor fragment, AMG 706, AMG 386, an anti-proliferative agent, a farnesyl protein transferase inhibitor, an αvβ3 inhibitor, an αvβ5 inhibitor, a p53 inhibitor, a Kit receptor inhibitor, a ret receptor inhibitor, a PDGFR inhibitor, a growth hormone secretion inhibitor, an angiopoietin inhibitor, a tumor infiltrating macrophage-inhibiting agent, a c-fms inhibiting agent, an anti-c-fms antibody, an CSF-1 inhibiting agent, an anti-CSF-1 antibody, a soluble c-fms fragment, pegvisomant, gemcitabine, panitumumab, irinothecan, and SN-38. In another embodiment, said method comprises administering to said subject a third treatment. In another embodiment, said condition is a cancer, said second treatment comprises administering panitumumab, and said third treatment comprises administering gemcitabine. In another embodiment, said condition is selected from the group consisting of acromegaly, bladder cancer, Wilm's tumor, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, diarrhea associated with metastatic carcinoid, vasoactive intestinal peptide secreting tumors, gigantism, psoriasis, atherosclerosis, smooth muscle restenosis of blood vessels, inappropriate microvascular proliferation, glioblastoma, medulloblastoma, head and neck squamous cell cancer, oral cancer, oral leukoplakia, prostate intraepithelial neoplasia, anal cancer, esophageal cancer, gastric cancer, bone cancer, metastatic cancer, polycythemia rubra vera, a benign condition related to oxidative stress, retinopathy of prematurity, Acute Respiratory Distress Syndrome, an overdose of acetaminophen, bronchopulmonary dysplasia, cystic fibrosis, lung fibrosis, and diabetic retinopathy.

[0030]In another aspect, the present invention provides a method of increasing the longevity of a subject comprising administering to said subject said pharmaceutical composition.

[0031]In another aspect, the present invention provides a method of decreasing IGF-1R activity in a subject in need thereof comprising administering to said subject said pharmaceutical composition.

[0032]In another aspect, the present invention provides a method of decreasing IGF-1R signaling in a subject in need thereof comprising administering to said subject said pharmaceutical composition.

[0033]In another aspect, the present invention provides a method of inhibiting the binding of IGF-1 and/or IGF-2 to IGF-1R in a subject in need thereof comprising administering to said subject said pharmaceutical composition.

DETAILED DESCRIPTION OF THE INVENTION

[0034]The present invention provides compositions, kits, and methods relating to molecules that bind to the Insulin-Like Growth Factor Receptor ("IGF-1R"), including molecules that agonize or antagonize IGF-1R, such as anti-IGF-1R antibodies, antibody fragments, and antibody derivatives, e.g., antagonistic anti-IGF-1R antibodies, antibody fragments, or antibody derivatives. Also provided are nucleic acids, and derivatives and fragments thereof, comprising a sequence of nucleotides that encodes all or a portion of a polypeptide that binds to IGF-1R, e.g., a nucleic acid encoding all or part of an anti-IGF-1R antibody, antibody fragment, or antibody derivative, plasmids and vectors comprising such nucleic acids, and cells or cell lines comprising such nucleic acids and/or vectors and plasmids. The provided methods include, for example, methods of making, identifying, or isolating molecules that bind to IGF-1R, such as anti-IGF-1R antibodies, methods of determining whether a molecule binds to IGF-1R, methods of determining whether a molecule agonizes or antagonizes IGF-1R, methods of making compositions, such as pharmaceutical compositions, comprising a molecule that binds to IGF-1R, and methods for administering a molecule that binds IGF-1R to a subject, for example, methods for treating a condition mediated by IGF-1R, and for agonizing or antagonizing a biological activity of IGF-1R, IGF-1, and/or IGF-2 in vivo or in vitro.

[0035]Polynucleotide and polypeptide sequences are indicated using standard one- or three-letter abbreviations. Unless otherwise indicated, polypeptide sequences have their amino termini at the left and their carboxy termini at the right and single-stranded nucleic acid sequences, and the top strand of double-stranded nucleic acid sequences, have their 5' termini at the left and their 3' termini at the right. A particular polypeptide or polynucleotide sequence also can be described by explaining how it differs from a reference sequence.

[0036]Polynucleotide and polypeptide sequences of particular light and heavy chain variable domains are shown in FIGS. 1, 2 and 3 where they are labeled, for example, L1 ("light chain variable domain 1"), H1 ("heavy chain variable domain 1"), etc. Antibodies comprising a light chain and heavy chain from FIGS. 2 and 3 are indicated by combining the name of the light chain and the name of the heavy chain variable domains. For example, "L4H7," indicates an antibody comprising the light chain variable domain of L4 and the heavy chain variable domain of H7.

[0037]Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992), and Harlow and Lane Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990), which are incorporated herein by reference. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The terminology used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0038]The following terms, unless otherwise indicated, shall be understood to have the following meanings:

[0039]The term "isolated molecule" (where the molecule is, for example, a polypeptide, a polynucleotide, or an antibody) is a molecule that by virtue of its origin or source of derivation (1) is not associated with naturally associated components that accompany it in its native state, (2) is substantially free of other molecules from the same species (3) is expressed by a cell from a different species, or (4) does not occur in nature. Thus, a molecule that is chemically synthesized, or synthesized in a cellular system different from the cell from which it naturally originates, will be "isolated" from its naturally associated components. A molecule also may be rendered substantially free of naturally associated components by isolation, using purification techniques well known in the art. Molecule purity or homogeneity may be assayed by a number of means well known in the art. For example, the purity of a polypeptide sample may be assayed using polyacrylamide gel electrophoresis and staining of the gel to visualize the polypeptide using techniques well known in the art. For certain purposes, higher resolution may be provided by using HPLC or other means well known in the art for purification.

[0040]The terms "IGF-1R inhibitor" and "IGF-1R antagonist" are used interchangeably. Each is a molecule that detectably inhibits at least one function of IGF-1R. Conversely, an "IGF-1R agonist" is a molecule that detectably increases at least one function of IGF-1R. The inhibition caused by an IGF-1R inhibitor need not be complete so long as it is detectable using an assay. Any assay of a function of IGF-1R can be used, examples of which are provided herein. Examples of functions of IGF-1R that can be inhibited by an IGF-1R inhibitor, or increased by an IGF-1R agonist, include binding to IGF-1, IGF-12, and/or another IGF-1R-activating molecule, kinase activity, downstream signaling, and so on. Examples of types of IGF-1R inhibitors and IGF-1R agonists include, but are not limited to, IGF-1R binding polypeptides such as antigen binding proteins (e.g., IGF-1R inhibiting antiben binding proteins), antibodies, antibody fragments, and antibody derivatives.

[0041]The terms "peptide," "polypeptide" and "protein" each refers to a molecule comprising two or more amino acid residues joined to each other by peptide bonds. These terms encompass, e.g., native and artificial proteins, protein fragments and polypeptide analogs (such as muteins, variants, and fusion proteins) of a protein sequence as well as post-translationally, or otherwise covalently or non-covalently, modified proteins. A peptide, polypeptide, or protein may be monomeric or polymeric.

[0042]The term "polypeptide fragment" as used herein refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion as compared to a corresponding full-length protein. Fragments can be, for example, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 50, 70, 80, 90, 100, 150 or 200 amino acids in length. Fragments can also be, for example, at most 1,000, 750, 500, 250, 200, 175, 150, 125, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 14, 13, 12, 11, or 10 amino acids in length. A fragment can further comprise, at either or both of its ends, one or more additional amino acids, for example, a sequence of amino acids from a different naturally-occurring protein (e.g., an Fc or leucine zipper domain) or an artificial amino acid sequence (e.g., an artificial linker sequence).

[0043]Polypeptides of the invention include polypeptides that have been modified in any way and for any reason, for example, to: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (4) confer or modify other physicochemical or functional properties. Analogs include muteins of a polypeptide. For example, single or multiple amino acid substitutions (e.g., conservative amino acid substitutions) may be made in the naturally occurring sequence (e.g., in the portion of the polypeptide outside the domain(s) forming intermolecular contacts. A "conservative amino acid substitution" is one that does not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterize the parent sequence or are necessary for its functionality). Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W.H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et at. Nature 354:105 (1991), which are each incorporated herein by reference.

[0044]The present invention also provides non-peptide analogs of IGF-1R binding polypeptides. Non-peptide analogs are commonly used in the pharmaceutical industry as drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics" or "peptidomimetics". Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger TINS p. 392 (1985); and Evans et al. J. Med. Chem. 30:1229 (1987), which are incorporated herein by reference. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect. Generally, peptidomimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a desired biochemical property or pharmacological activity), such as a human antibody, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: --CH₂NH--, --CH₂S--, --CH₂--CH₂--, --CH═CH-(cis and trans), --COCH₂--, --CH(OH)CH₂--, and --CH₂SO--, by methods well known in the art. Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) may also be used to generate more stable peptides. In addition, constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch Ann. Rev. Biochem. 61:387 (1992), incorporated herein by reference), for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide.

[0045]A "variant" of a polypeptide (e.g., an antibody) comprises an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence. Variants of the invention include fusion proteins.

[0046]A "derivative" of a polypeptide is a polypeptide (e.g., an antibody) that has been chemically modified, e.g., via conjugation to another chemical moiety such as, for example, polyethylene glycol, albumin (e.g., human serum albumin), phosphorylation, and glycosylation. Unless otherwise indicated, the term "antibody" includes, in addition to antibodies comprising two full-length heavy chains and two full-length light chains, derivatives, variants, fragments, and muteins thereof, examples of which are described below.

[0047]An "antigen binding protein" is a protein comprising a portion that binds to an antigen and, optionally, a scaffold or framework portion that allows the antigen binding portion to adopt a conformation that promotes binding of the antigen binding protein to the antigen. Examples of antigen binding proteins include antibodies, antibody fragments (e.g., an antigen binding portion of an antibody), antibody derivatives, and antibody analogs. The antigen binding protein can comprise, for example, an alternative protein scaffold or artificial scaffold with grafted CDRs or CDR derivatives. Such scaffolds include, but are not limited to, antibody-derived scaffolds comprising mutations introduced to, for example, stabilize the three-dimensional structure of the antigen binding protein as well as wholly synthetic scaffolds comprising, for example, a biocompatible polymer. See, for example, Korndorfer et al., 2003, Proteins: Structure, Function, and Bioinformatics, Volume 53, Issue 1:121-129; Roque et al., 2004, Biotechnol. Prog. 20:639-654. In addition, peptide antibody mimetics ("PAMs") can be used, as well as scaffolds based on antibody mimetics utilizing fibronection components as a scaffold.

[0048]An antigen binding protein can have, for example, the structure of a naturally occurring immunoglobulin. An "immunoglobulin" is a tetrameric molecule. In a naturally occurring immunoglobulin, each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. Within light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 more amino acids. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989)) (incorporated by reference in its entirety for all purposes). The variable regions of each light/heavy chain pair form the antibody binding site such that an intact immunoglobulin has two binding sites.

[0049]Naturally occurring immunoglobulin chains exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs. From N-terminus to C-terminus, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain is in accordance with the definitions of Kabat et al. in Sequences of Proteins of Immunological Interest, 5^th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication no. 91-3242, 1991.

[0050]An "antibody" refers to an intact immunoglobulin or to an antigen binding portion thereof that competes with the intact antibody for specific binding, unless otherwise specified. Antigen binding portions may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Antigen binding portions include, inter alia, Fab, Fab', F(ab')₂, Fv, domain antibodies (dAbs), and complementarity determining region (CDR) fragments, single-chain antibodies (scFv), chimeric antibodies, diabodies, triabodies, tetrabodies, and polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide.

[0051]A Fab fragment is a monovalent fragment having the V_L, V_H, C_L and C_H1 domains; a F(ab')₂ fragment is a bivalent fragment having two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment has the V_H and C_H1 domains; an Fv fragment has the V_L and V_H domains of a single arm of an antibody; and a dAb fragment has a V_H domain, a V_L domain, or an antigen-binding fragment of a V_H or V_L domain (U.S. Pat. Nos. 6,846,634, 6,696,245, US App. Pub. No. 05/0202512, 04/0202995, 04/0038291, 04/0009507, 03/0039958, Ward et al., Nature 341:544-546, 1989).

[0052]A single-chain antibody (scFv) is an antibody in which a V_L and a V_H region are joined via a linker (e.g., a synthetic sequence of amino acid residues) to form a continuous protein chain wherein the linker is long enough to allow the protein chain to fold back on itself and form a monovalent antigen binding site (see, e.g., Bird et al., 1988, Science 242:423-26 and Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-83). Diabodies are bivalent antibodies comprising two polypeptide chains, wherein each polypeptide chain comprises V_H and V_L domains joined by a linker that is too short to allow for pairing between two domains on the same chain, thus allowing each domain to pair with a complementary domain on another polypeptide chain (see, e.g., Holliger et al., 1993, Proc. Natl. Acad. Sci. USA 90:6444-48, and Poljak et al., 1994, Structure 2:1121-23). If the two polypeptide chains of a diabody are identical, then a diabody resulting from their pairing will have two identical antigen binding sites. Polypeptide chains having different sequences can be used to make a diabody with two different antigen binding sites. Similarly, tribodies and tetrabodies are antibodies comprising three and four polypeptide chains, respectively, and forming three and four antigen binding sites, respectively, which can be the same or different.

[0053]Complementarity determining regions (CDRs) and framework regions (FR) of a given antibody may be identified using the system described by Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication no. 91-3242, 1991. One or more CDRs may be incorporated into a molecule either covalently or noncovalently to make it an antigen binding protein. An antigen binding protein may incorporate the CDR(s) as part of a larger polypeptide chain, may covalently link the CDR(s) to another polypeptide chain, or may incorporate the CDR(s) noncovalently. The CDRs permit the antigen binding protein to specifically bind to a particular antigen of interest.

[0054]An antigen binding protein may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or may be different. For example, a naturally occurring human immunoglobulin typically has two identical binding sites, while a "bispecific" or "bifunctional" antibody has two different binding sites.

[0055]The term "human antibody" includes all antibodies that have one or more variable and constant regions derived from human immunoglobulin sequences. In one embodiment, all of the variable and constant domains are derived from human immunoglobulin sequences (a fully human antibody). These antibodies may be prepared in a variety of ways, examples of which are described below, including through the immunization with an antigen of interest of a mouse that is genetically modified to express antibodies derived from human heavy and/or light chain-encoding genes.

[0056]A humanized antibody has a sequence that differs from the sequence of an antibody derived from a non-human species by one or more amino acid substitutions, deletions, and/or additions, such that the humanized antibody is less likely to induce an immune response, and/or induces a less severe immune response, as compared to the non-human species antibody, when it is administered to a human subject. In one embodiment, certain amino acids in the framework and constant domains of the heavy and/or light chains of the non-human species antibody are mutated to produce the humanized antibody. In another embodiment, the constant domain(s) from a human antibody are fused to the variable domain(s) of a non-human species. In another embodiment, one or more amino acid residues in one or more CDR sequences of a non-human antibody are changed to reduce the likely immunogenicity of the non-human antibody when it is administered to a human subject, wherein the changed amino acid residues either are not critical for immunospecific binding of the antibody to its antigen, or the changes to the amino acid sequence that are made are conservative changes, such that the binding of the humanized antibody to the antigen is not significantly worse than the binding of the non-human antibody to the antigen. Examples of how to make humanized antibodies may be found in U.S. Pat. Nos. 6,054,297, 5,886,152 and 5,877,293.

[0057]The term "chimeric antibody" refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. In one embodiment, one or more of the CDRs are derived from a human anti-IGF-1R antibody. In another embodiment, all of the CDRs are derived from a human anti-IGF-1R antibody. In another embodiment, the CDRs from more than one human anti-IGF-1R antibodies are mixed and matched in a chimeric antibody. For instance, a chimeric antibody may comprise a CDR1 from the light chain of a first human anti-IGF-1R antibody, a CDR2 and a CDR3 from the light chain of a second human anti-IGF-1R antibody, and the CDRs from the heavy chain from a third anti-IGF-1R antibody. Further, the framework regions may be derived from one of the same anti-IGF-1R antibodies, from one or more different antibodies, such as a human antibody, or from a humanized antibody. In one example of a chimeric antibody, a portion of the heavy and/or light chain is identical with, homologous to, or derived from an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is/are identical with, homologous to, or derived from an antibody (-ies) from another species or belonging to another antibody class or subclass. Also included are fragments of such antibodies that exhibit the desired biological activity (i.e., the ability to specifically bind IGF-1R). See, e.g., U.S. Pat. No. 4,816,567 and Morrison, 1985, Science 229:1202-07.

[0058]A "neutralizing antibody" or "an inhibitory antibody" is an antibody that inhibits the binding of IGF-1R to IGF-I and/or IGF-2 when an excess of the anti-IGF-1R antibody reduces the amount of IGF-I and/or IGF-2 bound to IGF-1R by at least about 20% using the assay described in Example 9. In various embodiments, the antibody reduces the amount of IGF-I and/or IGF-2 bound to IGF-1R by at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, and 99.9%.

[0059]An "activating antibody" is an antibody that activates IGF-1R by at least about 20% when added to a cell, tissue or organism expressing IGF-1R, where "100% activation" is the level of activation achieved under physiological conditions by the same molar amount of IGF-1 and/or IGF-2. In various embodiments, the antibody activates IGF-1R activity by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 750%, or 1000%.

[0060]Fragments or analogs of antibodies can be readily prepared by those of ordinary skill in the art following the teachings of this specification and using techniques well-known in the art. Preferred amino- and carboxy-termini of fragments or analogs occur near boundaries of functional domains. Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases. Computerized comparison methods can be used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. See, e.g., Bowie et al., 1991, Science 253:164.

[0061]A "CDR grafted antibody" is an antibody comprising one or more CDRs derived from an antibody of a particular species or isotype and the framework of another antibody of the same or different species or isotype.

[0062]A "multi-specific antibody" is an antibody that recognizes more than one epitope on one or more antigens. A subclass of this type of antibody is a "bi-specific antibody" which recognizes two distinct epitopes on the same or different antigens.

[0063]An antigen binding protein "specifically binds" to an antigen (e.g., human IGF-1R) if it binds to the antigen with a dissociation constant of 1 nanomolar or less.

[0064]An "antigen binding domain," "antigen binding region," or "antigen binding site" is a portion of an antigen binding protein that contains amino acid residues (or other moieties) that interact with an antigen and contribute to the antigen binding protein's specificity and affinity for the antigen. For an antibody that specifically binds to its antigen, this will include at least part of at least one of its CDR domains.

[0065]An "epitope" is the portion of a molecule that is bound by an antigen binding protein (e.g., by an antibody). An epitope can comprise non-contiguous portions of the molecule (e.g., in a polypeptide, amino acid residues that are not contiguous in the polypeptide's primary sequence but that, in the context of the polypeptide's tertiary and quaternary structure, are near enough to each other to be bound by an antigen binding protein).

[0066]The "percent identity" of two polynucleotide or two polypeptide sequences is determined by comparing the sequences using the GAP computer program (a part of the GCG Wisconsin Package, version 10.3 (Accelrys, San Diego, Calif.)) using its default parameters.

[0067]The terms "polynucleotide," "oligonucleotide" and "nucleic acid" are used interchangeably throughout and include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and hybrids thereof. The nucleic acid molecule can be single-stranded or double-stranded. In one embodiment, the nucleic acid molecules of the invention comprise a contiguous open reading frame encoding an antibody, or a fragment, derivative, mutein, or variant thereof, of the invention.

[0068]Two single-stranded polynucleotides are "the complement" of each other if their sequences can be aligned in an anti-parallel orientiation such that every nucleotide in one polynucleotide is opposite its complementary nucleotide in the other polynucleotide, without the introduction of gaps, and without unpaired nucleotides at the 5' or the 3' end of either sequence. A polynucleotide is "complementary" to another polynucleotide if the two polynucleotides can hybridize to one another under moderately stringent conditions. Thus, a polynucleotide can be complementary to another polynucleotide without being its complement.

[0069]A "vector" is a nucleic acid that can be used to introduce another nucleic acid linked to it into a cell. One type of vector is a "plasmid," which refers to a linear or circular double stranded DNA molecule into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), wherein additional DNA segments can be introduced into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors comprising a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. An "expression vector" is a type of vector that can direct the expression of a chosen polynucleotide.

[0070]A nucleotide sequence is "operably linked" to a regulatory sequence if the regulatory sequence affects the expression (e.g., the level, timing, or location of expression) of the nucleotide sequence. A "regulatory sequence" is a nucleic acid that affects the expression (e.g., the level, timing, or location of expression) of a nucleic acid to which it is operably linked. The regulatory sequence can, for example, exert its effects directly on the regulated nucleic acid, or through the action of one or more other molecules (e.g., polypeptides that bind to the regulatory sequence and/or the nucleic acid). Examples of regulatory sequences include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Further examples of regulatory sequences are described in, for example, Goeddel, 1990, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. and Baron et al., 1995, Nucleic Acids Res. 23:3605-06.

[0071]A "host cell" is a cell that can be used to express a nucleic acid, e.g., a nucleic acid of the invention. A host cell can be a prokaryote, for example, E. coli, or it can be a eukaryote, for example, a single-celled eukaryote (e.g., a yeast or other fungus), a plant cell (e.g., a tobacco or tomato plant cell), an animal cell (e.g., a human cell, a monkey cell, a hamster cell, a rat cell, a mouse cell, or an insect cell) or a hybridoma. Examples of host cells include the COS-7 line of monkey kidney cells (ATCC CRL 1651) (see Gluzman et al., 1981, Cell 23:175), L cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary (CHO) cells or their derivatives such as Veggie CHO and related cell lines which grow in serum-free media (see Rasmussen et al., 1998, Cytotechnology 28:31) or CHO strain DX-B11, which is deficient in DHFR (see Urlaub et al., 1980, Proc. Natl. Acad. Sci. USA 77:4216-20), HeLa cells, BHK (ATCC CRL 10) cell lines, the CV1/EBNA cell line derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) (see McMahan et al., 1991, EMBO J. 10:2821), human embryonic kidney cells such as 293, 293 EBNA or MSR 293, human epidermal A431 cells, human Colo205 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HL-60, U937, HaK or Jurkat cells. Typically, a host cell is a cultured cell that can be transformed or transfected with a polypeptide-encoding nucleic acid, which can then be expressed in the host cell. The phrase "recombinant host cell" can be used to denote a host cell that has been transformed or transfected with a nucleic acid to be expressed. A host cell also can be a cell that comprises the nucleic acid but does not express it at a desired level unless a regulatory sequence is introduced into the host cell such that it becomes operably linked with the nucleic acid. It is understood that the term host cell refers not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to, e.g., mutation or environmental influence, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

IGF-1R

[0072]IGF-1R is a transmembrane receptor tyrosine kinase (Blume-Jensen et al., 2001, Nature 411:355-65). The human IGF-1R is synthesized as a 1367 amino acid precursor polypeptide that includes a 30 amino acid signal peptide removed during translocation into the endoplasmic reticulum (Swiss-Prot: P08069). The IGF-1R proreceptor is glycosylated and cleaved by a protease at positions 708-711 (counting from the first amino acid following the signal peptide sequence) during maturation in the ER-golgi resulting in the formation of an α-chain (1-707) and β-chain (712-1337) that remain linked by disulfide bonds (Bhaumick et al., 1981, Proc Natl Acad Sci USA 78:4279-83, Chemausek et al., 1981, Biochemistry 20:7345-50, Jacobs et al., 1983, Proc Natl Acad Sci USA 80:1228-31, LeBon et al., 1986, J Biol Chem 261:7685-89, Elleman, et al., 2000, Biochem J 347:771-79). The predominant form of the IGF-1R (and INSR) that exists on the cell-surface is a proteolytically processed and glycosylated (αβ)₂ dimer joined covalently by one or more disulfide bonds.

[0073]The extracellular portion of the IGF-1R consists of the α-chain and 191 amino acids of the β-chain (712-905). The receptor contains a single transmembrane spanning sequence (906-929) and a 408-residue cytoplasmic domain that includes a functional tyrosine kinase (Rubin et al., 1983, Nature 305:438-440). Comparative sequence analysis has revealed that the IGF-1R is composed of 11 distinct structural motifs (reviewed by Adams et al., 2000, Cell Mol Life Sci 57:1050-93, Marino-Buslje et al., 1998, FEBS Ltrs 441:331-36, Ward et al., 2001, BMC Bioinformatics 2:4). The N-terminal half of the extracellular domain contains two homologous domains referred to as L1 (1-151) and L2 (299-461) (Ward et al., 2001, supra) separated by a cysteine-rich (CR) region (152-298) consisting of several structural modules with disulfide linkages that align with repeating units present in the TNF receptor and laminin (Ward et al., 1995, Proteins 22:141-53). The crystal structure of the L1-CR-L2 domain has been solved (Garrett et al., 1998, Nature 394:395-99). The L2 domain is followed by three fibronectin type III domains (Marino-Buslje et al., 1998, supra, Mulhern et al., 1998, Trends Biochem Sci 23:465-66, 10. Ward et al., 1999, Growth Factors 16:315-22). The first FnIII domain (FnIII-1, 461-579) is 118 amino acids in length. The second FnIII domain (FnIII-2, 580-798) is disrupted by a major insert sequence (ID) of about 120 amino acids in length. The ID domain includes a furin protease cleavage site that separates the α and β chains of the mature receptor. The third FnIII domain (FnIII-3) is located entirely in the β-chain (799-901) terminating several residues before the transmembrane sequence. The catalytic domain of the IGF-1R tyrosine kinase is located between amino acids positions 973-1229, and its structure has been solved (Favelyukis et al., 2001, Nature Structural Biol 8:1058-63, Pautsch et al., 2001, Structure 9:955-65). The kinase is flanked by two regulatory regions, the juxtamembrane region (930-972) and a 108 amino acid C-terminal tail (1220-1337) (Surmacz et al., 1995, Experimental Cell Res 218:370-80, Hongo et al., 1996, Oncogene 12:1231-38). The two regulatory regions contain tyrosine residues that serve as docking sites for signal transducing proteins when phosphorylated by the activated IGF-1R tyrosine kinase (reviewed by Baserga (ed.), 1998 The IGF-1 Receptor in Normal and Abnormal Growth, Hormones and Growth Factors in Development and Neoplasia, Wiley-Liss, Inc., Adams et al., 2000, Cell Mol Life Sci 57:1050-93).

[0074]The IGF-1R amino acid sequence is about 70% identical to the insulin receptor (INSR; Swiss-Prot: P06213). The highest homology between the receptors is located in the tyrosine kinase domain (84%); the lowest identity is in the CR region and the C-terminus. The IGF-1R is also highly related (˜55% identical) to the insulin related receptor (IRR; Swiss-Prot: P14616).

[0075]Human IGF-1R can be activated by the insulin-like growth factors, IGF-1 and IGF-2 and insulin (INS)(Hill et al., 1985, Pediatric Research 19:879-86). IGF-1 and IGF-2 are encoded nonallelic genes (Brissenden et al., 1984, Nature 310: 781-8, Bell et al., 1985, Proceedings of the National Academy of Sciences of the United States of America 82: 6450-54), and both genes express alternative proteins related by differential RNA splicing and protein processing. The most common and well-studied mature forms of IGF-1 and IGF-2 are respectively 70 and 67 amino acids in length (Jansen et al., 1983, Nature 306:609-11, Dull et al., 1984, Nature 310: 777-81). These proteins (and their isoforms) are identical at 11/21 positions to the insulin A-peptide, and identical at 12/30 positions with the insulin B-peptide.

[0076]IGF-1R is expressed in all cells types in the normal adult animal except for liver hepatocytes and mature B-cells. Human blood plasma contains high concentrations of IGF-1 and IGF-2, and IGF-1 can be detected in most tissues. The receptor is an integral component of the physiological mechanism controlling organ size and homeostasis. Without being bound to a particular theory, the "Somatomedin Hypothesis" states that Growth Hormone (GH) mediated somatic growth that occurs during childhood and adolescence is dependent on the endocrine form of IGF-1 that is mainly produced and secreted by the liver (Daughaday, 2000, Pediatric Nephrology 14: 537-40). The synthesis of hepatic IGF-1 is stimulated by GH release in the pituitary in response to hypothalamic GHRH (GH releasing hormone). The serum concentration of IGF-1 increases over 100 fold between ages 5-15 in humans. The bioavailability of IGF-1 is regulated by IGF binding protein 3 (IGFBP3) with approximately 99% of the growth factor compartmentalized in the bound state. Primary IGF-1 deficiency arising form partial gene deletions, and secondary IGF-1 deficiency resulting from defects in GH production or signaling are not lethal (Woods, 1999, IGF Deficiency in Contemporary Endocrinology: The IGF System, R. a. R. Rosenfeld, C. Jr. Totowa, ed.s, Humana Press, NJ: 651-74). The affected individuals exhibit growth retardation at birth, grow slowly and can face certain CNS abnormalities.

[0077]IGF-1R signaling promotes cell growth and survival through the IRS adapter protein-dependent activation of the PI3Kinase/Akt pathway. IGF-1R transmits a signal to its major substrates, IRS-1 through IRS-4 and the Shc proteins (Blakesley et al., 1999, IGF-1 receptor function: transducing the IGF-1 signal into intracellular events in The IGF System, R. G. a. R. Rosenfeld, Jr. C. T. Totowa, ed.s, Humana Press, NJ: 143-63). This results in activation of the Ras/Raf/MAP kinase and PI3 Kinase/Akt signaling pathways. However, induction of Akt-mediated cell survival via IRS is the dominant pathway response upon IGF stimulation of most cells. See FIG. 10.

Antigen Binding Proteins

[0078]In one aspect, the present invention provides antigen binding proteins (e.g., antibodies, antibody fragments, antibody derivatives, antibody muteins, and antibody variants), that bind to IGF-1R, e.g., human IGF-1R.

[0079]Antigen binding proteins in accordance with the present invention include antigen binding proteins that inhibit a biological activity of IGF-1R. Examples of such biological activities include binding a signaling molecule (e.g., IGF-1 and/or IGF-2), and transducing a signal in response to binding a signaling molecule.

[0080]Different antigen binding proteins may bind to different domains or epitopes of IGF-1R or act by different mechanisms of action. Examples include but are not limited to antigen binding proteins that interfere with binding of IGF-1 and/or IGF-2 to IGF-1R or that inhibit signal transduction. The site of action may be, for example, intracellular (e.g., by interfering with an intracellular signaling cascade) or extracellular. An antigen binding protein need not completely inhibit an IGF-1 and/or IGF-2 induced activity to find use in the present invention; rather, antigen binding proteins that reduce a particular activity of IGF-1 and/or IGF-2 are contemplated for use as well. (Discussions herein of particular mechanisms of action for IGF-1R-binding antigen binding proteins in treating particular diseases are illustrative only, and the methods presented herein are not bound thereby.)

[0081]It has been observed that IGF-1 and IGF-2 each exhibits biphasic binding to IGF-1R. High affinity binding has been reported to have a K_D in the range of 0.2 nM; high affinity binding, about ten fold higher. Thus, in one embodiment, the present invention provides an IGF-1R inhibitor that inhibits both the high and low affinity binding of IGF-1 and/or IGF-2 to IGF-R. It has been suggested that the high affinity binding, rather than the low affinity binding, of IGF-1 and/or IGF-2 to IGF-1R is required for the conformation change that activates the tyrosine kinase activity of IGF-1R. Thus, in another embodiment, the IGF-1R inhibitor preferentially inhibits the high affinity binding of IGF-1 and/or IGF-2 to IGF-1R as compared to the low affinity binding.

[0082]In another aspect, the present invention provides antigen binding proteins that comprise a light chain variable region selected from the group consisting of L1 through L52 and/or a heavy chain variable region selected from the group consisting of H1 through H52, and fragments, derivatives, muteins, and variants thereof (see FIGS. 2 and 3). Such an antigen binding protein can be denoted using the nomenclature "LxHy", wherein "x" corresponds to the number of the light chain variable region and "y" corresponds to the number of the heavy chain variable region as they are labeled in FIGS. 2 and 3. For example, L2H1 refers to an antigen binding protein with a light chain variable region comprising the amino acid sequence of L2 and a heavy chain variable region comprising the amino acid sequence of H1, as shown in FIGS. 2 and 3. FIGS. 2 and 3 also indicate the location of the CDR and framework regions of each of these variable domain sequences. The CDR regions of each light and heavy chain also are grouped by type and by sequence similarity in FIGS. 4 through 9. Antigen binding proteins of the invention include, for example, antigen binding proteins having a combination of light chain and heavy chain variable domains selected from the group of combinations consisting of L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52.

[0083]In one embodiment, the present invention provides an antigen binding protein comprising a light chain variable domain comprising a sequence of amino acids that differs from the sequence of a light chain variable domain selected from the group consisting of L1 through L52 only at 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residues, wherein each such sequence difference is independently either a deletion, insertion, or substitution of one amino acid residue. In another embodiment, the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to the sequence of a light chain variable domain selected from the group consisting of L1 through L52. In another embodiment, the light chain variable domain comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to a nucleotide sequence that encodes a light chain variable domain selected from the group consisting of L1 through L52. In another embodiment, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain selected from the group consisting of L1 through L52. In another embodiment, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain selected from the group consisting of L1 through L52. In another embodiment, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to a complement of a light chain polynucleotide selected from FIG. 1.

[0084]In another embodiment, the present invention provides an antigen binding protein comprising a heavy chain variable domain comprising a sequence of amino acids that differs from the sequence of a heavy chain variable domain selected from the group consisting of H1 through H52 only at 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residue(s), wherein each such sequence difference is independently either a deletion, insertion, or substitution of one amino acid residue. In another embodiment, the heavy chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to the sequence of a heavy chain variable domain selected from the group consisting of H1 through H52. In another embodiment, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to a nucleotide sequence that encodes a heavy chain variable domain selected from the group consisting of H1 through H52. In another embodiment, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain selected from the group consisting of H1 through H52. In another embodiment, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain selected from the group consisting of H1 through H52. In another embodiment, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to a complement of a heavy chain polynucleotide selected from FIG. 1.

[0085]Particular embodiments of antigen binding proteins of the present invention comprise one or more amino acid sequences that are identical to the amino acid sequences of one or more of the CDRs and/or FRs illustrated in FIGS. 2 through 9. In one embodiment, the antigen binding protein comprises a light chain CDR1 sequence illustrated in FIG. 4. In another embodiment, the antigen binding protein comprises a light chain CDR2 sequence illustrated in FIG. 5. In another embodiment, the antigen binding protein comprises a light chain CDR3 sequence illustrated in FIG. 6. In another embodiment, the antigen binding protein comprises a heavy chain CDR1 sequence illustrated in FIG. 7. In another embodiment, the antigen binding protein comprises a heavy chain CDR2 sequence illustrated in FIG. 8. In another embodiment, the antigen binding protein comprises a heavy chain CDR3 sequence illustrated in FIG. 9. In another embodiment, the antigen binding protein comprises a light chain FR1 sequence illustrated in FIG. 2. In another embodiment, the antigen binding protein comprises a light chain FR2 sequence illustrated in FIG. 2. In another embodiment, the antigen binding protein comprises a light chain FR3 sequence illustrated in FIG. 2. In another embodiment, the antigen binding protein comprises a light chain FR4 sequence illustrated in FIG. 2. In another embodiment, the antigen binding protein comprises a heavy chain FR1 sequence illustrated in FIG. 3. In another embodiment, the antigen binding protein comprises a heavy chain FR2 sequence illustrated in FIG. 3. In another embodiment, the antigen binding protein comprises a heavy chain FR3 sequence illustrated in FIG. 3. In another embodiment, the antigen binding protein comprises a heavy chain FR4 sequence illustrated in FIG. 3.

[0086]In one embodiment, the present invention provides an antigen binding protein that comprises one or more CDR sequences that differ from a CDR sequence shown in FIGS. 2 through 9 by no more than 5, 4, 3, 2, or 1 amino acid residues.

[0087]In one embodiment, the present invention provides an antigen binding protein that comprises at least one CDR from L1-L52 and/or H1-H52, as shown in FIGS. 2 through 9, and at least one CDR sequence from an anti-IGF-1R antibody described in U.S. Pat. App. Pub. Nos. 03/0235582, 04/0228859, 04/0265307, 04/0886503, 05/0008642, 05/0084906, 05/0186203, 05/0244408, PCT Pub. Nos. WO 03/059951, WO 03/100008, WO 04/071529A2, WO 04/083248, WO 04/087756, WO 05/016967, WO 05/016970, or WO 05/058967 (each of which is incorporated herein by reference in its entirety for all purposes) wherein the antigen binding protein binds to IGF-1 receptor. In another embodiment, the antigen binding protein comprises 2, 3, 4, or 5 CDR sequences from L1-L52 and/or H1-H52, as shown in FIGS. 2 through 9. In another embodiment, the antigen binding protein comprises 2, 3, 4, or 5 CDR sequences from an anti-IGF-1R antibody described in US Pat. App. Pub. Nos. 03/0235582, 04/0228859, 04/0265307, 04/0886503, 05/0008642, 05/0084906, 05/0186203, 05/0244408, PCT Pub. Nos. WO 03/059951, WO 03/100008, WO 04/071529A2, WO 04/083248, WO 04/087756, WO 05/016967, WO 05/016970, or WO 05/058967. In another embodiment, at least one of the antigen binding protein's CDR3 sequences is a CDR3 sequence from L1-L52 and/or H1-H52, as shown in FIGS. 2, 3, 6, and 9. In another embodiment, the antigen binding protein's light chain CDR3 sequence is a light chain CDR3 sequence from L1-L52 as shown in FIGS. 2 and 6 and the antigen binding protein's heavy chain CDR3 sequence is a heavy chain sequence from H1-H52 as shown in FIGS. 3 and 9. In another embodiment, the antigen binding protein comprises 1, 2, 3, 4, or 5 CDR sequences that each independently differs by 6, 5, 4, 3, 2, 1, or 0 single amino acid additions, substitutions, and/or deletions from a CDR sequence of L1-L52 and/or H1-H52, and the antigen binding protein further comprises 1, 2, 3, 4, or 5 CDR sequences that each independently differs by 6, 5, 4, 3, 2, 1, or 0 single amino acid additions, substitutions, and/or deletions from a CDR sequence of US Pat. App. Pub. Nos. 03/0235582, 04/0228859, 04/0265307, 04/0886503, 05/0008642, 05/0084906, 05/0186203, 05/0244408, PCT Pub. Nos. WO 03/059951, WO 03/100008, WO 04/071529A2, WO 04/083248, WO 04/087756, WO 05/016967, WO 05/016970, or WO 05/058967. In another embodiment, the CDR sequence(s) from US Pat. App. Pub. Nos. 03/0235582, 04/0228859, 04/0265307, 04/0886503, 05/0008642, 05/0084906, 05/0186203, 05/0244408, PCT Pub. Nos. WO 03/059951, WO 03/100008, WO 04/071529A2, WO 04/083248, WO 04/087756, WO 05/016967, WO 05/016970, or WO 05/058967. In another embodiment, the CDR sequence(s) are from (an) antibody(-ies) that bind(s) to the L2 portion of the extracellular domain of IGF-1 receptor. In another embodiment, the antigen binding protein does not comprise a light chain CDR3 sequence and/or a heavy chain CDR3 sequence from an anti-IGF-1R antibody from US Pat. App. Pub. Nos. 03/0235582, 04/0228859, 04/0265307, 04/0886503, 05/0008642, 05/0084906, 05/0186203, 05/0244408, PCT Pub. Nos. WO 03/059951, WO 03/100008, WO 04/071529A2, WO 04/083248, WO 04/087756, WO 05/016967, WO 05/016970, or WO 05/058967.

[0088]In one embodiment, the present invention provides an antigen binding protein that comprises a light chain CDR1 comprising the sequence RSSQSLLHX₁X₂GYNX₃LX₄ (SEQ ID NO:236), wherein X₁ is a serine or a threonine residue, X₂ is an asparagine, serine, or histidine residue, X₃ is a tyrosine or a phenylalanine residue, and X₄ is an aspartate or an asparagine residue. In another embodiment, the light chain CDR1 comprises the sequence TRSSGX₁IX₂X₃NYVQ (SEQ ID NO:237), wherein X₁ is a serine or an aspartate residue, X₂ is an alanine or an aspartate residue, and X₃ is a serine or an asparagine residue. In another embodiment, the light chain CDR1 comprises the sequence RASQX₁X₂X₃X₄X₅LX₆ (SEQ ID NO:238), wherein X₁ is a glycine or a serine residue, X₂ is an isoleucine, valine, or proline residue, and X₃ is a serine, glycine, or tyrosine residue, X₄ is any amino acid residue, X₅ is a phenylalanine, tyrosine, asparagine, or tryptophan residue, and X₆ is an alanine or an asparagine residue. In another embodiment, X₂ is an isoleucine or valine residue, X₃ is a glycine or serine residue, X₄ is an arginine, serine, asparagine, serine, tyrosine, or isoleucine residue, and X₅ is a phenylalanine or a tyrosine residue.

[0089]In one embodiment, the present invention provides an antigen binding protein that comprises a light chain CDR2 comprising the sequence LX₁X₂X₃RX₄S (SEQ ID NO:239), wherein X₁ is a glycine or a valine residue, X₂ is a serine or a phenylalanine residue, X₃ is an asparagine, tyrosine, or threonine residue, and X₄ is an alanine or an aspartate residue. In another embodiment, the CDR2 comprises the sequence AX₁SX₂LX₃S (SEQ ID NO:240), wherein X₁ is an alanine or a threonine residue, X₂ is a threonine or a glycine residue, and X₃ is a glutamine or a glutamate residue. In another embodiment, the CDR2 comprises the sequence X₁X₂NX₃RPS (SEQ ID NO:241), wherein X₁ is a glutamate, glutamine, or glycine residue, X₂ is an aspartate or lysine residue, and X₃ is any amino acid residue.

[0090]In one embodiment, the present invention provides an antigen binding protein that comprises a light chain CDR3 comprising the sequence MX₁X₂X₃X₄X₅PX₆X₇ (SEQ ID NO:242), wherein X₁ is a glutamine or glutamate residue, X₂ is an alanine, glycine, serine, or threonine residue, X₃ is a leucine or threonine residue, X₄ is a glutamine, glutamate, or histidine residue, X₅ is a threonine, tryptophan, methionine, or valine residue, X₆ is a nonpolar side chain residue, and X₇ is a threonine, serine, or alanine residue. In another embodiment, the CDR3 comprises the sequence QQX₁X₂X₃X₄PX₅T (SEQ ID NO:243), wherein X₁ is an arginine, serine, leucine, or alanine residue, X₂ is an asparagine, serine, or histidine residue, X₃ is a serine or an asparagine residue, X₄ is a nonpolar side chain residue, and X₅ is a leucine, isoleucine, tyrosine, or tryptophan residue. In another embodiment, the CDR3 comprises the sequence QSYX₁SX₂NX₃X₄V (SEQ ID NO:244), wherein X₁ is an aspartate or a glutamine residue, X₂ is a serine or an aspartate residue, X₃ is a glutamine, valine, or tryptophan residue, and X₄ is an arginine residue or no residue.

[0091]In one embodiment, the present invention provides an antigen binding protein that comprises a heavy chain CDR1 comprising the sequence X₁X₂X₃WWS (SEQ ID NO:245), wherein X₁ is a serine residue or no residue, X₂ is a serine or asparagine residue, and X₃ is an asparagine residue and an isoleucine residue. In another embodiment, the heavy chain CDR1 comprises the sequence X₁ X₂YWS (SEQ ID NO:246), wherein X₁ is a glycine, asparagine, or aspartate residue, and X₂ is a tyrosine or phenylalanine residue. In another embodiment, the heavy chain CDR1 comprises the sequence SYX₁X₂X₃ (SEQ ID NO:247), wherein X₁ is an alanine or glycine residue, X₂ is a methionine or isoleucine residue, and X₃ is a serine or histidine residue.

[0092]In one embodiment, the present invention provides an antigen binding protein that comprises a heavy chain CDR2 comprising the sequence X₁X₂X₃X₄X₅GX₆TX₇YNPSLX₈S (SEQ ID NO:248), wherein X₁ is a glutamate, tyrosine, or serine residue, X₂ is a isoleucine or valine residue, X₃ is a tyrosine, asparagine, or serine residue, X₄ is a histidine, tyrosine, aspartate, or proline residue, X₅ is a serine or arginine residue, X₆ is a serine or asparagine residue, X₇ is an asparagine or tyrosine residue, and X₈ is a lysine or glutamate residue. In another embodiment, the heavy chain CDR2 comprises the sequence X₁ISX₂X₃X₄X₅X₆X₇YYADSVKG (SEQ ID NO:249), wherein X₁ is a threonine, alanine, valine, or tyrosine residue, X₂ is a glycine, serine, or tyrosine residue, X₃ is a serine, asparagine, or aspartate residue, X₄ is a glycine or serine residue, X₅ is a glycine, serine, or aspartate residue, X₆ is a serine, threonine, or asparagine residue, and X₇ is a threonine, lysine, or isoleucine residue.

[0093]In one embodiment, the present invention provides an antigen binding protein that comprises a heavy chain CDR3 comprising the sequence X₁X₂X₃X₄X₅X₆X₇X₈X₉FDI (SEQ ID NO:250), wherein X₁ is a glutamate residue or no residue, X₂ is tyrosine, glycine, or serine residue or no residue, X₃ is a serine, asparagine, tryptophan, or glutamate residue, or no residue, X₄ is a serine, aspartate, tryptophan, alanine, arginine, threonine, glutamine, leucine, or glutamate residue, or no residue, X₅ is a serine, glycine, asparagine, threonine, tryptophan, alanine, valine, or isoleucine residue, X₆ is an arginine, glutamine, tyrosine, valine, alanine, glycine, serine, phenylalanine, or tryptophan residue, X₇ is a leucine, asparagine, aspartate, threonine, tryptophan, tyrosine, valine, alanine, or histidine residue, X₈ is an aspartate, serine, asparagine, or glutamine residue, and X₉ is an alanine or a proline residue. In another embodiment, the heavy chain CDR3 comprises the sequence X₁X₂X₃X₄X₅X₆X₇X₈X₉X- ₁₀X₁₁MDV (SEQ ID NO:251), wherein X₁ is an alanine residue, or no residue, X₂ is a glutamate, tyrosine, or glycine residue, or no residue, X₃ is a serine or arginine residue, or no residue, X₄ is an aspartate, glycine, serine, or valine residue, or no residue, X₅ is a serine, glycine, or aspartate residue, or no residue, X₆ is a glycine, phenylalanine, aspartate, serine, tryptophan, or tyrosine residue, or no residue, X₇ is a tyrosine, tryptophan, serine, or aspartate residue, or no residue, X₈ is an aspartate, arginine, serine, glycine, tyrosine, or tryptophan residue, X₉ is a tyrosine, isoleucine, leucine, phenylalanine, or lysine residue, X₁₀ is a tyrosine, phenylalanine, aspartate, or glycine residue, and X₁₁ is a glycine, tyrosine, or asparagine residue. In another embodiment, the heavy chain CDR3 comprises the sequence X₁X₂X₃X₄X₅X₆X₇X₈X₉X₁₀Y (SEQ ID NO:252), wherein X₁ is an aspartate or valine residue, or no residue, X₂ is a glycine, tyrosine, arginine, or aspartate residue, or no residue, X₃ is an asparagine, leucine, glycine, isoleucine, serine, valine, phenylalanine, or tyrosine residue, or no residue, X₄ is a leucine, serine, tryptophan, alanine, tyrosine, isoleucine, glycine, or aspartate residue, or no residue, X₅ is a glycine, alanine, tyrosine, serine, aspartate, or leucine residue, X₆ is a valine, alanine, glycine, threonine, proline, histidine, or glutamine residue, X₇ is a glutamate, glycine, serine, aspartate, glycine, valine, tryptophan, histidine, or arginine residue, X₈ is a glutamine, alanine, glycine, tyrosine, proline, leucine, aspartate, or serine residue, X₉ is a nonpolar side chain residue, and X₁₀ is an aspartate or alanine residue. In another embodiment, the heavy chain CDR3 comprises the sequence X₁X₂X₃X₄X₅X₆X₇X₈X₉X₁₀YF- DX₁₁ (SEQ ID NO:253), wherein X₁ is a glycine residue, or no residue, X₂ is a proline residue, or no residue, X₃ is an arginine or aspartate residue, or no residue, X₄ is a histidine or proline residue, X₅ is an arginine or glycine residue, X₆ is an arginine, serine, or phenylalanine residue, X₇ is an aspartate or serine residue, X₈ is a glycine, tryptophan, or tyrosine residue, X₉ is a tyrosine or alanine residue, X₁₀ is an asparagine or tryptophan residue, and X₁₁ is an asparagine or leucine residue. In another embodiment, the heavy chain CDR3 comprises the sequence X₁X₂X₃X₄DSSX₅X₆X₇X₈X₉X₁- 0X₁₁X₁₂ (SEQ ID NO:254), wherein X₁ is a phenylalanine residue, or no residue, X₂ is an asparagine or glycine residue, or no residue, X₃ is a tyrosine or a leucine residue, or no residue, X₄ is a tyrosine or glycine residue, or no residue, X₅ is a glycine, serine, or valine residue, X₆ is a tyrosine, phenylalanine, tryptophan, or glutamine residue, or no residue, X₇ is a tyrosine, glycine, or isoleucine residue, or no residue, X₈ is a tyrosine, leucine, or glycine residue, or no residue, X₉ is a methionine, glycine, or phenylalanine residue, or no residue, X₁₀ is an aspartate or methionine residue, or no residue, X₁₁ is a valine, aspartate, or tyrosine residue, or no residue, and X₁₂ is a valine residue, or no residue.

[0094]In one embodiment, the present invention provides an isolated antigen binding protein, comprising either: a. a light chain CDR3 comprising a sequence selected from the group consisting of: i. a light chain CDR3 sequence selected from the group consisting of the light chain CDR3 sequences of L1-L52 as shown in FIG. 6; ii. MQALQTPZT; iii. QQ(R/S)(N/S)(S/N)ZPLT; and iv. QSYDSSNXJV; b. a heavy chain CDR3 comprising a sequence selected from the group consisting of: i. a heavy chain CDR3 sequence that differs by no more than a total of three amino acid additions, substitutions, or deletions from a CDR3 sequence selected from the group consisting of the heavy chain CDR3 sequences of H1-H52 as shown in FIG. 9; ii. SRLDAFDI; iii. SXYDYYGMDV; iv. HRXDXAWYFDL; and v. DSSG; or c. the light chain CDR3 sequence of (a) and the heavy chain CDR3 sequence of (b); wherein amino acid residue symbols enclosed in parentheses identify alternative residues for the same position in a sequence, each X is independently any amino acid residue, each Z is independently a glycine residue, an alanine residue, a valine residue, a leucine residue, an isoleucine residue, a proline residue, a phenylalanine residue, a methionine residue, a tryptophan residue, or a cysteine residue, each J is independently a glutamine residue, an arginine residue, a valine residue, or a tryptophan residue, and the antigen binding protein binds to human IGF-1R.

[0095]The nucleotide sequences of FIG. 1, or the amino acid sequences of FIGS. 2 through 9, can be altered, for example, by random mutagenesis or by site-directed mutagenesis (e.g., oligonucleotide-directed site-specific mutagenesis) to create an altered polynucleotide comprising one or more particular nucleotide substitutions, deletions, or insertions as compared to the non-mutated polynucleotide. Examples of techniques for making such alterations are described in Walder et al., 1986, Gene 42:133; Bauer et al. 1985, Gene 37:73; Craik, BioTechniques, January 1985, 12-19; Smith et al., 1981, Genetic Engineering Principles and Methods, Plenum Press; and U.S. Pat. Nos. 4,518,584 and 4,737,462. These and other methods can be used to make, for example, derivatives of anti-IGF-1R antibodies that have a desired property, for example, increased affinity, avidity, or specificity for IGF-1R, increased activity or stability in vivo or in vitro, or reduced in vivo side-effects as compared to the underivatized antibody.

[0096]Other derivatives of anti-IGF-1R antibodies within the scope of this invention include covalent or aggregative conjugates of anti-IGF-1R antibodies, or fragments thereof, with other proteins or polypeptides, such as by expression of recombinant fusion proteins comprising heterologous polypeptides fused to the N-terminus or C-terminus of an anti-IGF-1R antibody polypeptide. For example, the conjugated peptide may be a heterologous signal (or leader) polypeptide, e.g., the yeast alpha-factor leader, or a peptide such as an epitope tag. Antigen binding protein-containing fusion proteins can comprise peptides added to facilitate purification or identification of antigen binding protein (e.g., poly-His). An antigen binding protein also can be linked to the FLAG peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (SEQ ID NO:255) as described in Hopp et al., Bio/Technology 6:1204, 1988, and U.S. Pat. No. 5,011,912. The FLAG peptide is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody (mAb), enabling rapid assay and facile purification of expressed recombinant protein. Reagents useful for preparing fusion proteins in which the FLAG peptide is fused to a given polypeptide are commercially available (Sigma, St. Louis, Mo.).

[0097]Oligomers that contain one or more antigen binding proteins may be employed as IGF-1R antagonists. Oligomers may be in the form of covalently-linked or non-covalently-linked dimers, trimers, or higher oligomers. Oligomers comprising two or more antigen binding protein are contemplated for use, with one example being a homodimer. Other oligomers include heterodimers, homotrimers, heterotrimers, homotetramers, heterotetramers, etc.

[0098]One embodiment is directed to oligomers comprising multiple antigen binding proteins joined via covalent or non-covalent interactions between peptide moieties fused to theantigen binding proteins. Such peptides may be peptide linkers (spacers), or peptides that have the property of promoting oligomerization. Leucine zippers and certain polypeptides derived from antibodies are among the peptides that can promote oligomerization of antigen binding proteins attached thereto, as described in more detail below.

[0099]In particular embodiments, the oligomers comprise from two to four antigen binding proteins. The antigen binding proteins of the oligomer may be in any form, such as any of the forms described above, e.g., variants or fragments. Preferably, the oligomers comprise antigen binding proteins that have IGF-1R binding activity.

[0100]In one embodiment, an oligomer is prepared using polypeptides derived from immunoglobulins. Preparation of fusion proteins comprising certain heterologous polypeptides fused to various portions of antibody-derived polypeptides (including the Fc domain) has been described, e.g., by Ashkenazi et al., 1991, PNAS USA 88:10535; Byrn et al., 1990, Nature 344:677; and Hollenbaugh et al., 1992 "Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19.11.

[0101]One embodiment of the present invention is directed to a dimer comprising two fusion proteins created by fusing an IGF-1R binding fragment of an anti-IGF-1R antibody to the Fc region of an antibody. The dimer can be made by, for example, inserting a gene fusion encoding the fusion protein into an appropriate expression vector, expressing the gene fusion in host cells transformed with the recombinant expression vector, and allowing the expressed fusion protein to assemble much like antibody molecules, whereupon interchain disulfide bonds form between the Fc moieties to yield the dimer.

[0102]The term "Fc polypeptide" as used herein includes native and mutein forms of polypeptides derived from the Fc region of an antibody. Truncated forms of such polypeptides containing the hinge region that promotes dimerization also are included. Fusion proteins comprising Fc moieties (and oligomers formed therefrom) offer the advantage of facile purification by affinity chromatography over Protein A or Protein G columns.

[0103]One suitable Fc polypeptide, described in PCT application WO 93/10151 (hereby incorporated by reference), is a single chain polypeptide extending from the N-terminal hinge region to the native C-terminus of the Fc region of a human IgG1 antibody. Another useful Fc polypeptide is the Fc mutein described in U.S. Pat. No. 5,457,035 and in Baum et al., 1994, EMBO J. 13:3992-4001. The amino acid sequence of this mutein is identical to that of the native Fc sequence presented in WO 93/10151, except that amino acid 19 has been changed from Leu to Ala, amino acid 20 has been changed from Leu to Glu, and amino acid 22 has been changed from Gly to Ala. The mutein exhibits reduced affinity for Fc receptors.

[0104]In other embodiments, the variable portion of the heavy and/or light chains of an anti-IGF-1R antibody may be substituted for the variable portion of an antibody heavy and/or light chain.

[0105]Alternatively, the oligomer is a fusion protein comprising multiple antigen binding proteins, with or without peptide linkers (spacer peptides). Among the suitable peptide linkers are those described in U.S. Pat. Nos. 4,751,180 and 4,935,233.

[0106]Another method for preparing oligomeric antigen binding proteins involves use of a leucine zipper. Leucine zipper domains are peptides that promote oligomerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al., 1988, Science 240:1759), and have since been found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize. Examples of leucine zipper domains suitable for producing soluble oligomeric proteins are described in PCT application WO 94/10308, and the leucine zipper derived from lung surfactant protein D (SPD) described in Hoppe et al., 1994, FEBS Letters 344:191, hereby incorporated by reference. The use of a modified leucine zipper that allows for stable trimerization of a heterologous protein fused thereto is described in Fanslow et al., 1994, Semin. Immunol. 6:267-78. In one approach, recombinant fusion proteins comprising an anti-IGF-1R antibody fragment or derivative fused to a leucine zipper peptide are expressed in suitable host cells, and the soluble oligomeric anti-IGF-1R antibody fragments or derivatives that form are recovered from the culture supernatant.

[0107]In one aspect, the present invention provides antigen binding proteins that interfere with the binding of IGF-1 and/or IGF-2 to an IGF-1R. Such antigen binding proteins can be made against IGF-1R, or a fragment, variant or derivative thereof, and screened in conventional assays for the ability to interfere with binding of IGF-1 and/or IGF-2 to IGF-1R. Examples of suitable assays are assays that test the antigen binding proteins for the ability to inhibit binding of IGF-1 and/or IGF-2 to cells expressing IGF-1R, or that test antigen binding proteins for the ability to reduce a biological or cellular response that results from the binding of IGF-1 and/or IGF-2 to cell surface IGF-1R receptors.

[0108]In another aspect, the present invention provides an antigen binding protein that blocks the binding of IGF-1 and/or IGF-2 to IGF-1R but does not significantly block the binding of insulin to insulin receptor (INS-R). In one embodiment, the antigen binding protein does not bind to INS-R. In another embodiment, the antigen binding protein binds to the INS-R with such a low affinity that it does not effectively block the binding of insulin to INS-R. In another embodiment, the antigen binding protein binds to INS-R, but antigen binding protein-bound INS-R can still bind to insulin. In another embodiment, the antigen binding protein's selectivity for IGF-1R is at least 50 times greater than its selectivity for insulin receptor. In another embodiment, the selectivity of the antigen binding protein is more than 100 times greater than its selectivity for insulin receptor.

[0109]In another aspect, the present invention provides an antigen binding protein that demonstrates species selectivity. In one embodiment, the antigen binding protein binds to one or more mammalian IGF-1R, for example, to human IGF-1R and one or more of mouse, rat, guinea pig, hamster, gerbil, cat, rabbit, dog, goat, sheep, cow, horse, camel, and non-human primate IGF-1R. In another embodiment, the antigen binding protein binds to one or more primate IGF-1R, for example, to human IGF-1R and one or more of cynomologous, marmoset, rhesus, and chimpanzee IGF-1R. In another embodiment, the antigen binding protein binds specifically to human, cynomologous, marmoset, rhesus, or chimpanzee IGF-1R. In another embodiment, the antigen binding protein does not bind to one or more of mouse, rat, guinea pig, hamster, gerbil, cat, rabbit, dog, goat, sheep, cow, horse, camel, and non-human primate IGF-1R. In another embodiment, the antigen binding protein does not bind to a New World monkey species such as a marmoset. In another embodiment, the antigen binding protein does not exhibit specific binding to any naturally occurring protein other than IGF-1R. In another embodiment, the antigen binding protein does not exhibit specific binding to any naturally occurring protein other than mammalian IGF-1R. In another embodiment, the antigen binding protein does not exhibit specific binding to any naturally occurring protein other than primate IGF-1R. In another embodiment, the antigen binding protein does not exhibit specific binding to any naturally occurring protein other than human IGF-1R. In another embodiment, the antigen binding protein specifically binds to mouse, rat, cynomolgus monkey, and human IGF-1R. In another embodiment, the antigen binding protein specifically binds to mouse, rat, cynomolgus monkey, and human IGF-1R with a similar binding affinity. In another embodiment, the antigen binding protein blocks binding of human IGF-1 and IGF-2 with mouse, rat, cynomolgus monkey, and human IGF-1R. In another embodiment, the antigen binding protein blocks binding of human IGF-1 and IGF-2 with mouse, rat, cynomolgus monkey, and human IGF-1R with similar K_i. In another embodiment, the antigen binding protein blocks binding of human IGF-1 and IGF-2 with mouse, rat, cynomolgus monkey, and human IGF-1R with a K_i of between about 0.57 and about 0.61 nM.

[0110]One may determine the selectivity of an antigen binding protein for an IGF-1R using methods well known in the art and following the teachings of the specification. For example, one may determine the selectivity using Western blot, FACS, ELISA or RIA.

[0111]In another aspect, the present invention provides an IGF-1R binding antigen binding protein (for example, an anti-IGF-1R antibody), that has one or more of the following characteristics: binds to both human and murine IGF-1R, inhibits the binding of both IGF-1 and IGF-2 to human IGF-1R, inhibits the binding of both IGF-1 and IGF-2 to murine IGF-1R, preferentially inhibits the high affinity binding of IGF-1 and/or of IGF-2 to IGF-1R, binds to the L2 domain of IGF-1R, causes relatively little down-regulation of cell-surface expressed IGF-1R after 17 hours of exposure (as compared to MAB391 (R&D systems, Minneapolis, Minn.); e.g., amount of IGF-1R is reduced by less than 20%), causes a level of down-regulation of cell-surface expressed IGF-1R on Colo-205 or MiaPaCa-2 xenograft tumor cells in mice as MAB391 after four weeks of once weekly doses of 200 micrograms.

[0112]Antigen-binding fragments of antigen binding proteins of the invention may be produced by conventional techniques. Examples of such fragments include, but are not limited to, Fab and F(ab')₂ fragments. Antibody fragments and derivatives produced by genetic engineering techniques also are contemplated.

[0113]Additional embodiments include chimeric antibodies, e.g., humanized versions of non-human (e.g., murine) monoclonal antibodies. Such humanized antibodies may be prepared by known techniques, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans. In one embodiment, a humanized monoclonal antibody comprises the variable domain of a murine antibody (or all or part of the antigen binding site thereof) and a constant domain derived from a human antibody. Alternatively, a humanized antibody fragment may comprise the antigen binding site of a murine monoclonal antibody and a variable domain fragment (lacking the antigen-binding site) derived from a human antibody. Procedures for the production of chimeric and further engineered monoclonal antibodies include those described in Riechmann et al., 1988, Nature 332:323, Liu et al., 1987, Proc. Nat. Acad. Sci. USA 84:3439, Larrick et al., 1989, Bio/Technology 7:934, and Winter et al., 1993, TIPS 14:139. In one embodiment, the chimeric antibody is a CDR grafted antibody. Techniques for humanizing antibodies are discussed in, e.g., U.S. patent application Ser. No. 10/194,975 (published Feb. 27, 2003), U.S. Pat. No.s 5,869,619, 5,225,539, 5,821,337, 5,859,205, Padlan et al., 1995, FASEB J. 9:133-39, and Tamura et al., 2000, J. Immunol. 164:1432-41.

[0114]Procedures have been developed for generating human or partially human antibodies in non-human animals. For example, mice in which one or more endogenous immunoglobulin genes have been inactivated by various means have been prepared. Human immunoglobulin genes have been introduced into the mice to replace the inactivated mouse genes. Antibodies produced in the animal incorporate human immunoglobulin polypeptide chains encoded by the human genetic material introduced into the animal. In one embodiment, a non-human animal, such as a transgenic mouse, is immunized with an IGF-1R polypeptide, such that antibodies directed against the IGF-1R polypeptide are generated in the animal. One example of a suitable immunogen is a soluble human IGF-1R, such as a polypeptide comprising the extracellular domain of the protein of FIG. 10, or other immunogenic fragment of the protein of FIG. 10. Examples of techniques for production and use of transgenic animals for the production of human or partially human antibodies are described in U.S. Pat. Nos. 5,814,318, 5,569,825, and 5,545,806, Davis et al., 2003, Production of human antibodies from transgenic mice in Lo, ed. Antibody Engineering: Methods and Protocols, Humana Press, NJ: 191-200, Kellermann et al., 2002, Curr Opin Biotechnol. 13:593-97, Russel et al., 2000, Infect Immun. 68:1820-26, Gallo et al., 2000, Eur J. Immun. 30:534-40, Davis et al., 1999, Cancer Metastasis Rev. 18:421-25, Green, 1999, J Immunol Methods. 231:11-23, Jakobovits, 1998, Advanced Drug Delivery Reviews 31:33-42, Green et al., 1998, J Exp Med. 188:483-95, Jakobovits A, 1998, Exp. Opin. Invest. Drugs. 7:607-14, Tsuda et al., 1997, Genomics. 42:413-21, Mendez et al., 1997, Nat. Genet. 15:146-56, Jakobovits, 1994, Curr Biol. 4:761-63, Arbones et al., 1994, Immunity. 1:247-60, Green et al., 1994, Nat. Genet. 7:13-21, Jakobovits et al., 1993, Nature. 362:255-58, Jakobovits et al., 1993, Proc Natl Acad Sci USA. 90:2551-55. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. Loring, D. Huszar. "Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus." International Immunology 5 (1993): 647-656, Choi et al., 1993, Nature Genetics 4: 117-23, Fishwild et al., 1996, Nature Biotechnology 14: 845-51, Harding et al., 1995, Annals of the New York Academy of Sciences, Lonberg et al., 1994, Nature 368: 856-59, Lonberg, 1994, Transgenic Approaches to Human Monoclonal Antibodies in Handbook of Experimental Pharmacology 113: 49-101, Lonberg et al., 1995, Internal Review of Immunology 13: 65-93, Neuberger, 1996, Nature Biotechnology 14: 826, Taylor et al., 1992, Nucleic Acids Research 20: 6287-95, Taylor et al., 1994, International Immunology 6: 579-91, Tomizuka et al., 1997, Nature Genetics 16: 133-43, Tomizuka et al., 2000, Proceedings of the National Academy of Sciences USA 97: 722-27, Tuaillon et al., 1993, Proceedings of the National Academy of Sciences USA 90: 3720-24, and Tuaillon et al., 1994, Journal of Immunology 152: 2912-20.

[0115]In another aspect, the present invention provides monoclonal antibodies that bind to IGF-1R. Monoclonal antibodies may be produced using any technique known in the art, e.g., by immortalizing spleen cells harvested from the transgenic animal after completion of the immunization schedule. The spleen cells can be immortalized using any technique known in the art, e.g., by fusing them with myeloma cells to produce hybridomas. Myeloma cells for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render them incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas). Examples of suitable cell lines for use in mouse fusions include Sp-20, P3-X63/Ag8, P3-X63-Ag8.653, NS1/1.Ag 4 1, Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S194/5XXO Bul; examples of cell lines used in rat fusions include R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210. Other cell lines useful for cell fusions are U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6.

[0116]In one embodiment, a hybridoma cell line is produced by immunizing an animal (e.g., a transgenic animal having human immunoglobulin sequences) with an IGF-1R immunogen; harvesting spleen cells from the immunized animal; fusing the harvested spleen cells to a myeloma cell line, thereby generating hybridoma cells; establishing hybridoma cell lines from the hybridoma cells, and identifying a hybridoma cell line that produces an antibody that binds an IGF-1R polypeptide. Such hybridoma cell lines, and anti-IGF-1R monoclonal antibodies produced by them, are encompassed by the present invention.

[0117]Monoclonal antibodies secreted by a hybridoma cell line can be purified using any technique known in the art. Hybridomas or mAbs may be further screened to identify mAbs with particular properties, such as the ability to block an IGF-1 and/or IGF-2 induced activity. Examples of such screens are provided in the examples below.

[0118]Molecular evolution of the complementarity determining regions (CDRs) in the center of the antibody binding site also has been used to isolate antibodies with increased affinity, for example, antibodies having increased affinity for c-erbB-2, as described by Schier et al., 1996, J. Mol. Biol. 263:551. Accordingly, such techniques are useful in preparing antibodies to IGF-1R.

[0119]Antigen binding proteins directed against an IGF-1R can be used, for example, in assays to detect the presence of IGF-1R polypeptides, either in vitro or in vivo. The antigen binding proteins also may be employed in purifying IGF-1R proteins by immunoaffinity chromatography. Those antigen binding proteins that additionally can block binding of IGF-1 and/or IGF-2 to IGF-1R may be used to inhibit a biological activity that results from such binding. Blocking antigen binding proteins can be used in the methods of the present invention. Such antigen binding proteins that function as IGF-1 and/or IGF-2 antagonists may be employed in treating any IGF-1 and/or IGF-2-induced condition, including but not limited to cancer. In one embodiment, a human anti-IGF-1R monoclonal antibody generated by procedures involving immunization of transgenic mice is employed in treating such conditions.

[0120]Antigen binding proteins may be employed in an in vitro procedure, or administered in vivo to inhibit an IGF-1 and/or IGF-2-induced biological activity. Disorders caused or exacerbated (directly or indirectly) by the interaction of IGF-1 and/or IGF-2 with cell surface IGF-1R, examples of which are provided above, thus may be treated. In one embodiment, the present invention provides a therapeutic method comprising in vivo administration of an IGF-1 and/or IGF-2 blocking antigen binding protein to a mammal in need thereof in an amount effective for reducing an IGF-1 and/or IGF-2-induced biological activity.

[0121]Antigen binding proteins of the invention include partially human and fully human monoclonal antibodies that inhibit a biological activity of IGF-1 and also inhibit a biological activity of IGF-2. One embodiment is directed to a human monoclonal antibody that at least partially blocks binding of IGF-1 and of IGF-2 to a cell that expresses human IGF-1R. In one embodiment, the antibodies are generated by immunizing a transgenic mouse with an IGF-1R immunogen. In another embodiment, the immunogen is a human IGF-1R polypeptide (e.g., a soluble fragment comprising all or part of the IGF-1R extracellular domain). Hybridoma cell lines derived from such immunized mice, wherein the hybridoma secretes a monoclonal antibody that binds IGF-1R, also are provided herein.

[0122]Although human, partially human, or humanized antibodies will be suitable for many applications, particularly those involving administration of the antibody to a human subject, other types of antigen binding proteins will be suitable for certain applications. The non-human antibodies of the invention can be, for example, derived from any antibody-producing animal, such as mouse, rat, rabbit, goat, donkey, or non-human primate (such as monkey (e.g., cynomologous or rhesus monkey) or ape (e.g., chimpanzee)). Non-human antibodies of the invention can be used, for example, in in vitro and cell-culture based applications, or any other application where an immune response to the antibody of the invention does not occur, is insignificant, can be prevented, is not a concern, or is desired. In one embodiment, a non-human antibody of the invention is administered to a non-human subject. In another embodiment, the non-human antibody does not elicit an immune response in the non-human subject. In another embodiment, the non-human antibody is from the same species as the non-human subject, e.g., a mouse antibody of the invention is administered to a mouse. An antibody from a particular species can be made by, for example, immunizing an animal of that species with the desired immunogen (e.g., a soluble IGF-1R polypeptide) or using an artificial system for generating antibodies of that species (e.g., a bacterial or phage display-based system for generating antibodies of a particular species), or by converting an antibody from one species into an antibody from another species by replacing, e.g., the constant region of the antibody with a constant region from the other species, or by replacing one or more amino acid residues of the antibody so that it more closely resembles the sequence of an antibody from the other species. In one embodiment, the antibody is a chimeric antibody comprising amino acid sequences derived from antibodies from two or more different species.

[0123]Antigen binding proteins may be prepared by any of a number of conventional techniques. For example, they may be purified from cells that naturally express them (e.g., an antibody can be purified from a hybridoma that produces it), or produced in recombinant expression systems, using any technique known in the art. See, for example, Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Kennet et al. (eds.), Plenum Press, New York (1980); and Antibodies: A Laboratory Manual, Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988).

[0124]Any expression system known in the art can be used to make the recombinant polypeptides of the invention. In general, host cells are transformed with a recombinant expression vector that comprises DNA encoding a desired polypeptide. Among the host cells that may be employed are prokaryotes, yeast or higher eukaryotic cells. Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells include insect cells and established cell lines of mammalian origin. Examples of suitable mammalian host cell lines include the COS-7 line of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., 1981, Cell 23:175), L cells, 293 cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary (CHO) cells, HeLa cells, BHK (ATCC CRL 10) cell lines, and the CV1/EBNA cell line derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) as described by McMahan et al., 1991, EMBO J. 10: 2821. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New York, 1985).

[0125]The transformed cells can be cultured under conditions that promote expression of the polypeptide, and the polypeptide recovered by conventional protein purification procedures. One such purification procedure includes the use of affinity chromatography, e.g., over a matrix having all or a portion (e.g., the extracellular domain) of IGF-1R bound thereto. Polypeptides contemplated for use herein include substantially homogeneous recombinant mammalian anti-IGF-1R antibody polypeptides substantially free of contaminating endogenous materials.

[0126]Antigen binding proteins may be prepared, and screened for desired properties, by any of a number of known techniques. Certain of the techniques involve isolating a nucleic acid encoding a polypeptide chain (or portion thereof) of an antigen binding protein of interest (e.g., an anti-IGF-1R antibody), and manipulating the nucleic acid through recombinant DNA technology. The nucleic acid may be fused to another nucleic acid of interest, or altered (e.g., by mutagenesis or other conventional techniques) to add, delete, or substitute one or more amino acid residues, for example.

[0127]In one aspect, the present invention provides antigen-binding fragments of an anti-IGF-1R antibody of the invention. Such fragments can consist entirely of antibody-derived sequences or can comprise additional sequences. Examples of antigen-binding fragments include Fab, F(ab')₂, single chain antibodies, diabodies, triabodies, tetrabodies, and domain antibodies. Other examples are provided in Lunde et al., 2002, Biochem. Soc. Trans. 30:500-06.

[0128]Single chain antibodies may be formed by linking heavy and light chain variable domain (Fv region) fragments via an amino acid bridge (short peptide linker), resulting in a single polypeptide chain. Such single-chain Fvs (scFvs) have been prepared by fusing DNA encoding a peptide linker between DNAs encoding the two variable domain polypeptides (V_L and V_H). The resulting polypeptides can fold back on themselves to form antigen-binding monomers, or they can form multimers (e.g., dimers, trimers, or tetramers), depending on the length of a flexible linker between the two variable domains (Kortt et al., 1997, Prot. Eng. 10:423; Kortt et al., 2001, Biomol. Eng. 18:95-108). By combining different V_L and V_H-comprising polypeptides, one can form multimeric scFvs that bind to different epitopes (Kriangkum et al., 2001, Biomol. Eng. 18:31-40). Techniques developed for the production of single chain antibodies include those described in U.S. Pat. No. 4,946,778; Bird, 1988, Science 242:423; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879; Ward et al., 1989, Nature 334:544, de Graaf et al., 2002, Methods Mol. Biol. 178:379-87. Single chain antibodies derived from antibodies provided herein include, but are not limited to, scFvs comprising the variable domain combinations L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52) are encompassed by the present invention.

[0129]Antigen binding proteins (e.g., antibodies, antibody fragments, and antibody derivatives) of the invention can comprise any constant region known in the art. The light chain constant region can be, for example, a kappa- or lambda-type light chain constant region, e.g., a human kappa- or lambda-type light chain constant region. The heavy chain constant region can be, for example, an alpha-, delta-, epsilon-, gamma-, or mu-type heavy chain constant regions, e.g., a human alpha-, delta-, epsilon-, gamma-, or mu-type heavy chain constant region. In one embodiment, the light or heavy chain constant region is a fragment, derivative, variant, or mutein of a naturally occurring constant region.

[0130]Techniques are known for deriving an antibody of a different subclass or isotype from an antibody of interest, i.e., subclass switching. Thus, IgG antibodies may be derived from an IgM antibody, for example, and vice versa. Such techniques allow the preparation of new antibodies that possess the antigen-binding properties of a given antibody (the parent antibody), but also exhibit biological properties associated with an antibody isotype or subclass different from that of the parent antibody. Recombinant DNA techniques may be employed. Cloned DNA encoding particular antibody polypeptides may be employed in such procedures, e.g., DNA encoding the constant domain of an antibody of the desired isotype. See also Lantto et al., 2002, Methods Mol. Biol. 178:303-16.

[0131]In one embodiment, an antigen binding protein of the invention comprises the IgG1 heavy chain domain of FIG. 13 or a fragment of the IgG1 heavy chain domain of FIG. 13. In another embodiment, an antigen binding protein of the invention comprises the kappa light chain constant chain region of FIG. 13 or a fragment of the kappa light chain constant region of FIG. 13. In another embodiment, an antigen binding protein of the invention comprises both the IgG1 heavy chain domain, or a fragment thereof, of FIG. 13 and the kappa light chain domain, or a fragment thereof, of FIG. 13. Accordingly, the antigen binding proteins of the present invention include those comprising, for example, the variable domain combinations L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52, having a desired isotype (for example, IgA, IgG1, IgG2, IgG3, IgG4, IgM, IgE, and IgD) as well as Fab or F(ab')₂ fragments thereof. Moreover, if an IgG4 is desired, it may also be desired to introduce a point mutation (CPSCP ->CPPCP) in the hinge region as described in Bloom et al., 1997, Protein Science 6:407, incorporated by reference herein) to alleviate a tendency to form intra-H chain disulfide bonds that can lead to heterogeneity in the IgG4 antibodies.

[0132]Moreover, techniques for deriving antigen binding proteins having different properties (i.e., varying affinities for the antigen to which they bind) are also known. One such technique, referred to as chain shuffling, involves displaying immunoglobulin variable domain gene repertoires on the surface of filamentous bacteriophage, often referred to as phage display. Chain shuffling has been used to prepare high affinity antibodies to the hapten 2-phenyloxazol-5-one, as described by Marks et al., 1992, BioTechnology, 10:779.

[0133]In particular embodiments, antigen binding proteins of the present invention have a binding affinity (K_a) for IGF-1R of at least 10⁶, measured as described in the Examples. In other embodiments, the antigen binding proteins exhibit a K_a of at least 10⁷, at least 10⁸, at least 10⁹, or at least 10¹⁰.

[0134]In another embodiment, the present invention provides an antigen binding protein that has a low dissociation rate from IGF-1R. In one embodiment, the antigen binding protein has a K_off of 1×10^-4 s^-1 or lower. In another embodiment, the K_off is 5×10^-5 s^-1 or lower. In another embodiment, the K_off is substantially the same as an antibody having a combination of light chain and heavy chain variable domain sequences selected from the group of combinations consisting of L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L181-118, L19H19, L20H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52. In another embodiment, the antigen binding protein binds to IGF-1R with substantially the same K_off as an antibody that comprises one or more CDRs from an antibody having a combination of light chain and heavy chain variable domain sequences selected from the group of combinations consisting of L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52. In another embodiment, the antigen binding protein binds to IGF-1R with substantially the same K_off as an antibody that comprises one of the amino acid sequences illustrated in FIGS. 2 through 9. In another embodiment, the antigen binding protein binds to IGF-1R with substantially the same K_off as an antibody that comprises one or more CDRs from an antibody that comprises one of the amino acid sequences illustrated in FIGS. 2 through 9.

[0135]In another aspect, the present invention provides an antigen binding protein that binds to the L2 domain of human IGF-1R. Antigen binding proteins that bind to the L2 domain can be made using any technique known in the art. For example, such antigen binding proteins can be isolated using the full-length IGF-1R polypeptide (e.g., in a membrane-bound preparation), a soluble extracellular domain fragment of IGF-1R (an example of which is provided in Example 1), or a smaller fragment of the IGF-1R extracellular domain comprising or consisting of the L2 domain (examples of which are provided in Example 10). Antigen binding proteins so isolated can be screened to determine their binding specificity using any method known in the art (an example of which is provided in Example 10).

[0136]In another aspect, the present invention provides an antigen binding protein that binds to human IGF-1R expressed on the surface of a cell and, when so bound, inhibits IGF-1R signaling activity in the cell without causing a significant reduction in the amount of IGF-1R on the surface of the cell. Any method for determining or estimating the amount of IGF-1R on the surface and/or in the interior of the cell can be used. In one embodiment, the present invention provides an antigen binding protein that binds to the L2 domain of a human IGF-1R expressed on the surface of a cell and, when so bound, inhibits IGF-1R signaling activity in the cell without significantly increasing the rate of internalization of the IGF-1R from the surface of the cell. In other embodiments, binding of the antigen binding protein to the IGF-1R-expressing cell causes less than about 75%, 50%, 40%, 30%, 20%, 15%, 10%, 5%, 1%, or 0.1% of the cell-surface IGF-1R to be internalized. In another aspect, binding of the antigen binding protein to the IGF-1R-expressing cell causes a gradual reduction in the amount of IGF-1R on the cell surface such that within a few hours of contacting the cell with the antigen binding protein, little or no decrease in cell surface IGF-1R is detected, but, after several days or weeks of exposure of the cell to the antigen binding protein, a marked decrease in cell surface IGF-1R is detected.

[0137]In another aspect, the present invention provides an antigen binding protein having a half-life of at least one day in vitro or in vivo (e.g., when administered to a human subject). In one embodiment, the antigen binding protein has a half-life of at least three days. In another embodiment, the antigen binding protein has a half-life of four days or longer. In another embodiment, the antigen binding protein has a half-life of eight days or longer. In another embodiment, the antigen binding protein is derivatized or modified such that it has a longer half-life as compared to the underivatized or unmodified antigen binding protein. In another embodiment, the antigen binding protein contains one or more point mutations to increase serum half life, such as described in WO 00/09560, published Feb. 24, 2000, incorporated by reference.

[0138]The present invention further provides multi-specific antigen binding proteins, for example, bispecific antigen binding protein, e.g., antigen binding protein that bind to two different epitopes of IGF-1R, or to an epitope of IGF-1R and an epitope of another molecule, via two different antigen binding sites or regions. Moreover, bispecific antigen binding protein as disclosed herein can comprise an IGF-1R binding site from one of the herein-described antibodies and a second IGF-1R binding region from another of the herein-described antibodies, including those described herein by reference to other publications. Alternatively, a bispecific antigen binding protein may comprise an antigen binding site from one of the herein described antibodies and a second antigen binding site from another IGF-1R antibody that is known in the art, or from an antibody that is prepared by known methods or the methods described herein.

[0139]Numerous methods of preparing bispecific antibodies are known in the art, and discussed in U.S. patent application Ser. No. 09/839,632, filed Apr. 20, 2001 (incorporated by reference herein). Such methods include the use of hybrid-hybridomas as described by Milstein et al., 1983, Nature 305:537, and others (U.S. Pat. No. 4,474,893, U.S. Pat. No. 6,106,833), and chemical coupling of antibody fragments (Brennan et al., 1985, Science 229:81; Glennie et al., 1987, J. Immunol. 139:2367; U.S. Pat. No. 6,010,902). Moreover, bispecific antibodies can be produced via recombinant means, for example by using leucine zipper moieties (i.e., from the Fos and Jun proteins, which preferentially form heterodimers; Kostelny et al., 1992, J. Immunol. 148:1547) or other lock and key interactive domain structures as described in U.S. Pat. No. 5,582,996. Additional useful techniques include those described in Kortt et al., 1997, supra; U.S. Pat. No. 5,959,083; and U.S. Pat. No. 5,807,706.

[0140]In another aspect, the antigen binding protein of the present invention comprises a derivative of an antibody. The derivatized antibody can comprise any molecule or substance that imparts a desired property to the antibody, such as increased half-life in a particular use. The derivatized antibody can comprise, for example, a detectable (or labeling) moiety (e.g., a radioactive, colorimetric, antigenic or enzymatic molecule, a detecable bead (such as a magnetic or electrodense (e.g., gold) bead), or a molecule that binds to another molecule (e.g., biotin or streptavidin)), a therapeutic or diagnostic moiety (e.g., a radioactive, cytotoxic, or pharmaceutically active moiety), or a molecule that increases the suitability of the antibody for a particular use (e.g., administration to a subject, such as a human subject, or other in vivo or in vitro uses). Examples of molecules that can be used to derivatize an antibody include albumin (e.g., human serum albumin) and polyethylene glycol (PEG). Albumin-linked and PEGylated derivatives of antibodies can be prepared using techniques well known in the art. In one embodiment, the antibody is conjugated or otherwise linked to transthyretin (TTR) or a TTR variant. The TTR or TTR variant can be chemically modified with, for example, a chemical selected from the group consisting of dextran, poly(n-vinyl pyurrolidone), polyethylene glycols, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols and polyvinyl alcohols. US Pat. App. No. 20030195154.

[0141]In another aspect, the present invention provides methods of screening for a molecule that binds to IGF-1R using the antigen binding proteins of the present invention. Any suitable screening technique can be used. In one embodiment, an IGF-1R molecule, or a fragment thereof to which an antigen binding protein of the present invention binds, is contacted with the antigen binding protein of the invention and with another molecule, wherein the other molecule binds to IGF-1R if it reduces the binding of the antigen binding protein to IGF-1R. Binding of the antigen binding protein can be detected using any suitable method, e.g., an ELISA. Detection of binding of the antigen binding protein to IGF-1R can be simplified by detectably labeling the antigen binding protein, as discussed above. In another embodiment, the IGF-1R-binding molecule is further analyzed to determine whether it inhibits IGF-1R, IGF-1, and/or IGF-2-mediated signaling.

Nucleic Acids

[0142]In one aspect, the present invention provides isolated nucleic acid molecules. The nucleic acids comprise, for example, polynucleotides that encode all or part of an antigen binding protein, for example, one or both chains of an antibody of the invention, or a fragment, derivative, mutein, or variant thereof, polynucleotides sufficient for use as hybridization probes, PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide, anti-sense nucleic acids for inhibiting expression of a polynucleotide, and complementary sequences of the foregoing. The nucleic acids can be any length. They can be, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1,000, 1,500, 3,000, 5,000 or more nucleotides in length, and/or can comprise one or more additional sequences, for example, regulatory sequences, and/or be part of a larger nucleic acid, for example, a vector. The nucleic acids can be single-stranded or double-stranded and can comprise RNA and/or DNA nucleotides, and artificial variants thereof (e.g., peptide nucleic acids).

[0143]Nucleic acids encoding antibody polypeptides (e.g., heavy or light chain, variable domain only, or full length) may be isolated from B-cells of mice that have been immunized with IGF-1R. The nucleic acid may be isolated by conventional procedures such as polymerase chain reaction (PCR).

[0144]FIG. 1 provides nucleic acid sequences encoding the variable regions of the heavy and light chain variable regions shown in FIGS. 2 and 3. The skilled artisan will appreciate that, due to the degeneracy of the genetic code, each of the polypeptide sequences in FIGS. 2 through 9 also is encoded by a large number of other nucleic acid sequences. The present invention provides each degenerate nucleotide sequence encoding each antigen binding protein of the invention.

[0145]The invention further provides nucleic acids that hybridize to other nucleic acids (e.g., nucleic acids comprising a nucleotide sequence of FIG. 1) under particular hybridization conditions. Methods for hybridizing nucleic acids are well-known in the art. See, e.g., Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. As defined herein, a moderately stringent hybridization condition uses a prewashing solution containing 5× sodium chloride/sodium citrate (SSC), 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization buffer of about 50% formamide, 6×SSC, and a hybridization temperature of 55° C. (or other similar hybridization solutions, such as one containing about 50% formamide, with a hybridization temperature of 42° C.), and washing conditions of 60° C., in 0.5×SSC, 0.1% SDS. A stringent hybridization condition hybridizes in 6×SSC at 45° C., followed by one or more washes in 0.1×SSC, 0.2% SDS at 68° C. Furthermore, one of skill in the art can manipulate the hybridization and/or washing conditions to increase or decrease the stringency of hybridization such that nucleic acids comprising nucleotide sequences that are at least 65, 70, 75, 80, 85, 90, 95, 98 or 99% identical to each other typically remain hybridized to each other. The basic parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by, for example, Sambrook, Fritsch, and Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11; and Current Protocols in Molecular Biology, 1995, Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4), and can be readily determined by those having ordinary skill in the art based on, for example, the length and/or base composition of the DNA.

[0146]Changes can be introduced by mutation into a nucleic acid, thereby leading to changes in the amino acid sequence of a polypeptide (e.g., an antigen binding protein) that it encodes. Mutations can be introduced using any technique known in the art. In one embodiment, one or more particular amino acid residues are changed using, for example, a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues is changed using, for example, a random mutagenesis protocol. However it is made, a mutant polypeptide can be expressed and screened for a desired property (e.g., binding to IGF-1R or blocking the binding of IGF-1 and/or IGF-2 to IGF-1R).

[0147]Mutations can be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one can make nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues. In one embodiment, a nucleotide sequence provided in FIG. 1, or a desired fragment, variant, or derivative thereof, is mutated such that it encodes an amino acid sequence comprising one or more deletions or substitutions of amino acid residues that are shown in FIGS. 2 through 9 to be residues where two or more sequences differ. In another embodiment, the mutagenesis inserts an amino acid adjacent to one or more amino acid residues shown in FIGS. 2 through 9 to be residues where two or more sequences differ. Alternatively, one or more mutations can be introduced into a nucleic acid that selectively change the biological activity (e.g., binding of IGF-1R, inhibiting IGF-1 and/or IGF-2, etc.) of a polypeptide that it encodes. For example, the mutation can quantitatively or qualitatively change the biological activity. Examples of quantitative changes include increasing, reducing or eliminating the activity. Examples of qualitative changes include changing the antigen specificity of an antigen binding protein.

[0148]In another aspect, the present invention provides nucleic acid molecules that are suitable for use as primers or hybridization probes for the detection of nucleic acid sequences of the invention. A nucleic acid molecule of the invention can comprise only a portion of a nucleic acid sequence encoding a full-length polypeptide of the invention, for example, a fragment that can be used as a probe or primer or a fragment encoding an active portion (e.g., an IGF-1R binding portion) of a polypeptide of the invention.

[0149]Probes based on the sequence of a nucleic acid of the invention can be used to detect the nucleic acid or similar nucleic acids, for example, transcripts encoding a polypeptide of the invention. The probe can comprise a label group, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used to identify a cell that expresses the polypeptide.

[0150]In another aspect, the present invention provides vectors comprising a nucleic acid encoding a polypeptide of the invention or a portion thereof. Examples of vectors include, but are not limited to, plasmids, viral vectors, non-episomal mammalian vectors and expression vectors, for example, recombinant expression vectors.

[0151]The recombinant expression vectors of the invention can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell. The recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells (e.g., SV40 early gene enhancer, Rous sarcoma virus promoter and cytomegalovirus promoter), those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences, see Voss et al., 1986, Trends Biochem. Sci. 11:287, Maniatis et al., 1987, Science 236:1237, incorporated by reference herein in their entireties), and those that direct inducible expression of a nucleotide sequence in response to particular treatment or condition (e.g., the metallothionin promoter in mammalian cells and the tet-responsive and/or streptomycin responsive promoter in both prokaryotic and eukaryotic systems (see id.). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.

[0152]In another aspect, the present invention provides host cells into which a recombinant expression vector of the invention has been introduced. A host cell can be any prokaryotic cell (for example, E. coli) or eukaryotic cell (for example, yeast, insect, or mammalian cells (e.g., CHO cells)). Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die), among other methods.

Indications

[0153]In one aspect, the present invention provides methods of treating a subject. The method can, for example, have a generally salubrious effect on the subject, e.g., it can increase the subject's expected longevity. Alternatively, the method can, for example, treat, prevent, cure, relieve, or ameliorate ("treat") a disease, disorder, condition, or illness ("a condition"). Among the conditions to be treated in accordance with the present invention are conditions characterized by inappropriate expression or activity of IGF-1, IGF-2, and/or IGF-1R. In some such conditions, the expression or activity level is too high, and the treatment comprises administering an IGF-1R antagonist as described herein. In other such conditions, the expression or activity level is too low, and the treatment comprises administering an IGF-1R agonist as described herein.

[0154]One example of a type of condition that can be treated using the methods and compositions of the present invention is a condition that involves cell growth, for example, a cancerous condition. Thus, in one embodiment, the present invention provides compositions and methods for treating a cancerous condition. The cancerous condition can be any cancerous condition that can be treated using the compositions comprised herein, for example, IGF-1R antagonizing antigen binding proteins such as anti-IGF-1R antibodies, antibody fragments, or antibody derivatives. Examples of cancerous conditions include, for example, Acute Lymphoblastic Leukemia, Adrenocortical Carcinoma, AIDS-Related Cancers, AIDS-Related Lymphoma, Anal Cancer, Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma, Basal Cell Carcinoma, Extrahepatic Bile Duct Cancer, Bladder Cancer, Osteosarcoma/Malignant Fibrous Histiocytoma Bone Cancer, Brain Tumors (e.g., Brain Stem Glioma, Cerebellar Astrocytoma, Cerebral Astrocytoma/Malignant Glioma, Ependymoma, Medulloblastoma, Supratentorial Primitive Neuroectodermal Tumors, Visual Pathway and Hypothalamic Glioma), Breast Cancer, Bronchial Adenomas/Carcinoids, Burkitt's Lymphoma, Carcinoid Tumor, Gastrointestinal Carcinoid Tumor, Carcinoma of Unknown Primary, Primary Central Nervous System, Cerebellar Astrocytoma, Cerebral Astrocytoma/Malignant Glioma, Cervical Cancer, Childhood Cancers, Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Chronic Myeloproliferative Disorders, Colon Cancer, Colorectal Cancer, Cutaneous T-Cell Lymphoma, Endometrial Cancer, Ependymoma, Esophageal Cancer, Ewing's Family of Tumors, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Intraocular Melanoma Eye Cancer, Retinoblastoma Eye Cancer, Gallbladder Cancer, Gastric (Stomach) Cancer, Gastrointestinal Carcinoid Tumor, Germ Cell Tumors (e.g., Extracranial, Extragonadal, and Ovarian), Gestational Trophoblastic Tumor, Glioma (e.g., Adult, Childhood Brain Stem, Childhood Cerebral Astrocytoma, Childhood Visual Pathway and Hypothalamic), Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular (Liver) Cancer, Hodgkin's Lymphoma, Hypopharyngeal Cancer, Hypothalamic and Visual Pathway Glioma, Intraocular Melanoma, Islet Cell Carcinoma (Endocrine Pancreas), Kaposi's Sarcoma, Kidney (Renal Cell) Cancer, Laryngeal Cancer, Leukemia (e.g., Acute Lymphoblastic, Acute Myeloid, Chronic Lymphocytic, Chronic Myelogenous, and Hairy Cell), Lip and Oral Cavity Cancer, Liver Cancer, Non-Small Cell Lung Cancer, Small Cell Lung Cancer, Lymphoma (e.g., AIDS-Related, Burkitt's, Cutaneous T-Cell, Hodgkin's, Non-Hodgkin's, and Primary Central Nervous System), Waldenstrom's Macroglobulinemia, Malignant Fibrous Histiocytoma of Bone/Osteosarcoma, Medulloblastoma, Melanoma, Intraocular (Eye) Melanoma, Merkel Cell Carcinoma, Mesothelioma, Metastatic Squamous Neck Cancer with Occult Primary, Multiple Endocrine Neoplasia Syndrome, Multiple Myeloma/Plasma Cell Neoplasm, Mycosis Fungoides, Myelodysplastic Syndromes, Myelodysplastic/Myeloproliferative Diseases, Myelogenous Leukemia, Chronic Myeloid Leukemia, Multiple Myeloma, Chronic Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Oral Cancer, Oropharyngeal Cancer, Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian Cancer, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Pancreatic Cancer, Islet Cell Pancreatic Cancer, Paranasal Sinus and Nasal Cavity Cancer, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pineoblastoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, Primary Central Nervous System Lymphoma, Prostate Cancer, Rectal Cancer, Renal Cell (Kidney) Cancer, Renal Pelvis and Ureter Transitional Cell Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Soft Tissue Sarcoma, Uterine Sarcoma, Sezary Syndrome, non-Melanoma Skin Cancer, Merkel Cell Skin Carcinoma, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Cell Carcinoma, Cutaneous T-Cell Lymphoma, Testicular Cancer, Thymoma, Thymic Carcinoma, Thyroid Cancer, Gestational Trophoblastic Tumor, Carcinoma of Unknown Primary Site, Cancer of Unknown Primary Site, Urethral Cancer, Endometrial Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and Hypothalamic Glioma, Vulvar Cancer, Waldenstrom's Macroglobulinemia, and Wilms' Tumor.

[0155]Four different groups have studied a total of 425 breast cancers, mostly ductal in origin, and 48 normal tissues or benign specimens by radioimmunoassay ("RIA") or immunohistochemistry ("IHC") (Papa et al., 1993, Cancer Research 53: 3736-40, Happerfield et al., 1997, Journal of Pathology 183: 412-17; Ellis et al., 1998, Breast Cancer Research & Treatment 52: 175-84, Lee et al., 1998, Breast Cancer Research & Treatment 47: 295-302, Schnarr et al., 2000, International Journal of Cancer 89: 506-13). These studies suggest that elevated IGF-1R expression, on the order of 5-10 fold, is associated with favorable prognosis and biomarkers (ER+PR+), suggesting that estrogen and IGF cooperate in the maintenance or progression of well differentiated tumor. Similarly, estrogen has been shown to be essential for the growth and survival of the ER+MCF-7 breast cancer cell line, and in this context IGF-1R is up-regulated by estrogen treatment (reviewed in Ellis et al., 1998, Breast Cancer Research & Treatment 52: 175-84). Thus, in one embodiment, the present invention provides a method of treating breast cancer in a subject in need of such treatment, comprising administering to the subject an effective amount of an IGF-1R antagonist as described herein. In another embodiment, the method further comprises administering a hormone inhibitor, e.g., an estrogen inhibitor.

[0156]A retrospective IGF-1R IHC analysis has been reported for a collection of 12 colonic adenomas, 36 primary colorectal adenocarcinomas and 27 corresponding metastases, and 34 adjacent normal tissues (Hakam et al., 1999, Human Pathology. 30: 1128-33). The frequency of moderate to strong IHC staining appeared to dramatically increase with higher stage and tumor grade (0% normal vs. 93% metastases). The results are consistent with RNA analysis by RNAse protection assay ("RPA") (Freier et al., 1999, Gut 44: 704-08). Thus, in one embodiment, the present invention provides a method of treating colon cancer in a subject in need of such treatment, comprising administering to the subject an effective amount of an IGF-1R antagonist as described herein.

[0157]High plasma IGF-1 and reduced IGFbp3 in men 40-80 years old is associated with increased prostate cancer risk (Chan et al., 1998, Science 279: 563-6). High IGF-1 is associated with a risk of other cancers including breast (Hankinson et al., 1998, Lancet 351: 1393-96), colon (Ma et al., 1999, Journal of the National Cancer Institute 91: 620-25) and lung (Yu et al., 1999, Journal of the National Cancer Institute 91: 151-56). In transgenic mouse models, tumor incidence is increased by IGF-1 overexpression in diverse locations (Bol et al., 1997, Oncogene 14: 1725-34; DiGiovanni et al., 2000, Cancer Research 60: 1561-70; DiGiovanni et al., 2000, Proceedings of the National Academy of Sciences of the United States of America 97: 3455-60, Hadsell et al., 2000, Oncogene 19: 889-98). These mouse studies point to a role for both serum and stromal produced IGF-1. Thus, in one embodiment, the present invention provides a method of treating a subject in need of such treatment, comprising administering to the subject an effective amount of an antagonist of IGF-1R as described herein, wherein the antagonist inhibits the activation of IGF-1R by IGF-1. In another embodiment, the subject has cancer. In another embodiment, the subject has a tumor. In another embodiment, the cancer is prostate, breast, colon or lung cancer.

[0158]It has been observed that bone is the major source of IGF-1 in the body. Thus, in one aspect, the present invention provides compositions and methods for inhibiting IGF-1R in a bone of a subject. In one embodiment, an IGF-1R inhibitor of the present invention is administered to a subject that has, or is at risk for developing, a tumor in a bone. The tumor can be, for example, a primary tumor or a metastatic tumor. The treatment optionally further comprises administering to the subject one or more additional therapeutic and/or palliative treatments, for example, an anti-tumor treatment (e.g., chemotherapy, radiation therapy, or anti-hormone therapy) or a treatment that inhibits bone turnover (e.g., denosumab (Amgen Inc., Thousand Oaks, Calif.)).

[0159]IGF-2 is overexpressed in a variety of tumors and stromal tissues. IGF-2 levels appear especially high (as much as 40 fold) in primary liver cancers (Cariani et al., 1988, Cancer Research 48: 6844-49) and adenocarcinoma of the colon (Freier et al., 1999, Gut 44: 704-08). Many of the overgrowth disorders are associated with an increased incidence of childhood tumors. Five to ten percent of individuals with either the prenatal growth disorder Beckwith-Weidmann Syndrome (BWS) or hemihyperplasia develop tumors such as nephroblastoma, adrenal carcinoma, and neuroblastoma (reviewed by Morison et al., 1998, Molecular Medicine Today 4: 110-05). The tumor-predisposing factor in these children appears to be the mosaic loss of maternal IGF-2 gene imprinting, or duplication of the paternal chromosomal arm (11p) that carries IGF-2. Both alterations would increase the level of IGF-2 expression. IGF-2 overexpression as a result of mosaic uniparental disomy or loss of IGF-2 imprinting has also been detected in Wilms tumors. Growth disorders are not observed in these children even though the IGF-2 gene alterations also occur in some normal tissues, perhaps reflecting the tissue distribution of the affected cells. Imprinting of the maternal IGF-2 gene also occurs in mice, and the effects of IGF-2 overexpression are consistent with the human situation (Cariani et al., 1991, Journal of Hepatology 13: 220-26, Schirmacher et al., 1992, Cancer Research 52: 2549-56; Harris et al., 1998, Oncogene 16: 203-09). The incidence of tumors and organomegaly increases in mice that transgenically express excess IGF-2 (Christofori et al., 1994, Nature 369: 414-18, Ward et al., 1994, Proceedings of the National Academy of Sciences of the United States of America 91: 10365-9, Wolf et al., 1994, Endocrinology 135: 1877-86, Bates et al., 1995, British Journal of Cancer 72: 1189-93, Hassan et al., 2000, Cancer Research 60: 1070-76). Local IGF-2 overexpression increases the spontaneous appearance of prostate, mammary, intestinal, liver and epidermal tumors. Plasma specific expression using liver promoters elevate hepatocellular carcinomas and lymphoma. Thus, in one embodiment, the present invention provides a method of treating a subject in need of such treatment, comprising administering to the subject an effective amount of an antagonist of IGF-1R as described herein, wherein the antagonist inhibits the activation of IGF-1R by IGF-2. In another embodiment, the subject has cancer. In another embodiment, the subject has a tumor. In another embodiment, the subject has liver cancer, adenocarcinoma of the colon, Beckwith-Weidmann Syndrome, hemihyperplasia, nephroblastoma, adrenal carcinoma, neuroblastoma, mosaic loss of maternal IGF-2 gene imprinting, duplication of the paternal chromosomal arm (11p), increased IGF-2 expression, a tumor (e.g., a prostate, mammary, intestinal, liver, epidermal, or Wilms tumor), organomegaly, hepatocellular carcinoma, or lymphoma.

[0160]In another aspect, the invention provides methods of preventing or inhibiting a cancer from spreading to another part of the body, or of treating a cancer that has spread to another part of the body. In one embodiment, the cancer has spread to a regional lymph node. In another embodiment, the cancer is metastatic. The primary tumor can be any kind of tumor, for example, an adenocarcinoma tumor (e.g., a prostate adenocarcinoma tumor, a breast carcinoma tumor, or a renal cell carcinoma tumor), a non-small cell or small cell lung cancer tumor, a thyroid cancer tumor, etc. The site of the metastatic tumor can be anywhere in the body. It can be, for example, in bone, the lymph system, lung, brain, eye, skin, pancrease, or liver. In one particular embodiment, a subject having a tumor disease is treated with an effective amount of an IGF-1R inhibiting composition of the present invention such that the primary tumor is prevented from metastasizing. In another particular embodiment, a subject having a primary tumor is treated with an effective amount of an IGF-1R inhibiting composition of the present invention such that the primary tumor is inhibited from metastasizing. In another particular embodiment, a subject having a metastatic tumor is treated with an effective amount of an IGF-1R inhibiting composition of the present invention such that growth or spreading of the secondary tumor is inhibited. In another particular embodiment, a subject having a metastatic tumor is treated with an effective amount of an IGF-1R inhibiting composition of the present invention such that the secondary tumor is reduced in size. In a more particular embodiment, the primary tumor is an adenocarcinoma tumor, a non-small cell lung tumor, a small cell lung tumor, or a thyroid cancer. In another more particular embodiment, the metastatic tumor is in a bone. In another more particular embodiment, a metastatic tumor is prevented or inhibited from forming in a bone. In another more particularly defined embodiment, the method comprises treating the subject with an IGF-1R inhibiting composition of the present invention and one or more other treatments (e.g., a treatment that kills or inhibits the growth of cancer cells, such as radiation, hormonal therapy, or chemotherapy, or a treatment that inhibits the turnover of bone, such as denosumab), non-limiting examples of which are provided herein. The one or more other treatments can include, for example the standard of care for the subject's particular condition and/or palliative care.

[0161]Without being bound to any particular theory, tumor cells appear to depend on the PI3 Kinase/Akt signaling pathway to resist the apoptosis-inducing activity of chemotherapeutics, radiation, and anti-hormone therapy. Thus, in one embodiment, the present invention provides methods of treating a subject in need of such treatment comprising administering to the subject an IGF-1R antagonist of the present invention and a chemotherapeutic, radiation, and/or an anti-hormone therapy. This concept has been validated experimentally in cell culture models and rodent tumor models by antisense and dominant negative mutations (reviewed by Baserga et al., 1997, Biochimica et Biophysica Acta 1332: F105-26, Baserga, 2000, Oncogene 19: 5574-81). In one embodiment, the chemotherapeutic agents is selected from the group consisting of mitotic inhibitors, alkylating agents, anti-metabolites, intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzymes, topoisomerase inhibitors, anti-survival agents, biological response modifiers, anti-hormones, e.g. anti-androgens, and anti-angiogenesis agents.

[0162]One example of a chemotherapeutic agent that can be administered in combination with an IGF-1 receptor inhibitor of the invention is CPT-11. CPT-11 (Irinotecan hydrorchloride trihydrate) is a semi synthetic, water soluble derivative of camptothecin, a plant alkaloid. CPT-11 and an associated metabolite called SN38 inhibit topoisomerase 1 (TOPO1). This enzyme introduces reversible single-strand breaks in DNA that allow unwinding and permit DNA replication to proceed. Inhibition of TOPO1 prevents religation of single-strand breaks after DNA replication resulting in greatly increased chromosomal fragmentation. This DNA damage promotes cell death by apoptosis through the action of p53 and other systems that monitor genome integrity. The cytotoxic effect of CPT-11 is generally limited to cells that are replicating DNA (S-Phase). Quiescent cells are largely unaffected.

[0163]In another embodiment, the present invention provides treating a subject in need thereof with an effective amount of an IGF-1R antagonist of the present invention and with an effective amount of an apoptosis-inducing agent.

[0164]In another embodiment, an anti-angiogenesis agent, such as an MMP-2 (matrix-metalloproteinase 2) inhibitor, an MMP-9 (matrix-metalloproteinase 9) inhibitor, and/or a COX-II (cyclooxygenase II) inhibitor, is used in conjunction with a compound of the invention. Examples of useful COX-II inhibitors include CELEBREX® (alecoxib), BEXTRA® (valdecoxib), and VIOXX® (rofecoxib). Examples of useful matrix metalloproteinase inhibitors are described in WO 96/33172 (published Oct. 24, 1996), WO 96/27583 (published Mar. 7, 1996), European Patent Application No. 97304971.1 (filed Jul. 8, 1997), European Patent Application No. 99308617.2 (filed Oct. 29, 1999), WO 98/07697 (published Feb. 26, 1998), WO 98/03516 (published Jan. 29, 1998), WO 98/34918 (published Aug. 13, 1998), WO 98/34915 (published Aug. 13, 1998), WO 98/33768 (published Aug. 6, 1998), WO 98/30566 (published Jul. 16, 1998), European Patent Publication 606,046 (published Jul. 13, 1994), European Patent Publication 931,788 (published Jul. 28, 1999), WO 90/05719 (published May 31, 1990), WO 99/52910 (published Oct. 21, 1999), WO 99/52889 (published Oct. 21, 1999), WO 99/29667 (published Jun. 17, 1999), PCT International Application No. PCT/IB98/01113 (filed Jul. 21, 1998), European Patent Application No. 99302232.1 (filed Mar. 25, 1999), Great Britain patent application number 9912961.1 (filed Jun. 3, 1999), U.S. Provisional Application No. 60/148,464 (filed Aug. 12, 1999), U.S. Pat. No. 5,863,949 (issued Jan. 26, 1999), U.S. Pat. No. 5,861,510 (issued Jan. 19, 1999), and European Patent Publication 780,386 (published Jun. 25, 1997), all of which are incorporated herein in their entireties by reference. In one embodiment, the MMP inhibitor is one that does not demonstrate arthralgia. In another embodiment, the MMP inhibitor selectively inhibits MMP-2 and/or MMP-9 relative to other matrix-metalloproteinases (i.e., MMP-1, MMP-3, MMP-4, MMP-5, MMP-6, MMP-7, MMP-8, MMP-10, MMP-11, MMP-12, and MMP-13). Some specific examples of MMP inhibitors useful in the present invention are AG-3340, RO 32-3555, RS 13-0830, and the compounds recited in the following list: 3-[[4-(4-fluoro-phenoxy)-benzene-sulfonyl]-(1-hydroxycarbamoyl-cyclopenty- l)-amino]-propionic acid; 3-exo-3-[4-(4-fluoro-phenoxy)-benzenesulfonylamino]-8-oxa-bicyclo[3.2.1]o- -ctane-3-carboxylic acid hydroxyamide; ((2R,3R)) 1-[4-(2-chloro-4-fluoro-ben-zyloxy)-benzenesulfonyl]-3-hydroxy-3-methyl-p- iperidine-2-carboxylic acid hydroxyamide; 4-[4-(4-fluoro-phenoxy)-benzenesulfonylamino]-tetrahydro-py-ran-4-carboxy- lic acid hydroxyamide; 3-[[4-(4-fluoro-phenoxy)-benzenesulfon-yl]-(1-hydroxycarbamoyl-cyclobutyl- )-amino]-propionic acid; 4-[4-(4-chloro-phenoxy)-benzenesulfonylamino]-tetrahydro-pyran-4-carboxyl- -is acid hydroxyamide; (R) 3-[4-(4-chloro-phenoxy)-benzenesulfonylamino]-tetrahydro-pyran-3-carboxyl- ic acid hydroxyamide; ((2R,3R)) 1-[4-(4-fluoro-2-methyl-benzyloxy)-benzenesulfonyl]-3-hydroxy-3-methyl-pi- -peridine-2-carboxylic acid hydroxyamide; 3-[[4-(4-fluoro-phenoxy)-benzenes-ulfonyl]-(1-hydroxycarbamoyl-1-methyl-e- thyl)-amino]-propionic acid; 3-[[4-(4-fluoro-phenoxy)-benzenesulfonyl]-(4-hydroxycarbamoyl-tetrahydro-- pyran-4-yl)-amino]-propionic acid; 3-exo-3-[4-(4-chloro-phenoxy)-benzenesulfonylamino]-8-oxa-icyclo[3.2.1]oc- tane-3-carboxylic acid hydroxyamide; 3-endo-3-[4-(4-fluoro-phenoxy)-benzenesulfonylamino]-8-oxa-icyclo[3.2.1]o- ctane-3-carboxylic acid hydroxyamide; and (R) 3-[4-(4-fluoro-phenoxy)-b-enzenesulfonylamino]-tetrahydro-furan-3-carboxy- lic acid hydroxyamide; and pharmaceutically acceptable salts, solvates, derivatives, and other preparations of the compounds.

[0165]Sporadic mutations that inactivate the PETN gene product occur relatively frequently in most human cancers (Yamada et al., 2001, J Cell Sci 114:2375-82, Hill et al., 2002, Pharmacol Therapeut 93:243-51). Loss of PTEN causes the Akt phosphorylated state to persist through loss of the ability to down-regulate stimulatory signals originating from IGF-1R and other sources. The status of the p53 tumor suppressor also influences the activity of the IGF-1R signaling system. In the ground state, the basal or constitutive transcription of IGF-1R is repressed by p53 via an indirect mechanism. Activation of Akt promotes the phosphorylation of mdm2, which then binds the p53 tumor suppressor and promotes its degradation (Mayo et al., 2002, TIBS 27:462-67), resulting in increased IGF-1R expression. A similar outcome is observed when p53 is inactivated by mutation. When transiently expressed in Saos-2 (a human osteosarcoma cell line) and RD (a rhabdomyosarcoma cell line), wild-type p53 is able to suppress the activity of a cotransfected IGF-1R promoter construct, whereas tumor-derived, mutant versions of p53 have no effect. It has been proposed that the increased level of IGF-1R promotes the resistance to apoptosis associated with p53 loss in malignant cells (Werner et al., 2000, Cell Mol Life Sci 57:932-42). Thus, in one embodiment, the present invention provides a method of treating a cancerous condition in a subject in need of such treatment comprising administering to the subject an effective amount of an IGF-1R antagonist as described herein, wherein the cancerous condition is characterized by cells that have a reduced expression or activity of p53.

[0166]The WT1 (Wilms kidney tumor suppressor 1 protein) also has been shown to bind and repress the IGF-1R promoter. Thus, in one embodiment, the present invention provides a method of treating a cancerous condition in a subject in need of such treatment comprising administering to the subject an effective amount of an IGF-1R antagonist as described herein wherein the cancerous condition is characterized by a reduced expression or activity of WT1.

[0167]The proliferation of normal fibroblasts has been shown to require, under defined culture conditions, the combined action of IGF and a stromal growth factor (e.g. PDGF, EGF) to ramp-up Ras/Raf/Map Kinase and promote cell cycle entry (the G0 to G1 transition). Fibroblasts derived from IGF-1R (-/-) mice do not respond to growth factor alone, or most oncogenes (e.g. oncogenic Ras) that activate the Ras/Raf/Map Kinase pathway. Thus, in one embodiment, the present invention provides a method of treating a subject in need of such treatment comprising administering to the subject an IGF-1R antagonist as described herein and an agent that targets a growth factor and/or a growth factor receptor, such as a growth factor receptor tyrosine kinase, e.g., the EGFR, HER-2, bcr-abl, VEGFR, Kit, raf, mTOR, CDK1/2, VEGFR2, Mek, and/or KDR. Examples of molecules that target such growth factors and/or receptors include panitumumab (Abgenix, Fremont, Calif./Amgen, Thousand Oaks, Calif.), HERCEPTINT® (Genentech, South San Francisco, Calif.), GLEEVEC® (Novartis, East Hanover, N.J.), IRESSA® (AstraZeneca, Wilmington, Del.), ERBITUX®, (ImClone, New York, N.Y.), AVASTINT®, (Genentech), PTK787 (Novartis), SU11248 (Pfizer, New York, N.Y.), TARCEVA® (OSI Pharmaceuticals, Melville, N.Y.), 43-9006 (Bayer, West Haven, Conn.), CCI-779 (Wyeth, Madison, N.J.), RAD001 (Novartis), BMS-387032 (Bristol-Myers Squibb, New York, N.Y.), IMC-1C11 (ImClone), LY333531 (Eli Lilly, Indianapolis, Ind.), PD 184352 (Pfizer), 2C4 (Genentech), and GW2016 (GlaxoSmithKline, Research Triangle Park, N.C.).

[0168]The role of IGF-1R in hematological malignancies has been reviewed by (Novak et al., 2003, Insulin-Like Growth Factors and Hematological Malignancies in Insulin-Like Growth Factors, LeRoith et al., ed.s, Landes Bioscience). A functional role for the IGF-1R in hematopoietic malignancies is demonstrated by, for example, the ability of IGF-1R monoclonal antibodies to block transformed cell growth in culture. IGF-I has been found to enhance growth of freshly isolated human acute myelogenous leukemia and acute lymphoblastic leukemia blasts. With respect to T cell malignancies, IGF-I has been shown to influence the growth of murine lymphoma cells bearing a pre-T cell phenotype and, immature and mature primary human T lineage acute lymphoblastic leukemia cells were found to express high numbers of IGF-1R. Thus, in one embodiment, the present invention provides methods of treating a hematological malignancy in a subject in need thereof comprising administering to the subject an antagonist of IGF-1R as described herein. In another embodiment, the malignancy is an acute myelogenous leukemia, an acute lymphoblastic leukemia, or a T cell malignancy.

[0169]In another aspect, the present invention provides methods of identifying subjects who are more likely to benefit from treatment using the compositions and/or methods of treatment of the present invention. Such methods can enable a caregiver to better tailor a therapeutic regimen to a particular subject's needs and reduce the likelihood of an ineffective or counterproductive course of treatment. In one embodiment, the present invention provides a method of determining whether a subject is a candidate for treatment using a composition or method as described herein comprising determining whether a target cell type in the subject expresses IGF-1R, wherein if the target cell type expresses IGF-1R, then the subject is a candidate for treatment. In another embodiment, the method comprises determining the approximate average number of IGF-1R molecules per target cell, wherein 10², 10³, 10⁴, 10⁵, or 10⁶ IGF-1R per cell indicates that the subject is a candidate for treatment. The approximate average number of IGF-1R molecules per target cell can be determined using any technique known in the art, for example, by staining a sample comprising cells of the target cell type with an IGF-1R binding molecule, and detecting the amount of IGF-1R binding molecule bound to the sample, where the amount of IGF-1R binding molecule detected is proportional to the average number of IGF-1R molecules in the sample. In another embodiment, the method comprises comparing the approximate average number of IGF-1R molecules per target cell to a reference standard, wherein if the approximate average number of IGF-1R molecules per target cell is greater than the reference standard, then the subject is more likely to benefit from treatment using the compositions and/or methods of treatment of the present invention. In another embodiment, the target cell type is a cancerous cell type. In another embodiment, the target cell type is a colon cancer cell type, a breast cancer cell type, an NSCLC cell type, or a leukemic cell type.

[0170]In another embodiment, a subject who is a candidate for treatment is identified by detecting IGF-1 and/or IGF-2 in the target cell type, or in the stratum of the target cell type. In another embodiment, the target cell type is a cancerous cell type. In another embodiment, the target cell type is a colon cancer cell type, a breast cancer cell type, an NSCLC cell type, or a leukemic cell type.

[0171]In another embodiment, a subject who is a candidate for treatment is identified by detecting activity of IGF-1R-mediated signaling in the target cell type (e.g., a tumor or other cancerous tissue), wherein IGF-1R-mediated signaling in the target cell type indicates that the subject is a candidate for treatment. Examples of molecules that can be monitored for IGF-1R-dependent changes are shown in FIG. 10, such as molecules in the PI3/Akt pathway, e.g., IGF-1R, IRS adapters, Akt, etc. Such molecules can be monitored for, for example, a change in phosphorylation status, e.g., an increase in phosphorylation. Phosphospecific antibodies that recognize the activated forms of these protein markers are highly developed, and these reagents have proven to be reliable for immunoblot detection in experimental systems.

[0172]In another embodiment, methods and compositions are provided for determining whether a tissue in a subject (for example, a tumor tissue or other cancerous tissue in the subject) has a molecular marker that identifies the subject as being more likely or less likely to respond favorably to treatment using the therapeutic methods and compositions of the present invention. Any such molecular marker can be used. In one embodiment, the molecular marker is a chromosomal abnormality (for example, in tumor-derived tissue), such as a chromosomal abnormality involving the EWS gene and a transcription factor. In one particular embodiment, the molecular marker is a EWS-FLI chromosomal translocation in a tumor or other cancerous tissue. Such translocations can be detected using any method known in the art (see, for example, Giovannini et al., 1994, J Clin Invest. 94:489-96; Delattre et al., 1994, NEJM 331:294-99; and Zoubek et al., 1994, Br J Cancer 70:908-13, each incorporated herein by reference in its entirety and for all purposes). Examples of such detection methods include cytological analysis, fluorescent in situ hybridization (FISH), sequence analysis of a EWS-FLI hybrid gene, detection and/or quantification of a transcriptional product of a EWS-FLI hybrid gene (using, e.g., a PCR-based technique such as RT-PCR, or a hybridization based technique such as in situ hybridization or a northern blot), detection and/or quantification of a polypeptide product of a EWS-FLI hybrid gene (using, e.g., an antibody-based technique such as in situ staining or a western blot), detection and/or quantification of a molecule or an activity associated with a EWS-FLI hybrid gene product, detection and/or quantification of a molecule or an activity dependent upon an activity of a EWS-FLI hybrid gene product, or detection and/or quantification of a molecule or an activity affected by an activity of a EWS-FLI hybrid gene product. In another particular embodiment, detection of a EWS-FLI hybrid gene product (e.g., a product of transcription or of translation) in a tumor or other cancerous tissue indicates that the tumor or cancerous tissue is more likely to respond to treatment using an anti-IGF-1 receptor inhibitor, or another inhibitor of signaling through the IGF-1 receptor signaling pathway, than a tumor or other cancerous tissue in which a EWS-FLI hybrid gene product is not detected. In another particular embodiment, a sample derived from a tumor or other cancerous tissue containing a EWS-FLI chromosomal translocation is tested to determine whether it expresses a EWS-FLI hybrid gene product. Detection of the EWS-FLI hybrid gene product indicates that the tumor or cancerous tissue is more likely to respond to treatment using an anti-IGF-1 receptor treatment or another inhibitor of signaling through the IGF-1 receptor signaling pathway.

[0173]In another embodiment, the molecular marker is a mutation in a signaling molecule, for example, in a kinase. The mutation can, for example, increase the activity of the signaling molecule, decrease the activity of the signaling molecule, and/or alter the ligand specificity, substrate specificity, timing, or location of the activity of the signaling molecule. In some embodiments, the signaling molecule is a RAS, and the mutation is an activating mutation. RAS mutations are found in about one third of all human tumors. Examples of activating RAS mutations include mutations to codons 12, 13, and 61. Other examples of activating RAS mutations include mutations in codons 10, 11, 15, 18, and 22. Other types of mutations or other changes can also cause an inappropriate increase in signaling through a RAS molecule. Examples of such other types of changes include gene amplification, overexpression, or upstream activation of a RAS pathway, e.g., approximately 40% of esophageal adenocarcinomas have an amplified KRAS gene, resulting in increased KRAS signaling; high levels of RAS activity are found in about half of all breast cancer tumors and are associated with expression of epidermal growth factor and HER-2, yet RAS mutations are rare in these tumors. Thus, the present invention provides methods for identifying subjects with elevated RAS activity as being more likely to respond favorably to treatment using an inhibitor of IGF-1 receptor signaling, and/or of treating such subjects with an inhibitor of IGF-1 receptor signaling.

[0174]In one particular embodiment, it is determined whether a subject has an activating KRAS mutation in at least some cells of at least one tumor, wherein the presence of the activating KRAS mutation indicates that the subject is more likely to respond to treatment of the tumor using an inhibitor of IGF-1 receptor signaling. The activating KRAS mutation can be any known in the art, for example, one affecting codon 10, 11, 12, 13, 15, 18, 22, 59, 61, and 63, such as G12C, G12D, G12E, and G12V. KRAS mutations are the most prevalent type of RAS mutations found in human tumors. Many tumor types are known to comprise activating KRAS mutations, including tumors of the pancreas (72-90% of which have an activating KRAS mutation), colon or rectum (32-57%), lung (15-50%), endometrium (5-50%), gallbladder (14-38%), and testes (9-12%), and multiple myeloma tumors (16-33%). Friday et al., 2005, Biochim Biophys Acta 1756:127-44. Thus, in various embodiments of the invention, methods and compositions are provided for detecting KRAS mutations in at least some cells of a tumor in a subject, and/or treating the subject with an inhibitor of IGF-1 receptor signaling. In particular embodiments, the subject has a tumor of the pancreas, colon, rectum, lung, endometrium, gallbladder, or testes, or a multiple myeloma tumors.

[0175]In another embodiment, a tumor that has a wild-type allele of KRAS is treated with an IGF-1 receptor inhibitor. In one particular embodiment, the tumor is also treated with an EGF receptor inhibitor, such as panitumumab or cetuximab. In another particular embodiment, the tumor was previously treated with an EGF receptor inhibitor, such as panitumumab or cetuximab, and is now treated with both an EGF receptor inhibitor (either the same EGF receptor inhibitor previously used, or another) and an IGF-1 receptor inhibitor. In another particular embodiment, the treated tumor is a colorectal tumor.

[0176]In another embodiment, it is determined whether some fraction of cells taken from a tumor in a subject has reduced PTEN activity, wherein reduced PTEN activity indicates that the tumor is less likely to respond to inhibition of IGF-1 receptor signaling. The reduction in PTEN activity can be detected using any suitable method. For example, expression levels can be detected using a method that detects PTEN RNA levels (e.g., via a hybridization-based method such as Northern Blot or in situ hybridization), protein levels (e.g., using a detecable PTEN-binding agent, such as a detectably labled anti-PTEN antibody), or PTEN enzymatic activity (e.g., by measuring PTEN activity directly or indirectly through its effects on other molecules, or by detecting mutations that cause a reduction of PTEN activity, such as partial or complete loss-of-function mutations in PTEN, for example PTEN D331G). See, e.g., Teng et al., 1997, Cancer Res 57:5221-25; Bonneau et al., 2000, Human Mutation 16:109-22, each incorporated herein by reference in its entirety for all purposes.

[0177]The compositions and/or methods of the present invention also can be used, for example, in cosmetic treatments, in veterinary treatments, to increase longevity, to treat reproductive defects, and to treat a variety of growth related disorders.

Therapeutic Methods

[0178]Certain methods provided herein comprise administering to a subject an inhibitor of IGF-1R-mediated signaling. Any treatment that results in a reduction of an activity or signal mediated by IGF-1R can be used. Examples of such treatments are provided in Sachdev et al., 2007, Mol Cancer Ther. 6:1-12. In one embodiment, the treatment comprises administering to the subject a substance that reduces an activity mediated by IGF-1R. Examples of such substances include, but are not limited to, antibodies (including fragments and derivatives thereof), peptibodies, and AVIMERS® (Amgen, Inc., Thousand Oaks, Calif.) that bind to IGF-1R, IGF-1, or IGF-2, soluble, IGF-1- and/or IGF-2-binding derivatives of IGF-1R, small molecules that bind to IGF-1R, IGF-1, IGF-2, IRS1, SHC, GRB2, SOS1, PI3K, SHP2, or any other molecule that acts in the IGF-1R signaling cascade, IGF-1 or IGF-2 binding proteins (and derivatives thereof), inhibitory nucleic acids (such as siRNA) and derivatives thereof (including peptide nucleic acids). Non-limiting examples of such molecules can be found in, for example, U.S. Pat. Nos. 7,329,7347 (published Feb. 12, 2008), 173,005 (issued Feb. 6, 2007), U.S. Pat. No. 7,071,300 (issued Jul. 4, 2006), U.S. Pat. No. 7,020,563 (issued Mar. 28, 2006), U.S. Pat. No. 6,875,741 (issued Apr. 5, 2005); U.S. Pat. App. Pub. Nos. 07/0299010 (published Dec. 27, 2007), 07/026,5189 (published Nov. 15, 2007), 07/0135340 (published Jun. 14, 2007), 07/0129399 (published Jun. 7, 2007), 07/0004634 A1 (published Jan. 4, 2007), 05/0282761 A1 (published Dec. 22, 2005), 05/0054638 A1 (published Mar. 10, 2005), 04/0023887 A1 (published Feb. 5, 2004), 03/0236190 A1 (published Dec. 25, 2003), 03/0195147 A1 (published Oct. 16, 2003); PCT Pub. No. WO 07/099171 (published Sep. 7, 2007), WO 07/099166 (published Sep. 7, 2007), 07/031745 (published Mar. 22, 2007), WO 07/029106 (published Mar. 15, 2007), WO 07/029107 (published Mar. 15, 2007), WO 07/004060 (published Jan. 11, 2007), WO 06/074057 A2 (published Jul. 13, 2006), WO 06/069202 A2 (published Jun. 29, 2006), WO 06/017443 A2 (published Feb. 16, 2006), WO 06/012422 A1 (published Feb. 2, 2006), WO 06/009962 A2 (published Jan. 26, 2006), WO 06/009950 A2 (published Jan. 26, 2006), WO 06/009947 A2 (published Jan. 26, 2006), WO 06/009933 A2 (published Jan. 26, 2006), WO 05/097800 A1 (Oct. 20, 2005), WO 05/082415 A2 (published Sep. 9, 2005), WO 05/037836 A2 (published Apr. 28, 2005), WO 03/070911 A2 (published Aug. 28, 2003), WO 99/28347 A2 (published Jun. 10, 1999); European Pat. No. EP 1 732 898 B1 (published Jan. 23, 2008), EP 0 737 248 B1 (published Nov. 14, 2007), European Pat. App. No. EP 1 496 935 A2 (published Jan. 19, 2005) and EP 1 432 433 A2 (published Jun. 30, 2004), and D'ambrosio et al., 1996, Cancer Res. 56:4013-20, each of which is incorporated herein by reference in its entirety. Specific examples of such molecules include OSI-906 (OSI Pharmaceuticals, Melvilee, N.Y.), BMS 536924 (Wittman et al., 2005, J Med. Chem. 48:5639-43; Bristol Myers Squibb, New York, N.Y.), XL228 (Exelexis, South San Francisco, Calif.), INSM-18, NDGA, and rhIGFBP-3 (Insmed, Inc., Richmond, Va.; Breuhahn et al, 2002006, Curr Cancer Ther Rev. 2:157-67; Youngren et al., 2005, Breast Cancer Res Treatment 94:37-46; U.S. Pat. No. 6,608,108), each of which reference is incorporated herein by reference in its entirety.

[0179]In one aspect, any suitable anti-IGF-1R antibody, antibody fragment, or antibody derivative can be used in the methods of the present invention. In one embodiment, the antibody, antibody fragment, or antibody derivative binds to the extracellular domain of IGF-1R. In another embodiment, the antibody, antibody fragment, or antibody derivative competes for binding to IGF-R with IGF-1 and/or IGF-2. In another embodiment, the antibody, antibody fragment, or antibody derivative, when bound to IGF-1R, reduces the amount of IGF-1 and/or IGF-2 that binds to the IGF-1R. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the L1 subdomain of the IGF-1R extracellular domain. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the CR subdomain of the IGF-1R extracellular domain. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the L2 subdomain of the IGF-1R extracellular domain. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the FnIII1 subdomain of the IGF-1R extracellular domain. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the FnIII2-ID subdomain of the IGF-1R extracellular domain. In another embodiment, the antibody, antibody fragment, or antibody derivative binds to the FnIII subdomain of the IGF-1R extracellular domain. (The IGF-1R extracellular subdomains are defined in Example 12, below.) In another embodiment, the antibody, antibody fragment, or antibody derivative binds to more than one IGF-1R extracellular domain. Non-limiting examples of anti-IGF-1R antibodies that can be used in the methods of the present invention include each of the antibodies identified herein as L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52, and IGF-1R-binding fragments and derivatives thereof. Other non-limiting examples of anti-IGF-1R antibodies for use in the methods of the present invention include those described in US Pat. App. Pub. Nos. 06/0040358 (published Feb. 23, 2006), 05/0008642 (published Jan. 13, 2005), 04/0228859 (published Nov. 18, 2004), e.g., antibody 1A (DSMZ Deposit No. DSM ACC 2586), antibody 8 (DSMZ Deposit No. DSM ACC 2589), antibody 23 (DSMZ Deposit No. DSM ACC 2588) and antibody 18 as described therein; PCT Pub. No. WO 06/138729 (published Dec. 28, 2006), WO 05/016970 (published Feb. 24, 2005), and Lu et al., 2004, J Biol. Chem. 279:2856-65, e.g., antibodies 2F8, A12, and IMC-A12 as described therein; PCT Pub. No. WO 07/012614 (published Feb. 1, 2007), WO 07/000328 (published Jan. 4, 2007), WO 06/013472 (published Feb. 9, 2006), 05/058967 (published Jun. 30, 2005), 03/059951 (published Jul. 24, 2003), US Pat. App. Pub. No. 05/0084906 (published Apr. 21, 2005), e.g., antibody 7C10, chimaeric antibody C7C10, antibody h7C10, antibody 7H2M, chimaeric antibody *7C10, antibody GM 607, humanized antibody 7C10 version 1, humanized antibody 7C10 version 2, humanized antibody 7C10 version 3, and antibody 7H2HM, as described therein; US Pat. App. Pub. Nos. 05/0249728 (published Nov. 10, 2005), 05/0186203 (published Aug. 25, 2005), 04/0265307 (published Dec. 30, 2004), 03/0235582 (published Dec. 25, 2003), Maloney et al., 2003, Cancer Res. 63:5073-83, e.g., antibody EM164, resurfaced EM164, humanized EM164, huEM164 v1.0, huEM164 v1.1, huEM164 v1.2, and huEM164 v1.3, as described therein; U.S. Pat. No. 7,037,498 (issued May 2, 2006), US Pat. App. Nos. 05/0244408 (published Nov. 30, 2005), 04/0086503 (published May 6, 2004), Cohen, et al., 2005, Clinical Cancer Res. 11:2063-73, e.g., antibody CP-751,871, each of the antibodies produced by the hybridomas having the ATCC accession numbers PTA-2792, PTA-2788, PTA-2790, PTA-2791, PTA-2789, PTA-2793, and antibodies 2.12.1, 2.13.2, 2.14.3, 3.1.1, 4.9.2, and 4.17.3, as described therein; US Pat. App. Nos. 05/0136063 (published Jun. 23, 2005), 04/0018191 (published Jan. 29, 2004), e.g. antibody 19D12 and an antibody comprising a heavy chain encoded by a polynucleotide in plasmid 15H12/19D12 HCA (y4), deposited at the ATCC under number PTA-5214, and a light chain encoded by a polynucleotide in plasmid 15H12/19D12 LCF (κ), deposited at the ATCC under number PTA-5220, as described therein; US Pat. App. No. 04/0202655 (published Oct. 14, 2004), e.g., antibodies PINT-6A1, PINT-7A2, PINT-7A4, PINT-7A5, PINT-7A6, PINT-8A1, PINT-9A2, PINT-11A1, PINT-11A2, PINT-11A3, PINT-11A4, PINT-11A5, PINT-11A7, PINT-11A12, PINT-12A1, PINT-12A2, PINT-12A3, PINT-12A4, and PINT-12A5, as described therein; U.S. patent application Ser. No. 07/0243194 (published Oct. 18, 2007), e.g., antibodies M13-C06, M14-G11, M14-C03, M14-B01, M12-E01, and M12-G04, and antibodies produced by hybridomas P2A7.3E11, 2008.3B8, P1A2.2B11, 20D8.24B11, P1E2.3B12, and P1G10.2B8. Each of the foregoing references is incorporated herein by reference in its entirety. Also suitable for use are antibodies, antibody fragments, or antibody derivatives that compete for binding to IGF-1 receptor with one of the aforementioned antibodies. In one embodiment, the antibody, antibody fragment, or antibody derivative binds to the same epitope as one of the aforementioned antibodies, or to an epitope that overlaps with the epitope of one of the aforementioned antibodies.

[0180]In particular embodiments, methods of the invention involve contacting endogenous IGF-1R with an IGF-1R binding antigen binding protein, e.g., via administration to a subject or in an ex vivo procedure.

[0181]The term "treatment" encompasses alleviation or prevention of at least one symptom or other aspect of a disorder, or reduction of disease severity, and the like. A treatment need not effect a complete cure, or eradicate every symptom or manifestation of a disease, to constitute a viable therapy. As is recognized in the pertinent field, drugs or other treatments employed as therapeutic agents may reduce the severity of a given disease state, but need not abolish every manifestation of the disease to be regarded as therapeutically useful. Similarly, a prophylactically administered treatment need not be completely effective in preventing the onset of a condition in order to constitute a viable prophylactic agent. Simply reducing the impact of a disease (for example, by reducing the number or severity of its symptoms, by delaying the onset of the condition, by accelerating the reduction of symptoms, by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reducing the likelihood that the disease will occur or worsen in a subject, is sufficient. Therapeutically useful treatments also include treatments that are effective in some patients, but not in others. One embodiment of the invention is directed to a method comprising administering to a patient an IGF-1R antagonist in an amount and for a time sufficient to induce a sustained improvement over baseline of an indicator that reflects the severity of the particular disorder.

[0182]The progress of a course of treatment can be monitored or measured using any suitable technique. For treating a tumor, such techniques include detecting the size, or change in size, of the tumor. The size of the tumor can be measured by its length, circumference, volume, etc., as determined or estimated using any suitable technique, including direct observation, radiological techniques, and the like. In certain embodiments, progress of the treatment is monitored using the RECIST techniques and criteria (Therasse et al. 2000, J Natl Cancer Inst. 92:205-16, incorporated herein by reference in its entirety for all purposes). Progress of the treatment can also be monitored in other ways, for example, by determining the relative health or vigor of the tumor tissue, e.g., by measuring the tumor's uptake of glucose using a PET scan, or by monitoring an aspect of the tumor that is correlated with the health or vigor of the tumor tissue, or with the effectiveness of the treatment. Examples of such aspects of the tumor include expression levels of particular genes or proteins, phosphorylation states or other post-translational modifications of particular proteins, and the like.

[0183]As is understood in the pertinent field, pharmaceutical compositions comprising the molecules of the invention are administered to a subject in a manner appropriate to the indication. Pharmaceutical compositions may be administered by any suitable technique, including but not limited to parenterally, topically, or by inhalation. If injected, the pharmaceutical composition can be administered, for example, via intra-articular, intravenous, intramuscular, intralesional, intraperitoneal or subcutaneous routes, by bolus injection, or continuous infusion. Localized administration, e.g. at a site of disease or injury is contemplated, as are transdermal delivery and sustained release from implants. Delivery by inhalation includes, for example, nasal or oral inhalation, use of a nebulizer, inhalation of the antagonist in aerosol form, and the like. Other alternatives include eyedrops; oral preparations including pills, syrups, lozenges or chewing gum; and topical preparations such as lotions, gels, sprays, and ointments.

[0184]Use of pharmaceutical compositions in ex vivo procedures also is contemplated. For example, a patient's blood or other bodily fluid may be contacted with an inhibitor of IGF-1R signaling ex vivo. The inhibitor may be bound to a suitable insoluble matrix or solid support material.

[0185]IGF-1R signaling inhibitors of the instant invention can be administered in the form of a composition comprising one or more additional components such as a physiologically acceptable carrier, excipient or diluent. Optionally, the composition additionally comprises one or more physiologically active agents, for example, a second IGF-1R signaling inhibitor, an anti-angiogenic substance, a chemotherapeutic substance, an analgesic substance, etc., non-exclusive examples of which are provided herein. In various particular embodiments, the composition comprises one, two, three, four, five, or six physiologically active agents in addition to an IGF-1R binding antigen binding protein

[0186]In one embodiment, the pharmaceutical composition comprise an inhibitor of IGF-1R signaling together with one or more substances selected from the group consisting of a buffer, an antioxidant such as ascorbic acid, a low molecular weight polypeptide (such as those having fewer than 10 amino acids), a protein, an amino acid, a carbohydrate such as glucose, sucrose or dextrins, a chelating agent such as EDTA, glutathione, a stabilizer, and an excipient. Neutral buffered saline or saline mixed with conspecific serum albumin are examples of appropriate diluents. In accordance with appropriate industry standards, preservatives such as benzyl alcohol may also be added. The composition may be formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose) as diluents. Suitable components are nontoxic to recipients at the dosages and concentrations employed. Further examples of components that may be employed in pharmaceutical formulations are presented in Remington's Pharmaceutical Sciences, 16^th Ed. (1980) and 20^th Ed. (2000), Mack Publishing Company, Easton, Pa.

[0187]Kits for use by medical practitioners include an IGF-1 receptor-inhibiting substance of the invention and a label or other instructions for use in treating any of the conditions discussed herein. In one embodiment, the kit includes a sterile preparation of one or more inhibitors of IGF-1R signaling, which may be in the form of a composition as disclosed above, and may be in one or more vials.

[0188]Dosages and the frequency of administration may vary according to such factors as the route of administration, the particular antigen binding proteins employed, the nature and severity of the disease to be treated, whether the condition is acute or chronic, and the size and general condition of the subject. Appropriate dosages can be determined by procedures known in the pertinent art, e.g. in clinical trials that may involve dose escalation studies. "Intermittent dosing" refers to methods of administering to a subject a therapeutic compound (for example, an inhibitor of IGF-1R signaling) in multiple doses, wherein there is an interval of time between administration of a particular dose and any subsequent dose. Any schedule of dosing can be used so long as it is therapeutically effective or otherwise medically justified. The interval between consecutive doses can be very short, on the order of seconds or minutes, or longer, on the order of hours, days, weeks, months, or even years. The interval can be the same between every dose, for example, one dose per week or month, or it can vary from dose to dose. Likewise, the amount of the therapeutically active compound (e.g., an inhibitor of IGF-1R signaling or chemotherapeutic agent) can vary from dose to dose. In one embodiment, the period between consecutive doses and the amount of a therapeutically active substance in each dose are selected to keep a pharmacodynamic or pharmacokinetic parameter of interest (for example, serum concentration of said substance or percent reduction in IGF-1R signaling activity) within a desired range. In another embodiment, the interval between doses and the amount of therapeutically active substance vary according to other criteria (for example, subject's objective or subjective response to the course of treatment).

[0189]In other embodiments, the IGF-1R signal inhibiting substance of the invention is administered over a period of at least a month or more, e.g., for one, two, or three months, six months, a year, for several years, or even indefinitely. For treating chronic conditions, long-term treatment is generally most effective. However, for treating acute conditions, administration for shorter periods, e.g. from one to six weeks, may be sufficient. In general, the IGF-1R signal inhibiting substance of the invention is administered until the patient manifests a medically relevant or desirable degree of improvement over baseline for the chosen indicator or indicators.

[0190]Particular embodiments of the present invention involve administering an IGF-1R inhibiting substance at a dosage of from about 1 ng of antigen binding protein per kg of subject's mass per dose ("1 ng/kg/dose") to about 50 mg/kg/dose, more preferably from about 1 mg/kg/dose to about 30 mg/kg/dose, and most preferably from about 10 mg/kg/dose to about 20 mg/kg/dose, to a subject. In additional embodiments, the IGF-1R inhibiting substance is administered to adults one time per month, once every two weeks, once per week, two times per week, or three or more times per week, to treat an IGF-1 and/or IGF-2 mediated disease, condition or disorder, e.g., a medical disorder disclosed herein. If injected, the effective amount of IGF-1R inhibiting substance per adult dose may range from 1-20 mg/m², and preferably is about 5-12 mg/m². Alternatively, a flat dose may be administered; the amount may range from 5-100 mg/dose. One range for a flat dose is about 20-30 mg per dose. In one embodiment of the invention, a flat dose of 25 mg/dose is repeatedly administered by injection. If a route of administration other than injection is used, the dose is appropriately adjusted in accordance with standard medical practices. One example of a therapeutic regimen involves injecting a dose of about 20-30 mg of IGF-1R inhibiting substance from one to three times per week over a period of at least three weeks, though treatment for longer periods may be necessary to induce the desired degree of improvement. For pediatric subjects (age 4-17), one exemplary suitable regimen involves the subcutaneous injection of 0.4 mg/kg, up to a maximum dose of 25 mg of IGF-1R inhibiting substance administered two or three times per week.

[0191]Particular embodiments of the methods provided herein involve subcutaneous injection of from 0.5 mg to 500 mg, preferably from 50 to 300 mg, of an antigen binding protein, once or twice per week. Another embodiment is directed to pulmonary administration (e.g., by nebulizer) of 3 or more mg of IGF-1R inhibiting substance.

[0192]Other examples of therapeutic regimens provided herein comprise subcutaneous or intravenous administration of a dose of 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, 300, 400, or 500 milligrams of an IGF-1R inhibitor of the present invention per kilogram body mass of the subject (mg/kg). The dose can be administered once to the subject, or more than once at a certain interval, for example, once a day, three times a week, twice a week, once a week, three times a month, twice a month, once a month, once every two months, once every three months, once every six months, or once a year. The duration of the treatment, and any changes to the dose and/or frequency of treatment, can be altered or varied during the course of treatment in order to meet the particular needs of the subject.

[0193]In another embodiment, an antigen binding protein is administered to the subject in an amount and for a time sufficient to induce an improvement, preferably a sustained improvement, in at least one indicator that reflects the severity of the disorder that is being treated. Various indicators that reflect the extent of the subject's illness, disease or condition may be assessed for determining whether the amount and time of the treatment is sufficient. Such indicators include, for example, clinically recognized indicators of disease severity, symptoms, or manifestations of the disorder in question. In one embodiment, an improvement is considered to be sustained if the subject exhibits the improvement on at least two occasions separated by two to four weeks. The degree of improvement generally is determined by a physician, who may make this determination based on signs, symptoms, biopsies, or other test results, and who may also employ questionnaires that are administered to the subject, such as quality-of-life questionnaires developed for a given disease. An improvement in a subject's condition can be one that is, for example, detected, measured, or quantified by a physician or other health care provider using any appropriate technique. Such techniques include, but are not limited to, observing the subject, testing the subject or a sample taken from the subject, and collecting from the subject, directly or indirectly, the subject's impressions of the subject's condition. Such impressions can relate to any aspect of the subject's health or well-being, particularly those aspects that are affected directly or indirectly by subject's tumor disease. Examples of such aspects include, but are not limited to, pain, discomfort, sleep, appetite, thirst, mobility, strength, flexibility, and mental state.

[0194]Elevated levels of IGF-1 and/or IGF-2 are associated with a number of disorders, including, for example, cancer (e.g., lung, prostate, breast and colon cancers), and acromegaly and other overgrowth disorders (e.g., constitutionally tall children). Subjects with a given disorder may be screened, to identify those individuals who have elevated IGF-1 and/or IGF-2 levels, thereby identifying the subjects who may benefit most from treatment with an IGF-1R signaling inhibitor. Thus, treatment methods provided herein optionally comprise a first step of measuring a subject's IGF-1 and/or IGF-2 levels. An antigen binding protein may be administered to a subject in whom IGF-1 and/or IGF-2 levels are elevated above a normal or a desirable level.

[0195]A subject's levels of IGF-1 and/or IGF-2 may be monitored before, during and/or after treatment with an antigen binding protein, to detect changes, if any, in their levels. For some disorders, the incidence of elevated IGF-1 and/or IGF-2 levels may vary according to such factors as the stage of the disease or the particular form of the disease. Known techniques may be employed for measuring IGF-1 and/or IGF-2 levels, e.g., in a subject's serum. IGF-1 and/or IGF-2 levels in blood samples may be measured using any suitable technique, for example, ELISA.

[0196]Particular embodiments of methods and compositions of the invention involve the use of an antigen binding protein and one or more additional IGF-1R antagonists, for example, two or more antigen binding proteins of the invention, or an antigen binding protein of the invention and one or more other IGF-1R antagonists. In further embodiments, antigen binding protein are administered alone or in combination with other agents useful for treating the condition with which the patient is afflicted. Examples of such agents include both proteinaceous and non-proteinaceous drugs. When multiple therapeutics are co-administered, dosages may be adjusted accordingly, as is recognized in the pertinent art. "Co-administration" and combination therapy are not limited to simultaneous administration, but also include treatment regimens in which an antigen binding protein is administered at least once during a course of treatment that involves administering at least one other therapeutic agent to the patient.

[0197]Examples of other agents that may be co-administered with an antigen binding protein are other antigen binding proteins or therapeutic polypeptides that are chosen according to the particular condition to be treated. Alternatively, non-proteinaceous drugs that are useful in treating one of the particular conditions discussed above may be co-administered with an IGF-1R antagonist.

[0198]Combination Therapy

[0199]In another aspect, the present invention provides a method of treating a subject with an IGF-1R inhibiting antigen binding protein and one or more other treatments. In one embodiment, such a combination therapy achieves synergy or an additive effect by, for example, attacking multiple sites or molecular targets in a tumor. Types of combination therapies that can be used in connection with the present invention include inhibiting or activating (as appropriate) multiple nodes in a single disease-related pathway, multiple pathways in a target cell, and multiple cell types within a target tissue (e.g., within a tumor). For example, an IGF-1R inhibitor of the present invention can be combined with a treatment that inhibits IGF-1, promotes apoptosis, inhibits angiogenesis, or inhibits macrophage. In another embodiment, a targeted agent, that, when used by itself, fails to elicit a therapeutically desired effect, could be used to, for example, sensitize cancer cells or augment treatment effect of other agents. In another embodiment, an IGF-1R inhibitor according to the invention is used in combination with a cytotoxic drug or other targeted agent that induces apoptosis. In another embodiment, an IGF-1R inhibitor is used in combination with one or more agents that inhibit different targets that are involved in cell survival (e.g., PKB, mTOR), different receptor tyrosine kinases (e.g., ErbB1, ErbB2, c-Met, c-kit), or different cell types (e.g., KDR inhibitors, c-fms). In another embodiment, an IGF-1R inhibitor of the invention is added to the existing standard of care for a particular condition. Examples of therapeutic agents include, but are not limited to, gemcitabine, taxol, taxotere, and CPT-11.

[0200]In another embodiment, a combination therapy method comprises administering to the subject two, three, four, five, six, or more of the IGF-1R agonists or antagonists described herein. In another embodiment, the method comprises administering to the subject two or more treatments that together inhibit or activate (directly or indirectly) IGF-1R-mediated signal transduction. Examples of such methods include using combinations of two or more IGF-1R inhibiting antigen binding progeins, of an IGF-1R inhibiting antigen binding protein and one or more other IGF-1, IGF-2, and/or IGF-1R agonists or antagonists (e.g., IGF-1 and/or IGF-2 binding polypeptides, IGF-1R binding polypeptides, IGF-1 and/or IGF-2 derivatives, anti-IGF-1 and/or IGF-2 antibodies, anti-sense nucleic acids against IGF-1, IGF-2, and/or IGF-1R, or other molecules that bind to IGF-1, IGF-2, and/or IGF-1R polypeptides or nucleic acids), or of an IGF-1R inhibiting antigen binding protein and one or more other treatments (e.g., surgery, ultrasound, radiotherapy, chemotherapy, or treatment with another anti-cancer agent), as described, for example, in U.S. Pat. No. 5,473,054 (issued Dec. 5, 1995), U.S. Pat. No. 6,051,593 (issued Apr. 18, 2000), U.S. Pat. No. 6,084,085 (issued Jul. 4, 2000), U.S. Pat. No. 6,506,763 (issued Jan. 14, 2003), US Pat. App. Pub. No.s 03/0092631 (published May 15, 2003), 03/0165502 (published Sep. 4, 2003), 03/0235582 (published Dec. 25, 2003), 04/0886503 (published May 6, 2004), 05/0272637 (published Dec. 8, 2005), PCT Pub. Ser. No.s WO 99/60023 (published Nov. 25, 1999), WO 02/053596 (published Jul. 11, 2002), WO 02/072780 (published Sep. 19, 2002), WO 03/027246 (published Mar. 3, 2003), WO 03/020698 (published Mar. 13, 2003), WO 03/059951 (published Jul. 24, 2003), WO 03/100008 (published Dec. 4, 2003), WO 03/106621 (published Dec. 24, 2003), WO 04/071529 (published Aug. 26, 2004), WO 04/083248 (published Sep. 30, 2004), WO 04/087756 (published Oct. 14, 2004), WO 05/112969 (published Dec. 1, 2005), Kull et al., 1983, J Biol Chem 258:6561-66, Flier et al., 1986, Proc Natl Acad Sci USA 83:664-668, Conover et al., 1987, J Cell Physiol 133:560-66, Rohlik et al., 1987, Biochem Biophys Res Comm 149:276-81, Arteaga et al., 1989, J Clinical Investigation 84:1418-23, Arteaga et al., 1989, Cancer Res 49:6237-41, Gansler et al., 1989, American J Pathol 135:961-66, Gustafson et al., 1990, J Biol Chem 265:18663-67, Steele-Perkins et al., 1990, Biochem Biophys Res Comm 171:1244-51, Cullen et al., 1992, Mol Endocrinol 6:91-100, Soos et al., 1992, J Biol Chem 267:12955-63, Xiong et al., 1992, Proc Natl Acad Sci USA 89:5356-60, Brunner et al., 1993, Euro J Cancer 29A:562-69, Furlanetto et al., 1993, Cancer Res 53:2522-26, Li et al., 1993, Biochem Biophys Res Comm 196:92-98, Kalebic et al., 1994, Cancer Res 54:5531-34, Lahm et al., 1994, Intl J Cancer 58:452-59, Zia et al., 1996, J Cell Biochem Supp 24:269-75, Jansson et al., 1997, J Biol Chem 272:8189-97, Scotlandi et al., 1998, Cancer Res 58:4127-31, Logie et al., 1999, Li et al., 2000, Cancer Immunol Immunotherapy 49:243-52, J Mol Endocrinol 23:23-32, De Meyts et al., 2002, Nature Reviews 1:769-83, Hailey et al., 2002, Mol Cancer Therapeutics 1:1349-53, Maloney et al., 2003, Cancer Research 63:5073-83, Burtrum et al., 2003, Cancer Research 63:8912-21, and Karavitaki et al., 2004, Hormones 3:27-36, (each incorporated herein by reference in its entirety) may be employed in methods and compositions of the present invention. Furthermore, one or more anti-IGF-1R antibodies or antibody derivatives can be used in combination with one or more molecules or other treatments, wherein the other molecule(s) and/or treatment(s) do not directly bind to or affect IGF-1R, IGF-1, or IGF-2, but which combination is effective for treating or preventing a condition, such as cancer or an overgrowth disorder (e.g., acromegaly). In one embodiment, one or more of the molecule(s) and/or treatment(s) treats or prevents a condition that is caused by one or more of the other molecule(s) or treatment(s) in the course of therapy, e.g., nausea, fatigue, alopecia, cachexia, insomnia, etc. In every case where a combination of molecules and/or other treatments is used, the individual molecule(s) and/or treatment(s) can be administered in any order, over any length of time, which is effective, e.g., simultaneously, consecutively, or alternately. In one embodiment, the method of treatment comprises completing a first course of treatment with one molecule or other treatment before beginning a second course of treatment. The length of time between the end of the first course of treatment and beginning of the second course of treatment can be any length of time that allows the total course of therapy to be effective, e.g., seconds, minutes, hours, days, weeks, months, or even years.

[0201]In another embodiment, the method comprises administering one or more of the IGF-1R antagonists described herein and one or more other treatments (e.g., a therapeutic or palliative treatment), for example, anti-cancer treatments (such as surgery, ultrasound, radiotherapy, chemotherapy, or treatment with another anti-cancer agent). Where a method comprises administering more than one treatment to a subject, it is to be understood that the order, timing, number, concentration, and volume of the administrations is limited only by the medical requirements and limitations of the treatment, i.e., two treatments can be administered to the subject, e.g., simultaneously, consecutively, alternately, or according to any other regimen. Examples of agents that can be administered in combination with the IGF-1R antagonists described herein include, but are not limited to, neutrophil-boosting agents, irinothecan, SN-38, gemcitabine, herstatin, or an IGF-1R-binding herstatin derivative (as described, for example, in US Pat. App. No. 05/0272637), AVASTIN® (Genentech, South San Francisco, Calif.), HERCEPTIN® (Genentech), RITUXAN® (Genentech), ARIMIDEX® (AstraZeneca, Wilmington, Del.), IRESSA® (AstraZeneca), BEXXAR® (Corixa, Seattle, Wash.), ZEVALIN® (Biogen Idec, Cambridge, Mass.), ERBITUX® (Imclone Systems Inc., New York, N.Y.), GEMZAR® (Eli Lilly and Co., Indianapolis, Ind.), CAMPTOSAR® (Pfizer, New York, N.Y.), GLEEVEC® (Novartis), SU-11248 (Pfizer), BMS-354825 (Bristol-Myers Squibb), VECTIBIX® (Abgenix, Fremont, Calif./Amgen Inc., Thousand Oaks, Calif.), and denosumab (Amgen Inc., Thousand Oaks, Calif.).

[0202]In another embodiment, the present invention provides a combination therapy for treating a tumor disease comprising administering to a subject an inhibitor of IGF-1 receptor signaling before, during, or after treatment of the subject with an inhibitor of RAS signaling, e.g., an inhibitor of KRAS, NRAS, or HRAS. Any inhibitor of RAS activity can be used. Examples of types of RAS inhibitors include antisense oligonucleotides, RNA interference, inhibition of RAS post-translational modification or processing (e.g., farnesyltransferase inhibitors (FTIs), such as CAAX peptidomimetics like FTI-276 and FTI-277, and non-peptidomimetics like tipifarnib (R115777), lonafarnib (SCH663366), and BMS-214662)), geranylgeranyltransferase inhibitors (GGTIs), combination FTI/GGTIs, inhibitors of RAS proteolytic cleavage, methylation, or palmitoylation, immunological approaches (e.g., vaccination against an activated RAS mutant), mutant RAS peptide inhibitors, and inhibitors of downstream RAS effectors such as Raf kinase (e.g., BAY 43-9006), MEK (e.g., CI-1040, PD0325901, and ARRY-142886), and mTOR (e.g., rapamycin, CCI-779, RAD001, and AP23573). See Friday et al., 2005, Biochim Biophys Acta 1756:127-44, incorporated herein by reference in its entirety for all purposes.

[0203]The following examples, both actual and prophetic, are provided for the purpose of illustrating specific embodiments or features of the instant invention and do not limit its scope.

EXAMPLE 1

Preparation of Antibodies

[0204]This example demonstrates a method of preparing antibodies recognizing the IGF-1 receptor.

[0205]IGF-1 receptor polypeptides may be employed as immunogens in generating monoclonal antibodies by conventional techniques. It is recognized that polypeptides in various forms may be employed as immunogens, e.g., full length proteins, fragments thereof, fusion proteins thereof such as Fc fusions, cells expressing the recombinant protein on the cell surface, etc.

[0206]To summarize an example of such a procedure, an IGF-1R immunogen emulsified in complete Freund's adjuvant is injected subcutaneously into Lewis rats, in amounts ranging from 10-100 μl. Three weeks later, the immunized animals are boosted with additional immunogen emulsified in incomplete Freund's adjuvant and boosted every three weeks thereafter. Serum samples are periodically taken by retro-orbital bleeding or tail-tip excision for testing by dot-blot assay, ELISA (enzyme-linked immunosorbent assay), or inhibition of binding of ¹²⁵I-IGF-1 or ¹²⁵I-IGF-2 to extracts of IGF-1R-expressing cells. Following detection of an appropriate antibody titer, positive animals are given a final intravenous injection of antigen in saline. Three to four days later, the animals are sacrificed, splenocytes harvested, and fused to the murine myeloma cell line AG8653. The resulting hybridoma cell lines are plated in multiple microtiter plates in a HAT selective medium (hypoxanthine, aminopterin, and thymidine) to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.

[0207]Hybridoma clones thus generated are screened for reactivity with IGF-1R. Initial screening of hybridoma supernatants utilizes an antibody capture and binding of partially purified ¹²⁵I-IGF-1 receptor. Hybridomas that are positive in this screening method are tested by a modified antibody capture to detect hybridoma cells lines that are producing blocking antibody. Hybridomas that secrete a monoclonal antibody capable of inhibiting ¹²⁵I-IGF-1 binding to cells expressing IGF-1R are thus detected. Such hydridomas then are injected into the peritoneal cavities of nude mice to produce ascites containing high concentrations (>1 mg/ml) of anti-IGF-1R monoclonal antibody. The resulting monoclonal antibodies may be purified by ammonium sulfate precipitation followed by gel exclusion chromatography, and/or affinity chromatography based on binding of antibody to Protein G.

[0208]Similar methods can be used to generate human antibodies in transgenic mice. See, e.g., Chen et al., 1993, Internat. Immunol. 5: 647-56; Chen et al., 1993, EMBO J. 12: 821-30; Choi et al., 1993, Nature Genetics 4: 117-23; Fishwild et al., 1996, Nature Biotech. 14: 845-51; Harding et al., 1995, Annals New York Acad. Sci.; Lonberg et al., 1994, Nature 368: 856-59; Lonberg, 1994, Handbook Exper.l Pharmacol. 113: 49-101; Lonberg et al., 1995, Internal Rev. Immunol. 13: 65-93; Morrison, 1994, Nature 368: 812-13; Neuberger, 1996, Nature Biotech. 14: 826; Taylor et al., 1992, Nuc. Acids Res. 20: 6287-95; Taylor et al., 1994, Internat. Immunol. 6: 579-91; Tomizuka et al., 1997, Nature Genetics 16: 133-43; Tomizuka et al., 2000, Proc. Nat. Acad. Sci. USA 97: 722-27; Tuaillon et al., 1993, Proc. Nat. Acad. Sci. USA 90: 3720-24; Tuaillon et al., 1994, J. Immunol. 152: 2912-20; Russel et al., 2000, Infection and Immunity April 2000: 1820-26; Gallo et al., 2000, Eur. J. Immunol. 30: 534-40; Davis et al., 1999, Cancer Metastasis Rev. 18:421-25; Green, 1999, J. Immunol. Methods 231:11-23; Jakobovits, 1998, Advanced Drug Delivery Rev. 31:33-42; Green et al., 1998, J. Exp. Med. 188: 483-95; Jakobovits, 1998, Exp. Opin. Invest. Drugs 7: 607-14; Tsuda et al., 1997, Genomics 42: 413-21; Mendez et al., 1997, Nature Genetics 15: 146-56; Jakobovits, 1996, Weir's Handbook of Experimental Immunology, The Integrated Immune System Vol. IV, 194.1-194.7; Mendez et al., 1995, Genomics 26: 294-307; Jakobovits, 1994, Current Biol. 4: 761-63; Arbones, 1994, Immunity 1: 247-60; Green et al., 1994, Nature Genetics 7: 13-21; Jakobovits et al., 1993, Nature 362: 255-58; Jakobovits et al., 1993, Proc. Nat. Acad. Sci. USA 90: 2551-55.

EXAMPLE 2

Isolation of Human IGF-1R(ECD)-C3-muIgG1

[0209]This example provides a method of making a soluble fragment of IGF-1R useful for raising antibodies.

Cloning of pDSRα:huIGF-1R(ECD)-C3-muIgG1Fc

TABLE-US-00001 Primers 2830-36: SEQ ID NO: 256) 5' AGCAAGCTTCCACCATGAAGTCTGGCTCCGGAGGAGG 3' and 2830-38: SEQ ID NO: 257) 5' ATTTGTCGACTTCGTCCAGATGGATGAAGTTTTCAT 3',

were used to amplify the human IGF-1R extracellular domain (1-906) cDNA sequence. The primers included a Kozak translation initiation sequence (underlined above) preceding the start codon, restriction sites for subsequent subcloning, and a caspace-3 site, which is inserted next to the extracellular domain C-terminus. PCR was performed on a PerkinElmer 2400 (PerkinElmer, Torrance, Calif.) under the following conditions: 1 cycle at 95° C. for 2 min, 23 cycles at 95° C. for 30 sec, 58.5° C. for 30 sec, and 72° C. for 3 min, and 1 cycle at 72° C. for 10 min. Final reaction conditions were 1×pfu TURBO® buffer (Stratagene, La Jolla, Calif.), 200 μM dNTPs, 2 μM each primer, 5 U pfu TURBO® (Stratagene) and 1 ng template DNA. The PCR product was purified using a Clontech Nucleospin Column (Clontech, Palo Alto, Calif.) according to the manufacturers instructions, digested with Hind III and Sal I (Roche, Indianapolis, Ind.) and gel purified. The human IGF-1R insert was ligated into HindIII/Sal I digested pDSRα-muIgG1. Integrity of the insert was confirmed by DNA sequencing. The sequence of the protein encoded by the resulting open reading frame (IGF-1R-C3-muFc) is shown in FIG. 10. The final expression vector, pDSRα:huIGF1R(ECD)-C3-muIgG1Fc, is described in Table 1.

TABLE-US-00002 TABLE 1 pDSRα: huIGF1R(ECD)-C3-muIgG1Fc Plasmid Base Pair Number: 11-3496 HuIGF1R (Caspase 3 site)-muIgG1Fc atgaagtctggctccggaggagggtccccgacctcgctgtgggggctcctgtttctctccgccgcgct ctcgctctggccgacgagtggagaaatctgcgggccaggcatcgacatccgcaacgactatcagca gctgaagcgcctggagaactgcacggtgatcgagggctacctccacatcctgctcatctccaaggcc gaggactaccgcagctaccgcttccccaagctcacggtcattaccgagtacttgctgctgttccgagtg gctggcctcgagagcctcggagacctcttccccaacctcacggtcatccgcggctggaaactcttcta caactacgccctggtcatcttcgagatgaccaatctcaaggatattgggctttacaacctgaggaacatt actcggggggccatcaggattgagaaaaatgctgacctctgttacctctccactgtggactggtccctg atcctggatgcggtgtccaataactacattgtggggaataagcccccaaaggaatgtggggacctgtgt ccagggaccatggaggagaagccgatgtgtgagaagaccaccatcaacaatgagtacaactaccgc tgctggaccacaaaccgctgccagaaaatgtgcccaagcacgtgtgggaagcgggcgtgcaccga gaacaatgagtgctgccaccccgagtgcctgggcagctgcagcgcgcctgacaacgacacggcctg tgtagcttgccgccactactactatgccggtgtctgtgtgcctgcctgcccgcccaacacctacaggttt gagggctggcgctgtgtggaccgtgacttctgcgccaacatcctcagcgccgagagcagcgactcc gaggggtttgtgatccacgacggcgagtgcatgcaggagtgcccctcgggcttcatccgcaacggca gccagagcatgtactgcatcccttgtgaaggtccttgcccgaaggtctgtgaggaagaaaagaaaaca aagaccattgattctgttacttctgctcagatgctccaaggatgcaccatcttcaagggcaatttgctcatt aacatccgacgggggaataacattgcttcagagctggagaacttcatggggctcatcgaggtggtgac gggctacgtgaagatccgccattctcatgccttggtctccttgtccttcctaaaaaaccttcgcctcatcct aggagaggagcagctagaagggaattactccttctacgtcctcgacaaccagaacttgcagcaactgt gggactgggaccaccgcaacctgaccatcaaagcagggaaaatgtactttgctttcaatcccaaattat gtgtttccgaaatttaccgcatggaggaagtgacggggactaaagggcgccaaagcaaaggggaca taaacaccaggaacaacggggagagagcctcctgtgaaagtgacgtcctgcatttcacctccaccac cacgtcgaagaatcgcatcatcataacctggcaccggtaccggccccctgactacagggatctcatca gcttcaccgtttactacaaggaagcaccctttaagaatgtcacagagtatgatgggcaggatgcctgcg gctccaacagctggaacatggtggacgtggacctcccgcccaacaaggacgtggagcccggcatct tactacatgggctgaagccctggactcagtacgccgtttacgtcaaggctgtgaccctcaccatggtgg agaacgaccatatccgtggggccaagagtgagatcttgtacattcgcaccaatgcttcagttccttccat tcccttggacgttctttcagcatcgaactcctcttctcagttaatcgtgaagtggaaccctccctctctgcc caacggcaacctgagttactacattgtgcgctggcagcggcagcctcaggacggctacctttaccggc acaattactgctccaaagacaaaatccccatcaggaagtatgccgacggcaccatcgacattgaggag gtcacagagaaccccaagactgaggtgtgtggtggggagaaagggccttgctgcgcctgccccaaa actgaagccgagaagcaggccgagaaggaggaggctgaataccgcaaagtctttgagaatttcctgc acaactccatcttcgtgcccagacctgaaaggaagcggagagatgtcatgcaagtggccaacaccac catgtccagccgaagcaggaacaccacggccgcagacacctacaacatcactgacccggaagagct ggagacagagtaccctttctttgagagcagagtggataacaaggagagaactgtcatttctaaccttcg gcctttcacattgtaccgcatcgatatccacagctgcaaccacgaggctgagaagctgggctgcagcg cctccaacttcgtctttgcaaggactatgcccgcagaaggagcagatgacattcctgggccagtgacct gggagccaaggcctgaaaactccatctttttaaagtggccggaacctgagaatcccaatggattgattc taatgtatgaaataaaatacggatcacaagttgaggatcagcgagaatgtgtgtccagacaggaataca ggaagtatggaggggccaagctaaaccggctaaacccggggaactacacagcccggattcaggcc acatctctctctgggaatgggtcgtggacagatcctgtgttcttctatgtccaggccaaaacaggatatg aaaacttcatccatctggacgaagtcgacggttgtaagccttgcatatgtacagtcccagaagtatcatct gtcttcatcttccccccaaagcccaaggatgtgctcaccattactctgactcctaaggtcacgtgtgttgt ggtagacatcagcaaggatgatcccgaggtccagttcagctggtttgtagatgatgtggaggtgcaca cagctcagacgcaaccccgggaggagcagttcaacagcactttccgctcagtcagtgaacttcccatc atgcaccaggactggctcaatggcaaggagttcaaatgcagggtaaacagtgcagctttccctgcccc catcgagaaaaccatctccaaaaccaaaggcagaccgaaggctccacaggtgtacaccattccacct cccaaggagcagatggccaaggataaagtcagtctgacctgcatgataacagacttcttccctgaaga cattactgtggagtggcagtggaatgggcagccagcggagaactacaagaacactcagcccatcatg gacacagatggctcttacttcgtctacagcaagctcaatgtgcagaagagcaactgggaggcaggaa atactttcacctgctctgtgttacatgagggcctgcacaaccaccatactgagaagagcctctcccactc tcctggtaaa (SEQ ID NO: 258) 3507 to 4391 A transcription termination/polyadenylation signal from the α-subunit of the bovine pituitary glycoprotein hormone (α-FSH) (Goodwin et al., 1983, Nucleic Acids Res. 11: 6873-82; Genbank Accession Number X00004) 4600 to 5163 A mouse dihydrofolate reductase (DHFR) minigene containing the endogenous mouse DHFR promoter, the cDNA coding sequences, and the DHFR transcription termination/polyadenylation signals (Gasser et al., 1982, Proc. Natl. Acad. Sci. U.S.A. 79: 6522-6; Nunberg et al., 1980, Cell 19: 355-64; Setzer et al., 1982, J. Biol. Chem. 257: 5143-7; McGrogan et al., 1985, J. Biol. Chem. 260: 2307-14) 6389 to 7246 pBR322 sequences containing the ampicillin resistance marker gene and the origin for replication of the plasmid in E. coli (Genbank Accession Number J01749) 7459 to 7802 An SV40 early promoter, enhancer and origin of replication (Takebe et al., 1988, Mol. Cell Biol. 8: 466-72, Genbank Accession Number J02400) 7809 to 8065 A translational enhancer element from the HTLV-1 LTR domain (Seiki et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 3618-22, Genbank Accession Number J02029) 8109 to 8205 An intron from the SV40 16S, 19S splice donor/acceptor signals (Okayama and Berg, 1983. Mol. Cell Biol. 3: 280-9, Genbank Accession Number J02400)

Expression of hu IGF-1R(ECD)-C3-muIgG1Fc

[0210]Fifteen micrograms of linearized expression vector pDSRα:huIGF1R(ECD)-C3-muIgG1Fc was transfected into AM-1/D CHOd-cells using LT1 lipofection reagent (PanVera Corp., Madison, Wis.), and cells cultured under conditions to allow expression and secretion of protein into the cell media. Twenty-four colonies were selected after 10-14 days on DHFR selection medium (Dulbecco's Modified Eagles Medium (Invitrogen) supplemented with 10% dialyzed fetal bovine serum, 1× penicillin-streptomycin (Invitrogen)) and expression levels evaluated by western blot. To perform this assay, 0.5 ml of serum free medium was added to a single well confluent cells cultured in a 24 well plate (Falcon). The conditioned medium was recovered after 48 hr. Samples for western blotting were run in 10% Tris-glycine gel (Novex), and blotted on 0.45 μm Nitrocellulose membrane (Invitrogen), using the Mini Trans-Blot cell (Biorad). The blotted membranes were incubated with rabbit anti-mouse IgG Fc antibody, conjugated with Horseradish Peroxidase (Pierce). The clone expressing the highest level of IGF-1R(ECD)-C3-muIgG1Fc was expanded in DHFR selection medium and 2×10⁷ cells were inoculated into 50 roller bottles each (Corning) in 250 ml of high-glucose DMEM (Invitrogen), 10% dialyzed FBS (Invitrogen), 1× glutamine (Invitrogen), 1× Non essential amino acids (Invitrogen), 1× sodium pyruvate (Invitrogen). Medium was gassed with 10% CO₂/balance air for 5 seconds before capping the roller bottle. Roller bottles were kept at 37° C. on roller racks spinning at 0.75 rpm.

[0211]When cells reached approximately 85-90% confluency (after approximately 5-6 days in culture), growth medium was discarded, cells washed with 100 ml PBS and 200 ml production medium was added (50% DMEM (Invitrogen)/50% F12 (Invitrogen), 1× glutamine (Invitrogen), 1× non-essential amino acids (Invitrogen), 1× sodium pyruvate (Invitrogen), 1.5% DMSO (Sigma)). The conditioned medium was harvested and replaced at one week intervals. The resulting 30 liters of conditioned medium were filtered through a 0.45 μm cellulose acetate filter (Corning, Acton, Mass.).

Purification of hu IGF-1R(ECD)-C3-muIgG1Fc

[0212]The resulting filtrate from the conditioned medium was concentrated 20-fold using a spiral-wound cartridge (molecular weight cut-off=10 kDa), then diluted 1:1 with 3 M KCl, 1 M glycine, pH 9.0 to bring the final salt concentration to 1.5 M KCl, 0.5 M glycine, pH 9.0. This sample was applied to a rProtein A-Sepharose column (Amersham Pharmacia Biotech, Uppsala, Sweden) which had been equilibrated in 1.5 M KCl, 0.5 M glycine, pH 9.0. The column was washed with 40 column volumes of the same buffer, then eluted with 20 column volumes of 0.1 M glycine-HCl, pH 2.8. Five-mL fractions were collected and immediately neutralized with 1 mL of 1 M Tris-HCl, pH 7.5. Fractions containing huIGF1R(ECD)-C3-mulgGFc were identified by SDS-PAGE, pooled, and dialyzed against phosphate-buffered saline. The yield was 2.4 mg/L of conditioned medium. The major protein species detected were the mature a and 3 chains and murine Fc, each of which appeared to be properly glycosylated based on their elevated and heterogeneous molecular weights. Unprocessed IGF-1R(ECD), as well as glycosylated but not proteolytically cleaved IGF-1R(CED), was also present in the preparation. The shift in bands to higher molecular weights under non-reducing conditions indicates that disulfide linkages joined the α and β chains. Amino-terminal sequencing of the final product indicated that 60% of the protein was correctly processed between the α- and β-chains of IGF-1R(ECD), while 40% remained unprocessed.

EXAMPLE 3

Isolation of Human INSR(ECD)-muIgG1

[0213]This example presents a method of cloning and expressing a soluble fragment of the human insulin receptor.

Cloning of pDSRα:huINSR(ECD)-muIgG1Fc

TABLE-US-00003 Primers 2830-40: SEQ ID NO: 259 5' AGCAAGCTTCCACCATGGGCACCGGGGGCCGG 3' (Hind III site underlined) and 2830-41: SEQ ID NO: 260 5' ATTTGTCGACTTTTGCAATATTTGACGGGACGTCTAA 3'

(Sal I site underlined) were used to amplify the human INSR extracellular domain (1-929) from and INSR parental plamid encoding the B form of the INSR splice variant (Ullrich et al., 1985, Nature 313:756-61; Ebina et al., 1985, Cell 40:747-58). The primers included a Kozak translation initiation sequence preceding the start codon and restriction sites for subsequent sub-cloning. PCR was performed on a PerkinElmer 2400 under the following conditions: 1 cycle at 95° C. for 2 min, 32 cycles at 95° C. for 30 sec, 58.5° C. for 30 sec, and 72° C. for 3 min, and 1 cycle at 72° C. for 10 min. Final reaction conditions were 1× pfu TURBO® buffer, 200 μM dNTPs, 2 μM each primer, 5 U pfu TURBO® (Stratagene) and 10 ng template DNA. The PCR product was purified using a NUCLEOSPIN® Column (BD Biosciences Clontech, Palo Alto, Calif.) according to the manufacturer's instructions, digested with Hind III and Sal I (Roche), and gel purified prior to ligation into Hind III/Sal I digested pDSRα-muIgG1. The integrity of the insert was confirmed by DNA sequencing. The protein sequence of the INSR-muFc is shown in FIG. 11. The final expression vector is described in Table 2.

TABLE-US-00004 TABLE 2 Plasmid Base Pair Number: 11-3550 HuINSR-muIgG1Fc atgggcaccgggggccggcggggggcggcggccgcgccgctgctggtggcggtggccgcgctg ctactgggcgccgcgggccacctgtaccccggagaggtgtgtcccggcatggatatccggaacaac ctcactaggttgcatgagctggagaattgctctgtcatcgaaggacacttgcagatactcttgatgttcaa aacgaggcccgaagatttccgagacctcagtttccccaaactcatcatgatcactgattacttgctgctct tccgggtctatgggctcgagagcctgaaggacctgttccccaacctcacggtcatccggggatcacga ctgttctttaactacgcgctggtcatcttcgagatggttcacctcaaggaactcggcctctacaacctgat gaacatcacccggggttctgtccgcatcgagaagaacaatgagctctgttacttggccactatcgactg gtcccgtatcctggattccgtggaggataatcacatcgtgttgaacaaagatgacaacgaggagtgtgg agacatctgtccgggtaccgcgaagggcaagaccaactgccccgccaccgtcatcaacgggcagttt gtcgaacgatgttggactcatagtcactgccagaaagtttgcccgaccatctgtaagtcacacggctgc accgccgaaggcctctgttgccacagcgagtgcctgggcaactgttctcagcccgacgaccccacca agtgcgtggcctgccgcaacttctacctggacggcaggtgtgtggagacctgcccgcccccgtacta ccacttccaggactggcgctgtgtgaacttcagcttctgccaggacctgcaccacaaatgcaagaactc gcggaggcagggctgccaccagtacgtcattcacaacaacaagtgcatccctgagtgtccctccggg tacacgatgaattccagcaacttgctgtgcaccccatgcctgggtccctgtcccaaggtgtgccacctc ctagaaggcgagaagaccatcgactcggtgacgtctgcccaggagctccgaggatgcaccgtcatc aacgggagtctgatcatcaacattcgaggaggcaacaatctggcagctgagctagaagccaacctcg gcctcattgaagaaatttcagggtatctaaaaatccgccgatcctacgctctggtgtcactttccttcttcc ggaagttacgtctgattcgaggagagaccttggaaattgggaactactccttctatgccttggacaacca gaacctaaggcagctctgggactggagcaaacacaacctcaccaccactcaggggaaactcttcttcc actataaccccaaactctgcttgtcagaaatccacaagatggaagaagtttcaggaaccaaggggcgc caggagagaaacgacattgccctgaagaccaatggggacaaggcatcctgtgaaaatgagttactta aattttcttacattcggacatcttttgacaagatcttgctgagatgggagccgtactggccccccgacttcc gagacctcttggggttcatgctgttctacaaagaggccccttatcagaatgtgacggagttcgatgggc aggatgcgtgtggttccaacagttggacggtggtagacattgacccacccctgaggtccaacgacccc aaatcacagaaccacccagggtggctgatgcggggtctcaagccctggacccagtatgccatctttgt gaagaccctggtcaccttttcggatgaacgccggacctatggggccaagagtgacatcatttatgtcca gacagatgccaccaacccctctgtgcccctggatccaatctcagtgtctaactcatcatcccagattattc tgaagtggaaaccaccctccgaccccaatggcaacatcacccactacctggttttctgggagaggcag gcggaagacagtgagctgttcgagctggattattgcctcaaagggctgaagctgccctcgaggacctg gtctccaccattcgagtctgaagattctcagaagcacaaccagagtgagtatgaggattcggccggcg aatgctgctcctgtccaaagacagactctcagatcctgaaggagctggaggagtcctcgtttaggaag acgtttgaggattacctgcacaacgtggttttcgtccccagaaaaacctcttcaggcactggtgccgag gaccctaggccatctcggaaacgcaggtcccttggcgatgttgggaatgtgacggtggccgtgccca cggtggcagctttccccaacacttcctcgaccagcgtgcccacgagtccggaggagcacaggcctttt gagaaggtggtgaacaaggagtcgctggtcatctccggcttgcgacacttcacgggctatcgcatcga gctgcaggcttgcaaccaggacacccctgaggaacggtgcagtgtggcagcctacgtcagtgcgag gaccatgcctgaagccaaggctgatgacattgttggccctgtgacgcatgaaatctttgagaacaacgt cgtccacttgatgtggcaggagccgaaggagcccaatggtctgatcgtgctgtatgaagtgagttatcg gcgatatggtgatgaggagctgcatctctgcgtctcccgcaagcacttcgctctggaacggggctgca ggctgcgtgggctgtcaccggggaactacagcgtgcgaatccgggccacctcccttgcgggcaacg gctcttggacggaacccacctatttctacgtgacagactatttagacgtcccgtcaaatattgcaaaagtc gacggttgtaagccttgcatatgtacagtcccagaagtatcatctgtcttcatcttccccccaaagcccaa ggatgtgctcaccattactctgactcctaaggtcacgtgtgttgtggtagacatcagcaaggatgatccc gaggtccagttcagctggtttgtagatgatgtggaggtgcacacagctcagacgcaaccccgggagg agcagttcaacagcactttccgctcagtcagtgaacttcccatcatgcaccaggactggctcaatggca aggagttcaaatgcagggtaaacagtgcagctttccctgcccccatcgagaaaaccatctccaaaacc aaaggcagaccgaaggctccacaggtgtacaccattccacctcccaaggagcagatggccaaggat aaagtcagtctgacctgcatgataacagacttcttccctgaagacattactgtggagtggcagtggaatg ggcagccagcggagaactacaagaacactcagcccatcatggacacagatggctcttacttcgtctac agcaagctcaatgtgcagaagagcaactgggaggcaggaaatactttcacctgctctgtgttacatga gggcctgcacaaccaccatactgagaagagcctctcccactctcctggtaaa (SEQ ID NO: 261) 3557 to 4441 A transcription termination/polyadenylation signal from the α-subunit of the bovine pituitary glycoprotein hormone (α-FSH) (Goodwin et al., 1983, Nucleic Acids Res. 11: 6873-82; Genbank Accession Number X00004) 4446 to 5586 A mouse dihydrofolate reductase (DHFR) minigene containing the endogenous mouse DHFR promoter, the cDNA coding sequences, and the DHFR transcription termination/polyadenylation signals (Gasser et al., 1982, Proc. Natl. Acad. Sci. U.S.A. 79: 6522-6; Nunberg et al., 1980, Cell 19: 355-64; Setzer et al., 1982, J. Biol. Chem. 257: 5143-7; McGrogan et al., 1985, J. Biol. Chem. 260: 2307-14) 5594 to 6241 pBR322 sequences containing the ampicillin resistance marker gene and the origin for replication of the plasmid in E. coli (Genbank Accession Number J01749) 7513 to 7856 An SV40 early promoter, enhancer and origin of replication (Takebe et al., 1988, Mol. Cell Biol. 8: 466-72, Genbank Accession Number J02400) 7863 to 8119 A translational enhancer element from the HTLV-1 LTR domain (Seiki et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 3618-22, Genbank Accession Number J02029) 8163 to 8259 An intron from the SV40 16S, 19S splice donor/acceptor signals (Okayama and Berg, 1983. Mol. Cell Biol. 3: 280-9, Genbank Accession Number J02400)

Expression of hu INSR(ECD)-C3-muIgG1Fc

[0214]AM-1/D CHOd-cells were transfected with 15 μm of linearized expression vector pDSRa:huINSR(ECD)--muIgG1Fc using FUGENE® 6 lipofection reagent (Roche Diagnostics Corp., Indianapolis, Ind.), then cultured under conditions to allow expression and secretion of protein into the cell medium. Colonies were selected and analyzed as described above.

Purification of hu INSR(ECD)-C3-muIgG1Fc

[0215]The filtered conditioned medium containing huINSR(ECD)-muIgGFc was concentrated 17-fold using a spiral-wound cartridge (molecular weight cut-off=10 kDa), then diluted 1:1 with 3 M KCl, 1 M glycine, pH 9.0 to bring the final salt concentration to 1.5 M KCl, 0.5 M glycine, pH 9.0. This sample was applied to a rProtein A-Sepharose column (Pharmacia) which had been equilibrated in 1.5 M KCl, 0.5 M glycine, pH 9.0. The column was washed with 40 column volumes of the same buffer, then eluted with 20 column volumes of 0.1 M glycine-HCl, pH 2.8. Five-mL fractions were collected and immediately neutralized with 1-mL of 1 M Tris-HCl, pH 7.5. Fractions containing huINSR(ECD)-mulgGFc were identified by SDS-PAGE, pooled, and dialyzed against phosphate-buffered saline. The yield was 0.9 mg/L of conditioned medium. The major protein species were the mature α and β chains and murine Fc. Each of these species appeared to be properly glycosylated based on its elevated and heterogeneous molecular weight. Unprocessed INSR (ECD) as well as glycosylated but not proteolytically cleaved INSR (CED) also was present in the preparation. The shift in bands to higher molecular weights under non-reducing conditions indicated that disulfide linkages joined the α and β chains. Amino-terminal sequencing of the final product indicated that 87% of the protein was correctly processed between the α- and β-chains of INSR(ECD), while 13% remained unprocessed.

EXAMPLE 3

Initial Screen for Anti-IGF-1R Phage Fab

[0216]This example provides a method of identifying Anti-IGF-1R antibodies.

[0217]A Target Quest Q Fab library ("the TQ library"; Target Quest, Maastricht, the Netherlands), which was constructed using peripheral blood lymphocytes from four healthy donors and splenic lymphocytes from one patient with gastric carcinoma, was obtained. The library diversity was 3.7×10¹⁰ clones, containing 3×10⁹ heavy chains. The source, screening methods, and characterization of the library have been published (de Haard et al, 1999, J Biol Chem 274:18218-30). Dynabeads (200 μl) M-450 Uncoated (catalog #140.02, Dynal, Lake Success, N.Y.) were washed 3 times with PBS, resuspended in 200 μl of IGF1R(ECD)-C3-mFc to a concentration of 0.5 μM in PBS, and incubated at 4° C. on a rotator overnight. The IGF-1R(ECD)-C3-mFc coated beads were washed 3× with 1 ml of 2% non-fat dry milk (M) in PBS (2% MPBS), and then blocked with 1 ml of 2% MPBS at room temperature for 1 hour. In parallel, 750 μl of the TQ library (4×10¹² pfu) was preblocked by mixing with 250 μl 8% MPBS at room temperature for 30 minutes to 1 hour. 500 μl of blocked beads were transferred into another microfuge tube and separated from the blocking solution on a magnetic separator. The preblocked phage mixture was added to the blocked beads and incubated for 90 minutes on a rotator at room temperature. Bead-bound phage were separated from the unbound phage, and then washed 6× with 1 ml 2% MPBS/0.1% Tween 20, 6× with 1 ml PBS/0.1% Tween 20, 2× with PBS with a change of tubes between different wash solutions. Bound phage was eluted with 1 ml of 0.1M TEA (pH11) for 10 minutes, then immediately separated from the beads and neutralized with 0.5 ml of 1 M Tris.HCl. The eluted phage pool was mixed with 4 ml 2×YT broth (10 g yeast extract, 16 g bacto-tryptone, 5 g NaCl per liter of water) and 5 ml of TG1 bacterial culture (O.D.₅₉₀ about 0.5) in a 50-ml conical tube. The infection mixture was incubate at 37° C. in an incubator for 30 min., then centrifuged at 3500 rpm for 20 min. The cell pellet was resuspended in 1500 μl 2× YT-CG broth and 300 μl were spread on each of five 2×YT-CG (2×YT broth containing 100 μg/ml carbenicillin and 2% glucose) plates. After 20 hours of incubation at 30° C., 4 ml of 2×YT-AG were added to each plate and the cells were recovered with cell scraper from the plates. This step was repeated three times. A small portion of the recovered cells was used for phage rescue (see below). The remaining cell suspension was centrifuged at 3500 rpm for 20 min. The cell pellet was suspended into an amount of 50% glycerol roughly half the volume of the pellet size and stored at -80° C.

[0218]In order to rescue phage, the plated-amplified cell suspension was used to inoculate 40 ml of 2×YT-CG to an OD₅₉₀ of about 0.05. The culture was incubated at 37° C. on a shaker to OD₅₉₀ 0.5. The log phase culture was infected with M13KO7 helper phage (GIBCO BRL, Gaithersburg, Md., catalog #18311-019, 1.1×10¹¹ pfu/ml) at M.O.I. 20 followed by incubation at 37° C. for 30 min. The infected cells were centrifuged at 4000 rpm for 20 min. The cell pellet was re-suspended in 200 ml of 2×YT-CK (100 μg/ml carbenicillin and 40 μg/ml kanamycin) and transferred to two 250-ml flasks and incubated at 30° C. with shaking at 270 rpm for 20 hours. The over-night culture was centrifuged at 4000 rpm for 20 min to removal cell debris. The centrifugation was repeated to ensure the removal of cell debris. About 1/5 volume of PEG solution (20% PEG 8000, 2.5 M NaCl) was added to the supernatant to precipitate the phage particles. The mixture was incubated on ice for at least 1 hour, followed by centrifugation at 4000 rpm for 20 min to collect the precipitated phage particles. The phage pellet was re-suspended into 1 ml of PBS and transferred to a microfuge tube. The phage suspension was left on ice for 1 hour to allow complete suspension of phage particles, and clarified by centrifugation at 14,000 rpm for 2 min to remove the residual cell debris. Phage precipitation step was repeated. The final phage pellet was suspended into PBS after clarification. The rescued phage suspension was used in the next round of selection.

[0219]Four rounds of selection were performed that included alterations of various standard binding parameters. The second round of selection was identical to the first round of selection. Variations in input phage number and elution reagent were introduced in rounds three and four. For the round three selection, 5×10¹¹ pfu of phages were selected and bound phages were eluted either with 1 μM IGF-1 (catalog #I3769, Sigma, St. Louis, Mo.) or with a 1 μM concentration of a chimeric αIR3-huFc antibody to yield two round-three pools, TQ4-3IS and TQ4-3CA. Round four selection was carried out on rescued phage pools from both round three pools. Two rounds of negative selection with mouse IgG Fc-coated DYNABEADS® (Dynal Biotech, Oslo, Norway) were included to remove mouse Fc binders prior to actual IGF-1R selection. The incubation time for negative selection was 30 minutes each. 3.78×10¹¹ pfu of TQ4-3IS pool and 3.75×10¹² pfu of TQ4-3CA pool were selected separately. Bound phage were eluted with 1 IGF-2 (catalog #I2526, Sigma, St. Louis, Mo.) to yield two round-4 pools, TQ4-4IS2 and TQ4-4CAI2. The sequence of about 96-192 phage DNA inserts was determined at each elution step.

[0220]In some cases, a secondary screen was done. Phagemid DNA mixtures of the total TQ library, and the selected phage amplified after several rounds of selection against IGF-1R, were prepared using a DNA Maxiprep kit according to the manufacturer's instructions (Qiagen, Valencia, Calif.). All four DNA preparations were digested with Asc I and EcoR I (New England Biolab, Beverly, Mass.). The resulting two Asc II EcoR I fragments were separated on preparative 0.5% agarose gels. The 2.1 kb fragments containing heavy chains were gel purified from the IGF-1R selected phage. The 3.9 kb fragments containing the light chains and pCES1 vector portion were gel purified from the total TQ library DNA. The 2.1 kb fragments were ligated to the 3.9 kb fragments from the DNA sample of TQ library in 3:1 ratio. The ligated DNA was precipitated and used to transform TG1 cells by electroporation. The library size of the resulted light chain shuffled secondary library was 8.8×10⁸. After sequencing 96 randomly picked clones, 76 unique light chain sequences were obtained, indicating that the attempt to shuffle light chains was successful.

[0221]The binding, washing and elution condition for screening the light chain shuffle library were essentially the same as described for the intial screen. However, several variations were included to increase selection pressure for amplification of IGF-1R binders with higher affinities, especially those with significantly slower off-rates. These parameters were: higher number of input phage (2-2.7×10¹³ pfu), smaller bead volume (100 μl for round one, 50 μl for round two, and 25 μl for round three), and extended specific elution time up to 20 hours. Elution buffers were 0.1 M TEA for round one (RD1), 1 μM IGF-1 in 0.4% MPBS for RD2 and 1 μM IGF-1 or IGF-2 in 0.4% MPBS for RD3. In RD2 and RD3, binders that were eluted in 15 min or 2 hours were discarded. Elution was continued and eluted phages were collected after 8-10 hours and again after 20 hours.

Phage Fab ELISA Screen

[0222]In 96-well 2-ml deep-well blocks, 480 μl/well 2×YT-CG broth was inoculated with 20 μl of overnight cultures of the individual clones, then incubated at 37° C., 300 rpm for 3 hours. To each well, 50 μl of 1:3 diluted M13KO7 helper phage were added to infect the cells. The block was incubated at 37° C. without shaking for 30 minutes, and then shaken gently for another 30 minutes at 150 rpm. The block was centrifuged at 3600 rpm for 20 minutes to pellet the infected cells. The cell pellet in each well was suspended into 480 μl of 2×YT-CK (2×YT broth containing 100 μg/ml carbenicillin and 40 μg/ml kanamycin), and incubated at 30° C. overnight for about 20 hours. The cell debris was separated by centrifugation at 3600 rpm for 20 minutes. The rescued phage supernatant was used in the phage ELISA to check for IGF-1R-specific, INSR-cross reactive, or mouse Fc binding of individual clones.

[0223]Three sets of Nunc MaxiSorb Immunoplates were coated with 100 μl/well of IGF-1R-C3-mFc at 5 μg/ml, INSR-mFc at 5 μg/ml, or mouse IgG1 (catalog # 010-0103, Rockland, Gilbertsville, Pa.) at 2 μg/ml in PBS, respectively, at 4° C. overnight. The coated plates were washed 3× with 300 μl/well of PBS. The washed plates were blocked with 300 μl/well 2% MPBS at room temperature for one hour. Meanwhile, rescued phages of individual clones were pre-blocked by mixing 170 μl of rescued phage with 170 μl of 4% MPBS. The blocked plates were washed 5× with 300 μl/well TBST (TBS: 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl; Tween-20. 0.1%). 100 μl/well of pre-blocked phage dilutions were distributed to each set of coated plate, which were incubated at room temperature on a rocker for 90 minutes. The plates were washed 5× with 300 μl/well TBST. 100 μl/well of anti-M13-HRP in 2% MPBS (1:3000 dilution, catalog number 27-9421-01, Amersham Pharmacia Biotech) were distributed, and plates were incubated at room temperature on rocker for one hour. The plates were washed 5× with 300 μl/well TBST. 100 μl/well of the substrate 1-Step® ABTS (Pierce Biotechnology, Rockford, Ill., catalog number 37615) were added. Plates were incubated for one hour. OD₄₀₅ was measured for signal detection.

[0224]The phage displayed antibodies exhibited essentially no crossreactivity with the insulin receptor and murine Fc domain. The signal observed in the IGF-1R ELISA is therefore specific for the IGF-1R extracellular domain. Results from similar assays for four of the phage-displayed antibodies are shown in FIG. 14.

[0225]The DNA inserts of IGF-1R positive, INSR and mu IgG1 negative, clones were sequenced. Fifty-two unique Fab sequences were identified, having the following combinations of light chain and heavy chain variable domain sequences: L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52, wherein "Lx" indicates light chain variable domain number "x" and "Hx" indicates heavy chain variable domain number "x." FIG. 1 presents the polynucleotide sequences of each of these light and heavy variable domains. FIGS. 2 and 3 present the corresponding amino acid sequences.

EXAMPLE 4

Subcloning of V_H and V_L into IgG1 Expression Vectors

[0226]This example presents a method of subcloning the previously identified variable domain sequences into an IgG1 expression vector.

Construction of pDSRα20 and pDSRα20:hIgG1C_H

[0227]The pDSRα20:hIgG1C_H expression vector (WO 90/14363) was a derivative of pDSR19:hIgG1C_H (see U.S. Provisional Patent Application No. 60/370,407, filed Apr. 5, 2002, "Human Anti-OPGL Neutralizing Antibodies As Selective OPGL Pathway Inhibitors," incorporated herein by reference in its entirety). The pDSRα19:hIgG1C_H plasmid encoded a rat variable region/human constant region IgG1 (rVh/hCh1). The plasmid was constructed by the three-piece ligation of Xba I and BsmB I terminated rat antibody variable region PCR product, the human IgG1 constant region (C_H1, hinge, C_H2 and C_H3 domains) derived by Sal I cleavage and gel isolation of the BsmB I and Sal I fragment from the linear plasmid pDSRα19:hIgG1 C_H (Hind III and BsmB I ends) and a linearized pDSRα19 with Xba I and Sal I ends. pDSRα20 was produced by changing nucleotide 2563 in pDSRα19 from a guanosine to an adenosine by site directed mutagenesis. The heavy chain expression vector, pDSRα20:hIgG1C_H rat variable region/human constant region IgG1 (rVh/hCh1), is 6163 base pairs and contains the 7 functional regions described in Table 3.

TABLE-US-00005 TABLE 3 Plasmid Base Pair Number: 2 to 881 A transcription termination/polyadenylation signal from the α-subunit of the bovine pituitary glycoprotein hormone (α-FSH) (Goodwin et al., 1983, Nucleic Acids Res. 11: 6873-82; Genbank Accession Number X00004) 882 to 2027 A mouse dihydrofolate reductase (DHFR) minigene containing the endogenous mouse DHFR promoter, the cDNA coding sequences, and the DHFR transcription termination/polyadenylation signals (Gasser et al., 1982, Proc. Natl. Acad Sci. U.S.A. 79: 6522-6; Nunberg et al., 1980 Cell 19: 355-64; Setzer et al., 1982, J. Biol. Chem. 257: 5143-7; McGrogan et al., 1985, J. Biol. Chem. 260: 2307-14) 2031 to 3947 pBR322 sequences containing the ampicillin resistance marker gene and the origin for replication of the plasmid in E. coli (Genbank Accession Number J01749) 3949 to 4292 An SV40 early promoter, enhancer and origin of replication (Takebe et al., 1988, Mol. Cell Biol. 8: 466-72, Genbank Accession Number J02400) 4299 to 4565 A translational enhancer element from the HTLV-1 LTR domain (Seiki et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 3618-22, Genbank Accession Number J02029) 4574 to 4730 An intron from the SV40 16S, 19S splice donor/acceptor signals (Okayama and Berg, 1983. Mol. Cell Biol. 3: 280-9, Genbank Accession Number J02400) 4755 to 6158 The rVh/hCh1 heavy chain cDNA between the Xbal and Sall sites. This heavy chain fragment sequence is shown below (SEQ ID NO: 262) with the sequences of the restriction sites underlined: XbaI TCTAG ACCACCATGG ACATCAGGCT CAGCTTAGTT TTCCTTGTCC TTTTCATAAA AGGTGTCCAG TGTGAGGTAG AACTGGTGGA GTCTGGGGGC GGCTTAGTAC AACCTGGAAG GTCCATGACA CTCTCCTGTG CAGCCTCGGG ATTCACTTTC AGAACCTATG GCATGGCCTG GGTCCGCCAG GCCCCAACGA AGGGTCTGGA GTGGGTCTCA TCAATTACTG CTAGTGGTGG TACCACCTAC TATCGAGACT CCGTGAAGGG CCGCTTCACT ATTTTTAGGG ATAATGCAAA AAGTACCCTA TACCTGCAGA TGGACAGTCC GAGGTCTGAG GACACGGCCA CTTATTTCTG TACATCAATT TCGGAATACT GGGGCCACGG AGTCATGGTC BsmB1 ACCGTCTCTA GTGCCTCCAC CAAGGGCCCA TCGGTCTTCC CCCTGGCACC CTCCTCCAAG AGCACCTCTG GGGGCACAGC GGCCCTGGGC TGCCTGGTCA AGGACTACTT CCCCGAACCG GTGACGGTGT CGTGGAACTC AGGCGCCCTG ACCAGCGGCG TGCACACCTT CCCGGCTGTC CTACAGTCCT CAGGACTCTA CTCCCTCAGC AGCGTGGTGA CCGTGCCCTC CAGCAGCTTG GGCACCCAGA CCTACATCTG CAACGTGAAT CACAAGCCCA GCAACACCAA GGTGGACAAG AAAGTTGAGC CCAAATCTTG TGACAAAACT CACACATGCC CACCGTGCCC AGCACCTGAA CTCCTGGGGG GACCGTCAGT CTTCCTCTTC CCCCCAAAAC CCAAGGACAC CCTCATGATC TCCCGGACCC CTGAGGTCAC ATGCGTGGTG GTGGACGTGA GCCACGAAGA CCCTGAGGTC AAGTTCAACT GGTACGTGGA CGGCGTGGAG GTGCATAATG CCAAGACAAA GCCGCGGGAG GAGCAGTACA ACAGCACGTA CCGTGTGGTC AGCGTCCTCA CCGTCCTGCA CCAGGACTGG CTGAATGGCA AGGAGTACAA GTGCAAGGTC TCCAACAAAG CCCTCCCAGC CCCCATCGAG AAAACCATCT CCAAAGCCAA AGGGCAGCCC CGAGAACCAC AGGTGTACAC CCTGCCCCCA TCCCGGGATG AGCTGACCAA GAACCAGGTC AGCCTGACCT GCCTGGTCAA AGGCTTCTAT CCCAGCGACA TCGCCGTGGA GTGGGAGAGC AATGGGCAGC CGGAGAACAA CTACAAGACC ACGCCTCCCG TGCTGGACTC CGACGGCTCC TTCTTCCTCT ATAGCAAGCT CACCGTGGAC AAGAGCAGGT GGCAGCAGGG GAACGTCTTC TCATGCTCCG TGATGCATGA GGCTCTGCAC AACCACTACA CGCAGAAGAG CCTCTCCCTG TCTCCGGGTA SalI AATGATAAGT CGAC

[0228]The linear plasmid pDSRα20:hIgG1C_H was prepared by digesting the pDSR20: rat variable region/human constant region IgG1 plasmid with the restriction enzymes Xba I and BsmB I to remove the rat variable region and purified using a QIAquick Gel Extraction kit. The linear plasmid pDSRα20:hIgG1C_H containing the 1.0 kbp human IgG1 constant region domain was used to accept anti-IGF-1R variable heavy chain coding sequences.

Construction of the anti-IGF-1R IgG1 Heavy Chain Expression Clones

[0229]The sequence coding for the anti-IGF-1R variable region of the heavy chains was amplified from phagemid DNA with complementary oligonucleotide primers. Primers for polymerase chain reaction (PCR) were designed to incorporate a Hind III site, Xba I site, Kozak sequence (CCACC) and signal sequence (translated peptide is MDMRVPAQLLGLLLLWLRGARC; SEQ ID NO:263) onto the 5' end of the variable region, while a BsmB I site was added onto the 3' end of the PCR product. The PCR products were digested with Xba I and BsmB I, and then cloned into the Xba I-BsmB I linear pDSRα20:hIgG1C_H expression vector containing the human IgG1 constant region (FIG. 13). The final expression vectors contained the seven functional regions described in Table 4.

TABLE-US-00006 TABLE 4 Plasmid Base Pair Number: 2 to 881 A transcription termination/polyadenylation signal from the α-subunit of the bovine pituitary glycoprotein hormone (α-FSH) (Goodwin et al., 1983, Nucleic Acids Res. 11: 6873-82; Genbank Accession Number X00004) 882 to 2027 A mouse dihydrofolate reductase (DHFR) minigene containing the endogenous mouse DHFR promoter, the cDNA coding sequences, and the DHFR transcription termination/polyadenylation signals (Gasser et al., 1982, Proc. Natl. Acad. Sci. U.S.A. 79: 6522-6; Nunberg et al., 1980, Cell 19: 355-64; Setzer et al., 1982, J. Biol. Chem. 257: 5143-7; McGrogan et al., 1985, J. Biol. Chem. 260: 2307-14) 2031 to 3947 pBR322 sequences containing the ampicillin resistance marker gene and the origin for replication of the plasmid in E. coli (Genbank Accession Number J01749) 3949 to 4292 An SV40 early promoter, enhancer and origin of replication (Takebe et al., 1988, Mol. Cell Biol. 8: 466-72, Genbank Accession Number J02400) 4299 to 4565 A translational enhancer element from the HTLV-1 LTR domain (Seiki et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 3618-22, Genbank Accession Number J02029) 4574 to 4730 An intron from the SV40 16S, 19S splice donor/acceptor signals (Okayama and Berg, 1983. Mol. Cell Biol. 3: 280-9, Genbank Accession Number J02400) 4755 to 6185 The heavy chain IgG1 cDNA between the Xbal and Sall sites

Construction of the anti-IGF-1R IgG1 Variable Chain Expression Clones.

[0230]The light chains encoded in anti-IGF-1R phage were either kappa or lambda class. They were cloned using one of two approaches. Complementary primers were designed to add a Hind III site, an Xba I site, Kozak sequence (CCACC) and signal sequence (translated peptide is MDMRVPAQLLGLLLLWLRGARC, SEQ ID NO:264) were added to the 5' end of the coding region. Those chains that had error-free coding regions were cloned as full-length products. The full-length light chains were cloned as Xba I and Sal I fragments into the expression vector pDSRα20. The final expression vectors contained the seven functional regions described in Table 5.

TABLE-US-00007 TABLE 5 Plasmid Base Pair Number: 2 to 881 A transcription termination/polyadenylation signal from the α-subunit of the bovine pituitary glycoprotein hormone (α-FSH) (Goodwin et al., 1983, Nucleic Acids Res. 11: 6873-82; Genbank Accession Number X00004) 882 to 2027 A mouse dihydrofolate reductase (DHFR) minigene containing the endogenous mouse DHFR promoter, the cDNA coding sequences, and the DHFR transcription termination/polyadenylation signals (Gasser et al, 1982, Proc. Natl. Acad. Sci. U.S.A. 79: 6522-6; Nunberg et al., 1980, Cell 19: 355-64; Setzer et al., 1982, J. Biol. Chem. 257: 5143-7; McGrogan et al., 1985, J. Biol. Chem. 260: 2307-14) 2031 to 3947 pBR322 sequences containing the ampicillin resistance marker gene and the origin for replication of the plasmid in E. coli (Genbank Accession Number J01749) 3949 to 4292 An SV40 early promoter, enhancer and origin of replication (Takebe et al., 1988, Mol. Cell Biol. 8: 466-72, Genbank Accession Number J02400) 4299 to 4565 A translational enhancer element from the HTLV-1 LTR domain (Seiki et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 3618-22, Genbank Accession Number J02029) 4574 to 4730 An intron from the SV40 16S, 19S splice donor/acceptor signals (Okayama and Berg, 1983, Mol. Cell Biol. 3: 280-9, Genbank Accession Number J02400) 4755 to 5485 The kappa light chain cDNA between the Xbal and Sall sites

[0231]Some kappa clones had errors in their constant regions when compared to natural human constant region sequence. To eliminate these discrepancies, the kappa variable region was amplified with a primer that would introduce an Xba I site into the 5' end and a BsmB I site into the 3' end. This fragment was then ligated along with a human kappa constant region (FIG. 13) with a compatible BsmB I on the 5' end and a 3' Sal I ends into pDSRα20 with Xba I and Sal I ends.

EXAMPLE 5

Transient Expression of Antibodies

[0232]This example provides a method of transiently expressing anti-IGF-1R antibodies.

[0233]The antibodies were expressed transiently in serum-free suspension adapted 293T cells. All transfections were performed as 250 mL cultures. Briefly, 1.25×10⁸ cells (5.0×10⁵ cells/mL×250 mL) were centrifuged at 2,500 RPM for 10 minutes at 4° C. to remove the conditioned medium. The cells were resuspended in serum-free DMEM and centrifuged again at 2,500 RPM for 10 minutes at 4° C. After aspirating the wash solution, the cells were resuspended in growth medium [DMEM/F12 (3:1)+1× Insulin-Transferrin-Selenium Supplement+1× Pen Strep Glut+2 mM L-Glutamine+20 mM HEPES+0.01% Pluronic F68] in a 500 mL spinner flask culture. The spinner flask culture was maintained on magnetic stir plate at 125 RPM which was placed in a humidified incubator maintained at 37° C. and 5% CO₂. The plasmid DNA was incubated with the transfection reagent in a 50 mL conical tube. The DNA-transfection reagent complex was prepared in 5% of the final culture volume in serum-free DMEM. One microgram of plasmid DNA per milliliter of culture was first added to serum-free DMEM, followed by 1 μl X-TremeGene RO-1539/mL culture. The complexes were incubated at room temperature for approximately 30 minutes and then added to the cells in the spinner flask. The transfection/expression was performed for 7 days, after which the conditioned medium was harvested by centrifugation at 4,000 RPM for 60 minutes at 4° C.

[0234]If the initial transfection failed to yield the required 100 μg purified antibody, those clones were re-expressed in roller bottles. These transfections used 293T adherent cells grown and maintained in DMEM supplemented with 5% FBS+1× Non-Essential Amino Acids+1× Pen Strep Glut+1× Sodium Pyruvate. Approximately, 4-5×10⁷ 293T cells were seeded in a 850 cm² roller bottles overnight. The previously seeded cells were then transfected the following day using FUGENE® 6 transfection reagent. The DNA transfection reagent mixture was prepared in approximately in 6.75 mL serum-free DMEM. 675 μl FUGENE® 6 transfection reagent was first added, followed by 112.5 μg plasmid DNA. The complex was incubated at room temperature for 30 minutes. The entire mixture was then added to a roller bottle. The roller bottle was infused with a 5% CO₂ gas mixture, capped tightly and placed in a 37° C. incubator on a roller rack rotating at 0.35 RPM. The transfection was performed for 24 hours after which the medium was replaced with 100 mL DMEM+1× Insulin-Transferrin-Selenium Supplement+1× Pen Strep Glu+1× Non-Essential Amino Acids+1× Sodium Pyruvate. Typically, 2-3 harvests (100 ml) were obtained from each roller bottle at a 48 hr interval. The harvested serum-free conditioned medium was pooled together and centrifuged at 4,000 RPM for 30 minutes at 4° C.

EXAMPLE 6

Anti-IGF-1R Antibody Small-Scale Purification

[0235]This example provides a method of purifying anti-IGF-1R antibodies on a small scale.

[0236]Conditioned medium was filtered through a 0.45 μm cellulose acetate filter and concentrated approximately 8-fold using a Vivaflow 200 50 K tangential flow membrane (Vivascience, Goettingen, Germany). rProtein A SEPHAROSE® Fast Flow resin (Amersham Biosciences, Piscataway, N.J.) was washed with phosphate buffered saline (2.7 mM potassium chloride, 138 mM sodium chloride, 1.5 mM potassium phosphate, and 8.1 mM sodium phosphate, pH 7.4) (PBS) four times then directly applied to the concentrated media. The amount of resin used was based on antibody concentration determined by ELISA where 1 μl of resin was used per 5 μg antibody. The medium was incubated overnight at 4° C. with gentle agitation. The resin was centrifuged at 500 g for 10 min. at 4° C. The supernatant was decanted as the unbound fraction. The resin was washed with PBS four times for one minute at room temperature with gentle agitation, each time collecting the resin by centrifugation at 500 g for 10 min. at 4° C. The antibody was eluted by incubating the resin with 1.5 volumes of 0.1 M glycine pH 3.0 for 10 min. at room temperature. The resin was centrifuged at 500 g for 10 min. at 4° C. and the supernatant decanted as eluted antibody. The elution step described above was repeated for a total of three elutions; each time the eluted material was neutralized with 0.04 volumes of 1.0 M tris-HCl, pH 9.2. The sample was filtered through a 0.2 μm cellulose acetate filter. Protein concentration was determined by the Bradford method using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, Calif.) as per the supplied instructions using Human IgG (Sigma-Aldrich, St. Louis, Mo.) as a standard. The sample was compared to a Human IgG 1, K standard (Sigma-Aldrich, St. Louis, Mo.) using a 4-20% tris-glycine SDS polyacrylamide gel (SDS-PAGE) gel stained with Coomassie brilliant blue dye. No contaminating protein was visible in these preparations.

EXAMPLE 7

Isolation of Stable CHO Clones Expressing Antibodies

[0237]This example provides a method for isolating stable CHO cell lines expressing anti-IGF-1R antibodies.

[0238]Stable expression of TQ11C, TQ25, TQ 58 and TQ59 IgG1 was achieved by co-transfection of AM1-D CHO cells (U.S. Pat. No. 6,210,924, incorporated herein by reference in its entirety) with pDSRα20 heavy and light chain IgG1 expression constructs. The plasmid transfections were performed using LF2000 (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. Briefly, 4×106AM1-D CHO cells were plated 24 hours prior to transfection, in 100 mm diameter FALCON® plastic petri dishes (BD Falcon, Franklin Lakes, N.J.) in 10 ml of Dulbecco's Modified Eagles Medium (Invitrogen) supplemented with 5% fetal bovine serum, 1× penicillin-streptomycin and glutamine (Invitrogen), non-essential amino acids (Invitrogen), sodium pyruvate, and HT (0.1 mM sodiumhypoxanthine, 16 nM thymidine; Invitrogen). Approximately 15 mg of each pDSRα21--light chain and heavy chain plasmid DNA were linearized using Pvu I (New England Biolabs) and diluted in 2 ml of OPTI-MEM® (Invitrogen). The diluted plasmids were mixed with 75 μl of LIPOFECTAMINE® 2000 (LF2000; GIBCO/BRL) diluted in 2 ml of OPTI-MEM® and the mixture was incubated for 20 min at room temperature. The following day fresh growth medium was added. The cells were cultured in complete growth medium for 48 hours, then plated in HT-selection medium in 1:20 and 1:50 dilutions. Approximately 2 weeks after transfection, 12-24 visible colonies were picked into 24-well plates, using the sterile cloning discs (RPI). The clones expressing the highest level of TQ11C, TQ25, TQ58 and TQ59 IgG1 were identified by western immunoblot analysis. To perform this assay, 0.5 ml of serum free medium was added to a single-well confluent cells cultured in a 24 well plate (BD Falcon). The conditioned medium was recovered after 24 hr, and 10 μl of CM was mixed with an equal volume of loading buffer to run a 10% Tris-Glycine polyacrylamide protein gel (Invitrogen). The gel was transferred to a 0.45 μm pore size nitrocellulose membrane (Invitrogen), and western blot analysis was done using 1:1000 dilution of goat anti-human IgG Fc ImmunoPure antibody (Pierce Biotechnology, Inc., Rockford, Ill.) and ECL as detection agent.

EXAMPLE 8

Mid-Scale Expression of Antibodies

[0239]This example provides a method of expressing anti IGF-1R antibodies expressed by stable CHO cell lines.

[0240]The CHO cell lines made according to Example 7 were expanded to T-175 tissue culture flasks (Falcon) for scale-up expression. A confluent T175 flask (approximately 2-3×10⁷ cells) was used to seed 3-850 cm2 roller bottles (Corning Life Sciences, Acton, Mass.), and three confluent roller bottles (approximately 1-2×10⁸ cells per roller bottle) were used to seed 30 rollers in 250 ml of high-glucose DMEM (Invitrogen), 10% dialyzed FBS (Invitrogen), 1× glutamine (Invitrogen), 1× non-essential amino acids (Invitrogen), 1× sodium pyruvate (Invitrogen). Medium was infused with 10% CO₂/balance air for 5 seconds before capping the roller bottle. Roller bottles were incubated at 37° C. on roller racks spinning at 0.75 rpm.

[0241]When cells reached approximately 85-90% confluency (approximately 5-6 days in culture), the growth medium was discarded, the cells were washed with 100 ml PBS, and 200 ml production medium was added (50% DMEM (Invitrogen)/50% F12 (Invitrogen), 1× glutamine (Invitrogen), 1× non-essential amino acids (Invitrogen), 1× sodium pyruvate (Invitrogen), 1.5% DMSO (Sigma). Conditioned medium was harvested every seven days for a total of four harvests.

[0242]Conditioned medium was filtered through a 0.45 μm cellulose acetate filter and concentrated approximately 10-fold using a Sartorius Sartocon Slice Disposable 30 K tangential flow membrane (Sartorius AG, Goettingen, Germany). The concentrated material was applied to a 10 ml rProtein A Sepharose column at 4° C. and the flowthrough was collected as the unbound fraction. The column was washed with four column volumes of PBS. The bound sample was eluted with approximately four column volumes of 0.1 M glycine pH 3.0. The eluate peak was collected and neutralized with 0.04 volumes of 1.0 M tris-HCl, pH 9.2. The eluate was dialyzed against 150 volumes of PBS overnight at 4° C. The sample was filtered through a 0.2 μm cellulose acetate filter and protein concentration was measured by determining the absorbance at 280 nm using an extinction coefficient of 14,000 M-1. The sample was compared to a Human IgGl, K standard (Sigma-Aldrich, St. Louis, Mo., USA) using a 4-20% tris-glycine SDS-PAGE gel stained with Coomassie brilliant blue stain. Endotoxin levels in each antibody preparation was determined using the Pyrotell Limulus Amebocyte Lysate Assay (Associates of Cape Cod, Inc., Falmouth, Mass.) as per the supplied instructions.

EXAMPLE 9

ORIGEN® Dose Response Competition Assays

[0243]This example provides methods for testing the ability of an antibody to block ligand binding to IGF-1R.

[0244]An ORIGEN® binding assay was used to determine whether TQ11C, TQ25, TQ 58 and TQ59 IgG1 antibodies could block ligand binding to IGF-1R using procedures provided by the manufacturer (Igen, Inc., Gaithersburg, Md.). To label IGF-1 and IGF-2 with ruthenium, lyophilized proteins were dissolved into PBS to give a 1.0 mg/ml solution. Label (ORI-TAG-NHS ester from Igen, Cat # 110034) was added to the protein at a molar ratio of 5:1 (label:protein) from a label stock of 5 mg/ml in DMSO. The mixture was incubated at room temperature (20-22° C.) for 1 hr in the dark then treated with 20 μl 2M glycine for 10 min at room temperature. The labeled protein was separated from the free label by application to an Amersham Biosciences NAP-5 column (Amersham Biosciences, Piscataway, N.J.) equilibrated in PBS and 0.33 ml fractions collected. The protein concentration of the fractions was determined by Micro BCA Protein Assay (Pierce Biotechnology, Inc., Rockford, Ill.). Fractions two and three contained significant protein and were combined. The amount of incorporated ruthenium label was assessed using the following formula: ruthenium tris-bipyridyl compound (Ru(bpy)₃²+) labeling of IGF-1 and IGF-2.

[0245]Dynal M450 paramagnetic beads coated with sheep anti-mouse IgG was used as the solid support phase for the IGF-1R(ECD)-C3-muFc. The M450 beads were prepared for receptor loading by washing three times with assay buffer containing 1×PBS, 0.05% TWEEN® 20 (ICI Americas, Inc., Wilmington Del.) 0.1% BSA, 0.01% sodium azide. The IGF-1R(ECD)-C3-muFc was bound for 1 hr at a ratio of 50 ng receptor per 1×10⁶ M450 beads in a volume of 25 μl assay buffer. To generate dose response data, the antibodies or unlabeled IGF-1 and IGF-2 factors were added at increasing concentrations (10^-11M to 10^-6M) simultaneously with 1 nM Ru-IGF-1 or 2 nM Ru-IGF-2. The final reaction volume was 100 μl. After incubation at room temperature in the dark for 2 hr, an M8 Analyzer (Igen) was used to remove free ruthenium labeled ligand and determine the amount of ligand bound to receptor. The data were expressed as the percent of total ligand bound minus background remaining after competition with excess unlabeled growth IGF1 or IGF-2. Competition curves were generated with GraphPad Prism software (GraphPad Software, San Diego, Calif.) using a single component equilibirium model. Essentially all (>98%) binding was competed with excess unlabeled growth factors. The positive control antibodies in the binding analysis were the murine anti-IGF-1R antibodies αIR3 (Calbiochem, San Diego, Calif.) or MAB391 (R&D systems, Minneapolis, Minn.), 24-57 (Biocarta, San Diego, Calif.) and 1H7 (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.). The negative control antibody was an anti-CD20 antibody. Ligand competition data are shown in FIG. 15. The Ki and maximum inhibition values observed for IGF-1 and IGF-2 binding reactions are listed in Table 6.

TABLE-US-00008 TABLE 6 IGF-1 IGF-2 Antibody Ki (nM)¹ Max (%)² Ki (nM)¹ Max (%)² TQ11C 0.6 84 0.3 91 TQ25 0.8 88 0.8 94 TQ58 0.8 91 0.8 91 TQ59 1.5 79 1.4 91 1H7 16.0 89 13.1 99 αIR3 5.3 91 No Inhibition ¹Ki of inhibition. ²Maximum level of inhibition at 1 μM antibody concentration.

EXAMPLE 10

SPA Dose Response Competition Assay

[0246]This example presents a scintillation proximity assay (SPA) for assesessing the effect of antibodies on the interaction of insulin (INS) with the insulin receptor (INSR) and of IGF-1 and IGF-2 to IGF-1R.

[0247]IGF-1R binding reactions for TQ11C, TQ25, TQ 58 and TQ59 IgG1 antibodies contained 1×PBS, 0,05% TWEEN® 20 (Mallinkrodt), 0.1% BSA (EM Science, Gibbstown, N.J.), 50 ng IGF-1R(ECD)-C3-muFc, 500 μg SPA PVT anti-mouse IgG fluoromicrospheres (Amersham) and ¹²⁵I-labeled IGF-1 or IGF-2 obtained from Amersham at a final concentration of 0.64 nM. The total reaction volume was 100 μl. The INSR binding reactions were identical except they contained 50 ng INSR(ECD)-muFc and 0.64 nM ¹²⁵I-INS (Amersham). Receptor was loaded onto SPA PVT microspheres for 1 h at room temperature prior to assembly of the binding reactions. To generate dose response data, antibodies or unlabeled growth factors were added at increasing concentrations (10^-11 M to 10^-6 M) simultaneously with ¹²⁵I-labeled growth factors. Essentially all binding was competed with excess unlabeled growth factors. The receptor-independent background, caused by random γ stimulation of the SPT PVT microspheres, was less than 0.5% of the input ¹²⁵I cpm. The data were expressed as the percent of total ligand bound minus background remaining after competition with excess unlabeled growth IGF1 or IGF-2. Competition curves were generated with GraphPad Prism software using a single component equilibrium model.

EXAMPLE 11

Antibody Binding to IGF-1R

[0248]This example provides a method of detecting the binding of an anti-IGF-1R antibody to IGF-1R.

[0249]BIACORE® 2000, sensor chip CM5, surfactant P20, HBS-EP (10 mM HEPES, 0.15M NaCl, 3.4 mM EDTA, 0.005% P20, pH 7.4), amine coupling kit, 10 mM acetate pH 4.5 and 10 mM glycine pH 1.5 all were purchased from BIACore, Inc. (Piscataway, N.J.). Phosphate-buffered saline (PBS, 1×, no calcium chloride, no magnesium chloride) was from Gibco. Bovine serum albumin (BSA, fraction V, IgG free) was from Sigma. Recombinant Protein G ("rProtein G") was from Pierce Biotechnology.

[0250]Immobilization of rProtein G and IGF-1R-C3-muFc to the sensor chip surface was performed according to manufacturer's instructions, using a continuous flow of 10 mM HEPES, 0.15M NaCl, 3.4 mM EDTA, 0.005% P20, pH 7.4 (HBS-EP buffer). Briefly, carboxyl groups on the sensor chips's surfaces were activated by injecting 60 μl of a mixture containing 0.2 M N-ethyl-N'-(dimethylaminopropyl)carbodiimide (EDC) and 0.05 M N-hydroxysuccinimide (NHS). Specific surfaces were obtained by injecting rProtein A (Pierce) or IGF-1R-C3-mFc diluted in 10 mM acetate, pH 4.5 at concentrations between 20 and 50 μg/ml. Excess reactive groups on the surfaces were deactivated by injecting 60 μl of 1 M ethanolamine. Final immobilized levels were 5,000-6,000 resonance units (RU) for the Protein G surfaces, and ˜7,800 RU for the IGF-1R-mFc surfaces. A blank, mock-coupled reference surface was also prepared on the IGF-1R-mFc sensor chip.

[0251]The kinetic analysis of the interaction between IGF-1R-mFc and antibodies was performed as follows. Antibodies as well as a positive control antibody (anti-IR3-CDR-human-mouse chimera) were diluted in PBS+0.005% P20+0.1 mg/ml BSA and injected over the Protein G surfaces to capture the antibodies. IGF-1R-mFc was diluted in PBS+0.005% P20+0.1 mg/ml BSA from 500 nM to 3.9 nM, and each concentration was injected over the captured antibody surfaces, as well as over a blank Protein G surface for background subtraction. After a 10 minute dissociation, each surface was regenerated by injecting 10 mM glycine, pH 1.5. Kinetic analysis of the resulting sensorgrams was performed using BIAEvaluation, v. 3.2 (BIACore, Inc.).

[0252]A solution affinity analysis was done by incubating two different concentrations (0.2 nM and 1 nM) of antibody with varying concentrations (0.01 nM to 50 nM) of IGF-1R-mFc in PBS+0.005% P-20+0.1 mg/ml BSA. Incubations were done at room temperature for at least five hours to allow samples to reach equilibrium. Samples were then injected over the immobilized IGF-1R-mFc surface. After the sample injection, the surfaces were regenerated by injecting 25 μl 8 mM glycine, pH 1.5. The binding signal obtained is proportional to the free antibody in solution at equilibrium. The dissociation equilibrium constant (K_D) was obtained from nonlinear regression analysis of the competition curves using a dual-curve one-site homogeneous binding model (KinExA software v. 2.3, Sapidyne Instruments Inc., Boise Id.). The data are shown in Table 7

TABLE-US-00009 TABLE 7 Kd (k_a/k_d) Kd Kinetic Equilibrium Antibody k_oa (1/Ms) K_d (1/s) Method Method TQ11C 6.0 × 10⁴ 6.7 × 10^-5 1.1 nM 0.3 nM TQ25 4.4 × 10⁴ <<5 × 10^-5 0.10 nM TQ58 1.1 × 10⁵ 2.8 × 10^-5 0.25 nM 0.25 nM TQ59 6.9 × 10⁴ 2.1 × 10^-4 3.0 nM 0.30 nM

EXAMPLE 12

Epitope Mapping Avidin-Fusion proteins

[0253]This example provides a method of determining the epitope of IGF-1R bound by an anti-IGF-1R antibody.

[0254]The subdomains of IGF-1R bound by antibodies TQ11C, TQ25, TQ58, and TQ59 were determined using avidin-IGF-1R fusion proteins. To express each protein the coding DNA sequences of the complete IGF-1R(ECD) was cloned into the expression vector pCep4-avidin-C such that chicken avidin sequence is joined to the C-terminus of the expressed IGF-1R protein. The ECD coding sequence (1-932) was PCR amplified from a parental IGF-1R plasmid using PCR primers 2804-25:

TABLE-US-00010 5' GCAAGCTTGGGAGAAATCTGCGGGCCAG 3' SEQ ID NO: 265

[0255]and 2826-68:

TABLE-US-00011 SEQ ID NO: 266 5' ATTGCGGCCGCTTCATATCCTGTTTTGGCCTG 3'

[0256]The primers include a 5' Hind III site and a 3' Not I site for cloning into pCep4-avidin-C. The amino acid sequence of the avidin-human IGF-1R(ECD) fusion protein is shown in FIG. 12. The IGF-1R subdomains constructs used for epitope mapping included: L1 (1-151), CR (152-298), L2 (299-461), FnIII-1 (461-579), FnIII-2/ID (580-798), FnIII-3 (799-901), L1+CR+L2 (1-461), and L1+CR (1-298). The amino acid coordinates of the IGF-1R subdomain represented in each expression plasmid are given in parenthesis. The coding sequence of each domain was PCR amplified from a parental IGF1R cDNA clone using the following primer pairs:

TABLE-US-00012 L1: (SEQ ID NO: 265) 2804-25: 2804-19: SEQ ID NO: 267 5' ATTGCGGCCGCCCCACATTCCTTTGGGGGC 3' CR: 2804-38: SEQ ID NO: 268 5' AGCAAGCTTGGACCTGTGTCCAGGGACC 3' 2804-20: SEQ ID NO: 269 5' ATTGCGGCCGCGCAAGGACCTTCACAAGGG 3' L2: 2804-39: SEQ ID NO: 270 5' AGCAAGCTTGCCGAAGGTCTGTGAGGAAG 3' 2804-23: SEQ ID NO: 271 5' ATTGCGGCCGCACTTTCACAGGAGGCTCTC 3' FnIII-1: 2808-08: SEQ ID NO: 272 5' AGCAAGCTTGGACGTCCTGCATTTCACCTC 3' 2804-52: SEQ ID NO: 273 5' ATTGCGGCCGCGGTGCGAATGTACAAGATCTC 3' FnIII-2 + ID: 2804-41: SEQ ID NO: 274 5' AGCAAGCTTGAATGCTTCAGTTCCTTCCATTC 3' 2804-51: SEQ ID NO: 275 5' ATTGCGGCCGCAGTCCTTGCAAAGACGAAGTTG 3' FnIII-3: 2804-42: SEQ ID NO: 276 5' AGCAAGCTTGATGCCCGCAGAAGGAGCAG 3' 2804-50: SEQ ID NO: 277 5' ATTGCGGCCGCTTTAATGGCCACTCTGGTTTC 3' L1 + CR + L2: 2804-25: SEQ ID NO: 278 5' AGCAAGCTTGGGAGAAATCTGCGGGCCAG 3' (SEQ ID NO: 272) 2804-23 L1 + CR: (SEQ ID NO: 279) 2804-25: AGC AAG CTT GGG AGA AAT CTG CGG GCC AG (SEO ID NO: 270) 2804-20

[0257]The primers included Hind III and Not I site for cloning as described for the IGF-1R (ECD). The IGF-1R subdomains were cloned into the expression vector pCep4avidin-N such that chicken avidin sequence (with endogenous signal sequence) is joined to the N-terminus of the expressed IGF-1R proteins.

Expression of each avidin-fusion protein was achieved by transient transfection of human 293-EBNA cells (Invitrogen) in roller bottles cultures. The cells were grown and maintained in DMEM supplemented with 5% FBS+1× Non-Essential Amino Acids+1× Pen Strep Glut+1× Sodium Pyruvate. Approximately 4-5×10⁷ 293-EBNA cells were seeded in 850 cm² roller bottles overnight. The previously seeded cells were then transfected with pCep4-avidin plasmid DNA the following day using FUGENE® 6 transfection reagent. The DNA-transfection reagent mixture was prepared in approximately in 6.75 mL serum-free DMEM. 675 μl FUGENE® 6 transfection reagent was first added, followed by 112.5 μg plasmid DNA. The complex was incubated at room temperature for 30 minutes. The entire mixture was then added to a roller bottle. The roller bottle was gassed with a 5% CO₂ gas mixture, capped tightly and placed in a 37° C. incubator on a roller rack rotating at 0.35 RPM. The transfection was performed for 24 hours after which the medium was replaced with 100 mL DMEM+1× Insulin-Transferrin-Selenium Supplement+1× Pen Strep Glu+1× Non-Essential Amino Acids+1× Sodium Pyruvate. Harvest of the condition medium and replacement with fresh medium occurred 48 hr intervals (2-3 cycles). The harvested serum-free conditioned medium was pooled together and clarified by centrifugation at 10,000×g for 30 minutes at 4° C.

[0258]The concentration of avidin-fusion in each conditioned medium was determined using a quantitative FACS based method. The avidin fusion protein in 200 μl of conditioned medium was captured by incubation for 2 hr at room temperature with 5 μl (˜3.5×10⁵) of biotin coated polystyrene beads (Spherotech, Inc., Libertyville, Ill.). The conditioned medium was removed by three cycles of centrifugation and resuspension of the avidin-coated beads in PBS containing 0.5% BSA (BPBS). The avidin-beads were stained with 1 μg/ml of goat FITC-labeled anti-avidin antibody (Vector Lab Burlingame, Calif.) in 1 ml BPBS. After 0.5 hr incubation antibody-beads complexes were collected by centrifugation at 1800 rpm for 5 min and the pellet was washed three times. The FITC fluorescence was detected with a FACSCAN (Beckton Dickson Bioscience, Franklin Lakes, N.J.). The signal was converted to protein mass using a standard curve derived with recombinant avidin. For epitope mapping the biotin-beads were loaded with 50-100 ng avidin-fusion protein per ˜3.5×10⁵ beads of beads by incubation with the appropriate amount (1-20 ml) of conditioned medium. The loaded beads were washed extensively and resuspended in 1 ml BPBS. For all experiment the biotin-beads were blocked with 10% BSA in PBS prior to loading fusion protein.

[0259]Method 1, One Color Assay: Biotin-coated polystyrene beads loaded with IGF-1R (ECD) and IGF-1R subdomain fusion proteins were mixed with 1 μg of anti-IGF-1R antibody in 1 ml of BPBS. After incubation for 1 hr at room temperature, 4 ml washing buffer was added and the antibody-beads complexes were collected by centrifugation for 5 min at 750 g. The pellet was washed 3 times by resuspension in 4 ml of BPBS. The antibody bound to avidin-bead complexes was detected by treatment with 0.5 μg/ml Phycoerythrin-(PE) labeled goat anti-human F(ab')2 (Southern Biotech Associates, Inc., Birmingham, Ala.) in 1 ml BPBS. Tested antibodies were found to bind to the avidin-fusion protein containing the complete IGF-1R ECD and the L2 domain. Binding to L1, CR or FnIII-1 was not detected in this experiment. A relatively weak reaction was also observed with the L1 domain.

[0260]Method 2, Two color assay: To simultaneously monitor the amounts of anti-IGF-1R monoclonal antibody and avidin-fusion bound to biotin-beads, FITC-labeled anti-avidin antibody was included (1 mg/ml) was included in the binding reaction in combination with 0.5 μg/ml PE-labeled goat anti-human IgG1. The beads were prepared for FACSCAN analysis as described for the one color assay.

[0261]Method 3, Antibody Competition: To prepare for labeling with fluorescein the antibodies were dialyzed or resuspended at a concentration of 1 mg/ml in PBS (pH 8.5). Label ([6-fluorescein-5-(and -6)-carboxamido] hexanoic acid, succinimidyl ester 5(6)-SFX] mixed isomers from Molecular Probes (Eugene, Oreg., Cat. No. F2181) was added to the protein at a molar ratio 9.5:1 (label:protein) from a label stock of 5 mg/ml in DMSO. The mixture was incubated at 4° C. overnight in the dark. The labeled antibody was separated from the free label by dialysis in PBS. The FITC/antibody ratios obtained ranged from 3 to 8. For each competition experiment, a binding reaction was assembled that contained a 50 fold excess (10-50 μg/ml) of unlabeled competitor antibody, 3.5×10⁵ biotin beads coated with avidin fusion protein in BPBS. The FITC-labeled antibody (1 μg/ml) was added after a 30 min preincubation. The process followed the one color method from this point forward.

[0262]Each of the four tested antibodies binds to the IGF-1R L2 domain, as shown in Table 8. However, the precise amino acid contacts of each antibody in the IGF-1R L2 domain may differ.

TABLE-US-00013 TABLE 8 Antibody L1¹ CR¹ L2¹ FnIII-1¹ ECD^1,2 TQ11C No No Yes No Yes TQ25 No No Yes No Yes TQ58 Yes No Yes No Yes TQ59 No No Yes No Yes ¹Epitope mapping was performed with avidin-IGF-1R fusion proteins containing the indicated human IGF-1R regions. ²The ECD fusion contains L1 + CR + L2 + FnIII-1 + FnIII-2 + ID + FnIII-3.

EXAMPLE 13

Antibody Binding to Cell-Surface IGF-1R

[0263]This example provides a method for detecting the binding of an anti-IGF-1R antibody to cell-surface expressed IGF-1R.

[0264]The ability of antibodies TQ11C, TQ25, TQ58, and TQ59 to bind to human IGF-1R displayed on the cell surface was evaluated using Balb/C 3T3 fibroblasts and MCF-7 human breast cancer cells engineered to overexpress the human IGF-1R receptor at a level of ˜3-4×10⁵ molecules per cell. A Balb/C 3T3 cell line that stably overexpresses the human IGF-1R (˜3×10⁵ receptors per cell) was derived using with a retroviral vector essentially as described by Pietrzkowski et al., 1992, Cell Growth Differentiation 3:199-205. MCF-7 breast cancer cells that overproduce huIGF-1R were transfected with a pcDNA3.1 expression vector (Invitrogen Corp.): Zeocin resistant cells that express a high level of hu IGF-1R (˜4×10⁵ receptors per cell) were expanded after selection by FACS using anti-IGF-1R monoclonal antibody αIR3 and an PE-labeled goat anti murine IgG antibody (Caltag Laboratories, Burlingame, Calif.). The process of selection and expansion was repeated four times.

[0265]IGF-1R Receptor antibody staining and receptor expression was monitored by FACS as follows: the cells were released from T175 flasks (Corning) by washing 2 times with excess PBS (Ca/Mg free) followed by treatment with 5 ml of Cell Dissociation Buffer (Sigma) for 10 min at room temperature. The cells were collected by centrifugation and washed two times by resuspending them in PBS and centrifugation. For primary antibody staining, 1 μg of antibody was added to 10⁶ cells resuspended in 100 μl PBS plus 0.5% BSA (BPBS) and the cells were incubated at 4° C. for 1.5 hr. The cells were collected by centrifugation and washed twice with BPBS to remove unbound primary antibody. The cells were resuspended in 100 μl of BPBS and incubated with 1 μg of FITC-labeled goat anti-human F(ab')2 (Southern Biotechnology Associates, Inc., Birmingham, Ala.) at 4° C. for 30 minutes. After washing to remove unbound FITC secondary antibody, the cells were resuspended in 1 ml of PBS+0.5% BSA and FITC cell fluorescence was detected with a FACSCAN (Beckton Dickson Bioscience, Franklin Lakes, N.J.). The fluorescence levels were converted to absolute receptor levels using Quantum microbead (Bangs Laboratories, Inc., Fishers, Ind.) with predetermined IgG1 binding capacity to generate a standard curve. Data reduction was performed with QuickCal v2.1 software (Verity Software House, Topsham, Me.) provided by the manufacturer.

[0266]The peak fluorescent intensity of anti-IGF-1R antibody labeling of the IGF-1R overexpressors was increased 10-20 fold relative to parental Balb/C 3T3 and MCF-7 cells for each of the tested antibodies. This is the result predicted for an antibody that specifically binds IGF-1R. Background fluorescence of cells treated with no antibodies or FITC-labeled secondary alone were insignificant.

EXAMPLE 14

Inhibition of IGF-1R

[0267]This example presents methods of detecting inhibition of IGF-1R by anti-IGF-1R antibodies.

32D hu IGF-1R+IRS-1 Cell Inhibition

[0268]Murine 32D cells that coexpress the human IGF-1R receptor (20K per cell) and human IRS-1 have proven to be a effective system to examine the molecular components IGF-1R signaling Valentinis et al., 1999, J Biol Chem 274:12423-30. Normal 32D cells express relatively low levels of the murine orthologs of these two gene products. 32D cell normally required IL3 for growth and survival. IGF-1 or IGF-2 can replace IL3 in 32D huIGF-1R+IRS-1 cells as shown in FIG. 16, panel A. The EC₅₀ to the IGF-1 dose response curve was about 0.5 nM, whereas the IGF-2 EC₅₀ (2.8 nM) is about six fold higher reflecting weaker affinity of IGF-2 for IGF-1R. To assess the ability of the antibodies TQ11C, TQ25, TQ58, and TQ59 to block IGF-1 or IGF-2 stimulation, 96-well microtitre plates were seeded with 30,000 32D hu IGF-1R+IRS-1 cells per well in a volume of 200 μl of RPMI (Gibco/BRL) containing 5% fetal bovine serum (Gibco/BRL) and 1× penicillin, streptomycin, glutamine (Giboco/BRL) and increasing concentrations of antibody (10^-12M to 10^-6M) or no antibody. IGF-1 (2 nM), IGF-2 (8 nM) or nothing was added after 1 hr preincubation with antibody. ³H-thymidine (1 μCi per well) was added at 27 hr post-antibody addition. The cells were harvested 21 hr later, and incorporation of ³H-thymidine into DNA was determined for each sample. The assays were performed in triplicate. An anti-CD20 antibody was used as a negative control. Each of antibodies TQ11C, TQ25, TQ58, and TQ59 was able to completely block the IGF-1 and IGF-2 mediated stimulation of the 32D cells. The reduction of background proliferation in the absence of added IGF-1 and IGF-2 is due to the inhibition of serum IGF-1 and IGF-2. The binding data were analyzed using GraphPad PRIZM® software. The data are shown in FIG. 16.

Balb/C 3T3 hu IGF-1R Cell Inhibition

[0269]IGF-1 greatly stimulates the incorporation of ³H-thymidine by serum-starved cultures of mouse embryonic fibroblasts (Balb/C 3T3 or NIH 3T3) that overexpress IGF-1R (˜1×10⁶ IGF1R per cell). Kato et al., 1993, J Biol Chem 268:2655-61; Pietrzkowski et al., 1992, Cell Growth Differentiation 3:199-205. This phenomenon is recapitulated with both IGF-1 and IGF-2 in a Balb/C 3T3 cell line hu IGF-1R overexpressor. Both growth factors stimulated ³H-thymidine incorporation by about 20-fold. The EC₅₀ of the IGF-1 dose response curve was about 0.7 nM, whereas the IGF-2 EC₅₀ (4.4 nM) is sevenfold higher, indicating a weaker affinity of IGF-2 for IGF-1R. To assess the ability of a given antibody to block IGF-1 or IGF-2 stimulation, 96-well microtitre plates were seeded with 10,000 cells per well in a volume of 200 μl of DMEM (Gibco/BRL) containing 10% calf serum (Gibco/BRL) and 1× penicillin, streptomycin, glutamine (Giboco/BRL). After overnight incubation when the cells were about 80% confluent the growth medium was replaced with 100 μl DMEM containing 0.1% BSA after washing once with 200 μl PBS. Antibodies at increasing concentrations (10^-12M to 10^-6M), or no antibody, were added at 24 hr post-serum starvation. IGF-1 (2 nM), IGF-2 (8 nM) and ³H-thymindine (1 μCi per well) were added after a 1 hr preincubation with antibody. The cells were harvested 24 hr later, and incorporation of ³H-thymidine into DNA was determined for each sample. The assays were performed in triplicate. Each tested antibody was able to completely block the IGF-1 and IGF-2 mediated stimulation of Balb/C 3T3 cells, as shown in FIG. 17. An anti-CD20 antibody was used as a negative control ("CD20" in FIG. 17).

EXAMPLE 15

Treatment of Cancer in Humans with an Anti-IGF-1R Antibody

[0270]This example demonstrates that inhibition of the IGF-1R pathway is effective for treating a variety of types of tumors in human subjects.

[0271]Human subjects were selected for treatment in a First in Human Phase 1 clinical trial with a fully-human anti-human IGF-1 receptor IgG1 monoclonal antibody comprising the light chain variable domain identified herein as L16 and the heavy chain variable domain identified herein as H16 ("Study Drug"), as shown in Table 9.

TABLE-US-00014 TABLE 9 Cohort #1 (1 mg/Kg) Subject #5 Diagnosis Thymus Baseline TM (cm) 10 Antibody per Dose (mg) 92.5 Dosed at Days 1, 15, 29 Day 50 Tumor (cm) 10.4 (+4%) Subject #8 Diagnosis Unknown Baseline TM (cm) 18.5 Antibody per Dose (mg) 84.1 Dosed at Days 1, 15, 29, 57, 71, 85, 99, 113, 127, 141, 155 Day 50 Tumor (cm) 18.2 (-2%) Day 106 Tumor (cm) 18.9 (+2%) Day 162 Tumor (cm) 23.2 (+25%) Subject #7 Diagnosis Adenoid Baseline TM (cm) 31.1 Antibody per Dose (mg) 60 Dosed at Days 1, 15, 29, 57, 71, 85 Day 50 Tumor (cm) 30.9 (-1%) Cohort #2 (3 mg/Kg) Subject #1 Diagnosis Nerve Sheath Baseline TM (cm) 1.1 Antibody per Dose (mg) 208 Dosed at Days 1, 15, 29 Day 50 Tumor (cm) 1.4 (+27%) Subject #11 Diagnosis Carcinoid Baseline TM (cm) 13.1 Antibody per Dose (mg) Week 1-35: 207 Week 39 and on: 828 Dosed at Days 1, 15, 29, 57, 85, 99, 120, 134, 148, 162, 176, 190, 204, 218, 232, 246, 260, 274, 296, 308, 331 Day 50 Tumor (cm) 14 (+7%) Day 106 Tumor (cm) 11 (-16%) Day 169 Tumor (cm) 10.6 (-19%) Day 225 Tumor (cm) 8.4 (-36%) Day 281 Tumor (cm) 8.2 (-37%) Day 338 Tumor (cm) 6.8 (-48%) Cohort #3 (10 mg/Kg) Subject #2 Diagnosis Prostate Baseline TM (cm) 15.6 Antibody per Dose (mg) 790 Dosed at Days 1, 15, 29 Day 50 Tumor (cm) 18.8 (+21%) Subject #6 Diagnosis Melanoma Baseline TM (cm) 28.1 Antibody per Dose (mg) 854.5 Dosed at Days 1, 15, 29, 57, 71 Day 50 Tumor (cm) 28.4 (+1%) Subject #4 Diagnosis Colorectal Baseline TM (cm) 42.2 Antibody per Dose (mg) 895 Dosed at Days 1, 15, 29 Day 50 Tumor (cm) 45.3 (+7%) Cohort #4 (20 mg/Kg) Subject #3 Diagnosis Ovarian Baseline TM (cm) 15.9 Antibody per Dose (mg) 2118 Dosed at Days 1, 15, 29 Day 50 Tumor (cm) 18.6 (+17%) Subject #9 Diagnosis Breast Baseline TM (cm) 4.8 Antibody per Dose (mg) 1570 Dosed at Days 1, 15, 29, 57, 71 Day 50 Tumor (cm) 4.7 (-2%) Cohort #5 (12 mg/Kg) Subject #12 Diagnosis Ewing's Baseline TM (cm) 9.8 Antibody per Dose (mg) 1190 Dosed at Days 1, 15, 29, 57, 71 Day 50 Tumor (cm) 2.2 (-78%) Day 85 Tumor (cm) 0.0 (-100%) Cohort #6 (20 mg/Kg) Subject #10 Diagnosis Adenoid R eye Baseline TM (cm) 38.7 Antibody per Dose (mg) 1763.6 Dosed at Days 1, 15, 29, 57, 71 Day 50 Tumor (cm) 35.2 (-9%)

[0272]Prior to being selected for the study, each subject had failed available conventional treatments for his or her particular tumor disease, if such treatments were available, and was receiving only supportive care.

[0273]Each subject was assigned to one of six dosing cohorts. Subjects in any given cohort each received the same dose of the Study Drug intravenously. Dosing between cohorts ranged from 1 to 20 milligrams of Study Drug per kilogram of subject's body mass (mg/kg), as shown in Table 9. The Study Drug was formulated at 30 mg/ml in 10 mM acetate, pH 5.2, 5.0% w/v sorbitol, and 0.004% w/v Polysorbate 20. During the course of treatment, the subjects received the Study Drug as their only anti-tumor treatment. The subjects also received individualized palliative care, as appropriate, to reduce the severity of their symptoms.

[0274]Response to treatment was assessed using the Response Evaluation Criteria in Solid Tumors (RECIST) criteria as described in Therasse et al. 2000, J Natl Cancer Inst. 92:205-16, incorporated herein by reference in its entirety for all purposes. Briefly, prior to administration of the first dose, each subject was given a computerized tomography (CT) scan to determine the length of the largest measurable tumor along its longest diameter ("Baseline TM (cm)" in Table 9). CT scans were used to measure the same tumors along the same diameter at certain points after initiation of treatment ("Day X Tumor (cm)" in Table 9). Each such measurement was compared to the baseline tumor measurement for the same subject to calculate the percent increase or decrease in tumor size. As shown in FIG. 18 and in Table 9, two of the subjects showed a reduction in tumor size of at least 30%. One of these subjects was classified as a partial responder (PR) according to RECIST. The other had a 100% reduction in tumor dimension and so was classified as a complete responder (CR) according to RECIST. Eight other subjects had as a best response either a reduction of tumor size of less than 30% or an increase of less than 20%, and so are classified as having stable disease (SD) using RECIST criteria (note that one of these subject's had as a best response an initial 2% reduction in tumor size, but that subsequently the tumor showed and overall increase in size of 25%). Each of these subjects (except the CR subject, discussed below) eventually showed disease progression and was taken off of study. The remaining two subjects had RECIST tumor measurements that increased by more than 20%, indicating a best response of progressive disease (PD).

[0275]The CR subject had classical Ewing's sarcoma (characterized by a EWS-FLI genetic translocation; see, e.g., Dagher et al., 2001, J Pediatr Hematol Oncol. 23:221-24; Morishita et al., 2001, Mol. Biotechnol. 18:97-104, each incorporated herein by reference in its entirety for all purposes) that had formed large metastatic tumors in the lungs, making breathing difficult, particularly while lying prone. The subject was resistant to multiple prior chemotherapy regimens, including 1) adriamycin and cytoxan, 2) ifosphamide and vincristine, 3) topotecan and vincristine, 4) taxotere, and 5) gemcitabine. The subject received a first dose of 12 mg/kg of anti-IGF-1R antibody. The subject experienced significant symptomatic relief within two days of receiving the first dose of the Study Drug, allowing him to comfortably sleep in a prone position for the first time in several months. The subject subsequently received three doses of 12 mg/kg at 14 day intervals. Fifty days after the first injection, a CT scan of the subject showed a decrease in tumor size from the baseline measurement of 9.8 cm to 2.2 cm, or 78%, using RECIST. At day 50, the subject was also given a PET scan, which showed no detectable uptake of labeled glucose, indicating that most or all of the remaining tumor tissue was dead. At day 85, the subject underwent a CT scan that showed a complete resolution of tumor from the pre-treatment diameter of 9.8 cm to 0 cm. The subject continued to receive 12 mg/kg of the Study Drug at 14 day intervals and at day 434 still had a CR according to RECIST.

[0276]The PR subject had a mid gut carcinoid tumor and achieved a partial response after 33 weeks in the trial with a RECIST tumor dimension decrease from 13.1 to 6.8 cm, or 48%. The subject continued to receive 3 mg/kg of the Study Drug at 14 day intervals and showed a maximum RECIST tumor dimension reduction of 63%. At day 655, the subject was discovered to have new bone metastases and was taken off of the study.

[0277]Some subjects exhibited grade 3 or 4 thrombocytopenia. In every case where thrombocytopenia was detected, it resolved spontaneously with cessation or interruption of dosing. There were no cases of spontaneous bleeding noted in these subjects.

[0278]Additional patients were treated on this study who also had diagnoses of either Ewing's sarcoma or Desmoplastic Small Round Cell Tumors. Each of these subjects had had multiple prior cytotoxic chemotherapy regimens and had subsequently shown progression. Twelve such subjects received either 12 mg/kg (n=6) or 20 mg/kg (n=6) of the Study Drug at two week intervals. Table 10 shows the results for the study.

TABLE-US-00015 TABLE 10 Subject Study PET Best Number Drug Dose Translocation Study Status D8 Response 1 20 mg/kg N/A Off at day 127 -32% SD 2 12 mg/kg N/A Off at day 114 -10% SD 3 20 mg/kg N/A Off at day 79 -57% N/A 4 20 mg/kg N/A Off at day 58 -60% PD 5 12 mg/kg N/A Off at day 57 +16% PD 6 12 mg/kg N/A Off at day 48 +10% PD 7 20 mg/kg Negative Off at day 43 +11% PD 8 12 mg/kg N/A Off at day 39 +25% PD 9 20 mg/kg "EWS-FLI" Off at day 37 -11% PD 10 12 mg/kg Negative Off at day 35 +1% PD 11 20 mg/kg N/A Off at day 34 -35% PD 12 12 mg/kg "EWS-FLI" Off at day 23 -12% PD

[0279]Two subjects were classified as having a best response of SD using RECIST criteria. One of them showed a reduction in tumor metabolic activity of 32%, the other of 10%, on day 8 according to a PET scan. A third subject achieved a PR according to RECIST and a 57% reduction in metabolic activity on day 8. The tumors in all three subjects subsequently progressed, and so the subjects were taken off of the study. The remaining subjects all showed progressive disease as a best response and were taken off of the study, although several of them showed reductions in metabolic activity on day 8 of between 11% and 35%.

[0280]The tumor genotypes of the three best responders were not available. However, two of the subjects who showed a reduction in metabolic activity on day 8 (but whose best RECIST response was PD) were found to contain the EWS-FLI translocation. Two other subjects who showed a best RECIST response of PD, and who showed no change or a slight increase in tumor metabolic activity on day 8, were found to not have the translocation.

[0281]Another study was done in subjects with carcinoid tumors. Five subjects were given either 6 (n=1) or 20 mg/kg (n=4) of the Study Drug at two week intervals. The results are shown in Table 11.

TABLE-US-00016 TABLE 11 Study Subject Drug Dose Best Number (mg/kg) Study Status RECIST Response 1 20 Off at day 288 -32% PR 2 20 Continued past -20% SD day 378 3 20 Continued past -2% SD day 282 4 6 Off at day 112 N/A SD 5 20 Off at day 191 -5% SD

[0282]Each of the subjects was enrolled in the study after having tried and failed other treatments. Subject 1 showed a best response of PR (32% reduction in tumor size according to RECIST criteria). The remaining subjects showed best responses of SD, with between a 2% and 20% reduction in tumor size according to RECIST criteria.

[0283]Subjects 2 and 3 remained on the study past day 378 and day 282, respectively. Subject 1 was removed from the study on day 288 after showing progressive disease. Subject 4 was removed from the study on day 112 for noncompliance. Subject 5 was removed from the study on day 191 after developing a pulmonary embolus.

[0284]Another study was done in subjects with colorectal cancer (CRC). Seven subjects were each given 6 mg/kg of panitumumab (a human anti-EGF receptor antibody) and either 6 (n=3) or 12 mg/kg (n=4) of the Study Drug at two week intervals. The results are shown in Table 12.

TABLE-US-00017 TABLE 12 Study Panitumumab Drug Best Wk 8 Wk 8 Subject Dose Dose Study Prior WHO change change Number (mg/kg) (mg/kg) Status EGFR Response (WHO) (RECIST) 1 6 6 Off at day Yes SD N/A N/A 99 2 6 6 Off at day Yes SD -39% -27% 113 3 6 6 Off at day -- PD N/A N/A 58 4 6 12 Off at day Yes SD -19% -5% 168 5 6 12 Continued Yes PR -54% -36% Past Day 191 6 6 12 Off at day 7 Yes PD** 7 6 12 Off at day No PD*** -7% +1% 57 * "Yes" indicates subject previously treated with EGF receptor inhibitor **Newly discovered brain metastases at day 7 ***Progression of non-index lesions at day 57

[0285]All of the subjects had advanced solid malignancies refractory to standard therapy. In table 12, "Yes" in the "Prior EGFR" column means that the subject had previously been treated with an anti-EGF receptor antibody (either panitumumab or cetuximab). "Best WHO Response" and "Wk 8 CT change (WHO)" refer to tumor assessments done using WHO criteria (Miller et al., 1981, Cancer 47:207-14, incorporated herein by reference in its entirety for all purposes).

[0286]Subject 5 showed a best WHO response of PR. The tumors of subject 5, who experienced a best WHO response of PR and who continued on the study past day 191, were found to have a wild-type allele of KRAS. Before beginning the study, subject 5 had failed four prior chemotherapy regimens and five cycles of irinotecan and cetuximab.

[0287]Three subjects with non-CRC tumors also received 6 mg/kg panitumumab and 6 mg/kg of Study Drug and had their best responses evaluated according to WHO criteria. None of these subjects had previously been treated with an EGF receptor inhibitor. A first subject with a thyroid tumor showed a best response of progressive disease and was removed from the study on day 55. This subject was prediabetic prior to participation in the study, with a fasting glucose level of 113 mg/dL, and experienced a dose limiting toxicity of Grade 3 hyperglycemia. A second subject with a GE Junction tumor had a best response of stable disease and was removed from the study on day 114. A third subject with a pancreatic tumor had a best response of stable disease and was removed from the study on day 106.

[0288]Another study was done using Study Drug in combination with gemcitabine treatment in subjects with a variety of tumor types. Eleven subjects were each given three doses of gemcitabine at 1000 mg/kg every four weeks and were also given Study Drug at either 6 (n=6) or 12 mg/kg (n=5) every 2 weeks. The results are shown in Table 13.

TABLE-US-00018 TABLE 13 Study Best Subject Drug Dose WHO Number (mg/kg) Diagnosis Study Status DLT Response 1 6 Ovarian Off at day 157 No SD 2 6 Ovarian Off at day 126 No SD 3 6 Lung Off at day 53 Yes* PD 4 6 Carcinoid Off at day 112 No SD 5 6 Lung Off at day 56 No SD 6 6 Head and Neck Off at day 123 No SD 7 12 Colon Off at day 106 No SD 8 12 Breast Off at day 184 No SD 9 12 Colon Continued past No SD day 116 10 12 Prostate Continued past No SD day 114 11 12 Gallbladder Continued past No N/A day 47 *Grade 4 Neutropenia on day 8

[0289]All but one evaluated subject had a best response according to WHO criteria of stable disease. Subject 3 had a best response of progressive disease, and also showed a dose limiting toxicity ("DLT" in Table 13) of Grade 4 neutropenia on day 8.

EXAMPLE 16

Correlation of Molecular Markers with Response to Inhibition of IGF-1 Receptor Signaling

[0290]This example demonstrates that molecular markers can be used to determine whether a subject is more likely or less likely to respond to an anti-tumor treatment comprising an inhibitor of IGF-1 receptor signaling.

[0291]The presence or absence of certain biomarkers was found to correlate with the response of subjects to treatment with an inhibitor of IGF-1 receptor signaling. Of the subjects listed in Table 9, both of the subjects with disease progression (PD) after eight weeks of treatment exhibited a reduction of PTEN expression (complete loss of PTEN expression in 10% of the tumor cells observed in one subject, complete loss of PTEN in 5% of tumor cells in the other subject) as assessed by immunohistochemical staining of archival formalin fixed paraffin embedded tumor sections by a contract laboratory (Ventana Medical Systems, Tucson, Ariz.), as shown in FIG. 18. PTEN expression was completely eliminated (absent in 100% of tumor cells) in one subject with stable disease (this subject exhibited a 4% increase in his tumor RECIST measurement). PTEN loss was not observed in either subject who had a PR or a CR to treatment with the anti-IGF-1R antibody.

[0292]The subject showing a complete loss of PTEN expression in 5% of tumor cells also was found to have a PTEN loss of function mutation (D331G).

[0293]An activating mutation of the gene encoding KRAS that changed the glycine normally found at codon twelve to a cysteine (i.e., KRAS G12C) was observed in the PR subject with the mid gut carcinoid tumor and in another subject with metastatic melanoma who had stable disease after eight weeks of treatment (RECIST 1% increased).

[0294]To further define the relationship between PTEN genotype and responsiveness to treatment with an anti-IGF-1 receptor inhibitor, six human tumor cell lines were identified that display negative PTEN status. Their sensitivity to an anti-IGF-1R antibody was tested in vivo in a mouse xenograft model. The cell lines used were PC-3 and LnCap (prostate), U-87MG (Glioblastoma), Cal-51 (Breast), 786-0 (Kidney), and Colo-320 (Colon/carcinoid). Five million cells of each of these cell lines were injected subcutaneously in the left flank of 4-6 week old female athymic nude mice. When the average tumor size reached approximately 200-220 mm³, mice were randomly assigned into groups (10 mice/group). Therapy with anti-IGF-1R antibody ("Antibody") at three doses (30, 100, or 300 μg/dose), or human IgG1 control ("Control"; 300 μg/dose) started on randomization day and continued until the end of each study. Administration of Antibody or Control occurred twice per week, intraperitoneally. Tumor volume and body weight of each animal were measured twice per week using calipers and an analytical scale, respectively. Data were gathered as mean+/-standard error. Cell lines were considered responsive to Antibody if a statistically significant decrease in tumor volume was measured between any dose group and the Control group. For the statistical analysis, repeated measures ANOVA (RMANOVA), post-hoc Scheffe, was employed. Results are shown in Table 14. Xenograft data showed that none of the six PTEN null models studied was sensitive to Antibody. In contrast, all sensitive xenograft models displayed wild-type PTEN status. These data support the clinical observations and support the use of PTEN status as a negative stratification marker for treatment with IGF-1R inhibitors.

TABLE-US-00019 TABLE 14 PTEN p53 Antibody Cell Line Status Status Tumor Type p < 0.05 TGI Colo 205 WT Mut Colon Yes DLD-1 WT Mut Colon Yes BT-474 WT Mut Breast Yes BxPC-3 WT Mut Pancreas Yes MiaPaCa WT Mut Pancreas Yes SJSA-1 WT mdm2 Osteosarcoma Yes U-87MG Null Wt GMB No Cal-51 Null Wt BBC No PC-3 Null Mut Prostate No LnCap Null Wt Prostate No Cal-51 Null Mut Breast No 786-O Null Mut Kidney No Colo-320 Null Mut Colon/Carcinoid No

[0295]Each reference cited herein is incorporated by reference in its entirety for all that it teaches and for all purposes.

Sequence CWU 1

2791336DNAArtificial Sequencelight chain variable region 1gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30agt gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Ser Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg atc acc ttc ggc caa ggg aca cga ctg gag att aaa 336Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 1102112PRTArtificial Sequencelight chain variable region 2Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Ser Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 1103327DNAArtificial Sequencelight chain variable region 3atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga gag ccg gcc 48Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly Glu Pro Ala1 5 10 15tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt aat gga tac 96Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly Tyr 20 25 30aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct cca cag ctc 144Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu 35 40 45ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct gac agg ttc 192Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro Asp Arg Phe 50 55 60agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc agc aga gtg 240Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val65 70 75 80gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct cta caa act 288Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala Leu Gln Thr 85 90 95ccg atc acc ttc ggc caa ggg aca cga ctg gag att aaa 327Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 1054109PRTArtificial Sequencelight chain variable region 4Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly Glu Pro Ala1 5 10 15Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly Tyr 20 25 30Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu 35 40 45Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro Asp Arg Phe 50 55 60Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val65 70 75 80Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala Leu Gln Thr 85 90 95Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 1055336DNAArtificial Sequencelight chain variable region 5gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cca ctc act ttc ggc ggc ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 1106112PRTArtificial Sequencelight chain variable region 6Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 1107336DNAArtificial Sequencelight chain variable region 7gaa att gtg atg acg cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct cac act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro His Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 1108112PRTArtificial Sequencelight chain variable region 8Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro His Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 1109336DNAArtificial Sequencelight chain variable region 9gaa att gtg ctg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa acc cct ctc act ttc ggc cct ggg acc aaa gtg gat atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11010112PRTArtificial Sequencelight chain variable region 10Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11011336DNAArtificial Sequencelight chain variable region 11gat gtt gtg atg act cag tct cca ctc tcc ctg gcc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Ala Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11012112PRTArtificial Sequencelight chain variable region 12Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Ala Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11013336DNAArtificial Sequencelight chain variable region 13gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11014112PRTArtificial Sequencelight chain variable region 14Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11015336DNAArtificial Sequencelight chain variable region 15gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gaa gat gtt ggg gtt tat tac tgt atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa acc ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11016112PRTArtificial Sequencelight chain variable region 16Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11017336DNAArtificial Sequencelight chain variable region 17gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5

10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg ttc acc ttc ggc caa ggg aca cga ctg gag att aaa 336Leu Gln Thr Pro Phe Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11018112PRTArtificial Sequencelight chain variable region 18Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Phe Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11019336DNAArtificial Sequencelight chain variable region 19gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctg gcg ttc ggc caa ggg acc aag gtg gaa atc aaa 336Leu Gln Thr Pro Leu Ala Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 11020112PRTArtificial Sequencelight chain variable region 20Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Ala Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 11021336DNAArtificial Sequencelight chain variable region 21gaa att gtg ctg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg aat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt gcc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct atc acc ttc ggc caa ggg aca cga ctg gag att aaa 336Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11022112PRTArtificial Sequencelight chain variable region 22Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11023333DNAArtificial Sequencelight chain variable region 23aat ttt atg ctg act cag ccc cac tct gtg tcg gag tct ccg ggg aag 48Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15acg gta acc atc tcc tgc acc cgc agc agt ggc agc att gcc agc aac 96Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Ser Asn 20 25 30tat gtg cag tgg tac cag cag cgc ccg ggc agt tcc ccc acc act gtg 144Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45atc tat gag gat aac caa aga ccc tct ggg gtc cct gat cgg ttc tct 192Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60ggc tcc atc gac agc tcc tcc aac tct gcc tcc ctc acc atc tct gga 240Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80ctg aag act gag gac gag gct gac tac tac tgt cag tct tat gat agc 288Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95agc aat cag aga gtg ttc ggc gga ggg acc aag ctg acc gtc cta 333Ser Asn Gln Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11024111PRTArtificial Sequencelight chain variable region 24Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Ser Asn 20 25 30Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95Ser Asn Gln Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11025336DNAArtificial Sequencelight chain variable region 25gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa acc ccg ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11026112PRTArtificial Sequencelight chain variable region 26Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11027336DNAArtificial Sequencelight chain variable region 27gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctt act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11028112PRTArtificial Sequencelight chain variable region 28Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11029336DNAArtificial Sequencelight chain variable region 29gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg caa aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct tat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Tyr Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt gcc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg atc acc ttc ggc caa ggg aca cga ctg gag att aaa 336Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11030112PRTArtificial Sequencelight chain variable region 30Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Tyr Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11031336DNAArtificial Sequencelight chain variable region 31gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc agg gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa ggt 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95aca cac tgg cct ctg acg ttc ggc caa ggg acc aag gtg gag atc aaa 336Thr His Trp Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 11032112PRTArtificial Sequencelight chain variable region 32Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95Thr His Trp Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 11033335DNAArtificial Sequencelight chain variable region 33gaa att gtg atg acg cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25

30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctc act ttc ggc gga ggg acc aag gtg gag atc aa 335Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile 100 105 11034111PRTArtificial Sequencelight chain variable region 34Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile 100 105 11035321DNAArtificial Sequencelight chain variable region 35gac atc cag ttg acc cag tct cca tct tcc gtg tct gcg tct gtc gga 48Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15gac aga gtc acc atc act tgt cgg gcg agt cag ggt att agc agg tgg 96Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Arg Trp 20 25 30tta gcc tgg tat caa cag aaa cca ggg aaa gcc cct aga ctc ctg atc 144Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Leu Leu Ile 35 40 45tat gct gcg tcc ggt tta caa agt ggg gtc cca tca agg ttc agc ggc 192Tyr Ala Ala Ser Gly Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60agt gga tct ggg aca gat ttc act ctc acc atc agc aac ctg cag cct 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro65 70 75 80gaa gat ttt gca act tac tat tgt caa cag gct agc agt ttt cca atc 288Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Ser Ser Phe Pro Ile 85 90 95acc ttc ggc caa ggg aca cga ctg gag act aaa 321Thr Phe Gly Gln Gly Thr Arg Leu Glu Thr Lys 100 10536107PRTArtificial Sequencelight chain variable region 36Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Arg Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Leu Leu Ile 35 40 45Tyr Ala Ala Ser Gly Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Ser Ser Phe Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Thr Lys 100 10537336DNAArtificial Sequencelight chain variable region 37gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt gga gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg tac act ttt ggc cag ggg acc aag ctg gag atc aaa 336Leu Gln Thr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11038112PRTArtificial Sequencelight chain variable region 38Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11039336DNAArtificial Sequencelight chain variable region 39gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60aac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asn Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cca ttc act ttc ggc cct ggg acc aaa gtg gat atc aaa 336Leu Gln Thr Pro Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11040112PRTArtificial Sequencelight chain variable region 40Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asn Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11041336DNAArtificial Sequencelight chain variable region 41gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30cat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144His Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca caa ctt ctg atc tat ttg ggt tct tat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Tyr Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa tct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser 85 90 95cta gaa gtt ccg ttc act ttt ggc cag ggg acc aag ctg gag atc aaa 336Leu Glu Val Pro Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11042112PRTArtificial Sequencelight chain variable region 42Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30His Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Tyr Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser 85 90 95Leu Glu Val Pro Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11043321DNAArtificial Sequencelight chain variable region 43tct tct gag ctg act cag gac cct gct gtg tct gtg gcc ttg gga cag 48Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln1 5 10 15aca gtc agg atc aca tgc caa gga gac agc ctc aga att tat tat aca 96Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ile Tyr Tyr Thr 20 25 30ggc tgg tac caa cag aag cca gga cag gcc cct gtg ctt gtc ctc ttt 144Gly Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Leu Phe 35 40 45ggt aag aac aat cgg ccc tca ggg atc cca gac cga ttc tct ggc tcc 192Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser 50 55 60cac tca ggg aac aca gct tcc ttg acc atc act ggg gct caa gcg gaa 240His Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu65 70 75 80gat gag gct gac tat tac tgt aac tcc cgg gac atc act ggt gtc cat 288Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ile Thr Gly Val His 85 90 95cga ttc ggc gga ggg acc aag ctg acc gtc cta 321Arg Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 10544107PRTArtificial Sequencelight chain variable region 44Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln1 5 10 15Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ile Tyr Tyr Thr 20 25 30Gly Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Leu Phe 35 40 45Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser 50 55 60His Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ile Thr Gly Val His 85 90 95Arg Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 10545336DNAArtificial Sequencelight chain variable region 45gaa att gtg ctg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11046112PRTArtificial Sequencelight chain variable region 46Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11047336DNAArtificial Sequencelight chain variable region 47gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct aac act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Asn Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11048112PRTArtificial Sequencelight chain variable region 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Asn Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11049336DNAArtificial Sequencelight chain variable region 49gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu

Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cca atc act ttc ggc cct ggg acc aaa gtg gat atc aaa 336Leu Gln Thr Pro Ile Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11050112PRTArtificial Sequencelight chain variable region 50Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Ile Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 11051336DNAArtificial Sequencelight chain variable region 51gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac acc tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Thr Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca caa ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agc ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag cct gag gat gtt ggg gtc tat tac tgc atg caa gct 288Ser Arg Val Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta gaa atg ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Glu Met Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11052112PRTArtificial Sequencelight chain variable region 52Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Thr Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Glu Met Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11053321DNAArtificial Sequencelight chain variable region 53gac atc cag ttg acc cag tct cca tcc ttc ctg tct gca tct gta gga 48Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly1 5 10 15gac aga gtc acc atc act tgc cgg gcc agt cag ggc att agc agt tat 96Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30tta gcc tgg tat cag caa aaa cca ggg aaa gcc cct aag ctc ctg atc 144Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45tat gct gca tcc act ttg caa agt ggg gtc cca tca agg ttc agc ggc 192Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60agt gga tct ggg aca gaa ttc act ctc aca atc agc agc ctg cag cct 240Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80gaa gat ttt gca act tat tac tgt caa cag ctt aat agt tac ccc ctc 288Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu 85 90 95act ttc ggc gga ggg acc aag gtg gag atc aaa 321Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10554107PRTArtificial Sequencelight chain variable region 54Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10555315DNAArtificial Sequencelight chain variable region 55tcc tat gtg ctg act cag cca ccc tca gtg tcc gtg tcc cca gga cag 48Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln1 5 10 15aca gcc agc atc acc tgc tct gga gat aaa ttg ggg gat aaa tat gtt 96Thr Ala Ser Ile Thr Cys Ser Gly Asp Lys Leu Gly Asp Lys Tyr Val 20 25 30ggc tgg tat cag caa aag gca ggc caa gcc cct gtt ttg gtc atc tat 144Gly Trp Tyr Gln Gln Lys Ala Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45caa gac aac aag cga ccc tca ggg atc cct gag cga ttc tct ggc tcc 192Gln Asp Asn Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60aac tct ggg aac aca gcc agt ctg acc atc agc ggg acc cag gct atg 240Asn Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Thr Gln Ala Met65 70 75 80gat gag gct gac tat tac tgt cag gcg tgg gac agc ggc acg gtg ttc 288Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Ser Gly Thr Val Phe 85 90 95ggc gga ggg acc aag ctg acc gtc cta 315Gly Gly Gly Thr Lys Leu Thr Val Leu 100 10556105PRTArtificial Sequencelight chain variable region 56Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln1 5 10 15Thr Ala Ser Ile Thr Cys Ser Gly Asp Lys Leu Gly Asp Lys Tyr Val 20 25 30Gly Trp Tyr Gln Gln Lys Ala Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45Gln Asp Asn Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Asn Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Thr Gln Ala Met65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Ser Gly Thr Val Phe 85 90 95Gly Gly Gly Thr Lys Leu Thr Val Leu 100 10557336DNAArtificial Sequencelight chain variable region 57gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa acc ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11058112PRTArtificial Sequencelight chain variable region 58Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11059336DNAArtificial Sequencelight chain variable region 59gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg gaa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Glu Ala 85 90 95cta caa act cca ttc act ttc ggc cct ggg acc aag gtg gaa atc aaa 336Leu Gln Thr Pro Phe Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys 100 105 11060112PRTArtificial Sequencelight chain variable region 60Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Glu Ala 85 90 95Leu Gln Thr Pro Phe Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys 100 105 11061321DNAArtificial Sequencelight chain variable region 61gac atc cag ttg acc cag tct cca tcc tcc ctg tct gcg tct gtg gga 48Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15gac aga gtc acc atc act tgc cgg tca agt caa ggc att ggt tac ttc 96Asp Arg Val Thr Ile Thr Cys Arg Ser Ser Gln Gly Ile Gly Tyr Phe 20 25 30tta aat tgg tat cag cag gaa cca ggg aaa gcc cca aag atc ctg atc 144Leu Asn Trp Tyr Gln Gln Glu Pro Gly Lys Ala Pro Lys Ile Leu Ile 35 40 45tct gct gca tcc act ttg caa agt ggg gtc cca tca agg ttc agt ggc 192Ser Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60agt gga tct ggg aca gat ttc aca ctc tcc atc aac aat ctg caa ccc 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Asn Leu Gln Pro65 70 75 80gca gat ttt gcg aca tac tac tgt caa cag agt cac agt ccc ccg tac 288Ala Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser His Ser Pro Pro Tyr 85 90 95act ttc ggc cag ggg acc aag gtg gag atc aaa 321Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 10562107PRTArtificial Sequencelight chain variable region 62Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ser Ser Gln Gly Ile Gly Tyr Phe 20 25 30Leu Asn Trp Tyr Gln Gln Glu Pro Gly Lys Ala Pro Lys Ile Leu Ile 35 40 45Ser Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Asn Leu Gln Pro65 70 75 80Ala Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser His Ser Pro Pro Tyr 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 10563336DNAArtificial Sequencelight chain variable region 63gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11064112PRTArtificial Sequencelight chain variable region 64Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11065336DNAArtificial Sequencelight chain variable region 65gaa att gtg ctg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atg tat ttg gtt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Met Tyr Leu Val Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gag agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Glu Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa act 288Ser Arg Val Glu

Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Thr 85 90 95cta caa act cct ctc agt ttt ggc cag ggg acc aag ctg gag atc aaa 336Leu Gln Thr Pro Leu Ser Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11066112PRTArtificial Sequencelight chain variable region 66Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Met Tyr Leu Val Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Glu Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Thr 85 90 95Leu Gln Thr Pro Leu Ser Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11067336DNAArtificial Sequencelight chain variable region 67gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11068112PRTArtificial Sequencelight chain variable region 68Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11069330DNAArtificial Sequencelight chain variable region 69aat ttt atg ctg act cag ccc cac tct gtg tcg gcg tct ccg ggg aag 48Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Ala Ser Pro Gly Lys1 5 10 15acg gtt acc atc tcc tgc acc cgc agc agt ggc gac att gac aac aac 96Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Asp Ile Asp Asn Asn 20 25 30tat gtg cag tgg tac cag cag cgc ccg ggc aat tcc ccc acc aat gtg 144Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Asn Ser Pro Thr Asn Val 35 40 45att tat gag gat aac cga aga ccc tct ggg gtc ccg gat cgc ttc tct 192Ile Tyr Glu Asp Asn Arg Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60ggc tcc atc gac agc tcc tcc aac tct gcc tcc ctc acc atc tct gga 240Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80ctg cag cct gag gac gag gct gac tac tat tgt cag tct tat caa agc 288Leu Gln Pro Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Gln Ser 85 90 95gac aat tgg gtg ttc ggc gga ggg acc aag gtg acc gtc cta 330Asp Asn Trp Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu 100 105 11070110PRTArtificial Sequencelight chain variable region 70Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Ala Ser Pro Gly Lys1 5 10 15Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Asp Ile Asp Asn Asn 20 25 30Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Asn Ser Pro Thr Asn Val 35 40 45Ile Tyr Glu Asp Asn Arg Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80Leu Gln Pro Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Gln Ser 85 90 95Asp Asn Trp Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu 100 105 11071330DNAArtificial Sequencelight chain variable region 71aat ttt atg ctg act cag ccc cac tct gtg tcg gag tct ccg ggg aag 48Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15acg gta acc atc tcc tgc acc cgc agc agt ggc agc att gcc agc aac 96Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Ser Asn 20 25 30tat gtg cag tgg tac cag cag cgc ccg ggc agt tcc ccc acc act gtg 144Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45atc tat gag gat aac caa aga ccc tct ggg gtc cct gat cga ttc tct 192Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60ggc tcc atc gac agc tcc tcc aac tct gcc tcc ctc acc atc tct gga 240Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80ctg aag act gag gac gag gct gac tac tac tgt cag tct tat gat agc 288Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95agc aat gtg gtg ttc ggc gga ggg acc aag ctg acc gtc cta 330Ser Asn Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11072110PRTArtificial Sequencelight chain variable region 72Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Ser Asn 20 25 30Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95Ser Asn Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11073336DNAArtificial Sequencelight chain variable region 73gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct ggg 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aac cgg gac tct ggg gtc cca 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Asp Ser Gly Val Pro 50 55 60gac aga ttc agc ggc agt ggg tca ggc act gat ttc aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc agg gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa ggt 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95aca cac tgg ccg tac act ttt ggc cag ggg acc agg ctg gag atc aaa 336Thr His Trp Pro Tyr Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11074112PRTArtificial Sequencelight chain variable region 74Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Asp Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95Thr His Trp Pro Tyr Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11075336DNAArtificial Sequencelight chain variable region 75gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag tcg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Ser Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac ttt ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Phe Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11076112PRTArtificial Sequencelight chain variable region 76Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Ser Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Phe Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11077336DNAArtificial Sequencelight chain variable region 77gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa acc ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11078112PRTArtificial Sequencelight chain variable region 78Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11079321DNAArtificial Sequencelight chain variable region 79gaa acg aca ctc acg cag tct cca gcc acc ctg tct ttg tct cca ggg 48Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly1 5 10 15caa aga gcc acc ctc tcc tgc agg gcc agt cag agt gtc tac aac tac 96Gln Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Tyr Asn Tyr 20 25 30tta gcc tgg tac caa cag aag cct ggc cag gct ccc agg ctc ctc atc 144Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45tat gat gca tcc aga agg gca act ggc atc cca gcc agg ttc agt ggc 192Tyr Asp Ala Ser Arg Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60agt ggg tct ggg aca gac ttc act ctc acc atc agc agc cta gag cct 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80gaa gat ttt gca gtt tat tac tgt cag cag cgt aac aac tgg ccg ctc 288Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Asn Asn Trp Pro Leu 85 90 95act ttc ggt gga ggg acc aag gtg gag atc aaa 321Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10580107PRTArtificial Sequencelight chain variable region 80Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly1 5 10 15Gln Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Tyr Asn Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Asp Ala Ser Arg Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Asn Asn Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10581321DNAArtificial Sequencelight chain variable region 81gac atc cag ttg acc cag tct cca tcc tcc ctg tct gct tct gtt gga 48Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15gac agc gtc acc atc tct tgc cgg gca agt cag agt cct ggc atc ttt 96Asp Ser Val Thr Ile Ser Cys Arg Ala Ser Gln Ser Pro Gly Ile Phe 20 25 30tta aat tgg tat cag cag ata cca ggg aaa gcc cct aaa ctc ctg atc 144Leu Asn Trp Tyr Gln Gln Ile Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45tac gct aca tcc act ctg gaa agt ggg gtc ccc ccc agg ttc acc ggc 192Tyr Ala Thr Ser Thr Leu Glu Ser Gly Val Pro Pro Arg Phe Thr Gly 50 55 60agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80gag gac ttt gca act tac tac tgt caa cag agt aac agt gtt ccg ctc 288Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Asn Ser Val Pro Leu 85 90 95act ttc ggc ggc ggg acc aag gtg gag atc aaa 321Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10582107PRTArtificial

Sequencelight chain variable region 82Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Ser Val Thr Ile Ser Cys Arg Ala Ser Gln Ser Pro Gly Ile Phe 20 25 30Leu Asn Trp Tyr Gln Gln Ile Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Thr Ser Thr Leu Glu Ser Gly Val Pro Pro Arg Phe Thr Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Asn Ser Val Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10583336DNAArtificial Sequencelight chain variable region 83gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca cta aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct cta acc ttc ggc caa ggg aca cga ctg gag att aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11084112PRTArtificial Sequencelight chain variable region 84Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 11085321DNAArtificial Sequencelight chain variable region 85gaa att gtg atg acg cag tct cca gcc acc ctg tct gtg tct cca ggg 48Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15gaa aga gcc acc ttc tcc tgt agg gcc agt cag agt gtt ggc agc aac 96Glu Arg Ala Thr Phe Ser Cys Arg Ala Ser Gln Ser Val Gly Ser Asn 20 25 30tta gcc tgg tac cag cag aaa cct ggc cag gct ccc agg ctc ctc atc 144Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45tat gat gca tcc aac agg gcc act ggc atc cca gcc agg ttc agt ggc 192Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60agt ggg tct ggg aca gac ttc act ctc acc atc agc aga ctg gag cct 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro65 70 75 80gaa gat ttt gca gtg tat tac tgt cag cag cgt agc aac tgg ccc ctc 288Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Leu 85 90 95act ttc ggc gga ggg acc aag gtg gag atc aaa 321Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10586107PRTArtificial Sequencelight chain variable region 86Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr Phe Ser Cys Arg Ala Ser Gln Ser Val Gly Ser Asn 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10587336DNAArtificial Sequencelight chain variable region 87gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccg ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11088112PRTArtificial Sequencelight chain variable region 88Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11089336DNAArtificial Sequencelight chain variable region 89gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tac ttg ggt tct act cgg gcc tcc ggc gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Thr Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act cct tac act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11090112PRTArtificial Sequencelight chain variable region 90Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Thr Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11091336DNAArtificial Sequencelight chain variable region 91gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95cta caa act ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11092112PRTArtificial Sequencelight chain variable region 92Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11093336DNAArtificial Sequencelight chain variable region 93gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat act 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Thr 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cgg ctc ctg atc tat ttg ggt ttt aat cgg gcc tcc ggg gtc cct 192Pro Arg Leu Leu Ile Tyr Leu Gly Phe Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgt atg caa ggt 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95cta caa act ccc ctc act ttc ggc gga ggg acc aag gtg gag atc aaa 336Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11094112PRTArtificial Sequencelight chain variable region 94Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Thr 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Arg Leu Leu Ile Tyr Leu Gly Phe Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11095336DNAArtificial Sequencelight chain variable region 95gat gtt gtg atg act cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30aat gga tac aac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctc ctg atc tat ttg ggt tct aat cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc agg gtg gag gct gag gat gtt ggg gtt tat tat tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95aca cac tgg ccg tac act ttt ggc cag ggg acc aag ctg gag atc aaa 336Thr His Trp Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11096112PRTArtificial Sequencelight chain variable region 96Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Thr His Trp Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11097330DNAArtificial Sequencelight chain variable region 97aat ttt atg ctg act cag ccc cac tct gtg tcg gag tct ccg ggg aag 48Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15acg gta agc atc tcc tgc acc cgc aac agt ggc agc att gcc agc aac 96Thr Val Ser Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ser Asn 20 25 30ttt gtg cag tgg tac cag cag cgc ccg ggc agt gcc ccc acc att gta 144Phe Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ala Pro Thr Ile Val 35 40 45atc tat gag gat aac caa aga ccc tct gcg gtc cct act cgg ttc tct 192Ile Tyr Glu Asp Asn Gln Arg Pro Ser Ala Val Pro Thr Arg Phe Ser 50 55 60ggc tcc atc gac agg tcc tcc aac tct gcc tcc ctc acc atc tct gga 240Gly Ser Ile Asp Arg Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80ctg acg act gag gac gag gct gac tac tac tgt cag tct tat gat agc 288Leu Thr Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95gcc aat gtc att ttc ggc ggg ggg acc aag ctg acc gtc cta 330Ala Asn Val Ile Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11098110PRTArtificial Sequencelight chain variable region 98Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15Thr Val Ser Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ser Asn 20 25

30Phe Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ala Pro Thr Ile Val 35 40 45Ile Tyr Glu Asp Asn Gln Arg Pro Ser Ala Val Pro Thr Arg Phe Ser 50 55 60Gly Ser Ile Asp Arg Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80Leu Thr Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95Ala Asn Val Ile Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11099324DNAArtificial Sequencelight chain variable region 99gaa acg aca ctc acg cag tct cca ggc acc ctg tct ttg tct cca ggg 48Glu Thr Thr Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15gag aga gcc acc ctc tcc tgc agg gcc agt cag act atc agc agc agc 96Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Thr Ile Ser Ser Ser20 25 30cac tta gcc tgg tac cag cag aaa cct ggc cag tct ccc agg ctc ctc 144His Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Arg Leu Leu35 40 45atc tat ggt gcg ggc tac agg gcc acc ggc att cca gac agg ttc agt 192Ile Tyr Gly Ala Gly Tyr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser50 55 60ggc agt ggg tct ggc aca gac ttc act ctc acc atc agc aga ctg gag 240Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75 80cct gaa gat ttt gca gtg tat tac tgt cag cac tat ggt agt tca ctc 288Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Tyr Gly Ser Ser Leu 85 90 95cgg acg ttc ggc caa ggg acc aag gtg gaa atc aaa 324Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105100108PRTArtificial Sequencelight chain variable region 100Glu Thr Thr Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Thr Ile Ser Ser Ser 20 25 30His Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Arg Leu Leu 35 40 45Ile Tyr Gly Ala Gly Tyr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Tyr Gly Ser Ser Leu 85 90 95Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105101330DNAArtificial Sequencelight chain variable region 101aat ttt atg ctg act cag ccc cac tct gtg tcg gag tct ccg ggg aag 48Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15acg gta acc atc tcc tgc acc ggc agc ggt ggc aac att gcc agc aat 96Thr Val Thr Ile Ser Cys Thr Gly Ser Gly Gly Asn Ile Ala Ser Asn 20 25 30tat gtg cag tgg tac cag cag cgc ccg ggc agg gcc ccc acc act gtg 144Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Arg Ala Pro Thr Thr Val 35 40 45atc tat gag gat aat cga aga ccc tct ggg gtc cct gat cgg ttc tct 192Ile Tyr Glu Asp Asn Arg Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60ggc tcc atc gac agc tcc tcc aac tct gcc tcc ctc acc atc tct gga 240Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80ctg aag act gaa gac gag gct gac tac tac tgt cag tct tat gat ccc 288Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Pro 85 90 95tac aat cga gtg ttc ggc gga ggg acc aag ctg acc gtc cta 330Tyr Asn Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110102110PRTArtificial Sequencelight chain variable region 102Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys1 5 10 15Thr Val Thr Ile Ser Cys Thr Gly Ser Gly Gly Asn Ile Ala Ser Asn 20 25 30Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Arg Ala Pro Thr Thr Val 35 40 45Ile Tyr Glu Asp Asn Arg Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly65 70 75 80Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Pro 85 90 95Tyr Asn Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110103336DNAArtificial Sequencelight chain variable region 103gaa att gtg atg acg cag tct cca ctc tcc ctg ccc gtc acc cct gga 48Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ctg cat act 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Thr 20 25 30aat gga tac gac tat ttg gat tgg tac ctg cag aag cca ggg cag tct 144Asn Gly Tyr Asp Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45cca cag ctt ctg atc tat ttg ggt tct act cgg gcc tcc ggg gtc cct 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Thr Arg Ala Ser Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tcg ggc aca gat ttt aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80agc aga gtg gag gct gag gat gtt ggg gtt tat tac tgc atg caa gct 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95ttt caa act ccg ctc act ttc ggc gga ggg acc aag atg gag atc aaa 336Phe Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Met Glu Ile Lys 100 105 110104112PRTArtificial Sequencelight chain variable region 104Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Thr 20 25 30Asn Gly Tyr Asp Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Thr Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Phe Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Met Glu Ile Lys 100 105 110105351DNAArtificial Sequenceheavy chain variable region 105gag gtg cag ctg gtg gag acc ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Thr Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ttt aat tac tat gat agt agt gtc tgg ggc cag gga acc ctg 336Ala Arg Phe Asn Tyr Tyr Asp Ser Ser Val Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115106117PRTArtificial Sequenceheavy chain variable region 106Glu Val Gln Leu Val Glu Thr Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Phe Asn Tyr Tyr Asp Ser Ser Val Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115107348DNAArtificial Sequenceheavy chain variable region 107gag gtg cag ctg gtg gag acc ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Thr Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggg gtt gag cag att gac tac tgg ggc cag gga acc ctg gtc 336Ala Arg Gly Val Glu Gln Ile Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110acc gtc tca agc 348Thr Val Ser Ser 115108116PRTArtificial Sequenceheavy chain variable region 108Glu Val Gln Leu Val Glu Thr Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Val Glu Gln Ile Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110Thr Val Ser Ser 115109354DNAArtificial Sequenceheavy chain variable region 109cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg act gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa aat tta gca gca ggg gcg gtt gcc tac tgg ggc cag ggc acc 336Ala Lys Asn Leu Ala Ala Gly Ala Val Ala Tyr Trp Gly Gln Gly Thr 100 105 110ctg gtc acc gtc tca agc 354Leu Val Thr Val Ser Ser 115110118PRTArtificial Sequenceheavy chain variable region 110Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asn Leu Ala Ala Gly Ala Val Ala Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 115111351DNAArtificial Sequenceheavy chain variable region 111cag gtg cag cta cag cag tgg ggc gca gga ctg ttg aag cct tcg gag 48Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggg tcc ttc agt ggt tac 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Phe Ser Gly Tyr 20 25 30tac tgg agc tgg atc cgt cag ccc cca ggg aag ggg ctg gag tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg gaa atc aat cat agt gga agt acc aac tac aac cgg tcc ctc aag 192Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Arg Ser Leu Lys 50 55 60agt cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg agc tct gtg acc gcc gcg gac acg gct gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95aga ctt tca tat ggt tcg ggc gtt gac tac tgg ggc cag ggc acc ctg 336Arg Leu Ser Tyr Gly Ser Gly Val Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115112117PRTArtificial Sequenceheavy chain variable region 112Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Phe Ser Gly Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Arg Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Leu Ser Tyr Gly Ser Gly Val Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115113360DNAArtificial Sequenceheavy chain variable region 113cag ctg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tca cag 48Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg agg tat agc agc agc cgc aat gat gct ttt gat atc tgg ggc caa 336Ala Arg Tyr Ser Ser Ser Arg Asn Asp Ala Phe Asp Ile Trp Gly Gln

100 105 110ggg aca atg gtc acc gtc tca agc 360Gly Thr Met Val Thr Val Ser Ser 115 120114120PRTArtificial Sequenceheavy chain variable region 114Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Tyr Ser Ser Ser Arg Asn Asp Ala Phe Asp Ile Trp Gly Gln 100 105 110Gly Thr Met Val Thr Val Ser Ser 115 120115354DNAArtificial Sequenceheavy chain variable region 115cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat ggg cag ctg gat gct ttt gat atc tgg ggc caa ggg aca 336Ala Arg Asp Gly Gln Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110atg gtc acc gtc tca agc 354Met Val Thr Val Ser Ser 115116118PRTArtificial Sequenceheavy chain variable region 116Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Gly Gln Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Met Val Thr Val Ser Ser 115117354DNAArtificial Sequenceheavy chain variable region 117cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ttt tgg gac tac tac ggt atg gac gtc tgg ggc caa ggg acc 336Ala Arg Phe Trp Asp Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110acg gtc acc gtc tca agc 354Thr Val Thr Val Ser Ser 115118118PRTArtificial Sequenceheavy chain variable region 118Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Phe Trp Asp Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110Thr Val Thr Val Ser Ser 115119351DNAArtificial Sequenceheavy chain variable region 119cag gtg cag cta cag cag tgg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60gag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Glu Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gca gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cgg tac tac ggt atg gac gtc tgg ggc caa ggg acc acg 336Ala Arg Asp Arg Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115120117PRTArtificial Sequenceheavy chain variable region 120Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Glu Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr 100 105 110Val Thr Val Ser Ser 115121354DNAArtificial Sequenceheavy chain variable region 121gag gtg cag ctg gtc gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg tac atc tat tat agt ggg agc acc tac tac aac ccg tcc ctc 192Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc atg tca gta gac acg tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gca gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga tgg agc tac ttg gat gct ttt gat atc tgg ggc caa ggg aca 336Ala Arg Trp Ser Tyr Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110atg gtc acc gtc tca agc 354Met Val Thr Val Ser Ser 115122118PRTArtificial Sequenceheavy chain variable region 122Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Ser Tyr Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Met Val Thr Val Ser Ser 115123354DNAArtificial Sequenceheavy chain variable region 123gag gtg cag ctg gtg gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat tac gat att ttc ggt atg gac gtc tgg ggc caa ggg acc 336Ala Arg Asp Tyr Asp Ile Phe Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110acg gtc acc gtc tca agc 354Thr Val Thr Val Ser Ser 115124118PRTArtificial Sequenceheavy chain variable region 124Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Tyr Asp Ile Phe Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110Thr Val Thr Val Ser Ser 115125354DNAArtificial Sequenceheavy chain variable region 125cag ctg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag tcc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Ser Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gcc aac aga gat gat gct ttt gat atc tgg ggc caa ggg aca 336Ala Arg Ala Asn Arg Asp Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110atg gtc acc gtc tca agc 354Met Val Thr Val Ser Ser 115126118PRTArtificial Sequenceheavy chain variable region 126Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Ser Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ala Asn Arg Asp Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Met Val Thr Val Ser Ser 115127357DNAArtificial Sequenceheavy chain variable region 127gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta cag ccg ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt agc agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cgg ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agt ctg agc gcc gac gac acg gcc gta tat ttc tgt 288Leu Gln Met Asn Ser Leu Ser Ala Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95gcg tcg ggt ggc tgg tac ggg gac tac ttt gac tac tgg ggc cag gga 336Ala Ser Gly Gly Trp Tyr Gly Asp Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115128119PRTArtificial Sequenceheavy chain variable region 128Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Ser Ala Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95Ala Ser Gly Gly Trp Tyr Gly Asp Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115129363DNAArtificial Sequenceheavy chain variable region 129cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5

10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gaa ggg aac cga acg gtg act agt gct ttt gat atc tgg ggc 336Ala Arg Glu Gly Asn Arg Thr Val Thr Ser Ala Phe Asp Ile Trp Gly 100 105 110caa ggg aca atg gtc acc gtc tca agc 363Gln Gly Thr Met Val Thr Val Ser Ser 115 120130121PRTArtificial Sequenceheavy chain variable region 130Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Glu Gly Asn Arg Thr Val Thr Ser Ala Phe Asp Ile Trp Gly 100 105 110Gln Gly Thr Met Val Thr Val Ser Ser 115 120131357DNAArtificial Sequenceheavy chain variable region 131cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tac tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggg ctg ggg gat agt agt ggt tat atc ctt tgg ggc caa ggg 336Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115132119PRTArtificial Sequenceheavy chain variable region 132Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115133357DNAArtificial Sequenceheavy chain variable region 133cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tac tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggg ctg ggg gat agt agt ggt tat atc ctt tgg ggc caa ggg 336Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115134119PRTArtificial Sequenceheavy chain variable region 134Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115135357DNAArtificial Sequenceheavy chain variable region 135cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga tgg acc ggg cgt act gat gct ttt gat atc tgg ggc caa ggg 336Ala Arg Trp Thr Gly Arg Thr Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115136119PRTArtificial Sequenceheavy chain variable region 136Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Thr Gly Arg Thr Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115137354DNAArtificial Sequenceheavy chain variable region 137cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga caa ggg gcg tta gat gct ttt gat atc tgg ggc caa ggg acc 336Ala Arg Gln Gly Ala Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110acg gtc acc gtc tca agc 354Thr Val Thr Val Ser Ser 115138118PRTArtificial Sequenceheavy chain variable region 138Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gln Gly Ala Leu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Thr Val Thr Val Ser Ser 115139366DNAArtificial Sequenceheavy chain variable region 139cag gtg cag ctg gtg gag tcc ggg gga ggc gtg gtc cga cct ggg ggg 48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttt agc agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45tca act att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192Ser Thr Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cgg ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg cag atg aac agc ctg aga gcc gag gac acg gcc gta tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa gag cgt ggc agt ggc tgg tcc tta gac aat atg gac gtc tgg 336Ala Lys Glu Arg Gly Ser Gly Trp Ser Leu Asp Asn Met Asp Val Trp 100 105 110ggc caa ggg acc acg gtc acc gtc tca agc 366Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120140122PRTArtificial Sequenceheavy chain variable region 140Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Glu Arg Gly Ser Gly Trp Ser Leu Asp Asn Met Asp Val Trp 100 105 110Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120141357DNAArtificial Sequenceheavy chain variable region 141cag gtg cag ctg gtg gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat agc agt ggg ttc tac ggt atg gac gtc tgg ggc caa ggg 336Ala Arg Asp Ser Ser Gly Phe Tyr Gly Met Asp Val Trp Gly Gln Gly 100 105 110acc acg gtc acc gtc tca agc 357Thr Thr Val Thr Val Ser Ser 115142119PRTArtificial Sequenceheavy chain variable region 142Gln Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Ser Ser Gly Phe Tyr Gly Met Asp Val Trp Gly Gln Gly 100 105 110Thr Thr Val Thr Val Ser Ser 115143360DNAArtificial Sequenceheavy chain variable region 143cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg act gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga agc agc agc tgg tac tgg aat gct ttt gat atc tgg ggc caa 336Ala Arg Ser Ser Ser Trp Tyr Trp Asn Ala Phe Asp Ile Trp Gly Gln

100 105 110ggg aca atg gtc acc gtc tca agc 360Gly Thr Met Val Thr Val Ser Ser 115 120144120PRTArtificial Sequenceheavy chain variable region 144Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ser Ser Ser Trp Tyr Trp Asn Ala Phe Asp Ile Trp Gly Gln 100 105 110Gly Thr Met Val Thr Val Ser Ser 115 120145351DNAArtificial Sequenceheavy chain variable region 145cag gtg cag cta cag cag tgg ggc cca gca ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Gln Trp Gly Pro Ala Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc tct gtc tct ggt gtc tcc atc acc agt aat 96Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Val Ser Ile Thr Ser Asn 20 25 30atc tgg tgg agt tgg gtc cgc cag tcc cca ggg aag ggg ctg gag tgg 144Ile Trp Trp Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa gtc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Val Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gct gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg ggg tac cgt agc ttc ggg gag tcc tac tgg ggc cag gga acc ctg 336Ala Gly Tyr Arg Ser Phe Gly Glu Ser Tyr Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115146117PRTArtificial Sequenceheavy chain variable region 146Gln Val Gln Leu Gln Gln Trp Gly Pro Ala Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Val Ser Ile Thr Ser Asn 20 25 30Ile Trp Trp Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Val Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Gly Tyr Arg Ser Phe Gly Glu Ser Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115147366DNAArtificial Sequenceheavy chain variable region 147cag gtg cag cta cag cag tgg ggc gca ggg ctg ttg aag cct tcg gag 48Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15acc ctg tct ctc acc tgc gtt gtc tat ggt ggg tcc ttc agc gat ttc 96Thr Leu Ser Leu Thr Cys Val Val Tyr Gly Gly Ser Phe Ser Asp Phe 20 25 30tac tgg agc tgg atc cgc cag ccc cca ggg aag ggg cca gag tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Pro Glu Trp Ile 35 40 45ggg gaa gtc aat cct aga gga agc acc aac tac aac ccg tcc ctc aag 192Gly Glu Val Asn Pro Arg Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gcc acc ata tca cta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Ala Thr Ile Ser Leu Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg agt tct gtg acc gcc gcg gac acg gct gtg tat ttc tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Phe Cys Ala 85 90 95aga ggt cct cgg ccc ggg aga gat ggc tac aat tac ttt gac aac tgg 336Arg Gly Pro Arg Pro Gly Arg Asp Gly Tyr Asn Tyr Phe Asp Asn Trp 100 105 110ggc cag ggc acc ctg gtc acc gtc tca agc 366Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120148122PRTArtificial Sequenceheavy chain variable region 148Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Val Val Tyr Gly Gly Ser Phe Ser Asp Phe 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Pro Glu Trp Ile 35 40 45Gly Glu Val Asn Pro Arg Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Ala Thr Ile Ser Leu Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Phe Cys Ala 85 90 95Arg Gly Pro Arg Pro Gly Arg Asp Gly Tyr Asn Tyr Phe Asp Asn Trp 100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120149357DNAArtificial Sequenceheavy chain variable region 149cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggt ata gca gca gct ggt caa ggt gac tac tgg ggc cag gga 336Ala Arg Gly Ile Ala Ala Ala Gly Gln Gly Asp Tyr Trp Gly Gln Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115150119PRTArtificial Sequenceheavy chain variable region 150Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Ile Ala Ala Ala Gly Gln Gly Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115151363DNAArtificial Sequenceheavy chain variable region 151cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30agt tac tac tgg ggc tgg atc cgc cag ccc cca ggg aag ggg ctg gag 144Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45tgg att ggg agt atc tat tat agt ggg agc acc tac tac aac ccg tcc 192Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60ctc aag agt cga gtc acc ata tcc gta gac acg tcc aag aac cag ttc 240Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe65 70 75 80tcc ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac 288Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95tgt gcg aga gat ggg gga tac tac tac tac ggt atg gac gtc tgg ggc 336Cys Ala Arg Asp Gly Gly Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly 100 105 110caa ggg acc acg gtc acc gtc tca agc 363Gln Gly Thr Thr Val Thr Val Ser Ser 115 120152121PRTArtificial Sequenceheavy chain variable region 152Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe65 70 75 80Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Asp Gly Gly Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly 100 105 110Gln Gly Thr Thr Val Thr Val Ser Ser 115 120153351DNAArtificial Sequenceheavy chain variable region 153cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg agt agt ggt tat gat gct ttt gat atc tgg ggc caa ggg acc acg 336Ala Ser Ser Gly Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Thr 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115154117PRTArtificial Sequenceheavy chain variable region 154Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Ser Ser Gly Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Thr 100 105 110Val Thr Val Ser Ser 115155357DNAArtificial Sequenceheavy chain variable region 155cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aat tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gca cga tac agc tat gga acg gta gga att gac tac tgg ggc cag gga 336Ala Arg Tyr Ser Tyr Gly Thr Val Gly Ile Asp Tyr Trp Gly Gln Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115156119PRTArtificial Sequenceheavy chain variable region 156Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Tyr Ser Tyr Gly Thr Val Gly Ile Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115157351DNAArtificial Sequenceheavy chain variable region 157gag gtg cag ctg gtg cag tct ggg gga ggc gtg gtc cag cct ggg acg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Thr1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc agc ttc aga agt cat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Arg Ser His 20 25 30ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata tca tat gat gga agt aat aaa tac tat gca gac tcc gtg 192Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg act ata ggg ccg ggg gga ttt gac tac tgg ggc cag ggc acc ctg 336Ala Thr Ile Gly Pro Gly Gly Phe Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115158117PRTArtificial Sequenceheavy chain variable region 158Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Thr1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Arg Ser His 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Thr Ile Gly Pro Gly Gly Phe Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115159357DNAArtificial Sequenceheavy chain

variable region 159cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc att aga aat tac 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Arg Asn Tyr 20 25 30tac tgg agt tgg atc cgg cag ccc cca ggg aag gga ctg gag tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg tat att tct gac agt ggg aat acc aac tac aat ccc tcc ctc aag 192Gly Tyr Ile Ser Asp Ser Gly Asn Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc cta 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg acc tct gtg acc gcc aca gac acg gct gcg tat ttc tgt gcg 288Lys Leu Thr Ser Val Thr Ala Thr Asp Thr Ala Ala Tyr Phe Cys Ala 85 90 95aga cat cga agc agc tgg gca tgg tac ttc gat ctc tgg ggc cgt ggc 336Arg His Arg Ser Ser Trp Ala Trp Tyr Phe Asp Leu Trp Gly Arg Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115160119PRTArtificial Sequenceheavy chain variable region 160Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Arg Asn Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Tyr Ile Ser Asp Ser Gly Asn Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Thr Ser Val Thr Ala Thr Asp Thr Ala Ala Tyr Phe Cys Ala 85 90 95Arg His Arg Ser Ser Trp Ala Trp Tyr Phe Asp Leu Trp Gly Arg Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115161354DNAArtificial Sequenceheavy chain variable region 161cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gtg ggc agt ggc tgg tac gtt gac tac tgg ggc cag gga acc 336Ala Arg Val Gly Ser Gly Trp Tyr Val Asp Tyr Trp Gly Gln Gly Thr 100 105 110ctg gtc acc gtc tca agc 354Leu Val Thr Val Ser Ser 115162118PRTArtificial Sequenceheavy chain variable region 162Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Val Gly Ser Gly Trp Tyr Val Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 115163360DNAArtificial Sequenceheavy chain variable region 163cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gtt tct ggc tac tac tac tac ggt atg gac gtc tgg ggc caa 336Ala Arg Val Ser Gly Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln 100 105 110ggg acc acg gtc acc gtc tca agc 360Gly Thr Thr Val Thr Val Ser Ser 115 120164120PRTArtificial Sequenceheavy chain variable region 164Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Val Ser Gly Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115 120165369DNAArtificial Sequenceheavy chain variable region 165gag gtc cag ctg gta cag tct ggg gga ggc gtg gtc cag cct ggg agg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata tca tat gat gga agt aat aaa tac tat gca gac tcc gtg 192Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa gcg tat agc agt ggc tgg tac gac tac tac ggt atg gac gtc 336Ala Lys Ala Tyr Ser Ser Gly Trp Tyr Asp Tyr Tyr Gly Met Asp Val 100 105 110tgg ggc caa ggg acc acg gtc acc gtc tca agc 369Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120166123PRTArtificial Sequenceheavy chain variable region 166Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Ala Tyr Ser Ser Gly Trp Tyr Asp Tyr Tyr Gly Met Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120167351DNAArtificial Sequenceheavy chain variable region 167cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gcc agc gtt gat gct ttt gat atc tgg ggc caa ggg aca atg 336Ala Arg Ala Ser Val Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115168117PRTArtificial Sequenceheavy chain variable region 168Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ala Ser Val Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met 100 105 110Val Thr Val Ser Ser 115169357DNAArtificial Sequenceheavy chain variable region 169cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tac tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggg ctg ggg gat agt agt ggt tat atc ctt tgg ggc caa ggg 336Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115170119PRTArtificial Sequenceheavy chain variable region 170Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Leu Gly Asp Ser Ser Gly Tyr Ile Leu Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115171348DNAArtificial Sequenceheavy chain variable region 171cag gta cag ctg cag cag tca ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg act ccc gag gac acg gct gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gca aga gat cac ggc ccc ttt gac tac tgg ggc cgg gga acc ctg gtc 336Ala Arg Asp His Gly Pro Phe Asp Tyr Trp Gly Arg Gly Thr Leu Val 100 105 110acc gtc tca agc 348Thr Val Ser Ser 115172116PRTArtificial Sequenceheavy chain variable region 172Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp His Gly Pro Phe Asp Tyr Trp Gly Arg Gly Thr Leu Val 100 105 110Thr Val Ser Ser 115173360DNAArtificial Sequenceheavy chain variable region 173cag gtg cag ctg gtg caa tct ggg gga ggc gtg gtc cag cct ggg agg 48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc gcc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg gtt 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45tca tac att agt agt agt agt agt acc ata tac tac gca gac tct gtg 192Ser Tyr Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gcc gag gac acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cga ttt ggg tcg ggg cac ttg ccc gac tac

tgg ggc cag 336Ala Arg Asp Arg Phe Gly Ser Gly His Leu Pro Asp Tyr Trp Gly Gln 100 105 110gga acc ctg gtc acc gtc tca agc 360Gly Thr Leu Val Thr Val Ser Ser 115 120174120PRTArtificial Sequenceheavy chain variable region 174Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Tyr Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Phe Gly Ser Gly His Leu Pro Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120175357DNAArtificial Sequenceheavy chain variable region 175cag gtg cag cta cag cag tgg ggc gca gga ctg ttg aag cct tcg gag 48Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tat ggt ggg tcc ttc agt ggt tac 96Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30tac tgg agc tgg atc cgc cag ccc cca ggg aag ggg ctg gag tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg gaa atc aat cat agt gga agc acc aac tac aac ccg tcc ctc aag 192Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg agc tct gtg acc gcc gcg gac acg gct gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95aga gtt ggg tat agc agt ggc cgt gac gtt gac tac tgg ggc cag ggc 336Arg Val Gly Tyr Ser Ser Gly Arg Asp Val Asp Tyr Trp Gly Gln Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115176119PRTArtificial Sequenceheavy chain variable region 176Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Val Gly Tyr Ser Ser Gly Arg Asp Val Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115177360DNAArtificial Sequenceheavy chain variable region 177gag gtc cag ctg gtg gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg atc cgg cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat agc agc agc tgg tac tac ggt atg gac gtc tgg ggc caa 336Ala Arg Asp Ser Ser Ser Trp Tyr Tyr Gly Met Asp Val Trp Gly Gln 100 105 110ggg acc acg gtc acc gtc tca agc 360Gly Thr Thr Val Thr Val Ser Ser 115 120178120PRTArtificial Sequenceheavy chain variable region 178Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Ser Ser Ser Trp Tyr Tyr Gly Met Asp Val Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115 120179348DNAArtificial Sequenceheavy chain variable region 179gag gtc cag ctg gtg gag tcc ggc cca gga ctg gtg aag cct tcg gag 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gta tat tat tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga tcg acg tgg tcc ctt gac tac tgg ggc cag ggc acc ctg gtc 336Ala Arg Ser Thr Trp Ser Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110acc gtc tca agc 348Thr Val Ser Ser 115180116PRTArtificial Sequenceheavy chain variable region 180Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ser Thr Trp Ser Leu Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110Thr Val Ser Ser 115181354DNAArtificial Sequenceheavy chain variable region 181gag gtc cag ctg gtg gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gta tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ctc tcg ttt gcc gat cct ttt gat atc tgg ggc caa ggg aca 336Ala Arg Leu Ser Phe Ala Asp Pro Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110atg gtc acc gtc tca agc 354Met Val Thr Val Ser Ser 115182118PRTArtificial Sequenceheavy chain variable region 182Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Leu Ser Phe Ala Asp Pro Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Met Val Thr Val Ser Ser 115183366DNAArtificial Sequenceheavy chain variable region 183cag gtc cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg tcc 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15tcg gtg aag gtc tcc tgc aag gct tct gga ggc acc ttc agc agc tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30gct atc agc tgg gtg cga cag gcc cct gga caa ggg ctt gag tgg atg 144Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga agg atc atc ccc atc ctt ggt ata gca aac tac gca cag aag ttc 192Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe 50 55 60cag ggc aga gtc acg att acc gcg gac aaa tcc acg agc aca gcc tac 240Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gca tat ggt tcg ggg agt tat tac gac tac tac tac atg gac gtc tgg 336Ala Tyr Gly Ser Gly Ser Tyr Tyr Asp Tyr Tyr Tyr Met Asp Val Trp 100 105 110ggc aaa ggg acc acg gtc acc gtc tca agc 366Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120184122PRTArtificial Sequenceheavy chain variable region 184Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Tyr Gly Ser Gly Ser Tyr Tyr Asp Tyr Tyr Tyr Met Asp Val Trp 100 105 110Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120185357DNAArtificial Sequenceheavy chain variable region 185gag gtc cag ctg gtg cag tct ggg gga ggc ttg gtc cag cct ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt tca gcc tcc gga ttc acc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30gct atg cac tgg gtc cgc cag gct cca ggg aag gga ctg gaa tat gtt 144Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val 35 40 45tca act att agt agt aat ggg gat agc aca tac tac gca gac tcc gtg 192Ser Thr Ile Ser Ser Asn Gly Asp Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa gaa gaa gta tgg cta cag gct ttt gat atc tgg ggc caa ggg 336Ala Lys Glu Glu Val Trp Leu Gln Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115186119PRTArtificial Sequenceheavy chain variable region 186Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val 35 40 45Ser Thr Ile Ser Ser Asn Gly Asp Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Glu Glu Val Trp Leu Gln Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115187345DNAArtificial Sequenceheavy chain variable region 187cag ctg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agt agt aac 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Asn 20 25 30tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg att 144Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg gaa atc tat cat agt ggg agc acc aac tac aac ccc tcc ctc aag 192Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gtc acc atc tca gta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95aga gat aag gga tac atg gac gtc tgg ggc aaa ggg acc acg gtc acc 336Arg Asp Lys Gly Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr 100 105 110gtc tca agc 345Val Ser Ser 115188115PRTArtificial Sequenceheavy chain variable region 188Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Asn 20 25 30Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Asp Lys Gly Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr 100 105 110Val Ser Ser 115189363DNAArtificial

Sequenceheavy chain variable region 189cag gta cag ctg cag cag tca ggg gct gag gtg aag aag cct ggg tcc 48Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15tcg gtg aag gtc tcc tgc aag gct tct gga ggc acc ttc agc agc tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30gct atc agc tgg gtg cga cag gcc cct gga caa ggg ctt gag tgg atg 144Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga agg atc atc cct atc ctt ggt ata gca aac tac gca cag aag ttc 192Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe 50 55 60cag ggc aga gtc acg att acc gcg gac aaa tcc acg agc aca gcc tac 240Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cat agg ttc gac tac gcc tgg tac ttc gat ctc tgg ggc 336Ala Arg Asp His Arg Phe Asp Tyr Ala Trp Tyr Phe Asp Leu Trp Gly 100 105 110cgt ggc acc ctg gtc acc gtc tca agc 363Arg Gly Thr Leu Val Thr Val Ser Ser 115 120190121PRTArtificial Sequenceheavy chain variable region 190Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp His Arg Phe Asp Tyr Ala Trp Tyr Phe Asp Leu Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val Ser Ser 115 120191351DNAArtificial Sequenceheavy chain variable region 191cag gtg cag ctg cag gag tcg ggc cca gga ctg ctg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Leu Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agc 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg gag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Glu Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtc tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cta acg ggg agt ctt gac tac tgg ggc cag gga acc ctg 336Ala Arg Asp Leu Thr Gly Ser Leu Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115192117PRTArtificial Sequenceheavy chain variable region 192Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Leu Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Glu Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Leu Thr Gly Ser Leu Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115193351DNAArtificial Sequenceheavy chain variable region 193cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ata cgc tat gat gct ttt gat atc tgg ggc caa ggg aca atg 336Ala Arg Ile Arg Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met 100 105 110gtc acc gtc tca agc 351Val Thr Val Ser Ser 115194117PRTArtificial Sequenceheavy chain variable region 194Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ile Arg Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met 100 105 110Val Thr Val Ser Ser 115195354DNAArtificial Sequenceheavy chain variable region 195cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcc gtg acg gca gcc cat gat gct ttt gat atc tgg ggc caa ggg aca 336Ala Val Thr Ala Ala His Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110atg gtc acc gtc tca agc 354Met Val Thr Val Ser Ser 115196118PRTArtificial Sequenceheavy chain variable region 196Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Val Thr Ala Ala His Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr 100 105 110Met Val Thr Val Ser Ser 115197357DNAArtificial Sequenceheavy chain variable region 197cag gtg cag cta cag cag tgg ggc cca gga ctg gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gac agc agt ggc caa ggg tac ttt gac tac tgg ggc cag ggc 336Ala Arg Asp Ser Ser Gly Gln Gly Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110acc ctg gtc acc gtc tca agc 357Thr Leu Val Thr Val Ser Ser 115198119PRTArtificial Sequenceheavy chain variable region 198Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Ser Ser Gly Gln Gly Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115199354DNAArtificial Sequenceheavy chain variable region 199gag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc 48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtc tcc tgc aag gct tct gga tac acc ttc act agc tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30gct atg cat tgg gtg cgc cag gcc ccc gga caa agg ctt gag tgg atg 144Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met 35 40 45gga tgg atc aac gct ggc aat ggt aac aca aaa tat tca cag aag ttc 192Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe 50 55 60cag ggc aga gtc acc atg acc agg gac acg tcc acg agc aca gtc tac 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gct aga cac tcg tac tac tac ggt atg gac gtc tgg ggc caa ggc acc 336Ala Arg His Ser Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110ctg gtc acc gtc tca agc 354Leu Val Thr Val Ser Ser 115200118PRTArtificial Sequenceheavy chain variable region 200Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met 35 40 45Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg His Ser Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 115201360DNAArtificial Sequenceheavy chain variable region 201cag gtg cag cta cag cag tgg ggc gca gga ctg ttg aag cct tcg gag 48Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc gct gtc tat ggt ggg tcc ttc agt ggt tac 96Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30tac tgg agc tgg atc cgc cag ccc cca ggg aag ggg ctg gag tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg gaa atc aat cat agt gga agc acc aac tac aac ccg tcc ctc aag 192Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gtc acc ata tcg gta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag ctg agc tct gtg acc gcc gcg gac acg gct gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95aga gtc ggg tat agc cac ggc gaa gaa gtc ctg gac gtc tgg ggc aaa 336Arg Val Gly Tyr Ser His Gly Glu Glu Val Leu Asp Val Trp Gly Lys 100 105 110ggg acc acg gtc acc gtc tca agc 360Gly Thr Thr Val Thr Val Ser Ser 115 120202120PRTArtificial Sequenceheavy chain variable region 202Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Val Gly Tyr Ser His Gly Glu Glu Val Leu Asp Val Trp Gly Lys 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115 120203354DNAArtificial Sequenceheavy chain variable region 203cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc ggc aat tat 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Gly Asn Tyr 20 25 30gac tgg agt tgg atc cgg cag ccc cca ggg aag gga ctg gag tgg att 144Asp Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg act atc tac tct agt ggg agt acg tac tac agt ccg tcc ctc aag 192Gly Thr Ile Tyr Ser Ser Gly Ser Thr Tyr Tyr Ser Pro Ser Leu Lys 50 55 60agt cga ctc acc ata tca gta gac aag tcc aag aac cgg ttc tcc ctg 240Ser Arg Leu Thr Ile Ser Val Asp Lys Ser Lys Asn Arg Phe Ser Leu65 70 75 80aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95aga gca cga ggg tat agc agc ccc ttc gac ccc tgg ggc cag ggc acc

336Arg Ala Arg Gly Tyr Ser Ser Pro Phe Asp Pro Trp Gly Gln Gly Thr 100 105 110ctg gtc acc gtc tca agc 354Leu Val Thr Val Ser Ser 115204118PRTArtificial Sequenceheavy chain variable region 204Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Gly Asn Tyr 20 25 30Asp Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Thr Ile Tyr Ser Ser Gly Ser Thr Tyr Tyr Ser Pro Ser Leu Lys 50 55 60Ser Arg Leu Thr Ile Ser Val Asp Lys Ser Lys Asn Arg Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Ala Arg Gly Tyr Ser Ser Pro Phe Asp Pro Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 115205357DNAArtificial Sequenceheavy chain variable region 205cag gtc cag ctg gta cag tct ggg gct gag gtg aag aag cct ggg tcc 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15tcg gtg aag gtc tcc tgc aag gct tct gga ggc acc ttc agc agc tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30gct atc agc tgg gtg cga cag gcc cct gga caa ggg ctt gag tgg atg 144Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga ata atc aac cct agt ggt ggt agc aca agc tac gca cag aag ttc 192Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe 50 55 60cag ggc aga gtc acc att acc agg gac aca tcc gcg agc aca gcc tac 240Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gaa gac acg gct gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cgg tgg agg tac gat gct ttt gat atc tgg ggc caa ggg 336Ala Arg Asp Arg Trp Arg Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110aca atg gtc acc gtc tca agc 357Thr Met Val Thr Val Ser Ser 115206119PRTArtificial Sequenceheavy chain variable region 206Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Trp Arg Tyr Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 115207348DNAArtificial Sequenceheavy chain variable region 207gag gtg cag ctg gtg gag tct ggc cca gga ctg gtg aag cct tcg ggg 48Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc agc agt agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45att ggg gaa atc tat cat agt ggg agc acc aac tac aac ccg tcc ctc 192Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60aag agt cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc 240Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt 288Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gaa aaa tcg ggt atg gac gtc tgg ggc caa ggg acc acg gtc 336Ala Arg Glu Lys Ser Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val 100 105 110acc gtc tca agc 348Thr Val Ser Ser 115208116PRTArtificial Sequenceheavy chain variable region 208Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Glu Lys Ser Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val 100 105 110Thr Val Ser Ser 115209321DNAArtificial Sequencelight chain constant region 209cga act gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 48Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu1 5 10 15cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 96Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 20 25 30tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 144Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 35 40 45tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 192Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 50 55 60acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 240Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu65 70 75 80aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 288Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 85 90 95ccc gtc aca aag agc ttc aac agg gga gag tgt 321Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100 105210107PRTArtificial Sequencelight chain constant region 210Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu1 5 10 15Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 20 25 30Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 35 40 45Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 50 55 60Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu65 70 75 80Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 85 90 95Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100 105211990DNAArtificial Sequenceheavy chain constant region 211gcc tcc acc aag ggc cca tcg gtc ttc ccc ctg gca ccc tcc tcc aag 48Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys1 5 10 15agc acc tct ggg ggc aca gcg gcc ctg ggc tgc ctg gtc aag gac tac 96Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30ttc ccc gaa ccg gtg acg gtg tcg tgg aac tca ggc gcc ctg acc agc 144Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45ggc gtg cac acc ttc ccg gct gtc cta cag tcc tca gga ctc tac tcc 192Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60ctc agc agc gtg gtg acc gtg ccc tcc agc agc ttg ggc acc cag acc 240Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr65 70 75 80tac atc tgc aac gtg aat cac aag ccc agc aac acc aag gtg gac aag 288Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95aaa gtt gag ccc aaa tct tgt gac aaa act cac aca tgc cca ccg tgc 336Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys 100 105 110cca gca cct gaa ctc ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca 384Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 115 120 125aaa ccc aag gac acc ctc atg atc tcc cgg acc cct gag gtc aca tgc 432Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135 140gtg gtg gtg gac gtg agc cac gaa gac cct gag gtc aag ttc aac tgg 480Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp145 150 155 160tac gtg gac ggc gtg gag gtg cat aat gcc aag aca aag ccg cgg gag 528Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 165 170 175gag cag tac aac agc acg tac cgt gtg gtc agc gtc ctc acc gtc ctg 576Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu 180 185 190cac cag gac tgg ctg aat ggc aag gag tac aag tgc aag gtc tcc aac 624His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 195 200 205aaa gcc ctc cca gcc ccc atc gag aaa acc atc tcc aaa gcc aaa ggg 672Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210 215 220cag ccc cga gaa cca cag gtg tac acc ctg ccc cca tcc cgg gat gag 720Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu225 230 235 240ctg acc aag aac cag gtc agc ctg acc tgc ctg gtc aaa ggc ttc tat 768Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 245 250 255ccc agc gac atc gcc gtg gag tgg gag agc aat ggg cag ccg gag aac 816Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260 265 270aac tac aag acc acg cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc 864Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 275 280 285ctc tat agc aag ctc acc gtg gac aag agc agg tgg cag cag ggg aac 912Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290 295 300gtc ttc tca tgc tcc gtg atg cat gag gct ctg cac aac cac tac acg 960Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr305 310 315 320cag aag agc ctc tcc ctg tct ccg ggt aaa 990Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325 330212330PRTArtificial Sequenceheavy chain constant region 212Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys1 5 10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr65 70 75 80Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys 100 105 110Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 115 120 125Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135 140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp145 150 155 160Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 165 170 175Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu 180 185 190His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 195 200 205Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210 215 220Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu225 230 235 240Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 245 250 255Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260 265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 275 280 285Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290 295 300Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr305 310 315 320Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325 3302139PRTArtificial SequenceLight chain CDR3 213Met Gln Ala Leu Gln Thr Pro Xaa Thr1 52149PRTArtificial SequenceLight chain CDR3 214Gln Gln Xaa Xaa Xaa Xaa Pro Leu Thr1 521510PRTArtificial SequenceLight chain CDR3 215Gln Ser Tyr Asp Ser Ser Asn Xaa Xaa Val1 5 102168PRTArtificial SequenceHeavy chain CDR3 216Ser Arg Leu Asp Ala Phe Asp Ile1 521710PRTArtificial SequenceHeavy chain CDR3 217Ser Xaa Tyr Asp Tyr Tyr Gly Met Asp Val1 5 1021811PRTArtificial SequenceHeavy chain CDR3 218His Arg Xaa Asp Xaa Ala Trp Tyr Phe Asp Leu1 5 102194PRTArtificial SequenceHeavy chain CDR3 219Asp Ser Ser Gly122016PRTArtificial SequenceLight chain CDR1 220Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly Tyr Asn Tyr Leu Asp1 5 10 1522111PRTArtificial SequenceLight chain CDR1 221Arg Ala Ser Gln Xaa Xaa Xaa Xaa Xaa Leu Xaa1 5 1022211PRTArtificial SequenceLight chain CDR1 222Arg Ser Ser Gln Ser Xaa Xaa Xaa Xaa Xaa Xaa1 5 102237PRTArtificial SequenceLight chain CDR2 223Leu Gly Ser Asn Arg Ala Ser1 52247PRTArtificial SequenceLight chain CDR2 224Ala Ala Ser Thr Leu Gln Ser1 52257PRTArtificial SequenceLight chain CDR2 225Glu Asp Asn Xaa Arg Pro Ser1 52266PRTArtificial SequenceHeavy chain CDR1 226Ser Ser Asn Trp Trp Ser1 52275PRTArtificial SequenceHeavy chain CDR1 227Xaa Tyr Tyr Trp Ser1 52285PRTArtificial SequenceHeavy chain CDR1 228Ser Tyr Ala Met Xaa1 522916PRTArtificial SequenceHeavy chain CDR2 229Xaa Xaa Xaa Xaa Ser Gly Ser Thr Xaa Tyr Asn Pro Ser Leu Lys Ser1 5 10 1523017PRTArtificial SequenceHeavy chain CDR2 230Xaa Ile Ser Xaa Ser Gly Xaa Ser Thr Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly2311162PRTArtificial SequencehuIGF-1RFc 231Met Lys Ser Gly Ser Gly Gly Gly Ser Pro Thr Ser Leu Trp Gly Leu1 5 10 15Leu Phe Leu Ser Ala Ala Leu Ser Leu Trp Pro Thr Ser Gly Glu Ile 20 25 30Cys Gly Pro Gly Ile Asp Ile Arg Asn Asp Tyr Gln Gln Leu Lys Arg 35 40 45Leu Glu Asn Cys Thr Val Ile Glu Gly Tyr Leu His Ile Leu Leu Ile 50 55 60Ser Lys Ala Glu Asp Tyr Arg Ser Tyr Arg Phe Pro Lys Leu Thr Val65 70 75 80Ile Thr Glu Tyr Leu Leu Leu Phe Arg Val Ala Gly Leu Glu Ser Leu 85 90 95Gly Asp Leu Phe Pro Asn Leu Thr Val Ile Arg Gly Trp Lys Leu Phe 100 105 110Tyr Asn Tyr Ala Leu Val Ile Phe Glu Met Thr Asn Leu Lys Asp Ile 115 120 125Gly Leu Tyr Asn Leu Arg Asn Ile Thr Arg Gly Ala Ile Arg Ile Glu 130 135 140Lys Asn Ala Asp Leu Cys Tyr Leu Ser Thr Val Asp Trp Ser Leu Ile145 150 155 160Leu Asp Ala Val Ser Asn Asn Tyr Ile Val Gly Asn Lys Pro Pro Lys 165 170 175Glu Cys Gly Asp Leu Cys Pro Gly Thr Met Glu Glu Lys Pro Met Cys 180 185 190Glu Lys Thr Thr Ile Asn Asn Glu Tyr Asn Tyr Arg Cys Trp

Thr Thr 195 200 205Asn Arg Cys Gln Lys Met Cys Pro Ser Thr Cys Gly Lys Arg Ala Cys 210 215 220Thr Glu Asn Asn Glu Cys Cys His Pro Glu Cys Leu Gly Ser Cys Ser225 230 235 240Ala Pro Asp Asn Asp Thr Ala Cys Val Ala Cys Arg His Tyr Tyr Tyr 245 250 255Ala Gly Val Cys Val Pro Ala Cys Pro Pro Asn Thr Tyr Arg Phe Glu 260 265 270Gly Trp Arg Cys Val Asp Arg Asp Phe Cys Ala Asn Ile Leu Ser Ala 275 280 285Glu Ser Ser Asp Ser Glu Gly Phe Val Ile His Asp Gly Glu Cys Met 290 295 300Gln Glu Cys Pro Ser Gly Phe Ile Arg Asn Gly Ser Gln Ser Met Tyr305 310 315 320Cys Ile Pro Cys Glu Gly Pro Cys Pro Lys Val Cys Glu Glu Glu Lys 325 330 335Lys Thr Lys Thr Ile Asp Ser Val Thr Ser Ala Gln Met Leu Gln Gly 340 345 350Cys Thr Ile Phe Lys Gly Asn Leu Leu Ile Asn Ile Arg Arg Gly Asn 355 360 365Asn Ile Ala Ser Glu Leu Glu Asn Phe Met Gly Leu Ile Glu Val Val 370 375 380Thr Gly Tyr Val Lys Ile Arg His Ser His Ala Leu Val Ser Leu Ser385 390 395 400Phe Leu Lys Asn Leu Arg Leu Ile Leu Gly Glu Glu Gln Leu Glu Gly 405 410 415Asn Tyr Ser Phe Tyr Val Leu Asp Asn Gln Asn Leu Gln Gln Leu Trp 420 425 430Asp Trp Asp His Arg Asn Leu Thr Ile Lys Ala Gly Lys Met Tyr Phe 435 440 445Ala Phe Asn Pro Lys Leu Cys Val Ser Glu Ile Tyr Arg Met Glu Glu 450 455 460Val Thr Gly Thr Lys Gly Arg Gln Ser Lys Gly Asp Ile Asn Thr Arg465 470 475 480Asn Asn Gly Glu Arg Ala Ser Cys Glu Ser Asp Val Leu His Phe Thr 485 490 495Ser Thr Thr Thr Ser Lys Asn Arg Ile Ile Ile Thr Trp His Arg Tyr 500 505 510Arg Pro Pro Asp Tyr Arg Asp Leu Ile Ser Phe Thr Val Tyr Tyr Lys 515 520 525Glu Ala Pro Phe Lys Asn Val Thr Glu Tyr Asp Gly Gln Asp Ala Cys 530 535 540Gly Ser Asn Ser Trp Asn Met Val Asp Val Asp Leu Pro Pro Asn Lys545 550 555 560Asp Val Glu Pro Gly Ile Leu Leu His Gly Leu Lys Pro Trp Thr Gln 565 570 575Tyr Ala Val Tyr Val Lys Ala Val Thr Leu Thr Met Val Glu Asn Asp 580 585 590His Ile Arg Gly Ala Lys Ser Glu Ile Leu Tyr Ile Arg Thr Asn Ala 595 600 605Ser Val Pro Ser Ile Pro Leu Asp Val Leu Ser Ala Ser Asn Ser Ser 610 615 620Ser Gln Leu Ile Val Lys Trp Asn Pro Pro Ser Leu Pro Asn Gly Asn625 630 635 640Leu Ser Tyr Tyr Ile Val Arg Trp Gln Arg Gln Pro Gln Asp Gly Tyr 645 650 655Leu Tyr Arg His Asn Tyr Cys Ser Lys Asp Lys Ile Pro Ile Arg Lys 660 665 670Tyr Ala Asp Gly Thr Ile Asp Ile Glu Glu Val Thr Glu Asn Pro Lys 675 680 685Thr Glu Val Cys Gly Gly Glu Lys Gly Pro Cys Cys Ala Cys Pro Lys 690 695 700Thr Glu Ala Glu Lys Gln Ala Glu Lys Glu Glu Ala Glu Tyr Arg Lys705 710 715 720Val Phe Glu Asn Phe Leu His Asn Ser Ile Phe Val Pro Arg Pro Glu 725 730 735Arg Lys Arg Arg Asp Val Met Gln Val Ala Asn Thr Thr Met Ser Ser 740 745 750Arg Ser Arg Asn Thr Thr Ala Ala Asp Thr Tyr Asn Ile Thr Asp Pro 755 760 765Glu Glu Leu Glu Thr Glu Tyr Pro Phe Phe Glu Ser Arg Val Asp Asn 770 775 780Lys Glu Arg Thr Val Ile Ser Asn Leu Arg Pro Phe Thr Leu Tyr Arg785 790 795 800Ile Asp Ile His Ser Cys Asn His Glu Ala Glu Lys Leu Gly Cys Ser 805 810 815Ala Ser Asn Phe Val Phe Ala Arg Thr Met Pro Ala Glu Gly Ala Asp 820 825 830Asp Ile Pro Gly Pro Val Thr Trp Glu Pro Arg Pro Glu Asn Ser Ile 835 840 845Phe Leu Lys Trp Pro Glu Pro Glu Asn Pro Asn Gly Leu Ile Leu Met 850 855 860Tyr Glu Ile Lys Tyr Gly Ser Gln Val Glu Asp Gln Arg Glu Cys Val865 870 875 880Ser Arg Gln Glu Tyr Arg Lys Tyr Gly Gly Ala Lys Leu Asn Arg Leu 885 890 895Asn Pro Gly Asn Tyr Thr Ala Arg Ile Gln Ala Thr Ser Leu Ser Gly 900 905 910Asn Gly Ser Trp Thr Asp Pro Val Phe Phe Tyr Val Gln Ala Lys Thr 915 920 925Gly Tyr Glu Asn Phe Ile His Leu Asp Glu Val Asp Gly Cys Lys Pro 930 935 940Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro945 950 955 960Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys 965 970 975Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp 980 985 990Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu 995 1000 1005Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile 1010 1015 1020Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val 1025 1030 1035Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 1040 1045 1050Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro 1055 1060 1065Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met 1070 1075 1080Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp 1085 1090 1095Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met 1100 1105 1110Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 1115 1120 1125Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu 1130 1135 1140His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His 1145 1150 1155Ser Pro Gly Lys 11602321180PRTArtificial Sequencehu INSRfC 232Met Gly Thr Gly Gly Arg Arg Gly Ala Ala Ala Ala Pro Leu Leu Val1 5 10 15Ala Val Ala Ala Leu Leu Leu Gly Ala Ala Gly His Leu Tyr Pro Gly 20 25 30Glu Val Cys Pro Gly Met Asp Ile Arg Asn Asn Leu Thr Arg Leu His 35 40 45Glu Leu Glu Asn Cys Ser Val Ile Glu Gly His Leu Gln Ile Leu Leu 50 55 60Met Phe Lys Thr Arg Pro Glu Asp Phe Arg Asp Leu Ser Phe Pro Lys65 70 75 80Leu Ile Met Ile Thr Asp Tyr Leu Leu Leu Phe Arg Val Tyr Gly Leu 85 90 95Glu Ser Leu Lys Asp Leu Phe Pro Asn Leu Thr Val Ile Arg Gly Ser 100 105 110Arg Leu Phe Phe Asn Tyr Ala Leu Val Ile Phe Glu Met Val His Leu 115 120 125Lys Glu Leu Gly Leu Tyr Asn Leu Met Asn Ile Thr Arg Gly Ser Val 130 135 140Arg Ile Glu Lys Asn Asn Glu Leu Cys Tyr Leu Ala Thr Ile Asp Trp145 150 155 160Ser Arg Ile Leu Asp Ser Val Glu Asp Asn His Ile Val Leu Asn Lys 165 170 175Asp Asp Asn Glu Glu Cys Gly Asp Ile Cys Pro Gly Thr Ala Lys Gly 180 185 190Lys Thr Asn Cys Pro Ala Thr Val Ile Asn Gly Gln Phe Val Glu Arg 195 200 205Cys Trp Thr His Ser His Cys Gln Lys Val Cys Pro Thr Ile Cys Lys 210 215 220Ser His Gly Cys Thr Ala Glu Gly Leu Cys Cys His Ser Glu Cys Leu225 230 235 240Gly Asn Cys Ser Gln Pro Asp Asp Pro Thr Lys Cys Val Ala Cys Arg 245 250 255Asn Phe Tyr Leu Asp Gly Arg Cys Val Glu Thr Cys Pro Pro Pro Tyr 260 265 270Tyr His Phe Gln Asp Trp Arg Cys Val Asn Phe Ser Phe Cys Gln Asp 275 280 285Leu His His Lys Cys Lys Asn Ser Arg Arg Gln Gly Cys His Gln Tyr 290 295 300Val Ile His Asn Asn Lys Cys Ile Pro Glu Cys Pro Ser Gly Tyr Thr305 310 315 320Met Asn Ser Ser Asn Leu Leu Cys Thr Pro Cys Leu Gly Pro Cys Pro 325 330 335Lys Val Cys His Leu Leu Glu Gly Glu Lys Thr Ile Asp Ser Val Thr 340 345 350Ser Ala Gln Glu Leu Arg Gly Cys Thr Val Ile Asn Gly Ser Leu Ile 355 360 365Ile Asn Ile Arg Gly Gly Asn Asn Leu Ala Ala Glu Leu Glu Ala Asn 370 375 380Leu Gly Leu Ile Glu Glu Ile Ser Gly Tyr Leu Lys Ile Arg Arg Ser385 390 395 400Tyr Ala Leu Val Ser Leu Ser Phe Phe Arg Lys Leu Arg Leu Ile Arg 405 410 415Gly Glu Thr Leu Glu Ile Gly Asn Tyr Ser Phe Tyr Ala Leu Asp Asn 420 425 430Gln Asn Leu Arg Gln Leu Trp Asp Trp Ser Lys His Asn Leu Thr Thr 435 440 445Thr Gln Gly Lys Leu Phe Phe His Tyr Asn Pro Lys Leu Cys Leu Ser 450 455 460Glu Ile His Lys Met Glu Glu Val Ser Gly Thr Lys Gly Arg Gln Glu465 470 475 480Arg Asn Asp Ile Ala Leu Lys Thr Asn Gly Asp Lys Ala Ser Cys Glu 485 490 495Asn Glu Leu Leu Lys Phe Ser Tyr Ile Arg Thr Ser Phe Asp Lys Ile 500 505 510Leu Leu Arg Trp Glu Pro Tyr Trp Pro Pro Asp Phe Arg Asp Leu Leu 515 520 525Gly Phe Met Leu Phe Tyr Lys Glu Ala Pro Tyr Gln Asn Val Thr Glu 530 535 540Phe Asp Gly Gln Asp Ala Cys Gly Ser Asn Ser Trp Thr Val Val Asp545 550 555 560Ile Asp Pro Pro Leu Arg Ser Asn Asp Pro Lys Ser Gln Asn His Pro 565 570 575Gly Trp Leu Met Arg Gly Leu Lys Pro Trp Thr Gln Tyr Ala Ile Phe 580 585 590Val Lys Thr Leu Val Thr Phe Ser Asp Glu Arg Arg Thr Tyr Gly Ala 595 600 605Lys Ser Asp Ile Ile Tyr Val Gln Thr Asp Ala Thr Asn Pro Ser Val 610 615 620Pro Leu Asp Pro Ile Ser Val Ser Asn Ser Ser Ser Gln Ile Ile Leu625 630 635 640Lys Trp Lys Pro Pro Ser Asp Pro Asn Gly Asn Ile Thr His Tyr Leu 645 650 655Val Phe Trp Glu Arg Gln Ala Glu Asp Ser Glu Leu Phe Glu Leu Asp 660 665 670Tyr Cys Leu Lys Gly Leu Lys Leu Pro Ser Arg Thr Trp Ser Pro Pro 675 680 685Phe Glu Ser Glu Asp Ser Gln Lys His Asn Gln Ser Glu Tyr Glu Asp 690 695 700Ser Ala Gly Glu Cys Cys Ser Cys Pro Lys Thr Asp Ser Gln Ile Leu705 710 715 720Lys Glu Leu Glu Glu Ser Ser Phe Arg Lys Thr Phe Glu Asp Tyr Leu 725 730 735His Asn Val Val Phe Val Pro Arg Lys Thr Ser Ser Gly Thr Gly Ala 740 745 750Glu Asp Pro Arg Pro Ser Arg Lys Arg Arg Ser Leu Gly Asp Val Gly 755 760 765Asn Val Thr Val Ala Val Pro Thr Val Ala Ala Phe Pro Asn Thr Ser 770 775 780Ser Thr Ser Val Pro Thr Ser Pro Glu Glu His Arg Pro Phe Glu Lys785 790 795 800Val Val Asn Lys Glu Ser Leu Val Ile Ser Gly Leu Arg His Phe Thr 805 810 815Gly Tyr Arg Ile Glu Leu Gln Ala Cys Asn Gln Asp Thr Pro Glu Glu 820 825 830Arg Cys Ser Val Ala Ala Tyr Val Ser Ala Arg Thr Met Pro Glu Ala 835 840 845Lys Ala Asp Asp Ile Val Gly Pro Val Thr His Glu Ile Phe Glu Asn 850 855 860Asn Val Val His Leu Met Trp Gln Glu Pro Lys Glu Pro Asn Gly Leu865 870 875 880Ile Val Leu Tyr Glu Val Ser Tyr Arg Arg Tyr Gly Asp Glu Glu Leu 885 890 895His Leu Cys Val Ser Arg Lys His Phe Ala Leu Glu Arg Gly Cys Arg 900 905 910Leu Arg Gly Leu Ser Pro Gly Asn Tyr Ser Val Arg Ile Arg Ala Thr 915 920 925Ser Leu Ala Gly Asn Gly Ser Trp Thr Glu Pro Thr Tyr Phe Tyr Val 930 935 940Thr Asp Tyr Leu Asp Val Pro Ser Asn Ile Ala Lys Val Asp Gly Cys945 950 955 960Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe 965 970 975Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val 980 985 990Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe 995 1000 1005Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln 1010 1015 1020Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu 1025 1030 1035Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys 1040 1045 1050Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr 1055 1060 1065Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr 1070 1075 1080Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 1085 1090 1095Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu 1100 1105 1110Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln 1115 1120 1125Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu 1130 1135 1140Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys 1145 1150 1155Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser 1160 1165 1170Leu Ser His Ser Pro Gly Lys 1175 11802331062PRTArtificial Sequencehu IGF-1Ravidin 233Met Lys Ser Gly Ser Gly Gly Gly Ser Pro Thr Ser Leu Trp Gly Leu1 5 10 15Leu Phe Leu Ser Ala Ala Leu Ser Leu Trp Pro Thr Ser Gly Glu Ile 20 25 30Cys Gly Pro Gly Ile Asp Ile Arg Asn Asp Tyr Gln Gln Leu Lys Arg 35 40 45Leu Glu Asn Cys Thr Val Ile Glu Gly Tyr Leu His Ile Leu Leu Ile 50 55 60Ser Lys Ala Glu Asp Tyr Arg Ser Tyr Arg Phe Pro Lys Leu Thr Val65 70 75 80Ile Thr Glu Tyr Leu Leu Leu Phe Arg Val Ala Gly Leu Glu Ser Leu 85 90 95Gly Asp Leu Phe Pro Asn Leu Thr Val Ile Arg Gly Trp Lys Leu Phe 100 105 110Tyr Asn Tyr Ala Leu Val Ile Phe Glu Met Thr Asn Leu Lys Asp Ile 115 120 125Gly Leu Tyr Asn Leu Arg Asn Ile Thr Arg Gly Ala Ile Arg Ile Glu 130 135 140Lys Asn Ala Asp Leu Cys Tyr Leu Ser Thr Val Asp Trp Ser Leu Ile145 150 155 160Leu Asp Ala Val Ser Asn Asn Tyr Ile Val Gly Asn Lys Pro Pro Lys 165 170 175Glu Cys Gly Asp Leu Cys Pro Gly Thr Met Glu Glu Lys Pro Met Cys 180 185 190Glu Lys Thr Thr Ile Asn Asn Glu Tyr Asn Tyr Arg Cys Trp Thr Thr 195 200 205Asn Arg Cys Gln Lys Met Cys Pro Ser Thr Cys Gly Lys Arg Ala Cys 210 215 220Thr Glu Asn Asn Glu Cys Cys His Pro Glu Cys Leu Gly Ser Cys Ser225 230 235 240Ala Pro Asp Asn Asp Thr Ala Cys Val Ala Cys Arg His Tyr Tyr Tyr 245 250 255Ala Gly Val Cys Val Pro Ala Cys Pro Pro Asn Thr Tyr Arg Phe Glu 260 265 270Gly Trp Arg Cys Val Asp Arg Asp Phe Cys Ala Asn Ile Leu Ser Ala 275 280 285Glu Ser Ser Asp Ser Glu Gly Phe Val Ile His Asp Gly Glu Cys Met 290 295 300Gln Glu Cys Pro Ser Gly Phe Ile Arg Asn Gly Ser Gln Ser Met Tyr305

310 315 320Cys Ile Pro Cys Glu Gly Pro Cys Pro Lys Val Cys Glu Glu Glu Lys 325 330 335Lys Thr Lys Thr Ile Asp Ser Val Thr Ser Ala Gln Met Leu Gln Gly 340 345 350Cys Thr Ile Phe Lys Gly Asn Leu Leu Ile Asn Ile Arg Arg Gly Asn 355 360 365Asn Ile Ala Ser Glu Leu Glu Asn Phe Met Gly Leu Ile Glu Val Val 370 375 380Thr Gly Tyr Val Lys Ile Arg His Ser His Ala Leu Val Ser Leu Ser385 390 395 400Phe Leu Lys Asn Leu Arg Leu Ile Leu Gly Glu Glu Gln Leu Glu Gly 405 410 415Asn Tyr Ser Phe Tyr Val Leu Asp Asn Gln Asn Leu Gln Gln Leu Trp 420 425 430Asp Trp Asp His Arg Asn Leu Thr Ile Lys Ala Gly Lys Met Tyr Phe 435 440 445Ala Phe Asn Pro Lys Leu Cys Val Ser Glu Ile Tyr Arg Met Glu Glu 450 455 460Val Thr Gly Thr Lys Gly Arg Gln Ser Lys Gly Asp Ile Asn Thr Arg465 470 475 480Asn Asn Gly Glu Arg Ala Ser Cys Glu Ser Asp Val Leu His Phe Thr 485 490 495Ser Thr Thr Thr Ser Lys Asn Arg Ile Ile Ile Thr Trp His Arg Tyr 500 505 510Arg Pro Pro Asp Tyr Arg Asp Leu Ile Ser Phe Thr Val Tyr Tyr Lys 515 520 525Glu Ala Pro Phe Lys Asn Val Thr Glu Tyr Asp Gly Gln Asp Ala Cys 530 535 540Gly Ser Asn Ser Trp Asn Met Val Asp Val Asp Leu Pro Pro Asn Lys545 550 555 560Asp Val Glu Pro Gly Ile Leu Leu His Gly Leu Lys Pro Trp Thr Gln 565 570 575Tyr Ala Val Tyr Val Lys Ala Val Thr Leu Thr Met Val Glu Asn Asp 580 585 590His Ile Arg Gly Ala Lys Ser Glu Ile Leu Tyr Ile Arg Thr Asn Ala 595 600 605Ser Val Pro Ser Ile Pro Leu Asp Val Leu Ser Ala Ser Asn Ser Ser 610 615 620Ser Gln Leu Ile Val Lys Trp Asn Pro Pro Ser Leu Pro Asn Gly Asn625 630 635 640Leu Ser Tyr Tyr Ile Val Arg Trp Gln Arg Gln Pro Gln Asp Gly Tyr 645 650 655Leu Tyr Arg His Asn Tyr Cys Ser Lys Asp Lys Ile Pro Ile Arg Lys 660 665 670Tyr Ala Asp Gly Thr Ile Asp Ile Glu Glu Val Thr Glu Asn Pro Lys 675 680 685Thr Glu Val Cys Gly Gly Glu Lys Gly Pro Cys Cys Ala Cys Pro Lys 690 695 700Thr Glu Ala Glu Lys Gln Ala Glu Lys Glu Glu Ala Glu Tyr Arg Lys705 710 715 720Val Phe Glu Asn Phe Leu His Asn Ser Ile Phe Val Pro Arg Pro Glu 725 730 735Arg Lys Arg Arg Asp Val Met Gln Val Ala Asn Thr Thr Met Ser Ser 740 745 750Arg Ser Arg Asn Thr Thr Ala Ala Asp Thr Tyr Asn Ile Thr Asp Pro 755 760 765Glu Glu Leu Glu Thr Glu Tyr Pro Phe Phe Glu Ser Arg Val Asp Asn 770 775 780Lys Glu Arg Thr Val Ile Ser Asn Leu Arg Pro Phe Thr Leu Tyr Arg785 790 795 800Ile Asp Ile His Ser Cys Asn His Glu Ala Glu Lys Leu Gly Cys Ser 805 810 815Ala Ser Asn Phe Val Phe Ala Arg Thr Met Pro Ala Glu Gly Ala Asp 820 825 830Asp Ile Pro Gly Pro Val Thr Trp Glu Pro Arg Pro Glu Asn Ser Ile 835 840 845Phe Leu Lys Trp Pro Glu Pro Glu Asn Pro Asn Gly Leu Ile Leu Met 850 855 860Tyr Glu Ile Lys Tyr Gly Ser Gln Val Glu Asp Gln Arg Glu Cys Val865 870 875 880Ser Arg Gln Glu Tyr Arg Lys Tyr Gly Gly Ala Lys Leu Asn Arg Leu 885 890 895Asn Pro Gly Asn Tyr Thr Ala Arg Ile Gln Ala Thr Ser Leu Ser Gly 900 905 910Asn Gly Ser Trp Thr Asp Pro Val Phe Phe Tyr Val Gln Ala Lys Thr 915 920 925Gly Tyr Glu Ala Ala Ala Ala Arg Lys Cys Ser Leu Thr Gly Lys Trp 930 935 940Thr Asn Asp Leu Gly Ser Asn Met Thr Ile Gly Ala Val Asn Ser Lys945 950 955 960Gly Glu Phe Thr Gly Thr Tyr Thr Thr Ala Val Thr Ala Thr Ser Asn 965 970 975Glu Ile Lys Glu Ser Pro Leu His Gly Thr Gln Asn Thr Ile Asn Lys 980 985 990Arg Thr Gln Pro Thr Phe Gly Phe Thr Val Asn Trp Lys Phe Ser Glu 995 1000 1005Ser Thr Thr Val Phe Thr Gly Gln Cys Phe Ile Asp Arg Asn Gly 1010 1015 1020Lys Glu Val Leu Lys Thr Met Trp Leu Leu Arg Ser Ser Val Asn 1025 1030 1035Asp Ile Gly Asp Asp Trp Lys Ala Thr Arg Val Gly Ile Asn Ile 1040 1045 1050Phe Thr Arg Leu Arg Thr Gln Lys Glu 1055 1060234107PRTArtificial Sequencehuman kappa light chain constant region 234Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu1 5 10 15Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 20 25 30Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 35 40 45Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 50 55 60Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu65 70 75 80Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 85 90 95Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100 105235330PRTArtificial Sequenceheavy chain constant region 235Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys1 5 10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr65 70 75 80Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys 100 105 110Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 115 120 125Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135 140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp145 150 155 160Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 165 170 175Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu 180 185 190His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 195 200 205Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210 215 220Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu225 230 235 240Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 245 250 255Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260 265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 275 280 285Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290 295 300Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr305 310 315 320Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325 33023616PRTArtificial Sequencelight chain CDR1 236Arg Ser Ser Gln Ser Leu Leu His Xaa Xaa Gly Tyr Asn Xaa Leu Xaa1 5 10 1523713PRTArtificial Sequencelight chain CDR1 237Thr Arg Ser Ser Gly Xaa Ile Xaa Xaa Asn Tyr Val Gln1 5 1023811PRTArtificial Sequencelight chain CDR1 238Arg Ala Ser Gln Xaa Xaa Xaa Xaa Xaa Leu Xaa1 5 102397PRTArtificial Sequencelight chain CDR2 239Leu Xaa Xaa Xaa Arg Xaa Ser1 52407PRTArtificial Sequencelight chain CDR2 240Ala Xaa Ser Xaa Leu Xaa Ser1 52417PRTArtificial Sequencelight chain CDR2 241Xaa Xaa Asn Xaa Arg Pro Ser1 52429PRTArtificial Sequencelight chain CDR3 242Met Xaa Xaa Xaa Xaa Xaa Pro Xaa Xaa1 52439PRTArtificial Sequencelight chain CDR3 243Gln Gln Xaa Xaa Xaa Xaa Pro Xaa Thr1 524410PRTArtificial Sequencelight chain CDR3 244Gln Ser Tyr Xaa Ser Xaa Asn Xaa Xaa Val1 5 102456PRTArtificial Sequenceheavy chain CDR1 245Xaa Xaa Xaa Trp Trp Ser1 52465PRTArtificial Sequenceheavy chain CDR1 246Xaa Xaa Tyr Trp Ser1 52475PRTArtificial Sequenceheavy chain CDR1 247Ser Tyr Xaa Xaa Xaa1 524816PRTArtificial Sequenceheavy chain CDR2 248Xaa Xaa Xaa Xaa Xaa Gly Xaa Thr Xaa Tyr Asn Pro Ser Leu Xaa Ser1 5 10 1524917PRTArtificial Sequenceheavy chain CDR2 249Xaa Ile Ser Xaa Xaa Xaa Xaa Xaa Xaa Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly25012PRTArtificial Sequenceheavy chain CDR3 250Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Asp Ile1 5 1025114PRTArtificial Sequenceheavy chain CDR3 251Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Met Asp Val1 5 1025211PRTArtificial Sequenceheavy chain CDR3 252Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr1 5 1025314PRTArtificial SequenceHeavy chain CDR3 253Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr Phe Asp Xaa1 5 1025415PRTArtificial Sequenceheavy chain CDR3 254Xaa Xaa Xaa Xaa Asp Ser Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 152558PRTArtificial Sequencefully synthetic 255Asp Tyr Lys Asp Asp Asp Asp Lys1 525637DNAArtificial Sequencefully synthetic 256agcaagcttc caccatgaag tctggctccg gaggagg 3725736DNAArtificial Sequencefully synthetic 257atttgtcgac ttcgtccaga tggatgaagt tttcat 362583486DNAArtificial SequenceHuman Mouse Fusion 258atgaagtctg gctccggagg agggtccccg acctcgctgt gggggctcct gtttctctcc 60gccgcgctct cgctctggcc gacgagtgga gaaatctgcg ggccaggcat cgacatccgc 120aacgactatc agcagctgaa gcgcctggag aactgcacgg tgatcgaggg ctacctccac 180atcctgctca tctccaaggc cgaggactac cgcagctacc gcttccccaa gctcacggtc 240attaccgagt acttgctgct gttccgagtg gctggcctcg agagcctcgg agacctcttc 300cccaacctca cggtcatccg cggctggaaa ctcttctaca actacgccct ggtcatcttc 360gagatgacca atctcaagga tattgggctt tacaacctga ggaacattac tcggggggcc 420atcaggattg agaaaaatgc tgacctctgt tacctctcca ctgtggactg gtccctgatc 480ctggatgcgg tgtccaataa ctacattgtg gggaataagc ccccaaagga atgtggggac 540ctgtgtccag ggaccatgga ggagaagccg atgtgtgaga agaccaccat caacaatgag 600tacaactacc gctgctggac cacaaaccgc tgccagaaaa tgtgcccaag cacgtgtggg 660aagcgggcgt gcaccgagaa caatgagtgc tgccaccccg agtgcctggg cagctgcagc 720gcgcctgaca acgacacggc ctgtgtagct tgccgccact actactatgc cggtgtctgt 780gtgcctgcct gcccgcccaa cacctacagg tttgagggct ggcgctgtgt ggaccgtgac 840ttctgcgcca acatcctcag cgccgagagc agcgactccg aggggtttgt gatccacgac 900ggcgagtgca tgcaggagtg cccctcgggc ttcatccgca acggcagcca gagcatgtac 960tgcatccctt gtgaaggtcc ttgcccgaag gtctgtgagg aagaaaagaa aacaaagacc 1020attgattctg ttacttctgc tcagatgctc caaggatgca ccatcttcaa gggcaatttg 1080ctcattaaca tccgacgggg gaataacatt gcttcagagc tggagaactt catggggctc 1140atcgaggtgg tgacgggcta cgtgaagatc cgccattctc atgccttggt ctccttgtcc 1200ttcctaaaaa accttcgcct catcctagga gaggagcagc tagaagggaa ttactccttc 1260tacgtcctcg acaaccagaa cttgcagcaa ctgtgggact gggaccaccg caacctgacc 1320atcaaagcag ggaaaatgta ctttgctttc aatcccaaat tatgtgtttc cgaaatttac 1380cgcatggagg aagtgacggg gactaaaggg cgccaaagca aaggggacat aaacaccagg 1440aacaacgggg agagagcctc ctgtgaaagt gacgtcctgc atttcacctc caccaccacg 1500tcgaagaatc gcatcatcat aacctggcac cggtaccggc cccctgacta cagggatctc 1560atcagcttca ccgtttacta caaggaagca ccctttaaga atgtcacaga gtatgatggg 1620caggatgcct gcggctccaa cagctggaac atggtggacg tggacctccc gcccaacaag 1680gacgtggagc ccggcatctt actacatggg ctgaagccct ggactcagta cgccgtttac 1740gtcaaggctg tgaccctcac catggtggag aacgaccata tccgtggggc caagagtgag 1800atcttgtaca ttcgcaccaa tgcttcagtt ccttccattc ccttggacgt tctttcagca 1860tcgaactcct cttctcagtt aatcgtgaag tggaaccctc cctctctgcc caacggcaac 1920ctgagttact acattgtgcg ctggcagcgg cagcctcagg acggctacct ttaccggcac 1980aattactgct ccaaagacaa aatccccatc aggaagtatg ccgacggcac catcgacatt 2040gaggaggtca cagagaaccc caagactgag gtgtgtggtg gggagaaagg gccttgctgc 2100gcctgcccca aaactgaagc cgagaagcag gccgagaagg aggaggctga ataccgcaaa 2160gtctttgaga atttcctgca caactccatc ttcgtgccca gacctgaaag gaagcggaga 2220gatgtcatgc aagtggccaa caccaccatg tccagccgaa gcaggaacac cacggccgca 2280gacacctaca acatcactga cccggaagag ctggagacag agtacccttt ctttgagagc 2340agagtggata acaaggagag aactgtcatt tctaaccttc ggcctttcac attgtaccgc 2400atcgatatcc acagctgcaa ccacgaggct gagaagctgg gctgcagcgc ctccaacttc 2460gtctttgcaa ggactatgcc cgcagaagga gcagatgaca ttcctgggcc agtgacctgg 2520gagccaaggc ctgaaaactc catcttttta aagtggccgg aacctgagaa tcccaatgga 2580ttgattctaa tgtatgaaat aaaatacgga tcacaagttg aggatcagcg agaatgtgtg 2640tccagacagg aatacaggaa gtatggaggg gccaagctaa accggctaaa cccggggaac 2700tacacagccc ggattcaggc cacatctctc tctgggaatg ggtcgtggac agatcctgtg 2760ttcttctatg tccaggccaa aacaggatat gaaaacttca tccatctgga cgaagtcgac 2820ggttgtaagc cttgcatatg tacagtccca gaagtatcat ctgtcttcat cttcccccca 2880aagcccaagg atgtgctcac cattactctg actcctaagg tcacgtgtgt tgtggtagac 2940atcagcaagg atgatcccga ggtccagttc agctggtttg tagatgatgt ggaggtgcac 3000acagctcaga cgcaaccccg ggaggagcag ttcaacagca ctttccgctc agtcagtgaa 3060cttcccatca tgcaccagga ctggctcaat ggcaaggagt tcaaatgcag ggtaaacagt 3120gcagctttcc ctgcccccat cgagaaaacc atctccaaaa ccaaaggcag accgaaggct 3180ccacaggtgt acaccattcc acctcccaag gagcagatgg ccaaggataa agtcagtctg 3240acctgcatga taacagactt cttccctgaa gacattactg tggagtggca gtggaatggg 3300cagccagcgg agaactacaa gaacactcag cccatcatgg acacagatgg ctcttacttc 3360gtctacagca agctcaatgt gcagaagagc aactgggagg caggaaatac tttcacctgc 3420tctgtgttac atgagggcct gcacaaccac catactgaga agagcctctc ccactctcct 3480ggtaaa 348625932DNAArtificial Sequencefully synthetic 259agcaagcttc caccatgggc accgggggcc gg 3226037DNAArtificial Sequencefully synthetic 260atttgtcgac ttttgcaata tttgacggga cgtctaa 372613540DNAArtificial SequenceHuman Mouse Fusion 261atgggcaccg ggggccggcg gggggcggcg gccgcgccgc tgctggtggc ggtggccgcg 60ctgctactgg gcgccgcggg ccacctgtac cccggagagg tgtgtcccgg catggatatc 120cggaacaacc tcactaggtt gcatgagctg gagaattgct ctgtcatcga aggacacttg 180cagatactct tgatgttcaa aacgaggccc gaagatttcc gagacctcag tttccccaaa 240ctcatcatga tcactgatta cttgctgctc ttccgggtct atgggctcga gagcctgaag 300gacctgttcc ccaacctcac ggtcatccgg ggatcacgac tgttctttaa ctacgcgctg 360gtcatcttcg agatggttca cctcaaggaa ctcggcctct acaacctgat gaacatcacc 420cggggttctg tccgcatcga gaagaacaat gagctctgtt acttggccac tatcgactgg 480tcccgtatcc tggattccgt ggaggataat cacatcgtgt tgaacaaaga tgacaacgag 540gagtgtggag acatctgtcc gggtaccgcg aagggcaaga ccaactgccc cgccaccgtc 600atcaacgggc agtttgtcga acgatgttgg actcatagtc actgccagaa agtttgcccg 660accatctgta agtcacacgg ctgcaccgcc gaaggcctct gttgccacag cgagtgcctg 720ggcaactgtt ctcagcccga cgaccccacc aagtgcgtgg cctgccgcaa cttctacctg 780gacggcaggt gtgtggagac ctgcccgccc ccgtactacc acttccagga ctggcgctgt 840gtgaacttca gcttctgcca ggacctgcac cacaaatgca agaactcgcg gaggcagggc 900tgccaccagt acgtcattca caacaacaag tgcatccctg agtgtccctc cgggtacacg 960atgaattcca gcaacttgct gtgcacccca tgcctgggtc cctgtcccaa ggtgtgccac 1020ctcctagaag gcgagaagac catcgactcg gtgacgtctg cccaggagct ccgaggatgc 1080accgtcatca acgggagtct gatcatcaac attcgaggag gcaacaatct ggcagctgag 1140ctagaagcca acctcggcct cattgaagaa atttcagggt atctaaaaat ccgccgatcc 1200tacgctctgg tgtcactttc cttcttccgg aagttacgtc tgattcgagg agagaccttg 1260gaaattggga actactcctt ctatgccttg gacaaccaga acctaaggca gctctgggac 1320tggagcaaac acaacctcac caccactcag gggaaactct tcttccacta taaccccaaa 1380ctctgcttgt cagaaatcca caagatggaa gaagtttcag gaaccaaggg gcgccaggag 1440agaaacgaca ttgccctgaa gaccaatggg gacaaggcat cctgtgaaaa tgagttactt 1500aaattttctt acattcggac atcttttgac aagatcttgc tgagatggga gccgtactgg 1560ccccccgact tccgagacct cttggggttc atgctgttct acaaagaggc cccttatcag 1620aatgtgacgg agttcgatgg gcaggatgcg tgtggttcca acagttggac ggtggtagac

1680attgacccac ccctgaggtc caacgacccc aaatcacaga accacccagg gtggctgatg 1740cggggtctca agccctggac ccagtatgcc atctttgtga agaccctggt caccttttcg 1800gatgaacgcc ggacctatgg ggccaagagt gacatcattt atgtccagac agatgccacc 1860aacccctctg tgcccctgga tccaatctca gtgtctaact catcatccca gattattctg 1920aagtggaaac caccctccga ccccaatggc aacatcaccc actacctggt tttctgggag 1980aggcaggcgg aagacagtga gctgttcgag ctggattatt gcctcaaagg gctgaagctg 2040ccctcgagga cctggtctcc accattcgag tctgaagatt ctcagaagca caaccagagt 2100gagtatgagg attcggccgg cgaatgctgc tcctgtccaa agacagactc tcagatcctg 2160aaggagctgg aggagtcctc gtttaggaag acgtttgagg attacctgca caacgtggtt 2220ttcgtcccca gaaaaacctc ttcaggcact ggtgccgagg accctaggcc atctcggaaa 2280cgcaggtccc ttggcgatgt tgggaatgtg acggtggccg tgcccacggt ggcagctttc 2340cccaacactt cctcgaccag cgtgcccacg agtccggagg agcacaggcc ttttgagaag 2400gtggtgaaca aggagtcgct ggtcatctcc ggcttgcgac acttcacggg ctatcgcatc 2460gagctgcagg cttgcaacca ggacacccct gaggaacggt gcagtgtggc agcctacgtc 2520agtgcgagga ccatgcctga agccaaggct gatgacattg ttggccctgt gacgcatgaa 2580atctttgaga acaacgtcgt ccacttgatg tggcaggagc cgaaggagcc caatggtctg 2640atcgtgctgt atgaagtgag ttatcggcga tatggtgatg aggagctgca tctctgcgtc 2700tcccgcaagc acttcgctct ggaacggggc tgcaggctgc gtgggctgtc accggggaac 2760tacagcgtgc gaatccgggc cacctccctt gcgggcaacg gctcttggac ggaacccacc 2820tatttctacg tgacagacta tttagacgtc ccgtcaaata ttgcaaaagt cgacggttgt 2880aagccttgca tatgtacagt cccagaagta tcatctgtct tcatcttccc cccaaagccc 2940aaggatgtgc tcaccattac tctgactcct aaggtcacgt gtgttgtggt agacatcagc 3000aaggatgatc ccgaggtcca gttcagctgg tttgtagatg atgtggaggt gcacacagct 3060cagacgcaac cccgggagga gcagttcaac agcactttcc gctcagtcag tgaacttccc 3120atcatgcacc aggactggct caatggcaag gagttcaaat gcagggtaaa cagtgcagct 3180ttccctgccc ccatcgagaa aaccatctcc aaaaccaaag gcagaccgaa ggctccacag 3240gtgtacacca ttccacctcc caaggagcag atggccaagg ataaagtcag tctgacctgc 3300atgataacag acttcttccc tgaagacatt actgtggagt ggcagtggaa tgggcagcca 3360gcggagaact acaagaacac tcagcccatc atggacacag atggctctta cttcgtctac 3420agcaagctca atgtgcagaa gagcaactgg gaggcaggaa atactttcac ctgctctgtg 3480ttacatgagg gcctgcacaa ccaccatact gagaagagcc tctcccactc tcctggtaaa 35402621409DNAArtificial SequenceHuman 262tctagaccac catggacatc aggctcagct tagttttcct tgtccttttc ataaaaggtg 60tccagtgtga ggtagaactg gtggagtctg ggggcggctt agtacaacct ggaaggtcca 120tgacactctc ctgtgcagcc tcgggattca ctttcagaac ctatggcatg gcctgggtcc 180gccaggcccc aacgaagggt ctggagtggg tctcatcaat tactgctagt ggtggtacca 240cctactatcg agactccgtg aagggccgct tcactatttt tagggataat gcaaaaagta 300ccctatacct gcagatggac agtccgaggt ctgaggacac ggccacttat ttctgtacat 360caatttcgga atactggggc cacggagtca tggtcaccgt ctctagtgcc tccaccaagg 420gcccatcggt cttccccctg gcaccctcct ccaagagcac ctctgggggc acagcggccc 480tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg aactcaggcg 540ccctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcctcagga ctctactccc 600tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac ccagacctac atctgcaacg 660tgaatcacaa gcccagcaac accaaggtgg acaagaaagt tgagcccaaa tcttgtgaca 720aaactcacac atgcccaccg tgcccagcac ctgaactcct ggggggaccg tcagtcttcc 780tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag gtcacatgcg 840tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac gtggacggcg 900tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc acgtaccgtg 960tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag tacaagtgca 1020aggtctccaa caaagccctc ccagccccca tcgagaaaac catctccaaa gccaaagggc 1080agccccgaga accacaggtg tacaccctgc ccccatcccg ggatgagctg accaagaacc 1140aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc gtggagtggg 1200agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg gactccgacg 1260gctccttctt cctctatagc aagctcaccg tggacaagag caggtggcag caggggaacg 1320tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag aagagcctct 1380ccctgtctcc gggtaaatga taagtcgac 140926322PRTArtificial Sequencefully synthetic 263Met Asp Met Arg Val Pro Ala Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Arg Gly Ala Arg Cys 2026422PRTArtificial Sequencefully synthetic 264Met Asp Met Arg Val Pro Ala Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Arg Gly Ala Arg Cys 2026528DNAArtificial Sequencefully synthetic 265gcaagcttgg gagaaatctg cgggccag 2826632DNAArtificial Sequencefully synthetic 266attgcggccg cttcatatcc tgttttggcc tg 3226730DNAArtificial Sequencefully synthetic 267attgcggccg ccccacattc ctttgggggc 3026828DNAArtificial Sequencefully synthetic 268agcaagcttg gacctgtgtc cagggacc 2826930DNAArtificial Sequencefully synthetic 269attgcggccg cgcaaggacc ttcacaaggg 3027029DNAArtificial Sequencefully synthetic 270agcaagcttg ccgaaggtct gtgaggaag 2927130DNAArtificial Sequencefully synthetic 271attgcggccg cactttcaca ggaggctctc 3027230DNAArtificial Sequencefully synthetic 272agcaagcttg gacgtcctgc atttcacctc 3027332DNAArtificial Sequencefully synthetic 273attgcggccg cggtgcgaat gtacaagatc tc 3227432DNAArtificial Sequencefully synthetic 274agcaagcttg aatgcttcag ttccttccat tc 3227533DNAArtificial Sequencefully synthetic 275attgcggccg cagtccttgc aaagacgaag ttg 3327629DNAArtificial Sequencefully synthetic 276agcaagcttg atgcccgcag aaggagcag 2927732DNAArtificial Sequencefully synthetic 277attgcggccg ctttaatggc cactctggtt tc 3227829DNAArtificial Sequencefully synthetic 278agcaagcttg ggagaaatct gcgggccag 2927929DNAArtificial Sequencefully synthetic 279agcaagcttg ggagaaatct gcgggccag 29

Claims

1. A method of treating a tumor in a human subject, comprising administering to said subject a therapeutically effective amount of an inhibitor of IGF-1R signalling, wherein said subject exhibits at least one of the following responses to said treatment:a. stable disease according to RECIST criteria,b. partial response according to RECIST criteria,c. complete response according to RECIST criteria,d. reduction in metabolic activity in said tumor as assayed by PET,e. elimination of metabolic activity in said tumor as assayed by PET, andf. improvement in a symptom associated with said tumor.

2. The method of claim 1, wherein said tumor is selected from the group consisting of:a. a sarcoma tumor,b. a Ewing's sarcoma tumor,c. an adenocarcinoma tumor,d. a pancreatic cancer tumor,e. a carcinoid tumor,f. a thymus tumor,g. an adenoid tumor,h. an adenoid R eye tumor,i. a melanoma tumor,j. a colorectal tumor,k. an ovarian tumor,l. a breast tumor,m. a tumor comprising a cell that has an activating RAS mutation,n. a tumor comprising a cell that has an activating KRAS mutation,o. a tumor comprising a cell that has an activating mutation in codon 12 of KRAS,p. a tumor comprising a cell that has a KRAS G12C mutation,q. a tumor comprising a cell that does not have a missense or a nonsense mutation in the PTEN tumor suppressor,r. a tumor comprising a cell that does not have a reduction of expression of PTEN, relative to a non-tumor tissue sample, detectable by immunohistochemistry using an antibody specific for PTEN,s. a tumor that exhibits a complete loss of PTEN expression in 5% or fewer of tumor cells as assessed by immunohistochemical staining of archival formalin fixed paraffin embedded tumor sections,t. a tumor comprising a cell that has an EWS-FLI genetic translocation,u. a tumor that expresses an EWS-FLI hybrid gene,v. a tumor comprising a cell that has an EWS/ets gene rearrangement,w. a tumor that expresses an EWS/ets hybrid gene, andx. a tumor comprising a cell that has a t(11;22)(q24;q12) chromosomal abnormality.

3. The method of claim 1, wherein said subject exhibits said response within six months of said administration of said inhibitor of IGF-1R signaling.

4. The method of claim 1, wherein said subject exhibits said response within 90 days of said administration of said inhibitor of IGF-1R signaling.

5. The method of claim 1, wherein said subject exhibits said response within 60 days of said administration of said inhibitor of IGF-1R signaling.

6. The method of claim 1, wherein said subject exhibits said response within 30 days of said administration of said inhibitor of IGF-1R signaling.

7. The method of claim 1, wherein said subject exhibits said response within 14 days of said administration of said inhibitor of IGF-1R signaling.

8. The method of claim 1, wherein said subject exhibits said response within 8 days of said administration of said inhibitor of IGF-1R signaling.

9-18. (canceled)

19. The method of claim 1, wherein said inhibitor of IGF-1R signaling is selected from the group consisting of:a. an antibody that specifically binds to the IGF-1 receptor,b. an antibody fragment that specifically binds to the IGF-1 receptor,c. an antibody derivative that specifically binds to the IGF-1 receptor,d. a peptibody that specifically binds to the IGF-1 receptor,e. an Avimer® that specifically binds to the IGF-1 receptor,f. an IGF-1 receptor siRNA, andg. a small molecule that binds to the IGF-1 receptor.

20. The method of claim 19, wherein said antibody is selected from the group consisting of an antibody comprising a combination of a light chain variable domain and a heavy chain variable domain selected from the group of combinations consisting of: L1H1, L2H2, L3H3, L4H4, L5H5, L6H6, L7H7, L8H8, L9H9, L10H10, L11H11, L12H12, L13H13, L14H14, L15H15, L16H16, L17H17, L18H18, L19H19, L20, H20, L21H21, L22H22, L23H23, L24H24, L25H25, L26H26, L27H27, L28H28, L29H29, L30H30, L31H31, L32H32, L33H33, L34H34, L35H35, L36H36, L37H37, L38H38, L39H39, L40H40, L41H41, L42H42, L43H43, L44H44, L45H45, L46H46, L47H47, L48H48, L49H49, L50H50, L51H51, and L52H52; antibody 1A (DSMZ Deposit No. DSM ACC 2586), antibody 8 (DSMZ Deposit No. DSM ACC 2589), antibody 23 (DSMZ Deposit No. DSM ACC 2588), antibody 18; antibody 2F8, antibody A12, antibody IMC-A12; antibody 7C10, chimaeric antibody C7C10, antibody h7C10, antibody 7H2M, chimaeric antibody *7C10, antibody GM 607, humanized antibody 7C10 version 1, humanized antibody 7C10 version 2, humanized antibody 7C10 version 3, antibody 7H2HM; antibody EM164, resurfaced antibody EM164, humanized antibody EM164, antibody huEM164 v1.0, antibody huEM164 v1.1, antibody huEM164 v1.2, and antibody huEM164 v1.3; antibody CP-751,871, the antibody produced by the hybridoma having the ATCC accession number PTA-2792, the antibody produced by the hybridoma having the ATCC accession number PTA-2788, the antibody produced by the hybridoma having the ATCC accession number PTA-2790, the antibody produced by the hybridoma having the ATCC accession number PTA-2791, the antibody produced by the hybridoma having the ATCC accession number PTA-2789, the antibody produced by the hybridoma having the ATCC accession number PTA-2793; antibody 2.12.1, antibody 2.13.2, antibody 2.14.3, antibody 3.1.1, antibody 4.9.2, and antibody 4.17.3; antibody 19D12, an antibody comprising a heavy chain encoded by a polynucleotide in plasmid 15H12/19D12 HCA (γ4), deposited at the ATCC under number PTA-5214, and a light chain encoded by a polynucleotide in plasmid 15H12/19D12 LCF (κ), deposited at the ATCC under number PTA-5220; antibody PINT-6A1, antibody PINT-7A2, antibody PINT-7A4, antibody PINT-7A5, antibody PINT-7A6, antibody PINT-8A1, antibody PINT-9A2, antibody PINT-11A1, antibody PINT-11A2, antibody PINT-11A3, antibody PINT-11A4, antibody PINT-11A5, antibody PINT-11A7, antibody PINT-11A12, antibody PINT-12A1, antibody PINT-12A2, antibody PINT-12A3, antibody PINT-12A4, antibody PINT-12A5, antibody M13-C06, antibody M14-G11, antibody M14-C03, antibody M14-B01, antibody M12-E01, and antibody M12-G04, and antibodies produced by hybridomas P2A7.3E11, 20C8.3B8, P1A2.2B11, 20D8.24B11, P1E2.3B12, and P1G10.2B8.

21. The method of claim 19, wherein said antibody binds to the IGF-1 receptor L2 domain.

22. The method of claim 19, wherein said antibody binds to the IGF-1 receptor FnIII 1 domain.

23. The method of claim 19, wherein said antibody binds to the IGF-1 receptor FnIII 2 domain.

24. The method of claim 19, wherein said antibody binds to the IGF-1 receptor L1 and FnIII 1 domains.

25. The method of claim 19, wherein said antibody competes for binding to IGF-1R with antibody L16/H16.

26. The method of claim 19, wherein said antibody comprises a light chain variable domain that is at least 90% identical to the light chain L16 and a heavy chain variable domain that is at least 90% identical to the heavy chain H16.

27. The method of claim 19, wherein said antibody comprises the light chain variable domain of L16 and the heavy chain variable domain of H16.

28. The method of claim 1, wherein said inhibitor of IGF-1R signaling is selected from the group consisting of:a. an antibody, or antibody fragment, that specifically binds to IGF-1,b. an antibody, or antibody fragment, that specifically binds to IGF-2,c. an IGF-1 and/or IGF-2 binding protein,d. a soluble, IGF-1 and/or IGF-2 binding fragment of the IGF-1 receptor,e. a soluble, IGF-2 binding fragment of the IGF-2 receptor,f. a small molecule that binds to IGF-1 and/or IGF-2,g. a small molecule that binds to IRS1,h. a small molecule that binds to SHC, GRB2, or SOS1, andi. a small molecule that binds to PI3K or SHP2.

30. (canceled)

31. The method of claim 1, wherein said human subject is less than 18 years old.

32. (canceled)

33. The method of claim 1, wherein said tumor is a metastatic tumor.

34-38. (canceled)

39. The method of claim 1, wherein said method comprises a combination therapy.

40. The method of claim 39, wherein said combination therapy comprises administering to said subject a chemotherapeutic agent.

41. (canceled)

42. The method of claim 39, wherein said combination therapy comprises administering to said subject at least one compound selected from the group consisting of adriamycin, cytoxan, ifosfamide, vincristine, topotecan, taxotere, cyclophosphamide, etoposide, actinomycin D, doxorubicin, busulfan, melphalan, cisplatinum, and gemcitabine.

43. The method of claim 39, wherein said combination therapy comprises administering to said subject at least one combination of compounds selected from the group of combinations consisting of:a. adriamycin and cytoxan,b. vincristine, actinomycin D, and cyclophosphamide,c. vincristine, actinomycin D, cyclophosphamide, and doxorubicin,d. vincristine, ifosfamide, doxorubicin, and etoposide,e. vincristine, topotecan, and cyclophosphamide,f. ifosfamide and etoposide,g. busulfan and melphalan,h. ifosfamide and vincristine, andi. topotecan and vincristine.

44. The method of claim 39, wherein said combination therapy comprises administering to said subject at least one compound selected from the group consisting of a corticosteroid, an anti-emetic, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, a cancer vaccine, a GM-CSF inhibiting agent, a GM-CSF DNA vaccine, a cell-based vaccine, a dendritic cell vaccine, a recombinant viral vaccine, a heat shock protein (HSP) vaccine, an allogeneic tumor vaccine, an autologous tumor vaccine, an analgesic, ibuprofen, naproxen, choline magnesium trisalicylate, an oxycodone hydrochloride, an anti-angiogenic agent, an anti-vascular agent, bevacizumab, an anti-VEGF antibody, an anti-VEGF receptor antibody, a soluble VEGF receptor fragment, an anti-TWEAK antibody, an anti-TWEAK receptor antibody, a soluble TWEAK receptor fragment, AMG 706, AMG 386, an anti-proliferative agent, a farnesyl protein transferase inhibitor, an αvβ3 inhibitor, an αvβ5 inhibitor, a p53 inhibitor, a Kit receptor inhibitor, a ret receptor inhibitor, a PDGFR inhibitor, a growth hormone secretion inhibitor, an angiopoietin inhibitor, a tumor infiltrating macrophage-inhibiting agent, a c-fms inhibiting agent, an anti-c-fms antibody, an CSF-1 inhibiting agent, an anti-CSF-1 antibody, a soluble c-fms fragment, pegvisomant, gemcitabine, panitumumab, irinothecan, and SN-38.

45. The method of claim 1, further comprising treating said subject with high-dose chemotherapy and autologous hematopoietic stem cell rescue.

46. The method of claim 1, further comprising treating said subject with radiation.

47. The method of claim 46, comprising whole lung irradiation.

48-53. (canceled)

54. The method of claim 1, further comprising surgically removing from said subject at least a portion of said tumor.

55. The method of claim 1, wherein said therapeutically effective amount of said inhibitor of IGF-1R signaling has an effect selected from the group consisting of:a. binds to at least 10% of subject's IGF-1 receptors within 24 hours of administration,b. binds to at least 25% of subject's IGF-1 receptors within 24 hours of administration,c. binds to at least 50% of subject's IGF-1 receptors within 24 hours of administration,d. binds to at least 75% of subject's IGF-1 receptors within 24 hours of administration,e. binds to at least 90% of subject's IGF-1 receptors within 24 hours of administration,f. binds to at least 99% of subject's IGF-1 receptors within 24 hours of administration,g. reduces signaling through subject's IGF-1 receptors by at least 10% within 24 hours of administration,h. reduces signaling through subject's IGF-1 receptors by at least 25% within 24 hours of administration,i. reduces signaling through subject's IGF-1 receptors by at least 50% within 24 hours of administration,j. reduces signaling through subject's IGF-1 receptors by at least 75% within 24 hours of administration,k. reduces signaling through subject's IGF-1 receptors by at least 90% within 24 hours of administration,l. reduces signaling through subject's IGF-1 receptors by at least 99% within 24 hours of administration,m. reduces autophosphorylation of IGF-1 receptor by at least 10% within 24 hours of administration,n. reduces autophosphorylation of IGF-1 receptor by at least 25% within 24 hours of administration,o. reduces autophosphorylation of IGF-1 receptor by at least 50% within 24 hours of administration,p. reduces autophosphorylation of IGF-1 receptor by at least 75% within 24 hours of administration,q. reduces autophosphorylation of IGF-1 receptor by at least 90% within 24 hours of administration,r. reduces autophosphorylation of IGF-1 receptor by at least 99% within 24 hours of administration,s. reduces phosphorylation of IRS-1 by at least 10% within 24 hours of administration,t. reduces phosphorylation of IRS-1 by at least 25% within 24 hours of administration,u. reduces phosphorylation of IRS-1 by at least 50% within 24 hours of administration,v. reduces phosphorylation of IRS-1 by at least 75% within 24 hours of administration,w. reduces phosphorylation of IRS-1 by at least 90% within 24 hours of administration, andx. reduces phosphorylation of IRS-1 by at least 99% within 24 hours of administration.

56. The method of claim 1, wherein said tumor is of a type selected from the group consisting of ovarian, lung, carcinoid, head and neck, colon, breast, prostate, and gallbladder, further comprising administering to said subject a therapeutically effective amount of gemcitabine.

57. A method of determining the relative likelihood that a tumor in a human subject will respond to a treatment comprising administering an inhibitor of IGF-1 receptor signaling to said subject, said method comprising determining whether cells from said tumor comprise a biomarker selected from the group consisting of:a. an activating RAS mutation, wherein presence of said activating RAS mutation indicates that said tumor is more likely to respond to said treatment,b. an activating mutation in codon 12 of a RAS, wherein presence of said activating mutation in codon 12 of said RAS indicates that said tumor is more likely to respond to said treatment,c. an activating KRAS mutation, wherein presence of said activating KRAS mutation indicates that said tumor is more likely to respond to said treatment,d. an activating mutation in codon 12 of KRAS, wherein presence of said activating mutation in codon 12 of said KRAS indicates that said tumor is more likely to respond to said treatment,e. a KRAS G12C mutation, wherein presence of said KRAS G12C mutation indicates that said tumor is more likely to respond to said treatment,f. a wild-type KRAS allele, wherein said treatment further comprises treating said human subject with an inhibitor of EGF receptor, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment,g. a wild-type KRAS allele, wherein said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment,h. a wild-type KRAS allele, wherein said subject previously received panitumumab and/or cetuximab, said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment,i. a wild-type KRAS allele, wherein said tumor is a colorectal tumor, said subject previously received panitumumab and/or cetuximab, said treatment further comprises treating said human subject with panitumumab and/or cetuximab, and presence of said wild-type KRAS allele indicates that said tumor is more likely to respond to said treatment,j. a reduced expression of PTEN, wherein presence of said reduced expression of PTEN indicates that said tumor is less likely to respond to said treatment,k. a missense or nonsense mutation in PTEN, wherein presence of said missence or nonsense mutation in PTEN indicates that said tumor is less likely to respond to said treatment,l. an EWS-FLI genetic translocation, wherein presence of said EWS-FLI genetic translocation indicates that said tumor is more likely to respond to said treatment,m. expression of an EWS-FLI hybrid gene, wherein expression of said EWS-FLI hybrid gene indicates that said tumor is more likely to respond to said treatment,n. an EWS/ets gene rearrangement, wherein presence of said EWS/ets gene rearrangement indicates that said tumor is more likely to respond to said treatment,o. expression of an EWS/ets hybrid gene, wherein expression of said EWS/ets hybrid gene indicates that said tumor is more likely to respond to said treatment, andp. a t(11;22)(q24;q12) chromosomal abnormality, wherein presence of said t(11;22)(q24;q12) chromosomal abnormality indicates that said tumor is more likely to respond to said treatment.

58. The method of claim 57, wherein said tumor is determined to be more likely to respond to said treatment, said method further comprising the subsequent step of administering said treatment to said subject.

59. A composition for treating a tumor disease in a human subject, comprising:between 10 and 150 mg/ml of an antibody, antibody fragment, or antibody derivative that specifically bind to IGF-1 receptor,between 1 and 100 mM acetate, pH between 4.0 and 9.0,between 0.5% and 20.0% w/v sorbitol, andbetween 0.001% and 0.010% w/v Polysorbate 20.

60. The composition of claim 59, comprising:30 mg/ml of said antibody, antibody fragment, or antibody derivative,10 mM acetate, pH 5.2,5% w/v sorbitol, and0.004% w/v Polysorbate 20.

Images