Entries |
Document | Title | Date |
20080199398 | Novel Peptides That Promote Lipid Efflux - Disclosed herein are peptides with domains that promote lipid efflux from cells and optionally possess at least one anti-inflammatory domain or a domain that stimulates LCAT activity. Provided herein are methods of using the peptides to treat or inhibit diseases including dyslipidemic disorders, stroke and myocardial infarction. Also provided are methods of detecting plaque in vessels using the labeled peptides of the present invention. | 08-21-2008 |
20080199399 | Interfacing Nanostructures to Biological Cells - Disclosed herein are methods and materials by which nanostructures such as carbon nanotubes, nanorods, etc. are bound to lectins and/or polysaccharides and prepared for administration to cells. Also disclosed are complexes comprising glycosylated nanostructures, which bind selectively to cells expressing glycosylated surface molecules recognized by the lectin. Exemplified is a complex comprising a carbon nanotube functionalized with a lipid-like alkane, linked to a polymer bearing repeated α-N-acetylgalactosamine sugar groups. This complex is shown to selectively adhere to the surface of living cells, without toxicity. In the exemplified embodiment, adherence is mediated by a multivalent lectin, which binds both to the cells and the α-N-acetylgalactosamine groups on the nanostructure. | 08-21-2008 |
20080199400 | Otologic nanotechnology - Diagnosing or treating a human ear includes transporting a conjugated nanoparticle or a magnetically responsive nanoparticle into a human's middle or inner ear. Otologic nanophoresis includes electrically, magnetically or electromagnetically driving a nanoparticle through a membrane of the ear, including a tympanic membrane, a round window membrane, an oval window membrane, or a circulatory membrane. An otologic diagnostic device includes a nanoparticle conjugated with a material selected from the group consisting of lipids, proteins, growth factors, growth hormones, antioxidants, free radical scavengers, steroid preparations, and metabolically active substances; an otologic therapeutic device includes the same categories of substances and chemotherapeutic drugs. Another otologic composition includes a nanoparticle conjugated with a substance perceptible to magnetic resonance imaging. | 08-21-2008 |
20080206139 | DELIVERY SYSTEM FOR DIAGNOSTIC AND THERAPEUTIC AGENTS - Nanovesicles are specifically targeted to abnormal cells. The targeting moiety is conjugated to the nanovesicle which comprises a therapeutic composition. These nanovesicles are useful in treatment of a wide spectrum of disorders. | 08-28-2008 |
20080206140 | Cspcna Isoform Antibodies and Uses Thereof - Antibodies specifically bind only to a cancer specific proliferating cell nuclear antigen (csPCNA) isoform and not to the non-malignant proliferating cell nuclear antigen (nmPCNA) isoform. Methods and compositions to detect the presence of csPCNA isoform are disclosed. | 08-28-2008 |
20080206141 | Optical Imaging Contrast Agents - The invention relates to optical imaging contrast agents. More specifically the invention relates to optical imaging activatable contrast agent for use in diagnosis and for monitoring the effect of treatment. The contrast agent employs a combined targeting and activation approach and comprises a target binding ligand (V), an enzyme cleavable group (E), a fluorophore (D) and a quencher agent (Q) covalently linked in one molecule. | 08-28-2008 |
20080206142 | Novel Peptides That Promote Lipid Efflux - Disclosed herein are peptides with domains that promote lipid efflux from cells and optionally possess at least one anti-inflammatory domain or a domain that stimulates LCAT activity. Provided herein are methods of using the peptides to treat or inhibit diseases including dyslipidemic disorders, stroke and myocardial infarction. Also provided are methods of detecting plaque in vessels using the labeled peptides of the present invention. | 08-28-2008 |
20080213179 | Differentially Expressed Nucleic Acids in the Blood-Brain Barrier Under Inflammatory Conditions - The present invention relates to nucleic acids and polypeptides encoded thereby, whose expression is modulated in brain microvascular endothelial cells undergoing early dynamic inflammation-induced changes in blood-brain barrier functionality. Such polypeptides are referred to as lipopolysaccharide-sensitive (LPSS) polypeptides herein. These nucleic acids and polypeptides may be useful in methods for controlling blood-brain barrier properties in mammals in need of such biological effects. This includes the diagnosis and treatment of disturbances in the blood-brain/retina barrier, brain (including the eye) disorders, as well as peripheral vascular disorders. Additionally, the invention relates to the use of anti-LPSS polypeptide antibodies or ligands as diagnostic probes, as blood-brain barrier targeting agents or as therapeutic agents as well as the use of ligands or modulators of expression, activation or bioactivity of LPSS polypeptides as diagnostic probes, therapeutic agents or drug delivery enhancers. | 09-04-2008 |
20080213180 | CA IX-Specific Inhibitors - Therapeutic methods for inhibiting the growth of preneoplastic/neoplastic vertebrate cells that abnormally express MN protein are disclosed. Screening assays are provided for identifying compounds, preferably organic compounds, preferably aromatic and heterocylic sulfonamides, which inhibit the enzymatic activity of MN/CA IX and that are useful for treating patients with preneoplastic/neoplastic disease. Further, the CA IX-specific inhibitors when labeled or linked to an appropriate visualizing means can also be used diagnostically/prognostically for preneoplastic/neoplastic disease, and for imaging use, for example, to detect hypoxic precancerous cells, tumors and/or metastases, by selectively binding to activated CA IX, preferably CA IX activated under hypoxic conditions, and not to inactive CA IX. Such detection of hypoxic conditions can be helpful in determining effective treatment options, and in predicting treatment outcome and the prognosis of disease development. Still further, the CA IX-specific inhibitors can be used therapeutically to selectively target hypoxic cells expressing activated CA IX. The CA IX-specific inhibitors can be labelled or conjugated to radioisotopes for radiotherapy of hypoxic cells. Alternatively, the CA IX-specific inhibitors can be used for gene therapy coupled to vectors for targeted delivery to hypoxic preneoplastic/neoplastic cells expressing activated CA IX on their surfaces. | 09-04-2008 |
20080213181 | Preparation of Paramagnetic Nanoparticles Conjugated to Leukotriene B4 (LTB4) Receptor Antagonists, and Their Use as MRI Contrast Agents for the Detection of Infection and Inflammation - Nanoparticle-based compositions and emulsions that are specifically targeted to leukotriene B4 (LTB4) receptors, and employing LTB4 receptor antagonist targeting agents, are set forth. In addition, there is provided the use of non-antibody based compositions for such targeting. The compositions of the invention are useful as imaging agents in diagnostic and therapeutic applications. | 09-04-2008 |
20080219924 | Imaging, diagnosis and treatment of disease - The present invention relates to endothelial cell-specific genes and encoded polypeptides and materials and uses thereof in the imaging, diagnosis and treatment of conditions involving the vascular endothelium. | 09-11-2008 |
20080219926 | SERS MOLECULAR PROBE FOR DIAGNOSTICS AND THERAPY AND METHODS OF USE THEREOF - An oligonucleotide-based SERS molecular probe (SMP) includes a nanoparticle having at least a metal component, and at least one pin loop, the pin loop including a loop sequence complementary to at least one target sequence, a first stem attached to one end of the loop sequence, a second stem attached to the other end of the loop sequence, and at least one SERS active label attached to the first stem. The nanoparticle is attached to the second stem. The probe generates a stronger SERS signal upon irradiation with excitation radiation when not bound to the target sequence as compared to the SERS signal generated following hybridization of the probe with the target sequence. | 09-11-2008 |
20080219927 | ADENOSINE DERIVATIVE FORMULATIONS FOR MEDICAL IMAGING - A stable composition useful for myocardial perfusion imaging contains one or more 2-alkynyladenosine derivatives; and a solvent which is made up of water and hydroxypropyl-β-cyclodextrin. | 09-11-2008 |
20080219928 | Measuring Gastrointestinal Parameters - The present application relates to methods for determining gastric residual volumes and amounts of dietary formula in gastric contents using measurements of soluble solids concentrations in gastric contents, and in some embodiments, a concentrate having a relatively high concentration of soluble solids. The methods can be used for measuring gastric residual volumes of subjects who have fasted or have a low or reduced gastric content. | 09-11-2008 |
20080219929 | Neurofibrillary labels - A method for determining the Braak stage of neurofibrillary degeneration associated with a tauopathy in a subject having neurofibrillary degeneration is disclosed. The method comprises the steps of (i) administering to the subject a conjugated, chelated or detectable chemical group-associated ligand that labels aggregated paired helical filament (PHF) tau protein and is capable of crossing the blood brain barrier; (ii) determining the presence and\or amount of ligand bound to extracellular aggregated PHF tau in the medial temporal lobe of the brain of the subject, and (iii) correlating the result of the determination made in (ii) with the extent of neurofibrillary degeneration in the subject. Preferred ligands include sulphonated-benzothiazole-like compounds and diamonophenothiazines. | 09-11-2008 |
20080226553 | Cell-Based Rna Interference and Related Methods and Compositions - This invention provides, among other things, methods for performing RNA interference in stem cells and methods for using stem cells in vivo. | 09-18-2008 |
20080226554 | Methods For Detecting Markers Associated With Endometrial Disease or Phase - Methods for detecting endometrial diseases or an endometrium phase in a subject are described comprising measuring endometrial markers or polynucleotides encoding the markers in a sample from the subject. The invention also provides localization or imaging methods for endometrial diseases, and kits for carrying out the methods of the invention. The invention also contemplates therapeutic applications for endometrial diseases employing endometrial markers, polynucleotides encoding the markers, and/or binding agents for the markers. | 09-18-2008 |
20080226555 | Method for the Use of [11C] Carbon Monoxide in Labeling Synthesis of 11C-Labelled Esters and Acids by Sensitized Photo-Induced Free Radical - Methods and reagents for photo-initiated carbonylation with carbon-isotope labeled carbon monoxide using alkyl/aryl iodides with alcohols or water treated by photosensitizers are provided. The resultant carbon-isotope labeled esters and acids, and pharmaceutical acceptable salts and solvates are useful as radiopharmaceuticals, especially for use in Positron Emission Tomography (PET). Associated kits and method for PET studies are also provided. | 09-18-2008 |
20080226556 | Removal promoters and inhibitor for apoptosis cells in vivo - The present invention is to provide a removal promoter for apoptotic cells which is capable of immediately removing apoptotic cells in vivo by macrophages, or a removal inhibitor which inhibits the removal of apoptotic cells in vivo by macrophages. A removal promoter for apoptotic cells in vivo containing the milk fat globule-EGF factor 8-L (MFG-E8-L), MFG-E8-L mutant having removal promotion action for apoptotic cells in vivo by macrophages, or preferably a recombinant human or mouse MFG-E8-L, or a recombinant human or mouse MFG-E8-L mutant as an active ingredient is prepared. Such removal promoters specifically bind to apoptotic cells and promote the phagocytosis of apoptotic cells by macrophages by recognizing aminophospholipids such as phosphatidylserine exposed on apoptotic cell surface. On the other hand, a point mutation (D89E) MFG-E8-L mutant is used as a removal inhibitor. | 09-18-2008 |
20080226557 | Luciferins - Novel luciferins, methods of making luciferins, and uses of the same are disclosed. | 09-18-2008 |
20080226558 | Mesoderm and definitive endoderm cell populations - The present invention provides cell populations that are enriched for mesendoderm and mesoderm, and cell populations that are enriched for endoderm. The cell populations of the invention are useful for generating cells for cell replacement therapy. | 09-18-2008 |
20080233048 | Oral Preparation Useful in Measurement Capacity to Metabolize Pyridine - An object of the present invention is to provide an oral preparation that can be used to diagnose the existence or degree of pyridine metabolic capacity disorder, pyrimidine metabolic rate, etc., with high accuracy and with little variation due to individual differences. The oral preparation is prepared using a powder material obtained by mixing and pulverizing (a) an isotope-labeled compound and/or a pyrimidine metabolite compound and (b) a sugar and/or a sugar alcohol. | 09-25-2008 |
20080241065 | Systems and methods for the detection and analysis of in vivo circulating cells, entities, and nanobots - An improved circulating cell counter for generating light, and for delivering this light to a site in vivo for determining the presence, absence, concentration or count of a target cell, in which a light source such as a laser diode ( | 10-02-2008 |
20080241066 | Anti-PRL-3 antibodies and methods of use thereof - The invention relates to antibodies or antigen-binding fragments thereof which bind PRL-3 without binding to and cross-reacting with PRL-1 or PRL-2. The invention also relates to methods of identifying and treating invasive or metastatic cancer using the anti-PRL-3 antibodies and the use of anti-PRL-3 antibodies in prognostic, preventative, diagnostic and other therapeutic methods. | 10-02-2008 |
20080247949 | Biological Tissue Examination Agent Comprising Hemoglobin Labeled With Oxygen Isotope And Method For Producing The Same - The present invention relates to a biological tissue examination agent comprising hemoglobin labeled with | 10-09-2008 |
20080247950 | Activation of peptide prodrugs by hK2 - The invention provides novel peptide prodrugs that contain cleavage sites specifically cleaved by human kallikrein 2 (hK2). These prodrugs are useful for substantially inhibiting the non-specific toxicity of a variety of therapeutic drugs. Upon cleavage of the prodrug by hK2, the therapeutic drugs are activated and exert their toxicity. Methods for treating cell proliferative disorders are also featured in the invention. | 10-09-2008 |
20080247951 | ANTI-ROBO4 ANTIBODIES AND USES THEREFOR - The invention provides anti-Robo4 antibodies, and compositions comprising the antibodies and methods of using these antibodies, including diagnostic and therapeutic methods. | 10-09-2008 |
20080247952 | Method for Quantifying a Cholinergic Neurotoxin in a Sample - The invention relates to a method for determining the kinetics of action of a cholinergic neurotoxin as well as a method for determining the quantity of neurotoxin in a sample. | 10-09-2008 |
20080253966 | Diagnostic, Prognostic, and Therapeutic Factor Smac/Diablo in Human Cancer - The present invention provides, for the first time, the finding that Smac/DIABLO is underexpressed in cancers such as renal cell carcinoma. In particular, the present invention provides methods of diagnosing and providing a prognosis for cancers that underexpress Smac/DIABLO, as well as methods of drug discovery to identify therapeutics useful when used alone or in combination with other cancer therapeutics. The present invention also provides methods of treating or inhibiting cancers that underexpresses Smac/DIABLO, in which potentiation of Smac/DIABLO expression and/or activity sensitizes resistant tumor cells to cytotoxic treatments including chemotherapy, radiation therapy, hormonal therapy, and immunotherapy. Compositions, kits, and integrated systems for carrying out the diagnostic, prognostic, and therapeutic methods of the present invention are also provided. | 10-16-2008 |
20080253967 | Halo-Stilbene Derivatives And Their Use For Binding And Imaging Of Amyloid Plaques - This invention relates to a method of imaging amyloid deposits and to styrylpyridine compounds, and methods of making radiolabeled styrylpyridine compounds useful in imaging amyloid deposits. This invention also relates to compounds, and methods of making compounds for inhibiting the aggregation of amyloid proteins to form amyloid deposits, and a method of delivering a therapeutic agent to amyloid deposits. | 10-16-2008 |
20080260640 | Use of Precursors Of Tachykinins and/or Their Fragments in Medical Diagnostic - The present invention relates to the use of protachykinin and/or fragments thereof that can be isolated from body fluids, tissues or other biological samples and therefore, serves as a marker peptide for medical diagnosis of diseases/disorders of the central nervous system, including Alzheimer's disease, Parkinson's disease, depression and/or conditions of pain, neurological, endocrinological, cerebral, muscular, local, systemic, chronic, inflammatory diseases, infectious diseases comprising bacterial and viral infections, meningitis, sepsis, Crohn's disease, colitis ulcerosa, sickle cell anemia, ischemia, amyotrophic lateral sclerosis, arthritis comprising rheumatoid arthritis, bronchitis, hyperalgesia, asthma, intoxication comprising bacterial intoxication, immunological disorders, poly/-trauma comprising cranio-cerebral trauma, tumors/cancer, stroke, stress, atopis dermatitis, HIV, Huntington's disease, burns, schizophrenia, Hirschsprung's disease, allergies, familial dysautononmia (Riley Day syndrome), hematopoietic disorders, gliomas comprising glioblastomas and astrocytomas, disorders of the blood brain barrier. The invention further provides antibodies for binding to certain proteins and their fragments, more specifically protachykinin and protachykinin peptides. In accordance with the invention, a kit useful for the above-mentioned diagnosis is also provided. | 10-23-2008 |
20080260641 | Human Monoclonal Antibodies Against Cd20 - Isolated human monoclonal antibodies which bind to and inhibit human CD20, and related antibody-based compositions and molecules, are disclosed. Also disclosed are pharmaceutical compositions comprising the human antibodies, and therapeutic and diagnostic methods for using the human antibodies. | 10-23-2008 |
20080260642 | Bacteriophage-Based Contrast Agents, the Use Thereof and a Method for the Production Thereof - Bacteriophage-based contrast agents and a method for the production thereof are disclosed. The bacteriophages, in at least one embodiment, contain a first fusion protein comprising a phage-surface protein and a ligand specific for an identifiable target structure and a second fusion protein comprising a phage-surface protein and a peptide binding a signal generating molecule. | 10-23-2008 |
20080267871 | Cardioinhibitory/ Antihypertensive Novel Endogenous Physiologically Active Peptide - [Object] The present invention is to provide a novel peptide having a potent hypotensive activity by inhibiting cardiac contractility, a DNA encoding the peptide, an antibody against the peptide, or a cardioinhibitory/hypotensive agent comprising the peptide as an active ingredient. A search of a genetic data base revealed the presence of a peptide biosynthesized by a processing of unspliced product of TOR2A mRNA. As a result of functional analysis, a peptide hormone exerting a potent bioactivity and expressed abundantly throughout human organs was found. The peptide is hydrophobic with a molecular weight of 2664.02 consisting of 24 amino acids (AIFIFISNTGGKQINQVALEAWRS) and shows a negative inotropism in rat hearts, as well as a marked systemic hypotensive activity. | 10-30-2008 |
20080267872 | Nucleic acid and corresponding protein entitled 98P4B6 useful in treatment and detection of cancer - A novel gene 098P4B6 (also designated STEAP-2) and its encoded protein, and variants thereof, are described wherein 98P4B6 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 98P4B6 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 98P4B6 gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 98P4B6 can be used in active or passive immunization. | 10-30-2008 |
20080267873 | Injection Solution for Rna - The invention relates to the use of RNA and an aqueous injection buffer containing a sodium salt, a calcium salt and optionally a potassium salt and optionally lactate, in the preparation of a RNA injection solution for increasing RNA transfer and/or RNA translation into/in a host organism. The invention relates further to a RNA injection solution and to a method for increasing the RNA transfer and/or RNA translation of RNA in vivo and in vitro. | 10-30-2008 |
20080267874 | Targeted Neuronal And Glial Human Embryonic Stem Cell Line - The present invention is related to human stem cells lines comprising a targeted gene construct, and in particular to human embryonic stem cells lines (hESC) comprising a reporter gene inserted into the Olig2 locus via homologous recombination. The hESC line remains pluripotent and maintains a normal karyotype, and allows for visualization of Olig2 expression by fluorescence microscopy and sorting by FACS. Since Olig2 is important is the development of motor neurons and oligodendrocytes, the present invention provides a means to study differentiation of stem cells into motor neurons and oligodendrocytes, as well as the study of intrinsic and extrinsic factors that affect such differentiation. The hESCs of the present invention also provide a means to study and determine optimal factors and conditions for cell differentiation. | 10-30-2008 |
20080267875 | STEROID CONJUGATES, PREPARATION THEREOF AND THE USE THEREOF - Conjugates comprising one or more steroids conjugated with one or more mammalian proteins are disclosed. The conjugates are useful for diagnosis or treatment of solid cancer aid haematological malignancies. Further the conjugates exhibits a synergistic action together with a cytoskeleton acting drug such as Taxol®, which enable the treatment of cancers that otherwise would be non responsive to Taxol®. | 10-30-2008 |
20080267876 | Nanoparticles for Targeted Delivery of Active Agent - The present invention concerns a delivery system comprising a polymer-based nanoparticle; and a linker comprising a first portion non-covalently anchored to said nanoparticle, wherein at least part of said first portion comprises a hydrophobic/lipophilic segment embedded in said nanoparticle; and a second portion comprising a maleimide compound exposed at the outer surface of said nanoparticle. In accordance with one embodiment, the delivery system comprises one or more targeting agents, each covalently bound to said maleimide compound. In accordance with yet another embodiment, the delivery system comprises a drug. A specific example for a linker in accordance with the invention is octadecyl-4-(maleimideomethyl)cyclohexane-carboxylic amide (OMCCA). | 10-30-2008 |
20080267877 | Peptide-based carrier devices for stellate cells - A compound includes a carrier molecule wherein the carrier molecule is linked to a further molecule, wherein the further molecule is at least one cyclic peptide in which the cyclic peptide portion thereof contains at least one sequence encoding a cell receptor recognizing peptide (RRP) and with the proviso that the compound is not a naturally occurring receptor agonist or antagonist. Preferably, the RRP is a receptor specific for Hepatic Stellate Cells (HSC) or a receptor that is up-regulated on HSC during disease. The RFP may be chosen from among a PDGF receptor, a collagen type VI receptor, cytokine receptor(s) such as TGBβ, INFα and interleukinβ. The cyclic portion of the peptide can contain at least one amino acid sequence RGD or KPT. The compounds can be used as an active targeting ingredient for manufacturing a pharmaceutical composition for therapy, prophylaxis or diagnosis of a disease chosen from fibrotic disease, sclerotic disease, and chronic or acute inflammatory processes including glomeruloscherosis, interstitial fibrosis, lung fibrosis, atherosclerosis, rheumatoid arthritis, Crohns disease, colitis ulcerosa, glomerulonephritis and sepsis, and particularly for targeting HSC. Pharmaceutical compositions contain the above-compound(s). | 10-30-2008 |
20080267878 | Targeted Imaging And/Or Therapy Using The [3+2] Azide-Alkyne Cycloaddition - The use of a selective chemical and bioorthogonal reaction providing a covalent ligation such as the [3+2] cycloaddition, in targeted molecular imaging and therapy is presented, more specifically with interesting applications for pre-targeted imaging or therapy. Current pre-targeted imaging is hampered by the fact that it relies solely on natural/biological targeting constructs (biotin/streptavidin). Size considerations and limitations associated with their endogenous nature severely limit the number of applications. The present invention describes how the use of an abiotic, bio-orthogonal reaction which forms a stable adduct under physiological conditions, by way of a small or undetectable bond, can overcome these limitations. | 10-30-2008 |
20080267879 | Novel Imaging Tracers for Early Detection and Treatment of Amyloid Plaques Caused by Alzheimer's Disease and Related Disorders - The present invention relates to compounds and methods for imaging and treating Alzheimer's disease or an amyloidosis-associated pathological condition that utilize a novel amyloid imaging tracer for detecting amyloid deposits in a subject suffering from these conditions. In certain embodiments, the invention relates to [N-2[18F]fluoropropyl]-2-(4′-(methylamino)-phenyl)-6-hydroxybenzothiazole (F-18MHT) and dimers thereof. | 10-30-2008 |
20080274054 | Composite for Thermo-Sensitive Cell-Tissue Transplanted Scaffold and Use thereof - A composite comprising a stem cell; a biodegradable layer, which can provide an environment for the stem cell to grow and to differentiate, and; a N-isopropylacrylamide (NIPAAm), which can polymerize with the biodegradable layer and possess the temperature-responsive character for easy stripping. This invention also provides a method of treating a subject with a skin defect by covering the composite of the present invention on the skin defect of the subject in need of such treatment. Furthermore, using this composite with different growth factors, stem cells can be induced to differentiate into skin-related, neuronal cells, neuron, and insulin-positive cells in biodegradable scaffolds as well as transplanted graft. Finally, this invention also provides a quick and convenient method of monitoring cell growth or tissue engineering in an animal. | 11-06-2008 |
20080274055 | Framework Residue Substituted Humanized Col-1 Antibodies and Their Use - The present disclosure provides humanized COL-1 monoclonal antibodies that retain CEA binding affinity, compared to a parent antibody. Also disclosed herein are humanized COL-1 monoclonal antibodies that have reduced immunogenicity, compared to a parent antibody. The disclosed humanized COL-1 antibodies include substitution of framework residues with residues from the corresponding positions of a homologous human sequence. In several embodiments, methods are disclosed for the use of a humanized COL-1 antibody in the detection or treatment of a CEA-expressing tumor or cell in a subject. Also disclosed is a kit including the humanized COL-1 antibodies described herein. | 11-06-2008 |
20080274056 | NANOPARTICLE DELIVERY SYSTEMS FOR MEMBRANE-INTEGRATING PEPTIDES - Compositions which comprise emulsions of nanoparticles for delivery of membrane-integrating peptides are described. The nanoparticles comprise a liquid hydrophobic core coated with a lipid/surfactant layer which contains the membrane-integrating peptides. Methods to use such compositions are also described. | 11-06-2008 |
20080274057 | Staudinger Reaction in Imaging and Therapy and Kits for Use in Imaging and Therapy - The Staudinger reaction can be used for activation of prodrugs or pro-imaging probes. The invention relates to a method of preparing and activating prodrugs or pro-imaging probes by using the Staudinger reaction and to kits for medical imaging and/or therapy comprising at least one prodrug and/or pro-imaging probe comprising at least one azide and/or phosphine group. | 11-06-2008 |
20080279775 | Benztropinamine Analogs as Dopamine Uptake Inhibitors - Disclosed are benztropinamine analogs having the formula I (I) in which E is NR | 11-13-2008 |
20080286203 | Inhibitors and Methods of Treatment of Cardiovascular Diseases, and Methods for Identifying Inhibitors - The present invention provides, inter alia, inhibitors of cardiovascular diseases and disorders. The present invention also provides therapeutic methods for preventing and/or treating cardiovascular diseases and disorders. Further, the present invention provides methods of identifying inhibitors of cardiovascular diseases and disorders as well as model systems suitable for identifying such inhibitors as well as methods and compositions for detecting and/or diagnosing cardiovascular diseases and disorders. | 11-20-2008 |
20080292553 | Phosphoramidate Derivatives of Fau - The present invention provides phosphoramidate derivatives of a furanosyluracil analog, FAU, that can effectively deliver FAU monophosphate, or a derivative thereof, intracellularly. FAU-Phosphoramidate diesters can bypass the first step of phosphorylation and be activated intracellularly so as to be converted to nucleoside monophosphates. This results in improved formation of nucleoside triphosphates, and higher incorporation into DNA. The compounds of the invention can be used to treat cancer. | 11-27-2008 |
20080299042 | Membrane Associated Molecules - The present invention is directed to novel methods of treating, identifying or diagnosing a hyperproliferative disorder in a patient in need thereof. The methods of the invention include administering to a patient a composition comprising a binding molecule which binds to a cell surface expressed glycoprotein expressed predominantly in tumor or tumor-associated cells. In particular, the therapeutic and diagnostic methods of the present invention include the use of a binding molecule, for example an antibody or immunospecific fragment thereof, which specifically binds to a membrane associated molecule, variant polypeptide or fragment thereof. The present invention is based, at least in part, on the discovery of membrane associated proteins, i.e., nucleic acid molecules which encode membrane proteins and the use of these molecules to generate custom arrays to screen for markers associated with various diseases and disorders, e.g., cancer, e.g., lung, colon, pancreatic and ovarian cancer and autoimmune diseases or disorders. The invention further relates to various methods, reagents and kits for diagnosing, staging, prognosing, monitoring and treating hyperproliferative diseases or disorders such as cancer, e.g., lung, colon, pancreatic and ovarian cancer and autoimmune diseases or disorders. | 12-04-2008 |
20080299043 | HIGHER FATTY ACID TRIESTER COMPOUND HAVING DIETHYLENETRIAMINE-TYPE METAL CHELATE STRUCTURE - A compound having superior solubility and suitable for a liposome contrast medium selective for a lesion such as vascular diseases is provided which is represented by the following general formula (I) | 12-04-2008 |
20080305043 | Assay Method - Described is a method of detecting non-viable cells in a sample of cells, the method comprising contacting a sample of the cells with a detectable reagent and detecting binding of said reagent to cells of said sample. The detectable reagent is milk, a milk product or component thereof. A component which may be used is a lipopolysaccharide-binding protein, for example lactoferrin. The method may be performed in low Ca | 12-11-2008 |
20080305044 | Engineered Antibodies and Immunoconjugates - Antibody drug conjugates with predetermined sites and stoichiometries of drug attachment are provided. Also provided are methods of using antibody drug conjugates. | 12-11-2008 |
20080305045 | Methods of synthesis of non-toxic multifunctional nanoparticles and applications - The present invention involves multifunctional nanoparticle dispersions and methods for making them using sol-gel chemistry, doping, and sonication. These methods avoid the high thermal budget processes of the reference art. The dispersions can accommodate greater concentrations of nanoparticles, dopants, and ions than has previously been possible since these components can be added during synthesis. The unique optical, magnetic, luminescent, metallic, insulating, semi-conducting, and/or conducting properties of these particles can be utilized to enhance photovoltaic cells, portable electronic devices, and biomedical techniques among other applications. | 12-11-2008 |
20080311039 | Therapeutic and Prognostic Factor Yy1 in Human Cancer - The present invention provides for the first time YY1, a transcription factor gene over-expressed and/or functionally overactive in human cancer. The present invention provides methods of diagnosing and providing a prognosis for cancer such as prostate cancer, as well as methods of drug discovery. YY1 is also a therapeutic target for treatment of cancer resistant to conventional and experimental cancer therapeutics. Inhibition of YY1 expression and/or activity sensitizes resistant tumor cells to cytotoxic treatments, including chemotherapy, radiation therapy, hormonal therapy, and immunotherapy. | 12-18-2008 |
20080311040 | METHODS AND COMPOSITIONS FOR IMPROVED THERAPEUTIC EFFECTS WITH siRNA - The present invention relates to chemically modified, linked double-stranded (ds)RNA compositions comprising two or more double-stranded (ds) oligoribonucleotides linked by at least one linking moiety and methods of formulating and delivering such compositions to modulate gene expression through target-specific RNA co-interference (RNAco-i). The compositions of the invention may optionally comprise a conjugation or a complex with one or more small molecule drugs, protein therapeutics, or other dsRNA molecules. The present invention is directed at the methods of production for, methods of use of, and therapeutic utilities for RNAi co-interference therapy utilizing the compositions of the invention. | 12-18-2008 |
20080311041 | Water-Soluble, Fluorescent Compounds for Detection of Potassium Ions - The invention provides chromoionophore compounds comprising a triazacryptand (TAC) K | 12-18-2008 |
20080311042 | Loop-Variant Pdz Domains as Biotherapeutics, Diagnostics and Research Reagents - The present invention provides polypeptides that contain one or more PDZ loop-variants and are useful in the detection of pathogens and disease-associated molecules. The polypeptides of the invention are also useful in the diagnosis, treatment, and prevention of diseases. Also provided are methods of preparing polypeptides of the invention. | 12-18-2008 |
20080317669 | Cloning of honey bee allergen C - The present invention relates to a nucleic acid encoding a polypeptide capable of binding to IgE from subjects allergic to venom of an insect from the order | 12-25-2008 |
20080317670 | Compositions Containing, Methods Involving, and Uses of Non-Natural Amino Acids and Polypeptides - Disclosed herein are non-natural amino acids and polypeptides that include at least one non-natural amino acid, and methods for making such non-natural amino acids and polypeptides. The non-natural amino acids, by themselves or as a part of a polypeptide, can include a wide range of possible functionalities, but typical have at least one aromatic amine group. Also disclosed herein are non-natural amino acid polypeptides that are further modified post-translationally, methods for effecting such modifications, and methods for purifying such polypeptides. Typically, the modified non-natural amino acid polypeptides include at least one alkylated amine group. Further disclosed are methods for using such non-natural amino acid polypeptides and modified non-natural amino acid polypeptides, including therapeutic, diagnostic, and other biotechnology uses. | 12-25-2008 |
20080317671 | NON-IMIDAZOLE HETEROCYCLIC COMPOUNDS - Certain non-imidazole heterocyclic compounds are histamine H | 12-25-2008 |
20090004108 | Smmr (Small Molecule Metabolite Reporters) For Use As In Vivo Glucose Biosensors - Small Molecule Metabolite Reporters (SMMRs) for use as in vivo glucose biosensors, sensor compositions, and methods of use, are described. The SMMRs include boronic acid-containing xanthene, coumarin, carbostyril and phenalene-based small molecules which are used for monitoring glucose in vivo, advantageously on the skin. | 01-01-2009 |
20090004109 | Antibodies and Molecules Derived Therefrom that Bind to Steap-1 Proteins - Antibodies and molecules derived therefrom that bind to novel STEAP-1 protein, and variants thereof, are described wherein STEAP-1 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, STEAP-1 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The STEAP-1 gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with STEAP-1 can be used in active or passive immunization. | 01-01-2009 |
20090004110 | Multi-functional gelatin particle and its use - This invention is a continuing submission of multi-functional gelatin particle and its use, provisional patent application 60/880,734 filed at 01/17/2007. And this invention is related to former patent applications of 11/698,966, 11/788,829, 11/799,487. Multi-functional gelatin particle has been used for the variety of biological assays and applications. In this patent application, we extend to use multi-functional gelatin particles as for the in vivo & in vitro shuttle assay. | 01-01-2009 |
20090010848 | Recombinant Peptides Derived from the Mc3 Anti-BA46 Antibody, Methods of Use Thereof, and Methods of Humanizing Antibody Peptides - The present invention provides recombinant peptides that specifically and selectively bind to the human milk fat globule (HMFG) antigen, BA46. In particular, the present invention provides recombinant variants of the Mc3 antibody, including humanized versions of Mc3. The variant Mc3 peptides are particularly useful for diagnostic, prognostic, and therapeutic applications in the field of breast cancer. | 01-08-2009 |
20090016959 | Delivery of antibodies to the central nervous system - The invention relates to improvements in the field of drug delivery. More particularly, the invention relates to polypeptide derived from aprotinin and from aprotinin analogs as well as conjugates and pharmaceutical compositions comprising these polypeptides. The present invention also relates to the use of these polypeptide for transporting an antibody or antibody fragment across the blood-brain barrier of an individual and in the treatment and diagnosis of neurological diseases. | 01-15-2009 |
20090016960 | SYSTEM AND METHOD FOR USING GLASS MICROSPHERES CONTAINING A POSITRON-EMITTING ISOTOPE TO IMAGE BLOOD FLOW AND DISTRIBUTE A RADIOMEDICAL TREATMENT SPECIES - A method for imaging the blood flow in a patient receiving radiomedical treatment, including forming a first and a second plurality of generally spherical biologically stable members, with each respective member of the first plurality includes a first non-radioactive isotope distributed substantially uniformly therein that, upon being subjected to an effective amount of neutron irradiation, emits a therapeutic intensity and amount of beta or gamma radiation and wherein each respective member of the second plurality includes a second non-radioactive isotope distributed substantially uniformly therethrough that, upon being subjected to an effective amount of neutron irradiation, emits a detectable intensity and amount of positron radiation. The first and second members are subjected to an effective amount of neutron radiation and the irradiated first and second pluralities of irradiated first and second members are introduced into a patient's circulatory system upstream of a desired treatment site. The second plurality of irradiated members is imaged via positron emission tomography. The second isotope, once activated by neutron irradiation, has a maximum half-life of about four days. | 01-15-2009 |
20090016961 | Stem Cell Fusion Model of Carcinogenesis - Methods for modeling cancer cell migration, screening drugs for effects on tumor cell migration, and detecting the potential for tumor cell migration relating to the fusion of a bone marrow derived stem cell with a genetically altered cell (FIG. | 01-15-2009 |
20090016962 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCER - Provided are nanostructures comprising a charged outer surface and an inner core comprising a cancer therapeutic agent or imaging agent, wherein the charged outer surface is selectively removable. Further provided are methods of treating subjects having cell proliferative disorders, e.g., cancer, and kits comprising the above nanostructures. | 01-15-2009 |
20090022665 | Evaluation Of Immediate-Effect Skin Molding Agents Using DISC - The present invention pertains to methods of characterizing the effects on the skin of skin-molding agents and to methods of characterizing the physical behavior of the skin-molding agents themselves. A preferred embodiment of the present invention uses a non-invasive, in vivo form of digital image speckle correlation to track deformation of human skin caused by the application of a skin-molding agent, in particular, an immediate-effect skin molding agent. The skin-molding agent may or may not be part of a composition. The application to the skin of a skin-molding agent may or may not be part of a treatment regimen. The present invention may be applied to any surface of the human body, to non-humans and to inert matter. Unlike in vitro methods and unlike invasive, in vivo methods that tension the skin with an apparatus, the present invention relies on the applied skin-molding agent to create before and after deformation images. From those images, it is possible to develop quantitative and qualitative characterizations of skin's movement and of the skin-molding agent itself. These characterizations will aid in the development of improved and/or customized skin molding agents and improved compositions comprising skin-molding agents. Generally, the data collected by the methods described herein, may also suggest improved and/or customized treatment regimens for molding the skin. | 01-22-2009 |
20090022666 | Methods and systems relating to mitochondrial DNA information - The present application relates, in general, to a system or a method for detection or treatment. In some aspects, a system includes at least one computer program for use with at least one computer system and wherein the computer program includes a plurality of instructions including but not limited to one or more instructions for making at least one correlation between mitochondrial DNA information regarding at least one person and information regarding at least one clinical trial involving the at least one person. | 01-22-2009 |
20090028792 | NANO-PARTICLE SURFACE MODIFICATION - Oxide, oxysulfide, halide or phosphate host particles with a self-assembled organophosphonate monolayer covalently bonded thereto. Methods for coating the host particles and use of rare earth ion-doped particles in imaging methods and photodynamic therapy methods are also disclosed. | 01-29-2009 |
20090028793 | Vascular Tumor Markers - The present invention relates to a method for identifying neovascular structures in mammalian tissue, wherein said neovascular structures are identified by the detection of at least one specific protein in said tissue. It also relates to a method for identifying diseases or conditions associated with neovascularization, methods for targeting and/or imaging neovascular structures and methods for targeting diseases or conditions associated with neovascularization. Furthermore, the present invention is directed to the use of novel and/or known ligands, preferably antibodies, directed against novel and/or known target proteins for identifying tumor cells in mammalian tissue, preferably mammalian kidney tissue, more preferably mammalian vascular kidney tissue. The present invention also relates to novel ligands, preferably antibodies, fusion proteins comprising said ligands or antibodies, pharmaceutical and diagnostic compositions comprising said ligands, antibodies or fusion proteins, diagnostic and therapeutic methods as well as novel proteins and corresponding polynucleotides, vectors and host cells. | 01-29-2009 |
20090035216 | Method for determining in vivo biopharmaceutical concentration or bioavailability - The invention provides a method for determining the bioavailability of single light chain bio-agents in biological samples. The method determines that bioavailability by utilising a labelled form of the bio-agent and incubating with a probe that binds for the alternative light chain antibody form as compared to the form of the bio-agent, followed by a fractionation step where the probe, with any bound bio-agent, is isolated and the level of label from the labelled bio-agent is determined. | 02-05-2009 |
20090035217 | Truncated Fragments of Alpha-Synuclein in Lewy Body Disease - The application identifies novel fragments of alpha-synuclein in patients with Lewy Body Disease (LBD) and transgenic animal models thereof. These diseases are characterized by aggregations of alpha-synuclein. The fragments have a truncated C-terminus relative to full-length alpha-synuclein. Some fragments are characterized by a molecular weight of about 12 kDa as determined by SDS gel electrophoresis in tricine buffer and a truncation of at least ten contiguous amino acids from the C-terminus of natural alpha-synuclein. The site of cleavage preferably occurs after residue 117 and before residue 126 of natural alpha-synuclein. The identification of these novel fragments of alpha-synuclein has a number of application in for example, drug discovery, diagnostics, therapeutics, and transgenic animals. | 02-05-2009 |
20090035218 | SYSTEMS AND METHODS FOR TISSUE IMAGING - The present invention provides systems and methods for monitoring tissue regions. In particular, the present invention provides systems and methods for detecting changes in tissue regions over a period of time. In some embodiments, the systems and methods of the present invention are used to evaluate the effectiveness of a particular treatment of a tissue region. In some embodiments, the systems and methods employ functional diffusion map algorithms for imaging changes in tissue regions over time and/or in response to therapeutic interventions. | 02-05-2009 |
20090035219 | CB1 receptor antagonists and uses thereof - Neutral antagonists of the CB1 cannabinoid receptor, means for identifying neutral antagonists of the CB1 cannabinoid receptor, and uses thereof. Antagonists of the CB1 cannabinoid receptor can be used to prevent, treat or reduce the severity of various medical conditions and symptoms, including, but not limited to obesity, appetite disorder, another metabolic disorder, drug addiction and/or mental illness. Administering neutral CB1 cannabinoid receptor antagonists in place of or in combination with known CB1 cannabinoid receptor antagonists or inverse CB1 cannabinoid receptor agonists in an individual or animal to treat a medical condition with a reduction of unwanted side effects. A method of detecting a neutral CB1 cannabinoid receptor antagonist, including identifying a candidate compound; subjecting the candidate compound to one or more of a cAMP assay, CB1 competitive binding assay, food intake assay, thermoregulation assay, or emesis assay; and selecting the compound if it exhibits neutral antagonist activity. | 02-05-2009 |
20090041665 | METHOD FOR GENE DELIVERY TO NEURONAL CELLS - The present invention relates to the use of axonal transport to deliver a baculovirus vector to a target neuronal cell by administering the vector to a site that is remote from the target cell. Such delivery allows for tracing of neuronal pathways and further a baculovirus vector may be used to deliver therapeutic gene to a target neuronal which may otherwise be not readily accessible, for the treatment of a neuronal disorder in a subject. | 02-12-2009 |
20090041666 | Ophthalmic formulations of Amyloid-beta contrast agent and methods of use thereof - The invention provides ophthalmic formulations of Amyloid-β contrast agents. Also provided are methods of using such formulations in the diagnosis of Alzheimer's Disease or a predisposition thereto as well as methods for the prognosis of Alzheimer's Disease. | 02-12-2009 |
20090047216 | Tumor vasculature markers and methods of use thereof - This invention provides methods of detecting and localizing tumor vasculature cells (TVC) and solid tumors; and treating, impeding vascularization of, and determining the stage of solid tumors in a subject, comprising the step of contacting a subject or a TVC with a ligand that binds to a nucleic acid molecule of the present invention, or binds to a protein encoded by the nucleic acid molecule. | 02-19-2009 |
20090053139 | Dendrimer based compositions and methods of using the same - The present invention relates to novel therapeutic and diagnostic dendrimers. In particular, the present invention is directed to dendrimer based compositions and systems for use in disease diagnosis and therapy (e.g., cancer diagnosis and therapy). The compositions and systems comprise one or more components for targeting, imaging, sensing, and/or providing a therapeutic or diagnostic material and monitoring the response to therapy of a cell or tissue (e.g., a tumor). | 02-26-2009 |
20090053140 | METHODS OF IDENTIFYING GENES INVOLVED IN MEMORY FORMATION USING SMALL INTERFERING RNA(siRNA) - The present invention relates to a method of identifying a gene or gene product associated with transcription dependent memory formation in an animal comprising the steps of: (a) administering to said animal sufficient small interfering RNA (siRNA) specific for the gene to inhibit gene function; (b) training said animal under conditions sufficient to induce transcription dependent memory formation in a normal untreated animal; and (c) determining the level of transcription dependent memory formation induced by the training of the treated animal. The present invention provides methods of using small interfering PNAs (siRNA) in hippocampus to identify genes and gene product whose inhibition affects contextual and temporal long-term (LTM) memory, but not short-term memory (STM). | 02-26-2009 |
20090060839 | Gold Nanoparticle Conjugates and Uses Thereof - The disclosure generally relates to formation of polymers grafted to or polymerized from the surface of gold nanoparticles. The polymers are functionalized to include therapeutic agents and/or targeting agents at their surface, thereby allowing both therapeutic and targeting compounds to be directed to specific cells in a patient. | 03-05-2009 |
20090060840 | Lanthanide Nanoparticle Conjugates and Uses Thereof - The present disclosure is directed generally to lanthanide nanoparticle conjugates, such as gadolinium nanoparticle conjugates, nanoparticle conjugates including polymers, conjugation to targeting agents and therapeutic agents, and their use in targeting, treating, and/or imaging disease states in a patient. | 03-05-2009 |
20090068106 | Conjugation Product - A peptide which selectively inhibits α | 03-12-2009 |
20090068107 | ENZYME REGULATING ETHER LIPID SIGNALING PATHWAYS - A multidimensional profiling strategy that combines activity-based proteomics and metabolomics was used to determine that an active protein, which is a previously uncharacterized enzyme highly elevated in aggressive cancer cells, serves as a central node in an ether lipid signaling network that bridges platelet-activating factor and the lysophospholipids. Biochemical studies confirmed that the active protein regulates this pathway by hydrolyzing the metabolic intermediate 2-acetyl monoalkylglycerol. Inactivation of the active protein disrupted ether lipid metabolism in cancer cells and impaired cell migration and tumor growth in vivo. | 03-12-2009 |
20090068108 | BIOSPECIFIC CONTRAST AGENTS - Methods and apparatuses for detecting a condition of a sample (including cervical cancers and pre-cancers) through reflectance and/or fluorescence imaging. A sample is obtained. One or more metallic nanoparticles and/or one or more quantum dots are obtained. The one or more metallic nanoparticles and/or one or more quantum dots are coupled to one or more biomarkers of the sample that are associated with the condition. A reflectance and/or fluorescence image of the sample is then taken. The image(s) exhibit characteristic optical scattering from the one or more metallic nanoparticles and/or characteristic fluorescence excitation from the one or more quantum dots to signal the presence of the one or more biomarkers. In this way, the condition can be readily screened or diagnosed. | 03-12-2009 |
20090068109 | ANTI-MCP-1 ANTIBODIES, COMPOSITIONS, METHODS AND USES - The present invention relates to at least one novel anti-MCP-1 antibody, including isolated nucleic acids that encode at least one anti-MCP-1 antibody, MCP-1, vectors, host cells, transgenic animals or plants, and methods of making and using thereof, including therapeutic compositions, methods and devices. | 03-12-2009 |
20090074665 | Diagnosis and treatment of cancer:I - A method of diagnosing cancer comprising the steps of (i) obtaining a sample containing nucleic acid and/or protein from the patient; and (ii) determining whether the sample contains a level of SCN5A (and optionally also SCN9A) voltage-gated Na+ channel nucleic acid or protein associated with cancer. A method of diagnosing breast cancer comprising the steps of (i) obtaining a sample containing nucleic acid and/or protein from the patient; and (ii) determining whether the sample contains a level of voltage-gated Na+ channel nucleic acid or protein, preferably SCN5A or SCN9A, associated with cancer. A method of treating cancer comprising the step of administering to the patient an agent which selectively prevents the function of SCN5A (and optionally also SCN9A) voltage-gated Na+ channel. A method of treating breast cancer comprising the step of administering to the patient an agent which selectively prevents the function of a voltage-gated Na+ channel, preferably SCN5A or SCN9A. Genetic constructs and molecules useful in such methods. The methods and compositions are particularly suited to breast cancer. | 03-19-2009 |
20090081124 | VIRUS COAT PROTEIN/RECEPTOR CHIMERAS AND METHODS OF USE - The invention relates to chimeric molecules comprising a virus coat sequence and a receptor sequence that can inter-act with each other to form a complex that is capable of binding a co-receptor. Such chimeric molecules therefore exhibit functional properties characteristic of a receptor-coat protein complex and are useful as agents that inhibit virus infection of cells due to occn-panty of co-receptor present on the cell, for example. In particular aspects, the chimeric polypeptide includes an immunodeficiency virus envelope polypeptide, such as that of HIV, SIV, FIV, FeLV, FPV and herpes virus. Receptor sequences suitable for use in a chimeric polypeptide include, for example, CCR5 and CXCR4 sequences. | 03-26-2009 |
20090087380 | Polymer devices for therapeutic applications - Multi-layered polymer devices having three-dimensional containers for holding a therapeutic and/or imaging agent are provided. The devices have a high loading ratio of agent to polymer material for effective treatment. Delivery wings or regions with channels connected to the containers are also incorporated in the devices. The delivery wings can be flexible and insertable into hollow instruments, such as a needle. Anchoring structures are also provided for fixing the position of the device after injection into a subject. The polymer layers of the device can be biodegradable. Biodegradable materials can also be used to provide controlled release of agents, such as for immunizations and other therapeutic or non-therapeutic applications. | 04-02-2009 |
20090092550 | PORPHYRIN LINKED METRONIDAZOLE AGAINST GUM DISEASE: PORPHYROMONAS GINGIVALIS - The present invention relates generally to targeted molecular agents (TMAs) directed to a particular organism or group of organisms and uses thereof. More particularly, the present invention provides TMAs having a targeting moiety which comprises a natural or induced auxotrophic requirement of the particular organism as a vehicle for directing an agent linked to the moiety to be delivered to the target organism. The TMAs of the present invention are useful for targeting molecules such as antimicrobial agents and diagnostic agents to selected organisms. | 04-09-2009 |
20090092551 | Increasing lifespan by modulation of pha-4 - The roles of the pha-4 and daf-16 genes in diet-restricted induced longevity are described and characterized. Pha-4 acts, e.g., in the absence of daf-16, to increase lifespan, e.g., in nematodes. Given the role that pha-4 and daf-16 play in the mediation of longevity, they represent targets for modulation of life span. Methods of increasing life span and delaying age onset diseases by modulation of pha-4 activity are disclosed, as are screening methods for identifying compounds that modulate pha-4 and/or daf-16 activity. In addition, recombinant animals expressing the pha-4 gene and not the daf-16 gene, and methods of using the pha-4 and/or daf-16 genes to modulate longevity and age-onset diseases are described. | 04-09-2009 |
20090092552 | LIGHT STABLIZED IN VIVO STAIN COMPOSITION AND METHOD OF MANUFACTURE - Photochemical demethylation reactions in solutions of thiazine dyes, in which the dye molecules act as both sensitizer and substrate, are reduced by quenching triple-state dye molecules, returning them to the unreactive ground state. | 04-09-2009 |
20090098049 | Targeting transducible molecules to specific cell types - The disclosure provides fusion polypeptides and constructs useful in targeting molecules including diagnostics and therapeutics to a cell type of interest. The fusion constructs include a protein transduction domain, a ligand domain and a cargo domain. Also provided are methods of treating disease and disorders such as cell proliferative disorders. | 04-16-2009 |
20090098050 | CALCIUM BINDING PEPTIDES - Disclosed herein are a class of compounds comprising peptides of the sequence (X-Y-Z) | 04-16-2009 |
20090098051 | BACILLUS THURINGIENSIS TOXIN - A new Bt Cry toxin, Cry1M is able to exert insecticidal effects on insects and/or nematodes in general, and in addition, on insects that have acquired resistance to alternative Cry proteins. | 04-16-2009 |
20090098052 | TRANSGENIC MICE - A transgenic non-human animal, in particular a transgenic mouse encoding Aβ peptide proteins, which have been implicated in Aβ peptide-related diseases. Cells and cell lines comprising transgenes encoding for Aβ peptide. Methods and compositions for evaluating agents that affect Aβ peptide, for use in compositions for the treatment of Aβ peptide-related diseases. | 04-16-2009 |
20090098053 | LA1 - THE GENOME OF A LACTOBACILLUS STRAIN - The present invention pertains to the use of the DNA sequence of a | 04-16-2009 |
20090110637 | LMP and Regulation of Tissue Growth - Novel methods are provided for changing cell phenotype, comprising a method of changing a phenotype of a target cell comprising: increasing an amount of an amino acid sequence in a source cell, wherein the source cell is located within a volume of a media and wherein the amino acid sequence is selected from the group consisting of LMP-1 protein, an LMP-2 protein, an LMP-3 protein, an LMP-1s protein, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or combination thereof; collecting at least a portion of the volume of the media; and contacting the target cell with at least the portion of the media. | 04-30-2009 |
20090110638 | METHODS USING THE GRUENEBERG GANGLION CHEMOSENSORY SYSTEM - The present invention relates to physical and pharmaceutical methods of increasing or decreasing the activity of the Grueneberg Ganglion (GG) in a subject. In one embodiment, the method comprising administering a compound to the GG, wherein the compound is an agonist or antagonist, respectively, for at least one guanylyl cyclase receptor or the receptor's downstream effectors. The present invention also relates to methods of screening candidate compounds for their ability to modulate the activity of the GG. The present invention also relates to methods and kits for positively identifying a GG neuron based upon the presence or absence of the pGC-G or pGC-A receptors. | 04-30-2009 |
20090117043 | Antibodies That Specifically Bind to Neurokinin B - The present invention relates to antibodies and related molecules that specifically bind to neurokinin B. Such antibodies have uses, for example, in the prevention and treatment of cancer as well as immune system diseases and disorders including pre-eclampsia, hypertension, inflammation, asthma, gastrointestinal disorders, anxiety, depression, addiction, or pain. The invention also relates to nucleic acid molecules encoding anti-neurokinin B antibodies, vectors and host cells containing these nucleic acids, and methods for producing the same. The present invention relates to methods and compositions for preventing, detecting, diagnosing, treating or ameliorating a disease or disorder, especially pre-eclampsia, as well as hypertension, inflammation, asthma, gastrointestinal disorders, anxiety, depression, addiction, or pain, comprising administering to an animal, preferably a human, an effective amount of one or more antibodies or fragments or variants thereof, or related molecules, that specifically bind to neurokinin B. | 05-07-2009 |
20090117044 | Method for quantifying the uptake of at least one radiotracer in a body region of a patient of interest to a positron emission tomography measurement - A method for quantifying the uptake of at least one radiotracer in a body region of a patient of interest to a positron emission tomography measurement is disclosed. In at least one embodiment of the method, the uptake of the radiotracer in the body region of the patient of interest to the positron emission tomography measurement is quantified taking into account at least one permeability information item relating to the permeability of at least one blood vessel of the patient, in particular in the body region of interest. | 05-07-2009 |
20090117045 | Soy or lentil stabilized gold nanoparticles and method for making same - The invention provides stabilized, biocompatible gold nanoparticles that are stabilized with material from soy or lentil plant material or a reactive extract thereof of the plant material. The gold nanoparticles of the invention can be fabricated with an environmentally friendly method for making biocompatible stabilized gold nanoparticles. In methods of the invention, an aqueous solution containing gold salts is mixed with soy or lentil plant material or a reactive extract thereof. In preferred embodiment methods of making, an aqueous solution containing gold salts is provided. The aqueous solution is mixed with soy or lentil plant material or a reactive extract thereof. The gold salts react to form biocompatible gold nanoparticles that are stabilized with a robust coating derived of the soy or lentil plant material or a reactive extract thereof. | 05-07-2009 |
20090123374 | METHODS FOR DETERMINING CANCER RESISTANCE TO HISTONE DEACETYLASE INHIBITORS - Described herein are methods and compositions for determining whether a particular cancer is resistant to or susceptible to a histone deacetylase inhibitor or to histone deacetylase inhibitors. The methods include analysis of the expression levels of at least four biomarker genes associated with response to a histone deacetylase inhibitor. Also described herein are methods and compositions for increasing the likelihood of a therapeutically effective treatment in a patient, comprising an analysis of the expression levels of at least four biomarker genes associated with response to a histone deacetylase inhibitor. Also described herein are isolated populations of nucleic acids derived from a cancer sensitive to or resistant to a histone deacetylase inhibitor. Further described are kits and indications that are optionally used in conjunction with the aforementioned methods and compositions. | 05-14-2009 |
20090123375 | CCR3 Inhibition for Ocular Angiogenesis and Macular Degeneration - Provided are methods and compositions for the treatment or prevention of ocular angiogenesis and neovascularization. Administration of inhibitors of the CCR3 receptor or its ligands eotaxin (CCL11), eotaxin-2 (CCL24) or eotaxin-3 (CCL26) inhibits ocular angiogenesis. | 05-14-2009 |
20090130021 | Methods, products and uses involving platelets and/or the vasculature - The present disclosure relates to agents which interfere with the binding of GPVI to various components. Agents which interfere with GPVI interaction with one or both of fibronectin and vitronectin or sequences thereof are also disclosed. Methods of treating disorders or diseases which involve pathological, dysfunctional or non-pathological interaction of GPVI with fibronectin and/or vitronectin are included in the present disclosure. The invention also relates to uses of agents for the prevention or treatment of disorders arising from blood platelet adhesion and aggregation. | 05-21-2009 |
20090136423 | Methods for assessing psychotic disorders - This invention relates to the assessment of individuals with first-episode psychosis (FEP) or an at risk mental state (ARMS) using visuospatial associative learning tests such as paired associates learning (PAL). Visuospatial associative learning ability as determined by such tests may be prognostic of the severity of psychosis in FEP patients and diagnostic of psychosis in ARMS patients. | 05-28-2009 |
20090136424 | Rotanone Analogs: Method of Preparation and Use - The present invention provides rotenone analogs and methods of making and using them. Labeled with single photon and positron emitting isotopes, the rotenone analogs of the present invention are useful in, for example, clinical imaging applications as tracers to measure cardiac blood flow and detect regions of ischemia. | 05-28-2009 |
20090136425 | CONTRAST AGENTS - The present invention relates to a class of compounds and to diagnostic compositions containing such compounds where the compounds are iodine containing compounds. More specifically the iodine containing compounds are chemical compounds containing an aliphatic central moiety containing urea or urethane functions allowing for the arrangement of three iodinated phenyl groups bound thereto. The invention also relates to the use of such diagnostic compositions as contrast agents in diagnostic imaging and in particular in X-ray imaging and to contrast media containing such compounds. | 05-28-2009 |
20090136426 | CONTRAST MEDIA FOR USING IN MEDICAL AND DIAGNOSTIC PROCEDURES AND METHODS OF USING THE SAME - The present invention relates to contrast media having a low concentration of contrast agent (active ingredient) and/or low Hounsfield value for use in medical or diagnostic procedures, or for therapeutic use. In one alternative embodiment, the contrast media are comprised of a contrast agent, alone or in combination with a stabilizing agent or osmotic agent. The present invention is directed to a contrast media having a Hounsfield value less than 250. In another embodiment, the contrast media comprises a contrast agent, such as a less than 2% w/v barium-based compound. In another embodiment, the present invention also relates to formulations and methods for distending and imaging an anatomic segment of an individual. | 05-28-2009 |
20090142266 | PEPTIDES DERIVED FROM MAUROCALCINE USED AS VECTORS FOR INTRACELLULAR ADDRESSING OF MOLECULES OF INTEREST - Use of a peptide vector for intracellular addressing of a substance of interest, said vector essentially comprising a peptide which is derived from maurocalcine corresponding to the following sequence (I): Z-X | 06-04-2009 |
20090142267 | FUSOGENIC PROPERTIES OF SAPOSIN C AND RELATED PROTEINS AND PEPTIDES FOR APPLICATION TO TANSMEMBRANE DRUG DELIVERY SYSTEMS - The present invention comprises a method for delivering pharmaceutical and/or imaging agents within and/or through the dermal, mucosal and other cellular membranes, and across the blood-brain barrier, utilizing a fusogenic protein. The fusogenic protein is associated with a phospholipid membrane, such as a liposome. The liposome may include dioleoylphosphatidylserine, a negatively charged long-chain lipid. Alternatively, the liposome is comprised of a mixture of negatively charged long-chain lipids, neutral long-chain lipids, and neutral short-chain lipids. Preferred fusogenic proteins include saposin C and other proteins, polypeptides and peptide analogs derived from saposin C. The active agent contained within the liposome may comprise biomolecules and/or organic molecules. This technology can be used for both cosmetic and medicinal applications in which the objective is delivery of the active agent within and/or beneath biological membranes or across the blood-brain barrier and neuronal membranes. | 06-04-2009 |
20090142268 | CHAIN-END FUNCTIONALIZED POLY(ETHYKENE OXIDE) AND PROCESS FOR THE PREPARATION OF A NANO-SIZED TRANSITION METAL OR METAL SALT USING THE SAME - There is provided a novel chain-end functionalized PEO of formulas (I) to (IV) prepared via living anionic polymerization and chain-end functionalization, as well as a simple method of preparing nano-sized transition metal or metal salt particles using the same, which can be readily stabilized even in an aqueous medium. The water-soluble PEO-based polymers having various functional groups (including a drug group such as vitamin and anti-cancer agent) and the process of preparing nano-sized transition metal or metal salt particles using the same can be advantageously used in the development of new materials for drug delivering system and imaging, e.g., a contrast agent and an anti-cancer agent simultaneously. | 06-04-2009 |
20090142269 | ISOTOYPICALLY-LABELED BENZOTHIAZOLE COMPOUNDS AS IMAGING AGENTS FOR AMYLOIDOGENIC PROTEINS - The present invention provides an isolated linezolid impurity, desfluoro linezolid, the preparation thereof and its use as a reference standard. | 06-04-2009 |
20090142270 | PREVENTION AND TREATMENT OF CEREBRAL AMYLOID ANGIOPATHY - The invention provides improved agents and methods for treatment of cerebral amyloid angiopathy (CAA) and methods to effect prophylaxis of CAA. The methods can treat CAA concurrently with Alzheimer's disease or separately. The methods can effect prophylaxis of CAA concurrently with Alzheimer's disease or separately. The methods involve administering antibody that is specific for the N-terminus of Aβ or an agent that can induce such an antibody. | 06-04-2009 |
20090142271 | DENDRITIC CELLS - The present invention provides systems for isolating, characterizing, and modulating brain dendritic cells. The invention may allow a better understanding of and opportunities to modulate neurodevelopmental processes (such as, for example, neurogenesis) and neurological diseases (such as, for example, Alzheimer's Disease). | 06-04-2009 |
20090148383 | Anticoagulation Agent and Uses Thereof - The present invention provides an anticoagulant agent including a first element capable of inhibiting coagulation and a second element capable of targeting an activated platelet wherein upon administration of element directs the first element to the activated platelet. Also provided is a probe for detecting a blood vessel abnormality including (a) a binding element capable of targeting an activated platelet and (b) a label. Applicant has shown that agents and probes directed to activated platelets are useful in the diagnosis and therapy of coagulation disorders. | 06-11-2009 |
20090148384 | FUNCTIONALIZED, SOLID POLYMER NANOPARTICLES COMPRISING EPOTHILONES - The present invention describes polymer nanoparticles with a cationic surface potential, in which both hydrophobic and hydrophilic pharmaceutically active substances can be encapsulated. The hydrophilic and thus water-soluble substances are encapsulated in the particle core by co-precipitation through ionic complexing with a charged polymer. Both therapeutic agents and diagnostic agents can be used as pharmaceutically active substances for encapsulation. The cationic particle surface permits stable, electrostatic surface modification with partially oppositely charged compounds, which can contain target-specific ligands for improving passive and active targeting. | 06-11-2009 |
20090155171 | VISUALIZING AGENT COMPRISING A JANUS GREEN B AND VISUALIZING METHOD BY USING THE SAME - The present invention relates to a visualizing agent comprising a Janus Green B(JGB), and a visualizing method by using the same. More specifically, the method comprising A method of visualizing the intravascular threadlike structure (Bonghan duct) floating inside a lymphatic vessel comprising injecting JGB into the lymphatic tissue to be stained, and conducting microscopy. The present invention provides a major breakthrough in cellular anatomy and physiology. Further studies of its histological aspects and physiological functions suggest the possibility of critical new insights in both biology and medicine. | 06-18-2009 |
20090155172 | Antibodies to MAGMAS and uses thereof - The present invention relates to isolated and purified Magmas protein, isolated and purified nucleic acids encoding Magmas protein, and antibodies to Magmas protein, which interacts with granulocyte macrophage colony stimulating factor (GM-CSF). More specifically, the invention relates to uses of such anti-Magmas antibodies. The invention further relates to a method for diagnosis, prognosis and treatment of diseases, particularly, cancer, Alzheimer's disease and mitochondrial diseases using Magmas sequences and antibodies directed against the Magmas protein or fragments thereof. | 06-18-2009 |
20090155173 | PERSISTENT LUMINESCENCE NANOPARTICLES USED IN THE FORM OF A DIAGNOSIS AGENT FOR IN VIVO OPTICAL IMAGING - The invention relates to using persistent luminescence nanoparticles, functionalised if necessary, in the form of an diagnosis agent for an in vivo optical imaging. Said nanoparticles are preferably consist of a compound selected from a group comprising (1) silicates, aluminates, aluminosilicates, germanates, titanates, oxysulphides, phosphates and vanadates, wherein said compounds contain at least one type of metal oxide, (2) the sulphides comprise at least one metal ion selected from zinc, strontium and calcium, and (3) metal oxides, wherein said compounds is doped with at least one rare earth ion, and possibly with at least one transition metal ion. In a preferred embodiment, the diagnosis agent is used for an organism vascularisation imaging. A method and kit for detecting or quantifying in vitro a substance of biological or chemical interest in a sample by using said pre-functionalised nanoparticles are also disclosed. | 06-18-2009 |
20090155174 | RNA Interference Mediating Small RNA Molecules - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 06-18-2009 |
20090155175 | SIMULTANEOUS TRANSLUMINAL CORONARY SINUS APPLICATION OF CELLS IN CONJUNCTION WITH DEVICE RESYNCHRONIZATION THERAPY - Method and instrumentation for repairing tissue of a heart in a patient's body and implantation of biventricular stimulation. Adult stem cells that have the capability to repair tissue of the selected organ are recovered by harvesting from the patient's body from the same site as the implant of the device and in the same procedure simultaneously. The harvested stem cells are then intraluminally applied through the coronary venous circulation. During the time the stem cells are being applied to the targeted tissue downstream, the designated vessel is selectively occluded to increase concentration and pressure of the applied adult stem cells within that vessel. The implantation of a left ventricular stimulating electrode through the coronary sinus is done within the same operative procedure and connected to either a pacemaker capable of biventricular stimulation for resynchronization therapy or biventricular stimulation and additional defibrillation. | 06-18-2009 |
20090155176 | Compositions and methods for treatment of diabetic retinopathy - The present invention provides compounds and methods for the treatment of diabetic retinopathy. In particular, LFA-1 antagonists are described herein to be used in the treatment of diabetic retinopathy. One aspect of the invention provides for diagnosis of diabetic retinopathy and administration of a LFA-1 antagonist, after the patient is diagnosed with diabetic retinopathy. | 06-18-2009 |
20090155177 | Phthalocyanine dyes and their preparation and use - Phthalocyanine dyes of general formula (II) | 06-18-2009 |
20090155178 | LIPIDATED GLYCOSAMINOGLYCAN PARTICLES AND THEIR USE IN DRUG AND GENE DELIVERY FOR DIAGNOSIS AND THERAPY - Lipidated glycosaminoglycan particles, prepared by reacting a glycosaminoglycan with at least one lipid to cross-link the carboxylic acid groups in the glycosaminoglycan with a primary amine in the lipid, are used to encapsulate drugs for use in the treatment of pathological conditions in an animal. | 06-18-2009 |
20090162284 | ANTI-IGF-I RECEPTOR ANTIBODY - Antibodies, humanized antibodies, resurfaced antibodies, antibody fragments, derivatized antibodies, and conjugates of these molecules with cytotoxic agents, which specifically bind to and inhibit insulin-like growth factor-I receptor, antagonize the effects of IGF-I and are substantially devoid of agonist activity toward the insulin-like growth factor-I receptor. These molecules can be conjugated to cytotoxic agents for use in the treatment of tumors that express elevated levels of IGF-I receptor, such as breast cancer, colon cancer, lung cancer, ovarian carcinoma, synovial sarcoma and pancreatic cancer. These molecules can also be labeled for in vitro and in vivo diagnostic uses, such as in the diagnosis and imaging of tumors that express elevated levels of IGF-I receptor. | 06-25-2009 |
20090162285 | ANTI-INFLAMMATORY FUSION PROTEIN - The present invention relates to a fusion protein comprising therapeutical and diagnostic potential against chronic vascular diseases, such as atherosclerosis, a nucleic acid molecule encoding said fusion protein, a pharmaceutical and diagnostic composition which comprises the fusion protein or the nucleic acid molecule, the use of the fusion protein or the nucleic acid molecule for the production of a pharmaceutical and diagnostic composition, a method for the diagnosis of acute or chronic vascular diseases, and a method for the production of a fusion protein. | 06-25-2009 |
20090169476 | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer - A novel gene 08P1D4 (also designated STEAP-1) and its encoded protein, and variants thereof, are described wherein STEAP-1 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, STEAP-1 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The STEAP-1 gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with STEAP-1 can be used in active or passive immunization. | 07-02-2009 |
20090169477 | DELAYING OR PREVENTING ONSET OF MULTIPLE SCLEROSIS - Methods of treating persons at risk for relapsing MS are described. | 07-02-2009 |
20090175789 | Antibody raised against the ldl receptor - The present invention relates to a monoclonal antibody raised against the human LDL (Low Density Lipoprotein) receptor, binding to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) in the peptide sequence for the human LDL receptor; to the use thereof as a drug; to a pharmaceutical composition containing this antibody; and to the use thereof in immunohistochemical analyses of cancerous, healthy, or cirrhotic tissues, in Western-Blot or ELISA analyses, or in in vivo quantification tests. | 07-09-2009 |
20090175790 | CARDIAC ARRHYTHMIA TREATMENT METHODS AND BIOLOGICAL PACEMAKER - Disclosed are methods of preventing or treating cardiac arrhythmia. In one embodiment, the methods include administering to an amount of at least one polynucleotide that modulates an electrical property of the heart. The methods have a wide variety of important uses including treating cardiac arrhythmia. Also disclosed are methods and systems for modulating electrical behavior of cardiac cells. Preferred methods include administering a polynucleotide or cell-based composition that can modulate cardiac contraction to desired levels, e.g., the administered composition functions as a biological pacemaker. | 07-09-2009 |
20090175791 | Anti-VEGF Antibody Compositions and Methods - Disclosed are human antibodies that specifically inhibit VEGF binding to only one (VEGFR2) of the two primary VEGF receptors. The antibodies effectively inhibit angiogenesis and induce tumor regression, and yet have improved safety due to their specificity. The present invention thus provides new human antibody-based compositions, methods and combined protocols for treating cancer and other angiogenic diseases. Advantageous immunoconjugate compositions and methods using the new VEGF-specific human antibodies are also provided. | 07-09-2009 |
20090175792 | GLYCOMIMETIC INHIBITORS OF SIGLEC-8 - Compounds, compositions and methods are provided for detecting or modulating in vitro and in vivo processes mediated by Siglec-8 binding. More specifically, Siglec-8 modulators and their use are described, wherein the Siglec-8 modulators that modulate a Siglec-8-mediated function comprise particular glycomimetics alone or linked to a diagnostic or therapeutic agent. | 07-09-2009 |
20090175794 | INHIBITORS OF CARBONIC ANHYDRASE IX - Novel radiopharmaceuticals that are useful in diagnostic imaging and therapeutic treatment of disease characterized by over expression of CA-IX comprise a complex that contains a sulfonamide moiety which is capable of binding the active catalytic site of CA-IX, and a radionuclide adapted for radioimaging and/or radiotherapy: | 07-09-2009 |
20090185975 | DIAGNOSTIC PROBE FOR CONFORMATION DISEASE - The invention provides a probe compound useful for early diagnosis of conformation disease, a composition and a kit comprising it for diagnosis for conformation disease, and a medical composition for treatment and/or prevention of conformation disease. | 07-23-2009 |
20090185976 | METHOD FOR INTRODUCING A CHEMICAL AGENT INTO THE SYSTEMIC CIRCULATION - A method for introducing a drug, imaging agent and/or other chemical agent into the systemic circulation comprises providing a the drug, imaging agent and/or other chemical agent in liposomes having a mean diameter of less than about 200 nm, preferably less than about 80 nm, as determined by negative-staining transmission electron microscopy. The liposomes are orally administered. It has been found that liposomes of such small sizes are not absorbed by the macrophages in the Peyer's patches of the gut, but instead are introduced into the venous circulation from the Peyer's patches, and then through the portal vein or inferior vena cava system, through the heart, and into the systemic circulation. | 07-23-2009 |
20090185977 | Composition and method for imaging cells - The invention relates to compositions containing a polynucleotide encoding for a reporter gene, a selectable marker and a regulatory element, that provide a method for imaging cells in vivo. | 07-23-2009 |
20090185978 | Monoclonal antibody capable of binding integrin alpha 10 beta 1 - The present invention provides a monoclonal antibody or a fragment thereof binding to the extracellular I-domain of integrin alpha10beta1 and a hybridoma cell line deposited at the Deutsche Sammlung von Microorganismen und Zellkulturen GmbH under the accession number DSM ACC2583. Furthermore, the present invention also provides a monoclonal antibody or a fragment thereof binding to the extracellular I-domain of integrin alpha10beta1 produced by the hybridoma cell line deposited. Methods and uses of said antibody or a fragment thereof in identifying and selecting cells of a chondrogenic nature for treatment purposes, in particular for the identification and isolation of chondrocytes, mesenchymal progenitor cells and embryonic stem cells for tissue engineering of cartilage, or for identifying diagnostic and therapeutic tools in studying the biological role and the structural/functional relationships of the integrin alpha10beta1 with its various extracellular matrix ligands are also included. | 07-23-2009 |
20090185979 | Integrin Heterodimer and an Alpha Subunit Thereof - A recombinant or isolated integrin heterodimer comprising a novel subunit α11 in association with a subunit β is described. The integrin or the subunit α11 can be used as marker or target of all types of cells. The integrin or subunit α11 thereof can be used as marker or target in different physiological or therapeutic methods. They can also be used as active ingredients in pharmaceutical compositions and vaccines. | 07-23-2009 |
20090191126 | PEPTIDE AND MULTIVALENT PEPTIDE CONJUGATE FOR DIAGNOSIS AND TREATMENT OF VASCULAR PLAQUES - This invention encompasses compositions and methods for treating and imaging vulnerable plaque and other inflamed regions in a subject. | 07-30-2009 |
20090196823 | Chemokine antagonists as treatment for obesity-related and metabolic syndrome-related conditions - The present invention provides methods to decrease or maintain body weight and/or body fat in patients, e.g. humans and animals, for example in the treatment of overweight or obese patients, or as a means to produce leaner meat in food stock animals, e.g., cattle, chickens, pigs, alone or in combination with second therapeutic agent; methods to treat diabetes and/or glucose intolerance; and methods to treat metabolic syndrome disorders in patients in need thereof, by administering a CCR2 therapeutic agent, kits for the above-identified therapeutic uses, and methods of identifying CCR2 therapeutic agents for treating the above-described therapeutic uses. | 08-06-2009 |
20090196824 | TREATMENT OF SEQUELAE OF PSYCHIATRIC DISORDERS - In general, the invention provides methods and compositions for treating sequela of weight gain or pain insensitivity, e.g., in a subject suffering from a psychiatric disorder, such as schizophrenia. The combinations employed in the invention include a second generation antipsychotic agent and an opioid receptor antagonist. | 08-06-2009 |
20090202437 | Therapeutic Use of Lpi, a Staphylococcal Lectin Pathway Inhibitor in Inflammatory diseases - The invention relates to nucleic acid molecules encoding (poly)peptides having LPI (Lectin Pathway Inhibitor) activity, to recombinant vectors harboring such molecules, and the host cells carrying the vectors. The invention further relates to methods for preparing recombinant (poly)peptides having LPI activity and to the use of such recombinant (poly)peptides having LPI activity for diagnosis, prophylaxis and treatment, such as the treatment of inflammation reactions. In addition the invention provides therapeutic and diagnostic compositions comprising as the active ingredient the (poly)peptide having LPI activity. | 08-13-2009 |
20090202438 | EPITOPE REGIONS OF A THYROTROPHIN (TSH) RECEPTOR, USES THEREOF AND ANTIBODIES THERETO - The present invention is concerned with epitope regions of a thyrotrophin (TSH) receptor, uses thereof and antibodies thereto. | 08-13-2009 |
20090208415 | Tropane compounds - The present invention provides novel tropane compounds and methods for their use. | 08-20-2009 |
20090214426 | Assay Method - The present invention is related to the field of pharmacy. The present invention more particularly discloses a method of determining the emotional, sensory, physiological, social and cognitive effects of a pain condition in a non human animal and further discloses a method for preclinically identifying pharmaceutical therapeutics which improve the emotional, sensory, physiological, social and cognitive effects associated with a pain condition in a non human animal. | 08-27-2009 |
20090214427 | Novel peptides - Isolated peptides comprising an amino acid sequence having Formula I | 08-27-2009 |
20090214428 | Human Monoclonal Antibodies Against Hendra and Nipah Viruses - The present invention relates to monoclonal antibodies that bind or neutralize Hendra or Nipah virus. The invention provides such antibodies, fragments of such antibodies retaining Hendra or Nipah virus-binding ability, fully human antibodies retaining Hendra or Nipah virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 08-27-2009 |
20090214429 | METHODS AND COMPOSITIONS RELATED TO TARGETING TUMORS AND WOUNDS - Disclosed are compositions and methods useful for targeting tumors, sites of injury and blood clots. The compositions and methods are based on peptide sequences that selectively bind to and home to tumors, sites of injury and blood clots in animals. The disclosed targeting is useful for delivering therapeutic and detectable agents to tumors, sites of injury and blood clots. | 08-27-2009 |
20090214430 | POLYPEPTIDE SPECIFICALLY BOUND TO PHOSPHATIDYLSERINE AND THE USE THEREOF - The present invention relates to a polypeptide specifically bound to phosphatidylserine and use thereof, and more particularly to a polypeptide having an amino acid sequence designated as sequence number 1 and specifically bound to phosphatidylserine, a phosphatidylserine detecting composition containing the polypeptide as an active ingredient, a detecting method of phosphatidylserine by using polypeptide, a apoptotic cell detecting containing the polypeptide as an active ingredient, a drug delivery composition containing the polypeptide as an active ingredient, a composition for treatment and prevention of a tumorous disease, and a composition for visualization of a tumorous region. A polypeptide having an amino acid sequence designated sequence number 1 is specifically bound to phosphatidylserine. Therefore, the polypeptide of the present invention is useful for detecting phosphatidylserine, furthermore detecting apoptotic cells expressing phosphatidylserine on the surface of the cell and tumor cells, and also useful for visualization of apoptotic cells or tumor cells. | 08-27-2009 |
20090220421 | METHOD FOR SCREENING MTP-INHIBITING COMPOUNDS - The present invention relates to a screening method for selecting active materials that inhibit microsomal triglyceride transfer protein (MTP) and to a screening kit using the said method. | 09-03-2009 |
20090220422 | Drug Delivery Material - The present invention provides a drug delivery material, which is a conjugate of 1) a drug-carrying molecular assembly, 2) a linker and 3) a substance that recognizes activated platelet, injury site of blood vessel and/or inflammatory tissue, and capable of efficiently delivering a drug to a desired site, during which the drug under delivery does not affect sites other than a desired site (hence, low possibility of causing side effects), which releases the drug only at the desired site without requiring an external means and allows the drug to exhibit an effect. | 09-03-2009 |
20090220423 | METHOD OF ACTIVATING A PHOTOSENSITIZER - The invention relates to a method of activating a photosensitizer, wherein for the photosensitizer nanoparticles of a catalyst capable of catalyzing the production of active oxygen ( | 09-03-2009 |
20090220424 | Pro104 Antibody Compositions and Methods of Use - The invention provides isolated anti-ovarian, pancreatic, lung or breast cancer antigen (Pro104) antibodies that bind to Pro104 on a mammalian cell in vivo. The invention also encompasses compositions comprising an anti-Pro104 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-Pro104 antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-Pro104 antibodies. The invention encompasses a method of producing the anti-Pro104 antibodies. Other aspects of the invention are a method of killing a Pro104-expressing cancer cell, comprising contacting the cancer cell with an anti-Pro104 antibody and a method of alleviating or treating a Pro104-expressing cancer in a mammal, comprising administering a therapeutically effective amount of the anti-Pro104 antibody to the mammal. | 09-03-2009 |
20090232736 | Dual specificity antibodies and methods of making and using - Antibodies having dual specificity for two different but structurally related antigens are provided. The antibodies can be, for example, entirely human antibodies, recombinant antibodies, or monoclonal antibodies. Preferred antibodies have dual specificity for IL-1α and IL-1β and neutralize IL-1α and IL-1β activity in vitro and in vivo. An antibody of the invention can be a full-length antibody or an antigen-binding portion thereof. Methods of making and methods of using the antibodies of the invention are also provided. The antibodies, or antibody portions, of the invention are useful for detecting two different but structurally related antigens (e.g., IL-1α and IL-1β) and for inhibiting the activity of the antigens, e.g., in a human subject suffering from a disorder in which IL-1α and/or IL-1β activity is detrimental. | 09-17-2009 |
20090232737 | Purification of proteins - The present invention relates to a selectively soluble polymer capable of binding to a desired molecules in an unclarified mixture containing various biological materials and the methods of using such a polymer to purify a molecule from such a mixture. The polymer is soluble in the mixture under a certain set of process conditions such as pH or temperature and/or salt concentration and is rendered insoluble and precipitates out of solution upon a change in the process conditions. The polymer is capable of binding to the desired molecule (protein, polypeptide, etc) and remains capable of binding to that molecule even after the polymer is precipitated out of solution. The precipitate can then be filtered out from the remainder of the stream and the desired biomolecule is recovered such as by elution and further processed. | 09-17-2009 |
20090232738 | Methods for modulating de novo hepatic lipogenesis by modulating XBP-1 activity - The invention provides methods and compositions for modulating the expression, processing, post-translational modification, stability and/or activity of XBP-1 protein, or a protein in a signal transduction pathway involving XBP-1 to treat dyslipidemias and steatosis disorders. The present invention also pertains to methods for identifying compounds that modulate the expression, processing, post-translational modification, and/or activity of XBP-1 protein or a molecule in a signal transduction pathway involving XBP-1. | 09-17-2009 |
20090238761 | Novel Aryl Piperazine Derivatives With Medical Utility - This invention provides novel aryl piperazine derivatives having medical utility, in particular as modulators of dopamine and serotonin receptors, preferably the D | 09-24-2009 |
20090246134 | COMPOSITIONS AND METHODS FOR MODULATING GATED ION CHANNELS - The present invention is directed toward radiolabelled ASIC imaging agents, as well as metabolites of ASIC antagonists. These compounds are useful for the diagnosis and treatment of diseases and disorders related to the activity of gated ion channels. | 10-01-2009 |
20090246135 | DIAGNOSTIC AGENT - A diagnostic agent for being sprinkled to the inner wall of a gastrointestine in endoscopic observation, comprising an acidic aqueous solution of pH 1 to 5 containing a colorant and also containing at least one acid selected from the group consisting of a carboxylic acid, hydrochloric acid, sulfuric acid and phosphoric acid. By sprinkling such a diagnostic agent to the inner wall of a gastrointestine in endoscopic observation, it is possible to clearly observe a lesion which is difficult to be determined. In particular, it is suitable for observing lesions having cancer cells in the stomach or the Barrett's esophagus. | 10-01-2009 |
20090246136 | IDENTIFICATION OF MICRO-RNAS INVOLVED IN NEUROMUSCULAR SYNAPSE MAINTENANCE AND REGENERATION - The present invention relates to the identification of miRNAs that are involved in the process of neuromuscular synaptic maintenance and regeneration following injury or disease. Modulation of these miRNAs is proposed as treatment for spinal cord injury and neurodegenerative disease. | 10-01-2009 |
20090246137 | PYRIDYL DERIVATIVES AS CFTR MODULATORS - The present invention relates to modulators of ATP-Binding Cassette (“ABC”) transporters or fragments thereof, including Cystic Fibrosis Transmembrane Conductance Regulator (“CFTR”), compositions thereof, and methods therewith. The present invention also relates to methods of treating ABC transporter mediated diseases using such modulators. | 10-01-2009 |
20090252681 | Nanobodies and Polypeptides Against EGFR and IGF-IR - The invention relates to polypeptides and Nanobodies against Epidermal Growth Factor Receptor (EGFR) and/or Insulin Growth Factor-I Receptor (IGF-IR). The invention also relates to nucleic acids encoding such Nanobodies and polypeptides; to methods for preparing such Nanobodies and polypeptides; to host cells expressing or capable of expressing such Nanobodies or polypeptides; to compositions, and in particular to pharmaceutical compositions, that comprise such Nanobodies, polypeptides, nucleic acids and/or host cells; and to uses of such Nanobodies, polypeptides, nucleic acids, host cells and/or compositions, in particular for prophylactic, therapeutic or diagnostic purposes. | 10-08-2009 |
20090252682 | IN-VIVO OPTICAL IMAGING METHOD INCLUDING ANALYSIS OF DYNAMIC IMAGES - In-vivo optical molecular imaging methods for producing an image of an animal are described. A time series of image data sets of an optical contrast substance in the animal is acquired using an optical detector Each image data set is obtained at a selected time and has the same plurality of pixels, with each pixel having an associated value. The image data sets are analyzed to identify a plurality of distinctive time courses, and respective pixel sets are determined from the plurality of pixels which correspond to each of the time courses. In one embodiment, each pixel set is associated with an identified anatomical or other structure, and an anatomical image map of the animal can be generated which includes one or more of the anatomical structures. | 10-08-2009 |
20090257953 | NOVEL FLUORINE-18 LABELED RHODAMINE DERIVATIVES FOR MYOCARDIAL PERFUSION IMAGING WITH POSITRON EMISSION TOMOGRAPHY - The present invention is directed toward novel fluorine-18 labeled rhodamine dye derivatives and methods of making the same. The present invention is also directed toward methods of using novel fluorine-18 labeled rhodamine dye derivatives as positron emission tomography imaging agents and myocardial perfusion imaging agents. | 10-15-2009 |
20090263323 | Novel means and methods for the treatment of hearing loss and phantom hearing - This invention relates to a method of identifying a modulator of an NADPH oxidase, whereby said modulator is suitable as a lead compound and/or as a medicament for the treatment and/or prevention of hearing loss and/or phantom hearing, the method comprising the steps of (a) contacting a test compound with a protein, wherein said protein (i) comprises or consists of the amino acid sequence of any one of SEQ ID NO: 1, 3 or 5, or (ii) is encoded by a nucleic acid comprising or consisting of the sequence of any one of SEQ ID NO: 2, 4, 6, 23 or 24, or (iii) is a fragment of the protein according to (i) or (ii) and exhibits NADPH oxidase activity, or (iv) has a sequence at least 75% identical with the protein according to (i) or (ii) or with the fragment according to (iii) and exhibits NADPH oxidase activity, and optionally with one or more NADPH oxidase subunits, under conditions allowing binding of said test compound to said protein or, if present, said subunit(s); (b) optionally determining whether said test compound binds to said protein or, if present, said subunit(s); and (c) determining whether (ca) said test compound, upon contacting in step (a); or (cb) said test compound, upon binding in step (b) modulates the expression and/or activity of said protein or, if present, said subunit(s). Also provided are pharmaceutical compositions, medical uses and diagnostic uses of compounds of the invention. | 10-22-2009 |
20090269279 | Toxicology and Cellular Effect of Manufactured Nanomaterials - The increasing use of nanotechnology in consumer products and medical applications underlies the importance of understanding its potential toxic effects to people and the environment. Herein are described methods and assays to predict and evaluate the cellular effects of nanomaterial exposure. Exposing cells to nanomaterials at cytotoxic doses induces cell cycle arrest and increases apoptosis/necrosis, activates genes involved in cellular transport, metabolism, cell cycle regulation, and stress response. Certain nanomaterials induce genes indicative of a strong immune and inflammatory response within skin fibroblasts. Furthermore, the described multiwall carbon nanoonions (MWCNOs) can be used as a therapeutic in the treatment of cancer due to its cytotoxicity. | 10-29-2009 |
20090274625 | Compositions and Methods for The Treatment of Cancer - The instant invention provides methods and compositions for the treatment and diagnosis of cancer, e.g., cancers characterized by the expression of prostate specific membrane antigen (PSMA). | 11-05-2009 |
20090280060 | PHOTOCHROMIC PROBES - The present invention provides photochromic compounds and derivatives thereof as shown in claim | 11-12-2009 |
20090280061 | ESTERS OF 5-AMINOLEVULINIC ACID AS PHOTOSENSITIZING AGENTS IN PHOTOCHEMOTHERAPY - The present invention relates to compounds being esters of | 11-12-2009 |
20090285757 | METHODS OF TARGETING CELLS FOR DIAGNOSIS AND THERAPY - Methods of making bispecific binding complexes and nanopolymers coupled to detection and/or therapeutic agents are disclosed. Also disclosed are methods of using such bispecific binding complexes and nanopolymers for detecting and treating cells. | 11-19-2009 |
20090297448 | Quantum Dot Barcode Structures and Uses Thereof - The present invention provides novel barcode microstructures and methods for making and using the microstructures for molecular recognition, and/or delivery of therapeutic, diagnostic, contrast, and imaging agents. | 12-03-2009 |
20090297449 | METALLOPROTEINASE 9 AND METALLOPROTEINASE 2 BINDING PROTEINS - Proteins that bind to matrix metalloproteinase 9 and to matrix metalloproteinase 2 and methods of using such proteins are described. | 12-03-2009 |
20090304588 | BIOLOGICALLY EXCITABLE CELLS - As an alternative strategy to electronic pacemaker devices, we explored the feasibility of converting normally-quiescent ventricular myocytes into pacemakers by somatic cell fusion. The idea is to create chemically-induced fusion between myocytes and syngeneic fibroblasts engineered to express HCN1 pacemaker ion channels (HCN1 fibroblasts), in normally-quiescent myocardium. HCN1-expressing fibroblasts formed stable heterokaryons with myocytes, generating spontaneously-oscillating action potentials as well as ventricular pacemaker activity in vivo and provides a platform for an autologous, non-viral, adult somatic cell therapy. We also converted a depolarization-activated potassium-selective channel, Kv1.4, into a hyperpolarization-activated non-selective channel by site-directed mutagenesis (R447N, L448A, and R453I in S4 and G528S in the pore). Gene transfer into ventricular myocardium demonstrated the ability of this construct to induce pacemaker activity, with spontaneous action potential oscillations in adult ventricular myocytes and idioventricular rhythms by in vivo electrocardiography. Given the sparse expression of Kv1 family channels in the human ventricle, gene transfer of a synthetic pacemaker channel based on the Kv1 family has therapeutic utility as a biological alternative to electronic pacemakers. | 12-10-2009 |
20090304589 | RADIATION SENSITIVE LIPOSOMES - The present invention relates to a radiation sensitive liposome, and the use of this liposome as carrier for therapeutic and diagnostic agent(s). In particular, the invention encompasses a liposome composition comprising a stable liposome-forming lipid and a polymerizable colipid, and a chain transfer agent. The present invention further contemplates methods of diagnosing and treating conditions and diseases that are responsive to liposome-encapsulated or associated agents. | 12-10-2009 |
20090304590 | Therapeutic compositions and methods - The present application provides novel binding proteins, including human binding proteins that specifically bind to the human ErbB2. | 12-10-2009 |
20090304591 | METHOD AND DEVICE FOR OPTICAL DETECTION OF THE EYE - A solution for optical detection of the eye. Molecular markers are used for high-contrast diagnosis of eye diseases, other diseases, and other vital parameters which can be diagnosed in the eye. For optical detection of the eye, a molecular marker with spectral characteristics of absorption and/or scattering in the visual and infrared spectral region is introduced into the eye and bound to a specific target. The interaction of the molecular marker with the target is detected by means of optical imaging methods, such as fundus photography, confocal laser microscopy, polarisation-optical imaging methods, holographic methods or especially OCT methods. The use of optical methods is strongly preferred for the diagnosis of the eye as a result of the high transparency of the optical system of the eye compared to other body parts. | 12-10-2009 |
20090304592 | TREATMENT OF METASTATIC TUMORS - The present invention is directed to methods and methods for the treatment, inhibition and/or reduction, and detection of metastatic tumors. In some embodiments, the inventive methods include systemic (e.g., intravenous) administration of a chlorotoxin agent that may or may not be labeled. In some embodiments, the inventive methods allow treatment, inhibition and/or reduction, and detection of metastases in the brain. In some embodiments, neovascularization is inhibited and/or newly formed vessels are caused to regress. | 12-10-2009 |
20090304593 | DETECTION OF THE DETACHMENT OF IMMOBILIZED CONTRAST AGENT IN MEDICAL IMAGING APPLICATIONS - An embodiment of a solution is proposed for imaging a body-part that is perfused with a contrast agent. A corresponding method includes the step of providing a sequence of input images (for example, acquired with an ultrasound scanner); the input images offer a digital representation over time of the body-part. Each input image includes a plurality of input values (i.e., pixel or voxel values); each input value is indicative of a response to an interrogation signal (such as an echo signal for ultrasound waves) of a corresponding location of the body-part, which possibly includes the contrast agent. The method further includes the step of generating at least one filtered image from a plurality of selected ones of the input images (such as all of them or a subset thereof). Each filtered image includes a filtered value for each of a plurality of selected ones of the locations (for example, in a region of interest, or ROI). The filtered value of each selected location is indicative of the contrast agent that leaves the selected location after being substantially stationary at the selected location for a period of time, which is comprised between a first non-zero threshold and a second threshold higher than the first threshold (such as because the contrast agent detaches from the location after having been immobilized thereon, or because it was moving very slowly). The filtered value is obtained by reducing, where present, a contribution of the contrast agent that is substantially stationary at the selected location along the selected input images for a period of time equal to or shorter than the first threshold, and by reducing a contribution of the contrast agent that is substantially stationary at the selected location along the selected input images for a period of time equal to or longer than the second threshold. | 12-10-2009 |
20090311180 | Protein Isoforms and Uses Thereof - A method for screening for or diagnosis or prognosis of a neurological disorder in a subject, for determining the stage or severity of such a neurological disorder in a subject, for identifying a subject at risk of developing such a neurological disorder, or for monitoring the effect of therapy administered to a subject having such a neurological disorder, said method comprising: (a) analyzing a test sample of body fluid or tissue from the subject said sample comprising at least one Protein Isoform selected from the Protein Isoform Nos 1-6 listed in Table 1; and (b) comparing the abundance of said Protein Isoform(s) in the test sample with the abundance of said Protein Isoform(s) in a test sample from one or more persons free from neurological disorder, or with a previously determined reference range for that Protein Isoform in subjects free from neurological disorder, wherein a diagnosis of or a positive result in screening for or a prognosis of a more advanced condition of said neurological disorder is indicated by increased abundance of said Protein Isoform(s) in the test sample relative to the abundance of said Protein Isoform(s) in the test sample from one or more persons free from neurological disorder, or with the previously determined reference range for that Protein Isoform in subjects free from neurological disorder. | 12-17-2009 |
20090311181 | Engineered Anti-Prostate Stem Cell Antigen (PSCA) Antibodies for Cancer Targeting - The invention provides novel humanized antibody fragments that specifically bind prostate cell-surface antigen (PSCA), a protein which is overexpressed in variety of cancers, including prostate, bladder, and pancreatic cancer. Methods are provided for the use of the compositions of the invention for the treatment of cancer, diagnosis of cancer, to provide a prognosis of cancer progression, and for cancer imaging. | 12-17-2009 |
20090311182 | Macromolecular Delivery Systems for Non-Invasive Imaging, Evaluation and Treatment of Arthritis and Other Inflammatory Diseases - This invention relates to biotechnology, more particularly, to water-soluble polymeric delivery systems for the imaging, evaluation and/or treatment of rheumatoid arthritis and other inflammatory diseases. Using modern MR imaging techniques, the specific accumulation of macromolecules in arthritic joints in adjuvant-induced arthritis in rats is demonstrated. The strong correlation between the uptake and retention of the MR contrast agent labeled polymer with histopathological features of inflammation and local tissue damage demonstrates the practical applications of the macromolecular delivery system of the invention. | 12-17-2009 |
20090311183 | METALLOPROTEINASE 12 BINDING PROTEINS - Proteins that bind to matrix metalloproteinase 12 and methods of using such proteins are described. | 12-17-2009 |
20090311184 | HIGH PENETRATION PRODRUG COMPOSITIONS OF PEPTIDES AND PEPTIDE-RELATED COMPOUNDS - The invention provides compositions of novel high penetration compositions (HPC) or high penetration prodrugs (HPP) of peptides and peptide-related compounds, which are capable of crossing biological barriers with high penetration efficiency. The HPPs are capable of being converted to parent active drugs or drug metabolites after crossing the biological barrier and thus can render treatments for the conditions that the parent drugs or metabolites can. Additionally, the HPPs are capable of reaching areas that parent drugs may not be able to access or to render a sufficient concentration at the target areas and therefore render novel treatments. The HPPs can be administered to a subject through various administration routes, e.g., locally delivered to an action site of a condition with a high concentration or systematically administered to a biological subject and enter the general circulation with a faster rate. | 12-17-2009 |
20090317331 | Method of Identifying Partial Agonists of the A2A Receptor - The present invention provides a method for identifying and using partial adenosine A | 12-24-2009 |
20090324498 | METHOD OF MEASURING QUANTITY OF IN-VIVO SUBSTANCE BY USE OF COHERENT ANTI-STOKES RAMAN SCATTERED LIGHT - A method of measuring the quantity of an in-vivo substance includes the steps of: irradiating an in-vivo substance with two near infrared femtosecond laser beams of different frequencies; detecting coherent anti-Stokes Raman scattered light emitted from the in-vivo substance due to coincidence of the frequency difference between the two near infrared femtosecond laser beams with a natural frequency of the in-vivo substance; and determining the quantity of the in-vivo substance, based on a peak intensity of a Raman scattering spectrum obtained. | 12-31-2009 |
20090324499 | VITAMIN-TARGETED IMAGING AGENTS - The invention relates to compounds and methods for targeting radionuclide-based imaging agents to cells having receptors for a vitamin, or vitamin receptor binding derivative or analog thereof, by using such a vitamin as the targeting ligand for the imaging agent. The invention provides a compound of the formula | 12-31-2009 |
20100003193 | UNIT DOSAGE OF APADENOSON - The present invention provides a unit dosage of Apadenoson, a pharmacological stress agent, and use of the same as a pharmacologic agent for myocardial perfusion imaging. | 01-07-2010 |
20100008857 | NOVEL HEXATRIENE-BETA-CARBONYL COMPOUND - A label with which labeling is easy when labeling a molecule, i.e., a label that has a high reaction rate upon labeling and that produces a high reaction yield, as well as a precursor for the production of the label are provided. This is achieved by a hexatriene-β-carbonyl compound represented by Formula (I), a hexatriene-β-carbonyl compound represented by Formula (II), a hexatriene-β-carbonyl compound represented by Formula (III) and a hexatriene-β-carbonyl compound represented by Formula (IV). | 01-14-2010 |
20100008858 | Methods and Compositions for Improved F-18 Labeling of Proteins, Peptides and Other Molecules - The present application discloses compositions and methods of synthesis and use of F-18 labeled molecules of use, for example, in PET imaging techniques. In particular embodiments, the labeled molecules may be peptides or proteins, although other types of molecules including but not limited to aptamers, oligonucleotides and nucleic acids may be labeled and utilized for such imaging studies. In preferred embodiments, the F-18 label may be conjugated to a targeting molecule by formation of a metal complex and binding of the F-18-metal complex to a chelating moiety, such as DOTA, NOTA, DTPA, TETA or NETA. In other embodiments, the metal may first be conjugated to the chelating group and subsequently the F-18 bound to the metal. In other preferred embodiments, the F-18 labeled moiety may comprise a targetable conjugate that may be used in combination with a bispecific or multi specific antibody to target the F-18 to an antigen expressed on a cell or tissue associated with a disease, medical condition, or pathogen. Exemplary results show that F-18 labeled targetable conjugate peptides are stable in human serum at 37° C. for several hours, sufficient time to perform PET imaging analysis. | 01-14-2010 |
20100015054 | FLUORO-SUBSTITUTED BENZOXAZOLE POLYMETHINE DYES - Disclosed are reactive polyfluoro benzoxazole polymethine dyes that are useful for labelling and detecting biological and other materials. The dyes are of formula (I): | 01-21-2010 |
20100015055 | PRETREATMENT OF A BIOLOGICAL SAMPLE FROM AN AUTOIMMUNE DISEASE SUBJECT - The present application describes a method for pretreating a biological sample from an autoimmune disease subject in order to avoid interference, especially where the sample is to be subjected to a cell-based biological activity assay, such as a neutralizing antibody assay. | 01-21-2010 |
20100021382 | Pyrazine Derivatives and Uses Thereof - Disclosed herein are pyrazine derivatives and methods of using the same. | 01-28-2010 |
20100021383 | MOLECULAR PROBE FOR SPHINGOLIPIDS - There is presently provided a probe comprising an isolated sphingolipid binding domain (SBD) polypeptide, wherein the isolated SBD polypeptide is capable of binding to a sphingolipid, and methods and uses relating to such a probe. | 01-28-2010 |
20100021384 | USE OF VHH ANTIBODIES FOR THE PREPARATION OF PEPTIDE VECTORS FOR DELIVERING A SUBSTANCE OF INTEREST AND THEIR APPLICATIONS - Use of a variable fragment (VHH antibody) of a camelid single-chain antibody for the preparation of a peptide vector for delivering a substance of interest across the blood-brain barrier or into a cell. | 01-28-2010 |
20100021385 | BENZOXAZOLE DERIVATIVES - It is intended to provide a benzoxazole derivative or a pharmaceutically acceptable salt or solvate thereof which is useful in the early diagnosis of a conformation disease; a composition or a kit containing the same for diagnosing a conformation disease; a medical composition for treating and/or preventing a conformation disease; and so on. | 01-28-2010 |
20100028259 | USE OF ORGANIC CATION TRANSPORTERS FOR CANCER DIAGNOSIS AND THERAPY - The present invention provides, for the first time, the finding that organic cation transporters (OCTs) are major determinants of the anticancer activity of platinum-based drugs such as oxaliplatin, and therefore have clinical significance for selecting oxaliplatin as the preferred therapy for a cancer that expresses one or more OCTs, such as colorectal cancer or liver cancer. In addition, the OCT genotype can also be used to predict oxaliplatin response or to select therapy. The present invention also provides methods of treating or inhibiting cancers that expresses one or more OCTs by administering a therapeutically effective amount of a platinum-based drug such as an oxaliplatin analog having an organic non-leaving group with an increased size. The present invention further provides methods of sensitizing a therapy resistant cancer to a platinum-based drug such as oxaliplatin by administering a therapeutically effective amount of a nucleic acid encoding an OCT. Compositions, kits, and integrated systems for carrying out the diagnostic, prognostic, and therapeutic methods of the present invention are also provided. | 02-04-2010 |
20100028260 | Color-Coded Polymeric Particles of Predetermined Size for Therapeutic and/or Diagnostic Applications and Related Methods - Various embodiments are directed to color-coded and size-calibrated polymeric particles comprising an acrylate-based hydrogel core incorporating one or more chromophores of interest, and an outer shell comprising polyphosphazenes of formula I, useful for various therapeutic and/or diagnostic procedures. In various embodiments, the color-coded and size-calibrated polymeric particles can be employed in any particle-mediated procedure, including as embolic agents, dermal fillers, and various implantable devices for a broad range of clinical and cosmetic applications. The incorporation of a particular chromophore formulation that correlates with a pre-determined size specificity for implantable and loadable polymeric particles (“color-coded and size-calibrated”) enables the visual detection and identification of particles exhibiting a particular size of interest, and minimizes the probability of user-introduced or procedural errors. | 02-04-2010 |
20100028261 | Molecular Specific Photoacoustic Imaging - Methods relating to photoacoustic imaging of biological tissue are provided. One such method comprises contacting a biological tissue with a bioconjugate and irradiating the bioconjugate so as to generate an acoustic wave, wherein the bioconjugate comprises a nanoparticle and a moiety capable of selectively coupling a molecular marker. Suitable moieties include, among other things, epithelial growth factor receptor (EGFR). | 02-04-2010 |
20100028262 | 3,4-METHYLENEDIOXY-SUBSTITUTED CHALCONES AS THERAPEUTIC AGENTS - The present invention pertains to the use of a compounds for the manufacture of a medicament for use in the treatment of a proliferative condition, wherein the compounds have the following formula: | 02-04-2010 |
20100034742 | MODULAR MONOLAYER COATINGS FOR SELECTIVE ATTACHMENT OF NANOPARTICLES TO BIOMOLECULES - Nanoparticles are functionalized for use as bio-imaging probes using a novel, modular approach. Particle surface modification is based on a phosphonate monolayer platform on which was built a multi-segmented, multi-functional film: the first segment provided hydrolytic stability, the second aqueous suspendability, and the third, selectivity for cell attachment. In vitro imaging experiments visualized nanoparticle—cell surface binding. Peptide-derivatized nano-particles were not displaced from cells by soluble peptide. Methods for coating the host particles and use of rare earth ion-doped particles in imaging methods and photodynamic therapy methods are also disclosed. | 02-11-2010 |
20100034743 | Raman Characterization of Transplant Tissue - A system and method for determining a disease state and clinical outcome of a sample. A sample is illuminated to produce Raman scattered photons, the Raman scattered photons are assessed to generate a Raman spectroscopic data set representative of the sample, wherein said Raman spectroscopic data set comprises at least one of: a Raman spectra of the sample and a spatially accurate wavelength resolved Raman image of the sample; the Raman spectroscopic data set is evaluated using a chemometric technique to classify the disease state of the sample as: acute, chronic, incipient, or none. In one embodiment, the chemontric technique is principle component analysis. In another embodiment, the sample is obtained prior to transplantation and analysis can determine the likelihood of rejection by a host. | 02-11-2010 |
20100040546 | Biological targeting compositions and methods of using the same - Modified red blood cells are described. In an embodiment, the modified red blood cell includes a target-binding agent. Targeted delivery of imaging agents, drugs, and peptide and protein pharmaceuticals using modified red blood cells are described. Processes for preparing the modified red blood cells, pharmaceutical and diagnostic compositions containing the same and methods of diagnosis and treatment involving the modified red blood cells are described. | 02-18-2010 |
20100040547 | DYES AND PRECURSORS AND CONJUGATES THEREOF - Novel dyes, precursors to novel dyes, and conjugates of the novel dyes are disclosed, as well as methods of making and using the same. | 02-18-2010 |
20100040548 | HIGH PENETRATION PRODRUG COMPOSITIONS OF ANTIMICROBIALS AND ANTIMICROBIAL-RELATED COMPOUNDS - The invention provides compositions of novel high penetration compositions (HPC) or high penetration prodrugs (HPP) of antimicrobials and antimicrobial-related compounds, which are capable of crossing biological barriers with high penetration efficiency. The HPPs are capable of being converted to parent active drugs or drug metabolites after crossing the biological barrier and thus can render treatments for the conditions that the parent drugs or metabolites can. Additionally, the HPPs are capable of reaching areas that parent drugs may not be able to access or to render a sufficient concentration at the target areas and therefore render novel treatments. The HPPs can be administered to a subject through various administration routes, e.g., locally delivered to an action site of a condition with a high concentration or systematically administered to a biological subject and enter the general circulation with a faster rate. | 02-18-2010 |
20100040549 | Composition for Targeted Drug Delivery and Controlled Release - Disclosed herein are novel targeted drug delivery and controlled release methods and compositions where optically absorbing nanoparticles, such as nanoshells, are functionalized on their surfaces with thermolabile molecules that bind the drug molecules to be delivered. The linkage between the thermolabile moiety on the nanoparticles and the drug is deliberately designed or selected to be temperature sensitive, so that upon illumination of the nanoparticle at a wavelength of light, the drug molecules on the nanoparticles will be released. Targeting molecules, such as antibodies, aptamers or other molecules like folic acid, can be concurrently bound to the nanoparticle surface to deliver the nanoparticle to specifically targeted cells or tissues prior to the photothermally induced drug release. In this way the nanoparticles can be advantageously concentrated on the target prior to illumination, which makes the disclosed compositions both a targeted delivery and a controllable drug release vehicle. | 02-18-2010 |
20100047170 | Peptide Prodrugs - Provided herein are a novel class of oligopeptides and prodrugs that include amino acid sequences containing cleavage sites for fibroblast activation protein (FAP). Also provided herein are methods of treating FAP related disorders, including cancer. | 02-25-2010 |
20100047171 | Fusion Proteins That Contain Natural Junctions - A method for preparing recombinant fusion proteins that comprise at least one natural junction is described. Fusion proteins that contain at least one natural junction have reduced potential for immunogenicity, improved stability, reduced tendency to aggregate, improved expression and/or improved production yields relative to conventional fusion proteins. Novel fusion proteins that comprise at least one natural junction, compositions comprising the fusion proteins and methods of using the proteins are also disclosed. | 02-25-2010 |
20100047172 | Use of bacterial beta-lactamase for in vitro diagnostics and in vivo imaging, diagnostics and therapeutics - Provided herein are imaging methods for detecting, diagnosing and imaging pathogenic bacteria or a pathophysiological condition associated therewith using fluorescent, luminescent or colorimetric detection agents, e.g., fluorogenic substrates for bacterial enzymes, caged luciferins and fluorescent proteins, luciferases and enzymes expressed by recombinant bacteria. Signals emitted by the fluorescent, luminescent or colorimetric detection agents in the presence of the bacteria are compared to controls to detect and locate the pathogenic bacteria. Also provided is a method for screening therapeutic agents to treat the pathophysiological conditions by measuring fluorescence or luminescence emitted from the detection agents in the presence and absence of the potential therapeutic agent. In addition, a method for detecting a pathogenic bacteria via PET or SPECT imaging using a positron-emitting or gamma-emitting substrate for a beta-lactamase or other enzyme or protein of the pathogenic bacteria. Further provided are the fluorogenic substrates CNIR-7 or CNIR7-TAT or the radiolabeled substrates. | 02-25-2010 |
20100047173 | Methods for Using Optical Agents - In certain embodiments, the present invention is directed to novel processes for using hepatobiliary cleared optical agents to detect one or more tissues of the biliary tract of a surgical patient. In certain embodiments, the invention is directed to kits that include one or more optical agents and instructions for using the agent(s), for example, in a process of the invention. | 02-25-2010 |
20100047174 | AAV CAPSID LIBRARY AND AAV CAPSID PROTEINS - Recombinant adeno-associated viral (AAV) capsid proteins are provided. Methods for generating the recombinant adeno-associated viral capsid proteins and a library from which the capsids are selected are also provided. | 02-25-2010 |
20100047175 | Sincalide Formulations - The invention features sincalide formulations that include an effective amount of sincalide, a bulking agent/tonicity adjuster, a stabilizer, a surfactant, a chelator, and a buffer. The invention also features kits and methods for preparing improved sincalide formulations as well as methods for treating, preventing, and diagnosing gall bladder-related disorders using sincalide formulations. | 02-25-2010 |
20100061932 | PEPTIDES USEFUL AS CELL-PENETRATING PEPTIDES - The present invention is related to a peptide having an amino acid sequence comprising at least 8 consecutive amino acids of the human lactoferrin protein or of the bovine lactoferrin protein, whereby the peptide is suitable to act as a cell-penetrating peptide. | 03-11-2010 |
20100061933 | PHARMACEUTICAL COMPOSITION COMPRISING ANTI-HB-EGF ANTIBODY AS ACTIVE INGREDIENT - An anti-HB-EGF antibody having an internalizing activity is disclosed. A cytotoxic substance is preferably bound to the anti-HB-EGF antibody of the present invention. Also provided are an anti-cancer agent and a cell proliferation inhibitor, which comprise the antibody of the present invention as an active ingredient, a method of treating cancer and a method of diagnosing cancer, which comprise the administration of the antibody of the present invention. Cancers that can be treated by the anti-cancer agent of the present invention include pancreatic cancer, liver cancer, esophageal cancer, melanoma, colorectal cancer, gastric cancer, ovarian cancer, uterine cervical cancer, breast cancer, bladder cancer, brain tumors, and hematological cancers. | 03-11-2010 |
20100061934 | Methods for diagnosis or treatment of amyloidosis by targeting hyper-sulfated proteoglycans present in amyloid - Amyloid in an individual may be targeted by systemically administering to an individual a ligand that binds to a hyper-sulfated proteoglycan and permitting the ligand to bind to hyper-sulfated proteoglycans associated with amyloid within the body of the individual. | 03-11-2010 |
20100068141 | USE OF HEAT SHOCK TO TREAT OCULAR DISEASE - The invention generally provides methods for recruiting stem cells to an ocular tissue. The methods involve inducing heat shock in the ocular tissue using a subthreshold laser and/or an agent. In some embodiments, the heat shock is induced following the administration of an agent that mobilizes HSCs. | 03-18-2010 |
20100068142 | MELANOMA REPOPULATING CELLS - The invention relates to the identification of melanoma repopulating cells, characterization of these cells, and diagnostic and therapeutic methods based on an understanding of the properties of these cells. | 03-18-2010 |
20100068143 | METAL-POLYMER COORDINATION COMPLEX INCORPORATING PHOSPHORUS ATOMS AND APPLICATIONS USING SUCH A COMPLEX - The invention relates to a compound comprising at least one polymeric chain incorporating phosphorus atoms and consisting, in all or in part, of identical or different repeated units, each of said units being represented by the following formula: | 03-18-2010 |
20100068144 | NONLINEAR OPTICAL DETECTION OF MOLECULES COMPRISING AN UNNATURAL AMINO ACID POSSESSING A HYPERPOLARIZABILITY - A system for making molecules, and proteins in particular, suitable for detection by a surface-selective nonlinear optical technique. A first use of the invention is for determining a protein's structure in real space and real time. A second use of the invention is to detect a protein or its activity (conformational change). A third use of the invention is for drug screening. A further aspect of the present invention is measuring probe tilt angle orientation in an oriented protein. | 03-18-2010 |
20100068145 | Bispecific fusion protein having therapeutic and diagnostic potential - The present invention relates to a bispecific fusion protein, comprising (a) a first polypeptide which binds to collagen, and (b) a second polypeptide which binds to endothelial precursor cells. Also, pharmaceutical compositions are disclosed, comprising the fusion protein of the invention, as well as methods for using the fusion protein, in particular for treating or preventing lesions of vessels and tissues. | 03-18-2010 |
20100074845 | ENHANCED SENSITIVITY CARBON NANOTUBES AS TARGETED PHOTOACOUSTIC MOLECULAR IMAGING AGENTS - The present disclosure provides contrast photoacoustic probes, and compositions comprising such probes, designed to non-invasively detect and monitor various disease states, or targets within a subject human or animal. The probes are designed to be optically excited in tissue, ultimately generating thermal energy, which is transformed into acoustic energy by the response of the aqueous environment in the subject to the thermal emissions. The acoustic energy (sound) can then be detected by suitably applied transducers and digitally transformed into images indicating the location of the probe in the subject. One aspect of the disclosure encompasses photoacoustic probes that comprise: a carbon nanotube and a plurality of dye molecules bound to the carbon nanotube. The probes may further comprise a targeting moiety for localizing the probe at the site of a specific target. Another aspect of the present disclosure encompasses methods of detecting a target in animal or human subject, comprising: delivering a photoacoustic probe to a subject, allowing the photoacoustic probe to selectively bind to a target of the subject; and illuminating the system with an optical energy absorbable by the photoacoustic probe to generate an acoustic signal; and detecting the acoustic signal, thereby detecting the target in the subject. | 03-25-2010 |
20100086481 | DIFFERENTIAL EXPRESSION OF MOLECULES ASSOCIATED WITH INTRA-CEREBRAL HEMORRHAGE - Methods are provided for evaluating a stroke, for example for determining whether a subject has had a hemorrhagic stroke, determining the severity or likely neurological recovery of a subject who has had a hemorrhagic stroke, and determining a treatment regimen for a subject who has had a hemorrhagic stroke, as are arrays and kits that can be used to practice the methods. In particular examples, the method includes screening for expression of hemorrhagic stroke related genes (or proteins), such as genes (or proteins) involved in suppression of the immune response, genes (or proteins) involved in vascular repair, genes (or proteins) involved in the acute inflammatory response, genes (or proteins) involved in cell adhesion, genes (or proteins) involved in hypoxia, genes (or proteins) involved in signal transduction, and genes (or proteins) involved in the response to the altered cerebral microenvironment. Arrays and kits are provided that can be used in the disclosed methods. Also provided are methods of identifying one or more agents that alter the activity (such as the expression) of a hemorrhagic stroke-related molecule. | 04-08-2010 |
20100086482 | DIVERGENT SYNTHESIS OF LOOPED POLY(ESTER)-AND POLY(ETHER)-SUBSTITUTED DENDRONS AND DENDRIMERS - The present invention describes a process for preparing new looped dendrimer and dendron compounds by controlling the molar amount of branch cell reagent monomer that is combined with various cores bearing core-XR functionalities (e.g., primary, or secondary amines, thiol, or epoxy functionalities). These looped, macrocyclic structures are more robust to various conditions, with greater resistance to acid/base hydrolysis. Alternatively, the looped, macrocyclic structure may offer new orientations that would qualify it as a better chelation ligand for metals, and other similar uses. | 04-08-2010 |
20100086483 | METHOD OF MULTIDETECTOR COMPUTED TOMAGRAPHY - This invention relates to methods for multidetector computed tomography myocardial perfusion imaging comprising administering doses of a rate-control agent and one or more adenosine A | 04-08-2010 |
20100086484 | IN VIVO DRUG CONCENTRATION DISTRIBUTION MEASURING DEVICE, VARIABLE-WAVELENGTH FILTER USED FOR THE SAME, AND IN VIVO DRUG CONCENTRATION DISTRIBUTION MEASURING METHOD - An in vivo drug concentration distribution measuring device for measuring, when a drug having an imaging function is administered, in vivo concentration distribution of the drug is disclosed. The device includes: a light source which casts light to a living body as a measuring target; a variable-wavelength filter which, when the light is cast to the drug from outside of the living body, the light emitted from the drug to outside of the living body becomes incident on and transmits light of a predetermined wavelength range, of an entire wavelength range of the incident light, and which is capable of changing the predetermined wavelength range; a photodetector unit which detects intensity of light made incident through the variable-wavelength filter and acquires intensity distribution of light emitted from plural positions on the measuring target; and a drug concentration calculating unit which calculates a concentration of the drug in accordance with the intensity distribution of the light at the plural positions on the measuring target acquired by the photodetector unit. | 04-08-2010 |
20100092388 | Anthracycline Derivatives - Anthracycline derivatives are suitable for use in cancer therapy and diagnosis. These anthracycline derivatives can be radiolabelled and used as an imaging agent in cancer diagnosis. The radiolabelled anthracycline derivatives can also be used together with a drug delivery system, in particular including a two-step targeting strategy, for treating solid and disseminated tumours. These drug delivery system can advantageously be used for treatment and diagnosis of breast cancer. | 04-15-2010 |
20100098635 | MODULAR ANTIGEN TRANSPORTER MOLECULES (MAT MOLECULES) FOR MODULATING IMMUNE REACTIONS, ASSOCIATED CONSTRUCTS, METHODS AND USES - It is therefore the object of the invention to provide means for supplying any of a wide variety of antigens in a sufficiently targeted manner to their processing site that even better therapeutic and diagnostic use thereof is possible. | 04-22-2010 |
20100098636 | Compositions for Delivery of Therapeutics and Other Materials - This disclosure relates to compositions for delivering agents to a subject, and in particular, to compositions for delivery of therapeutic agents or diagnostic agents in the presence or absence of targeting moieties. In part, this disclosure relates to compositions comprising a hydrophobic group with a first end and a second end, a first metal binding domain linked to the hydrophobic group, a metal ion capable of being chelated to the first metal binding domain, and an agent linked to a second metal binding domain capable of chelating to the metal ion. | 04-22-2010 |
20100098637 | DYE-LOADED NANOPARTICLE - The present invention generally relates to dye-loaded nanoparticles. In particular, the present invention provides methods for the staining and visualization of tumor and tumor boundaries using dye-loaded nanoparticles. | 04-22-2010 |
20100104513 | METHOD AND SYSTEM FOR DYE ASSESSMENT - The present disclosure generally relates to systems and methods for identifying the boundaries of tumors and assessing quantitatively the ability of dyes to highlight a tumor's boundary. In accordance with these methods and systems, images are taken of subjects administered agents labeled with dyes. After accessing the images, tumors are selected and routines employed to both identify the boundaries of the tumors, as well as, to quantify various aspects of the tumor boundaries. From these quantifiable descriptors the performances of the various dyes to highlight the boundaries of tumors are evaluated. | 04-29-2010 |
20100111865 | CONTRAST AGENTS - The present invention provides novel compounds and pharmaceutical compositions containing such compounds, wherein the compounds have affinity for proteoglycans. The compounds comprise an amino acid based core unit linked to positively charged moieties. The compounds further comprise at least one imaging moiety detectable in in vivo imaging making the compounds useful as diagnostic contrast agents for imaging of proteoglycans, such as heparan sulphate proteoglycans. | 05-06-2010 |
20100111866 | Receptor and Antigen Targeted Prodrug - The present invention relates to a prodrug which comprises at least one pharmaceutically and/or diagnostically active compound bound by a cleavable linker, a receptor and/or antigen targeting moiety and a protein-binding moiety which is capable of binding to a carrier molecule. | 05-06-2010 |
20100111867 | CARBORANE-PHOSPHONIUM COMPOUNDS AND THEIR USE IN BORON NEUTRON CAPTURE THERAPY AND IMAGING - The invention describes compounds for use in BCNT. These compounds comprise a carborane group coupled to a phosphorus containing group. The compounds may comprise a carborane group coupled to a phosphonium group. | 05-06-2010 |
20100111868 | MONOCLONAL ANTIBODIES FOR NEUTRALIZING ANTHRAX TOXIN - Isolated monoclonal antibodies that bind and/or neutralize anthrax protective antigen (PA) are disclosed as well as hybridomas secreting such antibodies. The invention also provides anti-PA fragments of the antibodies of the invention and recombinantly produced antibodies. Also provided are pharmaceutical compositions containing the antibodies or antibody fragments and uses and methods involving same. | 05-06-2010 |
20100111869 | Stinging cells expressing an exogenous polynucleotide encoding a therapeutic, diagnostic or a cosmetic agent and methods compositions and devices utilizing such stinging cells or capsules derived therefrom for delivering the therapeutic, diagnostic or cosmetic agent into a tissue - A stinging cell comprising an exogenous polynucleotide capable of expressing a therapeutic, cosmetic or diagnostic agent in the stinging cell is provided. | 05-06-2010 |
20100111870 | EVALUATION METHOD AND SCREENING METHOD FOR SUBSTANCE HAVING ACTION OF ACTIVATING/SUPPRESSING INNATE IMMUNITY, AGENT AND FOOD PRODUCT FOR ACTIVATING/SUPPRESSING INNATE IMMUNE MECHANISM AND METHOD FOR PRODUCING THE SAME - It is intended to provide an evaluation method and a screening method capable of eliminating a substance that disturbs in vivo kinetics in an individual and capable of simply and easily searching a substance having an action of activating/suppressing an innate immune mechanism without being affected by LPS derived from bacteria, which can be contaminated during the search, as well as a drug and a food for activating/suppressing the innate immune mechanism, and methods of producing the same. The present invention provides a method of evaluating or screening the substance having the action of activating/suppressing the innate immune mechanism using a muscular contraction of an organism having the innate immune mechanism as an indicator, and methods of producing the drug and the food for activating/suppressing the innate immune mechanism. Also, an innate immunity activator and the food having the action of activating the innate immune mechanism containing the substance having the action of contracting the muscle of the organism having the innate immune mechanism, and an innate immunity suppressor and the food having the action of suppressing the innate immunity containing the substance having the action of suppressing the contraction of the muscle of the organism having the innate immune mechanism are provided. | 05-06-2010 |
20100111871 | PHOTOACOUSTIC PROBES AND METHODS OF IMAGING - Embodiments of the present disclosure provide for photoacoustic probes, methods of determining the presence and location of a specific target, methods of determining the presence and location of an enzyme, methods of determining the presence and location of a specific target and an enzyme, and the like. | 05-06-2010 |
20100119449 | SOX11 EXPRESSION IN MALIGNANT LYMPHOMAS - The present invention provides a binding moiety which selectively binds to Sox11 protein and/or mRNA for imaging, diagnosis or prognosis of lymphomas, such as mantle cell lymphomas (MCL) and diffuse large B-cell lymphoma (DLBCL). Optionally, the moiety is an antibody or antigen-binding fragment thereof. Advantageously, moiety comprises a further, readily detectable moiety. The invention also provides methods of imaging lymphomas cells as well as methods of diagnosing or prognosing lymphomas in an individual. A further aspect of the present invention provides a method of identifying cells associated with lymphomas, the method comprising analysing the pattern of gene expression in a sample of cells to be tested and comparing it to the pattern of gene expression in a sample of known lymphomas cells. Preferably, the cells to be tested are identified as lymphoma cells if the expression of Sox11 is upregulated compared to normal B-cells. | 05-13-2010 |
20100119450 | SOLUBLE LOW-DENSITY LIPOPROTEIN RECEPTOR RELATED PROTEIN BINDS DIRECTLY TO ALZHEIMER'S AMYLOID-BETA PEPTIDE - A soluble derivative of low-density lipoprotein receptor related protein-1 (sLRP-1) binds directly to Alzheimer's amyloid-β peptide (Aβ). This binding may be used to detect Aβ or to separate Aβ from the rest of a subject's body. In Alzheimer's disease, it may be used to provide diagnostic results by detecting Aβ, treatment by removing Aβ, or both. | 05-13-2010 |
20100119451 | METHODS OF USING IN SITU HYDRATION OF HYDROGEL ARTICLES FOR SEALING OR AUGMENTATION OF TISSUE OR VESSELS - Pharmaceutically acceptable hydrogel polymers of natural, recombinant or synthetic origin, or hybrids thereof, are introduced in a thy, less hydrated, or substantially deswollen state and rehydrate in a physiological environment to undergo a volumetric expansion and to affect sealing, plugging, or augmentation of tissue, defects in tissue, or of organs. The hydrogel polymers may deliver therapeutic entities by controlled release at the site. Methods to form useful devices from such polymers, and to implant the devices are provided. | 05-13-2010 |
20100135907 | Oral Drug Compliance Monitoring Using Sound Detection - A tablet, pill or capsule containing a material which produces sound waves when the tablet, pill or capsule is exposed to the gastrointestinal system. A two step method for oral drug compliance monitoring. The first step is to ingest a tablet, pill or capsule containing a material which produces sound waves when the tablet, pill or capsule is exposed to the gastrointestinal system of a person. The second step is to detect the sound waves produced when the tablet, pill or capsule is exposed to the gastrointestinal system to confirm that the person has ingested the tablet, pill or capsule. | 06-03-2010 |
20100135908 | Delivery devices for modulating inflammation - Certain embodiments disclosed relate to compositions, including therapeutic compositions, methods, devices, and systems that modulate at least one inflammatory response or reaction. According to various embodiments, the compositions, methods, devices, and systems relate to modulating one or more of Toll-like receptors, Src family kinases, NF-kB molecules, proteases, or proteasomes. | 06-03-2010 |
20100135909 | DENDRIMERS AND METHODS OF MAKING AND USING THEREOF - A metal treatment composition including Tin (II) Chloride and processed montmorillonite clay. The addition of Tin (II) Chloride to the composition provides Tin for forming a ceramic-metal layer on the surfaces of the friction pair. Tin (II) Chloride provides Chlorine ions for forming Chloric films for protecting juvenile surfaces which form in the friction zone. The clay is heated and pulverized to produce a powder comprising both particles having crystalline layer structure and salts and oxides. The layered crystalline structure of the clay contains slip planes that transversely shift when tangential pressure from the friction pair is applied thereby lubricating the friction pair. The salts and oxides contribute to the formation of the ceramic-metal layer. | 06-03-2010 |
20100143254 | MOLECULES WITH REDUCED HALF-LIVES, COMPOSITIONS AND USES THEREOF - The present invention provides polypeptides containing at least the FcRn binding portion of an Fc region of an immunoglobulin molecule and that have altered amino acid sequences relative to wild type immunoglobulin molecules. The polypeptides have decreased in vivo serum half-lives and can be employed in various methods. | 06-10-2010 |
20100143255 | FIG4 GENE MUTATIONS IN NEURODEGENERATION - The present invention relates to neuropathy, in particular to mutations in the FI G4 gene. The present invention also provides assays for the detection of variant FIG4 alleles, and assays for detecting FIG4 polymorphisms and mutations associated with disease states. | 06-10-2010 |
20100150837 | ANTIBODIES AGAINST GPIb alpha - This application relates to agents capable of specifically recognizing GPIbα, a key receptor required for platelet adhesion and aggregation. More specifically, this application relates to monoclonal antibodies and derivatives thereof capable of specifically recognizing both the murine and the human GPIbα. These monoclonal antibodies and derivatives are particularly useful in the treatment or prevention of thrombosis as well as research tools. | 06-17-2010 |
20100150838 | METHODS FOR EVALUATING OSTEOARTHRITIS RISK - Methods are provided for evaluating osteoarthritis (OA), for example for diagnosing OA, to confirm a diagnosis of OA, to assess or prognose progression of OA, determining the severity of a subject who has OA, and determining a subject's risk of developing OA in the future, as are arrays and kits that can be used to practice the methods. In particular examples, the method includes determining an amount of activity (such as an amount of protein present or an amount of expression) of OA risk-related molecules, such as soluble vascular adhesion protein 1 (sVAP-1) or interleukin-15 (IL-15). Also provided are methods of identifying one or more compounds that alter the activity of an OA-related molecule, thereby identifying potential anti-osteoarthritis drugs. | 06-17-2010 |
20100158805 | QUANTUM DOT LABELED STEM CELLS FOR USE IN CARDIAC REPAIR - The present invention provides methods and compositions relating to the labeling of target cells with quantum dots (QDs). Specifically, a delivery system is disclosed based on the use of negatively charged QDs for delivery of a tracking fluorescent signal into the cytosol of target cells via a passive endocytosis-mediated delivery process. In a specific embodiment of the invention the target cell is a stem cell, preferably a mesenchymal stem cell (MSC). Such labeled MSCs provide a means for tracking the distribution and fate of MSCs that have been administered to a subject to promote cardiac repair. The invention is based on the discovery that MSCs can be tracked in vitro for up to at least 6 weeks. Additionally, QDs delivered in vivo can be tracked for up to at least 8 weeks, thereby permitting for the first time, the complete 3-D reconstruction of the locations of all MSCs following administration into a host. | 06-24-2010 |
20100158806 | Compositions for Delivery of Therapeutics and Other Materials - This disclosure relates to compositions for delivering agents to a subject, and in particular, to compositions for delivery of therapeutic agents or diagnostic agents in the presence or absence of targeting moieties. In part, this disclosure relates to compositions comprising a hydrophobic group with a first end and a second end, a first metal binding domain linked to the hydrophobic group, a metal ion capable of being chelated to the first metal binding domain, and an agent linked to a second metal binding domain capable of chelating to the metal ion. | 06-24-2010 |
20100166655 | 1, 4-DISUBSTITUTED 3-CYANO-PYRIDONE DERIVATIVES AND THEIR USE AS POSITIVE ALLOSTERIC MODULATORS OF MGLUR2-RECEPTORS - The present invention relates to novel compounds, in particular novel pyridinone derivatives according to Formula (I) | 07-01-2010 |
20100166656 | Diagnostic And Radiotherapeutic Contrast Agents And Process For Their Preparation - The present invention refers to diagnostically or radiotherapeutically useful compounds which are able to selectively bind to lectins, having formula (I) wherein R, R′, R | 07-01-2010 |
20100166657 | USE OF EphA4 AND MODULATOR OF EphA4 FOR DIAGNOSIS, TREATMENT AND PREVENTION OF CANCER - The present invention relates to methods and compositions designed for the treatment, management, or prevention of cancer, particularly, metastatic cancer. In one embodiment, the methods of the invention comprise the administration of an effective amount of one or more antibodies that bind to EphA4 and agonize EphA4. In another embodiment, the methods of the invention comprise the administration of an effective amount of one or more antibodies that bind to EphA4 and inhibit cancer cell colony formation in soft agar or tubular network formation in three-dimensional basement membrane or extracellular matrix preparation. In another embodiment, the methods of the invention comprise the administration of an effective amount of one or more antibodies that preferentially binds to an EphA4 epitope that is exposed on cancer cells but not non-cancer cells. In another embodiment, the methods of the invention comprise the administration of an effective amount of one or more antibodies that bind to EphA4 with a very low K | 07-01-2010 |
20100166658 | MONKEY HOMOLOG OF HUMAN ONCOSTATIN M - Cytokine oncostatin M nucleic acids from Cynomolgus monkey are useful for expression of oncostatin M proteins that are functional homologs of human oncostatin M. The nucleic acids and proteins produced therefrom are useful in screening and safety testing of oncostatin M, the generation and testing of oncostatin M modulators and related activities. | 07-01-2010 |
20100166659 | USE OF CYANINE DYES FOR THE DIAGNOSIS OF PROLIFERATIVE DISEASES - The present invention concerns the use of the cyanine dye SF64 for the diagnosis of proliferative diseases upon administration of less than 5 mg/kg body weight. | 07-01-2010 |
20100172837 | MN Gene and Protein - A new gene—MN—and proteins/polypeptides encoded therefrom are disclosed. Recombinant nucleic acid molecules for expressing MN proteins/polypeptides and recombinant proteins are provided. Expression of the MN gene is disclosed as being associated with tumorigenicity, and the invention concerns methods and compositions for detecting and/or quantitating MN antigen and/or MN-specific antibodies in vertebrate samples that are diagnostic/prognostic for neoplastic and pre-neoplastic disease. MN-specific antibodies are disclosed that can be used diagnostically/prognostically, therapeutically, for imaging, and/or for affinity purification of MN proteins/polypeptides. The invention still further concerns antisense nucleic acid sequences that can be used to inhibit MN gene expression. | 07-08-2010 |
20100172838 | ENDOMETRIAL BIOMARKERS - Methods for detecting endometrial diseases or an endometrium phase in a subject are described comprising measuring endometrial markers or polynucleotides encoding the markers in a sample from the subject. The invention also provides localization or imaging methods for endometrial diseases, and kits for carrying out the methods of the invention. The invention also contemplates therapeutic applications for endometrial diseases employing endometrial markers, polynucleotides encoding the markers, and/or binding agents for the markers. | 07-08-2010 |
20100172839 | METHOD AND SYSTEM FOR EVALUATING GASTROINTESTINAL MOTILITY - A system and method for evaluating gastrointestinal motility that can be effectively employed to acquire one or more signals associated with acoustic energy (i.e. sound) emanating from an abdominal region of a body and determine at least one gastrointestinal parameter based on the acoustic energy signal(s) is described. The gastrointestinal parameter can include a gastrointestinal event, including gastrointestinal mixing, emptying, contraction and propulsion, and gastrointestinal transit time. | 07-08-2010 |
20100172840 | PREPARATION OF CARBON NANOTUBES WITH LANTHANOID CATALYSTS - A lanthanoid metal catalyst for the formation carbon nanotubes from a carbon-containing gas mixture, a method for the formation of carbon nanotubes with the lanthanoid metal catalyst, endohedral carbon nanotube complexes containing lanthanoid metal atoms and/or ions, carbon nanotube imaging contrast agents, and a method for imaging living tissue with carbon nanotube imaging contrast agents are provided. | 07-08-2010 |
20100183513 | N-(METHYL) -1H-PYRAZOL-3-AMINE, N-(METHYL)-PYRIDIN-2-AMINE AND N-(METHYL)-THIAZOL-2-AMINE DERIVATIVES FOR THE TREATMENT OF DISEASES ASSOCIATED WITH AMYLOID OR AMYLOID-LIKE PROTEINS, LIKE E.G. ALZHEIMER'S - The present invention relates to novel compounds of formula (II) that can be employed in the treatment of a group of disorders and abnormalities associated with amyloid protein, such as Alzheimer's disease, and of diseases or conditions associated with amyloid-like proteins. The compounds of the present invention can also be used in the treatment of ocular diseases associated with pathological abnormalities/changes in the tissues of the visual system. The present invention further relates to pharmaceutical compositions comprising these compounds and to the use of these compounds for the preparation of medicaments for treating, or preventing diseases or conditions associated with amyloid and/or amyloid-like proteins. A method of treating or preventing diseases or conditions associated with amyloid and/or amyloid-like proteins is also disclosed. | 07-22-2010 |
20100183514 | MOLECULES INVOLVED IN REGULATION OF OSTEOBLAST ACTIVITY AND OSTEOCLAST ACTIVITY, AND METHODS OF USE THEREOF - The present invention is based, at least in part, on the identification of molecules involved in the differentiation and/or activity of osteoblasts and osteoclasts. Accordingly, the present invention provides methods of identifying modulators of bone formation, mineralization, and/or osteoclastogenesis and methods for treating disorders that would benefit from modulation of bone formation, mineralization, and/or osteoclastogenesis using agents identified as described herein. The target biomolecules of these methods are, for example, the osteoblast regulators TA0K2 or DLG1 or P1N1 or LYK5 or M0BKL2C or MAP4K2 or PACSIN2 or DCAMKLI or D0CK4 or PARO1 or TA0K3 or TRPV6 or CLK1 or AAK1 or PRKCA or AKAP8 or DGKJ or SMARCB1 or CIB2 or STIK33 or STK 39 or NRGN or PIK3R1 or RASSF5 or FRAPI or STK3S or LATSI or LATS2 or STK38L or GEFT or TNNI3K or STK4 or RAF1 or ARFI or CI7orf1 or SMURF2. The assays may involve mesenchymal cells. Also screening assays using osteoclast regulators such as GCK or WASH or PPP2CB or PPP2R1A or CREBBP or CUL3 or FBXW1 or MELK or PLCLI or MAP3K3 or DLGH1 or NEK7 or JIRAK3 or RHOC or SLC4A2 or PLCB4 or B-RAF or BMPR2 or MAPK3 or NHEDC2 are proposed, e.g. using hemapoietic stem cell assays. | 07-22-2010 |
20100183515 | COMPOSITIONS AND METHODS FOR TREATING THE VERTEBRAL COLUMN - The present invention relates to compositions and methods useful for treating structures of the vertebral column, including vertebral bodies. In one embodiment, a method for promoting bone formation in a vertebral body comprising providing a composition comprising a PDGF solution and a biocompatible matrix and applying the composition to at least one vertebral body. Promoting bone formation in a vertebral body, according to some embodiments, can increase bone volume, mass, and/or density leading to an increase in mechanical strength of the vertebral body treated with a composition of the present invention. | 07-22-2010 |
20100183516 | SELF COUPLING RECOMBINANT ANTIBODY FUSION PROTEINS - A compound comprising three components A, B, and C, which components are covalently bound forming the compound having the structure A-B-C wherein component A has a specific binding affinity for antigens, component B is covalently linked to component A component C is a compound having an alkylated purin or pyrimidin moiety such as guanin, cytosin or a Coenzyme A moiety and linked thereto a moiety having a physiological effect with the proviso that component B has an catalytical or acceptor activity to couple component C with covalently coupled components A-B. | 07-22-2010 |
20100183517 | Peptidomimetic Inhibitors Of PSMA, Compounds Comprising Them, And Methods Of Use - Compounds of the formula, A-L-B, wherein A is glutamate or a glutamate analog; L is a phosphoramidate or a phosphoramidate analog; and B is serine or a serine analog are described which are potent inhibitors of prostate-specific membrane antigen (PMSA). Such compounds are useful in treatment of prostate cancer; and when chemically attached to a fluorescent dye, can efficiently and selectively label prostate cancer cells for fluorescent imaging. | 07-22-2010 |
20100189646 | Carbazole Derivatives as Functional 5-HT6 Ligands - The present invention provides carbazole derivatives of formula (I), useful in treatment of a CNS disorders related to or affected by the 5-HT | 07-29-2010 |
20100189647 | Experimental Animal As Pathological Model, Method of Producing the Experimental Animal, and Method of Using the Experimental Animal - Problem to be Solved: There are provided a novel pathological model with an experimental animal which reproduces human nonalcoholic chronic hepatitis and/or liver fibrosis and/or cirrhosis progressed from fatty liver, a method for producing the same, and a method for utilizing the novel pathological model with an experimental animal. | 07-29-2010 |
20100189648 | INHIBITORS FOR DISRUPTING THE INTERACTION OF UBIQUITINATION RELATED ENZYMES AND USES THEREOF - A hydrophobic binding pocket on ubiquitin-protein ligase E3 is described, and used in designing the inhibitors disrupting ubiquitin conjugating enzyme E2 and E3 interaction. Four types of inhibitors designed by using the binding pocket are provided, which can be used for cancer treatment. | 07-29-2010 |
20100189649 | MONOCLONAL ANTIBODIES TO ACTIVATED ERBB FAMILY MEMBERS AND METHODS OF USE - Antibodies which bind to activated members of the erbB, TNF, and IgSF family of receptors and pharmaceutical compositions comprising the same are disclosed. Peptides and mimetics of erbB, TNF, and IgSF receptors and pharmaceutical compositions comprising the same are also described. Methods of using such antibodies, peptides, and mimetics in tumor therapeutic, prophylactic, imaging and diagnostic applications are disclosed. | 07-29-2010 |
20100189650 | Near-Infrared Responsive Carbon Nanostructures - The present invention provides for compositions comprising carbon nanotubes (CNT) and gold (Au). The present invention further provides methods of manufacture of gold-carbon nanotubes (gCNT). The present invention provides methods of using gCNT for biological application. | 07-29-2010 |
20100189651 | MODIFIED ANTIBODY COMPOSITIONS, METHODS OF MAKING AND USING THEREOF - The present disclosure provides modified antibodies which contain an antibody or antibody fragment (AB) modified with a masking moiety (MM). Such modified antibodies can be further coupled to a cleavable moiety (CM), resulting in activatable antibodies (AAs), wherein the CM is capable of being cleaved, reduced, photolysed, or otherwise modified. AAs can exhibit an activatable conformation such that the AB is more accessible to a target after, for example, removal of the MM by cleavage, reduction, or photolysis of the CM in the presence of an agent capable of cleaving, reducing, or photolysing the CM. The disclosure further provides methods of making and using such modified antibodies and activatable antibodies. | 07-29-2010 |
20100189652 | NOVEL DIAGNOSTIC MARKERS, ESPECIALLY FOR IN VIVO IMAGING, AND ASSAYS AND METHODS OF USE THEREOF - Novel splice variants as diagnostic markers, preferably membrane-bound. The novel variants according to the present invention may optionally be used for diagnosis of Marker-detectable disease as described herein, optionally through immunohistochemistry. | 07-29-2010 |
20100196275 | Methods and products for neutralizing the harmful effects of combustion products - The invention relates to the role of Acr-DNA adducts in p53 mutagenesis in CS-related lung cancer. The distribution of Acr-DNA adducts was mapped at the sequence level in the p53 gene of lung cells using the UvrABC incision method in combination with ligation-mediated PCR. It was determined that Acr preferentially binds at methylated CpG sites. Also, Acr can greatly reduce the DNA repair capacity for damage induced by benzo(a)pyrene diol epoxide. Together these results suggest that Acr is a major etiological agent for CS-related lung cancer and that it contributes to lung carcinogenesis through DNA damage and inhibition of DNA repair. Methods and compositions are provided for either removing an exogenous toxic agent from a combustion product or for preventing the toxic or mutagenic effect of these toxic agents on cells and tissues. Methods are also provided for screening for candidate compounds that protect cells from toxic combustion products. | 08-05-2010 |
20100196276 | RECOMBINANT CANINE THYROID STIMULATING HORMONE AND METHODS OF PRODUCTION AND USE THEREOF - The invention includes a nucleic acid having a sequence at least 98% homologous to SEQ ID NO: 1, which encodes the α subunit of canine thyroid stimulating hormone (TSH). The invention also includes a nucleic acid having a sequence at least 98% homologous to SEQ ID NO: 2, which encodes the β subunit of canine TSH. The invention also includes a method of producing a recombinant canine thyroid stimulating hormone (rcTSH) subunit by expressing a nucleic acid having a sequence of SEQ ID NO: 1 and a nucleic acid having a sequence of SEQ ID NO: 2 in a transgenic insect cell modified to sialylate proteins and producing a sialylated rcTSH subunit. The insect cell may be a lepidopteran cell. The rcTSH may be used for diagnosis and treatment. It may be used to diagnose canine hypothyroidism. | 08-05-2010 |
20100196277 | NANOPARTICLE COMPOSITIONS FOR CONTROLLED DELIVERY OF NUCLEIC ACIDS - Micro- and nano-particles are molded in micro- and nano-scale molds fabricated from non-wetting, low surface energy polymeric materials. The micro- and nano-particles can include pharmaceutical compositions, biologic drugs, drug compositions, organic materials, RNA, DNA, oligonucleotides, and the like. | 08-05-2010 |
20100196278 | PHOTOACOUSTIC IMAGING AGENT - A molecular probe marked with a color center material is used as a photoacoustic imaging agent to obtain an acoustic signal of practically adequate intensity using weak near-infrared light, which has good in vivo penetration depth but has small excitation energy, and is within the maximum permissible exposure, in photoacoustic tomography (PAT) diagnosis of a living body. | 08-05-2010 |
20100202966 | Implantable Sensor - Apparatus is provided for detecting a concentration of an analyte in a subject. The apparatus includes a housing ( | 08-12-2010 |
20100202967 | FIBRIN BINDING PEPETIDE CONJUGATES FOR DIAGNOSTIC AND THERAPEUTIC APPLICATIONS - The present invention relates to a novel class of diagnostically or therapeutically effective compounds comprising novel peptides able to bind fibrin, to a process for their preparation and to compositions thereof for use in therapy and diagnostics. The compounds of the invention bind, in particular, to fibrin present in the extracellular matrix (EC) of tumor or connective tissue of stroma thus acting as targeting moieties able to bring and successfully bound an active moiety linked thereto to fibrin depositions inside solid tumors. | 08-12-2010 |
20100202968 | Method of Providing Disease-Specific Binding Molecules and Targets - Provided are novel specific binding molecules, particularly human antibodies as well as fragments, derivatives and variants thereof that recognize neoepitopes of disease-associated proteins which derive from native endogenous proteins but are prevalent in the body of a patient in a variant form and/or out of their normal physiological context. In addition, pharmaceutical compositions comprising such binding molecules, antibodies and mimics thereof and methods of screening for novel binding molecules, which may or may not be antibodies as well as targets in the treatment of neurological disorders such as Alzheimer's disease are described. | 08-12-2010 |
20100202969 | NANOPARTICLES FOR IMAGING AND TREATING CHLAMYDIAL INFECTION - Compositions of nanoparticles and targeting moieties for imaging and treating Chlamydial infection are provided, including nanoparticles conjugated to folic acid and comprising at least one antibiotic effective against | 08-12-2010 |
20100202970 | INTRACELLULAR REPORTERS - The invention provides a variety of molecular tools for use in live-cell tracking of activities of biomolecules and in high-throughput drug screening. | 08-12-2010 |
20100202971 | COMPOUND HAVING TUMOR-RESIDENT PROPERTY - The problem to be solved of the present invention is to provide a novel compound which specifically resides in a tumor, a method for allowing it to reside in a tumor, and a method for detecting, diagnosing, and treating tumor with use thereof. Means for solving the problem is a compound represented by chemical formula (I) | 08-12-2010 |
20100209346 | AMYLOID BETA(1-42) OLIGOMERS, DERIVATIVES THEREOF AND ANTIBODIES THERETO, METHODS OF PREPARATION THEREOF AND USE THEREOF - The invention relates to neuromodulatory oligomers of the amyloid β(1-42) protein, a particular production method, by means of which the oligomer can be obtained in a reproducible manner at high yield, the use of the oligomers and diagnostic and therapeutic agents, for the generation of oligomer-specific antibodies and for the discovery of substances which can interact with the oligomers and in the formation thereof. | 08-19-2010 |
20100209347 | CYCLODEXTRIN COMPOUND MODIFIED WITH FOLIC ACID, PROCESS FOR PRODUCTION THEREOF, DRUG DELIVERY AGENT FOR TARGETING DRUG DELIVERY SYSTEM, PHARMACEUTICAL COMPOSITION, AND IMAGING AGENT - Disclosed is a cyclodextrin compound comprising glucopyranoses constituting cyclodextrin, the glucopyranoses having substituents each having folic acid substituted for two or more primary hydroxy groups at position-6 of the glucopyranoses. | 08-19-2010 |
20100215580 | Compositions and methods for enhancing transport through mucus - The invention generally relates to compositions and methods for transporting substances across mucosal barriers. The invention also relates to methods of making and using such substances. | 08-26-2010 |
20100215581 | CONTRAST AGENTS FOR DETECTING PROSTATE CANCER - The invention relates to contrast agents for diagnosing prostate cancer in a human or animal being. These contrast agents are compounds comprising a targeting module that is capable of interacting with a prostate cancer-specific molecular marker and a detectable unit. The invention also concerns the use of such compounds for diagnosing prostate cancer in a human or animal being. | 08-26-2010 |
20100215582 | LIPOSOME AND METHOD FOR PRODUCING LIPOSOME - It is intended to provide a liposome preparation which is a liposome, has a lipid bilayer membrane composed of an inner membrane constituted by a lipid including one or more types of functional lipids (a lipid capable of chemically interacting with another compound such as a charged lipid, a polarizable lipid, a lipid-soluble lipid or a water-soluble lipid) and an outer membrane constituted by a lipid with or without including one or more types of functional lipids, and is characterized in that at least a condition that the amount of any one type of functional lipid contained in the inner membrane is larger than in the outer membrane is satisfied. The liposome preparation is suitable as a liposome for encapsulating a contrast agent (a neutral substance having a hydroxy group), siRNA (an anionic substance) having an anticancer activity or the like. Its encapsulation ratio of drug agents, dispersion stability, control release and the like have been improved. | 08-26-2010 |
20100215583 | CELL NUCLEUS-ENTERING COMPOSITIONS - A pharmaceutically acceptable composition and method for entering a cell nucleus utilizes a cell nucleus-entering polypeptide including at least one of amino acid sequence LKKTET (SEQ ID NO: 1), amino acid sequence LKKTNT (SEQ ID NO: 2) or amino acid sequence KSKLKK (SEQ ID NO: 3), or a conservative variant thereof, linked to a physiologically active agent having at least one of therapeutic or diagnostic application in the cell nucleus. | 08-26-2010 |
20100221183 | PEPTIDES FOR TREATING AND DIAGNOSING CANCERS AND METHODS FOR USING THE SAME - Disclosed are peptides, polypeptides, antibodies, small molecules, and methods for their use for imaging a neoplasm and for treating cancer in a mammal. The methods include administering one or more of the agents of the invention to a mammal, e.g., a human; the peptides, polypeptides, antibodies, and small molecules, which specifically bind to neoplastic cells, can be labeled with a radioactive label or a therapeutic label, e.g., a cytotoxic agent. | 09-02-2010 |
20100221184 | Compositions for Delivery of Therapeutics and Other Materials - This disclosure relates to compositions for delivering agents to a subject, and in particular, to compositions for delivery of therapeutic agents or diagnostic agents in the presence or absence of targeting moieties. In part, this disclosure relates to compositions comprising a hydrophobic group with a first end and a second end, a first metal binding domain linked to the hydrophobic group, a metal ion capable of being chelated to the first metal binding domain, and an agent linked to a second metal binding domain capable of chelating to the metal ion. | 09-02-2010 |
20100221185 | VACCINES AND VACCINE COMPONENTS FOR INHIBITION OF MICROBIAL CELLS - The invention encompasses components from microbial cells which are useful for antibody production, including peptides, polypeptides comprising these peptides, polynucleotides which encode these peptides or polypeptides, and antibodies directed to these peptides, polypeptides, or polynucleotides. The invention also encompasses to expression vectors and host cells for producing these peptides, polypeptides, polynucleotides, and antibodies. The invention further encompasses methods and compositions, especially vaccine compositions, for detecting, targeting, and inhibiting microbial cells, especially methanogen cells, using one or more of the disclosed peptides, polypeptides, polynucleotides, antibodies, expression vectors, and host cells. | 09-02-2010 |
20100226855 | Rate-Controlled Oral Dosage Formulations - The present invention relates to a drug delivery system, in which a drug containing core, either alone or coated with a rate controlling membrane system, is enveloped on its circumference by an optionally bioadhesive coating, thereby yielding a monolithic system that allows for drug release in a regulated manner. | 09-09-2010 |
20100226856 | DYNAMIC BIO-NANOPARTICLE ELEMENTS - The invention in suitable embodiments is directed to dynamic bio-nanoparticle elements and bio-nanoparticle platforms employing such bio-nanoparticle elements. In one aspect, one or more elements of one or more types, formed from isolated, synthetic and or recombinant amino acid residues comprising in whole or in part one or more types of Clathrin and or Coatomer I/II proteins of one or more isoforms, execute one or more functions and or effect one or more ends, in vivo and or in vitro. | 09-09-2010 |
20100233083 | MICROPARTICLES COMPRISING A CROSSLINKED POLYMER - The present invention relates to a microparticle comprising a crosslinked polymer, which polymer is composed of a crosslinkable compound represented by the formula (I) wherein—X is a residue of a multifunctional radically polymerisable compound (having at least a functionality equal to n);—each Y independently is optionally present, and—if present—each Y independently represents a moiety selected from the group of O, S and NR | 09-16-2010 |
20100233084 | Method for Delivery Across the Blood Brain Barrier - The present invention provides compositions and methods useful for delivering agents to target cells or tissues, for example nerve cells and other cells in the central nervous system. The compositions and methods are useful for delivering agents across the blood-brain barrier. The present invention also provides methods of using the compositions provided by the present invention to deliver agents, for example therapeutic agents for the treatment of neurologically related disorders. | 09-16-2010 |
20100233085 | IONIC COMPLEX NANOPARTICLES FOR DETECTING HEPARANASE ACTIVITIES AND METHOD FOR PREPARING THE SAME - Disclosed are Ionic complex nanoparticles for detecting heparanase activities and a method for preparing the same. More specifically, disclosed are Ionic complex nanoparticles for detecting heparanase activities, wherein negative-ion substrate polymers specifically degraded by heparanase and positive-ion biocompatible polymers ionically bind to each other, and fluorophores or quenchers bind to each of the polymers. The ionic complex nanoparticles for detecting heparanase activities may be applied to a method for screening novel drugs such as inhibitors that prevent over-expression of heparanase. Various cells and tissues where over-expression of heparanase occurs may be non-invasively imaged in cancer cells, cancer tissues, and tissues of various inflammatory diseases. Accordingly, the ionic complex nanoparticles for detecting heparanase activities may be effectively used to early diagnose various diseases and incurable diseases including autoimmune diseases such as cancers, osteoarthritis, rheumatoid arthritis, and dementia. | 09-16-2010 |
20100233086 | COMPOUNDS FOR USE IN IMAGING, DIAGNOSING AND/OR TREATMENT OF DISEASES OF THE CENTRAL NERVOUS SYSTEM OR OF TUMORS - This invention relates to novel compounds suitable for labelling or already labelled by | 09-16-2010 |
20100239498 | METHOD OF MAINTAINING THE FUNCTION OF LIVER TISSUE CELLS OVER LONG TIME - The function of liver tissue cells can be maintained over a long period of time by culturing the liver tissue cells on a cell culture support, which is coated with a polymer showing a change in the hydration force in the temperature range of from 0 to 80° C., within the temperature range wherein the polymer has a small hydration force, then changing the temperature of the liquid culture medium to a level at which the polymer shows a large hydration force, thus stripping off the liver tissue cells having been cultured, and transplanting the thus obtained liver tissue cells into a definite site in vivo. | 09-23-2010 |
20100247436 | In vivo photodynamic therapy of cancer via a near infrared agent encapsulated in calcium phosphate nanoparticles - Nano-encapsulated photosensitizers and their use in the treatment of tumors and/or imaging is described. Preferably, the photosensitizers are encapsulated in a calcium phosphate nanoparticle (CPNP). Encapsulating the PS in a CPNP increases the half-life of the PS, increases absorption of the PS into the target cell tissue, increases the photostability of the PS, increases the photoefficiency of the PS, increases in vivo retention of the PS, or combinations thereof, ultimately making it a highly efficacious agent for use in photodynamic therapy, imaging target tissues, vessels, or tumors, and/or detecting or locating tumors. | 09-30-2010 |
20100247437 | MATERIALS AND METHODS FOR THE DELIVERY OF BIOMOLECULES TO CELLS OF AN ORGAN - The present invention is directed towards materials and methods of delivering biomolecules to cells that define an organ, and the organ being in situ, and electroporating cells defining the organ by delivering to the cells an amount of energy effective to electroporate the cells. The present invention is also directed towards materials and methods of expressing heterologous polypeptides in organs of a subject and electroporating cells defining the organ by delivering to the cells an amount of energy effective to electroporate the cells. | 09-30-2010 |
20100247438 | IN VITRO METHOD FOR DIAGNOSING TUMOR DISEASES - An in vitro method is for diagnosing a tumor disease in a patient. In at least one embodiment, the method includes: (i) determining an IVD marker or an IVD marker panel in at least one biological sample of a patient, wherein the IVD marker has a high sensitivity to the tumor disease, (ii) determining the proportion of patients tested positive due to an adapted reference range of the IVD marker/IVD marker panel, wherein the reference range was adapted such that the number of individuals with false negative tests, the number of individuals with false positive tests and the number of individuals ultimately needing to be subjected to imaging diagnostics to clarify false negative and false positive results are balanced in respect of one another such that tumor screening can be carried out, possibly: (iii) deciding to carry out an imaging method specific to the respective tumor disease for clarifying possible false negative and/or false positive IVD results, or (iv) repeating stages (i) and (ii) after a defined time interval, or (v) carrying out an imaging method for imaging the tumor. | 09-30-2010 |
20100247439 | DENDRITIC NANO-ANTIOXIDANTS - Provided are dendritic nano-antioxidant compounds according to Formula I, which may further comprise active agents covalently or non-covalently attached. Further provided are compositions comprising the disclosed compounds. Also disclosed are cosmetic compositions and dietary supplements comprising the compounds according to Formula I. The invention additionally provides methods of reducing free radicals or oxidative stress in a cell, a method of treating a subject, and a method of treating a condition comprising administering the compounds according to Formula I. | 09-30-2010 |
20100254904 | Novel therapeutic delivery systems - Targeted therapeutic delivery systems comprising gas- or gaseous precursor-filled lipid microspheres comprising a therapeutic are described. Methods for employing such microspheres in therapeutic delivery applications are also provided. | 10-07-2010 |
20100254905 | INHIBITORS OF BRUTON'S TYROSINE KINASE - Described herein are irreversible kinase inhibitor compounds, methods for synthesizing such irreversible inhibitors, and methods for using such irreversible inhibitors in the treatment of diseases. Further described herein are methods, assays and systems for determining an appropriate irreversible inhibitor of a protein, including a kinase. | 10-07-2010 |
20100254906 | NEW COMPOSITIONS BASED ON POLYSACCHARIDES GRAFTED BY POLYAMINE OR POLYSULPHURISED COMPOUNDS - New pharmaceutical compositions based on grafted polysaccharides and methods of preparing such compositions are provided. Methods of using the compositions in medical imaging—for example in scintigraphy and in internal radiotherapy—are also provided. | 10-07-2010 |
20100260675 | Oxytocin Receptor Antagonists and Their Use for the Treatment of Pulmonary Related Diseases - Methods of treating disorders related to Oxytocin Receptor activity utilize OXYTOCIN RECEPTOR antagonists, such as antibodies, including specified portions or variants, polypeptides, polynucleotides, small molecule drugs, siRNA, shRNA, and DNAzymes. Disorders related to Oxytocin Receptor activity include inflammatory disorders, such as pulmonary disorders, for example, asthma, emphysema, and COPD. | 10-14-2010 |
20100260676 | PRECISION-GUIDED NANOPARTICLE SYSTEMS FOR DRUG DELIVERY - A method of preparing multifunctionalized nanoparticles involves using a modular system of half-linkers to attach functional moieties that serve to deliver the nanoparticles to a desired target, exert an effect at the target, or track the nanoparticles within a cell or an animal. The modular chemistry of the half-linker system permits the custom design and synthesis of functionalized nanoparticles bearing multiple groups and therefore results in precise delivery to desired cell types and intracellular locations. The functionalized nanoparticles can be used to treat or diagnose a variety of medical conditions, including neoplastic diseases, infectious diseases, and chronic diseases. | 10-14-2010 |
20100260677 | METHODS AND SYSTEMS FOR TREATMENT AND/OR DIAGNOSIS - The invention relates to methods and systems that can be used for treatment and/or diagnosis. In one aspect, the present invention involves systems and methods for activating a biological cascade in a subject, and administering, to the subject, a composition or a component comprising an agent able to bind a product of a biological cascade or otherwise interact with the biological cascade. The biological cascade may be, for example, a coagulation cascade, a complement cascade, an inflammation cascade, or the like. In some cases, the concentration of a protein, the metabolic demand for a substrate, or the like may be increased as a result of activation of the biological cascade. As a specific non-limiting example, in one set of embodiments, the biological cascade may be a coagulation cascade and the composition administered to the subject may include a fibrin-binding peptide and an antitumor species. By activating the biological cascade, e.g., with an activation composition or by applying energy, coagulation may be induced in a tumor, which the antitumor species may associate with due to an increase in fibrin caused by the coagulation cascade. In addition, in certain aspects, the present invention involves systems and methods for changing tissue from a first state to a second state, for instance, with a first composition comprising nanoparticles. The second composition may be more responsive to the tissue in the second state than in the first state in some cases. In still other aspects, the present invention is generally directed to systems and methods for making such compositions, systems and methods for promoting such compositions, kits involving such compositions, or the like. | 10-14-2010 |
20100260678 | ANTI-IGF-I RECEPTOR ANTIBODIES - Antibodies, humanized antibodies, resurfaced antibodies, antibody fragments, derivatized antibodies, and conjugates of these molecules with cytotoxic agents, which specifically bind to and inhibit insulin-like growth factor-I receptor, antagonize the effects of IGF-I and are substantially devoid of agonist activity toward the insulin-like growth factor-I receptor. These molecules can be conjugated to cytotoxic agents for use in the treatment of tumors that express elevated levels of IGF-I receptor, such as breast cancer, colon cancer, lung cancer, ovarian carcinoma, synovial sarcoma, prostate cancer and pancreatic cancer. These molecules can also be labeled for in vitro and in vivo diagnostic uses, such as in the diagnosis and imaging of tumors that express elevated levels of IGF-I receptor. | 10-14-2010 |
20100260679 | METHOD AND APPARATUS FOR DETECTING AND REGULATING VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) BY FORMING A HOMEOSTATIC LOOP EMPLOYING A HALF-ANTIBODY BIOSENSOR - A biosensor for detection of vascular endothelial growth factor (VEGF) hybridization uses an array of parallel capacitors to detect electrochemical binding of circulating VEGF to immobilized anti-VEGF monoclonal half-antibodies (a-VEGF mhAb). Binding of a-VEGF mhAb modulates the threshold voltage of a circuit, changing the impedance of the circuit. An electrode coated with a p-Si substrate enhances the affinity between the VEGF molecules. A fluid cell delivers VEGF samples onto the active surface of the chip. An array of parallel capacitors arranged in an interdigitated pattern detects the VEGF in the fluid. The detector provides an accurately measured and quantifiable rate of change of the VEGF molecules in vivo, providing real time feedback which is used to measure response of the tumor to delivered chemotherapeutic agents and biological response modifiers (BRMs) for the purpose of determining tumor burden and efficacy of the chemotherapy as part of a homeostatic loop for chemotherapy. | 10-14-2010 |
20100266501 | METHODS AND COMPOSITIONS FOR ORGAN PROTECTION - The invention relates in some aspects to compositions that include a contrast agent and an antioxidant compound and the use of such compositions to prevent (e.g., reduce) organ damage in a subject. In some aspects, the invention relates to compositions that include N— acetylcysteine (NAC) and a contrast agent and the use of such compositions for preventing organ damage in a subject. Methods of preventing organ damage may include the simultaneous administration of a composition of the invention, such that a contrast agent and an antioxidant compound or a contrast agent and NAC are administered intravascularly to a subject. Examples of organ damage that may be treated with compositions and methods of the invention include contrast-induced and non-contrast induced organ damage associated with myocardial ischemia, myocardial infarction, reperfusion damage, nephropathy, etc. The invention, in some aspects, also includes kits that may include a contrast agent and NAC and/or an antioxidant compound. | 10-21-2010 |
20100266502 | Pharmaceutical composition comprising anti-HB-EGF antibody as active ingredient - An anti-HB-EGF antibody having an internalizing activity is disclosed. A cytotoxic substance is preferably bound to the anti-HB-EGF antibody of the present invention. Also provided are an anti-cancer agent and a cell proliferation inhibitor, which comprise the antibody of the present invention as an active ingredient, a method of treating cancer and a method of diagnosing cancer, which comprise the administration of the antibody of the present invention. Cancers that can be treated by the anti-cancer agent of the present invention include pancreatic cancer, liver cancer, esophageal cancer, melanoma, colorectal cancer, gastric cancer, ovarian cancer, uterine cervical cancer, breast cancer, bladder cancer, brain tumors, and hematological cancers. | 10-21-2010 |
20100278733 | COMPOSITION FOR DIAGNOSIS OF AMYLOID-RELATED DISEASE - There is provided a composition comprising a compound represented by general formula (I), wherein R | 11-04-2010 |
20100278734 | NANOPARTICLE CONTRAST AGENTS FOR DIAGNOSTIC IMAGING - Compositions of nanoparticles functionalized with at least one net positively charged group and at least one net negatively charged group, methods for making a plurality of nanoparticles, and methods of their use as diagnostic agents are provided. The nanoparticles have characteristics that result in minimal retention of the particles in the body compared to other nanoparticles. The nanoparticle comprises a core and a shell. The shell comprises a plurality of silane moieties; at least one silane moiety of the plurality is functionalized with a net positively charged group and at least one silane moiety of the plurality is functionalized with a net negatively charged group. | 11-04-2010 |
20100278735 | METHODS FOR DETECTION OF VULNERABLE PLAQUE WITH QUANTITATIVE COLORIMETRY DURING ANGEOSCOPY - Methods are provided for detecting lipid cores underneath thin fibrous caps (LCTC) and thin-cap fibroatheromas (TCFA) in a subject in need of diagnosis for having a vulnerable plaque, a plaque at risk of disruption or thrombosis, or risk of an acute coronary syndrome, and for screening compounds for modulators of this process. | 11-04-2010 |
20100278736 | FLT4 (VEGFR-3) as a Target for Tumor Imaging and Anti-Tumor Therapy - The present invention provide purified Flt4 receptor tyrosine kinase polypeptides and fragments thereof, polynucleotides encoding such polypeptides, antibodies that specifically bind such polypeptides, and uses therefor. | 11-04-2010 |
20100278737 | ORGANIC-INORGANIC HYBRID PARTICLES CONTAINING CONTRAST AGENT - This invention provides organic-inorganic hybrid particles containing as the essential components a block copolymer comprising an uncharged hydrophilic polymer chain segment and a polymer chain segment containing a repeated structural unit having a carboxylate ion group at its side chain; calcium ion (Ca | 11-04-2010 |
20100278738 | METHOD TO DETECT AND MONITOR ISCHEMIA IN TRANSPLANTED ORGANS AND TISSUES - Disclosed is a method of detecting and/or monitoring ischemia in a tissue or organ, such as a free flap transfer. The method includes the steps of measuring in real time or near-real time interstitial glucose concentration, or rate of change of interstitial glucose concentration over time, or both, in the tissue or organ. A reduced glucose concentration or a negative rate of change of glucose concentration in the tissue or organ as compared to a control glucose concentration or rate of change indicates ischemia in the tissue or organ. | 11-04-2010 |
20100278739 | TARGETED, NIR IMAGING AGENTS FOR THERAPY EFFICACY MONITORING, DEEP TISSUE DISEASE DEMARCATION AND DEEP TISSUE IMAGING - Compounds and methods related to NIR molecular imaging, in-vitro and in-vivo functional imaging, therapy/efficacy monitoring, and cancer and metastatic activity imaging. Compounds and methods demonstrated pertain to the field of peripheral benzodiazepine receptor imaging, metabolic imaging, cellular respiration imaging, cellular proliferation imaging as targeted agents that incorporate signaling agents. | 11-04-2010 |
20100284915 | GENES ASSOCIATED WITH CHEMOTHERAPY RESPONSE AND USES THEREOF - The invention provides molecular markers that are associated with responsiveness of a cancer patient to a chemotherapy treatment, and methods and computer systems for determining such responsiveness based on measurements of these molecular markers. The present invention also provides methods and compositions for enhancing the efficacy of chemotherapies in patients by modulating the expression or activity of genes encoding these molecular markers and/or their encoded proteins. | 11-11-2010 |
20100284916 | Antibodies Against Human Cytomegalovirus (HCMV) - The present invention provides novel antibody sequences that bind human cytomegalovirus (hCMV) and neutralize hCMV infection. The novel sequences can be used for the medical management of hCMV infections, in particular for preparing pharmaceutical compositions to be used in the prophylactic or therapeutic treatment of hCMV infections. | 11-11-2010 |
20100284917 | COMPOUNDS AND MARKERS FOR SURFACE-ENHANCED RAMAN SCATTERING - The present invention relates to compounds and markers for surface-enhanced Raman scattering (SERS), and methods for the preparation of the SERS markers. The present invention further relates to compositions, methods and uses, wherein the present SERS markers are employed. | 11-11-2010 |
20100284918 | PROTEIN - The present invention provides methods and compositions for treatment, screening, diagnosis and prognosis of breast cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, lung cancer and pancreatic cancer, for monitoring the effectiveness of breast cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, lung cancer and pancreatic cancer treatment, and for drug development. | 11-11-2010 |
20100284919 | Injectable Radio-Opaque Compositions for Tissue Augmentation - Injectable radio-opaque compositions for tissue augmentation and in particular hard tissue augmentation, and kits and methods of using thereof are described herein. The injectable compositions form porous, biologically degradable, fibrin matrices. The compositions are formed from fibrinogen, thrombin or another agent that causes the fibrinogen to crosslink, and strontium salts. Optionally an iodinated contrast agent is further incorporated in the composition. In certain aspects, the compositions have substantially no exothermicity when forming the matrix and the resulting matrices exhibit mechanical properties typically seen in elastomers. Adequate radio-opacity is achieved through the incorporation of strontium salts in combination or not with iodinated contrast agents. | 11-11-2010 |
20100284920 | USES OF MONOCLONAL ANTIBODY 8H9 - This invention provides a composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a suitable carrier. This invention provides a pharmaceutical composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a pharmaceutically acceptable carrier. This invention also provides an antibody other than the monoclonal antibody 8H9 comprising the complementary determining regions of monoclonal antibody 8H9 or a derivative thereof, capable of binding to the same antigen as the monoclonal antibody 8H9. This invention provides a substance capable of competitively inhibiting the binding of monoclonal antibody 8H9. This invention also provides an isolated scFv of monoclonal antibody 8H9 or a derivative thereof. This invention also provides the 8H9 antigen. This invention also provides different uses of the monoclonal antibody 8H9 or its derivative. | 11-11-2010 |
20100284921 | TARGETED NANOPARTICLES FOR INTRACELLULAR CANCER THERAPY - This invention provides constructs comprising a targeting member immobilized on a detectable particulate, in which binding of the targeting member to a target structure on a surface of a cancer cell triggers internalization of the construct. Such constructs can be used to identify or monitor cancer cells in cell cultures or in a tissue. Such construct can also be used to kill or prevent growth of cancer cells in vivo. Also included in the invention are methods for killing or preventing growth of cancer cells in vivo. | 11-11-2010 |
20100284922 | MARKER - The invention relates to the use of a cell death marker labelled with a wavelength-optimised label for identifying cell death in the eye. Suitable cell death markers are the Annexins and fragments and derivatives thereof. The invention also relates to a pharmaceutical composition comprising a cell death marker labelled with a wavelength-optimised label and a method for monitoring cell death in the eye using a cell death marker labelled with a wavelength-optimised label. | 11-11-2010 |
20100284923 | METHODS OF DIAGNOSING LATENT AND ACTIVE MALIGNANCIES - Disclosed are procedures and methods for diagnosing latent and active cancers in a subject. The described methods include the use of sandwich ELISA assays containing antibodies specific for certain epitopes on the A-protein. This enables the assay to discriminate between the monomelic and homopolymeric forms of A-protein. | 11-11-2010 |
20100284924 | NANO-DEVICES HAVING IMPELLERS FOR CAPTURE AND RELEASE OF MOLECULES - A nanodevice has a containment vessel defining a storage chamber therein and defining at least one port to provide transfer of molecules to or from the storage chamber, and a plurality of impellers attached to the containment vessel. The plurality of impellers are of a structure and are arranged to substantially block molecules from entering and exiting the storage chamber of the containment vessel when the impellers are static and are operable to impart motion to the molecules to cause the molecules to at least one of enter into or exit from the storage chamber of the containment vessel. | 11-11-2010 |
20100290992 | NANOPARTICLE NUCLEIC ACID BINDING COMPOUND CONJUGATES FORMING I-MOTIFS - The present invention concerns the field of nanoparticle bioconjugates which form an i-motif or an i-motif related structure (compositions) without or with at least one further nucleic acid binding compound. The i-motif base pairs can be charged or non-charged. Their assembly can be controlled by the pH value or temperature. At least one of these nucleic acid binding compounds has to be attached at least to a nanoparticle. The methods provide compositions used for DNA driven programmable nanoparticle assemblies, electronic circuits, diagnostic detection tools, biosensors, memory storage devices, diagnostic devices for biomolecule sequencing and detection, drug delivery, application in tumour diagnostics and treatment, nanomachines, nanofabrication, nanocatalysis, nanoarrays, and nanoscaled enzyme reactors. | 11-18-2010 |
20100290993 | Antibodies to IL-6 and use thereof - The present invention is directed to antibodies and fragments thereof having binding specificity for IL-6. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the V | 11-18-2010 |
20100290994 | O-Methylated Rapamycin Derivatives For Alleviation And Inhibition Of Lymphoproliferative Disorders - The present invention relates to methods of alleviating and inhibiting a lymphoproliferative disorder in a mammal, the method comprising administering one or more rapamycin derivatives (including rapamycin) to the mammal. Further, the invention provides a method for identifying agents which are useful for alleviating and inhibiting a lymphoproliferative disorders, as well as a method for identifying agents which are capable of inhibiting metastasis of lymphatic tumors in a mammal. | 11-18-2010 |
20100290995 | RADIO-OPAQUE COMPOUNDS, COMPOSITIONS CONTAINING SAME AND METHODS OF THEIR SYNTHESIS AND USE - Radio-opaque biodegradable compositions are formed by modifying terminal groups of synthetic and natural biodegradable polymers such as polylactones with iodinated moieties. The biodegradable property of the compositions renders them suitable for use in medical field such as drug delivery, imaging. Compounds disclosed in this invention exist as neat liquid. Certain compositions disclosed in this invention form hydrophobic iodine rich domains when dissolved in water, such domains provide better contrasting properties as well as ability to dissolve hydrophobic bioactive drugs. Certain iodinated moieties disclosed in the invention are capable of cross linking natural proteins in situ in presence of suitable catalysts and co-catalysts. | 11-18-2010 |
20100297008 | GANGLIOSIDE ASSOCIATED RECOMBINANT ANTIBODIES AND THE USE THEREOF IN THE DIAGNOSIS AND TREATMENT OF TUMORS - The present invention is related with the obtaining of modified antibodies by means of the DNA recombinant technology from the murine monoclonal antibody P3 (MAb P3) produced by the hybridoma cell line deposited under Budapest Treaty with accession number ECACC 94113026 and from its anti-idiotype murine monoclonal antibody 1E10 (MAbai 1E10) produced by the hybridoma cell line with deposit number ECACC 97112901, with the objective of achieving monoclonal antibodies which preserve the biological function of specific binding to the antigen of the original antibodies, but being at the same time less immunogenic. The chimeric antibodies of the invention contain the variable domains of the murine immunoglobulin and the constant regions of the human immunoglobulin; and those humanized, besides containing the constant regions of the human immunoglobulins, they are modified in the region of the murine frameworks (FRs) and in particular in those zones that could be in an antigenic site for the T cells, so several positions of the FRS are human as well. These antibodies can be used in the diagnosis and therapy of different types of tumors. The present invention is also related with use of the antibodies for therapeutical and diagnostic purposes. | 11-25-2010 |
20100297009 | SELF-ASSEMBLED POLYHEDRAL MULTIMERIC CHEMICAL STRUCTURES - Self-assembled, closed and hollow chemical multimer structures having a dodecahedral morphology, composed of chemical monomers having a structurally symmetric core which possess a 5-fold rotational symmetry, are provided. Also provided are methods of creating such chemical monomers, methods of creating such chemical multimer structures and compositions comprising these chemical multimer structures. Also provided are uses of these chemical multimer structures in applications such as drug delivery, imaging, immunization, formation of plastic crystals and nanoparticle matrices and other medical and material science applications. | 11-25-2010 |
20100297010 | TUMOR SUPPRESSOR GENE SCREENING USING RNA INTERFERENCE LIBRARIES AND METHOD OF TREATMENT - The present invention is directed to methods of identifying tumor suppressor genes in vivo, tumor suppressors thus found, methods of treatment taking advantage of the identified tumor suppressors, methods of and kits for diagnosis of cancer using the identified tumor suppressor, and pharmaceutical composition comprising an identified tumor suppressor or modulators thereof. | 11-25-2010 |
20100297011 | ISOLATED PEPTIDES AND USES THEREOF - The present invention provides isolated preproinsulin-derived peptides of 8 or 9 amino acids, comprising the amino acid sequence WGPDPAA (SEQ ID NO: 1), isolated Class I peptide-HLA complexes presenting said peptides and isolated molecules having binding affinity for said peptides and/or said peptide-HLA complexes. Such compositions are useful in the treatment of Type 1 diabetes mellitus (T1DM). | 11-25-2010 |
20100297012 | HUMANIZED ANTIBODY - The present invention provides novel methods and compositions comprising highly specific and highly effective antibodies that specifically recognize and bind to specific epitopes from a range of β-amyloid proteins. The antibodies of the present invention are particularly useful for the treatment of ocular diseases associated with pathological abnormalities/changes in the tissues of the visual system, particularly associated with amyloid-beta-related pathological abnormalities/changes in the tissues of the visual system. | 11-25-2010 |
20100297013 | HUMANIZED ANTIBODY - The present invention provides novel methods and compositions comprising highly specific and highly effective antibodies that specifically recognize and bind to specific epitopes from a range of β-amyloid proteins. The antibodies of the present invention are particularly useful for the treatment of ocular diseases associated with pathological abnormalities/changes in the tissues of the visual system, particularly associated with amyloid-beta-related pathological abnormalities/changes in the tissues of the visual system. | 11-25-2010 |
20100297014 | METHOD OF DETECTING THE RISK OF CANCER USING GENETIC MARKERS - An ex vivo method for the detection of the risk of cancer in a patient, comprising the step of:
| 11-25-2010 |
20100297015 | CANCER BIOMARKER AND USES THEREOF - A method of determining the cancer status of a subject, comprising the steps of (a) providing a sample of material obtained from a subject; (b) determining the level GTPCH in the sample; and (c) comparing the level determined in (b) with one or more reference values. | 11-25-2010 |
20100297016 | QUARTERNARY NITROGEN HETEROCYCLIC COMPOUNDS FOR DETECTING AQUEOUS MONOSACCHARIDES IN PHYSIOLOGICAL FLUIDS - Quaternary nitrogen heterocyclic boronic acid-containing compounds are described, which are sensitive to glucose and fructose, as well as a variety of other physiologically important analytes, such as aqueous chloride and iodide, and a method of using the compounds. Also disclosed is a contact lens doped with the quaternary nitrogen heterocyclic boronic acid-containing compound, and a method of using the doped contact lens to measure the concentration of analyte in tears under physiological conditions. | 11-25-2010 |
20100297017 | Method for Synthesizing and Using Pegylated Peptide-Photoactive Chromophore Conjugates and Micellular Formulations Thereof - The invention relates to a PEGylated peptide-chromophore conjugate, which forms irregular micelles, for use in photodiagnostic and phototherapeutic applications. Methods for synthesizing and using the conjugates of the invention are also provided. | 11-25-2010 |
20100303721 | Use of Parasitic Biological Agents for Diseases Prevention and Control - The invention relates to a method of treating an excessive immune response including an aberrant/enhanced Th1 response by administering a helminthic parasite preparation in an amount sufficient to reduce the excessive immune response in an individual. This invention is generally directed to autoimmune diseases which involve an excessive immune response or an aberrant/enhanced Th1 response. More specifically, the present invention is directed to the treatment of Crohn's disease and ulcerative colitis, both known as IBD. While the present invention discloses specific information about the treatment of IBD, the disclosure is in no way limiting. Additionally, rheumatoid arthritis, type 1 diabetes mellitus, lupus erythematosis, sarcoidosis, multiple sclerosis, autoimmune thyroiditis, allergic rhinitis, colon polyps/colon cancer and asthma can be treated by the methods and compositions disclosed therein. | 12-02-2010 |
20100303722 | ARTICLES COMPRISING LARGE-SURFACE-AREA BIO-COMPATIBLE MATERIALS AND METHODS FOR MAKING AND USING THEM - The present invention provides articles of manufacture comprising biocompatible nanostructures comprising significantly increased surface area for, e.g., organ, tissue and/or cell growth, e.g., for bone, tooth, kidney or liver growth, and uses thereof, e.g., for in vitro testing of drugs, chemicals or toxins, or as in vivo implants, including their use in making and using artificial tissues and organs, and related, diagnostic, screening, research and development and therapeutic uses, e.g., as drug delivery devices. The present invention provides biocompatible nanostructures with significantly increased surface area, such as with nanotube and nanopore array on the surface of metallic, ceramic, or polymer materials for enhanced cell and bone growth, for in vitro and in vivo testing, cleansing reaction, implants and therapeutics. The present invention provides optically transparent or translucent cell-culturing substrates. The present invention provides biocompatible and cell-growth-enhancing culture substrates comprising elastically compliant protruding nanostructure substrates coated with Ti, TiO | 12-02-2010 |
20100303723 | DRUG DELIVERY SYSTEMS USING FC FRAGMENTS - The present invention provides drug delivery systems comprising FcRn binding partners (e.g., FcRn binding partner, Fc fragment) associated with a particle or an agent to be delivered. Inventive drug delivery systems allow for binding to the FcRn receptor and transcytosis into and/or through a cell or cell layer. Inventive systems are useful for delivering therapeutic agents across the endothelium of blood vessels or the epithelium of an organ. | 12-02-2010 |
20100303724 | Polypeptides, Cyclic Polypeptides and Pharmaceutical Comprising Thereof for Non Invasive Specific Imaging of Fibrosis - The present invention relates to diagnostic imaging and in particular to the diagnostic imaging of fibrosis. More particularly, the present invention provides a polypeptides, cyclic polypeptides and pharmaceutical compositions suitable for the non-invasive visualization of fibrosis. The polypeptide of the invention may comprise an amino acid sequence consisting of: X1-X2-M-H-G-L-X7-L-X9-X10-D-E wherein amino acid X1 is R, F or P; amino acid X2 is F or V; amino acid X7 is Q, H or L; amino acid X9 is W or G and amino acid X10 is A or D. | 12-02-2010 |
20100303725 | Technetium- and Rhenium-Bis(heteroaryl) Complexes, and Methods of Use Thereof - One aspect of the invention relates to complexes of a radionuclide with various heteroaryl ligands, e.g., imidazolyl and pyridyl ligands, and their use in radiopharmaceuticals for a variety of clinical diagnostic and therapeutic applications. Another aspect of the invention relates to imidazolyl and pyridyl ligands that form a portion of the aforementioned complexes. Methods for the preparation of the radionuclide complexes are also described. Another aspect of the invention relates to imidazolyl and pyridyl ligands based on derivatized lysine, alanine and bis-amino acids for conjugation to small peptides by solid phase synthetic methods. Additionally, the invention relates to methods for imaging regions of a mammal using the complexes of the invention. | 12-02-2010 |
20100303726 | HUMANIZED COLLAGEN ANTIBODIES AND RELATED METHODS - The invention provides a grafted antibody, or functional fragment thereof, comprising one or more complementarity determining regions (CDRs) having at least one amino acid substitution in one or more CDRs of a heavy chain CDR, where the grafted antibody or functional fragment thereof has specific binding activity for a cryptic collagen epitope. The invention also provides methods of using an antibody having specific binding activity for a cryptic collagen epitope, including methods of inhibiting angiogenesis, tumor growth, and metastasis. | 12-02-2010 |
20100310458 | USE OF SOLUBLE CEACAM8 FOR DIAGNOSING, TREATING OR MONITORING DISEASES, AND A METHOD FOR SCREENING COMPOUNDS THAT PREVENT APOPTOSIS - The invention relates to new uses of soluble CEACAM6 or CEACAM8, or substances that are specific to soluble CEACAM8. Another object of the invention concerns the use of CEACAM1-specific and/or CEACAM6-specific compounds for apoptosis prevention in-vitro. The invention also relates to a method for screening compounds, which prevent apoptosis and a method for preventing apoptosis in human granulocytes. | 12-09-2010 |
20100310459 | Targeted Detection of Dysplasia In Barrett's Esophagus With A Novel Fluorescence-Labeled Polypeptide - The present invention is directed to compositions and methods for use in detecting dysplasia in Barrett's esophagus. | 12-09-2010 |
20100310460 | COMPOSITIONS AND METHODS FOR CHELATION THERAPY - The invention relates to compositions and methods of treatment using an iron chelator, an antioxidant, estrogen, and/or combinations thereof, optionally, linked to a nanoparticle, to treat a subject in need thereof. The compositions and methods may be used to restore or protect the normal functions of osteoblast and osteoclast by depleting iron and inhibiting oxidative damage. The compositions and methods may also be used to increase the bone formation rate in a subject. | 12-09-2010 |
20100310461 | BINDING OF PATHOLOGICAL FORMS OF PROTEINS USING CONJUGATED POLYELECTROLYTES - A method for treatment of a disease caused by aggregation of misfolded proteins including subjecting a body fluid of a patient to a separation of an aggregated misfolded protein which includes contacting both the misfolded and normal protein with a conjugated polyelectrolyte (CPE) and separating the CPE/protein complex from the other constituents of the sample. | 12-09-2010 |
20100310462 | BINDING OF PATHOLOGICAL FORMS OF PROTEINS USING CONJUGATED POLYELECTROLYTES - A method for separation of an aggregated misfolded protein from an environment including a non-aggregating normal form of the protein includes contacting both the misfolded and normal protein with a conjugated polyelectrolyte (CPE) and separating the CPE/protein complex from the other constituents of the sample. | 12-09-2010 |
20100310463 | Anti-EpCAM Antibodies - Disclosed are antibodies that bind to Epithelial Cell Adhesion Molecule (EpCAM) and display certain advantages over known antibodies which bind to EpCAM, for example, the antibodies of the invention show good affinity, good cross-reactivity profiles and excellent ADCC and CDCC activity. Antibodies comprising specific heavy and light chain CDRs are disclosed. The invention thus relates to these antibodies and all uses thereof, in particular in the treatment of cancer. The present invention thus provides new antibody-based compositions, methods and combined protocols for treating cancer. Advantageous immunoconjugate compositions and methods using the new anti-EpCAM antibodies are also provided. | 12-09-2010 |
20100310464 | Antibodies - The present invention provides antibodies which bind to an epitope in the extracellular domain of human CC chemokine receptor 4 (CCR4) and which are capable of inhibiting the binding of macrophage-derived chemokine (MDC) and/or thymus and activation regulated chemokine (TARC) to CCR4. Also provided are inter alia immunoconjugates and compositions comprising such antibodies and methods and uses involving such antibodies, particularly in the medical and diagnostic fields. | 12-09-2010 |
20100310465 | NANO-DEVICES HAVING RELEASABLE SEALS FOR CONTROLLED RELEASE OF MOLECULES - A nanodevice has a containment vessel defining a storage chamber therein and defining at least one port to provide access to and from said storage chamber, and a stopper assembly attached to the containment vessel. The stopper assembly has a blocking unit arranged proximate the at least one port and has a structure suitable to substantially prevent material after being loaded into the storage chamber from being released while the blocking unit is arranged in a blocking configuration. The stopper assembly is responsive to the presence of a predetermined stimulus such that the blocking unit is released in the presence of the predetermined stimulus to allow the material to be released from the storage chamber. The predetermined stimulus is a predetermined catalytic activity that is suitable to at least one of cleave, hydrolyze, oxidize, or reduce a portion of the stopper assembly, and the nanodevice has a maximum dimension of about 1 μm. | 12-09-2010 |
20100316568 | DIAGNOSTIC AGENT AND THERAPEUTIC AGENT FOR PANCREATIC CANCER - The present invention provides a novel diagnostic or therapeutic method for pancreatic cancer employing a blood marker. The present invention provides a diagnostic or therapeutic drug for pancreatic cancer containing an anti-AMIGO2 antibody. | 12-16-2010 |
20100316569 | NOVEL PEPTIDES - This invention relates to novel peptides, discovered by using phage display technique, that bind to VAP-1 (Vascular Adhesion Protein-1). The invention concerns also peptides useful as VAP-1 ligands. Such peptides constitute a portion of natural proteins that are present in the individual. The invention relates particularly to a peptide chain in the leukocyte surface protein, where said peptide chain is useful as a ligand for the VAP-1 molecule and thus facilitates the binding of leukocytes to the vascular endothelium. Furthermore, the invention relates to pharmaceutical and diagnostic compositions for targeting VAP-1 in vivo. | 12-16-2010 |
20100316570 | Protection of Virus from Immune Cell Uptake - The present invention relates to a viral particle. The viral particle has a radius of less than about 1 μm, and at least one peptide comprising at least a biologically active portion of CD47. The present invention also includes a method of increasing the life of a particle in vivo in a mammal. The method includes the steps of expressing at least one peptide comprising at least a biologically active portion of CD47 in a viral particle, and administering the viral particle having CD47 expressed to a mammal, wherein the administered viral particle has a longer half life in the mammal than an otherwise identical viral particle that does not have CD47 expressed thereon. | 12-16-2010 |
20100316571 | Method and Compositions for Polymer Nanocarriers Containing Therapeutic Molecules - A method of controlling a physical characteristic of polymeric nanocarrier-encapsulated protein particles includes altering or selecting a weight percentage of a hydrophobic polymer block in a total amphiphilic diblock copolymer of a primary emulsion of a double emulsion, freeze-thaw technique. The primary emulsion is formed using a freeze-thaw cycle of the amphiphilic diblock copolymer and a protein having a molecular weight of up to or equal to 300,000 Da. Selection of the hydrophobic polymer block percentage alters one or more characteristics of the resulting nanoparticles, such as shape. Thus, as one aspect, a method of producing filamentous polymeric nanocarrier-encapsulated protein (i.e., active enzyme) particles involves forming a primary emulsion using a freeze-thaw cycle of (i) an amphiphilic diblock copolymer, which has a molecular weight of about 10,000 to about 100,000 Da and comprises a conjugate of the hydrophobic polymer block and a hydrophilic polymer block, wherein the amphiphilic diblock copolymer comprises greater than 81% to about 95% by weight of the hydrophobic polymer block; and a protein having a molecular weight of up to or equal to about 300,000 Da. Various compositions comprising such filamentous-shaped nanocarrier particles, and methods of use for diagnosis and therapy are disclosed. | 12-16-2010 |
20100316572 | USE OF FSH RECEPTOR LIGANDS FOR DIAGNOSIS AND THERAPY OF CANCER - The present invention relates to diagnostic imaging and in particular to the diagnostic imaging and therapy of cancer by means of compositions which specifically target the FSH Receptor expressed by tumor endothelial cells and circulating blood cells. | 12-16-2010 |
20100322859 | ORAL DRUG COMPLIANCE MONITORING USING MAGNETIC-FIELD SENSORS - A method to measure compliance with a pharmaceutical regimen, by the steps of: (a) ingesting a dose of a medication ( | 12-23-2010 |
20100322860 | METHOD FOR DETERMINATION OF A POTENTIAL MUTATION - The invention is directed to a method for non-invasive determination of the potential presence of one or more loss-of-function mutation(s) in the gene encoding for filaggrin. | 12-23-2010 |
20100322861 | ENGINEERED CELLS, IMAGING REPORT GENE/PROBE SYSTEMS, AND METHODS OF IMAGING - Embodiments of the present disclosure provide: methods of imaging the location and survival of an engineered cell in a host (e.g., human) with an imaging reporter probe, methods of imaging the location and survival of an engineered cell in a host, and, kits, engineered cells, and methods of making the engineered cells, and the like. | 12-23-2010 |
20100322862 | METHODS AND COMPOSITIONS USING PEPTIDES AND PROTEINS WITH C-TERMINAL ELEMENTS - Disclosed are compositions and methods useful for targeting and internalizing molecules into cells of interest and for penetration by molecules of tissues of interest. The compositions and methods are based on peptide sequences that are selectively internalized by a cell, penetrate tissue, or both. The disclosed internalization and tissue penetration is useful for delivering therapeutic and detectable agents to cells and tissues of interest. | 12-23-2010 |
20100322863 | Methods and Uses of Anti-IL-23 Antibodies - An anti-IL-23p19 antibody, including isolated nucleic acids that encode at least one anti-IL-23p19 antibody, vectors, host cells, transgenic animals or plants, and methods of making and using thereof have applications in diagnostic and/or therapeutic compositions, methods and devices. | 12-23-2010 |
20100329980 | HUMANIZED ANTI-ALPHA 9 INTEGRIN ANTIBODIES AND THE USES THEREOF - The present invention provides humanized antibodies that immunospecifically recognize human α9 integrin. Some of these antibodies inhibit the biological functions of the α9 integrin, thereby exhibiting therapeutic effects on various disorders or diseases that are associated with α9 integrin, including cancer, e.g., the growth and metastasis of a cancer cell, and inflammatory diseases, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and so forth. | 12-30-2010 |
20100329981 | SIMPLIFIED AND IMPROVED METHOD FOR PREPARING AN ANTIBODY OR AN ANTIBODY FRAGMENT TARGETED IMMUNOLIPOSOME FOR SYSTEMIC ADMINISTRATION OF A THERAPEUTIC OR DIAGNOSTIC AGENT - A method of preparing an antibody- or antibody fragment-targeted cationic immunoliposome or polymer complex comprises the steps of (a) preparing an antibody or antibody fragment; (b) mixing said antibody or antibody fragment with a cationic liposome to form a cationic immunoliposome or with a cationic polymer to form a polyplex; and (c) mixing said cationic immunoliposome or said polyplex with a therapeutic or diagnostic agent to form said antibody- or antibody fragment-targeted cationic immunoliposome or polymer complex. | 12-30-2010 |
20100329982 | PARTICLES WITH INDUCIBLE CHANGE OF SHAPE - The invention relates to particles which exhibit a stimulable shape change and allow control of their uptake in active cells. The particles can be used as carrier systems for bioactive molecules or as diagnostic agents, and the spherical shape thereof has a size permitting uptake in a cell. Each particle assumes a temporary, non-spherical and thus non-uptakeable or only slightly uptakeable shape which can be transformed into a spherical and thus uptakeable shape by a suitable stimulus. | 12-30-2010 |
20100329983 | COMPOUNDS AND METHODS FOR THE DETECTION OF TRPV-6 CANCERS AND DRUG DELIVERY - Compounds containing TRPV6-binding peptides and their use in the detection and diagnosis of cancer are described. Also described are methods for detecting and staging cancer that use the compounds of the invention. Compounds containing TRPV6-binding peptides are useful for the delivery of diagnostic and therapeutic agents to cells or tumors that express TRPV6. | 12-30-2010 |
20100329984 | RESPIRATORY DISPERSION FOR METERED DOSE INHALERS - A respiratory dispersion for pulmonary delivery comprises one or more bioactive agents, a suspension medium, and a plurality of perforated microstructures having a mean aerodynamic diameter of less than 5 μm. The suspension medium comprises at least one propellant and permeates the perforated microstructures. | 12-30-2010 |
20110002851 | Cationic Colloidal Carriers for Delivery of Active Agents to the Blood-Brain Barrier in the Course of Neuroinflammatory Diseases - The present invention relates to the use of cationic colloidal compositions for the targeted delivery of an active compound to an inflammatory site or an activated vascular site for the preparation of a medicament for the treatment of MS and in general for all CNS or PNS inflammatory neurodegenerative and demyelinating diseases and for diagnostic applications of such compositions. | 01-06-2011 |
20110002852 | STEM CELLS FOR USE IN LOCATING AND TARGETING TUMOR CELLS - A composition for locating tumors, the composition includes stem cells. Stem cells for use in locating and treating tumors. A method of locating and treating a tumor by administering to a patient an effective amount of stem cells, wherein the stem cells locate and subsequently treat a tumor. | 01-06-2011 |
20110008255 | BETA-AMYLOID PET IMAGING AGENTS - Novel derivatives of imidazopyridinylbenzeneamines and novel derivatives of benzothiazolylbenzeneamines are disclosed that offer improved behavior when used as imaging agents for positron emission tomography of beta-amyloids. Also disclosed is a palladium-catalyzed reaction scheme under microwave conditions for aryl thioethers in general that provides a high ratio of substitution relative to reduction and can be used for the imidazopyridinylbenzeneamine derivatives as well as other compounds of related structure. | 01-13-2011 |
20110008256 | MONOCLONAL ANTIBODIES THAT BIND OR NEUTRALIZE DENGUE VIRUS - The present invention relates to monoclonal antibodies that bind or neutralize dengue type 1, 2, 3, and/or 4 virus. The invention provides such antibodies, fragments of such antibodies retaining dengue virus-binding ability, fully human or humanized antibodies retaining dengue virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 01-13-2011 |
20110008257 | INHIBITORS OF BRUTON'S TYROSINE KINASE - Disclosed herein are compounds that form covalent bonds with Bruton's tyrosine kinase (Btk). Also described are irreversible inhibitors of Btk. Methods for the preparation of the compounds are disclosed. Also disclosed are pharmaceutical compositions that include the compounds. Methods of using the Btk inhibitors are disclosed, alone or in combination with other therapeutic agents, for the treatment of autoimmune diseases or conditions, heteroimmune diseases or conditions, cancer, including lymphoma, and inflammatory diseases or conditions. | 01-13-2011 |
20110014122 | NOVEL ANTI-IGF-IR AND/OR ANTI-INSULIN/IGF-I HYBRID RECEPTORS ANTIBODIES AND USES THEREOF - The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor (IGF-IR) and/or the insulin/IGF-I hybrid receptor (hybrid-R) and/or capable of specifically inhibiting the tyrosine kinase activity of said IGF-IR and/or hybrid-R, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR and/or hybrid-R or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGF-IR and/or hybrid-R. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers. | 01-20-2011 |
20110014123 | RNA interference mediating small RNA molecules - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 01-20-2011 |
20110014124 | TARGETED ATHEROSCLEROSIS TREATMENT - This invention relates generally to methods for ameliorating at least one symptom or aspect of atherosclerosis. The methods include administration of targeted carrier compositions comprising a therapeutic agent effective in ameliorating at least one aspect of atherosclerosis coupled to a targeting ligand effective is targeting the therapeutic agent to tissue associated with atherosclerotic plaque. | 01-20-2011 |
20110014125 | PROTEASE ASSAY - The present invention provides a diagnostic reagent or assay for assessing the activity of a protease in vivo or in vitro and methods of detecting the presence of a cancerous or precancerous cell. The assays are comprised of two particles linked via an oligopeptide linkage that comprises a consensus sequence specific for the target protease. Cleavage of the sequence by the target protease can be detected visually or using various sensors, and the diagnostic results can be correlated with cancer prognosis. | 01-20-2011 |
20110020225 | POROUS POLYMER PARTICLES IMMOBILIZED WITH CHARGED MOLECULES AND METHOD FOR PREPARING THE SAME - The present invention relates to porous polymer particles containing a charged molecule immobilized therein and a method for preparing the same. According to the disclosed invention, porous particles can be prepared using a biocompatible polymer and, at the same time, a charged molecule can be immobilized in the pores of the porous particles, such that various charged molecules can be loaded in the porous particles. In addition, various kinds of drugs or functional materials can be loaded into the porous particles of the present invention by electrostatic attraction and absorption or adsorption by a capillary phenomenon occurring due to porous properties. | 01-27-2011 |
20110020226 | PARTICLE STRUCTURES COMPRISING STEROLS AND SAPONINS - The present invention pertains to complexes comprising sterols and saponins. The complexes are capable of binding a genetic determinant including a polynucleotide. The complexes may further comprise a lipophilic moiety, optionally a lipophilic moiety comprising a contacting group and/or a targeting ligand, and/or a saccharide moiety. The complexes may further comprise an immunogenic determinant and/or an antigenic determinant and/or a medicament and/or a diagnostic compound. The complexes may in even further embodiments be encapsulated by an encapsulation agent including a biodegradable microsphere. The present invention also pertains to pharmaceutical compositions and methods of treatment of an individual by therapy and/or surgery, methods of cosmetic treatment, and diagnostic methods practised on the human or animal body. | 01-27-2011 |
20110020227 | POLYSACCHARIDE-CONTAINING BLOCK COPOLMER PARTICLES AND USES THEREOF - The invention relates to new amphiphilic linear block copolymers of polysaccharides and polymers. The amphiphilic linear block copolymers do not form a true solution in water and are able to form micelles in selective solvents. Also disclosed are particles, each of which has a shell and a core, and a diameter of about 1 to 1,000 nanometers, and methods of delivering agents or removing substances, e.g., undesirable substances, from a subject or environment, by using these particles. | 01-27-2011 |
20110020228 | TARGETED CELLULAR SELECTIVITY OF SURFACE ACTIVE MOLECULES - A method for the treatment of cancer involves delivering a surface active agent to an organism, where the surface active agent selectively partitions to and kills cancer cells as opposed to healthy cells. The surface active agent can be an ionic or a non-ionic surfactant with a HLB of less than 29 or a mixture of surface active agents with a HLB of less than 40, where the hydrophobic portion is a lesser fraction of the surface active agent than the hydrophilic portion. A fluorescence method of detecting and locating cancer cells in an organism involves delivering a surface active agent, where the surface active agent includes a fluorescence moiety that upon selective partitioning of the surface active agent to the cancer cells and irradiation by a radiation source to excite the fluorescence moiety, a fluorescence emission is observed permitting the detection and location of the cancerous tissue by local volumes of relatively high intensity emission. | 01-27-2011 |
20110020229 | Multi-Component Biological Transport Systems - Compositions and methods are provided that are useful for the delivery of therapeutic agents, including nucleic acids. The compositions can be prepared with components useful for targeting the delivery of the compositions as well as imaging components. | 01-27-2011 |
20110020230 | BIOMARKERS FOR PROSTATE CANCER - The present invention relates to compositions and methods for the detecting, treating, and empirically investigating the prostate. In particular, the present invention provides compositions and methods for using neuroligin biomarkers (e.g., NLGN-4Y) in the diagnosis, treatment, and empirical investigation of prostate disorders (e.g., prostate cancer, benign prostatic hypertrophy). | 01-27-2011 |
20110020231 | QUATERNARY AMMONIUM DIPHENYLMETHYL COMPOUNDS USEFUL AS MUSCARINIC RECEPTOR ANTAGONISTS - The invention provides compounds of formula I: | 01-27-2011 |
20110027180 | DETECTION AND TREATMENT OF PROSTATE CANCER - An antigen is shown to be associated with prostate cancer, and is useful for new methods and compositions for diagnosing or treating prostate cancer. This is particularly useful for individuals with prostate cancer who test negative for Prostate Specific Antigen. Additionally, this is useful for distinguishing between benign prostate disease and prostate cancer in a patient diagnosed or presenting with prostate dysfunction. | 02-03-2011 |
20110027181 | Device including altered microorganisms, and methods and systems of use - Devices, methods, and systems are described for administration to at least one biological tissue of at least one device including at least one altered microorganism. In an embodiment, the altered microorganism includes at least one nucleic acid construct encoding at least one therapeutic agent. | 02-03-2011 |
20110027182 | SUBSTANCE FOR OBTAINING HIGHLY EFFECTIVE TUMOR MEDICATIONS AS WELL AS A PROCESS - The invention relates to a substance and a process for obtaining anti-tumor agents. | 02-03-2011 |
20110027183 | Hydrophobic Modified Pres-Derived Peptides of Hepatitis B Virus (HBV) and Their Use as Vehicles for the Specific Delivery of Compounds to the Liver - The present invention relates to hydrophobic modified preS-derived peptides of hepatitis B virus (HBV) which are versatile vehicles for the specific delivery of compounds to the liver, preferably to hepatocytes, in vitro as well as in vivo. Any kind of compound, but in particular drugs, such as interferons, viral reverse transcriptase inhibitors or core assembly inhibitors, and/or labels can be specifically targeted to the liver and so be enriched in the liver. This liver targeting can further be used for the targeted diagnosis, prevention and/or treatment of liver diseases or disorders, such as hepatitis, malaria, hepatocellular carcinoma (HCC), as well as for the prevention of HAV, HBV, HCV and/or HDV infection. The present invention relates to pharmaceutical compositions comprising said hydrophobic modified preS-derived peptide(s) and the compound(s) to be specifically delivered to the liver. The present invention furthermore relates to a method for the combined treatment of a liver disease and the prevention of HAV, HBV, HCV and/or HDV infection. The present invention relates also to the use of the preS-derived peptides in gene therapy and the delivery of immunogenic epitopes for hepatocyte-mediated antigen presentation to activate liver-directed immunological responses. | 02-03-2011 |
20110033383 | METHODS AND COMPOSITIONS FOR GENERATING AN IMMUNE RESPONSE BY INDUCING CD40 AND PATTERN RECOGNITION RECEPTORS AND ADAPTORS THEREOF - Provided are methods for activating an antigen-presenting cell and eliciting an immune response by inducing pattern recognition receptor activity, and CD40 activity. Also provided are methods for activating an antigen-presenting cell and eliciting an immune response by inducing CD40 activity without prostaglandin E2. Also provided are methods for activating an antigen-presenting cell and eliciting an immune response by inducing an inducible chimeric molecule comprising a region of a pattern recognition receptor or an adaptor thereof. | 02-10-2011 |
20110033384 | CHIMERIC POLYPEPTIDES AND THEIR USE - The presented invention concerns chimeric molecules that contain a preferential polypeptidic region, consisting of a specific affinity for the binding to specific DNA sequences, of a preferential polypeptidic region consisting of a DNA modifying activity, and this chimeric molecule is capable to cross biological membranes due to the presence of a region that contains delivery activity. The invention contains further the isolated polynucleotides that code for the chimeric molecules of the invention if they are as such entirely or partially of polypeptide nature. | 02-10-2011 |
20110033385 | Methods and apparatus for non-invasive determination of patient's blood conditions - A method and apparatus are presented for non-invasive determination of blood clotting related and blood circulation related parameters of a mammal. At least one stimulus ST is non-invasively induced in a blood containing medium in the mammal for a preset period of time t | 02-10-2011 |
20110033386 | METHOD OF DETECTING BLADDER CANCER - Provided is a sensitizing detection agent of an oral or intravenous administration type which enables the detection of bladder cancer with a higher sensitivity without causing pain to the patient. A sensitizing detection agent for bladder cancer comprising 5-aminolevulinic acid (ALA), a derivative thereof, or a salt of these is orally or intravenously administered, and a video camera system is inserted via the urethra and a blue light at 380-440 nm is irradiated to observe the red fluorescent part. Further, VLD-M1 is inserted and a blue light at 405 nm is irradiated to observe fluorescence intensity (relative intensity) of the red light part. For oral administration, 20 mg/kg (maximum of 1 g) of ALA is dissolved in 50 mL of a 5% glucose solution prior to the administration. | 02-10-2011 |
20110038797 | METHOD FOR DETECTING INFLAMMATORY DISORDERS OF THE CENTRAL NERVOUS SYSTEM - The present invention provides a biomarker for a central nervous system inflammatory disorder. The present invention also provides processes for detecting a central nervous system inflammatory disorder and processes for monitoring the effectiveness of a therapeutic treatment for a central nervous system inflammatory disorder. | 02-17-2011 |
20110038798 | AGENTS FOR DETECTING AND IMAGING CELL DEATH - This invention relates to molecular imaging agents comprising an S78C mutant synaptotagmin I C2A domain. These agents may be useful in detecting or assessing cell death in vitro and in vivo, for example in tumours following cancer treatment. | 02-17-2011 |
20110044900 | METHOD FOR TREATING AND/OR DIAGNOSING TUMOR BY GOLD PARTICLES COATED WITH A POLYMER - A method for treating and/or diagnosing a tumor is provided. The method includes administrating an effective amount of gold particles to a subject in need thereof, and observing the distribution of the gold particles in the subject, wherein the gold particles are coated with a polymer, and the gold particle has a size of about 6.1±1.9 nm. | 02-24-2011 |
20110044901 | NOVEL COMPOUNDS - The present invention is directed to sulphated compounds comprising at least one glycosidic amine group, and polysaccharide, oligosaccharide, peptide and protein derivatives comprising such compounds, and mixtures thereof. The present invention is also directed to methods of synthesising such compounds. Such compounds may bind to a range of proteins, find application in methods of modifying, or testing for a modification in the level of a cytokine in vivo, ex vivo or in vitro, and find application in the treatment and/or prevention of inflammation, an inflammatory disorder, a proliferative disorder, an immune disorder, an angiogenesis-dependent disorder, a sensitivity disorder, an adverse endocrine reaction, a degenerative disorder, wound healing, depression, and other diseases and disorders. | 02-24-2011 |
20110044902 | Modulation of the Immune Response - Methods for identifying compounds that modulate the generation of regulatory T cells (Treg) in vivo and in vitro, i.e., compounds that act on the transcription factors that increase or decrease expression of Foxp3. | 02-24-2011 |
20110044903 | METHODS FOR PRODUCING MICROBUBBLES - The present invention provides methods for the preparation of gas-filled microbubbles, and methods of using for therapeutic and/or diagnostic applications. In particular, the methods of the invention allow for the preparation of gas-filled microbubbles having narrow size distributions and defined ultrasonic properties. | 02-24-2011 |
20110044904 | CRYSTAL FORMS OF 2--ADENOSINE - The present invention provides novel crystalline polymorphic forms of 2-cyclohexylmethylidenehydrazino adenosine, also known as binodenoson, methods of making the same, and methods for the manufacture of a pharmaceutical composition by employing such crystal forms, in particular, for the use of binodenoson in a subject, in need thereof, as a pharmacological stress agent to produce coronary vasodilation. | 02-24-2011 |
20110044905 | OXYTOCIN ANALOGUES - The present invention relates to novel compounds, pharmaceutical compositions comprising the same, use of said compounds for the manufacture of a medicament for treatment of inter alia compromised lactation conditions as well as to a method for treatment of said conditions, wherein said compounds are administered. The compounds are represented by the general formula (I), as further defined in the specification. | 02-24-2011 |
20110044906 | Methods for the Treatment, the Prognostic Assessment and the Staging of Non-Small Cell Lung Cancer - The present invention relates to methods for the treatment, the prognosis and the diagnosis of non-small cell lung cancer. | 02-24-2011 |
20110052493 | USE OF POLYPEPTIDES OBTAINED THROUGH SYSTEMATIC MUTATIONS OF SINGLE AMINO ACIDS OF HUMAN AND NON-HUMAN BOX-A OF HMGB1 TO PREVENT AND/OR ANTAGONIZE PATHOLOGIES INDUCED BY HMGB1 - The present invention relates to polypeptide variants of the HMGB-1 high affinity binding domain Box-A (HMGB1 Box-A) or to a biologically active fragment of HMGB1 Box-A, which are obtained through systematic mutations of single amino acids of the wild-type HMGB1 Box-A protein and which show an increased resistance to proteases and which are therefore characterized by more favourable pharmacokinetic and pharmacodynamic profiles. Moreover, the present invention concerns the use of said polypeptide molecules of HMGB1 Box-A to diagnose, prevent, alleviate and/or treat pathologies associated with extracellular HMGB1 and associated with RAGE. | 03-03-2011 |
20110052494 | H-ANTIGEN BINDING POLYPEPTIDES AND METHODS OF USE - Polypeptides having high specific binding for H-antigen, particularly Lewis y and Lewis b antigens are described. The polypeptides are useful in making conjugates with diagnostic reporter molecules or therapeutic agents such as anticancer agents for binding to epithelial derived tumors or cancer cells which overexpress such antigens. | 03-03-2011 |
20110052495 | USE OF FULLERENES IN PHOTOACOUSTIC IMAGING - Fullerenes, when irradiated with electromagnetic radiation, generate acoustic waves. A photoacoustic tomography method using a material comprising fullerenes is disclosed that includes irradiating the material with a radiation beam such as a laser. The resultant photoacoustic effect produced by the material is detected by at least one detector. A photoacoustic tomography system using a material comprising fullerenes is also described. | 03-03-2011 |
20110052496 | HOLLOW NANOPARTICLES AND USES THEREOF - Aspects of the invention provide hollow nanoparticles and uses thereof. In particular, the invention provides membrane-enclosed vesicles comprising a truncated form of an HBsAg S protein lacking one or two of its amino-terminal transmembrane domains. | 03-03-2011 |
20110052497 | Minimally Invasive Systems and Methods for In Vivo Testing of Materials - Implantable material testing devices and method of testing materials in an animals are provided. In one embodiment, a method of testing a material in an animal includes associating the material with a retention frame to form a testing device. The retention frame movable between a first shape suited for insertion through a deployment instrument and a second shape suited for retention in the animal. The testing device is inserted in the first shape into the deployment instrument and is driven through the deployment instrument into the animal. Once in the animal, the testing device is permitted to assume the second shape so that the testing device is retained in the animal for a testing period. The testing device is removed from the animal after the testing period is complete, and the material is analyzed. The material may be analyzed for biofilm formation, encrustation, or degradation. The animal also may be analyzed for infection or other reactions to the material. Tissue may be collected from the animal, and the tissue may be analyzed. The testing period may be between about 1 day and about 90 days. | 03-03-2011 |
20110052498 | Antibodies and Vaccines for Use in Therapeutic and Diagnostic Methods for Alpha-Synuclein-Related Disorders - A vaccine for delaying an onset of or for treatment of an α-synuclein-related disorder in an individual comprises a therapeutically effective amount of isolated stabilized soluble α-synuclein oligomer having a lower formation rate to a non-soluble aggregated form than a non-stabilized oligomer of the α-synuclein. An antibody for delaying an onset of or for treatment of an α-synuclein-related disorder in an individual binds soluble α-synuclein. Methods for delaying an onset of for treatment or for prevention of an α-synuclein-related disorder employ the vaccine or antibody. Methods of detecting α-synuclein oligomers employ the antibody. | 03-03-2011 |
20110059015 | VACCINE - The application relates to antibodies and fragments capable of binding HIV-1 gp120 protein, nucleic acids encoding such proteins, to the use of such proteins to identify active compounds, and to the use of the compounds as vaccines. | 03-10-2011 |
20110059016 | OPTICAL ASSAY SYSTEM WITH A MULTI-PROBE IMAGING ARRAY - The subject matter described herein relates to an optical assay system having a multi-probe imaging array that orients a plurality of probes with respect to one another and to a sample. According to one aspect, the subject matter described herein includes a multi-probe imaging array for contacting biological samples and simultaneously illuminating a plurality of locations on the biological sample and collecting the reflected radiation from the locations. The multi-probe imaging array can be used for the rapid imaging of biological samples, for example, during surgery. | 03-10-2011 |
20110059017 | POLYMER COATED SERS NANOTAG - An encapsulated surface enhanced Raman scattering (SERS) tag. The tag includes a metal core and an encapsulant, typically a glass encapsulant. The encapsulant is further derivatized with a polymer. | 03-10-2011 |
20110059018 | COVALENTLY BINDING IMAGING PROBES - The present invention relates to molecular probes of the formula (I) | 03-10-2011 |
20110059019 | NOVEL ARYL PIPERAZINE DERIVATIVES USEFUL AS MODULATORS OF DOPAMINE AND SEROTONIN RECEPTORS - This invention provides novel aryl piperazine derivatives having medical utility, in particular as modulators of dopamine and serotonin receptors, preferably the D | 03-10-2011 |
20110059020 | LIPOSOME COMPOSITION, AND DIAGNOSTIC CONTRAST AGENT, THERAPEUTIC ENHANCER, AND PHARMACEUTICAL COMPOSITION USING THE SAME - To provide a liposome composition, which contains at least one liposome; gas entrapped in the liposome, and at least one metal oxide particle encapsulated in or adsorbed on the liposome, wherein the liposome composition satisfies a ratio B/A of 0.01 to 5, where A is a volume of the gas contained in the liposome on the basis of micro liter, and B is a mass of the at least one metal oxide particle contained in the liposome on the basis of milligram. | 03-10-2011 |
20110064663 | BETA 1,4-GALACTOSYLTRANSFERASES WITH ALTERED DONOR AND ACCEPTOR SPECIFICITIES, COMPOSITIONS AND METHODS OF USE - The invention relates generally to beta (1,4)-galactosyltransferase I mutants having altered donor and acceptor specificities, and methods of use thereof. In addition, the invention relates to methods for synthesizing oligosaccharides using the beta (1,4)-galactosyltransferase I mutants and to using the beta (1,4)-galactosyltransferase I mutants to conjugate agents, such as therapeutic agents or diagnostic agents, to acceptor molecules. | 03-17-2011 |
20110064664 | METHODS AND COMPOSITIONS INVOLVING CHITOSAN NANOPARTICLES - Disclosed are nanoparticles for the delivery of a therapeutic agent or a diagnostic agent to a subject that include a chitosan and a polyphosphate, wherein the weight ratio of the chitosan to the polyphosphate is about 1.0 or greater and the weight ratio of the polyphosphate to the therapeutic agent or diagnostic agent is about 15.0 or less. Also disclosed are nanoparticles that include a chitosan and an inhibitor of enhancer of Zeste homologue 2 (EZH2). Methods of delivering a therapeutic agent or a diagnostic agent to a subject for the treatment or prevention of a disease and methods of predicting prognosis of ovarian cancer in a subject that involve determining the expression and/or function of EZH2 in the subject are also disclosed. | 03-17-2011 |
20110064665 | Diagnostic and therapeutic nanoparticles - The present invention relates to diagnostic and therapeutic nanoparticles. More particularly, the present invention relates to creating a hybrid gold/gold sulfide nanoparticle with a chitosan matrix surrounding the metallic nanoparticle and a method for making the same. The chitosan-coated gold/gold sulfide nanoparticles can then be incorporated with additional therapeutic or diagnostic compounds such as iodine, antibodies, or other suitable compounds. The nanoparticles of the present invention have the dual capabilities of absorbing near infrared wavelength light to (1) act as a therapeutic agent by generating heat energy effective for cell ablation or for release of therapeutic compounds embedded in the chitosan matrix and (2) creating diagnostic benefit by incorporation of X-ray or MRI contrast agents. | 03-17-2011 |
20110064666 | COMPOUND - When an antigen present at lesion sites is detected using a compound containing a single-chain antibody moiety, the single-chain antibody moiety binds to the antigen present at sites other than lesion sites. As a result, the detection of the lesion sites with high sensitivity and high contrast is difficult, and a compound solving this problem is demanded. | 03-17-2011 |
20110064667 | AZIDE MODIFIED PROTEINS - The present invention describes the modification of polypeptides, more particularly channel proteins with a thiol reactive agent so as to introduce an azide group. The present invention further describes vesicles comprising channel proteins modified according to the invention, which upon reaction with a phosphine open up thereby releasing the content of the vesicles. The reagents, polypeptides and vesicles described in the present invention have in vivo and in vitro applications in both drug delivery and imaging. | 03-17-2011 |
20110070162 | RNA INTERFERENCE MEDIATING SMALL RNA MOLECULES - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 03-24-2011 |
20110070163 | CANCER CELL MIGRATION AND CANCER CELL INVASION INHIBITOR - Provided are an antibody which binds specifically PAR1 (protease activated receptor 1) or a fragment of the antibody which retains similar characteristics thereto; a composition containing the same for inhibiting the migration activity and invasion activity of cancer cells; and a medicinal composition for treating cancer and the like. | 03-24-2011 |
20110070164 | POST RELEASE MODIFICATION OF VIRAL ENVELOPES - The present invention relates to enveloped virus particles providing a modified composition of their envelope, methods for exogenously modifying the envelope composition of an enveloped viral particle making use of compounds consisting of a hydrophilic target domain and a lipophilic membrane anchor domain, wherein the lipophilic membrane anchor domain becomes anchored into the lipid double layer of the envelope and wherein the hydrophilic target domain becomes exposed to the surrounding incubation fluid. The invention further relates to methods and means to use said modified viral vectors and to pharmaceutical compositions containing such envelope modified viral vectors. | 03-24-2011 |
20110076234 | PEPTIDES COMPRISING AN ISODGR MOTIF - Disclosed herein are peptides which include an isoDGR motif and which selectively inhibit αvβ3 integrin. In some embodiments, the isoDGR motif results from the deamidation of an NGR motif. | 03-31-2011 |
20110081294 | CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING AND PHOTOACOUSTIC IMAGING METHOD - A method of detecting a contrast agent for photoacoustic imaging provides a high signal intensity. In a contrast agent for photoacoustic imaging, each particle containing an inorganic material supports at least an organic dye having an absorption coefficient in the near infrared region by means of chemical bonding. | 04-07-2011 |
20110081295 | PERIPHERAL-TYPE BENZODIAZEPINE RECEPTOR EXPRESSION LEVEL AS AN INDEX OF ORGAN DAMAGE AND REGENERATION - The present invention relates to methods, reagents, and kits for assessing organ damage, such as damage due to ischemia reperfusion injury, in the course of a transplantation therapy and/or for assessing organ regeneration following transplantation therapy. The invention provides a method for determining an index of organ health in the course of transplantation therapy comprising measuring the expression level of peripheral-type benzodiazepine receptor (PBR) in the organ. Measuring the expression level of PBR is also useful for assessing the progress of organ regeneration in the course of transplantation therapy by comparing the index of organ health. The expression level of PBR may be used as a predictor of the outcome of transplantation therapy. | 04-07-2011 |
20110085976 | METHODS FOR DETECTING CARDIAC DAMAGE - The present invention relates to a method for detecting heart damage in a patient. The invention also relates to methods for treatment of patients identified as having heart damage. The invention further pertains to methods for evaluating the efficacy of an ongoing therapeutic regimen designed to treat a damaged heart in a patient. | 04-14-2011 |
20110085977 | Use of UTP for the diagnosis of stenoses and other conditions of restricted blood flow - The present invention relates to methods for determining whether blood flow is restricted in a blood vessel of an individual suspected of compromised blood flow in the vessel, the method comprising the steps of delivering UTP, a derivative thereof, or a salt thereof to the vessel, assessing blood flow quantitatively in the vessel by obtaining a value that correlates to blood flow in said vessel, comparing the obtained value with a reference value, and determining whether the individual has compromised blood flow based on the results of the comparison. The invention also provides for methods of diagnosing atherosclerotic and ischemic heart diseases using UTP, a derivative thereof, or a salt thereof, as well as methods for inducing maximal hyperemia for diagnostic purposes. | 04-14-2011 |
20110085978 | NOVEL QUINOLINYLAMIDE DERIVATIVES USEFUL AS MODULATORS OF DOPAMINE AND SEROTONIN RECEPTORS - This invention provides novel quinolinylamide derivatives having medical utility, in particular as modulators of dopamine and serotonin receptors, preferably the D3, 5HT | 04-14-2011 |
20110085979 | CONJUGATE OF A POLYMER, AN ANTI-ANGIOGENESIS AGENT AND A TARGETING MOIETY, AND USES THEREOF IN THE TREATMENT OF BONE RELATED ANGIOGENESIS CONDITIONS - Conjugates of hydroxypropyl methacrylamide (HPMA)-derived copolymers having attached thereto TNP-470 and a high load (e.g., higher than 3 mol %) of alendronate (ALN), and processes of preparing same are disclosed. | 04-14-2011 |
20110091384 | Biomarker for identification of melanoma tumor cells - This invention relates to use of neuropilin-2 as a novel biomarker and therapeutic target for melanoma. The presence of neuropilin-2 can be used as a biomarker for diagnosing and detecting individuals suffering from or at risk for developing melanoma. Also described are methods of using neuropilin-2 to capture circulating melanoma cells. The present invention further relates to methods of treating an individual suffering from or at risk for developing melanoma with an agent that inhibits the activity of neuropilin-2. | 04-21-2011 |
20110091385 | SUBSTITUTED ARYL PIPERIDINYLALKYNYLADENOSINES AS A2AR AGONISTS | 04-21-2011 |
20110091386 | HUMANIZED ANTIBODIES SPECIFIC FOR AMINO ACID SEQUENCE RGD OF AN EXTRACELLULAR MATRIX PROTEIN AND THE USES THEREOF - The present invention provides humanized antibodies that immunospecifically recognize the RGD sequence. Some of these antibodies inhibit the biological functions of the RGD proteins, thereby exhibiting therapeutic effects on various disorders or diseases that are associated with RGD proteins, including cancer, e.g., the growth and metastasis of a cancer cell, and inflammatory diseases, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, endometriosis, bronchial asthma, fibrosis, diabetes, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and so forth. | 04-21-2011 |
20110097270 | Monoclonal Antibodies That Bind or Neutralize Hepatitis B Virus - The present invention relates to the isolation and characterization of a novel neutralizing chimpanzee monoclonal antibody to hepatitis B virus. The invention provides such antibodies, fragments of such antibodies retaining hepatitis B virus-binding ability, fully human or humanized antibodies retaining hepatitis B virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 04-28-2011 |
20110097271 | Colon Cancer Associated Transcript 1 (CCAT1) As A Cancer Marker - The present invention relates to the identification, isolation, and sequencing of a unique nucleic acid transcript termed Colon Cancer Associated Transcript 1 (CCAT-1) that is specifically expressed in cancer cells, in particular in colon, rectal, and lung cancer, as well as in precancerous lesions. The present invention thus provides methods for diagnosing cancer by detecting the expression of CCAT-1 as well as isolated polynucleotides, compositions and kits for use in the detection methods of the invention. | 04-28-2011 |
20110097272 | Method and Materials for Use in Diagnosing Viral Myocarditis - The invention consists of assay methods, assay kits and antibodies for detecting the polypeptide fragments of dystrophin protein cleavage by enteroviral protease | 04-28-2011 |
20110097273 | SPECTRAL IMAGING - A method includes concurrently modulating administration of at least two different contrast agents to a subject during an imaging procedure based on a modulation profile. The at least two different contrast agents exhibit different spectral characteristics. The method further includes performing a spectral decomposition of data indicative of the at least two different contrast agents, determining concentrations of the at least two different contrast agents based on the spectral reconstruction, and determining a perfusion parameter based on a ratio of the concentrations and the modulation profile. | 04-28-2011 |
20110104058 | DIMERIC MOLECULAR COMPLEXES - Dimeric molecular complexes comprising an IgE CH4 dimerization domain useful for diagnostics and therapeutics. | 05-05-2011 |
20110104059 | Membrane Associated Tumor Endothelium Markers - To gain a better understanding of tumor angiogenesis endothelial cells (ECs) were isolated and gene expression patterns were evaluated. When transcripts from ECs derived from normal and malignant colorectal tissues were compared with transcripts from non-endothelial cells, over 170 genes predominantly expressed in the endothelium were identified. Comparison between normal- and tumor-derived endothelium revealed differentially expressed genes, including many that were specifically elevated in tumor-associated endothelium. Experiments with representative genes from this group demonstrated that most were similarly expressed in the endothelium of primary lung, breast, brain, and pancreatic cancers as well as in metastatic lesions of the liver. These results demonstrate that neoplastic and normal endothelium in humans are distinct at the molecular level. | 05-05-2011 |
20110104060 | TREATMENT OF HYPERTENSION BY RENAL VASCULAR DELIVERY OF GUANETHIDINE - Sympathetic nerves run through the adventitia surrounding renal arteries and are critical in the modulation of systemic hypertension. Hyperactivity of these nerves can cause renal hypertension, a disease prevalent in 30-40% of the adult population. Hypertension can be treated with neuromodulating agents (such as angiotensin converting enzyme inhibitors, angiotensin II inhibitors, or aldosterone receptor blockers), but requires adherence to strict regimens and often does not reach target blood pressure threshold to reduce risk of major cardiovascular events. A minimally invasive solution is presented here to reduce the activity of the sympathetic nerves surrounding the renal artery by locally delivering neurotoxic or sympathetic nerve-blocking agents into the adventitia. Extended elution of these agents may also be accomplished in order to tailor the therapy to the patient. | 05-05-2011 |
20110104061 | TREATMENT OF RENAL HYPERTENSION OR CAROTID SINUS SYNDROME WITH ADVENTITIAL PHARMACEUTICAL SYMPATHETIC DENERVATION OR NEUROMODULATION - Sympathetic nerves run through the adventitia surrounding renal arteries and are critical in the modulation of systemic hypertension. Hyperactivity of these nerves can cause renal hypertension, a disease prevalent in 30-40% of the adult population. Hypertension can be treated with neuromodulating agents (such as angiotensin converting enzyme inhibitors, angiotensin II inhibitors, or aldosterone receptor blockers), but requires adherence to strict medication regimens and often does not reach target blood pressure threshold to reduce risk of major cardiovascular events. A minimally invasive solution is presented here to reduce the activity of the sympathetic nerves surrounding the renal artery by locally delivering neurotoxic or nerve-blocking agents into the adventitia. Extended elution of these agents may also be accomplished in order to tailor the therapy to the patient. | 05-05-2011 |
20110104062 | Biomarkers for Head-And-Neck Cancers and Precancers - The invention provides markers and methods for detecting head-and-neck precancers, (including OPLs), cancers and related disease conditions in a subject. The invention also provides localization and imaging methods for head-and-neck precancers (including OPLs) and cancers, along with kits for carrying out methods of the invention. The invention further provides therapeutic applications for head-and-neck precancers (including OPLs) and cancers which employ head-and-neck precancer and cancer markers, polynucleotides encoding the markers, and binding agents for the markers. | 05-05-2011 |
20110104063 | FLEXIBLY LABELING PEPTIDES - A solid phase peptide synthesis method for synthesizing a peptidyl contrast agent is disclosed. In one example, the method includes synthesizing an amino-chelator loaded resin, coupling of the amino-chelator loaded resin to the C-terminus and/or backbone of a peptide, cleaving the amino-chelator-peptide from a resin, and chelating a lanthanide metal to the amino-chelator-peptide. | 05-05-2011 |
20110104064 | CYCLIZED NON-NATIVE SYNTHETIC PEPTIDE AND COMPLEX OF PEPTIDES COMPRISING SAID CYCLIZED PEPTIDE, INTENDED TO INDUCE AND TO CHARACTERIZE THE PREVENTION OR TREATMENT OF CONDITIONS IN MAMMALS - Non-native synthetic peptide cyclized by means of a disulphide bridge, characterized by the amino acid sequence (E34P) that follows (SEQ ID No. 1): E-D-E-H-K-G-K-Y-C-R-L-G-N-D-C-R-T-T-E-P-T-T-T-A-T-P-R-G-T-P-T-P-A-P and a complex of non-native synthetic peptides that is intended to induce and characterize the prevention and/or treatment of conditions in mammals, the protective immunity of which depends on the stimulation of Th1 type lymphocytes, and, in particular, on a state of delayed hyperstimulation, containing: —said peptide (E34P), —the following sequence (A16E) of 16 amino acids (SEQ ID No. 2) or derivatives (structural analogues) thereof: A-A-R-C-A-R-C-R-E-G-Y-S-L-T-D-E —the following sequence (A16G) of 16 amino acids (SEQ ID No. 3) or derivatives (structural analogues) thereof: A-A-S-S-T-P-S-P-G-S-G-C-E-V-D-G, —and an adjuvant which preferably induces a cell-mediated response. | 05-05-2011 |
20110110856 | Optimized Adhesin Fragments And Corresponding Nanoparticles - The invention relates to optimized adhesins and nanoparticles to which said adhesins are bound. The invention furthermore relates to providing said nanoparticles by way of in vivo contrast agents, in particular for the diagnosis of bowel cancer. | 05-12-2011 |
20110110857 | MUTANT FORMS OF CHLAMYDIA HTRA - An immunogenic | 05-12-2011 |
20110110858 | Gold nanoparticle imaging agents and uses thereof - Overexpression of angiotensin-converting enzyme (ACE) has been associated with a number of pathophysiologies, including those associated with cancer and the cardiovascular system. Thus, targeted imaging of ACE is of crucial importance for monitoring tissue ACE activity as well as treatment efficacy. To this end, lisinopril-coated gold nanoparticles were prepared to provide a new type of probe for targeted molecular imaging of ACE by tuned K-edge computed tomography (CT) imaging. | 05-12-2011 |
20110110859 | Protein - The present invention provides methods and compositions for screening, diagnosis and prognosis of colorectal cancer, for monitoring the effectiveness of colorectal cancer treatment, and for drug development. | 05-12-2011 |
20110110860 | MODULATION OF LDL RECEPTOR GENE EXPRESSION WITH DOUBLE-STRANDED RNAS TARGETING THE LDL RECEPTOR GENE PROMOTER - Gene expression can be selectively regulated by double-stranded “antigene” RNAs that target regions of the low density lipoprotein receptor (LDL-R) promoter, thereby permitting modulation of LDL levels in vivo and subsequent effects on circulating LDL levels. | 05-12-2011 |
20110110861 | Methods of Detecting Cells with a Disrupted Cell Membrane, Cells Infected with A Pathogen, Dying Cells or Dead Cells - The present invention relates to methods of modulating the uptake and/or clearance of cells with a disrupted cell membrane, cells infected with a pathogen, dying cells or dead cells, or a portion thereof, which can be used to treat and/or prevent diseases such as cancer, autoimmunity and infections. The present invention also relates to methods of modulating antigen recognition, processing and/or presentation, as well as immune responses to material derived from cells with a disrupted cell membrane, cells infected with a pathogen, dying cells or dead cells, or a portion thereof. The present invention further relates to methods of detecting cells with a disrupted cell membrane, cells infected with a pathogen, dying cells or dead cells, or a portion thereof. | 05-12-2011 |
20110117017 | PEPTIDES WITH PROPERTIES OF AN ALLOSTERIC ANTAGONIST SELECTIVE FOR THE ALPHA 1A ADRENERGIC RECEPTOR AND USES THEREOF - Peptides characterized by: a) a sequence selected from the group consisting of the sequence SEQ ID NO: 2, and the derived variants having at least 70% identity or 80% similarity with the entire sequence SEQ ID NO: 2, b) a three-finger structure including eight cysteine residues linked by four disulfide bridges, respectively between the first and the third cysteine, the second and the fourth cysteine, the fifth and the sixth cysteine, and the seventh and the eighth cysteine, and c) an activity of an allosteric antagonist selective for the alpha 1a adrenergic receptor, and therapeutic and pharmacological uses thereof. | 05-19-2011 |
20110117018 | COMPOSITIONS AND METHODS FOR TREATING BONE - The present invention relates to compositions, methods and kits for the treatment of bone particularly impaired or damaged bone. | 05-19-2011 |
20110117019 | Novel Compositions and Uses Thereof - The present invention provides structured surfactant systems comprising water and from 0 to saturation of sugar, together with sufficient surfactant to form a structure capable of suspending solids, wherein the surfactant comprises a mixture of: (i) a major portion of at least one sugar ester and/or a triterpenoid glycoside (saponin) having an HLB greater than 10; and (ii) a minor portion of at least one fatty acid and/or lecithin. The invention further provides pharmaceutical compositions comprising a structured surfactant system of the invention and a pharmaceutical or veterinary active ingredient. | 05-19-2011 |
20110117020 | IMAGING DENDRIMER NANOPROBES AND USES THEREOF - This invention relates to imaging nanoprobe and methods of use thereof. Specifically, the invention relates to long-lived oxygen-insensitive nanoprobe comprising a lumisescent moeity with a long excited state lifetime, embedded in a dendrimer, wherein said dendrimer is internally cross-linked and has hydrophilic peripheral layer. | 05-19-2011 |
20110117021 | FULLY HUMAN ANTI-VAP-1 MONOCLONAL ANTIBODIES - Novel fully human anti-VAP-1 antibodies and fragments thereof are disclosed. Nucleic acids encoding anti-VAP-1 antibodies or fragments thereof, as well as expression vectors and host cells incorporating these nucleic acids for the recombinant expression of anti-VAP-1 antibodies are also given. Pharmaceutical compositions comprising said antibodies and therapeutic uses thereof are also disclosed. | 05-19-2011 |
20110117022 | METHOD OF USING AND ESTABLISHING AN ABSORPTION RATE LEVEL AND A NEURON FIRING LEVEL - A method and system used in establishing the homeostatic relationship between various amino acid neurotransmitters in the body. The method includes modulating the rate of neuron firing using GABA, glutamate or GAD. | 05-19-2011 |
20110117023 | CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING AND PHOTOACOUSTIC IMAGING METHOD USING THE SAME - It is intended to provide a novel contrast agent for photoacoustic imaging that is highly capable of binding to a target molecule and generates high photoacoustic signals. The present invention provides a contrast agent for photoacoustic imaging represented by Formula 1: | 05-19-2011 |
20110123447 | METHOD OF PROVIDING HUMAN TUMOR-SPECIFIC ANTIBODIES - Provided are novel tumor-specific binding molecules, particularly human antibodies as well as fragments, derivatives and variants thereof that recognize tumor-associated antigens and that are obtained from a tumor patient who shows at least partial clinical response or is symptom-free. In addition, pharmaceutical compositions comprising such binding molecules, antibodies and mimics thereof and methods of screening for novel binding molecules, which may or may not be antibodies as well as targets in the treatment of tumors are described. | 05-26-2011 |
20110123448 | OIL BODY CARRIERS, USES IN TARGET THERAPY AND/OR DETECTION OF THE SAME, AND FUSION PROTEINS COMPRISED THEREIN - An oil body carrier, its uses in target therapy and/or detection, and a fusion protein comprised therein are provided. The oil body carrier comprises: | 05-26-2011 |
20110123449 | Solid Forms of N-(4-(7-Azabicyclo[2.2.1]Heptan-7-yl)-2-Trifluoromethyl)Phenyl)-4-Oxo-5-(- Trifluoromethyl)-1,4-Dihydroquinoline-3-Carboxamide - The present invention relates to substantially crystalline and solid state forms of N-(4-(7-azabicyclo[2.2.1]heptan-7-yl)-2-(trifluoromethyl)phenyl)-4-oxo-5-(trifluoromethyl)-1,4-dihydroquinoline-3-carboxamide (Form A-HCl, Form B, Form B-HCl, or any combination of these forms), pharmaceutical compositions thereof, and methods of treatment therewith. | 05-26-2011 |
20110123450 | MACROCYCLIC CYANINE AND INDOCYANINE BIOCONJUGATES PROVIDE IMPROVED BIOMEDICAL APPLICATION - The sensitivity and specificity of the optical modality can be enhanced by the use of highly absorbing compounds as contrast agents. Novel macrocyclic cyanine and indocyanine bioconjugates that absorb and emit light in the near infrared region of electromagnetic spectrum are disclosed. These compounds are especially useful for endoscopic, localized photoacoustic, and sonofluorescence imaging, detection and therapy of tumors and other abnormalities. | 05-26-2011 |
20110123451 | Method for Cell Delivery Using Targeted Liposomes Associated with a Hemolysin - This invention describes a method for delivery of a therapeutic agent to target cells. Liposome delivery vesicles binds to a specific cell population via a targeting molecule attached to the liposome surface. After the liposomes bind to a target cell they are internalized into compartments within the cell called endosomes. It has been shown by prior art that by encapsulating a pore forming bacterial hemolysin into the lumen of a liposome, the endosome is broken down and drug is delivered into the cell cytoplasm. Instead of encapsulating the hemolysin within the liposome, this invention improves on current techniques by associating the hemolysin with the lipid membrane of the liposome. This modification reduces development cost significantly, eases production methods and increases the effectiveness and versatility of the treatment. Using this technique, we have demonstrated effective targeting and killing of Her-2 overexpressing tumor cells. | 05-26-2011 |
20110123452 | METAL OLIGOMERS AND POLYMERS AND THEIR USE IN BIOLOGY AND MEDICINE - Described herein are a class of metal oligomers and polymers that contain both metals and organic groups. Said oligomers and polymers have utility in many applications including biomedical imaging, radiation therapy, drug delivery, and in vitro analytical techniques, such as fluorescence and phosphorescence. | 05-26-2011 |
20110123453 | Polyoxazolines with Inert Terminating Groups, Polyoxazolines Prepared from Protected Initiating Groups and Related Compounds - The present disclosure provides novel functional polyoxazoline derivatives prepared by terminating polyoxazoline polymerization with inert chemical groups. In addition, the present disclosure demonstrates the synthesis of novel electrophilic initiators with protected functional groups capable of initiating oxazoline polymerization and capable of surviving the conditions of polymerization. These initiators are used to synthesize the above inert-terminal polyoxazoline derivatives as well as other poly-oxazolines with active terminal groups. Furthermore, the present disclosure provides for polyoxazoline-lipid conjugates and liposomal compositions prepared using such polyoxazoline-lipid conjugates. Methods of using the foregoing to prepare conjugates with target molecules are also disclosed. | 05-26-2011 |
20110129420 | MATERIALS AND METHODS FOR BIOLOGICAL IMAGING - Water soluble InAs(ZnCdS) semiconductor nanocrystals with bright and stable emission in the near infrared (NIR) wavelength range have been prepared. The NIR semiconductor nanocrystals can be functionalized to enable imaging of specific cellular proteins. In addition, the utility of the NIR region for in vivo biological imaging is clearly demonstrated by the superior ability of InAs(ZnCdS) semiconductor nanocrystals to image tumor vasculature. | 06-02-2011 |
20110129421 | MATRIX METALLOPROTEASE TARGETING NUCLEIC ACIDS - A reporter conjugate for non-invasive detection (e.g., imaging) of matrix metalloprotease (MMP) gene expression in vivo is disclosed. The conjugate includes a targeting nucleic acid linked to a contrast agent, such as a paramagnetic label that can be used with magnetic resonance (MR) imaging. The targeting nucleic acid can be an antisense strand that hybridizes to a portion of a messenger RNA encoded by the gene whose expression is to be imaged. In some embodiments, the contrast agent is a chelated metal such as gadolinium or dysprosium. The invention also features methods to detect MMP gene expression in various tissues, including the brain. | 06-02-2011 |
20110129422 | Viscous Terpolymers as Drug Delivery Platform - Disclosed are terpolymer compositions of lactide, glycolide, and caprolactone and methods of making such polymers with an initiator. Methods of using the terpolymers as a drug delivery platform are also disclosed. | 06-02-2011 |
20110135572 | COMPOSITIONS AND METHODS FOR DIAGNOSING LATE-ONSET ALZHEIMER'S DISEASE - Genetic markers for late-onset Alzheimer's disease (AD) within the TRPC4AP gene locus are provided. The genetic markers include single nucleotide polymorphisms (SNPs) and haplotypes. Methods and kits for using the disclosed genetic markers to identify, or assist in the identification of, subjects as having late-onset AD, or as having an increased risk for developing late-onset AD are provided. In a preferred embodiment the genetic markers are one or more SNPs selected from the group consisting of rs1058003, rs3746430, rs3736802, rs6088677, rs6087660, rs4911460, rs6087664, rs13042358, rs6088692, rs6120816, rs1885119, rs2065108 and rs6088727, or haplotype: rs1058003_G: rs3746430_T: rs3736802_T: rs6088677_C: rs6087660_T: rs4911460_G: rs6087664_C: rs13042358_G: rs6120816_G: rs1885119_T. | 06-09-2011 |
20110135573 | METALLOPROTEINASE 9 AND METALLOPROTEINASE 2 BINDING PROTEINS - Proteins that bind to matrix metalloproteinase 9 and to matrix metalloproteinase 2 and methods of using such proteins are described. | 06-09-2011 |
20110142761 | IL-1 BINDING PROTEINS - The present invention describes IL-1β binding proteins, including chimeric, CDR-grafted, and humanized antibodies that bind IL-1β. Binding proteins of the invention have high affinity for IL-1β and neutralize IL-1β activity. A binding protein of the invention can be a full-length antibody or an IL-1β-binding portion thereof. Methods of making and methods of using the binding proteins of the invention are also described. The IL-1β binding proteins of the invention are useful for detecting IL-1β and for inhibiting IL-1β activity, including in a human subject suffering from a disease or disorder in which IL-1β activity is detrimental. | 06-16-2011 |
20110142762 | Conjugates for medical imaging comprising carrier, targeting moiety and a contrast agent - This invention relates to the delivery of agents to the body. One particular class of such agents are contrast agents useful in medical imaging techniques. The agents may be metals useful as contrast agents in magnetic resonance imaging (MRI), or in nuclear imaging, including positron emission tomography (PET), or as therapeutic agents in radiotherapy. The agents may alternatively be contrast agents useful in X-ray imaging. The invention also relates to methods by which agents for delivery to the body can be coupled to carriers and to targeting moieties effective to direct the agent to a specific locus within the body. | 06-16-2011 |
20110142763 | Megalin-Based Delivery of Therapeutic Compounds to the Brain and Other Tissues - The present invention is directed to a methods and compositions for receptor mediated drug delivery, particularly across the blood-brain barrier. | 06-16-2011 |
20110142764 | CONJUGATES OF A POLYMER, A BISPHOSPHONATE AND AN ANTI-ANGIOGENESIS AGENT AND USES THEREOF IN THE TREATMENT AND MONITORING OF BONE RELATED DISEASES - Conjugates of polymers or copolymers having attached thereto an anti-angiogenesis agent and a bisphosphonate bone targeting agent, and processes of preparing same, are disclosed. | 06-16-2011 |
20110142765 | NOVEL PHLOROGLUCINOL DERIVATIVES HAVING SELECTIN LIGAND ACTIVITY - Pharmaceutical compositions comprising at least one compound of the formula (I) and a pharmaceutically acceptable carrier which is useful in a medicine wherein the symbols and substituents have the following meaning —X— is e.g. and Y being e.g. or the pharmaceutically acceptable salts, esters or amides and prodrugs can be applied to modulate the in-vitro and in-vivo binding processes mediated by E-, P- or selectin binding. | 06-16-2011 |
20110150765 | Frozen compositions and methods for piercing a substrate - Certain embodiments disclosed herein relate to compositions, methods, devices, systems, and products regarding frozen particles. In certain embodiments, the frozen particles include materials at low temperatures. In certain embodiments, the frozen particles provide vehicles for delivery of particular agents. In certain embodiments, the frozen particles are administered to at least one biological tissue. | 06-23-2011 |
20110150766 | Transdermal patch with fatal overdose protection - A transdermal patch having a top region containing an antagonist followed by a bottom region containing an agonist, whereby the bottommost end of the bottom region is secured to the skin of the patient for delivering a prescribed dosage of agonist to the patient over a predetermined period of time, the antagonist will be released by migrating or moving from the top region through the bottom region to the patient to prevent overdose. Visual indicators are provided in the patch for changing color to separately indicate the operation of the patch, delivery of prescribed dosage, and/or overdosage. | 06-23-2011 |
20110150767 | ALPHA-SUBSTITUTED AND ALPHA-UNSUBSTITUTED AROMATIC AMINO ACID DERIVATIVES AND COMPOSITIONS THEREOF FOR USE TO TREAT, DIAGNOSE, OR MONITOR A MEDICAL CONDITION - A compound represented by the general formula 1 as described, a pharmaceutically acceptable salt or ester thereof, a solvate thereof, a chelate thereof, a non-covalent complex thereof, a pro-drug thereof, a radio-labeled analog thereof (i.e. | 06-23-2011 |
20110150768 | COMPOSITIONS AND METHODS FOR DELIVERING INHIBITORY OLIGONUCLEOTIDES - The present invention features compositions and methods that make use of complexes comprising one or more inhibitory nucleic acids and a targeting polypeptide, wherein the targeting polypeptide consists of a cell surface receptor ligand. The compositions can be used in methods of silencing gene expression in a cell, in delivering agents to a target cell, and in treating or preventing a disease or disorder in a subject. | 06-23-2011 |
20110158908 | CYCLOSPORIN A-BINDING PROTEIN - Disclosed are: a composition and a method for the diagnosis and/or the treatment of a CSABP-related disease, the regulation of the proliferation of an RNA virus and the regulation of an RNA-metabolizing system, which targets a cyclosporin A-binding protein (CSABP); a method for the screening of a component that targets a CSABP; a composition and a method for the detection/inhibition of CsA, NS5B or cyclosphilin B by utilizing a CSABP; a promoter for a CSABP; a method for the screening of a substance capable of regulating the expression of a CSABP by utilizing the promoter; and a method for the determination of the occurrence or clinical stage of a CSABP-related disease. | 06-30-2011 |
20110158909 | Cationic Contrast Agents and Methods of Use Thereof - The present invention provides compounds useful as contrast agents, such as for the CT imaging of cartilage tissue. The contrast agents are generally iodinated organic molecules that are positively charged under physiological environments. Also provided are compositions containing contrast agents and methods of using the agents, including, for example, the monitoring of glycosaminoglycan content in cartilage tissue. The invention provides non-invasive analytical techniques for the diagnosis of osteoarthritis in its earliest stages. The invention also provides improvements over existing contrast agents for cartilage monitoring, which tend to exhibit low residence times and require high dosages. | 06-30-2011 |
20110158910 | MICROPARTICLES COMPRISING POLYMERS WITH THIOESTER BONDS - The present invention relates to particles suitable for delivery of active agents comprising a polymer containing thioester bonds which are obtained via the reaction of a thioic acid functionality and an unsaturated group. The polymer may be is linear, branched or crosslinked. The particles have an average diameter in the range of 10 nm to 1000 μm, preferably in the range of 100 nm-100 μm. The particles may comprise an active agent selected from the group of nutrients, pharmaceuticals, proteins and peptides, vaccines, genetic materials, diagnostic agents or imaging agents. The present invention further relates to the use of the particles in dermatology, muscular skeletal, oncology, in vascular applications, in orthopaedics, in ophthamology, spinal, intestinal, pulmonary, nasal, or auricular. | 06-30-2011 |
20110165077 | IN VIVO TUMOR TARGETING AND SPECTROSCOPIC DETECTION WITH SURFACE ENHANCED RAMAN NANOPARTICLE TAGS - Nanostructures, methods of preparing nanostructures, methods of detecting targets in subjects, and methods of treating diseases in subjects, are disclosed. An embodiment, among others, of the nanostructure includes a metallic gold surface-enhanced Raman scattering nanoparticle, a Raman reporter and a protection structure. The protection structure may include a thiol-polyethylene glycol to which may be attached a target-specific probe. | 07-07-2011 |
20110165078 | SPECIFIC BINDING MEMBERS AGAINST SYNAPTOPHYSIN - The present invention provides specific binding members that bind synaptophysin and which comprise: an antibody VH domain selected from the group consisting of the C1-3 VH domain (SEQ ID NO. 2) and a VH domain comprising a VH CDR3 with the amino acid sequence of SEQ ID NO. 12 and optionally one or more VH CDR's with an amino acid sequence selected from SEQ ID NO. 10 and SEQ ID NO. 11; and/or an antibody VL domain selected from the group consisting of the C1-3 VL domain (SEQ ID NO. 4) and a VL domain comprising one or more VL CDR's with an amino acid sequence selected from SEQ ID NO. 13, SEQ ID NO. 14 and SEQ ID NO. 15. The invention further provides related materials such as nucleic acids, kits and compositions, and also methods of use of the binding member, for instance in targeting entities to hepatic stellate cells which are implicated in liver fibrosis. | 07-07-2011 |
20110165079 | PEPTIDE FOR TRANSMIGRATION ACROSS BLOOD BRAIN BARRIER AND DELIVERY SYSTEMS COMPRISING THE SAME - An isolated peptide including an amino acid sequence of SEQ ID NO: 1 is provided. The disclosure also provides a delivery system comprising a carrier having a surface, a drug or a dye encapsulated in the carrier, and the disclosed peptide (having an amino acid sequence of SEQ ID NO: 1) grafted on the surface of the carrier. | 07-07-2011 |
20110165080 | MONOCLONAL ANTIBODIES AND THEIR USE - Isolated monoclonal antibodies are disclosed herein that specifically bind a cell surface antigen expressed on the human pancreatic endocrine cells or a subset thereof, and/or a precursor thereof. Isolated monoclonal antibodies are also disclosed herein that specifically bind a cell surface antigen expressed on human pancreatic exocrine cells or human ductal cells. Humanized forms of these antibodies, and functional fragments of these antibodies, are also disclosed. The antibodies can be conjugated to an effector molecule, such as a detectable marker, a therapeutic agent, or a toxin. These antibodies are of use to detect and isolate pancreatic cells or a subset thereof. The antibodies can be used for in vitro or in vivo detection and/or isolation of pancreatic endocrine cells. Methods of treating a pancreatic tumor are also disclosed. In several examples, the isolated monoclonal antibodies bind pancreatic endocrine cells and can be used to detect diabetes or a pancreatic endocrine cell tumor. | 07-07-2011 |
20110171131 | Method of Altering Perception of Time - Methods and compositions for modifying an individual's perception of an interval of time are disclosed. | 07-14-2011 |
20110176999 | PALATABLE LIQUID DILUTION VEHICLES FOR ORAL CONTRAST AGENTS - The invention relates to liquid vehicles that can be used to create dilute solutions of water-soluble pharmaceutical or non-pharmaceutical oral contrast agents. The liquid vehicles are formulated to provide desired osmolalities, viscosities, pH, and taste masking capabilities to match the particular intentions of the user and to complement the inherent differences in the various oral contrast agents. The liquid vehicles comprise an aqueous medium, an osmotic agent to adjust osmolality, a buffering agent, a viscosity agent, and sweeteners and flavoring agents to improve palatability. | 07-21-2011 |
20110177000 | Use of S-Nitrosothiol Signaling to Treat Disordered Control of Breathing - The present invention is directed to a method of treating disordered control of breathing including the treatment of apnea and hypoventilation associated with congenital or acquired brain stem abnormalities. Specifically the invention is directed to treating disordered control of breathing by administering an S-nitrosylating agent selected from the group consisting of ethylnitrite, glutathione, nitric oxide, S-nitrosocysteine, S-nitrosoglutathione, S-nitroso-L-cysteinyl glycine, N-acetyl cysteine and S-nitroso-N-acetyl cysteine. As shown in FIG. | 07-21-2011 |
20110182813 | AMPHIPHILIC COPOLYMERS AND COMPOSITIONS CONTAINING SUCH POLYMERS - Amphiphilic copolymer, containing at least a hydrophilic chain segment (A) and a hydrophobic chain segment (B), wherein the hydrophilic chain segment (A) contains peptides and wherein the hydrophobic chain segment (B) contains acetal groups or orthoester groups. The hydrophilic chain segment (A) preferably contains glutamine/glutamic acid units or asparagines/aspartic acid units, making a biodegradable copolymer which can form a thermogel. | 07-28-2011 |
20110182814 | PLECTIN-1 TARGETED AGENTS FOR DETECTION AND TREATMENT OF PANCREATIC DUCTAL ADENOCARCINOMA - Described herein are compositions and methods for cancer cell biomarkers, such as pancreatic ductal adenocarcinoma (PDAC) cell biomarkers, and binding molecules for diagnosis and treatment of cancer, e.g., PDAC. Methods of identifying “accessible” proteomes are disclosed for identifying cancer biomarkers, such as plectin-1, a PDAC biomarker. Additionally, imaging compositions are provided comprising magnetofluorescent nanoparticles conjugated to peptide ligands for identifying PDACs. | 07-28-2011 |
20110182815 | METHOD FOR THE DETECTION OF ENZYMATIC ACTIVITY WITH MAGNETICALLY FUNCTIONALIZED SUBSTRATES - The present invention provides methods for detecting an enzymatic activity, the method including combining at least one magnetic particle to an enzyme substrate to form a magnetically modified substrate, reacting the magnetically modified substrate with at least one enzyme; and detecting a change in a magnetic property of the magnetically modified substrate or its cleavage products, thereby detecting an activity of said at least one enzyme, wherein the method may be applied to a human subject to detect a disease selected from the group consisting of rheumatitis, arthritis, an injury, Dupuytren's disease, Peyronie's disease, a collagen related disease, steatosis, fibrosis, cirrhosis, metastasis, tissue regeneration, cancer, coronary disease, a liver disease, a metabolic condition, an infection and an inflammatory disease. | 07-28-2011 |
20110189091 | COLON LAVAGE SYSTEM - The present invention provides compositions, systems, kits, and methods for preparation prior to a colonoscopy or other gastrointestinal procedure. In particular, the present invention provides a colon lavage system comprising an aqueous portion and a solid portion. | 08-04-2011 |
20110189092 | POLYMER-AGENT CONJUGATES, PARTICLES, COMPOSITIONS, AND RELATED METHODS OF USE - Described herein are polymer-agent conjugates and particles, which can be used, for example, in the treatment of cancer. Also described herein are mixtures, compositions and dosage forms containing the particles, methods of using the particles (e.g., to treat a disorder), kits including the polymer-agent conjugates and particles, methods of making the polymer-agent conjugates and particles, methods of storing the particles and methods of analyzing the particles. | 08-04-2011 |
20110189093 | PROSTATE SPECIFIC MEMBRANE ANTIGEN ANTIBODIES AND ANTIGEN BINDING FRAGMENTS - Polypeptides, antibodies or antigen-binding fragments capable of binding to prostate specific membrane antigen (PSMA) are provided. These polypeptides, antibodies or antigen-binding fragments may be used for diagnostic and/or therapeutic purposes. | 08-04-2011 |
20110189094 | BIOLOGICAL METHOD FOR IN VIVO TRACKING OF MOLECULES AFFECTING CELLULAR MIGRATION - Cellular migration is a normal part of the normal development of the human being and, in certain pathologies, its alteration damages physiological performance, so that it is necessary to learn about its molecular and cellular foundations and establish methodologies to identify those molecules that modulate this cellular behavior. A screening method using zebra fish embryos is used to follow the advance in the migration of the lateral line primordium upon contact with a test compound. Modulators N found are Fenritinide, PGD2 and is-deoxy-PJE2. The invention refers to a biological method for the IN VIVO, fast, massive and simultaneous tracking of molecules capable of affecting cellular migration, in order to facilitate the for of potential candidates to be used in the diagnosis, prevention, and, principally, for the preparation of pharmaceutical compositions for the treatment of congenital pathologies, immune system dysfunctions, tissue regeneration failure, inflammation, cancer. | 08-04-2011 |
20110189095 | CRKL TARGETING PEPTIDES - Provided are methods and compositions for selectively targeting CRKL through the use of targeting peptides. Selective targeting of secreted CRKL through the use of a targeting peptide may be used, for example, in the treatment of cancer to deliver a chemotherapeutic compound, fusion protein, or fusion construct to a cancer cell or tissue. | 08-04-2011 |
20110189096 | CENTRAL NERVOUS SYSTEM TISSUE-LABELING COMPOSITION, METHOD FOR LABELING CENTRAL NERVOUS SYSTEM TISSUE, AND SCREENING METHOD USING CENTRAL NERVOUS SYSTEM TISSUE-LABELING COMPOSITION - To provide a central nervous system tissue-labeling composition labeling the central nervous tissue system. Also, another object of the present invention is to provide a method for non-invasively labeling the central nervous tissue system. Further, another object of the present invention is to provide a screening method using the above central nervous system tissue-labeling composition. A central nervous system tissue-labeling composition containing, as an active ingredient, at least one of compounds represented by the general formula (1) or (7). | 08-04-2011 |
20110195024 | ISATIN DERIVATIVES FOR USE AS IN VIVO IMAGING AGENTS - Isatin 5-sulfonamide derivatives, pharmaceutical compositions comprising the derivatives, their use as molecular imaging agents, their use for the diagnosis or treatment of diseases or disorders associated with dysregulation of apoptosis, methods for synthesizing the derivatives, methods for the molecular imaging of caspase activity and apoptosis, and methods of assessing the therapeutic effect of a test substance on caspase activity are disclosed. | 08-11-2011 |
20110195025 | ANIONIC OLIGOSACCHARIDE CONJUGATES - The invention relates to anionic oligosaccharide conjugates that may be used to mimic the structure and/or activity of the anionic bioactive molecules known as glycosaminoglycans (GAGs). | 08-11-2011 |
20110200527 | Peptide Ligand Directed Drug Delivery - Provided is a novel peptide ligand (Leu-Ala-Arg-Leu-Leu-Thr) for binding to an EGFR surface pocket based on its 3D crystal structure. When conjugated to the distal end of liposome surface PEG moieties, the peptide ligand directs liposome binding and uptake by EGFR high expressing cancer cells (H1299 and SPCA1) specifically and efficiently. The targeted delivery of liposomal anticancer drug doxorubicin results in better therapeutic efficacy towards cells in vitro. In vivo, the targeted liposomes are injected via tail vein and the time course of their distribution and accumulation in xenograft tumor tissues are studied using a live animal fluorescence imaging system. The LARLLT targeted liposomes were seen to gradually concentrate at the tumor site and be preferentially retained more than 80 hours after injection. | 08-18-2011 |
20110200528 | CYCLIZED NGR PEPTIDE COMPOUNDS, COMPOSITIONS, AND METHODS OF THEIR USE - Cyclized peptide compounds containing the NGR motif of formula (I) or a pharmaceutically-acceptable salt thereof are disclosed. Compositions comprising the cyclized peptide compounds and methods of their use are also disclosed. | 08-18-2011 |
20110200529 | ACTIVATABLE BIOLUMINESCENT PROBE SYSTEM AND METHOD OF USE THEREOF - A method of use of an activatable bioluminescent probe system includes: providing a bioluminescent protein and a quencher in a reaction environment; modifying a ligand between the quencher and the bioluminescent protein using a ligand interacting molecule; adding a bioluminescence initiating molecule to the reaction environment; and measuring light originating from the interaction between the bioluminescent protein and the bioluminescence initiating molecule. | 08-18-2011 |
20110200530 | TARGETING CONSTRUCT COMPRISING ANTI-POLYMER ANTIBODY AND CONTRAST/THERAPEUTIC AGENTS BINDING TO THE SAME - Pharmaceutical kit comprising (i) a targeting construct which comprises a targeting ligand and an anti-polymer antibody and (ii) a polymer-containing liposome or gas-filled microvesicle capable of binding or associating to said construct. Also disclosed are methods of preparing and of administering said assembly, as well as an assembly comprising said targeting construct and said liposome or gas-filled microvesicle. | 08-18-2011 |
20110206609 | FLUOROALKYL TETRABENAZINE CARBINOL COMPOUNDS AS IMAGING AGENTS AND PROBES - The present invention provides novel fluoroalkyl tetrabenazine carbinol compounds having structure I | 08-25-2011 |
20110206610 | COMPOSITIONS AND METHODS FOR ENHANCING DRUG DELIVERY ACROSS AND INTO EPITHELIAL TISSUES - This invention provides compositions and methods for enhancing delivery of drugs and other agents across epithelial tissues, including the skin, gastrointestinal tract, pulmonary epithelium, ocular tissues and the like. The compositions and methods are also useful for delivery across endothelial tissues, including the blood brain barrier. The compositions and methods employ a delivery enhancing transporter that has sufficient guanidino or amidino sidechain moieties to enhance delivery of a compound conjugated to the reagent across one or more layers of the tissue, compared to the non-conjugated compound. The delivery-enhancing polymers include, for example, poly-arginine molecules that are preferably between about 6 and 25 residues in length. | 08-25-2011 |
20110206611 | DNA Dendrimers as Thermal Ablation Devices - DNA dendrimers for targeted delivery of radiation absorbing nanoparticles and thermal ablation of cells and tissues are provided. Also provided are methods of making and methods of using the DNA dendrimers. | 08-25-2011 |
20110206612 | NOVEL SCREENS TO IDENTIFY AGENTS THAT MODULATE RETINAL BLOOD VESSEL FUNCTION AND PERICYTE FUNCTION AND DIAGNOSTIC AND THERAPEUTIC APPLICATION THEREFOR - The present invention provides methods for determining or identifying compounds that modulate the function of an isolated retinal pericyte or blood vessel, wherein a change in the contractile state of said pericyte or blood vessel is determined in the presence of a test compound, said change indicating that the test compound modulates the function of pericytes and/or blood vessels. | 08-25-2011 |
20110206613 | METHOD AND APPLICATION OF UNSYMMETRICALLY meso-SUBSTITUTED PORPHYRINS AND CHLORINS FOR PDT - Biologically active compounds are provided that can be used as photosensitizers for diagnostic and therapeutic applications, particularly for PDT of cancer, infections and other hyperproliferative diseases, fluorescence diagnosis and PDT treatment of a non-tumorous indication such as arthritis, inflammatory diseases, viral or bacterial infections, dermatological, ophthalmological or urological disorders as well as providing methods to obtain them in pharmaceutical quality. One embodiment consists of a method to synthesize a porphyrin with a defined arrangement of meso-substituents and then converting this porphyrin system to a chlorin system by dihydroxylation or reduction, and if more than one isomer is formed separate them by chromatography either on normal or reversed phase silica. In another embodiment the substituents on the porphyrin are selected to direct the reduction or dihydroxylation to the chlorin so that a certain isomer is selectively formed. Another embodiment is to provide amphiphilic compounds with a higher membrane affinity and increased PDT-efficacy. In another embodiment a method to reductively cleave the osmate(VI)ester avoiding the use of gaseous H | 08-25-2011 |
20110212027 | RADIATIVE HEATING FOR DRUG DELIVERY AND OTHER APPLICATIONS - The present invention generally relates to systems and methods for releasing a releasable species from an article using an external trigger, for example, using microwave radiation or other forms of radiation, e.g., radiofrequency radiation. Such systems and methods may be useful, for example, in biological applications (e.g., as an implant within a subject), industrial applications, commercial applications, or the like. One aspect of the invention is generally directed to an article containing a radiation-sensitive polymer or other radiation-sensitive material. Exposure of the radiation- sensitive material to radiation such as microwave and/or radiofrequency radiation may cause the material to increase in temperature. This increase in temperature may be used, in some cases, to cause the release of a drug or other releasable species from the article. For instance, a drug may be contained in a heat-sensitive material positioned in thermal communication with the radiation-sensitive material, or a drug may be contained within an enclosure that is isolated, at least in part, by a heat-sensitive material positioned in thermal communication with the radiation-sensitive material. In another aspect of the invention, a receive antenna, such as a microwave receive antenna may be used to focus microwave and/or radiofrequency radiation on an article. For instance, the receive antenna may focus microwave and/or radiofrequency radiation on a radiation-sensitive material in the article. Such focusing may be useful, in some embodiments, to control release of a drug or other releasable species from the article. Other aspects of the invention are directed to systems and methods of making or using such articles, e.g., by implanting the article within a subject, methods of treatment involving such articles, kits including such articles, and the like. | 09-01-2011 |
20110212028 | CHEMICALLY MODIFIED CELL-PENETRATING PEPTIDES FOR IMPROVED DELIVERY OF GENE MODULATING COMPOUNDS - The present invention relates to a system for intracellular delivery of a cargo comprising at least one component A chosen from aliphatic linear or branched moieties with at least 4 carbon atoms and/or cyclic ring systems comprising 2-4 rings which may contain several hetero atoms chosen from N, S, O and P, wherein component(s) A is (are) attached to a cell penetrating peptide B and/or a non-peptide analogue thereof. It also relates to methods of using the system in diagnosis of diseases, as research tool and as a targeting system, a composition comprising the system and especially a pharmaceutical composition a material covered with the system and a material having the delivery systems into the material. Finally it relates to novel peptides. | 09-01-2011 |
20110212029 | DETECTION OF CANCER - The use of nanoparticles for imaging a tumour in a mammal using electrical impedance tomography. The nanoparticles comprise a core of metal and/or semiconductor atoms to which are linked ligands that comprise a molecule capable of attaching to a specific tumour biomarker. | 09-01-2011 |
20110217235 | ALPHA 1-3 N-GALACTOSYLTRANSFERASE WITH ALTERED DONOR SPECIFICITIES - The invention generally features compositions and methods based on the structure-based design of alpha 1-3 N-Acetylgalactosaminyltransferase (alpha 3 GaINAc-T) enzymes from alpha 1-3 galactosyltransferase (a3Gal-T) that can transfer 2′-modified galactose from the corresponding UDP-derivatives due to substitutions that broaden the alpha 3Gal-T donor specificity and make the enzyme a3 GaINAc-T. | 09-08-2011 |
20110217236 | RADIATION SENSITIVE LIPOSOMES - The present invention relates to a radiation sensitive liposome, and the use of this liposome as carrier for therapeutic and diagnostic agent(s). In particular, the invention encompasses a liposomal delivery system, comprising a stable liposome-forming lipid and a polymerizable colipid, a fraction of which polymerizable colipid polymerizes upon exposure to ionizing, radiation, thereby destabilizing the liposomal membrane. Destabilization of liposomes allows for leakage of liposomal contents. The present invention further contemplates methods of diagnosing and treating conditions and diseases that are responsive to liposome-encapsulated or associated agents. | 09-08-2011 |
20110217237 | THERAPEUTIC DLL4 BINDING PROTEINS - DLL4 binding proteins are described herein, including antibodies, CDR-grafted antibodies, humanized antibodies, and DLL4 binding fragments thereof, proteins that bind DLL4 with high affinity, and DLL4 binding proteins that neutralize DLL4 and/or VEGF activity. The DLL4 binding proteins are useful for treating or preventing cancers and tumors and especially for treating or preventing tumor angiogenesis. | 09-08-2011 |
20110217238 | Method of Diagnosing or Prognosing Epithelial Ovarian Cancer - The present invention provides a binding moiety which selectively binds to Sox11 protein and/or mRNA for imaging, diagnosis or prognosis of epithelial ovarian cancer (EOC). Optionally, the moiety is an antibody or antigen-binding fragment thereof. Advantageously, moiety comprises a further, readily detectable moiety. The invention also provides methods of imaging EOC cells as well as methods of diagnosing or prognosing EOC in an individual. A further aspect of the present invention provides a method of identifying cells associated with EOC, the method comprising analysing the pattern of gene expression in a sample of cells to be tested and comparing it to the pattern of gene expression in a sample of known lymphomas cells. Preferably, the cells to be tested are identified as EOC cells if the expression of Sox11 is up-regulated compared to normal B-cells. Preferably EOC cells are identified as improved recurrence-free survival-associated if expression of Sox11 is up-regulated compared with non-cancerous epithelial ovarian cells. Preferably, EOC cells are identified as diminished recurrence-free survival-associated if expression of Sox11 is similar to, or down-regulated, compared with non-cancerous epithelial ovarian cells. | 09-08-2011 |
20110223104 | FLUID BED MEAL CONTAINING A MARKER AND METHODS OF MAKING - A standardized, edible food containing a label for use in the measurement of gastric emptying by the quantification of marker excreted in the breath of the patient and methods of making the same using fluid bed granulation processing. | 09-15-2011 |
20110223105 | NEW 5-AMINOLEVULINIC ACID PRODRUGS FOR USE IN PHOTODYNAMIC THERAPY AND PHOTODYNAMIC DIAGNOSIS - There is provided a compound of Formula | 09-15-2011 |
20110223106 | GRANIN PROTEINS AS MARKERS OF HEART DISEASE - The present invention relates to methods for the diagnosis of impaired cardiac function/heart disease. The present invention provides a method of diagnosing heart disease in a subject, said method comprising determining the level of CgB or SgII, or fragments thereof, in a body fluid of said subject. Such methods can also be used to determine the clinical severity or prognosis of heart disease in a subject. | 09-15-2011 |
20110223107 | ANTIBODIES THAT SPECIFICALLY BLOCK THE BIOLOGICAL ACTIVITY OF A TUMOR ANTIGEN - Novel monoclonal antibodies that specifically bind to KAAG1 are described. In some embodiments, the antibodies block the biological activity of KAAG1 and are useful in composition in certain cancers, more particularly in cancers that have increased cell surface expression of KAAG1, such as ovarian, renal, lung, colorectal, breast, brain, and prostate cancer, as well as melanoma. The invention also relates to cells expressing the monoclonal antibodies and antigen binding fragments such as humanized and chimeric antibodies. Additionally, methods of detecting and treating cancer using the antibodies and fragments are also disclosed. | 09-15-2011 |
20110229410 | TECHNETIUM-DIPYRIDINE COMPLEXES, AND METHODS OF USE THEREOF - One aspect of the invention relates to novel complexes of technetium (Tc) with various heteroaromatic ligands, e.g., pyridyl and imidazolyl ligands, and their use in radiopharmaceuticals for a variety of clinical diagnostic and therapeutic applications. Another aspect of the invention relates to novel pyridyl ligands that form a portion of the aforementioned complexes. Methods for the preparation of the technetium complexes are also described. Another aspect of the invention relates to novel pyridyl ligands based on derivatized lysine, alanine and bis-amino acids for conjugation to small peptides by solid phase synthetic methods. Additionally, the invention relates to methods for imaging regions of a mammal using the complexes of the invention. | 09-22-2011 |
20110229411 | USE OF P2X7 PATHWAY FOR ASSESSING THE SENSITIVITY OF A SUBJECT TO A CANCER TREATMENT - The present invention concerns methods for assessing the sensibility of a subject to an anticancer treatment, for screening compounds which are useful for treating a cancer and for determining the likelihood of a metastatic relapse in a subject. The methods are based on the finding that a non-functional P2X7-elicited NALP3 inflammasome pathway in a subject is indicative of a resistance to treatment. The invention further concerns methods for treating a cancer and for restoring the sensitivity of the subject to a cancer treatment. | 09-22-2011 |
20110236313 | HUMAN SALTY TASTE RECEPTOR AND METHODS OF MODULATING SALTY TASTE PERCEPTION - Methods for identifying modulators of the epithelial sodium ion channel and for identifying modulators of salty taste perception are described. Also featured are isolated human salty taste receptors, artificial lipid bilayers comprising an epithelial sodium ion channels, and kits for practicing the claimed methods. | 09-29-2011 |
20110236314 | METHOD OF DETECTION AND DIAGNOSIS OF ORAL AND NASOPHARYNGEAL CANCERS - The present invention relates to cancer and in particular to oral and nasopharyngeal cancers. In particular, the present invention relates to a method of detection and diagnosis of oral squamous cell carcinoma (OSCC) and nasopharyngeal cancers by determining the expression levels of certain genes. The method comprising (a) determining in a biological sample from the patient the amount of the expression level of at least one gene selected from the group consisting of GNA-12 and IFITM3; and (b) comparing the determined expression levels of said genes in said biological sample with the level in a reference. The invention also relates to polypeptides, antibodies and nucleic acids of the invention for use in medicine and a kit for performing the invention. | 09-29-2011 |
20110236315 | Ligands for Semiconductor Nanocrystals - In this invention, polyimidazole ligands (PILs) incorporating pendant imidazole moieties for nanocrystal binding and either sulfonatebetaine, carboxybetaine, or phosphocholinebetaine moieties for water-solubilization have been developed. Greatly enhanced stability of nanocrystals (both over time and in wide pH range) was achieved by incorporating multi-dentate imidazole moieties which provide strong coordination of the ligand to the nanocrystal surface and prevent aggregation of nanocrystals. Synthesis of betaine PILs was developed by modifying the synthesis of recently developed PEG containing poly imidazole ligands (PEG PILs). These nanocrystals are compact, water soluble, and biocompatible. | 09-29-2011 |
20110243847 | IMAGING DIAGNOSTICS BY COMBINING CONTRAST AGENTS - The present invention relates to the use of a combination of several contrast agents having different properties with respect to imaging representation. | 10-06-2011 |
20110243848 | STAR POLYMERS, METHODS OF PREPARATION THEREOF, AND USES THEREOF - A composition of matter comprising an amphiphilic star polymer, the star polymer comprising a crosslinked microgel core and 6 or more independent polymer arms covalently linked to the core, the 6 or more arms each comprising a hydrophilic polymer chain segment and a hydrophobic polymer chain segment; wherein each individual metal selected from the group consisting of beryllium, magnesium, calcium, strontium, barium, radium, aluminum, gallium, indium, thallium, germanium, tin, lead, arsenic, antimony, bismuth, tellurium, polonium, and metals of Groups 3 to 12 of the Periodic Table has a concentration in the star polymer of greater than or equal to 0 parts per million and less than or equal to 100 parts per million. | 10-06-2011 |
20110243849 | HEME-BINDING PHOTOACTIVE POLYPEPTIDES AND METHODS OF USE THEREOF - The present disclosure provides photoactive polypeptides. A subject photoactive polypeptide is useful in a variety of applications, which are also provided. | 10-06-2011 |
20110243850 | PROBE FOR A BIOLOGICAL SPECIMEN AND LABELLING METHOD AND SCREENING METHOD USING THE PROBE - Provided is a novel probe for a biological specimen for labelling by itself and clearly visualizing one of a specific cell and a specific cell organ in a living body, the probe having excellent spectral characteristics and exhibiting excellent storage stability. The probe for a biological specimen contains, as an active agent, at least one kind of compound represented by a general formula (I). | 10-06-2011 |
20110243851 | GLUCOSE-PEG CONJUGATES FOR REDUCING GLUCOSE TRANSPORT INTO A CELL - There is provided a glucose-PEG conjugate comprising a PEG moiety conjugated to a linear glucose moiety at the C1 position of the glucose moiety. The glucose-PEG conjugate may be used to reduce glucose transport into a cell and may be used to treat a proliferative disorder. | 10-06-2011 |
20110243852 | METHOD FOR THE PRODUCTION OF LABELLED SCAFFOLDS, COMPRISING AT LEAST ONE REACTIVE FLUORINATED SURFACTANT, AND SCAFFOLD PRODUCED THEREWITH - The present invention is related to scaffolds for tissue engineering and organ engineering. More particularly, the present invention is related to a method for the production of a labelled scaffold for tissue and/or organ engineering comprising a reactive fluorinated surfactant, which serve as imaging label for medical imaging means, like CT, MRI, PET, scintigraphy and/or ultrasound imaging and the like. | 10-06-2011 |
20110250138 | SINGLE-STRANDED AND DOUBLE-STRANDED OLIGONUCLEOTIDES COMPRISING A METAL-CHELATING LIGAND - The invention provides modified oligonucleotides of formula (I), comprising at least one metal chelator which provides a powerful tool for study of the pharmacokinetics of siRNA and its correlation with in vivo activity. The chelated metals provide luminescent properties enable detection of the oligonucleotides through the use of time-resolved fluorescent quenching based on energy transfer from the metal ion to a nonfluorescent quencher which can be used as non-isotopic labels of oligonucleotides for diagnostics and evaluation of cellular uptake. | 10-13-2011 |
20110250139 | Modified Pyrazine Derivatives and Uses Thereof - Provided herein are compounds, preparations and formulations comprising pyrazine derivatives having multiple poly(ethylene glycol) containing substituents. Many of the compounds disclosed herein are excretable by the renal system of a subject or patient and are useful for visualizing the renal system of a subject or patient. Upon excitation by electromagnetic radiation, a number of the compounds disclosed herein exhibit luminescence and are externally detectable when present in the body fluid of a patient or subject. Also provided herein are methods for visualizing the renal system of a subject or patient. | 10-13-2011 |
20110250140 | Modified Pyrazine Derivatives and Uses Thereof - In some embodiments, the invention provides modified pyrazine derivatives containing a central pyrazine ring with two secondary amine groups attached directly to the central pyrazine ring and two amino carbonyl groups attached directly to the central pyrazine ring. The secondary amine groups are terminated by alkyl groups containing from 1 to 6 carbons. The amino carbonyl groups can be terminated by a wide range of substituents including, but not limited to, alkyl and alkylene groups, polyether groups, including poly(ethylene glycol) groups, secondary and tertiary amine groups, polyhydroxylated alkyl groups, amino carbonyl groups, amino thioketone groups, and combinations thereof. In some embodiments, the invention provides modified pyrazine derivatives useful as optical agents in a wide variety of biomedical imaging procedures, including diagnostic and imaging procedures. In an embodiment, for example, modified pyrazine derivatives are provided which are useful in monitoring organ and system functioning, for example in monitoring renal system functioning. | 10-13-2011 |
20110256058 | Novel Peptides and Uses Thereof - The invention relates to a peptide of 8-50 amino acids comprising the sequence of KAHKKRAD or KARKKHAD, or a cyclic peptide of 8-50 amino acids comprising the sequence of HKKR or RKKH. Also disclosed are methods of using the peptide for detecting, monitoring, or treating cancer. | 10-20-2011 |
20110256059 | NANOPARTICULATE SYSTEMS PREPARED FROM ANIONIC POLYMERS - The present invention relates to a system for administering active ingredients comprising nanoparticles having an average size of less than 1 micrometer in turn comprising: (a) at least one anionic polymer; (b) a cationic cross-linking agent; and optionally (c) a cationic polymer; characterized in that the nanoparticles are cross-linked by means of electrostatic type interactions. Additionally, the invention relates to pharmaceutical, cosmetic, personal hygiene and nutritional compositions comprising said nanoparticle system, as well as to methods for the preparation and uses thereof. | 10-20-2011 |
20110256060 | MONOCLONAL ANTIBODY AND ITS USE FOR THE IDENTIFICATION OF THE ONCOFETAL ISOFORM OF FIBRONECTIN (B-FN) FOR DIAGNOSIS OR THERPAY - Epitopes localized on FNIII-8 repeat that are normally cryptic but are unmasked by insertion of FNIII-B into the FN molecule and are recognized by specific ligands are described; antibodies or their fragments able to identify the above said Cepitope are also described. | 10-20-2011 |
20110262354 | CYANINE-CONTAINING COMPOUNDS FOR CANCER IMAGING AND TREATMENT - This invention relates generally to cyanine-containing compounds; pharmaceutical compositions comprising cyanine-containing compounds; and methods of using cyanine-containing compounds for cancer cell imaging, cancer cell growth inhibition, and detecting cancer cells, for example. Compounds of the invention are preferentially taken up by cancer cells as compared to normal cells. This allows many uses in the cancer treatment, diagnosis, tracking and imaging fields. | 10-27-2011 |
20110262356 | Active Particles for Bio-Analytical Applications and Methods for Preparation Thereof - Luminescent and/or electroactive nanoparticles suitable for MRI (Magnetic Resonance Imaging) and/or PET (Positron Emission Tomography) are prepared by mixing luminescent or electroactive compounds and ethyl oxide/propyl oxide block-copolymers in an organic solvent, which is thereafter evaporated in order to obtain a residue; and by hydrolyzing-condensating tetraalkoxysilanes in an aqueous solution in the presence of the residue; the obtained nanoparticles show no or a negligible release of the luminescent or electroactive compounds and are useful for bio-analytic and bio-medic applications. | 10-27-2011 |
20110262357 | Metalloporphyrin Derivatives, Nanoparticles Comprising the Same, and Use Thereof for Photodynamic Therapy - Nanovectors are disclosed that make it possible to simultaneously target, image, and treat cancerous cells using photodynamic therapy. Also disclosed are novel molecules (I) derived from porphyrins, silica-based nanoparticles comprising the same, and their use in photodynamic therapy. | 10-27-2011 |
20110262358 | MOLECULAR MARKER FOR CANCER STEM CELL - A molecular marker for detecting a cancer stem cell in a cell mass which is a subject of interest, wherein the molecular marker can be detected in a cancer stem cell contained in the subject of interest but cannot be detected in a normal cell and a cancer cell that is different from a cancer stem cell; a method for determining the presence or absence of a cancer stem cell in a subject of interest by using the molecular marker as an measure; a kit for determining the presence or absence of a cancer stem cell, which comprises at least a reagent for detecting the molecular marker; a polypeptide encoded by the molecular marker; an antibody capable of recognizing an epitope of an expression product of a gene derived from the molecular marker; a nucleic acid capable of inhibiting the expression of the molecular marker; and a nucleic acid vaccine comprising a gene derived from the molecular marker. | 10-27-2011 |
20110268658 | POLYMER-AGENT CONJUGATES, PARTICLES, COMPOSITIONS, AND RELATED METHODS OF USE - Described herein are polymer-agent conjugates and particles, which can be used, for example, in the treatment of cancer. Also described herein are mixtures, compositions and dosage forms containing the particles, methods of using the particles (e.g., to treat a disorder), kits including the polymer-agent conjugates and particles, methods of making the polymer-agent conjugates and particles, methods of storing the particles and methods of analyzing the particles. | 11-03-2011 |
20110274620 | MULTIFUNCTIONAL DEGRADABLE NANOPARTICLES WITH CONTROL OVER SIZE AND FUNCTIONALITIES - In one aspect, the invention relates to polymers, crosslinked polymers, functionalized polymers, nanoparticles, and functionalized nanoparticles and methods of making and using same. In one aspect, the invention relates to degradable polymers and degradable nanoparticles. In one aspect, the invention relates to methods of preparing degradable nanoparticles and, more specifically, methods of controlling particle size during the preparation of degradable nanoparticles. In one aspect, the degradable nanoparticles are useful for complexing, delivering, and releasing payloads, including pharmaceutically active payloads. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present invention. | 11-10-2011 |
20110274621 | Active Particles for Bio-Analytical Applications and Methods for Their Preparation - Nanoparticles, which are luminescent and/or electroactive and/or suitable for MRI (magnetic resonance imaging and/or PET (positron emission tomography) applications, comprise a micelle, which has a hydrophilic shell and an hydrophobic central portion, and a polysilicate core; the micelle comprises a plurality of molecules of a functionalized surfactant having the following structure: M | 11-10-2011 |
20110274622 | Nanocrystal Nano-Emulsion - The invention relates to a nanocrystal formulation in the form of a nano-emulsion, comprising a continuous aqueous phase and at least one dispersed oily phase, in which the oily phase comprises at least one amphiphilic lipid and at least one solubilising lipid, and in which the aqueous phase comprises a cosurfactant. | 11-10-2011 |
20110274623 | Stabilized Fibronectin Domain Compositions, Methods and Uses - A protein scaffold based on a consensus sequence of fibronectin type III (FN3) proteins, such as the tenth FN3 repeat from human fibronectin (human Tenascin), including isolated nucleic acids that encode a protein scaffold, vectors, host cells, and methods of making and using thereof, exhibit enhanced thermal and chemical stability while presenting six modifiable loop domains which can be engineered to form a binding partner capable of binding to a target for applications in diagnostic and/or therapeutic compositions, methods and devices. | 11-10-2011 |
20110280805 | NEUROTOXIC STEROL GLYCOSIDES - The invention relates to compositions for use in animal models of neurodegenerative disease and methods therefor. More particularly, the invention relates to the use of neurotoxic sterol glycosides or neurotoxic glycolipids, or combinations thereof, in animal models of neurodegenerative disease. Neurotoxicity-modulating chromenols can also be used in these animal models in combination with the neurotoxic sterol glycosides or neurotoxic glycolipids, or combinations thereof. | 11-17-2011 |
20110280806 | DYE CONJUGATE IMAGING AGENTS - The present invention relates to imaging agents suitable for in vivo optical imaging, which comprise conjugates of dihydrocarbazolium dyes with biological targeting moieties, such as peptides. Also disclosed are pharmaceutical compositions and kits, as well as in vivo imaging methods. The dihydrocarbazolium dyes are functionalised with water solubilising groups and have functional groups which facilitate conjugation to biological targeting moieties. | 11-17-2011 |
20110286923 | NOVEL CONJUGATES OF POLYMERS HAVING A THERAPEUTICALLY ACTIVE AGENT AND AN ANGIOGENESIS TARGETING MOIETY ATTACHED THERETO AND USES THEREOF IN THE TREATMENT OF ANGIOGENESIS RELATED DISEASES - Conjugates of a polymer having attached thereto an angiogenesis targeting moiety and a therapeutically active agent such as an anti-cancer agent or anti-angiogenesis agent, and processes of preparing same are disclosed. | 11-24-2011 |
20110286924 | NOVEL HUMAN ENDOGENOUS RETROVIRAL ERV3 VARIANT AND USES THEREOF IN THE DIAGNOSING OVARIAN CANCER - The present invention relates to polynucleotide and polypeptide sequences of a novel human endogenous retroviral ERV3 variant which is differentially expressed in ovarian cancer cells when compared to normal cells. The present invention more particularly relates to the use of these polynucleotide and polypeptide in the diagnosis, prognosis or treatment of cancer and in the detection of cancer cells. | 11-24-2011 |
20110286925 | Embolizing Sclerosing Hydrogel - A sclerosing embolizing hydrogel comprising from about 0.1% by weight to about 4.0% by weight of chitosan; from about 0.01M to about 1M of hydrochloric acid; from 0% by volume to about 40% by volume of iopamidol; from 0.5% by weight to about 25% by weight of β-glycerophosphate disodium salt; and from about 0.05% by weight to about 4% by weight of sodium tetradecyl sulphate. Also a kit for synthesizing the hydrogel and a method using the hydrogel to treat a vascular defect in a subject. | 11-24-2011 |
20110286926 | DEGRADABLE HYDROGEL COMPOSITIONS AND METHODS - This invention concerns an in situ biodegradable hydrogel drug delivery system in which the components are assembled in a manner that provides a mechanism for the timed cleavage of a particular amide bond in a covalently linked active agent or of the hydrogel structure. | 11-24-2011 |
20110293521 | Anti-viral compositions and methods for administration - Certain embodiments disclosed relate to compositions, including therapeutic compositions, methods, articles of manufacture, systems, and devices. Certain embodiments relate to anti-viral compositions, methods, articles of manufacture, systems and devices. | 12-01-2011 |
20110293522 | SURFACE MODIFICATION OF POLYMERS VIA SURFACE ACTIVE AND REACTIVE END GROUPS - Polymer surface modification method comprising the steps of first forming a surface of primary reactive end groups tethered to the polymer chain ends during fabrication of an article, and then modifying the reactive surface with bio-active molecules, hydrophilic and hydrophobic monomers, oligomers, or polymers to attain specific surface properties. Alternatively, a multifunctional coupling agent can be used to couple the primary reactive group to a second reactive group capable of reacting with a functional group associated with bio-active molecules, hydrophilic and hydrophobic monomers, oligomers, and polymers to attain specific surface properties. The invention involves bringing reactive endgroups to the surface with surface active spacer attached to the polymer chain end. The surface active spacer allows the migration and enrichment of reactive end groups to the surface during fabrication. The invention provides medical devices having a bio-interface with anti-thrombogenic properties, lubricity, selective adsorption, and antimicrobial properties. | 12-01-2011 |
20110293523 | Diagnostic agent - A method of conducting an endoscopic observation of an inner wall of a gastrointestine by applying a diagnostic agent to the inner wall of the gastrointestine, the diagnostic agent being an acidic aqueous solution of pH 1 to 5 containing a colorant, and conducting the endoscopic observation of the inner wall. The acidic aqueous solution can contain at least one acid selected from a carboxylic acid, hydrochloric acid, sulfuric acid and phosphoric acid. By applying the diagnostic agent to the inner wall of the gastrointestine in the endoscopic observation, it is possible to clearly observe a lesion which is difficult to be determined. In particular, the method can be used for observing lesions having cancer cells in the stomach or the Barrett's esophagus. | 12-01-2011 |
20110300074 | 3,6-DISUBSTITUTED XANTHYLIUM SALTS - This invention pertains generally to processes, uses, methods and materials utilising particular xanthylium compounds, including compounds of formula (I) and (II), as further defined herein. These compounds are useful as drugs, for example, in the treatment of tauopathies, such as Alzheimer's disease. | 12-08-2011 |
20110300075 | Method of Risk Management for Patients Undergoing Natalizumab Treatment - Progressive multifocal leukoencephalopathy (PML) has been identified in patients taking natalizumab (NMAB) for the treatment of multiple sclerosis (MS). This patent application provides a novel method of patient screening and monitoring intended to decrease the risk of PML and other opportunistic central nervous system (CNS) diseases in patients undergoing MS therapy with NMAB, and proposes a novel method of screening and monitoring intended to decrease the risk of opportunistic disease processes of the CNS during the treatment of other medical disorders with NMAB. | 12-08-2011 |
20110305638 | Modulation of Macrophage Activation - The invention provides methods for treating pathological conditions associated with an undesirable inflammatory component. The invention is generally directed to reducing inflammation by administering cells that modulate macrophage activation. The invention is also directed to drug discovery methods to screen for agents that modulate the ability of the cells to modulate macrophage activation. The invention is also directed to cell banks that can be used to provide cells for administration to a subject, the banks comprising cells having desired potency to modulate macrophage activation. | 12-15-2011 |
20110305639 | METHOD AND FORMULATION FOR REDUCING AGGREGATION OF A MACROMOLECULE UNDER PHYSIOLOGICAL CONDITIONS - The invention provides a method for reducing aggregation and inhibiting flocculation of a macromolecule, such as a protein, under physiological conditions, by the addition of certain cyclodextrins (CDs). The invention also provides a method to minimize inflammation at the injection site during subcutaneous administration of a macromolecule and pharmaceutical formulations for such administration. Further the invention provides methods of treating a CD20 positive cancer or an autoimmune disease, comprising administering a humanized anti-CD20 antibody in a pharmaceutical formulation of the invention. The invention further provides an in vitro dialysis method to evaluate the ability of an excipient to reduce aggregation of an antibody or other macromolecule under physiological conditions. | 12-15-2011 |
20110305640 | METHOD TO TREAT PSORIASIS AND OTHER HYPERPROLIFERATIVE SKIN DISORDERS - Soluble adenylyl cyclase (sAC) is implicated in proliferation of keratinocytes. Inhibitors of sAC are useful for the treatment and/or prevention of psoriasis and other hyperproliferative skin disorders. Assays to identify such compounds are also described. | 12-15-2011 |
20110311448 | ANTIBODY TO RAGE AND USES FOR IN VIVO IMAGING OR FOR TARGETING THERAPY - This invention discloses an antibody which is raised to a peptide, the sequence of which is: N-R-N-G-K-E-T-K-S-N-Y-R-V-R-V-Y-Q-I-P, N-R-R-G-K-E-V-K-S-N-Y-R-V-R-V-Y-Q-I-P, S-R-N-G-K-E-T-K-S-N-Y-R-V-Q-V-Y-Q-I-P, N-R-R-G-K-E-V-K-S-N-Y-R-V-R-V-Y-Q-I-C, or Ac-N-R-R-G-K-E-V-K-S-N-Y-R-V-R-V-Y-Q-I-C-amide. This antibody can be labeled with an imageable marker or linked to an agent. This antibody can be a monoclonal antibody. The invention also includes a method for determining the location of receptor advanced glycation endproduct (RAGE) in a subject comprising administering the antibody labeled with an imageable marker and detecting the location of the labeled antibody in the subject thereby determining the location of RAGE in the subject. This invention further describes a method for treating a RAGE-related disorder in a subject comprising administering to the subject a therapeutically effective amount of the antibody which binds to the above-described epitope linked to an agent. | 12-22-2011 |
20110311449 | Antibodies - The present invention provides antibodies which bind to CXC chemokine receptor 4 (CXCR4) and which do not induce significant apoptosis of CXCR4 expressing cells. Also provided are inter alia immunoconjugates and compositions comprising such antibodies and methods and uses involving such antibodies, particularly in the medical and diagnostic fields. | 12-22-2011 |
20110311450 | POLYPEPTIDES AND POLYNUCLEOTIDES, AND USES THEREOF AS A DRUG TARGET FOR PRODUCING DRUGS AND BIOLOGICS - This invention relates to a novel target for production of immune and non-immune based therapeutics and for disease diagnosis. More particularly, the invention provides therapeutic antibodies against KRTCAP3, FAM26F, MGC52498, FAM70A or TMEM154 antigens, which are differentially expressed in cancer, and diagnostic and therapeutic usages. This invention further relates to extracellular domains of KRTCAP3, FAM26F, MGC52498, FAM70A and TMEM154 proteins and variants, and therapeutic usages thereof. | 12-22-2011 |
20110311451 | SYNTHESIS OF POLYMER CONJUGATES OF INDOLOCARBAZOLE COMPOUNDS - The present invention relates to a process for the preparation of polymer conjugates of iπdolocarbazole compounds, in particular of polymer conjugates of K-252a and derivatives thereof, by a synthetic route which results in a highly pure product, with a high product yield. In a further aspect the present invention relates to novel polymer conjugates of K-252a and derivatives thereof, wherein the chemical group linking the polymer unity to the K-252a or to the K-252a derivative compound is characterised by a 5-member oxazolidindionic cyclic structure. These novel polymer conjugates are obtained through the novel synthetic route with high purity and high yields, | 12-22-2011 |
20110311452 | INFLAMMATION TARGETING PARTICLES - Opsonizable micro- or nanoparticles, that contain at least one active agent, such as an imaging or therapeutic agent; that have a positive surface charge and that do not contain on their surface targeting ligands, such as antibodies, peptides or aptamers, can be used to treating and/or monitoring a condition associated with an inflammation, such as a cytokine stimulated inflammation. | 12-22-2011 |
20110311453 | Alloyed semiconductor quantum dots and concentration-gradient alloyed quantum dots, series comprising the same and methods related thereto - An alloyed semiconductor quantum dot comprising an alloy of at least two semiconductors, wherein the quantum dot has a homogeneous composition and is characterized by a band gap energy that is non-linearly related to the molar ratio of the at least two semiconductors; a series of alloyed semiconductor quantum dots related thereto; a concentration-gradient quantum dot comprising an alloy of a first semiconductor and a second semiconductor, wherein the concentration of the first semiconductor gradually increases from the core of the quantum dot to the surface of the quantum dot and the concentration of the second semiconductor gradually decreases from the core of the quantum dot to the surface of the quantum dot; a series of concentration-gradient quantum dots related thereto; in vitro and in vivo methods of use; and methods of producing the alloyed semiconductor and concentration-gradient quantum dots and the series of quantum dots related thereto. | 12-22-2011 |
20110311454 | MOLECULES WITH EXTENDED HALF-LIVES, COMPOSITIONS AND USES THEREOF - The present invention provides molecules, including IgGs, non-IgG immunoglobulins, proteins and non-protein agents, that have increased in vivo half-lives due to the presence of an IgG constant domain, or a portion thereof that binds the FcRn, having one or more amino acid modifications that increase the affinity of the constant domain or fragment for FcRn. Such proteins and molecules with increased half-lives have the advantage that smaller amounts and or less frequent dosing is required in the therapeutic, prophylactic or diagnostic use of such molecules. | 12-22-2011 |
20110318267 | PH-RESPONSIVE NANOSTRUCTURES - The present invention relates to compositions comprising stimuli-responsive materials which can be used for delivery of agents. Materials are provided that can respond to changes in a surrounding environment, including changes in ion concentration. For example, one or more properties of the material may be affected by a change in pH and/or a change in the concentration of an ion. Such properties may include, for example, a dimension of the material (e.g., volume), the permeability of the material, and the like. In cases where the material comprises a therapeutic or diagnostic agent, the material may undergo a change in the rate of release of the agent upon exposure to certain conditions. The invention may also provide the use of said compositions for the manufacture of a medicament for delivering a therapeutic or diagnostic agent, in some cases, with enhanced selectivity and sensitivity. | 12-29-2011 |
20110318268 | HERPES SIMPLEX VIRUS (HSV) WITH MODIFIED TROPISM, USES AND PROCESS OF PREPARATION THEREOF - A modified Herpes Simplex Virus (HSV), which has a portion of gD (glycoprotein D) of the glycoproteic envelope deleted and a heterologous single chain antibody inserted in place of such deleted portion; the modified HSV is capable of infecting cells through receptor HER2/ErbB2 but not through receptors HVEM/HveA and nectin1/HveC; uses of the modified HSV and a process of the preparation thereof are also disclosed. | 12-29-2011 |
20110318269 | Method For Screening Phage Display Libraries Against Each Other - The present invention relates to a method for screening phage display libraries against each other. In particular, the invention relates to a method for screening at least two phage display libraries against each other to identify and/or select one or more interacting binding partners or binding molecules making up such interacting binding partners. Kits providing two bispecific phage display libraries are also provided. | 12-29-2011 |
20110318270 | DRUG IDENTIFICATION PROTOCOL FOR TYPE 2 DIABETES BASED ON GENE EXPRESSION SIGNATURES - It relates generally to the field of drug identification and evaluation and therapeutic optimization. More particularly, it provides a protocol for identifying compounds useful in the treatment of TNFα associated diabetes or a condition associated with diabetes based on a signature of genomic or proteomic expression. Diagnostic and prognostic protocols for diabetes and conditions associated therewith are also provided. Further, optimization of therapeutic intervention is also provided. | 12-29-2011 |
20120003155 | DENDRIMER BASED NANODEVICES FOR THERAPEUTIC AND IMAGING PURPOSES - A nanodevice composition including N-acetyl cysteine linked to a dendrimer, such as a PAMAM dendrimer or a multiarm PEG polymer, is provided. Also provided is a nanodevice for targeted delivery of a compound to a location in need of treatment. The nanodevice includes a PAMAM dendrimer or multiarm PEG polymer, linked to the compound via a disulfide bond. There is provided a nanodevice composition for localizing and delivering therapeutically active agents, the nanodevice includes a PAMAM dendrimer or multiarm PEG polymer and at least one therapeutically active agent attached to the PAMAM dendrimer or multiarm PEG polymer. A method of site-specific delivery of a therapeutically active agent, by attaching a therapeutically active agent to a PAMAM dendrimer or multiarm PEG polymer using a disulfide bond, administering the PAMAM dendrimer or multiarm PEG polymer to a patient in need of treatment, localizing the dendrimer or multiarm PEG polymer to a site in need of treatment, and releasing the therapeutically active agent at the site in need of treatment. | 01-05-2012 |
20120003156 | METHODS FOR TREATING NEOPLASIA BY INHIBITING LACTATE DEHYDROGENASE AND/OR NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE - The invention provides compositions for the diagnosis or treatment of neoplasias, including lymphomas, leukemias, brain cancers (e. glioblastomas, medulloblastomas), breast cancer, colon cancer, and pancreatic cancer, and methods of use therefor. | 01-05-2012 |
20120003157 | USE OF ANTI-90K MONOCLONAL ANTIBODIES FOR THE PREVENTION AND TREATMENT OF TUMORS AND METASTASES THEREOF - The present invention relates to the use of anti-90K monoclonal antibodies for prevention and treatment of tumors and metastases thereof. In particular, the invention relates to the use of anti-90K monoclonal antibodies able to inhibit the adhesive processes of tumor cells and angiogenesis in tumors such as breast cancer, ovarian cancer, lung cancer, gastrointestinal cancer, melanoma, lymphoma and other tumors overexpressing 90K. | 01-05-2012 |
20120014874 | PHOTOSENSITIZER-METAL NANOPARTICLE CHARGE COMPLEX AND COMPOSITION CONTAINING THE COMPLEX FOR PHOTODYNAMIC THERAPY OR DIAGNOSIS - Provided are a photosensitizer-metal nanoparticle charge complex and a composition for photodynamic therapy or diagnosis containing the same. The complex includes a metal nanoparticle, a photosensitizer charged with a first charge, and a linker bound to the metal nanoparticle and charged with a second charge having an opposite polarity to the first charge. During circulation in blood, the photosensitizer-metal nanoparticle charge complex is maintained in a complex type, and thus duration of a side effect of photosensitivity can be reduced. In a tumor tissue, the complex is specifically accumulated, but in a normal tissue, it is difficult for the complex to penetrate. Thus, the complex can selectively destroy the tumor tissue. Moreover, selective fluorescence in the tumor tissue can provide further improvement in accuracy of diagnosing a tumor using the complex. | 01-19-2012 |
20120014875 | NUCLEIC ACID APTAMERS - The present invention relates to optimized aptamers and methods of using these aptamers. | 01-19-2012 |
20120014876 | ANTAGONISTIC PEPTIDES FOR FRIZZLED-1 AND FRIZZLED-2 - The invention is in the field of molecular medicine. It provides antagonistic compounds for frizzled 1 and/or frizzled 2 receptors, which may be useful in molecular imaging of the wound healing process after myocardial infarction and in therapeutic intervention into wound healing after remodeling of the heart, thereby ameliorating the consequences of myocardial infarction. The invention provides a method for antagonizing frizzled-1 or frizzled-2 receptors, wherein the receptor is contacted with a composition comprising a linear fragment of Wnt3(a) or Wnt5a or a functional analogue thereof, which comprises at least one cysteine residue, one threonine residue, one aspartic acid residue and one glycine residue. | 01-19-2012 |
20120014877 | COMPOSITIONS AND METHODS TO TREAT CANCER WITH CpG RICH DNA AND CUPREDOXINS - The present invention relates to compositions comprising CpG rich DNA from | 01-19-2012 |
20120014878 | Synthesis of Oligonucleotide Mediated Gold Core- Silver Shell Nanoparticles - The present invention relates to synthesis of oligonucleotide mediated gold core- silver shell nanoparticles and testing their SERS performance. A Raman reporter molecule and twelve-base long oligonucleotide are simultaneously attached on gold nanoparticles and a silver layer is deposited on the modified gold nanoparticles. The SERS performance of gold core- silver shell nanoparticles (CSNPs) is much greater than the CSNPs prepared without oligonucleotides and the same size non-modified gold nanoparticles after silver staining. | 01-19-2012 |
20120020885 | MHC-Less cells - The present disclosure relates to compositions, methods, systems, computer-implemented methods, and computer program products thereof that relate to biological cells for delivery of at least one therapeutic agent to a biological tissue or subject. | 01-26-2012 |
20120020886 | THERMAL SPIN CROSS-OVER COMPOUNDS AND METHODS OF USING SAME - A compound has the of Formula I or a salt thereof: | 01-26-2012 |
20120020887 | Use of Simple Amino Acids to Form Porous Particles - Particles having a tap density of less than 0.4 g/cm | 01-26-2012 |
20120020888 | BIOMARKER - Described are bladder cancer specific biomarkers and lung cancer specific biomarkers comprising the nucleic acid sequence of the Engrailed-2 (EN2) gene or the amino acid sequence of the encoded EN2 protein. Also described are uses of the biomarkers in the treatment, diagnosis, monitoring and imaging of bladder cancer and lung cancer. | 01-26-2012 |
20120020889 | Polypeptides Targeting Vascular Endothelial Growth Factor Receptor-2 and Alpha V Beta 3 Integrin - Polypeptides comprising variant vascular endothelial growth factor sequences are provided. The polypeptides are useful in cancer imaging, cancer diagnosis, monitoring and treatment as well as treatment of diseases characterized by excessive neovascularization. | 01-26-2012 |
20120020890 | STAPHYLOCOCCUS AUREUS PROTEINS AND NUCLEIC ACIDS - The invention provides proteins from | 01-26-2012 |
20120027676 | MODIFIED SODIUM IODIDE SYMPORTER PROTEINS AND USES THEREOF - A modified sodium iodide symporter (NIS) protein is provided. The modified NIS protein comprises an amino acid sequence of SEQ ID NO.1 with the proviso that at least one amino acid residue within SEQ ID NO. 1 is changed. The modified NIS protein has an enhanced transport function, and the expression of the modified NIS protein in the cells results in higher intracellular levels of a substrate of a NIS protein than does the expression of the same amount of a wild-type NIS protein. | 02-02-2012 |
20120027677 | Prion-specific peptoid reagents - The invention relates to peptoid reagents that interact preferentially with a pathogenic form of a conformational disease protein as compared to a nonpathogenic form of the conformational disease protein where the peptoid reagent comprises an amino-terminal region, a carboxy-terminal region, and at least one peptoid region between the amino-terminal region and the carboxy-terminal region where the peptoid region comprises 3 to about 30 N-substituted glycines, and optionally one or more amino acids. The invention also relates to methods of using the peptoids in detecting and isolating prions, and in the treatment and prevention of prion-related diseases. | 02-02-2012 |
20120027678 | METHOD OF USING STEM CELLS TO AID IN DIAGNOSIS - The present invention provides a method for the in vitro culture of embryonic stem cells, wherein the stem cells continue to express no antigen or antigen CD117, and mostly remain undifferentiated during culture. The present invention also relates to purified preparations of embryonic stem cells and for uses of embryonic stem cells in treating a wide variety of conditions, diseases and disorders. | 02-02-2012 |
20120027679 | CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING AND PHOTOACOUSTIC IMAGING METHOD USING THE SAME - It is intended to provide a novel contrast agent for photoacoustic imaging that is highly capable of binding to a target molecule and generates high photoacoustic signals. The present invention provides a contrast agent for photoacoustic imaging represented by Formula 1: | 02-02-2012 |
20120027680 | OXIME CONJUGATES AND METHODS FOR THEIR FORMATION AND USE - The present invention relates to biodegradable biocompatible polyketals, methods for their preparation, and methods for treating animals by administration of biodegradable biocompatible polyketals. In one aspect, a method for forming the biodegradable biocompatible polyketals comprises combining a glycol-specific oxidizing agent with a polysaccharide to form an aldehyde intermediate, which is combined with a reducing agent to form the biodegradable biocompatible polyketal. The resultant biodegradable biocompatible polyketals can be chemically modified to incorporate additional hydrophilic moieties. A method for treating animals includes the administration of the biodegradable biocompatible polyketal in which biologically active compounds or diagnostic labels can be disposed. | 02-02-2012 |
20120027681 | Low-Aspect Ratio Carbon Nanostructures - Low-aspect ratio nanostructures, such as nanocups, nanorings, and arrays of nanocups and nanorings, methods of fabrication of nanostructures, and methods of using nanostructures are disclosed. | 02-02-2012 |
20120027682 | Pyrazine Derivatives for Optical Imaging and Therapy - The invention provides compounds, including compositions, preparations and formulations, and methods of using and making such compounds. Compounds of the present invention include pyrazine derivatives having a pyrazine core and a plurality of substituents. In some embodiments, pyrazine derivatives of the invention are pyrazine core compounds having one or more electron donating groups and one or more electron withdrawing groups optionally functionalized to provide useful optical, biological, pharmacokinetic and/or physical properties. | 02-02-2012 |
20120034166 | AMYLOID BETA(1-42) OLIGOMERS, DERIVATIVES THEREOF AND ANTIBODIES THERETO, METHODS OF PREPARATION THEREOF AND USE THEREOF - The invention relates to neuromodulatory oligomers of the amyloid-β(1-42) protein, a particular production method, by means of which the oligomer can be obtained in a reproducible manner at high yield, the use of the oligomers as diagnostic and therapeutics agents, for the generation of oligomer-specific antibodies and for the discovery of substances which can interact with the oligomers and in the formation thereof. Corresponding methods for the production of the antibodies and for discovery of the substances are also disclosed as are the antibodies themselves and the use of the antibodies or substances as diagnostic and therapeutic agents. The invention further relates to derivatives of the oligomers and oligomers based on abbreviated forms of the amyloid-β(1-42) proteins, the production and use thereof. | 02-09-2012 |
20120039804 | Novel Tricyclic Modulators of Cannabinoid Receptors - The compounds of the invention are modulators of cannabinoid receptors CB1 or CB2. The compounds can be used for the prevention or treatment of, e.g., pain, cancer, skin diseases, weight-associated disorders, chemical addictions, psychiatric disorders, neurodegenerative disorders, bone diseases, and inflammatory diseases. The compounds of the invention can further be used to study these diseases and disorders, as well as cannabinoid receptor biology, by coupling the compounds to, e.g., imaging agents. | 02-16-2012 |
20120039805 | Therapeutics And Methods For Treating Neoplastic Diseases Comprising Determining The Level Of Caveolin-1 And/Or Caveolin-2 In A Stromal Cell Sample - The invention provides diagnostic and therapeutic methods for neoplastic disease patients with neoplasms of for example, the breast, skin, kidney, lung, pancreas, rectum and colon, prostate, bladder, epithelial, non-epithelial; lymphomas, sarcomas, melanomas, and the like, comprising determining the level of caveolin-1 and/or caveolin-2 in stromal cells adjacent to a neoplasm. | 02-16-2012 |
20120039806 | Compounds and Methods for Modulating an Immune Response - The present invention relates to the identification of proteins which bind the dendritic cell marker known as Clec9A. The present invention provides new compounds for targeting therapeutic agents such as antigens to dendritic cells. Also provided are methods of modulating a humoral and/or T cell mediated immune response to the antigen, methods of delivery of a cytotoxic agent to dendritic cells thereof involved in diseased states, methods of modulating the uptake and/or clearance of cells with a disrupted cell membrane, cells infected with a pathogen, dying cells or dead cells, or a portion thereof, and methods of modulating antigen recognition, processing and/or presentation, as well as immune responses to material derived from cells with a disrupted cell membrane, cells infected with a pathogen, dying cells or dead cells, or a portion thereof. | 02-16-2012 |
20120039807 | Anti-Tenascin-C A2 Antibodies and Methods of Use - The invention provides antibodies against the A2 domain of tenascin-C and methods of using the same. | 02-16-2012 |
20120039808 | Brain Tumor Stem Cell Differentiation Promoter, and Therapeutic Agent for Brain Tumor - A promoter for differentiation of brain tumor initiating cells is provided. | 02-16-2012 |
20120039809 | SYSTEMS AND TECHNIQUES FOR MONITORING SUBJECTS - The present invention generally relates to systems and methods for monitoring and/or providing feedback for drugs or other pharmaceuticals taken by a subject. In one aspect, the present invention is directed to devices and methods for determining a species within the skin of a subject; and producing feedback to a subject based on the determination of the species. The feedback may be, for example, visual, audible, tactile, a change in temperature, etc. In some cases, information regarding the determination of the species may be transmitted to another entity, e.g., a health care provider, a computer, a relative, etc., which may then provide feedback to the subject in some fashion. In some cases, the feedback may be directly indicative of the species, e.g., whether the species is present, the concentration of the species, whether a by-product of a reaction involving the species is present, whether a compound affected by the species is present, etc. However, the feedback may also be indirect in some embodiments. For example, the subject may be presented with an external reward, e.g., based on the determination of the species within the skin. For instance, a reward such as cash, coupons, songs, discounts, personal items, etc., may be offered based on the level of compliance of the subject. Still other aspects of the invention are generally directed to kits involving such devices (with or without the drug to be monitored), methods of promoting such systems, or the like. | 02-16-2012 |
20120039810 | APTAMER-CONTAINING COMPOSITIONS AND METHODS FOR TARGETING E-SELECTIN - An isolated nucleic acid molecule that selectively binds to an E-selectin protein comprises a contiguous 29-30 nucleotide sequence that includes at least one monothiophosphate or a dithiophosphate modified nucleotide. Also disclosed are methods of inhibiting an E-selectin mediated interaction with a natural E-selectin ligand, and methods of targeting an imaging agent or therapeutic agent to a target tissue bearing E-selectin. | 02-16-2012 |
20120039811 | MARKERS FOR CANCER DETECTION - The present invention relates to methods for detecting, prognosing and staging cancers, in particular cancers of the gastrointestinal tract. The methods of the invention comprise detecting specific protein markers in a tissue of interest, wherein the detected levels thereof may be indicative of pre-cancerous or cancerous tissue, or the stage or prognosis of a cancer. Further provided are methods of treating cancer, and cancer detection kits. | 02-16-2012 |
20120045395 | MicroRNAs In Idiopathic Pulmonary Fibrosis - The present invention relates to the discovery that certain microRNAs are differentially expressed in Idiopathic Pulmonary Fibrosis. The present invention provides for diagnostic methods, therapeutic methods, and kits related to these differentially expressed microRNAs. | 02-23-2012 |
20120045396 | POROUS STRUCTURES WITH MODIFIED BIODEGRADATION KINETICS - Biodegradation kinetics of biodegradable porous objects, such as porous silicon objects, can be controlled by a molecular weight of polymer chains, such as polyethylene glycol chains, disposed on an outer surface of the object. Provided are biodegradable porous objects, which have their biodegradation kinetics controlled by a molecular weight of the disposed polymer chains. Also provided are methods of making such biodegradable porous objects as well as methods of using such biodegradable porous objects for delivery of active agents, such as therapeutic agents and/or imaging agents. | 02-23-2012 |
20120058050 | LOADED LATEX OPTICAL MOLECULAR IMAGING PROBES CONTAINING LIPOPHILIC LARGE STOKES SHIFT DYES - The present invention relates to a loaded particle comprising at least one fluorescent dye, and in particular, a fluorescent dye with a large Stokes shift. The invention further relates to a method for producing an loaded latex particle, loaded with a fluorescent dye having a large stokes shift. In addition, the present invention relates to latex particles loaded with fluorescent dyes that are organic solvent soluble and insoluble in water. In a preferred embodiment, when the dyes are loaded into the water soluble latex particle, an increase is observed in quantum yield of fluorescence as compared to the quantum yield of the dye in aqueous solvent. | 03-08-2012 |
20120058051 | ANTI-HUMAN ROR1 ANTIBODIES - The invention relates to antibodies having specificity for human ROR1, compositions thereof, and methods for using such antibodies, including in the diagnosis and treatment of disorders associated with aberrant ROR1 expression. | 03-08-2012 |
20120070375 | COMPLEX AND CONTRAST AGENT FOR PHOTOIMAGING USING THE SAME - There is provided a gelatin-ICG complex that can suppress leakage of ICG included therein. The complex has a gelatin derivative including at least one of a phospholipid covalently bonded to a gelatin or a cholesterol covalently bonded to a gelatin, and indocyanine green. | 03-22-2012 |
20120070376 | YEAST CELL WALL PARTICLES FOR RECEPTOR-TARGETED NANOPARTICLE DELIVERY - The present invention generally relates to yeast cell wall microparticles loaded with nanoparticles for receptor-targeted nanoparticle delivery. In particular, the present invention relates to trapping nanoparticles either on the surface or inside a yeast glucan particles, for example, yeast glucal particles. The present invention further relates to methods of making the yeast cell wall particles loaded with nanoparticles. The present invention also relates to methods of using the yeast cell wall particles loaded with nanoparticles for receptor-targeted delivery of the nanoparticles, e.g., drug containing nanoparticles. | 03-22-2012 |
20120070377 | COMPOUNDS AND BIOLOGICAL MATERIALS AND USES THEREOF - The invention provides compounds of Formula (I): wherein b, D, R | 03-22-2012 |
20120076729 | METHODS OF TREATING CANCERS - The present application describes methods for treating and/or preventing cancer or a cancer symptom, e.g., AMPK-related cancers, in a patient in need thereof comprising administering to the patient a therapeutically effective amount of an FGF, e.g., FGF21, or an FGF agonist, or a pharmaceutical composition comprising the same. | 03-29-2012 |
20120076730 | PEPTIDES FOR TRANSPORT OF THERAPEUTICS AND THEIR CARRIERS IN MOUSE MODELS AND HUMANS - A system for targeted delivery of agents (e.g., molecular probes, diagnostic agents, therapeutic agents, imaging agents, research or analytical compounds, enzymes, peptides, proteins, lipids, lipoproteins, sugars, hormones, vitamins, nucleic acids, viruses, bacteria, and/or cells) including use of a composition containing the agent and a targeting moiety, specific for a determinant at the target location. An exemplary composition of the system includes a targeting moiety of one of peptides γ3, 2γ3, 3γ3, A1, B7, B8, B9, B1O, and D6, specific for targeting ICAM-I. The system enables effective, versatile, and safe targeting and transport of agents. The system is useful in research applications, as well as in the context of translational science and clinical interventions. | 03-29-2012 |
20120082620 | METHODS AND COMPOSITIONS FOR TREATMENT OF ADD/ADHD, DEPRESSION, MEMORY PROBLEMS AND OTHER CONDITIONS - Disclosed herein are compositions and methods for treating a variety of mood and behavioral disorders, including attention deficit hyperactivity disorder (ADHD), anxiety, depression, memory loss, as well as other conditions. Also disclosed herein are methods for diagnosing certain conditions, such as ADHD, using these compositions. | 04-05-2012 |
20120082621 | SWALLOWTAIL MOTIFS FOR IMPARTING WATER SOLUBILITY TO PORPHYRINIC COMPOUNDS - Porphyrinic compounds that contain solubilizing groups are described, along with methods of making and using the same and compositions comprising such compounds. Examples of such compounds include compounds compounds of Formula I: | 04-05-2012 |
20120087862 | ORGAN-SPECIFIC PROTEINS AND METHODS OF THEIR USE - The present invention relates generally to methods for identifying and using organ-specific proteins and transcripts. The present invention further provides compositions comprising organ-specific proteins and transcripts encoding the same, detection reagents for detecting such proteins and transcripts, and diagnostic panels, kits and arrays for measuring organ-specific proteins/transcripts in blood, biological tissue or other biological fluid. | 04-12-2012 |
20120087863 | Peptide Derivative and Use of the Same - A new peptide derivative is provided. The peptide derivative is represented by the following general formula (I), | 04-12-2012 |
20120093728 | MITOCHONDRIAL INHIBITORS TO TREAT HUMAN DISEASE - The present invention relates to inhibitors of mitochondria-associated, granulocyte-macrophage colony stimulating factor signaling molecule (Magmas), and related compositions and uses thereof. | 04-19-2012 |
20120093729 | NOVEL PHOSPHORUS-CONTAINING PRODRUGS - Novel cyclic phosphoramidate prodrugs of drugs of formula I | 04-19-2012 |
20120100074 | HUMANIZED ANTIBODIES AGAINST LIGHT AND USES THEREOF - The present invention is directed to antigen-binding polypeptides, or variants or derivatives thereof which specifically bind the LIGHT polypeptide. The invention is also directed to methods of making and using such antibodies specifically in the treatment or diagnosis of immune, inflammatory and malignant diseases or conditions (e.g. inflammatory bowel disease; Crohn's disease, ulcerative colitis, multiple sclerosis, rheumatoid arthritis and transplantation). | 04-26-2012 |
20120100075 | Fluorescent Gold Nanocluster Matrix - The present invention discloses a fluorescent gold nanocluster, comprising: a dihydrolipoic acid ligand (DHLA) on the surface thereof, wherein the fluorescent gold nanocluster generates fluorescence by the interaction between the dihydrolipoic acid ligand and the nanocluster and the particle diameter of the fluorescent gold nanocluster is between 0.5 nm and 3 nm, wherein the wavelength of the emission fluorescence of the fluorescent gold nanocluster is between 400 nm and 1000 nm. In addition, the fluorescent gold nanocluster is used as bioprobes and/or applied in fluorescent biological label, clinical image as contrast medium, clinical detection, clinical trace, and clinical treatment etc. | 04-26-2012 |
20120107241 | Particles for Inhalation Having Sustained Release Properties - The invention generally relates to a method for pulmonary delivery of therapeutic, prophylactic and diagnostic agents to a patient wherein the agent is released in a sustained fashion, and to particles suitable for use in the method. In particular, the invention relates to a method for the pulmonary delivery of a therapeutic, prophylactic or diagnostic agent comprising administering to the respiratory tract of a patient in need of treatment, prophylaxis or diagnosis an effective amount of particles comprising a therapeutic, prophylactic or diagnostic agent or any combination thereof in association with a charged lipid, wherein the charged lipid has an overall net charge which is opposite to that of the agent upon association with the agent. Release of the agent from the administered particles occurs in a sustained fashion. | 05-03-2012 |
20120107242 | NUCLEIC ACID-MEDIATED SHAPE CONTROL OF NANOPARTICLES FOR BIOMEDICAL APPLICATIONS - Embodiments of a method for nucleic acid-mediated control of a nanoparticle shape are disclosed. In some embodiments, one or more nucleic acid oligomers are adsorbed to a metal nanoseed, and additional metal is deposited onto the nanoseed to produce a shaped nanoparticle. In certain embodiments, the nanoseed is gold and the oligomers are 5-100 nucleotides in length. The nanoparticle shape is determined at least in part by the nucleic acid sequence of the oligomer(s). Shaped nanoparticles produced by embodiments of the method include nanoflowers, nanospheres, nanostars, and nanoplates. Embodiments for using the shaped nanoparticles also are disclosed. | 05-03-2012 |
20120107243 | PEPTIDE-MEDIATED NON-COVALENT DELIVERY OF ACTIVE AGENTS ACROSS THE BLOOD-BRAIN BARRIER - The peptides described herein can function as carrier peptides. These peptides can associate with (e.g., non-covalently bind) biologically active molecules or imaging agents to transport the biologically active molecules or imaging across the blood-brain barrier. In some cases, such transport may increase the effectiveness of the biological molecules or imaging agents. | 05-03-2012 |
20120114559 | NANOIMPRINT LITHOGRAPHY FORMATION OF FUNCTIONAL NANOPARTICLES USING DUAL RELEASE LAYERS - Functional nanoparticles may be formed using at least one nanoimprint lithography step. In one embodiment, sacrificial material may be patterned on a multilayer substrate including one or more functional layers between removable layers using an imprint lithography process. At least one of the functional layers includes a functional material such as a pharmaceutical composition or imaging agent. The pattern may be further etched into the multilayer substrate. At least a portion of the functional material may then be removed to provide a crown surface exposing pillars. Removing the removable layers releases the pillars from the patterned structure to form functional nanoparticles such as drug or imaging agent carriers. | 05-10-2012 |
20120114560 | ABETA BINDING MOLECULES - The present invention encompasses isolated antibodies, or fragments thereof, that are humanized variants of murine antibody 266 which employ complementarity determining regions derived from murine antibody 266. The variant antibodies are useful for treatment or prevention of conditions and diseases associated with Aη, including Alzheimer's disease, Down's syndrome, cerebral amyloid angiopathy, mild cognitive impairment, and the like. | 05-10-2012 |
20120121510 | LOCALIZED THERAPY FOLLOWING BREAST CANCER SURGERY - Particles providing prolonged release of chemotherapy are injected or implanted into surgical sites in the breast following removal of cancerous tissue. In one embodiment, the particles are designed to not release formulation for approximately two to three weeks after surgery so as to not inhibit healing; in another embodiment particles are not administered until two to three weeks after surgery, and release immediately. The particles then release an effective amount of a chemotherapeutic such as a taxane to inhibit proliferation of any remaining cancer cells at or near the surgical site. This may also help prevent overproliferation leading to scarring with the surgical region. | 05-17-2012 |
20120121511 | INFECTION DETECTION METHODS AND SYSTEMS AND RELATED COMPOUNDS AND COMPOSITIONS - A compound, or a pharmaceutically acceptable salt, ester, hydrate or solvate thereof, comprising formula I: | 05-17-2012 |
20120121512 | MONOCLONAL ANTIBODIES AND THEIR USE - Isolated monoclonal antibodies are disclosed herein that specifically bind a cell surface antigen expressed on the human pancreatic endocrine cells or a subset thereof, and/or a precursor thereof. Isolated monoclonal antibodies are also disclosed herein that specifically bind a cell surface antigen expressed on human pancreatic exocrine cells or human ductal cells. Humanized forms of these antibodies, and functional fragments of these antibodies, are also disclosed. The antibodies can be conjugated to an effector molecule, or a detectable marker. These antibodies are of use to detect and/or isolate pancreatic cells or a subset thereof. Methods of treating a pancreatic tumor are also disclosed. | 05-17-2012 |
20120128590 | NANOPARTICLE DELIVERY SYSTEMS FOR MEMBRANE-INTEGRATING PEPTIDES - Compositions which comprise emulsions of nanoparticles for delivery of membrane-integrating peptides are described. The nanoparticles comprise a liquid hydrophobic core coated with a lipid/surfactant layer which contains the membrane-integrating peptides. Methods to use such compositions are also described. | 05-24-2012 |
20120128591 | ANTI-FAP ANTIBODIES AND METHODS OF USE - The invention provides antibodies against Fibroblast Activation Protein (FAP) and methods of using the same. | 05-24-2012 |
20120128592 | SURFACE ENHANCED RAMAN SPECTROSCOPY (SERS) COMPOUNDS AND METHODS OF THEIR PREPARATION - A compound for detecting an analyte using Surface Enhanced Raman Spectroscopy (SERS) and a method of forming the compound is provided. The compound has Formula I: | 05-24-2012 |
20120134924 | Micro-Vesicles Providing Contrast To Target Tissue Electrical Property Gradients - Micro-vesicles that become acoustically sensitive in the presence of a Radio Frequency (RF) Electromagnetic (EM) field are presented. The micro-vesicles can comprise a main body having one or more affinity ligands configured to preferentially bind to a target tissue. Once bound, the micro-vesicles and the target tissue can be bathed in an RF EM field, which induces the target tissue or micro-vesicles to generate an acoustic signal. The micro-vesicles can also become receptive to acoustic energy. An acoustic therapeutic signal can be directed toward the target tissue and micro-vesicles, which causes therapeutic excitation of the micro-vesicles. The therapeutic excitation can include heating the target tissue, releasing a drug formulation, or other excitation. The disclosed techniques can be used with a high degree of precision to activate micro-vesicles local to the target tissue. | 05-31-2012 |
20120134925 | Application and Uses of PRG4 and Therapeutic Modulation Thereof - The present invention relates to the uses of the protein PRG4 and therapeutic modulation thereof. In particular, the present invention relates compositions and methods utilizing PRG4 and therapeutic modulation thereof, including, use as a surgical lubricant, use in a treatment for prevention or reduction of post-surgical adhesions, use in a treatment for oral ulcerations, use as an athletic lubricating patch, use as a dermal filler, use in a treatment for dry mouth, use in a drug delivery method or composition, and use in nursing lubrication. | 05-31-2012 |
20120134926 | CHARGE-DYNAMIC POLYMERS AND DELIVERY OF ANIONIC COMPOUNDS - The present invention provides dynamic charge state cationic polymers that are useful for delivery of anionic molecules. The dynamic charge state cationic polymers are designed to have cationic charge densities that decrease by removal of removable functional groups from the polymers. The present invention also provides interpolyelectrolyte complexes containing the polymers complexed to a polyanion. Methods for using the interpolyelectrolyte complexes to deliver anionic compounds are also provided. | 05-31-2012 |
20120134927 | BETA CELL MARKER ANTIBODY - The present invention relates to an antibody directed to a beta cell marker protein, in particular to an antibody directed to the protein TMEM27. | 05-31-2012 |
20120141378 | METHODS FOR TREATING CHRONIC KIDNEY DISEASE - The present invention relates to methods for treating chronic kidney disease (CKD) including methods for preventing or delaying onset of CKD and methods for preventing exacerbation and progression of CKD. In particular embodiments, the invention provides methods for treating a subject at risk of developing CKD comprising administering to the subject a composition comprising a) a therapeutically effective amount of at least one oligonucleotide compound which inhibits the expression of a human target gene associated with the kidney disease; and b) a pharmaceutically acceptable excipient or carrier, or mixtures thereof, thereby reducing the risk of CKD in the subject. | 06-07-2012 |
20120148493 | Composite Materials Loaded with Therapeutic and Diagnostic Agents Comprising Polymer Nanoparticles and Polymer Fibers - The invention relates to composite materials comprising polymer nanofibers and polymer nanoparticles, wherein at least one of the two polymer materials is loaded with a substance selected from therapeutic and diagnostic agents. Fibers and nanoparticles can comprise identical or different polymers; the polymer materials are, however, biocompatible in every case. Therapeutic and diagnostic agents can be hydrophilic or lipophilic and the two polymer materials likewise. The at least one polymer material and the substance with which said material is loaded are either both hydrophilic or both lipophilic. The polymer nanoparticles of the composite materials have a diameter of 10 nm to 600 nm. The polymer fibers have diameters of 10 nm to 50 μm and lengths of 1 μm to several meters. The invention further relates to a method for producing said composite materials. Polymer nanoparticles can be produced in different ways, such as through controlled precipitation of a polymer solution that optionally comprises a loading substance. The nanoparticles are then mixed with another polymer and a loading substance as applicable, depending on whether particles, fibers or both are to be loaded with substance. The processing of this solution into composites comprising polymer fibers polymer nanoparticles can occur by means of electrospinning, melt spinning, extruding or template process. Composite materials according to the invention are suitable for the production of pharmaceuticals that release therapeutically or diagnostically effective substances slowly and in a controlled manner. | 06-14-2012 |
20120148494 | ISOTOPICALLY-LABELED BENZOFURAN COMPOUNDS AS IMAGING AGENTS FOR AMYLOIDOGENIC PROTEINS - Benzofuran compounds which contain at least one detectable label selected from the group consisting of | 06-14-2012 |
20120156134 | COMPOSITIONS AND METHODS FOR DETECTING OR ELIMINATING SENESCENT CELLS TO DIAGNOSE OR TREAT DISEASE - Disclosed are agents (e.g., peptides, polypeptides, proteins, small molecules, antibodies, and antibody fragments that target senescent cells) and methods of their use for imaging senescent cells in vivo and for treating or preventing cancer, age-related disease, tobacco-related disease, or other diseases and disorders related to or caused by cellular senescence in a mammal. The methods include administering one or more of the agents of the invention to a mammal, e.g., a human. The agents, which specifically bind to senescent cells, can be labeled with a radioactive label or a therapeutic label, e.g., a cytotoxic agent. | 06-21-2012 |
20120156135 | PARTICLES WITH MULTIPLE FUNCTIONALIZED SURFACE DOMAINS - This disclosure relates to particles (e.g., nanoparticles and microparticles) that display multiple functionalized surface domains in a controlled mosaic pattern. The disclosure also provides simple methods to create various particles that have multiple functionalized surface domains while allowing the use of a wide variety of diverse core structures. The multiple functionalized domains provide controllable particle binding and orientation, and controlled and sustained drug release profiles. | 06-21-2012 |
20120156136 | METHOD AND DEVICE FOR IDENTIFYING A MATERIAL LIKELY TO GENERATE EYE OR SKIN DISCOMFORT, TINGLING, OR IRRITATION - The invention relates to a method for identifying a product capable of generating eye or skin discomfort, characterized in that it comprises the steps:
| 06-21-2012 |
20120171120 | LOW AFFINITY BLOOD BRAIN BARRIER RECEPTOR ANTIBODIES AND USES THEREFOR - The present invention relates to antibodies that bind blood brain barrier receptors (BBB-R) and methods of using the same. | 07-05-2012 |
20120171121 | Rosette Nanotubes as Drug Delivery Agents - The present invention is directed to delivery complexes of rosette nanotubes and one or more biologically active agents or diagnostic agents. | 07-05-2012 |
20120171122 | Loop-Variant Pdz Domains As Biotherapeutics, Diagnostics And Research Reagents - The present invention provides polypeptides that contain one or more PDZ loop-variants and are useful in the detection of pathogens and disease-associated molecules. The polypeptides of the invention are also useful in the diagnosis, treatment, and prevention of diseases. Also provided are methods of preparing polypeptides of the invention. | 07-05-2012 |
20120177573 | METHODS FOR CONJUGATING NUCLEIC ACIDS WITH SMALL MOLECULES - A method for conjugating a nucleic acid with a molecule is provided. The method includes steps of (a) reacting the nucleic acid having a 5′-monophosphate with an activating agent in a first buffer to form a solution; (b) mixing an alcohol with the solution formed in the step (a) to obtain an intermediate; and (c) dissolving the intermediate in a second buffer containing an ethylenediaminetetraacetic acid (EDTA) and adding a nucleophile thereinto to react the intermediate with the nucleophile. | 07-12-2012 |
20120177574 | MICROVESICLES DERIVED FROM NUCLEATED, MAMMALIAN CELLS AND USE THEREOF - The present invention relates to a microvesicle that is derived from nucleated mammalian cells, which are smaller than the nucleated cells. The microvesicles of the present invention can be used in the delivery of a therapeutic or diagnostic substance to specific tissues or cells, and more particularly, relates to microvesicles derived from monocytes, macrophages, dendritic cells, stem cells or the like, which can be used to deliver specific therapeutic or diagnostic substances for treating and/or diagnosing tissue associated with cancer, diseased blood vessels, inflammation, or the like. | 07-12-2012 |
20120177575 | FAS (APO-1,CD95) TARGETED PLATFORMS FOR INTRACELLULAR DRUG DELIVERY - A delivery vehicle, for delivering a pharmaceutically active agent or a marker to a cell, comprising a ligand binding portion specific for a Fas Ligand, and a carrier for the pharmaceutically active agent or marker. | 07-12-2012 |
20120177576 | OPTICAL DEVICE AND METHOD FOR NON-INVASIVE REAL-TIME TESTING OF BLOOD SUGAR LEVELS - A device and method for non-invasive real-time testing of blood sugar levels in a diabetic patient. Specifically, this invention is directed to an optical device comprising a contact lens having a glucose-sensing optical pattern imprinted, marked, coated or otherwise disposed on or incorporated within the contact lens. The indicator pattern is further comprised of a glucose-sensing coating containing a boronic acid derivative, which reacts in the presence of glucose to create a readable pattern, which can then be correlated to a pre-determined or pre-calibrated blood glucose level. A polarized light source is one method that may be used to read the indicator pattern. The invention is also directed to methods for quantifying blood glucose levels using the inventive optical device and manufacturing methods for disposing the glucose-sensing coating onto, or incorporating it into, the contact lens material. | 07-12-2012 |
20120183475 | Fucoidans as Ligands for the Diagnosis of Degenerative Pathologies - The present invention relates to the diagnosis of clinical conditions characterized by undesirable and/or abnormal selectin expression. In particular, the invention provides for the use of fucoidans for the detection of selectins using imaging techniques including ultrasonography, scintigraphy and MRI. Selectin-targeted imaging agents are provided that comprise at least one fucoidan moiety associated with at least one detectable moiety. Methods and kits are described for using these imaging agents in the diagnosis of clinical conditions such as thrombosis, myocardial ischemia/reperfusion injury, stroke and ischemic brain trauma, neurodegenerative disorders, tumor metastasis and tumor growth, and rheumatoid arthritis. | 07-19-2012 |
20120183476 | METHODS OF ADMINISTERING LIQUID DROPLET AEROSOLS OF NANOPARTICULATE DRUGS - There is disclosed an aerosol comprising droplets of an aqueous dispersion of nanoparticles, said nanoparticles comprising insoluble therapeutic or diagnostic agent particles having a surface modifier on the surface thereof. There is also disclosed a method for making the aerosol and methods for treatment and diagnosis using the aerosol. | 07-19-2012 |
20120195833 | Medical Contrast Agent Made of Microbubbles Containing Fluorescent Gold Nanoclusters - A medical contrast agent made of microbubbles containing Au nanoclusters is provided. The shell of the microbubbles contains fluorescent Au nanocluster-albumin complex, and the core contains air or fluorocarbons. The method for preparing the microbubbles is also disclosed. | 08-02-2012 |
20120201755 | SENSOR SYSTEM - A method of detecting an analyte in a fluid includes the step of positioning a sensor probe in the fluid. The sensor probe includes a sensing element which absorbs in the infrared region of the spectrum in response to the analyte. The change is then detected with a detection system. | 08-09-2012 |
20120201756 | PLASMA KALLIKREIN BINDING PROTEINS - Plasma kallikrein binding proteins and methods of using such proteins are described. | 08-09-2012 |
20120201757 | MUTANT LOW-DENSITY LIPOPROTEIN RECEPTOR RELATED PROTEIN WITH INCREASED BINDING TO ALZHEIMER AMYLOID-BETA PEPTIDE - A mutant low-density lipoprotein receptor related protein-1 binds to Alzheimer amyloid-beta (Aβ) peptide with greater affinity compared to its wild-type homolog. This binding may be used to detect Aβ or to separate Aβ from the rest of a subject's body. In Alzheimer disease, it may be used to provide diagnostic results by detecting Aβ, treatment by removing Aβ, or both. | 08-09-2012 |
20120207680 | Methods of Identifying Candidate Compounds of the Human G Protein-Coupled Receptor, GPR50, as Modulators of Body Mass or Adiposity - The present invention relates to methods of using a G protein-coupled receptor (GPCR) to screen one or more candidate compounds as a modulator of body mass or of adiposity or of percentage body fat in a subject or as a pharmaceutical agent for obesity and conditions related thereto. Inverse agonists and antagonists of the invention are useful as therapeutic agents for the prevention or treatment of obesity and conditions related thereto, including hypertension, insulin resistance, metabolic syndrome, Type 2 diabetes, dyslipidemia, atherosclerosis, coronary heart disease, and stroke. Agonists and partial agonists of the invention are useful as therapeutic agents for the prevention or treatment of disorders ameliorated by increasing body mass including, but not limited to, cachexia. | 08-16-2012 |
20120207681 | CHEMICAL COMPOSITIONS TO DETECT AND TREAT AMYLOID IN A PATIENTS BRAIN AND RETINA - The present invention is a chemical composition to detect and treat amyloid in a patient's brain or a retina, that include a nanoparticle or a Nano biopolymer delivery platform to deliver any combination of gadolinium, one or more contrast agents, one or more therapeutics and curcumin to mark said amyloid and a polymalic acid scaffold. | 08-16-2012 |
20120213704 | SYSTEM AND METHOD FOR MOLECULAR IN VIVO IMAGING AND THERANOSTICS - Systems and methods of characterizing biological tissues are provided. In the systems and methods, a first optical coherence tomography (OCT) image of a selected portion of biological tissues combined with a plurality of nanoparticles is obtained, where the plurality of nanoparticles are configured to bind to one or more types of biological molecules in the biological tissues and to produce contrast during OCT imaging. The systems and methods also include estimating a first distribution of the plurality of nanoparticles in the selected portion based on the first OCT image and characterizing the selected portion with respect to the types of biological molecules based on the distribution. | 08-23-2012 |
20120213705 | ENGINEERED Fc REGIONS FOR SITE-SPECIFIC CONJUGATION - Fc regions useful for site-specific conjugation to a variety of agents are provided. Methods for the design, preparation, screening, selection and use of such Fc regions are also provided. | 08-23-2012 |
20120219501 | BIOMARKER EN2 FOR GYNAECOLOGICAL CANCER - Described are gynaecological cancer specific biomarkers comprising the nucleic acid sequence of the Engrailed-2 (EN2) gene or the amino acid sequence of the encoded EN2 protein. Also described are uses of the biomarkers in the treatment, diagnosis, monitoring and imaging of gynaecological cancer. | 08-30-2012 |
20120219502 | METHODS AND COMPOSITIONS FOR TARGETING GC1QR/P32 - Disclosed are compositions and methods useful for targeting gC1q/p32 receptors. The disclosed targeting is useful for delivering therapeutic and detectable agents to cancerous cells, and to areas of inflammation. | 08-30-2012 |
20120219503 | HUMANIZED ANTIBODIES SPECIFIC FOR AMINO ACID SEQUENCE RGD OF AN EXTRACELLULAR MATRIX PROTEIN AND THE USES THEREOF - The present invention provides humanized antibodies that immunospecifically recognize the RGD sequence. Some of these antibodies inhibit the biological functions of the RGD proteins, thereby exhibiting therapeutic effects on various disorders or diseases that are associated with RGD proteins, including cancer, e.g., the growth and metastasis of a cancer cell, and inflammatory diseases, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, endometriosis, bronchial asthma, fibrosis, diabetes, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and so forth. | 08-30-2012 |
20120219504 | COMPLEX OF A PROTEIN COMPRISING ZINC OXIDE-BINDING PEPTIDES AND ZINC OXIDE NANOPARTICLES, AND USE THEREOF - The present invention relates to a complex of a protein comprising zinc oxide-binding peptides and zinc oxide nanoparticles, to the use thereof as a drug delivery carrier for manufacturing medicines, and to a vaccine composition and a contrast agent comprising the composite. The protein comprising zinc oxide-binding peptides significantly improves the in vivo availability of zinc oxide-binding peptides, and therefore the complex of the present invention can be used not only as a drug delivery carrier for in vivo drug delivery or intracellular drug delivery, but also for in vivo imaging or cell imaging. The complex can be used for producing separating agents for effectively separating biological materials, therapeutic agents for hyperthermia, etc., contrast agents for MRI, and beads applicable to biosensors. | 08-30-2012 |
20120225017 | MIXED MICELLES - This disclosure is directed to mixed micelle compositions for administration of e.g., therapeutic agents or imaging agents to a subject. | 09-06-2012 |
20120230915 | COMPOSITION AND METHOD FOR MEDICAL IMAGING OF BODY CAVITIES - A foamed aqueous image enhancing composition containing cellulose and/or cellulose derivative(s), has a pH between 5.5 and 7, wherein the viscosity of the composition is less than 1800 mPa·sec, and wherein a gas is maintained in the composition for at least 1 minute after preparation. The combination of low viscosity and foam stability makes the composition particularly suitable in patency tests and fallopian tube sterilization checks. | 09-13-2012 |
20120237447 | STAR POLYMER NANOSHELLS AND METHODS OF PREPARATION THEREOF - A nanoshell is disclosed, comprising a star polymer occlusion complex comprising i) an amphiphilic unimolecular star polymer having a crosslinked core covalently linked to 6 or more independent polymer arms, and ii) a cargo material occluded in the star polymer; and a shell comprising an inorganic material in contact with a peripheral surface of the star polymer occlusion complex. | 09-20-2012 |
20120244075 | 5 NM Nickel-NTA-Gold Nanoparticles - The present disclosure relates to the product, process, and use of 5 nm Nickel-Nitrilotriacetic acid (Ni-NTA) gold nanoparticles. Applications include diagnostic tests, imaging, therapies, detection technologies, gold conjugation to other molecules, and novel material constructs. | 09-27-2012 |
20120244076 | csPCNA Isoform Antibodies And Uses Thereof - Antibodies specifically bind only to a cancer specific proliferating cell nuclear antigen (csPCNA) isoform and not to the non-malignant proliferating cell nuclear antigen (nmPCNA) isoform. Methods and compositions to detect the presence of csPCNA isoform are disclosed. | 09-27-2012 |
20120251450 | NANOPARTICLES THAT PREFERENTIALLY ASSOCIATE WITH AND KILL DISEASED CELLS FOR DIAGNOSTIC AND THERAPEUTIC APPLICATIONS - Of the many compositions and methods provided herein, one composition includes a nanoparticle having a first oxide of a first metal and a dopant that includes an ion or an atom of a second metal. A method includes a method comprising providing a plurality of nanoparticles comprising a first oxide of a first metal and a dopant that comprises an ion or an atom of a second metal; providing a diseased cell and a healthy cell; contacting the diseased cell and the healthy cell with the nanoparticle; and allowing the nanoparticle to preferentially associate with the diseased cell. | 10-04-2012 |
20120251451 | Renal Cell Carcinoma Biomarkers - The invention provides markers for renal cancer, polynucleotides encoding same, and precursors thereof. The invention also provides methods for detecting, diagnosing, screening for, monitoring, assessing, and treating renal cancers and related disease conditions in a subject. The invention further provides a method of selecting for or assessing efficacy of agents against renal cancer, and a method for assessing renal cancer cell carcinogenic potential of a compound. The invention further provides localization and imaging methods for renal cancers. Also provided are diagnostic compositions and kits for carrying out methods of the invention. In addition, the invention provides therapeutic applications for renal cancers which employ protein renal cancer markers and polynucleotides encoding same, miRNA renal cancer markers and precursors thereof, and binding agents for the markers. | 10-04-2012 |
20120251452 | APPARATUS AND METHOD FOR IDENTIFYING ONE OR MORE AMYLOID BETA PLAQUES IN A PLURALITY OF DISCRETE OCT RETINAL LAYERS - The present invention is an apparatus to produce an OCT of an eye or a brain of a patient to identify one or more plaques in a plurality of discrete OCT retinal layers. The present invention also includes a plurality of methods for identifying one or more plaques in a plurality of discrete OCT retinal layers that can include a contrast agent and a normative database. | 10-04-2012 |
20120251453 | Methods and Compositions Related to Annexin 1-Binding Compounds - Disclosed are conjugates comprising the annexin 1-binding peptide IFLLWQR covalently linked to a therapeutic or detectable agent. Also disclosed are compositions comprising a moiety and a peptide comprising an amino acid sequence that can bind to a carbohydrate receptor on a cell. Also disclosed are isolated nucleic acids comprising a nucleic acid sequence encoding a peptide comprising an amino acid sequence that can bind to a carbohydrate receptor on a cell. Also disclosed are methods comprising administering to a subject a composition comprising a moiety and a peptide comprising an amino acid sequence that can bind to a carbohydrate receptor on a cell. Also disclosed are methods of targeting a tumor cell in a subject comprising administering to the subject a peptide comprising an amino acid sequence that can bind to a carbohydrate receptor on a cell. Also disclosed are methods of targeting a tumor cell in a subject comprising administering to the subject a composition comprising a moiety and a peptide comprising an amino acid sequence that can bind to a carbohydrate receptor on a cell. The disclosed targeting is useful for treatment of, for example, cancer. | 10-04-2012 |
20120251454 | Human Anti-IL-23 Antibodies, Compositions, Methods and Uses - A human anti-IL-23p19 antibody, including isolated nucleic acids that encode at least one anti-IL-23p19 antibody, vectors, host cells, and methods of making and using thereof have applications in diagnostic and/or therapeutic compositions, methods and devices. | 10-04-2012 |
20120258044 | LIPID-BASED NANOPARTICLES - Lipid-based nanoparticle compositions are provided. The compositions generally comprise lipid-hydrophilic polymer-amyloid binding ligand conjugates, and may be liposomal compositions. The compositions, including the liposomal compositions, may be useful for imaging and/or the treatment of amyloid-β plaque deposits characteristic of Alzheimer's Disease. | 10-11-2012 |
20120258045 | INHIBITORS AND METHODS OF TREATMENT OF CARDIOVASCULAR DISEASES, AND METHODS FOR IDENTIFYING INHIBITORS - The present invention provides, inter alia, inhibitors of cardiovascular diseases and disorders. The present invention also provides therapeutic methods for preventing and/or treating cardiovascular diseases and disorders. Further, the present invention provides methods of identifying inhibitors of cardiovascular diseases and disorders as well as model systems suitable for identifying such inhibitors as well as methods and compositions for detecting and/or diagnosing cardiovascular diseases and disorders. | 10-11-2012 |
20120258046 | MANNOSE-CONTAINING SOLUTION FOR LYOPHILIZATION, TRANSFECTION AND/OR INJECTION OF NUCLEIC ACIDS - The present invention is directed to (the use of) a solution containing at least one nucleic acid (sequence) and free mannose for lyophilization, transfection and/or injection, particularly of RNA and mRNA. The inventive solution exhibits a positive effect on stabilization of the nucleic acid (sequence) during lyophilization and storage but also leads to a considerable increase of the transfection efficiency of a nucleic acid. It thus also increases in vivo expression of a protein encoded by such a nucleic acid upon increased transfection rate. The present invention is furthermore directed to a method of lyophilization using the mannose-containing solution, to pharmaceutical compositions, vaccines, kits, first and second medical uses applying such a mannose-containing solution and/or a nucleic acid (sequence) lyophilized or resuspended with such a solution. | 10-11-2012 |
20120258047 | EPSILON-POLY-LYSINE CAPSULES - The present disclosure relates to capsules having a core and one or more capsular walls surrounding the core, wherein at least one of the capsular walls comprises a polymer comprising epsilon-poly-lysine or a derivative thereof. | 10-11-2012 |
20120263647 | Pro104 Antibody Compositions and Methods of Use - The invention provides isolated anti-ovarian, pancreatic, lung or breast cancer antigen (Pro104) antibodies that bind to Pro104 on a mammalian cell in vivo. The invention also encompasses compositions comprising an anti-Pro104 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect of the invention is an isolated nucleic acid encoding an anti-Pro104 antibody, as well as an expression vector comprising the isolated nucleic acid. Also provided are cells that produce the anti-Pro104 antibodies. The invention encompasses a method of producing the anti-Pro104 antibodies. Other aspects of the invention are a method of killing a Pro104-expressing cancer cell, comprising contacting the cancer cell with an anti-Pro104 antibody and a method of alleviating or treating a Pro104-expressing cancer in a mammal, comprising administering a therapeutically effective amount of the anti-Pro104 antibody to the mammal. | 10-18-2012 |
20120263648 | RNA NANOPARTICLES AND NANOTUBES - The instant invention provides polyvalent RNA nanoparticles comprising RNA motifs as building blocks that can form RNA nanotubes. The polyvalent RNA nanoparticles are suitable for therapeutic or diagnostic use in a number of diseases or disorders. | 10-18-2012 |
20120263649 | DETECTION OF MYCOBACTERIA - A method for determining the presence of mycobacteria species in an organism or biological sample, the method comprising adding to the organism or biological sample a probe molecule comprising a substrate and a label, which probe molecule can be incorporated into mycobacteria, the presence of mycobacteria being determined by a detector responsive to the presence of the label, optionally after applying a stimulus; suitable probe molecules include compounds comprising a label and a substrate, which label is can be detected by a detector responsive to the presence of the label, optionally after applying a stimulus, characterised by compound being able to engage with the active site of Antigen 85B (Ag85B) such that it can form simultaneous hydrogen bonds with two or more amino acids in the active site selected from Arg 43, Trp 264, Ser126, His 262 and Leu 42, or the corresponding amino acids in Antigen 85A (Ag85A) or Antigen 85C (Ag85C), at least one of which is with Ser126. | 10-18-2012 |
20120263650 | NITROXIDE MODIFIED NON-STEROIDAL ANTI-INFLAMMATORY COMPOUNDS AND USES THEREOF IN THE TREATMENT AND PREVENTION OF DISEASES OR DISORDERS - Disclosed are nitroxide modified NSAID compounds of the formula (I) or a pharmaceutically acceptable salt or enantiomer thereof: | 10-18-2012 |
20120263651 | Single Stranded DNA Aptamers Binding NF-kB/RelA - DNA aptamers are high affinity ligands selected by genetic enrichment techniques to bind to specific protein targets. Because these represent chemically stable and reproducible molecules, they have application as affinity reagents and/or therapeutic drugs to affect the target protein's actions. NF-kB is an important mediator of the innate immune response and mediator of tissue inflammation. Although RNA and double stranded DNA aptamers have been identified to bind to the NF-kB family of proteins, the present invention represents the first identification of single stranded DNA aptamers that recognize NFkB RelA. The aptamers disclosed herein bind to several distinct regions of RelA and may be useful to antagonize the DNA binding of RelA as an inhibitor of cellular inflammation, visualize the location or amount of RelA in tissues from pathological conditions, or to quantitatively measure the activated state of RelA by affinity binding. | 10-18-2012 |
20120263652 | TARGETED CARRIERS FOR DRUG DELIVERY ACROSS THE GASTROINTESTINAL EPITHELIUM - A system and method for transcellular transport of compositions containing agents (e.g., research, analytical, reporter or molecular probes, diagnostic and therapeutic agents, biologically active agents, research agents, analytical agents, imaging agents, monitoring agents, enzymes, proteins, peptides, nucleic acids, lipids, sugars, hormones, lipoproteins, chemicals, viruses, bacteria, cells, including modified cells, biosensors, markers, antibodies and/or ligands) across the gastrointestinal epithelial layer including use of a composition containing the agent and a targeting moiety, specific for a determinant at the target location. An exemplary composition of the system includes an anti-ICAM antibody targeting moiety, specific for targeting ICAM-1. The system enables effective, versatile, and safe targeting and transport of agents. The system is useful in research applications, as well as in the context of translational science and clinical interventions. | 10-18-2012 |
20120263653 | METHODS AND SYSTEMS FOR GENERATING NANOPARTICLES - In one aspect, the present invention provides a process for forming polymeric nanoparticles, which comprises using a static mixer to create a mixed flowing stream of an anti-solvent, e.g., by introducing a liquid anti-solvent into a static mixer, and introducing a polymer solution into the mixed flowing anti-solvent stream such that controlled precipitation of polymeric nanoparticles occurs. The nanoparticles can then be separated from the anti-solvent steam. | 10-18-2012 |
20120263654 | MELANOMA SPECIFIC BIOMARKER - Described are melanoma specific biomarkers comprising the nucleic acid sequence of the Engrailed-2 (EN2) gene or the amino acid sequence of the encoded EN2 protein. Also described are uses of the biomarkers in the treatment, diagnosis, monitoring and imaging of melanoma. | 10-18-2012 |
20120269728 | Methods and compositions for detecting one or more target agents using tracking components - The present invention provides devices and methods for real time detection of target agents in a sample. These devices utilize tracking technology and selective binding to allow the identification of one or more target agents in a sample, and preferably in a biological sample. The present invention provides specific embodiments employing radio frequency identification devices. | 10-25-2012 |
20120269729 | STABILIZED CHITOSAN-BASED NANOPARTICLES AND METHODS FOR MAKING THE SAME - A stabilized chitosan-based nanoparticle is provided having a chitosan polymer and a hydrophilic dispersing agent. In the stabilized nanoparticle, chains of the chitosan polymer electrostatically interact with chains of the hydrophilic dispersing agent to form an entangled network between the chitosan polymer and the hydrophilic dispersing agent. The stabilized chitosan-based nanoparticle has optimal particle integrity and stability properties under physiological conditions. | 10-25-2012 |
20120269730 | Intracellular Delivery of Contrast Agents with Functionalized Nanoparticles - The present invention is directed to compositions and methods for intracellular delivery of a contrast agent with a functionalized nanoparticle. | 10-25-2012 |
20120269731 | POLYPEPTIDES THAT HOME TO ATHEROSCLEROTIC PLAQUE - Described herein are homing polypeptides that home to atherosclerotic plaque(s) in mammals and nucleic acids that encode such polypeptides. Also described are methods for detecting and treating conditions or disorders associated with, or characterized, by elevated levels of homing polypeptides that home to atherosclerotic plaque and/or vulnerable plaque. | 10-25-2012 |
20120276008 | RADIOPAQUE INJECTABLE NUCLEUS HYDROGEL COMPOSITIONS - In one embodiment, the invention relates to a composition suitable for preparing a hydrogel useful as replacement material for all or part of a disc nucleus. The composition comprises:
| 11-01-2012 |
20120276009 | PHARMACEUTICAL COMPOSITION - The present invention relates to methods and compositions for the therapeutic and diagnostic use in the treatment of diseases and disorders which are caused by or associated with neurofibrillary tangles. In particular, the invention relates to antibodies, which specifically recognize and bind to phosphorylated pathological protein tau-conformers and to methods and compositions involving said antibodies for the therapeutic and diagnostic use in the treatment of tauopathies including Alzheimer's Disease (AD). | 11-01-2012 |
20120276010 | Microorganisms for therapy - Therapeutic methods and vaccinia virus therefor are provided. The viruses are designed so that they accumulate in immunoprivileged tissues and cells, such as in tumors and other proliferating tissue and in inflamed tissues, compared to other tissues, cells and organs, so that they exhibit relatively low toxicity to host organisms. Combinations of the viruses and anti-cancer agents and uses thereof for treating cancer also are provided. | 11-01-2012 |
20120282181 | METHODS FOR DETECTING A MYCOBACTERIUM TUBERCULOSIS INFECTION - Methods for detecting an infection with Mtb in a subject are disclosed. The methods include detecting the presence of CD8 | 11-08-2012 |
20120282182 | NANOPARTICLE CLUSTERS FORMED FROM INDIVIDUAL NANOPARTICLES OF TWO OR MORE TYPES - Nanoparticle clusters are described. In particular nanoparticle clusters formed from two or more individual nanoparticles of different types are described and methods for fabricating such nanoparticle clusters are further described. These nanoparticle clusters are fabricated by surface activating individual ones of the plurality of nanoparticles by desorption of surfactant molecules from the surface of the coated nanoparticles through exposure of the individual ones of the plurality of nanoparticles to an activating agent. | 11-08-2012 |
20120288446 | ORGANOPHOSPHOROUS & MULTIVALENT METAL COMPOUND COMPOSITIONS & METHODS - Compositions and methods of their use to adhere a variety of materials together are disclosed herein. The compositions include at least multivalent metal compound, an effective amount of a compound that is structurally similar to phosphoserine, and can be mixed with an aqueous solution. The compositions provide adhesive and cohesive strength in both wet and dry environments which exhibit bond strength upon curing with the possible usage as bone cement for bone filler applications. | 11-15-2012 |
20120301400 | MEDITOPES AND MEDITOPE-BINDING ANTIBODIES AND USES THEREOF - Antibodies and meditopes that bind to the antibodies are provided, as well as complexes, compositions and combinations containing the meditopes and antibodies, and methods of producing, using, testing, and screening the same, including therapeutic and diagnostic methods and uses. | 11-29-2012 |
20120301401 | ORTHOESTER DERIVATIVES OF CROWN ETHERS AS CARRIERS FOR PHARMACEUTICAL AND DIAGNOSTIC COMPOSITIONS - This invention relates to A crown ether of formula (I) | 11-29-2012 |
20120315218 | Toxicology and Cellular Effect of Manufactured Nanomaterials - The increasing use of nanotechnology in consumer products and medical applications underlies the importance of understanding its potential toxic effects to people and the environment. Herein are described methods and assays to predict and evaluate the cellular effects of nanomaterial exposure. Exposing cells to nanomaterials at cytotoxic doses induces cell cycle arrest and increases apoptosis/necrosis, activates genes involved in cellular transport, metabolism, cell cycle regulation, and stress response. Certain nanomaterials induce genes indicative of a strong immune and inflammatory response within skin fibroblasts. Furthermore, the described multiwall carbon nanoonions (MWCNOs) can be used as a therapeutic in the treatment of cancer due to its cytotoxicity. | 12-13-2012 |
20120315219 | Drug Delivery Coating For Use With A Stent - A coated medical device and a method of providing a coating on an implantable medical device result in a medical device having a bio-absorbable coating. The coating includes a bio-absorbable carrier component. In addition to the bio-absorbable carrier component, a therapeutic agent component can also be provided. The coated medical device is implantable in a patient to effect controlled delivery of the coating, including the therapeutic agent, to the patient. | 12-13-2012 |
20120328522 | DIAGNOSTIC COMPOSITION COMPRISING PLASMA CATIONS HAVING SUPERIOR SAFETY PROFILE - The present invention relates to a new diagnostic X-ray composition which exhibits a superior cardiac safety profile. The composition comprises a non-ionic iodinated dimer in a pharmaceutically acceptable carrier. More particularly, the invention provides a diagnostic composition comprising a Compound I, a pharmaceutically acceptable carrier, and dissolved therein a sodium compound and a calcium compound providing a sodium ion concentration of 40-50 mM and a calcium ion concentration of 0.1-0.7 mM. The invention also relates to methods of imaging using such diagnostic compositions. | 12-27-2012 |
20120328523 | POLYHYDROXYALKANOATES FOR IN VIVO APPLICATIONS - Polyhydroxyalkanoates (PHAs) from which pyrogen has been removed are provided. PHAs which have been chemically modified to enhance physical and/or chemical properties, for targeting or to modify biodegradability or clearance by the reticuloendothelial system (RES), are described. Methods for depyrogenating PHA polymers prepared by bacterial fermentation processes are also provided, wherein pyrogens are removed from the polymers without adversely impacting the polymers' inherent chemical structures and physical properties. PHAs with advantageous processing characteristics, including low melting points and/or solubility in non-toxic solvents, are also described. The PHAs are suitable for use in in vivo applications such as in tissue coatings, stents, sutures, tubing, bone, other prostheses, bone or tissue cements, tissue regeneration devices, wound dressings, drug delivery, and for diagnostic and prophylactic uses. | 12-27-2012 |
20120328524 | ANTI-GD2 ANTIBODIES AND METHODS AND USES RELATED THERETO - Described herein are antibodies that specifically bind ganglioside GD2. Also described are nucleotides encoding such antibodies, cells expressing such antibodies, methods of use for such antibodies, and methods for using the antibodies to treat diseases associated with ganglioside GD2. In addition, tissue culture media supplements are described as are methods of use for the supplements. Described herein are albumin-ganglioside conjugates and corresponding methods for producing such conjugates. Methods of purifying or isolating antibodies are also described. | 12-27-2012 |
20130004423 | POLYAZAMACROCYCLIC COMPOUND, AND A PRODUCTION METHOD AND A BIOMEDICAL USE THEREFOR - According to the present invention, a novel polyazamacrocyclic compound which is used as a bifunctional chelating agent (BFC) can be synthesized selectively and in high yield. The novel polyazamacrocyclic compound synthesized by this method chelates with metals and thus can be conjugated with bioactive molecules such as peptides, and can be used in the diagnosis and treatment of medical conditions. | 01-03-2013 |
20130004424 | METHODS FOR DETERMINING AGENTS TARGETING MENA ISOFORMS AND USES THEREOF FOR DIAGNOSIS AND TREATMENT OF METASTATIC TUMORS - The present invention relates to methods of determining agents that inhibit Mena | 01-03-2013 |
20130004425 | Biomineral and Metal Binding Liposomes, Their Synthesis, and Methods of Use Thereof - Drug carriers, methods of synthesizing, and methods of use thereof are provided. | 01-03-2013 |
20130004426 | ADENOSINE DERIVATIVE FORMULATIONS FOR MEDICAL IMAGING - A stable composition useful for myocardial perfusion imaging contains one or more 2-alkynyladenosine derivatives; and a solvent which is made up of water and hydroxypropyl-β-cyclodextrin. | 01-03-2013 |
20130022543 | Method for Treating and Confirming Diagnosis of Exertional Compartment Syndrome - Described is a method of treating chronic compartment syndrome in a muscle of a mammal, particularly exertional compartment syndrome. The method includes introducing an effective amount of a nerve-blocking toxin, such as human botulinum toxin into the muscle. In addition to treating chronic or exertional compartment syndrome, a method is included and described of confirming diagnosis of exertional compartment syndrome in a muscle of a mammal. In the method, venous compression and/or expansion in a mammal in an area of a muscle having a symptom associated with exertional compartment syndrome is evaluated by comparing venous flow at rest and after stress on the muscle. An anaesthetic is used to block a nerve supplying motor function to the muscle causing compression of a blood vessel. The mammal is evaluated after the block of the nerve to determine if the symptom associated with exertional compartment syndrome is alleviated | 01-24-2013 |
20130022544 | IMMUNOTHERAPEUTIC MODULATION OF AMYLOIDOGENIC DISEASE USING NON-FIBRILLOGENIC, NON-AMYLOIDOGENIC POLYMERIZED PROTEINS AND PEPTIDES - The present invention is directed to polymerized products and compositions useful for the treatment and prevention of amyloid disease in a subject. The invention further relates to isolated antibodies that recognize a common conformational epitope of amyloidogenic proteins or peptides that are useful for the diagnosis, treatment, and prevention of amyloid disease. | 01-24-2013 |
20130022545 | DRUG DELIVERY SYSTEM FOR TREATMENT OF LIVER CANCER BASED ON INTERVENTIONAL INJECTION OF TEMPERATURE AND pH-SENSITIVE HYDROGEL - A drug delivery system for the treatment of liver cancer that is based on interventional injection of a temperature and pH-sensitive hydrogel is provided. The drug delivery system is composed of a block copolymer applicable to hepatic arterial catheterization and a therapeutic agent is loaded inside the drug delivery system, and the drug delivery system is in the sol state outside, and undergoes a phase transition into the gel state inside the hepatic artery, thereby delaying or blocking blood supply of the hepatic artery, and slowly releasing the therapeutic agent during the phase transition into the gel state inside the hepatic artery. | 01-24-2013 |
20130022546 | Peptides that Specifically Target Amyloid Deposits - The present invention provides a novel method of detecting amyloids in a subject. The present invention provides peptides that bind selectively to amyloids and are useful for detecting amyloids and diagnosing and/or monitoring the progression of amyloid mediated conditions. | 01-24-2013 |
20130028839 | POLYMER COATED SERS NANOTAG - An encapsulated surface enhanced Raman scattering (SERS) tag. The tag includes a metal core and an encapsulant, typically a glass encapsulant. The encapsulant is further derivatized with a polymer. | 01-31-2013 |
20130028840 | FABRICATION OF CONDUCTING OPEN NANOSHELLS - A method involving ion milling is demonstrated to fabricate open-nanoshell suspensions and open-nanoshell monolayer structures. Ion milling technology allows the open-nanoshell geometry and upward orientation on substrates to be controlled. Substrates can be fabricated covered with stable and dense open-nanoshell monolayer structures, showing nanoaperture and nanotip geometry with upward orientation, that can be used as substrates for SERS-based biomolecule detection. | 01-31-2013 |
20130028841 | MIXING DEVICE, MIXING TUBE, DRUG SOLUTION INJECTING SYSTEM, AND DRUG SOLUTION MIXING METHOD - To provide a mixing device, a mixing tube, a drug solution injecting system, and a drug solution mixing method capable of evenly and efficiently mixing a plurality of kinds of drug solutions. The mixing device according to the present invention includes: a swirling flow generating chamber; a first inflow opening for introducing a first drug solution into the swirling flow generating chamber in a direction parallel to a central axis of the swirling flow; a second inflow opening for introducing a second drug solution into the swirling flow generating chamber so as to generate a swirling flow of the second drug solution having a specific gravity lower than that of the first drug solution; an outflow opening for discharging a mixed drug solution; and a narrowing chamber which is interposed between the swirling flow generating chamber and the outflow opening and has a space continuously narrowed toward the outflow opening. | 01-31-2013 |
20130034498 | OPTICAL MICROLABELS: SHAPES AND REFLECTORS - Labels and methods of producing labels for use in clinical, analytical and pharmaceutical development assays are provided. Labels may comprise shape-encoded particles which may be coupled to ligands such as DNA, RNA and antibodies, where different shapes are used to identify which ligand(s) are present. Labels may also comprise reflectors, including retroreflectors and retroreflectors susceptible to analyte-dependent assembly for efficient homogeneous assays. | 02-07-2013 |
20130039854 | MONOAMINE OXIDASE INHIBITORS AND METHODS FOR TREATMENT AND DIAGNOSIS OF PROSTATE CANCER - A mechanism of monoamine oxidases (MAOs) driven epithelium-to-mesenchymal transition (EMT) is disclosed. Also disclosed are methods for treating cancer by inhibiting or suppressing MAOs in cancer cells. Novel MAOs inhibitors, such as small molecules, siRNA, shRNA, antisense oligonucleotides, aptamers, decoys, and pharmaceutical compositions useful for treating cancer by disrupting the workings of MAOs are provided. In particular, a class of conjugates formed by covalently conjugating near infrared dye 783, IR-780, and MHI-148 to a MAO inhibitor, such as clorgyline, with and without encapsulation it in a nanoparticle is provided. Other aspects of the invention include methods for forming the nano-conjugates, method for monitoring treatment progress in a cancer patient by monitoring the changes in MAO activity, methods for screening patients who are at risk of cancer or differentiating different forms of cancer by assaying the level and location of MAO activity. | 02-14-2013 |
20130039855 | APTAMER TO FGF2 AND USE THEREOF - Provided are an aptamer having an inhibitory activity on FGF2; a complex containing an aptamer having a binding activity or an inhibitory activity on FGF2, and a functional substance (e.g., affinity substance, labeling substance, enzyme, drug delivery vehicle, or drug and the like); a medicament, diagnostic reagent or label containing an aptamer having a binding activity or an inhibitory activity on FGF2, or a complex containing said aptamer and a functional substance; and the like. | 02-14-2013 |
20130045166 | Methods of Polynucleotide Detection - The present invention provides methods of detecting for the presence of a polynucleotide in vivo. These methods are particularly useful for performing identification and/or analysis of samples or specimens in which it is impossible, impractical, or undesirable to move or remove them from their current environment. Methods of practicing the present invention for the purpose of identifying and/or analyzing transgenic plant tissue or cells, in addition to animal tissue or cells and bacterial cells are also provided. | 02-21-2013 |
20130045167 | Staining Composition - The invention is directed to a staining composition and to the use of the staining composition in staining ocular tissue. In a first aspect, the invention provides a staining composition comprising a vital dye and a density increasing compound chosen from the group consisting of water soluble polymers and small inert molecules. | 02-21-2013 |
20130058867 | SOLID COMPOSITION FOR THE ORAL ADMINISTRATION OF DYES AND DIAGNOSTIC USE THEREOF - The present application discloses solid compositions for the oral administration of dyes, and diagnostic use thereof. Preferably, such diagnostic use is aimed at the diagnostic evaluation of the gastrointestinal tract. | 03-07-2013 |
20130064771 | PHOTOACOUSTIC MATCHING MATERIAL - A photoacoustic matching material includes water, a thickener, and a light scattering member. | 03-14-2013 |
20130064772 | INFECTION ACTIVATED WOUND CARING COMPOSITIONS AND DEVICES - Provided are wound caring compositions and devices containing a pH-sensitive, preferably acid degradable, components contained in a water-permeable and hydronium ion permeable material. The pH-sensitive component encloses an antibiotic which is released to the wound upon infection by a microorganism at the wound site, and/or encloses a pH indicator. The antibiotic release is triggered by the microorganism's production of CO | 03-14-2013 |
20130071328 | Propynoic Acid Carbamoyl Methyl-Amides and Pharmaceutical Compositions and Methods Based Thereon - This invention discloses a series of novel propynoic acid carbamoyl methyl-amides (PACMAs), methods for synthesizing the PACMAs and pharmaceutical compositions containing the PACMAs. These novel compounds and compositions show cytotoxicity in cancer cells and are useful as lead compounds for anti-cancer drugs or pharmaceutical agents. This invention also discloses treatment methods that uses the PACMAs and pharmaceutical compositions as well as methods for promoting the release and nuclear localization of the transcription factor Nrf2. | 03-21-2013 |
20130071329 | THERANOSTIC DELIVERY SYSTEMS WITH MODIFIED SURFACES - The present invention pertains to therapeutic compositions and delivery systems comprising at least one microparticle or nanoparticle. In various embodiments, the surface of the microparticle or nanoparticle is modified or functionalized with at least a portion of an isolated cellular membrane, such as an isolated plasma membrane. In addition, the microparticle or nanoparticle contains at least one active agent, such as a therapeutic and/or imaging agent. In additional embodiments, the compositions and delivery systems of the present invention may be used for targeted delivery of an active agent. Also provided are methods of making the therapeutic compositions and delivery systems of the present invention. | 03-21-2013 |
20130078186 | AZO COMPOUNDS REDUCING FORMATION AND TOXICITY OF AMYLOID BETA AGGREGATION INTERMEDIATES - The present invention relates to compounds suitable as modulators of protein misfolding and/or protein aggregation. The compounds are particularly suitable as inhibitors of amyloid aggregate formation and/or modulators of amyloid surface properties, and/or as activators of degradation or reduction of amyloid aggregates. | 03-28-2013 |
20130089503 | Light-Sensitive Ion-Passing Molecules - The invention provides polynucleotides and methods for expressing light-activated proteins in animal cells and altering an action potential of the cells by optical stimulation. The invention also provides animal cells and non-human animals comprising cells expressing the light-activated proteins. | 04-11-2013 |
20130089504 | Compositions Comprising Enzyme-Cleavable Hydromorphone Prodrug - The embodiments provide Compound PC-5, [2-((S)-2-malonylamino-6-amino-hexanoyl amino)-ethyl]-ethyl-carbamic acid hydromorphone ester, or acceptable salts, solvates, and hydrates thereof. The present disclosure also provides pharmaceutical compositions, and their methods of use, where the pharmaceutical compositions comprise a prodrug, Compound PC-5, that provides enzymatically-controlled release of hydromorphone, and, optionally, a trypsin inhibitor that interacts with the enzyme that mediates the enzymatically-controlled release of hydromorphone from the prodrug so as to attenuate enzymatic cleavage of the prodrug. | 04-11-2013 |
20130095038 | PARTICLES, AND PHOTOACOUSTIC IMAGING CONTRAST AGENT AND SLN CONTRAST AGENT INCLUDING THE PARTICLES - Provided are particles where a hydrophilic coloring agent having an anionic functional group, such as ICG, hardly leaks from the particles. The particles include a coloring agent having an anionic functional group, such as ICG, ions of a polyvalent metal, such as iron ions (Fe | 04-18-2013 |
20130095039 | NUCLEIC ACID-MEDIATED SHAPE CONTROL OF NANOPARTICLES - Embodiments of a method to use nucleic acid oligomer sequences for modulating the shape of nanoparticles are disclosed, as well as nanoparticles and methods of using the nanoparticles. Systematic variations of the nucleic acid sequences offer mechanistic insights into the morphology control. A plurality of nucleic acid oligomers is adsorbed onto a metal nanoseed to provide an oligomer-functionalized nanoparticle. Additional metal is deposited onto the oligomer-functionalized nanoparticle to produce a shaped nanoparticle having a morphology based at least in part on the nanoseed morphology and the oligomer's sequence composition. Embodiments of methods for using the shaped nanoparticles also are disclosed. | 04-18-2013 |
20130095040 | DYE COMPOSITIONS AND DYE SYNTHESES - The present invention relates to sulfonated unsymmetrical pentamethine optical dye compositions, especially dyes suitable for biological applications in vitro, and for in vivo imaging. Improved dye compositions and intermediates are provided, which enable the suppression of undesirable newly-identified impurities. Also provided is the use of the improved dye compositions in the preparation of conjugates with biological targeting molecules. | 04-18-2013 |
20130101511 | IN VIVO IMAGING OF ENZYMATIC ACTIVITY - Compositions and methods are described for detecting enzyme activity in a live organism (e.g., animal) are provided. | 04-25-2013 |
20130101512 | CROSSLINKED POLYNUCLEOTIDE STRUCTURE - The present invention provides structures formed from crosslinked polynucleotides, where a subset of the polynucleotides binds to a target under physiological conditions, where the signal group detectably changes upon binding. | 04-25-2013 |
20130101513 | METHOD OF USING NEAR INFRARED FLUORESCENT DYES FOR IMAGING AND TARGETING CANCERS - The present invention describes methods of identifying, detecting, imaging, isolating and locating cancer cells in a subject. The method invokes the use of near-infrared (NIR) organic carbocyanine dyes, particularly, near infrared heptamethine cyanine dyes and the detection of the fluorescence of these NIR dyes. The uptake of these dyes by cancer cells and not by normal cells, as well as their high intensity, among other things, allow for the detection of cancerous cells in a subject and facilitate their subsequent isolation. Further, detection of many tumor types and tumor cell populations under cell culture and in vivo conditions are described. | 04-25-2013 |
20130101514 | COMPOSITIONS AND METHODS FOR TREATING NEPHROPATHY - Activated fatty acids, pharmaceutical composition compositions including activated fatty acids, methods for using activated fatty acids to treat nephropathy, and methods for preparing activated fatty acids are provided herein. | 04-25-2013 |
20130108549 | PEPTIDE PROBES FOR DIAGNOSTICS AND THERAPEUTICS | 05-02-2013 |
20130108550 | Bioabsorbable Co-Filler for Cerebrovascular Aneurysms | 05-02-2013 |
20130115169 | RED BLOOD CELL-MIMETIC PARTICLES AND METHODS FOR MAKING USE THEREOF - The present technology provides synthesized particles that mimic key structural and functional features of red blood cells. Such RBC-mimicking particles possess the ability to carry oxygen (and carbon dioxide) and flow through capillaries smaller than their own diameter. Further, such particles can also deliver drugs and imaging agents. These particles provide a new paradigm for the design of drug delivery and imaging carriers since they combine the functionality of natural RBCs with the broad applicability and versatility of synthetic drug delivery particles. Further, such particles can be used for detoxification and other biomedical applications. | 05-09-2013 |
20130115170 | GM1-LIKE PEPTIDES AND USES THEREOF - Compositions and methods relating to interfering with the interaction of gangliosides, such as GM1, with their ligands are provided. For example, methods are provided for treating infections by blocking the infectious agent from binding with GM1 using GM1-like peptides. Also provided are methods of inhibiting ligands from binding to GM 1 on the surface of cells and for neutralizing anti-GM1 antibodies in neurological diseases. | 05-09-2013 |
20130121915 | PROTEASE-ACTIVATABLE PORE-FORMING POLYPEPTIDES - An isolated pore-forming polypeptide is disclosed which comprises a naturally-occurring plugging module and a naturally-occurring pore domain, wherein at least one amino acid of the pore-forming polypeptide is mutated to generate a protease cleavage site, serving to at least partially remove the plugging module from the pore domain. The pore forming polypeptides may be inserted into an encapsulating particle and positioned such that it is capable of forming a pore through the lipid layer of the particle in a presence of the protease. | 05-16-2013 |
20130121916 | Compositions for Colon Lavage and Methods of Making and Using Same - Disclosed herein are compositions that include polyethylene glycol; alkali metal sulfate; electrolytes selected from the group consisting of sodium bicarbonate, sodium chloride, and potassium chloride or a mixture thereof; and a gastro-protected dye composition comprising a gastro-protectant and a dye suitable for use in an internal colon examination procedure. Also provided herein are sachets, and containers, e.g. sachets that include disclosed compositions; kits for colon cleansing, and aqueous solutions suitable for colon cleansing. | 05-16-2013 |
20130121917 | Lipid-Peptide-Polymer Conjugates and Nanoparticles Thereof - The present invention provides a conjugate having a peptide with from about 10 to about 100 amino acids, wherein the peptide adopts a helical structure. The conjugate also includes a first polymer covalently linked to the peptide, and a hydrophobic moiety covalently linked to the N-terminus of the peptide, wherein the hydrophobic moiety comprises a second polymer or a lipid moiety. The present invention also provides helix bundles form by self-assembling the conjugates, and particles formed by self-assembling the helix bundles. Methods of preparing the helix bundles and particles are also provided. | 05-16-2013 |
20130121918 | Nano-Hybrid Delivery System for Sequential Utilization of Passive and Active Targeting - The present invention features nanohybrid drug delivery composition which combines both passive and active targeting for the prevention and treatment of disease. The composition is shell-encapsulated multivalent polymeric scaffold with a therapeutic agent and targeting agent attached thereto. | 05-16-2013 |
20130129627 | Delivery of Nanoparticles to Neurons - A peptide attached to a nanoparticles (such as quantum dots) selectively directs the nanoparticles to neurons in a tissue or organism. | 05-23-2013 |
20130129628 | FUNCTIONALIZATION OF AND USE OF FUNCTIONALIZED SECOND HARMONIC GENERATING NANOPROBES - Functionalized second harmonic nanoprobes for imaging samples and a method of using such probes to monitor the dynamics different processeses using a variety of imaging techniques are provided. The functionalized second harmonic generating (SHG) nanoprobes are comprised of various kinds of nanocrystalline materials that do not possess an inversion symmetry and therefore are capable of generating second harmonic signals that can then be detected by conventional two-photon microscopy, and are provided with functional surface modifications that allow for targeted imaging of a variety of biological and non-biological processes and structures such as cell signaling, neuroimaging, protein conformation probing, DNA conformation probing, gene transcription, virus infection and replication in cells, protein dynamics, tumor imaging and cancer therapy evaluation and diagnosis as well as quantification in optical imaging. | 05-23-2013 |
20130136693 | Crystal Forms of 2--Adenosine - The present invention provides novel crystalline polymorphic forms of 2-cyclohexylmethylidenehydrazino adenosine, also known as binodenoson, methods of making the same, and methods for the manufacture of a pharmaceutical composition by employing such crystal forms, in particular, for the use of binodenoson in a subject, in need thereof, as a pharmacological stress agent to produce coronary vasodilation. | 05-30-2013 |
20130142731 | THREADS OF CROSS-LINKED HYALURONIC ACID AND METHODS OF USE THEREOF - This invention relates generally to threads of hyaluronic acid, methods of making such threads and uses thereof, for example, in aesthetic applications (e.g., facial contouring, dermal fillers), surgery (e.g., sutures), drug delivery, negative pressure wound therapy, moist wound dressing, and the like. | 06-06-2013 |
20130149245 | Novel Peptides and Uses Thereof - The invention relates to a peptide of 8-50 amino acids comprising the sequence of KAHKKRAD or KARKKHAD, or a cyclic peptide of 8-50 amino acids comprising the sequence of HKKR or RKKH. Also disclosed are methods of using the peptide for detecting, monitoring, or treating cancer. | 06-13-2013 |
20130149246 | Human Monoclonal Antibodies Against Hendra and Nipah Viruses - The present invention relates to monoclonal antibodies that bind or neutralize Hendra or Nipah virus. The invention provides such antibodies, fragments of such antibodies retaining Hendra or Nipah virus-binding ability, fully human antibodies retaining Hendra or Nipah virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention. | 06-13-2013 |
20130149247 | VIVO TUMOR TARGETING AND SPECTROSCOPIC DETECTION WITH SURFACE-ENHANCED RAMAN NANOPARTICLE TAGS - Nanostructures, methods of preparing nanostructures, methods of detecting targets in subjects, and methods of treating diseases in subjects, are disclosed. An embodiment, among others, of the nanostructure includes a metallic gold surface-enhanced Raman scattering nanoparticle, a Raman reporter and a protection structure. The protection structure may include a thiol-polyethylene glycol to which may be attached a target-specific probe. | 06-13-2013 |
20130149248 | AV 6 PEPTIDE LIGANDS AND THEIR USES - AVβ6 peptide ligands, functional variants thereof and their nucleic acids encoding them are disclosed with their uses in the treatment and imaging of AVβ6 mediated diseases. | 06-13-2013 |
20130149249 | IMAGING TUBERCULOSIS WITH PYRAZINAMIDE CONTRAST AGENTS - The present invention provides novel in vivo imaging agents useful for detecting the presence of mycobacteria using in vivo imaging methods. Also provided by the present invention is a precursor compound useful in the synthesis of the in vivo imaging agents of the invention, and a method to obtain the in vivo imaging agent of the invention using said precursor compound. Methods of in vivo imaging and diagnosis in which the in vivo imaging agent of the invention finds use are also provided. | 06-13-2013 |
20130156702 | METHODS FOR THE TREATMENT AND THE DIAGNOSIS OF CANCER - The present invention relates to methods for the diagnostic and the staging of cancer such as liver cancer. The present invention also relates to methods for the treatment of cancer including liver cancer such as hepatocellular carcinoma (HCC). | 06-20-2013 |
20130164219 | CELL-PENETRATING PEPTIDES AND USES THEREOF - The present invention relates to the identification and functional characterization of human cell-penetrating peptides (CPPs) and their use; in particular as transfection vehicles. | 06-27-2013 |
20130171070 | Humanized Anti-Factor D Antibodies And Uses Thereof - The invention relates to humanized anti-human Factor D monoclonal antibodies, their nucleic acid and amino acid sequences, the cells and vectors that harbor these antibodies and their use in the preparation of compositions and medicaments for treatment of diseases and disorders associated with excessive or uncontrolled complement activation. These antibodies are useful for diagnostics, prophylaxis and treatment of disease. | 07-04-2013 |
20130171071 | Novel Imidazolium Salts and Carbene Metal Complexes Based Thereon for Use as Bioanalytical Markers for Biomolecules - The present invention relates to imidazolium salts, particularly imidazolium salts of the general formula I as well as the respective carbene metal complexes and their utilisation as bioanalytical tags for biomolecules. | 07-04-2013 |
20130177502 | Targeted, NIR Imaging Agents for Therapy Efficacy Monitoring, Deep Tissue Disease Demarcation and Deep Tissue Imaging - Compounds and methods related to NIR molecular imaging, in-vitro and in-vivo functional imaging, therapy/efficacy monitoring, and cancer and metastatic activity imaging. Compounds and methods demonstrated pertain to the field of peripheral benzodiazepine receptor imaging, metabolic imaging, cellular respiration imaging, cellular proliferation imaging as targeted agents that incorporate signaling agents. | 07-11-2013 |
20130183241 | PEPTIDES THAT HOME TO TUMOR LYMPHATIC VASCULATURE AND METHODS OF USING SAME - The present invention provides a conjugate containing a moiety linked to a homing molecule that selectively homes to tumor lymphatic vasculature. The invention also provides a method of directing a moiety to tumor lymphatic vasculature in a subject by administering to the subject a conjugate containing a moiety linked to a homing molecule that selectively homes to tumor lymphatic vasculature. | 07-18-2013 |
20130183242 | METHODS FOR IDENTIFYING TUMOR-SPECIFIC POLYPEPTIDES - The present invention provides methods for identifying tumor-specific polypeptides, polypeptides so identified, and methods for their use. | 07-18-2013 |
20130183243 | Methods and Device for Tuning Multiplexed Markers for Disease Assay - The present invention relates to a diagnostic device and methods of using the same for diagnostic assays for monitoring the presence of biological samples wherein the device allows for the determination of at least two assay components on one sensor. More specifically, the invention relates to a multi-marker electrochemical impedance spectroscopy sensor comprising a plurality of molecular recognition elements wherein the sensor comprises multiple different molecular recognition element types that are tuned in a manner that alters the frequency of the molecular recognition element type such that it is at a detectably different frequency to the frequency of other molecular recognition element types on the same sensor. | 07-18-2013 |
20130183244 | Rapid Diffusion of Large Polymeric Nanoparticles in the Mammalian Brain - Non-adhesive particles as large as 110 nm can diffuse rapidly in the brain ECS, if coated with hydrophilic coatings such as PEG coatings and preferably having neutral surface charge. The ability to achieve brain penetration with larger particles will significantly improve drug and gene delivery within the CNS since larger particles offer higher drug payload, improved drug loading efficiency, and significantly longer drug release durations. | 07-18-2013 |
20130195759 | NANOSTRUCTURES SUITABLE FOR SEQUESTERING CHOLESTEROL AND OTHER MOLECULES - Articles, compositions, kits, and methods relating to nanostructures, including those that can sequester molecules such as cholesterol, are provided. Certain embodiments described herein include structures having a core-shell type arrangement; for instance, a nanoparticle core may be surrounded by a shell including a material, such as a lipid bilayer, that can interact with cholesterol and/or other lipids. In some embodiments, the structures, when introduced into a subject, can sequester cholesterol and/or other lipids and remove them from circulation. Accordingly, the structures described herein may be used to diagnose, prevent, treat or manage certain diseases or bodily conditions, especially those associated with abnormal lipid levels. | 08-01-2013 |
20130195760 | CHLOROTOXIN VARIANTS, CONJUGATES, AND METHODS FOR THEIR USE - Chlorotoxin variants, chlorotoxin variant conjugates, compositions that include the chlorotoxin variants or conjugates, and methods for using the chlorotoxin variants, conjugates, and compositions. | 08-01-2013 |
20130195761 | COMPOSITIONS COMPRISING ANTI-CAP37 ANTIBODIES AND METHODS OF PRODUCTION AND USE THEREOF - Compositions comprising antibodies raised against CAP37 and isoforms thereof, along with antigen binding fragments thereof, are disclosed. These compositions have many uses, such as in detection of CAP37 and as an early detection marker for various disease conditions. In addition, the compositions may be used therapeutically to inhibit, mitigate, or modulate certain cellular activities involving CAP37 or to monitor a disease progression or the success of a disease treatment. | 08-01-2013 |
20130202531 | INDICATORS FOR DETECTING THE PRESENCE OF METABOLIC BYPRODUCTS FROM MICROORGANISMS - Polymeric indicator films and pH indicating wraps are provided for visually monitoring, detecting, and/or determining the presence of metabolic byproducts from harmful or potentially harmful microorganisms. Also provided are methods of use and preparation of the polymeric indicator films. | 08-08-2013 |
20130202532 | MULTIPLE INPUT BIOLOGIC CLASSIFIER CIRCUITS FOR CELLS - Provided herein are high-input detector modules and multi-input biological classifier circuits and systems that integrate sophisticated sensing, information processing, and actuation in living cells and permit new directions in basic biology, biotechnology and medicine. The multi-input biological classifier circuits described herein comprise synthetic, scaleable transcriptional/post-transcriptional regulatory circuits that are designed to interrogate the status of a cell by simultaneously sensing expression levels of multiple endogenous inputs, such as microRNAs. The classifier circuits then compute whether to trigger a desired output or response if the expression levels match a pre-determined profile of interest. | 08-08-2013 |
20130209364 | Anti-Viral Azide Containing Compounds - Methods of using azide-modified biomolecules, such as fatty acids, carbohydrates and lipids, to treat a plant, an insect or an animal infected with a virus or to inhibit infectivity of a virus, such as the human immunodeficiency virus, are provided. Also provided are methods of labeling a virus, such as human immunodeficiency virus, with an azide-modified biomolecule, such as a fatty acid, a carbohydrate, or an isoprenoid lipid. Also, provided are methods of tracking a virus in vivo, with an azide-modified biomolecule, such as a fatty acid, a carbohydrate, or an isoprenoid lipid. The azide-modified biomolecules may be combined with a pharmaceutically acceptable excipient to produce a pharmaceutical composition, optionally containing another anti-viral agent and/or a delivery agent, such as a liposome. | 08-15-2013 |
20130209365 | Anti-C-Met Antibody and Methods of Use Thereof - Antibodies that bind to c-Met are provided herein, as well as related compositions and methods of use. Methods of use encompass cancer therapies and diagnostics. In certain embodiments, antibodies bind mammalian cell surface antigen (e.g., cancer cell surface antigen). The antibodies can also be endocytosed upon binding to cells. Cells that can be targeted by the antibodies include carcinomas, such as those in lung, kidney, liver, stomach, breast, and brain, etc. | 08-15-2013 |
20130216481 | USE OF UTP FOR THE DIAGNOSIS OF STENOSES AND OTHER CONDITIONS OF RESTRICTED BLOOD FLOW - The present invention relates to methods for determining whether blood flow is restricted in a blood vessel of an individual suspected of compromised blood flow in the vessel, the method comprising the steps of delivering UTP, a derivative thereof, or a salt thereof to the vessel, assessing blood flow quantitatively in the vessel by obtaining a value that correlates to blood flow in said vessel, comparing the obtained value with a reference value, and determining whether the individual has compromised blood flow based on the results of the comparison. The invention also provides for methods of diagnosing atherosclerotic and ischemic heart diseases using UTP, a derivative thereof, or a salt thereof, as well as methods for inducing maximal hyperemia for diagnostic purposes. | 08-22-2013 |
20130224115 | NON-RADIOACTIVE AGENTS FOR NEUROBLASTOMA IMAGING - Multi-modal tumor imaging of neuroblastoma is essential for tumor staging, response evaluation and detection of relapsed diseased. The present invention provides a norepinephine analogue with a near-infrared (near-IR) dye, W765-BG, that efficiently and stably detects neuroblastoma in vivo using near-IR optical imaging. Confocal microscopy and optical imaging of neuroblastoma xenografts shows cell specific uptake and reveals exceptional tumor retention with a high tumor-to-tissue ratio up to 7 days after injection of W765-BG. | 08-29-2013 |
20130224116 | Markers of Endothelial Progenitor Cells and Uses Thereof - The present invention provides markers of endothelial progenitor cells (EPCs) and use of those markers and reagents that bind thereto to detect EPC cells or diagnose, prognose, treat or prevent EPC-associated conditions. | 08-29-2013 |
20130236396 | NANOPARTICLES PRODUCED FROM RECOMBINANT POLYMERS AND METHODS OF MAKING AND USING THE SAME - Described herein are nanoparticles produced from recombinant polymers. The nanoparticles are substantially uniform in size, which provides numerous advantages with respect to the delivery of bioactive agents to a subject. Methods for making the nanoparticles are also described herein. In one aspect, the nanoparticles are produced by the method comprising: a. providing a solution comprising one or more recombinant polymer in a solvent; b. forming droplets comprising the one or more recombinant polymers and the solvent; c. removing the solvent to produce the nanoparticles; and d. separating the nanoparticles based on size to produce nanoparticles that are substantially uniform in size. Finally, pharmaceutical compositions composed of the nanoparticles and methods of using the same are also described. | 09-12-2013 |
20130243693 | SILK OPTICAL PARTICLES AND USES THEREOF - Disclosed herein are methods of preparing silk particles having at least one optical property, e.g., reflectivity, diffraction, refraction, absorption, optical-gain, fluorescence, and light scattering, and compositions resulted therefrom. The compositions and methods of the invention can be utilized in various applications, e.g., medical applications, cosmetics, sunscreen and food additives. | 09-19-2013 |
20130243694 | PARTICLES AND CONTRAST AGENT INCLUDING THE SAME FOR OPTICAL IMAGING - A particle includes a copolymer of lactic acid and glycolic acid, and at least one compound selected from silicon naphthalocyanine and derivatives of silicon naphthalocyanine, in which the particle has a particle size of 10 nm or more and less than 1000 nm. | 09-19-2013 |
20130243695 | CHEMOEMBOLISATION - A composition for chemoembolotherapy of solid tumours comprises particles of a water-insoluble water-swellable synthetic anionic polymer and, absorbed therein an anthracycline. Suitably the polymer is a poly(vinyl alcohol) based polymer and the drug is doxorubicin. | 09-19-2013 |
20130243696 | Compositions and Methods for the Treatment of Traumatic Brain Injury - Compositions and methods for the inhibition and/or prevention of traumatic brain injury and the symptoms associated with it are provided. | 09-19-2013 |
20130259806 | DIMERIC MOLECULAR COMPLEXES WITH FREE CYSTEINE RESIDUES AND CONJUGATES THEREOF - The invention relates generally to dimeric molecular complexes comprising two fusion proteins. Each fusion protein comprises a biological effector moiety, a polypeptide spacer sequence, and an IgE CH4 dimerization domain. The dimeric molecular complexes may be conjugated, at a defined site, to other molecules including drug moieties, cytotoxic agents, labels (such as detectable labels), or biocompatible polymers. | 10-03-2013 |
20130266514 | Method of Providing Disease-Specific Binding Molecules and Targets - Provided are novel specific binding molecules, particularly human antibodies as well as fragments, derivatives and variants thereof that recognize neoepitopes of disease-associated proteins which derive from native endogenous proteins but are prevalent in the body of a patient in a variant form and/or out of their normal physiological context. In addition, pharmaceutical compositions comprising such binding molecules, antibodies and mimics thereof and methods of screening for novel binding molecules, which may or may not be antibodies as well as targets in the treatment of neurological disorders such as Alzheimer's disease are described. | 10-10-2013 |
20130266515 | Specific Ligand for Annexin 2 - The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2. | 10-10-2013 |
20130266516 | LAR Protein-Specific Ligand - The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein. | 10-10-2013 |
20130272962 | STAINING AGENT FOR CORNEAL STAINING - The present invention relates to a staining agent for dyeing an ophthalmic membrane, in particular the cornea of a human eye or an animal's eye. In particular, the invention relates to the use of an aqueous, physiologically compatible solution, in which a dyestuff has been dissolved, for the purpose of coloring membranes, in particular the cornea or parts thereof in the human eye or in the eye of an animal. | 10-17-2013 |
20130272963 | Cholesterol Efflux Assay Probe Formulations, Methods of Making and Using - A cholesterol efflux assay probe formulation having a core comprised of a biocompatible hydrophobic material at least partially coated with a sphingomyelin/cholesterol layer, methods of making and methods of using are described. | 10-17-2013 |
20130272964 | MOLECULES WITH EXTENDED HALF-LIVES, COMPOSITIONS AND USES THEREOF - The present invention provides molecules, including IgGs, non-IgG immunoglobulins, proteins and non-protein agents, that have increased in vivo half-lives due to the presence of an IgG constant domain, or a portion thereof that binds the FcRn, having one or more amino acid modifications that increase the affinity of the constant domain or fragment for FcRn. Such proteins and molecules with increased half-lives have the advantage that smaller amounts and or less frequent dosing is required in the therapeutic, prophylactic or diagnostic use of such molecules. | 10-17-2013 |
20130280166 | IDENTIFICATION OF TUMOR-ASSOCIATED CELL SURFACE ANTIGENS FOR DIAGNOSIS AND THERAPY - The present invention provides agents with tumor-inhibiting activity, and which are selective for cells expressing or abnormally expressing a tumor-associated antigen. Said tumor-associated antigen has a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence selected from the specific sequences set forth herein, or a 6-50 contiguous nucleotide residue portion thereof; (b) a nucleotide sequence of a nucleic acid which hybridizes with a nucleic acid having the nucleotide sequence of (a) under stringent conditions; (c) a nucleotide sequence which is degenerate with respect to the nucleotide sequence of (a) or (b); and (d) a nucleotide sequence which is complementary to the nucleotide sequence of (a), (b) or (c). Pharmaceutical compositions and kits comprising the agents are also provided, as well as methods treating, diagnosing or monitoring a disease characterized by expression or abnormal expression of the tumor-associated antigen. | 10-24-2013 |
20130280167 | HUMAN ANTIBODIES AND DIAGNOSTIC AND THERAPEUTIC USES THEREOF FOR THE TREATMENT OF NEUROLOGICAL DISEASE - Specific binding members, particularly human antibodies, particularly recombinant antibodies, and fragments thereof, which are capable of binding to and recognizing neurons in the CNS and eliciting responses in CNS neurons are provided. The antibodies are useful for neuroprotection and in the diagnosis and treatment of conditions associated with nerve damage, injury or degeneration and neurodegenerative disease. The antibodies, variable regions or CDR domain sequences thereof, and fragments thereof of the invention may also be used in therapy in combination with chemotherapeutics, immune modulators, or neuroactive agents and/or with other antibodies or fragments thereof. Antibodies are exemplified by the antibodies IgM12 and IgM42 whose sequences are provided herein. | 10-24-2013 |
20130280168 | Flexible and/or Elastic Brachytherapy Seed or Sirand - A flexible or elastic brachytherapy strand that includes an imaging marker and/or a therapeutic, diagnostic or prophylactic agent such as a drug in a biocompatible carrier that can be delivered to a subject upon implantation into the subject through the bore of a brachytherapy implantation needle has been developed. Strands can be formed as chains or continuous arrays of seeds up to 50 centimeters or more, with or without spacer matetial, flaccid, rigid, or flexible. | 10-24-2013 |
20130280169 | CENTRAL NERVOUS SYSTEM TISSUE-LABELING COMPOSITION, METHOD FOR LABELING CENTRAL NERVOUS SYSTEM TISSUE, AND SCREENING METHOD USING CENTRAL NERVOUS SYSTEM TISSUE-LABELING COMPOSITION - To provide a central nervous system tissue-labeling composition labeling the central nervous tissue system. Also, another object of the present invention is to provide a method for non-invasively labeling the central nervous tissue system. Further, another object of the present invention is to provide a screening method using the above central nervous system tissue-labeling composition. A central nervous system tissue-labeling composition containing, as an active ingredient, at least one of compounds represented by the general formula (1) or (7). | 10-24-2013 |
20130287688 | NOVEL COMPOSITIONS AND USES OF ANTI-HYPERTENSION AGENTS FOR CANCER THERAPY - Methods and compositions for improving the delivery and/or efficacy of a therapy (e.g., a cancer therapy) are disclosed. In one embodiment, methods and compositions for treating or preventing a cancer (e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an anti-hypertensive agent, as a single agent or in combination with a microenvironment modulator and/or a therapy, e.g., a cancer therapy (for example, a therapeutic agent or therapy, including immunotherapy (e.g., antibodies, vaccine, cell-based), nanotherapeutics, radiation therapy, photodynamic therapy, low molecular weight chemotherapeutics, molecularly targeted therapeutics and/or oxygen radical) are disclosed. | 10-31-2013 |
20130287689 | Modified Hydrocyanine Dyes for the Detection of Reactive Oxygen Species - The present invention is directed to compounds, compositions, methods, and kits for detecting reactive oxygen species (ROS) by conventional fluorescence microscopy, fluorescence spectroscopy, flow cytometry, and/or high content imaging. The compounds disclosed herein are novel reduced dyes, including Cy-based hydrocyanine dyes and Cy-based deuterocyanine dyes, which dyes are probes for detecting ROS and measuring oxidative stress in cells either in vitro and/or in vivo. Also described herein are processes for preparing novel reduced dyes, i.e., ROS probes, for use in the disclosed compositions, methods and kits. | 10-31-2013 |
20130287690 | SOLID COMPOSITION FOR THE ORAL ADMINISTRATION OF DYES AND DIAGNOSTIC USE THEREOF - The present application discloses solid compositions for the oral administration of dyes, and diagnostic use thereof. Preferably, such diagnostic use is aimed at the diagnostic evaluation of the gastrointestinal tract. | 10-31-2013 |
20130287691 | ANTI-GD2 ANTIBODIES AND METHODS AND USES RELATED THERETO - Described herein are antibodies that specifically bind ganglioside GD2. Also described are nucleotides encoding such antibodies, cells expressing such antibodies, methods of use for such antibodies, and methods for using the antibodies to treat diseases associated with ganglioside GD2. In addition, tissue culture media supplements are described as are methods of use for the supplements. Described herein are albumin-ganglioside conjugates and corresponding methods for producing such conjugates. Methods of purifying or isolating antibodies are also described. | 10-31-2013 |
20130295012 | SHEAR CONTROLLED RELEASE FOR STENOTIC LESIONS AND THROMBOLYTIC THERAPIES - The invention provides compositions and methods for treating or imaging stenosis, stenotic lesions, occluded lumens, embolic phenomena or thrombotic disorders. The invention further provides compositions and methods for treating internal hemorrhage. | 11-07-2013 |
20130295013 | SOLID COMPOSITION FOR THE ORAL ADMINISTRATION OF DYES AND DIAGNOSTIC USE THEREOF - The present application discloses solid compositions for the oral administration of dyes, and diagnostic use thereof. Preferably, such diagnostic use is aimed at the diagnostic evaluation of the gastrointestinal tract. | 11-07-2013 |
20130302249 | INTESTINAL PEPTIDE TARGETING LIGANDS - Peptide ligands for transporting therapeutic agents across the intestinal epithelial barrier that ordinarily are inadequately absorbed and must be delivered by alternative means, which contain an isolated amino acid sequence wherein at least one pair of amino acids are of an opposite charge and the pair members are separated by a spacer of 1-12 amino acid residues including at least one hydrophobic amino acid, and wherein the length of the amino acid sequence is greater than 5 and less than 20 amino acids. Pharmaceutical compositions for gastro-intestinal delivery and methods for the gastrointestinal delivery of poorly absorbed therapeutic agents are also disclosed. | 11-14-2013 |
20130302250 | SINGLE DOMAIN BINDING MOLECULE - The present invention provides a single domain specific binding molecule having the structure | 11-14-2013 |
20130309171 | PRE-TARGETED NANOPARTICLE SYSTEM AND METHOD FOR LABELING BIOLOGICAL PARTICLES - Nanoparticle system and method for labeling, detecting, and treating biological particles. In the method, targeting functionality (fusion protein) and therapeutic/imaging modalities (nanoparticle) are separated. | 11-21-2013 |
20130309172 | CLEAVABLE FUNCTIONALIZED NANOPARTICLES - Provided herein, inter alia, are compositions of functionalized nanoparticles and methods of using functionalized nanoparticles in treating, imaging, and/or detecting cancers. | 11-21-2013 |
20130315828 | KIT AND METHOD OF USE OF TARGETING PEPTIDE FOR DIAGNOSIS AND THERAPY OF CANCER - The present invention relates to a method of delivering an agent to a cancer cell, comprising: (a) obtaining a peptide that selectively binds to a cancer cell, wherein the peptide comprises a cancer targeting motif having the amino acid sequence of SEQ ID NO: 1, wherein the peptide is attached or fused to an agent that one desires to target to a cancer cell; and (b) exposing the peptide to a population of cells suspected of containing cancer cells. The present invention also relates to a kit for applying the above method, comprising a peptide that binds to a cancer cell, wherein the peptide comprises a cancer targeting motif having the amino acid sequence of SEQ ID NO: 1. | 11-28-2013 |
20130315829 | Compounds and Methods for Detecting Reactive Oxygen Species - The present disclosure provides compounds that detect reactive oxygen species in a living cell, in a multicellular organism, or in a cell-free sample. The compounds find use in a variety of applications, which are also provided. The present disclosure provides compositions comprising a subject compound. | 11-28-2013 |
20130315830 | PSMA as a BioMarker for Androgen Activity in Prostate Cancer - The androgen receptor (AR) is the key driver of prostate differentiation and prostate cancer (PC) progression, and androgen ablation is the cornerstone of advanced PC treatment. Prostate-specific membrane antigen (PSMA) represents another target of interest in PC. Previous publications have reported inconsistent associations between androgen levels and PSMA expression. Using a panel of prototypical human PC cell lines, this relationship is clarified. PSMA is a biomarker that distinguishes AR-positive/PSMA-positive adenocarcinomas from AR-negative variants. PSMA is a cell surface barometer of androgen activity that can be readily identified by immunohistochemistry and/or in vivo imaging. Given that anti-androgen therapy is likely to remain a cornerstone of PC treatment, the associated up-regulation of PSMA, as well as its other characteristics, makes it a compelling target opportunity in PC. | 11-28-2013 |
20130315831 | LIPID-POLYMER HYBRID PARTICLES - A particle includes an aqueous core; a first amphiphilic layer surrounding the aqueous core; and a polymeric matrix surrounding the first amphiphilic layer. | 11-28-2013 |
20130323173 | ANTIBODIES TO TUMOR ENDOTHELIAL MARKER 8 - The present invention is directed to particular antibodies and fragments thereof that find use in the detection, prevention and treatment of diseases and disorders associated with abnormal angiogenesis. In particular, these antibodies detect tumor endothelial marker 8 (TEM8) in its native and cell-surface expressed form. Also disclosed are improved methods for producing monoclonal antibodies, as well as pharmaceutical compositions and kits. | 12-05-2013 |
20130323174 | METHODS OF DETECTING PANCREOBILIARY DUCTAL LEAKS - The present invention is directed to a method for identifying ductal leaks during pancreobiliary surgery in a human patient. The invention comprises the steps of: administering to a human patient undergoing pancreobiliary surgery an effective amount of a pharmaceutical composition comprising secretin and a pharmaceutically acceptable carrier; and observing the patient during the surgery for the presence of pancreobiliary ductal leaks. | 12-05-2013 |
20130336891 | FORMULATION OF ACOUSTICALLY ACTIVATABLE PARTICLES HAVING LOW VAPORIZATION ENERGY AND METHODS FOR USING SAME - Formulation of acoustically activatable particles having low vaporization energy and methods for using same are disclosed. According to one aspect, a method of producing particles of materials includes, with a first substance that includes at least one component that is a gas at room temperature and atmospheric pressure, performing one of: causing the first substance to condense to a liquid phase, and extruding or emulsifying the first substance into or in the presence of a second substance to create a droplet or emulsion in which the first substance is encapsulated by the second substance; or extruding or emulsifying the first substance into or in the presence of a second substance to create a bubble in which the first substance is encapsulated by the second substance and wherein at least some of the first substance is in a gaseous phase, and causing the first substance to condense to a liquid phase, which causes the bubble to transform into a droplet or emulsion. The droplet or emulsion so created is an activatable phase change agent that is stable at room temperature and pressure. | 12-19-2013 |
20130343995 | EFFICIENT SYNTHESIS OF ETHYLENEDICYSTEINE-SUGAR CONJUGATES FOR IMAGING AND THERAPY - Novel methods of synthesis of ethylenedicysteine-sugar conjugates and therapeutic and diagnostic applications of such conjugates are disclosed. Methods of synthesizing these conjugates in high purity are also presented as using starting materials such as thiazolidine carboxylic acid. Also disclosed are methods of imaging, treating and diagnosing disease in a subject using these conjugates prepared herein, such as methods of imaging a tumor within a subject and methods of diagnosing myocardial ischemia. | 12-26-2013 |
20130343996 | GRAPHITE-COATED MAGNETIC NANOPARTICLES - The present invention relates to graphite-coated magnetic nanoparticles, methods for the synthesis of graphite-coated magnetic nanoparticles, and methods of using graphite-coated magnetic nanoparticles for targeted delivery of siRNA-based therapy, as multimodal imaging probes and for hyperthermia cancer treatment. | 12-26-2013 |
20130343997 | Metal Coating of Rare Earth Nano-Phosphors and Uses Thereof - Core-shell nanoparticles comprises a phosphorescent core and metal shell comprising at least two metals The phosphorescent core may comprise an up converting phosphor. The phosphorescent core may comprise a trivalent rare earth cation. The phosphorescent core further may comprise a monovalent alkali metal. The phosphorescent core may optionally comprises a second and also optionally a third trivalent rare earth cation. | 12-26-2013 |
20140004045 | METHOD TO ENHANCE SWALLOWING SAFETY AND APPEAL OF BEVERAGES FOR TREATING DYSPHAGIA BASED ON RHEOLOGICAL AND SENSORY PARAMETERS | 01-02-2014 |
20140004046 | Pericyte Progenitors From Peripheral Blood | 01-02-2014 |
20140017170 | METHODS AND COMPOSITIONS FOR LOCALIZED AGENT DELIVERY - The invention provides compositions and methods for delivering agents to localized regions, tissues, or organs in vivo by conjugating agent-loaded nanoparticles to cells having homing capability. The agents may be therapeutic or diagnostic agents such as cancer chemotherapeutic agents and imaging agents respectively. | 01-16-2014 |
20140017171 | PARTICLE AND PHOTOACOUSTIC CONTRAST AGENT HAVING THE PARTICLE - An iron oxide particle constituting a Resovist (trademark) absorbs a small quantity of light in a near infrared region and emits a weak photoacoustic signal. According to a particle having a catechol-like compound and iron atoms, the particle having a ratio of the number of moles of the catechol-like compound to the number of moles of the iron atoms of 270/10,000 or more, light absorption in the near infrared region increases and a strong photoacoustic signal can be transmitted. | 01-16-2014 |
20140023588 | METHOD OF DRUG DELIVERY BY CARBON NANOTUBE CHITOSAN NANOCOMPLEXES - Functionalized Single Wall Carbon Nanotube (SWCNT) complexed with nanochitosan for use in the delivery of bioaffecting substances and diagnostic applications. fSWCNT complexed with the chitosan NG042 were used for delivery of DNA-encoding EGFP reporter protein and peptide. The results demonstrate that shown CNT-chitosan hybrid nanoparticles exhibit significantly higher transfection efficiency in vivo than chitosan alone. Furthermore, the functionalized nanotubes were tested for peptide transfer into HEK293 cells. The results showed that the hybrid nanoparticles efficiently transferred peptides. Together, these results show that hybrid SWCNT-chitosan particles increase DNA and peptide transfer into cells. | 01-23-2014 |
20140030192 | Functional Targeted Brain Endoskeletonization - Compositions and methods are provided for TEMPEST (Target-Element Modification by Physical and Enduring Structural Transmutation), a method for creating durable structures in vivo in a cell-type and/or circuit specific manner via the use of insoluble polymers. TEMPEST provides a way to functionally remove cells while preserving their “shadow” for easy post-experiment detection and classification. The method of the invention are of particular interest for modifying neurons, which may be central nervous system or peripheral nervous system cells, however the approach may be applied to other cellular systems as well, either in culture system models or in animals. | 01-30-2014 |
20140037545 | INHIBITION OF FIBROSIS AND AF BY TGF-BETA INHIBITION IN THE POSTERIOR LEFT ATRIUM (PLA) - The disclosed methods pertain to diagnosing whether a non-ablative, gene therapy is needed for reducing AF fibrosis in a subject, and if so, methods of reducing AF fibrosis in a subject using gene therapy with a dominant negative TGF-β R2 cDNA expression vector. Kits and computer program products are also described, wherein the kits provide materials for diagnosing and treating AF fibrosis, and the computer program products include a computer readable medium having computer readable program code for monitoring the efficacy of therapeutic ablation of fibrosis in a subject using a gene therapy method. | 02-06-2014 |
20140037546 | MIXTURE OF LIQUID-CRYSTAL COMPOUNDS, SYSTEM OF THREE LIQUID-CRYSTAL MIXTURES AND THEIR USE - Three organic compounds mixtures of liquid-crystal properties, which when mixed together in a precisely determined weight ratio, may show an ability to form thermo-optically active mesophases of established, narrow range thermooptical transitions separation, every 0.5° C., in the temperature range: from 31.8° C. to 32.8° C., from 32.8° C. to 33.8° C., and from 33.8° C. to 34.8° C. and system including these mixtures. The use of these mixtures and the system containing the above mentioned mixtures for colorimetric detection of temperature differentiation on the surface of biological objects in a narrow range of temperatures | 02-06-2014 |
20140044643 | Magnetic Calcium Phosphate Nanoparticles, Applications And Methods Of Preparation Thereof - Magnetic calcium phosphate particles are provided including particles comprising iron oxide and calcium phosphate. A chitosan coating is present on the particles, wherein the particles are less than or equal to 1,000 nm, are magnetic and exhibit a positive charge in the range of 1 mVolts to 60 mVolts. The particles are provided by preparing a calcium hydroxide solution and filtering the calcium hydroxide solution in a membrane filter. An iron chloride solution is formed and combined with the filtered calcium hydroxide solution. In addition, the phosphoric acid solution is combined with the combined solutions of iron chloride and calcium hydroxide, forming a mixture including particles comprising iron oxide and calcium phosphate. | 02-13-2014 |
20140044644 | ANKYRIN G AND MODULATORS THEREOF FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS - The present invention generally relates to the technical field of medicine, in particular to the field of neurodegenerative, neurological and protein misfolding disorders such as amyloidosis. By establishing a role of ankG in APP processing the method of the present invention provides a new insight into the role of ankG in AD pathology and provides ankG as a target, drug, diagnostic agent and particularly as a vaccine in the treatment and diagnosis of the pathogenesis of Alzheimer's disease (AD). | 02-13-2014 |
20140050664 | SOY, LENTIL OR EXTRACT STABILIZED, BIOCOMPATIBLE GOLD NANOPARTICLES - The invention provides stabilized, biocompatible gold nanoparticles that are stabilized with material from soy or lentil plant material or a reactive extract thereof of the plant material. The gold nanoparticles of the invention can be fabricated with an environmentally friendly method for making biocompatible stabilized gold nanoparticles. The nanoparticles can be introduced in vivo to conduct enhanced imaging. The nanoparticles can also be introduced in vivo to conduct therapy. | 02-20-2014 |
20140056813 | NANOPARTICLES DELIVERY SYSTEMS, PREPARATION AND USES THEREOF - The present application relates to thermosensitive liposomes encapsulating nanoparticles which can be used in the health sector, in particular in human health. The invention also relates to pharmaceutical and diagnostic compositions comprising thermosensitive liposomes as defined previously, as well as to their uses. | 02-27-2014 |
20140065071 | Sincalide Formulations - The invention features sincalide formulations that include an effective amount of sincalide, a bulking agent/tonicity adjuster, a stabilizer, a surfactant, a chelator, and a buffer. The invention also features kits and methods for preparing improved sincalide formulations as well as methods for treating, preventing, and diagnosing gall bladder-related disorders using sincalide formulations. | 03-06-2014 |
20140072510 | Synthetic Scaffolds for Metastasis Detection - Provided herein are synthetic scaffolds engineered to function as a pre-metastatic niche to detect metastasis. In particular, synthetic scaffolds described herein provide detection of the earliest events in metastasis, thereby enabling treatment of metastasis before the disease burden increases. | 03-13-2014 |
20140072511 | FLT4 (VEGFR-3) AS A TARGET FOR TUMOR IMAGING AND ANTI-TUMOR THERAPY - The present invention provide purified Flt4 receptor tyrosine kinase polypeptides and fragments thereof, polynucleotides encoding such polypeptides, antibodies that specifically bind such polypeptides, and uses therefor. | 03-13-2014 |
20140072512 | PERYLENEQUINONE DERIVATIVES AND USES THEREOF - The present invention relates to compounds which are perylenequinone derivatives, their stereoisomers and atropisomers. These compounds can be particularly useful as photosensitizers or sononsensitizers in photodynamic or sonodynamic therapy. The invention also relates to various methods for using these compounds in photodynamic and/or sonodynamic therapy. The compounds also are useful as therapeutic agents for treating various hyperproliferative disorders. | 03-13-2014 |
20140079636 | TARGETED THERAPEUTICS - The present invention provides pharmacological compounds including an effector moiety conjugated to an binding moiety that directs the effector moiety to a biological target of interest. Likewise, the present invention provides compositions, kits, and methods (e.g., therapeutic, diagnostic, and imaging) including the compounds. The compounds can be described as a protein interacting binding moiety-drug conjugate (SDC-TRAP) compounds, which include a protein interacting binding moiety and an effector moiety. For example, in certain embodiments directed to treating cancer, the SDC-TRAP can include an Hsp90 inhibitor conjugated to a cytotoxic agent as the effector moiety. | 03-20-2014 |
20140079637 | METHODS AND COMPOSITIONS FOR IMPROVING ANTIANGIOGENIC THERAPY WITH ANTI-INTEGRINS - Described here are methods and compositions for treating tumors and metastases that improve anti-angiogenesis therapy. By inhibiting these mechanisms in a biological system with an anti-beta one integrin composition in combination with an anti-angiogenic composition, tumors and metastases may be deprived of an adequate blood supply, thereby resulting in tumor cell growth arrest and possibly regression, including tumor cell death. The present compositions comprise an anti-beta one integrin agent in combination with an anti-VEGF agent, in a pharmaceutical composition or compositions. Methods of treatment and of imaging are also described. | 03-20-2014 |
20140079638 | NOVEL CONJUGATES OF POLYMERS HAVING A THERAPEUTICALLY ACTIVE AGENT AND AN ANGIOGENESIS TARGETING MOIETY ATTACHED THERETO AND USES THEREOF IN THE TREATMENT OF ANGIOGENESIS RELATED DISEASES - Conjugates of a polymer having attached thereto an angiogenesis targeting moiety and a therapeutically active agent such as an anti-cancer agent or anti-angiogenesis agent, and processes of preparing same are disclosed. | 03-20-2014 |
20140086838 | IDENTIFICATION OF A NEW MOLECULAR FACTOR FOR EARLY DIAGNOSIS OF UROTHELIAL CARCINOMA OF THE BLADDER - The identification is disclosed of a new molecular factor for the early diagnosis of urothelial carcinoma of the bladder. HtrA1 is a molecule that is produced mainly by the urothelium of the bladder, both in physiological and inflammatory pathologies, such as cystitis, whereas it is absent in the urothelial layer of the neoplastic bladder mucosa, regardless of cancer grade and level. By means of Western Blotting two forms of HtrA1 were identified, both in bladder tissue and urine, the native 50 kDa form and the autocatalytic 38 kDa form. The 38 kDa form is significantly underexpressed in tumoral tissues compared with normal tissues and concentration of the 50 kDa form in urine is significantly higher in patients affected by bladder cancer compared to healthy subjects and subjects with cystitis. Therefore, the evaluation of tissutal and urinary HtrA1 levels can be a specific marker of urothelial carcinoma of the bladder. | 03-27-2014 |
20140093454 | Human Monoclonal Antibodies Against CD20 - Isolated human monoclonal antibodies which bind to and inhibit human CD20, and related antibody-based compositions and molecules, are disclosed. The human antibodies can be produced by a transfectoma or in a non-human transgenic animal, e.g., a transgenic mouse, capable of producing multiple isotypes of human monoclonal antibodies by undergoing V-D-J recombination and isotype switching. Also disclosed are pharmaceutical compositions comprising the human antibodies, non-human transgenic animals and hybridomas which produce the human antibodies, and therapeutic and diagnostic methods for using the human antibodies. | 04-03-2014 |
20140093455 | METHOD FOR TREATING AND CONFIRMING DIAGNOSIS OF EXERTIONAL COMPARTMENT SYNDROME - Described is a new method of treating chronic compartment syndrome in a muscle of a mammal, particularly exertional compartment syndrome. The method includes introducing an effective amount of a nerve-blocking toxin, such as human botulinum toxin into the muscle. Further in addition to treating chronic or exertional compartment syndrome, a method is included and described in the disclosure of confirming diagnosis of exertional compartment syndrome in a muscle of a mammal. In the method, venous compression and/or expansion in a mammal in an area of a muscle having a symptom associated with exertional compartment syndrome is evaluated by comparing venous flow at rest and after stress on the muscle. An anaesthetic is used to block a nerve supplying motor function to the muscle causing compression of a blood vessel. The mammal is evaluated after the block of the nerve to determine if the symptom associated with exertional compartment syndrome is alleviated. | 04-03-2014 |
20140099263 | POLYMER-AGENT CONJUGATES, PARTICLES, COMPOSITIONS, AND RELATED METHODS OF USE - Described herein are polymer-agent conjugates and particles, which can be used, for example, in the treatment of cancer. Also described herein are mixtures, compositions and dosage forms containing the particles, methods of using the particles (e.g., to treat a disorder), kits including the polymer-agent conjugates and particles, methods of making the polymer-agent conjugates and particles, methods of storing the particles and methods of analyzing the particles. | 04-10-2014 |
20140105821 | ANTIBODY THAT STOPS OR SLOWS TUMOUR GROWTH (VARIANTS) - A monoclonal antibody is described herein specifically binding to domains II and IIIc of FGFR1 or to a complex of fibroblast growth factor receptor type 1 and heparan sulphate. A method is proposed for suppressing tumour growth, based on blocking the human fibroblast growth factor/human fibroblast growth factor receptor type 1 (domains II and IIIc) pathway and involves administering the antibody. A conjugate of the antibody and contrast agents is proposed intended for use in diagnosing malignant and other growths, whose cells express large quantities of FGFR1. A method is proposed for diagnosing malignant neoplasms. The proposed methods enable blocking the fibroblast growth factor/fibroblast growth factor receptor type 1 pathway by means of binding to domains II and IIIc of FGFR1, thus stopping or slowing tumour growth. The methods present novel preparations for the diagnosis and treatment of diseases related to overproliferation and neovascularization. | 04-17-2014 |
20140105822 | NANOSPHERES COMPRISING TOCOPHEROL, AN AMPHIPHILIC SPACER AND A THERAPEUTIC OR IMAGING AGENT - This invention relates to a nanosphere comprising tocopherol, an amphiphilic spacer and a therapeutic agent, an imaging agent, a hydrophobic antioxidant, a hydrophobic nonsteroidal anti-inflammatory drug (NSAID) derivative, a hydrophobic antioxidant and anti-inflammatory derivative of a nonsteroidal anti-inflammatory drug (NSAID), a statin lactone derivative, an antioxidant derivative of camptothecin or camptothecin analog, or a combination thereof. Methods of synthesizing the nanospheres and their use in treating, detecting or diagnosing diseases are also provided. | 04-17-2014 |
20140105823 | MOLECULES SPECIFICALLY BINDING PANCREATIC BETA CELLS BIOMARKERS - The present invention provides a synthetic peptide molecule that specifically binds an FXYD2-gamma isoform of pancreatic beta cells, said synthetic peptide molecule has 25 amino acids. | 04-17-2014 |
20140112869 | CENTRAL NERVOUS SYSTEM LABELLING COMPOSITION FOR INTRANASAL ADMINISTRATION AND LABELLING METHOD AND SCREENING METHOD USING CENTRAL NERVOUS SYSTEM LABELLING COMPOSITION FOR INTRANASAL ADMINISTRATION - There is provided a central nervous system labelling composition for intranasal administration for the purpose of labelling the central nervous system from the olfactory epithelium by way of the olfactory bulb and by means of intranasal administration. Additionally, there is provided a method of non-invasively labelling the central nervous system by way of an administration route that entails little transferability to the entire body. Furthermore, there is provided a screening method using a central nervous system labelling composition for intranasal administration. A central nervous system labelling composition for intranasal administration is characterized by labelling the central nervous system from the olfactory epithelium by way of the olfactory bulb and by means of intranasal administration and by containing at least one compound expressed either by the general formula (1) or the general formula (2) shown below as effective component: | 04-24-2014 |
20140127131 | ANTIBODIES RECOGNIZING ALPHA-SYNUCLEIN - The invention provides monoclonal antibody 5C1 and related antibodies. The 5C1 antibody binds to an epitope within residues 118-126 of α-synuclein. The antibodies of the invention are useful, for example, for treating and/or diagnosing disorders associated with α-synuclein, particularly accumulation of α-synuclein deposits. Such disorders include Lewy body diseases, such as Parkinson's disease, Diffuse Lewy Body Disease (DLBD), Lewy body variant of Alzheimer's disease (LBV), Combined Alzheimer's and Parkinson disease, pure autonomic failure and multiple system atrophy (MSA). | 05-08-2014 |
20140127132 | BRANCHED AMPHIPATHIC BLOCK POLYMER AND MOLECULAR AGGREGATE AND DRUG DELIVERY SYSTEM USING SAME - Provided is a polymeric micelle pharmaceutical preparation that can increase the ratio of contrast at tumor site to background contrast in a short period of time after administration of a lactosome and can suppress the ABC phenomenon so that the lactosome can be administered more than once within a short span. A branched-type amphiphilic block polymer comprising: a multi-branched hydrophilic block comprising sarcosine; and a hydrophobic block comprising polylactic acid. The branched-type amphiphilic block polymer, wherein the number of branches of the hydrophilic block is 3. A molecular assembly comprising the branched-type amphiphilic block polymer. The molecular assembly further comprising a linear type amphiphilic block polymer. | 05-08-2014 |
20140134108 | METHODS FOR METABOLIC IMAGING - The present embodiments disclose the preparation of hyperpolarized | 05-15-2014 |
20140140929 | CHEMICALLY MODIFIED CELL-PENETRATING PEPTIDES FOR IMPROVED DELIVERY OF GENE MODULATING COMPOUNDS - The present invention relates to a system for intracellular delivery of a cargo comprising at least one component A chosen from aliphatic linear or branched moieties with at least 4 carbon atoms and/or cyclic ring systems comprising 2-4 rings which may contain several hetero atoms chosen from N, S, O and P, wherein component(s) A is (are) attached to a cell penetrating peptide B and/or a non-peptide analogue thereof. It also relates to methods of using the system in diagnosis of diseases, as research tool and as a targeting system, a composition comprising the system and especially a pharmaceutical composition a material covered with the system and a material having the delivery systems into the material. Finally it relates to novel peptides. | 05-22-2014 |
20140147387 | NANOPARTICLE CONTRAST AGENTS FOR DIAGNOSTIC IMAGING - Compositions of nanoparticles functionalized with at least one zwitterionic moiety, methods for making a plurality of nanoparticles, and methods of their use as diagnostic agents are provided. The nanoparticles have characteristics that result in minimal retention of the particles in the body compared to other nanoparticles. The nanoparticle comprising a nanoparticulate transition metal oxide covalently functionalized with a silane-functionalized non-targeting zwitterionic moiety. | 05-29-2014 |
20140147388 | Nano-Seaurchin Contrast Agents With Pore-Filled Gold Nanorods And The Preparation Method Thereof - A nano-photoacoustic imaging agent is disclosed. The nano-photoacoustic imaging agent includes a porous carrier and a gold filling material embedded in the porous carrier. A method for the preparation of the nano-photoacoustic imaging agent is also provided. | 05-29-2014 |
20140170068 | BIOMARKER FOR CORONARY ARTERY DISEASE - In various embodiments methods are provided for identifying a mammal having an elevated risk for an adverse cardiac event (e.g. an MI) and/or determining the prognosis for the mammal. In certain embodiments the methods comprise determining, or causing to be determined, the presence and/or level of antibodies that bind a malondialdehyde-acetaldehyde adduct (MAA adduct) in a biological sample from the mammal, where an elevated level of anti-MAA adduct antibodies, as compared to the level found in a normal healthy mammal is an indicator that that said mammal has one or more atherosclerotic lesions and/or is at elevated risk for a myocardial infarction. | 06-19-2014 |
20140170069 | ASSESSMENT OF CORONARY HEART DISEASE WITH CARBON DIOXIDE - The invention provides methods for diagnosing coronary heart disease in a subject in need thereof comprising administering an admixture comprising CO | 06-19-2014 |
20140170070 | STABLE COLLOIDAL GOLD NANOPARTICLES WITH CONTROLLABLE SURFACE MODIFICATION AND FUNCTIONALIZATION - In the present invention, a method of producing stable bare colloidal gold nanoparticles is disclosed. The nanoparticles can subsequently be subjected to partial or full surface modification. The method comprises preparation of colloidal gold nanoparticles in a liquid by employing a top-down nanofabrication method using bulk gold as a source material. The surface modification of these nanoparticles is carried out by adding one or multiple types of ligands each containing functional groups which exhibit affinity for gold nanoparticle surfaces to produce the conjugates. Because of the high efficiency and excellent stability of the nanoparticles produced by this method, the fabricated gold nanoparticle conjugates can have surface coverage with functional ligands which can be tuned to be any percent value between 0 and 100%. | 06-19-2014 |
20140170071 | Modified Pyrazine Derivatives and Uses Thereof - In some embodiments, the invention provides modified pyrazine derivatives containing a central pyrazine ring with two secondary amine groups attached directly to the central pyrazine ring and two amino carbonyl groups attached directly to the central pyrazine ring. The secondary amine groups are terminated by alkyl groups containing from 1 to 6 carbons. The amino carbonyl groups can be terminated by a wide range of substituents including, but not limited to, alkyl and alkylene groups, polyether groups, including poly(ethylene glycol) groups, secondary and tertiary amine groups, polyhydroxylated alkyl groups, amino carbonyl groups, amino thioketone groups, and combinations thereof. In some embodiments, the invention provides modified pyrazine derivatives useful as optical agents in a wide variety of biomedical imaging procedures, including diagnostic and imaging procedures. In an embodiment, for example, modified pyrazine derivatives are provided which are useful in monitoring organ and system functioning, for example in monitoring renal system functioning. | 06-19-2014 |
20140186264 | EXTRACELLULAR VESICLE-ASSOCIATED PROTEIN MARKERS OF CANCER - Extracellular vesicle-associated protein biomarkers for use in diagnosing and staging carcinomas, e.g., lung and ovarian cancers. | 07-03-2014 |
20140186265 | MULTIFUNCTIONAL BACTERIOPHAGE FOR DELIVERY OF THERAPEUTIC AGENTS AND IMAGING REAGENTS - This invention relates to modified bacteriophage useful for the delivery of macromolecular biopolymers and nanoparticles to target cells, e.g., disease cells, and their use in cell-selective identification and imaging, as well as the treatment and prevention of diseases and other medical conditions. | 07-03-2014 |
20140186266 | CONJUGATES OF NITROIMIDAZOLES AND THEIR USE AS CHEMOTHERAPEUTIC AGENTS - Novel compounds which are derivatives of tetra-O-methyl nordihydroguaiaretic acid (NDGA), as well as pharmaceutically acceptable salts, solvates, and stereoisomers thereof are provided. These NDGA derivatives have a nitroimidazole moiety and these derivatives show preferential toxicity to hypoxic cells as hypoxic cytotoxins. Their cytotoxicity toward hypoxic cells is a result of abstraction of hydrogen from target molecules by free radicals formed in the reduction of the nitro group. This makes the disclosed compounds an effective anti cancer drug because hypoxic cells are generally considered to be more resistant to anti cancer drugs than normal cells. Pharmaceutical compositions comprising such compounds, as well as methods of use, and treatment for cancers, including hepatocellular carcinoma, breast cancer and prostate cancer, are also provided. | 07-03-2014 |
20140186267 | Modified Pyrazine Derivatives and Uses Thereof - Provided herein are compounds, preparations and formulations comprising pyrazine derivatives having multiple poly(ethylene glycol) containing substituents. Many of the compounds disclosed herein are excretable by the renal system of a subject or patient and are useful for visualizing the renal system of a subject or patient. Upon excitation by electromagnetic radiation, a number of the compounds disclosed herein exhibit luminescence and are externally detectable when present in the body fluid of a patient or subject. Also provided herein are methods for visualizing the renal system of a subject or patient. | 07-03-2014 |
20140193338 | COMPOUNDS FOR USE IN IMAGING, DIAGNOSING AND/OR TREATMENT OF DISEASES OF THE CENTRAL NERVOUS SYSTEM - This invention relates to novel compounds suitable for labelling by | 07-10-2014 |
20140193339 | NEW FAMILY OF ANALOGUES AND NADP+ OR NADPH, THEIR PREPARATION AND THEIR APPLICATION IN THERAPEUTICS - A new family of analogues of NADP+ or NADPH, their preparation and their application in therapeutics. | 07-10-2014 |
20140199241 | LIPOSOMES COMPRISING POLYMER-CONJUGATED LIPIDS AND RELATED USES - The present invention provides liposomes comprising a lipid bilayer and a polymer-conjugated lipid, wherein said polymer-conjugated lipid is incorporated into said lipid bilayer. The present invention also provides methods of producing the liposomes as well as a method of delivering a nucleic acid to a subject comprising the step of administering said nucleic acid encapsulated in a mixed liposome, a method for performing diagnostic imaging in a subject, comprising the step of administering a diagnostic agent encapsulated in a mixed liposome, and methods for treating, inhibiting, or suppressing a pathological condition in a subject comprising administering to said subject a mixed liposome. | 07-17-2014 |
20140199242 | COMPOSITIONS AND METHODS FOR DETECTION AND TREATMENT OF CANCER - Novel antibodies for the detection and/or treatment of a cancer (e.g., a pancreatic cancer or an ovarian cancer) are provided. In certain embodiments the antibodies bind a region of the MUC4 protein that does not comprise the central tandem repeat (TR) domain of MUC4. Certain antibodies bind to the MUC4 peptide fragment MUC4-α-N-Ter and/or to the MUC4 peptide fragment MUC4-α-C-Ter. Chimeric constructs comprising such antibodies are also provided. | 07-17-2014 |
20140199243 | BIFUNCTIONAL PHOSPHONATE CHELATING AGENTS - Compounds of the following Formula (I): | 07-17-2014 |
20140199244 | CONTROLLED RELEASE SYSTEM - The present invention relates to controlled release systems that may be administered other than intravenously. The controlled release system is directed to active ingredients, entrapped in or otherwise incorporated in or coupled to polymer carriers or polymeric devices, such as micelles, nanoparticles, microspheres and other types of polymer devices for controlled release; the active ingredients are covalently bonded to the polymer carriers or polymeric devices. The controlled release systems may suitably be used to treat diseases. | 07-17-2014 |
20140205538 | VACCINES TARGETING CELLULAR DEATH RECEPTORS - The invention provides therapeutics and methods to induce a mammalian host, including a human, to produce antibodies, which agonize death receptors and cause the apoptotic death of target cells within the host's body. The therapeutics are vaccine compositions, including genetic vaccines encoding death receptor antigens of the tumor necrosis factor receptor family. Also provided are means and methods for overcoming host immunological tolerance to death receptors. The vaccines are useful against cancer cells and other death receptor bearing target cells within the host, and can be used in both therapeutic and prophylactic settings. The vaccines are also useful for diagnostic testing of the immunocompetence of a host. | 07-24-2014 |
20140205539 | Dual Acting Prodrugs - The present invention relates to a prodrug which comprises at least two different pharmaceutically and/or diagnostically active compounds independently bound by cleavable linkers and a protein-binding moiety which is capable of binding to carrier a molecule. | 07-24-2014 |
20140212357 | CONJUGATE OF A POLYMER, AN ANTI-ANGIOGENESIS AGENT AND A TARGETING MOIETY, AND USES THEREOF IN THE TREATMENT OF BONE RELATED ANGIOGENESIS CONDITIONS - Conjugates of hydroxypropyl methacrylamide (HPMA)-derived copolymers having attached thereto TNP-470 and a high load (e.g., higher than 3 mol %) of alendronate (ALN), and processes of preparing same are disclosed. | 07-31-2014 |
20140219918 | PEPTIDE - The present invention provides a foot-and-mouth diseases virus (FMDV) VP1 capsid protein which comprises an entity of interest (EOI). The EOI sequence may, for example, be an epitope tag, an immunomodulatory molecule or a target molecule. The present invention also provides an FMDV vaccine which comprises such a VP1 capsid protein and its use to prevent FMD. | 08-07-2014 |
20140219919 | IL-11R BINDING PROTEINS AND USES THEREOF - The present disclosure provides proteins comprising antigen binding sites of antibodies that bind to interleukin-11 (IL-11) receptor alpha (IL-11Rα) and uses thereof, e.g., in therapy. | 08-07-2014 |
20140219920 | IMMUNOCYTOKINE COMBINATION THERAPY - Methods and compositions for treating tumours, especially skin tumours, by locally administering single doses of tumour necrosis factor alpha (TNFα) and interleukin-2 (IL2) at the tumour site, where the TNFα and IL2 are delivered as immunoconjugates comprising an antibody targeted to a splice isoform of an extracellular matrix component such as fibronectin. | 08-07-2014 |
20140234218 | MODIFIED VARIABLE DOMAIN MOLECULES AND METHODS FOR PRODUCING THEM B - The present disclosure provides an isolated, engineered or non-naturally occurring protein comprising an antibody light chain variable domain (V | 08-21-2014 |
20140234219 | Method and Device for Detecting Analytes | 08-21-2014 |
20140234220 | METHOD AND COMPOSITION FOR DISPERSIONS OF GOLD NANOPARTICLES - The present disclosure relates to a method for making a gold nanoparticle dispersion. The method includes providing a first solution that has gold ions in a liquid medium, adding NTA molecules to the first solution to form a gold nanoparticle dispersion. When the NTA molecules are added to the first solution, the NTA molecules act as a reducing agent to reduce the gold ions to gold atoms, after which the gold atoms nucleate to form gold nanoparticles. The excess NTA molecules then attach to the surface of the gold nanoparticles to stabilize the dispersion. The present disclosure also relates to a dispersion composition that includes a liquid medium, gold nanoparticles dispersed throughout the liquid medium, and NTA molecules directly coating the gold nanoparticles. | 08-21-2014 |
20140234221 | ANTIGEN-BINDING PROTEINS COMPRISING RECOMBINANT PROTEIN SCAFFOLDS - Disclosed herein are recombinant protein scaffolds and recombinant multifunctional protein scaffolds for use in producing antigen-binding proteins In addition, nucleic acids encoding such recombinant protein scaffolds, recombinant multifunctional protein scaffolds, and antigen-binding proteins are provided Vectors and cells useful for expression of the described proteins are also provided, as are methods of use. | 08-21-2014 |
20140241987 | ALPHA-SYNUCLEIN ANTIBODIES AND USES THEREOF - The invention describes antibodies having a high affinity for aggregated forms of α-synuclein and a low affinity for monomeric forms of α-synuclein. The antibodies are useful in the diagnosis of neurodegenerative diseases. | 08-28-2014 |
20140248214 | High-concentration aqueous dispersions of graphene using nonionic, biocompatible copolymers - Methods of using a surface active block copolymer to disperse graphene in an aqueous medium, such dispersions which can be subsequently separated and processed for a range of end-use applications, including biomedical applications. | 09-04-2014 |
20140255309 | Peptide for Synthesizing Silica, and Use Thereof - A peptide for synthesizing silica and use thereof are provided. The peptide for synthesizing silica can polymerize silica from a silica precursor in an aqueous solution having conditions of normal temperature, normal pressure and near-neutral weak base. The peptide for synthesizing silica can form a self-assembled structure during silica synthesis, and thus can be used as various biomaterials such as a silica-based protein immobilizer, a biosensor, and a drug delivery system. | 09-11-2014 |
20140271473 | ENCAPSULATED METAL ION NANOCLUSTERS - A metal ion nanocluster having a formula of X(OH) | 09-18-2014 |
20140271474 | INHIBITOR PROBES FOR IMAGING SODIUM-GLUCOSE COTRANSPORTERS IN HEALTH AND DISEASE - Radiolabeled tracers for binding to sodium/glucose cotransporters (SGLTs), and their synthesis, are provided. The tracers are high-affinity inhibitors of SGLTs, glycosides labeled with radioactive halogens. Also provided are in vivo and in vitro techniques for using the tracers as analytical tools to study the biodistribution and regulation of SGLTs in health and disease, and to evaluate therapeutic interventions. The ability to monitor radiolabel tracer disposition in real time enables the design of new SGLT inhibitors with lower metabolism and higher efficiency. | 09-18-2014 |
20140271475 | CELLULOSE NANOPARTICLE BIODEGRADABLE PHOTOACOUSTIC CONTRAST AGENTS - Biodegradable cellulose photoacoustic probes are provided that are able to detect biological targets and generate a detectable photoacoustic signal. The cellulose nanoparticles are biodegradable by cellulases. Clearance of the nanoparticles from a subject is enhanced and results in improved contrast of a photoacoustic-generated image. Methods to generate images by administering a cellulose nanoparticle probes to a subject and irradiating with light of a wavelength to emit photoacoustic energy detectable by sensors external to the subject are also provided. The detectable signal is convertible to a visual image of the nanoparticle probes in the subject. The methods may include allowing a cellulase to degrade nanoparticles so that undesirable background signals emitted are substantially reduced to increase the contrast and quality of the generated image. In the absence of an endogenous source of an enzyme for degrading the cellulose nanoparticles, a composition comprising a heterologous cellulase may be administered along with the nanoparticles. | 09-18-2014 |
20140271476 | SYNTHESIS AND COMPOSITION OF AMINO ACID LINKING GROUPS CONJUGATED TO COMPOUNDS USED FOR THE TARGETED IMAGING OF TUMORS - The present disclosure relates to compounds that are useful as near-infrared fluorescence probes, wherein the compounds include i) a pteroyl ligand that binds to a target receptor protein, ii) a dye molecule, and iii) a linker molecule that comprises an amino acid or derivative thereof. The disclosure further describes methods and compositions for making and using the compounds, methods incorporating the compounds, and kits incorporating the compounds. | 09-18-2014 |
20140271477 | MONOCLONAL ANTIBODIES TO EGFR, AND USES THEREFOR - The present invention relates to isolated monoclonal anti-EGFR antibodies, and to the use of such antibodies and antibody fragments to detect EGFR, particularly those expressed by cancer cells. The antibodies are useful in diagnostic as well as therapeutic indications. Methods, devices and kits for the immunodetection and immunotherapy of cells expressing EGFR is also encompassed. | 09-18-2014 |
20140271478 | ANTIBODIES THAT BIND INTEGRIN ALPHA-V BETA-8 - Provided herein are antibodies with high affinity for the β8 subunit of αβ8. | 09-18-2014 |
20140286866 | IMAGING AGENTS WITH IMPROVED PHARMACOKINETIC PROFILES - The invention relates to compounds suitable for use in an imaging agent said imaging agent showing an improved pharmacokinetic profile. | 09-25-2014 |
20140294726 | METHODS FOR DIAGNOSING AND TREATING ALZHEIMER'S DISEASE BY ADMINISTERING AN ANTI-ANGIOGENIC AGENT - Methods for diagnosing and treating Alzheimer's disease are provided. In particular, methods of restoring blood-brain barrier integrity and/or promoting vascular reversion in a person suffering from Alzheimer's disease by administering an anti-angiogenic agent or an agent that is capable of restoring tight junction integrity. Methods of preventing or delaying the onset of Alzheimer's disease in a subject are also provided. | 10-02-2014 |
20140294727 | PEPTIDES FOR ASSISTING DELIVERY ACROSS THE BLOOD BRAIN BARRIER - The present invention provides compositions and methods useful for delivering agents to target cells or tissues, for example nerve cells and other cells in the central nervous system. The compositions and methods are useful for delivering agents across the blood-brain barrier. The present invention also provides methods of using the compositions provided by the present invention to deliver agents, for example therapeutic agents for the treatment of neurologically related disorders. | 10-02-2014 |
20140308206 | FC RECEPTOR BINDING PROTEINS - The disclosure relates to antibodies that bind FcRn and methods of using these antibodies. | 10-16-2014 |
20140308207 | OPEN MICROFLUIDIC DEVICES FOR CHEMOTAXIS, METHODS OF USING SAME, AND APPLICATIONS OF SAME - In one aspect, an on-chip microfluidic device (OMD) is provided for microscopic observation. In one embodiment, an on-chip gradient generating device has a silica chip having a cell loading portion configured to load the tissue. A microfluidic channel is formed in the silica chip for a chemoattractant solution having the chemoattractant to flow through, and a plurality of gradient generating ports is formed to connect to the microfluidic channel to the cell loading portion. A chemoattractant supply device is connected to an inlet of the at least one microfluidic channel for supplying the chemoattractant with a constant positive pressure to the chemoattractant solution flowing in the microfluidic channel to create the passive gradient of the chemoattractant in the chemoattractant solution such that the tissue is exposed to the chemoattractant solution having different concentration of the chemoattractant at each gradient generating port. | 10-16-2014 |
20140308208 | CAGED COMPOUND DELIVERY AND RELATED COMPOSITIONS, METHODS AND SYSTEMS - Methods are described and related devices, compositions, and systems, in which a caged compound is administered to a biological environment, the caged compound being caged with a long wavelength absorber, the long wavelength being a wavelength greater than or equal to 750 nm; and irradiating the biological environment to excite the long wavelength absorber with light at a wavelength in a range from 900-1100 nm, thus decaging the compound. | 10-16-2014 |
20140314672 | NANOPARTICLE THERAPEUTIC AGENTS, THEIR FORMULATIONS, AND METHODS OF THEIR USE - Nanoparticle therapeutic agents, formulations that include the nanoparticle therapeutic agents, and methods for treating diseases treatable by the therapeutic agents. | 10-23-2014 |
20140314673 | TREATMENT OF CANCER WITH DIHYDROPYRAZINO-PYRAZINES - Provided herein are methods for treating or preventing head and neck squamous cell carcinoma characterized by deletion of chromosome 11q22 or loss of ataxia telangiectasia mutated expression, comprising administering an effective amount of a dihydropyrazino-pyrazine to a patient having head and neck squamous cell carcinoma characterized by deletion of chromosome 11q22 or loss of ataxia telangiectasia mutated expression. | 10-23-2014 |
20140322134 | Treatment and Imaging Methods Using Antibodies to Aminophospholipids - Disclosed are the surprising discoveries that aminophospholipids, such as phosphatidylserine and phosphatidylethanolamine, are stable and specific markers accessible on the luminal surface of tumor blood vessels, and that the administration of an anti-aminophospholipid antibody alone is sufficient to induce thrombosis, tumor necrosis and tumor regression in vivo. This invention therefore provides anti-aminophospholipid antibody-based methods and compositions for use in the specific destruction of tumor blood vessels and in the treatment of solid tumors. Although various antibody conjugates and combinations are thus provided, the use of naked, or unconjugated, anti-phosphatidylserine antibodies is a particularly important aspect of the invention, due to simplicity and effectiveness of the approach. | 10-30-2014 |
20140328758 | USE OF FSH RECEPTOR LIGANDS FOR DIAGNOSIS AND THERAPY OF CANCER - The present invention relates to diagnostic imaging and in particular to the diagnostic imaging and therapy of cancer by means of compositions which specifically target the FSH Receptor expressed by tumor endothelial cells and circulating blood cells. | 11-06-2014 |
20140328759 | LIMIT SIZE LIPID NANOPARTICLES AND RELATED METHODS - Various lipid nanoparticles are disclosed, including nanoparticles comprising a lipid bilayer comprising a phospholipid, a sterol, a polyethylene glycol-lipid surrounding an aqueous core which comprises a therapeutic and/or diagnostic agent and nanoparticles comprising a lipid monolayer surrounding a hydrophobic core. Of particular interest are limit size lipid nanoparticles with a diameter from 10-100 nm. Such lipid nanoparticles are the smallest particles possible for a specific particle composition. Methods and apparatus for preparing such limit size lipid nanoparticles are disclosed. | 11-06-2014 |
20140328760 | ISOTOPIC LABELING OF HIGHER ORGANISMS - The invention generally relates to metabolic labeling of a target organism with a stable isotope. In a first aspect, the present invention relates to a method for metabolic labeling of a target organism with a stable isotope. The present invention also relates to a method of producing a diet for metabolic labeling of a target organism and to a diet composition for metabolic labeling of a target organism. In a further aspect the invention describes the use of the diet composition according to the present invention for producing a metabolically labeled target organism as a reference for a quantitative proteomic approach. The present invention also relates, in a further aspect, to the use of a diet composition for pulse SILAC labeling. The present invention also relates to the use of a target organism labeled by the method according to the first aspect of the present invention as a spike-in standard in quantitative proteomics approaches. | 11-06-2014 |
20140328761 | Local J-Coupling Dye-Zeolite Antenna Composite Materials - A dye loaded zeolite composite material comprises a plurality of zeolite crystals each having a plurality of straight through uniform channels extending between the proximal face and the distal face and having a channel axis parallel to and a channel width transverse to a longitudinal crystal axis A. Each channel contains a substantially linear arrangement of dye molecules comprising first and second dye molecules having an elongated shape with a longitudinal extension exceeding said channel width and a lateral extension not exceeding said channel width. Each dye molecule consists of a chromophore moiety arranged between a pair of terminal moieties, wherein: the chromophore moieties of the first and second dye molecules are substantially identical, the terminal moieties of the first dye molecules have a lateral extension larger than half of the channel width, the terminal moieties of the second dye molecules have a lateral extension smaller than half of the channel width, the linear arrangement of dye molecules comprises at least one pair of second dye molecules adjacent each other. | 11-06-2014 |
20140335020 | COMPOSITION AND METHOD OF MAKING THE NOVEL POLYMER GEL FOR USE IN DOSIMETER - Normal N-(Hydroxymethyl) acrylamide (PNHMAG) and normoxic N-(Hydroxymethyl) acrylamide (NHMAGAT) polymer gel dosimeters with low toxicity and low cost are invented for radiation treatment planning. A high dose response was displayed in this invention using nuclear magnetic resonance (NMR) and spectrophotometer methods. The response of both types of gels showed an independence of dose rate and radiation energy and a high degree of stability after irradiation. | 11-13-2014 |
20140335021 | Ocular Neostigmine Drops for Diagnosing Myasthenia Gravis - Disclosed is a method for aiding in the diagnosis of myasthenia gravis. Neostigmine, for example one drop of standard intravenous neostigmine solution (2.5 mg/ml) is instilled into each symptomatic or ptotic eye of patients with suspected or probable myasthenia gravis. The patient is later evaluated for possible changes in ptosis. An observable increase of the palpebral fissure height of at least 2 mm, e.g., after 30-60 minutes after neostigmine instillation is considered to be diagnostic. | 11-13-2014 |
20140335022 | METHOD FOR PATIENT SELECTION - The present invention relates to methods useful in the selection of cancer patients suitable for treatment with therapies directed at c-Met. The method employs imaging agents which comprise | 11-13-2014 |
20140341809 | High-Affinity DMF5 T Cell Receptor (TCR) Variants - High-affinity variants of the DMF5 TCR, and methods of use thereof for the treatment and imaging of cancer in a patient. | 11-20-2014 |
20140356286 | Polypeptides Targeting Vascular Endothelial Growth Factor Receptor-2 and Alpha V Beta 3 Integrin - Polypeptides comprising variant vascular endothelial growth factor sequences are provided. The polypeptides are useful in cancer imaging, cancer diagnosis, monitoring and treatment as well as treatment of diseases characterized by excessive neovascularization. | 12-04-2014 |
20140356287 | PLOD2 as a Target of Intervention for Sarcoma Metastasis - The invention provides compositions and methods for treating a disease or disorder by lowering the level of PLOD2 in a subject. | 12-04-2014 |
20140356288 | Topical Examination Compositions and Methods - Topical compositions for examining the tissue under human breasts for lumps, nodules, knots or thickening comprising: (a) a “Pro Breast Health Complex” consisting essentially of (i) Green Tea Extract, (ii) Vitamin D, or a derivative thereof, (iii) Vitamin E, or a derivative thereof, and (iv) | 12-04-2014 |
20140356289 | Multisomes: Encapsulated Droplet Networks - The invention provides a droplet encapsulate comprising: a drop of a hydrophobic medium; a peripheral layer of non-polymeric amphipathic molecules around the surface of the drop; and an aqueous droplet within the peripheral layer, the aqueous droplet comprising: (a) an aqueous medium and (b) an outer layer of non-polymeric amphipathic molecules around the surface of the aqueous medium. The invention also provides processes for preparing the droplet encapsulates. Various uses of the droplet encapsulates are also described, including their use as drug delivery vehicles, in synthetic biology, and in the study of membrane proteins. | 12-04-2014 |
20140363379 | NUTRITIONAL APPROACH TO THE USE OF ERGOTHIONEINE AND VITAMIN D2 FOR HAIR, NAIL AND SKIN GROWTH - Nutritional products, including food and/or beverage compositions, pharmaceutical and cosmetic preparations and methods of use are disclosed for the prevention, suppression and treatment of skin, hair, and nail conditions for the improvement of skin, hair and nail growth through the identification and/or use of stem cells, as well as maintenance of healthy tissues. Uses of Ergothioneine and/or Vitamin D to neutralize free radicals, and improve skin, hair and nail growth are disclosed. | 12-11-2014 |
20140377179 | COMPOSITIONS AND METHODS FOR DELIVERING INHIBITORY OLIGONUCLEOTIDES - The present invention features compositions and methods that make use of complexes comprising one or more inhibitory nucleic acids and a targeting polypeptide, wherein the targeting polypeptide consists of a cell surface receptor ligand. The compositions can be used in methods of silencing gene expression in a cell, in delivering agents to a target cell, and in treating or preventing a disease or disorder in a subject. | 12-25-2014 |
20140377180 | PHOTOACOUSTIC CONTRAST AGENT HAVING LIPID PARTICLE CONTAINING SILICON NAPHTHALOCYANINE ANALOG - A conventional silicon naphthalocyanine-containing liposome is required to incorporate a dye dispersed therein for use in photodynamic therapy, and is thus low in dye content and also low in photoacoustic signal. According to a lipid particle containing a silicon naphthalocyanine analog, in which the ratio A/B of an absorption coefficient A at a first absorption local maximum to an absorption coefficient B at a second absorption local maximum in a range from 700 nm to 800 nm is 5.0 or less, the dye content in the lipid particle can be increased and the photoacoustic signal intensity can be improved. | 12-25-2014 |
20140377181 | MOLECULES WITH EXTENDED HALF-LIVES, COMPOSITIONS AND USES THEREOF - The present invention provides molecules, including IgGs, non-IgG immunoglobulins, proteins and non-protein agents, that have increased in vivo half-lives due to the presence of an IgG constant domain, or a portion thereof that binds the FcRn, having one or more amino acid modifications that increase the affinity of the constant domain or fragment for FcRn. Such proteins and molecules with increased half-lives have the advantage that smaller amounts and or less frequent dosing is required in the therapeutic, prophylactic or diagnostic use of such molecules. | 12-25-2014 |
20150017099 | DIAGNOSIS AND TREATMENT FOR RESPIRATORY TRACT DISEASES - The invention provides methods and compositions for the diagnosis, prognosis and treatment of respiratory tract diseases. Specifically, the invention provides diagnosis, prognosis and treatment of respiratory infections using bitter and sweet taste signal transduction pathways. In one aspect, the invention relates to a method for treating a respiratory infection by administering a composition to the respiratory tract of a subject in an amount capable of activating bitter taste signaling and/or inhibiting sweet taste signaling. The composition comprises at least a bitter receptor agonist and, optionally, a pharmaceutically acceptable carrier for delivering the composition to the respiratory tract. In another aspect, the invention relates to a composition for treatment of a respiratory infection. Such composition comprises at least a bitter receptor agonist and, optionally, a pharmaceutically acceptable carrier for delivering the composition to the respiratory tract. | 01-15-2015 |
20150017100 | ORAL PREPARATION USEFUL IN MEASURING CAPACITY TO METABOLIZE PYRIDINE - An object of the present invention is to provide an oral preparation that can be used to diagnose the existence or degree of pyridine metabolic capacity disorder, pyrimidine metabolic rate, etc., with high accuracy and with little variation due to individual differences. The oral preparation is prepared using a powder material obtained by mixing and pulverizing (a) an isotope-labeled compound and/or a pyrimidine metabolite compound and (b) a sugar and/or a sugar alcohol. | 01-15-2015 |
20150023879 | DIAGNOSTIC CHEWING GUM FOR PATHOGENS - The document proposes a diagnostic chewing gum for identifying the presence of pathogens detectable via the mouth, in particular residing in nasal, oropharyngeal, laryngeal, oesophageal, ocular and/or pulmonal tissue of a user, comprising a base material or particles ( | 01-22-2015 |
20150030541 | NANOPARTICLE PEG MODIFICATION WITH H-PHOSPHONATES - The present invention provides phosphonate conjugates and methods of preparing the phosphonate conjugates so as to allow, for example, improved methods and compounds for modifying the surface of a nanoparticle to increase in vivo circulation times and targeted delivery performance. | 01-29-2015 |
20150037254 | CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING - Provided is a particle having a large photoacoustic signal per unit dye, the particle including: one of a hydrophobic metal naphthalocyanine dye and a hydrophobic metal phthalocyanine dye; one of an oil, a fatty acid, and a fatty acid ester as a matrix material; and a surfactant, in which a ratio of the weight of the matrix material to the weight of the particle is 50% or more. | 02-05-2015 |
20150037255 | PHTHALOCYANINE DYE-CONTAINING CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING - To provide a particle promoting hydrophobic metal phthalocyanine aggregation, having absorption in a wavelength region suitable for a photoacoustic imaging method and having a high molar absorbance coefficient per particle by increasing the weight percentage of the dye in the particle. The particle of the present invention is a particle having a hydrophobic metal phthalocyanine and a surfactant, wherein the weight percentage of the hydrophobic metal phthalocyanine is 6% or more. | 02-05-2015 |
20150037256 | USE OF SILVER(I) COMPLEXES AS ANTICANCER AGENTS - The present invention relates to the use of silver(l) monophosphine complexes as Active Pharmaceutical Ingredients (API's), including anticancer agents, for the treatment, diagnosis and/or prevention of cancer. The present invention also relates to pharmaceutical compositions containing such complexes and further extends to a method of treating or diagnosing a subject/patient suffering from cancer. | 02-05-2015 |
20150044137 | NEUTRALIZING ANTIBODIES TO HIV-1 AND THEIR USE - Neutralizing antibodies that specifically bind to HIV-1 gp120 and antigen binding fragments of these antibodies are disclosed. Nucleic acids encoding these antibodies, vectors and host cells are also provided. Methods for detecting HIV using these antibodies are disclosed. In addition, the use of these antibodies, antigen binding fragment, nucleic acids and vectors to prevent and/or treat an HIV infection is disclosed. | 02-12-2015 |
20150050214 | COMPOSITION AND METHOD OF MAKING THE NOVEL 3D POLYMER GEL FOR USE IN RADIATION TREATMENT PLANNING - Polymer gel dosimeters based on radiation-induced polymerization of N-(Isobutoxymethyl) acrylamide (NIBMA) polymer gels in normal atmospheric condition (NIBMAGAT) have been synthesized and studied as a new composition of polymer gel dosimeters for radiotherapy treatment planning. The dosimeters were irradiated with at absorbed doses up to 30 Gy and no change in dose response was observed even after using repeatedly for eight times. The novel composition shows no change in the relaxation rate or absorbance of the gel dosimeters up to 144 hours. Dose response of NIBMAGAT gel dosimeters increases with increase of monomer concentration. The relaxation rate of NIBMAGAT gel increases with increase of THPC concentration from 2.5 to 5 mM, but the dose response is not affected with increase of THPC concentration from 5 to 20 mM. The results show that the dose sensitivity increases significantly with increase of glycerol concentration up to ≈30% within gel dosimeters. | 02-19-2015 |
20150050215 | PROTEIN-BASED THERAPY AND DIAGNOSIS OF TAU-MEDIATED PATHOLOGY IN ALZHEIMER'S DISEASE - The invention provides unique therapeutic and diagnostic antibodies, as well as their fragments, portions, derivatives, and variants thereof, that bind regions of the tau protein that contribute to the initiation and propagation of pathological tau-tau interactions, as well as methods of making them. The invention also relates to methods of using those antibodies for diagnostics, prevention, and treatment of Alzheimer's disease and related tauopathies. The present invention also provides a method for a prophylactic and therapeutic treatment of Alzheimer's disease and other neurodegenerative tauopathies. This method entails the injection of antibodies and/or peptide vaccines that elicits an immune response directed to pathological tau proteins and tau deposits in the brains of patients. Suitable vaccines represent a tau peptide carrying one or more of the tau therapeutic epitopes provided herein. | 02-19-2015 |
20150056139 | TELODENDRIMERS AND NANOCARRIERS AND METHODS OF USING SAME - Provided are functional segregated telodendrimers having, for example, two or three functional segments. The telodendrimers can have one or more crosslinking groups (e.g., reversible photocrosslinking groups). The telodendrimers can aggregate to form nanocarriers. Cargo such as drugs, imaging probes, and other materials may be sequestered in the core of the aggregates via non-covalent or covalent interactions with the telodendrimers. Such nanocarriers may be used in drug delivery applications and imaging applications. | 02-26-2015 |
20150056140 | ELECTROLYTE PURGATIVES - The invention provides compositions for use in purgatives, for use as purgatives, and to methods for inducing purgation of the colon. In alternative embodiments, the invention provides compositions, e.g., a purgative, comprising: a water-soluble sodium salt (especially sodium sulphate), a water-soluble potassium salt (especially potassium sulphate), and a water-soluble magnesium salt (especially magnesium sulphate); and, compositions further comprising: a bisoxatin, or a detergent stool softening agent (such as sodium picosulphate) and/or a water-soluble sugar (such as xylose or equivalent); or, compositions having these ingredients at different amounts, but at equivalent proportions. In alternative embodiments, the invention provides purgative compositions comprising electrolytes, salts, sugars, bisoxatin, dyes and biofilm disruptors. | 02-26-2015 |
20150071856 | ANTAGONISTIC PEPTIDES FOR FRIZZLED-1 AND FRIZZLED-2 - The invention is in the field of molecular medicine. It provides antagonistic compounds for frizzled-1 and/or frizzled-2 receptors, which may be useful in molecular imaging of the wound healing process after myocardial infarction and in therapeutic intervention into wound healing after remodeling of the heart, thereby ameliorating the consequences of myocardial infarction. The invention provides a method for antagonizing frizzled-1 or frizzled-2 receptors, wherein the receptor is contacted with a composition comprising a linear fragment of Wnt3(a) or Wnt5a or a functional analogue thereof, which comprises at least one cysteine residue, one threonine residue, one aspartic acid residue and one glycine residue. | 03-12-2015 |
20150079002 | IN-VIVO REACTIVE SPECIES IMAGING - The disclosure features methods that include: administering to a subject a composition that includes particles, where each one of the particles features at least one targeting group that binds to a structural entity in the subject and at least one reacting group that reacts chemically with a reactive oxygen species in the subject, and where the particle emits luminescence when the reaction occurs; detecting the luminescence emission from the particles; and displaying an image of the subject showing locations of at least some reactive oxygen species in the subject based on the detected luminescence. | 03-19-2015 |
20150093331 | BIOMARKERS FOR BREAST CANCER - The present invention relates to biomarkers, methods and assay kits for the identification, monitoring and treatment of breast cancer. | 04-02-2015 |
20150098904 | EYE DROP COMPOSITION - The present invention relates to an eye-drop composition comprising 2-amino-9-[[(1S,2R)-1,2-bis(hydroxymethyl)cyclopropyl]methyl]-1,9-dihydro-6H-Purin-6-one, and the use thereof for the diagnosis and treatment of herpetic eye infections in companion animals. | 04-09-2015 |
20150104390 | ALL-PROTEIN IMPLANTABLE, RESORBABLE REFLECTORS - The invention provides for compositions and process for fabricating an optical reflector constructed from biocompatible and bioresorbable silk fibroin proteins. For example, the silk retroreflectors may be built based on millimeter size microprism arrays to rotate the image plane of imaged cortical layers, thus enhancing the amount of photons that are detectable in the reflected direction when inserted in a sample to be analyzed, and ultimately increasing in contrast ratio in multiphoton microscopy. Such device can be used as a label-free, biocompatible, bioresorbable, implantable device for various applications ranging from medical imaging/diagnostics, drug/therapeutic delivery, to food chain safety and environmental monitoring. | 04-16-2015 |
20150118158 | Method For Detecting And Purifying Pancreatic Beta Cells - The invention is based, in part, on the discovery that a polypeptide, referred to herein as Betacam, is selectively expressed on the surface of pancreatic islet cells. Thus, in one aspect, the invention is directed to compositions comprising Betacam or that can be used to detect Betacam. In another aspect, the invention provides methods of detecting (e.g., non-invasively) pancreatic beta cells from a mammalian cell source. Another aspect of the invention is directed to cellular purification of pancreatic beta cells from a heterogeneous cell source of multiple kinds. In another aspect, the invention provides methods of identifying agents that modulate activity of Betacam. In yet another aspect, the invention provides for improved treatment and diagnosis of diabetes. | 04-30-2015 |
20150125391 | BONE AND METAL TARGETED POLYMERIC NANOPARTICLES - Bone- and metal-targeted polymeric nanoparticles are provided. Exemplary nanoparticles have three main components: 1) a targeting element that can selectively bind to bone, minerals, or metal ions; 2) a layer of stealth to allow the polymer to evade immune response; and 3) a biodegradable polymeric material, forming an inner core which can carry therapeutics or other diagnostics. Preferred nanoparticles contain a blend of target-element polymer conjugate and polymer that optimizes the ligand density on the surface of the nanoparticle to provide improved targeting of the nanoparticle. The ratio of target-element polymer conjugate to polymer can also be optimized to improve the half-life of the nanoparticles in the blood of the subject. The nanoparticles also exhibit prolonged, sustained release of therapeutic agents loaded into the particles. | 05-07-2015 |
20150125392 | AV 6 PEPTIDE LIGANDS AND THEIR USES - AVβ6 peptide ligands, functional variants thereof and their nucleic acids encoding them are disclosed with their uses in the treatment and imaging of AVβ6 mediated diseases. | 05-07-2015 |
20150125393 | LIPOSOME AND METHOD FOR PRODUCING LIPOSOME - It is intended to provide a liposome preparation which is a liposome, has a lipid bilayer membrane composed of an inner membrane constituted by a lipid including one or more types of functional lipids (a lipid capable of chemically interacting with another compound such as a charged lipid, a polarizable lipid, a lipid-soluble lipid or a water-soluble lipid) and an outer membrane constituted by a lipid with or without including one or more types of functional lipids, and is characterized in that at least a condition that the amount of any one type of functional lipid contained in the inner membrane is larger than in the outer membrane is satisfied. The liposome preparation is suitable as a liposome for encapsulating a contrast agent (a neutral substance having a hydroxy group), siRNA (an anionic substance) having an anticancer activity or the like. Its encapsulation ratio of drug agents, dispersion stability, control release and the like have been improved. | 05-07-2015 |
20150132224 | ANTIBODIES TO IL-6 AND USE THEREOF - The present invention is directed to antibodies and fragments thereof and humanized versions thereof having binding specificity for IL-6. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the V | 05-14-2015 |
20150139904 | Dendrimer Conjugates for Coating Cells - The present invention provides dendrimer conjugates. The present invention provides a composition comprising a dendrimer conjugate and a cell, such as a cell covered with dendrimer conjugates, in which dendrimer conjugates home the cell to a target tissue. | 05-21-2015 |
20150139905 | TARGETED THERAPEUTICS - The present invention provides pharmacological compounds including an effector moiety conjugated to a binding moiety that directs the effector moiety to a biological target of interest. Likewise, the present invention provides compositions, kits, and methods (e.g., therapeutic, diagnostic, and imaging) including the compounds. The compounds can be described as a protein interacting binding moiety-drug conjugate (SDC-TRAP) compounds, which include a protein interacting binding moiety and an effector moiety. For example, in certain embodiments directed to treating cancer, the SDC-TRAP can include an Hsp90 inhibitor conjugated to a cytotoxic agent as the effector moiety. | 05-21-2015 |
20150139906 | SURFACE-MODIFIED NANOPARTICLES FOR INTRACELLULAR DELIVERY OF THERAPEUTIC AGENTS AND COMPOSITIONS FOR MAKING SAME - Surface-modified polymeric nanoparticles (NPs), compositions for making them, and their use in drug delivery are disclosed. | 05-21-2015 |
20150139907 | CALCIUM-BINDING AGENTS INDUCE HAIR GROWTH AND/OR NAIL GROWTH - This invention provides novel methods for inducing hair growth and/or inhibiting hair loss and/or inducing nail growth in a mammal. In various embodiments the methods involve administering, e.g., to a mammal in need thereof, a calcium-binding peptide and/or peptide-like moiety in an amount sufficient to induce hair growth and/or to inhibit hair loss. In certain embodiments the agent is topically and/or transdermally administered. | 05-21-2015 |
20150147274 | ANTIBODIES AGAINST HGF - RECEPTOR AND USES - Antibodies which are antagonists of the human HGF receptor (MET), wherein the antibodies specifically bind to amino acid residues 568-741 of human MET (SEQ ID No: 1) with high affinity. | 05-28-2015 |
20150147275 | ANTHRACENYL-TETRALACTAM MACROCYCLES AND THEIR USE IN DETECTING A TARGET SACCHARIDE - A water-soluble compound of the formula (I): (Formula (I)) wherein R | 05-28-2015 |
20150290345 | CONTRAST AGENT FOR PHOTOACOUSTIC IMAGING - There is provided a contrast agent for photoacoustic imaging, the contrast agent exhibiting high tumor accumulation and high photoacoustic signal intensity even when time has passed since administration. | 10-15-2015 |
20150291695 | MATERIALS AND METHODS RELATING TO MODIFYING THE BINDING OF ANTIBODIES - The invention relates to materials and methods for modifying the binding of antibodies, and more particularly to antibodies that are obtainable by inserting an amino acid sequence capable of binding to a target into a complementarity determining region of a parent antibody so that the antibody thus obtained is capable of binding to the target. The invention further relates to the uses of the antibodies for therapy, diagnosis or imaging, and to methods of producing the antibodies. | 10-15-2015 |
20150307441 | NEW COMPOUNDS AND USES THEREOF - An anthraquinone compound of formula I (such as the compounds of formulae II to X) and processes for making the same are provided. Pharmaceutical compositions for use in the treatment of cancer, optionally in combination with an agent capable of reducing the level of oxygenation of a tumour, are also provided. Additionally, an option for combination with chemotherapeutic and radiotherapeutic modalities to enhance overall tumour cell kill is provided. Methods for the detection of cellular hypoxia, both in vivo and in vitro, are additionally provided. | 10-29-2015 |
20150316536 | METHODS FOR SCREENING - Methods and systems for discovering drug candidates are disclosed. Methods and systems can include generating libraries of potential drug candidates (e.g., libraries of peptides) that can be screened to identify sub-libraries of potential drug candidates (e.g., sub-libraries of peptides) having selected pharmacological properties. Methods of making and using peptide libraries are also provided. D-amino acid chlorotoxins and D-amino acid chlorotoxin variants are also provided. | 11-05-2015 |
20150328254 | FUCOIDAN NANOGELS AND METHODS OF THEIR USE AND MANUFACTURE - Described herein are polymeric drug-carrying nanogels that are capable of targeting to P-selectin for the treatment of cancer and other diseases and conditions associated with P-selectin. Furthermore, in certain embodiments, the nanogels presented here offer a drug release mechanism based on acidic pH in the microenvironment of a tumor, thereby providing improved treatment targeting capability and allowing use of lower drug doses, thereby reducing toxicity. | 11-19-2015 |
20150328315 | SYSTEMS AND METHODS FOR TARGETED IMAGING AND ABLATION OF CARDIAC CELLS - The present invention relates to nanoparticles. In particular, the present invention provides nanoparticles for clinical (e.g., targeted therapeutic), diagnostic (e.g., imaging), and research applications in the field of cardiology. For example, in some embodiments, the present invention provides a method of treating (e.g., ablating) cardiac tissue, comprising: a) contacting an animal with a nanoparticle comprising a matrix, a toxic (e.g., ablative) agent (e.g., sonosensitizer, chemotherapeutic agent (e.g., doxorubicin or cisplatin), or photosensitizer), and a cardiac targeting moiety; and b) administering an activator of the toxic agent (e.g., light, chemical (e.g., pharmaceutical agent) or ultrasound) to at least a portion of the cardiac tissue (e.g., heart) of the animal to activate the toxic agent. | 11-19-2015 |
20150329636 | LOW AFFINITY BLOOD BRAIN BARRIER RECEPTOR ANTIBODIES AND USES THEREFOR - The present invention relates to antibodies that bind blood brain barrier receptors (BBB-R) and methods of using the same. | 11-19-2015 |
20150335764 | Compositions and Methods for Parkinson's Disease Treatment by BDNF-flag Gene Transfer through Neurotensin Polyplex to Nigral Dopamine Neuro - The present invention pertains to the field of genomics and nanotechnology, specifically to the in vivo gene expression technologies and their application in gene therapy. It consists of the performance of the NTS-polyplex nanocomplex, which can carry nucleic acids to the neurons, involving neurotrophic therapy to treat neurodegenerative diseases. In particular, the present invention addresses the treatment of Parkinson's disease by the regulated expression of the BDNF neurotrophin. | 11-26-2015 |
20150335765 | CYANINE-CONTAINING COMPOUNDS FOR CANCER IMAGING AND TREATMENT - This invention relates generally to cyanine-containing compounds; pharmaceutical compositions comprising cyanine-containing compounds; and methods of using cyanine-containing compounds for cancer cell imaging, cancer cell growth inhibition, and detecting cancer cells, for example. Compounds of the invention are preferentially taken up by cancer cells as compared to normal cells. This allows many uses in the cancer treatment, diagnosis, tracking and imaging fields. | 11-26-2015 |
20150335916 | INTERNAL ULTRASOUND GEL - An ultrasound gel is provided for use with internal ultrasound imaging and/or therapy. The gel can have acoustic properties that can closely match a soft tissue to be imaged/treated and can be of a high viscosity that is maintained when heated by the body. In some embodiments, the gel can act as a lubricant and, although water based, can be hydrophobic and not dissolve in bodily fluids. In some embodiments, the gel can be sterile, safe for ingestion, and include a preservative. The gel can be used for oral or non-oral applications and when used orally, can comprise a dental agent for inhibiting growth of dental microorganisms and/or prevent respiratory infections. | 11-26-2015 |
20150337035 | ANTIBODIES TO TNF ALPHA AND USE THEREOF - The present invention is directed to antibodies and fragments thereof having binding specificity for TNF-α. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the V | 11-26-2015 |
20150337308 | MATRIX METALLOPROTEINASE 9 (MMP-9) APTAMER AND USES THEREOF - The present invention relates to a nucleic acid aptamer that binds specifically to human matrix metalloproteinase 9 (h MMP-9) and its use for imaging h MMP-9 in a subject in need thereof. | 11-26-2015 |
20150352118 | EYE DROP COMPOSITION - The present invention relates to an eye-drop composition comprising 2-amino-9-[[(1S,2R)-1,2-bis(hydroxymethyl)cyclopropyl]methyl]-1,9-dihydro-6H-Purin-6-one, and the use thereof for the diagnosis and treatment of herpetic eye infections in companion animals. | 12-10-2015 |
20150353645 | HUMAN MONOCLONAL ANTIBODIES TO GANGLIOSIDE GD2 - The present invention provides compositions for the production of an antibody or functional fragment thereof directed against disialoganglioside-GD2. The compositions of the invention include polynucleotides encoding a heavy chain and/or a light chain variable domain that binds to GD2. The invention also provides an isolated antibody or functional fragment thereof and methods of treating or preventing a disease, such as cancer or tumor formation, wherein the antibody or functional fragment includes a variable heavy chain domain and a variable light chain domain that has an amino acid sequence provided herein. The invention further provides a conjugate of an antibody or functional fragment thereof conjugated or recombinantly fused to a diagnostic agent, detectable agent or therapeutic agent, and methods of treating, preventing or diagnosing a disease in a subject in need thereof. | 12-10-2015 |
20150359902 | PRETARGETED ACTIVATABLE CELL PENETRATING PEPTIDE WITH INTRACELLULARLY RELEASABLE PRODRUG - Disclosed herein, the invention pertains to methods and compositions that find use in treatment, diagnosis, prognosis and characterization of disease and disease samples based on the ability of a disease sample to cleave a MTS molecule of the present invention. The MTS molecules of the present invention have a formula as disclosed herein and wherein A is a peptide with a sequence comprising 5 to 9 consecutive acidic amino acids, wherein the amino acids are selected from: aspartates and glutamates; B is a peptide with a sequence comprising 5 to 20 consecutive basic amino acids; X and Y are linkers; P is a pre-targeting moiety; M is a macromolecular carrier, C is a detectable moiety; and T is a compound for delivery to a target, including for example a therapeutic compound. | 12-17-2015 |
20150366996 | APTAMERS FOR TUMOR INITIATING CELLS - Aptamers consisting of a single stranded nucleic acids having 100 nucleotides or less that specifically binds to tumor initiating cancer cells are described. The aptamers can be identified by screening a large pool of randomly generated aptamers to obtain a discrete set of aptamers that specifically bind to tumor initiating cancer cells, such as those found in brain cancer or glioblastoma. The aptamers can also be linked or complexed with anticancer agents or imaging agents for use in therapy or diagnosis. | 12-24-2015 |
20150374852 | Use of IGF-1 as a Reagent for Early Diagnosis and/or Prognosis of Alzheimer Disease - The invention relates to the use of the insulin-like growth factor (IGF-1) as a reagent for the early diagnosis and/or prognosis of Alzheimer disease, to a kit comprising IGF-1 and a sedative, and to the use thereof in the early diagnosis and/or prognosis of Alzheimer disease. | 12-31-2015 |
20150374856 | NEAR-INFRARED DYE-CONJUGATED HYALURONIC ACID DERIVATIVE AND CONTRAST AGENT FOR OPTICAL IMAGING INCLUDING THEM - Provided is a compound having a high ICG content that has high accumulation property in a tumor and has a large intensity of a photoacoustic signal emitted from the tumor even when a time period elapses after administration. Specifically, provided is a hyaluronic acid derivative to which polyethylene glycol and an ICG derivative are conjugated. | 12-31-2015 |
20160015826 | Constructs Binding to Phosphatidylserine and Their Use in Disease Treatment and Imaging - Disclosed are new phosphatidylserine binding constructs with surprising combinations of properties, and a range of diagnostic and therapeutic conjugates thereof. The new constructs effectively bind phosphatidylserine targets in disease and enhance their destruction, and can also specifically deliver attached imaging or therapeutic agents to the disease site. Also disclosed are methods of using the new construct compositions, therapeutic conjugates and combinations thereof in tumor vasculature targeting, cancer diagnosis and treatment, and fir treating viral infections and other diseases. | 01-21-2016 |
20160024207 | MONOCLONAL ANTIBODIES TARGETING EPCAM FOR DETECTION OF PROSTATE CANCER LYMPH NODE METASTASES - Embodiments of the invention provide high affinity recombinant EpCAM-binding antibodies. Methods of using a such antibodies as imaging agents, diagnostics and therapeutics are also provided. Dual-nuclear and fluorescently labeled or singly fluorescently labeled contrast agents promise the advantage of molecularly-guided surgical resection via surgical field near-infrared fluorescence (NIRF) imaging following (in the case of dual labeled agents) nuclear imaging for general localization. Currently, nodal staging of most cancers is performed following lymph node (LN) biopsy and dissection for subsequent pathological examination. | 01-28-2016 |
20160038627 | METHOD OF CAUSING DELAYED HEMOSTASIS - A method of causing delayed hemostasis. A hemostatic product is formed by applying a hemostatic agent to a dextran support. The hemostatic agent is provided with at least one of a reduced concentration and a reduce availability. The hemostatic product is applied to a wound from which blood is being discharged. At least one foreign object or pathogen is proximate the wound. Hemostasis is progressively caused so that blood continues to be discharged from the wound to cause the at least one foreign object or pathogen to move away from the wound. | 02-11-2016 |
20160039938 | ANTIBODIES AGAINST HUMAN AND CANINE IL-13RA2 - Provided herein is an antibody (e.g., an isolated antibody) that specifically binds an epitope (e.g., linear epitope) within amino acids spanning the extracellular portion of human IL-13RA2. In some embodiments, the amino acids spanning the extracellular portion of human IL-13RA2 have at least 90% identity with the corresponding canine sequence of IL-13RA2. In some embodiments, the antibody specifically binds both human and canine IL-13RA2. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a recombinant antibody. In some embodiments, the antibody is humanized. In some embodiments, the antibody is the monoclonal antibody produced by hybridoma 1E10B9 or a recombinant form thereof. | 02-11-2016 |
20160046668 | TARGETING PEPTIDES AND USES THEREOF - Provided are peptides, fusion proteins which include the peptide sequences, compositions comprising such peptides and fusion proteins, and methods for making and using the compositions. The peptides are characterized as being able to selectively bind to components of the endothelial compartment that are exposed during the period between 1 and 7 days after androgen deprivation. | 02-18-2016 |
20160051483 | DRUG CARRIER HAVING SELF-ASSEMBLED 3-D NUCLEIC ACID NANOSTRUCTURE - The present invention relates to a molecule delivery technology and a carrier technology, which may selectively deliver a material to a desired specific cell and living tissue. The present invention may be utilized in the field of a drug carrier which effectively delivers an imaging probe and a therapeutic agent to an affected part. | 02-25-2016 |
20160051701 | IMPROVED METHODS FOR OSTEOARTHRITIS THERAPY - The present invention provides improved methods for osteoarthritis therapy. In particular, the present invention provides a method for predicting the responsiveness of a subject to cell therapy for osteoarthritis comprising administering to the subject platelet-rich plasma (PRP) and assessing pain and/or mobility, wherein a decrease in pain and/or an increase in mobility indicates that the subject will be responsive to cell therapy. | 02-25-2016 |
20160051705 | FUNCTIONALIZATION OF AND USE OF FUNCTIONALIZED SECOND HARMONIC GENERATING NANOPROBES - Functionalized second harmonic nanoprobes for imaging samples and a method of using such probes to monitor the dynamics different processes using a variety of imaging techniques are provided. The functionalized second harmonic generating (SHG) nanoprobes are comprised of various kinds of nanocrystalline materials that do not possess an inversion symmetry and therefore are capable of generating second harmonic signals that can then be detected by conventional two-photon microscopy, and are provided with functional surface modifications that allow for targeted imaging of a variety of biological and non-biological processes and structures such as cell signaling, neuroimaging, protein conformation probing, DNA conformation probing, gene transcription, virus infection and replication in cells, protein dynamics, tumor imaging and cancer therapy evaluation and diagnosis as well as quantification in optical imaging. | 02-25-2016 |
20160060296 | Cell Penetrating Peptides for Intracellular Delivery of Molecules - A cell-penetrating peptide characterized in that it comprises an amino acid sequence: X | 03-03-2016 |
20160068600 | ISOLATION OF THERAPEUTIC TARGET SPECIFIC VNAR DOMAINS TO ICOSL - The present invention provides ICOSL specific antigen binding molecules which are isolated from immunized and synthetic Elasmobranchii derived libraries. In particular, the present invention relates to shark Variable New Antigen Receptor (VNAR) domains that specifically bind and neutralize the activity of human Induced Co-Stimulatory Ligand (ICOSL). The neutralizing VNAR domains are isolated from two independent sources; an immunized nurse shark library and a synthetic spiny dogfish framework fusion library. The molecules may be formulated as pharmaceutical compositions and used in medicine. | 03-10-2016 |
20160074520 | WOUND HEALING COMPOSITIONS COMPRISING BIOCOMPATIBLE CELLULOSE HYDROGEL MEMBRANES AND METHODS OF USE THEREOF - The present invention provides a wound healing composition comprising a biocompatible hydrogel membrane wherein the hydrogel membrane has one or more of the following properties: high water content, high transparency, high permeability, high biocompatibility, high tensile strength and an optimal thickness. The invention further provides methods of treating a wound in a subject in need thereof, comprising contacting the wound with a biocompatible cellulose hydrogel membrane of the invention. | 03-17-2016 |
20160074521 | PEPTIDE-MEDIATED INTRAVESICAL DELIVERY OF THERAPEUTIC AND DIAGNOSTIC AGENTS - The present invention relates to compositions comprising therapeutic and/or diagnostic anionic agents together with cationic peptides and their use in methods for delivering the anionic agents to bladder cells. | 03-17-2016 |
20160074554 | EMULSIONS OR MICROEMULSIONS FOR USE IN ENDOSCOPIC MUCOSAL RESECTIONING AND/OR ENDOSCOPIC SUBMUCOSAL DISSECTION - The present invention relates to a pharmaceutical composition in form of emulsion or microemulsion and the use thereof as aid during endoscopic procedures in which it is injected in a target tissue in order to form a cushion. More in details, the invention relates to a method for performing an endoscopic procedure, which comprises injecting said pharmaceutical composition in form of emulsion or microemulsion in a target tissue of a patient, in order to form a cushion, which cushion is then optionally subjected to an endoscopic surgical procedure, such as a resection. | 03-17-2016 |
20160083479 | MAB 2 ANTI-MET ANTIBODY - Antibodies specifically binding an epitope comprised in the α-chain of c-Met, modifications, compositions and uses thereof are disclosed herein. | 03-24-2016 |
20160083519 | Polymer Comprising A Plurality Of Phenothiazine Groups And Methods Of Making The Same - A non-leaching mediator may include a polymer having a polymeric backbone, and a plurality of phenothiazine groups bonded to the polymeric backbone. The plurality of phenothiazine groups may include at least one of a phenothiazine group having the general formula (IV): | 03-24-2016 |
20160096869 | CHLOROTOXIN CONJUGATES AND METHODS OF USE THEREOF - Compositions, formulations and kits comprising chlorotoxin conjugate compounds are provided, including native and modified variants of chlorotoxin peptide conjugated to reporter molecules including fluorescent dyes. Methods of detecting and treating cancers and tumors with chlorotoxin conjugate compounds are also provided, including methods of imaging tumor tissues and cells. Dosing and pharmacokinetic profiles for therapeutic and diagnostic applications using chlorotoxin conjugate compounds are also provided. | 04-07-2016 |
20160096894 | ANTIBODIES TO INSULIN-LIKE GROWTH FACTOR I RECEPTOR - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to insulin-like growth factor I receptor (IGF-IR), which is preferably human IGF-IR. The invention also relates to human anti-IGF-IR antibodies, including chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulin molecules derived from anti-IGF-IR antibodies and nucleic acid molecules encoding such molecules. The present invention also relates to methods of making anti-IGF-IR antibodies, pharmaceutical compositions comprising these antibodies and methods of using the antibodies and compositions thereof for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-IGF-IR antibodies. The invention also relates to gene therapy methods and transgenic animals comprising nucleic acid molecules of the present invention. | 04-07-2016 |
20160101194 | SMART.RTM. Medication Adherence Formulation, Method, Device and System for Topical, Vaginal or Rectal Routes of Administration - Novel compositions, methods, systems and devices are disclosed which contain markers for definitive medication adherence monitoring for Active Pharmaceutical Ingredients (APIs) delivered topically, vaginally or rectally. This invention is useful in a wide range of contexts, including, but not limited to, clinical trial settings, home use settings, or other settings, where it is necessary to definitively confirm that a given patient has taken or been administered a given medication at the correct time and in the correct dosage via a topical, vaginal or rectal route of delivery. Specific formulations of markers are disclosed for inclusion in compositions for Active Pharmaceutical Ingredient (API) delivery, including but not limited to delivery of microbicidally active compounds such that on topical, vaginal or rectal delivery, said AEM is detected in the breath or an Exhaled Drug Emplacement Marker, EDEM, which is a metabolite of the AEM, is detected in the breath. | 04-14-2016 |
20160101195 | DIAGNOSTIC KIT - Compounds and a method for imaging myocardial perfusion, including administering to a patient a compound linked to an imaging moiety, wherein the compound binds MC-1, and scanning the patient using diagnostic imaging. Kits including the compound or precursor compounds linked or not linked to an imaging moiety are also described. | 04-14-2016 |
20160106880 | WOUND DRESSING MATERIALS INCORPORATING ANTHOCYANINS DERIVED FROM FRUIT OR VEGETABLE SOURCES - A wound dressing composition, such as gauze, bandages, and surgical tapes comprising a substrate material impregnated with a pH sensitive dye composition comprising at least one anthocyanin derived from fruit or vegetable sources, and methods of use thereof. | 04-21-2016 |
20160108429 | PEG-PROM MEDIATED SURFACE EXPRESSION OF AVIDIN/STREPTAVIDIN - The presently disclosed subject matter relates to compositions and methods directed to cancer theranostic nucleic acid constructs that permit simultaneous cancer-specific viral replication, expression of a diagnostic gene product, and expression of a therapeutic gene. | 04-21-2016 |
20160109463 | Methods for Safe Administration of Nephrotoxic Agents - Methods for determining the risk of developing acute renal failure in a human subject by measuring human neutrophil gelatinase-associated lipocalin (NGAL) are provided. | 04-21-2016 |
20160114032 | BACTERIOPHAGE-POLYMER HYBRID - The invention provides a targeted bacteriophage-polymer complex comprising a recombinant targeted-bacteriophage and a cationic polymer. The complex has a net positive charge. The invention provides methods of preparing bacteriophages and complexes thereof, and to their uses for the delivery of transgenes in a variety of gene therapy applications. | 04-28-2016 |
20160115173 | METHODS AND COMPOSITIONS FOR STUDYING, IMAGING, AND TREATING PAIN - Saxitoxin analogue compounds, compositions, pharmaceutical compositions, methods of synthesis of saxitoxin analogues, methods of imaging, methods of treatment, including methods of treating pain, are provided. Saxitoxin (STX), gonyautoxin (GTX), and zetekitoxin, and variant STX compounds bind to sodium channels and are effective to reduce or block flow of sodium ions through such channels. Such channel block affects nerve and muscle action, and may be effective to reduce or block pain sensations, relax muscles, reduce muscle spasm, and reduce wrinkles. STX analogue binding to sodium channels may also be useful to locate, image, or mark sodium channels, and so be useful in studying sodium channels and sodium channel disorders, and in the diagnosis and treatment of patients suffering from sodium channel disorders. In embodiments, the variant STX compounds include conjugates having increased serum half-life as compared to STX when administered to a subject. | 04-28-2016 |
20160115192 | ANTIOXIDANT, ANTI-INFLAMMATORY AND ANTICANCER DERIVATIVES OF TRIPTOLIDE AND NANOSPHERES THEREOF - This invention relates to uses of conjugates of triptolide nanoprodrugs in cancer immunotherapy, specifically compound such as D-I or D-II wherein X | 04-28-2016 |
20160115237 | CELL SENESCENCE MARKERS AS DIAGNOSTIC AND THERAPEUTIC TARGETS - Provided are methods and agents for depleting senescent cells endogenous to a subject, involving administering to the subject a binding agent that is selectively toxic to senescent cells in an amount effective to reduce the number of such cells, wherein the binding agent binds selectively to a senescent cell surface protein having a misfolded conformation, relative to said protein in a native conformation. | 04-28-2016 |
20160115522 | MUTANT PROTEASE BIOSENSORS WITH ENHANCED DETECTION CHARACTERISTICS - A polynucleotide encoding a biosensor polypeptide comprising a modified circularly-permuted thermostable luciferase and a linker linking the C-terminal portion of the thermostable luciferase to the N-terminal portion of the thermostable luciferase. The modified circularly-permuted thermostable luciferase is modified relative to a parental circularly-permuted thermostable luciferase. The linker contains a sensor region capable of interacting with a target molecule in a cell. The modified circularly-permuted thermostable luciferase has an enhanced response after interaction of the biosensor with the target molecule relative to the parental circularly-permuted thermostable luciferase in the presence of the target molecule. Alternatively, the modified circularly-permuted thermostable luciferase has an enhanced response after interaction of the biosensor with the target molecule relative to the modified circularly-permuted thermostable luciferase in the absence of the target molecule. | 04-28-2016 |
20160122394 | FC RECEPTOR (FcRn) BINDING PEPTIDES AND USES THEREOF - The invention provided herein includes isolated polypeptides that specifically block the interaction between neonatal Fc receptor (FcRn) and albumin. Blocking the interaction treats diseases and conditions caused by increased amounts of albumin or modified albumin that possesses pathogenic properties wherein it is deemed desirable to decrease albumin levels. Accordingly, also provided are methods of using these isolated polypeptides to treat various diseases and conditions caused by increased amounts of albumin or modified albumin that possesses pathogenic properties. The invention provided herein also includes isolated polypeptides capable of binding to a non-IgG and non-albumin competitive site on an FcRn alpha 3 domain. These can be useful for tracking FcRn without inhibiting IgG or albumin binding or function. Accordingly, the invention also includes methods and systems to track FcRn without inhibiting IgG or albumin binding or function. | 05-05-2016 |
20160130362 | ANTIBODIES AGAINST CD38 FOR TREATMENT OF MULTIPLE MYELOMA - Isolated human monoclonal antibodies which bind to human CD38, and related antibody-based compositions and molecules, are disclosed. Also disclosed are pharmaceutical compositions comprising the human antibodies, and therapeutic and diagnostic methods for using the human antibodies. | 05-12-2016 |
20160136106 | Nanoparticles Leverage Biological Membranes to Target Pathogens for Disease Treatment and Diagnosis - Provided are methods, combinations and pharmaceutical compositions for treating or preventing an infection in a subject using a nanoparticle comprising a) an inner core comprising a non-cellular material, and b) an outer surface comprising a cellular membrane configured for adhesion of a pathogen that causes said infection. Exemplary infection includes infection caused by a virus, bacterium, fungus, or protozoan. | 05-19-2016 |
20160137713 | FCRN-SPECIFIC HUMAN ANTIBODY AND COMPOSITION FOR TREATMENT OF AUTOIMMUNE DISEASES - The present invention relates to a human antibody specific for FcRn that is a receptor with a high affinity for IgG, a production method thereof, a composition for treating autoimmune disease, which comprises the antibody, and a method of treating and diagnosing autoimmune disease using the same. The FcRn-specific antibody according to the present invention can bind to FcRn non-competitively with IgG or the like to reduce serum auto-antibody levels, and thus can be used for the treatment of autoimmune diseases. | 05-19-2016 |
20160145328 | Modified Variable Domain Molecules And Methods For Producing And Using Same - The present disclosure provides an isolated protein comprising an antibody heavy chain variable region (V | 05-26-2016 |
20160158154 | PROTEIN VESICLES AND METHODS OF MAKING AND USING THEREOF - Hollow, protein vesicles are provided. The protein vesicles can be loaded with desired cargo to be delivered to a subject, for example a human. One embodiment provides a protein vesicle made of a protein membrane surrounding a hollow core. The protein membrane includes a first and a second modular protein amphiphile. The first modular protein amphiphile includes a hydrophobic block and a first hydrophilic protein binding block. The second modular protein amphiphile includes a variable polypeptide block and a second hydrophilic protein binding block that binds to the first hydrophilic protein binding block. The first and second protein amphiphiles self-assemble to form the hollow, protein vesicle. | 06-09-2016 |
20160158412 | ARTICLES COMPRISING LARGE-SURFACE-AREA BIO-COMPATIBLE MATERIALS AND METHODS FOR MAKING AND USING THEM - The present invention provides articles of manufacture comprising biocompatible nanostructures comprising significantly increased surface area for, e.g., organ, tissue and/or cell growth, e.g., for bone, tooth, kidney or liver growth, and uses thereof, e.g., for in vitro testing of drugs, chemicals or toxins, or as in vivo implants, including their use in making and using artificial tissues and organs, and related, diagnostic, screening, research and development and therapeutic uses, e.g., as drug delivery devices. The present invention provides biocompatible nanostructures with significantly increased surface area, such as with nanotube and nanopore array on the surface of metallic, ceramic, or polymer materials for enhanced cell and bone growth, for in vitro and in vivo testing, cleansing reaction, implants and therapeutics. The present invention provides optically transparent or translucent cell-culturing substrates. The present invention provides biocompatible and cell-growth-enhancing culture substrates comprising elastically compliant protruding nanostructure substrates coated with Ti, TiO | 06-09-2016 |
20160166482 | LIGHT ATTENUATING FORMULATIONS | 06-16-2016 |
20160176128 | Extremely Compliant Yet Tough Hydrogel Systems as Ultrasound Transmission Agents | 06-23-2016 |
20160176943 | NOVEL ALTERNATIVE SPLICE TRANSCRIPTS FOR MHC CLASS I RELATED CHAIN ALPHA (MICA) AND USES THEREOF | 06-23-2016 |
20160178652 | INTELLIGENT SENSOR PLATFORMS | 06-23-2016 |
20160184460 | SOLID COMPOSITION FOR THE ORAL ADMINISTRATION OF DYES AND DIAGNOSTIC USE THEREOF - The present application discloses solid compositions for the oral administration of dyes, and diagnostic use thereof. Preferably, such diagnostic use is aimed at the diagnostic evaluation of the gastrointestinal tract. | 06-30-2016 |
20160193310 | RM2 ANTIGENS AND USE THEREOF | 07-07-2016 |
20160193588 | POROUS SILICA HAVING HIGH PORE VOLUME AND METHODS OF MAKING AND USING SAME | 07-07-2016 |
20160199514 | LAPAROSCOPIC SURGERY SOLUTION AND METHOD OF USING THE SAME | 07-14-2016 |
20160251419 | Amyloid Protofibril Antibodies and Methods of Use Thereof | 09-01-2016 |
20160375142 | TARGETED THERAPEUTICS - The present invention provides pharmacological compounds including an effector moiety conjugated to a binding moiety that directs the effector moiety to a biological target of interest. Likewise, the present invention provides compositions, kits, and methods (e.g., therapeutic, diagnostic, and imaging) including the compounds. The compounds can be described as a protein interacting binding moiety-drug conjugate (SDC-TRAP) compounds, which include a protein interacting binding moiety and an effector moiety. For example, in certain embodiments directed to treating cancer, the SDC-TRAP can include an Hsp90 inhibitor conjugated to a cytotoxic agent as the effector moiety. | 12-29-2016 |
20160376302 | N-ALKYL 2-(DISUBSTITUTED)ALKYNYLADENOSINE-5-URONAMIDES AS A2A AGONISTS - The present invention provides N-alkyl 2-(disubstituted)alkynyladenosine-5′-uronamides and derivatives thereof and pharmaceutical compositions containing the same that are selective agonists of A | 12-29-2016 |
20160376328 | PROTEINS COMPRISING AMINO-TERMINAL PROXIMAL SHIGA TOXIN A SUBUNIT EFFECTOR REGIONS AND CELL-TARGETING IMMUNOGLOBULIN-TYPE BINDING REGIONS - The present invention provides proteins comprising immunoglobulin-type binding regions for cell-type specific targeting and Shiga toxin A Subunit effector regions for Shiga toxin effector functions (e.g. cellular internalization, directing subcellular routing, and/or cytotoxicity), wherein the binding regions and Shiga toxin effector regions are combined such that the Shiga toxin effector regions are proximal to the amino-terminals of the proteins. The presently disclosed proteins can comprise additional exogenous materials, such as, e.g., antigens, cytotoxic agents, and detection-promoting agents, and are capable of targeted delivery of these additional exogenous materials into the interiors of target cells. The proteins of the present invention have uses in methods such as, e.g., methods involving targeted killing of target cells, delivering exogenous materials into target cells, labeling subcellular compartments of target cells, and diagnosing and/or treating a variety of conditions including cancers, tumors, other growth abnormalities, immune disorders, and microbial infections. | 12-29-2016 |
20160376575 | PEPTIDE CAPABLE OF SILICA DEPOSITION AND USE THEREOF - A peptide for synthesizing silica and use thereof are provided. The peptide for synthesizing silica can polymerize silica from a silica precursor in an aqueous solution having conditions of normal temperature, normal pressure and near-neutral weak base. The peptide for synthesizing silica can form a self-assembled structure during silica synthesis, and thus can be used as various biomaterials such as a silica-based protein immobilizer, a biosensor, and a drug delivery system. | 12-29-2016 |
20170232109 | PROTEIN/OLIGONUCLEOTIDE CORE-SHELL NANOPARTICLE THERAPEUTICS | 08-17-2017 |
20170232116 | MULTIFUNCTIONAL METALLIC NANOPARTICLE-PEPTIDE BILAYER COMPLEXES | 08-17-2017 |
20170233471 | ANTI-LGR5 ANTIBODIES AND USES THEREOF | 08-17-2017 |
20180021459 | DETERMINING THE CONDITION OF A WOUND | 01-25-2018 |
20190142751 | LIPOSOMES COMPRISING POLYMER-CONJUGATED LIPIDS AND RELATED USES | 05-16-2019 |
20190142945 | FLUORESCEIN AND BENOXINATE COMPOSITIONS | 05-16-2019 |
20190142960 | FUCOIDAN NANOGELS AND METHODS OF THEIR USE AND MANUFACTURE | 05-16-2019 |