COLLAGEN PRODUCING PLANTS AND METHODS OF GENERATING AND USING SAME

Abstract

A method of producing collagen in a plant and plants producing collagen are provided. The method is effected by expressing in the plant at least one type of a collagen alpha chain in a manner enabling accumulation of the collagen alpha chain in a subcellular compartment devoid of endogenous P4H activity, thereby producing the collagen in the plant.

Description

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 11/730,071 filed on Mar. 29, 2007, which is a continuation-in-part of PCT Patent Application No. PCT/IL2005/001045 filed on Sep. 28, 2005, which claims the benefit of priority of U.S. Provisional Patent Application No. 60/613,719 filed on Sep. 29, 2004. The contents of all of the above applications are incorporated by reference as if fully set forth herein.

FIELD AND BACKGROUND OF THE INVENTION

[0002] The present invention relates to collagen producing plants and methods of generating and using same. More particularly, the present invention relates to a novel approach for generating plants capable of producing high levels of hydroxylated collagen chains which are capable of forming native triple helix type I collagen fibers.

[0003] Collagens are the main structural proteins responsible for the structural integrity of vertebrates and many other multicellular organisms. Type I collagen represents the prototypical fibrillar collagen and is the major collagen type in most tissues.

[0004] Type I collagen is the predominant collagen component of bone and tendon and is found in large amounts in skin, aorta, and lung. Type I collagen fibers provide great tensile strength and limited extensibility. The most abundant molecular form of type I collagen is a heterotrimer composed of two different alpha chains [alpha 1(I)]₂ and alpha 2(I) (Inkinen, 2003). All fibrillar collagen molecules contain three polypeptide chains constructed from a repeating Gly-X-Y triplet, where X and Y can be any amino acid but are frequently the imino acids proline and hydroxyproline.

[0005] Fibril forming collagens are synthesized as precursor procollagens containing globular N- and C-terminal extension propeptides. The biosynthesis of procollagen is a complex process involving a number of different post-translational modifications including proline and lysine hydroxylation, N-linked and O-linked glycosylation and both intra- and inter-chain disulphide-bond formation. The enzymes carrying out these modifications act in a coordinated fashion to ensure the folding and assembly of a correctly aligned and thermally stable triple-helical molecule.

[0006] Each procollagen molecule assembles within the rough endoplasmic reticulum from the three constituent polypeptide chains. As the polypeptide chain is co-translationally translocated across the membrane of the endoplasmic reticulum, hydroxylation of proline and lysine residues occurs within the Gly-X-Y repeat region. Once the polypeptide chain is fully translocated into the lumen of the endoplasmic reticulum the C-propeptide folds. Three pro-alpha chains then associate via their C-propeptides to form a trimeric molecule allowing the Gly-X-Y repeat region to form a nucleation point at its C-terminal end, ensuring correct alignment of the chains. The Gly-X-Y region then folds in a C-to-N direction to form a triple helix.

[0007] The temporal relationship between polypeptide chain modification and triple-helix formation is crucial as hydroxylation of proline residues is required to ensure stability of the triple helix at body temperature, once formed, the triple helix no longer serves as a substrate for the hydroxylation enzyme. The C-propeptides (and to a lesser extent the N-propeptides) keep the procollagen soluble during its passage through the cell (Bulleid et al., 2000). Following or during secretion of procollagen molecules into the extracellular matrix, propeptides are removed by procollagen N- and C-proteinases, thereby triggering spontaneous self-assembly of collagen molecules into fibrils (Hulmes, 2002). Removal of the propeptides by procollagen N- and C-proteinases lowers the solubility of procollagen by >10000-fold and is necessary and sufficient to initiate the self-assembly of collagen into fibers. Crucial to this assembly process are short non triple-helical peptides called telopeptides at the ends of the triple-helical domain, which ensure correct registration of the collagen molecules within the fibril structure and lower the critical concentration for self-assembly (Bulleid et al., 2000). In nature, the stability of the triple-helical structure of collagen requires the hydroxylation of prolines by the enzyme prolyl-4-hydroxylase (P4H) to form residues of hydroxyproline within a collagen chain.

[0008] Plants expressing collagen chains are known in the art, see for example, U.S. Pat. No. 6,617,431 and (Merle et al., 2002, Ruggiero et al., 2000). Although plants are capable of synthesizing hydroxyproline-containing proteins the prolyl hydroxylase that is responsible for synthesis of hydroxyproline in plant cells exhibits relatively loose substrate sequence specificity as compared with mammalian P4H and thus, production of collagen containing hydroxyproline only in the Y position of Gly-X-Y triplets requires plant co-expression of collagen and P4H genes (Olsen et al, 2003).

[0009] An attempt to produce human collagens that rely on the hydroxylation machinery naturally present in plants resulted in collagen that is poor in proline hydroxylation (Merle et al., 2002). Such collagen melts or loses its triple helical structure at temperatures below 30° C. Co-expression of collagen and prolyl- hydroxylase results with stable hydroxylated collagen that is biologically relevant for applications at body temperatures (Merle et al., 2002).

[0010] Lysyl hydroxylase (LH,EC 1.14.11.4), galactosyltransferase (EC 2.4.1.50) and glucosyltransferase (EC 2.4.1.66) are enzymes involved in posttranslational modifications of collagens. They sequentially modify lysyl residues in specific positions to hydroxylysyl, galactosylhydroxylysyl and glucosylgalactosyl hydroxylysyl residues. These structures are unique to collagens and essential for their functional activity (Wang et al, 2002). A single human enzyme, Lysyl hydroxylase 3 (LH3) can catalyze all three consecutive steps in hydroxylysine linked carbohydrate formation (Wang et al, 2002).

[0011] Hydroxylysins of a human collagen expressed in tobacco form less than 2% of the hydroxylysins found in a bovine collagen (0.04% of residues/1.88% of residues). This suggests that plant endogenic Lysyl hydroxylase is unable to sufficiently hydroxylate lysines in collagen.

[0012] While reducing the present invention to practice, the present inventors uncovered that efficient hydroxylation of collagen chains relies upon sequestering of the collagen chain along with an enzyme capable of correctly modifying this polypeptide.

SUMMARY OF THE INVENTION

[0013] According to one aspect of the present invention there is provided a method of producing collagen in a plant or an isolated plant cell comprising expressing in the plant or the isolated plant cell at least one type of a collagen alpha chain and exogenous P4H in a manner enabling accumulation of the at least one type of the collagen alpha chain and the exogenous P4H in a subcellular compartment devoid of endogenous P4H activity, thereby producing the collagen in the plant. According to an additional aspect of the present invention there is provided

[0014] According to further features in preferred embodiments of the invention described below, the method further comprises expressing exogenous LH3 in the subcellular compartment devoid of endogenous P4H activity.

[0015] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain includes a signal peptide for targeting to an apoplast or a vacuole.

[0016] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is devoid of an ER targeting or retention sequence.

[0017] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is expressed in a DNA-containing organelle of the plant.

[0018] According to still further features in the described preferred embodiments the exogenous P4H includes a signal peptide for targeting to an apoplast or a vacuole.

[0019] According to still further features in the described preferred embodiments the exogenous P4H is devoid of an ER targeting or retention sequence.

[0020] According to still further features in the described preferred embodiments the exogenous P4H is expressed in a DNA-containing organelle of the plant.

[0021] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is alpha 1 chain.

[0022] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is alpha 2 chain.

[0023] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain includes a C-terminus and/or an N-terminus propeptide.

[0024] According to still further features in the described preferred embodiments the plant is selected from the group consisting of Tobacco, Maize, Alfalfa, Rice, Potato, Soybean, Tomato, Wheat, Barley, Canola and Cotton.

[0025] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain or the exogenous P4H are expressed in only a portion of the plant.

[0026] According to still further features in the described preferred embodiments the portion of the plant is leaves, seeds, roots, tubers or stems.

[0027] According to still further features in the described preferred embodiments the exogenous P4H is capable of specifically hydroxylating the Y position of Gly-X-Y triplets of the at least one type of the collagen alpha chain.

[0028] According to still further features in the described preferred embodiments the exogenous P4H is human P4H.

[0029] According to still further features in the described preferred embodiments the plant is subjected to a stress condition.

[0030] According to still further features in the described preferred embodiments the stress condition is selected from the group consisting of drought, salinity, injury, cold and spraying with stress inducing compounds.

[0031] According to another aspect of the present invention there is provided a genetically modified plant or isolated plant cell capable of accumulating a collagen alpha chain having a hydroxylation pattern identical to that produced when the collagen alpha chain is expressed in human cells.

[0032] According to yet another aspect of the present invention there is provided a genetically modified plant or isolated plant cell capable of accumulating a collagen alpha chain in a subcellular compartment devoid of endogenous P4H activity.

[0033] According to still further features in the described preferred embodiments the genetically modified plant further comprises an exogenous P4H.

[0034] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain includes a signal peptide for targeting to an apoplast or a vacuole.

[0035] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is devoid of an ER targeting or retention sequence.

[0036] According to still further features in the described preferred embodiments the at least one type of the collagen alpha chain is expressed in a DNA-containing organelle of the plant.

[0037] According to still further features in the described preferred embodiments the exogenous P4H includes a signal peptide for targeting to an apoplast or a vacuole.

[0038] According to still further features in the described preferred embodiments the exogenous P4H is devoid of an ER targeting or retention sequence.

[0039] According to still further features in the described preferred embodiments the exogenous P4H is expressed in a DNA-containing organelle of the plant.

[0040] According to still further features in the described preferred embodiments the collagen alpha chain is alpha 1 chain.

[0041] According to still further features in the described preferred embodiments the collagen alpha chain is alpha 2 chain.

[0042] According to still further features in the described preferred embodiments the collagen alpha chain includes a C-terminus and/or an N-terminus propeptide.

[0043] According to still another aspect of the present invention there is provided a plant system comprising a first genetically modified plant capable of accumulating a collagen alpha 1 chain and a second genetically modified plant capable of accumulating a collagen alpha 2 chain.

[0044] According to yet another aspect of the present invention there is provided a plant system comprising a first genetically modified plant capable of accumulating a collagen alpha 1 chain and a collagen alpha 2 chain and a second genetically modified plant capable of accumulating P4H.

[0045] According to still further features in the described preferred embodiments at least one of the first genetically modified plant and the second genetically modified plant further comprises exogenous P4H.

[0046] According to yet another aspect of the present invention there is provided a method of producing fibrillar collagen comprising: (a) expressing in a first plant a collagen alpha 1 chain; (b) expressing in a second plant a collagen alpha 2 chain, wherein expression in the first plant and the second plant the is configured such that the collagen alpha 1 chain and the collagen alpha 2 chain are each capable of accumulating in a subcellular compartment devoid of endogenous P4H activity; and (c) crossing the first plant and the second plant and selecting progeny expressing the collagen alpha 1 chain and the collagen alpha 2 chain thereby producing fibrillar collagen.

[0047] According to still further features in the described preferred embodiments the method further comprises expressing an exogenous P4H in each of the first plant and the second plant.

[0048] According to still further features in the described preferred embodiments each of the collagen alpha 1 chain and the collagen alpha 2 chain includes a signal peptide for targeting to an apoplast or a vacuole.

[0049] According to still further features in the described preferred embodiments each of the collagen alpha 1 chain and the collagen alpha 2 chain is devoid of an ER targeting or retention sequence.

[0050] According to still further features in the described preferred embodiments steps (a) and (b) are effected via expression in a DNA-containing organelle of the plant.

[0051] According to still further features in the described preferred embodiments the exogenous P4H includes a signal peptide for targeting to an apoplast or a vacuole.

[0052] According to still further features in the described preferred embodiments the exogenous P4H is devoid of an ER targeting or retention sequence.

[0053] According to still further features in the described preferred embodiments the exogenous P4H is expressed in a DNA-containing organelle of the plant.

[0054] According to still further features in the described preferred embodiments each of the collagen alpha 1 chain and the collagen alpha 2 chain includes a C-terminus and/or an N-terminus propeptide.

[0055] According to still further features in the described preferred embodiments the exogenous P4H is capable of specifically hydroxylating the Y position of Gly-X-Y triplets of the at least one type of the collagen alpha chain.

[0056] According to still further features in the described preferred embodiments the exogenous P4H is human P4H.

[0057] According to still further features in the described preferred embodiments the first plant and the second plant are subjected to a stress condition.

[0058] According to still further features in the described preferred embodiments the stress condition is selected from the group consisting of drought, salinity, injury, heavy metal toxicity and cold stress.

[0059] According to yet another aspect of the present invention there is provided a method of producing fibrillar collagen comprising: (a) expressing in a first plant a collagen alpha 1 chain and a collagen alpha 2 chain, wherein expression in the first plant is configured such that the collagen alpha 1 chain and the collagen alpha 2 chain are each capable of accumulating in a subcellular compartment devoid of endogenous P4H activity; (b) expressing in a second plant an exogenous P4H capable of accumulating in the subcellular compartment devoid of endogenous P4H activity; and (c) crossing the first plant and the second plant and selecting progeny expressing the collagen alpha 1 chain, the collagen alpha 2 chain and the P4H thereby producing fibrillar collagen.

[0060] According to yet another aspect of the present invention there is provided a nucleic acid construct comprising a polynucleotide encoding a human P4H positioned under the transcriptional control of a promoter functional in plant cells.

[0061] According to still further features in the described preferred embodiments the promoter is selected from the group consisting of the CaMV 35S promoter, the Ubiquitin promoter, the rbcS promoter and the SVBV promoter.

[0062] According to yet another aspect of the present invention there is provided a genetically modified plant or isolated plant cell being capable of expressing collagen alpha 1 chain, collagen alpha 2 chain, P4H, LH3 and protease C and/or protease N.

[0063] According to still further features in the described preferred embodiments the collagen alpha 1 chain and the collagen alpha 2 chain are each capable of accumulating in a subcellular compartment devoid of endogenous plant P4H activity.

[0064] According to yet another aspect of the present invention there is provided a genetically modified plant or isolated plant cell being capable of accumulating collagen having a temperature stability characteristic identical to that of mammalian collagen.

[0065] According to still further features in the described preferred embodiments the collagen is type I collagen.

[0066] According to still further features in the described preferred embodiments the mammalian collagen is human collagen.

[0067] According to yet another aspect of the present invention there is provided a collagen-encoding sequence optimized for expression in a plant.

[0068] According to still further features in the described preferred embodiments the collagen encoding sequence is as set forth by SEQ ID NO:1.

[0069] The present invention successfully addresses the shortcomings of the presently known configurations by providing a plant capable of expressing correctly hydroxylated collagen chains which are capable of assembling into collagen having properties similar to that of human collagen.

[0070] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

BRIEF DESCRIPTION OF THE DRAWINGS

[0071] The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0072] In the drawings:

[0073] FIGS. 1a-d illustrate construction of various expression cassettes and vectors used to transform test plants. All of the coding sequences synthesized as a part of the present study were optimized for expression in tobacco. FIG. 1a shows a cloning scheme of type I collagen alpha I chain or type II collagen alpha 2 chain into a plant expression vector in accordance with some embodiments of the present invention; FIG. 1b shows a cloning scheme of the enzyme prolyl-4-hydroxylase (P4H) into a plant expression vector in accordance with some embodiments of the present invention; FIG. 1c shows a cloning scheme proteinase C or proteinase N into a plant expression vector in accordance with some embodiments of the present invention; FIG. 1d shows a cloning scheme of Lysyl hydroxylase 3 (LH3) into a plant expression vector in accordance with some embodiments of the present invention. A multiple cloning site set forth in SEQ ID NO: 29 is shown at the bottom of each panel.

[0074] FIG. 2 illustrates various co-transformations approaches. Each expression cassette is represented by the short name of the coding sequence. The coding sequences are specified in table 1. Each co-transformation was performed by two pBINPLUS binary vectors. Each rectangle represents a single pBINPLUS vector carrying one, two or three expression cassettes. Promoter and terminators are specified in Example 1.

[0075] FIG. 3 is a multiplex PCR screening of transformants showing plants that are positive for Collagen alpha 1 (324 bp fragment) or Collagen alpha 2 (537 bp fragment) or both.

[0076] FIG. 4 is western blot analysis of transgenic plants generated by co-transformations 2, 3 and 4. Total soluble proteins were extracted from tobacco co-transformants #2, #3 and #4 and tested with anti-Collagen I antibody (#AB745 from Chemicon Inc.). Size markers were #SM0671 from Fermentas Inc. W.T. is a wild type tobacco. Positive collagen bands are visible in plants that are PCR positive for collagen typeI alpha 1 or alpha 2 or both. Positive control band of 500 ng collagen type I from human placenta (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) represents about 0.3% of the total soluble proteins (about 150 μg) in the samples from the transgenic plants. The larger band at about 140 kDa in the human collagen sample is a procollagen with it's C-propeptide as detected by anti carboxy-terminal pro-peptide of collagen type I antibody (#MAB 1913 from Chemicon Inc.). The smaller band at about 120 kDa in the human collagen sample is a collagen without propeptides. Due to their unusual composition proline rich proteins (including collagen)s consistently migrate on polyacrylamid gels as bands with molecular mass higher than expected. Therefore the collagen chains without propeptides with a molecular weight of about 95 kDa migrate as a band of about 120 kDa.

[0077] FIG. 5 is a western blot analysis of transgenic plant generated by co-transformation #8 (carrying appoplast signals translationally fused to the collagen chains). Total soluble proteins were extracted from transgenic tobacco leaves and tested with anti-Collagen I antibody (#AB745 from Chemicon Inc.) Positive collagen alpha 2 band is visible in plant 8-141. Collagen type I from human placenta (#CC050 from Chemicon Inc.) served as control.

[0078] FIGS. 6a-b illustrate collagen triple helix assembly and thermal stability as qualified by heat treatment and Trypsin or Pepsin digestion. In FIG. 6a--total soluble protein from tobacco 2-9 (expressing only col alpha1 and no P4H) and 3-5 (expressing both col alpha 1+2 and human P4H alpha and beta subunits) were subjected to heat treatment (15 minutes in 38° C. or 43° C.) followed by Trypsin digestion (20 minutes in R.T.) and tested with anti-Collagen I antibody in a Western blot procedure. Positive controls were samples of 500 ng human collagen I+total soluble proteins of w.t. tobacco. In FIG. 6b--total soluble proteins were extracted from transgenic tobacco 13-6 (expressing collagen I alpha 1 and alpha 2 chains--pointed by arrows, human P4H alpha and beta subunits and human LH3) and subjected to heat treatment (20 minutes in 33° C., 38° C. or 42° C.), immediately cooled on ice to prevent reassembly of triple helix and incubated with pepsin for 30 minutes in room temperature (about 22° C.) followed by testing with anti-Collagen I antibody ((#AB745 from Chemicon Inc.) in a standard Western blot procedure. Positive control was sample of ˜50 ng human collagen I (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) which was added to total soluble proteins extracted from w.t. tobacco.

[0079] FIG. 7 illustrates Northern blot analysis conducted on wild type tobacco. Blots were probed with tobacco P4H cDNA.

[0080] FIG. 8 is a western blot analysis of transgenic plants generated by co-transformations 2, 3 and 13. Total soluble protein was extracted from tobacco co-transformants and tested with anti human P4H alpha and beta and anti-Collagen I antibodies.

[0081] FIG. 9 is a western blot analysis of (lane 1) cross breeding vacuolar targeted plants A(2-300 +20-279 ) grown under normal light regimen; and 13-652 vacuolar targeted plants grown for 8 days in the dark. All plants express exogenous col1, col2, P4H α and β as well as LH3 (PCR validated).

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0082] The present invention is of plants expressing and accumulating collagen which can be used to produce collagen and collagen fibers which display characteristics of mammalian collagen.

[0083] The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.

[0084] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

[0085] Collagen producing plants are known in the art. Although such plants can be used to produce collagen chains as well as collagen, such chains are incorrectly hydroxylated and thus self-assembly thereof, whether in planta or not, leads to collagen which is inherently unstable.

[0086] While reducing the present invention to practice, the present inventors have devised a plant expression approach which ensures correct hydroxylation of collagen chains and thus enables in-planta production of collagen which closely mimics the characteristics (e.g. temperature stability) of human type I collagen.

[0087] Thus, according to one aspect of the present invention there is provided a genetically modified plant which is capable of expressing at least one type of a collagen alpha chain and accumulating it in a subcellular compartment which is devoid of endogenous P4H activity.

[0088] As used herein, the phrase "genetically modified plant" refers to any lower (e.g. moss) or higher (vascular) plant or a tissue or an isolated cell thereof (e.g., of a cell suspension) which is stably or transiently transformed with an exogenous polynucleotide sequence. Examples of plants include Tobacco, Maize, Alfalfa, Rice, Potato, Soybean, Tomato, Wheat, Barley, Canola, Cotton, Carrot as well as lower plants such as moss.

[0089] As used herein, the phrase "collagen chain" refers to a collagen subunit such as the alpha 1 or 2 chains of collagen fibers, preferably type I fibers. As used herein, the phrase "collagen " refers to an assembled collagen trimer, which in the case of type I collagen includes two alpha 1 chains and one alpha 2 chain. A collagen fiber is collagen which is devoid of terminal propeptides C and N.

[0090] As is used herein, the phrase "subcellular compartment devoid of endogenous P4H activity" refers to any compartmentalized region of the cell which does not include plant P4H or an enzyme having plant-like P4H activity. Examples of such subcellular compartments include the vacuole, apoplast and cytoplasm as well as organelles such as the chloroplast, mitochondria and the like.

[0091] Any type of collagen chain can be expressed by the genetically modified plant of the present invention. Examples include Fibril-forming collagens (types I, II, III, V, and XI), networks forming collagens (types IV, VIII, and X), collagens associated with fibril surfaces (types IX, XII, and XIV), collagens which occur as transmembrane proteins (types XIII and XVII), or form 11-nm periodic beaded filaments (type VI). For further description please see Hulmes, 2002.

[0092] Preferably, the collagen chain expressed is an alpha 1 and/or 2 chain of type I collagen. The expressed collagen alpha chain can be encoded by any polynucleotide sequences derived from any mammal. Preferably, the sequences encoding collagen alpha chains are human and are set forth by SEQ ID NOs: 1 and 4.

[0093] Typically, alpha collagen chains expressed in plants may or may not include their terminal propeptides (i.e. propeptide C and propeptide N).

[0094] Ruggiero et al. (2000) note that processing of procollagen by plant proteolytic activity is different then normal processing in human and that propeptide C is removed by plant proteolytic activity although the cleavage site is unknown. Cleavage of the C propeptide may take place on a procollagen peptide before the assembly of trimmer (association of three C-Propeptides is essential for initiating the assembly of trimmers).

[0095] N-propeptide cleavage by plant proteolytic activity takes place in mature plants but not in plantlets. Such cleavage removes 2 amino acids from the N telopeptide (2 out of 17).

[0096] The C-propeptides (and to a lesser extent the N-propeptides) maintain the procollagen soluble during its passage through the animal cell (Bulleid et al., 2000) and are expected to have a similar effect in the plant cell. Following or during secretion of procollagen molecules into the extracellular matrix, propeptides are removed by procollagen N- and C-proteinases, thereby triggering spontaneous self-assembly of collagen molecules into fibrils (Hulmes, 2002). Removal of the propeptides by procollagen N- and C-proteinases lowers the solubility of procollagen by >10000-fold and is necessary and sufficient to initiate the self-assembly of collagen into fibers. Crucial to this assembly process are short non triple-helical peptides called telopeptides at the ends of the triple-helical domain, which ensure correct registration of the collagen molecules within the fibril structure and lower the critical concentration for self-assembly (Bulleid et al., 2000). Prior art describe the use of pepsin to cleave the propeptides during production of collagen (Bulleid et al 2000). However pepsin damages the telopeptides and as a result, pepsin-extracted collagen is unable to form ordered fibrillar structures (Bulleid et al 2000).

[0097] Protein disulfide isomerase (PDI) that form the beta subunit of human P4H was shown to bind to the C-propeptide prior to trimmer assembly thereby also acting as a molecular chaperone during chain assembly (Ruggiero et al, 2000).

[0098] The use of human Procollagen I N-proteinase and Procollagen C-proteinase expressed in a different plants may generate collagen that is more similar to the native human collagen and can form ordered fibrillar structures.

[0099] In a case where N or C propeptides or both are included in the expressed collagen chain, the genetically modified plant of the present invention can also express the respective protease (i.e. C or N or both). Polynucleotide sequences encoding such proteases are exemplified by SEQ ID NOs: 18 (protease C) and 20 (Protease N). Such proteases can be expressed such that they are accumulated in the same subcellular compartment as the collagen chain.

[0100] Accumulation of the expressed collagen chain in a subcellular compartment devoid of endogenous P4H activity can be effected via any one of several approaches.

[0101] For example, the expressed collagen chain can include a signal sequence for targeting the expressed protein to a subcellular compartment such as the apoplast or an organelle (e.g. chloroplast). Examples of suitable signal sequences include the chloroplast transit peptide (included in Swiss-Prot entry P07689, amino acids 1-57) and the Mitochondrion transit peptide (included in Swiss-Prot entry P46643, amino acids 1-28). The Examples section which follows provides additional examples of suitable signal sequences as well as guidelines for employing such signal sequences in expression of collagen chains in plant cells.

[0102] Alternatively, the sequence of the collagen chain can be modified in a way which alters the cellular localization of collagen when expressed in plants.

[0103] As is mentioned hereinabove, the ER of plants includes a P4H which is incapable of correctly hydroxylating collagen chains. Collagen alpha chains natively include an ER targeting sequence which directs expressed collagen into the ER where it is post-translationally modified (including incorrect hydroxylation). Thus, removal of the ER targeting sequence will lead to cytoplasmic accumulation of collagen chains which are devoid of post translational modification including any hydroxylations.

[0104] Example 1 of the Examples section which follows describes generation of collagen sequences which are devoid of ER sequences.

[0105] Still alternatively, collagen chains can be expressed and accumulated in a DNA containing organelle such as the chloroplast or mitochondria. Further description of chloroplast expression is provided hereinbelow.

[0106] As is mentioned hereinabove, hydroxylation of alpha chains is required for assembly of a stable type I collagen. Since alpha chains expressed by the genetically modified plant of the present invention accumulate in a compartment devoid of endogenous P4H activity, such chains must be isolated from the plant, plant tissue or cell and in-vitro hydroxylated. Such hydroxylation can be achieved by the method described by Turpeenniemi-Hujanen and Myllyla (Concomitant hydroxylation of proline and lysine residues in collagen using purified enzymes in vitro. Biochim Biophys Acta. 1984 Jul. 16; 800(1):59-65).

[0107] Although such in-vitro hydroxylation can lead to correctly hydroxylated collagen chains, it can be difficult and costly to achieve.

[0108] To overcome the limitations of in-vitro hydroxylation, the genetically modified plant of the present invention preferably also co-expresses P4H which is capable of correctly hydroxylating the collagen alpha chain(s) [i.e. hydroxylating only the proline (Y) position of the Gly-X-Y triplets]. P4H is an enzyme composed of two subunits, alpha and beta. Both are needed to form an active enzyme while the Beta subunit also posses a chaperon function.

[0109] The P4H expressed by the genetically modified plant of the present invention is preferably a human P4H which is encoded by, for example, SEQ ID's NO:12 and 14. In addition, P4H mutants which exhibit enhanced substrate specificity, or P4H homologues can also be used.

[0110] A suitable P4H homologue is exemplified by an Arabidopsis oxidoreductase identified by NCBI accession NP_--179363. Pairwise alignment of this protein sequence and a human P4H alpha subunit conducted by the present inventors revealed the highest homology between functional domains of any known P4H homologs of plants.

[0111] Since P4H needs to co-accumulate with the expressed collagen chain, the coding sequence thereof is preferably modified accordingly (addition of signal sequences, deletions which may prevent ER targeting etc).

[0112] In mammalian cells, collagen is also modified by Lysyl hydroxylase, galactosyltransferase and glucosyltransferase. These enzymes sequentially modify lysyl residues in specific positions to hydroxylysyl, galactosylhydroxylysyl and glucosylgalactosyl hydroxylysyl residues. A single human enzyme, Lysyl hydroxylase 3 (LH3) can catalyze all three consecutive steps in hydroxylysine linked carbohydrate formation.

[0113] Thus, the genetically modified plant of the present invention preferably also expresses mammalian LH3. An LH3 encoding sequence such as that set forth by SEQ ID NO: 22 can be used for such purposes.

[0114] The collagen chain(s) and modifying enzymes described above can be expressed from a stably integrated or a transiently expressed nucleic acid construct which includes polynucleotide sequences encoding the alpha chains and/or modifying enzymes (e.g. P4H and LH3) positioned under the transcriptional control of plant functional promoters. Such a nucleic acid construct (which is also termed herein as an expression construct) can be configured for expression throughout the whole plant, defined plant tissues or defined plant cells, or at define developmental stages of the plant. Such a construct may also include selection markers (e.g. antibiotic resistance), enhancer elements and an origin of replication for bacterial replication.

[0115] It will be appreciated that constructs including two expressible inserts (e.g. two alpha chain types, or an alpha chain and P4H) preferably include an individual promoter for each insert, or alternatively such constructs can express a single transcript chimera including both insert sequences from a single promoter. In such a case, the chimeric transcript includes an IRES sequence between the two insert sequences such that the downstream insert can be translated therefrom.

[0116] Numerous plant functional expression promoters and enhancers which can be either tissue specific, developmentally specific, constitutive or inducible can be utilized by the constructs of the present invention, some examples are provided hereinunder.

[0117] As used herein in the specification and in the claims section that follows the phrase "plant promoter" or "promoter" includes a promoter which can direct gene expression in plant cells (including DNA containing organelles). Such a promoter can be derived from a plant, bacterial, viral, fungal or animal origin. Such a promoter can be constitutive, i.e., capable of directing high level of gene expression in a plurality of plant tissues, tissue specific, i.e., capable of directing gene expression in a particular plant tissue or tissues, inducible, i.e., capable of directing gene expression under a stimulus, or chimeric, i.e., formed of portions of at least two different promoters.

[0118] Thus, the plant promoter employed can be a constitutive promoter, a tissue specific promoter, an inducible promoter or a chimeric promoter.

[0119] Examples of constitutive plant promoters include, without being limited to, CaMV35S and CaMV19S promoters, FMV34S promoter, sugarcane bacilliform badnavirus promoter, CsVMV promoter, Arabidopsis ACT2/ACT8 actin promoter, Arabidopsis ubiquitin UBQ1 promoter, barley leaf thionin BTH6 promoter, and rice actin promoter.

[0120] Examples of tissue specific promoters include, without being limited to, bean phaseolin storage protein promoter, DLEC promoter, PHS promoter, zein storage protein promoter, conglutin gamma promoter from soybean, AT2S 1 gene promoter, ACT11 actin promoter from Arabidopsis, napA promoter from Brassica napus and potato patatin gene promoter.

[0121] The inducible promoter is a promoter induced by a specific stimuli such as stress conditions comprising, for example, light, temperature, chemicals, drought, high salinity, osmotic shock, oxidant conditions or in case of pathogenicity and include, without being limited to, the light-inducible promoter derived from the pea rbcS gene, the promoter from the alfalfa rbcS gene, the promoters DRE, MYC and MYB active in drought; the promoters INT, INPS, prxEa, Ha hsp17.7G4 and RD21 active in high salinity and osmotic stress, and the promoters hsr203J and str246C active in pathogenic stress.

[0122] Preferably the promoter utilized by the present invention is a strong constitutive promoter such that over expression of the construct inserts is effected following plant transformation.

[0123] It will be appreciated that any of the construct types used in the present invention can be co-transformed into the same plant using same or different selection markers in each construct type. Alternatively the first construct type can be introduced into a first plant while the second construct type can be introduced into a second isogenic plant, following which the transgenic plants resultant therefrom can be crossed and the progeny selected for double transformants. Further self-crosses of such progeny can be employed to generate lines homozygous for both constructs.

[0124] There are various methods of introducing nucleic acid constructs into both monocotyledonous and dicotyledenous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276). Such methods rely on either stable integration of the nucleic acid construct or a portion thereof into the genome of the plant, or on transient expression of the nucleic acid construct in which case these sequences are not inherited by a progeny of the plant.

[0125] In addition, several method exist in which a nucleic acid construct can be directly introduced into the DNA of a DNA containing organelle such as a chloroplast.

[0126] There are two principle methods of effecting stable genomic integration of exogenous sequences such as those included within the nucleic acid constructs of the present invention into plant genomes:

[0127] (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112.

[0128] (ii) direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.

[0129] The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledenous plants.

[0130] There are various methods of direct DNA transfer into plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals, tungsten particles or gold particles, and the microprojectiles are physically accelerated into cells or plant tissues.

[0131] Following transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.

[0132] Transient expression methods which can be utilized for transiently expressing the isolated nucleic acid included within the nucleic acid construct of the present invention include, but are not limited to, microinjection and bombardment as described above but under conditions which favor transient expression, and viral mediated expression wherein a packaged or unpackaged recombinant virus vector including the nucleic acid construct is utilized to infect plant tissues or cells such that a propagating recombinant virus established therein expresses the non-viral nucleic acid sequence.

[0133] Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.

[0134] Construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and Takamatsu et al. FEBS Letters (1990) 269:73-76.

[0135] When the virus is a DNA virus, the constructions can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.

[0136] Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of the present invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.

[0137] In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.

[0138] In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.

[0139] In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.

[0140] In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.

[0141] The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.

[0142] A technique for introducing exogenous nucleic acid sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous nucleic acid is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous nucleic acid molecule into the chloroplasts. The exogenous nucleic acid is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid stretch which is derived from the chloroplast's genome. In addition, the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous nucleic acid. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.

[0143] The above described transformation approaches can be used to produce collagen chains and/or modifying enzymes as well as assembled collagen (with or without propeptides) in any species of plant, or plant tissue or isolated plants cell derived therefrom.

[0144] Preferred plants are those which are capable of accumulating large amounts of collagen chains, collagen and/or the processing enzymes described herein. Such plants may also be selected according to their resistance to stress conditions and the ease at which expressed components or assembled collagen can be extracted. Examples of preferred plants include Tobacco, Maize, Alfalfa, Rice, Potato, Soybean, Tomato, Wheat, Barley, Canola and Cotton.

[0145] Collagen fibers are extensively used in the food and cosmetics industry. Thus, although collagen fiber components (alpha chains) and modifying enzymes expressed by plants find utility in industrial synthesis of collagen, complete collagen production in plants is preferred for its simplicity and cost effectiveness.

[0146] Several approaches can be used to generate type I collagen in plants. For example, collagen alpha 1 chain can be isolated from a plant expressing collagen alpha 1 and P4H (and optionally LH3) and mixed with a collagen alpha 2 chain which is isolated from a plant expressing collagen alpha 2 and P4H (and optionally LH3 and protease C and/or N). Since collagen alpha 1 chain self assembles into a triple helix by itself, it may be necessary to denature such a homo-trimer prior to mixing and renaturation with the collagen alpha 2 chain.

[0147] Preferably, a first plant expressing collagen alpha 1 and P4H (and optionally LH3 and protease C and/or N) can be crossed with a second (and preferably isogenic) plant which expresses collagen alpha 2 or alternatively, a first plant expressing both alpha chains can be crossed with a second plant expressing P4H and optionally LH3 and protease C and/or N.

[0148] It should be noted that although the above described plant breeding approaches utilize two individually transformed plants, approaches which utilize three or more individually transformed plants, each expressing one or two components can also be utilized.

[0149] One of ordinary skill in the art would be well aware of various plant breeding techniques and as s such no further description of such techniques is provided herein.

[0150] Although plant breeding approaches are preferred, it should be noted that a single plant expressing collagen alpha 1 and 2, P4H and LH3 (and optionally protease C and/or N) can be generated via several transformation events each designed for introducing one more expressible components into the cell. In such cases, stability of each transformation event can be verified using specific selection markers.

[0151] In any case, transformation and plant breeding approaches can be used to generate any plant, expressing any number of components. Presently preferred are plants which express collagen alpha 1 and 2 chains, P4H, LH3 and at least one protease (e.g. protease C and/or N). As is further described in the Examples section which follows, such plants accumulate collagen which exhibits stability at temperatures of up to 42° C.

[0152] Progeny resulting from breeding or alternatively multiple-transformed plants can be selected, by verifying presence of exogenous mRNA and/or polypeptides by using nucleic acid or protein probes (e.g. antibodies). The latter approach is preferred since it enables localization of the expressed polypeptide components (by for example, probing fractionated plants extracts) and thus also verifies a potential for correct processing and assembly. Examples of suitable probes are provided in the Examples section which follows

[0153] Once collagen-expressing progeny is identified, such plants are further cultivated under conditions which maximize expression of the collagen chains as well as the modifying enzymes.

[0154] Since free proline accumulation may facilitate over production of different proline-rich proteins including the collagen chains expressed by the genetically modified plants of the present invention, preferred cultivating conditions are those which increase free proline accumulation in the cultivated plant.

[0155] Free proline accumulates in a variety of plants in response to a wide range of environmental stresses including water deprivation, salinization, low temperature, high temperature, pathogen infection, heavy metal toxicity, anaerobiosis, nutrient deficiency, atmospheric pollution and UV--irradiation (Hare and Cress, 1997).

[0156] Free proline may also accumulate in response to treatment of the plant or soil with compounds such as ABA or stress inducing compounds such as copper salt, paraquate, salicylic acid and the like.

[0157] Thus, collagen-expressing progeny can be grown under different stress conditions (e.g. different concentrations of NaCl ranging from 50 mM up to 250 mM). In order to further enhance collagen production, the effect of various stress conditions on collagen expression will examined and optimized with respect to plant viability, biomass and collagen accumulation.

[0158] Plant tissues/cells are preferably harvested at maturity, and the collagen fibers are isolated using well know prior art extraction approaches, one such approach is detailed below.

[0159] Leaves of transgenic plants are ground to a powder under liquid nitrogen and the homogenate is extracted in 0.5 M acetic acid containing 0.2 M NaCl for 60 h at 4° C. Insoluble material is removed by centrifugation. The supernatant containing the recombinant collagen is salt-fractionated at 0.4 M and 0.7 M NaCl. The 0.7 M NaCl precipitate, containing the recombinant heterotrimeric collagen, is dissolved in and dialyzed against 0.1 M acetic acid and stored at -20° C. (following Ruggiero et al., 2000).

[0160] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES

[0161] Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.

[0162] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, Calif. (1990); Marshak et al., "Strategies for Protein Purification and Characterization--A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

Example 1

Constructs and Transformation Schemes

[0163] Constructions of expression cassettes and vectors used in this work are illustrated in FIG. 1a-d. All of the coding sequences in this work were optimized for expression in tobacco and chemically synthesized with desired flanking regions (SEQ ID NOs: 1, 4, 7, 12, 14, 16, 18, 20, 22). FIG. 1a--the synthetic genes coding for Col1 and Col2 (SEQ ID's 1, 4) fused either to the vacuolar signal or to the apoplast signal (encoded by SEQ ID NO: 7) or without signals were cloned in expression cassettes composed of a Chrysanthemum rbcS1 promoter and 5' UTR (SEQ ID NO: 10) and a Chrysanthemum rbcS1 3'UTR and terminator (SEQ ID NO: 11). The complete expression cassettes were cloned in the multiple cloning site of the pBINPLUS plant transformation vector (van Engelen et al., 1995, Transgenic Res 4: 288-290). FIG. 1b--The synthetic genes coding for P4H beta-human, P4H alpha-human and P4H-plant (SEQ ID NOs: 12, 14 and 16) fused either to the vacuolar signal or to the apoplast signal (encoded by SEQ ID NO: 7) or without signals were cloned in expression cassettes composed of the CaMV 35S promoter and TMV omega sequence and Agrobacterium Nopaline synthetase (NOS) terminator carried by the vector pJD330 (Galili et al., 1987, Nucleic Acids Res 15: 3257-3273). The complete expression cassettes were cloned in the multiple cloning site of the pBINPLUS vectors carrying the expression cassettes of Col1 or Col2. FIG. 1c--The synthetic genes coding for Proteinase C and Proteinase N (SEQ ID NOs: 18, 20) fused either to the vacuolar signal or to the apoplast signal (encoded by SEQ ID NO: 7) were cloned in expression cassettes composed of a Chrysanthemum rbcS1 promoter and 5' UTR (SEQ ID NO: 10) and a Chrysanthemum rbcS1 3'UTR and terminator (SEQ ID NO: 11). The complete expression cassettes were cloned in the multiple cloning site of the pBINPLUS plant transformation vector. FIG. 1d--The synthetic gene coding for LH3 (SEQ ID NO: 22) with flanking Strawberry vein banding virus (SVBV) promoter (NCBI accession AF331666 REGION: 623 . . . 950 version AF331666.1 GI:13345788) and terminated by Agrobacterium octopin synthase (OCS) terminator (NCBI accession Z37515 REGION: 1344 . . . 1538 version Z37515.1 GI:886843) fused either to the vacuolar signal or to the apoplast signal (encoded by SEQ ID NO: 7) or without signals was cloned in the multiple cloning site of the pBINPLUS vector carrying the expression cassettes of Col1 and P4H beta.

[0164] Co-transformations schemes utilizing the expression cassettes described in FIG. 1 into a host plant are illustrated in FIG. 2. Each expression cassette insert is represented by a short name of the coding sequence. The coding sequences and related SEQ ID NOs. are described in Table 1. Each co-transformation is preformed by two pBINPLUS binary vectors. Each rectangle represents a single pBINPLUS vector carrying one, two or three expression cassettes. Promoters and terminators are specified in FIG. 1.

Example 2

Plant Collagen Expression

[0165] Synthetic polynucleotide sequences encoding the proteins listed in Table 1 below were designed and optimized for expression in tobacco plants.

TABLE-US-00001 TABLE 1 List of expressed proteins Included Encoded SwissProt Amino Splicing in SEQ by SEQ Name: accession acids isoform Deletions name ID NO. ID NO. Collagen p02452 1442 One ER signal Col1 3 1 alpha 1(I) version chain [Precursor] Collagen p08123 1342 One ER signal Col2 6 4 alpha 2(I) Two changes version chain done in [Precursor] p08123: D549A and N249I Prolyl 4- p07237 487 One ER signal, P4H 13 12 hydroxylase version KDEL betaHuman beta subunit Prolyl 4- p13674 517 P13674-1 ER signal P4H 15 14 hydroxylase alphaHuman alpha-1 subunit Prolyl 4- No entry in 252 One Mitochon- P4Hplant 17 16 hydroxylase Swissprot. version drial signal Plant NCBI predicted accession: as: aa1-39 gi:15227885 Procollagen p13497 866 P13497-1 ER signal, Proteinase 19 18 C-proteinase BMP1-3 propeptide C Procollagen I o95450 958 O95450-1 ER signal, Proteinase 21 20 N-proteinase LpNPI propeptide N Lysyl o60568 714 One ER signal LH3 23 22 hydroxylase 3 version

[0166] Signal Peptides

[0167] (i) Vacuole signal sequence of barley gene for Thiol protease aleurain precursor (NCBI accession P05167 GI:113603) MAHARVLLLALAVLATAAVAVASSSSFADSNPIRPVTDRAASTLA (SEQ ID NO: 24).

[0168] (ii) Apoplast signal of Arabidopsis thaliana endo-1,4-beta-glucanase (Cell, NCBI accession CAA67156.1 GI:2440033); SEQ ID NO. 9, encoded by SEQ ID NO. 7.

[0169] Construction of Plasmids

[0170] Plant expression vectors were constructed as taught in Example 1, the composition of each constructed expression vector was confirmed via restriction analysis and sequencing.

[0171] Expression vectors including the following expression cassettes were constructed: [0172] 1. Collagen alpha 1 [0173] 2. Collagen alpha 1+human P4H beta subunit [0174] 3. Collagen alpha 1+human P4H beta subunit+human LH3 [0175] 4. Collagen alpha 2 [0176] 5. Collagen alpha 2+with human P4H alpha subunit [0177] 6. Collagen alpha 2+with Arabidopsis P4H [0178] 7. Human P4H beta subunit+human LH3 [0179] 8. Human P4H alpha subunit Each of the above described coding sequences was either translationally fused to a vacuole transit peptide or to an apoplasm transit peptide or was devoid of any transit peptide sequences, in which case cytoplasmic accumulation is expected.

[0180] Plant Transformation and PCR Screening

[0181] Tobacco plants (Nicotiana tabacum, Samsun NN) were transformed with the above described expression vectors according to the transformation scheme taught in FIG. 2.

[0182] Resultant transgenic plants were screened via multiplex PCR using four primers which were designed capable of amplifying a 324 bp fragment of Collagen alpha 1 and a 537 bp fragment of Collagen alpha 2 (Table 2). FIG. 3 illustrates the results of one mulitplex PCR screen.

TABLE-US-00002 TABLE 2 List of primers for multiplex PCR for amplification of a 324 bp fragment of Collagen alpha 1 and a 537 bp fragment of Collagen alpha 2 Col1 forward 5' ATCACCAGGAGAACAGGGACCATC 3' SEQ ID 25 primer (24-mer): Col1 reverse 5' TCCACTTCCAAATCTCTATCCCTAACAAC 3' SEQ ID 26 primer (29-mer): Col2 forward 5' AGGCATTAGAGGCGATAAGGGAG 3' SEQ ID 27 primer (23-mer): Col2 reverse 5' TCAATCCAATAATAGCCACTTGACCAC 3' SEQ ID 28 primer (27-mer):

Example 3

Detection of Human Collagen in Transgenic Tobacco Plants

[0183] Total soluble proteins were extracted from tobacco transformants 2, 3 and 4 by grinding 500 mg of leaves in 0.5 ml 50 mM Tris-HCl pH=7.5 with a "Complete" protease inhibitor cocktail (product #1836145 from Roche Diagnostics GmbH, 1 tablet per 50 ml buffer). The crude extract was mixed with 250 μl 4× Sample application buffer containing 10% beta-mercapto-ethanol and 8% SDS, the samples were boiled for 7 minutes and centrifuged for 8 minutes in 13000 rpm. 20 μl of the supernatant were loaded in a 10% polyacrylamide gel and tested with anti-Collagen I (denatured) antibody ((#AB745 from Chemicon Inc.) in a standard Western blot procedure (FIG. 4). W.T. is a wild type tobacco. Positive collagen bands are visible in plants that are PCR positive for collagen typeI alpha 1 or alpha 2 or both. Positive control band of 500 ng collagen type I from human placenta (#CC050 from Chemicon Inc.) represents about 0.3% of the total soluble proteins (about 150 μg) in the samples from the transgenic plants.

[0184] Plants expressing collagen at the expected molecular weight up to ˜1% of the total soluble proteins were detected when collagen was targeted to the vacuole (FIG. 4). Subcellular targeting of full length collagen to the apoplast was sucsessfuly achieved (FIG. 5). Plants expessing collagen in the cytoplasm (i.e. no targeting peptide) did not accumulate collagen to detectable levels showing that subcellular tareting of collagen in plants is critical for success.

[0185] In addition in contrast to the studies of Ruggiero et al. 2000 and Merle et al. 2002 which showed that collagen lacking the N-propeptide was subjected to significant proteolysis, using the present approach full length collagen proteins with C-propeptide and N-propeptide accumulated in subcellular compartments at high levels.

[0186] The present data also clearly shows that crossing two plants each expressing a different collagen chain type is advantageous in that it enables selection of plants expressing optimal levels of each chain type and subsequent plant crossing to achieve the desired collagen producing plant.

[0187] Collagen produced by the plants of the present invention includes the native propeptides and therefore is expected to form a larger protein then the human control that was purified by proteolysis. The calculated molecular weight of Collagen alpha 1 and alpha 2 chains without hydroxylations or glycosylations are the following: Col1 with propeptides -136 kDa, Col1 without propeptides -95 kDa, Col2 with propeptides -127kDa, Col2 without propeptides -92 kDa.

[0188] As can be seen in FIGS. 4, the Col1 bands in transformants 3-5 and 3-49 appears larger then Col1 bands in other plants. This indicates prolines hydroxylation in collagen chains by human proline-4-hydroxylase holoenzyme composed of alpha and beta subunits that were coexpressed in these plants and targeted to the same subcellular compartment as the human collagen chains (e.g. vacuole).

Example 4

Collagen Triple Helix Assembly and Thermal Stability in Transgenic Plants

[0189] Assembly of collagen triple helix and the helix thermal stability in transgenic plants were tested by thermal denaturation followed by trypsin or pepsin digestion of the total crude protein extract of transgenic plants (FIGS. 6a-b).

[0190] In a first experiment, total soluble proteins from tobacco 2-9 (expressing only col alfa1 and no P4H) and 3-5 (expressing both col alfa1+2 and P4H) were extracted by grinding 500 mg leaves in 0.5 ml of 50 mM Tris-HCl pH=7.5, centrifuging for 10 minutes in 13000 rpm and collecting the supernatant. 50 μl of the supernatant were subjected to heat treatment (15 minutes in 33° C. or 43° C.) and then immediately placed on ice. Trypsin digestion was initiated by adding to each sample 6 μl of 1 mg/ml Trypsin in 50 mM Tris-HCl pH=7.5. The samples were incubated for 20 minutes at room temperature (about 22° C.). The digestion was terminated by addition of 20 μl 4× sample application buffer containing 10% betamercaptoethanol and 8% SDS, the samples were boiled for 7 minutes and centrifuged for 7 minutes at 13000 rpm. 500 of the supernatant were loaded onto a 10% polyacrylamide gel and tested with anti-Collagen I antibody ((#AB745 from Chemicon Inc.) using a standard Western blot procedure. Positive controls were samples of ˜500 ng human collagen I (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) which was added to 50 μl total soluble proteins extracted from w.t. tobacco.

[0191] As shown in FIG. 6a, collagen triple helix that formed in plants #3-5 as well as control human collagen was resistant to denaturation at 33° C. In contrast, collagen formed by plants #2-9 denatured at 33° C. This difference in thermal stability indicates a successful triple helix assembly and post translational proline hydroxylation in transformants #3-5 which express both collagen alpha 1 and collagen alpha 2 as well as P4H beta and alpha subunits.

[0192] Two bands in transformants #2-9 may represent dimers or trimers, which are stable following 7 minutes of boiling with SDS and mercaptoethanol. Similar bands are visible in human collagen (upper panel) and in transformants #3-5. A possible explanation is a covalent bond between two peptides in different triple helixes (cross link), formed following oxidative deamination of two lysines by Lysine oxidase. In a second experiment, total soluble proteins from transgenic tobacco 13-6 (expressing collagen I alpha 1 and alpha 2 chains--pointed by arrows, human P4H alpha and beta subunits and human LH3) were extracted by grinding 500 mg of leaves in 0.5 ml of 100 mM Tris-HCl pH=7.5 and 300 mM NaCl, centrifuging for 7 minutes at 10000 rpm and collecting the supernatant. 50 μl of the supernatant was subjected to heat treatment (20 minutes in 33° C., 38° C. or 42° C.) and then immediately placed on ice. Pepsin digestion was initiated by adding to each sample 4.5 μl of 0.1M HCl and 4 μl of 2.5 mg/ml Pepsin in 10 mM acetic acid. The samples were incubated for 30 minutes at room temperature (about 22° C.). The digestion was terminated by adding 5 μl of unbuffered 1 M Tris. Each sample was mixed with 22 μl 4× Sample application buffer containing 10% beta-mercapto-ethanol and 8% SDS, boiled for 7 minutes and centrifuged for 7 minutes in 13000 rpm. 40 μl of the supernatant were loaded in a 10% polyacrylamide gel and tested with anti-Collagen I antibody ((#AB745 from Chemicon Inc.) in a standard Western blot procedure. Positive control was sample of ˜50 ng human collagen I (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) added to total soluble proteins from w.t. tobacco.

[0193] As is illustrated in FIG. 6b, collagen triple helix that formed in plant #13-6 was resistant to denaturation at 42° C. Cleavage of the propetides is first visible at 33° C. and gradually increases in efficiency when the temperature is raised to 38° C. and again to 42° C. The cleaved collagen triple helix domain shows a similar migration on the gel to the migration of the pepsin treated human collagen. The human collagen that was used in this experiment was extracted from human placenta by pepsin proteolysis and therefore lacks the propeptides and some of the telopeptides.

Example 5

Plant P4H Expression

[0194] Induction of Native Plant P4H

[0195] Tobacco P4H cDNA was cloned and used as a probe to determine conditions and treatments that would induce endogenous P4H expression. Northern blot analysis (FIG. 7) clearly shows that P4H is expressed at relatively high levels in the shoot apex and at low levels in leaves. P4H level was induced significantly in leaves 4 hours following abrasion treatment ("wounded" in the lower panel). Similar results were achieved using other stress conditions (not shown).

[0196] Detection of Human P4H Alpha and Beta Subunits and Collagen Alpha 1 and Alpha 2 Chains in Transgenic Tobacco Plants

[0197] Detection of human P4H alpha and beta subunits and collagen type I alpha 1 and alpha 2 chains in transgenic tobacco plants was effected using anti-human P4H alpha subunit antibody (#63-163 from ICN Biomedicals Inc.), anti-human P4H beta subunit antibody (#MAB2701 from Chemicon Inc.) and anti-Collagen I antibody (#AB745 from Chemicon Inc.). The results of a western blot probed with these antibodies are shown in FIG. 8.

[0198] Expression of P4H alpha, P4H beta and collagen I alpha 1 and alpha 2 bands was confirmed in plant 13-6 (also transformed also with human LH3). The calculated molecular weights of P4H alpha and beta including the vacuolar signal peptide are 65.5 kDa and 53.4 kDa respectively. The calculated molecular weights of Collagen alpha 1 and alpha 2 chains with propeptides, without hydroxylations or glycosylations are 136 kDa and 127 kDa respectively.

Example 6

Vacuolar Targeted Collagen is Stably Expressed in Dark-Grown Plants

[0199] Collagen expressing plants--The 20-279 parental tobacco plant line was generated by co-transformation with an expression vector expressing P4Hbeta+LH3 and another expression vector expressing P4H alpha. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease,

[0200] The 2-300 parental tobacco plant line was generated by co-transformation with an expression vector expressing col1 and another expression vector expressing col2. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease.

[0201] The 13-652 plant was generated by co-transformation of tobacco plant with an expression vector encoding Col1, P4Hbeta and LH3 and a second expression vector encoding Col2 and P4H alpha. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease, Cassete sequences included in the vectors are described in Example 1 above.

[0202] Light and darkness trial--Analysis of six 13-6/52 homozygote plants. Samples from leaf #4+5/6 were taken daily at the same time (12:30) for 8 days, from 3 plants that were grown at regular conditions (16 hours under light conditions and 8 hours in the dark) and from 3 plants that were grown only in the dark.

[0203] Total protein extraction and Western blot analysis--Ninety mg of tobacco leaves were homogenized by mixer mill Type MM301 (Retsch) in an extraction buffer (100 mM Tris HCl pH=7.5, protease inhibitor cocktail available from Roche Catalog Number, 04-693-116-001) at 4° C. Following 30 min of centrifugation (20,000×g at 4° C.), the supernatant was collected. Protein samples were fractionated on 8% SDS-PAGE (Laemmli 1970) and transferred to a nitrocellulose membrane using BIO-RAD® Protein TRANS-BLOT® apparatus. The membrane was blocked for 30 min at room temperature in 3% (g/v) skim milk (Difco), and then reacted with either commercial rabbit anti-human collagen type I polyclonal antibodies (Chemicon), for over night (o.n.) at room temperature. The membrane was rinsed with water 3-5 times and then washed for 30 min in TBS. Following incubation with a secondary antibody [goat anti rabbit-IgG antibody conjugated to alkaline phosphatase (chemicon)] for 2 hours at room temperature, the membrane was rinsed with water for 3-5 times and washed for 30 min in TBS. Immunodetection was effected with nitrotetrazolium blue chloride (NBT, Sigma) and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Sigma), at room temperature for 2 hour--o.n.

[0204] Results

[0205] As shown in FIG. 9, tobacco plants transgenic for vacuolar targeted collagen express Proα1 and Proα2 (lane 1). Collagen from dark grown vacuolar targeted plants exhibited similar stability (lane 2), substantiating the exceptional stability of collagen generated according to the teachings of the present invention

[0206] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0207] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications and GenBank Accession numbers mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application or GenBank

[0208] Accession number was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

REFERENCES

Other References are Cited in the Document

[0209] 1. Bulleid N J, John D C, Kadler K E. Recombinant expression systems for the production of collagen. Biochem Soc Trans. 2000;28(4):350-3. Review. PMID: 10961917 [PubMed--indexed for MEDLINE] [0210] 2. Hare P D, Cress W A. Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regulation 1997; 21: 79-102. [0211] 3. Hieta R, Myllyharju J. Cloning and characterization of a low molecular weight prolyl 4-hydroxylase from Arabidopsis thaliana. Effective hydroxylation of proline-rich, collagen-like, and hypoxia-inducible transcription factor alpha-like peptides. J Biol Chem. 2002 Jun. 28; 277(26):23965-71. Epub 2002 Apr. 25. PMID: 11976332 [PubMed--indexed for MEDLINE] [0212] 4. Hulmes D J. Building collagen molecules, fibrils, and suprafibrillar structures. J Struct Biol. 2002 January-February; 137(1-2):2-10. Review. PMID: 12064927 [PubMed--indexed for MEDLINE] [0213] 5. Inkinen K. Connective tissue formation in wound healing. An experimental study. Academic Dissertation, September 2003. University of Helsinki, Faculty of Science, Department of Biosciences, Division of Biochemistry (ISBN 952-10-1313-3) http://ethesis.helsinki.fi/julkaisut/mat/bioti/vk/inkinen/ [0214] 6. Merle C, Perret S, Lacour T, Jonval V, Hudaverdian S, Garrone R, Ruggiero F, Theisen M. Hydroxylated human homotrimeric collagen I in Agrobacterium tumefaciens-mediated transient expression and in transgenic tobacco plant. FEBS Lett. 2002 Mar. 27; 515(1-3):114-8. PMID: 11943205 [PubMed--indexed for MEDLINE] [0215] 7. Olsen D, Yang C, Bodo M, Chang R, Leigh S, Baez J, Carmichael D, Perala M, Hamalainen E R, Jarvinen M, Polarek J. Recombinant collagen and gelatin for drug delivery. Adv Drug Deliv Rev. 2003 Nov. 28; 55(12):1547-67. PMID: 14623401 [PubMed--in process] [0216] 8. Ruggiero F, Exposito J Y, Bournat P, Gruber V, Perret S, Comte J, Olagnier B, Garrone R, Theisen M. Triple helix assembly and processing of human collagen produced in transgenic tobacco plants. FEBS Lett. 2000 Mar. 3; 469(1):132-6. PMID: 10708770 [PubMed--indexed for MEDLINE] [0217] 9. Tanaka M, Sato K, Uchida T. Plant prolyl hydroxylase recognizes poly(L-proline) II helix. J Biol Chem. 1981 Nov. 25; 256(22):11397-400. PMID: 6271746 [PubMed--indexed for MEDLINE] [0218] 10. Wang C, Luosujarvi H, Heikkinen J, Risteli M, Uitto L, Myllyla R. The third activity for lysyl hydroxylase 3: galactosylation of hydroxylysyl residues in collagens in vitro. Matrix Biol. 2002 November; 21(7):559-66. PMID: 12475640 [PubMed--indexed for MEDLINE]

Sequence CWU 1

2914662DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Collagen alpha 1(I) chain and flanking regions 1gcgatgcatg taatgtcatg agccacatga tccaatggcc acaggaacgt aagaatgtag 60atagatttga ttttgtccgt tagatagcaa acaacattat aaaaggtgtg tatcaatacg 120aactaattca ctcattggat tcatagaagt ccattcctcc taagtatcta aaccatggct 180cacgctcgtg ttctcctcct cgctctcgct gttttggcaa cagctgctgt ggctgtggct 240tctagttctt cttttgctga ttcaaaccct attagacctg ttactgatag agcagcttcc 300actttggctc aattgcaaga ggagggccag gttgagggcc aagatgagga tatccctcca 360attacatgcg tgcaaaatgg cttgcgttac cacgataggg atgtgtggaa acctgaacct 420tgtcgtatct gtgtgtgtga taacggcaag gtgctctgcg atgatgttat ctgcgatgag 480acaaaaaatt gccctggcgc tgaagttcct gagggcgagt gttgccctgt gtgccctgat 540ggttccgagt ccccaactga tcaggaaact actggcgtgg agggcccaaa aggagatact 600ggtccacgtg gtcctagggg tccagcaggt cctccaggta gagatggtat tccaggccag 660cctggattgc caggaccacc aggcccacct ggcccaccag gacctcctgg tcttggtgga 720aatttcgctc cacaactctc ttatggctat gatgagaagt caacaggtgg tatttccgtt 780ccaggtccta tgggaccatc cggaccaaga ggtctcccag gtcctccagg tgctcctgga 840cctcaaggct ttcaaggacc tccaggcgaa ccaggagaac caggcgcttc tggaccaatg 900ggcccaaggg gaccacctgg cccaccagga aaaaatggcg atgatggcga agctggaaag 960cctggtcgtc ctggagagag aggtcctcct ggcccacagg gtgcaagagg cttgccagga 1020actgctggct tgcctggaat gaagggacat aggggcttct ccggcctcga tggcgctaag 1080ggtgatgctg gccctgctgg accaaagggc gagccaggtt cccctggaga aaacggtgct 1140cctggacaaa tgggtcctcg tggacttcca ggagaaaggg gtcgtccagg cgctccagga 1200ccagcaggtg ctaggggaaa cgatggtgca acaggcgctg ctggccctcc tggcccaact 1260ggtcctgctg gccctccagg attcccaggc gcagttggag ctaaaggaga agcaggacca 1320cagggcccta ggggttctga aggacctcag ggtgttagag gtgaaccagg tcctccaggc 1380ccagctggag cagctggtcc agcaggaaat ccaggtgctg atggtcaacc tggagctaag 1440ggcgctaatg gcgcaccagg tatcgcaggc gcaccaggtt ttcctggcgc tagaggccca 1500agtggtcctc aaggaccagg tggaccacca ggtccaaaag gcaattctgg cgaacctggc 1560gctccaggtt ctaaaggaga tactggtgct aaaggcgaac caggacctgt tggtgttcag 1620ggtcctcctg gtcctgctgg agaagaagga aaaagaggtg ctcgtggaga accaggacca 1680actggacttc ctggacctcc tggtgaacgt ggcggacctg gctcaagggg tttccctgga 1740gctgatggag tggcaggtcc aaaaggccct gctggagaga gaggttcacc aggtccagct 1800ggtcctaagg gctcccctgg tgaagcaggt agaccaggcg aagcaggatt gccaggcgca 1860aagggattga caggctctcc tggtagtcct ggcccagatg gaaaaacagg cccaccaggt 1920ccagcaggac aagatggacg tccaggccca ccaggtcctc ctggagcaag gggacaagct 1980ggcgttatgg gttttccagg acctaaaggt gctgctggag agccaggaaa ggcaggtgaa 2040agaggagttc ctggtccacc aggagcagtg ggtcctgctg gcaaagatgg tgaagctgga 2100gcacagggcc ctccaggccc tgctggccca gctggcgaac gtggagaaca aggcccagct 2160ggtagtccag gatttcaagg attgcctggc cctgctggcc ctccaggaga agcaggaaaa 2220cctggagaac aaggagttcc tggtgatttg ggagcacctg gaccttcagg agcacgtggt 2280gaaagaggct tccctggcga gaggggtgtt caaggtccac caggtccagc aggacctaga 2340ggtgctaatg gcgctcctgg caacgatgga gcaaaaggtg atgctggtgc tcctggcgca 2400cctggaagtc agggtgctcc tggattgcaa ggaatgcctg gagagagggg tgctgctggc 2460ttgccaggcc caaagggcga taggggtgat gctggaccaa aaggtgctga tggatcccca 2520ggaaaagatg gagttcgtgg tcttactggc ccaatcggac ctccaggccc tgctggcgct 2580ccaggtgata agggcgaaag tggcccaagt ggacctgctg gacctactgg tgctagaggt 2640gcacctggtg ataggggtga acctggacca cctggtccag ctggttttgc tggtcctcct 2700ggagctgatg gacaacctgg cgcaaagggt gaaccaggtg atgctggcgc aaagggagat 2760gctggtccac ctggacctgc tggtccagca ggcccccctg ggccaatcgg taatgttgga 2820gcaccaggtg ctaagggagc taggggttcc gctggtccac ctggagcaac aggatttcca 2880ggcgctgctg gtagagttgg cccaccaggc ccatccggaa acgcaggccc tcctggtcct 2940ccaggtcctg ctggcaagga gggtggcaaa ggaccaaggg gcgaaactgg ccctgctggt 3000agacctggcg aagttggccc tcctggacca ccaggtccag caggagaaaa aggttcccca 3060ggagctgatg gcccagctgg tgctccagga actccaggcc ctcaaggtat tgctggacag 3120agaggcgttg tgggactccc tggtcaaagg ggagagagag gatttccagg cttgccagga 3180cctagtggag aacctggaaa acaaggccca tcaggcgcta gtggagagcg tggacctcct 3240ggccctatgg gacctcctgg attggctggc ccacctggcg aatcaggtcg tgaaggcgca 3300ccaggcgcag aaggatcacc tggaagagat ggatcccctg gtgctaaagg cgatcgtgga 3360gaaactggtc cagcaggccc accaggcgca ccaggtgcac ctggcgctcc aggacctgtg 3420ggaccagctg gaaaatccgg agataggggc gagacaggcc cagcaggacc agctggacct 3480gttggccctg ctggcgctcg tggaccagca ggacctcaag gaccaagggg agataaggga 3540gaaacaggcg aacaaggcga taggggcatt aagggtcata ggggttttag tggcctccag 3600ggtcctcctg gcccacctgg atcaccagga gaacagggac catctggtgc ttccggccca 3660gctggtccaa gaggacctcc aggatcagct ggtgcacctg gaaaagatgg tcttaacggt 3720ctcccaggac caatcggccc tccaggacct agaggaagaa caggagatgc tggccctgtt 3780ggccctccag gacctcctgg tccaccaggt ccacctggtc ctccatcagc tggattcgat 3840ttttcatttc ttccacagcc accacaagag aaagctcacg atggcggcag atattaccgt 3900gctgatgatg ctaacgttgt tagggataga gatttggaag tggatacaac tttgaaatcc 3960ctctcccagc aaattgaaaa cattagatct ccagaaggtt cacgtaaaaa cccagctaga 4020acatgtcgtg atttgaaaat gtgtcactcc gattggaaaa gtggtgaata ctggattgat 4080ccaaatcagg gctgtaatct cgatgctatc aaagttttct gtaacatgga aacaggcgaa 4140acatgcgttt atcctactca accttccgtg gctcagaaaa attggtacat ctcaaaaaat 4200cctaaagata agaggcacgt ttggttcggt gaaagtatga ctgatggatt tcaatttgag 4260tacggcggtc aaggtagtga tccagctgat gtggctattc aactcacatt tttgcgtctt 4320atgtccacag aggcatcaca aaacatcact taccactgca aaaacagtgt ggcttatatg 4380gatcaacaaa caggaaacct taagaaggct cttcttttga agggctcaaa cgagattgag 4440attagagcag agggcaactc aaggtttact tattcagtta ctgttgatgg ctgcacttca 4500catactggcg cttggggtaa aacagttatc gagtataaga ctacaaaaac atcaagactc 4560ccaatcattg atgttgctcc tctcgatgtt ggcgctcctg atcaagagtt cggttttgat 4620gtgggcccag tttgtttcct ctaatgagct cgcggccgca tc 466224662DNAArtificial sequenceSynthetic sequence of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Collagen alpha 1(I) chain and flanking regions 2gcgatgcatg taatgtcatg agccacatga tccaatggcc acaggaacgt aagaatgtag 60atagatttga ttttgtccgt tagatagcaa acaacattat aaaaggtgtg tatcaatacg 120aactaattca ctcattggat tcatagaagt ccattcctcc taagtatcta aacc atg 177 Met 1gct cac gct cgt gtt ctc ctc ctc gct ctc gct gtt ttg gca aca gct 225Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr Ala 5 10 15gct gtg gct gtg gct tct agt tct tct ttt gct gat tca aac cct att 273Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro Ile 20 25 30aga cct gtt act gat aga gca gct tcc act ttg gct caa ttg caa gag 321Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Gln Glu 35 40 45gag ggc cag gtt gag ggc caa gat gag gat atc cct cca att aca tgc 369Glu Gly Gln Val Glu Gly Gln Asp Glu Asp Ile Pro Pro Ile Thr Cys50 55 60 65gtg caa aat ggc ttg cgt tac cac gat agg gat gtg tgg aaa cct gaa 417Val Gln Asn Gly Leu Arg Tyr His Asp Arg Asp Val Trp Lys Pro Glu 70 75 80cct tgt cgt atc tgt gtg tgt gat aac ggc aag gtg ctc tgc gat gat 465Pro Cys Arg Ile Cys Val Cys Asp Asn Gly Lys Val Leu Cys Asp Asp 85 90 95gtt atc tgc gat gag aca aaa aat tgc cct ggc gct gaa gtt cct gag 513Val Ile Cys Asp Glu Thr Lys Asn Cys Pro Gly Ala Glu Val Pro Glu 100 105 110ggc gag tgt tgc cct gtg tgc cct gat ggt tcc gag tcc cca act gat 561Gly Glu Cys Cys Pro Val Cys Pro Asp Gly Ser Glu Ser Pro Thr Asp 115 120 125cag gaa act act ggc gtg gag ggc cca aaa gga gat act ggt cca cgt 609Gln Glu Thr Thr Gly Val Glu Gly Pro Lys Gly Asp Thr Gly Pro Arg130 135 140 145ggt cct agg ggt cca gca ggt cct cca ggt aga gat ggt att cca ggc 657Gly Pro Arg Gly Pro Ala Gly Pro Pro Gly Arg Asp Gly Ile Pro Gly 150 155 160cag cct gga ttg cca gga cca cca ggc cca cct ggc cca cca gga cct 705Gln Pro Gly Leu Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro 165 170 175cct ggt ctt ggt gga aat ttc gct cca caa ctc tct tat ggc tat gat 753Pro Gly Leu Gly Gly Asn Phe Ala Pro Gln Leu Ser Tyr Gly Tyr Asp 180 185 190gag aag tca aca ggt ggt att tcc gtt cca ggt cct atg gga cca tcc 801Glu Lys Ser Thr Gly Gly Ile Ser Val Pro Gly Pro Met Gly Pro Ser 195 200 205gga cca aga ggt ctc cca ggt cct cca ggt gct cct gga cct caa ggc 849Gly Pro Arg Gly Leu Pro Gly Pro Pro Gly Ala Pro Gly Pro Gln Gly210 215 220 225ttt caa gga cct cca ggc gaa cca gga gaa cca ggc gct tct gga cca 897Phe Gln Gly Pro Pro Gly Glu Pro Gly Glu Pro Gly Ala Ser Gly Pro 230 235 240atg ggc cca agg gga cca cct ggc cca cca gga aaa aat ggc gat gat 945Met Gly Pro Arg Gly Pro Pro Gly Pro Pro Gly Lys Asn Gly Asp Asp 245 250 255ggc gaa gct gga aag cct ggt cgt cct gga gag aga ggt cct cct ggc 993Gly Glu Ala Gly Lys Pro Gly Arg Pro Gly Glu Arg Gly Pro Pro Gly 260 265 270cca cag ggt gca aga ggc ttg cca gga act gct ggc ttg cct gga atg 1041Pro Gln Gly Ala Arg Gly Leu Pro Gly Thr Ala Gly Leu Pro Gly Met 275 280 285aag gga cat agg ggc ttc tcc ggc ctc gat ggc gct aag ggt gat gct 1089Lys Gly His Arg Gly Phe Ser Gly Leu Asp Gly Ala Lys Gly Asp Ala290 295 300 305ggc cct gct gga cca aag ggc gag cca ggt tcc cct gga gaa aac ggt 1137Gly Pro Ala Gly Pro Lys Gly Glu Pro Gly Ser Pro Gly Glu Asn Gly 310 315 320gct cct gga caa atg ggt cct cgt gga ctt cca gga gaa agg ggt cgt 1185Ala Pro Gly Gln Met Gly Pro Arg Gly Leu Pro Gly Glu Arg Gly Arg 325 330 335cca ggc gct cca gga cca gca ggt gct agg gga aac gat ggt gca aca 1233Pro Gly Ala Pro Gly Pro Ala Gly Ala Arg Gly Asn Asp Gly Ala Thr 340 345 350ggc gct gct ggc cct cct ggc cca act ggt cct gct ggc cct cca gga 1281Gly Ala Ala Gly Pro Pro Gly Pro Thr Gly Pro Ala Gly Pro Pro Gly 355 360 365ttc cca ggc gca gtt gga gct aaa gga gaa gca gga cca cag ggc cct 1329Phe Pro Gly Ala Val Gly Ala Lys Gly Glu Ala Gly Pro Gln Gly Pro370 375 380 385agg ggt tct gaa gga cct cag ggt gtt aga ggt gaa cca ggt cct cca 1377Arg Gly Ser Glu Gly Pro Gln Gly Val Arg Gly Glu Pro Gly Pro Pro 390 395 400ggc cca gct gga gca gct ggt cca gca gga aat cca ggt gct gat ggt 1425Gly Pro Ala Gly Ala Ala Gly Pro Ala Gly Asn Pro Gly Ala Asp Gly 405 410 415caa cct gga gct aag ggc gct aat ggc gca cca ggt atc gca ggc gca 1473Gln Pro Gly Ala Lys Gly Ala Asn Gly Ala Pro Gly Ile Ala Gly Ala 420 425 430cca ggt ttt cct ggc gct aga ggc cca agt ggt cct caa gga cca ggt 1521Pro Gly Phe Pro Gly Ala Arg Gly Pro Ser Gly Pro Gln Gly Pro Gly 435 440 445gga cca cca ggt cca aaa ggc aat tct ggc gaa cct ggc gct cca ggt 1569Gly Pro Pro Gly Pro Lys Gly Asn Ser Gly Glu Pro Gly Ala Pro Gly450 455 460 465tct aaa gga gat act ggt gct aaa ggc gaa cca gga cct gtt ggt gtt 1617Ser Lys Gly Asp Thr Gly Ala Lys Gly Glu Pro Gly Pro Val Gly Val 470 475 480cag ggt cct cct ggt cct gct gga gaa gaa gga aaa aga ggt gct cgt 1665Gln Gly Pro Pro Gly Pro Ala Gly Glu Glu Gly Lys Arg Gly Ala Arg 485 490 495gga gaa cca gga cca act gga ctt cct gga cct cct ggt gaa cgt ggc 1713Gly Glu Pro Gly Pro Thr Gly Leu Pro Gly Pro Pro Gly Glu Arg Gly 500 505 510gga cct ggc tca agg ggt ttc cct gga gct gat gga gtg gca ggt cca 1761Gly Pro Gly Ser Arg Gly Phe Pro Gly Ala Asp Gly Val Ala Gly Pro 515 520 525aaa ggc cct gct gga gag aga ggt tca cca ggt cca gct ggt cct aag 1809Lys Gly Pro Ala Gly Glu Arg Gly Ser Pro Gly Pro Ala Gly Pro Lys530 535 540 545ggc tcc cct ggt gaa gca ggt aga cca ggc gaa gca gga ttg cca ggc 1857Gly Ser Pro Gly Glu Ala Gly Arg Pro Gly Glu Ala Gly Leu Pro Gly 550 555 560gca aag gga ttg aca ggc tct cct ggt agt cct ggc cca gat gga aaa 1905Ala Lys Gly Leu Thr Gly Ser Pro Gly Ser Pro Gly Pro Asp Gly Lys 565 570 575aca ggc cca cca ggt cca gca gga caa gat gga cgt cca ggc cca cca 1953Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp Gly Arg Pro Gly Pro Pro 580 585 590ggt cct cct gga gca agg gga caa gct ggc gtt atg ggt ttt cca gga 2001Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly Val Met Gly Phe Pro Gly 595 600 605cct aaa ggt gct gct gga gag cca gga aag gca ggt gaa aga gga gtt 2049Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys Ala Gly Glu Arg Gly Val610 615 620 625cct ggt cca cca gga gca gtg ggt cct gct ggc aaa gat ggt gaa gct 2097Pro Gly Pro Pro Gly Ala Val Gly Pro Ala Gly Lys Asp Gly Glu Ala 630 635 640gga gca cag ggc cct cca ggc cct gct ggc cca gct ggc gaa cgt gga 2145Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Glu Arg Gly 645 650 655gaa caa ggc cca gct ggt agt cca gga ttt caa gga ttg cct ggc cct 2193Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe Gln Gly Leu Pro Gly Pro 660 665 670gct ggc cct cca gga gaa gca gga aaa cct gga gaa caa gga gtt cct 2241Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro Gly Glu Gln Gly Val Pro 675 680 685ggt gat ttg gga gca cct gga cct tca gga gca cgt ggt gaa aga ggc 2289Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly Ala Arg Gly Glu Arg Gly690 695 700 705ttc cct ggc gag agg ggt gtt caa ggt cca cca ggt cca gca gga cct 2337Phe Pro Gly Glu Arg Gly Val Gln Gly Pro Pro Gly Pro Ala Gly Pro 710 715 720aga ggt gct aat ggc gct cct ggc aac gat gga gca aaa ggt gat gct 2385Arg Gly Ala Asn Gly Ala Pro Gly Asn Asp Gly Ala Lys Gly Asp Ala 725 730 735ggt gct cct ggc gca cct gga agt cag ggt gct cct gga ttg caa gga 2433Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu Gln Gly 740 745 750atg cct gga gag agg ggt gct gct ggc ttg cca ggc cca aag ggc gat 2481Met Pro Gly Glu Arg Gly Ala Ala Gly Leu Pro Gly Pro Lys Gly Asp 755 760 765agg ggt gat gct gga cca aaa ggt gct gat gga tcc cca gga aaa gat 2529Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp Gly Ser Pro Gly Lys Asp770 775 780 785gga gtt cgt ggt ctt act ggc cca atc gga cct cca ggc cct gct ggc 2577Gly Val Arg Gly Leu Thr Gly Pro Ile Gly Pro Pro Gly Pro Ala Gly 790 795 800gct cca ggt gat aag ggc gaa agt ggc cca agt gga cct gct gga cct 2625Ala Pro Gly Asp Lys Gly Glu Ser Gly Pro Ser Gly Pro Ala Gly Pro 805 810 815act ggt gct aga ggt gca cct ggt gat agg ggt gaa cct gga cca cct 2673Thr Gly Ala Arg Gly Ala Pro Gly Asp Arg Gly Glu Pro Gly Pro Pro 820 825 830ggt cca gct ggt ttt gct ggt cct cct gga gct gat gga caa cct ggc 2721Gly Pro Ala Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly Gln Pro Gly 835 840 845gca aag ggt gaa cca ggt gat gct ggc gca aag gga gat gct ggt cca 2769Ala Lys Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly Asp Ala Gly Pro850 855 860 865cct gga cct gct ggt cca gca ggc ccc cct ggg cca atc ggt aat gtt 2817Pro Gly Pro Ala Gly Pro Ala Gly Pro Pro Gly Pro Ile Gly Asn Val 870 875 880gga gca cca ggt gct aag gga gct agg ggt tcc gct ggt cca cct gga 2865Gly Ala Pro Gly Ala Lys Gly Ala Arg Gly Ser Ala Gly Pro Pro Gly 885 890 895gca aca gga ttt cca ggc gct gct ggt aga gtt ggc cca cca ggc cca 2913Ala Thr Gly Phe Pro Gly Ala Ala Gly Arg Val Gly Pro Pro Gly Pro 900 905 910tcc gga aac gca ggc cct cct ggt cct cca ggt cct gct ggc aag gag 2961Ser Gly Asn Ala Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Lys Glu 915 920 925ggt ggc aaa gga cca agg ggc gaa act ggc cct gct ggt aga cct ggc 3009Gly Gly Lys Gly Pro Arg Gly Glu Thr Gly Pro Ala Gly Arg Pro Gly930 935 940 945gaa gtt ggc cct cct gga cca cca ggt cca gca gga gaa aaa ggt tcc 3057Glu Val Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Glu Lys Gly Ser 950 955 960cca gga gct gat ggc cca gct ggt gct cca gga act cca ggc cct caa 3105Pro Gly Ala Asp Gly Pro Ala Gly Ala Pro Gly Thr Pro Gly Pro Gln 965 970 975ggt att gct gga cag aga ggc gtt gtg gga ctc cct ggt caa agg gga 3153Gly Ile Ala Gly Gln Arg Gly Val Val Gly Leu Pro Gly Gln Arg Gly 980 985 990gag aga gga ttt cca ggc ttg cca gga cct agt gga gaa cct

gga aaa 3201Glu Arg Gly Phe Pro Gly Leu Pro Gly Pro Ser Gly Glu Pro Gly Lys 995 1000 1005caa ggc cca tca ggc gct agt gga gag cgt gga cct cct ggc cct 3246Gln Gly Pro Ser Gly Ala Ser Gly Glu Arg Gly Pro Pro Gly Pro1010 1015 1020atg gga cct cct gga ttg gct ggc cca cct ggc gaa tca ggt cgt 3291Met Gly Pro Pro Gly Leu Ala Gly Pro Pro Gly Glu Ser Gly Arg1025 1030 1035gaa ggc gca cca ggc gca gaa gga tca cct gga aga gat gga tcc 3336Glu Gly Ala Pro Gly Ala Glu Gly Ser Pro Gly Arg Asp Gly Ser1040 1045 1050cct ggt gct aaa ggc gat cgt gga gaa act ggt cca gca ggc cca 3381Pro Gly Ala Lys Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly Pro1055 1060 1065cca ggc gca cca ggt gca cct ggc gct cca gga cct gtg gga cca 3426Pro Gly Ala Pro Gly Ala Pro Gly Ala Pro Gly Pro Val Gly Pro1070 1075 1080gct gga aaa tcc gga gat agg ggc gag aca ggc cca gca gga cca 3471Ala Gly Lys Ser Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly Pro1085 1090 1095gct gga cct gtt ggc cct gct ggc gct cgt gga cca gca gga cct 3516Ala Gly Pro Val Gly Pro Ala Gly Ala Arg Gly Pro Ala Gly Pro1100 1105 1110caa gga cca agg gga gat aag gga gaa aca ggc gaa caa ggc gat 3561Gln Gly Pro Arg Gly Asp Lys Gly Glu Thr Gly Glu Gln Gly Asp1115 1120 1125agg ggc att aag ggt cat agg ggt ttt agt ggc ctc cag ggt cct 3606Arg Gly Ile Lys Gly His Arg Gly Phe Ser Gly Leu Gln Gly Pro1130 1135 1140cct ggc cca cct gga tca cca gga gaa cag gga cca tct ggt gct 3651Pro Gly Pro Pro Gly Ser Pro Gly Glu Gln Gly Pro Ser Gly Ala1145 1150 1155tcc ggc cca gct ggt cca aga gga cct cca gga tca gct ggt gca 3696Ser Gly Pro Ala Gly Pro Arg Gly Pro Pro Gly Ser Ala Gly Ala1160 1165 1170cct gga aaa gat ggt ctt aac ggt ctc cca gga cca atc ggc cct 3741Pro Gly Lys Asp Gly Leu Asn Gly Leu Pro Gly Pro Ile Gly Pro1175 1180 1185cca gga cct aga gga aga aca gga gat gct ggc cct gtt ggc cct 3786Pro Gly Pro Arg Gly Arg Thr Gly Asp Ala Gly Pro Val Gly Pro1190 1195 1200cca gga cct cct ggt cca cca ggt cca cct ggt cct cca tca gct 3831Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Ser Ala1205 1210 1215gga ttc gat ttt tca ttt ctt cca cag cca cca caa gag aaa gct 3876Gly Phe Asp Phe Ser Phe Leu Pro Gln Pro Pro Gln Glu Lys Ala1220 1225 1230cac gat ggc ggc aga tat tac cgt gct gat gat gct aac gtt gtt 3921His Asp Gly Gly Arg Tyr Tyr Arg Ala Asp Asp Ala Asn Val Val1235 1240 1245agg gat aga gat ttg gaa gtg gat aca act ttg aaa tcc ctc tcc 3966Arg Asp Arg Asp Leu Glu Val Asp Thr Thr Leu Lys Ser Leu Ser1250 1255 1260cag caa att gaa aac att aga tct cca gaa ggt tca cgt aaa aac 4011Gln Gln Ile Glu Asn Ile Arg Ser Pro Glu Gly Ser Arg Lys Asn1265 1270 1275cca gct aga aca tgt cgt gat ttg aaa atg tgt cac tcc gat tgg 4056Pro Ala Arg Thr Cys Arg Asp Leu Lys Met Cys His Ser Asp Trp1280 1285 1290aaa agt ggt gaa tac tgg att gat cca aat cag ggc tgt aat ctc 4101Lys Ser Gly Glu Tyr Trp Ile Asp Pro Asn Gln Gly Cys Asn Leu1295 1300 1305gat gct atc aaa gtt ttc tgt aac atg gaa aca ggc gaa aca tgc 4146Asp Ala Ile Lys Val Phe Cys Asn Met Glu Thr Gly Glu Thr Cys1310 1315 1320gtt tat cct act caa cct tcc gtg gct cag aaa aat tgg tac atc 4191Val Tyr Pro Thr Gln Pro Ser Val Ala Gln Lys Asn Trp Tyr Ile1325 1330 1335tca aaa aat cct aaa gat aag agg cac gtt tgg ttc ggt gaa agt 4236Ser Lys Asn Pro Lys Asp Lys Arg His Val Trp Phe Gly Glu Ser1340 1345 1350atg act gat gga ttt caa ttt gag tac ggc ggt caa ggt agt gat 4281Met Thr Asp Gly Phe Gln Phe Glu Tyr Gly Gly Gln Gly Ser Asp1355 1360 1365cca gct gat gtg gct att caa ctc aca ttt ttg cgt ctt atg tcc 4326Pro Ala Asp Val Ala Ile Gln Leu Thr Phe Leu Arg Leu Met Ser1370 1375 1380aca gag gca tca caa aac atc act tac cac tgc aaa aac agt gtg 4371Thr Glu Ala Ser Gln Asn Ile Thr Tyr His Cys Lys Asn Ser Val1385 1390 1395gct tat atg gat caa caa aca gga aac ctt aag aag gct ctt ctt 4416Ala Tyr Met Asp Gln Gln Thr Gly Asn Leu Lys Lys Ala Leu Leu1400 1405 1410ttg aag ggc tca aac gag att gag att aga gca gag ggc aac tca 4461Leu Lys Gly Ser Asn Glu Ile Glu Ile Arg Ala Glu Gly Asn Ser1415 1420 1425agg ttt act tat tca gtt act gtt gat ggc tgc act tca cat act 4506Arg Phe Thr Tyr Ser Val Thr Val Asp Gly Cys Thr Ser His Thr1430 1435 1440ggc gct tgg ggt aaa aca gtt atc gag tat aag act aca aaa aca 4551Gly Ala Trp Gly Lys Thr Val Ile Glu Tyr Lys Thr Thr Lys Thr1445 1450 1455tca aga ctc cca atc att gat gtt gct cct ctc gat gtt ggc gct 4596Ser Arg Leu Pro Ile Ile Asp Val Ala Pro Leu Asp Val Gly Ala1460 1465 1470cct gat caa gag ttc ggt ttt gat gtg ggc cca gtt tgt ttc ctc 4641Pro Asp Gln Glu Phe Gly Phe Asp Val Gly Pro Val Cys Phe Leu1475 1480 1485taa tgagctcgcg gccgcatc 466231489PRTArtificial sequenceSynthetic Construct 3Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Gln 35 40 45Glu Glu Gly Gln Val Glu Gly Gln Asp Glu Asp Ile Pro Pro Ile Thr 50 55 60Cys Val Gln Asn Gly Leu Arg Tyr His Asp Arg Asp Val Trp Lys Pro65 70 75 80Glu Pro Cys Arg Ile Cys Val Cys Asp Asn Gly Lys Val Leu Cys Asp 85 90 95Asp Val Ile Cys Asp Glu Thr Lys Asn Cys Pro Gly Ala Glu Val Pro 100 105 110Glu Gly Glu Cys Cys Pro Val Cys Pro Asp Gly Ser Glu Ser Pro Thr 115 120 125Asp Gln Glu Thr Thr Gly Val Glu Gly Pro Lys Gly Asp Thr Gly Pro 130 135 140Arg Gly Pro Arg Gly Pro Ala Gly Pro Pro Gly Arg Asp Gly Ile Pro145 150 155 160Gly Gln Pro Gly Leu Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly 165 170 175Pro Pro Gly Leu Gly Gly Asn Phe Ala Pro Gln Leu Ser Tyr Gly Tyr 180 185 190Asp Glu Lys Ser Thr Gly Gly Ile Ser Val Pro Gly Pro Met Gly Pro 195 200 205Ser Gly Pro Arg Gly Leu Pro Gly Pro Pro Gly Ala Pro Gly Pro Gln 210 215 220Gly Phe Gln Gly Pro Pro Gly Glu Pro Gly Glu Pro Gly Ala Ser Gly225 230 235 240Pro Met Gly Pro Arg Gly Pro Pro Gly Pro Pro Gly Lys Asn Gly Asp 245 250 255Asp Gly Glu Ala Gly Lys Pro Gly Arg Pro Gly Glu Arg Gly Pro Pro 260 265 270Gly Pro Gln Gly Ala Arg Gly Leu Pro Gly Thr Ala Gly Leu Pro Gly 275 280 285Met Lys Gly His Arg Gly Phe Ser Gly Leu Asp Gly Ala Lys Gly Asp 290 295 300Ala Gly Pro Ala Gly Pro Lys Gly Glu Pro Gly Ser Pro Gly Glu Asn305 310 315 320Gly Ala Pro Gly Gln Met Gly Pro Arg Gly Leu Pro Gly Glu Arg Gly 325 330 335Arg Pro Gly Ala Pro Gly Pro Ala Gly Ala Arg Gly Asn Asp Gly Ala 340 345 350Thr Gly Ala Ala Gly Pro Pro Gly Pro Thr Gly Pro Ala Gly Pro Pro 355 360 365Gly Phe Pro Gly Ala Val Gly Ala Lys Gly Glu Ala Gly Pro Gln Gly 370 375 380Pro Arg Gly Ser Glu Gly Pro Gln Gly Val Arg Gly Glu Pro Gly Pro385 390 395 400Pro Gly Pro Ala Gly Ala Ala Gly Pro Ala Gly Asn Pro Gly Ala Asp 405 410 415Gly Gln Pro Gly Ala Lys Gly Ala Asn Gly Ala Pro Gly Ile Ala Gly 420 425 430Ala Pro Gly Phe Pro Gly Ala Arg Gly Pro Ser Gly Pro Gln Gly Pro 435 440 445Gly Gly Pro Pro Gly Pro Lys Gly Asn Ser Gly Glu Pro Gly Ala Pro 450 455 460Gly Ser Lys Gly Asp Thr Gly Ala Lys Gly Glu Pro Gly Pro Val Gly465 470 475 480Val Gln Gly Pro Pro Gly Pro Ala Gly Glu Glu Gly Lys Arg Gly Ala 485 490 495Arg Gly Glu Pro Gly Pro Thr Gly Leu Pro Gly Pro Pro Gly Glu Arg 500 505 510Gly Gly Pro Gly Ser Arg Gly Phe Pro Gly Ala Asp Gly Val Ala Gly 515 520 525Pro Lys Gly Pro Ala Gly Glu Arg Gly Ser Pro Gly Pro Ala Gly Pro 530 535 540Lys Gly Ser Pro Gly Glu Ala Gly Arg Pro Gly Glu Ala Gly Leu Pro545 550 555 560Gly Ala Lys Gly Leu Thr Gly Ser Pro Gly Ser Pro Gly Pro Asp Gly 565 570 575Lys Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp Gly Arg Pro Gly Pro 580 585 590Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly Val Met Gly Phe Pro 595 600 605Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys Ala Gly Glu Arg Gly 610 615 620Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala Gly Lys Asp Gly Glu625 630 635 640Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Glu Arg 645 650 655Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe Gln Gly Leu Pro Gly 660 665 670Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro Gly Glu Gln Gly Val 675 680 685Pro Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly Ala Arg Gly Glu Arg 690 695 700Gly Phe Pro Gly Glu Arg Gly Val Gln Gly Pro Pro Gly Pro Ala Gly705 710 715 720Pro Arg Gly Ala Asn Gly Ala Pro Gly Asn Asp Gly Ala Lys Gly Asp 725 730 735Ala Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu Gln 740 745 750Gly Met Pro Gly Glu Arg Gly Ala Ala Gly Leu Pro Gly Pro Lys Gly 755 760 765Asp Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp Gly Ser Pro Gly Lys 770 775 780Asp Gly Val Arg Gly Leu Thr Gly Pro Ile Gly Pro Pro Gly Pro Ala785 790 795 800Gly Ala Pro Gly Asp Lys Gly Glu Ser Gly Pro Ser Gly Pro Ala Gly 805 810 815Pro Thr Gly Ala Arg Gly Ala Pro Gly Asp Arg Gly Glu Pro Gly Pro 820 825 830Pro Gly Pro Ala Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly Gln Pro 835 840 845Gly Ala Lys Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly Asp Ala Gly 850 855 860Pro Pro Gly Pro Ala Gly Pro Ala Gly Pro Pro Gly Pro Ile Gly Asn865 870 875 880Val Gly Ala Pro Gly Ala Lys Gly Ala Arg Gly Ser Ala Gly Pro Pro 885 890 895Gly Ala Thr Gly Phe Pro Gly Ala Ala Gly Arg Val Gly Pro Pro Gly 900 905 910Pro Ser Gly Asn Ala Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Lys 915 920 925Glu Gly Gly Lys Gly Pro Arg Gly Glu Thr Gly Pro Ala Gly Arg Pro 930 935 940Gly Glu Val Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Glu Lys Gly945 950 955 960Ser Pro Gly Ala Asp Gly Pro Ala Gly Ala Pro Gly Thr Pro Gly Pro 965 970 975Gln Gly Ile Ala Gly Gln Arg Gly Val Val Gly Leu Pro Gly Gln Arg 980 985 990Gly Glu Arg Gly Phe Pro Gly Leu Pro Gly Pro Ser Gly Glu Pro Gly 995 1000 1005Lys Gln Gly Pro Ser Gly Ala Ser Gly Glu Arg Gly Pro Pro Gly 1010 1015 1020Pro Met Gly Pro Pro Gly Leu Ala Gly Pro Pro Gly Glu Ser Gly 1025 1030 1035Arg Glu Gly Ala Pro Gly Ala Glu Gly Ser Pro Gly Arg Asp Gly 1040 1045 1050Ser Pro Gly Ala Lys Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly 1055 1060 1065Pro Pro Gly Ala Pro Gly Ala Pro Gly Ala Pro Gly Pro Val Gly 1070 1075 1080Pro Ala Gly Lys Ser Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly 1085 1090 1095Pro Ala Gly Pro Val Gly Pro Ala Gly Ala Arg Gly Pro Ala Gly 1100 1105 1110Pro Gln Gly Pro Arg Gly Asp Lys Gly Glu Thr Gly Glu Gln Gly 1115 1120 1125Asp Arg Gly Ile Lys Gly His Arg Gly Phe Ser Gly Leu Gln Gly 1130 1135 1140Pro Pro Gly Pro Pro Gly Ser Pro Gly Glu Gln Gly Pro Ser Gly 1145 1150 1155Ala Ser Gly Pro Ala Gly Pro Arg Gly Pro Pro Gly Ser Ala Gly 1160 1165 1170Ala Pro Gly Lys Asp Gly Leu Asn Gly Leu Pro Gly Pro Ile Gly 1175 1180 1185Pro Pro Gly Pro Arg Gly Arg Thr Gly Asp Ala Gly Pro Val Gly 1190 1195 1200Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Ser 1205 1210 1215Ala Gly Phe Asp Phe Ser Phe Leu Pro Gln Pro Pro Gln Glu Lys 1220 1225 1230Ala His Asp Gly Gly Arg Tyr Tyr Arg Ala Asp Asp Ala Asn Val 1235 1240 1245Val Arg Asp Arg Asp Leu Glu Val Asp Thr Thr Leu Lys Ser Leu 1250 1255 1260Ser Gln Gln Ile Glu Asn Ile Arg Ser Pro Glu Gly Ser Arg Lys 1265 1270 1275Asn Pro Ala Arg Thr Cys Arg Asp Leu Lys Met Cys His Ser Asp 1280 1285 1290Trp Lys Ser Gly Glu Tyr Trp Ile Asp Pro Asn Gln Gly Cys Asn 1295 1300 1305Leu Asp Ala Ile Lys Val Phe Cys Asn Met Glu Thr Gly Glu Thr 1310 1315 1320Cys Val Tyr Pro Thr Gln Pro Ser Val Ala Gln Lys Asn Trp Tyr 1325 1330 1335Ile Ser Lys Asn Pro Lys Asp Lys Arg His Val Trp Phe Gly Glu 1340 1345 1350Ser Met Thr Asp Gly Phe Gln Phe Glu Tyr Gly Gly Gln Gly Ser 1355 1360 1365Asp Pro Ala Asp Val Ala Ile Gln Leu Thr Phe Leu Arg Leu Met 1370 1375 1380Ser Thr Glu Ala Ser Gln Asn Ile Thr Tyr His Cys Lys Asn Ser 1385 1390 1395Val Ala Tyr Met Asp Gln Gln Thr Gly Asn Leu Lys Lys Ala Leu 1400 1405 1410Leu Leu Lys Gly Ser Asn Glu Ile Glu Ile Arg Ala Glu Gly Asn 1415 1420 1425Ser Arg Phe Thr Tyr Ser Val Thr Val Asp Gly Cys Thr Ser His 1430 1435 1440Thr Gly Ala Trp Gly Lys Thr Val Ile Glu Tyr Lys Thr Thr Lys 1445 1450 1455Thr Ser Arg Leu Pro Ile Ile Asp Val Ala Pro Leu Asp Val Gly 1460 1465 1470Ala Pro Asp Gln Glu Phe Gly Phe Asp Val Gly Pro Val Cys Phe 1475 1480 1485Leu44362DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Collagen alpha 2(I) chain and flanking regions 4gcgatgcatg taatgtcatg agccacatga tccaatggcc acaggaacgt aagaatgtag 60atagatttga ttttgtccgt tagatagcaa acaacattat aaaaggtgtg tatcaatacg 120aactaattca ctcattggat tcatagaagt ccattcctcc taagtatcta aaccatggct 180cacgctcgtg ttctcctcct cgctctcgct gttttggcaa cagctgctgt ggctgtggct 240tcaagttcta gttttgctga ttccaaccca attcgtccag ttactgatag agcagcttcc 300actttggctc aattgcttca agaagaaact gtgaggaagg gccctgctgg cgataggggc 360cctaggggcg aaaggggtcc accaggacct ccaggcaggg atggcgaaga tggtccaact 420ggccctcctg gacctcctgg ccctccaggg ccacccggct tgggcggaaa cttcgcagct 480caatacgatg gcaagggtgt tggtcttggt cctggtccta tgggcttgat gggacctaga 540ggcccacctg gtgctgctgg tgctcctgga ccacagggtt ttcagggacc agctggcgag 600ccaggagagc caggccaaac aggaccagct ggtgcaaggg gacctgctgg acctcctgga 660aaagctggtg aagatggtca cccaggcaaa ccaggacgtc ctggcgaaag aggtgttgtt 720ggaccacaag gcgctagggg atttccaggt

acacctggat tgccaggttt taagggcatt 780cgtggtcata acggcctcga tggattgaag ggacagcctg gcgcacctgg cgttaagggt 840gaacctggag caccaggtga aaacggtact cctggccaga ctggtgcaag aggactccca 900ggtgaaaggg gtagagttgg tgctcctgga cctgctggag ctaggggtag tgatggtagt 960gttggtcctg tgggccctgc tggtccaatc ggttccgctg gcccacctgg attcccaggc 1020gctccaggac ctaaaggaga aatcggtgct gtgggtaacg caggtcctac tggtccagca 1080ggtcctcgtg gagaagtggg attgccagga ctttctggtc cagtgggccc tccaggcaac 1140cctggagcta acggcttgac aggagctaaa ggcgcagcag gactccctgg agtggctggc 1200gcaccaggat tgcctggtcc aaggggtatc ccaggccctg ttggcgcagc tggagctact 1260ggtgcacgtg gacttgttgg cgaaccaggc cctgctggat caaaaggcga gtctggaaat 1320aagggagaac ctggttctgc tggacctcaa ggtcctcctg gaccttctgg agaagaagga 1380aaaaggggac caaatggcga ggctggatca gcaggtccac caggaccacc tggacttcgt 1440ggatcccctg gtagtagagg acttccaggc gctgatggta gagcaggcgt tatgggacca 1500ccaggaagta gaggagcatc cggtccagca ggagttaggg gtcctaacgg agatgctggt 1560agaccaggtg aaccaggtct tatgggccca aggggcctcc caggtagtcc aggaaatatc 1620ggccctgctg gaaaagaagg ccctgttgga cttccaggta ttgatggacg tcctggccct 1680attggcccag caggtgcaag aggagaacct ggcaatattg gatttccagg accaaagggt 1740ccaacaggcg atcctggaaa aaatggagat aagggtcatg ctggattggc aggcgcaagg 1800ggcgctcctg gtccagatgg aaacaacggc gcacagggtc cacctggccc tcagggtgtt 1860caaggcggaa aaggcgaaca aggcccagct ggaccaccag gctttcaagg cttgccagga 1920ccaagtggtc cagcaggtga agttggcaag ccaggcgagc gtggacttca tggcgagttt 1980ggactccctg gaccagcagg accaaggggt gaaagaggcc ctcctggaga gagtggcgct 2040gctggaccaa caggcccaat cggtagtaga ggtcctagtg gacctccagg cccagatgga 2100aataagggtg aaccaggagt tgtgggcgct gttggaacag ctggtccttc aggaccatca 2160ggactcccag gcgagagagg cgctgctggc attcctggag gaaaaggtga aaaaggcgaa 2220cctggcctcc gtggcgaaat cggaaatcct ggacgtgatg gtgctcgtgg tgcacacggc 2280gctgtgggcg ctccaggccc tgctggtgct actggtgata gaggagaggc tggcgcagct 2340ggcccagcag gtcctgctgg cccaaggggt agtcctggtg aaagaggcga agttggacct 2400gctggcccta acggctttgc tggccctgct ggagcagcag gtcaacctgg cgctaaaggt 2460gaaaggggcg gaaagggccc aaaaggtgaa aatggcgttg tgggaccaac tggtccagtg 2520ggcgcagctg gacctgctgg tccaaatgga ccaccaggac cagcaggtag tagaggagat 2580ggtggacctc caggaatgac aggttttcca ggtgctgctg gtagaacagg acctcctggt 2640cctagtggta tttctggtcc accaggacca ccaggtcctg ctggaaaaga aggattgagg 2700ggtccacgtg gtgatcaagg accagtgggc agaactggtg aagttggcgc agtgggacca 2760cctggttttg ctggagaaaa gggcccttct ggagaggcag gaacagctgg tcctcctggt 2820acacctggac ctcaaggact tttgggtgca cctggtattc tcggattgcc aggaagtagg 2880ggcgaacgtg gacttcctgg cgtggcagga gcagttggag aacctggccc tctcggaatc 2940gcaggcccac caggcgcaag aggaccacca ggagctgttg gatcaccagg cgtgaatggt 3000gcacctggcg aggctggtcg tgatggaaac ccaggaaatg atggcccacc aggaagagat 3060ggtcaacctg gacacaaagg cgagaggggc tacccaggaa atattggccc agttggtgct 3120gctggcgcac caggcccaca cggtccagtt ggaccagcag gaaaacacgg taatcgtggc 3180gaaacaggcc cttcaggccc agtgggacct gctggtgctg ttggcccaag aggaccatct 3240ggacctcaag gcattagagg cgataaggga gagcctggcg aaaaaggacc tagaggcttg 3300cctggtttta aaggacacaa cggtctccaa ggacttccag gtatcgctgg tcatcatgga 3360gatcagggtg ctcctggatc agtgggtcca gcaggtccta gaggcccagc aggcccttcc 3420ggtccagcag gaaaggatgg acgtactggc caccctggaa ctgtgggccc tgctggaatt 3480agaggtcctc aaggtcatca gggccctgct ggccctccag gtccaccagg tcctccaggc 3540ccaccaggag tttcaggtgg tggttacgat tttggttacg atggtgattt ttaccgtgct 3600gatcaaccta gaagtgctcc ttctctccgt cctaaagatt atgaagttga tgctactttg 3660aaatcactta acaaccagat tgagactctt ctcacacctg agggatcaag aaagaatcca 3720gcacgtacat gccgtgatct cagacttagt cacccagagt ggtcaagtgg ctattattgg 3780attgatccta atcagggttg tacaatggag gctatcaaag tttactgtga ttttccaact 3840ggagagacat gtattagggc acaacctgag aacattccag ctaaaaattg gtatcgttcc 3900tctaaagata agaaacatgt ttggctcgga gagactatta acgctggttc tcagttcgag 3960tataatgttg agggcgttac ttctaaagag atggcaactc agctcgcttt tatgagattg 4020ctcgctaact acgcatccca aaacatcact tatcactgca aaaattccat tgcatatatg 4080gatgaggaga caggaaattt gaagaaagca gttattctcc aaggtagtaa cgatgttgag 4140cttgtggctg agggaaatag tagattcact tacacagttt tggtggatgg atgctcaaag 4200aaaactaatg agtggggcaa gacaatcatt gagtacaaga caaataagcc ttctaggctc 4260ccatttctcg atattgcacc tcttgatatc ggaggagctg atcacgagtt ttttgttgat 4320atcggacctg tttgttttaa gtaatgagct cgcggccgca tc 436254362DNAArtificial sequenceSynthetic sequence of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Collagen alpha 2(I) chain and flanking regions 5gcgatgcatg taatgtcatg agccacatga tccaatggcc acaggaacgt aagaatgtag 60atagatttga ttttgtccgt tagatagcaa acaacattat aaaaggtgtg tatcaatacg 120aactaattca ctcattggat tcatagaagt ccattcctcc taagtatcta aacc atg 177 Met 1gct cac gct cgt gtt ctc ctc ctc gct ctc gct gtt ttg gca aca gct 225Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr Ala 5 10 15gct gtg gct gtg gct tca agt tct agt ttt gct gat tcc aac cca att 273Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro Ile 20 25 30cgt cca gtt act gat aga gca gct tcc act ttg gct caa ttg ctt caa 321Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Leu Gln 35 40 45gaa gaa act gtg agg aag ggc cct gct ggc gat agg ggc cct agg ggc 369Glu Glu Thr Val Arg Lys Gly Pro Ala Gly Asp Arg Gly Pro Arg Gly50 55 60 65gaa agg ggt cca cca gga cct cca ggc agg gat ggc gaa gat ggt cca 417Glu Arg Gly Pro Pro Gly Pro Pro Gly Arg Asp Gly Glu Asp Gly Pro 70 75 80act ggc cct cct gga cct cct ggc cct cca ggg cca ccc ggc ttg ggc 465Thr Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Leu Gly 85 90 95gga aac ttc gca gct caa tac gat ggc aag ggt gtt ggt ctt ggt cct 513Gly Asn Phe Ala Ala Gln Tyr Asp Gly Lys Gly Val Gly Leu Gly Pro 100 105 110ggt cct atg ggc ttg atg gga cct aga ggc cca cct ggt gct gct ggt 561Gly Pro Met Gly Leu Met Gly Pro Arg Gly Pro Pro Gly Ala Ala Gly 115 120 125gct cct gga cca cag ggt ttt cag gga cca gct ggc gag cca gga gag 609Ala Pro Gly Pro Gln Gly Phe Gln Gly Pro Ala Gly Glu Pro Gly Glu130 135 140 145cca ggc caa aca gga cca gct ggt gca agg gga cct gct gga cct cct 657Pro Gly Gln Thr Gly Pro Ala Gly Ala Arg Gly Pro Ala Gly Pro Pro 150 155 160gga aaa gct ggt gaa gat ggt cac cca ggc aaa cca gga cgt cct ggc 705Gly Lys Ala Gly Glu Asp Gly His Pro Gly Lys Pro Gly Arg Pro Gly 165 170 175gaa aga ggt gtt gtt gga cca caa ggc gct agg gga ttt cca ggt aca 753Glu Arg Gly Val Val Gly Pro Gln Gly Ala Arg Gly Phe Pro Gly Thr 180 185 190cct gga ttg cca ggt ttt aag ggc att cgt ggt cat aac ggc ctc gat 801Pro Gly Leu Pro Gly Phe Lys Gly Ile Arg Gly His Asn Gly Leu Asp 195 200 205gga ttg aag gga cag cct ggc gca cct ggc gtt aag ggt gaa cct gga 849Gly Leu Lys Gly Gln Pro Gly Ala Pro Gly Val Lys Gly Glu Pro Gly210 215 220 225gca cca ggt gaa aac ggt act cct ggc cag act ggt gca aga gga ctc 897Ala Pro Gly Glu Asn Gly Thr Pro Gly Gln Thr Gly Ala Arg Gly Leu 230 235 240cca ggt gaa agg ggt aga gtt ggt gct cct gga cct gct gga gct agg 945Pro Gly Glu Arg Gly Arg Val Gly Ala Pro Gly Pro Ala Gly Ala Arg 245 250 255ggt agt gat ggt agt gtt ggt cct gtg ggc cct gct ggt cca atc ggt 993Gly Ser Asp Gly Ser Val Gly Pro Val Gly Pro Ala Gly Pro Ile Gly 260 265 270tcc gct ggc cca cct gga ttc cca ggc gct cca gga cct aaa gga gaa 1041Ser Ala Gly Pro Pro Gly Phe Pro Gly Ala Pro Gly Pro Lys Gly Glu 275 280 285atc ggt gct gtg ggt aac gca ggt cct act ggt cca gca ggt cct cgt 1089Ile Gly Ala Val Gly Asn Ala Gly Pro Thr Gly Pro Ala Gly Pro Arg290 295 300 305gga gaa gtg gga ttg cca gga ctt tct ggt cca gtg ggc cct cca ggc 1137Gly Glu Val Gly Leu Pro Gly Leu Ser Gly Pro Val Gly Pro Pro Gly 310 315 320aac cct gga gct aac ggc ttg aca gga gct aaa ggc gca gca gga ctc 1185Asn Pro Gly Ala Asn Gly Leu Thr Gly Ala Lys Gly Ala Ala Gly Leu 325 330 335cct gga gtg gct ggc gca cca gga ttg cct ggt cca agg ggt atc cca 1233Pro Gly Val Ala Gly Ala Pro Gly Leu Pro Gly Pro Arg Gly Ile Pro 340 345 350ggc cct gtt ggc gca gct gga gct act ggt gca cgt gga ctt gtt ggc 1281Gly Pro Val Gly Ala Ala Gly Ala Thr Gly Ala Arg Gly Leu Val Gly 355 360 365gaa cca ggc cct gct gga tca aaa ggc gag tct gga aat aag gga gaa 1329Glu Pro Gly Pro Ala Gly Ser Lys Gly Glu Ser Gly Asn Lys Gly Glu370 375 380 385cct ggt tct gct gga cct caa ggt cct cct gga cct tct gga gaa gaa 1377Pro Gly Ser Ala Gly Pro Gln Gly Pro Pro Gly Pro Ser Gly Glu Glu 390 395 400gga aaa agg gga cca aat ggc gag gct gga tca gca ggt cca cca gga 1425Gly Lys Arg Gly Pro Asn Gly Glu Ala Gly Ser Ala Gly Pro Pro Gly 405 410 415cca cct gga ctt cgt gga tcc cct ggt agt aga gga ctt cca ggc gct 1473Pro Pro Gly Leu Arg Gly Ser Pro Gly Ser Arg Gly Leu Pro Gly Ala 420 425 430gat ggt aga gca ggc gtt atg gga cca cca gga agt aga gga gca tcc 1521Asp Gly Arg Ala Gly Val Met Gly Pro Pro Gly Ser Arg Gly Ala Ser 435 440 445ggt cca gca gga gtt agg ggt cct aac gga gat gct ggt aga cca ggt 1569Gly Pro Ala Gly Val Arg Gly Pro Asn Gly Asp Ala Gly Arg Pro Gly450 455 460 465gaa cca ggt ctt atg ggc cca agg ggc ctc cca ggt agt cca gga aat 1617Glu Pro Gly Leu Met Gly Pro Arg Gly Leu Pro Gly Ser Pro Gly Asn 470 475 480atc ggc cct gct gga aaa gaa ggc cct gtt gga ctt cca ggt att gat 1665Ile Gly Pro Ala Gly Lys Glu Gly Pro Val Gly Leu Pro Gly Ile Asp 485 490 495gga cgt cct ggc cct att ggc cca gca ggt gca aga gga gaa cct ggc 1713Gly Arg Pro Gly Pro Ile Gly Pro Ala Gly Ala Arg Gly Glu Pro Gly 500 505 510aat att gga ttt cca gga cca aag ggt cca aca ggc gat cct gga aaa 1761Asn Ile Gly Phe Pro Gly Pro Lys Gly Pro Thr Gly Asp Pro Gly Lys 515 520 525aat gga gat aag ggt cat gct gga ttg gca ggc gca agg ggc gct cct 1809Asn Gly Asp Lys Gly His Ala Gly Leu Ala Gly Ala Arg Gly Ala Pro530 535 540 545ggt cca gat gga aac aac ggc gca cag ggt cca cct ggc cct cag ggt 1857Gly Pro Asp Gly Asn Asn Gly Ala Gln Gly Pro Pro Gly Pro Gln Gly 550 555 560gtt caa ggc gga aaa ggc gaa caa ggc cca gct gga cca cca ggc ttt 1905Val Gln Gly Gly Lys Gly Glu Gln Gly Pro Ala Gly Pro Pro Gly Phe 565 570 575caa ggc ttg cca gga cca agt ggt cca gca ggt gaa gtt ggc aag cca 1953Gln Gly Leu Pro Gly Pro Ser Gly Pro Ala Gly Glu Val Gly Lys Pro 580 585 590ggc gag cgt gga ctt cat ggc gag ttt gga ctc cct gga cca gca gga 2001Gly Glu Arg Gly Leu His Gly Glu Phe Gly Leu Pro Gly Pro Ala Gly 595 600 605cca agg ggt gaa aga ggc cct cct gga gag agt ggc gct gct gga cca 2049Pro Arg Gly Glu Arg Gly Pro Pro Gly Glu Ser Gly Ala Ala Gly Pro610 615 620 625aca ggc cca atc ggt agt aga ggt cct agt gga cct cca ggc cca gat 2097Thr Gly Pro Ile Gly Ser Arg Gly Pro Ser Gly Pro Pro Gly Pro Asp 630 635 640gga aat aag ggt gaa cca gga gtt gtg ggc gct gtt gga aca gct ggt 2145Gly Asn Lys Gly Glu Pro Gly Val Val Gly Ala Val Gly Thr Ala Gly 645 650 655cct tca gga cca tca gga ctc cca ggc gag aga ggc gct gct ggc att 2193Pro Ser Gly Pro Ser Gly Leu Pro Gly Glu Arg Gly Ala Ala Gly Ile 660 665 670cct gga gga aaa ggt gaa aaa ggc gaa cct ggc ctc cgt ggc gaa atc 2241Pro Gly Gly Lys Gly Glu Lys Gly Glu Pro Gly Leu Arg Gly Glu Ile 675 680 685gga aat cct gga cgt gat ggt gct cgt ggt gca cac ggc gct gtg ggc 2289Gly Asn Pro Gly Arg Asp Gly Ala Arg Gly Ala His Gly Ala Val Gly690 695 700 705gct cca ggc cct gct ggt gct act ggt gat aga gga gag gct ggc gca 2337Ala Pro Gly Pro Ala Gly Ala Thr Gly Asp Arg Gly Glu Ala Gly Ala 710 715 720gct ggc cca gca ggt cct gct ggc cca agg ggt agt cct ggt gaa aga 2385Ala Gly Pro Ala Gly Pro Ala Gly Pro Arg Gly Ser Pro Gly Glu Arg 725 730 735ggc gaa gtt gga cct gct ggc cct aac ggc ttt gct ggc cct gct gga 2433Gly Glu Val Gly Pro Ala Gly Pro Asn Gly Phe Ala Gly Pro Ala Gly 740 745 750gca gca ggt caa cct ggc gct aaa ggt gaa agg ggc gga aag ggc cca 2481Ala Ala Gly Gln Pro Gly Ala Lys Gly Glu Arg Gly Gly Lys Gly Pro 755 760 765aaa ggt gaa aat ggc gtt gtg gga cca act ggt cca gtg ggc gca gct 2529Lys Gly Glu Asn Gly Val Val Gly Pro Thr Gly Pro Val Gly Ala Ala770 775 780 785gga cct gct ggt cca aat gga cca cca gga cca gca ggt agt aga gga 2577Gly Pro Ala Gly Pro Asn Gly Pro Pro Gly Pro Ala Gly Ser Arg Gly 790 795 800gat ggt gga cct cca gga atg aca ggt ttt cca ggt gct gct ggt aga 2625Asp Gly Gly Pro Pro Gly Met Thr Gly Phe Pro Gly Ala Ala Gly Arg 805 810 815aca gga cct cct ggt cct agt ggt att tct ggt cca cca gga cca cca 2673Thr Gly Pro Pro Gly Pro Ser Gly Ile Ser Gly Pro Pro Gly Pro Pro 820 825 830ggt cct gct gga aaa gaa gga ttg agg ggt cca cgt ggt gat caa gga 2721Gly Pro Ala Gly Lys Glu Gly Leu Arg Gly Pro Arg Gly Asp Gln Gly 835 840 845cca gtg ggc aga act ggt gaa gtt ggc gca gtg gga cca cct ggt ttt 2769Pro Val Gly Arg Thr Gly Glu Val Gly Ala Val Gly Pro Pro Gly Phe850 855 860 865gct gga gaa aag ggc cct tct gga gag gca gga aca gct ggt cct cct 2817Ala Gly Glu Lys Gly Pro Ser Gly Glu Ala Gly Thr Ala Gly Pro Pro 870 875 880ggt aca cct gga cct caa gga ctt ttg ggt gca cct ggt att ctc gga 2865Gly Thr Pro Gly Pro Gln Gly Leu Leu Gly Ala Pro Gly Ile Leu Gly 885 890 895ttg cca gga agt agg ggc gaa cgt gga ctt cct ggc gtg gca gga gca 2913Leu Pro Gly Ser Arg Gly Glu Arg Gly Leu Pro Gly Val Ala Gly Ala 900 905 910gtt gga gaa cct ggc cct ctc gga atc gca ggc cca cca ggc gca aga 2961Val Gly Glu Pro Gly Pro Leu Gly Ile Ala Gly Pro Pro Gly Ala Arg 915 920 925gga cca cca gga gct gtt gga tca cca ggc gtg aat ggt gca cct ggc 3009Gly Pro Pro Gly Ala Val Gly Ser Pro Gly Val Asn Gly Ala Pro Gly930 935 940 945gag gct ggt cgt gat gga aac cca gga aat gat ggc cca cca gga aga 3057Glu Ala Gly Arg Asp Gly Asn Pro Gly Asn Asp Gly Pro Pro Gly Arg 950 955 960gat ggt caa cct gga cac aaa ggc gag agg ggc tac cca gga aat att 3105Asp Gly Gln Pro Gly His Lys Gly Glu Arg Gly Tyr Pro Gly Asn Ile 965 970 975ggc cca gtt ggt gct gct ggc gca cca ggc cca cac ggt cca gtt gga 3153Gly Pro Val Gly Ala Ala Gly Ala Pro Gly Pro His Gly Pro Val Gly 980 985 990cca gca gga aaa cac ggt aat cgt ggc gaa aca ggc cct tca ggc cca 3201Pro Ala Gly Lys His Gly Asn Arg Gly Glu Thr Gly Pro Ser Gly Pro 995 1000 1005gtg gga cct gct ggt gct gtt ggc cca aga gga cca tct gga cct 3246Val Gly Pro Ala Gly Ala Val Gly Pro Arg Gly Pro Ser Gly Pro1010 1015 1020caa ggc att aga ggc gat aag gga gag cct ggc gaa aaa gga cct 3291Gln Gly Ile Arg Gly Asp Lys Gly Glu Pro Gly Glu Lys Gly Pro1025 1030 1035aga ggc ttg cct ggt ttt aaa gga cac aac ggt ctc caa gga ctt 3336Arg Gly Leu Pro Gly Phe Lys Gly His Asn Gly Leu Gln Gly Leu1040 1045 1050cca ggt atc gct ggt cat cat gga gat cag ggt gct cct gga tca 3381Pro Gly Ile Ala Gly His His Gly Asp Gln Gly Ala Pro Gly Ser1055 1060 1065gtg ggt cca gca ggt cct aga ggc cca gca ggc cct tcc ggt cca 3426Val Gly Pro Ala Gly Pro Arg Gly Pro Ala Gly Pro Ser Gly Pro1070 1075 1080gca gga aag gat gga cgt act ggc cac cct gga act gtg ggc cct 3471Ala Gly Lys Asp Gly Arg Thr Gly His Pro Gly Thr Val Gly Pro1085 1090 1095gct gga att aga ggt cct caa ggt cat cag ggc cct gct ggc cct 3516Ala Gly Ile Arg Gly Pro Gln Gly His Gln Gly Pro Ala Gly Pro1100 1105 1110cca ggt cca cca ggt cct cca ggc cca cca gga gtt tca ggt ggt 3561Pro Gly Pro Pro Gly Pro Pro Gly

Pro Pro Gly Val Ser Gly Gly1115 1120 1125ggt tac gat ttt ggt tac gat ggt gat ttt tac cgt gct gat caa 3606Gly Tyr Asp Phe Gly Tyr Asp Gly Asp Phe Tyr Arg Ala Asp Gln1130 1135 1140cct aga agt gct cct tct ctc cgt cct aaa gat tat gaa gtt gat 3651Pro Arg Ser Ala Pro Ser Leu Arg Pro Lys Asp Tyr Glu Val Asp1145 1150 1155gct act ttg aaa tca ctt aac aac cag att gag act ctt ctc aca 3696Ala Thr Leu Lys Ser Leu Asn Asn Gln Ile Glu Thr Leu Leu Thr1160 1165 1170cct gag gga tca aga aag aat cca gca cgt aca tgc cgt gat ctc 3741Pro Glu Gly Ser Arg Lys Asn Pro Ala Arg Thr Cys Arg Asp Leu1175 1180 1185aga ctt agt cac cca gag tgg tca agt ggc tat tat tgg att gat 3786Arg Leu Ser His Pro Glu Trp Ser Ser Gly Tyr Tyr Trp Ile Asp1190 1195 1200cct aat cag ggt tgt aca atg gag gct atc aaa gtt tac tgt gat 3831Pro Asn Gln Gly Cys Thr Met Glu Ala Ile Lys Val Tyr Cys Asp1205 1210 1215ttt cca act gga gag aca tgt att agg gca caa cct gag aac att 3876Phe Pro Thr Gly Glu Thr Cys Ile Arg Ala Gln Pro Glu Asn Ile1220 1225 1230cca gct aaa aat tgg tat cgt tcc tct aaa gat aag aaa cat gtt 3921Pro Ala Lys Asn Trp Tyr Arg Ser Ser Lys Asp Lys Lys His Val1235 1240 1245tgg ctc gga gag act att aac gct ggt tct cag ttc gag tat aat 3966Trp Leu Gly Glu Thr Ile Asn Ala Gly Ser Gln Phe Glu Tyr Asn1250 1255 1260gtt gag ggc gtt act tct aaa gag atg gca act cag ctc gct ttt 4011Val Glu Gly Val Thr Ser Lys Glu Met Ala Thr Gln Leu Ala Phe1265 1270 1275atg aga ttg ctc gct aac tac gca tcc caa aac atc act tat cac 4056Met Arg Leu Leu Ala Asn Tyr Ala Ser Gln Asn Ile Thr Tyr His1280 1285 1290tgc aaa aat tcc att gca tat atg gat gag gag aca gga aat ttg 4101Cys Lys Asn Ser Ile Ala Tyr Met Asp Glu Glu Thr Gly Asn Leu1295 1300 1305aag aaa gca gtt att ctc caa ggt agt aac gat gtt gag ctt gtg 4146Lys Lys Ala Val Ile Leu Gln Gly Ser Asn Asp Val Glu Leu Val1310 1315 1320gct gag gga aat agt aga ttc act tac aca gtt ttg gtg gat gga 4191Ala Glu Gly Asn Ser Arg Phe Thr Tyr Thr Val Leu Val Asp Gly1325 1330 1335tgc tca aag aaa act aat gag tgg ggc aag aca atc att gag tac 4236Cys Ser Lys Lys Thr Asn Glu Trp Gly Lys Thr Ile Ile Glu Tyr1340 1345 1350aag aca aat aag cct tct agg ctc cca ttt ctc gat att gca cct 4281Lys Thr Asn Lys Pro Ser Arg Leu Pro Phe Leu Asp Ile Ala Pro1355 1360 1365ctt gat atc gga gga gct gat cac gag ttt ttt gtt gat atc gga 4326Leu Asp Ile Gly Gly Ala Asp His Glu Phe Phe Val Asp Ile Gly1370 1375 1380cct gtt tgt ttt aag taa tgagctcgcg gccgcatc 4362Pro Val Cys Phe Lys138561389PRTArtificial sequenceSynthetic Construct 6Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Leu 35 40 45Gln Glu Glu Thr Val Arg Lys Gly Pro Ala Gly Asp Arg Gly Pro Arg 50 55 60Gly Glu Arg Gly Pro Pro Gly Pro Pro Gly Arg Asp Gly Glu Asp Gly65 70 75 80Pro Thr Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Leu 85 90 95Gly Gly Asn Phe Ala Ala Gln Tyr Asp Gly Lys Gly Val Gly Leu Gly 100 105 110Pro Gly Pro Met Gly Leu Met Gly Pro Arg Gly Pro Pro Gly Ala Ala 115 120 125Gly Ala Pro Gly Pro Gln Gly Phe Gln Gly Pro Ala Gly Glu Pro Gly 130 135 140Glu Pro Gly Gln Thr Gly Pro Ala Gly Ala Arg Gly Pro Ala Gly Pro145 150 155 160Pro Gly Lys Ala Gly Glu Asp Gly His Pro Gly Lys Pro Gly Arg Pro 165 170 175Gly Glu Arg Gly Val Val Gly Pro Gln Gly Ala Arg Gly Phe Pro Gly 180 185 190Thr Pro Gly Leu Pro Gly Phe Lys Gly Ile Arg Gly His Asn Gly Leu 195 200 205Asp Gly Leu Lys Gly Gln Pro Gly Ala Pro Gly Val Lys Gly Glu Pro 210 215 220Gly Ala Pro Gly Glu Asn Gly Thr Pro Gly Gln Thr Gly Ala Arg Gly225 230 235 240Leu Pro Gly Glu Arg Gly Arg Val Gly Ala Pro Gly Pro Ala Gly Ala 245 250 255Arg Gly Ser Asp Gly Ser Val Gly Pro Val Gly Pro Ala Gly Pro Ile 260 265 270Gly Ser Ala Gly Pro Pro Gly Phe Pro Gly Ala Pro Gly Pro Lys Gly 275 280 285Glu Ile Gly Ala Val Gly Asn Ala Gly Pro Thr Gly Pro Ala Gly Pro 290 295 300Arg Gly Glu Val Gly Leu Pro Gly Leu Ser Gly Pro Val Gly Pro Pro305 310 315 320Gly Asn Pro Gly Ala Asn Gly Leu Thr Gly Ala Lys Gly Ala Ala Gly 325 330 335Leu Pro Gly Val Ala Gly Ala Pro Gly Leu Pro Gly Pro Arg Gly Ile 340 345 350Pro Gly Pro Val Gly Ala Ala Gly Ala Thr Gly Ala Arg Gly Leu Val 355 360 365Gly Glu Pro Gly Pro Ala Gly Ser Lys Gly Glu Ser Gly Asn Lys Gly 370 375 380Glu Pro Gly Ser Ala Gly Pro Gln Gly Pro Pro Gly Pro Ser Gly Glu385 390 395 400Glu Gly Lys Arg Gly Pro Asn Gly Glu Ala Gly Ser Ala Gly Pro Pro 405 410 415Gly Pro Pro Gly Leu Arg Gly Ser Pro Gly Ser Arg Gly Leu Pro Gly 420 425 430Ala Asp Gly Arg Ala Gly Val Met Gly Pro Pro Gly Ser Arg Gly Ala 435 440 445Ser Gly Pro Ala Gly Val Arg Gly Pro Asn Gly Asp Ala Gly Arg Pro 450 455 460Gly Glu Pro Gly Leu Met Gly Pro Arg Gly Leu Pro Gly Ser Pro Gly465 470 475 480Asn Ile Gly Pro Ala Gly Lys Glu Gly Pro Val Gly Leu Pro Gly Ile 485 490 495Asp Gly Arg Pro Gly Pro Ile Gly Pro Ala Gly Ala Arg Gly Glu Pro 500 505 510Gly Asn Ile Gly Phe Pro Gly Pro Lys Gly Pro Thr Gly Asp Pro Gly 515 520 525Lys Asn Gly Asp Lys Gly His Ala Gly Leu Ala Gly Ala Arg Gly Ala 530 535 540Pro Gly Pro Asp Gly Asn Asn Gly Ala Gln Gly Pro Pro Gly Pro Gln545 550 555 560Gly Val Gln Gly Gly Lys Gly Glu Gln Gly Pro Ala Gly Pro Pro Gly 565 570 575Phe Gln Gly Leu Pro Gly Pro Ser Gly Pro Ala Gly Glu Val Gly Lys 580 585 590Pro Gly Glu Arg Gly Leu His Gly Glu Phe Gly Leu Pro Gly Pro Ala 595 600 605Gly Pro Arg Gly Glu Arg Gly Pro Pro Gly Glu Ser Gly Ala Ala Gly 610 615 620Pro Thr Gly Pro Ile Gly Ser Arg Gly Pro Ser Gly Pro Pro Gly Pro625 630 635 640Asp Gly Asn Lys Gly Glu Pro Gly Val Val Gly Ala Val Gly Thr Ala 645 650 655Gly Pro Ser Gly Pro Ser Gly Leu Pro Gly Glu Arg Gly Ala Ala Gly 660 665 670Ile Pro Gly Gly Lys Gly Glu Lys Gly Glu Pro Gly Leu Arg Gly Glu 675 680 685Ile Gly Asn Pro Gly Arg Asp Gly Ala Arg Gly Ala His Gly Ala Val 690 695 700Gly Ala Pro Gly Pro Ala Gly Ala Thr Gly Asp Arg Gly Glu Ala Gly705 710 715 720Ala Ala Gly Pro Ala Gly Pro Ala Gly Pro Arg Gly Ser Pro Gly Glu 725 730 735Arg Gly Glu Val Gly Pro Ala Gly Pro Asn Gly Phe Ala Gly Pro Ala 740 745 750Gly Ala Ala Gly Gln Pro Gly Ala Lys Gly Glu Arg Gly Gly Lys Gly 755 760 765Pro Lys Gly Glu Asn Gly Val Val Gly Pro Thr Gly Pro Val Gly Ala 770 775 780Ala Gly Pro Ala Gly Pro Asn Gly Pro Pro Gly Pro Ala Gly Ser Arg785 790 795 800Gly Asp Gly Gly Pro Pro Gly Met Thr Gly Phe Pro Gly Ala Ala Gly 805 810 815Arg Thr Gly Pro Pro Gly Pro Ser Gly Ile Ser Gly Pro Pro Gly Pro 820 825 830Pro Gly Pro Ala Gly Lys Glu Gly Leu Arg Gly Pro Arg Gly Asp Gln 835 840 845Gly Pro Val Gly Arg Thr Gly Glu Val Gly Ala Val Gly Pro Pro Gly 850 855 860Phe Ala Gly Glu Lys Gly Pro Ser Gly Glu Ala Gly Thr Ala Gly Pro865 870 875 880Pro Gly Thr Pro Gly Pro Gln Gly Leu Leu Gly Ala Pro Gly Ile Leu 885 890 895Gly Leu Pro Gly Ser Arg Gly Glu Arg Gly Leu Pro Gly Val Ala Gly 900 905 910Ala Val Gly Glu Pro Gly Pro Leu Gly Ile Ala Gly Pro Pro Gly Ala 915 920 925Arg Gly Pro Pro Gly Ala Val Gly Ser Pro Gly Val Asn Gly Ala Pro 930 935 940Gly Glu Ala Gly Arg Asp Gly Asn Pro Gly Asn Asp Gly Pro Pro Gly945 950 955 960Arg Asp Gly Gln Pro Gly His Lys Gly Glu Arg Gly Tyr Pro Gly Asn 965 970 975Ile Gly Pro Val Gly Ala Ala Gly Ala Pro Gly Pro His Gly Pro Val 980 985 990Gly Pro Ala Gly Lys His Gly Asn Arg Gly Glu Thr Gly Pro Ser Gly 995 1000 1005Pro Val Gly Pro Ala Gly Ala Val Gly Pro Arg Gly Pro Ser Gly 1010 1015 1020Pro Gln Gly Ile Arg Gly Asp Lys Gly Glu Pro Gly Glu Lys Gly 1025 1030 1035Pro Arg Gly Leu Pro Gly Phe Lys Gly His Asn Gly Leu Gln Gly 1040 1045 1050Leu Pro Gly Ile Ala Gly His His Gly Asp Gln Gly Ala Pro Gly 1055 1060 1065Ser Val Gly Pro Ala Gly Pro Arg Gly Pro Ala Gly Pro Ser Gly 1070 1075 1080Pro Ala Gly Lys Asp Gly Arg Thr Gly His Pro Gly Thr Val Gly 1085 1090 1095Pro Ala Gly Ile Arg Gly Pro Gln Gly His Gln Gly Pro Ala Gly 1100 1105 1110Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Val Ser Gly 1115 1120 1125Gly Gly Tyr Asp Phe Gly Tyr Asp Gly Asp Phe Tyr Arg Ala Asp 1130 1135 1140Gln Pro Arg Ser Ala Pro Ser Leu Arg Pro Lys Asp Tyr Glu Val 1145 1150 1155Asp Ala Thr Leu Lys Ser Leu Asn Asn Gln Ile Glu Thr Leu Leu 1160 1165 1170Thr Pro Glu Gly Ser Arg Lys Asn Pro Ala Arg Thr Cys Arg Asp 1175 1180 1185Leu Arg Leu Ser His Pro Glu Trp Ser Ser Gly Tyr Tyr Trp Ile 1190 1195 1200Asp Pro Asn Gln Gly Cys Thr Met Glu Ala Ile Lys Val Tyr Cys 1205 1210 1215Asp Phe Pro Thr Gly Glu Thr Cys Ile Arg Ala Gln Pro Glu Asn 1220 1225 1230Ile Pro Ala Lys Asn Trp Tyr Arg Ser Ser Lys Asp Lys Lys His 1235 1240 1245Val Trp Leu Gly Glu Thr Ile Asn Ala Gly Ser Gln Phe Glu Tyr 1250 1255 1260Asn Val Glu Gly Val Thr Ser Lys Glu Met Ala Thr Gln Leu Ala 1265 1270 1275Phe Met Arg Leu Leu Ala Asn Tyr Ala Ser Gln Asn Ile Thr Tyr 1280 1285 1290His Cys Lys Asn Ser Ile Ala Tyr Met Asp Glu Glu Thr Gly Asn 1295 1300 1305Leu Lys Lys Ala Val Ile Leu Gln Gly Ser Asn Asp Val Glu Leu 1310 1315 1320Val Ala Glu Gly Asn Ser Arg Phe Thr Tyr Thr Val Leu Val Asp 1325 1330 1335Gly Cys Ser Lys Lys Thr Asn Glu Trp Gly Lys Thr Ile Ile Glu 1340 1345 1350Tyr Lys Thr Asn Lys Pro Ser Arg Leu Pro Phe Leu Asp Ile Ala 1355 1360 1365Pro Leu Asp Ile Gly Gly Ala Asp His Glu Phe Phe Val Asp Ile 1370 1375 1380Gly Pro Val Cys Phe Lys 13857127DNAArtificial sequenceSynthetic sequence containing the coding region of the appoplast signal of Arabidopsis thaliana endo-1,4-beta- glucanase and flanking regions 7gccatggcta ggaagtcttt gattttccca gtgattcttc ttgctgtgct tcttttctct 60ccacctattt actctgctgg acacgattat agggatgctc ttaggaagtc atctatggct 120caattgc 1278127DNAArtificial sequenceSynthetic sequence of the appoplast signal of Arabidopsis thaliana endo-1,4-beta-glucanase and flanking regions 8gccatggct agg aag tct ttg att ttc cca gtg att ctt ctt gct gtg ctt 51 Arg Lys Ser Leu Ile Phe Pro Val Ile Leu Leu Ala Val Leu 1 5 10ctt ttc tct cca cct att tac tct gct gga cac gat tat agg gat gct 99Leu Phe Ser Pro Pro Ile Tyr Ser Ala Gly His Asp Tyr Arg Asp Ala15 20 25 30ctt agg aag tca tct atg gct caattgc 127Leu Arg Lys Ser Ser Met Ala 35937PRTArtificial sequenceSynthetic Construct 9Arg Lys Ser Leu Ile Phe Pro Val Ile Leu Leu Ala Val Leu Leu Phe1 5 10 15Ser Pro Pro Ile Tyr Ser Ala Gly His Asp Tyr Arg Asp Ala Leu Arg 20 25 30Lys Ser Ser Met Ala 35101037DNAArtificial sequenceChrysanthemum rbcS1 promoter and 5' UTR 10aaatggcgcg ccaagcttag acaaacaccc cttgttatac aaagaatttc gctttacaaa 60atcaaattcg agaaaataat atatgcacta aataagatca ttcggatcca atctaaccaa 120ttacgatacg ctttgggtac acttgatttt tgtttcagta gttacatata tcttgtttta 180tatgctatct ttaaggatct tcactcaaag actatttgtt gatgttcttg atggggctcg 240gaagatttga tatgatacac tctaatcttt aggagatacc agccaggatt atattcagta 300agacaatcaa attttacgtg ttcaaactcg ttatcttttc atttaatgga tgagccagaa 360tctctataga atgattgcaa tcgagaatat gttcggccga tatccctttg ttggcttcaa 420tattctacat atcacacaag aatcgaccgt attgtaccct ctttccataa aggaacacac 480agtatgcaga tgcttttttc ccacatgcag taacataggt attcaaaaat ggctaaaaga 540agttggataa caaattgaca actatttcca tttctgttat ataaatttca caacacacaa 600aagcccgtaa tcaagagtct gcccatgtac gaaataactt ctattatttg gtattgggcc 660taagcccagc tcagagtacg tgggggtacc acatatagga aggtaacaaa atactgcaag 720atagccccat aacgtaccag cctctcctta ccacgaagag ataagatata agacccaccc 780tgccacgtgt cacatcgtca tggtggttaa tgataaggga ttacatcctt ctatgtttgt 840ggacatgatg catgtaatgt catgagccac atgatccaat ggccacagga acgtaagaat 900gtagatagat ttgattttgt ccgttagata gcaaacaaca ttataaaagg tgtgtatcaa 960tacgaactaa ttcactcatt ggattcatag aagtccattc ctcctaagta tctaaacata 1020tgcaattgtc gactaaa 103711975DNAArtificial sequenceChrysanthemum rbcS1 3'UTR and terminator 11aaaaggatcc gcggccgcat aagttttact atttaccaag acttttgaat attaaccttc 60ttgtaacgag tcggttaaat ttgattgttt agggttttgt attatttttt tttggtcttt 120taattcatca ctttaattcc ctaattgtct gttcatttcg ttgtttgttt ccggatcgat 180aatgaaatgt aagagatatc atatataaat aataaattgt cgtttcatat ttgcaatctt 240tttttacaaa cctttaatta attgtatgta tgacattttc ttcttgttat attaggggga 300aataatgtta aataaaagta caaaataaac tacagtacat cgtactgaat aaattaccta 360gccaaaaagt acacctttcc atatacttcc tacatgaagg cattttcaac attttcaaat 420aaggaatgct acaaccgcat aataacatcc acaaattttt ttataaaata acatgtcaga 480cagtgattga aagattttat tatagtttcg ttatcttctt ttctcattaa gcgaatcact 540acctaacacg tcattttgtg aaatattttt tgaatgtttt tatatagttg tagcattcct 600cttttcaaat tagggtttgt ttgagatagc atttcagccg gttcatacaa cttaaaagca 660tactctaatg ctggaaaaaa gactaaaaaa tcttgtaagt tagcgcagaa tattgaccca 720aattatatac acacatgacc ccatatagag actaattaca cttttaacca ctaataatta 780ttactgtatt ataacatcta ctaattaaac ttgtgagttt ttgctagaat tattatcata 840tatactaaaa ggcaggaacg caaacattgc cccggtactg tagcaactac ggtagacgca 900ttaattgtct atagtggacg cattaattaa ccaaaaccgc ctctttcccc ttcttcttga 960agcttgagct ctttt 975121633DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Prolyl 4-hydroxylase beta subunit and flanking regions 12ctcgagtaaa ccatggctca tgctagggtt ttgcttttgg ctcttgctgt tcttgctact 60gctgctgttg ctgtggcttc ttcttcatct ttcgctgatt ctaacccaat taggccagtg 120actgatagag ctgcttctac tcttgctcaa ttggtcgaca tggatgctcc agaagaggag 180gatcacgttc ttgtgcttag gaagtctaac ttcgctgaag ctcttgctgc tcacaagtac 240cttcttgtgg agttttatgc tccttggtgc

ggacattgca aagctcttgc tccagagtat 300gctaaggctg ctggaaagtt gaaggctgag ggatctgaaa ttaggcttgc taaagtggat 360gctactgagg agtctgatct tgctcaacag tacggagtta ggggataccc aactattaag 420ttcttcagga acggagatac tgcttctcca aaggagtata ctgctggaag ggaggctgat 480gatattgtga actggcttaa gaagagaact ggaccagctg ctactactct tccagatgga 540gctgctgctg aatctcttgt ggagtcatct gaggtggcag tgattggatt cttcaaggat 600gtggagtctg attctgctaa gcagttcctt caagctgctg aggctattga tgatattcca 660ttcggaatta cttctaactc tgatgtgttc tctaagtacc agcttgataa ggatggagtg 720gtgcttttca agaaattcga tgagggaagg aacaatttcg agggagaggt gacaaaggag 780aaccttcttg atttcattaa gcacaaccag cttccacttg tgattgagtt cactgagcag 840actgctccaa agattttcgg aggagagatt aagactcaca ttcttctttt ccttccaaag 900tctgtgtctg attacgatgg aaagttgtct aacttcaaga ctgctgctga gtctttcaag 960ggaaagattc ttttcatttt cattgattct gatcacactg ataaccagag gattcttgag 1020ttcttcggac ttaagaagga agagtgccca gctgttaggc ttattactct tgaggaggag 1080atgactaagt acaagccaga gtctgaagaa cttactgctg agaggattac tgagttctgc 1140cacagattcc ttgagggaaa gattaagcca caccttatgt ctcaagagct tccagaggat 1200tgggataagc agccagttaa ggtgttggtg ggtaaaaact tcgaggatgt ggctttcgat 1260gagaagaaga acgtgttcgt ggagttctac gcaccttggt gtggtcactg taagcagctt 1320gctccaattt gggataagtt gggagagact tacaaggatc acgagaacat tgtgattgct 1380aagatggatt ctactgctaa cgaggtggag gctgttaagg ttcactcttt cccaactttg 1440aagttcttcc cagcttctgc tgataggact gtgattgatt acaacggaga aaggactctt 1500gatggattca agaagttcct tgagtctgga ggacaagatg gagctggaga tgatgatgat 1560cttgaggatt tggaagaagc tgaggagcca gatatggagg aggatgatga tcagaaggct 1620gtgtgatgag ctc 163313537PRTArtificial sequenceSynthetic sequence containing the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Prolyl 4-hydroxylase beta subunit and flanking regions 13Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Val 35 40 45Asp Met Asp Ala Pro Glu Glu Glu Asp His Val Leu Val Leu Arg Lys 50 55 60Ser Asn Phe Ala Glu Ala Leu Ala Ala His Lys Tyr Leu Leu Val Glu65 70 75 80Phe Tyr Ala Pro Trp Cys Gly His Cys Lys Ala Leu Ala Pro Glu Tyr 85 90 95Ala Lys Ala Ala Gly Lys Leu Lys Ala Glu Gly Ser Glu Ile Arg Leu 100 105 110Ala Lys Val Asp Ala Thr Glu Glu Ser Asp Leu Ala Gln Gln Tyr Gly 115 120 125Val Arg Gly Tyr Pro Thr Ile Lys Phe Phe Arg Asn Gly Asp Thr Ala 130 135 140Ser Pro Lys Glu Tyr Thr Ala Gly Arg Glu Ala Asp Asp Ile Val Asn145 150 155 160Trp Leu Lys Lys Arg Thr Gly Pro Ala Ala Thr Thr Leu Pro Asp Gly 165 170 175Ala Ala Ala Glu Ser Leu Val Glu Ser Ser Glu Val Ala Val Ile Gly 180 185 190Phe Phe Lys Asp Val Glu Ser Asp Ser Ala Lys Gln Phe Leu Gln Ala 195 200 205Ala Glu Ala Ile Asp Asp Ile Pro Phe Gly Ile Thr Ser Asn Ser Asp 210 215 220Val Phe Ser Lys Tyr Gln Leu Asp Lys Asp Gly Val Val Leu Phe Lys225 230 235 240Lys Phe Asp Glu Gly Arg Asn Asn Phe Glu Gly Glu Val Thr Lys Glu 245 250 255Asn Leu Leu Asp Phe Ile Lys His Asn Gln Leu Pro Leu Val Ile Glu 260 265 270Phe Thr Glu Gln Thr Ala Pro Lys Ile Phe Gly Gly Glu Ile Lys Thr 275 280 285His Ile Leu Leu Phe Leu Pro Lys Ser Val Ser Asp Tyr Asp Gly Lys 290 295 300Leu Ser Asn Phe Lys Thr Ala Ala Glu Ser Phe Lys Gly Lys Ile Leu305 310 315 320Phe Ile Phe Ile Asp Ser Asp His Thr Asp Asn Gln Arg Ile Leu Glu 325 330 335Phe Phe Gly Leu Lys Lys Glu Glu Cys Pro Ala Val Arg Leu Ile Thr 340 345 350Leu Glu Glu Glu Met Thr Lys Tyr Lys Pro Glu Ser Glu Glu Leu Thr 355 360 365Ala Glu Arg Ile Thr Glu Phe Cys His Arg Phe Leu Glu Gly Lys Ile 370 375 380Lys Pro His Leu Met Ser Gln Glu Leu Pro Glu Asp Trp Asp Lys Gln385 390 395 400Pro Val Lys Val Leu Val Gly Lys Asn Phe Glu Asp Val Ala Phe Asp 405 410 415Glu Lys Lys Asn Val Phe Val Glu Phe Tyr Ala Pro Trp Cys Gly His 420 425 430Cys Lys Gln Leu Ala Pro Ile Trp Asp Lys Leu Gly Glu Thr Tyr Lys 435 440 445Asp His Glu Asn Ile Val Ile Ala Lys Met Asp Ser Thr Ala Asn Glu 450 455 460Val Glu Ala Val Lys Val His Ser Phe Pro Thr Leu Lys Phe Phe Pro465 470 475 480Ala Ser Ala Asp Arg Thr Val Ile Asp Tyr Asn Gly Glu Arg Thr Leu 485 490 495Asp Gly Phe Lys Lys Phe Leu Glu Ser Gly Gly Gln Asp Gly Ala Gly 500 505 510Asp Asp Asp Asp Leu Glu Asp Leu Glu Glu Ala Glu Glu Pro Asp Met 515 520 525Glu Glu Asp Asp Asp Gln Lys Ala Val 530 535141723DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Prolyl 4-hydroxylase alpha-1 subunit and flanking regions 14ctcgagtaaa ccatggctca tgctagggtt ttgcttttgg ctcttgctgt tcttgctact 60gctgctgttg ctgtggcttc ttcttcatct ttcgctgatt ctaacccaat taggccagtg 120actgatagag ctgcttctac tcttgctcaa ttggtcgaca tgcacccagg attcttcact 180tctattggac agatgactga tcttattcac actgagaagg atcttgtgac ttctcttaag 240gattacatta aggctgagga ggataagttg gagcagatta agaagtgggc tgagaagttg 300gataggctta cttctactgc tacaaaagat ccagagggat tcgttggtca tccagtgaac 360gctttcaagt tgatgaagag gcttaacact gagtggagtg agcttgagaa ccttgtgctt 420aaggatatgt ctgatggatt catttctaac cttactattc agaggcagta cttcccaaat 480gatgaggatc aagtgggagc tgctaaggct cttcttaggc ttcaggatac ttacaacctt 540gatactgata caatttctaa gggaaacctt ccaggagtta agcacaagtc tttccttact 600gctgaggatt gcttcgagct tggaaaggtt gcatacactg aggctgatta ctaccacact 660gagctttgga tggaacaagc tcttaggcaa cttgatgagg gagagatttc tactattgat 720aaggtgtcag tgcttgatta cctttcttac gctgtgtacc agcagggtga tcttgataag 780gctcttttgc ttactaagaa gttgcttgag cttgatccag aacatcagag ggctaacgga 840aaccttaagt acttcgagta cattatggct aaggaaaagg atgtgaacaa gtctgcttct 900gatgatcagt ctgatcaaaa gactactcca aagaagaagg gagtggctgt tgattatctt 960cctgagaggc agaagtatga gatgttgtgt aggggagagg gtattaagat gactccaagg 1020aggcagaaga agttgttctg caggtatcac gatggaaaca ggaacccaaa gttcattctt 1080gctccagcta agcaagaaga tgagtgggat aagccaagga ttattaggtt ccacgatatt 1140atttctgatg ctgagattga gattgtgaag gatcttgcta agccaagact taggagggct 1200actatttcta accctattac tggtgatctt gagactgtgc actacaggat ttctaagtct 1260gcttggcttt ctggatacga gaacccagtg gtgtctagga ttaacatgag gattcaggat 1320cttactggac ttgatgtgtc tactgctgag gagcttcaag ttgctaacta cggagttgga 1380ggacaatatg agccacactt cgatttcgct aggaaggatg agccagatgc ttttaaggag 1440cttggaactg gaaacaggat tgctacttgg cttttctaca tgtctgatgt ttctgctgga 1500ggagctactg ttttcccaga agtgggagct tctgtttggc caaagaaggg aactgctgtg 1560ttctggtaca accttttcgc ttctggagag ggagattact ctactaggca tgctgcttgc 1620ccagttcttg ttggaaacaa gtgggtgtca aacaagtggc ttcatgagag gggacaagag 1680tttagaaggc catgcactct ttctgagctt gagtgatgag ctc 172315567PRTArtificial sequenceSynthetic sequence containing the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Prolyl 4-hydroxylase alpha-1 subunit and flanking regions 15Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Val 35 40 45Asp Met His Pro Gly Phe Phe Thr Ser Ile Gly Gln Met Thr Asp Leu 50 55 60Ile His Thr Glu Lys Asp Leu Val Thr Ser Leu Lys Asp Tyr Ile Lys65 70 75 80Ala Glu Glu Asp Lys Leu Glu Gln Ile Lys Lys Trp Ala Glu Lys Leu 85 90 95Asp Arg Leu Thr Ser Thr Ala Thr Lys Asp Pro Glu Gly Phe Val Gly 100 105 110His Pro Val Asn Ala Phe Lys Leu Met Lys Arg Leu Asn Thr Glu Trp 115 120 125Ser Glu Leu Glu Asn Leu Val Leu Lys Asp Met Ser Asp Gly Phe Ile 130 135 140Ser Asn Leu Thr Ile Gln Arg Gln Tyr Phe Pro Asn Asp Glu Asp Gln145 150 155 160Val Gly Ala Ala Lys Ala Leu Leu Arg Leu Gln Asp Thr Tyr Asn Leu 165 170 175Asp Thr Asp Thr Ile Ser Lys Gly Asn Leu Pro Gly Val Lys His Lys 180 185 190Ser Phe Leu Thr Ala Glu Asp Cys Phe Glu Leu Gly Lys Val Ala Tyr 195 200 205Thr Glu Ala Asp Tyr Tyr His Thr Glu Leu Trp Met Glu Gln Ala Leu 210 215 220Arg Gln Leu Asp Glu Gly Glu Ile Ser Thr Ile Asp Lys Val Ser Val225 230 235 240Leu Asp Tyr Leu Ser Tyr Ala Val Tyr Gln Gln Gly Asp Leu Asp Lys 245 250 255Ala Leu Leu Leu Thr Lys Lys Leu Leu Glu Leu Asp Pro Glu His Gln 260 265 270Arg Ala Asn Gly Asn Leu Lys Tyr Phe Glu Tyr Ile Met Ala Lys Glu 275 280 285Lys Asp Val Asn Lys Ser Ala Ser Asp Asp Gln Ser Asp Gln Lys Thr 290 295 300Thr Pro Lys Lys Lys Gly Val Ala Val Asp Tyr Leu Pro Glu Arg Gln305 310 315 320Lys Tyr Glu Met Leu Cys Arg Gly Glu Gly Ile Lys Met Thr Pro Arg 325 330 335Arg Gln Lys Lys Leu Phe Cys Arg Tyr His Asp Gly Asn Arg Asn Pro 340 345 350Lys Phe Ile Leu Ala Pro Ala Lys Gln Glu Asp Glu Trp Asp Lys Pro 355 360 365Arg Ile Ile Arg Phe His Asp Ile Ile Ser Asp Ala Glu Ile Glu Ile 370 375 380Val Lys Asp Leu Ala Lys Pro Arg Leu Arg Arg Ala Thr Ile Ser Asn385 390 395 400Pro Ile Thr Gly Asp Leu Glu Thr Val His Tyr Arg Ile Ser Lys Ser 405 410 415Ala Trp Leu Ser Gly Tyr Glu Asn Pro Val Val Ser Arg Ile Asn Met 420 425 430Arg Ile Gln Asp Leu Thr Gly Leu Asp Val Ser Thr Ala Glu Glu Leu 435 440 445Gln Val Ala Asn Tyr Gly Val Gly Gly Gln Tyr Glu Pro His Phe Asp 450 455 460Phe Ala Arg Lys Asp Glu Pro Asp Ala Phe Lys Glu Leu Gly Thr Gly465 470 475 480Asn Arg Ile Ala Thr Trp Leu Phe Tyr Met Ser Asp Val Ser Ala Gly 485 490 495Gly Ala Thr Val Phe Pro Glu Val Gly Ala Ser Val Trp Pro Lys Lys 500 505 510Gly Thr Ala Val Phe Trp Tyr Asn Leu Phe Ala Ser Gly Glu Gly Asp 515 520 525Tyr Ser Thr Arg His Ala Ala Cys Pro Val Leu Val Gly Asn Lys Trp 530 535 540Val Ser Asn Lys Trp Leu His Glu Arg Gly Gln Glu Phe Arg Arg Pro545 550 555 560Cys Thr Leu Ser Glu Leu Glu 56516928DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the plant Prolyl 4-hydroxylase Plant and flanking regions 16ctcgagtaaa ccatggctca tgctagggtt ttgcttttgg ctcttgctgt tcttgctact 60gctgctgttg ctgtggcttc ttcttcatct ttcgctgatt ctaacccaat taggccagtg 120actgatagag ctgcttctac tcttgctcaa ttggtcgaca tgcttggtat tctttctctt 180ccaaacgcta acaggaactc ttctaagact aacgatctta ctaacattgt gaggaagtct 240gagacttctt ctggagatga ggagggaaat ggagaaagat gggtggaagt gatttcttgg 300gagccaaggg ctgttgttta ccacaacttc cttactaatg aggagtgcga gcaccttatt 360tctcttgcta agccatctat ggtgaagtct actgtggtgg atgagaaaac tggaggatct 420aaggattcaa gagtgaggac ttcatctggt actttcctta ggaggggaca tgatgaagtt 480gtggaagtta ttgagaagag gatttctgat ttcactttca ttccagtgga gaacggagaa 540ggacttcaag ttcttcacta ccaagtggga caaaagtacg agccacacta cgattacttc 600cttgatgagt tcaacactaa gaacggagga cagaggattg ctactgtgct tatgtacctt 660tctgatgtgg atgatggagg agagactgtt tttccagctg ctaggggaaa catttctgct 720gttccttggt ggaacgagct ttctaagtgt ggaaaggagg gactttctgt gcttccaaag 780aaaagggatg ctcttctttt ctggaacatg aggccagatg cttctcttga tccatcttct 840cttcatggag gatgcccagt tgttaaggga aacaagtggt catctactaa gtggttccac 900gtgcacgagt tcaaggtgta atgagctc 92817302PRTArtificial sequenceSynthetic sequence containing the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the plant Prolyl 4-hydroxylase Plant and flanking regions 17Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Val 35 40 45Asp Met Leu Gly Ile Leu Ser Leu Pro Asn Ala Asn Arg Asn Ser Ser 50 55 60Lys Thr Asn Asp Leu Thr Asn Ile Val Arg Lys Ser Glu Thr Ser Ser65 70 75 80Gly Asp Glu Glu Gly Asn Gly Glu Arg Trp Val Glu Val Ile Ser Trp 85 90 95Glu Pro Arg Ala Val Val Tyr His Asn Phe Leu Thr Asn Glu Glu Cys 100 105 110Glu His Leu Ile Ser Leu Ala Lys Pro Ser Met Val Lys Ser Thr Val 115 120 125Val Asp Glu Lys Thr Gly Gly Ser Lys Asp Ser Arg Val Arg Thr Ser 130 135 140Ser Gly Thr Phe Leu Arg Arg Gly His Asp Glu Val Val Glu Val Ile145 150 155 160Glu Lys Arg Ile Ser Asp Phe Thr Phe Ile Pro Val Glu Asn Gly Glu 165 170 175Gly Leu Gln Val Leu His Tyr Gln Val Gly Gln Lys Tyr Glu Pro His 180 185 190Tyr Asp Tyr Phe Leu Asp Glu Phe Asn Thr Lys Asn Gly Gly Gln Arg 195 200 205Ile Ala Thr Val Leu Met Tyr Leu Ser Asp Val Asp Asp Gly Gly Glu 210 215 220Thr Val Phe Pro Ala Ala Arg Gly Asn Ile Ser Ala Val Pro Trp Trp225 230 235 240Asn Glu Leu Ser Lys Cys Gly Lys Glu Gly Leu Ser Val Leu Pro Lys 245 250 255Lys Arg Asp Ala Leu Leu Phe Trp Asn Met Arg Pro Asp Ala Ser Leu 260 265 270Asp Pro Ser Ser Leu His Gly Gly Cys Pro Val Val Lys Gly Asn Lys 275 280 285Trp Ser Ser Thr Lys Trp Phe His Val His Glu Phe Lys Val 290 295 300182689DNAArtificial sequenceSynthetic sequence containing the coding regions of the human Procollagen C-proteinase and flanking regions 18agatctatcg atgcatgcca tggtaccgcg ccatggctca attggctgca acatcaaggc 60ctgaaagagt ttggccagat ggtgttattc ctttcgttat tggtggaaac tttactggat 120ctcagagagc agtttttaga caagctatga gacattggga aaagcacact tgtgtgacat 180tccttgaaag gactgatgaa gattcttata ttgtgttcac ataccgtcca tgtggatgct 240gctcatatgt tggtagaagg ggaggaggtc cacaagcaat ttctattgga aaaaactgcg 300ataagttcgg aattgtggtg catgaattgg gacatgttgt tggtttctgg cacgaacaca 360caaggccaga tagggatagg cacgtgtcta ttgtgaggga aaacattcag ccaggtcaag 420agtacaattt tcttaagatg gaacctcaag aggtggaatc tctcggagag acttacgact 480tcgactccat catgcactac gcaaggaata ctttcagcag gggcatcttc ttggatacca 540ttgtgcctaa gtacgaggtg aacggcgtta agccacctat tggtcaaagg actaggctct 600ctaagggtga tattgcacag gctaggaagc tctacaaatg tccagcatgc ggagaaactc 660ttcaggattc cactggcaac ttctcatctc cagagtaccc aaacggatac tctgctcata 720tgcactgtgt ttggaggatc tcagtgactc ctggagagaa gatcatcctc aacttcactt 780ccctcgatct ctatcgttct aggctctgtt ggtacgacta tgtggaagtg agagatggct 840tctggagaaa ggctccactt agaggaaggt tctgcggatc taaacttcct gagccaatcg 900tgtctactga ttccagattg tgggtggagt tcaggtcctc ttctaattgg gttggcaagg 960gcttttttgc tgtgtacgag gctatttgtg gcggcgacgt gaaaaaggac tacggacata 1020ttcaaagtcc aaattaccca gatgattacc gtccttcaaa agtgtgtatt tggaggattc 1080aagtgagtga gggtttccat gttggattga cattccaatc tttcgaaatt gagagacacg 1140attcatgcgc atacgattat ttggaagtga gagatggaca ctctgaatct tctacactta 1200ttggaaggta ctgcggttat gagaaacctg atgatattaa gtctacttct agtaggttgt 1260ggcttaaatt

tgtgtcagat ggttctatta acaaggctgg tttcgcagtg aacttcttca 1320aggaagtgga tgaatgctca agacctaaca gaggaggatg tgagcaaaga tgccttaaca 1380ctttgggaag ttacaagtgt tcttgcgatc ctggatacga gttggctcct gataagagaa 1440gatgcgaagc tgcttgcggt ggttttttga caaaattgaa cggatctatt acttctcctg 1500gatggccaaa agagtaccca cctaataaga attgcatttg gcagcttgtt gcacctactc 1560agtaccgtat ttcattgcaa ttcgattttt tcgagactga gggtaatgat gtgtgcaagt 1620acgatttcgt ggaagtgaga tcaggtctta ctgctgatag taaattgcac ggaaagttct 1680gcggatctga aaaaccagaa gtgattacat cacagtacaa caatatgagg gtggagttca 1740aatctgataa tactgtttct aaaaaaggtt ttaaggcaca tttcttttct gataaggacg 1800agtgctctaa agataatggt ggttgccagc aggattgcgt gaacacattc ggttcatatg 1860agtgccaatg ccgtagtgga tttgttcttc acgataacaa acatgattgc aaagaggcag 1920gttgcgatca caaggtgaca tctacttcag gtactatcac atctccaaac tggcctgata 1980agtatccttc aaaaaaagaa tgtacatggg caatttcttc tacaccaggt catagggtta 2040agttgacatt catggagatg gatattgaga gtcaaccaga gtgcgcttat gatcatcttg 2100aggtgttcga tggaagggat gctaaggctc ctgttcttgg tagattctgt ggtagtaaaa 2160agccagaacc agtgcttgca acaggatcta ggatgttcct tagattctac tctgataact 2220cagttcagag gaaaggattc caagctagtc acgcaactga atgcggtgga caagttagag 2280cagatgttaa gactaaggat ctttactcac acgcacagtt cggagataac aactaccctg 2340gaggagttga ttgcgagtgg gttattgtgg ctgaagaggg atacggagtt gagcttgttt 2400tccagacatt cgaggtggag gaggaaactg attgcggtta cgattatatg gaactttttg 2460atggatacga tagtactgct ccaagacttg gaaggtattg tggtagtggt ccaccagaag 2520aggtgtactc agctggagat agtgttcttg ttaagttcca cagtgatgat acaattacta 2580agaagggatt ccatcttaga tatacttcaa ctaagtttca ggatactctt cattctagga 2640agtaatgagc tcgcggccgc atccaagctt ctgcagacgc gtcgacgtc 268919870PRTArtificial sequenceSynthetic sequence containing the human Procollagen C-proteinase and flanking regions 19Met Ala Gln Leu Ala Ala Thr Ser Arg Pro Glu Arg Val Trp Pro Asp1 5 10 15Gly Val Ile Pro Phe Val Ile Gly Gly Asn Phe Thr Gly Ser Gln Arg 20 25 30Ala Val Phe Arg Gln Ala Met Arg His Trp Glu Lys His Thr Cys Val 35 40 45Thr Phe Leu Glu Arg Thr Asp Glu Asp Ser Tyr Ile Val Phe Thr Tyr 50 55 60Arg Pro Cys Gly Cys Cys Ser Tyr Val Gly Arg Arg Gly Gly Gly Pro65 70 75 80Gln Ala Ile Ser Ile Gly Lys Asn Cys Asp Lys Phe Gly Ile Val Val 85 90 95His Glu Leu Gly His Val Val Gly Phe Trp His Glu His Thr Arg Pro 100 105 110Asp Arg Asp Arg His Val Ser Ile Val Arg Glu Asn Ile Gln Pro Gly 115 120 125Gln Glu Tyr Asn Phe Leu Lys Met Glu Pro Gln Glu Val Glu Ser Leu 130 135 140Gly Glu Thr Tyr Asp Phe Asp Ser Ile Met His Tyr Ala Arg Asn Thr145 150 155 160Phe Ser Arg Gly Ile Phe Leu Asp Thr Ile Val Pro Lys Tyr Glu Val 165 170 175Asn Gly Val Lys Pro Pro Ile Gly Gln Arg Thr Arg Leu Ser Lys Gly 180 185 190Asp Ile Ala Gln Ala Arg Lys Leu Tyr Lys Cys Pro Ala Cys Gly Glu 195 200 205Thr Leu Gln Asp Ser Thr Gly Asn Phe Ser Ser Pro Glu Tyr Pro Asn 210 215 220Gly Tyr Ser Ala His Met His Cys Val Trp Arg Ile Ser Val Thr Pro225 230 235 240Gly Glu Lys Ile Ile Leu Asn Phe Thr Ser Leu Asp Leu Tyr Arg Ser 245 250 255Arg Leu Cys Trp Tyr Asp Tyr Val Glu Val Arg Asp Gly Phe Trp Arg 260 265 270Lys Ala Pro Leu Arg Gly Arg Phe Cys Gly Ser Lys Leu Pro Glu Pro 275 280 285Ile Val Ser Thr Asp Ser Arg Leu Trp Val Glu Phe Arg Ser Ser Ser 290 295 300Asn Trp Val Gly Lys Gly Phe Phe Ala Val Tyr Glu Ala Ile Cys Gly305 310 315 320Gly Asp Val Lys Lys Asp Tyr Gly His Ile Gln Ser Pro Asn Tyr Pro 325 330 335Asp Asp Tyr Arg Pro Ser Lys Val Cys Ile Trp Arg Ile Gln Val Ser 340 345 350Glu Gly Phe His Val Gly Leu Thr Phe Gln Ser Phe Glu Ile Glu Arg 355 360 365His Asp Ser Cys Ala Tyr Asp Tyr Leu Glu Val Arg Asp Gly His Ser 370 375 380Glu Ser Ser Thr Leu Ile Gly Arg Tyr Cys Gly Tyr Glu Lys Pro Asp385 390 395 400Asp Ile Lys Ser Thr Ser Ser Arg Leu Trp Leu Lys Phe Val Ser Asp 405 410 415Gly Ser Ile Asn Lys Ala Gly Phe Ala Val Asn Phe Phe Lys Glu Val 420 425 430Asp Glu Cys Ser Arg Pro Asn Arg Gly Gly Cys Glu Gln Arg Cys Leu 435 440 445Asn Thr Leu Gly Ser Tyr Lys Cys Ser Cys Asp Pro Gly Tyr Glu Leu 450 455 460Ala Pro Asp Lys Arg Arg Cys Glu Ala Ala Cys Gly Gly Phe Leu Thr465 470 475 480Lys Leu Asn Gly Ser Ile Thr Ser Pro Gly Trp Pro Lys Glu Tyr Pro 485 490 495Pro Asn Lys Asn Cys Ile Trp Gln Leu Val Ala Pro Thr Gln Tyr Arg 500 505 510Ile Ser Leu Gln Phe Asp Phe Phe Glu Thr Glu Gly Asn Asp Val Cys 515 520 525Lys Tyr Asp Phe Val Glu Val Arg Ser Gly Leu Thr Ala Asp Ser Lys 530 535 540Leu His Gly Lys Phe Cys Gly Ser Glu Lys Pro Glu Val Ile Thr Ser545 550 555 560Gln Tyr Asn Asn Met Arg Val Glu Phe Lys Ser Asp Asn Thr Val Ser 565 570 575Lys Lys Gly Phe Lys Ala His Phe Phe Ser Asp Lys Asp Glu Cys Ser 580 585 590Lys Asp Asn Gly Gly Cys Gln Gln Asp Cys Val Asn Thr Phe Gly Ser 595 600 605Tyr Glu Cys Gln Cys Arg Ser Gly Phe Val Leu His Asp Asn Lys His 610 615 620Asp Cys Lys Glu Ala Gly Cys Asp His Lys Val Thr Ser Thr Ser Gly625 630 635 640Thr Ile Thr Ser Pro Asn Trp Pro Asp Lys Tyr Pro Ser Lys Lys Glu 645 650 655Cys Thr Trp Ala Ile Ser Ser Thr Pro Gly His Arg Val Lys Leu Thr 660 665 670Phe Met Glu Met Asp Ile Glu Ser Gln Pro Glu Cys Ala Tyr Asp His 675 680 685Leu Glu Val Phe Asp Gly Arg Asp Ala Lys Ala Pro Val Leu Gly Arg 690 695 700Phe Cys Gly Ser Lys Lys Pro Glu Pro Val Leu Ala Thr Gly Ser Arg705 710 715 720Met Phe Leu Arg Phe Tyr Ser Asp Asn Ser Val Gln Arg Lys Gly Phe 725 730 735Gln Ala Ser His Ala Thr Glu Cys Gly Gly Gln Val Arg Ala Asp Val 740 745 750Lys Thr Lys Asp Leu Tyr Ser His Ala Gln Phe Gly Asp Asn Asn Tyr 755 760 765Pro Gly Gly Val Asp Cys Glu Trp Val Ile Val Ala Glu Glu Gly Tyr 770 775 780Gly Val Glu Leu Val Phe Gln Thr Phe Glu Val Glu Glu Glu Thr Asp785 790 795 800Cys Gly Tyr Asp Tyr Met Glu Leu Phe Asp Gly Tyr Asp Ser Thr Ala 805 810 815Pro Arg Leu Gly Arg Tyr Cys Gly Ser Gly Pro Pro Glu Glu Val Tyr 820 825 830Ser Ala Gly Asp Ser Val Leu Val Lys Phe His Ser Asp Asp Thr Ile 835 840 845Thr Lys Lys Gly Phe His Leu Arg Tyr Thr Ser Thr Lys Phe Gln Asp 850 855 860Thr Leu His Ser Arg Lys865 870202912DNAArtificial sequenceSynthetic sequence containing the coding regions of the human Procollagen I N-proteinase and flanking regions 20gcgccatggc tcaattgagg agaagggcta ggagacacgc agctgatgat gattacaaca 60ttgaagtttt gcttggtgtt gatgatagtg tggtgcaatt ccacggaaaa gagcatgttc 120agaaatatct tttgacactt atgaatattg tgaacgaaat ctaccatgat gagtctttgg 180gagcacacat taacgtggtt cttgtgagga ttattcttct ttcatacggt aaatctatgt 240cacttattga gattggaaac ccttctcagt ctcttgagaa tgtgtgcaga tgggcatacc 300ttcaacagaa gcctgatact ggacacgatg agtatcacga tcacgctatt ttccttacaa 360ggcaggattt cggtccaagt ggaatgcaag gatatgctcc tgttactggt atgtgccacc 420ctgttaggtc ttgtacactt aaccacgagg atggtttttc atctgctttc gtggtggctc 480atgagacagg tcatgttttg ggaatggaac atgatggaca gggtaataga tgtggagatg 540aagtgagact tggttcaatt atggctcctc ttgttcaagc tgcttttcat aggttccact 600ggagtaggtg ttcacagcaa gagttgagta gataccttca ttcttacgat tgcttgcttg 660atgatccatt tgctcatgat tggccagctt tgcctcaact tcctggattg cactactcta 720tgaacgagca gtgcagattt gatttcggtc ttggttacat gatgtgcaca gctttcagga 780ctttcgatcc atgcaaacag ttgtggtgtt cacacccaga taacccatat ttctgtaaaa 840caaaaaaagg tccaccactt gatggtacta tgtgcgcacc tggaaagcac tgcttcaagg 900gacactgcat ttggcttact cctgatattc ttaaaaggga tggatcatgg ggagcttggt 960ctccattcgg aagttgctca agaacttgcg gaacaggtgt taagtttaga actaggcagt 1020gcgataatcc acaccctgct aatggtggta gaacttgctc tggacttgct tacgattttc 1080agttgtgttc taggcaagat tgccctgata gtcttgctga ttttagagaa gagcaatgta 1140gacagtggga tctttacttt gagcacggcg acgctcagca ccactggctt ccacacgagc 1200atagagatgc aaaagaaagg tgtcaccttt attgcgagag tagagagact ggagaggtgg 1260tgtcaatgaa gagaatggtg cacgatggta caaggtgttc ttataaggat gcattctctt 1320tgtgtgtgag gggagattgc aggaaagtgg gttgtgatgg agtgattgga tctagtaagc 1380aagaagataa gtgcggagtg tgcggaggag ataactctca ttgcaaggtt gtgaaaggaa 1440cttttacaag atcaccaaaa aaacacggtt acattaagat gttcgaaatt cctgctggag 1500caaggcattt gcttattcag gaagtggatg caacatctca ccacttggca gtgaaaaacc 1560ttgagactgg aaaattcatt ttgaacgagg agaacgatgt tgatgcatct agtaagactt 1620tcattgcaat gggtgttgaa tgggagtata gggatgagga tggaagggaa acacttcaaa 1680caatgggtcc tcttcatgga acaattactg tgttggtgat tccagtggga gatacaaggg 1740tgtcattgac atacaagtat atgattcacg aggatagtct taacgttgat gataacaacg 1800ttttggaaga agattctgtg gtttacgagt gggctcttaa gaaatggtca ccttgctcta 1860agccatgtgg tggaggaagt cagttcacta agtatggttg taggaggagg cttgatcata 1920agatggttca taggggattt tgcgcagcac ttagtaagcc aaaggcaatt aggagggctt 1980gtaaccctca agaatgctca caaccagttt gggtgacagg agagtgggag ccatgttcac 2040aaacatgcgg aagaactgga atgcaagtta gatcagttag atgcattcaa cctcttcatg 2100ataacactac aagaagtgtg cacgcaaaac actgtaacga tgctaggcca gagagtagaa 2160gagcttgctc tagggaactt tgccctggta gatggagggc aggaccttgg agtcagtgct 2220ctgtgacatg tggaaacggt actcaggaaa gacctgttcc atgtagaact gctgatgata 2280gtttcggaat ttgtcaggag gaaaggccag aaacagctag gacttgtaga cttggacctt 2340gtcctaggaa tatttctgat cctagtaaaa aatcatacgt ggtgcaatgg ttgagtaggc 2400cagatccaga ttcaccaatt aggaagattt cttcaaaagg acactgccag ggtgataaga 2460gtattttctg cagaatggaa gttcttagta ggtactgttc tattccaggt tataacaaac 2520tttcttgtaa gagttgcaac ttgtataaca atcttactaa cgtggagggt agaattgaac 2580ctccaccagg aaagcacaac gatattgatg tgtttatgcc tactcttcct gtgccaacag 2640ttgcaatgga agttagacct tctccatcta ctccacttga ggtgccactt aatgcatcaa 2700gtactaacgc tactgaggat cacccagaga ctaacgcagt tgatgagcct tataagattc 2760acggacttga ggatgaggtt cagccaccaa accttattcc taggaggcca agtccttacg 2820aaaaaactag aaatcagagg attcaggagc ttattgatga gatgaggaaa aaggagatgc 2880ttggaaagtt ctaatgagct cgcggccgca tc 291221962PRTArtificial sequenceSynthetic sequence containing the human Procollagen I N-proteinase and flanking regions 21Met Ala Gln Leu Arg Arg Arg Ala Arg Arg His Ala Ala Asp Asp Asp1 5 10 15Tyr Asn Ile Glu Val Leu Leu Gly Val Asp Asp Ser Val Val Gln Phe 20 25 30His Gly Lys Glu His Val Gln Lys Tyr Leu Leu Thr Leu Met Asn Ile 35 40 45Val Asn Glu Ile Tyr His Asp Glu Ser Leu Gly Ala His Ile Asn Val 50 55 60Val Leu Val Arg Ile Ile Leu Leu Ser Tyr Gly Lys Ser Met Ser Leu65 70 75 80Ile Glu Ile Gly Asn Pro Ser Gln Ser Leu Glu Asn Val Cys Arg Trp 85 90 95Ala Tyr Leu Gln Gln Lys Pro Asp Thr Gly His Asp Glu Tyr His Asp 100 105 110His Ala Ile Phe Leu Thr Arg Gln Asp Phe Gly Pro Ser Gly Met Gln 115 120 125Gly Tyr Ala Pro Val Thr Gly Met Cys His Pro Val Arg Ser Cys Thr 130 135 140Leu Asn His Glu Asp Gly Phe Ser Ser Ala Phe Val Val Ala His Glu145 150 155 160Thr Gly His Val Leu Gly Met Glu His Asp Gly Gln Gly Asn Arg Cys 165 170 175Gly Asp Glu Val Arg Leu Gly Ser Ile Met Ala Pro Leu Val Gln Ala 180 185 190Ala Phe His Arg Phe His Trp Ser Arg Cys Ser Gln Gln Glu Leu Ser 195 200 205Arg Tyr Leu His Ser Tyr Asp Cys Leu Leu Asp Asp Pro Phe Ala His 210 215 220Asp Trp Pro Ala Leu Pro Gln Leu Pro Gly Leu His Tyr Ser Met Asn225 230 235 240Glu Gln Cys Arg Phe Asp Phe Gly Leu Gly Tyr Met Met Cys Thr Ala 245 250 255Phe Arg Thr Phe Asp Pro Cys Lys Gln Leu Trp Cys Ser His Pro Asp 260 265 270Asn Pro Tyr Phe Cys Lys Thr Lys Lys Gly Pro Pro Leu Asp Gly Thr 275 280 285Met Cys Ala Pro Gly Lys His Cys Phe Lys Gly His Cys Ile Trp Leu 290 295 300Thr Pro Asp Ile Leu Lys Arg Asp Gly Ser Trp Gly Ala Trp Ser Pro305 310 315 320Phe Gly Ser Cys Ser Arg Thr Cys Gly Thr Gly Val Lys Phe Arg Thr 325 330 335Arg Gln Cys Asp Asn Pro His Pro Ala Asn Gly Gly Arg Thr Cys Ser 340 345 350Gly Leu Ala Tyr Asp Phe Gln Leu Cys Ser Arg Gln Asp Cys Pro Asp 355 360 365Ser Leu Ala Asp Phe Arg Glu Glu Gln Cys Arg Gln Trp Asp Leu Tyr 370 375 380Phe Glu His Gly Asp Ala Gln His His Trp Leu Pro His Glu His Arg385 390 395 400Asp Ala Lys Glu Arg Cys His Leu Tyr Cys Glu Ser Arg Glu Thr Gly 405 410 415Glu Val Val Ser Met Lys Arg Met Val His Asp Gly Thr Arg Cys Ser 420 425 430Tyr Lys Asp Ala Phe Ser Leu Cys Val Arg Gly Asp Cys Arg Lys Val 435 440 445Gly Cys Asp Gly Val Ile Gly Ser Ser Lys Gln Glu Asp Lys Cys Gly 450 455 460Val Cys Gly Gly Asp Asn Ser His Cys Lys Val Val Lys Gly Thr Phe465 470 475 480Thr Arg Ser Pro Lys Lys His Gly Tyr Ile Lys Met Phe Glu Ile Pro 485 490 495Ala Gly Ala Arg His Leu Leu Ile Gln Glu Val Asp Ala Thr Ser His 500 505 510His Leu Ala Val Lys Asn Leu Glu Thr Gly Lys Phe Ile Leu Asn Glu 515 520 525Glu Asn Asp Val Asp Ala Ser Ser Lys Thr Phe Ile Ala Met Gly Val 530 535 540Glu Trp Glu Tyr Arg Asp Glu Asp Gly Arg Glu Thr Leu Gln Thr Met545 550 555 560Gly Pro Leu His Gly Thr Ile Thr Val Leu Val Ile Pro Val Gly Asp 565 570 575Thr Arg Val Ser Leu Thr Tyr Lys Tyr Met Ile His Glu Asp Ser Leu 580 585 590Asn Val Asp Asp Asn Asn Val Leu Glu Glu Asp Ser Val Val Tyr Glu 595 600 605Trp Ala Leu Lys Lys Trp Ser Pro Cys Ser Lys Pro Cys Gly Gly Gly 610 615 620Ser Gln Phe Thr Lys Tyr Gly Cys Arg Arg Arg Leu Asp His Lys Met625 630 635 640Val His Arg Gly Phe Cys Ala Ala Leu Ser Lys Pro Lys Ala Ile Arg 645 650 655Arg Ala Cys Asn Pro Gln Glu Cys Ser Gln Pro Val Trp Val Thr Gly 660 665 670Glu Trp Glu Pro Cys Ser Gln Thr Cys Gly Arg Thr Gly Met Gln Val 675 680 685Arg Ser Val Arg Cys Ile Gln Pro Leu His Asp Asn Thr Thr Arg Ser 690 695 700Val His Ala Lys His Cys Asn Asp Ala Arg Pro Glu Ser Arg Arg Ala705 710 715 720Cys Ser Arg Glu Leu Cys Pro Gly Arg Trp Arg Ala Gly Pro Trp Ser 725 730 735Gln Cys Ser Val Thr Cys Gly Asn Gly Thr Gln Glu Arg Pro Val Pro 740 745 750Cys Arg Thr Ala Asp Asp Ser Phe Gly Ile Cys Gln Glu Glu Arg Pro 755 760 765Glu Thr Ala Arg Thr Cys Arg Leu Gly Pro Cys Pro Arg Asn Ile Ser 770 775 780Asp Pro Ser Lys Lys Ser Tyr Val Val Gln Trp Leu Ser Arg Pro Asp785 790 795 800Pro Asp Ser Pro Ile Arg Lys Ile Ser Ser Lys Gly His Cys Gln Gly 805 810 815Asp Lys Ser Ile Phe Cys Arg Met Glu Val Leu Ser Arg Tyr Cys Ser 820

825 830Ile Pro Gly Tyr Asn Lys Leu Ser Cys Lys Ser Cys Asn Leu Tyr Asn 835 840 845Asn Leu Thr Asn Val Glu Gly Arg Ile Glu Pro Pro Pro Gly Lys His 850 855 860Asn Asp Ile Asp Val Phe Met Pro Thr Leu Pro Val Pro Thr Val Ala865 870 875 880Met Glu Val Arg Pro Ser Pro Ser Thr Pro Leu Glu Val Pro Leu Asn 885 890 895Ala Ser Ser Thr Asn Ala Thr Glu Asp His Pro Glu Thr Asn Ala Val 900 905 910Asp Glu Pro Tyr Lys Ile His Gly Leu Glu Asp Glu Val Gln Pro Pro 915 920 925Asn Leu Ile Pro Arg Arg Pro Ser Pro Tyr Glu Lys Thr Arg Asn Gln 930 935 940Arg Ile Gln Glu Leu Ile Asp Glu Met Arg Lys Lys Glu Met Leu Gly945 950 955 960Lys Phe222888DNAArtificial sequenceSynthetic sequence containing the coding regions of the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Lysyl hydroxylase 3 and flanking regions 22gcgaattcgc tagctatcac tgaaaagaca gcaagacaat ggtgtctcga tgcaccagaa 60ccacatcttt gcagcagatg tgaagcagcc agagtggtcc acaagacgca ctcagaaaag 120gcatcttcta ccgacacaga aaaagacaac cacagctcat catccaacat gtagactgtc 180gttatgcgtc ggctgaagat aagactgacc ccaggccagc actaaagaag aaataatgca 240agtggtccta gctccacttt agctttaata attatgtttc attattattc tctgcttttg 300ctctctatat aaagagcttg tattttcatt tgaaggcaga ggcgaacaca cacacagaac 360ctccctgctt acaaaccaga tcttaaacca tggctcacgc tagggttttg cttcttgctc 420ttgctgttct tgctactgct gctgttgctg tggcttcttc aagttctttc gctgattcta 480acccaattag gccagtgact gatagagctg cttctactct tgctcaattg agatctatgt 540ctgatagacc aaggggaagg gatccagtta atccagagaa gttgcttgtg attactgtgg 600ctactgctga gactgaagga taccttagat tccttaggag tgctgagttc ttcaactaca 660ctgtgaggac tcttggactt ggagaagaat ggaggggagg agatgttgct agaactgttg 720gaggaggaca gaaagtgaga tggcttaaga aagagatgga gaagtacgct gatagggagg 780atatgattat tatgttcgtg gattcttacg atgtgattct tgctggatct ccaactgagc 840ttttgaagaa attcgttcag tctggatcta ggcttctttt ctctgctgag tctttttgtt 900ggccagaatg gggacttgct gagcaatatc cagaagtggg aactggaaag agattcctta 960actctggagg attcattgga ttcgctacta ctattcacca gattgtgagg cagtggaagt 1020acaaggatga cgatgatgat cagcttttct acactaggct ttaccttgat ccaggactta 1080gggagaagtt gtctcttaac cttgatcaca agtctaggat tttccagaac cttaacggtg 1140ctcttgatga ggttgtgctt aagttcgata ggaacagagt gaggattagg aacgtggctt 1200acgatactct tcctattgtg gtgcatggaa acggaccaac aaaactccag cttaactacc 1260ttggaaacta cgttccaaac ggatggactc cagaaggagg atgtggattc tgcaatcagg 1320ataggagaac tcttccagga ggacaaccac caccaagagt tttccttgct gtgttcgttg 1380aacagccaac tccattcctt ccaagattcc ttcagaggct tcttcttttg gattacccac 1440cagatagggt gacacttttc cttcacaaca acgaggtttt ccacgagcca cacattgctg 1500attcttggcc acagcttcag gatcatttct ctgctgtgaa gttggttggt ccagaagaag 1560ctctttctcc aggagaagct agggatatgg ctatggattt gtgcaggcag gatccagagt 1620gcgagttcta cttctctctt gatgctgatg ctgtgcttac taaccttcag actcttagga 1680ttcttattga ggagaacagg aaagtgattg ctccaatgct ttctaggcac ggaaagttgt 1740ggtctaattt ctggggtgct ctttctcctg atgagtacta cgctagatca gaggactacg 1800tggagcttgt tcagagaaag agagtgggag tttggaacgt tccttatatt tctcaggctt 1860acgtgattag gggagatact cttaggatgg agcttccaca gagggatgtt ttctctggat 1920ctgatactga tccagatatg gctttctgca agtctttcag ggataaggga attttccttc 1980acctttctaa ccagcatgag ttcggaagat tgcttgctac ttcaagatac gatactgagc 2040accttcatcc tgatctttgg cagattttcg ataacccagt ggattggaag gagcagtaca 2100ttcacgagaa ctactctagg gctcttgaag gagaaggaat tgtggagcaa ccatgcccag 2160atgtttactg gttcccactt ctttctgagc aaatgtgcga tgagcttgtt gctgagatgg 2220agcattacgg acaatggagt ggaggtagac atgaggattc taggcttgct ggaggatacg 2280agaacgttcc aactgtggat attcacatga agcaagtggg atacgaggat caatggcttc 2340agcttcttag gacttatgtg ggaccaatga ctgagtctct tttcccagga taccacacta 2400aggctagggc tgttatgaac ttcgttgtga ggtatcgtcc agatgagcaa ccatctctta 2460ggccacacca cgattcttct actttcactc ttaacgtggc tcttaaccac aagggacttg 2520attatgaggg aggaggatgc cgtttcctta gatacgattg cgtgatttct tcaccaagaa 2580agggatgggc tcttcttcat ccaggaaggc ttactcatta ccacgaggga cttccaacta 2640cttggggaac tagatatatt atggtgtctt tcgtggatcc atgactgctt taatgagata 2700tgcgagacgc ctatgatcgc atgatatttg ctttcaattc tgttgtgcac gttgtaaaaa 2760acctgagcat gtgtagctca gatccttacc gccggtttcg gttcattcta atgaatatat 2820cacccgttac tatcgtattt ttatgaataa tattctccgt tcaatttact gattgtccag 2880aattcgcg 288823764PRTArtificial sequenceSynthetic sequence containing the vacuolar signal sequence of barley gene for Thiol protease aleurain precursor fused to the human Lysyl hydroxylase 3 and flanking regions 23Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala Gln Leu Arg 35 40 45Ser Met Ser Asp Arg Pro Arg Gly Arg Asp Pro Val Asn Pro Glu Lys 50 55 60Leu Leu Val Ile Thr Val Ala Thr Ala Glu Thr Glu Gly Tyr Leu Arg65 70 75 80Phe Leu Arg Ser Ala Glu Phe Phe Asn Tyr Thr Val Arg Thr Leu Gly 85 90 95Leu Gly Glu Glu Trp Arg Gly Gly Asp Val Ala Arg Thr Val Gly Gly 100 105 110Gly Gln Lys Val Arg Trp Leu Lys Lys Glu Met Glu Lys Tyr Ala Asp 115 120 125Arg Glu Asp Met Ile Ile Met Phe Val Asp Ser Tyr Asp Val Ile Leu 130 135 140Ala Gly Ser Pro Thr Glu Leu Leu Lys Lys Phe Val Gln Ser Gly Ser145 150 155 160Arg Leu Leu Phe Ser Ala Glu Ser Phe Cys Trp Pro Glu Trp Gly Leu 165 170 175Ala Glu Gln Tyr Pro Glu Val Gly Thr Gly Lys Arg Phe Leu Asn Ser 180 185 190Gly Gly Phe Ile Gly Phe Ala Thr Thr Ile His Gln Ile Val Arg Gln 195 200 205Trp Lys Tyr Lys Asp Asp Asp Asp Asp Gln Leu Phe Tyr Thr Arg Leu 210 215 220Tyr Leu Asp Pro Gly Leu Arg Glu Lys Leu Ser Leu Asn Leu Asp His225 230 235 240Lys Ser Arg Ile Phe Gln Asn Leu Asn Gly Ala Leu Asp Glu Val Val 245 250 255Leu Lys Phe Asp Arg Asn Arg Val Arg Ile Arg Asn Val Ala Tyr Asp 260 265 270Thr Leu Pro Ile Val Val His Gly Asn Gly Pro Thr Lys Leu Gln Leu 275 280 285Asn Tyr Leu Gly Asn Tyr Val Pro Asn Gly Trp Thr Pro Glu Gly Gly 290 295 300Cys Gly Phe Cys Asn Gln Asp Arg Arg Thr Leu Pro Gly Gly Gln Pro305 310 315 320Pro Pro Arg Val Phe Leu Ala Val Phe Val Glu Gln Pro Thr Pro Phe 325 330 335Leu Pro Arg Phe Leu Gln Arg Leu Leu Leu Leu Asp Tyr Pro Pro Asp 340 345 350Arg Val Thr Leu Phe Leu His Asn Asn Glu Val Phe His Glu Pro His 355 360 365Ile Ala Asp Ser Trp Pro Gln Leu Gln Asp His Phe Ser Ala Val Lys 370 375 380Leu Val Gly Pro Glu Glu Ala Leu Ser Pro Gly Glu Ala Arg Asp Met385 390 395 400Ala Met Asp Leu Cys Arg Gln Asp Pro Glu Cys Glu Phe Tyr Phe Ser 405 410 415Leu Asp Ala Asp Ala Val Leu Thr Asn Leu Gln Thr Leu Arg Ile Leu 420 425 430Ile Glu Glu Asn Arg Lys Val Ile Ala Pro Met Leu Ser Arg His Gly 435 440 445Lys Leu Trp Ser Asn Phe Trp Gly Ala Leu Ser Pro Asp Glu Tyr Tyr 450 455 460Ala Arg Ser Glu Asp Tyr Val Glu Leu Val Gln Arg Lys Arg Val Gly465 470 475 480Val Trp Asn Val Pro Tyr Ile Ser Gln Ala Tyr Val Ile Arg Gly Asp 485 490 495Thr Leu Arg Met Glu Leu Pro Gln Arg Asp Val Phe Ser Gly Ser Asp 500 505 510Thr Asp Pro Asp Met Ala Phe Cys Lys Ser Phe Arg Asp Lys Gly Ile 515 520 525Phe Leu His Leu Ser Asn Gln His Glu Phe Gly Arg Leu Leu Ala Thr 530 535 540Ser Arg Tyr Asp Thr Glu His Leu His Pro Asp Leu Trp Gln Ile Phe545 550 555 560Asp Asn Pro Val Asp Trp Lys Glu Gln Tyr Ile His Glu Asn Tyr Ser 565 570 575Arg Ala Leu Glu Gly Glu Gly Ile Val Glu Gln Pro Cys Pro Asp Val 580 585 590Tyr Trp Phe Pro Leu Leu Ser Glu Gln Met Cys Asp Glu Leu Val Ala 595 600 605Glu Met Glu His Tyr Gly Gln Trp Ser Gly Gly Arg His Glu Asp Ser 610 615 620Arg Leu Ala Gly Gly Tyr Glu Asn Val Pro Thr Val Asp Ile His Met625 630 635 640Lys Gln Val Gly Tyr Glu Asp Gln Trp Leu Gln Leu Leu Arg Thr Tyr 645 650 655Val Gly Pro Met Thr Glu Ser Leu Phe Pro Gly Tyr His Thr Lys Ala 660 665 670Arg Ala Val Met Asn Phe Val Val Arg Tyr Arg Pro Asp Glu Gln Pro 675 680 685Ser Leu Arg Pro His His Asp Ser Ser Thr Phe Thr Leu Asn Val Ala 690 695 700Leu Asn His Lys Gly Leu Asp Tyr Glu Gly Gly Gly Cys Arg Phe Leu705 710 715 720Arg Tyr Asp Cys Val Ile Ser Ser Pro Arg Lys Gly Trp Ala Leu Leu 725 730 735His Pro Gly Arg Leu Thr His Tyr His Glu Gly Leu Pro Thr Thr Trp 740 745 750Gly Thr Arg Tyr Ile Met Val Ser Phe Val Asp Pro 755 7602445PRTArtificial sequenceVacuole signal sequence of barley gene for Thiol protease aleurain precursor 24Met Ala His Ala Arg Val Leu Leu Leu Ala Leu Ala Val Leu Ala Thr1 5 10 15Ala Ala Val Ala Val Ala Ser Ser Ser Ser Phe Ala Asp Ser Asn Pro 20 25 30Ile Arg Pro Val Thr Asp Arg Ala Ala Ser Thr Leu Ala 35 40 452524DNAArtificial sequenceSingle strand DNA oligonucleotide 25atcaccagga gaacagggac catc 242629DNAArtificial sequenceSingle strand DNA oligonucleotide 26tccacttcca aatctctatc cctaacaac 292723DNAArtificial sequenceSingle strand DNA oligonucleotide 27aggcattaga ggcgataagg gag 232827DNAArtificial sequenceSingle strand DNA oligonucleotide 28tcaatccaat aatagccact tgaccac 2729102DNAArtificial sequencepBINPLUS multiple cloning site 29atgaccatga ttacgccaag ctggcgcgcc aagcttgcat gcctgcaggt cgactctaga 60ggatccccgg gtaccgagct cgaattctta attaacaatt ca 102

Claims

1. A method of producing collagen in a plant or an isolated plant cell comprising targeting to a vacuole of the plant or the isolated plant cell the collagen alpha 1 chain as set forth in SEQ ID NO: 3 and an exogenous prolyl-4-hydroxylase (P4H) so as to allow hydroxylation of the collagen alpha 1 chain by said exogenous P4H and not by an endogenous P4H of the plant or isolated plant cell, thereby producing the collagen in the plant.

2. The method of claim 1, further comprising expressing an exogenous polypeptide selected from the group consisting of Lysyl hydroxylase (LH), protease N and protease C.

3. The method of claim 1, wherein said exogenous P4H comprises a mammalian P4H.

4. The method of claim 1, wherein the plant is selected from the group consisting of Tobacco, Maize, Alfalfa, Rice, Potato, Soybean, Tomato, Wheat, Barley, Canola, Carrot and Cotton.

5. The method of claim 1, wherein said exogenous P4H is capable of specifically hydroxylating the Y position of Gly-X-Y triplets of said at least one type of said collagen chain.

6. The method of claim 3, wherein said mammalian P4H comprises a human P4H.

7. The method of claim 1, wherein the plant is subjected to a stress condition.

8. The method of claim 7, wherein said stress condition is selected from the group consisting of drought, salinity, injury, cold and spraying with stress inducing compounds.

9. The method of claim 1, further comprising targeting to a vacuole of the plant or the isolated plant cell the collagen alpha 2 chain as set forth in SEQ ID NO: 6 so as to allow hydroxylation of the collagen alpha 2 chain by said exogenous P4H and not by an endogenous P4H of the plant or isolated plant cell.

10. A genetically modified plant or isolated plant cell comprising in a vacuole thereof: (i) at least one type of a collagen chain; and (ii) an exogenous P4H.

11. A method of producing collagen or comprising: (a) providing a plant system comprising: a first genetically modified plant comprising in a vacuole thereof: (i) the collagen alpha 1 chain as set forth in SEQ ID NO: 3; and (ii) an exogenous P4H; and a second genetically modified plant comprising in a vacuole thereof: (i) the collagen alpha 2 chain as set forth in SEQ ID NO: 6; and (ii) an exogenous P4H; (b) crossing said first plant and said second plant; and (c) selecting progeny expressing said collagen alpha 1 chain and said collagen alpha 2 chain thereby producing collagen.

12. The method of claim 11, wherein said exogenous P4H is capable of specifically hydroxylating the Y position of Gly-X-Y triplets of said collagen alpha 1 chain or collagen alpha 2 chain.

13. The method of claim 11, wherein said exogenous P4H is human P4H.

14. A method of producing collagen comprising: (a) providing the plant system comprising: a first genetically modified plant comprising in a vacuole thereof: (i) the collagen alpha 1 chain as set forth in SEQ ID NO: 3; and (ii) the collagen alpha 2 chain as set forth in SEQ ID NO: 6; and a second genetically modified plant comprising in a vacuole thereof an exogenous P4H; and (b) crossing said first plant and said second plant and selecting progeny expressing the collagen alpha 1 chain, the collagen alpha 2 chain and said P4H thereby producing collagen.

Images