Patent application title: FERMENTIVE PRODUCTION OF FOUR CARBON ALCOHOLS
Inventors:
Gail K. Donaldson (Newark, DE, US)
Gail K. Donaldson (Newark, DE, US)
Andrew C. Eliot (Wilmington, DE, US)
Andrew C. Eliot (Wilmington, DE, US)
Vasantha Nagarajan (Wilmington, DE, US)
Charles E. Nakamura (Claymont, DE, US)
Lixuan Lisa Huang (Hockessin, DE, US)
Lixuan Lisa Huang (Hockessin, DE, US)
Assignees:
BUTAMAX(TM) ADVANCED BIOFUELS LLC
IPC8 Class: AC12P716FI
USPC Class:
435160
Class name: Containing hydroxy group acyclic butanol
Publication date: 2012-08-02
Patent application number: 20120196341
Abstract:
Methods for the fermentive production of four carbon alcohols are
provided. Specifically, butanol, preferably 2-butanol is produced by the
fermentive growth of a recombinant bacteria expressing a 2-butanol
biosynthetic pathway. The recombinant microorganisms and methods of the
invention can also be adapted to produce 2-butanone, an intermediate in
the 2-butanol biosynthetic pathways disclosed herein.Claims:
1-16. (canceled)
17. A method for the production of 2-butanol comprising: 1) providing a recombinant microbial host cell comprising at least one DNA molecule encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: i) pyruvate to alpha-acetolactate; ii) alpha-acetolactate to acetoin; iii) acetoin to 3-amino-2-butanol; iv) 3-amino-2-butanol to 3-amino-2-butanol phosphate; v) 3-amino-2-butanol phosphate to 2-butanone; and vi) 2-butanone to 2-butanol; wherein the at least one DNA molecule is heterologous to said microbial host cell; and 2) contacting the host cell of (1) with a fermentable carbon substrate in a fermentation medium under conditions whereby 2-butanol is produced.
18. (canceled)
19. A method according to claim 17 wherein the fermentable carbon substrate is selected from the group consisting of monosaccharides, oligosaccharides, and polysaccharides.
20. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of pyruvate to alpha-acetolactate is acetolactate synthase.
21. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of alpha-acetolactate to acetoin is acetolactate decarboxylase.
22. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of acetoin to 3-amino-2-butanol is acetoin aminase.
23. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of 3-amino-2-butanol to 3-amino-2-butanol phosphate is aminobutanol kinase.
24. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of 3-amino-2-butanol phosphate to 2-butanone is aminobutanol phosphate phospho-lyase.
25. A method according to claim 17 wherein the polypeptide that catalyzes a substrate to product conversion of 2-butanone to 2-butanol is butanol dehydrogenase.
26. A method according to claim 17 wherein the cell is selected from the group consisting of: a bacterium, a cyanobacterium, a filamentous fungus, and a yeast.
27. A method according to claim 26 wherein the cell is a member of a genus selected from the group consisting of Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces.
28. A method according to claim 20 wherein the acetolactate synthase has an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:77, and SEQ ID NO:79 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
29. A method according to claim 21 wherein the acetolactate decarboxylase has an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO: 81, and SEQ ID NO:83 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
30. A method according to claim 22 wherein the acetoin aminase has an amino acid sequence having at least 95% identity to an amino acid sequence as set forth in SEQ ID NO:122 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
31. A method according to claim 23 wherein the aminobutanol kinase has an amino acid sequence having at least 95% identity to an amino acid sequence as set forth in SEQ ID NO:124 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
32. A method according to claim 24 wherein the aminobutanol phosphate phospho-lyase has an amino acid sequence having at least 95% identity to an amino acid sequence as set forth in SEQ ID NO:126 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
33. A method according to claim 25 wherein the butanol dehydrogenase has an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:72, SEQ ID NO:75, and SEQ ID NO:91 based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
34-35. (canceled)
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of and claims priority to U.S. application Ser. No. 11/741,892, filed Apr. 30, 2007, which claims priority under 35 U.S.C. §119 from U.S. Provisional Application Ser. No. 60/796,816, filed May 2, 2006 and U.S. Provisional Application Ser. No. 60/871,156, filed Dec. 21, 2006.
FIELD OF THE INVENTION
[0002] The invention relates to the field of industrial microbiology and the production of alcohols. More specifically, 2-butanol is produced via industrial fermentation of a recombinant microorganism. The recombinant microorganisms and methods of the invention can also be adapted to produce 2-butanone, an intermediate in the 2-butanol biosynthetic pathways disclosed herein.
BACKGROUND OF THE INVENTION
[0003] Butanol is an important industrial chemical, useful as a fuel additive, as a feedstock chemical in the plastics industry, and as a food-grade extractant in the food and flavor industry. Each year 10 to 12 billion pounds of butanol are produced by petrochemical means and the need for this commodity chemical will likely increase. 2-Butanone, also referred to as methyl ethyl ketone (MEK), is a widely used solvent and is the most important commercially produced ketone, after acetone. It is used as a solvent for paints, resins, and adhesives, as well as a selective extractant and activator of oxidative reactions.
[0004] Methods for the chemical synthesis of 2-butanone are known, such as by dehydrogenation of 2-butanol or in a process where liquid butane is catalytically oxidized giving 2-butanone and acetic acid (Ullmann's Encyclopedia of Industrial Chemistry, 6th edition, 2003, Wiley-VCHVerlag GmbH and Co., Weinheim, Germany, Vol. 5, pp. 727-732). 2-Butanone may also be converted chemically to 2-butanol by hydrogenation (Breen et al., J. or Catalysis 236: 270-281 (2005)). Methods for the chemical synthesis of 2-butanol are known, such as n-butene hydration (Ullmann's Encyclopedia of Industrial Chemistry, 6th edition, 2003, Wiley-VCHVerlag GmbH and Co., Weinheim, Germany, Vol. 5, pp. 716-719). These processes use starting materials derived from petrochemicals and are generally expensive, and are not environmentally friendly. The production of 2-butanone and 2-butanol from plant-derived raw materials would minimize greenhouse gas emissions and would represent an advance in the art.
[0005] Methods for producing 2-butanol by biotransformation of other organic chemicals are also known. For example, Stampfer et al. (WO 03/078615) describe the production of secondary alcohols, such as 2-butanol, by the reduction of ketones which is catalyzed by an alcohol dehydrogenase enzyme obtained from Rhodococcus ruber. Similarly, Kojima et al. (EP 0645453) describe a method for preparing secondary alcohols, such as 2-butanol, by reduction of ketones which is catalyzed by a secondary alcohol dehydrogenase enzyme obtained from Candida parapsilosis. Additionally, Kuehnle et al. (EP 1149918) describe a process that produces both 1-butanol and 2-butanol by the oxidation of hydrocarbons by various strains of Rhodococcus ruber. The process favored 1-butanol production with a selectivity of 93.8%.
[0006] The production of 2-butanol by certain strains of Lactobacilli is also known (Speranza et. al. J. Agric. Food Chem. (1997) 45:3476-3480). The 2-butanol is produced by the transformation of meso-2,3-butanediol. The production of 2-butanol from acetolactate and acetoin by these Lactobacilli strains was also demonstrated. However, there have been no reports of a recombinant microorganism designed to produce 2-butanol.
[0007] There is a need, therefore, for environmentally responsible, cost-effective processes for the production of 2-butanol and 2-butanone. The present invention addresses this need through the discovery of recombinant microbial production hosts expressing 2-butanol and 2-butanone biosynthetic pathways.
SUMMARY OF THE INVENTION
[0008] The invention provides a recombinant microorganism having an engineered 2-butanol biosynthetic pathway. Also provided is a recombinant microorganism having an engineered 2-butanone biosynthetic pathway, which is the same as the 2-butanol biosynthetic pathway with omission of the last step. The engineered microorganisms may be used for the commercial production of 2-butanol or 2-butanone.
[0009] Accordingly, the invention provides a recombinant microbial host cell comprising at least one DNA molecule encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: [0010] i) pyruvate to alpha-acetolactate; [0011] ii) alpha-acetolactate to acetoin; [0012] iii) acetoin to 3-amino-2-butanol; [0013] iv) 3-amino-2-butanol to 3-amino-2-butanol phosphate; [0014] v) 3-amino-2-butanol phosphate to 2-butanone; and [0015] vi) 2-butanone to 2-butanol; [0016] wherein the at least one DNA molecule is heterologous to said microbial host cell and wherein said microbial host cell produces 2-butanol.
[0017] Similarly the invention provides a recombinant microbial host cell comprising at least one DNA molecule encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of:
[0018] i) pyruvate to alpha-acetolactate;
[0019] ii) alpha-acetolactate to acetoin;
[0020] iii) acetoin to 3-amino-2-butanol;
[0021] iv) 3-amino-2-butanol to 3-amino-2-butanol phosphate; and
[0022] v) 3-amino-2-butanol phosphate to 2-butanone;
wherein the at least one DNA molecule is heterologous to said microbial host cell and wherein said microbial host cell produces 2-butanone.
[0023] In another embodiment the invention provides a method for the production of 2-butanol comprising: [0024] 1) providing a recombinant microbial host cell comprising at least one DNA molecule encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: [0025] i) pyruvate to alpha-acetolactate; [0026] ii) alpha-acetolactate to acetoin; [0027] iii) acetoin to 3-amino-2-butanol; [0028] iv) 3-amino-2-butanol to 3-amino-2-butanol phosphate; [0029] v) 3-amino-2-butanol phosphate to 2-butanone; and [0030] vi) 2-butanone to 2-butanol; [0031] wherein the at least one DNA molecule is heterologous to said microbial host cell; and [0032] 2) contacting the host cell of (1) with a fermentable carbon substrate in a fermentation medium under conditions whereby 2-butanol is produced.
[0033] Similarly the invention provides a method for the production of 2-butanone comprising: [0034] 1) providing a recombinant microbial host cell comprising at least one DNA molecule encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: [0035] i) pyruvate to alpha-acetolactate; [0036] ii) alpha-acetolactate to acetoin; [0037] iii) acetoin to 3-amino-2-butanol; [0038] iv) 3-amino-2-butanol to 3-amino-2-butanol phosphate; and [0039] v) 3-amino-2-butanol phosphate to 2-butanone; [0040] wherein the at least one DNA molecule is heterologous to said microbial host cell; and [0041] 2) contacting the host cell of (1) with a fermentable carbon substrate in a fermentation medium under conditions whereby 2-butanone is produced.
[0042] In another embodiment the invention provides a 2-butanol or 2-butanone containing fermentation product medium produced by the methods of the invention.
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE DESCRIPTIONS
[0043] The invention can be more fully understood from the following detailed description, FIGURE, and the accompanying sequence descriptions, which form a part of this application.
[0044] FIG. 1 shows four different pathways for biosynthesis of 2-butanone and 2-butanol.
[0045] The following sequences conform with 37 C.F.R. 1.821-1.825 ("Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures--the Sequence Rules") and are consistent with World Intellectual Property Organization (WIPO) Standard ST.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.
TABLE-US-00001 TABLE 1 Summary of Nucleic Acid and Protein SEQ ID Numbers SEQ ID Nucleic SEQ ID Description acid Protein budA, acetolactate decarboxylase from Klebsiella 1 2 pneumoniae ATCC 25955 alsD, acetolactate decarboxylase from Bacillus 80 81 subtilis budA, acetolactate decarboxylase from Klebsiella 82 83 terrigena budB, acetolactate synthase from Klebsiella 3 4 pneumoniae ATCC 25955 alsS, acetolactate synthase from Bacillus subtilis 76 77 budB, acetolactate synthase from Klebsiella 78 79 terrigena budC butanediol dehydrogenase from Klebsiella 5 6 pneumoniae IAM1063 butanediol dehydrogenase from Bacillus cereus 84 85 butanediol dehydrogenase from Bacillus cereus 86 87 butB, butanediol dehydrogenase from Lactococcus 88 89 lactis pddA, butanediol dehydratase alpha subunit from 7 8 Klebsiella oxytoca ATCC 8724 pddB, butanediol dehydratase beta subunit from 9 10 Klebsiella oxytoca ATCC 8724 pddC, butanediol dehydratase gamma subunit from 11 12 Klebsiella oxytoca ATCC 8724 pduC, B12 dependent diol dehydratase large 92 93 subunit from Salmonella typhimurium pduD, B12 dependent diol dehydratase medium 94 95 subunit from Salmonella typhimurium pduE, B12 dependent diol dehydratase small 96 97 subunit from Salmonella typhimurium pduC, B12 dependent diol dehydratase large 98 99 subunit from Lactobacillus collinoides pduD, B12 dependent diol dehydratase medium 100 101 subunit from Lactobacillus collinoides pduE, B12 dependent diol dehydratase small 102 103 subunit from Lactobacillus collinoides pddC, adenosylcobalamin-dependent diol 104 105 dehydratase alpha subunit from Klebsiella pneumoniae pddD, adenosylcobalamin-dependent diol 106 107 dehydratase beta subunit from Klebsiella pneumoniae pddD, adenosylcobalamin-dependent diol 108 109 dehydratase gamma subunit from Klebsiella pneumoniae ddrA, diol dehydratase reactivating factor large 110 111 subunit from Klebsiella oxytoca ddrB, diol dehydratase reactivating factor small 112 113 subunit from Klebsiella oxytoca pduG, diol dehydratase reactivating factor large 114 115 subunit from Salmonella typhimurium pduH, diol dehydratase reactivating factor small 116 117 subunit from Salmonella typhimurium pduG, diol dehydratase reactivating factor large 118 119 subunit from Lactobacillus collinoides pduH, diol dehydratase reactivating factor small 120 121 subunit from Lactobacillus collinoides sadH, butanol dehydrogenase from Rhodococcus 13 14 ruber 219 adhA, butanol dehydrogenase from Pyrococcus 90 91 furiosus chnA, cyclohexanol dehydrogenase from 71 72 Acinteobacter sp. yqhD, butanol dehydrogenase from Escherichia coli 74 75 amine: pyruvate transaminase from Vibrio fluvialis 144 122 (an acetoin aminase) codon opt. Aminobutanol kinase from Erwinia carotovora 123 124 subsp. atroseptica amino alcohol O-phosphate lyase from Erwinia 125 126 carotovora subsp. atroseptica budC, acetoin reductase (butanediol 133 134 dehydrogenase) from Klebsiella terrigena (now Raoultella terrigena) glycerol dehydratase alpha subunit from Klebsiella 145 146 pneumoniae glycerol dehydratase beta subunit from Klebsiella 147 148 pneumoniae glycerol dehydratase gamma subunit from 149 150 Klebsiella pneumoniae glycerol dehydratase reactivase large subunit from 151 152 Klebsiella pneumoniae glycerol dehydratase reactivase small subunit from 153 154 Klebsiella pneumoniae
[0046] SEQ ID NOs:15-65 are the nucleotide sequences of oligonucleotide PCR, cloning, screening, and sequencing primers used in the Examples.
[0047] SEQ ID NO:66 is nucleotide sequence of the deleted region of the yqhD gene in E. coli strain MG1655 ΔyqhCD, described in Example 11.
[0048] SEQ ID NO:67 is the nucleotide sequence of a variant of the glucose isomerase promoter 1.6GI.
[0049] SEQ ID NO:68 is the nucleotide sequence of the 1.5GI promoter.
[0050] SEQ ID NO:69 is the nucleotide sequence of the diol dehydratase operon from Klebsiella oxytoca.
[0051] SEQ ID NO:70 is the nucleotide sequence of the diol dehydratase reactivating factor operon from Klebsiella oxytoca.
[0052] SEQ ID NO:73 is the nucleotide sequence of pDCQ2, which is described in Example 9.
[0053] SEQ ID NOs:127-132 are the nucleotide sequences of additional oligonucleotide PCR and cloning primers used in the Examples.
[0054] SEQ ID NO:155 is a codon optimized coding region for the amino alcohol kinase of Erwinia carotovora subsp. atroseptica.
[0055] SEQ ID NO:156 is a codon optimized coding region for the amino alcohol O-phosphate lyase of Erwinia carotovora subsp. atroseptica.
[0056] SEQ ID NOs:157-163 are the nucleotide sequences of additional oligonucleotide PCR and cloning primers used in the Examples.
[0057] SEQ ID NO:164 is the nucleotide sequence of an operon from Erwinia carotovora subsp. atroseptica.
TABLE-US-00002 TABLE 2 Additional glycerol and diol dehydratase large, medium and small subunits protein aDescription bsubunit SEQ ID Corresponding subunits from same organismc Glycerol dehydratase alpha subunit from Clostridium L 135 pasteurianum Glycerol dehydratase beta subunit from Clostridium M 136 pasteurianum Glycerol dehydratase gamma subunit from Clostridium S 137 pasteurianum Glycerol dehydratase alpha subunit from Escherichia L 138 blattae Glycerol dehydratase beta subunit from Escherichia M 139 blattae Glycerol dehydratase gamma subunit from Escherichia S 140 blattae Glycerol dehydratase alpha subunit from Citrobacter L 141 freundii Glycerol dehydratase beta subunit from Citrobacter M 142 freundii Glycerol dehydratase gamma subunit from Citrobacter S 143 freundii aDescription: from the Genbank annotation of the sequence and may not be correct including the glycerol or diol designation, or may not include subunit information. bSubunit: identified by sequence homology to the large, medium, or small subunit.of the Klebsiella oxytoca enzyme. c Subunts are listed together that are from the same organism and have annotations as the same enzyme, or have Genbank numbers close together indicating proximity in the genome.
DETAILED DESCRIPTION OF THE INVENTION
[0058] The present invention relates to methods for the production of 2-butanol using recombinant microorganisms. The present invention meets a number of commercial and industrial needs. Butanol is an important industrial commodity chemical with a variety of applications, where its potential as a fuel or fuel additive is particularly significant. Although only a four-carbon alcohol, butanol has an energy content similar to that of gasoline and can be blended with any fossil fuel. Butanol is favored as a fuel or fuel additive as it yields only CO2 and little or no SOX or NOX when burned in the standard internal combustion engine. Additionally butanol is less corrosive than ethanol, the most preferred fuel additive to date.
[0059] In addition to its utility as a biofuel or fuel additive, butanol has the potential of impacting hydrogen distribution problems in the emerging fuel cell industry. Fuel cells today are plagued by safety concerns associated with hydrogen transport and distribution. Butanol can be easily reformed for its hydrogen content and can be distributed through existing gas stations in the purity required for either fuel cells or combustion engines in vehicles.
[0060] Finally the present invention produces 2-butanol from plant derived carbon sources, avoiding the negative environmental impact associated with standard petrochemical processes for butanol production.
[0061] The present invention also provides recombinant microorganisms and methods for producing 2-butanone, an intermediate in the 2-butanol biosynthetic pathways disclosed herein. 2-Butanone, also known as methyl ethyl ketone (MEK), is useful as a solvent in paints and other coatings. It is also used in the synthetic rubber industry and in the production of paraffin wax.
[0062] The following definitions and abbreviations are to be used for the interpretation of the claims and the specification.
[0063] The term "invention" or "present invention" as used herein is a non-limiting term and is not intended to refer to any single embodiment of the particular invention but encompasses all possible embodiments as described in the specification and the claims.
[0064] The term "2-butanol biosynthetic pathway" refers to the enzyme pathways to produce 2-butanol from pyruvate.
[0065] The term "2-butanone biosynthetic pathway" refers to the enzyme pathways to produce 2-butanone from pyruvate.
[0066] The term "acetolactate synthase", also known as "acetohydroxy acid synthase", refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of two molecules of pyruvic acid to one molecule of alpha-acetolactate. Acetolactate synthase, known as EC 2.2.1.6 [formerly 4.1.3.18] (Enzyme Nomenclature 1992, Academic Press, San Diego) may be dependent on the cofactor thiamin pyrophosphate for its activity. Suitable acetolactate synthase enzymes are available from a number of sources, for example, Bacillus subtilis [GenBank Nos: AAA22222 NCBI (National Center for Biotechnology Information) amino acid sequence (SEQ ID NO:77), L04470 NCBI nucleotide sequence (SEQ ID NO:76)], Klebsiella terrigena [GenBank Nos: AAA25055 (SEQ ID NO:79), L04507 (SEQ ID NO:78)], and Klebsiella pneumoniae [GenBank Nos: AAA25079 (SEQ ID NO:4), M73842 (SEQ ID NO:3)].
[0067] The term "acetolactate decarboxylase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of alpha-acetolactate to acetoin. Acetolactate decarboxylases are known as EC 4.1.1.5 and are available, for example, from Bacillus subtilis [GenBank Nos: AAA22223 (SEQ ID NO:81), L04470 (SEQ ID NO:80)], Klebsiella terrigena [GenBank Nos: AAA25054 (SEQ ID NO:83), L04507 (SEQ ID NO:82)] and Klebsiella pneumoniae [GenBank Nos: AAU43774 (SEQ ID NO:2), AY722056 (SEQ ID NO:1)].
[0068] The term "acetoin aminase" or "acetoin transaminase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of acetoin to 3-amino-2-butanol. Acetoin aminase may utilize the cofactor pyridoxal 5'-phosphate or NADH (reduced nicotinamide adenine dinucleotide) or NADPH (reduced nicotinamide adenine dinucleotide phosphate). The resulting product may have (R) or (S) stereochemistry at the 3-position. The pyridoxal phosphate-dependent enzyme may use an amino acid such as alanine or glutamate as the amino donor. The NADH- and NADPH-dependent enzymes may use ammonia as a second substrate. A suitable example of an NADH-dependent acetoin aminase, also known as amino alcohol dehydrogenase, is described by Ito et al. (U.S. Pat. No. 6,432,688). An example of a pyridoxal-dependent acetoin aminase is the amine:pyruvate aminotransferase (also called amine:pyruvate transaminase) described by Shin and Kim (J. Org. Chem. 67:2848-2853 (2002)).
[0069] The term "butanol dehydrogenase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the interconversion of 2-butanone and 2-butanol. Butanol dehydrogenases are a subset of a broad family of alcohol dehydrogenases. Butanol dehydrogenase may be NAD- or NADP-dependent. The NAD-dependent enzymes are known as EC 1.1.1.1 and are available, for example, from Rhodococcus ruber [GenBank Nos: CAD36475 (SEQ ID NO:14), AJ491307 (SEQ ID NO:13)]. The NADP-dependent enzymes are known as EC 1.1.1.2 and are available, for example, from Pyrococcus furiosus [GenBank Nos: AAC25556 (SEQ ID NO:91), AF013169 (SEQ ID NO:90)]. Additionally, a butanol dehydrogenase is available from Escherichia coli [GenBank Nos:NP--417484 (SEQ ID NO:75), NC--000913 (SEQ ID NO:74)] and a cyclohexanol dehydrogenase is available from Acinetobacter sp. [GenBank Nos: AAG10026 (SEQ ID NO:72), AF282240 (SEQ ID NO:71)].
[0070] The term "acetoin kinase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of acetoin to phosphoacetoin. Acetoin kinase may utilize ATP (adenosine triphosphate) or phosphoenolpyruvate as the phosphate donor in the reaction. Although there are no reports of enzymes catalyzing this reaction on acetoin, there are enzymes that catalyze the analogous reaction on the similar substrate dihydroxyacetone, for example, enzymes known as EC 2.7.1.29 (Garcia-Alles et al. (2004) Biochemistry 43:13037-13046).
[0071] The term "acetoin phosphate aminase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of phosphoacetoin to 3-amino-2-butanol O-phosphate. Acetoin phosphate aminase may use the cofactor pyridoxal 5'-phosphate, NADH or NADPH. The resulting product may have (R) or (S) stereochemistry at the 3-position. The pyridoxal phosphate-dependent enzyme may use an amino acid such as alanine or glutamate. The NADH- and NADPH-dependent enzymes may use ammonia as a second substrate. Although there are no reports of enzymes catalyzing this reaction on phosphoacetoin, there is a pyridoxal phosphate-dependent enzyme that is proposed to carry out the analogous reaction on the similar substrate serinol phosphate (Yasuta et al. (2001) Appl. Environ. Microbiol. 67:4999-5009).
[0072] The term "aminobutanol phosphate phospho-lyase", also called "amino alcohol O-phosphate lyase", refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of 3-amino-2-butanol O-phosphate to 2-butanone. Aminobutanol phosphate phospho-lyase may utilize the cofactor pyridoxal 5'-phosphate. There are no previous reports of enzymes catalyzing this reaction on aminobutanol phosphate, though there are reports of enzymes that catalyze the analogous reaction on the similar substrate 1-amino-2-propanol phosphate (Jones et al. (1973) Biochem J. 134:167-182). The present invention describes a newly identified aminobutanol phosphate phospho-lyase (SEQ ID NO: 126) from the organism Erwinia carotovora, with the activity demonstrated in Example 15 herein.
[0073] The term "aminobutanol kinase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of 3-amino-2-butanol to 3-amino-2-butanol O-phosphate. Aminobutanol kinase may utilize ATP as the phosphate donor. Although there are no reports of enzymes catalyzing this reaction on 3-amino-2-butanol, there are reports of enzymes that catalyze the analogous reaction on the similar substrates ethanolamine and 1-amino-2-propanol (Jones et al., supra). The present invention describes, in Example 14, an amino alcohol kinase of Erwinia carotovora subsp. atroseptica (SEQ ID NO:124). The term "butanediol dehydrogenase" also known as "acetoin reductase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of acetoin to 2,3-butanediol. Butanediol dehydrogenases are a subset of the broad family of alcohol dehydrogenases. Butanediol dehydrogenase enzymes may have specificity for production of (R)- or (S)-stereochemistry in the alcohol product. (S)-specific butanediol dehydrogenases are known as EC 1.1.1.76 and are available, for example, from Klebsiella pneumoniae (GenBank Nos: BBA13085 (SEQ ID NO:6), D86412 (SEQ ID NO:5)). (R)-specific butanediol dehydrogenases are known as EC 1.1.1.4 and are available, for example, from Bacillus cereus [GenBank Nos. NP--830481 (SEQ ID NO:85), NC--004722 (SEQ ID NO:84); AAP07682 (SEQ ID NO:87), AE017000 (SEQ ID NO:86)], and Lactococcus lactis [GenBank Nos. AAK04995 (SEQ ID NO:89), AE006323 (SEQ ID NO:88)].
[0074] The term "butanediol dehydratase", also known as "diol dehydratase" or "propanediol dehydratase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of 2,3-butanediol to 2-butanone. Butanediol dehydratase may utilize the cofactor adenosyl cobalamin (vitamin B12). Adenosyl cobalamin-dependent enzymes are known as EC 4.2.1.28 and are available, for example, from Klebsiella oxytoca [GenBank Nos: BAA08099 (alpha subunit) (SEQ ID NO:8), D45071 (SEQ ID NO:7); BAA08100 (beta subunit) (SEQ ID NO:10), D45071 (SEQ ID NO:9); and BBA08101 (gamma subunit) (SEQ ID NO:12), D45071 (SEQ ID NO:11) (Note all three subunits are required for activity)], and Klebsiella pneumoniae [GenBank Nos: AAC98384 (alpha subunit) (SEQ ID NO:105), AF102064 (SEQ ID NO:104); GenBank Nos: AAC98385 (beta subunit) (SEQ ID NO:107), AF102064 (SEQ ID NO:106), GenBank Nos: AAC98386 (gamma subunit) SEQ ID NO:109), AF102064 (SEQ ID NO:108)]. Other suitable diol dehydratases include, but are not limited to, B12-dependent diol dehydratases available from Salmonella typhimurium [GenBank Nos: AAB84102 (large subunit) (SEQ ID NO:93), AF026270 (SEQ ID NO:92); GenBank Nos: AAB84103 (medium subunit) (SEQ ID NO:95), AF026270 (SEQ ID NO:94); GenBank Nos: AAB84104 (small subunit) (SEQ ID NO:97), AF026270 (SEQ ID NO:96)]; and Lactobacillus collinoides [GenBank Nos: CAC82541 (large subunit) (SEQ ID NO:99), AJ297723 (SEQ ID NO:98); GenBank Nos: CAC82542 (medium subunit) (SEQ ID NO:101); AJ297723 (SEQ ID NO:100); GenBank Nos: CAD01091 (small subunit) (SEQ ID NO:103), AJ297723 (SEQ ID NO:102)]; and enzymes from Lactobacillus brevis (particularly strains CNRZ 734 and CNRZ 735, Speranza et al., supra), and nucleotide sequences that encode the corresponding enzymes. Methods of diol dehydratase gene isolation are well known in the art (e.g., U.S. Pat. No. 5,686,276).
[0075] The term "glycerol dehydratase" refers to a polypeptide (or polypeptides) having an enzyme activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde. Adenosyl cobalamin-dependent glycerol dehydratases are known as EC 4.2.1.30. The glycerol dehydratases of EC 4.2.1.30 are similar to the diol dehydratases in sequence and in having three subunits. The glycerol dehydratases can also be used to convert 2,3-butanediol to 2-butanone. Some examples of glycerol dehydratases of EC 4.2.1.30 include those from Klebsiella pneumoniae (alpha subunit, SEQ ID NO:145, coding region and SEQ ID NO:146, protein; beta subunit, SEQ ID NO:147, coding region and SEQ ID NO:148, protein; and gamma subunit SEQ ID NO:149, coding region and SEQ ID NO:150, protein); from Clostridium pasteurianum [GenBank Nos: 3360389 (alpha subunit, SEQ ID NO:135), 3360390 (beta subunit, SEQ ID NO:136), and 3360391 (gamma subunit, SEQ ID NO:137)]; from Escherichia blattae [GenBank Nos: 60099613 (alpha subunit, SEQ ID NO:138), 57340191 (beta subunit, SEQ ID NO:139), and 57340192 (gamma subunit, SEQ ID NO:140)]; and from Citrobacter freundii [GenBank Nos: 1169287 (alpha subunit, SEQ ID NO:141), 1229154 (beta subunit, SEQ ID NO:142), and 1229155 (gamma subunit, SEQ ID NO:143)]. Note that all three subunits are required for activity. Additional glycerol dehydratases are listed in Table 2.
[0076] Diol and glycerol dehydratases may undergo suicide inactivation during catalysis. A reactivating factor protein, also referred to herein as "reactivase", can be used to reactivate the inactive enzymes (Mori et al., J. Biol. Chem. 272:32034 (1997)). Preferably, the reactivating factor is obtained from the same source as the diol or glycerol dehydratase used. For example, suitable diol dehydratase reactivating factors are available from Klebsiella oxytoca [GenBank Nos: AAC15871 (large subunit) (SEQ ID NO:111), AF017781 (SEQ ID NO:110); GenBank Nos: AAC15872 (small subunit) (SEQ ID NO:113), AF017781 (SEQ ID NO:112)]; Salmonella typhimurium [GenBank Nos: AAB84105 (large subunit) (SEQ ID NO:115), AF026270 (SEQ ID NO:114), GenBank Nos: AAD39008 (small subunit) (SEQ ID NO:117), AF026270 (SEQ ID NO:116)]; and Lactobacillus collinoides [GenBank Nos: CAD01092 (large subunit) (SEQ ID NO:119), AJ297723 (SEQ ID NO:118); GenBank Nos: CAD01093 (small subunit) (SEQ ID NO:121), AJ297723 (SEQ ID NO:120)]. Both the large and small subunits are required for activity. For example, suitable glycerol dehydratase reactivating factors are available from Klebsiella pneumoniae (large subunit, SEQ ID NO:151, coding region and SEQ ID NO:152, protein;, and small subunit, SEQ ID NO:153, coding region and SEQ ID NO:154, protein).
[0077] The term "a facultative anaerobe" refers to a microorganism that can grow in both aerobic and anaerobic environments.
[0078] The term "carbon substrate" or "fermentable carbon substrate" refers to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.
[0079] The term "gene" refers to a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" or "heterologous" gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A "transgene" is a gene that has been introduced into the genome by a transformation procedure.
[0080] As used herein, an "isolated nucleic acid fragment" or "isolated nucleic acid molecule" or "genetic construct" will be used interchangeably and will mean a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
[0081] A nucleic acid fragment is "hybridizable" to another nucleic acid fragment, such as a cDNA, genomic DNA, or RNA molecule, when a single-stranded form of the nucleic acid fragment can anneal to the other nucleic acid fragment under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989), particularly Chapter 11 and Table 11.1 therein (entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments (such as homologous sequences from distantly related organisms), to highly similar fragments (such as genes that duplicate functional enzymes from closely related organisms). Post-hybridization washes determine stringency conditions. One set of preferred conditions uses a series of washes starting with 6×SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2×SSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2×SSC, 0.5% SDS at 50° C. for 30 min. A more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2×SSC, 0.5% SDS was increased to 60° C. Another preferred set of highly stringent conditions uses two final washes in 0.1×SSC, 0.1% SDS at 65° C. An additional set of stringent conditions include hybridization at 0.1×SSC, 0.1% SDS, 65° C. and washes with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS, for example.
[0082] Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51). For hybridizations with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). In one embodiment the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least about 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.
[0083] A "substantial portion" of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a "substantial portion" of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches the complete amino acid and nucleotide sequence encoding particular proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.
[0084] The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
[0085] The terms "homology" and "homologous" are used interchangeably herein. They refer to nucleic acid fragments wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences.
[0086] Moreover, the skilled artisan recognizes that homologous nucleic acid sequences encompassed by this invention are also defined by their ability to hybridize, under moderately stringent conditions (e.g., 0.5×SSC, 0.1% SDS, 60° C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein.
[0087] "Codon degeneracy" refers to the nature in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
[0088] The term "percent identity", as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); and 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).
[0089] Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the MegAlign® program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences is performed using the "Clustal method of alignment" which encompasses several varieties of the algorithm including the "Clustal V method of alignment" corresponding to the alignment method labeled Clustal V (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the MegAlign® program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a "percent identity" by viewing the "sequence distances" table in the same program. Additionally the "Clustal W method of alignment" is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) and found in the MegAlign® v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). Default parameters for multiple alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs(%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB). After alignment of the sequences using the Clustal W program, it is possible to obtain a "percent identity" by viewing the "sequence distances" table in the same program.
[0090] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, from other species, wherein such polypeptides have the same or similar function or activity. Useful examples of percent identities include, but are not limited to: 24%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 24% to 100% may be useful in describing the present invention, such as 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.
[0091] The term "sequence analysis software" refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. "Sequence analysis software" may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1.) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) Sequencher (Gene Codes Corporation, Ann Arbor, Mich.); and 5.) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified. As used herein "default values" will mean any set of values or parameters that originally load with the software when first initialized.
[0092] As used herein the term "coding sequence" or "CDS" refers to a DNA sequence that codes for a specific amino acid sequence. "Suitable regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.
[0093] The term "promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
[0094] The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
[0095] The term "expression", as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
[0096] As used herein the term "transformation" refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms.
[0097] The terms "plasmid" and "vector" refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell. "Transformation vector" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell.
[0098] As used herein the term "codon degeneracy" refers to the nature in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
[0099] The term "codon-optimized" as it refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA.
[0100] The term "fermentation product medium" refers to a medium in which fermentation has occurred such that product is present in the medium.
[0101] Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter "Maniatis"); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).
The 2-Butanol and 2-Butanone Biosynthetic Pathways
[0102] Carbohydrate utilizing microorganisms employ the Embden-Meyerhof-Parnas (EMP) pathway, the Entner-Doudoroff pathway and the pentose phosphate cycle as the central, metabolic routes to provide energy and cellular precursors for growth and maintenance. These pathways have in common the intermediate glyceraldehyde 3-phosphate, and, ultimately, pyruvate is formed directly or in combination with the EMP pathway. The combined reactions of sugar conversion to pyruvate produce energy (e.g. adenosine 5'-triphosphate, ATP) and reducing equivalents (e.g. reduced nicotinamide adenine dinucleotide, NADH, and reduced nicotinamide adenine dinucleotide phosphate, NADPH). NADH and NADPH must be recycled to their oxidized forms (NAD.sup.+ and NADP.sup.+, respectively). In the presence of inorganic electron acceptors (e.g. O2, NO3.sup.- and SO42-), the reducing equivalents may be used to augment the energy pool; alternatively, a reduced carbon by-product may be formed.
[0103] The invention enables the production of 2-butanone or 2-butanol from carbohydrate sources with recombinant microorganisms by providing a complete biosynthetic pathway from pyruvate to 2-butanone or 2-butanol. Three additional pathways are described. Although 2-butanol is not known to be the major product of any bacterial fermentation, there are a number of possible pathways for the production of 2-butanol via known biochemical reaction types. These pathways are shown in FIG. 1. The letters and roman numerals cited below correspond to the letters and roman numerals in FIG. 1, which are used to depict the conversion steps and products, respectively. As described below, 2-butanone is an intermediate in all of these 2-butanol biosynthetic pathways.
[0104] All of the pathways begin with the initial reaction of two pyruvate molecules to yield alpha-acetolactate (I), shown as the substrate to product conversion (a) in FIG. 1. From alpha-acetolactate, there are 4 possible pathways to 2-butanone (V), referred to herein as 2-butanone biosynthetic pathways: [0105] Pathway 1) I--->II--->III--->IV--->V (substrate to product conversions b, c, d, e); This is the pathway of the present invention. [0106] 2) I--->II--->VII--->IV--->V (substrate to product conversions b, g, h, e) [0107] 3) I--->II--->VIII--->V (substrate to product conversions b, i, j): [0108] 4) I--->IX--->X--->V (substrate to product conversions k, l, m) The 2-butanol biosynthetic pathways conclude with the conversion of 2-butanone (V) to 2-butanol (VI). A detailed discussion of the substrate to product conversions in each pathway is given below.
Pathway 1:
(a) pyruvate to alpha-acetolactate
[0109] The initial step in pathway 1 is the conversion of two molecules of pyruvate to one molecule of alpha-acetolactate (compound I in FIG. 1) and one molecule of carbon dioxide catalyzed by a thiamin pyrophosphate-dependent enzyme. Enzymes catalyzing this substrate to product conversion (generally called either acetolactate synthase or acetohydroxy acid synthase; EC 2.2.1.6 [switched from 4.1.3.18 in 2002]) are well-known, and they participate in the biosynthetic pathway for the proteinogenic amino acids leucine and valine, as well as in the pathway for fermentative production of 2,3-butanediol and acetoin of a number of organisms.
[0110] The skilled person will appreciate that polypeptides having acetolactate synthase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. Some example of suitable acetolactate synthase enzymes are available from a number of sources, for example, Bacillus subtilis [GenBank Nos: AAA22222 NCBI (National Center for Biotechnology Information) amino acid sequence (SEQ ID NO:77), L04470 NCBI nucleotide sequence (SEQ ID NO:76)], Klebsiella terrigena [GenBank Nos: AAA25055 (SEQ ID NO:79), L04507 (SEQ ID NO:78)], and Klebsiella pneumoniae [GenBank Nos: AAA25079 (SEQ ID NO:4), M73842 (SEQ ID NO:3)]. Preferred acetolactate synthase enzymes are those that have at least 80%-85% identity to SEQ ID NO's 4, 77, and 79, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
(b) alpha-acetolactate to acetoin
[0111] Alpha-acetolactate (I) is converted to acetoin (II) by the action of an enzyme such as acetolactate decarboxylase (EC 4.1.1.5). Like acetolactate synthase, this enzyme is thiamin pyrophosphate-dependent and is also involved in the production of 2,3-butanediol and acetoin by a number of organisms. The enzymes from different sources vary quite widely in size (25-50 kilodaltons), oligomerization (dimer-hexamer), localization (intracellular of extracellular), and allosteric regulation (for example, activation by branched-chain amino acids). For the purpose of the present invention, an intracellular location is preferable to extracellular, but other variations are generally acceptable.
[0112] The skilled person will appreciate that polypeptides having acetolactate decarboxylase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. Some example of suitable acetolactate decarboxylase enzymes are available from a number of sources, for example, Bacillus subtilis [GenBank Nos: AAA22223 (SEQ ID NO:81), L04470 (SEQ ID NO:80)], Klebsiella terrigena [GenBank Nos: AAA25054 (SEQ ID NO:83), L04507 (SEQ ID NO:82)] and Klebsiella pneumoniae [GenBank Nos: AAU43774 (SEQ ID NO:2), AY722056 (SEQ ID NO:1)].
[0113] Preferred acetolactate decarboxylase enzymes are those that have at least 80%-85% identity to SEQ ID NO's 2, 81 and 83, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
(c) acetoin to 3-amino-2-butanol
[0114] There are two known types of biochemical reactions that could effect the substrate to product conversion of acetoin (II) to 3-amino-2-butanol (III), specifically, pyridoxal phosphate-dependent transamination utilizing an accessory amino donor and direct reductive amination with ammonia. In the latter case, the reducing equivalents are supplied in the form of a reduced nicotinamide cofactor (either NADH or NADPH). An example of an NADH-dependent enzyme catalyzing this reaction with acetoin as a substrate is reported by Ito et al. (U.S. Pat. No. 6,432,688). Any stereospecificity of this enzyme has not been assessed. An example of a pyridoxal phosphate-dependent transaminase that catalyzes the conversion of acetoin to 3-amino-2-butanol has been reported by Shin and Kim (supra). This enzyme was shown in Example 13 herein to convert both the (R) isomer of acetoin to the (2R,3S) isomer of 3-amino-2-butanol and the (S) isomer of acetoin to the (2S,3S) isomer of 3-amino-2-butanol. Either type of enzyme (i.e., transaminase or reductive aminase) is considered to be an acetoin aminase and may be utilized in the production of 2-butanol. Other enzymes in this group may have different stereospecificities.
[0115] The skilled person will appreciate that polypeptides having acetoin aminase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. One example of this activity has is described herein and is identified as SEQ ID NO:122. Accordingly preferred acetoin aminase enzymes are those that have at least 80%-85% identity to SEQ ID NO:122, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
(d) 3-amino-2-butanol to 3-amino-2-butanol O-phosphate
[0116] There are no enzymes known in the art that catalyze the substrate to product conversion of 3-amino-2-butanol (III) to 3-amino-2-butanol phosphate (IV). However, a few Pseudomonas and Erwinia species have been shown to express an ATP-dependent ethanolamine kinase (EC 2.7.1.82) which allows them to utilize ethanolamine or 1-amino-2-propanol as a nitrogen source (Jones et al. (1973) Biochem. J. 134:167-182). It is likely that this enzyme also has activity towards 3-amino-2-butanol or could be engineered to do so, thereby providing an aminobutanol kinase. The present invention describes in Example 14, a gene of Erwinia carotovora subsp. atroseptica (SEQ ID NO:123) that encodes a protein (SEQ ID NO: 124). This protein has been identified as an amino alcohol kinase. This enzyme may be used to convert 3-amino-2-butanol to 3-amino-2-butanol O-phosphate.
[0117] The skilled person will appreciate that polypeptides having aminobutanol kinase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. One example of this activity has is described herein and is identified as SEQ ID NO:124. Accordingly preferred aminobutanol kinase enzymes are those that have at least 80%-85% identity to SEQ ID NO:124, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
(e) 3-amino-2-butanol phosphate to 2-butanone
[0118] Although there are no enzymes reported to catalyze the substrate to product conversion of 3-amino-2-butanol phosphate (IV) to 2-butanone (V), the substrate is very similar to those utilized by the pyridoxal phosphate-dependent phosphoethanolamine phospho-lyase enzyme, which has been found in a small number of Pseudomonas and Erwinia species. These enzymes have activity towards phosphoethanolamine and both enantiomers of 2-phospho-1-aminopropane (Jones et al. (1973) Biochem. J. 134:167-182), and may also have activity towards 3-amino-2-butanol O-phosphate. Identified herein is a gene of Erwinia carotovora subsp. atroseptica (SEQ ID NO:125) that encodes a protein (SEQ ID NO:126) with homology to class III aminotransferases. Example 15 demonstrates that this enzyme is active on both aminopropanol phosphate and aminobutanol phosphate substrates. The newly identified and characterized enzyme was able to catalyze the conversion of a mixture of (R)-3-amino-(S)-2-butanol and (S)-3-amino-(R)-2-butanol O-phosphate, and a mixture of (R)-3-amino-(R)-2-butanol and (S)-3-amino-(S)-2-butanol O-phosphate to 2-butanone. The newly identified and characterized enzyme was also able to catalyze the conversion of both (R) and (S)-2-amino-1-propanol phosphate to propanone, with a preference for (S)-2-amino-1-propanol phosphate. The highest activity was observed with the proposed natural substrate DL-1-amino-2-propanol phosphate, which was converted to propionaldehyde.
[0119] The skilled person will appreciate that polypeptides having aminobutanol phosphate phospho-lyase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. One example of a suitable aminobutanol phosphate phospho-lyase enzyme is described herein as SEQ ID NO: 126. Accordingly preferred aminobutanol phosphate phospho-lyase enzymes are those that have at least 80%-85% identity to SEQ ID NO's 126, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
(f) 2-butanone to 2-butanol
[0120] The final step in all pathways to produce 2-butanol from pyruvic acid is the reduction of 2-butanone (V) to 2-butanol (VI). This substrate to product conversion is catalyzed by some members of the broad class of alcohol dehydrogenases (types utilizing either NADH or NADPH as a source of hydride, depending on the enzyme) that may be called butanol dehydrogenases. Enzymes of each type that catalyze the reduction of 2-butanone are well known, as described above in the definition for butanol dehydrogenase.
[0121] The skilled person will appreciate that polypeptides having butanol dehydrogenase activity isolated from a variety of sources will be useful in the present invention independent of sequence homology. Some example of suitable butanol dehydrogenase enzymes are available from a number of sources, for example, Rhodococcus ruber [GenBank Nos: CAD36475 (SEQ ID NO:14), AJ491307 (SEQ ID NO:13)]. The NADP-dependent enzymes are known as EC 1.1.1.2 and are available, for example, from Pyrococcus furiosus [GenBank Nos: AAC25556 (SEQ ID NO:91), AF013169 (SEQ ID NO:90)]. Additionally, a butanol dehydrogenase is available from Escherichia coli [GenBank Nos:NP--417484 (SEQ ID NO:75), NC--000913 (SEQ ID NO:74)] and a cyclohexanol dehydrogenase is available from Acinetobacter sp. [GenBank Nos: AAG10026 (SEQ ID NO:72), AF282240 (SEQ ID NO:71)]. Preferred butanol dehydrogenase enzymes are those that have at least 80%-85% identity to SEQ ID NO's 14, 91, 75, and 72, where at least 85%-90% identity is more preferred and where at least 95% identity based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is most preferred.
Pathway 2:
(a) pyruvate to alpha-acetolactate
[0122] This substrate to product conversion is the same as described above for Pathway 1.
(b) alpha-acetolactate to acetoin
[0123] This substrate to product conversion is the same as described above for Pathway 1.
(g) acetoin to phosphoacetoin
[0124] Although enzymes that catalyze the substrate to product conversion of acetoin (II) to phosphoacetoin (VII) have not been described, the structure of the substrate acetoin is very similar to that of dihydroxyacetone, and therefore acetoin may be an acceptable substrate for dihydroxyacetone kinase (EC 2.7.1.29), an enzyme which catalyzes phosphorylation of dihydroxyacetone. Protein engineering techniques for the alteration of substrate specificity of enzymes are well known (Antikainen and Martin (2005) Bioorg. Med. Chem. 13:2701-2716) and may be used to generate an enzyme with the required specificity. In this conversion, the phosphate moiety may be supplied by any high energy biological phosphate donor, with the common substrates being phosphoenolpyruvate (as in the E. coli dihydroxyacetone kinase) and ATP (as in the Citrobacter freundii dihydroxyacetone kinase) (Garcia-Alles et al. (2004) Biochemistry 43:13037-13045).
(h) phosphoacetoin to 3-amino-2-butanol O-phosphate
[0125] Although enzymes that catalyze the substrate to product conversion of phosphoacetoin (VII) to 3-amino-2-butanol O-phosphate (IV) have not been described, the structure of the substrate is very similar to that of dihydroxyacetone phosphate a substrate for the proposed serinol phosphate aminotransferase encoded by the 5' portion of the rtxA gene in some species of Bradyrhizobium (Yasuta et al., supra). Thus a serinol phosphate aminotransferase may be functional in this step.
(e) 3-amino-2-butanol O-phosphate to 2-butanone
[0126] This substrate to product conversion is the same as described above for Pathway 1.
(f) 2-butanone to 2-butanol
[0127] This substrate to product conversion is the same as described above for Pathway 1.
Pathway 3:
(a) pyruvate to alpha-acetolactate
[0128] This substrate to product conversion is the same as described above for Pathway 1. (b) alpha-acetolactate to acetoin:
[0129] This substrate to product conversion is the same as described above for Pathway 1.
(i) acetoin to 2,3-butanediol
[0130] The substrate to product conversion of acetoin (II) to 2,3-butanediol (VIII) may be catalyzed by a butanediol dehydrogenase that may either utilize NADH or NADPH as the source of reducing equivalents when carrying out reductions. Enzymes with activity towards acetoin participate in the pathway for production of 2,3-butanediol in organisms that produce that compound. The reported enzymes (e.g., BudC from Klebsiella pneumoniae (Ui et al. (2004) Letters in Applied Microbiology 39:533-537) generally utilize NADH. Either cofactor is acceptable for use in the production of 2-butanol by this pathway.
(j) 2,3-butanediol to 2-butanone
[0131] The substrate to product conversion of 2,3-butanediol (VIII) to 2-butanone (V) may be catalyzed by diol dehydratase enzymes (EC 4.2.1.28) and glycerol dehydratase enzymes (EC 4.2.1.30). The best characterized diol dehydratase is the coenzyme B12-dependent Klebsiella oxytoca enzyme, but similar enzymes are found in a number of enteric bacteria. The K. oxytoca enzyme has been shown to accept meso-2,3-butanediol as a substrate (Bachovchin et al. (1977) Biochemistry 16:1082-1092), producing the desired product 2-butanone. Example 17 demonstrates that the Klebsiella pneumoniae glycerol dehydratase was able to convert meso-2,3-butanediol to 2-butanone. The three subunits of the Klebsiella pneumoniae glycerol dehydratase (alpha: SEQ ID NO:145 (coding region) and 146 (protein); beta: SEQ ID NO: 147 (coding region) and 148 (protein); and gamma: SEQ ID NO: 149 (coding region) and 150 (protein)) were expressed in conjunction with the two subunits of the Klebsiella pneumoniae glycerol dehydratase reactivase (large subunit, SEQ ID NO: 151 (coding region) and 152 (protein); and small subunit, SEQ ID NO: 153 (coding region) and 154 (protein)) to provide activity.
[0132] There are also reports in the literature of a B12-independent diol dehydratase from Clostridium glycolicum (Hartmanis et al. (1986) Arch. Biochem. Biophys. 245:144-152). This enzyme has activity towards 2,3-butanediol, although this activity is less than 1% of the activity towards ethanediol, but the enzyme may be engineered to improve that activity. A better-characterized B12-independent dehydratase is the glycerol dehydratase from Clostridium butyricum (O'Brien et al. (2004) Biochemistry 43:4635-4645), which has high activity towards 1,2-propanediol as well as glycerol. This enzyme uses S-adenosylmethionine as a source of adenosyl radical. There are no reports of activity towards 2,3-butanediol, but such activity, if not already present, may possibly be engineered.
(f) 2-butanone to 2-butanol
[0133] This substrate to product conversion is the same as described above for Pathway 1.
Pathway 4:
(a) pyruvate to alpha-acetolactate
[0134] This substrate to product conversion is the same as described above for Pathway 1.
(k) alpha-acetolactate to 2,3-dihydroxy-2-methylbutanoic acid
[0135] The substrate to product conversion of acetolactate (I) to 2,3-dihydroxy-2-methylbutanoic acid (IX) is not known in the art. However, the product of this conversion has been reported as a component of fermentation broths (Ziadi et al. (1973) Comptes Rendus des Seances de l'Academie des Sciences, Serie D: Sciences Naturelles 276:965-8), but the mechanism of formation is unknown. The likely mechanism of formation is reduction of acetolactate with NADH or NADPH as the electron donor. To utilize this pathway for production of 2-butanol, an enzyme catalyzing this reaction needs to be identified or engineered. However, the precedent for enzymatic reduction of ketones to alcohols is well established.
(l) 2,3-dihydroxy-2-methylbutanoic acid to 2-hydroxy-2-methyl-3-phosphobutanoic acid
[0136] There are no enzymes known that catalyze the substrate to product conversion of 2,3-dihydroxy-2-methylbutanoic acid (IX) to 2-hydroxy-2-methyl-3-phosphobutanoic acid (X). However, there are a large number of kinases in Nature that possess varying specificity. It is therefore likely that an enzyme could be isolated or engineered with this activity.
(m) 2-hydroxy-2-methyl-3-phosphobutanoic acid to 2-butanone
[0137] There are no known enzymes that catalyze the substrate to product conversion of 2-hydroxy-2-methyl-3-phosphobutanoic acid (X) to 2-butanone (V). The combination of this reaction with the previous one is very similar to the multi-step reaction catalyzed by mevalonate-5-pyrophosphate (M5PP) decarboxylase, which consists of initial phosphorylation of M5PP to 3-phosphomevalonate-5-PP, followed by decarboxylation-dependent elimination of phosphate (Alvear et al. (1982) Biochemistry 21:4646-4650).
(f) 2-butanone to 2-butanol
[0138] This substrate to product conversion is the same as described above for Pathway 1.
[0139] Thus, in providing multiple recombinant pathways from pyruvate to 2-butanol, there exists a number of choices to fulfill the individual conversion steps, and the person of skill in the art will be able to utilize publicly available sequences and sequences disclosed herein to construct the relevant pathways. A listing of a representative number of genes known in the art and useful in the construction of 2-butanol biosynthetic pathways is given above in Tables 1 and 2.
Microbial Hosts for 2-Butanol and 2-Butanone Production
[0140] Microbial hosts for 2-butanol or 2-butanone production may be selected from bacteria, cyanobacteria, filamentous fungi and yeasts. The microbial host used for 2-butanol or 2-butanone production should be tolerant to the product produced, so that the yield is not limited by toxicity of the product to the host. The selection of a microbial host for 2-butanol production is described in detail below. The same criteria apply to the selection of a host for 2-butanone production.
[0141] Microbes that are metabolically active at high titer levels of 2-butanol are not well known in the art. Although butanol-tolerant mutants have been isolated from solventogenic Clostridia, little information is available concerning the butanol tolerance of other potentially useful bacterial strains. Most of the studies on the comparison of alcohol tolerance in bacteria suggest that butanol is more toxic than ethanol (de Cavalho et al., Microsc. Res. Tech. 64:215-22 (2004) and Kabelitz et al., FEMS Microbiol. Lett. 220:223-227 (2003)). Tomas et al. (J. Bacteriol. 186:2006-2018 (2004)) report that the yield of 1-butanol during fermentation in Clostridium acetobutylicum may be limited by butanol toxicity. The primary effect of 1-butanol on Clostridium acetobutylicum is disruption of membrane functions (Hermann et al., Appl. Environ. Microbiol. 50:1238-1243 (1985)).
[0142] The microbial hosts selected for the production of 2-butanol should be tolerant to 2-butanol and should be able to convert carbohydrates to 2-butanol using the introduced biosynthetic pathway. The criteria for selection of suitable microbial hosts include the following: intrinsic tolerance to 2-butanol, high rate of carbohydrate utilization, availability of genetic tools for gene manipulation, and the ability to generate stable chromosomal alterations.
[0143] Suitable host strains with a tolerance for 2-butanol may be identified by screening based on the intrinsic tolerance of the strain. The intrinsic tolerance of microbes to 2-butanol may be measured by determining the concentration of 2-butanol that is responsible for 50% inhibition of the growth rate (IC50) when grown in a minimal medium. The IC50 values may be determined using methods known in the art. For example, the microbes of interest may be grown in the presence of various amounts of 2-butanol and the growth rate monitored by measuring the optical density at 600 nanometers. The doubling time may be calculated from the logarithmic part of the growth curve and used as a measure of the growth rate. The concentration of 2-butanol that produces 50% inhibition of growth may be determined from a graph of the percent inhibition of growth versus the 2-butanol concentration. Preferably, the host strain should have an IC50 for 2-butanol of greater than about 0.5%. More suitable is a host strain with an IC50 for 2-butanol that is greater than about 1.5%. Particularly suitable is a host strain with an IC50 for 2-butanol that is greater than about 2.5%.
[0144] The microbial host for 2-butanol production should also utilize glucose and/or other carbohydrates at a high rate. Most microbes are capable of utilizing carbohydrates. However, certain environmental microbes cannot efficiently use carbohydrates, and therefore would not be suitable hosts.
[0145] The ability to genetically modify the host is essential for the production of any recombinant microorganism. Modes of gene transfer technology that may be used include by electroporation, conjugation, transduction or natural transformation. A broad range of host conjugative plasmids and drug resistance markers are available. The cloning vectors used with an organism are tailored to the host organism based on the nature of antibiotic resistance markers that can function in that host.
[0146] The microbial host also may be manipulated in order to inactivate competing pathways for carbon flow by inactivating various genes. This requires the availability of either transposons or chromosomal integration vectors to direct inactivation. Additionally, production hosts that are amenable to chemical mutagenesis may undergo improvements in intrinsic 2-butanol tolerance through chemical mutagenesis and mutant screening.
[0147] Based on the criteria described above, suitable microbial hosts for the production of 2-butanol and 2-butanone include, but are not limited to, members of the genera Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces. Preferred hosts include: Escherichia coli, Alcaligenes eutrophus, Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, Pediococcus pentosaceus, Pediococcus acidilactici, Bacillus subtilis and Saccharomyces cerevisiae.
Construction of Production Host
[0148] Recombinant organisms containing the necessary genes that encode the enzymatic pathway for the conversion of a fermentable carbon substrate to 2-butanol or 2-butanone may be constructed using techniques well known in the art. In the present invention, genes encoding the enzymes of the 2-butanol biosynthetic Pathway 1: acetolactate synthase, acetolactate decarboxylase, acetoin aminase (or amine:pyruvate transaminase), aminobutanol kinase, aminobutanol O-phosphate lyase and butanol dehydrogenase; or 2-butanone biosynthetic Pathway 1 omitting the butanol dehydrogenase, may be isolated from various sources, as described above.
[0149] Methods of obtaining desired genes from a bacterial genome are common and well known in the art of molecular biology. For example, if the sequence of the gene is known, primers may be designed and the desired sequence amplified using standard primer-directed amplification methods such as polymerase chain reaction (U.S. Pat. No. 4,683,202) to obtain amounts of DNA suitable for cloning into expression vectors. If a gene that is heterologous to a known sequence is to be isolated, suitable genomic libraries may be created by restriction endonuclease digestion and may be screened with probes having complementary sequence to the desired gene sequence. Once the sequence is isolated, the DNA may be amplified using standard primer-directed amplification methods such as polymerase chain reaction (U.S. Pat. No. 4,683,202) to obtain amounts of DNA suitable for cloning into expression vectors, which are then transformed into appropriate host cells.
[0150] In addition, given the amino acid sequence of a protein with desired enzymatic activity, the coding sequence may be ascertained by reverse translating the protein sequence. A DNA fragment containing the coding sequence may be prepared synthetically and cloned into an expression vector, then transformed into the desired host cell.
[0151] In preparing a synthetic DNA fragment containing a coding sequence, this sequence may be optimized for expression in the target host cell. Tools for codon optimization for expression in a heterologous host are readily available. Some tools for codon optimization are available based on the GC content of the host organism. The GC contents of some exemplary microbial hosts are given Table 3.
TABLE-US-00003 TABLE 3 GC Contents of Microbial Hosts Strain % GC B. licheniformis 46 B. subtilis 42 C. acetobutylicum 37 E. colt 50 P. putida 61 A. eutrophus 61 Paenibacillus macerans 51 Rhodococcus erythropolis 62 Brevibacillus 50 Paenibacillus polymyxa 50
[0152] Once the relevant pathway genes are identified and isolated they may be transformed into suitable expression hosts by means well known in the art. Vectors useful for the transformation of a variety of host cells are common and commercially available from companies such as EPICENTRE® (Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), Stratagene (La Jolla, Calif.), and New England Biolabs, Inc. (Beverly, Mass.). Typically the vector contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. In addition, suitable vectors comprise a promoter region which harbors transcriptional initiation controls and a transcriptional termination control region, between which a coding region DNA fragment may be inserted, to provide expression of the inserted coding region. Both control regions may be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions may also be derived from genes that are not native to the specific species chosen as a production host.
[0153] Initiation control regions or promoters, which are useful to drive expression of the relevant pathway coding regions in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genetic elements is suitable for the present invention including, but not limited to, promoters derived from the following genes: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI, CUP1, FBA, GPD, and GPM (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); as well as the lac, ara, tet, trp, IPL, IPR, T7, tac, and trc promoters (useful for expression in Escherichia coli, Alcaligenes, and Pseudomonas); the amy, apr, and npr promoters, and various phage promoters useful for expression in Bacillus subtilis, Bacillus licheniformis, and Paenibacillus macerans; nisA (useful for expression Gram-positive bacteria, Eichenbaum et al. Appl. Environ. Microbiol. 64(8):2763-2769 (1998)); and the synthetic P11 promoter (useful for expression in Lactobacillus plantarum, Rud et al., Microbiology 152:1011-1019 (2006)).
[0154] Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included.
[0155] Certain vectors are capable of replicating in a broad range of host bacteria and can be transferred by conjugation. The complete and annotated sequence of pRK404 and three related vectors: pRK437, pRK442, and pRK442(H), are available. These derivatives have proven to be valuable tools for genetic manipulation in Gram-negative bacteria (Scott et al., Plasmid 50(1):74-79 (2003)). Several plasmid derivatives of broad-host-range Inc P4 plasmid RSF1010 are also available with promoters that can function in a range of Gram-negative bacteria. Plasmid pAYC36 and pAYC37, have active promoters along with multiple cloning sites to allow for heterologous gene expression in Gram-negative bacteria.
[0156] Chromosomal gene replacement tools are also widely available. For example, a thermosensitive variant of the broad-host-range replicon pWV101 has been modified to construct a plasmid pVE6002 which can be used to effect gene replacement in a range of Gram-positive bacteria (Maguin et al., J. Bacteriol. 174(17):5633-5638 (1992)). Additionally, in vitro transposomes are available from commercial sources such as EPICENTRE® to create random mutations in a variety of genomes.
[0157] The expression of a 2-butanol biosynthetic pathway in various preferred microbial hosts is described in more detail below. For the expression of a 2-butanone biosynthetic pathway, the same description applies, but the final substrate to product conversion of 2-butanone to 2-butanol is omitted.
[0158] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in E. Coli
[0159] Vectors useful for the transformation of E. coli are common and commercially available from the companies listed above. For example, the genes of a 2-butanol biosynthetic pathway may be isolated from various sources, as described above, cloned onto a modified pUC19 vector and transformed into E. coli NM522, as described in Examples 6 and 7. Alternatively, the genes encoding a 2-butanol biosynthetic pathway may be divided into multiple operons, cloned onto expression vectors, and transformed into various E. coli strains, as described in Examples 9, 10, and 11. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0160] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Rhodococcus Erythropolis
[0161] A series of E. coli-Rhodococcus shuttle vectors are available for expression in R. erythropolis, including, but not limited to pRhBR17 and pDA71 (Kostichka et al., Appl. Microbiol. Biotechnol. 62:61-68 (2003)). Additionally, a series of promoters are available for heterologous gene expression in R. erythropolis (see for example Nakashima et al., Appl. Environ. Microbiol. 70:5557-5568 (2004), and Tao et al., Appl. Microbiol. Biotechnol. 2005, DOI 10.1007/s00253-005-0064). Targeted gene disruptions in chromosomal genes of R. erythropolis may be created using the methods described by Tao et al., supra, and Brans et al. (Appl. Envion. Microbiol. 66: 2029-2036 (2000)).
[0162] The heterologous genes required for the production of 2-butanol, as described above, may be cloned initially in pDA71 or pRhBR71 and transformed into E. coli. The vectors may then be transformed into R. erythropolis by electroporation, as described by Kostichka et al., supra. The recombinants may be grown in synthetic medium containing glucose and the production of 2-butanol can be followed using fermentation methods known in the art. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0163] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in B. Subtilis
[0164] Methods for gene expression and creation of mutations in B. subtilis are also well known in the art. For example, the genes of a 2-butanol biosynthetic pathway may be isolated from various sources, as described above, cloned into a modified E. coli-Bacillus shuttle vector and transformed into Bacillus subtilis BE1010, as described in Example 8, The desired genes may be cloned into a Bacillus expression vector and transformed into a strain to make a production host. Alternatively, the genes may be integrated into the Bacillus chromosome using conditional replicons or suicide vectors that are known to one skilled in the art. For example, the Bacillus Genetic Stock Center carries numerous integration vectors. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0165] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in B. Licheniformis
[0166] Most of the plasmids and shuttle vectors that replicate in B. subtilis may be used to transform B. licheniformis by either protoplast transformation or electroporation. The genes required for the production of 2-butanol may be cloned in plasmids pBE20 or pBE60 derivatives (Nagarajan et al., Gene 114:121-126 (1992)). Methods to transform B. licheniformis are known in the art (for example see Fleming et al. Appl. Environ. Microbiol., 61(11):3775-3780 (1995)). The plasmids constructed for expression in B. subtilis may be transformed into B. licheniformis to produce a recombinant microbial host that produces 2-butanol. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0167] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Paenibacillus Macerans
[0168] Plasmids may be constructed as described above for expression in B. subtilis and used to transform Paenibacillus macerans by protoplast transformation to produce a recombinant microbial host that produces 2-butanol. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0169] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Alcaligenes (Ralstonia) Eutrophus
[0170] Methods for gene expression and creation of mutations in Alcaligenes eutrophus are known in the art (see for example Taghavi et al., Appl. Environ. Microbiol., 60(10):3585-3591 (1994)). The genes for a 2-butanol biosynthetic pathway may be cloned in any of the broad host range vectors described above, and electroporated into Alcaligenes eutrophus to generate recombinants that produce 2-butanol. The poly(hydroxybutyrate) pathway in Alcaligenes has been described in detail, a variety of genetic techniques to modify the Alcaligenes eutrophus genome are known, and those tools can be applied for engineering a 2-butanol biosynthetic pathway. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0171] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Pseudomonas Putida
[0172] Methods for gene expression in Pseudomonas putida are known in the art (see for example Ben-Bassat et al., U.S. Pat. No. 6,586,229, which is incorporated herein by reference). The genes of a 2-butanol biosynthetic pathway may be inserted into pPCU18, and this ligated DNA may be electroporated into electrocompetent Pseudomonas putida DOT-T1 C5aAR1 cells to generate recombinants that produce 2-butanol. The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0173] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Lactobacillus Plantarum
[0174] The Lactobacillus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Bacillus subtilis and Streptococcus may be used for Lactobacillus. Non-limiting examples of suitable vectors include pAMβ1 and derivatives thereof (Renault et al., Gene 183:175-182 (1996); and O'Sullivan et al., Gene 137:227-231 (1993)); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al. Appl. Environ. Microbiol. 62:1481-1486 (1996)); pMG1, a conjugative plasmid (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002)); pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 63:4581-4584 (1997)); pAM401 (Fujimoto et al., Appl. Environ. Microbiol. 67:1262-1267 (2001)); and pAT392 (Arthur et al., Antimicrob. Agents Chemother. 38:1899-1903 (1994)). Several plasmids from Lactobacillus plantarum have also been reported (van Kranenburg et al., Appl. Environ. Microbiol. 71(3):1223-1230 (2005)).
[0175] The various genes for a 2-butanol biosynthetic pathway may be assembled into any suitable vector, such as those described above. The codons can be optimized for expression based on the codon index deduced from the genome sequences of Lactobacillus plantarum or Lactobacillus arizonensis. The plasmids may be introduced into the host cell using methods known in the art, such as electroporation (Cruz-Rodz et al. Molecular Genetics and Genomics 224:1252-154 (1990), Bringel, et al. Appl. Microbiol. Biotechnol. 33: 664-670 (1990), Alegre et al., FEMS Microbiology letters 241:73-77 (2004)), and conjugation (Shrago et al., Appl. Environ. Microbiol. 52:574-576 (1986)). The 2-butanol biosynthetic pathway genes can also be integrated into the chromosome of Lactobacillus using integration vectors (Hols et al., Appl. Environ. Microbiol. 60:1401-1403 (1990), Jang et al., Micro. Lett. 24:191-195 (2003)). The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0176] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Enterococcus faecium, Enterococcus gallinarium, and Enterococcus faecalis
[0177] The Enterococcus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Lactobacillus, Bacillus subtilis, and Streptococcus, described above, may be used for Enterococcus. Expression vectors for E. faecalis using the nisA gene from Lactococcus may also be used (Eichenbaum et al., Appl. Environ. Microbiol. 64:2763-2769 (1998). Additionally, vectors for gene replacement in the E. faecium chromosome may be used (Nallaapareddy et al., Appl. Environ. Microbiol. 72:334-345 (2006)).
[0178] The various genes for a 2-butanol biosynthetic pathway may be assembled into any suitable vector, such as those described above. The codons can be optimized for expression based on the codon index deduced from the genome sequences of Enterococcus faecalis or Enterococcus faecium. The plasmids may be introduced into the host cell using methods known in the art, such as electroporation, as described by Cruz-Rodz et al. (Molecular Genetics and Genomics 224:1252-154 (1990)) or conjugation, as described by Tanimoto et al. (J. Bacteriol. 184:5800-5804 (2002)) and Grohamann et al. (Microbiol. Mol. Biol. Rev. 67:277-301 (2003)). The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
[0179] Expression of a 2-Butanol or 2-Butanone Biosynthetic Pathway in Pediococcus Pentosaceus and Pediococcus Acidilactici,
[0180] The Pediococcus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Bacillus subtilis and Streptococcus, described above, may be used for Pediococcus. A non-limiting example of a suitable vector is pHPS9 (Bukhtiyarova et al. Appl. Environ. Microbiol. 60:3405-3408 (1994)). Several plasmids from Pediococcus have also been reported (Alegre et al., FEMS Microbiol. Lett. 250:151-156 (2005); Shareck et al. Crit. Rev Biotechnol. 24:155-208 (2004)).
[0181] The genes for a 2-butanol biosynthetic pathway may be assembled into any suitable vector, such as those described above. The codons can be optimized for expression based on the codon index deduced from the genome sequence of Pediococcus pentosaceus. The plasmids may be introduced into the host cell using methods known in the art, such as electroporation (see for example, Osmanagaoglu et al., J. Basic Microbiol. 40:233-241 (2000); Alegre et al., FEMS Microbiol. Lett. 250:151-156 (2005)) and conjugation (Gonzalez and Kunka, Appl. Environ. Microbiol. 46:81-89 (1983)). The 2-butanol biosynthetic pathway genes can also be integrated into the chromosome of Pediococcus using integration vectors (Davidson et al. Antonie van Leeuwenhoek 70:161-183 (1996)). The 2-butanone biosynthesis pathway may be similarly expressed, omitting the butanol dehydrogenase.
Fermentation Media
[0182] Fermentation media in the present invention must contain suitable carbon substrates. Suitable substrates may include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeasts are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1-Compd., [Int. Symp.], 7th (1993), 415-32, Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol. 153:485-489 (1990)). Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism.
[0183] Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention, preferred carbon substrates are glucose, fructose, and sucrose, as well as mixtures of any of these sugars. Sucrose may be obtained from feedstocks such as sugar cane, sugar beets, cassaya, and sweet sorghum. Glucose and dextrose may be obtained through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, and oats.
[0184] In addition, fermentable sugars may be obtained from cellulosic and lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in co-owned and co-pending US patent application US20070031918A1, which is herein incorporated by reference. Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass may also comprise additional components, such as protein and/or lipid. Biomass may be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass could comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves. Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste. Examples of biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure.
[0185] In addition to an appropriate carbon source, fermentation media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of an enzymatic pathway necessary for 2-butanol or 2-butanone production.
Culture Conditions
[0186] Typically cells are grown at a temperature in the range of about 25° C. to about 40° C. in an appropriate medium. Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast Medium (YM) broth. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or fermentation science. The use of agents known to modulate catabolite repression directly or indirectly, e.g., cyclic adenosine 2':3'-monophosphate, may also be incorporated into the fermentation medium.
[0187] Suitable pH ranges for the fermentation are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is preferred as the initial condition.
[0188] Fermentations may be performed under aerobic or anaerobic conditions, where anaerobic or microaerobic conditions are preferred.
Industrial Batch and Continuous Fermentations
[0189] The present process employs a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired organism or organisms, and fermentation is permitted to occur without adding anything to the system. Typically, however, a "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.
[0190] A variation on the standard batch system is the fed-batch system. Fed-batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Batch and fed-batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36:227, (1992), herein incorporated by reference.
[0191] Although the present invention is performed in batch mode it is contemplated that the method would be adaptable to continuous fermentation methods. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density.
[0192] Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by the turbidity of the culture medium, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to the medium being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
[0193] It is contemplated that the present invention may be practiced using either batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells may be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for 2-butanol or 2-butanone production.
Methods for 2-Butanol and 2-Butanone Isolation from the Fermentation Medium
[0194] The bioproduced 2-butanol may be isolated from the fermentation medium using methods known in the art for ABE fermentations (see for example, Durre, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot et al., Process Biochem. 27:61-75 (1992), and references therein). For example, solids may be removed from the fermentation medium by centrifugation, filtration, decantation, or the like. Then, the 2-butanol may be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation. These same methods may be adapted to isolate bioproduced 2-butanone from the fermentation medium.
EXAMPLES
[0195] The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating a preferred embodiment of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and, without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions.
General Methods
[0196] Standard recombinant DNA and molecular cloning techniques described in the Examples are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., (1989) (Maniatis) and by T. J. Silhavy, M. L. Bennan, and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987).
[0197] Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following Examples may be found as set out in Manual of Methods for General Bacteriology (Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds), American Society for Microbiology, Washington, D.C. (1994)) or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, Mass. (1989). All reagents, restriction enzymes and materials described for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wis.), BD Diagnostic Systems (Sparks, Md.), Life Technologies (Rockville, Md.), or Sigma Chemical Company (St. Louis, Mo.) unless otherwise specified. Bacterial strains are obtained from the American Type Culture Collection (ATCC, Manassas, Va.) unless otherwise noted.
Oligonucleotide Primers Described in the Following Examples are Given in Table 4. all Oligonucleotide Primers were Synthesized by Sigma-Genosys (Woodlands, Tex.).
TABLE-US-00004 [0198] TABLE 4 Cloning and Screening Primers Primer SEQ ID Gene Name Sequence NO: Description budB B1 CACCATGGACAAACAGTA 15 budB TCCGGTACGCC forward budB B2 CGAAGGGCGATAGCTTTA 16 budB CCAATCC reverse budA B3 CACCATGAATCATTCTGC 17 budA forward TGAATGCACCTGCG budA B4 GATACTGTTTGTCCATGT 18 budA reverse GACC budC B5 CACCATGAAAAAAGTCGC 19 budC ACTTGTTACC forward budC B6 TTAGTTAAATACCAT 20 budC reverse pddA B7 CACCATGAGATCGA 21 pddABC AAAGATTTG forward pddC B8 CTTAGAGAAGTTAATCGT 22 pddABC CGCC reverse sadh B9 CACCATGAAAGCCCTCCA 23 sadh GTACACC forward sadh B10 CGTCGTGTCATGCCCGG 24 sadh G reverse budA B11 GATCGAATTCGTTTAAACT 25 budABC TAGTTTTCTACCGCACG forward budC B12 GATCGCATGCAAGCTTTC 26 budABC ATATAGTCGGAATTCC reverse pddA B13 GATCGAATTCGTTTAAACA 27 pddABC AAGGAGGTCTGATTCATG forward AGATCG pddC B14 GATCGGATTCTTAATCGT 28 pddABC CGCC reverse sadh B15 GATCGGATCCAAAGGAGG 29 sadh TCGGGCGCATGAAAGCC forward C sadh B16 GATCTCTAGAAAGCTTTC 30 sadh AGCCCGGGACGACC reverse ---- BenF ACTTTCTTTCGCCTGTTTC 31 ---- AC ---- BenBPR CATGAAGCTTGTTTAAACT 32 ---- CGGTGACCTTGAAAATAA TGAAAACTTATATTGTTTT GAAAATAATGAAAACTTAT ATTG budAB BABC F GAGCTCGAATTCAAAGGA 33 budAB GGAAGTGTATATGAATCA forward TTC budAB BAB R GGATCCTCTAGAATTAGT 34 budAB TAAATACCATCCCGCCG reverse budC BC Spe F ACTAGTAAAGGAGGAAAG 40 budC forward AGTATGAAGAAGGTCGCA CT budC BC Xba R TCTAGAAAGCAGGGGCAA 41 budC reverse GCCATGTC pddAB DDo For AAGCTTAAAGGAGGCTGA 44 pddABC-ddrAB C- TTCATGAGATCGAAAAGA forward ddrAB TT pddAB DDo Rev TCTAGATTATTCATCCTGC 45 pddABC-ddrAB C- TGTTCTCC reverse ddrAB chnA ChnA F CATCAATTGACTACGTAG 54 chnA forward TCGTACGTGTAAGGAGGT TTGAAATGGAAAAAATTAT G chnA ChnA R CATGCTAGCCCCGGGTAT 55 chnA reverse CTTCTACTCATTTTTTATTT CG ---- Top ter F1 CTAGAAGTCAAAAGCCTC 58 forward CGACCGGAGGCTTTTGA ---- Top ter F2 CTGCTCGAGTTGCTAGC 59 forward AAGTTTAAACAAAAAAAA GCCCGCTCATTAGGCGG GCTGAGCT ---- Bot ter R1 CAGCCCGCCTAATGAGC 60 reverse GGGCTTTTTTTTGTTTAA AC ---- Bot ter R2 TTGCTAGCAACTCGAGCA 61 reverse GTCAAAAGCCTCCGGTC GGAGGCTTTTGACTT KA-AT OT872 CTCCGGAATTCATGTCTG 127 Aminoalcohol ACGGACGACTCACCGCA kinase/lyase operon forward KA-AT OT873 TTCCAATGCATTGGCTGC 128 Aminoalcohol AGTTATCTCTGTGCACGA kinase/lyase GTGCCGATGA operon reverse KA OT879 AACAGCCAAGCTTGGCT 129 Aminoalcohol GCAGTCATCGCGCATTCT kinase CCGGG reverse AT OT880 TCTCCGGAATTCATGACG 130 Aminoalcohol TCTGAAATGACAGCGACA lyase GAAG forward pBAD. OT909 GCTAACAGGAGGAAGAA 131 Adds EcoRI HisB TTCATGGGGGGTTCTC site to replace NcoI site pBAD. OT910 GAGAACCCCCCATGAATT 132 Adds EcoRI HisB CTTCCTCCTGTTAGC site to replace NcoI site BudAB N84seqR3 GGACCTGCTTCGCTTTAT 159 reverse CG APT APTfor GCGCGCCCGGGAAGAAG 162 APT forward GAGCTCTTCACCATGAAC AAACCACAGTCTTGG APT APTrev GCGCGCCCGGGTTCATG 163 APT reverse CCACCTCTGCG
TABLE-US-00005 TABLE 5 Sequencing Primers Gene- SEQ ID Name Sequence specific NO: M13 Forward GTAAAACGACGGCCAGT ---- 35 M13 Reverse AACAGCTATGACCATG ---- 36 N83 SeqF2 GCTGGATTACCAGCTCGACC ---- 37 N83 SeqF3 CGGACGCATTACCGGCAAAG ---- 38 N84 Seq R2 GCATCGAGATTATCGGGATG ---- 65 N84 Seq R4 CGAAGCGAGAGAAGTTATCC ---- 39 Trc F TTGACAATTAATCATCCGGC all 42 Trc R CTTCTCTCATCCGCCAAAAC all 43 DDko seq F2 GCATGGCGCGGATTTGACGAAC pddABC- 46 ddrAB DDko seq F5 CATTAAAGAGACCAAGTACGTG pddABC- 47 ddrAB DDko seq F7 ATATCCTGGTGGTGTCGTCGGCGT pddABC- 48 ddrAB DDko seq F9 TCTTTGTCACCAACGCCCTGCG pddABC- 49 ddrAB DDko seq R1 GCCCACCGCGCTCGCCGCCGCG pddABC- 50 ddrAB DDko seq R3 CCCCCAGGATGGCGGCTTCGGC pddABC- 51 ddrAB DDko seq R7 GGGCCGACGGCGATAATCACTT pddABC- 52 ddrAB DDko seq R10 TTCTTCGATCCACTCCTTAACG pddABC- 53 ddrAB chnSeq F1 CTCAACAGGGTGTAAGTGTAGT chnA 56 chnSeq R1 CGTTTTGATATAGCCAGGATGT chnA 57 pCL1925 CGGTATCATCAACAGGCTTACC all 62 vec F pCL1925 AGGGTTTTCCCAGTCACGACGT all 63 vec R1 pCL1925 CGCAATAGTTGGCGAAGTAATC all 64 vec R2 APTseqRev GCTAGAGATGATAGC APT 160 APTseqFor GGAAGAGACTATCCAGCG APT 161
Methods for Determining 2-Butanol and 2-Butanone Concentration in Culture Media
[0199] The concentration of 2-butanol and 2-butanone in the culture media can be determined by a number of methods known in the art. For example, a specific high performance liquid chromatography (HPLC) method utilized a Shodex SH-1011 column with a Shodex SH-G guard column, both purchased from Waters Corporation (Milford, Mass.), with refractive index (RI) detection. Chromatographic separation was achieved using 0.01 M H2SO4 as the mobile phase with a flow rate of 0.5 mL/min and a column temperature of 50° C. Under the conditions used, 2-butanone and 2-butanol had retention times of 39.5 and 44.3 min, respectively. Alternatively, gas chromatography (GC) methods are available. For example, a specific GC method utilized an HP-INNOWax column (30 m×0.53 mm id, 1 μm film thickness, Agilent Technologies, Wilmington, Del.), with a flame ionization detector (FID). The carrier gas was helium at a flow rate of 4.5 mL/min, measured at 150° C. with constant head pressure; injector split was 1:25 at 200° C.; oven temperature was 45° C. for 1 min, 45 to 220° C. at 10° C./min, and 220° C. for 5 min; and FID detection was employed at 240° C. with 26 mL/min helium makeup gas. The retention times of 2-butanone and 2-butanol were 3.61 and 5.03 min, respectively.
[0200] 2-Butanone can also be detected by derivatization with 3-methyl-2-benzothiazolinone hydrazone (MBTH). An aqueous solution containing 2-butanone is mixed with an equal volume of an aqueous solution of 6 mg/mL MBTH in 375 mM glycine-HCl (pH 2.7) and incubated at 100° C. for 3 min. The resulting MBTH-derivatized samples are analyzed on a 25 cm×4.6 mm (id) Supelosil LC-18-D5 5 μm column (Supelco) using a mobile phase of 55% acetonitrile in water at a flow rate of 1 mL/min. The 2-butanone derivative appears as two peaks (cis and trans isomers) with retention times of approximately 12.3 and 13.3 min and absorbance maxima of 230 and 307 nm.
[0201] The meaning of abbreviations is as follows: "s" means second(s), "min" means minute(s), "h" means hour(s), "psi" means pounds per square inch, "nm" means nanometers, "d" means day(s), "μL" means microliter(s), "mL" means milliliter(s), "L" means liter(s), "mm" means millimeter(s), "nm" means nanometers, "mM" means millimolar, "M" means molar, "mmol" means millimole(s), "μmol" means micromole(s), "g" means gram(s), "μg" means microgram(s) and "ng" means nanogram(s), "PCR" means polymerase chain reaction, "OD" means optical density, "OD600" means the optical density measured at a wavelength of 600 nm, "kDa" means kilodaltons, "g" means the gravitation constant, "bp" means base pair(s), "kbp" means kilobase pair(s), "% w/v" means weight/volume percent, % v/v'' means volume/volume percent, "wt %" means percent by weight, "HPLC" means high performance liquid chromatography, and "GC" means gas chromatography. The term "molar selectivity" is the number of moles of product produced per mole of sugar substrate consumed and is reported as a percent.
Example 1
Cloning and Expression of Acetolactate Synthase
[0202] The purpose of this Example was to clone and express in E. coli the budB gene that encodes the enzyme acetolactate synthase. The budB gene was amplified from Klebsiella pneumoniae strain ATCC 25955 genomic DNA using PCR.
[0203] The budB sequence which encodes acetolactate synthase was amplified from Klebsiella pneumoniae (ATCC 25955) genomic DNA by PCR using the primer pair B1 (SEQ ID NO:15) and B2 (SEQ ID NO:16). Other PCR amplification reagents (e.g. Kod HiFi DNA Polymerase (Novagen Inc., Madison, Wis.; catalog no. 71805-3)) were supplied in manufacturers' kits and used according to the manufacturer's protocol. Klebsiella pneumoniae genomic DNA was prepared using the Gentra Puregene Puregene kit (Gentra Systems, Inc., Minneapolis, Minn.; catalog number D-5000A). Amplification was carried out in a DNA Thermocycler GeneAmp 9700 (PE Applied Biosystems, Foster city, CA). The nucleotide sequence of the open reading frame (ORF) and the predicted amino acid sequence of the enzyme are given as SEQ ID NO:3 and SEQ ID NO:4, respectively.
[0204] For expression studies the Gateway cloning technology (Invitrogen Corp., Carlsbad, Calif.) was used. The entry vector pENTR/SD/D-TOPO allows directional cloning and provided a Shine-Dalgarno sequence for the gene of interest. The destination vector pDEST14 used a T7 promoter for expression of the gene with no tag. The forward primer incorporated four bases (CACC) immediately adjacent to the translational start codon to allow directional cloning of the budB acetolactate synthase coding region PCR product into pENTR/SD/D-TOPO (Invitrogen), generating the plasmid pENTRSDD-TOPObudB. The pENTR construct was transformed into E. coli Top10 (Invitrogen) cells and plated according to the manufacturer's recommendations. Transformants were grown overnight and plasmid DNA was prepared using the QIAprep Spin Miniprep kit (Qiagen, Valencia, Calif.; catalog no. 27106) according to the manufacturer's recommendations. To create an expression clone, the budB coding region from pENTRSDD-TOPObudB was transferred to the pDEST 14 vector by in vitro recombination using the LR Clonase mix (Invitrogen, Corp., Carlsbad, Calif.). The resulting vector, pDEST14budB, was transformed into BL-21-AI cells (Invitrogen Corp.). BL-21-AI cells carry a chromosomal copy of the T7 RNA polymerase under control of the arabinose-inducible araBAD promoter.
[0205] Transformants are inoculated into LB medium supplemented with 50 μg/mL of ampicillin and grown overnight. An aliquot of the overnight culture is used to inoculate 50 mL of LB medium supplemented with 50 μg/mL of ampicillin. The culture is incubated at 37° C. with shaking until the OD600 reaches 0.6-0.8. The culture is split into two 25-mL portions and arabinose is added to one of the flasks to a final concentration of 0.2% w/v. The negative control flask is not induced with arabinose. The flasks are incubated for 4 h at 37° C. with shaking. Cells are harvested by centrifugation and the cell pellets are resuspended in 50 mM MOPS, pH 7.0 buffer. The cells are disrupted either by sonication or by passage through a French Pressure Cell. Each cell lysate is centrifuged yielding the supernatant and the pellet or the insoluble fraction. An aliquot of each fraction (whole cell lysate, from induced and control cells, is resuspended in SDS (MES) loading buffer (Invitrogen), heated to 85° C. for 10 min and subjected to SDS-PAGE analysis (NuPAGE 4-12% Bis-Tris Gel, catalog no. NP0322Box, Invitrogen). A protein of the expected molecular weight, as deduced from the nucleic acid sequence, is present in the induced culture but not in the uninduced control.
[0206] Acetolactate synthase activity in the cell free extracts is measured using the method described by Bauerle et al. (Bauerle et al. (1964) Biochim. Biophys. Acta 92:142-149). Protein concentration is measured by either the Bradford method or by the Bicinchoninic Kit (Sigma, catalog no. BCA-1; St. Louis, Mo.) using Bovine serum albumin (BSA) (Bio-Rad, Hercules, Calif.) as the standard.
Example 2
Cloning and Expression of Acetolactate Decarboxylase
[0207] The purpose of this Example was to clone and express in E. coli the budA gene that encodes the enzyme acetolactate decarboxylase. The budA gene was amplified from Klebsiella pneumoniae strain ATCC 25955 genomic DNA using PCR.
[0208] The budA sequence which encodes acetolactate decarboxylase, was cloned in the same manner as described for budB in Example 1, except that the primers used for PCR amplification were B3 (SEQ ID NO:17) and B4 (SEQ ID NO:18). The nucleotide sequence of the open reading frame (ORF) and the predicted amino acid sequence of the enzyme are given as SEQ ID NO:1 and SEQ ID NO:2, respectively. The resulting plasmid was named pENTRSDD-TOPObudA.
[0209] Acetolactate decarboxylase activity in the cell free extracts is measured using the method described by Bauerle et al., supra.
Example 3
Prophetic
Cloning and Expression of Butanediol Dehydrogenase
[0210] The purpose of this prophetic Example is to describe how to clone and express in E. coli the budC gene that encodes the enzyme butanediol dehydrogenase. The budC gene is amplified from Klebsiella pneumoniae strain IAM1063 genomic DNA using PCR.
[0211] The budC sequence encoding butanediol dehydrogenase is cloned and expressed in the same manner as described for budA in Example 1, except that the primers used for PCR amplification are B5 (SEQ ID NO:19) and B6 (SEQ ID NO:20) and the genomic template DNA is from Klebsiella. pneumoniae IAM1063 (which is obtained from the Institute of Applied Microbiology Culture Collection, Tokyo, Japan). Klebsiella pneumoniae IAM1063 genomic DNA is prepared using the Gentra Puregene Puregene kit (Gentra Systems, Inc., Minneapolis, Minn.; catalog number D-5000A). The nucleotide sequence of the open reading frame (ORF) and the predicted amino acid sequence of the enzyme are given as SEQ ID NO:5 and SEQ ID NO:6, respectively.
[0212] Butanediol dehydrogenase activity in the cell free extracts is measured spectrophotometrically by following NADH consumption at an absorbance of 340 nm.
Example 4
Prophetic
Cloning and Expression of Butanediol Dehydratase
[0213] The purpose of this prophetic Example is to describe how to clone and express in E. coli the pddA, pddB and pddC genes that encode butanediol dehydratase. The pddA, pddB and pddC genes are amplified from Klebsiella oxytoca ATCC 8724 genomic DNA using PCR.
[0214] The pddA, pddB and pddC sequences which encode butanediol dehydratase are cloned and expressed in the same manner as described for budA in Example 1, except that the genomic template DNA is from Klebsiella oxytoca ATCC 8724, and the primers are B7 (SEQ ID NO:21) and B8 (SEQ ID NO:22). Klebsiella oxytoca genomic DNA is prepared using the Gentra Puregene Puregene kit (Gentra Systems, Inc., Minneapolis, Minn.; catalog number D-5000A). A single PCR product including all three open reading frames (ORFs) is cloned, so that all three coding regions are expressed as an operon from a single promoter on the expression plasmid. The nucleotide sequences of the open reading frames for the three subunits are given as SEQ ID NOs:7, 9, and 11, respectively, and the predicted amino acid sequences of the three enzyme subunits are given as SEQ ID NOs:8, 10, and 12, respectively.
[0215] Butanediol dehydratase activity in the cell free extracts is measured by derivatizing the ketone product with 2,4-dinitrophenylhydrazine (DNPH). Briefly, 100 μL of reaction mixture, cell extract containing approximately 0.0005 units of enzyme, 40 mM potassium phosphate buffer (pH 8.0), 2 μg of adenosylcobalamin, 5 μg of 2,3,-butanediol, and 1 μg of bovine serum albumin, is quenched by addition of an equal volume of 0.05 wt % DNPH in 1.0 N HCl. After 15 min at room temperature, the color is developed by addition of 100 μL of 4 N NaOH. The amount of product is determined from the absorbance of the final solution at 550 nm compared to a standard curve prepared with 2-butanone. All reactions are carried out at 37° C. under dim red light.
Example 5
Prophetic
Cloning and Expression of Butanol Dehydrogenase
[0216] The purpose of this prophetic Example is to describe how to clone and express in E. coli the sadh gene that encodes butanol dehydrogenase. The sadh gene is amplified from Rhodococcus ruber strain 219 genomic DNA using PCR.
[0217] The sadh sequence encoding butanol dehydrogenase is cloned and expressed in the same manner as described for budA in Example 1, except that the genomic template DNA is from Rhodococcus ruber strain 219 (Meens, Institut fuer Mikrobiologie, Universitaet Hannover, Hannover, Germany) and the primers are B9 (SEQ ID NO:23) and B10 (SEQ ID NO:24). Rhodococcus ruber genomic DNA is prepared using the Ultra Clean® Microbial DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, Calif.), according to the manufacturer's protocol. The nucleotide sequence of the open reading frame (ORF) and the predicted amino acid sequence of the enzyme are given as SEQ ID NO:13 and SEQ ID NO:14, respectively.
[0218] Butanol dehydrogenase activity in cell free extracts is measured by following the increase in absorbance at 340 nm resulting from the conversion of NAD to NADH when the enzyme is incubated with NAD and 2-butanol.
Example 6
Prophetic
Construction of a Transformation Vector for the Genes in a 2-Butanol Biosynthetic Pathway
[0219] The purpose of this prophetic Example is to describe the preparation of a transformation vector for the genes in a 2-butanol biosynthetic pathway (i.e., Pathway 3 as described above). Like most organisms, E. coli converts glucose initially to pyruvic acid. The enzymes required to convert pyruvic acid to 2-butanol following Pathway 3, i.e., acetolactate synthase, acetolactate decarboxylase, butanediol dehydrogenase, butanediol dehydratase, and butanol dehydrogenase, are encoded by the budA, budB, budC, pddA, pddB, pddC and sadh genes. To simplify building the 2-butanol biosynthetic pathway in a recombinant organism, the genes encoding the 5 steps in the pathway are divided into two operons. The upper pathway comprises the first three steps catalyzed by acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase. The lower pathway comprises the last two steps catalyzed by butanediol dehydratase and butanol dehydrogenase.
[0220] The coding sequences are amplified by PCR with primers that incorporate restriction sites for later cloning, and the forward primers contain an optimized E. coli ribosome binding site (AAAGGAGG). PCR products are TOPO cloned into the pCR4Blunt-TOPO vector and transformed into Top10 cells (Invitrogen). Plasmid DNA is prepared from the TOPO clones, and the sequence of the cloned PCR fragment is verified. Restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, Mass.) are used according to manufacturer's recommendations. For cloning experiments, restriction fragments are gel-purified using QIAquick Gel Extraction kit (Qiagen).
[0221] After confirmation of the sequence, the coding regions are subcloned into a modified pUC19 vector as a cloning platform. The pUC19 vector is modified by a HindIII/SapI digest, followed by treatment with Klenow DNA polymerase to fill in the ends. The 2.4 kB vector fragment is gel-purified and religated creating pUC19dHS. Alternatively the pUC19 vector is modified by a SphI/SapI digest, followed by treatment with Klenow DNA polymerase to blunt the ends. The 2.4 kB vector fragment is gel-purified and religated creating pUC19dSS. The digests remove the lac promoter adjacent to the MCS (multiple cloning sites), preventing transcription of the operons from the vector.
Upper Pathway:
[0222] The budABC coding regions are amplified from Klebsiella pneumoniae genomic DNA by PCR using primer pair B11 and B12 (Table 4), given as SEQ ID NOs:25 and 26, respectively. The forward primer incorporates an EcoRI restriction site and a ribosome binding site (RBS). The reverse primer incorporates an SphI restriction site. The PCR product is cloned into pCR4Blunt-TOPO creating pCR4Blunt-TOPO-budABC.
[0223] To construct the upper pathway operon pCR4Blunt-TOPO-budABC is digested with EcoRI and SphI releasing a 3.2 kbp budABC fragment. The pUC19dSS vector is also digested with EcoRI and SphI, releasing a 2.0 kbp vector fragment. The budABC fragment and the vector fragment are ligated together using T4 DNA ligase (New England Biolabs) to form pUC19dSS-budABC.
Lower Pathway:
[0224] The pddABC coding regions are amplified from Klebsiella oxytoca ATCC 8724 genomic DNA by PCR using primers B13 and B14 (Table 4), given as SEQ ID NOs:27 and 28, respectively, creating a 2.9 kbp product. The forward primer incorporates EcoRI and PmeI restriction sites and a RBS. The reverse primer incorporates the BamHI restriction site. The PCR product is cloned into pCRBlunt II-TOPO creating pCRBluntII-pdd.
[0225] The sadh gene is amplified from Rhodococcus ruber strain 219 genomic DNA by PCR using primers B15 and B16 (Table 4), given as SEQ ID NOs:29 and 30, respectively, creating a 1.0 kbp product. The forward primer incorporates a BamHI restriction site and a RBS. The reverse primer incorporates an XbaI restriction site. The PCR product is cloned into pCRBlunt II-TOPO creating pCRBluntII-sadh.
[0226] To construct the lower pathway operon, a 2.9 kbp EcoRI and BamHI fragment from pCRBluntII-pdd, a 1.0 kbp BamHI and XbaI fragment from pCRBluntII-sadh, and the large fragment from an EcoRI and XbaI digest of pUC19dHS are ligated together. The three-way ligation creates pUC19dHS-pdd-sadh.
[0227] The pUC19dSS-budABC vector is digested with PmeI and HindIII, releasing a 3.2 kbp fragment that is cloned into pBenBP, an E. coli-B. subtilis shuttle vector. Plasmid pBenBP is created by modification of the pBE93 vector, which is described by Nagarajan (WO 93/2463, Example 4). To generate pBenBP, the Bacillus amyloliquefaciens neutral protease promoter (NPR) signal sequence and the phoA gene are removed from pBE93 with an NcoI/HindIII digest. The NPR promoter is PCR amplified from pBE93 by primers BenF and BenBPR, given by SEQ ID NOs:31 and 32, respectively. Primer BenBPR incorporates BstEII, PmeI and HindIII sites downstream of the promoter. The PCR product is digested with NcoI and HindIII, and the fragment is cloned into the corresponding sites in the vector pBE93 to create pBenBP. The upper operon fragment is subcloned into the PmeI and HindIII sites in pBenBP creating pBen-budABC.
[0228] The pUC19dHS-pdd-sadh vector is digested with PmeI and HindIII releasing a 3.9 kbp fragment that is cloned into the PmeI and HindIII sites of pBenBP, creating pBen-pdd-sadh.
Example 7
Prophetic
Expression of a 2-Butanol Biosynthetic Pathway in E. coli
[0229] The purpose of this prophetic Example is to describe how to express a 2-butanol biosynthetic pathway in E. coli.
[0230] The plasmids pBen-budABC and pBen-pdd-sadh, prepared as described in Example 6, are separately transformed into E. coli NM522 (ATCC No. 47000), and expression of the genes in each operon is monitored by SDS-PAGE analysis and enzyme assay. After confirmation of expression of all genes, pBen-budABC is digested with EcoRI and HindIII to release the NPR promoter-budABC fragment. The fragment is blunt ended using the Klenow fragment of DNA polymerase (New England Biolabs, catalog no. M0210S). The plasmid pBen-pdd-sadh is digested with EcoRI and similarly blunted to create a linearized, blunt-ended vector fragment. The vector and NPR-budABC fragments are ligated, creating p2BOH. This plasmid is transformed into E. coli NM522 to give E. coli NM522/p2BOH, and expression of the genes is monitored as previously described.
[0231] E. coli NM522/p2BOH is inoculated into a 250 mL shake flask containing 50 mL of medium and shaken at 250 rpm and 35° C. The medium is composed of: dextrose, 5 g/L; MOPS, 0.05 M; ammonium sulfate, 0.01 M; potassium phosphate, monobasic, 0.005 M; S10 metal mix, 1% (v/v); yeast extract, 0.1% (w/v); casamino acids, 0.1% (w/v); thiamine, 0.1 mg/L; proline, 0.05 mg/L; and biotin 0.002 mg/L, and is titrated to pH 7.0 with KOH. S10 metal mix contains: MgCl2, 200 mM; CaCl2, 70 mM; MnCl2, 5 mM; FeCl3, 0.1 mM; ZnCl2, 0.1 mM; thiamine hydrochloride, 0.2 mM; CuSO4, 172 μM; CoCl2, 253 μM; and Na2MoO4, 242 μM. After 18 h, 2-butanol is detected by HPLC or GC analysis using methods that are well known in the art, for example, as described in the General Methods section above.
Example 8
Prophetic
Expression of a 2-Butanol Biosynthetic Pathway in Bacillus Subtilis
[0232] The purpose of this prophetic Example is to describe how to express a 2-butanol biosynthetic pathway in Bacillus subtilis.
[0233] The plasmids pBen-budABC and pBen-pdd-sadh, prepared as described in Example 6, are separately transformed into Bacillus subtilis BE1010 (J. Bacteriol. 173:2278-2282 (1991)) and expression of the genes in each operon is monitored as described in Example 7. The plasmid pBen-budABC is digested with EcoRI and HindIII to release the NPR promoter-budABC fragment. The fragment is blunt ended using the Klenow fragment of DNA polymerase (New England Biolabs, catalog no. M0210S). The plasmid pBen-pdd-sadh is digested with EcoRI and similarly blunted to create a linearized, blunt-ended vector fragment. The vector and NPR-budABC fragments are ligated, creating p2BOH. This plasmid is transformed into Bacillus subtilis BE1010 to give Bacillus subtilis BE1010/p2BOH, and expression of the genes is monitored as previously described.
[0234] Bacillus subtilis BE1010/p2BOH is inoculated into a 250 mL shake flask containing 50 mL of medium and shaken at 250 rpm and 35° C. for 18 h. The medium is composed of: dextrose, 5 g/L; MOPS, 0.05 M; glutamic acid, 0.02 M; ammonium sulfate, 0.01 M; potassium phosphate, monobasic buffer, 0.005 M; S10 metal mix (as described in Example 7), 1% (v/v); yeast extract, 0.1% (w/v); casamino acids, 0.1% (w/v); tryptophan, 50 mg/L; methionine, 50 mg/L; and lysine, 50 mg/L, and is titrated to pH 7.0 with KOH. After 18 h, 2-butanol is detected by HPLC or GC analysis using methods that are well known in the art, for example, as described in the General Methods section above.
Example 9
Construction of a Transformation Vector for the Genes in a 2-Butanol Biosynthetic Pathway
[0235] The purpose of this Example was to prepare a recombinant E. coli host carrying the genes in a 2-butanol biosynthetic pathway (i.e., Pathway 3 as described above). Like most organisms, E. coli converts glucose initially to pyruvic acid. The enzymes required to convert pyruvic acid to 2-butanone in Pathway 3, i.e., acetolactate synthase, acetolactate decarboxylase, butanediol dehydrogenase, and butanediol dehydratase are encoded by the budA, budB, budC, pddA, pddB, and pddC genes. In the last step of the pathway, a butanol dehydrogenase converts 2-butanone to 2-butanol. Dehydrogenases that carry out this last step are promiscuous and may be found in many organisms. To simplify building the 2-butanol biosynthetic pathway in a recombinant organism, the genes encoding the 5 steps in the pathway were divided into multiple operons. The upper pathway operon comprised the first three steps catalyzed by acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase and were cloned onto an expression vector. The lower pathway comprised the last two steps catalyzed by butanediol dehydratase including the reactivating factor (Mori et al., J. Biol. Chem. 272:32034 (1997)) and a butanol dehydrogenase. The diol dehydratase can undergo suicide inactivation during catalysis. The reactivating factor protein encoded by ddrA and ddrB (GenBank AF017781, SEQ ID NO:70) reactivates the inactive enzyme. The ddrA and ddrB genes flank the diol dehydratase operon. The operons for the dehydratase/reactivating factor and the butanol dehydrogenase were either cloned onto another expression vector or the dehydratase/reactivating factor operon was cloned singly onto another expression vector and the last step was provided by an endogenous activity in the demonstration host.
[0236] Construction of Vector pTrc99a-budABC:
[0237] The budAB coding regions were amplified from K. pneumoniae ATCC 25955 genomic DNA by PCR using primer pair BABC F and BAB R, given as SEQ ID NOs:33 and 34, respectively (see Table 4), creating a 2.5 kbp product. The forward primer incorporated SacI and EcoRI restriction sites and a ribosome binding site (RBS). The reverse primer incorporated a SpeI restriction site. The PCR product was cloned into pCR4Blunt-TOPO creating pCR4Blunt-TOPO-budAB. Plasmid DNA was prepared from the TOPO clones and the sequence of the genes was verified with primers M13 Forward (SEQ ID NO:35), M13 Reverse (SEQ ID NO:36), N83 SeqF2 (SEQ ID NO:37), N83 SeqF3 (SEQ ID NO:38) and N84 SeqR4 (SEQ ID NO:39) (see Table 5).
[0238] The budC coding region was amplified from K. pneumoniae ATCC 25955 genomic DNA by PCR using primer pair BC Spe F and BC Xba R given as SEQ ID NOs:40 and 41, respectively, creating a 0.8 kbp product. The forward primer incorporated a SpeI restriction site, a RBS and modified the CDS by changing the second and third codons from AAA to AAG. The reverse primer incorporated an XbaI restriction site. The PCR product was cloned into pCR4Blunt-TOPO creating pCR4Blunt-TOPO-budC. Plasmid DNA was prepared from the TOPO clones and the sequence of the genes was verified with primers M13 Forward (SEQ ID NO:35) and M13 Reverse (SEQ ID NO:36).
[0239] To construct the budABC operon, pCR4Blunt-TOPO-budC was digested with SnaBI and XbaI releasing a 1.0 kbp budC fragment. The vector pTrc99a (Amann et al., Gene 69(2):301-315 (1988)) was digested with SmaI and XbaI creating a 4.2 kbp linearized vector fragment. The vector and the budC fragment were ligated to create pTrc99a-budC and transformed into E. coli Top 10 cells (Invitrogen). Transformants were analyzed by PCR amplification with primers Trc F (SEQ ID NO:42) and Trc R (SEQ ID NO:43) for a 1.2 kbp product to confirm the presence of the budC insert. The budAB genes were subcloned from pCR4Blunt-TOPO-budAB as a 2.5 kbp EcoRI/SpeI fragment. Vector pTrc99a-budC was digested with EcoRI and SpeI and the resulting 5.0 kbp vector fragment was gel-purified. The purified vector and budAB insert were ligated and transformed into E. coli Top 10 cells. Transformants were screened by PCR amplification with primers Trc F (SEQ ID NO:42) and N84 Seq R2 (SEQ ID NO:65) to confirm creation of pTrc99a-budABC. In this plasmid, the bud A, B, and C coding regions are adjacent to each other, in this order, and between the Trc promoter and the rrnB termination sequence.
Results:
[0240] Three independent isolates of E. coli Top 10/pTrc99a-budABC were examined for the production of butanediol, using E. coli Top 10/pCL1925-Kodd-ddr (described below) as a negative control. The strains were grown in LB medium containing 100 μg/mL carbenicillin. The resulting cells were used to inoculate shake flasks (approximately 175 mL total volume) containing 125 mL of TM3a/glucose medium with 100 μg/mL carbenicillin. In addition, the flasks inoculated with strains carrying pTrc99a-budABC contained 0.4 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). TM3a/glucose medium contains (per liter): 10 g glucose, 13.6 g KH2PO4, 2.0 g citric acid monohydrate, 3.0 g (NH4)2SO4, 2.0 g MgSO4.7H2O, 0.2 g CaCl2.2H2O, 0.33 g ferric ammonium citrate, 1.0 mg thiamine.HCl, 0.50 g yeast extract, and 10 mL trace elements solution, adjusted to pH 6.8 with NH4OH. The solution of trace elements contained: citric acid .H2O (4.0 g/L), MnSO4.H2O (3.0 g/L), NaCl (1.0 g/L), FeSO4.7H2O (0.10 g/L), CoCl2.6H2O (0.10 g/L), ZnSO4.7H2O (0.10 g/L), CuSO4.5H2O (0.010 g/L), H3BO3 (0.010 g/L), and Na2MoO4.2H2O (0.010 g/L). The flasks, capped with vented caps, were inoculated at a starting OD600 of approximately 0.03 units and incubated at 34° C. with shaking at 300 rpm.
[0241] Approximately 23 h after induction, an aliquot of the broth was analyzed by HPLC (Shodex Sugar SH1011 column) and GC (HP-INNOWax), using the same methods described in the General Methods section for 2-butanol and 2-butanone. The results of the analysis are given in Table 6. The three E. coli clones converted glucose to acetoin and meso-2,3-butanediol, the desired intermediates of the pathway, with a molar selectivity of 14%. This selectivity was approximately 35-fold higher than that observed with the E. coli control strain lacking budABC.
TABLE-US-00006 TABLE 6 Production of Acetoin and meso-2,3-butanediol by E. coli Top 10/pTrc99a-budABC Meso-2,3- Butanediol, Molar Strain OD600 Acetoin, mM mM Selectivitya, % Negative 1.4 0.07 0.03 0.4 control Isolate #1 1.5 0.64 1.3 14 Isolate #2 1.4 0.70 1.2 14 Isolate #3 1.4 0.74 1.3 15 aMolar selectivity is (acetoin + meso-2,3-butanendiol)/(glucose consumed).
Construction of Vector pCL1925-KoDD-ddr:
[0242] The diol dehydratase (Gen Bank D45071, SEQ ID NO:69) and reactivating factor (GenBank AF017781, SEQ ID NO:70) operons were PCR amplified from Klebsiella oxytoca ATCC 8724 as a single unit with primers DDo For (SEQ ID NO: 44) and DDo Rev (SEQ ID NO:45). The forward primer incorporated an optimized E. coli RBS and a HindIII restriction site. The reverse primer included an XbaI restriction site. The 5318 bp PCR product was cloned into pCR4Blunt-TOPO and clones of the resulting pCR4Blunt-TOPO-Kodd-ddr were sequenced with primers M13 Forward (SEQ ID NO:35), M13 Reverse (SEQ ID NO:36), DDko seq F2 (SEQ ID NO:46), DDko seq F5 (SEQ ID NO:47), DDko seq F7 (SEQ ID NO:48), DDko seq F9 (SEQ ID NO:49), DDko seq R1 (SEQ ID NO:50), DDko seq R3 (SEQ ID NO:51), DDko seq R7 (SEQ ID NO:52), and DDko seq R10 (SEQ ID NO:53). A clone having the insert with the expected sequence was identified.
[0243] For expression, the diol dehydratase/reactivating factor genes were subcloned into pCL1925 (U.S. Pat. No. 7,074,608), a low copy plasmid carrying the glucose isomerase promoter from Streptomcyes. pCR4Blunt-TOPO-Kodd-ddr was digested with HindIII and XbaI and the resulting 5.3 kbp Kodd-ddr fragment was gel-purified. Vector pCL1925 was digested with HindIII and XbaI and the resulting 4539 bp vector fragment was gel purified. The vector and Kodd-ddr fragment were ligated and transformed into E. coli Top10. Transformants were screened by PCR with primers DDko Seq F7 (SEQ ID NO:48) and DDko Seq R7 (SEQ ID NO: 52). Amplification of the plasmid (pCL1925-Kodd-ddr) carrying the insert resulted in a product of approximately 797 bp.
[0244] Activity of diol dehydratase towards meso-2,3-butanediol was measured by incubating cell extract (total protein ˜0.8 mg/mL) with 10 mM butanediol and 12 mM coenzyme B12 in 80 mM HEPES (pH 8.2) for 17 h at room temperature. Formation of the expected product, 2-butanone, was determined by HPLC as described in the General Methods.
Construction of Vector pCL1925-KoDD-ddr::T5 chnA ter:
[0245] To provide a heterologous alcohol dehydrogenase activity, the chnA gene encoding cyclohexanol dehydrogenase from Acinetobacter sp. (Cheng et al., J. Bacteriol. 182:4744-4751 (2000)) was cloned into the pCL1925 vector with the diol dehydratase operon, pCL1925-Kodd-ddr. The chnA gene, given as SEQ ID NO:71 (Genbank No: AF282240, SEQ ID NO:73) was amplified from pDCQ2, a cosmid carrying the cyclohexanol gene cluster from Acinetobacter, with primers ChnA F (SEQ ID NO:54) and ChnA R (SEQ ID NO:55). The resulting 828 bp PCR product was cloned into pCR4Blunt-TOPO to create pCR4Blunt-TOPO-chnA and transformants were screened by colony PCR with primers M13 Forward (SEQ ID NO:35) and M13 Reverse (SEQ ID NO:36). Correct clones produced a PCR product of about 1 kbp and were sequenced with primers M13 Forward (SEQ ID NO:35) and M13 Reverse (SEQ ID NO:36).
[0246] After sequencing pCR4Blunt-TOPO-chnA to confirm the correct sequence, the chnA gene was subcloned from the plasmid as an 813 bp MfeII/SmaI fragment. The expression vector pQE30 (Qiagen) was digested with MfeII and SmaI and the resulting 3350 bp vector fragment was gel-purified. The chnA fragment and the purified vector were ligated and transformed into E. coli Top10 cells. Transformants were colony PCR screened with primers chnSeq F1 (SEQ ID NO:56) and chnseq R1 (SEQ ID NO:57) for a 494 b PCR product. This cloning placed the chnA gene under the control of the T5 promoter in the plasmid, pQE30-chnA.
[0247] To prepare the pCL1925 vector to carry two operons, terminators were added to the vector. A tonB terminator-mcs-trpA terminator fragment was prepared by oligonucleotide annealing with primers Top ter F1 (SEQ ID NO:58), Top ter F2 (SEQ ID NO:59), Bot ter R1 (SEQ ID NO:60) and Bot ter R2 (SEQ ID NO:61). The annealed DNA was gel-purified on a 6% PAGE gel (Embi-tec, San Diego, Calif.). Vector pCL1925 was digested with SacI and XbaI and gel-purified. The annealed DNA and vector fragment were ligated to create pCL1925-ter. Transformants were screened by colony PCR amplification with primers pCL1925 vec F (SEQ ID NO:62) and pCL1925 vec R1 (SEQ ID NO:63) for the presence of a PCR product of approximately 400 bp. Positive clones from the PCR screen were sequenced with the same primers.
[0248] Vector pCL1925-ter was digested with XhoI and PmeI and the resulting 4622 bp fragment was gel-purified. pQE30-chnA was digested with NcoI and the DNA was treated with Klenow DNA polymerase to blunt the ends. pQE30-chnA was then digested with XhoI and the resulting 1.2 kbp T5 promoter-chnA fragment was gel-purified. The pCL1925-ter vector and the chnA operon fragment were ligated together to give pCL1925-ter-T5chnA and transformed into E. coli Top10. Transformants were screened by colony PCR amplification with primers pCL1925 vec F (SEQ ID NO:64) and chnseq R1 (SEQ ID NO:59) for a product of approximately 1 kbp.
[0249] To finish building the pathway vector, the pCL1925-KoDD-ddr plasmid was digested with XbaI and SacI and the resulting 9504 bp vector fragment was gel-purified. The chnA operon flanked by terminators, with the trpA terminator (Koichi et al. (1997) Volume 272, Number 51, pp. 32034-32041) 3' to the chnA coding sequence, from pCL1925-ter-T5chnA was gel-purified as a 1271 bp XbaI/SacI fragment. After ligation of the fragments and transformation into E. coli Top10, transformants were screened by colony PCR. Primers chnSeq F1 (SEQ ID NO:58) and pCL1925 vec R2 (SEQ ID NO:64) amplified the expected 1107 bp PCR product in the resulting plasmid, pCL1925-KoDD-ddr::ter-T5chnA.
Example 10
Expression of a 2-Butanol Biosynthetic Pathway in E. Coli with Overexpressed Endogenous Alcohol Dehydrogenase
[0250] The purpose of this Example was to express a 2-butanol biosynthetic pathway in several E. coli strains.
Construction of E. Coli Strains Constitutively Expressing yghD:
[0251] E. coli contains a native gene (yqhD) that was identified as a 1,3-propanediol dehydrogenase (U.S. Pat. No. 6,514,733). The yqhD gene, given as SEQ ID NO:74, has 40% identity to the gene adhB in Clostridium, a probable NADH-dependent butanol dehydrogenase. The yqhD gene was placed under the constitutive expression of a variant of the glucose isomerase promoter 1.6GI (SEQ ID NO:67) in E. coli strain MG1655 1.6yqhD::Cm (WO 2004/033646) using X Red technology (Datsenko and Wanner, Proc. Natl. Acad. Sci. U.S.A. 97:6640 (2000)). Similarly, the native promoter was replaced by the 1.5GI promoter (WO 2003/089621) (SEQ ID NO:68), creating strain MG1655 1.5yqhD::Cm, thus, replacing the 1.6GI promoter of MG1655 1.6yqhD::Cm with the 1.5GI promoter. The 1.5GI and 1.6GI promoters differ by 1 bp in the -35 region, thereby altering the strength of the promoters (WO 2004/033646). While replacing the native yqhD promoter with either the 1.5GI or 1.6GI promoter, the yqhC gene encoding the putative transcriptional regulator for the yqh operon was deleted. Butanol dehydrogenase activity was confirmed by enzyme assay using methods that are well known in the art.
Transformation of E. coli Strains:
[0252] Pathway plasmids pCL1925-Kodd-ddr and pTrc99a-budABC, described in Example 9, were co-transformed into E. coli strains MG1655, MG1655 1.6yqhD, and MG1655 1.5yqhD. The two latter strains overexpress the 1,3-propanediol dehydrogenase, YqhD, which also has butanol dehydrogenase activity. Strains were examined for the production of 2-butanone and 2-butanol essentially as described above. Cells were inoculated into shake flasks (approximately 175 mL total volume) containing either 50 or 150 mL of TM3a/glucose medium (with 0.1 mg/L vitamin B12, appropriate antibiotics and IPTG) to represent medium and low oxygen conditions, respectively. Spectinomycin (50 μg/mL) and carbenicillin (100 μg/mL) were used for plasmids pCL1925-Kodd-ddr and pTrc99a-budABC, respectively. The flasks were inoculated at a starting OD600 of ≦0.04 units and incubated at 34° C. with shaking at 300 rpm. The flasks containing 50 mL of medium were capped with vented caps; the flasks containing 150 mL, were capped with non-vented caps to minimize air exchange. IPTG was present at time zero at a concentration of zero or 0.04 mM. Analytical results for 2-butanone and 2-butanol production are presented in Table 7. All the E. coli strains comprising a 2-butanol biosynthetic pathway produced 2-butanone under low and medium oxygen conditions and produced 2-butanol under low oxygen conditions.
TABLE-US-00007 TABLE 7 Production of 2-Butanone and 2-Butanol by E. coli MG1655 strains harboring pathway plasmids pCL1925-Kodd-ddr and pTrc99a-budABC Volume of 2-Butanone, 2-Butanol, Straina, b IPTG, mM Medium, mL mM mM MG1655 #1 0 50 0.08 Not detected MG1655 #2 0 50 0.11 Not detected MG1655 #1 0.04 50 0.12 Not detected MG1655 #2 0.04 50 0.11 Not detected MG1655 #1 0 150 0.15 0.047 MG1655 #2 0 150 0.19 0.041 MG1655 #1 0.04 150 0.10 0.015 MG1655 #2 0.04 150 0.11 0.015 MG1655 0 50 0.10 Not detected 1.5yqhD #1 MG1655 0 50 0.07 Not detected 1.5yqhD #2 MG1655 0.04 50 0.12 Not detected 1.5yqhD #1 MG1655 0.04 50 0.18 Not detected 1.5yqhD #2 MG1655 0 150 0.16 0.030 1.5yqhD #1 MG1655 0 150 0.18 0.038 1.5yqhD #2 MG1655 0.04 150 0.10 0.021 1.5yqhD #1 MG1655 0.04 150 0.09 0.017 1.5yqhD #2 MG1655 0 50 0.08 Not detected 1.6yqhD #1 MG1655 0 50 0.07 Not detected 1.6yqhD #2 MG1655 0.04 50 0.12 Not detected 1.6yqhD #1 MG1655 0.04 50 0.15 Not detected 1.6yqhD #2 MG1655 0 150 0.17 0.019 1.6yqhD #1 MG1655 0 150 0.18 0.041 1.6yqhD #2 MG1655 0.04 150 0.11 0.026 1.6yqhD #1 MG1655 0.04 150 0.11 0.038 1.6yqhD #2 Control Not detected Not detected (uninoculated medium) a#1 and #2 represent independent isolates. bMG1655 is MG1655/pCL1925-Kodd-ddr/pTrc99a-budABC MG1655 1.6yqhD is MG1655 1.6yqhD/pCL1925-Kodd-ddr/pTrc99a-budABC MG1655 1.6yqhD is MG1655 1.5yqhD/pCL1925-Kodd-ddr/pTrc99a-budABC.
Example 11
Expression of a 2-Butanol Biosynthetic Pathway in E. coli with Heterologous Alcohol Dehydrogenase
[0253] Plasmids pCL1925-KoDD-ddr::ter-T5chnA and pTrc99a-budABC, described in Example 9, were transformed into E. coli strains MG1655 and MG1655 ΔyqhCD for a demonstration of the production of 2-butanol.
[0254] MG1655 ΔyqhCD carries a yqhCD inactivation that was made using the method of Datsenko and Wanner (Proc. Natl. Acad. Sci. U.S.A. 97(12):6640-6645 (2000)). After replacement of the region with the FRT-CmR-FRT cassette of pKD3, the chloramphenicol resistance marker was removed using the FLP recombinase. The sequence of the deleted region is given as SEQ ID NO:66.
[0255] Strains MG1655/pTrc99a-budABC/pCL1925KoDD-ddr::ter-T5 chnA and MG1655 ΔyqhCD/pTrc99a-budABC/pCL1925KoDD-ddr::ter-T5 chnA were examined for the production of 2-butanone and 2-butanol essentially as described above. Strain MG1655 ΔyqhCD/pCL1925 was used as a negative control. Cells were inoculated into shake flasks (approximately 175 mL total volume) containing 50 or 150 mL of TM3a/glucose medium (with 0.1 mg/L vitamin B12 and appropriate antibiotics) to represent medium and low oxygen conditions, respectively. Spectinomycin (50 μg/mL) and ampicillin (100 μg/mL) were used for selection of pCL1925 based plasmids and pTrc99a-budABC, respectively. Enzyme activity derived from pTrc99a-budABC was detected by enzyme assay in the absence of IPTG inducer, thus, IPTG was not added to the medium. The flasks were inoculated at a starting OD600 of ≦0.01 units and incubated at 34° C. with shaking at 300 rpm for 24 h. The flasks containing 50 mL of medium were capped with vented caps; the flasks containing 150 mL, were capped with non-vented caps to minimize air exchange. Analytical results for 2-butanone and 2-butanol production are presented in Table 8. Both E. coli strains comprising a 2-butanol biosynthetic pathway produced 2-butanone under low and medium oxygen conditions and produced 2-butanol under low oxygen conditions, while the negative control strain did not produce detectable levels of either 2-butanone or 2-butanol.
TABLE-US-00008 TABLE 8 Production of 2-butanone and 2-butanol by E. coli strains Volume, 2-Butanone, Straina mL mM 2-Butanol, mM Negative control, MG1655 50 Not detected Not detected ΔyqhCD/pCL1925 MG1655/pTrc99a- 50 0.33 Not detected budABC/pCL1925KoDD-ddr::T5 chnA ter MG1655 ΔyqhCD/pTrc99a- 50 0.23 Not detected budABC/pCL1925KoDD-ddr::T5 chnA ter #1 MG1655 ΔyqhCD/pTrc99a- 50 0.19 Not detected budABC/pCL1925KoDD-ddr::T5 chnA #2 Negative control, MG1655 150 Not detected Not detected ΔyqhCD/pCL1925 MG1655/pTrc99a- 150 0.41 0.12 budABC/pCL1925KoDD-ddr::T5 chnA ter MG1655 ΔyqhCD/pTrc99a- 150 0.15 0.46 budABC/pCL1925KoDD-ddr::T5 chnA #1 MG1655 ΔyqhCD/pTrc99a- 150 0.44 0.14 budABC/pCL1925KoDD-ddr::T5 chnA #2 Medium Not detected Not detected a#1and #2 represent independent isolates.
Example 12
Cloning of Amino:Pyruvate Transaminase (APT)
[0256] An amino:pyruvate transaminase (APT) from Vibrio Fluvialis JS17 was identified by Shin et al. (Appl. Microbiol. Biotechnol. (2003) 61:463-471). The amino acid sequence (SEQ ID NO:122) was found to have significant homology with ω-amino acid:pyruvate transaminases (Shin and Kim (J. Org. Chem. 67:2848-2853 (2002)). It was shown that the Vibrio Fluvialis APT has transaminase activity towards acetoin.
[0257] For expression of the APT enzyme in E. coli, a codon optimized APT coding region (SEQ ID NO:144) was designed using the preferred E. coli codons with additional considerations such as codon balance and mRNA stability, and synthesized (by DNA2.0; Redwood City, Calif.). The coding region DNA fragment was subcloned into the pBAD.H isB vector (Invitrogen) between the NcoI and HindIII sites and the resulting plasmid, hereafter referred to as pBAD.APT1, was transformed into TOP10 cells.
Example 13
Characterization of Vibrio Fluvialis APT Alanine:Acetoin Aminotransferase Activity
[0258] A 5 mL volume of LB broth+100 μg/mL ampicillin was inoculated with a fresh colony of TOP10/pBAD:APT1 cells. The culture was incubated at 37° C. for approximately 16 h with shaking (225 rpm). A 300 μL aliquot of this culture was used to inoculate 300 mL of the same medium, which was incubated at 37° C. with shaking (225 rpm). When the culture reached an OD600 of 0.8, L-arabinose was added to a final concentration of 0.2% (w/v). The culture was incubated for an additional 16 h, then harvested. The cells were washed once with 100 mM potassium phosphate buffer (pH 7.8) and then frozen and stored at -80° C.
[0259] To isolate the enzyme, the cell pellet was thawed and resuspended in 8 mL of 100 mM potassium phosphate buffer (pH 7) containing 0.2 mM ethylenediaminetetraacetate, 1 mM dithiothreitol and 1 tablet of protease inhibitor cocktail (Roche; Indianapolis, Ind.). The cells were lysed by two passes through a French pressure cell at 900 psi, and the resulting lysate was clarified by centrifugation for 30 min at 17000×g. Ammonium sulfate was added to 35% saturation, and the solution was stirred for 30 min at room temperature, at which point precipitated solids were removed by centrifugation (30 min, 17000×g). Additional ammonium sulfate was added to the supernatant to give 55% saturation, and the solution was again stirred for 30 min at room temperature. The precipitated solids were removed by centrifugation (30 min, 17000×g) and then resuspended in 5 mL of 100 mM potassium phosphate buffer (pH 7) containing 10 μM pyridoxal 5'-phosphate and 1 mM dithiothreitol. This solution was desalted by passage through a PD10 column equilibrated with Buffer A (50 mM bis-tris propane buffer (pH 6) containing 10 μM pyridoxal 5'-phosphate and 1 mM dithiothreitol). The desalted extract was then loaded onto a 20 mL Q-Fast Flow column pre-equilibrated with Buffer A. APT was eluted with a linear gradient of 0-0.1 M NaCl in Buffer A. The enzyme was detected in eluted fractions by the presence of a protein band of size ˜50 kD when analyzed by SDS-polyacrylamide gel electrophoresis and by the characteristic absorbance at 418 nm. Fractions containing the enzyme eluted at ˜0.3 M NaCl. These fractions were pooled to yield a total of 6 mL of a 5.45 mg/mL solution of enzyme, which was >90% pure, as judged by SDS-polyacrylamide gel electrophoresis.
[0260] The alanine:acetoin aminotransferase activity of APT was assayed using a lactic dehydrogenase coupled assay. Reaction mixtures contained 100 mM bis-tris propane (pH 9.0), 10 μM pyridoxal 5'-phosphate, 0-50 mM acetoin, 0-5 mM L-alanine, 0.14 or 0.28 mg/mL purified enzyme, 200 μM NADH and 20 U/mL lactic dehydrogenase (Sigma; St. Louis, Mo.). The reaction was followed by measuring the change in absorbance at 340 nm, indicative of the oxidation of NADH. Under these conditions, the kat/Km for acetoin was 10 M-1 s-1 and that for L-alanine was 400 M-1 s-1.
[0261] The identity of the expected product 3-amino-2-butanol was confirmed by comparison to a synthetic standard. A mixture of (R,R)- and (S,S)-3-amino-2-butanol was synthesized by the method of Dickey et al. [J Amer Chem Soc 74:944 (1952)]: 5 g of trans-2,3-epoxybutane were slowly stirred into 150 mL of cold (4° C.) NH4OH. The reaction was slowly warmed to room temperature, sealed and stirred at room temperature for an additional 10 days. At this time, excess ammonia and water and residual epoxybutane were removed by rotary evaporation under vacuum at 40° C. The resulting clear oil (2.9 g) was resuspended in water to a concentration of 10% (w/v). Production of the desired product was confirmed by NMR analysis and comparison of the spectrum to that reported by Levy et al. [Org. Magnetic Resonance 14:214 (1980)]. A mixture of the corresponding (2R,3S)- and (2S,3R)-isomers was produced using the identical method with the exception that the starting material was the cis-isomer of 2,3-epoxybutane.
[0262] An analytical method for detection of 3-amino-2-butanol was developed based on the o-phthaldialdehyde derivatization method for amino acid determination reported by Roth [Anal. Chem. 43:880 (1971)]. A 200 μL aliquot of 1 mM 3-amino-2-butanol (mixture of isomers) was mixed with 200 μL of a 50 mM solution of borate (pH 9.5), to which was added 10 μL of 5 μL/mL 2-mercaptoethanol in ethanol and 10 μL of 10 mg/mL o-phthaldialdehdye in ethanol. The solution was incubated at room temperature for 10 min, at which time the derivative was extracted into 200 μL hexane. The hexane was separated from the aqueous solution by decanting, and 10 μL were injected onto a Chiracel OD HPLC column (Daicel Chemical Industries; Fort Lee, N.J.). The column was run isocratically with a mobile phase of 90:10 hexane:isopropanol at a rate of 1 mL/min. The derivatized isomers of 3-amino-2-butanol were detected by absorbance at 340 nm with retention times of approximately 15.7 and 16.8 min [(2S,3S) and (2R,3R)], and 18.4 and 21.9 min [(2R,3S) and (2S,3R)]. To differentiate the enantiomers in the first mixture, the pure (2R,3R) isomer (Bridge Organics; Vicksburg, Mich.) was also run under the identical conditions and found to be the 16.8 min peak. To differentiate the enantiomers in the second mixture, the mixture was first kinetically resolved using the alanine:acetoin aminotransferase: 0.28 mg of purified enzyme was incubated with 10 mM pyruvate and 10 mM 3-amino-2-butanol [1:1 mixture of (2R,3S) and (2S,3R) isomers] in 1 mL of 100 mM bis-tris propane (pH 9.0). After 24 h at room temperature, an aliquot was removed and analyzed as described above. Analysis revealed that the 18.4 min peak was 95% depleted, while the 21.9 min peak was >90 retained. A 100 μL aliquot of the remaining reaction mixture was mixed with 50 μL of 20 mM NADH and 10 μL of extract from the TOP10/pTrc99a-BudC strain described in Example 9. The BudC enzyme is known to reduce (R)-acetoin to meso-2,3-butanediol and (S)-acetoin to (S,S)-2,3-butanediol [Ui et al. (2004) Letters in Applied Microbiology 39:533-537]. After 3 h, samples were taken from the reaction and analyzed as described above for acetoin and butanediol. The analysis indicated that the primary product of the reduction was meso-2,3-butanediol, indicating that the product of the aminotransferase reaction was (R)-acetoin, and therefore the consumed 3-amino-2-butanol isomer was the (2R,3S) isomer. Thus the retention time of 18.4 min can be assigned to this isomer and 21.9 to the (2S,3R) isomer.
[0263] To confirm that the product of the APT-catalyzed alanine:acetoin aminotransferase reaction was 3-amino-2-butanol, 0.28 mg of purified enzyme was incubated with 10 mM acetoin, 10 mM L-alanine, 50 U lactic dehydrogenase and 200 μM NADH in 1 mL of 100 mM bis-tris propane (pH 9.0). The reaction mixture was incubated at room temperature for 20 h, after which a 200 μL aliquot was removed and derivatized as described above. The retention times of the derivatized products were 15.8 min (major product) and 18.5 min (minor product), matching that of the (2S,3S)- and (2R,3S)-3-amino-2-butanol standards.
Example 14
Identification and Cloning of Erwinia carotovora subsp. atroseptica Amino Alcohol Kinase and Amino Alcohol O-Phosphate Lyase
[0264] The purpose of this example is to describe the identification and cloning of sequences encoding an amino alcohol kinase and amino alcohol O-phosphate lyase from the bacterium Erwinia carotovora. These two enzymes are part of Pathway 1 for the conversion of 3-amino-2-butanol to 2-butanone via the intermediate 3-amino-2-butanol phosphate as shown in FIG. 1.
Prediction of the Erwinia Amino Alcohol Kinase and the Amino Alcohol O-Phosphate Lyase
[0265] ATP-dependent amino alcohol kinase and amino alcohol O-phosphate lyase activities have been detected in several Pseudomonas and Erwinia species, including Pseudomonas sp. P6 (NCIB10431), Pseudomonas putida NCIB 10558 (Jones et al. (1973) Biochem. J. 134:167-182), Erwinia carotovora, Erwinia amanas, Erwina milletiae, and Erwinia atroseptica (Jones et al. (1973) Biochem. J. 134:959-968). In these studies, the extracts of the above species were shown to have activity for the enzymatic conversion of aminopropanol through aminopropanol O-phosphate to propionaldehyde, and the conversion of ethanolamine through ethanolamine O-phosphate to acetaldehyde.
[0266] The genomic sequence of the Erwinia atroseptica strain in which these activities were reported to exist (now designated as Erwinia carotovora subsp. atroseptica strain SCRI1043 (ATCC BAA-672)) has been determined at the Sanger Institute (Bell et al. Proc. Natl. Acad. Sci. USA 101(30): 11105-11110). Analysis of the putative kinases in the Erwinia carotovora subsp. atroseptica genome revealed an operon sequence (SEQ ID NO:164) encoding a putative protein (ECA2059; SEQ ID NO:124) that is 39% identical to a Rhizobium loti homoserine kinase and a putative class-III pyridoxal phosphate (PLP)-dependent aminotransferase (ECA2060; SEQ ID NO:126) that is 58% identical to a putative aminotransferase from Rhizobium meliloti. Based on the above it was expected that ECA2059 was an amino alcohol kinase and ECA2060 was an amino alcohol O-phosphate lyase which uses PLP as cofactor.
Cloning of the Putative Amino Alcohol Kinase and Putative Amino Alcohol O-Phosphase Lyase from Erwinia carotovora Subsp. Atroseptica
[0267] Genomic DNA of Erwinia carotovora subsp. atroseptica (ATCC #: BAA-672D) was obtained from American Type Culture Collection (ATCC). The operon encoding the putative amino alcohol kinase (KA) and amino alcohol O-phosphate lyase (AT) was named KA-AT (SEQ ID NO:164. This operon was amplified from the Erwinia genomic DNA by Phusion DNA polymerase (Finnzymes; via New England Biolabs; Ipswich, Mass.) using primers OT872 (SEQ. ID. No. 127) and OT873 (SEQ. ID. No128). A DNA fragment of 2.4 kb was obtained by the PCR reaction, which corresponds to the size of the KA-AT operon. The PCR product was digested with EcoRI and PstI restriction enzymes, and cloned into vector pKK223-3 (Amersham Biosciences; Piscataway, N.J.) which was digested with the same restriction enzymes. This produced plasmid pKK223.KA-AT, which contained the putative Erwinia amino alcohol kinase-lyase operon under control of the tac promoter. Similarly, plasmids pKK223.KA and pKK223.AT were made which placed the putative Erwinia kinase and the putative Erwinia lyase coding regions in separate vectors, each under the control of the tac promoter. For the PCR cloning of the KA coding region (SEQ ID NO:123), primers OT872 (SEQ. ID. No. 127) and OT879 (SEQ. ID. No. 129) were used; and for the PCR cloning of AT coding region (SEQ ID NO:125), primers OT873 (SEQ. ID. No. 128) and OT880 (SEQ. ID. No. 130) were used in the PCR amplifications, which generated PCR products of 1.1 kb and 1.3 kb respectively. The PCR products were each digested with EcoRI and PstI, and ligated into vector pKK223-3 to generate pKK223.KA and pKK223.AT.
In Vivo Activity of the Putative Amino Alcohol Kinase and Putative Amino Alcohol O-Phosphate Lyase from Erwinia carotovora Subsp. Atroseptica
[0268] Plasmids pKK223.KA-AT, pKK223.KA, pKK223.AT and pKK223-3 were transformed into the E. coli MG1655 strain. The transformants were restreaked onto a MOPS minimal media plate containing 1% glucose, 0.5% aminopropanol as a sole nitrogen source, 1 mM IPTG and 100 μg/mL ampicillin. Expression of KA-AT, KA and AT genes were induced by the IPTG. A control plate had no IPTG included. The plates were incubated at 37° C. for 7 days. On the plate with IPTG, only the strain MG1655/pKK223.KA-AT grew, while all the other three strains did not grow. On the plate without added IPTG, the strain MG1655/pKK223.KA-AT grew, but the colonies were significantly smaller than those on the IPTG-containing plate, which corresponds to the lower expression levels of KA and AT in the uninduced cells. None of the other three strains grew on this plate. This indicates that the co-expression of the putative Erwinia KA and AT genes provided sufficient enzyme activities that allowed the E. coli strain MG1655/pKK223.KA-AT to utilize aminopropanol as a sole nitrogen source. Expression of each individual enzyme of either KA or AT was not sufficient to provide such enzyme activity in vivo.
Example 15
In Vitro Activity of Erwinia Putative Amino Alcohol Kinase and Amino Alcohol O-Phosphate Lyase
[0269] Subcloning of the Erwinia KA-AT Operon into the pBAD.HisB Vector and Induction of Protein Expression
[0270] The protein expression levels of Erwinia putative KA and AT enzymes expressed in MG1655 cells from the pKK223.KA-AT vector were analyzed by SDS-PAGE analysis. The expression level of the Erwinia AT enzyme was relatively low, with a new protein band detected at the correct molecular weight of 46 kD in the soluble fraction of a cell extract, while no new protein band was detected at the size predicted for the KA enzyme.
[0271] In an effort to improve the expression of the Erwinia putative KA and AT genes, the KA-AT operon was subcloned into the EcoRI and HindIII sites of vector pBAD.H isB-EcoRI. pBAD.H isB-EcoRI was derived from the pBAD.H isB vector (Invitrogen), by replacing the NcoI site in pBAD.H isB with an EcoRI site via QuickChange site-directed mutagenesis (Stratagene, La Jolla, Calif.) using primers OT909 (SEQ ID.#131) & OT910 (SEQ ID.#132). In the constructed plasmid pBAD.KA-AT, the KA-AT operon was placed directly under control of the araB promoter (without His-tag).
[0272] The pBAD.KA-AT plasmid was transformed into the E. coli TOP10 strain. A 50 mL culture of TOP10/pBAD.KA-AT strain was grown to mid log phase (0D600=0.6) in LB, 100 μg/mL ampicillin media at 37° C. with shaking at 250 rpm. The culture was induced by addition of L-arabinose to a final concentration of 0.1% (w/v), and it was further incubated at 37° C. for 5 h before harvesting by centrifugation. The cell pellet was resuspended in ice cold 50 mM Tris-HCl, pH 8.0, and disrupted by sonication on ice with a Fischer Sonic Model 300 Dismembrator (Fischer, Pittsburgh, Pa.) at 50% power, repeating four cycles of 30 seconds sonication with 60 seconds rest in-between each cycle. Each sonicated sample was centrifuged (15,000×g, 4 min, 4° C.). Clarified cell free extracts were analyzed for protein expression level and amino alcohol O-phosphate lyase activity.
Chemical Synthesis of Aminobutanol O-Phosphate and Aminopropanol O-Phosphate
[0273] The substrate (R,R)-3-amino-2-butanol O-phosphate was synthesized by a method based on that reported by Ferrari and Ferrari (U.S. Pat. No. 2,730,542 [1956]) for phosphoethanolamine: 10 mmol of H3PO4 in a 50% (w/v) aqueous solution was mixed with a 50% (w/v) solution of 3-amino-2-butanol (˜20:1 (R,R):(S,S) isomers; Bridge Organics; Vicksburg, Mich.) while stirring on ice. After mixing, the solution was slowly warmed to room temperature and then stirred under vacuum and heated to 70° C. After 1 h at 70° C., the temperature was slowly increased to 185° C. and maintained there for an additional 2 h. At that time, the reaction was cooled to room temperature and the vacuum released. The remaining material was dissolved in water, and analysis by NMR indicated that 80% of the starting material was converted to product with 20% remaining unreacted. No additional products were observed.
[0274] The additional substrates (2R,3S)-3-amino-2-butanol O-phosphate and (2S,3R)-3-amino-2-butanol O-phosphate were synthesized by the same procedure using a 1:1 mixture of (2R,3S)-3-amino-2-butanol and (2S,3R)-3-amino-2-butanol (synthesized as described in Example 13) as the starting material. DL-1-amino-2-propanol O-phosphate, (S)-2-amino-1-propanol O-phosphate, and (R)-2-amino-1-propanol O-phosphate were synthesized by the same procedure using DL-1-amino-2-propanol, (R)-2-amino-1-propanol, or (S)-2-amino-1-propanol as the starting material.
Analysis of the Aminopropanol O-Phosphate Lyase Activity Encoded by the Putative Erwinia KA-AT Operon
[0275] The aminopropanol O-phosphate lyase assay was performed as described by Jones et al. (1973, Biochem. J. 134:167-182) and G. Gori et al. (1995, Chromatographia 40:336) The formation of propionaldehyde from aminopropanol O-phosphate was assayed colorimetrically with MBTH, which allows the detection of aldehyde formation. The reaction was performed as follows. In a 1 mL reaction, 100 μg cell free extract of E. coli TOP10/pBAD.KA-AT was added to 10 mM DL-1-amino-2-propanol O-phosphate in 100 mM Tris-HCl, pH 7.8, with 0.1 mM PLP. The reaction was incubated at 37° C. for 10 min and 30 min, with an aliquot of 100 μL reaction mixture removed at each time point and mixed with 100 μL of 6 mg/mL MBTH in 375 mM glycine-HCl, pH 2.7. This mixture was incubated at 100° C. for 3 min, cooled on ice for 15-30 s, and 1 mL of 3.3 mg/mL FeCl3.6H2O (in 10 mM HCl) was added, followed by incubation for 30 min at room temperature. The absorbance of the reaction mixture which contains the aldehyde-MBTH adduct, was measured at 670 nm. The results of the assay are listed in Table 9. In the presence of the aminopropanol phosphate substrate, PLP and cell free extract, formation of aldehyde was detected, as indicated by an Abs670 that was higher than the control background of up to 0.3. In the absence of either the substrate or the cell free extract, no aldehyde formation was detected. In the absence of added PLP, somewhat less amount aldehyde was detected, presumably due to the presence of PLP in the cell free extract. Cell free extract of the uninduced TOP10/pBAD.KA-AT culture did not produce any detectable aldehyde in the reaction. These results indicated that the putative Erwinia amino alcohol O-phosphate lyase does catalyze the conversion of aminopropanol O-phosphate to propionaldehyde.
TABLE-US-00009 TABLE 9 Aminopropanol O-phosphate lyase assay. Enzyme Induction Aminopro- extract Sample by 0.1% panol O- (100 OD670, OD670, Number arabinose phosphate PLP μg/mL) 10 min 30 min 1 uninduced (+) (+) (+) 0.262 0.255 2 induced (+) (+) (+) 1.229 2.264 3 induced (-) (+) (+) 0.303 0.223 4 induced (+) (-) (+) 0.855 1.454 5 induced (+) (+) (-) 0.156 0.065 Sample 1 was the cell free extract of a non-induced control of E. coli TOP10/pBAD.KA-AT. Samples 2-5 contained the cell free extract of the induced culture E. coli TOP10/pBAD.KA-AT.
Analysis of the Activity of the Erwinia Amino Alcohol O-Phosphate Lyase Towards Aminobutanol O-Phosphate Substrate
[0276] The activity of the amino alcohol O-phosphate lyase towards the aminobutanol O-phosphate substrates was studied under the same conditions as described above. The reaction was carried out at 37° C. overnight in a 1 mL reaction that contained 100 μg of cell free extract of E. coli TOP10/pBAD.KA-AT, 10 mM aminobutanol O-phosphate (either the mixture of (R,R)+(S,S) or the mixture of (R,S)+(S,R) isomers described in Example 15) in 100 mM Tris-HCl, pH 7.8, with 0.1 mM PLP. An aliquot of 100 μL reaction mixture was removed and the 2-butanone product was detected using the MBTH derivatization method described in the General Methods. The two peaks representing the derivatized 2-butanone isomers were observed. Therefore the Erwinia amino alcohol O-phosphate lyase is an aminobutanol phosphate phospho-lyase in addition to an aminopropanol phosphate phospho-lyase.
Analysis of the Activity of the Erwinia Amino Alcohol O-Phosphate Lyase Towards Stereoisomers of Aminopropanol O-Phosphate and Aminobutanol O-Phosphate
[0277] The activity of the Erwinia amino alcohol O-phosphate lyase towards various stereoisomers of aminopropanol O-phosphate and aminobutanol O-phosphate was studied under the same conditions as described above. In the presence of the Erwinia amino alcohol O-phosphate lyase, both (R) and (S)-2-amino-1-propanol O-phosphate were converted to propanone by the enzyme, but the product yield was much higher with the (S) isomer. The enzyme also produced butanone from both mixtures of 3-amino)-2-butanol O-phosphate isomers, with a higher product yield found in the reaction containing the (R,S) and (S,R) substrate isomers. Both propanone and butanone products were derivatized by MBTH, and detected by HPLC as described in General Methods.
Optimization of the Gene Expression Level for the Erwinia Amino Alcohol Kinase and Amino Alcohol O-Phosphate Lyase
[0278] In order to improve the expression levels for the Erwinia amino alcohol kinase and the amino alcohol O-phosphate lyase in E. coli, codon optimized coding regions for both enzymes (named EKA: SEQ ID NO:155 and EAT: SEQ ID NO:156 respectively) were synthesized by DNA2.0 (Redwood City, Calif.). Each coding region was synthesized with 5' and 3' tails including restriction sites for cloning: EKA has 5' BbsI and 3' EcoRI, HindIII sites; EAT has 5' EcoRI and 3' HindIII sites. The EKA and EAT coding regions were provided from DNA2.0 as plasmids pEKA and pEAT, which were in the pJ51 vector of DNA2.0. The EKA optimized coding region was subcloned by ligating a BbsI and HindIII digested fragment of pEKA into the pBAD.HisB vector between the NcoI and HindIII sites, to generate plasmid pBAD.EKA. In the resulting plasmid the coding region is 5' to the His tag, so a coding region for an N-terminus His6 tag fused to the Erwinia amino alcohol kinase was constructed by performing a QuickChange site-directed mutagenesis reaction using primers SEQ ID NO:157 and SEQ ID NO:158 to generate vector pBAD.His-EKA.
[0279] pBAD.His-EKA was transformed into E. coli strain BL21-AI (F.sup.ompT hsdSB (rB.sup.- mB.sup.-) gal dcm araB::T7RNAP-tetA; Invitrogen to produce strain BL21-AI/pBAD.H isA-EKA. A 50 mL culture of BL21-AI/pBAD.H isA-EKA was grown to mid-log stage (0D600=0.6), induced with 0.1% arabinose, and further incubated at 30° C. overnight. Cell free extracts were prepared by sonication. The His6-tagged fusion protein of Erwinia amino alcohol kinase was purified using the ProBond® Purification System (Invitrogen) under non-denaturing purification conditions following the manufacturer's instructions.
[0280] Prophetic Result
[0281] The kinase activity of the His6-tagged Erwinia amino alcohol kinase is analyzed by the ADP Quest Assay (DiscoveRx, Fremont, Calif.) following the manufacture's instructions. This is a biochemical assay that measures the accumulation of ADP, a product of the amino alcohol kinase reaction using either aminopropanol or aminobutanol as substrate. 10 mM substrate is mixed with His6-tagged Erwinia amino alcohol kinase, in 100 mM Tris-HCl, pH 7.8, 10 mM MgCl2, 2 mM KCl, 0.1 mM ATP, and incubated at 37° C. for 1 h in a 0.2 mL reaction. ADP reagent A (100 μL) and ADP reagent B (200 μL) are added and the mixture is incubated at room temperature for 30 min. The fluorescence signal indicating activity is measured with excitation wavelength of 530 nm and emission wavelength of 590 nm.
Example 16
Expression of Entire Pathway 3
Construction of Vector pCLBudAB-ter-T5chnA
[0282] The vector pTrc99a::BudABC (described in Example 9) is digested with EcoRI, and the DNA is treated with Klenow DNA polymerase to blunt the ends. The blunted vector is subsequently digested with SpeI to yield a 2.5 kb fragment containing the budA and budB genes. The vector pCL1925-ter-T5chnA (described in Example 9) is digested with HindIII, and the DNA was treated with Klenow DNA polymerase to blunt the ends. The blunted vector is subsequently digested with XbaI to yield a 4.6 kb fragment which is then ligated to the budAB fragment from pTrc99a::BudABC. The resulting plasmid, designated pCLBudAB-ter-T5chnA, is used to transform E. coli Top10 cells, and single colonies are screened for proper plasmid structure by PCR using primers pCL1925vecF (SEQ ID NO:62) and N84seqR3 (SEQ ID NO:159). Plasmid is prepared from a single colony which yields a PCR product of the expected size of 1.4 kb.
Construction of Vector pKK223.KA-AT-APT
[0283] The APT gene is amplified from the vector pBAD.APT (described in Example 12) by PCR using primers APTfor (SEQ ID NO:162; 5' includes RBS and SmaI site) and APTrev (SEQ ID NO:163; 3' adds SmaI site). The product of expected size of 1.7 kbp is gel purified and digested with SmaI to yield blunt ends. The vector pKK223.KA-AT (described in Example 14) is digested with PstI, and the DNA is treated with Klenow DNA polymerase to blunt the ends. The resulting DNA fragment is ligated with the SmaI-digested PCR product, and the ligation product is used to transform E. coli Top10 cells. Individual ampicillin resistant colonies are screened by PCR using primers OT872 (SEQ ID NO:127) and APTrev (SEQ ID NO:163). The presence of a PCR product of the expected size of 4.1 kbp indicates that the gene encoding APT is present and oriented in the same direction as the genes encoding KA and AT. The sequence of the insert is verified using the primers APTseqRev (SEQ ID NO:160) and APTseqFor (SEQ ID NO:161). This plasmid is named pKK223.KA-AT-APT. Proper expression of all three genes is verified by growing a 5 mL culture of Top10/pKK223.KA-AT-APT in LB+100 μg/mL ampicillin at 37° C. with shaking. When the OD600 reaches ˜0.8, expression of the genes on the plasmid is induced by addition of IPTG to 0.4 mM. The expression is evaluated by SDS PAGE and activity assays as described above.
Construction of 2-Butanol Production Strain and Production of 2-Butanone and 2-Butanol
[0284] E. coli strain MG1655 is transformed with both pKK223.KA-AT-APT and pCLBudAB-ter-T5chnA, and transformants selected for ampicillin and spectinomycin resistance, indicative of the presence of the plasmids. The cells are inoculated into shake flasks (approximately 175 mL total volume) containing 50 or 150 mL of TM3a/glucose medium (with appropriate antibiotics) to represent medium and low oxygen conditions, respectively. IPTG is added to 0.4 mM to induce expression of genes from pKK223.KA-AT-APT. As a negative control, MG1655 cells are grown in the same medium lacking antibiotics. The flasks are inoculated at a starting OD600 of ≦0.01 and incubated at 34° C. with shaking at 300 rpm for 24 h. The flasks containing 50 mL of medium are capped with vented caps; the flasks containing 150 mL are capped with non-vented caps to minimize air exchange. The MG1655/pKK223.KA-AT-APT/pCLBudAB-ter-T5chnA strain comprising a 2-butanol biosynthetic pathway produces both 2-butanone and 2-butanol under low and medium oxygen conditions while the negative control strain does not produce detectable levels of either 2-butanone or 2-butanol.
Example 17
Characterization of Glycerol Dehydratase Butanediol Dehydratase Activity
[0285] Glycerol dehydratase (E.C. 4.2.1.30) and diol dehydratase (E.C. 4.2.1.28), while structurally related, are often distinguished in the art based on various differences that include substrate specificity. This example demonstrates that glycerol dehydratase converts meso-2,3-butanediol to 2-butanone. The recombinant E. coli strain KLP23/pSYCO12, comprising Klebsiella pneumoniae genes encoding the multiple subunits of glycerol dehydratase (alpha: SEQ ID NO:145 (coding region) and 146 (protein); beta: SEQ ID NO: 147 (coding region) and 148 (protein); and gamma: SEQ ID NO: 149 (coding region) and 150 (protein)) and Klebsiella pneumoniae genes encoding the multiple subunits of glycerol dehydratase reactivase (large subunit, SEQ ID NO: 151 (coding region) and 152 (protein); and small subunit, SEQ ID NO: 153 (coding region) and 154 (protein)), is described in Emptage et al. U.S. Pat. No. 6,514,733 and in WO 2003089621, which are herein incorporated by reference. A crude, cell free extract of KLP23/pSYCO12 was prepared by methods known to one skilled in the art. Enzyme assay was performed in the absence of light in 80 mM HEPES buffer, pH 8.2 at 37° C. with 12 μM coenzyme B12 and 10 mM meso-2,3-butanediol. The formation of 2-butanone was monitored by HPLC (Shodex SH-1011 column and SH-G guard column with refractive index detection; 0.01 M H2SO4 as the mobile phase at a flow rate of 0.5 mL/min and a column temperature of 50° C.; 2-butanone retention time=40.2 min). The rate of 2-butanone formation by the glycerol dehydratase preparation was determined to be 0.4 nmol/min/mg of crude protein.
Sequence CWU
1
1641780DNAKlebsiella pneumoniae 1atgaatcatt ctgctgaatg cacctgcgaa
gagagtctat gcgaaaccct gcgggcgttt 60tccgcgcagc atcccgagag cgtgctctat
cagacatcgc tcatgagcgc cctgctgagc 120ggggtttacg aaggcagcac caccatcgcg
gacctgctga aacacggcga tttcggcctc 180ggcaccttta atgagctgga cggggagctg
atcgccttca gcagtcaggt ctatcagctg 240cgcgccgacg gcagcgcgcg caaagcccag
ccggagcaga aaacgccgtt cgcggtgatg 300acctggttcc agccgcagta ccggaaaacc
tttgaccatc cggtgagccg ccagcagctg 360cacgaggtga tcgaccagca aatcccctct
gacaacctgt tctgcgccct gcgcatcgac 420ggccatttcc gccatgccca tacccgcacc
gtgccgcgcc agacgccgcc gtaccgggcg 480atgaccgacg tcctcgacga tcagccggtg
ttccgcttta accagcgcga aggggtgctg 540gtcggcttcc ggaccccgca gcatatgcag
gggatcaacg tcgccgggta tcacgagcac 600tttattaccg atgaccgcaa aggcggcggt
cacctgctgg attaccagct cgaccatggg 660gtgctgacct tcggcgaaat tcacaagctg
atgatcgacc tgcccgccga cagcgcgttc 720ctgcaggcta atctgcatcc cgataatctc
gatgccgcca tccgttccgt agaaagttaa 7802259PRTKlebsiella pneumoniae 2Met
Asn His Ser Ala Glu Cys Thr Cys Glu Glu Ser Leu Cys Glu Thr1
5 10 15Leu Arg Ala Phe Ser Ala Gln
His Pro Glu Ser Val Leu Tyr Gln Thr 20 25
30Ser Leu Met Ser Ala Leu Leu Ser Gly Val Tyr Glu Gly Ser
Thr Thr 35 40 45Ile Ala Asp Leu
Leu Lys His Gly Asp Phe Gly Leu Gly Thr Phe Asn 50 55
60Glu Leu Asp Gly Glu Leu Ile Ala Phe Ser Ser Gln Val
Tyr Gln Leu65 70 75
80Arg Ala Asp Gly Ser Ala Arg Lys Ala Gln Pro Glu Gln Lys Thr Pro
85 90 95Phe Ala Val Met Thr Trp
Phe Gln Pro Gln Tyr Arg Lys Thr Phe Asp 100
105 110His Pro Val Ser Arg Gln Gln Leu His Glu Val Ile
Asp Gln Gln Ile 115 120 125Pro Ser
Asp Asn Leu Phe Cys Ala Leu Arg Ile Asp Gly His Phe Arg 130
135 140His Ala His Thr Arg Thr Val Pro Arg Gln Thr
Pro Pro Tyr Arg Ala145 150 155
160Met Thr Asp Val Leu Asp Asp Gln Pro Val Phe Arg Phe Asn Gln Arg
165 170 175Glu Gly Val Leu
Val Gly Phe Arg Thr Pro Gln His Met Gln Gly Ile 180
185 190Asn Val Ala Gly Tyr His Glu His Phe Ile Thr
Asp Asp Arg Lys Gly 195 200 205Gly
Gly His Leu Leu Asp Tyr Gln Leu Asp His Gly Val Leu Thr Phe 210
215 220Gly Glu Ile His Lys Leu Met Ile Asp Leu
Pro Ala Asp Ser Ala Phe225 230 235
240Leu Gln Ala Asn Leu His Pro Asp Asn Leu Asp Ala Ala Ile Arg
Ser 245 250 255Val Glu
Ser31680DNAKlebsiella pneumoniae 3atggacaaac agtatccggt acgccagtgg
gcgcacggcg ccgatctcgt cgtcagtcag 60ctggaagctc agggagtacg ccaggtgttc
ggcatccccg gcgccaaaat tgacaaggtc 120ttcgactcac tgctggattc ctcgattcgc
attattccgg tacgccacga agccaacgcc 180gcgtttatgg ccgccgccgt cggacgcatt
accggcaaag cgggcgtggc gctggtcacc 240tccggtccgg gctgttccaa cctgatcacc
ggcatggcca ccgcgaacag cgaaggcgac 300ccggtggtgg ccctgggcgg cgcggtaaaa
cgcgccgata aagcgaagca ggtccaccag 360agtatggata cggtggcgat gttcagcccg
gtcaccaaat acgccgtcga ggtgacggcg 420ccggatgcgc tggcggaagt ggtctccaac
gccttccgcg ccgccgagca gggccggccg 480ggcagcgcgt tcgttagcct gccgcaggat
gtggtcgatg gcccggtcag cggcaaagtg 540ctgccggcca gcggggcccc gcagatgggc
gccgcgccgg atgatgccat cgaccaggtg 600gcgaagctta tcgcccaggc gaagaacccg
atcttcctgc tcggcctgat ggccagccag 660ccggaaaaca gcaaggcgct gcgccgtttg
ctggagacca gccatattcc agtcaccagc 720acctatcagg ccgccggagc ggtgaatcag
gataacttct ctcgcttcgc cggccgggtt 780gggctgttta acaaccaggc cggggaccgt
ctgctgcagc tcgccgacct ggtgatctgc 840atcggctaca gcccggtgga atacgaaccg
gcgatgtgga acagcggcaa cgcgacgctg 900gtgcacatcg acgtgctgcc cgcctatgaa
gagcgcaact acaccccgga tgtcgagctg 960gtgggcgata tcgccggcac tctcaacaag
ctggcgcaaa atatcgatca tcggctggtg 1020ctctccccgc aggcggcgga gatcctccgc
gaccgccagc accagcgcga gctgctggac 1080cgccgcggcg cgcagctgaa ccagtttgcc
ctgcatccgc tgcgcatcgt tcgcgccatg 1140caggacatcg tcaacagcga cgtcacgttg
accgtggaca tgggcagctt ccatatctgg 1200attgcccgct acctgtacag cttccgcgcc
cgtcaggtga tgatctccaa cggccagcag 1260accatgggcg tcgccctgcc ctgggctatc
ggcgcctggc tggtcaatcc tgagcgaaaa 1320gtggtctccg tctccggcga cggcggcttc
ctgcagtcga gcatggagct ggagaccgcc 1380gtccgcctga aagccaacgt actgcacctg
atctgggtcg ataacggcta caacatggtg 1440gccattcagg aagagaaaaa ataccagcgc
ctgtccggcg tcgagttcgg gccgatggat 1500tttaaagcct atgccgaatc cttcggcgcg
aaagggtttg ccgtggaaag cgccgaggcg 1560ctggagccga ccctgcacgc ggcgatggac
gtcgacggcc cggcggtggt ggccattccg 1620gtggattatc gcgataaccc gctgctgatg
ggccagctgc atctgagtca gattctgtaa 16804559PRTKlebsiella pneumoniae 4Met
Asp Lys Gln Tyr Pro Val Arg Gln Trp Ala His Gly Ala Asp Leu1
5 10 15Val Val Ser Gln Leu Glu Ala
Gln Gly Val Arg Gln Val Phe Gly Ile 20 25
30Pro Gly Ala Lys Ile Asp Lys Val Phe Asp Ser Leu Leu Asp
Ser Ser 35 40 45Ile Arg Ile Ile
Pro Val Arg His Glu Ala Asn Ala Ala Phe Met Ala 50 55
60Ala Ala Val Gly Arg Ile Thr Gly Lys Ala Gly Val Ala
Leu Val Thr65 70 75
80Ser Gly Pro Gly Cys Ser Asn Leu Ile Thr Gly Met Ala Thr Ala Asn
85 90 95Ser Glu Gly Asp Pro Val
Val Ala Leu Gly Gly Ala Val Lys Arg Ala 100
105 110Asp Lys Ala Lys Gln Val His Gln Ser Met Asp Thr
Val Ala Met Phe 115 120 125Ser Pro
Val Thr Lys Tyr Ala Val Glu Val Thr Ala Pro Asp Ala Leu 130
135 140Ala Glu Val Val Ser Asn Ala Phe Arg Ala Ala
Glu Gln Gly Arg Pro145 150 155
160Gly Ser Ala Phe Val Ser Leu Pro Gln Asp Val Val Asp Gly Pro Val
165 170 175Ser Gly Lys Val
Leu Pro Ala Ser Gly Ala Pro Gln Met Gly Ala Ala 180
185 190Pro Asp Asp Ala Ile Asp Gln Val Ala Lys Leu
Ile Ala Gln Ala Lys 195 200 205Asn
Pro Ile Phe Leu Leu Gly Leu Met Ala Ser Gln Pro Glu Asn Ser 210
215 220Lys Ala Leu Arg Arg Leu Leu Glu Thr Ser
His Ile Pro Val Thr Ser225 230 235
240Thr Tyr Gln Ala Ala Gly Ala Val Asn Gln Asp Asn Phe Ser Arg
Phe 245 250 255Ala Gly Arg
Val Gly Leu Phe Asn Asn Gln Ala Gly Asp Arg Leu Leu 260
265 270Gln Leu Ala Asp Leu Val Ile Cys Ile Gly
Tyr Ser Pro Val Glu Tyr 275 280
285Glu Pro Ala Met Trp Asn Ser Gly Asn Ala Thr Leu Val His Ile Asp 290
295 300Val Leu Pro Ala Tyr Glu Glu Arg
Asn Tyr Thr Pro Asp Val Glu Leu305 310
315 320Val Gly Asp Ile Ala Gly Thr Leu Asn Lys Leu Ala
Gln Asn Ile Asp 325 330
335His Arg Leu Val Leu Ser Pro Gln Ala Ala Glu Ile Leu Arg Asp Arg
340 345 350Gln His Gln Arg Glu Leu
Leu Asp Arg Arg Gly Ala Gln Leu Asn Gln 355 360
365Phe Ala Leu His Pro Leu Arg Ile Val Arg Ala Met Gln Asp
Ile Val 370 375 380Asn Ser Asp Val Thr
Leu Thr Val Asp Met Gly Ser Phe His Ile Trp385 390
395 400Ile Ala Arg Tyr Leu Tyr Ser Phe Arg Ala
Arg Gln Val Met Ile Ser 405 410
415Asn Gly Gln Gln Thr Met Gly Val Ala Leu Pro Trp Ala Ile Gly Ala
420 425 430Trp Leu Val Asn Pro
Glu Arg Lys Val Val Ser Val Ser Gly Asp Gly 435
440 445Gly Phe Leu Gln Ser Ser Met Glu Leu Glu Thr Ala
Val Arg Leu Lys 450 455 460Ala Asn Val
Leu His Leu Ile Trp Val Asp Asn Gly Tyr Asn Met Val465
470 475 480Ala Ile Gln Glu Glu Lys Lys
Tyr Gln Arg Leu Ser Gly Val Glu Phe 485
490 495Gly Pro Met Asp Phe Lys Ala Tyr Ala Glu Ser Phe
Gly Ala Lys Gly 500 505 510Phe
Ala Val Glu Ser Ala Glu Ala Leu Glu Pro Thr Leu His Ala Ala 515
520 525Met Asp Val Asp Gly Pro Ala Val Val
Ala Ile Pro Val Asp Tyr Arg 530 535
540Asp Asn Pro Leu Leu Met Gly Gln Leu His Leu Ser Gln Ile Leu545
550 5555771DNAKlebsiella pneumoniae 5atgaaaaaag
tcgcacttgt taccggcgcc ggccagggga ttggtaaagc tatcgccctt 60cgtctggtga
aggatggatt tgccgtggcc attgccgatt ataacgacgc caccgccaaa 120gcggtcgcct
cggaaatcaa ccaggccggc ggacacgccg tggcggtgaa agtggatgtc 180tccgaccgcg
atcaggtatt tgccgccgtt gaacaggcgc gcaaaacgct gggcggcttc 240gacgtcatcg
tcaataacgc cggtgtggca ccgtctacgc cgatcgagtc cattaccccg 300gagattgtcg
acaaagtcta caacatcaac gtcaaagggg tgatctgggg tattcaggcg 360gcggtcgagg
cctttaagaa agaggggcac ggcgggaaaa tcatcaacgc ctgttcccag 420gccggccacg
tcggcaaccc ggagctggcg gtgtatagct ccagtaaatt cgcggtacgc 480ggcttaaccc
agaccgccgc tcgcgacctc gcgccgctgg gcatcacggt caacggctac 540tgcccgggga
ttgtcaaaac gccaatgtgg gccgaaattg accgccaggt gtccgaagcc 600gccggtaaac
cgctgggcta cggtaccgcc gagttcgcca aacgcatcac tctcggtcgt 660ctgtccgagc
cggaagatgt cgccgcctgc gtctcctatc ttgccagccc ggattctgat 720tacatgaccg
gtcagtcgtt gctgatcgac ggcgggatgg tatttaacta a
7716256PRTKlebsiella pneumoniae 6Met Lys Lys Val Ala Leu Val Thr Gly Ala
Gly Gln Gly Ile Gly Lys1 5 10
15Ala Ile Ala Leu Arg Leu Val Lys Asp Gly Phe Ala Val Ala Ile Ala
20 25 30Asp Tyr Asn Asp Ala Thr
Ala Lys Ala Val Ala Ser Glu Ile Asn Gln 35 40
45Ala Gly Gly His Ala Val Ala Val Lys Val Asp Val Ser Asp
Arg Asp 50 55 60Gln Val Phe Ala Ala
Val Glu Gln Ala Arg Lys Thr Leu Gly Gly Phe65 70
75 80Asp Val Ile Val Asn Asn Ala Gly Val Ala
Pro Ser Thr Pro Ile Glu 85 90
95Ser Ile Thr Pro Glu Ile Val Asp Lys Val Tyr Asn Ile Asn Val Lys
100 105 110Gly Val Ile Trp Gly
Ile Gln Ala Ala Val Glu Ala Phe Lys Lys Glu 115
120 125Gly His Gly Gly Lys Ile Ile Asn Ala Cys Ser Gln
Ala Gly His Val 130 135 140Gly Asn Pro
Glu Leu Ala Val Tyr Ser Ser Ser Lys Phe Ala Val Arg145
150 155 160Gly Leu Thr Gln Thr Ala Ala
Arg Asp Leu Ala Pro Leu Gly Ile Thr 165
170 175Val Asn Gly Tyr Cys Pro Gly Ile Val Lys Thr Pro
Met Trp Ala Glu 180 185 190Ile
Asp Arg Gln Val Ser Glu Ala Ala Gly Lys Pro Leu Gly Tyr Gly 195
200 205Thr Ala Glu Phe Ala Lys Arg Ile Thr
Leu Gly Arg Leu Ser Glu Pro 210 215
220Glu Asp Val Ala Ala Cys Val Ser Tyr Leu Ala Ser Pro Asp Ser Asp225
230 235 240Tyr Met Thr Gly
Gln Ser Leu Leu Ile Asp Gly Gly Met Val Phe Asn 245
250 25571665DNAKlebsiella oxytoca 7atgagatcga
aaagatttga agcactggcg aaacgccctg tgaatcagga cggcttcgtt 60aaggagtgga
tcgaagaagg ctttatcgcg atggaaagcc cgaacgaccc aaaaccgtcg 120attaaaatcg
ttaacggcgc ggtgaccgag ctggacggga aaccggtaag cgattttgac 180ctgatcgacc
actttatcgc ccgctacggt atcaacctga accgcgccga agaagtgatg 240gcgatggatt
cggtcaagct ggccaacatg ctgtgcgatc cgaacgttaa acgcagcgaa 300atcgtcccgc
tgaccaccgc gatgacgccg gcgaaaattg tcgaagtggt ttcgcatatg 360aacgtcgtcg
agatgatgat ggcgatgcag aaaatgcgcg cccgccgcac cccgtcccag 420caggcgcacg
tcaccaacgt caaagataac ccggtacaga ttgccgccga cgccgccgaa 480ggggcatggc
gcggatttga cgaacaggaa accaccgttg cggtagcgcg ctatgcgccg 540ttcaacgcca
tcgcgctgct ggtgggctcg caggtaggcc gtccgggcgt gctgacgcag 600tgctcgctgg
aagaagccac cgagctgaag ctcggcatgc tgggccacac ctgctacgcc 660gaaaccatct
ccgtctacgg caccgagccg gtctttaccg acggcgacga cacgccgtgg 720tcgaagggct
tcctcgcctc gtcctacgcc tctcgcgggc tgaaaatgcg ctttacctcc 780ggctccggct
cggaagtgca gatgggctac gccgaaggca aatccatgct ttatctggaa 840gcgcgctgca
tctacatcac caaagccgcg ggcgtacagg gtctgcaaaa cggttccgta 900agctgcatcg
gcgtgccgtc tgcggtgcct tccggcattc gcgcggtgct ggcggaaaac 960ctgatctgtt
cgtcgctgga tctggagtgc gcctccagca acgaccagac cttcacccac 1020tccgatatgc
gtcgtaccgc gcgcctgctg atgcagttcc tgccgggcac cgactttatc 1080tcctccggtt
attccgcggt gccgaactac gacaacatgt tcgccggctc caacgaagat 1140gccgaagact
ttgacgacta caacgtcatc cagcgcgacc tgaaggtgga cggcggtttg 1200cgtccggttc
gcgaagagga cgtcatcgcc atccgtaaca aagccgcccg cgcgctgcag 1260gccgtgtttg
ccggaatggg gctgccgccg attaccgatg aagaagttga agccgcgacc 1320tacgcccacg
gttcgaaaga tatgccggag cgcaacatcg tcgaagacat caagttcgcc 1380caggaaatca
tcaataaaaa ccgcaacggt ctggaagtgg tgaaagcgct ggcgcagggc 1440ggattcaccg
acgtggccca ggacatgctc aacatccaga aagctaagct gaccggggac 1500tacctgcata
cctccgcgat tatcgtcggc gacgggcagg tgctgtcagc cgtcaacgac 1560gtcaacgact
atgccggtcc ggcaacgggc tatcgcctgc agggcgaacg ctgggaagag 1620attaaaaaca
tccctggcgc tcttgatccc aacgagattg attaa
16658554PRTKlebsiella oxytoca 8Met Arg Ser Lys Arg Phe Glu Ala Leu Ala
Lys Arg Pro Val Asn Gln1 5 10
15Asp Gly Phe Val Lys Glu Trp Ile Glu Glu Gly Phe Ile Ala Met Glu
20 25 30Ser Pro Asn Asp Pro Lys
Pro Ser Ile Lys Ile Val Asn Gly Ala Val 35 40
45Thr Glu Leu Asp Gly Lys Pro Val Ser Asp Phe Asp Leu Ile
Asp His 50 55 60Phe Ile Ala Arg Tyr
Gly Ile Asn Leu Asn Arg Ala Glu Glu Val Met65 70
75 80Ala Met Asp Ser Val Lys Leu Ala Asn Met
Leu Cys Asp Pro Asn Val 85 90
95Lys Arg Ser Glu Ile Val Pro Leu Thr Thr Ala Met Thr Pro Ala Lys
100 105 110Ile Val Glu Val Val
Ser His Met Asn Val Val Glu Met Met Met Ala 115
120 125Met Gln Lys Met Arg Ala Arg Arg Thr Pro Ser Gln
Gln Ala His Val 130 135 140Thr Asn Val
Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala Glu145
150 155 160Gly Ala Trp Arg Gly Phe Asp
Glu Gln Glu Thr Thr Val Ala Val Ala 165
170 175Arg Tyr Ala Pro Phe Asn Ala Ile Ala Leu Leu Val
Gly Ser Gln Val 180 185 190Gly
Arg Pro Gly Val Leu Thr Gln Cys Ser Leu Glu Glu Ala Thr Glu 195
200 205Leu Lys Leu Gly Met Leu Gly His Thr
Cys Tyr Ala Glu Thr Ile Ser 210 215
220Val Tyr Gly Thr Glu Pro Val Phe Thr Asp Gly Asp Asp Thr Pro Trp225
230 235 240Ser Lys Gly Phe
Leu Ala Ser Ser Tyr Ala Ser Arg Gly Leu Lys Met 245
250 255Arg Phe Thr Ser Gly Ser Gly Ser Glu Val
Gln Met Gly Tyr Ala Glu 260 265
270Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Tyr Ile Thr Lys
275 280 285Ala Ala Gly Val Gln Gly Leu
Gln Asn Gly Ser Val Ser Cys Ile Gly 290 295
300Val Pro Ser Ala Val Pro Ser Gly Ile Arg Ala Val Leu Ala Glu
Asn305 310 315 320Leu Ile
Cys Ser Ser Leu Asp Leu Glu Cys Ala Ser Ser Asn Asp Gln
325 330 335Thr Phe Thr His Ser Asp Met
Arg Arg Thr Ala Arg Leu Leu Met Gln 340 345
350Phe Leu Pro Gly Thr Asp Phe Ile Ser Ser Gly Tyr Ser Ala
Val Pro 355 360 365Asn Tyr Asp Asn
Met Phe Ala Gly Ser Asn Glu Asp Ala Glu Asp Phe 370
375 380Asp Asp Tyr Asn Val Ile Gln Arg Asp Leu Lys Val
Asp Gly Gly Leu385 390 395
400Arg Pro Val Arg Glu Glu Asp Val Ile Ala Ile Arg Asn Lys Ala Ala
405 410 415Arg Ala Leu Gln Ala
Val Phe Ala Gly Met Gly Leu Pro Pro Ile Thr 420
425 430Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala His Gly
Ser Lys Asp Met 435 440 445Pro Glu
Arg Asn Ile Val Glu Asp Ile Lys Phe Ala Gln Glu Ile Ile 450
455 460Asn Lys Asn Arg Asn Gly Leu Glu Val Val Lys
Ala Leu Ala Gln Gly465 470 475
480Gly Phe Thr Asp Val Ala Gln Asp Met Leu Asn Ile Gln Lys Ala Lys
485 490 495Leu Thr Gly Asp
Tyr Leu His Thr Ser Ala Ile Ile Val Gly Asp Gly 500
505 510Gln Val Leu Ser Ala Val Asn Asp Val Asn Asp
Tyr Ala Gly Pro Ala 515 520 525Thr
Gly Tyr Arg Leu Gln Gly Glu Arg Trp Glu Glu Ile Lys Asn Ile 530
535 540Pro Gly Ala Leu Asp Pro Asn Glu Ile
Asp545 5509675DNAKlebsiella oxytoca 9atggaaatta
atgaaaaatt gctgcgccag ataattgaag acgtgctcag cgagatgaag 60ggcagcgata
aaccggtctc gtttaatgcg ccggcggcct ccgcggcgcc ccaggccacg 120ccgcccgccg
gcgacggctt cctgacggaa gtgggcgaag cgcgtcaggg aacccagcag 180gacgaagtga
ttatcgccgt cggcccggct ttcggcctgg cgcagaccgt caatatcgtc 240ggcatcccgc
ataagagcat tttgcgcgaa gtcattgccg gtattgaaga agaaggcatt 300aaggcgcgcg
tgattcgctg ctttaaatcc tccgacgtgg ccttcgtcgc cgttgaaggt 360aatcgcctga
gcggctccgg catctctatc ggcatccagt cgaaaggcac cacggtgatc 420caccagcagg
ggctgccgcc gctctctaac ctggagctgt tcccgcaggc gccgctgctg 480accctggaaa
cctatcgcca gatcggcaaa aacgccgccc gctatgcgaa acgcgaatcg 540ccgcagccgg
tcccgacgct gaatgaccag atggcgcggc cgaagtacca ggcgaaatcg 600gccattttgc
acattaaaga gaccaagtac gtggtgacgg gcaaaaaccc gcaggaactg 660cgcgtggcgc
tttga
67510224PRTKlebsiella oxytoca 10Met Glu Ile Asn Glu Lys Leu Leu Arg Gln
Ile Ile Glu Asp Val Leu1 5 10
15Ser Glu Met Lys Gly Ser Asp Lys Pro Val Ser Phe Asn Ala Pro Ala
20 25 30Ala Ser Ala Ala Pro Gln
Ala Thr Pro Pro Ala Gly Asp Gly Phe Leu 35 40
45Thr Glu Val Gly Glu Ala Arg Gln Gly Thr Gln Gln Asp Glu
Val Ile 50 55 60Ile Ala Val Gly Pro
Ala Phe Gly Leu Ala Gln Thr Val Asn Ile Val65 70
75 80Gly Ile Pro His Lys Ser Ile Leu Arg Glu
Val Ile Ala Gly Ile Glu 85 90
95Glu Glu Gly Ile Lys Ala Arg Val Ile Arg Cys Phe Lys Ser Ser Asp
100 105 110Val Ala Phe Val Ala
Val Glu Gly Asn Arg Leu Ser Gly Ser Gly Ile 115
120 125Ser Ile Gly Ile Gln Ser Lys Gly Thr Thr Val Ile
His Gln Gln Gly 130 135 140Leu Pro Pro
Leu Ser Asn Leu Glu Leu Phe Pro Gln Ala Pro Leu Leu145
150 155 160Thr Leu Glu Thr Tyr Arg Gln
Ile Gly Lys Asn Ala Ala Arg Tyr Ala 165
170 175Lys Arg Glu Ser Pro Gln Pro Val Pro Thr Leu Asn
Asp Gln Met Ala 180 185 190Arg
Pro Lys Tyr Gln Ala Lys Ser Ala Ile Leu His Ile Lys Glu Thr 195
200 205Lys Tyr Val Val Thr Gly Lys Asn Pro
Gln Glu Leu Arg Val Ala Leu 210 215
22011522DNAKlebsiella oxytoca 11atgaataccg acgcaattga atcgatggta
cgcgacgtat tgagccgcat gaacagcctg 60cagggcgagg cgcctgcggc ggctccggcg
gctggcggcg cgtcccgtag cgccagggtc 120agcgactacc cgctggcgaa caagcacccg
gaatgggtga aaaccgccac caataaaacg 180ctggacgact ttacgctgga aaacgtgctg
agcaataaag tcaccgccca ggatatgcgt 240attaccccgg aaaccctgcg cttacaggct
tctattgcca aagacgcggg ccgcgaccgg 300ctggcgatga acttcgagcg cgccgccgag
ctgaccgcgg taccggacga tcgcattctt 360gaaatctaca acgccctccg cccctatcgc
tcgacgaaag aggagctgct ggcgatcgcc 420gacgatctcg aaagccgcta tcaggcgaag
atttgcgccg ctttcgttcg cgaagcggcc 480acgctgtacg tcgagcgtaa aaaactcaaa
ggcgacgatt aa 52212173PRTKlebsiella oxytoca 12Met
Asn Thr Asp Ala Ile Glu Ser Met Val Arg Asp Val Leu Ser Arg1
5 10 15Met Asn Ser Leu Gln Gly Glu
Ala Pro Ala Ala Ala Pro Ala Ala Gly 20 25
30Gly Ala Ser Arg Ser Ala Arg Val Ser Asp Tyr Pro Leu Ala
Asn Lys 35 40 45His Pro Glu Trp
Val Lys Thr Ala Thr Asn Lys Thr Leu Asp Asp Phe 50 55
60Thr Leu Glu Asn Val Leu Ser Asn Lys Val Thr Ala Gln
Asp Met Arg65 70 75
80Ile Thr Pro Glu Thr Leu Arg Leu Gln Ala Ser Ile Ala Lys Asp Ala
85 90 95Gly Arg Asp Arg Leu Ala
Met Asn Phe Glu Arg Ala Ala Glu Leu Thr 100
105 110Ala Val Pro Asp Asp Arg Ile Leu Glu Ile Tyr Asn
Ala Leu Arg Pro 115 120 125Tyr Arg
Ser Thr Lys Glu Glu Leu Leu Ala Ile Ala Asp Asp Leu Glu 130
135 140Ser Arg Tyr Gln Ala Lys Ile Cys Ala Ala Phe
Val Arg Glu Ala Ala145 150 155
160Thr Leu Tyr Val Glu Arg Lys Lys Leu Lys Gly Asp Asp
165 170131041DNARhodococcus ruber 13atgaaagccc
tccagtacac cgagatcggc tccgagccgg tcgtcgtcga cgtccccacc 60ccggcgcccg
ggccgggtga gatcctgctg aaggtcaccg cggccggctt gtgccactcg 120gacatcttcg
tgatggacat gccggcagag cagtacatct acggtcttcc cctcaccctc 180ggccacgagg
gcgtcggcac cgtcgccgaa ctcggcgccg gcgtcaccgg attcgagacg 240ggggacgccg
tcgccgtgta cgggccgtgg gggtgcggtg cgtgccacgc gtgcgcgcgc 300ggccgggaga
actactgcac ccgcgccgcc gagctgggca tcaccccgcc cggtctcggc 360tcgcccgggt
cgatggccga gtacatgatc gtcgactcgg cgcgccacct cgtcccgatc 420ggggacctcg
accccgtcgc ggcggttccg ctcaccgacg cgggcctgac gccgtaccac 480gcgatctcgc
gggtcctgcc cctgctggga cccggctcga ccgcggtcgt catcggggtc 540ggcggactcg
ggcacgtcgg catccagatc ctgcgcgccg tcagcgcggc ccgcgtgatc 600gccgtcgatc
tcgacgacga ccgactcgcg ctcgcccgcg aggtcggcgc cgacgcggcg 660gtgaagtcgg
gcgccggggc ggcggacgcg atccgggagc tgaccggcgg tgagggcgcg 720acggcggtgt
tcgacttcgt cggcgcccag tcgacgatcg acacggcgca gcaggtggtc 780gcgatcgacg
ggcacatctc ggtggtcggc atccatgccg gcgcccacgc caaggtcggc 840ttcttcatga
tcccgttcgg cgcgtccgtc gtgacgccgt actggggcac gcggtccgag 900ctgatggacg
tcgtggacct ggcccgtgcc ggccggctcg acatccacac cgagacgttc 960accctcgacg
agggacccac ggcctaccgg cggctacgcg agggcagcat ccgcggccgc 1020ggggtggtcg
tcccgggctg a
104114346PRTKlebsiella oxytoca 14Met Lys Ala Leu Gln Tyr Thr Glu Ile Gly
Ser Glu Pro Val Val Val1 5 10
15Asp Val Pro Thr Pro Ala Pro Gly Pro Gly Glu Ile Leu Leu Lys Val
20 25 30Thr Ala Ala Gly Leu Cys
His Ser Asp Ile Phe Val Met Asp Met Pro 35 40
45Ala Glu Gln Tyr Ile Tyr Gly Leu Pro Leu Thr Leu Gly His
Glu Gly 50 55 60Val Gly Thr Val Ala
Glu Leu Gly Ala Gly Val Thr Gly Phe Glu Thr65 70
75 80Gly Asp Ala Val Ala Val Tyr Gly Pro Trp
Gly Cys Gly Ala Cys His 85 90
95Ala Cys Ala Arg Gly Arg Glu Asn Tyr Cys Thr Arg Ala Ala Glu Leu
100 105 110Gly Ile Thr Pro Pro
Gly Leu Gly Ser Pro Gly Ser Met Ala Glu Tyr 115
120 125Met Ile Val Asp Ser Ala Arg His Leu Val Pro Ile
Gly Asp Leu Asp 130 135 140Pro Val Ala
Ala Val Pro Leu Thr Asp Ala Gly Leu Thr Pro Tyr His145
150 155 160Ala Ile Ser Arg Val Leu Pro
Leu Leu Gly Pro Gly Ser Thr Ala Val 165
170 175Val Ile Gly Val Gly Gly Leu Gly His Val Gly Ile
Gln Ile Leu Arg 180 185 190Ala
Val Ser Ala Ala Arg Val Ile Ala Val Asp Leu Asp Asp Asp Arg 195
200 205Leu Ala Leu Ala Arg Glu Val Gly Ala
Asp Ala Ala Val Lys Ser Gly 210 215
220Ala Gly Ala Ala Asp Ala Ile Arg Glu Leu Thr Gly Gly Glu Gly Ala225
230 235 240Thr Ala Val Phe
Asp Phe Val Gly Ala Gln Ser Thr Ile Asp Thr Ala 245
250 255Gln Gln Val Val Ala Ile Asp Gly His Ile
Ser Val Val Gly Ile His 260 265
270Ala Gly Ala His Ala Lys Val Gly Phe Phe Met Ile Pro Phe Gly Ala
275 280 285Ser Val Val Thr Pro Tyr Trp
Gly Thr Arg Ser Glu Leu Met Asp Val 290 295
300Val Asp Leu Ala Arg Ala Gly Arg Leu Asp Ile His Thr Glu Thr
Phe305 310 315 320Thr Leu
Asp Glu Gly Pro Thr Ala Tyr Arg Arg Leu Arg Glu Gly Ser
325 330 335Ile Arg Gly Arg Gly Val Val
Val Pro Gly 340 3451529DNAArtificial
SequencePrimer 15caccatggac aaacagtatc cggtacgcc
291625DNAArtificial SequencePrimer 16cgaagggcga tagctttacc
aatcc 251732DNAArtificial
SequencePrimer 17caccatgaat cattctgctg aatgcacctg cg
321822DNAArtificial SequencePrimer 18gatactgttt gtccatgtga
cc 221928DNAArtificial
SequencePrimer 19caccatgaaa aaagtcgcac ttgttacc
282015DNAArtificial SequencePrimer 20ttagttaaat accat
152123DNAArtificial
SequencePrimer 21caccatgaga tcgaaaagat ttg
232222DNAArtificial SequencePrimer 22cttagagaag ttaatcgtcg
cc 222325DNAArtificial
SequencePrimer 23caccatgaaa gccctccagt acacc
252418DNAArtificial SequencePrimer 24cgtcgtgtca tgcccggg
182536DNAArtificial
SequencePrimer 25gatcgaattc gtttaaactt agttttctac cgcacg
362634DNAArtificial SequencePrimer 26gatcgcatgc aagctttcat
atagtcggaa ttcc 342743DNAArtificial
SequencePrimer 27gatcgaattc gtttaaacaa aggaggtctg attcatgaga tcg
432822DNAArtificial SequencePrimer 28gatcggattc ttaatcgtcg
cc 222936DNAArtificial
SequencePrimer 29gatcggatcc aaaggaggtc gggcgcatga aagccc
363032DNAArtificial SequencePrimer 30gatctctaga aagctttcag
cccgggacga cc 323121DNAArtificial
SequencePrimer 31actttctttc gcctgtttca c
213279DNAArtificial SequencePrimer 32catgaagctt gtttaaactc
ggtgaccttg aaaataatga aaacttatat tgttttgaaa 60ataatgaaaa cttatattg
793339DNAArtificial
SequencePrimer BABC F 33gagctcgaat tcaaaggagg aagtgtatat gaatcattc
393435DNAArtificial SequencePrimer BAB R 34ggatcctcta
gaattagtta aataccatcc cgccg
353517DNAArtificial SequencePrimer M13 Forward 35gtaaaacgac ggccagt
173616DNAArtificial
SequencePrimer M13 Reverse 36aacagctatg accatg
163720DNAArtificial SequencePrimer N83 SeqF2
37gctggattac cagctcgacc
203820DNAArtificial SequencePrimer N83SeqF3 38cggacgcatt accggcaaag
203920DNAArtificial
SequencePrimer N84 SeqR4 39cgaagcgaga gaagttatcc
204038DNAArtificial SequencePrimer BC Spe F
40actagtaaag gaggaaagag tatgaagaag gtcgcact
384126DNAArtificial SequencePrimer BC Xba R 41tctagaaagc aggggcaagc
catgtc 264220DNAArtificial
SequencePrimer Trc F 42ttgacaatta atcatccggc
204320DNAArtificial SequencePrimer Trc R 43cttctctcat
ccgccaaaac
204438DNAArtificial SequencePrimer DDo For 44aagcttaaag gaggctgatt
catgagatcg aaaagatt 384527DNAArtificial
SequencePrimer DDo Rev 45tctagattat tcatcctgct gttctcc
274622DNAArtificial SequencePrimer DDko seq F2
46gcatggcgcg gatttgacga ac
224722DNAArtificial SequencePrimer DDko seq F5 47cattaaagag accaagtacg tg
224824DNAArtificial
SequencePrimer DDko seq F7 48atatcctggt ggtgtcgtcg gcgt
244922DNAArtificial SequencePrimer DDko seq F9
49tctttgtcac caacgccctg cg
225022DNAArtificial SequencePrimer DDko seq R1 50gcccaccgcg ctcgccgccg cg
225122DNAArtificial
SequencePrimer DDko seq R3 51cccccaggat ggcggcttcg gc
225222DNAArtificial SequencePrimer DDko seq R7
52gggccgacgg cgataatcac tt
225322DNAArtificial SequencePrimer DDko seq R10 53ttcttcgatc cactccttaa
cg 225456DNAArtificial
SequencePrimer ChnA F 54catcaattga ctacgtagtc gtacgtgtaa ggaggtttga
aatggaaaaa attatg 565540DNAArtificial SequencePrimer ChnA R
55catgctagcc ccgggtatct tctactcatt ttttatttcg
405622DNAArtificial SquencePrimer chnSeq F1 56ctcaacaggg tgtaagtgta gt
225722DNAArtificial
SequencePrimer chnSeq R1 57cgttttgata tagccaggat gt
225835DNAArtificial SequencePrimer Top ter F1
58ctagaagtca aaagcctccg accggaggct tttga
355960DNAArtificial SequencePrimer Top ter F2 59ctgctcgagt tgctagcaag
tttaaacaaa aaaaagcccg ctcattaggc gggctgagct 606037DNAArtificial
SequencePrimer Bot ter R1 60cagcccgcct aatgagcggg cttttttttg tttaaac
376150DNAArtificial SequencePrimer Bot ter R2
61ttgctagcaa ctcgagcagt caaaagcctc cggtcggagg cttttgactt
506222DNAArtificial SequencePrimer pCL1925 vec F 62cggtatcatc aacaggctta
cc 226322DNAArtificial
SequencePrimer pCL1925 vec R1 63agggttttcc cagtcacgac gt
226422DNAArtificial SequencePrimer pCL1925
vec R2 64cgcaatagtt ggcgaagtaa tc
226520DNAArtificial SequencePrimer N84 Seq R2 65gcatcgagat
tatcgggatg
2066208DNAEscherichia coli 66atcgcccgca ttcttgccgc atcttccccc ggcgtcacac
cgaagtaacg tttaaactca 60cggctgtgta ggctggagct gcttcgaagt tcctatactt
tctagagaat aggaacttcg 120gaataggaac taaggaggat attcatatga ttacgttgga
tgtcagccgc cgtatatacg 180aagccgcccg ctaagctttt tacgcctc
2086742DNAArtificial SquencePromoter 1.6GI Variant
67gcccttgaca atgccacatc ctgagcaaat aattcaacca ct
426842DNAArtificial SequencePromoter 1.5 GI 68gcccttgact atgccacatc
ctgagcaaat aattcaacca ct 42693240DNAKlebsiella
oxytoca 69ggcgcggtcc gccaggcggt cacctccgcg cgcgaaatcg gcaaaaccgt
ccttgcgacc 60ctcggtgctg aaccgaaaaa cgatcgcccg tcctacatct gatacccacg
aggctgattc 120atgagatcga aaagatttga agcactggcg aaacgccctg tgaatcagga
cggcttcgtt 180aaggagtgga tcgaagaagg ctttatcgcg atggaaagcc cgaacgaccc
aaaaccgtcg 240attaaaatcg ttaacggcgc ggtgaccgag ctggacggga aaccggtaag
cgattttgac 300ctgatcgacc actttatcgc ccgctacggt atcaacctga accgcgccga
agaagtgatg 360gcgatggatt cggtcaagct ggccaacatg ctgtgcgatc cgaacgttaa
acgcagcgaa 420atcgtcccgc tgaccaccgc gatgacgccg gcgaaaattg tcgaagtggt
ttcgcatatg 480aacgtcgtcg agatgatgat ggcgatgcag aaaatgcgcg cccgccgcac
cccgtcccag 540caggcgcacg tcaccaacgt caaagataac ccggtacaga ttgccgccga
cgccgccgaa 600ggggcatggc gcggatttga cgaacaggaa accaccgttg cggtagcgcg
ctatgcgccg 660ttcaacgcca tcgcgctgct ggtgggctcg caggtaggcc gtccgggcgt
gctgacgcag 720tgctcgctgg aagaagccac cgagctgaag ctcggcatgc tgggccacac
ctgctacgcc 780gaaaccatct ccgtctacgg caccgagccg gtctttaccg acggcgacga
cacgccgtgg 840tcgaagggct tcctcgcctc gtcctacgcc tctcgcgggc tgaaaatgcg
ctttacctcc 900ggctccggct cggaagtgca gatgggctac gccgaaggca aatccatgct
ttatctggaa 960gcgcgctgca tctacatcac caaagccgcg ggcgtacagg gtctgcaaaa
cggttccgta 1020agctgcatcg gcgtgccgtc tgcggtgcct tccggcattc gcgcggtgct
ggcggaaaac 1080ctgatctgtt cgtcgctgga tctggagtgc gcctccagca acgaccagac
cttcacccac 1140tccgatatgc gtcgtaccgc gcgcctgctg atgcagttcc tgccgggcac
cgactttatc 1200tcctccggtt attccgcggt gccgaactac gacaacatgt tcgccggctc
caacgaagat 1260gccgaagact ttgacgacta caacgtcatc cagcgcgacc tgaaggtgga
cggcggtttg 1320cgtccggttc gcgaagagga cgtcatcgcc atccgtaaca aagccgcccg
cgcgctgcag 1380gccgtgtttg ccggaatggg gctgccgccg attaccgatg aagaagttga
agccgcgacc 1440tacgcccacg gttcgaaaga tatgccggag cgcaacatcg tcgaagacat
caagttcgcc 1500caggaaatca tcaataaaaa ccgcaacggt ctggaagtgg tgaaagcgct
ggcgcagggc 1560ggattcaccg acgtggccca ggacatgctc aacatccaga aagctaagct
gaccggggac 1620tacctgcata cctccgcgat tatcgtcggc gacgggcagg tgctgtcagc
cgtcaacgac 1680gtcaacgact atgccggtcc ggcaacgggc tatcgcctgc agggcgaacg
ctgggaagag 1740attaaaaaca tccctggcgc tcttgatccc aacgagattg attaaggggt
gagaaatgga 1800aattaatgaa aaattgctgc gccagataat tgaagacgtg ctcagcgaga
tgaagggcag 1860cgataaaccg gtctcgttta atgcgccggc ggcctccgcg gcgccccagg
ccacgccgcc 1920cgccggcgac ggcttcctga cggaagtggg cgaagcgcgt cagggaaccc
agcaggacga 1980agtgattatc gccgtcggcc cggctttcgg cctggcgcag accgtcaata
tcgtcggcat 2040cccgcataag agcattttgc gcgaagtcat tgccggtatt gaagaagaag
gcattaaggc 2100gcgcgtgatt cgctgcttta aatcctccga cgtggccttc gtcgccgttg
aaggtaatcg 2160cctgagcggc tccggcatct ctatcggcat ccagtcgaaa ggcaccacgg
tgatccacca 2220gcaggggctg ccgccgctct ctaacctgga gctgttcccg caggcgccgc
tgctgaccct 2280ggaaacctat cgccagatcg gcaaaaacgc cgcccgctat gcgaaacgcg
aatcgccgca 2340gccggtcccg acgctgaatg accagatggc gcggccgaag taccaggcga
aatcggccat 2400tttgcacatt aaagagacca agtacgtggt gacgggcaaa aacccgcagg
aactgcgcgt 2460ggcgctttga taaaggataa ctccatgaat accgacgcaa ttgaatcgat
ggtacgcgac 2520gtattgagcc gcatgaacag cctgcagggc gaggcgcctg cggcggctcc
ggcggctggc 2580ggcgcgtccc gtagcgccag ggtcagcgac tacccgctgg cgaacaagca
cccggaatgg 2640gtgaaaaccg ccaccaataa aacgctggac gactttacgc tggaaaacgt
gctgagcaat 2700aaagtcaccg cccaggatat gcgtattacc ccggaaaccc tgcgcttaca
ggcttctatt 2760gccaaagacg cgggccgcga ccggctggcg atgaacttcg agcgcgccgc
cgagctgacc 2820gcggtaccgg acgatcgcat tcttgaaatc tacaacgccc tccgccccta
tcgctcgacg 2880aaagaggagc tgctggcgat cgccgacgat ctcgaaagcc gctatcaggc
gaagatttgc 2940gccgctttcg ttcgcgaagc ggccacgctg tacgtcgagc gtaaaaaact
caaaggcgac 3000gattaacttc tctaagtaat tcgagatgca ttgaggcggc aagtgagtga
caaattcgtc 3060tggaacgaat ttgaacagcc ataggctggc tttagtgagg gacagggatg
tccctcataa 3120ccccgatgag cttactgtag taagtgattc gggtgaaaga acgcagccaa
caaaaaggca 3180gtttgaagta cgacgagaaa aggggcatgt gatgcgatat atagctggca
ttgatatcgg 3240702640DNAKlebsiella oxytoca 70acgtcgagcg taaaaaactc
aaaggcgacg attaacttct ctaagtaatt cgagatgcat 60tgaggcggca agtgagtgac
aaattcgtct ggaacgaatt tgaacagcca taggctggct 120ttagtgaggg acagggatgt
ccctcataac cccgatgagc ttactgtagt aagtgattcg 180ggtgaaagaa cgcagccaac
aaaaaggcag tttgaagtac gacgagaaaa ggggcatgtg 240atgcgatata tagctggcat
tgatatcggc aactcatcga cggaagtcgc cctggcgacc 300ctggatgagg ctggcgcgct
gacgatcacc cacagcgcgc tggcggaaac caccggaatc 360aaaggcacgt tgcgtaacgt
gttcgggatt caggaggcgc tcgccctcgt cgccagaggc 420gccgggatcg ccgtcagcga
tatttcgctc atccgcatca acgaagcgac gccggtgatt 480ggcgatgtgg cgatggaaac
cattaccgaa accatcatca ccgaatcgac catgatcggc 540cataacccga aaacgcccgg
cggcgcgggg cttggcacag gcatcaccat tacgccgcag 600gagctgctaa cccgcccggc
ggacgcgccc tatatcctgg tggtgtcgtc ggcgttcgat 660tttgccgata tcgccagcgt
gattaacgct tccctgcgcg ccgggtatca gattaccggc 720gtcattttac agcgcgacga
tggcgtgctg gtcagcaacc ggctggaaaa accgctgccg 780atcgttgacg aagtgctgta
catcgaccgc attccgctgg ggatgctggc ggcgattgag 840gtcgccgttc cggggaaggt
catcgaaacc ctctctaacc cttacggcat cgccaccgtc 900tttaacctca gccccgagga
gacgaagaac atcgtcccga tggcccgggc gctgattggc 960aaccgttccg ccgtggtggt
caaaacgcca tccggcgacg tcaaagcgcg cgcgataccc 1020gccggtaatc ttgagctgct
ggcccagggc cgtagcgtgc gcgtggatgt ggccgccggc 1080gccgaagcca tcatgaaagc
ggtcgacggc tgcggcaggc tcgataacgt caccggcgaa 1140tccggcacca atatcggcgg
catgctggaa cacgtgcgcc agaccatggc cgagctgacc 1200aacaagccga gcagcgaaat
atttattcag gacctgctgg ccgttgatac ctcggtaccg 1260gtgagcgtta ccggcggtct
ggccggggag ttctcgctgg agcaggccgt gggcatcgcc 1320tcgatggtga aatcggatcg
cctgcagatg gcaatgatcg cccgcgaaat cgagcagaag 1380ctcaatatcg acgtgcagat
cggcggcgca gaggccgaag ccgccatcct gggggcgctg 1440accacgccgg gcaccacccg
accgctggcg atcctcgacc tcggcgcggg ctccaccgat 1500gcctccatca tcaaccccaa
aggcgacatc atcgccaccc atctcgccgg cgcaggcgac 1560atggtgacga tgattattgc
ccgcgagctg gggctggaag accgctatct ggcggaagag 1620atcaagaagt acccgctggc
taaggtggaa agcctgttcc atttacgcca cgaggacggc 1680agcgtgcagt tcttctccac
gccgctgccg cccgccgtgt tcgcccgcgt ctgcgtggtg 1740aaagcggacg aactggtgcc
gctgcccggc gatttagcgc tggaaaaagt gcgcgccatt 1800cgccgcagcg ccaaagagcg
ggtctttgtc accaacgccc tgcgcgcgct gcgtcaggtc 1860agccccaccg gcaacattcg
cgatattccg ttcgtggtgc tggtcggcgg ttcgtcgctg 1920gatttcgaag tcccgcagct
ggtcaccgat gcgctggcgc actaccgcct ggttgccgga 1980cggggaaata ttcgcggcag
cgagggcccc cgaaacgcgg tggccaccgg cctgattctc 2040tcctggcata aggagtttgc
gcatgaacgg taatcacagc gccccggcca tcgcgatcgc 2100cgtcatcgac ggctgcgacg
gcctgtggcg cgaagtgctg ctgggtatcg aagaggaagg 2160tatccctttc cggctccagc
atcacccggc cggagaggtc gtggacagcg cctggcaggc 2220ggcgcgcagc tcgccgctgc
tggtgggcat cgcctgcgac cgccatatgc tggtcgtgca 2280ctacaagaat ttacccgcat
cggcgccgct ttttacgctg atgcatcatc aggacagtca 2340ggcccatcgc aacaccggta
ataacgcggc acggctggtc aaggggatcc ctttccggga 2400tctgaatagc gaagcaacag
gagaacagca ggatgaataa cgcactggga ctggttgaaa 2460caaaagggtt agtgggcgcc
attgaggccg ccgatgcgat ggtgaaatcc gccaacgtgc 2520agctggtcgg ctacgaaaaa
attggctcgg gcctcgtcac cgtgatggtg cgcggcgacg 2580tcggcgcggt caaagcggcg
gtagacgcgg gcagcgcggc ggcgagcgcg gtgggcgaag 264071756DNAAcinetobacter
sp. 71atggaaaaaa ttatgtcaaa taaattcaac aataaagtcg ctttaattac tggcgctggt
60tcaggtattg gtaaaagcac cgcactgctt ttggctcaac agggtgtaag tgtagtggtt
120tcagatatta acctggaagc agcacagaaa gttgtggacg aaattgtcgc tttaggcggg
180aaagcggctg cgaataaggc caatactgct gagcctgaag acatgaaagc tgcagtcgag
240tttgcggtca gcacttttgg tgcactgcat ttggccttca ataatgcggg aattctgggt
300gaagttaact ccaccgaaga attgagcatt gaaggatggc gtcgtgtgat tgatgtgaac
360ttgaatgcgg ttttctacag catgcattat gaagttcctg caatcttggc cgcagggggc
420ggagcgattg tcaataccgc ttctattgca ggcttgatcg ggattcaaaa tatttcaggc
480tatgtcgctg caaaacatgg cgtaacgggt ctaacgaaag cggcggcatt ggaatatgca
540gataaaggga ttcgcattaa ttcagtacat cctggctata tcaaaacgcc tttgattgca
600gaatttgaag aagcagaaat ggtaaaacta catccgattg gtcgtttggg acagccggaa
660gaagttgctc aggttgttgc cttcctactt tctgatgatg cttcatttgt gaccggtagt
720cagtatgtgg tcgatggtgc atatacctcg aaataa
75672251PRTAcinetobacter sp. 72Met Glu Lys Ile Met Ser Asn Lys Phe Asn
Asn Lys Val Ala Leu Ile1 5 10
15Thr Gly Ala Gly Ser Gly Ile Gly Lys Ser Thr Ala Leu Leu Leu Ala
20 25 30Gln Gln Gly Val Ser Val
Val Val Ser Asp Ile Asn Leu Glu Ala Ala 35 40
45Gln Lys Val Val Asp Glu Ile Val Ala Leu Gly Gly Lys Ala
Ala Ala 50 55 60Asn Lys Ala Asn Thr
Ala Glu Pro Glu Asp Met Lys Ala Ala Val Glu65 70
75 80Phe Ala Val Ser Thr Phe Gly Ala Leu His
Leu Ala Phe Asn Asn Ala 85 90
95Gly Ile Leu Gly Glu Val Asn Ser Thr Glu Glu Leu Ser Ile Glu Gly
100 105 110Trp Arg Arg Val Ile
Asp Val Asn Leu Asn Ala Val Phe Tyr Ser Met 115
120 125His Tyr Glu Val Pro Ala Ile Leu Ala Ala Gly Gly
Gly Ala Ile Val 130 135 140Asn Thr Ala
Ser Ile Ala Gly Leu Ile Gly Ile Gln Asn Ile Ser Gly145
150 155 160Tyr Val Ala Ala Lys His Gly
Val Thr Gly Leu Thr Lys Ala Ala Ala 165
170 175Leu Glu Tyr Ala Asp Lys Gly Ile Arg Ile Asn Ser
Val His Pro Gly 180 185 190Tyr
Ile Lys Thr Pro Leu Ile Ala Glu Phe Glu Glu Ala Glu Met Val 195
200 205Lys Leu His Pro Ile Gly Arg Leu Gly
Gln Pro Glu Glu Val Ala Gln 210 215
220Val Val Ala Phe Leu Leu Ser Asp Asp Ala Ser Phe Val Thr Gly Ser225
230 235 240Gln Tyr Val Val
Asp Gly Ala Tyr Thr Ser Lys 245
2507317417DNAAcinetobacter sp. 73ctagcattta cgcgtgaggt aggtgggtag
gtctgtaatg tgaagatcta cgaggaaatc 60ggcgtcatga cgtgaggtcc agcgaaccgt
cttgcgtaat ccgtcattca tggtgagtaa 120cattgcccgt atttcgcgtt cagtatatag
cagaccagca tgattaacga gatcctgggt 180attttagtcc ggacacccaa agtcccatgc
ggtcgccaga tccagtaagt cgactacgac 240ttgctcatct gtagccaacc ccgcaatcac
ttccacaatt ttcatcagtg gaaccggatt 300gaagaaatgg aaacctgcga tacggccctg
atgctgacac gcagatgcaa ttgaggtcac 360agatagtgag gatgtatttg aaaccagaat
agtttcttca gccacaatcc tttcaagctg 420tttaaacaaa gtttgcttga tttccagatt
ttcaataatt gcttctacga ccagatcaac 480gccagcaacc tcttcaatgc tttccaagat
aatcaatcgg gctaaggtat ccacaagctg 540ctgttcggtt aactttcctt tagcagctag
tttgtgcaag gttactttta atttttccaa 600gccttgctca gcagcgccgg gtttagcatc
aaataaacgg acctcaacac ccgcctgtgc 660tgcaatttgc gcaataccca ttcccattac
gcctgtgcca atcaaggcca ttttttgaat 720cgtcatgact tattttcctt gatattgagg
gcttcgcttt tcgaaaaagg cattgacgcc 780ttctttttga tcttgtgtat caaataaaat
ttggaaggct ttacgctcta atgccaaagc 840accatcgagt ggcatattgg cacctagtgt
tgtgacttct ttgatctgtt caacggcaat 900cggtgagagt tgggcaatct gtgtcgcaat
ttcaaccgct ttagcaaggg tttgatcatc 960ctcaaccact tcggaaacca accccatttt
gtcagcttct tctgcagaaa agatctttcc 1020tgttaacact atttgcatgg ctttaaactt
ccctaccgca cgcagtaagc gttgggtacc 1080accagcacct ggcatcagcc ccaatttgac
ttcaggctga ccaaactggg ctgattttcc 1140ggcaataatg atgtctgcat gcattgcaag
ttcacaccca ccacccaatg catatccatt 1200cacagcagcc acaatcggtt tagggcaatc
aataatggcc cgccagtact gttccgtatg 1260gcgtaaatac atgtctacgg tttttgcagt
ggtgaagtcc cggatatccg cacctgctgc 1320aaatactttt tcaccaccag taatgacaat
tgcgcggact gtatcagatg cagcgagctg 1380ctcaaacatt gctgcgagct gttggcgcag
ttccagattc aatgcatttc tagtatctgg 1440acgatgtagt tcaacaatgg ccacaccatt
actttgaata tctaaattca atatttcatt 1500ttccataaca acctacatgt ttcgcatagc
ggtttattta aaccaaatat acctgttttt 1560ttgcaacaat aaagcccaca ggaacatagt
tttaaattaa aaattggcta aaaatattta 1620aaaaacacaa ataaaatacc gcacagcggt
atttgatatc aatattattg catttatttt 1680tccattctgt catattattt tcattccaaa
gcattagatc acccctgcat gaagcagaga 1740tggctaaatt tacctatcta atacaagggc
ttaaaaatga ttcgcgatca agacacatta 1800aatcagctgg ttgacatgat ccgtcagttt
gtcgatggcg ttcttattcc caatgaagaa 1860attgttgcgg aaaccgatga aattccagct
gaaatcgtgc agcaaatgaa agaactgggt 1920ctttttggtc tcaccattcc tgaggaatat
gagggtcttg gcctgaccat ggaggaagag 1980gtttacattg catttgaact gggacgtacc
tctcctgctt tccgttcact gatcggcact 2040aacaatggga tcggttcatc aggcttaatt
attgatggct ccgaagagca gaaacagtat 2100tttttgccac gtctggcaag tggtgaaatt
attggttcat tctgtttaac tgaacctgat 2160tccggttcag atgctgcctc tttaaaaacc
acagcggtga aagatggtga tcattacatt 2220ttaaatggca ctaagcgtta catcaccaat
gcaccgcatg cgggtgtctt tactgtcatg 2280gcacgtacca gtaccgaaat taaaggtaca
ggtggaattt cagcctttat cgtggacagt 2340aaaactcctg gtatttcctt gggtaaacgt
gataagaaga tgggccaaaa aggtgcacat 2400acctgtgatg tgatttttga aaactgtcgt
attcctgcat ctgcactcat tggtggtgtt 2460gaaggtgtag gttttaaaac tgcaatgaag
gtacttgata aaggccgtat tcatattgct 2520gcattaagtg taggtgctgc tacgcgtatg
ctggaagatt ccctacaata tgccgttgag 2580cgcaaacagt ttggtcaagc gattgcgaac
ttccagttga ttcaaggtat gttagccgat 2640tctaaagctg aaatttacgc agcaaaatgt
atggtattag atgctgcccg acttcgtgat 2700gctggacaga atgtcagcac ggaagcatct
tgtgccaaga tgtttgccac tgaaatgtgt 2760ggccgtgtcg cagatcgtgg cgtacagatc
catggtggtg cgggttatat cagtgaatat 2820gctattgagc gtttttaccg tgatgtacgt
ttattccgtt tgtatgaagg tacaacgcaa 2880atccaacagg tcattattgc ccgcaatatg
atccgtgaag cgactcaata attgtataac 2940aggtattgag tgtatctaaa aggacgggat
tagtgattta agctataact tgaatactaa 3000tcctgacttt ttgatggcaa ggctataaaa
cctcctagct cattttatct ctaagctaat 3060cacagctgaa agatattttc agtcttcatc
cttaccagac agttcacaat acaaaattgg 3120attttatgaa tatgcaagaa caagaaatcg
aacgcgaatc aatggagttt gacgtcgtga 3180ttgtcggcgc aggaccggcc ggtctttctg
cagcgatcaa gatccgtcaa cttgcaattg 3240aaaacaacct gaacgatctg tcggtttgtg
tggtggaaaa aggctctgaa gtcggtgcgc 3300acatcttgtc cggtgcggta ctggaaccac
gtgccatgaa tgagctgttc ccgaactgga 3360aggaagaagg tgcaccttta aatgttccag
tgaccgaaga caagacctat ttcctgctct 3420cggatgaaaa atcacaagaa gcgccacact
ggatggtgcc taaaaccatg cataacgatg 3480gcaactatgt tatctcgctc ggcaacgtag
tgcgctggtt gggtcaaaaa gcggaagagc 3540tggaagtatc tattttcccg ggctttgccg
ctgctgaaat tctgtaccat gcagatggtt 3600cggtgaaagg cattcaaacc ggtgacatgg
gcattggcaa ggatggcgaa ccgacccata 3660actttactcc gggctatgaa ctgcatgcca
aatacaccct gtttgctgaa ggctgccgtg 3720gccacctcgg caagcgttta attgccaaat
acaacctcga taaagattca gatccacaac 3780attacggtat cggtatcaaa gagctgtggg
aaatcgaccc ggcgaaacac aagccaggtc 3840tggtgatgca cggtgccggc tggccattgt
ctgaaaccgg ttcttcaggc ggctggtggt 3900tgtatcatgc ggaaaacaat caggtgactt
tgggcatgat cgtcgatctg tcttacacca 3960acccgcatat gtatccgttt atggaaatgc
agcgctggaa aacccatccg ctgatcaagc 4020agtatctgga aggtggcaaa cgtatttctt
atggcgcgcg tgcggtaacc aaaggcggct 4080ttaactcgct accgaaattt accttcccgg
gcggatcgct gattggtgac gatgccggct 4140tcctgaactt tgccaaaatc aagggctcac
ataccgcgat gaaatccggc atgctctgcg 4200gtgaagcagt gtttgaagcc attgctgccg
gtgtggaaaa aggtggtgac cttgcggttg 4260cgcgtgtgac ggaaggcgaa gacttgtttg
ccaaaaaact gacttcttac accgacaagt 4320tcaataatag ctggctgaaa gaagagctgt
acaactcgcg taactttggc ccggccatgc 4380acaagtttgg tcagtggctc ggtggtgcgt
ttaactttat cgaccagaac gtgtttaagg 4440tgccgtttac cctgcatgac ctggtgacgg
atttcggtgc gctgaaaacc gtcgatgcgg 4500tgaacttcaa gccgaattat ccaaaaccgg
atggcaaact gacctttgac cgtctgtctt 4560cggtgtttgt atccaacacg gtgcatgaag
aaaaccagcc agcgcattta aaactgactg 4620acacttcgat tccggtgaat gtcaacctgc
caaaatggga tgaaccggcg cagcgctact 4680gccccgcggg tgtatacgaa atcatggaaa
atgatgacgg ttcgaaacgc ttccagatca 4740atgcagccaa ctgtgtgcac tgcaagacct
gtgacatcaa ggatccttca cagaacatca 4800cctgggtaac accggaaggt ggtggtggtc
caaactatcc gaatatgtaa gtctaatcac 4860ttcaaggaag aggtttccca tttcccttct
ttctagcaga tgaagaagct tgcaactaaa 4920agagattgtt tggatcagtt acccaaaatc
gttgaaaaga ttttaactct tcgattttta 4980ttttttaggt aatcctagcc ctctcggggg
ctaggattaa aaattttaag ttattccaac 5040acgaatgaca aattgttcaa tgcaaaataa
aaacatacaa tatataaata tattttttaa 5100ttaaaacata agattacaat aaaataagaa
tttttatttg gagtttgttt tttttctaca 5160atgatcatta tgtacaattt ttaggttcac
cccatccaag ccttgtgatt gcattcctgc 5220gattctttat tcaatgaata agcaatgcta
ttaatcagca atgaataacc agcactgcag 5280attttgaata aattcacatg tcgtaatgga
gattatcatg tcacaaaaaa tggattttga 5340tgctatcgtg attggtggtg gttttggcgg
actttatgca gtcaaaaaat taagagacga 5400gctcgaactt aaggttcagg cttttgataa
agccacggat gtcgcaggta cttggtactg 5460gaaccgttac ccaggtgcat tgtcggatac
agaaacccac ctctactgct attcttggga 5520taaagaatta ctacaatcgc tagaaatcaa
gaaaaaatat gtgcaaggcc ctgatgtacg 5580caagtattta cagcaagtgg ctgaaaagca
tgatttaaag aagagctatc aattcaatac 5640cgcggttcaa tcggctcatt acaacgaagc
agatgccttg tgggaagtca ccactgaata 5700tggtgataag tacacggcgc gtttcctcat
cactgcttta ggcttattgt ctgcgcctaa 5760cttgccaaac atcaaaggca ttaatcagtt
taaaggtgag ctgcatcata ccagccgctg 5820gccagatgac gtaagttttg aaggtaaacg
tgtcggcgtg attggtacgg gttccaccgg 5880tgttcaggtt attacggctg tggcacctct
ggctaaacac ctcactgtct tccagcgttc 5940tgcacaatac agcgttccaa ttggcaatga
tccactgtct gaagaagatg ttaaaaagat 6000caaagacaat tatgacaaaa tttgggatgg
tgtatggaat tcagcccttg cctttggcct 6060gaatgaaagc acagtgccag caatgagcgt
atcagctgaa gaacgcaagg cagtttttga 6120aaaggcatgg caaacaggtg gcggtttccg
tttcatgttt gaaactttcg gtgatattgc 6180caccaatatg gaagccaata tcgaagcgca
aaatttcatt aagggtaaaa ttgctgaaat 6240cgtcaaagat ccagccattg cacagaagct
tatgccacag gatttgtatg caaaacgtcc 6300gttgtgtgac agtggttact acaacacctt
taaccgtgac aatgtccgtt tagaagatgt 6360gaaagccaat ccgattgttg aaattaccga
aaacggtgtg aaactcgaaa atggcgattt 6420cgttgaatta gacatgctga tatgtgccac
aggttttgat gccgtcgatg gcaactatgt 6480gcgcatggac attcaaggta aaaacggctt
ggccatgaaa gactactgga aagaaggtcc 6540gtcgagctat atgggtgtca ccgtaaataa
ctatccaaac atgttcatgg tgcttggacc 6600gaatggcccg tttaccaacc tgccgccatc
aattgaatca caggtggaat ggatcagtga 6660taccattcaa tacacggttg aaaacaatgt
tgaatccatt gaagcgacaa aagaagcgga 6720agaacaatgg actcaaactt gcgccaatat
tgcggaaatg accttattcc ctaaagcgca 6780atcctggatt tttggtgcga atatcccggg
caagaaaaac acggtttact tctatctcgg 6840tggtttaaaa gaatatcgca gtgcgctagc
caactgcaaa aaccatgcct atgaaggttt 6900tgatattcaa ttacaacgtt cagatatcaa
gcaacctgcc aatgcctaaa tatatggggg 6960gcatccccca tattccattt tgtttaacat
cagtcatatg ccagggatgt cttatcatga 7020actatccaaa tataccttta tatatcaacg
gtgagtttct agatcatacc aatagagacg 7080tcaaagaagt ttttaatcca gtgaaccatg
aatgtattgg actcatggcc tgtgcatcac 7140aagcagacct ggactacgca cttgaaagtt
cacaacaggc ttttctaagg tggaaaaaaa 7200cttctcctat cacccgtagt gaaatcctca
gaacctttgc gaaactagcg cgtgaaaaag 7260cagcagaaat cgggcgcaat attacccttg
atcaaggtaa gcccctgaaa gaagccattg 7320cagaagtcac tgtctgtgca gaacatgcag
aatggcatgc agaagaatgc cgacgcattt 7380atggccgtgt tattccaccg cgtaacccaa
atgtacagca actagtagtc agagaaccgc 7440tgggcgtatg tctggcattt tcaccgtgga
atttcccgtt taatcaggca attcgtaaaa 7500tttctgctgc aattgctgcc ggctgcacca
tcattgtgaa aggttctggc gacacaccaa 7560gcgcggtata tgcgattgcc cagctatttc
atgaggcggg tttgccgaat ggtgtgctga 7620atgtgatttg gggtgactca aacttcattt
ctgattacat gatcaaatcg ccgatcatcc 7680aaaagatttc attcacaggc tcaaccccgg
tgggtaaaaa attagcctcg caagcgagtc 7740tgtatatgaa gccttgcacc atggaattgg
gtggtcatgc accggtcatc gtctgtgatg 7800atgctgatat tgatgccgct gttgaacatc
tggtcggtta taaattccgt aatgcaggac 7860aggtctgtgt atcaccaacc cgtttttatg
tgcaggaagg tatttataag gaattttctg 7920agaaagtggt gttaagagcc aaacagatca
aagtgggttg tggcttagac gcatcctcag 7980atatgggacc attggctcaa gctcgccgca
tgcatgcaat gcaacaaatt gttgaagatg 8040cggttcataa aggctcaaaa ttactgcttg
gcggaaataa aatttctgac aaaggcaatt 8100tttttgaacc aacggtactc ggtgacttgt
gcaatgacac ccagtttatg aatgacgagc 8160catttggtcc gatcattggt ttgatacctt
ttgacacaat agaccatgtc ctggaagaag 8220caaatcgatt accatttgga ttagcctctt
acgcttttac cacatccagc aaaaatgcgc 8280atcaaatctc atacggactg gaggctggca
tggtttcgat taaccacatg ggattggcgc 8340tcgctgaaac accttttggt ggtattaagg
atagcggttt tggtagtgaa gggggtatcg 8400aaacctttga cggttacctc agaaccaaat
ttattacgca actcaattag aaatggatct 8460tggtgtgcgt aggcacacca attctctttt
gactttaagg atgaaagtta aatgagcaca 8520gacaaagcaa atacgctgat caaacccgaa
gatgtcgtgt tatggattcc gggtaatgtc 8580acaattgaca gcatgaatgc cggttgggaa
aacattgcaa tcagagggta cgaatatacc 8640aacctcgatg tgcatattcc tgccatgcgt
gactacatga tcgtcaacta taaaaaaagt 8700gcggcggaaa tgcgtagaaa aggcgatgcc
tcttgggata cccaagtggt taagccgggt 8760tatgtctcct tgttgacctg tggtgaagat
tcccgctggg cgtggaatga ccatattgcc 8820gtcacccatg tctacatttc gcatgactcc
atcacctcaa tggcgaataa ggtgtttgat 8880tatgatatcg cttcgatccg aatcagagac
gaagtcggtg tggaagatca tgttttacct 8940gctctgactt cacttttaga actagaatta
aagcaaggtg gtttaggtgg aaacctgtat 9000ttagagagca ttaaaaacca gatcgccctg
catttactcc gtcagtatgc caaattagat 9060tttaaggaag gacagtgccg ttctggtttt
actcccctac aacgcagact gttattagaa 9120tttatcaatg aaaacatgag cattaaaatt
accctcgaag atttagcggg attagtcaag 9180atgagcgtgc ctcatttaat gagaaaattt
aaagtcgatt ttggtaattc ccctgctgcc 9240tacatcatga atctcagggt gcaatttgct
aaacgtttgc tcacttcaaa aaaagaaatt 9300ccactgaaag tgattgccag tgaagccggt
ttttgcgatc agagccatat gacccgagta 9360tttcaaaaat tttttgggaa aacacccatc
gaaatcagac aggaacacac caatctcgtg 9420tctgaaaatt cagtctcctc tattgttttt
tgagtactaa gagccacgca agaacctgat 9480tttcaataaa gcatccactg aaaaccagtg
tggacttaca tgcattattt atgcaaaata 9540acaaatgtca tgtgagtatc aagatatact
ttctatcgct atcaagaact tgccagtaca 9600ggcaatatgg atgcactcat caaccagagt
cgcagaactc caaatttaaa aaaccgagtg 9660gatgagcaaa ctgaataagc tgttgttgat
tttgcaatcc aatatccagc ttatggtcag 9720catcggacca gtaatgagct acgtcagatt
ggcatcttcg tatctggcag cggtgtgcgc 9780tctatctggc ttagacacaa tcttgagaat
ttcaaaaagc gattaaaggc acttgaaatt 9840aaagttgctc aagaaggcat tcagttgaat
gatcagcaga ttgccgcatt agaacgtaaa 9900catgaagatg atgttgcttg tggtgaaatt
gaaacacatc atccaggtta ccttggagca 9960caagatactt tttatgtcgg aaatctaaaa
ggtgttgggc atatttatca gcaaactttt 10020attgatactt atagcaaagt ggttcactgc
aagctgtaca caaccaagac accaatcaca 10080gccgcagatt tattgaatga ccgcgtgtta
ccattctatg agtcacaagg attgccaatg 10140cttcgcattt tgaccgacag aggcaccgaa
tattgcggta aagttgaaca tcacgattat 10200gagctttatt tggctctgaa tgatattgat
cacactaaaa ctaaagcagc atcaccacaa 10260acaaatggga tctgtgagcg cttccataag
acgatcttgc aggagtttta tcagattact 10320tttcgaaaga aactctatag ctcattagaa
gagttacagc ttgatctaga cggttggctg 10380aaattctata atactgaacg aacccatcag
ggtaaggtgt gtaatggcag atgagcagca 10440ttgctgcgca agattgcaac attacttgat
ggaaaacgta tttgggctga aaagaattta 10500gttcaaattt aacctgacag tcttaagcaa
atatcggtaa ctatcagatc aggtttgaga 10560taccgtctga aacgtcaagt aaatgattga
gaattcatgc tcaataatct gcttgataag 10620gctgttggtg tttgagcaca ccataacaaa
gatgaatcaa cttcctcatc gcggctccaa 10680tcgctatcat cttggtttta ccattcgcca
ataaacgttc attcattgcc ctgatgtgag 10740ggttatgccg agttgcgaca atggctgcca
tatataaacc agcacgtatt ttggaagagc 10800ccgctttgga taaacggctt ctgccatgaa
tggaactacc cgattgcttt tgaatgggga 10860ccaaaccgac aaaggcagcc gcttgactag
ccctttcaaa agtatggctg cgcaagaaac 10920tgagcattaa taaactggtt cgatctgcaa
tggctggaat actgctgagc agttctttat 10980cattttttaa atcaggattc tgattaatgt
gatcatcaat ttgctggtcg ataccctgaa 11040tgtgtttgtt taactgttca atactcttgt
ggatagactg aagtacaggt tccatcgtga 11100aggtcgactc tgctttttcc aaacgattct
tttcacgttg taaatcttca caaagaatag 11160ctcttctatc cagcaaagca ttcagcaatt
gaatatgttt aggtaaaggt tgccaaaaat 11220gtagatcggc agtcatcgca aatcgagcta
ggacctcact atccaccttg tctgttttat 11280tcagcttaga catactctga gcaaaatatc
gagctctggc aggattggtt acacagactt 11340gatagcccgc atcaaataaa tatttaacca
agagttcatg ataaatagat gttgcttcca 11400ttaaaataat ggtctgcgta gaagttgcag
catgctgctt tagccaggtt tgaagttgct 11460caaaaccttt tggtgtattt gaaaaagttt
tggttttctt tttatttgca gaattttcta 11520aaattaaaca gcaatcaatt ttagctttag
caacatcaat accaagataa aacataatct 11580ttacctgctt tatttatcca attattgttt
tagcataacc accgtctttt cttgtgaatg 11640cagcatcaaa gtgcttgtta ccgtccagag
ttgtgcaagt ggttagggca aattacaggt 11700tttatctcaa actctaactt tatgttttgc
tagtacacga aactctgcaa tttgcaatat 11760agtgatagct aatcactatg aatggtaaga
tacaagctag tacacataag aagatattac 11820ttcttctcag gcagattcgc agcaaagaaa
aattttccct tacaacaata gataaaagaa 11880aagagggtat cacccctctt tcctctttat
atgggggtat cttctactca ttttttattt 11940cgaggtatat gcaccatcga ccacatactg
actaccggtc acaaatgaag catcatcaga 12000aagtaggaag gcaacaacct gagcaacttc
ttccggctgt cccaaacgac caatcggatg 12060tagttttacc atttctgctt cttcaaattc
tgcaatcaaa ggcgttttga tatagccagg 12120atgtactgaa ttaatgcgaa tccctttatc
tgcatattcc aatgccgccg ctttcgttag 12180acccgttacg ccatgttttg cagcgacata
gcctgaaata ttttgaatcc cgatcaagcc 12240tgcaatagaa gcggtattga caatcgctcc
gccccctgcg gccaagattg caggaacttc 12300ataatgcatg ctgtagaaaa ccgcattcaa
gttcacatca atcacacgac gccatccttc 12360aatgctcaat tcttcggtgg agttaacttc
acccagaatt cccgcattat tgaaggccaa 12420atgcagtgca ccaaaagtgc tgaccgcaaa
ctcgactgca gctttcatgt cttcaggctc 12480agcagtattg gccttattcg cagccgcttt
cccgcctaaa gcgacaattt cgtccacaac 12540tttctgtgct gcttccaggt taatatctga
aaccactaca cttacaccct gttgagccaa 12600aagcagtgcg gtgcttttac caatacctga
accagcgcca gtaattaaag cgactttatt 12660gttgaattta tttgacataa ttttttccat
ttcaaatttt aagcatcaaa gcttgtttca 12720tattttaaga ttcaagaaac cagatccggt
agatgactcg tctgccaagc gacaacccgt 12780ctgatatcag gcttgcgatt caccctgtag
acggttttca ttcctaaatt ctgtatttcc 12840aagttatata aacaaaagtg ctaatctatg
gggaattccc aggatccaaa caaatagaat 12900gccatgaaag catcttttgc caagcgctgt
gctgtatgtt tcctagacaa accaccaacg 12960ataactgcaa ctttttgaac tccttacaat
ttccttattt tctttcccct tcatcgcata 13020aaaatagttt ttgcattcac aacaaaatca
gcatgaatag tttttaaact cactgtacat 13080attttctata ttgatgacca agctggatat
tgaattgcaa aattctatac agcctgttca 13140acatgatcga tttagaaggc atacagtaaa
cgtgactgaa gtccagaaat ttccaagcca 13200ttttcaacat tcacatcttg tcgccattgt
aataatagct gcagattcgg cttgatattg 13260gtagaagcag aaacgacaaa ggtatctttt
ctatcactgc cacgttcagt gacaccattc 13320accttttctt taccgccatc ggtatgtctc
caggtgacag ccaaattgga tttatcggtc 13380actttataga gtgcggagaa atctgtctgg
aaaaaaacct ctttctcaat gttggtatat 13440ttttgctcgc tataaagttc aaactgcccc
accccctcaa gcgcaaattt atcagttaaa 13500gcatggtaat aaccggcctg aacattatat
tgatagcgat cattactgat ggcaaaaccc 13560ttcgtttcat tactgccggt aggtacggtc
aaaaaaccac cgaaaccaaa atagcgccct 13620ttttcagcat catgcaatgg ccaggcgata
ccacccacaa ttaaatcacc gacacccgag 13680atatcatcag cgccattcat cttttgcttg
gcaaaaggca agaggaattg aggatctaca 13740atccaatccc ctacttcaat aaaacgaacg
taacgcaata ttcccaaatc aatgcttaaa 13800tcgagatcat cagcgacttt atcaccattt
gcatacgcct tatccgcttc cgtatgctgg 13860taataggcaa ccgctaagtt ggttccccct
ggaagtgctt gataatcccc ggcatcagaa 13920ctcacccctg cggcttgcag gtccaaagcg
gcagttaaag caaagaccaa agcagctatt 13980ttttgatttg aacgatgata gaaatagttt
ttcatttgtt tcatttttaa ctctccgttg 14040ttttgactca tttttttaaa atgagtcttc
ctagcacaaa gaccactcag gtctttgcgc 14100aatttcttga ttttgatttg ggtattaaat
atggaaaaac gttgggtgat cagttttcgt 14160gcataagcac aatacgcccg atgacgttgc
catctttcaa gtctccaaat gcggaattga 14220tctgcgaaat tggcagtttt ttcacgggaa
tggctgacat gtgggtttct ttcaccagct 14280ccaccagctc tcttaattcc tctaccgtcc
ctacataact gccctggatt gtgagtggtc 14340tcattggaat caccggaatg gaaagcttaa
tttctccccc catcaatccg cagatcacaa 14400tatgcccacc acgtgcagca ctcgccaagg
caaggctcaa tgttggatta ctgccaacca 14460gatcaaggat cagacgtgca ccaccgtcag
ttgcctgaat cagctgttga gcagcatcct 14520cacttcggct attgatgacc gataatgcac
cggcagcacg tgctgcttcc agtttgctgt 14580catcaatatc aactacgatt gcgcctttgg
cttgcatagc tttgagcaac tcgagtgcca 14640tcagccctaa accaccggca ccaatgatca
ccaccggctc gctttgaatc aaatcaccga 14700attttttcag tgcactgtat gttgtcacgc
ctgcacatgc caaaggtgca gcttcagcca 14760gatccagacc tgcaatatcc accagatatc
gtggatgcgg cacgatgata tattcggcaa 14820aaccacccgg cttggcgatg cctaactgtt
gcggtttggc acacaggttt tcttcgccac 14880gtttacagta gttgcattca ccgcaaccaa
tccatggatg aaccaagctg accatgccga 14940ccttgactga ttccgcatct ggaccgacag
caaccacctg acctgtaatt tcatgactta 15000aggttaaggg tggcttcagc ccacgatctg
caagggataa acgcttgccc ccacctagat 15060cataataacc ttcccataag tgtaaatccg
tatggcatag acctgcggct tttacatgga 15120gtaaaacttc agtacctttc ggttgcggaa
tttctttctc aacgtcttcg agtggttgtc 15180catgatgcgt cacgcagtaa cagtgcatga
atctctcctt tgaaacaata aaatagacgg 15240ccttgtagtg aacaaagtct tttattcact
aagttttata cgccgtgtgg gcactgattt 15300atgctttaaa ccactgcgca attttcgcta
attcttgatc agcttcactt gcacgcccag 15360ctaggaaagg aaaaacgtgc tgcatgttgt
ccaccacaga taaagtcaca tcaacaccct 15420ctttttttgc aatatcagca agacgtgttg
cattgtctac aagtgattca actgatccgg 15480cattgatata caaacgtggg aaaacctgat
aattggcttt taacggattc gccaatggat 15540ttgccggatc accatgttca cccaagaaca
tttgtgacat gcctttaagc agatccactg 15600taatcaaggc atcagtggca tcgttgctga
tcagggtttc acctttgtgc tccatatcca 15660gccaaggaga gaatgcaatc actgctcctg
gcaactcaat cccttcattt cgtagattga 15720gtacggttga tatcgccaga ttcccccccg
cagaatcccc tgcggtcagc atattttttg 15780cagtaaagcc acgctggagt agttctttat
atactgctgt cacgtcctga atttgtgccg 15840ggaagacatg ttctggtgaa cgtcggtaat
caaccacaaa tgcggatacc cctaaatact 15900tggccaaatg ccccaccagc ttacggtgac
tggccgaaga accgaccgca aatccaccgc 15960catgggtata aatgatgact ttggataagt
cagcatcttt cggataaatc caaagacctt 16020ctacacctgc cacaacatcg aatttataag
acacttcttc cggttccaat gtaggttgat 16080gccattcatc aaacatactg cgaaagtctt
caatggtcat attcggattt tcctgcatcc 16140gtcttgacca gttcgcatat aaatcgaaaa
gaaattgagt attgctttgt gtgctattca 16200ttttaaaatc cttgatttga tatttaagga
ataaatccta gttttattcc atgaagatat 16260aaaaacttga gtgccatcac tcatggctag
acactcagaa gatccaaatc taaagagtgg 16320ctttgcatca ctggtttgat acaatttttt
gcatgactaa gtaatctacg gataatctaa 16380ccgtttcaaa ttagtatttt aaaatgtaaa
aaatacatac cagcgaatgt tttctgcaaa 16440atcgcatcct gttcaatata gcttttgatc
ctacttattc tcttttctat tccagtccgt 16500tataaaaaag ctttcattca ttttcatgca
atcatgagct atgaatgttc ttaaacatta 16560aacgattgtg tgtatggctg acttgtacat
tcttgtactt atttttgtat aaaatgatca 16620ggctcatcaa tttatgggaa aaattacaat
tcgggtacaa tatctttcct gtttcatgaa 16680tctattcaac tcattaaact tacgaccctc
aactgcccaa aatcatagga tctgccgatc 16740cacttgcaga attagcaatg ctaaaacatg
aactccaaag agttactaaa aaaagagcat 16800attaaaaaaa agccgtggca tatttcgcaa
gccagttcaa gtcaggtatg tctttattca 16860gtacctcagt taaactttag attttcataa
cgatggttat tctgcatggc taaatacgct 16920aatcagcaaa aaactctcca aaagataggc
acagaaacac atatcaacca taaaaaccat 16980ctcagacagt atatttacaa gcctctaatt
caccgcactc acacttctct gcaagccttt 17040ttaaataccc tgtacaaagt tctcagcctg
atgaagcttc accttggact tagctttcag 17100ttcagcctgt acttggtcag tttctgaatt
ttcatttgca taaaactcct ccaccacatc 17160cataccctcc tcaatgtcag tttcaaaatg
tgcattgtca tagccttgcc gtgccatttg 17220aatggcttat tgaagattaa tggcatcacg
taaagttaaa tccacgtaat acacaggtgt 17280tcgatagctt tgcgtcgtag actttctcga
agagtcaatt gcagcggtag gcatgacagc 17340aagccattca atgccgcatg gtaataactc
agccgtgcgg ccaacgttcg tatgctgtta 17400aaacccggtt attctaa
17417741164DNAEscherichia coli
74atgaacaact ttaatctgca caccccaacc cgcattctgt ttggtaaagg cgcaatcgct
60ggtttacgcg aacaaattcc tcacgatgct cgcgtattga ttacctacgg cggcggcagc
120gtgaaaaaaa ccggcgttct cgatcaagtt ctggatgccc tgaaaggcat ggacgtgctg
180gaatttggcg gtattgagcc aaacccggct tatgaaacgc tgatgaacgc cgtgaaactg
240gttcgcgaac agaaagtgac tttcctgctg gcggttggcg gcggttctgt actggacggc
300accaaattta tcgccgcagc ggctaactat ccggaaaata tcgatccgtg gcacattctg
360caaacgggcg gtaaagagat taaaagcgcc atcccgatgg gctgtgtgct gacgctgcca
420gcaaccggtt cagaatccaa cgcaggcgcg gtgatctccc gtaaaaccac aggcgacaag
480caggcgttcc attctgccca tgttcagccg gtatttgccg tgctcgatcc ggtttatacc
540tacaccctgc cgccgcgtca ggtggctaac ggcgtagtgg acgcctttgt acacaccgtg
600gaacagtatg ttaccaaacc ggttgatgcc aaaattcagg accgtttcgc agaaggcatt
660ttgctgacgc taatcgaaga tggtccgaaa gccctgaaag agccagaaaa ctacgatgtg
720cgcgccaacg tcatgtgggc ggcgactcag gcgctgaacg gtttgattgg cgctggcgta
780ccgcaggact gggcaacgca tatgctgggc cacgaactga ctgcgatgca cggtctggat
840cacgcgcaaa cactggctat cgtcctgcct gcactgtgga atgaaaaacg cgataccaag
900cgcgctaagc tgctgcaata tgctgaacgc gtctggaaca tcactgaagg ttccgatgat
960gagcgtattg acgccgcgat tgccgcaacc cgcaatttct ttgagcaatt aggcgtgccg
1020acccacctct ccgactacgg tctggacggc agctccatcc cggctttgct gaaaaaactg
1080gaagagcacg gcatgaccca actgggcgaa aatcatgaca ttacgttgga tgtcagccgc
1140cgtatatacg aagccgcccg ctaa
116475387PRTEscherichia coli 75Met Asn Asn Phe Asn Leu His Thr Pro Thr
Arg Ile Leu Phe Gly Lys1 5 10
15Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val
20 25 30Leu Ile Thr Tyr Gly Gly
Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40
45Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu Glu Phe
Gly Gly 50 55 60Ile Glu Pro Asn Pro
Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu65 70
75 80Val Arg Glu Gln Lys Val Thr Phe Leu Leu
Ala Val Gly Gly Gly Ser 85 90
95Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu
100 105 110Asn Ile Asp Pro Trp
His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115
120 125Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro
Ala Thr Gly Ser 130 135 140Glu Ser Asn
Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys145
150 155 160Gln Ala Phe His Ser Ala His
Val Gln Pro Val Phe Ala Val Leu Asp 165
170 175Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val
Ala Asn Gly Val 180 185 190Val
Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195
200 205Asp Ala Lys Ile Gln Asp Arg Phe Ala
Glu Gly Ile Leu Leu Thr Leu 210 215
220Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val225
230 235 240Arg Ala Asn Val
Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245
250 255Gly Ala Gly Val Pro Gln Asp Trp Ala Thr
His Met Leu Gly His Glu 260 265
270Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val
275 280 285Leu Pro Ala Leu Trp Asn Glu
Lys Arg Asp Thr Lys Arg Ala Lys Leu 290 295
300Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu Gly Ser Asp
Asp305 310 315 320Glu Arg
Ile Asp Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln
325 330 335Leu Gly Val Pro Thr His Leu
Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345
350Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr
Gln Leu 355 360 365Gly Glu Asn His
Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370
375 380Ala Ala Arg385761623DNABacillus subtilis
76atgtatttgg cattccaggt gcaaaaattg atgcggtatt tgacgcttta caagataaag
60gacctgaaat tatcgttgcc cggcacgaac aaaacgcagc aattcatggc ccaagcagtc
120ggccgtttaa ctggaaaacc gggagtcgtg ttagtcacat caggaccggg tgcctctaac
180ttggcaacag gcctgctgac agcgaacact gaaggagacc ctgtcgttgc gcttgctgga
240aacgtgatcc gtgcatatcg tttaaaacgg acacatcaat ctttggataa tgcggcgcta
300ttccagccga ttacaaaata cagtgtagaa gttcaagatg taaaaaatat accggaagct
360gttacaaatg catttaggat agcgtcagca gggcaggctg gggccgcttt tgtgagcttt
420ccgcaagatg ttgtgaatga agtcacaaat acgaaaaacg tgcgtgctgt tgcagcgcca
480aaactcggtc ctgcagcaga tgatgcaatc agtgcggcca tagcaaaaat ccaaacagca
540aaacttcctg tcgttttggt cggcatgaaa ggcggaagac cggaagcaat taaagcggtt
600cgcaagcttt tgaaaaaggt tcagcttcca tttgttgaaa catatcaagc tgccggtacc
660ctttctagag atttagagga tcaatatttt ggccgtatcg gtttgttccg caaccagcct
720ggcgatttac tgctagagca ggcagatgtt gttctgacga tcggctatga cccgattgaa
780tatgatccga aattctggaa tatcaatgga gaccggacaa ttatccattt agacgagatt
840atcgctgaca ttgatcatgc ttaccagcct gatcttgaat tgatcggtga cattccgtcc
900acgatcaatc atatcgaaca cgatgctgtg aaagtggaat ttgcagagcg tgagcagaaa
960atcctttctg atttaaaaca atatatgcat gaaggtgagc aggtgcctgc agattggaaa
1020tcagacagag cgcaccctct tgaaatcgtt aaagagttgc gtaatgcagt cgatgatcat
1080gttacagtaa cttgcgatat cggttcgcac tccatttgga tgtcacgtta tttccgcagc
1140tacgagccgt taacattaat gatcagtaac ggtatgcaaa cactcggcgt tgcgcttcct
1200tgggcaatcg gcgcttcatt ggtgaaaccg ggagaaaaag tggtttctgt ctctggtgac
1260ggcggtttct tattctcagc aatggaatta gagacagcag ttcgactaaa agcaccaatt
1320gtacacattg tatggaacga cagcacatat gacatggtgc atttccagca attgaaaaaa
1380tataaccgta catctgcggt cgatttcgga aatatcgata tcgtgaaata tgcggaaagc
1440ttcggagcaa ctgcgttgcg cgtagaatca ccagaccagc tggcagatgt tctgcgtcaa
1500ggcatgaacg ctgaaggtcc tgtcatcatc gatgtcccgg ttgactacag tgataacatt
1560aatttagcaa gtgacaagct tccgaaagaa ttcggggaac tcatgaaaac gaaagctctc
1620tag
162377540PRTBacillus subtilis 77Met Tyr Leu Ala Phe Gln Val Gln Lys Leu
Met Arg Tyr Leu Thr Leu1 5 10
15Tyr Lys Ile Lys Asp Leu Lys Leu Ser Leu Pro Gly Thr Asn Lys Thr
20 25 30Gln Gln Phe Met Ala Gln
Ala Val Gly Arg Leu Thr Gly Lys Pro Gly 35 40
45Val Val Leu Val Thr Ser Gly Pro Gly Ala Ser Asn Leu Ala
Thr Gly 50 55 60Leu Leu Thr Ala Asn
Thr Glu Gly Asp Pro Val Val Ala Leu Ala Gly65 70
75 80Asn Val Ile Arg Ala Tyr Arg Leu Lys Arg
Thr His Gln Ser Leu Asp 85 90
95Asn Ala Ala Leu Phe Gln Pro Ile Thr Lys Tyr Ser Val Glu Val Gln
100 105 110Asp Val Lys Asn Ile
Pro Glu Ala Val Thr Asn Ala Phe Arg Ile Ala 115
120 125Ser Ala Gly Gln Ala Gly Ala Ala Phe Val Ser Phe
Pro Gln Asp Val 130 135 140Val Asn Glu
Val Thr Asn Thr Lys Asn Val Arg Ala Val Ala Ala Pro145
150 155 160Lys Leu Gly Pro Ala Ala Asp
Asp Ala Ile Ser Ala Ala Ile Ala Lys 165
170 175Ile Gln Thr Ala Lys Leu Pro Val Val Leu Val Gly
Met Lys Gly Gly 180 185 190Arg
Pro Glu Ala Ile Lys Ala Val Arg Lys Leu Leu Lys Lys Val Gln 195
200 205Leu Pro Phe Val Glu Thr Tyr Gln Ala
Ala Gly Thr Leu Ser Arg Asp 210 215
220Leu Glu Asp Gln Tyr Phe Gly Arg Ile Gly Leu Phe Arg Asn Gln Pro225
230 235 240Gly Asp Leu Leu
Leu Glu Gln Ala Asp Val Val Leu Thr Ile Gly Tyr 245
250 255Asp Pro Ile Glu Tyr Asp Pro Lys Phe Trp
Asn Ile Asn Gly Asp Arg 260 265
270Thr Ile Ile His Leu Asp Glu Ile Ile Ala Asp Ile Asp His Ala Tyr
275 280 285Gln Pro Asp Leu Glu Leu Ile
Gly Asp Ile Pro Ser Thr Ile Asn His 290 295
300Ile Glu His Asp Ala Val Lys Val Glu Phe Ala Glu Arg Glu Gln
Lys305 310 315 320Ile Leu
Ser Asp Leu Lys Gln Tyr Met His Glu Gly Glu Gln Val Pro
325 330 335Ala Asp Trp Lys Ser Asp Arg
Ala His Pro Leu Glu Ile Val Lys Glu 340 345
350Leu Arg Asn Ala Val Asp Asp His Val Thr Val Thr Cys Asp
Ile Gly 355 360 365Ser His Ser Ile
Trp Met Ser Arg Tyr Phe Arg Ser Tyr Glu Pro Leu 370
375 380Thr Leu Met Ile Ser Asn Gly Met Gln Thr Leu Gly
Val Ala Leu Pro385 390 395
400Trp Ala Ile Gly Ala Ser Leu Val Lys Pro Gly Glu Lys Val Val Ser
405 410 415Val Ser Gly Asp Gly
Gly Phe Leu Phe Ser Ala Met Glu Leu Glu Thr 420
425 430Ala Val Arg Leu Lys Ala Pro Ile Val His Ile Val
Trp Asn Asp Ser 435 440 445Thr Tyr
Asp Met Val His Phe Gln Gln Leu Lys Lys Tyr Asn Arg Thr 450
455 460Ser Ala Val Asp Phe Gly Asn Ile Asp Ile Val
Lys Tyr Ala Glu Ser465 470 475
480Phe Gly Ala Thr Ala Leu Arg Val Glu Ser Pro Asp Gln Leu Ala Asp
485 490 495Val Leu Arg Gln
Gly Met Asn Ala Glu Gly Pro Val Ile Ile Asp Val 500
505 510Pro Val Asp Tyr Ser Asp Asn Ile Asn Leu Ala
Ser Asp Lys Leu Pro 515 520 525Lys
Glu Phe Gly Glu Leu Met Lys Thr Lys Ala Leu 530 535
540781680DNAKlebsiella terrigena 78atggacaaac cgcgtcacga
acgtcaatgg gcccacggtg ccgacttaat cgtcagccag 60cttgaggccc agggcgtacg
ccaggtcttc ggcatccccg gtgccaaaat cgacaaggtg 120tttgattccc tcctcgactc
ctcaatccgc attattccgg tgcgccacga ggctaacgcc 180gcctttatgg ccgcggcggt
cgggcggatt accggtaaag cgggcgtcgc gctggtgacc 240tccggtcccg gctgctcaaa
cctgattacc ggcatggcca ccgccaatag cgaaggcgac 300ccggtggtgg cgctgggcgg
cgcggtgaag cgcgcggata aggccaagct ggttcaccaa 360agcatggaca ccgtggcgat
gttcagcccg gtcaccaaat acgccgtcga ggtgaccgcc 420tccgacgcgc tggccgaggt
ggtctccaac gcctttcgcg ccgccgaaca ggggcgtccg 480gggagcgcgt ttgtcagcct
gccgcaggat atcgttgacg gccccgccag cggcagcacg 540ctgcccgcca gcagagcgcc
gcagatgggc gccgcgccgg atggcgccgt tgacagcgtg 600gcgcaggcga tcgccgcggc
gaagaaccct atcttcctgc tcgggctgat ggccagccag 660ccggaaaaca gccgcgccct
gcaccgccat gctggaaaaa agccatattc cggtcaccag 720cacctatcag gcgccggggc
ggtaaatcag gataacttcg cccgcttcgc cggccgggta 780ggcctgttta ataaccaggc
gggcgatcgc ctgctgcgtc aggcggacct gatcatctgc 840atcggctata gcccggttga
gtacgaaccg gcgatgtgga acagcggcac ggcaaccctg 900gtgcatatcg acgtgctgcc
ggcctatgaa gagcggaact acgtcccgga tatcgagctg 960gtgggcgaca tcgccgccac
cctcgagaag ctggcccagc gcattgaaca tcggctggtg 1020ttaactccgc aggcggcgga
catcctcgcc gaccgccagc gccagcggga gctgcttgac 1080cgccgcgggg cgcagctgaa
tcagtttgcg ctccacccgc tgcgcatcgt gcgggcgatg 1140caggatatcg tcaatagcga
cgtcaccttg accgtcgata tgggcagttt ccatatctgg 1200attgcccgct acctctacag
cttccgcgcc cgccaggtga tgatctccaa cggtcagcaa 1260acgatgggcg tcgcgctgcc
gtgggcaatc ggcgcgtggc tggtcaatcc gcagcgcaag 1320gtggtctcgg tatccggcga
tggcggcttc ctgcagtcga gcatggagct ggagaccgcc 1380gtgcgcctgc acgccaatat
tctgcacatc atctgggtcg ataacggcta caacatggtg 1440gcgattcagg aacagaagaa
atatcagcgc ctctccggcg tggagttcgg cccggtcgat 1500ttcaaagtct acgccgaagc
gttcggggcc tgcgggtttg cggtagagag cgccgaggcc 1560ctggagccga ccctgcgcgc
ggcgatggat gtcgacggcc cggcggtggt cgccattccg 1620gtcgattacc gcgataaccc
tctgctgatg ggccagctcc atctcagcca aatactgtga 168079559PRTKlebsiella
terrigena 79Met Asp Lys Pro Arg His Glu Arg Gln Trp Ala His Gly Ala Asp
Leu1 5 10 15Ile Val Ser
Gln Leu Glu Ala Gln Gly Val Arg Gln Val Phe Gly Ile 20
25 30Pro Gly Ala Lys Ile Asp Lys Val Phe Asp
Ser Leu Leu Asp Ser Ser 35 40
45Ile Arg Ile Ile Pro Val Arg His Glu Ala Asn Ala Ala Phe Met Ala 50
55 60Ala Ala Val Gly Arg Ile Thr Gly Lys
Ala Gly Val Ala Leu Val Thr65 70 75
80Ser Gly Pro Gly Cys Ser Asn Leu Ile Thr Gly Met Ala Thr
Ala Asn 85 90 95Ser Glu
Gly Asp Pro Val Val Ala Leu Gly Gly Ala Val Lys Arg Ala 100
105 110Asp Lys Ala Lys Leu Val His Gln Ser
Met Asp Thr Val Ala Met Phe 115 120
125Ser Pro Val Thr Lys Tyr Ala Val Glu Val Thr Ala Ser Asp Ala Leu
130 135 140Ala Glu Val Val Ser Asn Ala
Phe Arg Ala Ala Glu Gln Gly Arg Pro145 150
155 160Gly Ser Ala Phe Val Ser Leu Pro Gln Asp Ile Val
Asp Gly Pro Ala 165 170
175Ser Gly Ser Thr Leu Pro Ala Ser Arg Ala Pro Gln Met Gly Ala Ala
180 185 190Pro Asp Gly Ala Val Asp
Ser Val Ala Gln Ala Ile Ala Ala Ala Lys 195 200
205Asn Pro Ile Phe Leu Leu Gly Leu Met Ala Ser Gln Pro Glu
Asn Ser 210 215 220Arg Ala Leu His Arg
His Ala Gly Lys Lys Pro Tyr Ser Gly His Gln225 230
235 240His Leu Ser Gly Ala Gly Ala Val Asn Gln
Asp Asn Phe Ala Arg Phe 245 250
255Ala Gly Arg Val Gly Leu Phe Asn Asn Gln Ala Gly Asp Arg Leu Leu
260 265 270Arg Gln Ala Asp Leu
Ile Ile Cys Ile Gly Tyr Ser Pro Val Glu Tyr 275
280 285Glu Pro Ala Met Trp Asn Ser Gly Thr Ala Thr Leu
Val His Ile Asp 290 295 300Val Leu Pro
Ala Tyr Glu Glu Arg Asn Tyr Val Pro Asp Ile Glu Leu305
310 315 320Val Gly Asp Ile Ala Ala Thr
Leu Glu Lys Leu Ala Gln Arg Ile Glu 325
330 335His Arg Leu Val Leu Thr Pro Gln Ala Ala Asp Ile
Leu Ala Asp Arg 340 345 350Gln
Arg Gln Arg Glu Leu Leu Asp Arg Arg Gly Ala Gln Leu Asn Gln 355
360 365Phe Ala Leu His Pro Leu Arg Ile Val
Arg Ala Met Gln Asp Ile Val 370 375
380Asn Ser Asp Val Thr Leu Thr Val Asp Met Gly Ser Phe His Ile Trp385
390 395 400Ile Ala Arg Tyr
Leu Tyr Ser Phe Arg Ala Arg Gln Val Met Ile Ser 405
410 415Asn Gly Gln Gln Thr Met Gly Val Ala Leu
Pro Trp Ala Ile Gly Ala 420 425
430Trp Leu Val Asn Pro Gln Arg Lys Val Val Ser Val Ser Gly Asp Gly
435 440 445Gly Phe Leu Gln Ser Ser Met
Glu Leu Glu Thr Ala Val Arg Leu His 450 455
460Ala Asn Ile Leu His Ile Ile Trp Val Asp Asn Gly Tyr Asn Met
Val465 470 475 480Ala Ile
Gln Glu Gln Lys Lys Tyr Gln Arg Leu Ser Gly Val Glu Phe
485 490 495Gly Pro Val Asp Phe Lys Val
Tyr Ala Glu Ala Phe Gly Ala Cys Gly 500 505
510Phe Ala Val Glu Ser Ala Glu Ala Leu Glu Pro Thr Leu Arg
Ala Ala 515 520 525Met Asp Val Asp
Gly Pro Ala Val Val Ala Ile Pro Val Asp Tyr Arg 530
535 540Asp Asn Pro Leu Leu Met Gly Gln Leu His Leu Ser
Gln Ile Leu545 550 55580768DNABacillus
subtilis 80atgaaacgag aaagcaacat tcaagtgctc agccgtggtc aaaaagatca
gcctgtgagc 60cagatttatc aagtatcaac aatgacttct ctattagacg gagtatatga
cggagatttt 120gaactgtcag agattccgaa atatggagac ttcggtatcg gaacctttaa
caagcttgac 180ggagagctga ttgggtttga cggcgaattt taccgtcttc gctcagacgg
aaccgcgaca 240ccggtccaaa atggagaccg ttcaccgttc tgttcattta cgttctttac
accggacatg 300acgcacaaaa ttgatgcgaa aatgacacgc gaagactttg aaaaagagat
caacagcatg 360ctgccaagca gaaacttatt ttatgcaatt cgcattgacg gattgtttaa
aaaggtgcag 420acaagaacag tagaacttca agaaaaacct tacgtgccaa tggttgaagc
ggtcaaaaca 480cagccgattt tcaacttcga caacgtgaga ggaacgattg taggtttctt
gacaccagct 540tatgcaaacg gaatcgccgt ttctggctat cacctgcact tcattgacga
aggacgcaat 600tcaggcggac acgtttttga ctatgtgctt gaggattgca cggttacgat
ttctcaaaaa 660atgaacatga atctcagact tccgaacaca gcggatttct ttaatgcgaa
tctggataac 720cctgattttg cgaaagatat cgaaacaact gaaggaagcc ctgaataa
76881255PRTBacillus subtilis 81Met Lys Arg Glu Ser Asn Ile
Gln Val Leu Ser Arg Gly Gln Lys Asp1 5 10
15Gln Pro Val Ser Gln Ile Tyr Gln Val Ser Thr Met Thr
Ser Leu Leu 20 25 30Asp Gly
Val Tyr Asp Gly Asp Phe Glu Leu Ser Glu Ile Pro Lys Tyr 35
40 45Gly Asp Phe Gly Ile Gly Thr Phe Asn Lys
Leu Asp Gly Glu Leu Ile 50 55 60Gly
Phe Asp Gly Glu Phe Tyr Arg Leu Arg Ser Asp Gly Thr Ala Thr65
70 75 80Pro Val Gln Asn Gly Asp
Arg Ser Pro Phe Cys Ser Phe Thr Phe Phe 85
90 95Thr Pro Asp Met Thr His Lys Ile Asp Ala Lys Met
Thr Arg Glu Asp 100 105 110Phe
Glu Lys Glu Ile Asn Ser Met Leu Pro Ser Arg Asn Leu Phe Tyr 115
120 125Ala Ile Arg Ile Asp Gly Leu Phe Lys
Lys Val Gln Thr Arg Thr Val 130 135
140Glu Leu Gln Glu Lys Pro Tyr Val Pro Met Val Glu Ala Val Lys Thr145
150 155 160Gln Pro Ile Phe
Asn Phe Asp Asn Val Arg Gly Thr Ile Val Gly Phe 165
170 175Leu Thr Pro Ala Tyr Ala Asn Gly Ile Ala
Val Ser Gly Tyr His Leu 180 185
190His Phe Ile Asp Glu Gly Arg Asn Ser Gly Gly His Val Phe Asp Tyr
195 200 205Val Leu Glu Asp Cys Thr Val
Thr Ile Ser Gln Lys Met Asn Met Asn 210 215
220Leu Arg Leu Pro Asn Thr Ala Asp Phe Phe Asn Ala Asn Leu Asp
Asn225 230 235 240Pro Asp
Phe Ala Lys Asp Ile Glu Thr Thr Glu Gly Ser Pro Glu 245
250 25582780DNAKlebsiella terrigena
82gtgaatcatt atcctgaatg cacctgccag gagagcctgt gcgaaaccgt acgcggcttc
60tccgcccacc accctgatag cgttatctat cagacctctc tgatgagcgc gctgctgagc
120ggggtctatg agggtagcac caccatcgcc gacctgctga cccacggcga cttcggtctc
180ggcaccttta acgaactcga tggcgaactg attgccttta gcagcgaggt ctaccagctg
240cgcgctgacg gcagcgcgcg taaagcccgg gcggatcaaa aaacgccctt cgcggtgatg
300acctggttca gaccgcagta ccgtaaaacc tttgaccacc cggtcagccg ccagcagctg
360cacgacgtta tcgaccagca aatcccctcc gataacctgt tctgcgccct gcatattgat
420ggtcactttc gccacgccca cacccgcacc gtgccgcggc agacgccgcc ctatcgggcg
480atgaccgacg tgctcgatga ccagccggtt ttccgcttca accagcgcaa ggggacgctg
540gtcggctttc gcaccccgca gcatatgcag ggccttaacg ttgccggcta ccacgagcac
600tttattaccg acgatcgcca gggcggcggc catctgctgg actaccagct cgatagcggc
660gtgctgacct tcggcgagat ccacaagctg atgattgacc tcccggccga cagcgctttc
720ctgcaggccg acctgcatcc tgacaatctc gatgccgcta ttcgtgcggt agaaaactaa
78083259PRTKlebsiella terrigena 83Met Asn His Tyr Pro Glu Cys Thr Cys Gln
Glu Ser Leu Cys Glu Thr1 5 10
15Val Arg Gly Phe Ser Ala His His Pro Asp Ser Val Ile Tyr Gln Thr
20 25 30Ser Leu Met Ser Ala Leu
Leu Ser Gly Val Tyr Glu Gly Ser Thr Thr 35 40
45Ile Ala Asp Leu Leu Thr His Gly Asp Phe Gly Leu Gly Thr
Phe Asn 50 55 60Glu Leu Asp Gly Glu
Leu Ile Ala Phe Ser Ser Glu Val Tyr Gln Leu65 70
75 80Arg Ala Asp Gly Ser Ala Arg Lys Ala Arg
Ala Asp Gln Lys Thr Pro 85 90
95Phe Ala Val Met Thr Trp Phe Arg Pro Gln Tyr Arg Lys Thr Phe Asp
100 105 110His Pro Val Ser Arg
Gln Gln Leu His Asp Val Ile Asp Gln Gln Ile 115
120 125Pro Ser Asp Asn Leu Phe Cys Ala Leu His Ile Asp
Gly His Phe Arg 130 135 140His Ala His
Thr Arg Thr Val Pro Arg Gln Thr Pro Pro Tyr Arg Ala145
150 155 160Met Thr Asp Val Leu Asp Asp
Gln Pro Val Phe Arg Phe Asn Gln Arg 165
170 175Lys Gly Thr Leu Val Gly Phe Arg Thr Pro Gln His
Met Gln Gly Leu 180 185 190Asn
Val Ala Gly Tyr His Glu His Phe Ile Thr Asp Asp Arg Gln Gly 195
200 205Gly Gly His Leu Leu Asp Tyr Gln Leu
Asp Ser Gly Val Leu Thr Phe 210 215
220Gly Glu Ile His Lys Leu Met Ile Asp Leu Pro Ala Asp Ser Ala Phe225
230 235 240Leu Gln Ala Asp
Leu His Pro Asp Asn Leu Asp Ala Ala Ile Arg Ala 245
250 255Val Glu Asn841053DNABacillus cereus
84atgaaagcac tactttggca taatcaacgt gatgtacgag tagaagaagt accagaacca
60acagtaaaac caggaacagt gaaaatcaaa gttaaatggt gtggtatttg tgggacagac
120ttgcatgaat atttagcagg gcctattttt attccaacag aagaacatcc attaacacat
180gtgaaagcac ctgttatttt aggtcatgag tttagtggtg aggtaataga gattggtgaa
240ggagttacat ctcataaagt gggagaccgc gttgttgtag agccaattta ttcttgtggt
300aaatgtgaag cttgtaaaca tggacattac aatgtttgtg aacaacttgt tttccacggt
360cttggcggag aaggcggcgg tttctctgaa tatacagtag taccagaaga tatggttcat
420cacattccag atgaaatgac gtatgaacaa ggtgcgcttg tagaaccagc agcagtagca
480gttcatgcag tacgtcaaag taaattaaaa gaaggggaag ctgtagcggt atttggttgc
540ggtccaattg gacttcttgt tatccaagca gctaaagcag caggagcaac tcctgttatt
600gcagttgaac tttctaaaga acgtcaagag ttagcgaaat tagcaggtgc ggattatgta
660ttaaatccag caactcaaga tgtgttagct gaaattcgta acttaacaaa tggtttaggt
720gtaaatgtta gctttgaagt aacaggtgtt gaagttgtac tacgccaagc gattgaaagt
780acaagcttcg aaggacaaac tgtaattgtt agtgtatggg aaaaagacgc aacaattact
840ccaaataact tagtattaaa agaaaaagaa gttattggta ttttaggata ccgtcacatc
900ttcccagctg ttattaaatt gattagctcc ggtcaaattc aagcagagaa attaattacg
960aaaaaaatta cagtggatca agttgttgaa gaaggatttg aagcacttgt aaaagataaa
1020acacaagtga aaattcttgt ttcacctaaa taa
105385350PRTBacillus cereus 85Met Lys Ala Leu Leu Trp His Asn Gln Arg Asp
Val Arg Val Glu Glu1 5 10
15Val Pro Glu Pro Thr Val Lys Pro Gly Thr Val Lys Ile Lys Val Lys
20 25 30Trp Cys Gly Ile Cys Gly Thr
Asp Leu His Glu Tyr Leu Ala Gly Pro 35 40
45Ile Phe Ile Pro Thr Glu Glu His Pro Leu Thr His Val Lys Ala
Pro 50 55 60Val Ile Leu Gly His Glu
Phe Ser Gly Glu Val Ile Glu Ile Gly Glu65 70
75 80Gly Val Thr Ser His Lys Val Gly Asp Arg Val
Val Val Glu Pro Ile 85 90
95Tyr Ser Cys Gly Lys Cys Glu Ala Cys Lys His Gly His Tyr Asn Val
100 105 110Cys Glu Gln Leu Val Phe
His Gly Leu Gly Gly Glu Gly Gly Gly Phe 115 120
125Ser Glu Tyr Thr Val Val Pro Glu Asp Met Val His His Ile
Pro Asp 130 135 140Glu Met Thr Tyr Glu
Gln Gly Ala Leu Val Glu Pro Ala Ala Val Ala145 150
155 160Val His Ala Val Arg Gln Ser Lys Leu Lys
Glu Gly Glu Ala Val Ala 165 170
175Val Phe Gly Cys Gly Pro Ile Gly Leu Leu Val Ile Gln Ala Ala Lys
180 185 190Ala Ala Gly Ala Thr
Pro Val Ile Ala Val Glu Leu Ser Lys Glu Arg 195
200 205Gln Glu Leu Ala Lys Leu Ala Gly Ala Asp Tyr Val
Leu Asn Pro Ala 210 215 220Thr Gln Asp
Val Leu Ala Glu Ile Arg Asn Leu Thr Asn Gly Leu Gly225
230 235 240Val Asn Val Ser Phe Glu Val
Thr Gly Val Glu Val Val Leu Arg Gln 245
250 255Ala Ile Glu Ser Thr Ser Phe Glu Gly Gln Thr Val
Ile Val Ser Val 260 265 270Trp
Glu Lys Asp Ala Thr Ile Thr Pro Asn Asn Leu Val Leu Lys Glu 275
280 285Lys Glu Val Ile Gly Ile Leu Gly Tyr
Arg His Ile Phe Pro Ala Val 290 295
300Ile Lys Leu Ile Ser Ser Gly Gln Ile Gln Ala Glu Lys Leu Ile Thr305
310 315 320Lys Lys Ile Thr
Val Asp Gln Val Val Glu Glu Gly Phe Glu Ala Leu 325
330 335Val Lys Asp Lys Thr Gln Val Lys Ile Leu
Val Ser Pro Lys 340 345
350861053DNABacillus cereus 86atgaaagcac tactttggca taatcaacgt gatgtacgag
tagaagaagt accagaacca 60acagtaaaac caggaacagt gaaaatcaaa gttaaatggt
gtggtatttg tgggacagac 120ttgcatgaat atttagcagg gcctattttt attccaacag
aagaacatcc attaacacat 180gtgaaagcac ctgttatttt aggtcatgag tttagtggtg
aggtaataga gattggtgaa 240ggagttacat ctcataaagt gggagaccgc gttgttgtag
agccaattta ttcttgtggt 300aaatgtgaag cttgtaaaca tggacattac aatgtttgtg
aacaacttgt tttccacggt 360cttggcggag aaggcggcgg tttctctgaa tatacagtag
taccagaaga tatggttcat 420cacattccag atgaaatgac gtatgaacaa ggtgcgcttg
tagaaccagc agcagtagca 480gttcatgcag tacgtcaaag taaattaaaa gaaggggaag
ctgtagcggt atttggttgc 540ggtccaattg gacttcttgt tatccaagca gctaaagcag
caggagcaac tcctgttatt 600gcagttgaac tttctaaaga acgtcaagag ttagcgaaat
tagcaggtgc ggattatgta 660ttaaatccag caactcaaga tgtgttagct gaaattcgta
acttaacaaa tggtttaggt 720gtaaatgtta gctttgaagt aacaggtgtt gaagttgtac
tacgccaagc gattgaaagt 780acaagcttcg aaggacaaac tgtaattgtt agtgtatggg
aaaaagacgc aacaattact 840ccaaataact tagtattaaa agaaaaagaa gttattggta
ttttaggata ccgtcacatc 900ttcccagctg ttattaaatt gattagctcc ggtcaaattc
aagcagagaa attaattacg 960aaaaaaatta cagtggatca agttgttgaa gaaggatttg
aagcacttgt aaaagataaa 1020acacaagtga aaattcttgt ttcacctaaa taa
105387350PRTBacillus cereus 87Met Lys Ala Leu Leu
Trp His Asn Gln Arg Asp Val Arg Val Glu Glu1 5
10 15Val Pro Glu Pro Thr Val Lys Pro Gly Thr Val
Lys Ile Lys Val Lys 20 25
30Trp Cys Gly Ile Cys Gly Thr Asp Leu His Glu Tyr Leu Ala Gly Pro
35 40 45Ile Phe Ile Pro Thr Glu Glu His
Pro Leu Thr His Val Lys Ala Pro 50 55
60Val Ile Leu Gly His Glu Phe Ser Gly Glu Val Ile Glu Ile Gly Glu65
70 75 80Gly Val Thr Ser His
Lys Val Gly Asp Arg Val Val Val Glu Pro Ile 85
90 95Tyr Ser Cys Gly Lys Cys Glu Ala Cys Lys His
Gly His Tyr Asn Val 100 105
110Cys Glu Gln Leu Val Phe His Gly Leu Gly Gly Glu Gly Gly Gly Phe
115 120 125Ser Glu Tyr Thr Val Val Pro
Glu Asp Met Val His His Ile Pro Asp 130 135
140Glu Met Thr Tyr Glu Gln Gly Ala Leu Val Glu Pro Ala Ala Val
Ala145 150 155 160Val His
Ala Val Arg Gln Ser Lys Leu Lys Glu Gly Glu Ala Val Ala
165 170 175Val Phe Gly Cys Gly Pro Ile
Gly Leu Leu Val Ile Gln Ala Ala Lys 180 185
190Ala Ala Gly Ala Thr Pro Val Ile Ala Val Glu Leu Ser Lys
Glu Arg 195 200 205Gln Glu Leu Ala
Lys Leu Ala Gly Ala Asp Tyr Val Leu Asn Pro Ala 210
215 220Thr Gln Asp Val Leu Ala Glu Ile Arg Asn Leu Thr
Asn Gly Leu Gly225 230 235
240Val Asn Val Ser Phe Glu Val Thr Gly Val Glu Val Val Leu Arg Gln
245 250 255Ala Ile Glu Ser Thr
Ser Phe Glu Gly Gln Thr Val Ile Val Ser Val 260
265 270Trp Glu Lys Asp Ala Thr Ile Thr Pro Asn Asn Leu
Val Leu Lys Glu 275 280 285Lys Glu
Val Ile Gly Ile Leu Gly Tyr Arg His Ile Phe Pro Ala Val 290
295 300Ile Lys Leu Ile Ser Ser Gly Gln Ile Gln Ala
Glu Lys Leu Ile Thr305 310 315
320Lys Lys Ile Thr Val Asp Gln Val Val Glu Glu Gly Phe Glu Ala Leu
325 330 335Val Lys Asp Lys
Thr Gln Val Lys Ile Leu Val Ser Pro Lys 340
345 350881113DNALactococcus lactis 88ttgcctgaaa
cgacaaccat cctatataga ggaggcgttt ttatgcgcgc agcacgtttt 60tacgaccgcg
gggatatccg cattgatgaa attaatgaac caatagtaaa agctggccaa 120gttggcattg
atgtggcttg gtgtggaatt tgtggaacag atctccatga atttttagat 180ggcccaattt
tttgtccgtc agcagaacat cctaatccaa ttactggaga agtaccacca 240gtcactcttg
gacatgaaat gtctggggtt gtaaatttta taggtgaagg agtaagcgga 300cttaaagtag
gtgaccatgt cgttgtcgaa ccttatatcg ttcccgaagg gactgataca 360agtgaaactg
gacattataa cctctcagaa ggctcaaact ttattggttt gggcggaaat 420ggtggaggtt
tggctgaaaa aatttctgtt gatgaacgtt gggttcacaa aattcctgat 480aacttaccat
tggatgaagc tgctctaatt gagccactat cagtcggcta tcacgctgtt 540gaacgagcaa
atttaagtga aaagagtacg gtattagttg ttggtgctgg accaattgga 600ctattaactg
ctgccgttgc aaaagcgcaa ggacatactg ttatcatcag tgaacctagt 660ggacttcgtc
gtaaaaaagc acaagaagca caagttgctg attatttctt caatccaatt 720gaagatgaca
ttcaagctaa agttcatgaa attaatgaaa aaggagtgga cgcagccttt 780gaatgtacct
ctgtccaacc gggatttgac gcttgtctag atgcgattcg tatgggtgga 840acagttgtca
ttgtcgcaat ttggggcaag cctgctagtg ttgatatggc aaaattagta 900atcaaagaag
ctaacctttt aggaacgatt gcttataata acactcatcc aaaaacaatt 960gatttagtat
caacaggtaa aataaaattg gaccaattca tcacagctaa aatcggtttg 1020gatgatttga
ttgataaagg attcgatacg ctgattcatc ataatgaaac agctgttaaa 1080attttagttt
caccaactgg taaaggtcta taa
111389370PRTLactococcus lactis 89Met Pro Glu Thr Thr Thr Ile Leu Tyr Arg
Gly Gly Val Phe Met Arg1 5 10
15Ala Ala Arg Phe Tyr Asp Arg Gly Asp Ile Arg Ile Asp Glu Ile Asn
20 25 30Glu Pro Ile Val Lys Ala
Gly Gln Val Gly Ile Asp Val Ala Trp Cys 35 40
45Gly Ile Cys Gly Thr Asp Leu His Glu Phe Leu Asp Gly Pro
Ile Phe 50 55 60Cys Pro Ser Ala Glu
His Pro Asn Pro Ile Thr Gly Glu Val Pro Pro65 70
75 80Val Thr Leu Gly His Glu Met Ser Gly Val
Val Asn Phe Ile Gly Glu 85 90
95Gly Val Ser Gly Leu Lys Val Gly Asp His Val Val Val Glu Pro Tyr
100 105 110Ile Val Pro Glu Gly
Thr Asp Thr Ser Glu Thr Gly His Tyr Asn Leu 115
120 125Ser Glu Gly Ser Asn Phe Ile Gly Leu Gly Gly Asn
Gly Gly Gly Leu 130 135 140Ala Glu Lys
Ile Ser Val Asp Glu Arg Trp Val His Lys Ile Pro Asp145
150 155 160Asn Leu Pro Leu Asp Glu Ala
Ala Leu Ile Glu Pro Leu Ser Val Gly 165
170 175Tyr His Ala Val Glu Arg Ala Asn Leu Ser Glu Lys
Ser Thr Val Leu 180 185 190Val
Val Gly Ala Gly Pro Ile Gly Leu Leu Thr Ala Ala Val Ala Lys 195
200 205Ala Gln Gly His Thr Val Ile Ile Ser
Glu Pro Ser Gly Leu Arg Arg 210 215
220Lys Lys Ala Gln Glu Ala Gln Val Ala Asp Tyr Phe Phe Asn Pro Ile225
230 235 240Glu Asp Asp Ile
Gln Ala Lys Val His Glu Ile Asn Glu Lys Gly Val 245
250 255Asp Ala Ala Phe Glu Cys Thr Ser Val Gln
Pro Gly Phe Asp Ala Cys 260 265
270Leu Asp Ala Ile Arg Met Gly Gly Thr Val Val Ile Val Ala Ile Trp
275 280 285Gly Lys Pro Ala Ser Val Asp
Met Ala Lys Leu Val Ile Lys Glu Ala 290 295
300Asn Leu Leu Gly Thr Ile Ala Tyr Asn Asn Thr His Pro Lys Thr
Ile305 310 315 320Asp Leu
Val Ser Thr Gly Lys Ile Lys Leu Asp Gln Phe Ile Thr Ala
325 330 335Lys Ile Gly Leu Asp Asp Leu
Ile Asp Lys Gly Phe Asp Thr Leu Ile 340 345
350His His Asn Glu Thr Ala Val Lys Ile Leu Val Ser Pro Thr
Gly Lys 355 360 365Gly Leu
37090705DNAPyrococcus furiosus 90atgaaggttg ccgtaattac tggggcatcc
cgtggaatcg gggaagctat agcaaaggcc 60cttgctgaag atggatattc ccttgcctta
ggggctagaa gtgttgatag gttagagaag 120attgccaagg aactcagcga aaaacatggg
gtggaggtat tttacgacta cctcgatgta 180tcaaaaccag aaagcgttga agagtttgca
aggaaaacgc tagctcactt tggagatgtg 240gacgttgttg tggccaatgc ggggcttggt
tactttggta ggcttgaaga gcttacagaa 300gagcagttcc acgaaatgat tgaagtaaac
cttttgggag tttggagaac aataaaagct 360ttcttaaact ccttaaagcg gactggagga
gtggctattg ttgttacttc agatgtttct 420gcaaggctac ttccatacgg tggaggttat
gtggcaacta aatgggctgc aagagcattg 480gtaaggacct tccagattga gaatccagat
gtgaggttct tcgagctaag acctggagca 540gtagatacat attttggagg gagcaaagct
gggaagccaa aggagcaagg gtatttaaaa 600cctgaggaag ttgctgaggc agtaaaatac
ctcctaagac ttccaaagga tgttagggtt 660gaggaattaa tgttgcgctc aatttatcaa
aaacctgagt attga 70591234PRTPyrococcus furiosus 91Met
Lys Val Ala Val Ile Thr Gly Ala Ser Arg Gly Ile Gly Glu Ala1
5 10 15Ile Ala Lys Ala Leu Ala Glu
Asp Gly Tyr Ser Leu Ala Leu Gly Ala 20 25
30Arg Ser Val Asp Arg Leu Glu Lys Ile Ala Lys Glu Leu Ser
Glu Lys 35 40 45His Gly Val Glu
Val Phe Tyr Asp Tyr Leu Asp Val Ser Lys Pro Glu 50 55
60Ser Val Glu Glu Phe Ala Arg Lys Thr Leu Ala His Phe
Gly Asp Val65 70 75
80Asp Val Val Val Ala Asn Ala Gly Leu Gly Tyr Phe Gly Arg Leu Glu
85 90 95Glu Leu Thr Glu Glu Gln
Phe His Glu Met Ile Glu Val Asn Leu Leu 100
105 110Gly Val Trp Arg Thr Ile Lys Ala Phe Leu Asn Ser
Leu Lys Arg Thr 115 120 125Gly Gly
Val Ala Ile Val Val Thr Ser Asp Val Ser Ala Arg Leu Leu 130
135 140Pro Tyr Gly Gly Gly Tyr Val Ala Thr Lys Trp
Ala Ala Arg Ala Leu145 150 155
160Val Arg Thr Phe Gln Ile Glu Asn Pro Asp Val Arg Phe Phe Glu Leu
165 170 175Arg Pro Gly Ala
Val Asp Thr Tyr Phe Gly Gly Ser Lys Ala Gly Lys 180
185 190Pro Lys Glu Gln Gly Tyr Leu Lys Pro Glu Glu
Val Ala Glu Ala Val 195 200 205Lys
Tyr Leu Leu Arg Leu Pro Lys Asp Val Arg Val Glu Glu Leu Met 210
215 220Leu Arg Ser Ile Tyr Gln Lys Pro Glu
Tyr225 230921665DNASalmonella typhimurium 92atgagatcga
aaagatttga agcactggcg aaacgccctg tgaatcagga cggctttgtt 60aaggagtgga
tcgaagaagg ctttatcgcg atggaaagcc cgaacgaccc aaaaccgtcg 120ataaaaatcg
ttaacggcgc ggtaaccgag ctggacggaa aaccggttag cgaattcgac 180ctgatcgacc
actttatcgc ccgctacggc atcaacctga accgcgccga agaagtgatg 240gcgatggatt
cggtcaagct ggctaacatg ctgtgcgatc cgaacgtcaa gcgcagcgaa 300atcgttccgc
taaccaccgc gatgacccca gcgaaaattg tcgaagtggt ttcgcatatg 360aacgtggttg
agatgatgat ggcgatgcag aaaatgcgcg cccgccgtac tccatctcaa 420caggcgcacg
tcaccaacgt taaagacaac ccggtgcaaa ttgccgccga tgccgccgaa 480ggcgcatggc
gcgggtttga cgaacaagag acgacggttg cggtagcgcg ctatgcgccg 540ttcaacgcca
tcgcgctgct ggttggttct caggtaggtc gtccgggggt actgactcaa 600tgctcgctgg
aagaagccac cgagctgaag ctcggcatgc tgggccacac ctgctacgcc 660gaaaccatct
ccgtttacgg caccgagccg gtcttcaccg acggtgacga taccccatgg 720tcgaagggct
tcttagcctc ttcctacgcc tctcgcggcc tgaaaatgcg cttcacctcc 780ggctccggct
ccgaagtgca gatgggctac gccgaaggca aatccatgct gtatctggaa 840gcgcgctgca
tctatatcac caaagccgcg ggcgttcagg ggctgcaaaa cggctccgta 900agcagcatcg
gcgtaccgtc tgccgtgccg tcaggcattc gtgccgtgct ggcggaaaac 960ctgatctgct
cttcgctgga tctggaatgc gcctccagta acgaccagac cttcacccac 1020tccgatatgc
gtcgtaccgc tcgcctgctg atgcagttcc tgccgggtac cgactttatc 1080tcctccggtt
attccgcggt gccgaactac gacaacatgt tcgccggttc caacgaagat 1140gcggaagact
ttgacgacta caacgttatc cagcgtgacc tgaaagtgga cggcggtctg 1200cgcccggttc
gcgaagagga cgttatcgcc atccgtaaca aagccgcccg cgcgctgcag 1260gccgtgtttg
ccggaatggg actgccgccg attaccgatg aagaagttga agccgcgacc 1320tatgcccacg
gttcgaaaga tatgccggag cgcaacatcg tcgaagacat caagttcgcc 1380caggaaatca
tcaataaaaa ccgcaacggt ctggaagttg tgaaagcgct ggctcagggc 1440gggtttaccg
acgtggccca ggacatgctc aacatccaga aagccaagct aaccggcgac 1500tatttgcaca
cctccgccat tatcgtcggc gacggacaag tgctctctgc ggttaatgac 1560gtcaatgact
atgccggtcc ggcaacaggt tatcgcctgc agggagaacg ctgggaagag 1620attaaaaaca
tccctggcgc tcttgatccc aacgagattg attaa
166593554PRTSalmonella typhimurium 93Met Arg Ser Lys Arg Phe Glu Ala Leu
Ala Lys Arg Pro Val Asn Gln1 5 10
15Asp Gly Phe Val Lys Glu Trp Ile Glu Glu Gly Phe Ile Ala Met
Glu 20 25 30Ser Pro Asn Asp
Pro Lys Pro Ser Ile Lys Ile Val Asn Gly Ala Val 35
40 45Thr Glu Leu Asp Gly Lys Pro Val Ser Glu Phe Asp
Leu Ile Asp His 50 55 60Phe Ile Ala
Arg Tyr Gly Ile Asn Leu Asn Arg Ala Glu Glu Val Met65 70
75 80Ala Met Asp Ser Val Lys Leu Ala
Asn Met Leu Cys Asp Pro Asn Val 85 90
95Lys Arg Ser Glu Ile Val Pro Leu Thr Thr Ala Met Thr Pro
Ala Lys 100 105 110Ile Val Glu
Val Val Ser His Met Asn Val Val Glu Met Met Met Ala 115
120 125Met Gln Lys Met Arg Ala Arg Arg Thr Pro Ser
Gln Gln Ala His Val 130 135 140Thr Asn
Val Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala Glu145
150 155 160Gly Ala Trp Arg Gly Phe Asp
Glu Gln Glu Thr Thr Val Ala Val Ala 165
170 175Arg Tyr Ala Pro Phe Asn Ala Ile Ala Leu Leu Val
Gly Ser Gln Val 180 185 190Gly
Arg Pro Gly Val Leu Thr Gln Cys Ser Leu Glu Glu Ala Thr Glu 195
200 205Leu Lys Leu Gly Met Leu Gly His Thr
Cys Tyr Ala Glu Thr Ile Ser 210 215
220Val Tyr Gly Thr Glu Pro Val Phe Thr Asp Gly Asp Asp Thr Pro Trp225
230 235 240Ser Lys Gly Phe
Leu Ala Ser Ser Tyr Ala Ser Arg Gly Leu Lys Met 245
250 255Arg Phe Thr Ser Gly Ser Gly Ser Glu Val
Gln Met Gly Tyr Ala Glu 260 265
270Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Tyr Ile Thr Lys
275 280 285Ala Ala Gly Val Gln Gly Leu
Gln Asn Gly Ser Val Ser Ser Ile Gly 290 295
300Val Pro Ser Ala Val Pro Ser Gly Ile Arg Ala Val Leu Ala Glu
Asn305 310 315 320Leu Ile
Cys Ser Ser Leu Asp Leu Glu Cys Ala Ser Ser Asn Asp Gln
325 330 335Thr Phe Thr His Ser Asp Met
Arg Arg Thr Ala Arg Leu Leu Met Gln 340 345
350Phe Leu Pro Gly Thr Asp Phe Ile Ser Ser Gly Tyr Ser Ala
Val Pro 355 360 365Asn Tyr Asp Asn
Met Phe Ala Gly Ser Asn Glu Asp Ala Glu Asp Phe 370
375 380Asp Asp Tyr Asn Val Ile Gln Arg Asp Leu Lys Val
Asp Gly Gly Leu385 390 395
400Arg Pro Val Arg Glu Glu Asp Val Ile Ala Ile Arg Asn Lys Ala Ala
405 410 415Arg Ala Leu Gln Ala
Val Phe Ala Gly Met Gly Leu Pro Pro Ile Thr 420
425 430Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala His Gly
Ser Lys Asp Met 435 440 445Pro Glu
Arg Asn Ile Val Glu Asp Ile Lys Phe Ala Gln Glu Ile Ile 450
455 460Asn Lys Asn Arg Asn Gly Leu Glu Val Val Lys
Ala Leu Ala Gln Gly465 470 475
480Gly Phe Thr Asp Val Ala Gln Asp Met Leu Asn Ile Gln Lys Ala Lys
485 490 495Leu Thr Gly Asp
Tyr Leu His Thr Ser Ala Ile Ile Val Gly Asp Gly 500
505 510Gln Val Leu Ser Ala Val Asn Asp Val Asn Asp
Tyr Ala Gly Pro Ala 515 520 525Thr
Gly Tyr Arg Leu Gln Gly Glu Arg Trp Glu Glu Ile Lys Asn Ile 530
535 540Pro Gly Ala Leu Asp Pro Asn Glu Ile
Asp545 55094675DNASalmonella typhimurium 94atggaaatta
atgaaaaatt gctgcgccag ataattgaag acgtactccg cgatatgaag 60ggcagcgata
aacccgtctc gtttaatgcg cctgcggcat ccacagcacc acagaccgct 120gcgcctgcgg
gcgacggctt tctgaccgaa gtgggcgaag cgcgccaggg cactcagcag 180gacgaagtca
ttatcgccgt cggcccggca tttggcctgg cgcaaaccgt caatatcgtc 240ggcttaccgc
ataagagcat tctgcgcgaa gtcattgccg gtattgaaga agaaggcatc 300aaggcgcgcg
tgattcgctg ctttaaatct tccgacgtgg cgttcgtcgc cgttgaaggt 360aaccgcctga
gcggatccgg catctccatc ggcatccagt cgaaaggtac tacggttatc 420caccagcagg
ggctaccgcc gctctccaac ctggagctgt tcccgcaggc accgctgctg 480acgctggaaa
cctaccgtca gattggtaaa aacgccgccc gctatgcgaa acgagaatca 540ccgcagccgg
tccctacgct caatgaccag atggcacgcc cgaagtacca ggcaaagtcg 600gccattttgc
atattaaaga gaccaagtac gtcgtgacgg gcaaaaaccc gcaggaactg 660cgcgtggcgc
tttga
67595224PRTSalmonella typhimurium 95Met Glu Ile Asn Glu Lys Leu Leu Arg
Gln Ile Ile Glu Asp Val Leu1 5 10
15Arg Asp Met Lys Gly Ser Asp Lys Pro Val Ser Phe Asn Ala Pro
Ala 20 25 30Ala Ser Thr Ala
Pro Gln Thr Ala Ala Pro Ala Gly Asp Gly Phe Leu 35
40 45Thr Glu Val Gly Glu Ala Arg Gln Gly Thr Gln Gln
Asp Glu Val Ile 50 55 60Ile Ala Val
Gly Pro Ala Phe Gly Leu Ala Gln Thr Val Asn Ile Val65 70
75 80Gly Leu Pro His Lys Ser Ile Leu
Arg Glu Val Ile Ala Gly Ile Glu 85 90
95Glu Glu Gly Ile Lys Ala Arg Val Ile Arg Cys Phe Lys Ser
Ser Asp 100 105 110Val Ala Phe
Val Ala Val Glu Gly Asn Arg Leu Ser Gly Ser Gly Ile 115
120 125Ser Ile Gly Ile Gln Ser Lys Gly Thr Thr Val
Ile His Gln Gln Gly 130 135 140Leu Pro
Pro Leu Ser Asn Leu Glu Leu Phe Pro Gln Ala Pro Leu Leu145
150 155 160Thr Leu Glu Thr Tyr Arg Gln
Ile Gly Lys Asn Ala Ala Arg Tyr Ala 165
170 175Lys Arg Glu Ser Pro Gln Pro Val Pro Thr Leu Asn
Asp Gln Met Ala 180 185 190Arg
Pro Lys Tyr Gln Ala Lys Ser Ala Ile Leu His Ile Lys Glu Thr 195
200 205Lys Tyr Val Val Thr Gly Lys Asn Pro
Gln Glu Leu Arg Val Ala Leu 210 215
22096522DNASalmonella typhimurium 96atgaataccg acgcaattga atcgatggtc
cgggacgtat tgagccgcat gaacagcctg 60cagggcgatg cgccagcagc ggctcctgcg
gcaggcggca cgtcccgcag cgcaaaggtc 120agcgactacc cgctggcgaa caaacacccg
gaatgggtga aaaccgccac caataaaacg 180ctggacgact ttacgctgga aaacgtgctg
agcaataaag tcaccgctca ggatatgcgt 240attaccccgg aaaccctgcg cttacaggcc
tctatcgcca aagatgcggg tcgcgaccgg 300ctggcgatga acttcgaacg cgccgccgaa
ctgaccgcgg taccggacga tcgcattctt 360gaaatctaca acgcccttcg tccgtatcgt
tcaacgaaag aagagctgct cgctatcgcc 420gacgatctcg aaaaccgtta tcaggcaaag
atttgcgcag ctttcgttcg tgaagcggca 480gggctgtacg ttgagcgtaa aaaactcaaa
ggcgacgatt aa 52297173PRTSalmonella typhimurium
97Met Asn Thr Asp Ala Ile Glu Ser Met Val Arg Asp Val Leu Ser Arg1
5 10 15Met Asn Ser Leu Gln Gly
Asp Ala Pro Ala Ala Ala Pro Ala Ala Gly 20 25
30Gly Thr Ser Arg Ser Ala Lys Val Ser Asp Tyr Pro Leu
Ala Asn Lys 35 40 45His Pro Glu
Trp Val Lys Thr Ala Thr Asn Lys Thr Leu Asp Asp Phe 50
55 60Thr Leu Glu Asn Val Leu Ser Asn Lys Val Thr Ala
Gln Asp Met Arg65 70 75
80Ile Thr Pro Glu Thr Leu Arg Leu Gln Ala Ser Ile Ala Lys Asp Ala
85 90 95Gly Arg Asp Arg Leu Ala
Met Asn Phe Glu Arg Ala Ala Glu Leu Thr 100
105 110Ala Val Pro Asp Asp Arg Ile Leu Glu Ile Tyr Asn
Ala Leu Arg Pro 115 120 125Tyr Arg
Ser Thr Lys Glu Glu Leu Leu Ala Ile Ala Asp Asp Leu Glu 130
135 140Asn Arg Tyr Gln Ala Lys Ile Cys Ala Ala Phe
Val Arg Glu Ala Ala145 150 155
160Gly Leu Tyr Val Glu Arg Lys Lys Leu Lys Gly Asp Asp
165 170981677DNALactobacillus collinoides 98ttggaacgtc
aaaaaagatt tgaaaaatta gagaaacgtc cagtgcattt agatgggttc 60gttaagaact
gggacgacga aggtttagtt gcccttaacg gtaagaacga tccaaagcca 120agcattacga
tcgaaaacgg tgttgttact gaaatggatg gtaagaagaa ggcagacttc 180gaccttatcg
acaagtacat cgctgaatac gggatcaact tggacaatgc tgaaaagact 240ttaaacacag
attcagttaa gatcgccaac atgatgtgtg atcctaacgt ctcccgtgct 300gaaattattg
aatatacaac tgctatgaca ccagccaagg ctgctgaagt tatcagccag 360ttaaacttcg
ctgaaatgat catggcaact caaaagatgc ggccacgtcg gacccctatg 420actcaagtcc
acgctaccaa cactttggat aacccagttg aaatcgctgc tgatgctgcc 480gaagctgcat
tacgtggggt tcctgaagaa gaaaccacca ctgccattgc tcggtatgcg 540ccaatgaacg
ctatttcaat catggttggg gcccaagcag gccgtcctgg tgttatcacc 600caatgttcag
ttgaagaagc tgacgaattg agtttgggga tgcgtgggtt tactgcctat 660gctgaaacca
tttcagttta tgggactgac cgggtcttca ctgatggtga tgatacccct 720tggtcaaaag
gtttcttagc ttcttgctac gcttcacgtg gtttgaagat gcggtttact 780tcaggtgccg
gttcagaagc tatgatgggc tacactgaag gtaaatcaat gctttacctt 840gaagctcgtt
gtatctacat taccaaggcg tcaggtgttc aaggtctgca aaacggtggt 900gttagttgta
tcgggatgcc aggtgccgtc gttggtggta tccgtgaagt cttaggtgaa 960aacttactat
gtatgtcact tgatgttgaa tgtgcttctg gttgtgacca agccttctct 1020cactctgaca
ttcgtcggac tggccggatg attggccaat tcatcgctgg tactgattac 1080ctgtcatcag
gttacgctgc cgaagaaaac atggataaca ccttcgctgg ttcaaacatg 1140gatgttctgg
actacgatga ttacatcact ttggaacgtg atatggctat taacggtggt 1200atcatgccaa
ttaccgaaga ggaatctatt aagattcgtc acaaggctgc ggttgctatc 1260caagctgtct
ttgatggctt aggcctacca cagatcactg atgaagaagt tgaagccgca 1320acttatggca
gcaattcaaa cgacatgcca aaacgtgaca tggttcaaga tatgaaagct 1380gctcaaggtc
tgatgactcg tggcattact gttgttgacg ttatcaaggc cttatatgac 1440catgatatta
aagacgtcgc tgaggctgtg cttaagttag cgcaacaaaa ggtttgtggt 1500gattacctgc
aaacatctgc tgtcttcttg gatggttgga agtgtacttc agctattaac 1560aacgctaacg
attacaaagg cccaggtact ggttaccgtc tatgggaaga caaagacaaa 1620tgggatcgtc
tagaaaacgt tccgtgggct ttggatcctc agaagttgga attctaa
167799558PRTLactobacillus collinoides 99Met Glu Arg Gln Lys Arg Phe Glu
Lys Leu Glu Lys Arg Pro Val His1 5 10
15Leu Asp Gly Phe Val Lys Asn Trp Asp Asp Glu Gly Leu Val
Ala Leu 20 25 30Asn Gly Lys
Asn Asp Pro Lys Pro Ser Ile Thr Ile Glu Asn Gly Val 35
40 45Val Thr Glu Met Asp Gly Lys Lys Lys Ala Asp
Phe Asp Leu Ile Asp 50 55 60Lys Tyr
Ile Ala Glu Tyr Gly Ile Asn Leu Asp Asn Ala Glu Lys Thr65
70 75 80Leu Asn Thr Asp Ser Val Lys
Ile Ala Asn Met Met Cys Asp Pro Asn 85 90
95Val Ser Arg Ala Glu Ile Ile Glu Tyr Thr Thr Ala Met
Thr Pro Ala 100 105 110Lys Ala
Ala Glu Val Ile Ser Gln Leu Asn Phe Ala Glu Met Ile Met 115
120 125Ala Thr Gln Lys Met Arg Pro Arg Arg Thr
Pro Met Thr Gln Val His 130 135 140Ala
Thr Asn Thr Leu Asp Asn Pro Val Glu Ile Ala Ala Asp Ala Ala145
150 155 160Glu Ala Ala Leu Arg Gly
Val Pro Glu Glu Glu Thr Thr Thr Ala Ile 165
170 175Ala Arg Tyr Ala Pro Met Asn Ala Ile Ser Ile Met
Val Gly Ala Gln 180 185 190Ala
Gly Arg Pro Gly Val Ile Thr Gln Cys Ser Val Glu Glu Ala Asp 195
200 205Glu Leu Ser Leu Gly Met Arg Gly Phe
Thr Ala Tyr Ala Glu Thr Ile 210 215
220Ser Val Tyr Gly Thr Asp Arg Val Phe Thr Asp Gly Asp Asp Thr Pro225
230 235 240Trp Ser Lys Gly
Phe Leu Ala Ser Cys Tyr Ala Ser Arg Gly Leu Lys 245
250 255Met Arg Phe Thr Ser Gly Ala Gly Ser Glu
Ala Met Met Gly Tyr Thr 260 265
270Glu Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Tyr Ile Thr
275 280 285Lys Ala Ser Gly Val Gln Gly
Leu Gln Asn Gly Gly Val Ser Cys Ile 290 295
300Gly Met Pro Gly Ala Val Val Gly Gly Ile Arg Glu Val Leu Gly
Glu305 310 315 320Asn Leu
Leu Cys Met Ser Leu Asp Val Glu Cys Ala Ser Gly Cys Asp
325 330 335Gln Ala Phe Ser His Ser Asp
Ile Arg Arg Thr Gly Arg Met Ile Gly 340 345
350Gln Phe Ile Ala Gly Thr Asp Tyr Leu Ser Ser Gly Tyr Ala
Ala Glu 355 360 365Glu Asn Met Asp
Asn Thr Phe Ala Gly Ser Asn Met Asp Val Leu Asp 370
375 380Tyr Asp Asp Tyr Ile Thr Leu Glu Arg Asp Met Ala
Ile Asn Gly Gly385 390 395
400Ile Met Pro Ile Thr Glu Glu Glu Ser Ile Lys Ile Arg His Lys Ala
405 410 415Ala Val Ala Ile Gln
Ala Val Phe Asp Gly Leu Gly Leu Pro Gln Ile 420
425 430Thr Asp Glu Glu Val Glu Ala Ala Thr Tyr Gly Ser
Asn Ser Asn Asp 435 440 445Met Pro
Lys Arg Asp Met Val Gln Asp Met Lys Ala Ala Gln Gly Leu 450
455 460Met Thr Arg Gly Ile Thr Val Val Asp Val Ile
Lys Ala Leu Tyr Asp465 470 475
480His Asp Ile Lys Asp Val Ala Glu Ala Val Leu Lys Leu Ala Gln Gln
485 490 495Lys Val Cys Gly
Asp Tyr Leu Gln Thr Ser Ala Val Phe Leu Asp Gly 500
505 510Trp Lys Cys Thr Ser Ala Ile Asn Asn Ala Asn
Asp Tyr Lys Gly Pro 515 520 525Gly
Thr Gly Tyr Arg Leu Trp Glu Asp Lys Asp Lys Trp Asp Arg Leu 530
535 540Glu Asn Val Pro Trp Ala Leu Asp Pro Gln
Lys Leu Glu Phe545 550
555100693DNALactobacillus collinoides 100gtgagttcag aaatcgatga aacattgctt
agaaatatca ttaaaggcgt tttaaatgaa 60gttcaaaact ctgatacgcc aatttccttt
ggtggccaag atgcagcccc agttgccggt 120gccaaggaag gtgccgcacc agaaaagaag
ttggattggt tccaacacgt tggaatcgcc 180aaaccaggtt tgtcaaagga tgaagttgta
attggtgttg ccccagcatt tgctgaagtg 240ttgacgcaaa ctatgacgaa gatccaacac
aaagacatcc tgcgtcaaat cattgccgga 300gttgaagaag aaggtctcaa ggcccgtgtc
gttaaggttt atcggacttc agacgtttcc 360ttcgtttccg ctgatgttga caagttgtca
ggttcaggaa tttcagttgc cgttcaatca 420aaggggacaa cgattattca ccaaaaggat
caagcaccgt tgtcaaacct tgaattgttc 480ccacaggctc cagttttgac attggacgct
taccgtcaaa tcggtaagaa cgctgcccag 540tatgctaagg gtatgtcacc aaccccagtg
ccaacaatta acgaccagat ggcacgtgtg 600caatatcaag cactttctgc tttgatgcac
atcaaggaaa caaaacaggt tgttgttggg 660aagcctgctg aagaaattaa ggtaaccttt
tag 693101230PRTLactobacillus collinoides
101Met Ser Ser Glu Ile Asp Glu Thr Leu Leu Arg Asn Ile Ile Lys Gly1
5 10 15Val Leu Asn Glu Val Gln
Asn Ser Asp Thr Pro Ile Ser Phe Gly Gly 20 25
30Gln Asp Ala Ala Pro Val Ala Gly Ala Lys Glu Gly Ala
Ala Pro Glu 35 40 45Lys Lys Leu
Asp Trp Phe Gln His Val Gly Ile Ala Lys Pro Gly Leu 50
55 60Ser Lys Asp Glu Val Val Ile Gly Val Ala Pro Ala
Phe Ala Glu Val65 70 75
80Leu Thr Gln Thr Met Thr Lys Ile Gln His Lys Asp Ile Leu Arg Gln
85 90 95Ile Ile Ala Gly Val Glu
Glu Glu Gly Leu Lys Ala Arg Val Val Lys 100
105 110Val Tyr Arg Thr Ser Asp Val Ser Phe Val Ser Ala
Asp Val Asp Lys 115 120 125Leu Ser
Gly Ser Gly Ile Ser Val Ala Val Gln Ser Lys Gly Thr Thr 130
135 140Ile Ile His Gln Lys Asp Gln Ala Pro Leu Ser
Asn Leu Glu Leu Phe145 150 155
160Pro Gln Ala Pro Val Leu Thr Leu Asp Ala Tyr Arg Gln Ile Gly Lys
165 170 175Asn Ala Ala Gln
Tyr Ala Lys Gly Met Ser Pro Thr Pro Val Pro Thr 180
185 190Ile Asn Asp Gln Met Ala Arg Val Gln Tyr Gln
Ala Leu Ser Ala Leu 195 200 205Met
His Ile Lys Glu Thr Lys Gln Val Val Val Gly Lys Pro Ala Glu 210
215 220Glu Ile Lys Val Thr Phe225
230102522DNALactobacillus collinoides 102atgagtgaag tagatgactt
agtagctaga attgctgctc agctacaaca aagtggaaac 60gcttctagtg cctcaactag
tgccggtact tctgctggtt ccgagaaaga attaggcgca 120gcagattacc cactatttga
aaagcaccca gatcaaatca agacgccatc aggtaaaaat 180gttgaagaaa tcaccttgga
aaatgttatt aacggcaagg tagacgcaaa ggatatgcgg 240attacgcccg caaccctgaa
gttacaaggt gaaattgctg ccaacgcagg tcggccagca 300atccaacgga acttccagcg
ggcttctgaa ttaacttcag ttcccgatga tgttgttttg 360gacttatata attcattacg
gccattccgt tcaaccaagc aagaattatt ggataccgcc 420aaggagcttc gtgacaagta
tcacgcacct atctgtgccg gctggttcga agaagcagcc 480gaaaactacg aagtcaacaa
gaagttgaag ggcgataact ag 522103173PRTLactobacillus
collinoides 103Met Ser Glu Val Asp Asp Leu Val Ala Arg Ile Ala Ala Gln
Leu Gln1 5 10 15Gln Ser
Gly Asn Ala Ser Ser Ala Ser Thr Ser Ala Gly Thr Ser Ala 20
25 30Gly Ser Glu Lys Glu Leu Gly Ala Ala
Asp Tyr Pro Leu Phe Glu Lys 35 40
45His Pro Asp Gln Ile Lys Thr Pro Ser Gly Lys Asn Val Glu Glu Ile 50
55 60Thr Leu Glu Asn Val Ile Asn Gly Lys
Val Asp Ala Lys Asp Met Arg65 70 75
80Ile Thr Pro Ala Thr Leu Lys Leu Gln Gly Glu Ile Ala Ala
Asn Ala 85 90 95Gly Arg
Pro Ala Ile Gln Arg Asn Phe Gln Arg Ala Ser Glu Leu Thr 100
105 110Ser Val Pro Asp Asp Val Val Leu Asp
Leu Tyr Asn Ser Leu Arg Pro 115 120
125Phe Arg Ser Thr Lys Gln Glu Leu Leu Asp Thr Ala Lys Glu Leu Arg
130 135 140Asp Lys Tyr His Ala Pro Ile
Cys Ala Gly Trp Phe Glu Glu Ala Ala145 150
155 160Glu Asn Tyr Glu Val Asn Lys Lys Leu Lys Gly Asp
Asn 165 1701041665DNAKlebsiella pneumoniae
104atgagatcga aaagatttga agcactggcg aaacgccctg tgaatcagga tggtttcgtt
60aaggagtgga ttgaagaggg ctttatcgcg atggaaagtc ctaacgatcc caaaccttct
120atccgcatcg tcaacggcgc ggtgaccgaa ctcgacggta aaccggttga cgagttcgac
180ctgattgacc actttatcgc gcgctacggc attaatctcg cccgggccga agaagtgatg
240gccatggatt cggttaagct cgccaacatg ctctgcgacc cgaacgttaa acgcagcgac
300atcgtgccgc tcactaccgc gatgaccccg gcgaaaatcg tggaagtggt gtcgcatatg
360aacgtggtcg agatgatgat ggcgatgcaa aaaatgcgcg cccgccgcac gccgtcccag
420caggcgcatg tcactaatat caaagataat ccggtacaga ttgccgccga cgccgctgaa
480ggcgcatggc gcggctttga cgaacaggag accaccgtcg ccgtggcgcg ctacgcgcgg
540ttcaacgcca tcgccctgct ggtgggttca caggttggcc gccccggcgt cctcacccag
600tgttcgctgg aagaagccac cgagctgaaa ctgggcatgc tgggccacac ctgctatgcc
660gaaaccattt cggtatacgg tacggaaccg gtgtttaccg atggcgatga cactccatgg
720tcgaaaggct tcctcgcctc ctcctacgcc tcgcgcggcc tgaaaatgcg ctttacctcc
780ggttccggtt ctgaagtaca gatgggctat gccgaaggca aatcgatgct ttatctcgaa
840gcgcgctgca tctacatcac caaagccgcc ggggtgcaag gcctgcagaa tggctccgtc
900agctgtatcg gcgtaccgtc cgccgtgccg tccgggatcc gcgccgtact ggcggaaaac
960ctgatctgct cagcgctgga tctggagtgc gcctccagca acgatcaaac ctttacccac
1020tcggatatgc ggcgtaccgc gcgtctgctg atgcagttcc tgccaggcac cgacttcatc
1080tcctccggtt actcggcggt gcccaactac gacaacatgt tcgccggttc caacgaagat
1140gccgaagact tcgatgacta caacgtgatc cagcgcgacc tgaaggtcga tgggggtctg
1200cggccggtgc gtgaagagga cgtgatcgcc attcgcaaca aagccgcccg cgcgctgcag
1260gcggtatttg ccggcatggg tttgccgcct attacggatg aagaggtaga agccgccacc
1320tacgcccacg gttcaaaaga tatgcctgag cgcaatatcg tcgaggacat caagtttgct
1380caggagatca tcaacaagaa ccgcaacggc ctggaggtgg tgaaagccct ggcgaaaggc
1440ggcttccccg atgtcgccca ggacatgctc aatattcaga aagccaagct caccggcgac
1500tacctgcata cctccgccat cattgttggc gagggccagg tgctctcggc cgtgaatgac
1560gtgaacgatt atgccggtcc ggcaacaggc taccgcctgc aaggcgagcg ctgggaagag
1620attaaaaata tcccgggcgc gctcgatccc aatgaacttg gctaa
1665105554PRTKlebsiella pneumoniae 105Met Arg Ser Lys Arg Phe Glu Ala Leu
Ala Lys Arg Pro Val Asn Gln1 5 10
15Asp Gly Phe Val Lys Glu Trp Ile Glu Glu Gly Phe Ile Ala Met
Glu 20 25 30Ser Pro Asn Asp
Pro Lys Pro Ser Ile Arg Ile Val Asn Gly Ala Val 35
40 45Thr Glu Leu Asp Gly Lys Pro Val Asp Glu Phe Asp
Leu Ile Asp His 50 55 60Phe Ile Ala
Arg Tyr Gly Ile Asn Leu Ala Arg Ala Glu Glu Val Met65 70
75 80Ala Met Asp Ser Val Lys Leu Ala
Asn Met Leu Cys Asp Pro Asn Val 85 90
95Lys Arg Ser Asp Ile Val Pro Leu Thr Thr Ala Met Thr Pro
Ala Lys 100 105 110Ile Val Glu
Val Val Ser His Met Asn Val Val Glu Met Met Met Ala 115
120 125Met Gln Lys Met Arg Ala Arg Arg Thr Pro Ser
Gln Gln Ala His Val 130 135 140Thr Asn
Ile Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala Glu145
150 155 160Gly Ala Trp Arg Gly Phe Asp
Glu Gln Glu Thr Thr Val Ala Val Ala 165
170 175Arg Tyr Ala Arg Phe Asn Ala Ile Ala Leu Leu Val
Gly Ser Gln Val 180 185 190Gly
Arg Pro Gly Val Leu Thr Gln Cys Ser Leu Glu Glu Ala Thr Glu 195
200 205Leu Lys Leu Gly Met Leu Gly His Thr
Cys Tyr Ala Glu Thr Ile Ser 210 215
220Val Tyr Gly Thr Glu Pro Val Phe Thr Asp Gly Asp Asp Thr Pro Trp225
230 235 240Ser Lys Gly Phe
Leu Ala Ser Ser Tyr Ala Ser Arg Gly Leu Lys Met 245
250 255Arg Phe Thr Ser Gly Ser Gly Ser Glu Val
Gln Met Gly Tyr Ala Glu 260 265
270Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Tyr Ile Thr Lys
275 280 285Ala Ala Gly Val Gln Gly Leu
Gln Asn Gly Ser Val Ser Cys Ile Gly 290 295
300Val Pro Ser Ala Val Pro Ser Gly Ile Arg Ala Val Leu Ala Glu
Asn305 310 315 320Leu Ile
Cys Ser Ala Leu Asp Leu Glu Cys Ala Ser Ser Asn Asp Gln
325 330 335Thr Phe Thr His Ser Asp Met
Arg Arg Thr Ala Arg Leu Leu Met Gln 340 345
350Phe Leu Pro Gly Thr Asp Phe Ile Ser Ser Gly Tyr Ser Ala
Val Pro 355 360 365Asn Tyr Asp Asn
Met Phe Ala Gly Ser Asn Glu Asp Ala Glu Asp Phe 370
375 380Asp Asp Tyr Asn Val Ile Gln Arg Asp Leu Lys Val
Asp Gly Gly Leu385 390 395
400Arg Pro Val Arg Glu Glu Asp Val Ile Ala Ile Arg Asn Lys Ala Ala
405 410 415Arg Ala Leu Gln Ala
Val Phe Ala Gly Met Gly Leu Pro Pro Ile Thr 420
425 430Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala His Gly
Ser Lys Asp Met 435 440 445Pro Glu
Arg Asn Ile Val Glu Asp Ile Lys Phe Ala Gln Glu Ile Ile 450
455 460Asn Lys Asn Arg Asn Gly Leu Glu Val Val Lys
Ala Leu Ala Lys Gly465 470 475
480Gly Phe Pro Asp Val Ala Gln Asp Met Leu Asn Ile Gln Lys Ala Lys
485 490 495Leu Thr Gly Asp
Tyr Leu His Thr Ser Ala Ile Ile Val Gly Glu Gly 500
505 510Gln Val Leu Ser Ala Val Asn Asp Val Asn Asp
Tyr Ala Gly Pro Ala 515 520 525Thr
Gly Tyr Arg Leu Gln Gly Glu Arg Trp Glu Glu Ile Lys Asn Ile 530
535 540Pro Gly Ala Leu Asp Pro Asn Glu Leu
Gly545 550106687DNAKlebsiella pneumoniae 106atggaaatta
acgaaacgct gctgcgccag attatcgaag aggtgctgtc ggagatgaaa 60tcaggcgcag
ataagccggt ctcctttagc gcgccggcgt ctgtcgcctc tgccgcgccg 120gtcgccgttg
cgcctgtgtc cggcgacagc ttcctgacgg aaatcggcga agccaaaccc 180ggcacgcagc
aggatgaagt cattattgcc gtcgggccag cgtttggtct ggcgcaaacc 240gccaatatcg
tcggcattcc gcataaaaat attctgcgcg aagtgatcgc cggcattgag 300gaagaaggca
tcaaagcccg ggtgatccgc tgctttaagt catctgacgt cgccttcgtg 360gcagtggaag
gcaaccgcct gagcggctcc ggcatctcga tcggtattca gtcgaaaggc 420accaccgtca
tccaccagcg cggcctgccg ccgctttcca atctggaact cttcccgcag 480gcgccgctgt
taacgctgga aacctaccgt cagattggca aaaacgccgc gcgctacgcc 540aaacgcgagt
cgccgcagcc ggtgccgacg cttaacgatc agatggctcg tcccaaatac 600caggcgaagt
cggccatttt gcacattaaa gagaccaaat acgtggtgac gggcaaaaac 660ccgcaggaac
tgcgcgtggc gctttaa
687107228PRTKlebsiella pneumoniae 107Met Glu Ile Asn Glu Thr Leu Leu Arg
Gln Ile Ile Glu Glu Val Leu1 5 10
15Ser Glu Met Lys Ser Gly Ala Asp Lys Pro Val Ser Phe Ser Ala
Pro 20 25 30Ala Ser Val Ala
Ser Ala Ala Pro Val Ala Val Ala Pro Val Ser Gly 35
40 45Asp Ser Phe Leu Thr Glu Ile Gly Glu Ala Lys Pro
Gly Thr Gln Gln 50 55 60Asp Glu Val
Ile Ile Ala Val Gly Pro Ala Phe Gly Leu Ala Gln Thr65 70
75 80Ala Asn Ile Val Gly Ile Pro His
Lys Asn Ile Leu Arg Glu Val Ile 85 90
95Ala Gly Ile Glu Glu Glu Gly Ile Lys Ala Arg Val Ile Arg
Cys Phe 100 105 110Lys Ser Ser
Asp Val Ala Phe Val Ala Val Glu Gly Asn Arg Leu Ser 115
120 125Gly Ser Gly Ile Ser Ile Gly Ile Gln Ser Lys
Gly Thr Thr Val Ile 130 135 140His Gln
Arg Gly Leu Pro Pro Leu Ser Asn Leu Glu Leu Phe Pro Gln145
150 155 160Ala Pro Leu Leu Thr Leu Glu
Thr Tyr Arg Gln Ile Gly Lys Asn Ala 165
170 175Ala Arg Tyr Ala Lys Arg Glu Ser Pro Gln Pro Val
Pro Thr Leu Asn 180 185 190Asp
Gln Met Ala Arg Pro Lys Tyr Gln Ala Lys Ser Ala Ile Leu His 195
200 205Ile Lys Glu Thr Lys Tyr Val Val Thr
Gly Lys Asn Pro Gln Glu Leu 210 215
220Arg Val Ala Leu225108525DNAKlebsiella pneumoniae 108atgaataccg
acgcaattga atccatggta cgcgacgtgc tgagccggat gaacagccta 60caggacgggg
taacgcccgc gccagccgcg ccgacaaacg acaccgttcg ccagccaaaa 120gttagcgact
acccgttagc gacctgccat ccggagtggg tcaaaaccgc taccaataaa 180acgctcgatg
acctgacgct ggagaacgta ttaagcgatc gcgttacggc gcaggacatg 240cgcatcactc
cggaaacgct gcgtatgcag gcggcgatcg cccaggatgc cggacgcgat 300cggctggcga
tgaactttga gcgggccgca gagctcaccg cggttcccga cgaccgaatc 360cttgagatct
acaacgccct gcgcccatac cgttccaccc aggcggagct actggcgatc 420gctgatgacc
tcgagcatcg ctaccaggca cgactctgtg ccgcctttgt tcgggaagcg 480gccgggctgt
acatcgagcg taagaagctg aaaggcgacg attaa
525109174PRTKlebsiella pneumoniae 109Met Asn Thr Asp Ala Ile Glu Ser Met
Val Arg Asp Val Leu Ser Arg1 5 10
15Met Asn Ser Leu Gln Asp Gly Val Thr Pro Ala Pro Ala Ala Pro
Thr 20 25 30Asn Asp Thr Val
Arg Gln Pro Lys Val Ser Asp Tyr Pro Leu Ala Thr 35
40 45Cys His Pro Glu Trp Val Lys Thr Ala Thr Asn Lys
Thr Leu Asp Asp 50 55 60Leu Thr Leu
Glu Asn Val Leu Ser Asp Arg Val Thr Ala Gln Asp Met65 70
75 80Arg Ile Thr Pro Glu Thr Leu Arg
Met Gln Ala Ala Ile Ala Gln Asp 85 90
95Ala Gly Arg Asp Arg Leu Ala Met Asn Phe Glu Arg Ala Ala
Glu Leu 100 105 110Thr Ala Val
Pro Asp Asp Arg Ile Leu Glu Ile Tyr Asn Ala Leu Arg 115
120 125Pro Tyr Arg Ser Thr Gln Ala Glu Leu Leu Ala
Ile Ala Asp Asp Leu 130 135 140Glu His
Arg Tyr Gln Ala Arg Leu Cys Ala Ala Phe Val Arg Glu Ala145
150 155 160Ala Gly Leu Tyr Ile Glu Arg
Lys Lys Leu Lys Gly Asp Asp 165
1701101833DNAKlebsiella oxytoca 110atgcgatata tagctggcat tgatatcggc
aactcatcga cggaagtcgc cctggcgacc 60ctggatgagg ctggcgcgct gacgatcacc
cacagcgcgc tggcggaaac caccggaatc 120aaaggcacgt tgcgtaacgt gttcgggatt
caggaggcgc tcgccctcgt cgccagaggc 180gccgggatcg ccgtcagcga tatttcgctc
atccgcatca acgaagcgac gccggtgatt 240ggcgatgtgg cgatggaaac cattaccgaa
accatcatca ccgaatcgac catgatcggc 300cataacccga aaacgcccgg cggcgcgggg
cttggcacag gcatcaccat tacgccgcag 360gagctgctaa cccgcccggc ggacgcgccc
tatatcctgg tggtgtcgtc ggcgttcgat 420tttgccgata tcgccagcgt gattaacgct
tccctgcgcg ccgggtatca gattaccggc 480gtcattttac agcgcgacga tggcgtgctg
gtcagcaacc ggctggaaaa accgctgccg 540atcgttgacg aagtgctgta catcgaccgc
attccgctgg ggatgctggc ggcgattgag 600gtcgccgttc cggggaaggt catcgaaacc
ctctctaacc cttacggcat cgccaccgtc 660tttaacctca gccccgagga gacgaagaac
atcgtcccga tggcccgggc gctgattggc 720aaccgttccg ccgtggtggt caaaacgcca
tccggcgacg tcaaagcgcg cgcgataccc 780gccggtaatc ttgagctgct ggcccagggc
cgtagcgtgc gcgtggatgt ggccgccggc 840gccgaagcca tcatgaaagc ggtcgacggc
tgcggcaggc tcgataacgt caccggcgaa 900tccggcacca atatcggcgg catgctggaa
cacgtgcgcc agaccatggc cgagctgacc 960aacaagccga gcagcgaaat atttattcag
gacctgctgg ccgttgatac ctcggtaccg 1020gtgagcgtta ccggcggtct ggccggggag
ttctcgctgg agcaggccgt gggcatcgcc 1080tcgatggtga aatcggatcg cctgcagatg
gcaatgatcg cccgcgaaat cgagcagaag 1140ctcaatatcg acgtgcagat cggcggcgca
gaggccgaag ccgccatcct gggggcgctg 1200accacgccgg gcaccacccg accgctggcg
atcctcgacc tcggcgcggg ctccaccgat 1260gcctccatca tcaaccccaa aggcgacatc
atcgccaccc atctcgccgg cgcaggcgac 1320atggtgacga tgattattgc ccgcgagctg
gggctggaag accgctatct ggcggaagag 1380atcaagaagt acccgctggc taaggtggaa
agcctgttcc atttacgcca cgaggacggc 1440agcgtgcagt tcttctccac gccgctgccg
cccgccgtgt tcgcccgcgt ctgcgtggtg 1500aaagcggacg aactggtgcc gctgcccggc
gatttagcgc tggaaaaagt gcgcgccatt 1560cgccgcagcg ccaaagagcg ggtctttgtc
accaacgccc tgcgcgcgct gcgtcaggtc 1620agccccaccg gcaacattcg cgatattccg
ttcgtggtgc tggtcggcgg ttcgtcgctg 1680gatttcgaag tcccgcagct ggtcaccgat
gcgctggcgc actaccgcct ggttgccgga 1740cggggaaata ttcgcggcag cgagggcccc
cgaaacgcgg tggccaccgg cctgattctc 1800tcctggcata aggagtttgc gcatgaacgg
taa 1833111610PRTKlebsiella oxytoca 111Met
Arg Tyr Ile Ala Gly Ile Asp Ile Gly Asn Ser Ser Thr Glu Val1
5 10 15Ala Leu Ala Thr Leu Asp Glu
Ala Gly Ala Leu Thr Ile Thr His Ser 20 25
30Ala Leu Ala Glu Thr Thr Gly Ile Lys Gly Thr Leu Arg Asn
Val Phe 35 40 45Gly Ile Gln Glu
Ala Leu Ala Leu Val Ala Arg Gly Ala Gly Ile Ala 50 55
60Val Ser Asp Ile Ser Leu Ile Arg Ile Asn Glu Ala Thr
Pro Val Ile65 70 75
80Gly Asp Val Ala Met Glu Thr Ile Thr Glu Thr Ile Ile Thr Glu Ser
85 90 95Thr Met Ile Gly His Asn
Pro Lys Thr Pro Gly Gly Ala Gly Leu Gly 100
105 110Thr Gly Ile Thr Ile Thr Pro Gln Glu Leu Leu Thr
Arg Pro Ala Asp 115 120 125Ala Pro
Tyr Ile Leu Val Val Ser Ser Ala Phe Asp Phe Ala Asp Ile 130
135 140Ala Ser Val Ile Asn Ala Ser Leu Arg Ala Gly
Tyr Gln Ile Thr Gly145 150 155
160Val Ile Leu Gln Arg Asp Asp Gly Val Leu Val Ser Asn Arg Leu Glu
165 170 175Lys Pro Leu Pro
Ile Val Asp Glu Val Leu Tyr Ile Asp Arg Ile Pro 180
185 190Leu Gly Met Leu Ala Ala Ile Glu Val Ala Val
Pro Gly Lys Val Ile 195 200 205Glu
Thr Leu Ser Asn Pro Tyr Gly Ile Ala Thr Val Phe Asn Leu Ser 210
215 220Pro Glu Glu Thr Lys Asn Ile Val Pro Met
Ala Arg Ala Leu Ile Gly225 230 235
240Asn Arg Ser Ala Val Val Val Lys Thr Pro Ser Gly Asp Val Lys
Ala 245 250 255Arg Ala Ile
Pro Ala Gly Asn Leu Glu Leu Leu Ala Gln Gly Arg Ser 260
265 270Val Arg Val Asp Val Ala Ala Gly Ala Glu
Ala Ile Met Lys Ala Val 275 280
285Asp Gly Cys Gly Arg Leu Asp Asn Val Thr Gly Glu Ser Gly Thr Asn 290
295 300Ile Gly Gly Met Leu Glu His Val
Arg Gln Thr Met Ala Glu Leu Thr305 310
315 320Asn Lys Pro Ser Ser Glu Ile Phe Ile Gln Asp Leu
Leu Ala Val Asp 325 330
335Thr Ser Val Pro Val Ser Val Thr Gly Gly Leu Ala Gly Glu Phe Ser
340 345 350Leu Glu Gln Ala Val Gly
Ile Ala Ser Met Val Lys Ser Asp Arg Leu 355 360
365Gln Met Ala Met Ile Ala Arg Glu Ile Glu Gln Lys Leu Asn
Ile Asp 370 375 380Val Gln Ile Gly Gly
Ala Glu Ala Glu Ala Ala Ile Leu Gly Ala Leu385 390
395 400Thr Thr Pro Gly Thr Thr Arg Pro Leu Ala
Ile Leu Asp Leu Gly Ala 405 410
415Gly Ser Thr Asp Ala Ser Ile Ile Asn Pro Lys Gly Asp Ile Ile Ala
420 425 430Thr His Leu Ala Gly
Ala Gly Asp Met Val Thr Met Ile Ile Ala Arg 435
440 445Glu Leu Gly Leu Glu Asp Arg Tyr Leu Ala Glu Glu
Ile Lys Lys Tyr 450 455 460Pro Leu Ala
Lys Val Glu Ser Leu Phe His Leu Arg His Glu Asp Gly465
470 475 480Ser Val Gln Phe Phe Ser Thr
Pro Leu Pro Pro Ala Val Phe Ala Arg 485
490 495Val Cys Val Val Lys Ala Asp Glu Leu Val Pro Leu
Pro Gly Asp Leu 500 505 510Ala
Leu Glu Lys Val Arg Ala Ile Arg Arg Ser Ala Lys Glu Arg Val 515
520 525Phe Val Thr Asn Ala Leu Arg Ala Leu
Arg Gln Val Ser Pro Thr Gly 530 535
540Asn Ile Arg Asp Ile Pro Phe Val Val Leu Val Gly Gly Ser Ser Leu545
550 555 560Asp Phe Glu Val
Pro Gln Leu Val Thr Asp Ala Leu Ala His Tyr Arg 565
570 575Leu Val Ala Gly Arg Gly Asn Ile Arg Gly
Ser Glu Gly Pro Arg Asn 580 585
590Ala Val Ala Thr Gly Leu Ile Leu Ser Trp His Lys Glu Phe Ala His
595 600 605Glu Arg
610112378DNAKlebsiella oxytoca 112atgaacggta atcacagcgc cccggccatc
gcgatcgccg tcatcgacgg ctgcgacggc 60ctgtggcgcg aagtgctgct gggtatcgaa
gaggaaggta tccctttccg gctccagcat 120cacccggccg gagaggtcgt ggacagcgcc
tggcaggcgg cgcgcagctc gccgctgctg 180gtgggcatcg cctgcgaccg ccatatgctg
gtcgtgcact acaagaattt acccgcatcg 240gcgccgcttt ttacgctgat gcatcatcag
gacagtcagg cccatcgcaa caccggtaat 300aacgcggcac ggctggtcaa ggggatccct
ttccgggatc tgaatagcga agcaacagga 360gaacagcagg atgaataa
378113125PRTKlebsiella oxytoca 113Met
Asn Gly Asn His Ser Ala Pro Ala Ile Ala Ile Ala Val Ile Asp1
5 10 15Gly Cys Asp Gly Leu Trp Arg
Glu Val Leu Leu Gly Ile Glu Glu Glu 20 25
30Gly Ile Pro Phe Arg Leu Gln His His Pro Ala Gly Glu Val
Val Asp 35 40 45Ser Ala Trp Gln
Ala Ala Arg Ser Ser Pro Leu Leu Val Gly Ile Ala 50 55
60Cys Asp Arg His Met Leu Val Val His Tyr Lys Asn Leu
Pro Ala Ser65 70 75
80Ala Pro Leu Phe Thr Leu Met His His Gln Asp Ser Gln Ala His Arg
85 90 95Asn Thr Gly Asn Asn Ala
Ala Arg Leu Val Lys Gly Ile Pro Phe Arg 100
105 110Asp Leu Asn Ser Glu Ala Thr Gly Glu Gln Gln Asp
Glu 115 120
1251141833DNASalmonella typhimurium 114atgcgatata tagctggcat tgacatcggt
aactcatcaa cggaagtcgc actggcgcgg 60caagatgaga ctggcgcact gacgattaca
cacagcgcgc tggcggaaac caccgggatc 120aaaggcacgt tgcgtaacgt gttcggcatt
caggaagcgc tcgccctcgt cgcaaagcgc 180gcggggatca atgtcagaga tatttcgctc
atccgcatta acgaagccac gccggtgatt 240ggcgatgtgg cgatggaaac cattaccgaa
accatcatca ccgaatcgac aatgatcggc 300cataacccaa aaacgccggg cggagcaggc
cttggtgtgg gtatcacgat tacgccggag 360gagctgttaa cccgcccggc ggactcgtcc
tatattctgg tggtatcgtc agcctttgat 420tttgctgata tcgccaatgt tatcaacgcc
tcaatgcgcg ccggatacca gattaccggc 480gtcattttgc agcgcgacga tggcgtactg
gtcagcaacc ggctggaaaa atcgctaccg 540attgtcgatg aagttctgta catcgaccgc
attccgctgg ggatgctggc ggcgattgaa 600gtcgccgtgc cgggaaaggt tatcgaaacc
ctctctaacc cttacggcat cgccaccgta 660tttaatctca acgccgatga gacaaaaaac
atcgtcccga tggcgcgcgc gctgattggc 720aaccgttccg ccgtggtggt taaaacgcca
tccggcgacg tcaaagcgcg cgcaataccc 780gccggtaacc tggagctgca ggctcagggt
cgtaccgtgc gcgtggatgt tgccgccggt 840gccgaagcca tcatgaaagc ggtggacggt
tgcggcaagc tcgacaacgt caccggcgag 900gccgggacca atatcggcgg catgctggag
cacgtgcgcc agaccatggc cgaactgacc 960aacaagccga gcagtgagat tttcattcag
gatctactgg ccgttgacac ctcggttccg 1020gtgagcgtca ccggcggtct ggccggggag
ttctcgctgg agcaggccgt cggcatcgcc 1080tcgatggtga aatcagaccg tctgcagatg
gcgatgattg cccgtgaaat tgagcagaag 1140cttaatatcg acgtgcagat cggcggcgct
gaggctgaag ccgccattct gggcgcgctg 1200accacgccgg gtaccacccg accgctggcg
atcctcgacc tcggcgcggg ctccaccgat 1260gcctccatca tcaaccctaa aggcgaaatc
atcgccaccc atctcgccgg ggcaggcgac 1320atggtcacga tgattattgc ccgcgaactg
gggctggaag accgctatct ggcggaagag 1380atcaaaaaat acccgctggc taaggtcgaa
agcctgttcc acttacgcca cgaggacggc 1440agcgtccagt tcttcccgac gccgctgcct
cccgccgtgt tcgcccgcgt ctgcgtggtg 1500aaaccggacg aactggtgcc gcttcccggc
gacttagcgc tggaaaaagt gcgcgccatt 1560cgccgcagcg ctaaagaacg cgtctttgtc
accaacgccc tgcgcgcgct gcgccaggtc 1620agtccaaccg gcaacattcg cgatattccg
ttcgtggtgc tggtcggcgg ctcgtcgctg 1680gatttcgaag ttccgcagct ggtcaccgat
gcgctggcgc actaccgcct ggtcgccggg 1740cgaggaaata ttcgcggcag cgaaggccca
agaaacgcgg tggccaccgg cctgattctc 1800tcctggcata aggagtttgc gcatggacag
taa 1833115610PRTSalmonella typhimurium
115Met Arg Tyr Ile Ala Gly Ile Asp Ile Gly Asn Ser Ser Thr Glu Val1
5 10 15Ala Leu Ala Arg Gln Asp
Glu Thr Gly Ala Leu Thr Ile Thr His Ser 20 25
30Ala Leu Ala Glu Thr Thr Gly Ile Lys Gly Thr Leu Arg
Asn Val Phe 35 40 45Gly Ile Gln
Glu Ala Leu Ala Leu Val Ala Lys Arg Ala Gly Ile Asn 50
55 60Val Arg Asp Ile Ser Leu Ile Arg Ile Asn Glu Ala
Thr Pro Val Ile65 70 75
80Gly Asp Val Ala Met Glu Thr Ile Thr Glu Thr Ile Ile Thr Glu Ser
85 90 95Thr Met Ile Gly His Asn
Pro Lys Thr Pro Gly Gly Ala Gly Leu Gly 100
105 110Val Gly Ile Thr Ile Thr Pro Glu Glu Leu Leu Thr
Arg Pro Ala Asp 115 120 125Ser Ser
Tyr Ile Leu Val Val Ser Ser Ala Phe Asp Phe Ala Asp Ile 130
135 140Ala Asn Val Ile Asn Ala Ser Met Arg Ala Gly
Tyr Gln Ile Thr Gly145 150 155
160Val Ile Leu Gln Arg Asp Asp Gly Val Leu Val Ser Asn Arg Leu Glu
165 170 175Lys Ser Leu Pro
Ile Val Asp Glu Val Leu Tyr Ile Asp Arg Ile Pro 180
185 190Leu Gly Met Leu Ala Ala Ile Glu Val Ala Val
Pro Gly Lys Val Ile 195 200 205Glu
Thr Leu Ser Asn Pro Tyr Gly Ile Ala Thr Val Phe Asn Leu Asn 210
215 220Ala Asp Glu Thr Lys Asn Ile Val Pro Met
Ala Arg Ala Leu Ile Gly225 230 235
240Asn Arg Ser Ala Val Val Val Lys Thr Pro Ser Gly Asp Val Lys
Ala 245 250 255Arg Ala Ile
Pro Ala Gly Asn Leu Glu Leu Gln Ala Gln Gly Arg Thr 260
265 270Val Arg Val Asp Val Ala Ala Gly Ala Glu
Ala Ile Met Lys Ala Val 275 280
285Asp Gly Cys Gly Lys Leu Asp Asn Val Thr Gly Glu Ala Gly Thr Asn 290
295 300Ile Gly Gly Met Leu Glu His Val
Arg Gln Thr Met Ala Glu Leu Thr305 310
315 320Asn Lys Pro Ser Ser Glu Ile Phe Ile Gln Asp Leu
Leu Ala Val Asp 325 330
335Thr Ser Val Pro Val Ser Val Thr Gly Gly Leu Ala Gly Glu Phe Ser
340 345 350Leu Glu Gln Ala Val Gly
Ile Ala Ser Met Val Lys Ser Asp Arg Leu 355 360
365Gln Met Ala Met Ile Ala Arg Glu Ile Glu Gln Lys Leu Asn
Ile Asp 370 375 380Val Gln Ile Gly Gly
Ala Glu Ala Glu Ala Ala Ile Leu Gly Ala Leu385 390
395 400Thr Thr Pro Gly Thr Thr Arg Pro Leu Ala
Ile Leu Asp Leu Gly Ala 405 410
415Gly Ser Thr Asp Ala Ser Ile Ile Asn Pro Lys Gly Glu Ile Ile Ala
420 425 430Thr His Leu Ala Gly
Ala Gly Asp Met Val Thr Met Ile Ile Ala Arg 435
440 445Glu Leu Gly Leu Glu Asp Arg Tyr Leu Ala Glu Glu
Ile Lys Lys Tyr 450 455 460Pro Leu Ala
Lys Val Glu Ser Leu Phe His Leu Arg His Glu Asp Gly465
470 475 480Ser Val Gln Phe Phe Pro Thr
Pro Leu Pro Pro Ala Val Phe Ala Arg 485
490 495Val Cys Val Val Lys Pro Asp Glu Leu Val Pro Leu
Pro Gly Asp Leu 500 505 510Ala
Leu Glu Lys Val Arg Ala Ile Arg Arg Ser Ala Lys Glu Arg Val 515
520 525Phe Val Thr Asn Ala Leu Arg Ala Leu
Arg Gln Val Ser Pro Thr Gly 530 535
540Asn Ile Arg Asp Ile Pro Phe Val Val Leu Val Gly Gly Ser Ser Leu545
550 555 560Asp Phe Glu Val
Pro Gln Leu Val Thr Asp Ala Leu Ala His Tyr Arg 565
570 575Leu Val Ala Gly Arg Gly Asn Ile Arg Gly
Ser Glu Gly Pro Arg Asn 580 585
590Ala Val Ala Thr Gly Leu Ile Leu Ser Trp His Lys Glu Phe Ala His
595 600 605Gly Gln
610116372DNASalmonella typhimurium 116atggacagta atcacagcgc cccggctatc
gtcattaccg ttatcaacga ctgcgccagc 60ctctggcacg aagtgctgct gggcattgaa
gaggaaggca tccctttcct gcttcagcat 120cacccggctg gagatatcgt tgacagcgcc
tggcaggcgg cgcgcagctc gccgctgctg 180gtcggcattg cctgcgatcg acactcgctg
gtcgtgcatt acaagaattt acccgcatcg 240gcgccgcttt ttacgctgat gcatcatcag
gacagtcagg cccaacgcaa caccggtaat 300aacgcggcac ggctggtcaa agggatccct
ttcgggatct ccatgcttaa tcacaggaga 360acggcagtat ga
372117123PRTSalmonella typhimurium
117Met Asp Ser Asn His Ser Ala Pro Ala Ile Val Ile Thr Val Ile Asn1
5 10 15Asp Cys Ala Ser Leu Trp
His Glu Val Leu Leu Gly Ile Glu Glu Glu 20 25
30Gly Ile Pro Phe Leu Leu Gln His His Pro Ala Gly Asp
Ile Val Asp 35 40 45Ser Ala Trp
Gln Ala Ala Arg Ser Ser Pro Leu Leu Val Gly Ile Ala 50
55 60Cys Asp Arg His Ser Leu Val Val His Tyr Lys Asn
Leu Pro Ala Ser65 70 75
80Ala Pro Leu Phe Thr Leu Met His His Gln Asp Ser Gln Ala Gln Arg
85 90 95Asn Thr Gly Asn Asn Ala
Ala Arg Leu Val Lys Gly Ile Pro Phe Gly 100
105 110Ile Ser Met Leu Asn His Arg Arg Thr Ala Val
115 1201181833DNALactobacillus collinoides 118atgacacgtg
taattggtgt tgatatcggg aattcctcta cagaagttgc gcttgctgat 60gtgtctgaca
gtggtgaagt aaatttcatt aattctggaa tttccgatac aactggcatt 120aaaggtacta
aacaaaattt gatcggggtg cgtaaatcca tccagatcgt tttgaaaaag 180tcgaatatgc
aaatttccga tgttgacctg attcggatca acgaagcaac gcccgttatc 240ggtgatgttg
ccatggagac catcaccgaa acggtgatta ctgaatcgac gatgatcggc 300cacaacccag
ggactcctgg gggtgtcggt actggttctg gttacacggt gaatttgctt 360gatttgttga
gccaaacgga taaggatcgt ccttatatcg ttatcatctc gaaagaaatc 420gattttgctg
acgcagctaa gctgatcaac gcttatgtgg cttctggtta taatattacc 480gctgccattc
tgcaaagtga tgatggggtg ctgatcaata atcggttgac ccataagatt 540cccatcgtgg
atgaagtctc acagatcgac aaggtaccgt tgaacatgct tgccgcagtg 600gaagttgcac
cgcctggcaa agtaattgct caactttcca acccgtatgg cattgccaca 660ctgttcgaac
tttcctctga agaaaccaag aacattgtgc cagttgcccg agccttaatc 720ggaaaccggt
cagcggttgt tattaaaacc cctgccggtg atgttaaagc tcgtgttatc 780ccagccggga
aaatcttgat caatggccaa ccgaatggtc atggtgaagt taacgttgcg 840gctggtgccg
atgccatcat gaaaaaggtg aacgagttcg atagtgtcga tgacattacc 900ggtgaatcgg
gcactaacgt tggtgggatg cttgaaaaag ttcgtcaaac aatggctgag 960ttgaccgaca
agcaaaatag cgacattgcc attcaagatt tattagctgt caatacgtcc 1020gttccagtaa
cggtgcgtgg tggtctggct ggtgaattct caatggaaca agccgttggg 1080attgctgcta
tggtcaaatc tgatcacttg caaatgcaag cgattgcaga cctgatgaaa 1140gatgaatttc
acgttcaagt cgaaatcggc ggtgctgaag ctgaatcagc catcctcggt 1200gcgctaacaa
cgccagggac gacaaaacca attgccatcc ttgatttggg ggctggttca 1260acggatgcat
caattatcaa ccaaaaggac gaaaaggtcg ctattcactt ggctggtgcc 1320ggtgatatgg
ttaccatgat catcaattct gaacttgggt tggaagaccc atatttagct 1380gaggatatta
agaaatatcc gctggctaaa gttgataatc tattccagct acggcatgaa 1440gatggtgccg
ttcaattctt tgaagatcca ttacctgctg atttatttgc cagagttgtg 1500gctgttaaac
cagatggtta cgaaccactt cctggtaatt tgagtatcga gaaagttaaa 1560atcgtccgtc
aaactgctaa gaagcgggtg ttcgtaacga acgcaattcg tgccttacac 1620cacgttagcc
caacaggtaa tatccgagat atcccatttg tggtcattgt cggcggctca 1680gccctcgatt
ttgaaattcc acaattggtc accgatgaat tatcacactt taacttagtt 1740gcaggtcgtg
gtaatattcg gggaattgaa ggtccacgga acgccgtggc aactggtttg 1800attctttcat
acgcgagtga gaagagggga tag
1833119610PRTLactobacillus collinoides 119Met Thr Arg Val Ile Gly Val Asp
Ile Gly Asn Ser Ser Thr Glu Val1 5 10
15Ala Leu Ala Asp Val Ser Asp Ser Gly Glu Val Asn Phe Ile
Asn Ser 20 25 30Gly Ile Ser
Asp Thr Thr Gly Ile Lys Gly Thr Lys Gln Asn Leu Ile 35
40 45Gly Val Arg Lys Ser Ile Gln Ile Val Leu Lys
Lys Ser Asn Met Gln 50 55 60Ile Ser
Asp Val Asp Leu Ile Arg Ile Asn Glu Ala Thr Pro Val Ile65
70 75 80Gly Asp Val Ala Met Glu Thr
Ile Thr Glu Thr Val Ile Thr Glu Ser 85 90
95Thr Met Ile Gly His Asn Pro Gly Thr Pro Gly Gly Val
Gly Thr Gly 100 105 110Ser Gly
Tyr Thr Val Asn Leu Leu Asp Leu Leu Ser Gln Thr Asp Lys 115
120 125Asp Arg Pro Tyr Ile Val Ile Ile Ser Lys
Glu Ile Asp Phe Ala Asp 130 135 140Ala
Ala Lys Leu Ile Asn Ala Tyr Val Ala Ser Gly Tyr Asn Ile Thr145
150 155 160Ala Ala Ile Leu Gln Ser
Asp Asp Gly Val Leu Ile Asn Asn Arg Leu 165
170 175Thr His Lys Ile Pro Ile Val Asp Glu Val Ser Gln
Ile Asp Lys Val 180 185 190Pro
Leu Asn Met Leu Ala Ala Val Glu Val Ala Pro Pro Gly Lys Val 195
200 205Ile Ala Gln Leu Ser Asn Pro Tyr Gly
Ile Ala Thr Leu Phe Glu Leu 210 215
220Ser Ser Glu Glu Thr Lys Asn Ile Val Pro Val Ala Arg Ala Leu Ile225
230 235 240Gly Asn Arg Ser
Ala Val Val Ile Lys Thr Pro Ala Gly Asp Val Lys 245
250 255Ala Arg Val Ile Pro Ala Gly Lys Ile Leu
Ile Asn Gly Gln Pro Asn 260 265
270Gly His Gly Glu Val Asn Val Ala Ala Gly Ala Asp Ala Ile Met Lys
275 280 285Lys Val Asn Glu Phe Asp Ser
Val Asp Asp Ile Thr Gly Glu Ser Gly 290 295
300Thr Asn Val Gly Gly Met Leu Glu Lys Val Arg Gln Thr Met Ala
Glu305 310 315 320Leu Thr
Asp Lys Gln Asn Ser Asp Ile Ala Ile Gln Asp Leu Leu Ala
325 330 335Val Asn Thr Ser Val Pro Val
Thr Val Arg Gly Gly Leu Ala Gly Glu 340 345
350Phe Ser Met Glu Gln Ala Val Gly Ile Ala Ala Met Val Lys
Ser Asp 355 360 365His Leu Gln Met
Gln Ala Ile Ala Asp Leu Met Lys Asp Glu Phe His 370
375 380Val Gln Val Glu Ile Gly Gly Ala Glu Ala Glu Ser
Ala Ile Leu Gly385 390 395
400Ala Leu Thr Thr Pro Gly Thr Thr Lys Pro Ile Ala Ile Leu Asp Leu
405 410 415Gly Ala Gly Ser Thr
Asp Ala Ser Ile Ile Asn Gln Lys Asp Glu Lys 420
425 430Val Ala Ile His Leu Ala Gly Ala Gly Asp Met Val
Thr Met Ile Ile 435 440 445Asn Ser
Glu Leu Gly Leu Glu Asp Pro Tyr Leu Ala Glu Asp Ile Lys 450
455 460Lys Tyr Pro Leu Ala Lys Val Asp Asn Leu Phe
Gln Leu Arg His Glu465 470 475
480Asp Gly Ala Val Gln Phe Phe Glu Asp Pro Leu Pro Ala Asp Leu Phe
485 490 495Ala Arg Val Val
Ala Val Lys Pro Asp Gly Tyr Glu Pro Leu Pro Gly 500
505 510Asn Leu Ser Ile Glu Lys Val Lys Ile Val Arg
Gln Thr Ala Lys Lys 515 520 525Arg
Val Phe Val Thr Asn Ala Ile Arg Ala Leu His His Val Ser Pro 530
535 540Thr Gly Asn Ile Arg Asp Ile Pro Phe Val
Val Ile Val Gly Gly Ser545 550 555
560Ala Leu Asp Phe Glu Ile Pro Gln Leu Val Thr Asp Glu Leu Ser
His 565 570 575Phe Asn Leu
Val Ala Gly Arg Gly Asn Ile Arg Gly Ile Glu Gly Pro 580
585 590Arg Asn Ala Val Ala Thr Gly Leu Ile Leu
Ser Tyr Ala Ser Glu Lys 595 600
605Arg Gly 610120351DNALactobacillus collinoides 120atggcatttg
attctgaacg tccgtcaatt ctattggcga caccaacggg ttctaatggc 60caacttccag
aagttctaaa accaatgctc aatggtattg aagaagaaca gattcctttt 120cagattctcg
atatggaagg cggttcagca gttgagcggg cttataacgc gtcagttgct 180tcacgattat
cagtgggcgt tgggtttgat gatgcacata tcattgtgca ttataaaaac 240ttgaaaccag
aaaaaccgct gtttgatgtt gccatcactg atgcagcatc cattcgtaaa 300gttggcgcaa
acgccgctcg acttgtaaag ggagttccat tcaagaagta a
351121116PRTLactobacillus collinoides 121Met Ala Phe Asp Ser Glu Arg Pro
Ser Ile Leu Leu Ala Thr Pro Thr1 5 10
15Gly Ser Asn Gly Gln Leu Pro Glu Val Leu Lys Pro Met Leu
Asn Gly 20 25 30Ile Glu Glu
Glu Gln Ile Pro Phe Gln Ile Leu Asp Met Glu Gly Gly 35
40 45Ser Ala Val Glu Arg Ala Tyr Asn Ala Ser Val
Ala Ser Arg Leu Ser 50 55 60Val Gly
Val Gly Phe Asp Asp Ala His Ile Ile Val His Tyr Lys Asn65
70 75 80Leu Lys Pro Glu Lys Pro Leu
Phe Asp Val Ala Ile Thr Asp Ala Ala 85 90
95Ser Ile Arg Lys Val Gly Ala Asn Ala Ala Arg Leu Val
Lys Gly Val 100 105 110Pro Phe
Lys Lys 115122453PRTVibrio fluvialis 122Met Asn Lys Pro Gln Ser
Trp Glu Ala Arg Ala Glu Thr Tyr Ser Leu1 5
10 15Tyr Gly Phe Thr Asp Met Pro Ser Leu His Gln Arg
Gly Thr Val Val 20 25 30Val
Thr His Gly Glu Gly Pro Tyr Ile Val Asp Val Asn Gly Arg Arg 35
40 45Tyr Leu Asp Ala Asn Ser Gly Leu Trp
Asn Met Val Ala Gly Phe Asp 50 55
60His Lys Gly Leu Ile Asp Ala Ala Lys Ala Gln Tyr Glu Arg Phe Pro65
70 75 80Gly Tyr His Ala Phe
Phe Gly Arg Met Ser Asp Gln Thr Val Met Leu 85
90 95Ser Glu Lys Leu Val Glu Val Ser Pro Phe Asp
Ser Gly Arg Val Phe 100 105
110Tyr Thr Asn Ser Gly Ser Glu Ala Asn Asp Thr Met Val Lys Met Leu
115 120 125Trp Phe Leu His Ala Ala Glu
Gly Lys Pro Gln Lys Arg Lys Ile Leu 130 135
140Thr Arg Trp Asn Ala Tyr His Gly Val Thr Ala Val Ser Ala Ser
Met145 150 155 160Thr Gly
Lys Pro Tyr Asn Ser Val Phe Gly Leu Pro Leu Pro Gly Phe
165 170 175Val His Leu Thr Cys Pro His
Tyr Trp Arg Tyr Gly Glu Glu Gly Glu 180 185
190Thr Glu Glu Gln Phe Val Ala Arg Leu Ala Arg Glu Leu Glu
Glu Thr 195 200 205Ile Gln Arg Glu
Gly Ala Asp Thr Ile Ala Gly Phe Phe Ala Glu Pro 210
215 220Val Met Gly Ala Gly Gly Val Ile Pro Pro Ala Lys
Gly Tyr Phe Gln225 230 235
240Ala Ile Leu Pro Ile Leu Arg Lys Tyr Asp Ile Pro Val Ile Ser Asp
245 250 255Glu Val Ile Cys Gly
Phe Gly Arg Thr Gly Asn Thr Trp Gly Cys Val 260
265 270Thr Tyr Asp Phe Thr Pro Asp Ala Ile Ile Ser Ser
Lys Asn Leu Thr 275 280 285Ala Gly
Phe Phe Pro Met Gly Ala Val Ile Leu Gly Pro Glu Leu Ser 290
295 300Lys Arg Leu Glu Thr Ala Ile Glu Ala Ile Glu
Glu Phe Pro His Gly305 310 315
320Phe Thr Ala Ser Gly His Pro Val Gly Cys Ala Ile Ala Leu Lys Ala
325 330 335Ile Asp Val Val
Met Asn Glu Gly Leu Ala Glu Asn Val Arg Arg Leu 340
345 350Ala Pro Arg Phe Glu Glu Arg Leu Lys His Ile
Ala Glu Arg Pro Asn 355 360 365Ile
Gly Glu Tyr Arg Gly Ile Gly Phe Met Trp Ala Leu Glu Ala Val 370
375 380Lys Asp Lys Ala Ser Lys Thr Pro Phe Asp
Gly Asn Leu Ser Val Ser385 390 395
400Glu Arg Ile Ala Asn Thr Cys Thr Asp Leu Gly Leu Ile Cys Arg
Pro 405 410 415Leu Gly Gln
Ser Val Val Leu Cys Pro Pro Phe Ile Leu Thr Glu Ala 420
425 430Gln Met Asp Glu Met Phe Asp Lys Leu Glu
Lys Ala Leu Asp Lys Val 435 440
445Phe Ala Glu Val Ala 4501231122DNAErwinia caratovora subsp.
atroseptica 123atgtctgacg gacgactcac cgcacttttt cctgcattcc cacacccggc
gtccaatcag 60cccgtatttg ccgaggcttc accgcacgac gacgagttaa tgacgcaggc
cgtaccgcag 120gtttcctgtc agcaggcgtt ggcgattgcg cagcaagaat atggcttgtc
tgggcagatg 180tcgctgcttc agggcgagcg tgatgtgaat ttctgtctga cggtgacgcc
agatgaacgc 240tacatgctga aagtcatcaa tgcggcagaa cctgccgacg tcagcaattt
ccaaaccgcg 300ctgctgctgc atcttgcccg tcaggcacct gaactgcccg taccgcgtat
caggtcgaca 360aaagcgggtc agtcggaaac aggcgttgag atcgatggtg tactgctgcg
tgtgcggctt 420gtgagctatc tggcaggaat gccgcagtat ctggcctcac cgtcaacggc
gctgatgccg 480cagttggggg gaacgctggc gcagttggat aacgcgcttc acagctttac
gcatccggcg 540gcaaaccgtg cgctgctgtg ggatatcagc cgggcagagc aggtgcgtcc
ttacctcgat 600ttcgtttctg aaccgcagca gtatcagcat cttcagcgta tttttgaccg
ttatgacagt 660aacgttgctc ctctgttgac gacgctacgt cgtcaggtca ttcataacga
tctgaatccg 720cataacgtgc tggtggatgg atcgtcgccg acgcgggtta ctggcattat
cgattttggc 780gatgccgtat ttgccccgtt aatttgcgaa gtcgcgacgg cactggcgta
tcagatcggc 840gatggaaccg atttgttgga gcatgttgtg ccgtttgttg cggcctatca
ccaacgcatt 900ccgttagcac cggaggagat tgcgctgtta cccgatctga tagcgacccg
tatggcgctg 960accctgacca ttgcgcagtg gcgagcatcg cgttatcccg acaatcggga
gtatctgctg 1020cgtaacgtgc cgcgctgttg gcacagtttg cagcgcattg cgacctattc
ccatgcgcaa 1080tttttgactc gcctacagca ggtttgcccg gagaatgcgc ga
1122124374PRTErwinia caratovora subsp. atroseptica 124Met Ser
Asp Gly Arg Leu Thr Ala Leu Phe Pro Ala Phe Pro His Pro1 5
10 15Ala Ser Asn Gln Pro Val Phe Ala
Glu Ala Ser Pro His Asp Asp Glu 20 25
30Leu Met Thr Gln Ala Val Pro Gln Val Ser Cys Gln Gln Ala Leu
Ala 35 40 45Ile Ala Gln Gln Glu
Tyr Gly Leu Ser Gly Gln Met Ser Leu Leu Gln 50 55
60Gly Glu Arg Asp Val Asn Phe Cys Leu Thr Val Thr Pro Asp
Glu Arg65 70 75 80Tyr
Met Leu Lys Val Ile Asn Ala Ala Glu Pro Ala Asp Val Ser Asn
85 90 95Phe Gln Thr Ala Leu Leu Leu
His Leu Ala Arg Gln Ala Pro Glu Leu 100 105
110Pro Val Pro Arg Ile Arg Ser Thr Lys Ala Gly Gln Ser Glu
Thr Gly 115 120 125Val Glu Ile Asp
Gly Val Leu Leu Arg Val Arg Leu Val Ser Tyr Leu 130
135 140Ala Gly Met Pro Gln Tyr Leu Ala Ser Pro Ser Thr
Ala Leu Met Pro145 150 155
160Gln Leu Gly Gly Thr Leu Ala Gln Leu Asp Asn Ala Leu His Ser Phe
165 170 175Thr His Pro Ala Ala
Asn Arg Ala Leu Leu Trp Asp Ile Ser Arg Ala 180
185 190Glu Gln Val Arg Pro Tyr Leu Asp Phe Val Ser Glu
Pro Gln Gln Tyr 195 200 205Gln His
Leu Gln Arg Ile Phe Asp Arg Tyr Asp Ser Asn Val Ala Pro 210
215 220Leu Leu Thr Thr Leu Arg Arg Gln Val Ile His
Asn Asp Leu Asn Pro225 230 235
240His Asn Val Leu Val Asp Gly Ser Ser Pro Thr Arg Val Thr Gly Ile
245 250 255Ile Asp Phe Gly
Asp Ala Val Phe Ala Pro Leu Ile Cys Glu Val Ala 260
265 270Thr Ala Leu Ala Tyr Gln Ile Gly Asp Gly Thr
Asp Leu Leu Glu His 275 280 285Val
Val Pro Phe Val Ala Ala Tyr His Gln Arg Ile Pro Leu Ala Pro 290
295 300Glu Glu Ile Ala Leu Leu Pro Asp Leu Ile
Ala Thr Arg Met Ala Leu305 310 315
320Thr Leu Thr Ile Ala Gln Trp Arg Ala Ser Arg Tyr Pro Asp Asn
Arg 325 330 335Glu Tyr Leu
Leu Arg Asn Val Pro Arg Cys Trp His Ser Leu Gln Arg 340
345 350Ile Ala Thr Tyr Ser His Ala Gln Phe Leu
Thr Arg Leu Gln Gln Val 355 360
365Cys Pro Glu Asn Ala Arg 3701251272DNAErwinia caratovora subsp.
atroseptica 125atgacagcga cagaagcttt gctggcgcgc cgtcagcgag tgttgggcgg
cggttatcgc 60ctgttttatg aagagccgct gcatgtcgcg cgcggcgagg gcgtgtggct
gttcgatcac 120caagggaaac gttatctgga tgtctacaat aatgtggctt cggtcggaca
ttgccacccc 180gcggtggttg aagccgtggc gcgacagagc gcacaactca atacccacac
gcgctatttg 240caccacgcga ttgtcgattt tgcggaagat ttgctgagcg aatttcccgc
cgaattgaac 300aatgtaatgc tgacctgtac cggcagtgag gctaacgatc tggcgctgcg
tatcgcccga 360catgtcacgg gcgggacggg gatgttggtg acgcgctggg cgtatcacgg
cgtgaccagc 420gcgctggcgg aactgtctcc gtcgctgggg gatggcgttg tgcgcggtag
ccatgtgaag 480ctgatcgacg cgccagacac ttatcgtcag cccggtgcat ttcttaccag
cattcgtgaa 540gcgctggcgc agatgcaacg ggaaggtatt cgtcctgcgg cgctgctggt
agataccatt 600ttttccagcg atggcgtgtt ctgtgcgccg gaaggcgaaa tggcacaggc
ggcggcgttg 660atccgtcagg cgggcgggct gtttattgcg gatgaagtgc agccgggctt
cgggcgcacc 720ggggaatcac tgtggggctt tgcgcgccac aatgtcgtcc ctgatttggt
gagtctaggg 780aaaccgatgg gcaacggaca tcccatcgct ggattggtgg ggcgttccgc
tctgttcgac 840gcatttgggc gcgatgtgcg ctatttcaat acctttggcg gcaatccggt
ttcctgtcag 900gcggcgcacg cggtgctgcg ggtgattcgg gaagagcagt tgcagcagaa
tgcccagcgg 960gtcggtgatt atctgcggca agggttgcag caactggcgc agcatttccc
gctgattggt 1020gatattcggg cttacggcct gtttattggt gcggagctgg tcagcgatcg
cgaaagtaaa 1080acgccggcaa gtgaatccgc gttgcaggtg gtgaatgcga tgcgccaacg
tggtgtgctc 1140atcagcgcga cggggccagc ggcgaacata ctgaaaattc gcccgccgct
ggtgtttctg 1200gaagaacacg ccgatgtgtt cttaaccacg ctgagtgacg ttttagcgct
catcggcact 1260cgtgcacaga ga
1272126424PRTErwinia caratovora subsp. atroseptica 126Met Thr
Ala Thr Glu Ala Leu Leu Ala Arg Arg Gln Arg Val Leu Gly1 5
10 15Gly Gly Tyr Arg Leu Phe Tyr Glu
Glu Pro Leu His Val Ala Arg Gly 20 25
30Glu Gly Val Trp Leu Phe Asp His Gln Gly Lys Arg Tyr Leu Asp
Val 35 40 45Tyr Asn Asn Val Ala
Ser Val Gly His Cys His Pro Ala Val Val Glu 50 55
60Ala Val Ala Arg Gln Ser Ala Gln Leu Asn Thr His Thr Arg
Tyr Leu65 70 75 80His
His Ala Ile Val Asp Phe Ala Glu Asp Leu Leu Ser Glu Phe Pro
85 90 95Ala Glu Leu Asn Asn Val Met
Leu Thr Cys Thr Gly Ser Glu Ala Asn 100 105
110Asp Leu Ala Leu Arg Ile Ala Arg His Val Thr Gly Gly Thr
Gly Met 115 120 125Leu Val Thr Arg
Trp Ala Tyr His Gly Val Thr Ser Ala Leu Ala Glu 130
135 140Leu Ser Pro Ser Leu Gly Asp Gly Val Val Arg Gly
Ser His Val Lys145 150 155
160Leu Ile Asp Ala Pro Asp Thr Tyr Arg Gln Pro Gly Ala Phe Leu Thr
165 170 175Ser Ile Arg Glu Ala
Leu Ala Gln Met Gln Arg Glu Gly Ile Arg Pro 180
185 190Ala Ala Leu Leu Val Asp Thr Ile Phe Ser Ser Asp
Gly Val Phe Cys 195 200 205Ala Pro
Glu Gly Glu Met Ala Gln Ala Ala Ala Leu Ile Arg Gln Ala 210
215 220Gly Gly Leu Phe Ile Ala Asp Glu Val Gln Pro
Gly Phe Gly Arg Thr225 230 235
240Gly Glu Ser Leu Trp Gly Phe Ala Arg His Asn Val Val Pro Asp Leu
245 250 255Val Ser Leu Gly
Lys Pro Met Gly Asn Gly His Pro Ile Ala Gly Leu 260
265 270Val Gly Arg Ser Ala Leu Phe Asp Ala Phe Gly
Arg Asp Val Arg Tyr 275 280 285Phe
Asn Thr Phe Gly Gly Asn Pro Val Ser Cys Gln Ala Ala His Ala 290
295 300Val Leu Arg Val Ile Arg Glu Glu Gln Leu
Gln Gln Asn Ala Gln Arg305 310 315
320Val Gly Asp Tyr Leu Arg Gln Gly Leu Gln Gln Leu Ala Gln His
Phe 325 330 335Pro Leu Ile
Gly Asp Ile Arg Ala Tyr Gly Leu Phe Ile Gly Ala Glu 340
345 350Leu Val Ser Asp Arg Glu Ser Lys Thr Pro
Ala Ser Glu Ser Ala Leu 355 360
365Gln Val Val Asn Ala Met Arg Gln Arg Gly Val Leu Ile Ser Ala Thr 370
375 380Gly Pro Ala Ala Asn Ile Leu Lys
Ile Arg Pro Pro Leu Val Phe Leu385 390
395 400Glu Glu His Ala Asp Val Phe Leu Thr Thr Leu Ser
Asp Val Leu Ala 405 410
415Leu Ile Gly Thr Arg Ala Gln Arg 42012735DNAArtificial
SeqquencePrimer 127ctccggaatt catgtctgac ggacgactca ccgca
3512846DNAArtificial SeqquencePrimer 128ttccaatgca
ttggctgcag ttatctctgt gcacgagtgc cgatga
4612940DNAArtificial SeqquencePrimer 129aacagccaag cttggctgca gtcatcgcgc
attctccggg 4013040DNAArtificial SeqquencePrimer
130tctccggaat tcatgacgtc tgaaatgaca gcgacagaag
4013133DNAArtificial SequencePrimer 131gctaacagga ggaagaattc atggggggtt
ctc 3313233DNAArtificial SequencePrimer
132gagaaccccc catgaattct tcctcctgtt agc
33133723DNAKlebsiella terrigena 133atgcaaaaag tcgcacttgt caccggcgcc
ggtcagggca tcggtaaagc tatcgccctg 60cgtctggtga aggatggatt tgccgtggca
atcgccgatt acaacgacgc tacggccaca 120gcggtagccg ctgaaatcaa ccaggccggc
ggccgcgcgg tggccattaa ggtcgacgtc 180tcgcgccggg accaggtttt cgccgccgtt
gagcaggcgc gtaaagccct gggcggattc 240aacgttatcg tcaacaacgc cggcatcgcg
ccgtcaacgc cgatcgagtc catcaccgag 300gagatcgtcg accgggtcta taacatcaac
gttaagggcg tcatctgggg gatgcaggcg 360gcggtggagg ccttcaaaaa agaggggcac
ggcgggaaga tcgtcaacgc ctgctcccag 420gccggccacg tcggcaaccc ggagctggcg
gtctacagtt cgagtaaatt cgccgtgcgc 480ggcctgacgc aaaccgccgc ccgcgatctg
gcgccgctgg gcatcaccgt taacggcttc 540tgcccaggga tcgttaagac gccaatgtgg
gcggagattg accgtcagtg tcggaagcgg 600cgggcaaacc gctgggctac ggcacggctg
aatttgccaa acgcatcacc cttggccgcc 660tgtcggagcc tgaagacgtc gccgcctgcg
tgtcgttcct cgccagcccg gattccgact 720ata
723134241PRTKlebsiella terrigena 134Met
Gln Lys Val Ala Leu Val Thr Gly Ala Gly Gln Gly Ile Gly Lys1
5 10 15Ala Ile Ala Leu Arg Leu Val
Lys Asp Gly Phe Ala Val Ala Ile Ala 20 25
30Asp Tyr Asn Asp Ala Thr Ala Thr Ala Val Ala Ala Glu Ile
Asn Gln 35 40 45Ala Gly Gly Arg
Ala Val Ala Ile Lys Val Asp Val Ser Arg Arg Asp 50 55
60Gln Val Phe Ala Ala Val Glu Gln Ala Arg Lys Ala Leu
Gly Gly Phe65 70 75
80Asn Val Ile Val Asn Asn Ala Gly Ile Ala Pro Ser Thr Pro Ile Glu
85 90 95Ser Ile Thr Glu Glu Ile
Val Asp Arg Val Tyr Asn Ile Asn Val Lys 100
105 110Gly Val Ile Trp Gly Met Gln Ala Ala Val Glu Ala
Phe Lys Lys Glu 115 120 125Gly His
Gly Gly Lys Ile Val Asn Ala Cys Ser Gln Ala Gly His Val 130
135 140Gly Asn Pro Glu Leu Ala Val Tyr Ser Ser Ser
Lys Phe Ala Val Arg145 150 155
160Gly Leu Thr Gln Thr Ala Ala Arg Asp Leu Ala Pro Leu Gly Ile Thr
165 170 175Val Asn Gly Phe
Cys Pro Gly Ile Val Lys Thr Pro Met Trp Ala Glu 180
185 190Ile Asp Arg Gln Cys Arg Lys Arg Arg Ala Asn
Arg Trp Ala Thr Ala 195 200 205Arg
Leu Asn Leu Pro Asn Ala Ser Pro Leu Ala Ala Cys Arg Ser Leu 210
215 220Lys Thr Ser Pro Pro Ala Cys Arg Ser Ser
Pro Ala Arg Ile Pro Thr225 230 235
240Ile135554PRTClostridium pasteurianum 135Met Lys Ser Lys Arg
Phe Gln Val Leu Ser Glu Arg Pro Val Asn Lys1 5
10 15Asp Gly Phe Ile Gly Glu Trp Pro Glu Glu Gly
Leu Ile Ala Met Ser 20 25
30Ser Pro Asn Asp Pro Lys Pro Ser Ile Lys Ile Lys Glu Gly Lys Val
35 40 45Ile Glu Leu Asp Gly Lys Asn Arg
Glu Asp Phe Asp Met Ile Asp Arg 50 55
60Phe Ile Ala Asn Tyr Gly Ile Asn Leu Asn Arg Ala Glu Asp Val Ile65
70 75 80Lys Met Asp Ser Val
Lys Leu Ala Lys Met Leu Val Asp Ile Asn Val 85
90 95Asp Arg Lys Thr Ile Val Glu Leu Thr Thr Ala
Met Thr Pro Ala Lys 100 105
110Ile Val Glu Val Val Gly Asn Met Asn Val Val Glu Met Met Met Ala
115 120 125Leu Gln Lys Met Arg Ala Arg
Lys Thr Pro Ser Asn Gln Cys His Val 130 135
140Thr Asn Leu Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala
Glu145 150 155 160Ala Ala
Ile Arg Gly Phe Asp Glu Gln Glu Thr Thr Val Gly Ile Val
165 170 175Arg Tyr Ala Pro Phe Asn Ala
Leu Ala Leu Leu Val Gly Ala Gln Val 180 185
190Gly Arg Gly Gly Val Leu Thr Gln Cys Ala Ile Glu Glu Ala
Thr Glu 195 200 205Leu Glu Leu Gly
Met Arg Gly Leu Thr Ser Tyr Ala Glu Thr Val Ser 210
215 220Val Tyr Gly Thr Glu Asn Val Phe Thr Asp Gly Asp
Asp Thr Pro Trp225 230 235
240Ser Lys Ala Phe Leu Ala Ser Ala Tyr Ala Ser Arg Gly Leu Lys Met
245 250 255Arg Phe Thr Ser Gly
Ser Gly Ser Glu Ala Leu Met Gly Tyr Ala Glu 260
265 270Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile
Tyr Ile Thr Lys 275 280 285Ala Ala
Gly Val Gln Gly Leu Gln Asn Gly Ser Val Ser Cys Ile Gly 290
295 300Met Thr Gly Ala Leu Pro Ser Gly Ile Arg Ala
Val Leu Gly Glu Asn305 310 315
320Leu Ile Thr Thr Met Leu Asp Ile Glu Val Ala Ser Ala Asn Asp Gln
325 330 335Thr Phe Ser His
Ser Asp Ile Arg Arg Thr Ala Arg Met Leu Met Gln 340
345 350Met Leu Pro Gly Thr Asp Phe Ile Phe Ser Gly
Tyr Ser Ser Val Pro 355 360 365Asn
Tyr Asp Asn Met Phe Ala Gly Ser Asn Phe Asp Ala Glu Asp Phe 370
375 380Asp Asp Tyr Asn Val Ile Gln Arg Asp Leu
Met Val Asp Gly Gly Leu385 390 395
400Arg Pro Val Ser Glu Glu Glu Val Ile Thr Ile Arg Asn Lys Ala
Ala 405 410 415Arg Ala Ile
Gln Ala Val Phe Glu Gly Leu Lys Leu Pro Ala Ile Thr 420
425 430Asp Glu Glu Val Glu Ala Val Thr Tyr Ser
His Gly Ser Lys Asp Val 435 440
445Pro Glu Arg Asn Val Val Glu Asp Leu Lys Ala Ala Glu Glu Met Ile 450
455 460Asn Arg Gly Ile Thr Gly Ile Asp
Val Val Lys Ala Leu Ser Lys His465 470
475 480Gly Phe Asp Asp Ile Ala Glu Asn Ile Leu Asn Met
Leu Lys Gln Arg 485 490
495Ile Ser Gly Asp Tyr Leu Gln Thr Ser Ala Ile Ile Asp Lys Asn Phe
500 505 510Asn Val Val Ser Ala Val
Asn Asp Cys Asn Asp Tyr Met Gly Pro Gly 515 520
525Thr Gly Tyr Arg Leu Ser Lys Glu Arg Trp Asp Glu Ile Lys
Asn Ile 530 535 540Pro Asn Ala Met Lys
Pro Glu Asp Ile Lys545 550136179PRTClostridium
pasteurianum 136Met Glu Leu Lys Glu Lys Asp Ile Ala Leu Ser Gly Asn Gln
Ser Asn1 5 10 15Glu Val
Val Ile Gly Ile Ala Pro Ala Phe Gly Lys Tyr Gln His Gln 20
25 30Ser Ile Val Gly Val Pro His Asp Lys
Ile Leu Arg Glu Leu Ile Ala 35 40
45Gly Ile Glu Glu Glu Gly Leu Lys Ser Arg Val Val Arg Ile Ile Arg 50
55 60Thr Ser Asp Val Ser Phe Ile Ala His
Asp Ala Ala Val Leu Ser Gly65 70 75
80Ser Gly Ile Gly Ile Gly Ile Gln Ser Lys Gly Thr Thr Val
Ile His 85 90 95Gln Lys
Asp Leu Leu Pro Leu Asn Asn Leu Glu Leu Phe Pro Gln Ala 100
105 110Pro Leu Leu Asp Leu Asp Ile Phe Arg
Leu Ile Gly Lys Asn Ala Ala 115 120
125Lys Tyr Ala Lys Gly Glu Ser Pro Asn Pro Val Pro Thr Arg Asn Asp
130 135 140Gln Met Val Arg Pro Lys Phe
Gln Ala Lys Ala Ala Leu Leu His Ile145 150
155 160Lys Glu Thr Lys His Val Val Gln Asn Ala Lys Pro
Ile Glu Leu Glu 165 170
175Ile Ile Ser 137146PRTClostridium pasteurianum 137Met Ser Asp Ile Thr
Asn Asn Ile Lys Val Asp Tyr Glu Asn Asp Tyr1 5
10 15Pro Leu Ala Ala Lys Arg Ser Glu Trp Ile Lys
Thr Pro Thr Gly Lys 20 25
30Asn Leu Lys Asp Ile Thr Leu Glu Ala Val Ile Asp Glu Asn Val Lys
35 40 45Ala Glu Asp Val Arg Ile Ser Arg
Asp Thr Leu Glu Leu Gln Ala Gln 50 55
60Val Ala Glu Gly Ser Gly Arg Cys Ala Ile Ala Arg Asn Phe Arg Arg65
70 75 80Ala Ala Glu Leu Ile
Ser Ile Ser Asp Glu Arg Ile Leu Glu Ile Tyr 85
90 95Asn Ala Leu Arg Pro Tyr Arg Ser Thr Lys Asn
Glu Leu Leu Ala Ile 100 105
110Ala Asp Glu Leu Glu Glu Lys Tyr Asp Ala Lys Val Asn Ala Asp Phe
115 120 125Ile Arg Glu Ala Ala Glu Val
Tyr Ser Lys Arg Asn Lys Val Arg Ile 130 135
140Glu Asp145138555PRTEscherichia blattae 138Met Arg Arg Ser Lys Arg
Phe Glu Val Leu Glu Lys Arg Pro Val Asn1 5
10 15Gln Asp Gly Leu Ile Gly Glu Trp Pro Glu Glu Gly
Leu Ile Ala Met 20 25 30Gly
Ser Pro Trp Asp Pro Pro Ser Ser Val Lys Val Glu Gln Gly Arg 35
40 45Ile Val Glu Leu Asp Gly Lys Ala Arg
Ala Asp Phe Asp Met Ile Asp 50 55
60Arg Phe Ile Ala Asp Tyr Ala Ile Asn Ile Glu Glu Thr Glu His Ala65
70 75 80Met Gly Leu Asp Ala
Leu Thr Ile Ala Arg Met Leu Val Asp Ile Asn 85
90 95Val Ser Arg Ala Glu Ile Ile Lys Val Thr Thr
Ala Ile Thr Pro Ala 100 105
110Lys Ala Val Glu Val Met Ser His Met Asn Val Val Glu Met Met Met
115 120 125Ala Leu Gln Lys Met Arg Ala
Arg Arg Thr Pro Ser Asn Gln Cys His 130 135
140Val Thr Asn Leu Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala
Ala145 150 155 160Glu Ala
Gly Ile Arg Gly Phe Ser Glu Gln Glu Thr Thr Val Gly Ile
165 170 175Ala Arg Tyr Ala Pro Phe Asn
Ala Leu Ala Leu Leu Ile Gly Ser Gln 180 185
190Ser Gly Arg Pro Gly Val Leu Thr Gln Cys Ser Val Glu Glu
Ala Thr 195 200 205Glu Leu Glu Leu
Gly Met Arg Gly Phe Thr Ser Tyr Ala Glu Thr Val 210
215 220Ser Val Tyr Gly Thr Glu Ala Val Phe Thr Asp Gly
Asp Asp Thr Pro225 230 235
240Trp Ser Lys Ala Phe Leu Ala Ser Ala Tyr Ala Ser Arg Gly Leu Lys
245 250 255Met Arg Tyr Thr Ser
Gly Thr Gly Ser Glu Ala Leu Met Gly Tyr Ala 260
265 270Glu Ser Lys Ser Met Leu Tyr Leu Glu Ser Arg Cys
Ile Phe Ile Thr 275 280 285Lys Gly
Ala Gly Val Gln Gly Leu Gln Asn Gly Ala Val Ser Cys Ile 290
295 300Gly Met Thr Gly Ala Val Pro Ser Gly Ile Arg
Ala Val Leu Ala Glu305 310 315
320Asn Leu Ile Ala Ser Met Leu Asp Leu Glu Val Ala Ser Ala Asn Asp
325 330 335Gln Thr Phe Ser
His Ser Asp Ile Arg Arg Thr Ala Arg Thr Leu Met 340
345 350Gln Met Leu Pro Gly Thr Asp Phe Ile Phe Ser
Gly Tyr Ser Ala Val 355 360 365Pro
Asn Tyr Asp Asn Met Phe Ala Gly Ser Asn Phe Asp Ala Glu Asp 370
375 380Phe Asp Asp Tyr Asn Ile Leu Gln Arg Asp
Leu Met Val Asp Gly Gly385 390 395
400Leu Arg Pro Val Ser Glu Glu Glu Thr Ile Ala Ile Arg Asn Lys
Ala 405 410 415Ala Arg Ala
Val Gln Ala Val Phe Arg Glu Leu Gly Leu Pro Pro Val 420
425 430Thr Asp Glu Glu Val Thr Ala Ala Thr Tyr
Ala His Gly Ser Lys Asp 435 440
445Met Pro Pro Arg Asn Val Val Glu Asp Leu Ser Ala Val Glu Glu Met 450
455 460Met Lys Arg Asn Ile Thr Gly Leu
Asp Ile Val Arg Ala Leu Ser Val465 470
475 480Asn Gly Phe Asp Asp Val Ala Asn Asn Ile Leu Asn
Met Leu Arg Gln 485 490
495Arg Val Thr Gly Asp Tyr Leu Gln Thr Ser Ala Ile Leu Asp Arg Glu
500 505 510Phe Glu Val Val Ser Ala
Val Asn Asp Ile Asn Asp Tyr Gln Gly Pro 515 520
525Gly Thr Gly Tyr Arg Ile Ser Pro Gln Arg Trp Glu Glu Ile
Lys Asn 530 535 540Ile Ala Thr Val Ile
Gln Pro Asp Ser Ile Glu545 550
555139196PRTEscherichia blattae 139Met Glu Thr Thr Gln Lys Lys Ala Pro
Val Phe Thr Leu Asn Leu Val1 5 10
15Glu Ser Gly Val Ala Lys Pro Gly Glu Arg Ser Asp Glu Val Val
Ile 20 25 30Gly Val Gly Pro
Ala Phe Asp Lys Tyr Gln His Lys Thr Leu Ile Asp 35
40 45Met Pro His Lys Ala Ile Ile Lys Glu Leu Val Ala
Gly Val Glu Glu 50 55 60Glu Gly Leu
His Ala Arg Val Val Arg Ile Leu Arg Thr Ser Asp Val65 70
75 80Ser Phe Met Ala Trp Asp Ala Ala
Asn Leu Ser Gly Ser Gly Ile Gly 85 90
95Ile Gly Ile Gln Ser Lys Gly Thr Thr Val Ile His Gln Arg
Asp Leu 100 105 110Leu Pro Leu
Ser Asn Leu Glu Leu Phe Ser Gln Ala Pro Leu Leu Thr 115
120 125Leu Glu Thr Tyr Arg Gln Ile Gly Lys Asn Ala
Ala Arg Tyr Ala Arg 130 135 140Lys Glu
Ser Pro Ser Pro Val Pro Val Val Asn Asp Gln Met Val Arg145
150 155 160Pro Lys Phe Met Ala Lys Ala
Ala Leu Phe His Ile Lys Glu Thr Lys 165
170 175His Val Val Ala Asp Ala Lys Pro Val Thr Leu Asn
Ile Glu Ile Thr 180 185 190Arg
Glu Glu Ala 195140141PRTEscherichia blattae 140Met Thr Thr Thr Lys
Met Ser Ala Ala Asp Tyr Pro Leu Ala Ser Arg1 5
10 15Cys Pro Glu Arg Ile Gln Thr Pro Thr Gly Lys
Pro Leu Thr Asp Ile 20 25
30Thr Leu Glu Asn Val Leu Ala Gly Lys Val Gly Pro Gln Asp Val Arg
35 40 45Ile Ser Arg Glu Thr Leu Glu Tyr
Gln Ala Gln Ile Ala Glu Gln Met 50 55
60His Arg His Ala Ile Ala Arg Asn Leu Arg Arg Ala Gly Glu Leu Ile65
70 75 80Ala Ile Pro Asp Ala
Arg Ile Leu Glu Ile Tyr Asn Ala Leu Arg Pro 85
90 95Tyr Arg Ser Ser Val Glu Glu Leu Leu Ala Ile
Ala Asp Glu Leu Glu 100 105
110Thr Arg Tyr Gln Ala Thr Val Asn Ala Ala Phe Ile Arg Glu Ala Ala
115 120 125Glu Val Tyr Arg Gln Arg Asp
Lys Leu Arg Lys Glu Ala 130 135
140141555PRTCitrobacter freundii 141Met Arg Arg Ser Lys Arg Phe Glu Val
Leu Ala Gln Arg Pro Val Asn1 5 10
15Gln Asp Gly Leu Ile Gly Glu Trp Pro Glu Glu Gly Leu Ile Ala
Met 20 25 30Glu Ser Pro Tyr
Asp Pro Ala Ser Ser Val Lys Val Glu Asn Gly Arg 35
40 45Ile Val Glu Leu Asp Gly Lys Ser Arg Ala Glu Phe
Asp Met Ile Asp 50 55 60Arg Phe Ile
Ala Asp Tyr Ala Ile Asn Val Pro Glu Ala Glu Arg Ala65 70
75 80Met Gln Leu Asp Ala Leu Glu Ile
Ala Arg Met Leu Val Asp Ile His 85 90
95Val Ser Arg Glu Glu Ile Ile Ala Ile Thr Thr Ala Ile Thr
Pro Ala 100 105 110Lys Arg Leu
Glu Val Met Ala Gln Met Asn Val Val Glu Met Met Met 115
120 125Ala Leu Gln Lys Met Arg Ala Arg Arg Thr Pro
Ser Asn Gln Cys His 130 135 140Val Thr
Asn Leu Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala145
150 155 160Glu Ala Gly Ile Arg Gly Phe
Ser Glu Gln Glu Thr Thr Val Gly Ile 165
170 175Ala Arg Tyr Ala Pro Phe Asn Ala Leu Ala Leu Leu
Val Gly Ser Gln 180 185 190Cys
Gly Ala Pro Gly Val Leu Thr Gln Cys Ser Val Glu Glu Ala Thr 195
200 205Glu Leu Glu Leu Gly Met Arg Gly Leu
Thr Ser Tyr Ala Glu Thr Val 210 215
220Ser Val Tyr Gly Thr Glu Ser Val Phe Thr Asp Gly Asp Asp Thr Pro225
230 235 240Trp Ser Lys Ala
Phe Leu Ala Ser Ala Tyr Ala Ser Arg Gly Leu Lys 245
250 255Met Arg Tyr Thr Ser Gly Thr Gly Ser Glu
Ala Leu Met Gly Tyr Ser 260 265
270Glu Ser Lys Ser Met Leu Tyr Leu Glu Ser Arg Cys Ile Phe Ile Thr
275 280 285Lys Gly Ala Gly Val Gln Gly
Leu Gln Asn Gly Ala Val Ser Cys Ile 290 295
300Gly Met Thr Gly Ala Val Pro Ser Gly Ile Arg Ala Val Leu Ala
Glu305 310 315 320Asn Leu
Ile Ala Ser Met Leu Asp Leu Glu Val Ala Ser Ala Asn Asp
325 330 335Gln Thr Phe Ser His Ser Asp
Ile Arg Arg Thr Ala Arg Thr Leu Met 340 345
350Gln Met Leu Pro Gly Thr Asp Phe Ile Phe Ser Gly Tyr Ser
Ala Val 355 360 365Pro Asn Tyr Asp
Asn Met Phe Ala Gly Ser Asn Phe Asp Ala Glu Asp 370
375 380Phe Asp Asp Tyr Asn Ile Leu Gln Arg Asp Leu Met
Val Asp Gly Gly385 390 395
400Leu Arg Pro Val Thr Glu Glu Glu Thr Ile Ala Ile Arg Asn Lys Ala
405 410 415Ala Arg Ala Ile Gln
Ala Val Phe Arg Glu Leu Gly Leu Pro Leu Ile 420
425 430Ser Asp Glu Glu Val Asp Ala Ala Thr Tyr Ala His
Gly Ser Lys Asp 435 440 445Met Pro
Ala Arg Asn Val Val Glu Asp Leu Ala Ala Val Glu Glu Met 450
455 460Met Lys Arg Asn Ile Thr Gly Leu Asp Ile Val
Gly Ala Leu Ser Ser465 470 475
480Ser Gly Phe Glu Asp Ile Ala Ser Asn Ile Leu Asn Met Leu Arg Gln
485 490 495Arg Val Thr Gly
Asp Tyr Leu Gln Thr Ser Ala Ile Leu Asp Arg Gln 500
505 510Phe Asp Val Val Ser Ala Val Asn Asp Ile Asn
Asp Tyr Gln Gly Pro 515 520 525Gly
Thr Gly Tyr Arg Ile Ser Ala Glu Arg Trp Ala Glu Ile Lys Asn 530
535 540Ile Ala Gly Val Val Gln Pro Gly Ser Ile
Glu545 550 555142194PRTCitrobacter
freundii 142Met Glu Cys Thr Thr Glu Arg Lys Pro Val Phe Thr Leu Gln Val
Ser1 5 10 15Glu Gly Glu
Ala Ala Lys Ala Asp Glu Arg Val Asp Glu Val Val Ile 20
25 30Gly Val Gly Pro Ala Phe Asp Lys Tyr Gln
His Lys Thr Leu Ile Asp 35 40
45Met Pro His Lys Ala Ile Leu Lys Glu Leu Val Ala Gly Ile Glu Glu 50
55 60Glu Gly Leu His Ala Arg Val Val Arg
Ile Leu Arg Thr Ser Asp Val65 70 75
80Ser Phe Met Ala Trp Asp Ala Ala Asn Leu Ser Gly Ser Gly
Ile Gly 85 90 95Ile Gly
Ile Gln Ser Lys Gly Thr Thr Val Ile His Gln Arg Asp Leu 100
105 110Leu Pro Leu Ser Asn Leu Glu Leu Phe
Ser Gln Ala Pro Leu Leu Thr 115 120
125Leu Glu Thr Tyr Arg Gln Ile Gly Lys Asn Ala Ala Arg Tyr Ala Arg
130 135 140Lys Glu Ser Pro Ser Pro Val
Pro Val Val Asn Asp Gln Met Val Arg145 150
155 160Pro Lys Phe Met Ala Lys Ala Ala Leu Phe His Ile
Lys Glu Thr Lys 165 170
175His Val Val Gln Asp Arg Ala Pro Val Thr Leu His Ile Ala Leu Val
180 185 190Arg
Glu143142PRTCitrobacter freundii 143Met Asn Asp Asn Ile Met Thr Ala Gln
Asp Tyr Pro Leu Ala Thr Arg1 5 10
15Cys Pro Glu Lys Ile Gln Thr Pro Thr Gly Lys Pro Leu Thr Glu
Ile 20 25 30Thr Leu Glu Asn
Val Leu Ala Gly Arg Val Gly Pro Gln Asp Val Arg 35
40 45Ile Ser Gln Gln Thr Leu Glu Tyr Gln Ala Gln Ile
Ala Glu Gln Met 50 55 60Gln Arg His
Ala Val Ala Arg Asn Phe Arg Arg Ala Ala Glu Leu Ile65 70
75 80Ala Ile Pro Asp Ala Arg Ile Leu
Glu Ile Tyr Asn Ala Leu Arg Pro 85 90
95Phe Arg Ser Ser Phe Ala Glu Leu Gln Ala Ile Ala Asp Glu
Leu Glu 100 105 110His Thr Trp
His Ala Thr Val Asn Ala Gly Phe Val Arg Glu Ser Ala 115
120 125Glu Val Tyr Leu Gln Arg Asn Lys Leu Arg Lys
Gly Ser Gln 130 135
1401441359DNAArtificial sequenceCodon optimized Vibrio fluvialis amine
pyruvate transaminase 144atgaacaaac cacagtcttg ggaagctcgt gcagaaacct
attctctgta cggcttcact 60gacatgccgt ccctgcacca gcgtggtact gttgttgtca
cgcacggcga aggtccgtac 120attgttgacg tcaatggtcg ccgttatctg gacgctaatt
ctggcctgtg gaatatggtt 180gcaggttttg accataaggg tctgatcgac gcagctaagg
ctcagtacga gcgttttccg 240ggctaccatg cgttcttcgg tcgtatgagc gatcagacgg
tgatgctgtc cgaaaaactg 300gtagaagtct ctccgttcga cagcggccgt gtgttctata
cgaacagcgg tagcgaagca 360aacgacacta tggttaagat gctgtggttc ctgcatgcgg
cggaaggtaa gccacaaaag 420cgcaaaattc tgacccgttg gaacgcgtat cacggcgtta
ctgcagttag cgcctccatg 480accggtaaac cgtacaacag cgttttcggt ctgccgctgc
caggtttcgt tcacctgact 540tgccctcact actggcgtta cggtgaagaa ggcgagacgg
aagaacaatt cgttgcacgc 600ctggcacgcg aactggaaga gactatccag cgtgagggtg
ctgacactat cgctggcttc 660tttgctgagc cggttatggg tgcaggtggt gttattccgc
ctgctaaagg ttattttcag 720gctattctgc caatcctgcg taaatatgac atcccggtta
tctctgacga agttatctgt 780ggttttggtc gcactggcaa cacctggggt tgcgtaactt
atgattttac tccggatgct 840atcatctcta gcaaaaacct gaccgccggt ttcttcccga
tgggcgcagt gatcctgggt 900ccagaactga gcaagcgcct ggaaaccgca attgaagcaa
tcgaggaatt tccgcacggc 960tttaccgcgt ccggccatcc ggtaggctgt gcaatcgcgc
tgaaagcgat cgatgttgtt 1020atgaacgaag gcctggcgga aaacgttcgc cgtctggcac
cgcgcttcga agaacgtctg 1080aaacatatcg cggaacgtcc gaacattggt gaatatcgtg
gtatcggttt tatgtgggct 1140ctggaggcag tcaaagacaa agcgtctaaa actccgttcg
atggcaatct gagcgtgagc 1200gaacgtatcg ccaacacttg caccgacctg ggtctgatct
gccgtccact gggccaaagc 1260gtagtgctgt gtccgccgtt tatcctgacc gaagcgcaaa
tggacgaaat gttcgacaaa 1320ctggagaaag cactggataa agtgttcgca gaggtggca
13591451668DNAKlebsiella pneumoniae 145atgaaaagat
caaaacgatt tgcagtactg gcccagcgcc ccgtcaatca ggacgggctg 60attggcgagt
ggcctgaaga ggggctgatc gccatggaca gcccctttga cccggtctct 120tcagtaaaag
tggacaacgg tctgatcgtc gaactggacg gcaaacgccg ggaccagttt 180gacatgatcg
accgatttat cgccgattac gcgatcaacg ttgagcgcac agagcaggca 240atgcgcctgg
aggcggtgga aatagcccgt atgctggtgg atattcacgt cagccgggag 300gagatcattg
ccatcactac cgccatcacg ccggccaaag cggtcgaggt gatggcgcag 360atgaacgtgg
tggagatgat gatggcgctg cagaagatgc gtgcccgccg gaccccctcc 420aaccagtgcc
acgtcaccaa tctcaaagat aatccggtgc agattgccgc tgacgccgcc 480gaggccggga
tccgcggctt ctcagaacag gagaccacgg tcggtatcgc gcgctacgcg 540ccgtttaacg
ccctggcgct gttggtcggt tcgcagtgcg gccgccccgg cgtgttgacg 600cagtgctcgg
tggaagaggc caccgagctg gagctgggca tgcgtggctt aaccagctac 660gccgagacgg
tgtcggtcta cggcaccgaa gcggtattta ccgacggcga tgatacgccg 720tggtcaaagg
cgttcctcgc ctcggcctac gcctcccgcg ggttgaaaat gcgctacacc 780tccggcaccg
gatccgaagc gctgatgggc tattcggaga gcaagtcgat gctctacctc 840gaatcgcgct
gcatcttcat tactaaaggc gccggggttc agggactgca aaacggcgcg 900gtgagctgta
tcggcatgac cggcgctgtg ccgtcgggca ttcgggcggt gctggcggaa 960aacctgatcg
cctctatgct cgacctcgaa gtggcgtccg ccaacgacca gactttctcc 1020cactcggata
ttcgccgcac cgcgcgcacc ctgatgcaga tgctgccggg caccgacttt 1080attttctccg
gctacagcgc ggtgccgaac tacgacaaca tgttcgccgg ctcgaacttc 1140gatgcggaag
attttgatga ttacaacatc ctgcagcgtg acctgatggt tgacggcggc 1200ctgcgtccgg
tgaccgaggc ggaaaccatt gccattcgcc agaaagcggc gcgggcgatc 1260caggcggttt
tccgcgagct ggggctgccg ccaatcgccg acgaggaggt ggaggccgcc 1320acctacgcgc
acggcagcaa cgagatgccg ccgcgtaacg tggtggagga tctgagtgcg 1380gtggaagaga
tgatgaagcg caacatcacc ggcctcgata ttgtcggcgc gctgagccgc 1440agcggctttg
aggatatcgc cagcaatatt ctcaatatgc tgcgccagcg ggtcaccggc 1500gattacctgc
agacctcggc cattctcgat cggcagttcg aggtggtgag tgcggtcaac 1560gacatcaatg
actatcaggg gccgggcacc ggctatcgca tctctgccga acgctgggcg 1620gagatcaaaa
atattccggg cgtggttcag cccgacacca ttgaataa
1668146555PRTKlebsiella pneumoniae 146Met Lys Arg Ser Lys Arg Phe Ala Val
Leu Ala Gln Arg Pro Val Asn1 5 10
15Gln Asp Gly Leu Ile Gly Glu Trp Pro Glu Glu Gly Leu Ile Ala
Met 20 25 30Asp Ser Pro Phe
Asp Pro Val Ser Ser Val Lys Val Asp Asn Gly Leu 35
40 45Ile Val Glu Leu Asp Gly Lys Arg Arg Asp Gln Phe
Asp Met Ile Asp 50 55 60Arg Phe Ile
Ala Asp Tyr Ala Ile Asn Val Glu Arg Thr Glu Gln Ala65 70
75 80Met Arg Leu Glu Ala Val Glu Ile
Ala Arg Met Leu Val Asp Ile His 85 90
95Val Ser Arg Glu Glu Ile Ile Ala Ile Thr Thr Ala Ile Thr
Pro Ala 100 105 110Lys Ala Val
Glu Val Met Ala Gln Met Asn Val Val Glu Met Met Met 115
120 125Ala Leu Gln Lys Met Arg Ala Arg Arg Thr Pro
Ser Asn Gln Cys His 130 135 140Val Thr
Asn Leu Lys Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala145
150 155 160Glu Ala Gly Ile Arg Gly Phe
Ser Glu Gln Glu Thr Thr Val Gly Ile 165
170 175Ala Arg Tyr Ala Pro Phe Asn Ala Leu Ala Leu Leu
Val Gly Ser Gln 180 185 190Cys
Gly Arg Pro Gly Val Leu Thr Gln Cys Ser Val Glu Glu Ala Thr 195
200 205Glu Leu Glu Leu Gly Met Arg Gly Leu
Thr Ser Tyr Ala Glu Thr Val 210 215
220Ser Val Tyr Gly Thr Glu Ala Val Phe Thr Asp Gly Asp Asp Thr Pro225
230 235 240Trp Ser Lys Ala
Phe Leu Ala Ser Ala Tyr Ala Ser Arg Gly Leu Lys 245
250 255Met Arg Tyr Thr Ser Gly Thr Gly Ser Glu
Ala Leu Met Gly Tyr Ser 260 265
270Glu Ser Lys Ser Met Leu Tyr Leu Glu Ser Arg Cys Ile Phe Ile Thr
275 280 285Lys Gly Ala Gly Val Gln Gly
Leu Gln Asn Gly Ala Val Ser Cys Ile 290 295
300Gly Met Thr Gly Ala Val Pro Ser Gly Ile Arg Ala Val Leu Ala
Glu305 310 315 320Asn Leu
Ile Ala Ser Met Leu Asp Leu Glu Val Ala Ser Ala Asn Asp
325 330 335Gln Thr Phe Ser His Ser Asp
Ile Arg Arg Thr Ala Arg Thr Leu Met 340 345
350Gln Met Leu Pro Gly Thr Asp Phe Ile Phe Ser Gly Tyr Ser
Ala Val 355 360 365Pro Asn Tyr Asp
Asn Met Phe Ala Gly Ser Asn Phe Asp Ala Glu Asp 370
375 380Phe Asp Asp Tyr Asn Ile Leu Gln Arg Asp Leu Met
Val Asp Gly Gly385 390 395
400Leu Arg Pro Val Thr Glu Ala Glu Thr Ile Ala Ile Arg Gln Lys Ala
405 410 415Ala Arg Ala Ile Gln
Ala Val Phe Arg Glu Leu Gly Leu Pro Pro Ile 420
425 430Ala Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala His
Gly Ser Asn Glu 435 440 445Met Pro
Pro Arg Asn Val Val Glu Asp Leu Ser Ala Val Glu Glu Met 450
455 460Met Lys Arg Asn Ile Thr Gly Leu Asp Ile Val
Gly Ala Leu Ser Arg465 470 475
480Ser Gly Phe Glu Asp Ile Ala Ser Asn Ile Leu Asn Met Leu Arg Gln
485 490 495Arg Val Thr Gly
Asp Tyr Leu Gln Thr Ser Ala Ile Leu Asp Arg Gln 500
505 510Phe Glu Val Val Ser Ala Val Asn Asp Ile Asn
Asp Tyr Gln Gly Pro 515 520 525Gly
Thr Gly Tyr Arg Ile Ser Ala Glu Arg Trp Ala Glu Ile Lys Asn 530
535 540Ile Pro Gly Val Val Gln Pro Asp Thr Ile
Glu545 550 555147585DNAKlebsiella
pneumoniae 147gtgcaacaga caacccaaat tcagccctct tttaccctga aaacccgcga
gggcggggta 60gcttctgccg atgaacgcgc cgatgaagtg gtgatcggcg tcggccctgc
cttcgataaa 120caccagcatc acactctgat cgatatgccc catggcgcga tcctcaaaga
gctgattgcc 180ggggtggaag aagaggggct tcacgcccgg gtggtgcgca ttctgcgcac
gtccgacgtc 240tcctttatgg cctgggatgc ggccaacctg agcggctcgg ggatcggcat
cggtatccag 300tcgaagggga ccacggtcat ccatcagcgc gatctgctgc cgctcagcaa
cctggagctg 360ttctcccagg cgccgctgct gacgctggag acctaccggc agattggcaa
aaacgctgcg 420cgctatgcgc gcaaagagtc accttcgccg gtgccggtgg tgaacgatca
gatggtgcgg 480ccgaaattta tggccaaagc cgcgctattt catatcaaag agaccaaaca
tgtggtgcag 540gacgccgagc ccgtcaccct gcacatcgac ttagtaaggg agtga
585148194PRTKlebsiella pneumoniae 148Met Gln Gln Thr Thr Gln
Ile Gln Pro Ser Phe Thr Leu Lys Thr Arg1 5
10 15Glu Gly Gly Val Ala Ser Ala Asp Glu Arg Ala Asp
Glu Val Val Ile 20 25 30Gly
Val Gly Pro Ala Phe Asp Lys His Gln His His Thr Leu Ile Asp 35
40 45Met Pro His Gly Ala Ile Leu Lys Glu
Leu Ile Ala Gly Val Glu Glu 50 55
60Glu Gly Leu His Ala Arg Val Val Arg Ile Leu Arg Thr Ser Asp Val65
70 75 80Ser Phe Met Ala Trp
Asp Ala Ala Asn Leu Ser Gly Ser Gly Ile Gly 85
90 95Ile Gly Ile Gln Ser Lys Gly Thr Thr Val Ile
His Gln Arg Asp Leu 100 105
110Leu Pro Leu Ser Asn Leu Glu Leu Phe Ser Gln Ala Pro Leu Leu Thr
115 120 125Leu Glu Thr Tyr Arg Gln Ile
Gly Lys Asn Ala Ala Arg Tyr Ala Arg 130 135
140Lys Glu Ser Pro Ser Pro Val Pro Val Val Asn Asp Gln Met Val
Arg145 150 155 160Pro Lys
Phe Met Ala Lys Ala Ala Leu Phe His Ile Lys Glu Thr Lys
165 170 175His Val Val Gln Asp Ala Glu
Pro Val Thr Leu His Ile Asp Leu Val 180 185
190Arg Glu 149426DNAKlebsiella pneumoniae 149atgagcgaga
aaaccatgcg cgtgcaggat tatccgttag ccacccgctg cccggagcat 60atcctgacgc
ctaccggcaa accattgacc gatattaccc tcgagaaggt gctctctggc 120gaggtgggcc
cgcaggatgt gcggatctcc cgccagaccc ttgagtacca ggcgcagatt 180gccgagcaga
tgcagcgcca tgcggtggcg cgcaatttcc gccgcgcggc ggagcttatc 240gccattcctg
acgagcgcat tctggctatc tataacgcgc tgcgcccgtt ccgctcctcg 300caggcggagc
tgctggcgat cgccgacgag ctggagcaca cctggcatgc gacagtgaat 360gccgcctttg
tccgggagtc ggcggaagtg tatcagcagc ggcataagct gcgtaaagga 420agctaa
426150141PRTKlebsiella pneumoniae 150Met Ser Glu Lys Thr Met Arg Val Gln
Asp Tyr Pro Leu Ala Thr Arg1 5 10
15Cys Pro Glu His Ile Leu Thr Pro Thr Gly Lys Pro Leu Thr Asp
Ile 20 25 30Thr Leu Glu Lys
Val Leu Ser Gly Glu Val Gly Pro Gln Asp Val Arg 35
40 45Ile Ser Arg Gln Thr Leu Glu Tyr Gln Ala Gln Ile
Ala Glu Gln Met 50 55 60Gln Arg His
Ala Val Ala Arg Asn Phe Arg Arg Ala Ala Glu Leu Ile65 70
75 80Ala Ile Pro Asp Glu Arg Ile Leu
Ala Ile Tyr Asn Ala Leu Arg Pro 85 90
95Phe Arg Ser Ser Gln Ala Glu Leu Leu Ala Ile Ala Asp Glu
Leu Glu 100 105 110His Thr Trp
His Ala Thr Val Asn Ala Ala Phe Val Arg Glu Ser Ala 115
120 125Glu Val Tyr Gln Gln Arg His Lys Leu Arg Lys
Gly Ser 130 135
1401511824DNAKlebsiella pneumoniae 151atgccgttaa tagccgggat tgatatcggc
aacgccacca ccgaggtggc gctggcgtcc 60gactacccgc aggcgagggc gtttgttgcc
agcgggatcg tcgcgacgac gggcatgaaa 120gggacgcggg acaatatcgc cgggaccctc
gccgcgctgg agcaggccct ggcgaaaaca 180ccgtggtcga tgagcgatgt ctctcgcatc
tatcttaacg aagccgcgcc ggtgattggc 240gatgtggcga tggagaccat caccgagacc
attatcaccg aatcgaccat gatcggtcat 300aacccgcaga cgccgggcgg ggtgggcgtt
ggcgtgggga cgactatcgc cctcgggcgg 360ctggcgacgc tgccggcggc gcagtatgcc
gaggggtgga tcgtactgat tgacgacgcc 420gtcgatttcc ttgacgccgt gtggtggctc
aatgaggcgc tcgaccgggg gatcaacgtg 480gtggcggcga tcctcaaaaa ggacgacggc
gtgctggtga acaaccgcct gcgtaaaacc 540ctgccggtgg tggatgaagt gacgctgctg
gagcaggtcc ccgagggggt aatggcggcg 600gtggaagtgg ccgcgccggg ccaggtggtg
cggatcctgt cgaatcccta cgggatcgcc 660accttcttcg ggctaagccc ggaagagacc
caggccatcg tccccatcgc ccgcgccctg 720attggcaacc gttccgcggt ggtgctcaag
accccgcagg gggatgtgca gtcgcgggtg 780atcccggcgg gcaacctcta cattagcggc
gaaaagcgcc gcggagaggc cgatgtcgcc 840gagggcgcgg aagccatcat gcaggcgatg
agcgcctgcg ctccggtacg cgacatccgc 900ggcgaaccgg gcacccacgc cggcggcatg
cttgagcggg tgcgcaaggt aatggcgtcc 960ctgaccggcc atgagatgag cgcgatatac
atccaggatc tgctggcggt ggatacgttt 1020attccgcgca aggtgcaggg cgggatggcc
ggcgagtgcg ccatggagaa tgccgtcggg 1080atggcggcga tggtgaaagc ggatcgtctg
caaatgcagg ttatcgcccg cgaactgagc 1140gcccgactgc agaccgaggt ggtggtgggc
ggcgtggagg ccaacatggc catcgccggg 1200gcgttaacca ctcccggctg tgcggcgccg
ctggcgatcc tcgacctcgg cgccggctcg 1260acggatgcgg cgatcgtcaa cgcggagggg
cagataacgg cggtccatct cgccggggcg 1320gggaatatgg tcagcctgtt gattaaaacc
gagctgggcc tcgaggatct ttcgctggcg 1380gaagcgataa aaaaataccc gctggccaaa
gtggaaagcc tgttcagtat tcgtcacgag 1440aatggcgcgg tggagttctt tcgggaagcc
ctcagcccgg cggtgttcgc caaagtggtg 1500tacatcaagg agggcgaact ggtgccgatc
gataacgcca gcccgctgga aaaaattcgt 1560ctcgtgcgcc ggcaggcgaa agagaaagtg
tttgtcacca actgcctgcg cgcgctgcgc 1620caggtctcac ccggcggttc cattcgcgat
atcgcctttg tggtgctggt gggcggctca 1680tcgctggact ttgagatccc gcagcttatc
acggaagcct tgtcgcacta tggcgtggtc 1740gccgggcagg gcaatattcg gggaacagaa
gggccgcgca atgcggtcgc caccgggctg 1800ctactggccg gtcaggcgaa ttaa
1824152607PRTKlebsiella pneumoniae
152Met Pro Leu Ile Ala Gly Ile Asp Ile Gly Asn Ala Thr Thr Glu Val1
5 10 15Ala Leu Ala Ser Asp Tyr
Pro Gln Ala Arg Ala Phe Val Ala Ser Gly 20 25
30Ile Val Ala Thr Thr Gly Met Lys Gly Thr Arg Asp Asn
Ile Ala Gly 35 40 45Thr Leu Ala
Ala Leu Glu Gln Ala Leu Ala Lys Thr Pro Trp Ser Met 50
55 60Ser Asp Val Ser Arg Ile Tyr Leu Asn Glu Ala Ala
Pro Val Ile Gly65 70 75
80Asp Val Ala Met Glu Thr Ile Thr Glu Thr Ile Ile Thr Glu Ser Thr
85 90 95Met Ile Gly His Asn Pro
Gln Thr Pro Gly Gly Val Gly Val Gly Val 100
105 110Gly Thr Thr Ile Ala Leu Gly Arg Leu Ala Thr Leu
Pro Ala Ala Gln 115 120 125Tyr Ala
Glu Gly Trp Ile Val Leu Ile Asp Asp Ala Val Asp Phe Leu 130
135 140Asp Ala Val Trp Trp Leu Asn Glu Ala Leu Asp
Arg Gly Ile Asn Val145 150 155
160Val Ala Ala Ile Leu Lys Lys Asp Asp Gly Val Leu Val Asn Asn Arg
165 170 175Leu Arg Lys Thr
Leu Pro Val Val Asp Glu Val Thr Leu Leu Glu Gln 180
185 190Val Pro Glu Gly Val Met Ala Ala Val Glu Val
Ala Ala Pro Gly Gln 195 200 205Val
Val Arg Ile Leu Ser Asn Pro Tyr Gly Ile Ala Thr Phe Phe Gly 210
215 220Leu Ser Pro Glu Glu Thr Gln Ala Ile Val
Pro Ile Ala Arg Ala Leu225 230 235
240Ile Gly Asn Arg Ser Ala Val Val Leu Lys Thr Pro Gln Gly Asp
Val 245 250 255Gln Ser Arg
Val Ile Pro Ala Gly Asn Leu Tyr Ile Ser Gly Glu Lys 260
265 270Arg Arg Gly Glu Ala Asp Val Ala Glu Gly
Ala Glu Ala Ile Met Gln 275 280
285Ala Met Ser Ala Cys Ala Pro Val Arg Asp Ile Arg Gly Glu Pro Gly 290
295 300Thr His Ala Gly Gly Met Leu Glu
Arg Val Arg Lys Val Met Ala Ser305 310
315 320Leu Thr Gly His Glu Met Ser Ala Ile Tyr Ile Gln
Asp Leu Leu Ala 325 330
335Val Asp Thr Phe Ile Pro Arg Lys Val Gln Gly Gly Met Ala Gly Glu
340 345 350Cys Ala Met Glu Asn Ala
Val Gly Met Ala Ala Met Val Lys Ala Asp 355 360
365Arg Leu Gln Met Gln Val Ile Ala Arg Glu Leu Ser Ala Arg
Leu Gln 370 375 380Thr Glu Val Val Val
Gly Gly Val Glu Ala Asn Met Ala Ile Ala Gly385 390
395 400Ala Leu Thr Thr Pro Gly Cys Ala Ala Pro
Leu Ala Ile Leu Asp Leu 405 410
415Gly Ala Gly Ser Thr Asp Ala Ala Ile Val Asn Ala Glu Gly Gln Ile
420 425 430Thr Ala Val His Leu
Ala Gly Ala Gly Asn Met Val Ser Leu Leu Ile 435
440 445Lys Thr Glu Leu Gly Leu Glu Asp Leu Ser Leu Ala
Glu Ala Ile Lys 450 455 460Lys Tyr Pro
Leu Ala Lys Val Glu Ser Leu Phe Ser Ile Arg His Glu465
470 475 480Asn Gly Ala Val Glu Phe Phe
Arg Glu Ala Leu Ser Pro Ala Val Phe 485
490 495Ala Lys Val Val Tyr Ile Lys Glu Gly Glu Leu Val
Pro Ile Asp Asn 500 505 510Ala
Ser Pro Leu Glu Lys Ile Arg Leu Val Arg Arg Gln Ala Lys Glu 515
520 525Lys Val Phe Val Thr Asn Cys Leu Arg
Ala Leu Arg Gln Val Ser Pro 530 535
540Gly Gly Ser Ile Arg Asp Ile Ala Phe Val Val Leu Val Gly Gly Ser545
550 555 560Ser Leu Asp Phe
Glu Ile Pro Gln Leu Ile Thr Glu Ala Leu Ser His 565
570 575Tyr Gly Val Val Ala Gly Gln Gly Asn Ile
Arg Gly Thr Glu Gly Pro 580 585
590Arg Asn Ala Val Ala Thr Gly Leu Leu Leu Ala Gly Gln Ala Asn
595 600 605153354DNAKlebsiella pneumoniae
153atgtcgcttt caccgccagg cgtacgcctg ttttacgatc cgcgcgggca ccatgccggc
60gccatcaatg agctgtgctg ggggctggag gagcaggggg tcccctgcca gaccataacc
120tatgacggag gcggtgacgc cgctgcgctg ggcgccctgg cggccagaag ctcgcccctg
180cgggtgggta tcgggctcag cgcgtccggc gagatagccc tcactcatgc ccagctgccg
240gcggacgcgc cgctggctac cggacacgtc accgatagcg acgatcaact gcgtacgctc
300ggcgccaacg ccgggcagct ggttaaagtc ctgccgttaa gtgagagaaa ctga
354154117PRTKlebsiella pneumoniae 154Met Ser Leu Ser Pro Pro Gly Val Arg
Leu Phe Tyr Asp Pro Arg Gly1 5 10
15His His Ala Gly Ala Ile Asn Glu Leu Cys Trp Gly Leu Glu Glu
Gln 20 25 30Gly Val Pro Cys
Gln Thr Ile Thr Tyr Asp Gly Gly Gly Asp Ala Ala 35
40 45Ala Leu Gly Ala Leu Ala Ala Arg Ser Ser Pro Leu
Arg Val Gly Ile 50 55 60Gly Leu Ser
Ala Ser Gly Glu Ile Ala Leu Thr His Ala Gln Leu Pro65 70
75 80Ala Asp Ala Pro Leu Ala Thr Gly
His Val Thr Asp Ser Asp Asp Gln 85 90
95Leu Arg Thr Leu Gly Ala Asn Ala Gly Gln Leu Val Lys Val
Leu Pro 100 105 110Leu Ser Glu
Arg Asn 1151551125DNAartificial sequenceCodon optimized amino
alcohol kinase from Erwinia caratovora subsp. atroseptica
155atgagcgatg gccgtctgac cgcactgttt cctgcatttc cacatccggc atccaaccag
60ccagtgtttg cggaggcttc cccgcacgac gatgaactga tgacgcaggc ggtgccgcag
120gtttcctgcc agcaagccct ggcaattgcc cagcaggaat atggcctgag cggtcagatg
180agcctgctgc agggcgaacg tgacgttaat ttctgtctga ccgtaacgcc agatgaacgc
240tatatgctga aagtcatcaa cgctgctgaa ccggcagatg tgagcaactt tcagactgcg
300ctgctgctgc acctggcacg tcaggcgcca gaactgccag tccctcgtat ccgctccacg
360aaggctggtc agtctgaaac gggcgtcgaa attgatggtg ttctgctgcg tgtgcgtctg
420gtttcctacc tggctggcat gccgcagtac ctggcgtctc cgagcacggc actgatgcca
480cagctgggcg gtactctggc gcagctggac aacgctctgc actctttcac ccatccggcg
540gctaaccgtg ctctgctgtg ggacatctcc cgcgcagagc aggtccgccc gtacctggac
600ttcgttagcg agccgcagca gtatcagcac ctgcagcgca tctttgatcg ctatgactct
660aacgtggcac cgctgctgac gacgctgcgc cgccaggtta tccacaacga cctgaacccg
720cataacgtcc tggtcgatgg ttccagcccg acgcgcgtca cgggtatcat cgacttcggc
780gatgcagtgt tcgcgccgct gatctgtgag gttgcgaccg ctctggcgta ccaaattggc
840gacggcacgg atctgctgga acatgtggta ccgtttgtcg cagcgtatca ccagcgtatt
900ccgctggcgc cggaggaaat cgccctgctg ccagatctga tcgcgacccg catggcactg
960actctgacca tcgctcagtg gcgtgcgtct cgctacccag ataaccgcga atacctgctg
1020cgcaacgtgc cgcgctgctg gcactccctg cagcgtatcg caacttacag ccacgcacaa
1080tttctgacgc gcctgcagca ggtttgccca gaaaacgctc gttga
11251561275DNAartificial sequenceCodon optimized amino alcohol
O-phosphate lyase from Erwinia caratovora subsp. atroseptica
156atgactgcaa ctgaagctct gctggcacgt cgtcagcgcg ttctgggcgg tggctaccgt
60ctgttctacg aagaaccgct gcatgttgca cgcggcgaag gtgtatggct gttcgatcat
120cagggtaaac gttacctgga cgtatataac aacgtagcta gcgtaggtca ctgtcacccg
180gccgttgtag aagcggtcgc gcgtcaatct gcgcaactga acacccatac gcgctacctg
240catcacgcga tcgtagattt tgctgaagat ctgctgtctg agttcccggc agaactgaac
300aacgtcatgc tgacctgtac tggctccgaa gcgaacgacc tggccctgcg cattgcgcgt
360cacgttacgg gtggtaccgg catgctggtg acccgttggg cctaccatgg tgttacgtcc
420gctctggcgg agctgtcccc gtccctgggc gacggcgtag tacgcggttc ccacgtaaag
480ctgatcgatg ctccggatac ctaccgtcag ccgggtgctt tcctgacctc tatccgcgaa
540gcgctggcac agatgcagcg tgaaggtatt cgtccggcgg ctctgctggt tgatactatc
600ttctcctccg acggtgtatt ctgtgcgccg gaaggtgaga tggcccaggc agccgcactg
660atccgtcagg ccggtggcct gttcattgcg gacgaagtgc agccgggctt tggtcgtacc
720ggtgaatccc tgtggggttt cgcacgtcat aacgtggttc cagatctggt ttctctgggc
780aaaccgatgg gtaacggcca tccgattgct ggtctggtag gtcgctccgc actgttcgac
840gcttttggtc gtgatgttcg ctactttaat actttcggcg gtaacccagt atcctgccag
900gcggcacatg ctgttctgcg cgttatccgt gaagaacagc tgcagcagaa cgcgcagcgt
960gttggtgatt atctgcgcca aggtctgcag cagctggcac aacacttccc gctgatcggt
1020gacattcgtg catatggtct gtttatcggt gctgaactgg tttccgaccg tgaatccaaa
1080accccagcga gcgagtctgc actgcaggtt gttaacgcga tgcgtcagcg tggtgtactg
1140atctccgcaa ccggcccggc ggcgaacatt ctgaagatcc gtcctccgct ggtattcctg
1200gaggaacacg cggacgtgtt cctgactacc ctgtccgacg tgctggcgct gatcggtact
1260cgtgcacagc gttaa
127515777DNAartificial sequencePrimer 157caggaggaat taaccatggg gggttctcat
catcatcatc atcatggtga cgatgacgat 60aagatgagcg atggccg
7715877DNAartificial sequencePrimer
158cggccatcgc tcatcttatc gtcatcgtca ccatgatgat gatgatgatg agaacccccc
60atggttaatt cctcctg
7715920DNAartificial sequencePrimer 159ggacctgctt cgctttatcg
2016015DNAartificial sequencePrimer
160gctagagatg atagc
1516118DNAartificial sequencePrimer 161ggaagagact atccagcg
1816250DNAartificial sequencePrimer
162gcgcgcccgg gaagaaggag ctcttcacca tgaacaaacc acagtcttgg
5016328DNAartificial sequencePrimer 163gcgcgcccgg gttcatgcca cctctgcg
281642432DNAErwinia caratovora subsp.
atroseptica 164atgtctgacg gacgactcac cgcacttttt cctgcattcc cacacccggc
gtccaatcag 60cccgtatttg ccgaggcttc accgcacgac gacgagttaa tgacgcaggc
cgtaccgcag 120gtttcctgtc agcaggcgtt ggcgattgcg cagcaagaat atggcttgtc
tgggcagatg 180tcgctgcttc agggcgagcg tgatgtgaat ttctgtctga cggtgacgcc
agatgaacgc 240tacatgctga aagtcatcaa tgcggcagaa cctgccgacg tcagcaattt
ccaaaccgcg 300ctgctgctgc atcttgcccg tcaggcacct gaactgcccg taccgcgtat
caggtcgaca 360aaagcgggtc agtcggaaac aggcgttgag atcgatggtg tactgctgcg
tgtgcggctt 420gtgagctatc tggcaggaat gccgcagtat ctggcctcac cgtcaacggc
gctgatgccg 480cagttggggg gaacgctggc gcagttggat aacgcgcttc acagctttac
gcatccggcg 540gcaaaccgtg cgctgctgtg ggatatcagc cgggcagagc aggtgcgtcc
ttacctcgat 600ttcgtttctg aaccgcagca gtatcagcat cttcagcgta tttttgaccg
ttatgacagt 660aacgttgctc ctctgttgac gacgctacgt cgtcaggtca ttcataacga
tctgaatccg 720cataacgtgc tggtggatgg atcgtcgccg acgcgggtta ctggcattat
cgattttggc 780gatgccgtat ttgccccgtt aatttgcgaa gtcgcgacgg cactggcgta
tcagatcggc 840gatggaaccg atttgttgga gcatgttgtg ccgtttgttg cggcctatca
ccaacgcatt 900ccgttagcac cggaggagat tgcgctgtta cccgatctga tagcgacccg
tatggcgctg 960accctgacca ttgcgcagtg gcgagcatcg cgttatcccg acaatcggga
gtatctgctg 1020cgtaacgtgc cgcgctgttg gcacagtttg cagcgcattg cgacctattc
ccatgcgcaa 1080tttttgactc gcctacagca ggtttgcccg gagaatgcgc gatgaaccag
aaaggaatga 1140cgtctatgac gtctgaaatg acagcgacag aagctttgct ggcgcgccgt
cagcgagtgt 1200tgggcggcgg ttatcgcctg ttttatgaag agccgctgca tgtcgcgcgc
ggcgagggcg 1260tgtggctgtt cgatcaccaa gggaaacgtt atctggatgt ctacaataat
gtggcttcgg 1320tcggacattg ccaccccgcg gtggttgaag ccgtggcgcg acagagcgca
caactcaata 1380cccacacgcg ctatttgcac cacgcgattg tcgattttgc ggaagatttg
ctgagcgaat 1440ttcccgccga attgaacaat gtaatgctga cctgtaccgg cagtgaggct
aacgatctgg 1500cgctgcgtat cgcccgacat gtcacgggcg ggacggggat gttggtgacg
cgctgggcgt 1560atcacggcgt gaccagcgcg ctggcggaac tgtctccgtc gctgggggat
ggcgttgtgc 1620gcggtagcca tgtgaagctg atcgacgcgc cagacactta tcgtcagccc
ggtgcatttc 1680ttaccagcat tcgtgaagcg ctggcgcaga tgcaacggga aggtattcgt
cctgcggcgc 1740tgctggtaga taccattttt tccagcgatg gcgtgttctg tgcgccggaa
ggcgaaatgg 1800cacaggcggc ggcgttgatc cgtcaggcgg gcgggctgtt tattgcggat
gaagtgcagc 1860cgggcttcgg gcgcaccggg gaatcactgt ggggctttgc gcgccacaat
gtcgtccctg 1920atttggtgag tctagggaaa ccgatgggca acggacatcc catcgctgga
ttggtggggc 1980gttccgctct gttcgacgca tttgggcgcg atgtgcgcta tttcaatacc
tttggcggca 2040atccggtttc ctgtcaggcg gcgcacgcgg tgctgcgggt gattcgggaa
gagcagttgc 2100agcagaatgc ccagcgggtc ggtgattatc tgcggcaagg gttgcagcaa
ctggcgcagc 2160atttcccgct gattggtgat attcgggctt acggcctgtt tattggtgcg
gagctggtca 2220gcgatcgcga aagtaaaacg ccggcaagtg aatccgcgtt gcaggtggtg
aatgcgatgc 2280gccaacgtgg tgtgctcatc agcgcgacgg ggccagcggc gaacatactg
aaaattcgcc 2340cgccgctggt gtttctggaa gaacacgccg atgtgttctt aaccacgctg
agtgacgttt 2400tagcgctcat cggcactcgt gcacagagat aa
2432
User Contributions:
Comment about this patent or add new information about this topic: