Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Humanized GM-CSF antibodies

Inventors:  Christoph Renner (Homburg, DE)  Antony Burgess (Parkville/melbourne, AU)  Andrew Scott (Parkville/melbourne, AU)
IPC8 Class: AC07K1624FI
USPC Class: 5303873
Class name: Globulins immunoglobulin, antibody, or fragment thereof, other than immunoglobulin antibody, or fragment thereof that is conjugated or adsorbed chimeric, mutated, or recombined hybrid (e.g., bifunctional, bispecific, rodent-human chimeric, single chain, rfv, immunoglobulin fusion protein, etc.)
Publication date: 2012-02-02
Patent application number: 20120029172



Abstract:

Chimeric antibodies, as well as fusion proteins which comprise chimeric antibodies, are disclosed. The antibodies bind to GM-CSF, CD-30, and G250 antigen. The fusion proteins include biologically active portions of tumor necrosis factor, or full length tumor necrosis factor. Expression vectors adapted for production of the antibodies, as well as methods for manufacturing these, are also disclosed.

Claims:

1-16. (canceled)

17. An isolated, humanized antibody which specifically binds to granulocyte, macrophage, colony stimulating factor (GM-CSF, wherein a complementary determining region (CDR) of said humanized antibody is of non-human origin.

18. The isolated humanized antibody of claim 17, wherein said isolated humanized antibody comprises a light chain, complementary determining region (CDR) of murine origin.

19. The isolated humanized antibody of claim 17, wherein said isolated humanized antibody comprises a heavy chain, complementary determining region (CDR) of murine origin.

20. The isolated humanized antibody of claim 17, wherein said isolated humanized antibody comprise both a light chain, complementary determining region (CDR) of murine origin, and a heavy chain, complementary determining region (CDR) of murine origin.

21. The isolated humanized antibody of claim 17, wherein both of said CDRs have an amino acid sequence identical to the CDR sequences of murine 19/2 antibody.

Description:

RELATED APPLICATION

[0001] This application claims priority of application Ser. No. 60/355,838, filed Feb. 13, 2002, and incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0002] This invention relates to the field of molecular immunology, generally, and to vectors useful for expression of proteins, especially antibodies, such as fully human, humanized, and chimeric antibodies, as well as fusion proteins which incorporate the antibody and a protein or protein fragment, in eukaryotic cells, mammalian cells in particular. The resulting antibodies and fusion proteins are also a feature of the invention.

BACKGROUND AND PRIOR ART

[0003] One serious problem with using murine antibodies for therapeutic applications in humans is that they quickly raise a human anti-mouse response (HAMA) which reduces the efficacy of the antibody in patients, and prevents continued administration thereof. Parallel issues arise with the administration of antibodies from other, non-human species. One approach to overcoming this problem is to generate so-called "chimeric" antibodies. These can comprise murine variable regions, and human constant regions (Boulianne et al. (1984) Nature 312(5995): 643-646; incorporated by reference herein in its entirety). Although chimeric antibodies contain murine sequences and can elicit an anti-mouse response in humans (LoBuglio et al. (1989) Proc. Natl. Acad. Sci. USA 86(11): 4220-4224; incorporated by reference herein in its entirety), trials with chimeric antibodies in the area of hematological disease (e.g., Non-Hodgkin-Lymphoma; Witzig et al. (1999) J. Clin. Oncol. 17(12): 3793-3803; incorporated by reference herein in its entirety) or autoimmune disease (e.g., rheumatoid arthritis, chronic inflammatory bowel disease; Van den Bosch; et al, Lancet 356(9244):1821-2 (2000), incorporated by reference herein in its entirety) have led to FDA approval and demonstrate that these molecules have significant clinical potential and efficacy.

[0004] Recent studies have indicated that granulocyte-macrophage colony stimulating growth factor (GM-CSF) plays a role in the development of rheumatoid arthritis (RA) (Cook, et al., Arthritis Res. 2001, 3:293-298, incorporated by reference herein in its entirety) and possibly other inflammatory diseases and conditions. Therefore, it would be of interest to develop a drug which would block GM-CSF and its effect on cells. The present invention provides a chimeric antibody, targeting the GM-CSF molecule, which has blocking capacity.

[0005] The increased use of chimeric antibodies in therapeutic applications has created the need for expression vectors that effectively and efficiently produce high yields of functional chimeric antibodies in eukaryotic cells, such as mammalian cells, which are preferred for production. The present invention provides novel expression vectors, transformed host cells and methods for producing chimeric antibodies in mammalian cells, as well as the antibodies themselves and fusion proteins containing them.

BRIEF DESCRIPTION OF THE FIGURES

[0006] FIG. 1 shows the binding of recombinant, chimeric anti GM-CSF antibody via Western Blotting.

[0007] FIG. 2 shows the binding of the antibody via ELISA.

[0008] FIG. 3 shows the blocking effect of the antibody on GM-CSF growth dependent TF-1 cells.

[0009] FIG. 4 shows the blocking effect of the antibody on GM-CSF growth dependent AML-193 cells.

[0010] FIG. 5 shows results of an assay testing the effect of increasing concentration of murine or chimeric 19/2 mAbs, on TF-1 cells grown in the presence of a constant amount of human GM-CSF.

[0011] FIG. 6 parallels the experiment of FIG. 5, but uses the AML-153 cells.

[0012] FIG. 7 shows a schematic map of the two expression vectors used to prepare the recombinant antibodies.

SUMMARY OF INVENTION

[0013] The present invention provides expression vectors which are useful in the expression of proteins, such as antibodies, especially fully human, humanized or chimerized antibodies, and fusion proteins containing these. Both light chains and heavy chains can be expressed. The expression vectors of the present invention comprise a human elongation factor 1α (EF1α) promoter/enhancer sequence, an internal ribosome entry site (IRES) sequence (U.S. Pat. No. 4,937,190; incorporated herein in its entirety), a nucleotide sequence that confers neomycin resistance to a cell containing the expression vector, and a nucleotide sequence under control of a simian virus 40 promoter (SV40) that confers ampicillin resistance to a cell containing the expression vector. In a preferred embodiment, the EF1α promoter/enhancer sequence is upstream and adjacent to a nucleotide sequence encoding a chimeric light chain.

[0014] The expression vector of the present invention may contain a nucleotide sequence encoding any immunoglobulin light chain. In a preferred embodiment the light chain variable region is of murine origin, and the light chain constant region is either human kappa or human lambda. In a more preferred embodiment, the chimeric light chain variable region is derived from a murine antibody that binds to GM-CSF, CD-30, or G250 and in especially preferred embodiments, to the human forms of these molecules.

[0015] The present invention also provides a further expression vector useful in the expression of proteins, such as antibodies, especially fully human, humanized or chimeric antibodies, and fusion proteins containing these. This second embodiment differs from, the first in that instead of the neomycin resistance sequence, described supra, it comprises a nucleotide sequence which encodes dihydrofolate reductase or "dhfr," which generates resistance against the well known selection marker methotrexate. Such an expression vector may contain nucleotide sequences encoding any antibody or portion thereof, such as heavy or light chains of fully human, humanized or chimerized antibodies. In a preferred embodiment, a heavy chain is expressed, where the variable region is of murine origin, and the heavy chain constant region is human IgG1. In a more preferred embodiment, the chimeric heavy chain variable region is derived from a murine antibody that binds CD-30, GM-CSF or G250, preferably the human forms of these.

[0016] In another embodiment, the present invention provides host cells transformed or transfected with any one of the expression vectors of the present invention. In a preferred embodiment, a host cell, preferably a eukaryotic cell, more preferably a mammalian cell, is transformed or transfected with an expression vector comprising a chimeric immunoglobulin light chain and an expression vector comprising a chimeric immunoglobulin heavy chain. The present invention contemplates prokaryotic and eukaryotic cells, such as mammalian cells, insect cells, bacterial or fungal cells. In a preferred embodiment, the host cell is a human or Chinese Hamster Ovary ("CHO") cell.

[0017] The present invention also provides methods for the recombinant production of a chimeric immunoglobulin light or heavy chain comprising the step of culturing a transformed or transfected host cell of the present invention. In one embodiment, the methods of the present invention further comprise the isolation of the chimeric immunoglobulin light or heavy chain.

[0018] The present invention also provides methods for the recombinant production of a fully human, humanized or chimeric immunoglobulin comprising culturing a host cell that has been transformed or transfected with an expression vector comprising a chimeric immunoglobulin light chain and an expression vector comprising a chimeric immunoglobulin heavy chain, or an expression vector encodes both chains. In one embodiment, the methods of the present invention further comprise the self-assembly of the chimeric heavy and light chain immunoglobulins and isolation of the chimeric immunoglobulin. Methods for accomplishing this are well known in the art.

[0019] The present invention also provides the chimeric immunoglobulin light chain, heavy chain or assembled chimeric immunoglobulin produced by the methods of the present invention. In another embodiment, the present invention provides compositions comprising the chimeric immunoglobulin light chain, heavy chain or assembled chimeric immunoglobulin of the present invention and a pharmaceutically acceptable carrier.

DETAILED DESCRIPTION OF INVENTION

1. Definitions

[0020] As used herein "chimerized" refers to an immunoglobulin such as an antibody, wherein the heavy and light chains of the variable regions are not of human origin and wherein the constant regions of the heavy and light chains are of human origin.

[0021] "Humanized" refers to an immunoglobulin such as an antibody, wherein the amino acids directly involved in antigen binding, the so-called complementary determining regions (CDR), of the heavy and light chains are not of human origin, while the rest of the immunoglobulin molecule, the so-called framework regions of the variable heavy and light chains, and the constant regions of the heavy and light chains are of human origin.

[0022] "Fully human" refers to an immunoglobulin, such as an antibody, where the whole molecule is of human origin or consists of an amino acid sequence identical to a human form of the antibody.

[0023] "Immunoglobulin" or "antibody" refers to any member of a group of glycoproteins occurring in higher mammals that are major components of the immune system. As used herein, "immunoglobulins" and "antibodies" comprise four polypeptide chains--two identical light chains and two identical heavy chains that are linked together by disulfide bonds. An immunoglobulin molecule includes antigen binding domains, which each include the light chains and the end-terminal portion of the heavy chain, and the Fc region, which is necessary for a variety of functions, such as complement fixation. There are five classes of immunoglobulins wherein the primary structure of the heavy chain, in the Fc region, determines the immunoglobulin class. Specifically, the alpha, delta, epsilon, gamma, and mu chains correspond to IgA, IgD, IgE, IgG and IgM, respectively. As used herein "immunoglobulin" or "antibody" includes all subclasses of alpha, delta, epsilon, gamma, and mu and also refers to any natural (e.g., IgA and IgM) or synthetic multimers of the four-chain immunoglobulin structure.

[0024] "Antigen-binding fragment", "antigen-binding domain" and "Fab fragment" all refer to the about 45 kDa fragment obtained by papain digestion of an immunoglobulin molecule and consists of one intact light chain linked by a disulfide bond to the N-terminal portion of the contiguous heavy chain. As used herein, "F(ab)2 fragment" refers to the about 90 kDa protein produced by pepsin hydrolysis of an immunoglobulin molecule. It consists of the N-terminal pepsin cleavage product and contains both antigen binding fragments of a divalent immunoglobulin, such as IgD, IgE, and IgG. Neither the "antigen-binding fragment" nor "F(ab)2 fragment" contain the about 50 kDa Fc fragment produced by papain digestion of an immunoglobulin molecule that contains the C-terminal halves of the immunoglobulin heavy chains, which are linked by two disulfide bonds, and contain sites necessary for compliment fixation.

[0025] "Epitope" refers to an immunological determinant of an antigen that serves as an antibody-binding site. Epitopes can be structural or conformational.

[0026] "Hybridoma" refers to the product of a cell-fusion between a cultured neoplastic lymphocyte and a normal, primed B- or T-lymphocyte, which expresses the specific immune potential of the parent cell.

[0027] "Heavy chain" refers to the longer & heavier of the two types of polypeptide chain in immunoglobulin molecules that contain the antigenic determinants that differentiate the various Ig classes, e.g., IgA, IgD, IgE, IgG, IgM, and the domains necessary for complement fixation, placental transfer, mucosal secretion, and interaction with Fc receptors.

[0028] "Light chain" refers to the shorter & lighter of the two types of polypeptide chain in an Ig molecule of any class. Light chains, like heavy chains, comprise variable and constant regions.

[0029] "Heavy chain variable region" refers to the amino-terminal domain of the heavy chain that is involved in antigen binding and combines with the light chain variable region to form the antigen-binding domain of the immunoglobulin.

[0030] "Heavy chain constant region" refers to one of the three heavy chain domains that are carboxy-terminal portions of the heavy chain.

[0031] "Light chain variable region" refers to the amino-terminal domain of the light chain and is involved in antigen binding and combines with the heavy chain to form the antigen-binding region.

[0032] "Light chain constant region" refers to the one constant domain of each light chain. The light chain constant region consists of either kappa or lambda chains.

[0033] "Murine anti-human-GM-CSF 19/2 antibody" refers to a murine monoclonal antibody that is specific for human GM-CSF. This antibody is well known and it has been studied in detail. See Dempsey, et al, Hybridoma 9:545-58 (1990); Nice, et al, Growth Factors 3:159-169 (1990), both incorporated by reference.

[0034] "Effective amount" refers to an amount necessary to produce a desired effect.

[0035] "Antibody" refers to any glycoprotein of the immunoglobulin family that non-covalently, specifically, and reversibly binds a corresponding antigen.

[0036] "Monoclonal antibody" refers to an immunoglobulin produced by a single clone of antibody-producing cells. Unlike polyclonal antiserum, monoclonal antibodies are monospecific (e.g., specific for a single epitope of a single antigen).

[0037] "Granulocytes" include neutrophils, eosinophils, and basophils.

[0038] "GM-CSF" refers to a family of glycoprotein growth factors that control the production, differentiation, and function of granulocytes and monocytes-macrophages. Exemplary, but by no means the only form of such molecules, can be seen in U.S. Pat. No. 5,602,007, incorporated by reference.

[0039] "Inflammatory condition" refers to immune reactions that are either specific or non-specific. For example, a specific reaction is an immune reaction to an antigen. Examples of specific reactions include antibody responses to antigens, such as viruses and allergens, including delayed-type hypersensitivity, including psoriasis, asthma, delayed type hypersensitivity, inflammatory bowel disease, multiple sclerosis, viral pneumonia, bacterial pneumonia, and the like. A non-specific reaction is an inflammatory response that is mediated by leukocytes such as macrophages, eosinophils and neutrophils. Examples of non-specific reactions include the immediate swelling after a bee sting, and the collection of polymorphonuclear (PMN) leukocytes at sites of bacterial infection. Other "inflammatory conditions" within the scope of this invention include, e.g., autoimmune disorders such as psoriasis, rheumatoid arthritis, lupus, post-ischemic leukocyte mediated tissue damage (reperfusion injury), frost-bite injury or shock, acute leukocyte-mediated lung injury (acute respiratory distress syndrome or ARDS), asthma, traumatic shock, septic shock, nephritis, acute and chronic inflammation, and platelet-mediated pathologies such as ateriosclerosis and inappropriate blood clotting.

[0040] "Pharmaceutically acceptable carrier" refers to any carrier, solvent, diluent, vehicle, excipient, adjuvant, additive, preservative, and the like, including any combination thereof, that is routinely used in the art.

[0041] Physiological saline solution, for example, is a preferred carrier, but other pharmaceutically acceptable carriers are also contemplated by the present invention. The primary solvent in such a carrier may be either aqueous or non-aqueous. The carrier may contain other pharmaceutically acceptable excipients for modifying or maintaining pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, and/or odor. Similarly, the carrier may contain still other pharmaceutically acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption or penetration across the blood-brain barrier.

[0042] The fully human, humanized or chimerized antibodies of the present invention may be administered orally, topically, parenterally, rectally or by inhalation spray in dosage unit formulations that contain conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles. As used herein, "parenterally" refers to subcutaneous, intravenous, intramuscular, intrasternal, intrathecal, and intracerebral injection, including infusion techniques.

[0043] The fully human, humanized or chimerized antibodies may be administered parenterally in a sterile medium. The antibodies, depending on the vehicle and concentration used, may be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle. The most preferred routes of administration of the pharmaceutical compositions of the invention are subcutaneous, intramuscular, intrathecal or intracerebral administration. Other embodiments of the present invention encompass administration of the composition in combination with one or more agents that are usually and customarily used to formulate dosages for parenteral administration in either unit dose or multi-dose form, or for direct infusion.

[0044] Active ingredient may be combined with the carrier materials in amounts necessary to produce single dosage forms. The amount of the active ingredient will vary, depending upon the type of antibody used, the host treated, the particular mode of administration, and the condition from which the subject suffers. Preferably, the amount of fully human, humanized or chimerized anti-GM-CSF immunoglobulin, for example, is a therapeutically effective amount which is sufficient to decrease an inflammatory response or ameliorate the symptoms of an inflammatory condition. It will be understood by those skilled in the art, however, that specific dosage levels for specific patients will depend upon a variety of factors, including the activity of the specific immunoglobulins utilized, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy. Administration of the fully human, humanized or chimerized immunoglobulins of the present invention may require either one or multiple dosings.

[0045] Regardless of the manner of administration, however, the specific dose is calculated according to approximate body weight or body surface area of the patient. Further refinement of the dosing calculations necessary to optimize dosing for each of the contemplated formulations is routinely conducted by those of ordinary skill in the art without undue experimentation, especially in view of the dosage information and assays disclosed herein.

[0046] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.

EXAMPLES

Example 1

Cloning Strategy for 19/2 Heavy (H) and Light (L) Variable (V)-Region Genes

[0047] Total RNA from the hybridoma producing murine 19/2 antibody was obtained by standard RNA isolation techniques (Chomczynski et al. (1987) Anal. Biochem. 162: 156-159; incorporated by reference herein in its entirety). First strand cDNA was prepared using a commercially available, first strand cDNA synthesis kit and priming with d(T)18 for both the heavy and light chains (Renner et al. (1998) Biotechniques 24(5): 720-722; incorporated by reference herein in its entirety). The resulting cDNA was subjected to PCR using combinations of primers for the heavy and light chains. The nucleotide sequences of the 5' primers for the heavy and light chains are shown in Tables 1 and 2 respectively. The 3' primers are shown in Table 3. The light chain primer hybridized within the mouse kappa constant region not far from the V-C junction. The heavy chain 3' primer hybridised within the CH-1 constant region of mouse heavy chain subgroup 1 not far from the V-CH1 junction.

TABLE-US-00001 TABLE 1 Oligonucleotide primers for the 5' region of Mouse Heavy Variable (MHV) domains. SEQ ID NO: 1 MHV-1: 5'ATGAAATGCAGCTGGGTCATSTTCTTC 3' 1 MHV-2: 5'ATGGGATGGAGCTRATCATSYTCTT 3' 2 MHV-3: 5'ATGAAGWTGTGGTTAAACTGGGTTTTT 3' 3 MHV-4: 5'ATGRACTTTGWYTCAGCTTGRTTT 3' 4 MHV-5: 5'ATGGACTCCAGGCTCAAMAGTTTTCCTT 3' 5 MHV-6: 5'ATGGCTGTCYTRGSGCTRCTCTTCTGC 3' 6 MHV-7: 5'ATGGRATGGAGCKGGRTCTTTMTCTT 3' 7 MHV-8: 5'ATGAGAGTGCTGATTCTTTTGTG 3' 8 MHV-9: 5'ATGGMTTGGGTGTGGAMCTTGCTATTCCTG 3' 9 MHV-10: 5'ATGGGCAGACTTACATTCTCATTCCTG 3' 10 MHV-11: 5'ATGGATTTTGGGCTGATTTTTTTTATTG 3' 11 MHV-12: 5'ATGATGGTGTTAAGTCTTCTGTACCTG 3' 12 NB KEY R = A/G, Y = T/C, W = A/T, K = T/G, M = A/C, S = C/G.

TABLE-US-00002 TABLE 2 Oligonucleotides primers for the 5' region of Mouse Kappa Variable (MKV) domains. SEQ ID NO: 1 MKV-1: 5'ATGAAGTTGCCTGTTAGGCTGTTGGTGCTG 3' 13 MKV-2: 5'ATGGAGWCAGACACACTCCTGYTATGGGT 3' 14 MKV-3: 5'ATGAGTGTGCTCACTCAGGTCCTGGSGTTG 3' 15 MKV-4: 5'ATGAGGRCCCCTGCTCAGWTTYTTGGMWTCTTG 3' 16 MKV-5: 5'ATGGATTTWCAGGTGCAGATTWTCAGCTTC 3' 17 MKV-6: 5'ATGAGGTKCYYTGYTSAGYTYCTGRGG 3' 18 MKV-7: 5'ATGGGCWTCAAGATGGAGTCACAKWYYCWGG 3' 19 MKV-8: 5'ATGTGGGGAYCTKTTTYCMMTTTTTCAATTG 3' 20 MKV-9: 5'ATGGTRTCCWCASCTCAGTTCCTTG 3' 21 MKV-10: 5'ATGTATATATGTTTGTTGTCTATTTCT 3' 22 MKV-11: 5'ATGGAAGCCCCAGCTCAGCTTCTCTTCC 3' 23 MKV-12: 5'ATGAAGTTTCCTTCTCAACTTCTGCTC 3' 24 NB KEY R = A/G, Y = T/C, W = A/T, K = T/G, M = A/C, S = C/G.

TABLE-US-00003 TABLE 3 Oligonucleotide primers for the 3' ends of mouse VH and VL genes. Light chain (MKC): 5'TGGATGGTGGGAAGATG 3' 25 Heavy chain (MHC): 5'CCAGTGGATAGACAGATG 3' 26

Example 2

Ig Sequences Cloned from the 19/2 Murine Hybridoma

[0048] Using the cloning strategy described, supra, PCR products for VH and VL of murine 19/2 were cloned using a commercially available product, and art recognized techniques. For the murine 19/2 VL region, PCR products were obtained using the mouse kappa constant region primer and primers MKV2 and MKV7 (SEQ ID NOS: 14 & 19). For the mouse 19/2 VH region, PCR products were obtained using the mouse gamma 1 constant region primer and primers MHV2, MHV5 and MHV7 (SEQ ID NOS: 2, 5 and 7). Extensive DNA sequencing of the cloned V-region inserts revealed two different light chain sequences and 2 different heavy chain sequences. Pseudogenes for heavy and light chain were amplified and were eliminated by standard sequence analyses. A novel immunoglobulin-coding sequence was determined for both the heavy and light chains. This is set forth at SEQ ID NOS: 27, 28, 29 & 30, which present the cDNA and amino acid sequences for the murine 19/2 heavy chain variable region (27 & 28), and the light chain variable region (29 & 30).

Example 3

Mouse 19/2 Heavy Chain Leader Sequence

[0049] When comparing the DNA sequence of the leader sequence for 19/2 heavy chain obtained with the primers described supra, with the database, it appeared that the 19/2 HC leader sequence is short (17 amino acids) and unique vis a vis public data bases. Specifically, amino acids 2, 3 and 5 were E, L & M, as compared to S, W & F in the data bases. As compared to the database, hydrophilic amino acids in the N-terminal region were separated by neutral or basic ones, respectively; however, since the influence of these changes on the secretory capability of the leader sequence is unclear, this sequence was unaltered in further experiments.

Example 4

Construction of Mouse-Human Chimeric Genes

[0050] The chimeric 19/2 antibody was designed to have the mouse 19/2 VL and VH regions linked to human kappa and gamma-1 constant regions, respectively. PCR primers were used to modify the 5'- and 3'-sequences flanking the cDNA sequences coding for the mouse 19/2 VL and VH regions. PCR primers specific for 19/2 light chain V-region were designed using the sequence of the 19/2 light chain V-region gene obtained. These adapted mouse 19/2 variable regions were then subcloned into mammalian cell expression vectors already containing the human kappa (pREN-Neo vector) or the gamma-1 (pREN-DHFR vector) constant regions. The vectors employ parts of the human elongation factor 1α (EF1α) promoter/enhancer sequence to efficiently transcribe the light and heavy chains. The vectors also contain an IRES sequence following the multiple cloning site to allow for stringent, bicistronic expression and control of the individual selection marker in CHO cells. This pair of vectors was used in all of the recombinant work described herein, i.e., to manufacture all chimeric antibodies. The expression vectors were designed to have the variable regions inserted as PmeI-BamHI DNA fragments. PCR primers were designed to introduce these restrictions sites at the 5'-(PmeI) and 3'-(BamHI) ends of the cDNAs coding for the V-regions. In addition, the PCR primers were designed to introduce a standard Kozak sequence (Kozak (1987) Nucleic Acids Res. 15(20): 8125-8148, incorporated by reference herein in its entirety) at the 5'-ends of both the light and heavy chain cDNAs to allow efficient translation, and to introduce splice donor sites at the 3'-ends of both the light and heavy chain cDNAs for the variable regions to be spliced to the constant regions. The PCR primers used for the construction of the chimeric 19/2 light and heavy chains were as follows: catgtttaaacgccfccaccatgggcttcaagatggagtca (5' end, light chain variable region, SEQ ID NO: 31); agaggatccactcacgtttcagttccacttggtcccag (3' end, SEQ ID NO: 32); catgtttaaacgccgccaccatggagctgatcatgctcttcct (primer for the 5' end of the heavy chain variable region, SEQ ID NO: 33); and agaggatccactcacctgaggagactctgagagtggt (primer for the 3' end of the heavy chain variable region, SEQ ID NO: 34). The DNA and amino acid sequences of the mouse 19/2 VL and VH regions were adapted for use from the construction of chimeric 19/2 light and heavy chains. The entire DNA sequences of mouse 19/2 light and heavy chains cloned into the eukaryotic expression vectors pREN-Neo and pREN-DHFR, respectively, are set forth as SEQ ID NO: 35 & 36, with the resulting light and heavy chains resulting in chimerized molecules. Specifically, in SEQ ID NO: 35, nucleotides 1357-1756 encode the murine, light chain sequence, with nucleotides 1763-2206 encoding the human kappa region. Within this sequence (1763-2206), a 120 base pair region constituting an intron and splice acceptor site begins at nucleotide 1886. Within SEQ ID NO: 36, nucleotides 1357-1770 encode the murine 9/2 heavy chain constant sequence with a splice donor site. Nucleotides 1777-2833 encode the human IgG1 constant region. Within this sequence, there is a 60 base pair intron region and splice acceptor site which precedes the coding region.

Example 5

[0051] The objective of the experiments described herein was to create stable cell lines expressing chimeric 19/2 (c19/2) anti-human GM-CSF monoclonal antibodies (mAb) in CHO (Chinese hamster ovary) DG44 cells and to test the secreted antibody for its binding properties. To do this, the DHFR negative CHO cell line DG044 was used. See Morris et al. (1990) Gene 94(2): 289-294; incorporated by reference herein in its entirety). The CHO cells were cultured in RPMI, supplemented with 10% FCS and Hypoxanthine-Thymidine. DNA for transfection was purified from E. coli cells using a commercially available product, and the instructions provided therein. All DNA preparations were examined by restriction enzyme digestion. Sequences of chimeric 19/2 mAb variable regions in their respective vectors were confirmed using an ABI PRISM 310 or LICOR Sequencer.

[0052] Vectors encoding heavy and light chains of chimeric 19/2 mAbs were co-transfected simultaneously into CHO DG44 cells growing at log phase, using electroporation (270V, 975 uF). Cells were plated in 10 cm dishes and cultured with standard medium. Twenty-four hours later, medium was harvested and replaced by fresh RPMI medium supplemented with 10% dialyzed FCS and 500 ug/mL geneticin. After the initial phase of cell killing was over (7-10 days), GMP-grade methotrexate was added at a concentration of 5 nM and gradually increased to 100 nM over the following weeks. Out-growing colonies were picked and screened for antibody production.

Example 6

PCR Amplification of Variable Chain DNA

[0053] CHO DG44 cells were centrifuged in an Eppendorf microcentrifuge, briefly, at full speed, washed once with PBS, and pelleted once again. Genomic DNA was prepared by ethanol precipitation after SDS lysis and Proteinase K treatment of the cell pellets.

[0054] A mixture containing one of the primer pairs described supra, dNTPs, buffer, and Pfu polymerase was used to amplify either the heavy or light chain variable region using genomic DNA as a template using methods well known in the art. The resulting PCR products were digested with the appropriate restriction enzyme and analysed by agarose gel electrophoresis to confirm their identity.

[0055] The primer pairs for the light chain were:

TABLE-US-00004 ttcttgaagt ctggtgatgc tgcc, (SEQ ID NO: 37) and caagctagcc ctctaagactc ctcccctgtt. (SEQ ID NO: 38)

[0056] For the light chain and SEQ ID NO: 37 plus

TABLE-US-00005 (SEQ ID NO: 39) gaactcgagt catttacccg gagacaggga gag

for the heavy chain.

[0057] The undigested heavy chain PCR product had a predicted size of 1200 base pairs, while the light chain PCR product had a predicted size of 800 base pairs. Identity was verified by restriction enzyme digest with BamHI.

Example 7

Dot-Blot Method for Measuring Assembled IgG1/Kappa Antibody in CHO Cell Supernatants

[0058] CHO cell lines were transfected with the corresponding plasmids. Geneticin resistant cells were obtained and these cells were further selected for resistance to methotrexate. Single colonies were picked after amplification and transferred into 24-well plates. Culture supernatant was tested for chimeric IgG 3-4 days later by standard Dot Blot assays.

[0059] Any positive colonies were sub-cloned and cultured to achieve sufficient antibody production. The chimeric 19/2 antibody was purified from the supernatant on protein G columns and tested for its specific binding with recombinant GM-CSF by Western Blot (FIG. 1) and ELISA (FIG. 2).

[0060] Finally, the identity of producer cell lines were confirmed using PCR amplification of both their heavy and light chain variable regions. The DNA sequence of the heavy chain variable region PCR products for chimeric 19/2 mAb transfected cells was confirmed.

Example 8

[0061] In order to optimize cell growth and antibody production, the CHODG44/pREN c19/2 cell line was first cultured in commercially available IMDM containing 10% FCS, at 37° C., in a 10% CO2 atmosphere. The cells were then weaned into serum free medium, and cultured in a custom made medium, i.e., IMDM SFII, with the following additives, at 37° C., in a 10% CO2 atmosphere.

TABLE-US-00006 Final Concentration Base IMDM Medium Pluronic F68 1.0 mg/ml Hypep 4601 1.0 mg/ml Hypep 4605 DEV 0.5 mg/ml HEPES 5.958 mg/ml Na2HCO3 3.024 mg/ml Additives Dextran sulfate 50.0 μg/ml Putrescine 100.0 nM Albumax I 2.0 mg/ml Choline chloride 1.0 mg/ml Trace elements FeSO4•7H20 0.8 μg/ml ZnSO4•7H20 1.0 μg/ml CuSO4•5H20 0.0025 μg/ml C6H5FeO.sub.7•H20 5.0 μg/ml IGF-1 50.0 ng/ml Transferrin 35.0 μg/ml Ethanolamine 50.0 μM Mercaptoethanol 50.0 μM

[0062] Culture supernatants were harvested asceptically, and then clarified by centrifugation. The antibodies were then purified by affinity chromatography on a 5 ml protein. A sepharose fast flow column that had been pre-equilibriated in 50 mM Tris-HCL, pH8, was used. The column was washed, 20 times, with this buffer, and any bound antibody was eluted using 50 mM sodium citrate, pH 3.0, and the eluate was then neutralized, immediately, using 1M Tris-HCl, pH8. Antibodies were concentrated with a centrifugal filter, and dialyzed overnight at 4° C. in PBS. The yield was about 4-5 mg/liter. The purity of the antibodies was examined via SDS-PAGE, under both reducing and non-reducing conditions, using a 4-20% gradient on the SDS-PAGE.

[0063] Purified antibodies migrated as a single band under non-reducing conditions, and separated into the heavy and light chains, as expected, under reducing conditions.

[0064] The antibodies were also analyzed via size exclusion chromatography, (0.5 mg/ml), on a precalibrated HPLC column. Running buffer (5% n-propanol/PBS (0.5 M phosphate, 0/25 M NaCl, pH 7.4)) was used, at a flow rate of 0.2 ml/min at a temperature of 22° C., which is ambient column temperature.

[0065] The analysis demonstrated the integrity of the antibodies, which had calculated molecular weights of 179 kilodaltons.

Example 9

[0066] The experiments described in this example were designed to determine the binding activity of the antibodies.

[0067] Biosensor analyses were carried out using a commercially available, BIAcore 2000, and a carboxymethyldetran coated sensor chip. The chip was derivatized with 1000, 300, or 100 RVs of recombinant human GM-CSF, on channels 1, 2, and 3 of the machine using standard amine coupling chemistry with channel 4 retained as the control blank channel.

[0068] Samples of the chimeric antibody were diluted in HBS buffer (10 mM HEPES, pH7.4, 150 mM NaCl, 3.4 mM di-NA-EDTA, 0.005% Tween-20), and aliquots were injected over the sensor chip at a flow rate of 1 μl/min. After injection, dissociation was monitored by allowing HBS buffer to flow over the chip surface for 5 minutes. Any bound antibody was then eluted, and the chip surface was regenerated, between samples, via injecting 40 μl of 100 mM HCl, pH 2.7, at a rate of 5 μl/min. In order to carry out kinetic analyses of the binding of the chimeric antibody, varying concentrations, ranging from 1-10 nM, were injected over the chip surface, and both apparent association ("Ka") and dissociation ("Kd") rate constants were calculated, using a Langmuir 1:1 binding model, with global and local fitting for calculation of Rmax, using B1Aevaluation V3.1 software.

[0069] The results indicated that the chimeric antibody had slightly higher affinity for rhGM-CSF than the murine antibody. The calculated Ka for the chimeric antibody was 5.1×105 M-1s-1 using 100 RU of GM-CSF. No dissociation was observed, regardless of analyte concentration, precluding Kd determination and indicating very high affinity.

[0070] Global fitting of Rmax, using the software referred to, gave an off rate of Kd=1.9×10-5 s-1 and a high affinity for the chimeric antibody of 2.69×1010 M-1.

Example 10

[0071] These experiments were designed to determine both the binding activity of the antibodies, and if they cross-reacted with each other.

[0072] Nunc plates were coated with recombinant human GM-CSF (1 μg/ml), in carbonate buffer (pH 9.6, 0.05 M), 50 μl/well, and were incubated at 4° C., overnight, and were then blocked with 3% FCS/PBS at room temperature, for one hour.

[0073] Half-log, serially diluted triplicate 100 μl samples of either murine or chimeric antibody (10 μg/ml) were added to each well, to yield final concentrations of from 1.0 ng/ml to 10 μg/ml. Following incubation for 1 hour at room temperature, either goat antimouse IgG or antihuman IgG, labelled with horseradish peroxidase (10 ul/well Fc specific; 1:1000 dilution in 1% FCS/PBS) were used to detect bound antibody. After extensive washings, the bound antibodies were visualized by the addition of ABTS substrate (100 μl/well).

[0074] Optical density was read at 415 nm in a microplate reader.

[0075] The same protocol for binding antibody to the solid phase was used to determine if the antibodies competed with each other. As in the experiments, supra, half-log, serially diluted 100 μl samples, in triplicate, of 10 μg/ml of the murine or chimeric antibody were combined with 20 μg/ml of competing antibody, and then 100 ml of the mixture was added to the coated ELISA plates. Incubation was as above, and anti-murine or anti-human IgG labelled with horseradish peroxidase was used, also as described supra.

[0076] The results indicated that the antibodies did compete for binding for recombinant human GM-CSF. A shift in the binding curve was effected by addition of the excess, competing antibody. This indicated binding to, and competition for, a common epitope.

Example 11

[0077] These experiments were designed to test the neutralizing activity of the anti-GM-CSF antibodies. Two human GM-CSF dependent cell lines, i.e., TF-1 and AML-193 were used. Growth curves were established, in the presence or absence of 0.5 ng/ml of recombinant human GM-CSF, and viable cell numbers were determined, via Trypan Blue exclusion, on day 0, 1, 2, 3, 5 and 7.

[0078] In a first bioassay, recombinant human GM-CSF, in amounts ranging from 0.0003 ng/ml up to 10 μg/ml, was mixed with anti-human GM-CSF antibodies, at a final concentration of 30 μg/ml, in 96 well, microtitre plates. Either TF-1 or AML-193 cells were added (103 cells/well), and plates were incubated at 37° C. for 7 days.

[0079] After this incubation period, the DNA proliferation marker MTS was added, at 20 μl/well. Dye incorporation was measured after 2 hours, by measuring light absorbance at A490nm.

[0080] Increased MTS dye incorporation was observed as the amount of rhGM-CSF in the medium increased. Total growth inhibition of both cell types was observed with the chimeric antibody when rhGM-CSF concentration was 0.1 ng/ml or less, and there was marked inhibition of cell growth at 0.3-10 ng/ml rhGM-CSF.

[0081] In contrast, while the murine antibody had a similar effect on AML-193 cells, it was less effective on TF-1 cells. These results are seen in FIGS. 3 and 4.

[0082] In a second bioassay TF-1 and AML-193 cells were grown in the presence of 0.5 ng/mL rhGM-CSF and increasing amounts of murine or chimeric 19/2 mAbs (0.003-100 μg/mL) were added to the culture media and the neutralizing activity assessed after 7 days culture. Results are shown in FIGS. 5 and 6 for the TF-1 and AML-193 cells, respectively. In agreement with the initial bioassay, the chimeric 19/2 demonstrated marked neutralizing activity of GM-CSF stimulated cell growth. A direct correlation was observed between increasing ch19/2 concentration and GM-CSF neutralizing activity plateaued at 3 μg/mL for both cell lines, with higher concentrations unable to effect a greater reduction in TF-1 or AML-193 cell growth. These observations may be due to lower affinity of the murine mAb or steric hindrance at the binding site on GM-CSF.

Example 12

[0083] Additional experiments were carried out to produce a chimeric, HRS-3 antibody. The murine form of this antibody is described by Hombach, et al, Int. J. Cancer 55:830-836 (1993), incorporated by reference. The murine antibody binds to CD-30 molecules.

[0084] The protocols set forth for production of chimeric, anti GM-CSF antibody set forth supra were used. Since the antibodies were different, and sequences were known, however, different primers were used. These primers serve to introduce splice sites into the cDNA sequences encoding the murine heavy chain and light chain variable regions, and are set forth at SEQ ID NOS: 44, 45, 46 & 47, with SEQ ID NOS: 44 & 45 the nucleotide and amino acid sequences of the heavy chain, and 46 & 47 comparable sequences for the light chain

[0085] The primers were:

TABLE-US-00007 (SEQ ID NO: 40) gcgccatggc ccaggtgcaa ctgcagcagt ca and (SEQ ID NO: 41) cagggatcca ctcacctgag gagacggtga ccgt,

and for the light chain:

TABLE-US-00008 (SEQ ID NO: 42) agcgccatgg acatcgagct cactcagtct cca and (SEQ ID NO: 43) cagggatcca actcacgtttg atttccagct tggt.

[0086] Following amplification, the murine heavy and light chain variable regions were cloned into the pREN Neo and pREN-DHFR sequences, which are set forth at SEQ ID NOS: 48 & 49, respectively. The cloning was possible because the amplification introduced PmeI and BamHI restriction sites into SEQ ID NO: 44, at nucleotides 1-7, and the final 6 nucleotides. Comparable sites are found at nucleotides 1340-1348, and 1357-1362 of SEQ ID NO: 48. Similarly, PmeI and BamHI restriction sites were introduced at nucleotides 1-8, and the last 6 nucleotides of SEQ ID NO: 47, such that this nucleotide sequence could be cloned into SEQ ID NO: 49, at positions 1337-1344, and 1349-1354.

[0087] The chimeric HRS-3 antibody was designed to have murine HRS-3 VL and VH regions linked to human kappa and gamma-1 constant regions, respectively. PCR primers were used to modify the 5'- and 3'-sequences flanking the cDNA sequences coding for the murine HRS-3 VL and VH regions. Modification included the insertion of a NcoI site at the 5' primer end and a splice donor site followed by a BamHI restriction site at the 3'-end of both the light and heavy chain cDNAs for the variable regions to be spliced to the constant regions. These adapted mouse HRS-3 variable regions were then subcloned through the NcoI/BamHI restriction sites into a prokaryotic vector harboring a 5'PmeI site followed by a 5' Kozak sequence and by a human antibody leader sequence. Sequences were cut from the prokaryotic vector by PmeI/BamHI digest and subcloned into mammalian cell expression vectors already containing the human kappa (pREN-Neo vector) or gamma-1 (pREN-DHFR vector) constant regions, described supra.

Example 13

[0088] Once the constructs were established, they were transfected into DGO44 cells, as described supra.

[0089] Positive colonies were sub-cloned, cultured to achieve sufficient antibody production, after which the antibodies were purified, on protein G columns via the Fc fragment.

[0090] The purified antibodies were analyzed via SDS-PAGE, following Laemmli, Nature 227:680-5 (1970), as modified by Renner, et al, Eur. J. Immunol 25:2027-35 (1995), incorporated by reference. Samples from different stages of purification were diluted, in either reducing or non-reducing buffer, and were separated on 10-12% polyacrylamide gel via electrophoreses followed by standard Coomassic staining.

[0091] The results were in accordance with production of a complete, chimeric antibody, as evidenced by the banding patterns found in both reducing and non-reducing solutions.

Example 14

[0092] The binding capacity of the chimeric HRS-3 antibody was determined via flow cytometry, in accordance with Renner, et al, supra. In brief, 1×106 cells of a target tumor line which expressed CD-30 were washed, twice, in PBS, and then incubated with varying concentration of antibody, at 4° C., for 30 minutes. The cells were then washed, and incubated with a secondary antibody, which was directed to the light chain, conjugated to either FITC or PE.

[0093] The results indicated that there was weak binding from cell culture supernatant purified from transfected CHO cells, and string binding with purified antibody. No binding was found when CD-30 negative tumor cells were used.

Example 15

[0094] The antibody dependent cellular toxicity (ADCC), and the complement dependent toxicity of the chimeric HRS-3 antibody were determined using a europium released assay, as described by Hombach, et al, supra, and Renner, et al, supra.

[0095] In brief, for the ADCC assay, peripheral blood lymphocytes were isolated from tow healthy donors, and used at an effector:target ratio of 10:1, with 10,000 europium labelled, CD-30 antigen positive L540CY tumor cells. Antibody was added at varying concentrations (10 μl, 0.1 and 0.01 μg/ml), as was a control of 0 μg/ml. The effect was compared to the murine antibody, a bispecific murine anti-CD16/CD30 antibody, and an irrelevant, chimeric IgG1 antibody. A CD30 negative line was also used. Maximum lysis was measured after 0.025% Triton was added, and all assays were carried out in triplicate.

[0096] The results indicated that the chimeric antibody performed better in the ADCC than the murine antibody.

[0097] In the CDC assays, 10,000 europium labelled cells (100 μg) (L540Y), were incubated, with 50, 5, 0.5, or 0.05 μg/ml antibody in a 50 μl volume. Freshly isolated complement (50 μl) was added, and the mixture was incubated for 2 hours, at 37° C. The murine antibody was also tested, as was an anti CD-16 antibody and a chimeric anti IgG antibody, which served as controls, as did a CD-30 negative cell.

[0098] As in the ADCC assay the chimeric antibody was superior in terms of percent lysis to all other antibodies tested.

Example 16

[0099] This example details the production of a fusion protein of a chimeric, G250 specific antibody, and tumor necrosis factor ("TNF" hereafter).

[0100] G250 is an antigen also now as "carbonic anhydrase 9," or "CA9," or "MN." The G250 antigen and the corresponding antibody was described as being associated with renal cancer carcinoma by Oosterwijk, et al, PCT/US88/01511. The G250 antibody has also been the subject of several clinical trials (Oosterwijk, et al., Int. J. Cancer 1986: Oct. 15, 38(4):489-494; Divgi, et al., Clin. Cancer Res. 1998: Nov. 4(11):2729-739.

[0101] Zavada, et al, have issued a series of patents in which the G250 antigen is referred to as "MN" or "MN/CAIX." See, e.g., U.S. Pat. Nos. 6,051,226; 6,027,887; 5,995,075, and 5,981,711, all of which are incorporated by reference. These parents provide details on the antigen, and describe various tumors in which it is found, including cervical cancer, bladder cancer, mammary carcinoma, uterine, cervical, ovarian, and endometrial cancer.

[0102] Recently, Ivanov, et al, Am. Journal of Pathology 158(3):905-919 (2001), conducted investigations of CA9 and CA12 on tumor cells, and cell lines.

[0103] cDNA sequences for the light and heavy variable regions of a murine. G250 specific antibody are known, and these include the endogenous antibody leader sequence. PCR primers were used to modify both the 5' and 3' regions, in order to introduce restriction sites necessary for the introduction of the coding sequences to the vectors employed, which were SEQ ID NOS: 48 & 49, supra. The cDNA sequence which encodes the murine G250 heavy chain variable region is set forth at SEQ ID NO: 50, with the amino acid sequence at SEQ ID NO: 51 and the light chain variable region, at SEQ ID NO: 52, with amino acid sequence at SEQ ID NO: 53. The first 8 nucleotides in each of SEQ ID NOS 50 & 52 represent a PmeI restriction site. The first 19 amino acids encoded by the nucleotide sequence represent the leader region, and the first 24 the leader sequence for the light chain. The last 6 nucleotides in each of SEQ ID NOS: 50 & 52 are a BamHI restriction site. The same protocol as was used for the HRS-3 chimera was used to splice these variable regions into SEQ ID NOS: 46 & 47.

[0104] To secure the cDNA encoding human TNF, a human leukocyte cDNA library was used. The peripheral blood lymphocytes were stimulated with PMA, and the cDNA for TNF was amplified, using standard methods. Restriction sites were introduced in the cDNA sequence, so that the cDNA for TNF was positioned right after the hinge region of the G250 heavy chain. A (Gly) Ser coding sequence linked the two. SEQ ID NOS: 54 & 55 set forth the nucleotide and amino acid sequences of a TNF fragment, and SEQ ID NO: 56, a construct wherein the human gamma-1 heavy chain is followed by the TNF coding sequence, right after the IgG1 hinge region.

[0105] Within SEQ ID NO: 56, nucleotides 1419-1754 encode a partial, human IgG1 constant region, containing the CH1 and hinge domain, preceded by a 60 base pair intron region and splice acceptor site. The linker, i.e., (Gly)4Ser is encoded by nucleotides 1755-1769. The coding sequence for the human TNF fragment is set forth at nucleotides 1776-2296.

[0106] The resulting constructs were transfected into host cells, as described supra, and expressed. Note that SEQ ID NO: 56 contains a variant of the heavy chain vector noted supra, as it contains the human CH1 and hinge regions, followed by the TNF encoding sequence.

[0107] Cells were transfected and cultured as described supra for the HRS-3 chimera, and amplification was carried out using the primers of SEQ ID NOS: 40-43, described supra. The predicted size of the amplification product was 1100 base pairs, and this was in fact confirmed.

[0108] Positive colonies were then sub-cloned and cultured, as described supra. The chimeric G250-TNF fusion proteins were purified using anion exchanged chromatography on DEAE columns, using 5 ml samples, and increased salt concentrations in the elution buffer (NaCl, 0→0.5 M) (pH 8). The purity of the fusion proteins was determined, on SDS-PAGE, under reducing conditions. Two bands, of 45 and 28 kDa, respectively, appeared, consistent with the production of a chimeric fusion protein.

[0109] The purity of the chimeric fusion protein was confirmed in a sandwich ELISA. In brief, plates were coated with 1:6000 dilutions of affinity purified, goat anti-human IgG serum, and incubated overnight. They were then blocked with 2% gelatin. Either cell culture supernatant, or purified antibody was added, at varying concentrations, and then contacted with biotinylated goat anti-human TNFα specific serum, at 0.1 μg/ml, followed by visualization with a standard streptavidin peroxidase reagent.

[0110] The ELISA confirmed the purity of the antibody.

Example 17

[0111] FACS was carried out, as described supra for the chimeric HRS-3 antibodies, this time using the fusion protein, and G250 positive tumor cells. Two different purification runs were tested, with chimeric G250 antibody as a positive control, and an irrelevant chimeric IgG1 antibody as a negative control.

[0112] The results indicated that the chimeric fusion protein bound as well as the chimeric antibody did. No binding was detected when G250 negative cells were used.

Example 18

[0113] These experiments were designed to determine if the fusion proteins retained the ability of TNF to mediate cell death.

[0114] This was accomplished using an MTT assay as described by Renner, et al, Eur. J. Immunol. 25:2027-2035 (1995), incorporated by reference, and TNF sensitive ("WEHI-R") cells. The WEHI cells were seeded at a density of 10,000 cells/well. Then, after 18 hours, sterile samples of the fusion protein, recombinant TNF, chimeric G250 antibody, or a negative control (plain medium), were added, at concentrations of 1.0×105, 1.0×102, 1, 1.0×10-2, 1.0×10-4, and 1.0×10-5 ng/ml, and the culture was incubated for additional period of from 48-72 hours. Any viable cells were detected, via standard methods, including Annexin V staining, and flow cytometry. To do this, 1×106 WEHI cells were incubated, overnight, with varying antibody concentrations, and dye positive cells were counted. The effect of antibody loaded tumor cells in WEHI killing was determined by pre-staining with commercially available PKH-26GL dye.

[0115] The chimeric fusion proteins were found to be as effective as recombinant TNF in killing cells.

Example 19

[0116] It is known that TNF stimulates H2O2 release by human leukocytes. The chimeric fusion proteins were tested for this property.

[0117] Granulocytes were isolated from blood samples via standard methods, and were resuspended in reaction buffer (KRPG=145 mM NaCl, 5 mM Na2HPO4, 4.8 mM KCl, 0.5 mM CaCl2, 1.2 mM MgSO4, 0.2 mM glucose, pH 7.35). This mix was added plates that had been precoated with fibronectin (1 μg/ml, 2 hours, 37° C.) to permit granulocyte adherence. Following this, 100 μl of a dye solution (10 ml KRPG+50 μl A6550+10 μl horseradish-peroxidase) were added and incubated for 15 minutes at 37° C. Granulocytes were added, at 30,000 cells per well, and then either buffer (KRPG), PMA (5 ng/ml), the chimeric fusion protein (1 μg/ml) plus recombinant human IFN-γ (100 μ/ml), or the fusion protein plus the recombinant IFN-γ (at the indicated concentrations), were added. H2O2 release was measured for 3 hours, using standard methods.

[0118] The PMA served as a positive control. The chimeric fusion protein induced H2O2 release significantly higher than antibody alone, and the H2O2 release increases even more when IFN-γ was added.

Sequence CWU 1

56127DNAArtificial SequenceOligonucleotide primer 1atgaaatgca gctgggtcat sttcttc 27225DNAArtificial SequenceOligonucleotide primer 2atgggatgga gctratcats ytctt 25327DNAArtificial SequenceOligonucleotide primer 3atgaagwtgt ggttaaactg ggttttt 27424DNAArtificial SequenceOligonucleotide primer 4atgractttg wytcagcttg rttt 24528DNAArtificial SequenceOligonucleotide primer 5atggactcca ggctcaamag ttttcctt 28627DNAArtificial SequenceOligonucleotide primer 6atggctgtcy trgsgctrct cttctgc 27726DNAArtificial SequenceOligonucleotide primer 7atggratgga gckggrtctt tmtctt 26823DNAArtificial SequenceOligonucleotide primer 8atgagagtgc tgattctttt gtg 23930DNAArtificial SequenceOligonucleotide primer 9atggmttggg tgtggamctt gctattcctg 301027DNAArtificial SequenceOligonucleotide primer 10atgggcagac ttacattctc attcctg 271128DNAArtificial SequenceOligonucleotide primer 11atggattttg ggctgatttt ttttattg 281227DNAArtificial SequenceOligonucleotide primer 12atgatggtgt taagtcttct gtacctg 271330DNAArtificial SequenceOligonucleotide primer 13atgaagttgc ctgttaggct gttggtgctg 301429DNAArtificial SequenceOligonucleotide primer 14atggagwcag acacactcct gytatgggt 291530DNAArtificial SequenceOligonucleotide primer 15atgagtgtgc tcactcaggt cctggsgttg 301633DNAArtificial SequenceOligonucleotide primer 16atgaggrccc ctgctcagwt tyttggmwtc ttg 331730DNAArtificial SequenceOligonucleotide primer 17atggatttwc aggtgcagat twtcagcttc 301827DNAArtificial SequenceOligonucleotide primer 18atgaggtkcy ytgytsagyt yctgrgg 271931DNAArtificial SequenceOligonucleotide primer 19atgggcwtca agatggagtc acakwyycwg g 312031DNAArtificial SequenceOligonucleotide primer 20atgtggggay ctktttycmm tttttcaatt g 312125DNAArtificial SequenceOligonucleotide primer 21atggtrtccw casctcagtt ccttg 252227DNAArtificial SequenceOligonucleotide primer 22atgtatatat gtttgttgtc tatttct 272328DNAArtificial SequenceOligonucleotide primer 23atggaagccc cagctcagct tctcttcc 282427DNAArtificial SequenceOligonucleotide primer 24atgaagtttc cttctcaact tctgctc 272517DNAArtificial SequenceOligonucleotide primer 25tggatggtgg gaagatg 172618DNAArtificial SequenceOligonucleotide primer 26ccagtggata gacagatg 1827456DNAMus musculusmurine 19/2 heavy chain variable region 27atggagctga tcatgctctt cctcctgtca ggaactgcag gcgtccactc 50tgaggtccag cttcagcagt caggacctga actggtgaaa cctggggcct 100cagtgaagat atcctgcaag gcttctggat acactttcac tgactacaac 150atacactggg tgaaacagag ccatggaaag agccttgact ggattggata 200tattgctcct tacagtggtg gtactggtta caaccaggag ttcaagaaca 250gggccacatt gactgtagac aaatcctcca gcacagccta catggagctc 300cgcagtctga catctgatga ctctgcagtc tattactgtg ctagacgaga 350ccgtttccct tattactttg actactgggg ccaaggcacc cctctcacag 400tctcctcagc caaaacgaca cccccatctg tctatccact ggcaagggcg 450aattcc 45628139PRTMus musculusamino acid sequence for murine 19/2 heavy chain variable region 28Met Glu Leu Ile Met Leu Phe Leu Leu Ser Gly Thr Ala Gly Val His 5 10 15Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly 20 25 30Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp 35 40 45Tyr Asn Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Asp Trp 50 55 60Ile Gly Tyr Ile Ala Pro Tyr Ser Gly Gly Thr Gly Tyr Asn Gln Glu65 70 75 80Phe Lys Asn Arg Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala 85 90 95Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Tyr 100 105 110Cys Ala Arg Arg Asp Arg Phe Pro Tyr Phe Asp Tyr Trp Gly Gln Gly 115 120 125Thr Thr Leu Arg Val Ser Ser Val Ser Gly Ser 130 13529450DNAMus musculusmurine 19/2 light chain variable region 29atgggcttca agatggagtc acagatccag gtctttgtat acatgttgct 50gtggttgtct ggtgttgatg gagacattgt gatgatccag tctcaaaaat 100tcgtatccac atcagtagga gacagggtca atatcacctg caaggccagt 150cagaatgtgg gaagtaatgt agcctggttg caacagaaac ctggacaatc 200tcctaaaacg ctgatttact cggcatcgta ccggtccggt cgagtccctg 250atcgcttcac aggcagtgga tctggaacag atttcattct taccatcact 300actgtgcagt ctgaagactt ggcagaatat ttctgtcagc aatttaacag 350gtctcctctc acgttcggtt ctgggaccaa gttggaactg aaacgggctg 400atgctgcacc aactgtatcc atcttcccac catccagtaa gggcgaattc 45030150PRTMus musculusamino acid sequence for murine 19/2 light chain variable region 30Met Gly Phe Lys Met Glu Ser Gln Ile Gln Val Phe Val Tyr Met Leu 5 10 15Leu Trp Leu Ser Gly Val Asp Gly Asp Ile Val Met Ile Gln Ser Gln 20 25 30Lys Phe Val Ser Thr Ser Val Gly Asp Arg Val Asn Ile Thr Cys Lys 35 40 45Ala Ser Gln Asn Val Gly Ser Asn Val Ala Trp Leu Gln Gln Lys Pro 50 55 60Gly Gln Ser Pro Lys Thr Leu Ile Tyr Ser Ala Ser Tyr Arg Ser Gly65 70 75 80Arg Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ile 85 90 95Leu Thr Ile Thr Thr Val Gln Ser Glu Asp Leu Ala Glu Tyr Phe Cys 100 105 110Gln Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu 115 120 125Glu Leu Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro 130 135 140Ser Ser Lys Gly Glu Phe145 1503141DNAArtificial Sequenceprimer used for the construction of the chimeric 19/2 light chain 31catgtttaaa cgccgccacc atgggcttca agatggagtc a 413238DNAArtificial Sequenceprimer used for the construction of the chimeric 19/2 light chain 32agaggatcca ctcacgtttc agttccactt ggtcccag 383343DNAArtificial Sequenceprimer used for the construction of the chimeric 19/2 heavy chain 33catgtttaaa cgccgccacc atggagctga tcatgctctt cct 433437DNAArtificial Sequenceprimer used for the construction of the chimeric 19/2 heavy chain 34agaggatcca ctcacctgag gagactctga gagtggt 37356159DNAArtificial SequencepREN 19/2 LC Neo Vector 35ctcgagagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 50attaggcacc ccaggcttta cactttatgc tcccggctcg tatgttgtgt 100ggagattgtg agcggataac aatttcacac agaattcgtg aggctccggt 150gcccgtcagt gggcagagcg cacatcgccc acagtccccg agaagttggg 200gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa 250actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 300ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 350cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 400ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacg 450cccctggctg cagtacgtga ttcttgatcc cgagcttcgg gttggaagtg 500ggtgggagag ttcgaggcct tgcgcttaag gagccccttc gcctcgtgct 550tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 600gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 650atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta 700aatgcgggcc aagatctgca cactggtatt tcggtttttg gggccgcggg 750cggcgacggg gcccgtgcgt cccagcgcac atgttcggcg aggcggggcc 800tgcgagcgcg gccaccgaga atcggacggg ggtagtctca agctggccgg 850cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 900ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 950ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga 1000gagcgggcgg gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc 1050agccgtcgct tcatgtgact ccacggagta ccgggcgccg tccaggcacc 1100tcgattagtt ctcgagcttt tggagtacgt cgtctttagg ttggggggag 1150gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1200taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1250agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt 1300tttcttccat ttcaggtgta cgcgtctcgg gaagctttag tttaaacgcc 1350gccacc atg ggc ttc aag atg gag tca cag atc cag gtc ttt 1392 Met Gly Phe Lys Met Glu Ser Gln Ile Gln Val Phe 5 10gta tac atg ttg ctg tgg ttg tct ggt gtt gat gga gac att 1434Val Tyr Met Leu Leu Trp Leu Ser Gly Val Asp Gly Asp Ile 15 20 25gtg atg atc cag tct caa aaa ttc gta tcc aca tca gta gga 1476Val Met Ile Gln Ser Gln Lys Phe Val Ser Thr Ser Val Gly 30 35 40gac agg gtc aat atc acc tgc aag gcc agt cag aat gtg gga 1518Asp Arg Val Asn Ile Thr Cys Lys Ala Ser Gln Asn Val Gly 45 50agt aat gta gcc tgg ttg caa cag aaa cct gga caa tct cct 1560Ser Asn Val Ala Trp Leu Gln Gln Lys Pro Gly Gln Ser Pro55 60 65aaa acg ctg att tac tcg gca tcg tac cgg tcc ggt cga gtc 1602Lys Thr Leu Ile Tyr Ser Ala Ser Tyr Arg Ser Gly Arg Val 70 75 80cct gat cgc ttc aca ggc agt gga tct gga aca gat ttc att 1644Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ile 85 90 95ctt acc atc act act gtg cag tct gaa gac ttg gca gaa tat 1686Leu Thr Ile Thr Thr Val Gln Ser Glu Asp Leu Ala Glu Tyr 100 105 110ttc tgt cag caa ttt aac agg tct cct ctc acg ttc ggt tct 1728Phe Cys Gln Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Ser 115 120ggg acc aag ttg gaa ctg aaa cgt gagtggatcc atctgggata 1772Gly Thr Lys Leu Glu Leu Lys Arg125 130agcatgctgt tttctgtctg tccctaacat gccctgtgat tatgcgcaaa 1822caacacaccc aagggcagaa ctttgttact taaacaccat cctgtttgct 1872tctttcctca gga act gtg gct gca cca tct gtc ttc atc ttc 1915 Thr Val Ala Ala Pro Ser Val Phe Ile Phe 135 140ccg cca tct gat gag cag ttg aaa tct gga act gcc tct gtt 1957Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val 145 150 155gtg tgc ctg ctg aat aac ttc tat ccc aga gag gcc aaa gta 1999Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Gly Ala Lys Val 160 165 170cag tgg aag gtg gat aac gcc ctc caa tcg ggt aac tcc cag 2041Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 175 180gag agt gtc aca gag cag gac agc aag gac agc acc tac agc 2083Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser185 190 195ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag aaa 2125Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 200 205 210cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc 2167His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser 215 220 225tcg ccc gtc aca aag agc ttc aac agg gga gag tgt tga 2206Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 230 235gctagaacta actaactaag ctagcaacgg tttccctcta gcgggatcaa 2256ttccgccccc cccccctaac gttactggcc gaagccgctt ggaataaggc 2306cggtgtgcgt ttgtctatat gttattttcc accatattgc cgtcttttgg 2356caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 2406ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg 2456aaggaagcag ttcctctgga agcttcttga agacaaacaa cgtctgtagc 2506gaccctttgc aggcagcgga accccccacc tggcgacagg tgcctctgcg 2556gccaaaagcc acgtgtataa gatacacctg caaaggcggc acaaccccag 2606tgccacgttg tgagttggat agttgtggaa agagtcaaat ggctctcctc 2656aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 2706tgggatctga tctggggcct cggtgcacat gctttacgtg tgtttagtcg 2756aggttaaaaa acgtctaggc cccccgaacc acggggacgt ggttttcctt 2806tgaaaaacac gataatacca tggttgaaca agatggattg cacgcaggtt 2856ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag 2906acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg 2956cccggttctt tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc 3006aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 3056gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt 3106gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg 3156agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat 3206ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc 3256acgtactcgg atggaagccg gtcttgtcga tcaggatgat ctggacgaag 3306agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc 3356atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc 3406gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc 3456ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat 3506attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta 3556cggtatcgcc gctcccgatt cgcagcgcat cgccttctat cgccttcttg 3606acgagttctt ctgagtcgat cgacctggcg taatagcgaa gaggcccgca 3656ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atgggacgcg 3706ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt 3756gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc 3806cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 3856gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa 3906aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga 3956cggtttttcg cctttgacgt tggagtccac gttctttaat agtggactct 4006tgttccaaac tggaacaaca ctcaacccta tctcggtcta tttataaggg 4056attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa 4106tttaacgcga attttaacaa aatattaacg cttacaattt aggtggcact 4156tttcggggaa atgtgcgcgg aacccctata tttgtttatt tttctaaata 4206cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca 4256ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc 4306ttattccctt ttttgcggca ttttgcctta ctgtttttgc tcacccagaa 4356acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 4406ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc 4456ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 4506gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat 4556acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 4606atattacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 4656atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 4706gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc 4756ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 4806gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac 4856tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 4906aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 4956tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat 5006cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct 5056acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 5106gagataggtg cctcactgat taagcattgg taactgtcag accaagttta 5156ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 5206tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt 5256gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatg 5306ttcttgagat cctttttttc tgcacgtaat ctgctgcttg caaacaaaaa 5356accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 5406tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc 5456cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc 5506gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg 5556gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5606aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt

5656ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 5706aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc 5756ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc 5806ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc 5856gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5906aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 5956gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 6006ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag 6056tcagtgagcg aggaagcgga agagcgccca atacgcaaac cgcctctccc 6106cgcgcgttgg ccgattcatt aatgcaggta tcacgaggcc ctttcgtctt 6156cac 6159366579DNAArtificial SequencepREN 19/2 HC DHFR Vector 36ctcgagagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 50attaggcacc ccaggcttta cactttatgc tcccggctcg tatgttgtgt 100ggagattgtg agcggataac aatttcacac agaattcgtg aggctccggt 150gcccgtcagt gggcagagcg cacatcgccc acagtccccg agaagttggg 200gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa 250actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 300ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 350cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 400ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacg 450ggtgggagag ttcgaggcct tgcgcttaag gagccccttc gcctcgtgct 500tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 550gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 600atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta 650aatgcgggcc aagatctgca cactggtatt tcggtttttg gggccgcggg 700cggcgacggg gcccgtgcgt cccagcgcac atgttcggcg aggcggggcc 750tgcgagcgcg gccaccgaga atcggacggg ggtagtctca agctggccgg 800cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 850ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 900ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga 950gagcgggcgg gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc 1000agccgtcgct tcatgtgact ccacggagta ccgggcgccg tccaggcacc 1050tcgattagtt ctcgagcttt tggagtacgt cgtctttagg ttggggggag 1100gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1150taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1200agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt 1250tttcttccat ttcaggtgta cgcgtctcgg gaagctttag tttaaacgcc 1300gccacc atg gag ctg atc atg ctc ttc ctc ctg tca gga act 1342 Met Glu Leu Ile Met Leu Phe Leu Leu Ser Gly Thr 5 10gca ggc gtc cac tct gag gtc cag ctt cag cag tca gga cct 1384Ala Gly Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro 15 20 25gaa ctg gtg aaa cct ggg gcc tca gtg aag ata tcc tgc aag 1426Glu Leu Val Lys Pro Gly Ala Ser Val Lys Ile Ser Cys Lys 30 35 40gct tct gga tac act ttc act gac tac aac ata cac tgg gtg 1468Ala Ser Gly Tyr Thr Phe Thr Asp Tyr Asn Ile His Trp Val 45 50aaa cag agc cat gga aag agc ctt gac tgg att gga tat att 1510Lys Gln Ser His Gly Lys Ser Leu Asp Trp Ile Gly Tyr Ile55 60 65gct cct tac agt ggt ggt act ggt tac aac cag gag ttc aag 1552Ala Pro Tyr Ser Gly Gly Thr Gly Tyr Asn Gln Glu Phe Lys 70 75 80aac agg gcc aca ttg act gta gac aaa tcc tcc agc aca gcc 1594Asn Arg Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala 85 90 95tac atg gag ctc cgc agt ctg aca tct gat gac tct gca gtc 1636Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Ser Ala Val 100 105 110tat tac tgt gct aga cga gac cgt ttc cct tat tac ttt gac 1678Tyr Tyr Cys Ala Arg Arg Asp Arg Phe Pro Tyr Tyr Phe Asp 115 120tac tgg ggc caa ggc acc act ctc aga gtc tcc tca gtg agt 1720Tyr Trp Gly Gln Gly Thr Thr Leu Arg Val Ser Ser125 130 135ggatcctctg cgcctgggcc cagctctgtc ccacaccgcg gtcacatggc 1770accacctctc ttgcagcc tcc acc aag ggc cca tcg gtc ttc 1812 Ser Thr Lys Gly Pro Ser Val Phe 140ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc aca 1851Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr145 150 155gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg 1893Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro 160 165 170gtg acg gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg 1935Val Thr Val Ser Trp Asn Ser Gly Ala Lys Thr Ser Gly Val 175 180 185cac acc ttc ccg gct gtc cta cag tcc tca gga ctc tac tcc 1977His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 190 195ctc agc agc gtg gtg acc gtg ccc tcc agc agc ttg ggc acc 2019Leu Ser Ser Val Val Ser Val Pro Ser Ser Ser Leu Gly Thr200 205 210cag acc tac atc tgc aac gtg aat cac aag ccc agc aac acc 2061Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr 215 220 225aag gtg gac aag aaa gtt gag ccc aaa tct tgt gac aaa act 2103Lys Val Asn Lys Lys Val Glu Pro Lys Ser Cys Asn Lys Thr 230 235 240cac aca tgc cca ccg tgc cca gca cct gaa ctc ctg ggg gga 2145His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 245 250 255ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc ctc 2187Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asn Thr Leu 260 265atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac 2229Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asn270 275 280gtg agc cac gaa gac cct gag gtc aag ttc aac tgg tac gtg 2271Val Ser His Glu Asn Pro Glu Val Lys Phe Asn Trp Tyr Val 285 290 295gac ggc gtg gag gtg cat aac gcc aag aca aag ccg cgg gag 2313Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 300 305 310gag cag tac aac agc acg tac cgg gtg gtc agc gtc ctc acc 2355Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 315 320 325gtc ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc 2397Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 330 335aag gtc tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc 2439Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr340 345 350atc tcc aaa gcc aaa ggg cag ccc cga gaa cca cag gtg tac 2481Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360 365acc ctg ccc cca tcc cgg gag gag atg acc aag aac cag gtc 2523Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val 370 375 380agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc 2565Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asn Ile 385 390 395gcc gtg gag tgg gag agc aat ggg cag ccg gag aac aac tac 2607Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 400 405aag acc acg cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc 2649Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe410 415 420ctc tac agc aag ctc acc gtg gac aag agc agg tgg cag cag 2691Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln 425 430 435ggg aac gtc ttc tca tgc tcc gtg atg cat gag gct ctg cac 2733Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 440 445 450aac cac tac acg cag aag agc ctc tcc ctg tct ccg ggt aaa 2775Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 455 460 465tga gctagaaact aactaagcta gcaacggttt ccctctagcg ggatcaattc 2828cgcccccccc ccctaacgtt actggccgaa gccgcttgga ataaggccgg 2878tgtgcgtttg tctatatgtt attttccacc atattgccgt cttttggcaa 2928tgtgagggcc cggaaacctg gccctgtctt cttgacgagc attcctaggg 2978gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag 3028gaagcagttc ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac 3078cctttgcagg cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc 3128aaaagccacg tgtataagat acacctgcaa aggcggcaca accccagtgc 3178cacgttgtga gttggatagt tgtggaaaga gtcaaatggc tctcctcaag 3228cgtattcaac aaggggctga aggatgccca gaaggtaccc cattgtatgg 3278gatctgatct ggggcctcgg tgcacatgct ttacgtgtgt ttagtcgagg 3328ttaaaaaacg tctaggcccc ccgaaccacg gggacgtggt tttcctttga 3378aaaacacgat aataccatgg ttcgaccatt gaactgcatc gtcgccgtgt 3428cccaaaatat ggggattggc aagaacggag acctaccctg gcctccgctc 3478aggaacgagt tcaagtactt ccaaagaatg accacaacct cttcagtgga 3528aggtaaacag aatctggtga ttatgggtag gaaaacctgg ttctccattc 3578ctgagaagaa tcgaccttta aaggacagaa ttaatggttc gatatagttc 3628tcagtagaga actcaaagaa ccaccacgag gagctcattt tcttgccaaa 3678agtttggatg atgccttaag acttattgaa caaccggaat tggcaagtaa 3728agtagacatg gtttggatag tcggaggcag ttctgtttac caggaagcca 3778tgaatcaacc aggccacctc agactctttg tgacaaggat catgcaggaa 3828tttgaaagtg acacgttttt cccagaaatt gatttgggga aatataaact 3878tctcccagaa tacccaggcg tcctctctga ggtccaggag gaaaaaggca 3928tcaagtataa gtttgaagtc tacgagaaga aagactaaca ggaagatgct 3978ttcaagttct ctgctcccct cctaaagcta tgcattttta taagaccatg 4028ggacttttgc tggtcgatcg acctggcgta atagcgaaga ggcccgcacc 4078gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc 4128ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga 4178ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct 4228tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg 4278gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 4328aacttgatta gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg 4378gtttttcgcc tttgacgttg gagtccacgt tctttaatag tggactcttg 4428ttccaaactg gaacaacact caaccctatc tcggtctatt tataagggat 4478tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaatt 4528taacgcgaat tttaacaaaa tattaacgct tacaatttag gtggcacttt 4578tcggggaaat gtgcgcggaa cccctatatt tgtttatttt tctaaataca 4628ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 4678aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 4728attccctttt ttgcggcatt ttgccttact gtttttgctc acccagaaac 4778gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt 4828acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 4878gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 4928ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 4978actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat 5028attacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat 5078gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga 5128aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 5178gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 5228caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 5278gcgaactact tactctagct tcccggcaac aattaataga ctggatggag 5328gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg 5378gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca 5428ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 5478acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga 5528gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 5578catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc 5628taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga 5678gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatgtt 5728cttgagatcc tttttttctg cacgtaatct gctgcttgca aacaaaaaac 5778caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 5828tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct 5878tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc 5928ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 5978gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa 6028ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg 6078agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 6128agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg 6178cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct 6228ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 6278tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa 6328cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt 6378tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt 6428gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc 6478agtgagcgag gaagcggaag agcgcccaat acgcaaaccg cctctccccg 6528cgcgttggcc gattcattaa tgcaggtatc acgaggccct ttcgtcttca 6578c 65793724DNAArtificial Sequenceprimer 37ttcttgaagt ctggtgatgc tgcc 243831DNAArtificial Sequenceprimer 38caagctagcc ctctaagact cctcccctgt t 313933DNAArtificial Sequenceprimer 39gaactcgagt catttacccg gagacaggga gag 334032DNAArtificial Sequenceprimer 40gcgccatggc ccaggtgcaa ctgcagcagt ca 324134DNAArtificial Sequenceprimer 41cagggatcca ctcacctgag gagacggtga ccgt 344233DNAArtificial Sequenceprimer 42agcgccatgg acatcgagct cactcagtct cca 334335DNAArtificial Sequenceprimer 43cagggatcca actcacgttt gatttccagc ttggt 3544465DNAMus Musculusnucleotide sequence of murine heavy chain variable region 44gtttaaacgc cgccaccatg aactggacct ggaccgtgtt ttgcctgctc 50gctgtggctc ctggggccca cagcgccatg gcccaggtgc aactgcagca 100gtcaggggct gagctggcta gacctggggc ttcagtgaag atgtcctgca 150aggcttctgg ctacaccttt actacctaca caatacactg ggtaagacag 200aggcctggac acgatctgga atggattgga tacattaatc ctagcagtgg 250atattctgac tacaatcaaa gcttcaaggg caagaccaca ttgactgcag 300acaagtcctc caacacagcc tacatgcaac tgaacagcct gacatctgag 350gactctgcgg tctattactg tgcaagaaga gcggactatg gtaactacga 400atatacctgg tttgcttact ggggccaagg gaccacggtc accgtctcct 450caggtgagtg gatcc 46545145PRTMus musculusamino acid sequence for murine heavy chain variable region 45Met Asn Trp Thr Trp Thr Val Phe Cys Leu Leu Ala Val Ala Pro Gly 5 10 15Ala His Ser Ala Met Ala Gln Val Gln Leu Gln Gln Ser Gly Ala Glu 20 25 30Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly 35 40 45Tyr Thr Phe Thr Thr Tyr Thr Ile His Trp Val Arg Gln Arg Pro Gly 50 55 60His Asp Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Ser Gly Tyr Ser65 70 75 80Asp Tyr Asn Gln Ser Phe Lys Gly Lys Thr Thr Leu Thr Ala Asp Lys 85 90 95Ser Ser Asn Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp 100 105 110Ser Ala Val Tyr Tyr Cys Ala Arg Arg Ala Asp Tyr Gly Asn Tyr Glu 115 120 125Tyr Thr Trp Phe Ala Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser 130 135 140Ser14546415DNAMus musculusnucleotide sequence for murine light chain variable region 46gtttaaacgc cgccaccatg aactggacct ggaccgtgtt ttgcctgctc 50gctgtggctc ctggggccca cagcgccatg gacatcgagc tcactcagtc 100tccaaaattc atgtccacat cagtaggaga cagggtcaac gtcacctaca 150aggccagtca gaatgtgggt actaatgtag cctggtttca acaaaaacca 200gggcaatctc ctaaagttct gatttactcg gcatcttacc gatacagtgg 250agtccctgat cgcttcacag gcagtggatc tggaacagat ttcactctca 300ccatcagcaa tgtgcagtct gaagacttgg cagagtattt ctgtcagcaa 350tatcacacct atcctctcac gttcggaggg ggcaccaagc tggaaatcaa 400acgtgagttg gatcc 41547129PRTMus musculusamino acid sequence for murine light chain variable region 47Met Asn Trp Thr Trp Thr Val Phe Cys Leu Leu Ala Val Ala Pro Gly 5 10 15Ala His Ser Ala Met Asp Ile Glu Leu Thr Gln Ser Pro Lys Phe Met 20 25 30Ser Thr Ser Val Gly Asp Arg Val Asn Val Thr Tyr Lys Ala Ser Gln 35 40 45Asn Val Gly Thr Asn Val Ala

Trp Phe Gln Gln Lys Pro Gly Gln Ser 50 55 60Pro Lys Val Leu Ile Tyr Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro65 70 75 80Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95Ser Asn Val Gln Ser Glu Asp Leu Ala Glu Tyr Phe Cys Gln Gln Tyr 100 105 110His Thr Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125Arg 485759DNAArtificial SequenceLight chain expression vector pREN-Neo. 48ctcgagagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 50attaggcacc ccaggcttta cactttatgc tcccggctcg tatgttgtgt 100ggagattgtg agcggataac aatttcacac agaattcgtg aggctccggt 150gcccgtcagt gggcagagcg cacatcgccc acagtccccg agaagttggg 200gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa 250actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 300ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 350cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 400ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacg 450cccctggctg cagtacgtga ttcttgatcc cgagcttcgg gttggaagtg 500ggtgggagag ttcgaggcct tgcgcttaag gagccccttc gcctcgtgct 550tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 600gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 650atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta 700aatgcgggcc aagatctgca cactggtatt tcggtttttg gggccgcggg 750cggcgacggg gcccgtgcgt cccagcgcac atgttcggcg aggcggggcc 800tgcgagcgcg gccaccgaga atcggacggg ggtagtctca agctggccgg 850cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 900ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 950ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga 1000gagcgggcgg gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc 1050agccgtcgct tcatgtgact ccacggagta ccgggcgccg tccaggcacc 1100tcgattagtt ctcgagcttt tggagtacgt cgtctttagg ttggggggag 1150gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1200taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1250agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt 1300tttcttccat ttcaggtgta cgcgtctcgg gaagctttag tttaaacgcc 1350gtgagtggat ccatctggga taagcatgct gttttctgtc tgtccctaac 1400atgccctgtg attatgcgca aacaacacac ccaagggcag aactttgtta 1450cttaaacacc atcctgtttg cttctttcct cagga act gtg gct gca cca 1500 Thr Val Ala Ala Pro 5tct gtc ttc atc ttc ccg cca tct gat gag cag ttg aaa tct gga 1545Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 10 15 20act gcc tct gtt gtg tgc ctg ctg aat aac ttc tat ccc aga gag 1590Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 25 30 35gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa tcg ggt aac 1635Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn 40 45 50tcc cag gag agt gtc aca gag cag gac agc aag gac agc acc tac 1680Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 55 60 65agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag aaa 1725Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 70 75 80cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 1770His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 85 90 95ccc gtc aca aag agc ttc aac agg gga gag tgt tga 1806Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100 105gctagaacta actaactaag ctagcaacgg tttccctcta gcgggatcaa 1856ttccgccccc cccccctaac gttactggcc gaagccgctt ggaataaggc 1906cggtgtgcgt ttgtctatat gttattttcc accatattgc cgtcttttgg 1956caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 2006ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg 2056aaggaagcag ttcctctgga agcttcttga agacaaacaa cgtctgtagc 2106gaccctttgc aggcagcgga accccccacc tggcgacagg tgcctctgcg 2156gccaaaagcc acgtgtataa gatacacctg caaaggcggc acaaccccag 2206tgccacgttg tgagttggat agttgtggaa agagtcaaat ggctctcctc 2256aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 2306tgggatctga tctggggcct cggtgcacat gctttacgtg tgtttagtcg 2356aggttaaaaa acgtctaggc cccccgaacc acggggacgt ggttttcctt 2406tgaaaaacac gataatacca tggttgaaca agatggattg cacgcaggtt 2456ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag 2506acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg 2556cccggttctt tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc 2606aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 2656gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt 2706gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg 2756agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat 2806ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc 2856acgtactcgg atggaagccg gtcttgtcga tcaggatgat ctggacgaag 2906agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc 2956atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc 3006gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc 3056ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat 3106attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta 3156cggtatcgcc gctcccgatt cgcagcgcat cgccttctat cgccttcttg 3206acgagttctt ctgagtcgat cgacctggcg taatagcgaa gaggcccgca 3256ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atgggacgcg 3306ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt 3356gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc 3406cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 3456gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa 3506aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga 3556cggtttttcg cctttgacgt tggagtccac gttctttaat agtggactct 3606tgttccaaac tggaacaaca ctcaacccta tctcggtcta tttataaggg 3656attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa 3706tttaacgcga attttaacaa aatattaacg cttacaattt aggtggcact 3756tttcggggaa atgtgcgcgg aacccctata tttgtttatt tttctaaata 3806cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca 3856ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc 3906ttattccctt ttttgcggca ttttgcctta ctgtttttgc tcacccagaa 3956acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 4006ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc 4056ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 4106gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat 4156acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 4206atattacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 4256atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 4306gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc 4356ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 4406gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac 4456tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 4506aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 4556tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat 4606cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct 4656acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 4706gagataggtg cctcactgat taagcattgg taactgtcag accaagttta 4756ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 4806tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt 4856gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatg 4906ttcttgagat cctttttttc tgcacgtaat ctgctgcttg caaacaaaaa 4956accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 5006tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc 5056cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc 5106gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg 5156gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5206aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 5256ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 5306aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc 5356ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc 5406ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc 5456gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5506aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 5556gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 5606ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag 5656tcagtgagcg aggaagcgga agagcgccca atacgcaaac cgcctctccc 5706cgcgcgttgg ccgattcatt aatgcaggta tcacgaggcc ctttcgtctt 5756cac 5759496207DNAArtificial SequenceHeavy chain expression vector pREN-DHFR. 49ctcgagagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 50attaggcacc ccaggcttta cactttatgc tcccggctcg tatgttgtgt 100ggagattgtg agcggataac aatttcacac agaattcgtg aggctccggt 150gcccgtcagt gggcagagcg cacatcgccc acagtccccg agaagttggg 200gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa 250actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 300ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 350cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 400ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacg 450cccctggctg cagtacgtga ttcttgatcc cgagcttcgg gttggaagtg 500ggtgggagag ttcgaggcct tgcgcttaag gagccccttc gcctcgtgct 550tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 600gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 650atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta 700aatgcgggcc aagatctgca cactggtatt tcggtttttg gggccgcggg 750cggcgacggg gcccgtgcgt cccagcgcac atgttcggcg aggcggggcc 800tgcgagcgcg gccaccgaga atcggacggg ggtagtctca agctggccgg 850cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 900ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 950ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga 1000gagcgggcgg gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc 1050agccgtcgct tcatgtgact ccacggagta ccgggcgccg tccaggcacc 1100tcgattagtt ctcgagcttt tggagtacgt cgtctttagg ttggggggag 1150gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1200taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1250agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt 1300cttccatttc aggtgtacgc gtctcgggaa gctttagttt aaacgcctgg 1350atcctctgcg cctgggccca gctctgtccc acaccgcggt cacatggcac 1400cacctctctt gcagcc tcc acc aag ggc cca tcg gtc ttc ccc ctg 1446 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu 5 10gca ccc tcc tcc aag agc acc tct ggg ggc aca gcg gcc ctg ggc 1491Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 15 20 25tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg gtg tcg tgg 1536Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp 30 35 40aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc ccg gct gtc 1581Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 45 50 55cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg acc gtg 1626Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Ser Val 60 65 70ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg aat 1671Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 75 80 85cac aag ccc agc aac acc aag gtg gac aag aaa gtt gag ccc aaa 1716His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys 90 95 100tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa 1761Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu 105 110 115ctc ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag 1806Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 120 125 130gac acc ctc atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg 1851Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 135 140 145gtg gac gtg agc cac gaa gac cct gag gtc aag ttc aac tgg tac 1896Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 150 155 160gtg gac ggc gtg gag gtg cat aac gcc aag aca aag ccg cgg gag 1941Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 165 170 175gag cag tac aac agc acg tac cgg gtg gtc agc gtc ctc acc gtc 1986Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 180 185 190ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc aag gtc 2031Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 195 200 205tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc atc tcc aaa 2076Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 210 215 220gcc aaa ggg cag ccc cga gaa cca cag gtg tac acc ctg ccc cca 2121Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 225 230 235tcc cgg gag gag atg acc aag aac cag gtc agc ctg acc tgc ctg 2166Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 240 245 250gtc aaa ggc ttc tat ccc agc gac atc gcc gtg gag tgg gag agc 2211Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 255 260 265aat ggg cag ccg gag aac aac tac aag acc acg cct ccc gtg ctg 2256Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 270 275 280gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc acc gtg gac 2301Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 285 290 295aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc gtg atg 2346Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 300 305 310cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc ctg 2391His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 315 320 325tct ccg ggt aaa tga gctagaaact aactaagcta gcaacggttt 2436Ser Pro Gly Lysccctctagcg ggatcaattc cgcccccccc ccctaacgtt actggccgaa 2486gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc 2536atattgccgt cttttggcaa tgtgagggcc cggaaacctg gccctgtctt 2586cttgacgagc attcctaggg gtctttcccc tctcgccaaa ggaatgcaag 2636gtctgttgaa tgtcgtgaag gaagcagttc ctctggaagc ttcttgaaga 2686caaacaacgt ctgtagcgac cctttgcagg cagcggaacc ccccacctgg 2736cgacaggtgc ctctgcggcc aaaagccacg tgtataagat acacctgcaa 2786aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga 2836gtcaaatggc tctcctcaag cgtattcaac aaggggctga aggatgccca 2886gaaggtaccc cattgtatgg gatctgatct ggggcctcgg tgcacatgct 2936ttacgtgtgt ttagtcgagg ttaaaaaacg tctaggcccc ccgaaccacg 2986gggacgtggt tttcctttga aaaacacgat aataccatgg ttcgaccatt 3036gaactgcatc gtcgccgtgt cccaaaatat ggggattggc aagaacggag 3086acctaccctg gcctccgctc aggaacgagt tcaagtactt ccaaagaatg 3136accacaacct cttcagtgga aggtaaacag aatctggtga ttatgggtag 3186gaaaacctgg ttctccattc ctgagaagaa tcgaccttta aaggacagaa 3236ttaatggttc gatatagttc tcagtagaga actcaaagaa ccaccacgag 3286gagctcattt tcttgccaaa agtttggatg atgccttaag acttattgaa 3336caaccggaat tggcaagtaa agtagacatg gtttggatag tcggaggcag 3386ttctgtttac caggaagcca tgaatcaacc aggccacctc agactctttg 3436tgacaaggat catgcaggaa tttgaaagtg acacgttttt cccagaaatt 3486gatttgggga aatataaact tctcccagaa tacccaggcg tcctctctga 3536ggtccaggag gaaaaaggca tcaagtataa gtttgaagtc tacgagaaga 3586aagactaaca ggaagatgct ttcaagttct ctgctcccct cctaaagcta 3636tgcattttta taagaccatg ggacttttgc tggtcgatcg acctggcgta 3686atagcgaaga

ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg 3736aatggcgaat gggacgcgcc ctgtagcggc gcattaagcg cggcgggtgt 3786ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 3836ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc 3886cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 3936acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg 3986ggccatcgcc ctgatagacg gtttttcgcc tttgacgttg gagtccacgt 4036tctttaatag tggactcttg ttccaaactg gaacaacact caaccctatc 4086tcggtctatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa 4136tgagctgatt taacaaaatt taacgcgaat tttaacaaaa tattaacgct 4186tacaatttag gtggcacttt tcggggaaat gtgcgcggaa cccctatatt 4236tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata 4286accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc 4336aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttact 4386gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 4436gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 4486tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt 4536aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga 4586gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact 4636caccagtcac agaaaagcat attacggatg gcatgacagt aagagaatta 4686tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 4736gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 4786gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc 4836ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac 4886gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac 4936aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 4986tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 5036gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 5086cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa 5136cgaaatagac agatcgctga gataggtgcc tcactgatta agcattggta 5186actgtcagac caagtttact catatatact ttagattgat ttaaaacttc 5236atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 5286accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 5336agaaaagatc aaaggatgtt cttgagatcc tttttttctg cacgtaatct 5386gctgcttgca aacaaaaaac caccgctacc agcggtggtt tgtttgccgg 5436atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 5486cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt 5536caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac 5586cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 5636agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc 5686gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc 5736tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 5786gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga 5836gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc 5886acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 5936ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg 5986ctggcctttt gctcacatgt tctttcctgc gttatcccct gattctgtgg 6036ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 6086acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat 6136acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcaggtatc 6186acgaggccct ttcgtcttca c 620750444DNAMus musculusmurine G250 heavy chain variable region 50gtttaaacgc cgccaccatg aacttcgggc tcagattgat tttccttgtc 50ctggttttaa aaggtgtcct gtgtgacgtg aagctcgtgg agtctggggc 100agccttagtg aagcttggag ggtccctgaa actctcctgt gcagcctctg 150gattcacttt cagtaactat tacatgtctt gggttcgcca gactccagag 200aagaggctgg agttggtcgc agccattaat agtgatggtg gtatcaccta 250ctatctagac actgtgaagg gccgattcac catttcaaga gacaatgcca 300agaacaccct gtacctgcaa atgagcagtc tgaagtctga ggacacagcc 350ttgttttact gtgcaagaca ccgctcaggc tacttttcta tggactactg 400gggtcaagga acctcagtca ccgtctcctc aggtgagtgg atcc 44451140PRTMus musculusamino acid sequence for murine G250 heavy chain variable region 51Met Asn Phe Gly Leu Arg Leu Ile Phe Leu Val Leu Val Leu Lys Gly 5 10 15Val Leu Cys Asp Val Lys Leu Val Glu Ser Gly Ala Ala Leu Val Lys 20 25 30Leu Gly Gly Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45Ser Asn Tyr Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu 50 55 60Glu Leu Val Ala Ala Ile Asn Ser Asp Gly Gly Ile Thr Tyr Tyr Leu65 70 75 80Asp Thr Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 85 90 95Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Leu 100 105 110Phe Tyr Cys Ala Arg His Arg Ser Gly Tyr Phe Ser Met Asp Tyr Trp 115 120 125Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Glu 130 135 14052423DNAMus musculusmurine G250 light chain variable region 52gtttaaacgc cgccaccatg ggcttcaaga tggagtttca tactcaggtc 50tttgtattcg tgtttctctg gttgtctggt gttgatggag acattgtgat 100gacccagtct caaagattca tgtccacaac agtaggagac agggtcagca 150tcacctgcaa ggccagtcag aatgtggttt ctgctgttgc ctggtatcaa 200cagaaaccag gacaatctcc taaactactg atttactcag catccaatcg 250gtacactgga gtccctgatc gcttcacagg cagtggatct gggacagatt 300tcactctcac cattagcaat atgcagtctg aagacctggc tgattttttc 350tgtcaacaat atagcaacta tccgtggacg ttcggtggag gcaccaagct 400ggaaatcaaa cgtgagtgga tcc 42353132PRTMus musculusamino acid sequence for murine G250 light chain variable region 53Met Gly Phe Lys Met Glu Phe His Thr Gln Val Phe Val Phe Val Phe 5 10 15Leu Trp Leu Ser Gly Val Asp Gly Asp Ile Val Met Thr Gln Ser Gln 20 25 30Arg Phe Met Ser Thr Thr Val Gly Asp Arg Val Ser Ile Thr Cys Lys 35 40 45Ala Ser Gln Asn Val Val Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro 50 55 60Gly Gln Ser Pro Lys Leu Leu Ile Tyr Ser Ala Ser Asn Arg Tyr Thr65 70 75 80Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95Leu Thr Ile Ser Asn Met Gln Ser Glu Asp Leu Ala Asp Phe Phe Cys 100 105 110Gln Gln Tyr Ser Asn Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu 115 120 125Glu Ile Lys Arg 13054482DNAHomo sapiensnucleotide sequence of a TNF fragment 54ccatggtctc atcttctcga accccgagtg acaagcctgt agcccatgtt 50gtagcaaacc ctcaagctga ggggcagctc cagtggctga accgccgggc 100caatgccctc ctggccaatg gcgtggagct gagagataac cagctggtgg 150tgccatcaga gggcctgtac ctcatctact cccaggtcct cttcaagggc 200caaggctgcc cctccaccca tgtgctcctc acccacacca tcagccgcat 250cgccgtctcc taccagacca aggtcaacct cctctctgcc atcaagagcc 300cctgccagag ggagacccca gagggggctg aggccaagcc ctggtatgag 350cccatctatc tgggaggggt cttccagctg gagaagggtg accgactcag 400cgctgagatc aatcggcccg actatctcga ctttgccgag tctgggcagg 450tctactttgg gatcattgcc ctgtgatcta ga 48255157PRTHomo sapiensamino acid sequence of a TNF fragment 55Met Val Ser Ser Ser Arg Thr Pro Ser Asp Lys Pro Val Ala His Val 5 10 15Val Ala Asn Pro Gln Ala Glu Gly Gln Leu Gln Trp Leu Asn Arg Arg 20 25 30Ala Asn Ala Leu Leu Ala Asn Gly Val Glu Leu Arg Asp Asn Gln Leu 35 40 45Val Val Pro Ser Glu Gly Leu Tyr Leu Ile Tyr Ser Gln Val Leu Phe 50 55 60Lys Gly Gln Gly Cys Pro Ser Thr His Val Leu Leu Thr His Thr Ile65 70 75 80Ser Arg Ile Ala Val Ser Tyr Gln Thr Lys Val Asn Leu Leu Ser Ala 85 90 95Ile Lys Ser Pro Cys Gln Arg Glu Thr Pro Glu Gly Ala Glu Ala Lys 100 105 110Pro Trp Tyr Glu Pro Ile Tyr Leu Gly Gly Val Phe Gln Leu Glu Lys 115 120 125Gly Asp Arg Leu Ser Ala Glu Ile Asn Arg Pro Asp Tyr Leu Asp Phe 130 135 140Ala Glu Ser Gly Gln Val Tyr Phe Gly Ile Ile Ala Leu145 150 155566047DNAArtificial SequenceHeavy chain expression vector pREN-DHFR-TNF. 56ctcgagagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 50attaggcacc ccaggcttta cactttatgc tcccggctcg tatgttgtgt 100ggagattgtg agcggataac aatttcacac agaattcgtg aggctccggt 150gcccgtcagt gggcagagcg cacatcgccc acagtccccg agaagttggg 200gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa 250actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 300ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa 350cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 400ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacg 450cccctggctg cagtacgtga ttcttgatcc cgagcttcgg gttggaagtg 500ggtgggagag ttcgaggcct tgcgcttaag gagccccttc gcctcgtgct 550tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 600gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 650atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta 700aatgcgggcc aagatctgca cactggtatt tcggtttttg gggccgcggg 750cggcgacggg gcccgtgcgt cccagcgcac atgttcggcg aggcggggcc 800tgcgagcgcg gccaccgaga atcggacggg ggtagtctca agctggccgg 850cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 900ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 950ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga 1000gagcgggcgg gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc 1050agccgtcgct tcatgtgact ccacggagta ccgggcgccg tccaggcacc 1100tcgattagtt ctcgagcttt tggagtacgt cgtctttagg ttggggggag 1150gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1200taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1250agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt 1300tttcttccat ttcaggtgta cgcgtctcgg gaagctttag tttaaacgcc 1350ggatcctctg cgcctgggcc cagctctgtc ccacaccgcg gtcacatggc 1400accacctctc ttgcagcc tcc acc aag ggc cca tcg gtc ttc ccc ctg 1448 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu 5 10gca ccc tcc tcc aag agc acc tct ggg ggc aca gcg gcc ctg ggc 1493Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 15 20 25tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg gtg tcg tgg 1538Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp 30 35 40aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc ccg gct gtc 1583Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 45 50 55cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg acc gtg 1628Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Ser Val 60 65 70ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg aat 1673Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 75 80 85cac aag ccc agc aac acc aag gtg gac aag aaa gtt gag ccc aaa 1718His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys 90 95 100tct tgt gac aaa act cac aca tgc cca ccg tgc cca ggt gga ggt 1763Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Gly Gly Gly 105 110 115gga tca cca atg gtc tca tct tct cga acc ccg agt gac aag cct 1808Gly Ser Pro Met Val Ser Ser Ser Arg Thr Pro Ser Asp Lys Pro 120 125 130gta gcc cat gtt gta gca aac cct caa gct gag ggg cag ctc cag 1853Val Ala His Val Val Ala Asn Pro Gln Ala Glu Gly Gln Leu Gln 135 140 145tgg ctg aac cgc cgg gcc aat gcc ctc ctg gcc aat ggc gtg gag 1898Trp Leu Asn Arg Arg Ala Asn Ala Leu Leu Ala Asn Glu Val Glu 150 155 160ctg aga gat aac cag ctg gtg gtg cca tca gag ggc ctg tac ctc 1943Leu Arg Asp Asn Gln Leu Val Val Pro Ser Glu Gly Leu Tyr Leu 165 170 175atc tac tcc cag gtc ctc ttc aag ggc caa ggc tgc ccc tcc acc 1988Ile Tyr Ser Gln Val Leu Phe Lys Gly Gln Gly Cys Pro Ser Thr 180 185 190cat gtg ctc ctc acc cac acc atc agc cgc atc gcc gtc tcc tac 2033His Val Leu Leu Thr His Thr Ile Ser Arg Ile Ala Val Ser Tyr 195 200 205cag acc aag gtc aac ctc ctc tct gcc atc aag agc ccc tgc cag 2078Gln Thr Lys Val Asn Leu Leu Ser Ala Ile Lys Ser Pro Cys Gln 210 215 220agg gag acc cca gag ggg gct gag gcc aag ccc tgg tat gag ccc 2123Arg Glu Thr Pro Glu Gly Ala Glu Ala Lys Pro Trp Tyr Glu Pro 225 230 235atc tat ctg gga ggg gtc ttc cag ctg gag aag ggt gac cga ctc 2168Ile Tyr Leu Gly Gly Val Phe Gln Leu Glu Lys Gly Asp Arg Leu 240 245 250agc gct gag atc aat cgg ccc gac tat ctc gac ttt gcc gag tct 2213Ser Ala Glu Ile Asn Arg Pro Asp Tyr Leu Asp Phe Ala Glu Ser 255 260 265ggg cag gtc tac ttt ggg atc att gcc ctg tga tctagaaact 2256Gly Gln Val Tyr Phe Gly Ile Ile Ala Leu 270 275aactaagcta gcaacggttt ccctctagcg ggatcaattc cgcccccccc 2306ccctaacgtt actggccgaa gccgcttgga ataaggccgg tgtgcgtttg 2356tctatatgtt attttccacc atattgccgt cttttggcaa tgtgagggcc 2406cggaaacctg gccctgtctt cttgacgagc attcctaggg gtctttcccc 2456tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc 2506ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg 2556cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg 2606tgtataagat acacctgcaa aggcggcaca accccagtgc cacgttgtga 2656gttggatagt tgtggaaaga gtcaaatggc tctcctcaag cgtattcaac 2706aaggggctga aggatgccca gaaggtaccc cattgtatgg gatctgatct 2756ggggcctcgg tgcacatgct ttacgtgtgt ttagtcgagg ttaaaaaacg 2806tctaggcccc ccgaaccacg gggacgtggt tttcctttga aaaacacgat 2856aataccatgg ttcgaccatt gaactgcatc gtcgccgtgt cccaaaatat 2906ggggattggc aagaacggag acctaccctg gcctccgctc aggaacgagt 2956tcaagtactt ccaaagaatg accacaacct cttcagtgga aggtaaacag 3006aatctggtga ttatgggtag gaaaacctgg ttctccattc ctgagaagaa 3056tcgaccttta aaggacagaa ttaatggttc gatatagttc tcagtagaga 3106actcaaagaa ccaccacgag gagctcattt tcttgccaaa agtttggatg 3156atgccttaag acttattgaa caaccggaat tggcaagtaa agtagacatg 3206gtttggatag tcggaggcag ttctgtttac caggaagcca tgaatcaacc 3256aggccacctc agactctttg tgacaaggat catgcaggaa tttgaaagtg 3306acacgttttt cccagaaatt gatttgggga aatataaact tctcccagaa 3356tacccaggcg tcctctctga ggtccaggag gaaaaaggca tcaagtataa 3406gtttgaagtc tacgagaaga aagactaaca ggaagatgct ttcaagttct 3456ctgctcccct cctaaagcta tgcattttta taagaccatg ggacttttgc 3506tggtcgatcg acctggcgta atagcgaaga ggcccgcacc gatcgccctt 3556cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc ctgtagcggc 3606gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 3656tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg 3706ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta 3756gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta 3806gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 3856tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 3906gaacaacact caaccctatc tcggtctatt tataagggat tttgccgatt 3956tcggcctatt ggttaaaaaa tgagctgatt taacaaaatt taacgcgaat 4006tttaacaaaa tattaacgct tacaatttag gtggcacttt tcggggaaat 4056gtgcgcggaa cccctatatt tgtttatttt tctaaataca ttcaaatatg 4106tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 4156aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 4206ttgcggcatt ttgccttact gtttttgctc acccagaaac gctggtgaaa 4256gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact 4306ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt 4356ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 4406cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 4456gaatgacttg gttgagtact caccagtcac agaaaagcat attacggatg

4506gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac 4556actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac 4606cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg 4656aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 4706cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 4756tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 4806ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct 4856gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact 4906ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga 4956gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 5006tcactgatta agcattggta actgtcagac caagtttact catatatact 5056ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 5106tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc 5156cactgagcgt cagaccccgt agaaaagatc aaaggatgtt cttgagatcc 5206tttttttctg cacgtaatct gctgcttgca aacaaaaaac caccgctacc 5256agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg 5306taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag 5356ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct 5406cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt 5456gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 5506tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac 5556ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc 5606ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 5656acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta 5706tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat 5756gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 5806ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc 5856gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg 5906ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag 5956gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc 6006gattcattaa tgcaggtatc acgaggccct ttcgtcttca c 6047


Patent applications by Andrew Scott, Parkville/melbourne AU

Patent applications by Antony Burgess, Parkville/melbourne AU

Patent applications by Christoph Renner, Homburg DE

Patent applications in class Chimeric, mutated, or recombined hybrid (e.g., bifunctional, bispecific, rodent-human chimeric, single chain, rFv, immunoglobulin fusion protein, etc.)

Patent applications in all subclasses Chimeric, mutated, or recombined hybrid (e.g., bifunctional, bispecific, rodent-human chimeric, single chain, rFv, immunoglobulin fusion protein, etc.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
People who visited this patent also read:
Patent application numberTitle
20200160691ALERTHUB SYSTEM WITH TWO TOUCH BADGE
20200160690METHODS AND SYSTEMS OF SMART CAMPUS SECURITY SHIELD
20200160689LASER DAMAGE DETECTION MECHANISMS FOR SAFETY INTERLOCK AND FAULT DETECTION
20200160688ALARM DEVICE
20200160687SERVER AND NON-TRANSITORY RECORDING MEDIUM STORING PROGRAM
Images included with this patent application:
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Humanized GM-CSF antibodies diagram and imageHumanized GM-CSF antibodies diagram and image
Similar patent applications:
DateTitle
2009-01-08Humanized anti-ccr2 antibodies and methods of use therefor
2009-10-15Human gm-csf antibodies
2011-02-24Humanized high affinity recombinant antibody against hepatitis b surface antigen
2011-08-04Humanized anti-c5ar antibodies
2008-11-27Production and use of novel peptide-based agents for use with bi-specific antibodies
New patent applications in this class:
DateTitle
2022-05-05Bispecific antibodies that bind pd-l1 and cd28
2022-05-05Polypeptide modification method for purifying polypeptide multimers
2019-05-16Generating targeted sequence diversity in fusion proteins
2019-05-16Anti-pd-1 monoclonal antibody and obtaining method therefor
2019-05-16Modified chimeric antigen receptors and methods of use
New patent applications from these inventors:
DateTitle
2010-07-01Humanized gm-csf antibodies
Top Inventors for class "Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof"
RankInventor's name
1Kevin I. Segall
2Martin Schweizer
3John R. Desjarlais
4Brent E. Green
5David M. Goldenberg
Website © 2025 Advameg, Inc.