Patent application title: RT-LATE-PCR
Inventors:
Cristina Hartshorn (Needham, MA, US)
Cristina Hartshorn (Needham, MA, US)
Kenneth E. Pierce (Natick, MA, US)
Arthur Henry Reis, Jr. (Arlington, MA, US)
John E. Rice (Quincy, MA, US)
John E. Rice (Quincy, MA, US)
J. Aquiles Sanchez (Framingham, MA, US)
J. Aquiles Sanchez (Framingham, MA, US)
Lawrence J. Wangh (Auburndale, MA, US)
Lawrence J. Wangh (Auburndale, MA, US)
Assignees:
Brandeis University
IPC8 Class: AC12Q168FI
USPC Class:
435 611
Class name: Measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving nucleic acid nucleic acid based assay involving a hybridization step with a nucleic acid probe, involving a single nucleotide polymorphism (snp), involving pharmacogenetics, involving genotyping, involving haplotyping, or involving detection of dna methylation gene expression
Publication date: 2011-12-22
Patent application number: 20110311971
Abstract:
An assay comprising more than one primer pair and more than one detection
probe, a low copy number synthetic amplicon corresponding to each of the
primer pairs. The assay can detect and distinguish between various
sub-types and strains of an influenza virus using any suitable nucleic
acid amplification technique. Related kits and methods are also
described.Claims:
1. (canceled)
2. A reverse transcription-polymerase chain reaction (PCR) method comprising: a) adding to a reaction vessel a reaction mixture comprising at least one RNA comprising a target sequence, reverse transcriptase, DNA amplification reagents that include an excess primer and a limiting primer for the target sequence, and DNA polymerase, wherein the concentration of the excess primer is 500-2000 nM and at least five times higher than the concentration of the limiting primer, and wherein the concentration-adjusted melting temperature of the limiting primer to the target sequence is equal to or greater than the concentration-adjusted melting temperature of the excess primer to the target sequence; b) incubating the reaction mixture at a first temperature to reverse transcribe the target sequence from the RNA utilizing the excess primer and the reverse transcriptase to create a cDNA template for LATE-PCR amplification, said first temperature being sufficiently high to disrupt secondary structure of the RNA but sufficiently low to provide a reverse-transcriptase half-life of at least 2.2 minutes, wherein the effective melting temperature of the excess primer to the RNA is not lower than 2.degree. C. below said first temperature; and c) thermally cycling the reaction mixture to amplify the cDNA template using the excess primer, the limiting primer and the DNA polymerase to produce both double-stranded amplification product and single-stranded amplification product.
3. The method of claim 2 wherein the concentration of the excess primer is at least ten times higher than the concentration of the limiting primer.
4. The method of claim 2 wherein the concentration of the excess primer is at least twenty times higher than the concentration of the limiting primer.
5. The method of claim 1 wherein the RNA is added to the reaction mixture as at least one lysed cell or at least one lysed virus.
6. The method of claim 1 wherein the reverse transcriptase and the DNA polymerase are a single enzyme that has both reverse transcription activity and DNA polymerase activity.
7. The method of claim 1 wherein the reaction mixture includes a fluorescently-labeled hybridization probe for detection of the single-stranded amplification product.
8. The method of claim 1 wherein said at least one RNA comprises at least two target sequences, and the DNA amplification reagents include an excess primer and a Limiting primer for each target sequence.
9. The method of claim 1 wherein said first temperature is in the range of 50.degree. C. to 60.degree. C.
10. A reaction mixture comprising: (a) at least one RNA, wherein said RNA comprises a target sequence; (b) reverse transcriptase; (c) DNA amplification reagents including an excess primer and a limiting primer for the target sequence, wherein the concentration of the excess primer is 500-2000 nM and at least five times higher than the concentration of the limiting primer, and wherein the concentration-adjusted melting temperature of the limiting primer to the target sequence is equal to or greater than the concentration-adjusted melting temperature of the excess primer to the target sequence; and (d) DNA polymerase.
11. The reaction mixture of claim 10 wherein the concentration of the excess primer is at least ten times higher than the concentration of the limiting primer.
12. The reaction mixture of claim 11 wherein the concentration of the excess primer is at least twenty times higher than the concentration of the limiting primer.
13. The reaction mixture of claim 10 wherein the RNA is added to the reaction mixture as at least one lysed cell or at least one lysed virus.
14. The reaction mixture of claim 10 wherein the reverse transcriptase and the DNA polymerase are a single enzyme that has both reverse transcription activity and DNA polymerase activity.
15. The reaction mixture of claim 10 further comprising a fluorescently-labeled hybridization probe for detection of the single-stranded amplification product.
16. The reaction mixture of claim 10 wherein said at least one RNA comprises at least two target sequences, and the DNA amplification reagents include an excess primer and a Limiting primer for each target sequence.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 11/822,536, filed Jul. 6, 2007, which claims priority to U.S. Provisional Patent Application Ser. No. 60/819,000, filed Jul. 7, 2006, each of which is hereby incorporated by reference in their entireties.
BACKGROUND
[0002] Rapid detection and typing of influenza virus and identification of its various strains is critical to identification and control of a potential human pandemic. Influenza virus is composed of eight single-stranded RNA molecules (HA, NA, PB2, PB1, PA, NS, M, NP) that code for eleven specific proteins. The RNA for the matrix protein (M) is relatively conserved and is therefore used to detect and distinguish a Type A virus. M can also be used to detect and distinguish H5N1.
[0003] The hemagglutinin protein (HA) and neuraminidase protein (NA) are grouped into 16 and 9 subtypes, respectively, both have high sequence variability even within subtypes and thus provide an effective means of monitoring changes that might occur in a virus. The HA protein protrudes from the surface of the virus and allows it to attach to a cell to begin the infection cascade. The NA protein is also located on the surface of the virus and allows the release of new particles within the infected cell.
[0004] Currently the Eurasian H5N1 virus infects only the lower lungs in human and is therefore less readily transmitted human-to-human than annual strains of human influenza that infect the upper respiratory track. But, mutations within the HA and NA RNAs are frequent and alter viral infectivity and lethality in different hosts and their tissues. In addition, gene assortment among the different viral subtypes is another very worrisome feature of influenza and could result in recombining RNA sequences for high infectivity in humans with high lethality.
SUMMARY
[0005] Accordingly, there is a need for an informative influenza assay that can be performed in the field, i.e., at the point of care ("POC"). Moreover, in order to save both time and money it will also be important to make POC assays compatible with more extensive laboratory analysis, such as sequencing of, for example, HA and NA. In this way, the evolution of a viral disease and viral genomics can be analyzed in real-time.
[0006] One embodiment is directed to an assay comprising a plurality of primer pairs, a plurality of probes, and a low copy number synthetic amplicon corresponding to each of the plurality of primer pairs.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 illustrates an embodiment of LATE PCR (left) and provides fluorescence curves produced by LATE PCR.
[0008] FIG. 2 is an agarose gel showing four sets of reactions, performed in triplicate, each reaction using the same Excess Primer (thick arrow), plus a different own Limiting Primer (thin arrow). The melting temperature of the four different Limiting Primers increases from left to right and the annealing temperature used for each set of reactions is 2° C. below the melting temperature of the Limiting Primer.
[0009] FIG. 3 shows agarose gels of identical LATE-PCR without ELIXIR (left) and with ELIXIR (right). The replicate reactions are prepared using four different preparations of commercially available Taq polymerases, both with and without a hot start. The reactions were incubated at room temperature for 30 minutes before amplification.
[0010] FIG. 4 is an agarose gel of a pentaplex LATE-PCR without ELIXIR (left six lanes), monoplex LATE-PCR with ELIXIR (middle five lanes), and pentaplex with ELIXIR (right six lanes). A molecular weight ladder is shown in far right lane. In the pentaplex reactions, all five targets are amplified simultaneously.
[0011] FIG. 5 shows reaction design (left panels) and dF/dT in the presence of SybrGreen (right panels) where five primer pairs and (a) one template or (b) one template corresponding to one primer pair+four low copy number amplicons corresponding to the remaining four primer pairs are included.
[0012] FIG. 6 shows pyrosequencing of a LATE-PCR monoplex reaction (left panel) and a multiplex reaction (right panel). The post-LATE-PCR reactions are split into five aliquots each and pyrosequencing performed in the presence of a sequencing primer corresponding to each amplicon.
[0013] FIG. 7 shows an embodiment of a Low-Tm Probe detection approach.
[0014] FIG. 8 compares amplification and detection of a high-Tm molecular beacon probe and a low-Tm molecular beacon probe.
[0015] FIG. 9 compares resolution of single nucleotide polymorphism in heterozygous CC, heterozygous CT, and homozygous TT using an anneal down protocol (left) and a melt-up protocol (right).
[0016] FIG. 10. LATE-PCR The captions under the bars indicate the temperature used for RT prior to LATE-PCR. No RTase (light blue bar), the inactivated RTase (blue bar), 30 min at 50° C. (green bar), 30 min at 55° C.; 10 min at 60° C.+20 min at 55° C. (orange bar). LATE-PCR is identical for all samples.
[0017] FIG. 11. LATE-PCR protocol with 50 nM limiting primer (LP) and 2 μM RT primer and LATE-PCR excess primer (XP).
[0018] FIG. 12 is a clustal comparison of Influenza Virus M RNA sequences for H3N2, H5N1, H1N1, and B.
[0019] FIG. 13 is a clustal comparison of Influenza Virus HA RNA sequences for H3N2, H5N1, H1N1, and B.
[0020] FIG. 14 is a clustal comparison of Influenza Virus NA RNA sequences for H3N2, H5N1, H1N1, and B.
[0021] FIG. 15 shows a schematic of an embodiment of an assay
[0022] FIG. 16 shows the layout and an possible outcomes for an exemplary assay.
[0023] FIG. 17 provides primer, probe, and amplicon sequences that can be used in an embodiment of an influenza virus assay.
DETAILED DESCRIPTION
[0024] All references cited are incorporated herein by reference.
[0025] An influenza virus assay can detect and distinguish between various sub-types and strains of an influenza virus using any suitable nucleic acid amplification technique. This assay can be performed in a single reaction vessel with all reagents present at the start of an assay. An assay can use more than one primer pairs in combination with one or more probes to amplify and detect specific target nucleic acid sequences of influenza. Using the information obtained from an amplification reaction it is possible to distinguish between various sub-types and strains of the an influenza virus. Specifically, an assay can provide a positive or negative (yes/no) determination of the likely presence or absence of influenza virus types A and B, and sub-types H1N1, H3N2, and H5N1 in a sample. An assay also can be used to monitor for one or more mutations in an influenza virus strain. Mutations in an influenza virus, within, for example the HA and NA, can alter viral infectivity and lethality in different hosts and different tissues.
[0026] A sample can be any material to be tested, such as, for example, a biological or environmental sample. Biological samples can be obtained from any organism. In one embodiment, a sample is obtained from a mammal, such as a human, or a bird. In one embodiment, a sample comprises a nasopharyngeal aspirate, blood, saliva, or any other bodily fluid.
[0027] A nucleic acid amplification method used in an assay can be a thermal cycling technique, such as a polymerase chain reaction ("PCR") or an isothermal technique. Standard PCR amplification methods are described in, for example, U.S. Pat. Nos. 4,683,195 and 4,683,202 (both of which are incorporated herein by reference). In one embodiment, the nucleic acid amplification method is linear after the exponential ("LATE") PCR ("LATE-PCR"), as described in U.S. patent application Ser. No. 10/320,893, which is incorporated by reference. An embodiment of LATE-PCR is illustrated in FIG. 1. LATE-PCR is an asymmetric PCR method, which uses unequal concentrations of primers and can yield single-stranded primer-extension products, or amplicons. LATE-PCR amplifications and assays typically include at least 30 cycles, at least 60 cycles, or at least 70 cycles. FIG. 2, which shows an agarose gel showing that amplification product production is less specific when the melting temperature of the Limiting Primer is below that of the Excess Primer, demonstrates the specificity advantage that can be afforded by a properly designed LATE-PCR. An Excess Primer can misprime at a low annealing temperature, but the reaction can becomes very specific when the melting temperature of the Limiting Primer is above the melting temperature of the Excess Primer (TmL[0]-TmX[0]≧0).
[0028] As used interchangeably herein, the terms "nucleic acid primer", "primer molecule", "primer", and "oligonucleotide primer" include short, (for example, between about 16 and about 50 bases) single-stranded oligonucleotides which, upon hybridization with a corresponding template nucleic acid molecule, serve as a starting point for synthesis of the complementary nucleic acid strand by an appropriate polymerase molecule. Primer molecules can be complementary to either the sense or the anti-sense strand of a template nucleic acid molecule. A primer can be composed of naturally occurring or synthetic oligonucleotides, or a mixture of the two. If the primers in a pair of PCR primers are used in unequal concentrations, as is the case in LATE-PCR, primer added at a lower concentration is a "Limiting Primer", and primer added at a higher concentration is an "Excess Primer."
[0029] As used herein "amplification target sequence" used interchangeably with "target sequence" and "target nucleic acid" refers to a DNA sequence that provides a template for copying by the steps an amplification technique. An amplification target sequence can be single-stranded or double-stranded. If the starting material is RNA, for example messenger RNA, the DNA amplification target sequence is created by reverse transcription of RNA to create complementary DNA, and the amplification target sequence is a cDNA molecule. Thus, in a PCR assay for RNA, a hybridization probe signals copying of a cDNA amplification target sequence, indirectly signifying the presence of the RNA whose reverse transcription produced the cDNA molecules containing the amplification target sequence. An amplification target sequence typically is bracketed in length by a pair of primers used to amplify it. An extension product (or amplicon), whether double-stranded or, in non-symmetric PCR, single-stranded, is the exponentially amplified amplicon, bracketed by the primer pair.
[0030] An amplification target sequence can be a single nucleic acid sequence. In some cases an amplification target sequence will contain allelic variations or mutations and, thus, will not be a single sequence, even though amplified by a single primer pair. An assay for an amplification target sequence containing variations may use one detection probe for all variations, a single allele-discriminating probe for one variant, or multiple allele-discriminating probes, one for each variant.
[0031] Any suitable primer pair can be used, such as, for example, one of more of the following primer pairs:
TABLE-US-00001 H5 Limiting Primer (reverse complement) GGATAGACCAGCTACCATGATTGCC, Tm = 66.8 (H5N1), 21.5(H3N2), 30.3 (H1N1), 14.2 (B) Excess Primer-RNA 63.2 linear GTGGAGTAAAATTGGAATCAATAGG, Tm = 63.6(H5N1), 15.7(H3N2), 53.8(H1N1), 34.6(B) H1 Limiting Primer (reverse complement) CACCCGTTTCCTATTTCTTTGGCATTATTC, Tm = 22.5(H5N1), 21.6(H3N2), 66.7(H1N1), 30.2(B) Excess Primer, RNA 64.2 linear CCATGACTCCAATGTGAAG, Tm = 36.1(H5N1), 30.1(H3N2), 63.8(H1N1), 20.3(B) N1 Limiting Primer (reverse complement) CAGCACCGTCTGGCCAAGAC, Tm = 69.3(H5N1), 69.3(H1N1), 41.0(H3N2), 5.7(B) Excess Primer, RNA 66.3 linear GCAATAACTGATTGGTCAGG, TM = 62.9 (H5N1), 62.7(H1N1), 29.9(H3N2), 40.4(B) H3 Limiting Primer (reverse complement) CGTTGTATGACCAGAGATCTATTTTAGTGTCCT, Tm = 12.2(H5N1), 67.9(H3N2), 4.6(H1N1), -0.6(B) Excess Primer, RNA 59.7 linear CCATCAGATTGAAAAAGAATTCT, Tm = 29.3(H5N1), 62.7(H3N2), 21.5(H1N1), 22.2(B) B(HA) Limiting Primer (reverse complement) CAGGAGGTCTATATTTGGTTCCATTGGC, Tm = 14.4(H5N1), 21.0(H3N2), 24.8(H1N1), 67.5(B) Excess Primer, RNA 58.9 linear CGGTGGATTAAACAAAAGCA, Tm = 12.1(H5N1), 26.0(H3N2), 20.3(H1N1), 62.4(B) B(NA) Limiting Primer (reverse complement) CCCAATACAGGGGACATCACATTTCTTG, Tm = 10.9(H5N1), 16.2(H1N1), -4.6(H3N2), 68.9(B) Excess Primer, RNA 69.7 just linear CATGGGCTGACAGTGAT, Tm = 38.7(H5N1), 43.2(H1N1), 42.5(H3N2), 63.7(B) M Limiting Primer (reverse complement) GGTGACAGGATTGGTCTTGTCTTTAGC, Tm = 67.3 (H5N1), 67.3(H3N2), 67.3(H1N1), 14.4(B) Excess Primer CTAACCGAGGTCGAAAC, Tm = 62.2(H5N1), 62.2(H3N2), 62.2(H1N1), 20.6(B) N2 Limiting Primer (reverse complement) GATGCAGCTTTTGCCTTCAACAGAG, Tm = 29.4(H5N1), 16.7(H1N1), 67.4(H3N2), 15.6(B) Excess Primer, RNA 69.4 just before hairpin GGTCCAACCCTAATTCCAA, Tm = 13.6(H5N1), 22.0(H1N1), 63.4(H3N2), 22.7(B) H3 Control Limiting Primer (reverse complement) CGTTGTATGACCAGAGATCTATTTTAGTGTCCT, Tm = 12.2(H5N1), 67.9(H3N2), 4.6(H1N1), -0.6(B) Excess Primer CCATCAGATTGAAAAAGAATTCT, Tm = 29.3(H5N1), 62.7(H3N2), 21.5(H1N1), 22.2(B) H5 Delete Region Limiting Primer (reverse complement) CCTCCCTCTATAAAACCTGCTATAGCTCCAAA, Tm = 69.7(H5N1), 14.3(H3N2), 20.5(H1N1), 6.5(B) Excess Primer CGACTGGGCTCAGAAA, Tm = 62.9(H5N1), 17.4(H3N2), 29.3(H1N1), 17.4(B)
[0032] In one embodiment all of the above primer pairs are used.
[0033] A target sequence can be present at a starting concentration of greater than or equal to approximately 1,000,000 copies/sample. In one embodiment, a target sequence is present at a concentration of approximately 10 to approximately 1,000,000 copies/sample. In another embodiment a target sequence is present at a concentration of less than 10 copies/sample, less than 100 copies/sample, less than 1,000 copies/sample, less than 10,000 copies/sample, less than 100,000 copies/sample, less than 500,000 copies/sample, or less than 1,000,000 copies/sample.
[0034] In one embodiment, a target sequence can produce an amplicon as provided in FIG. 17.
[0035] An assay includes reagents for an amplification reaction, such as those used in LATE-PCR, a symmetric PCR amplification, or an isothermal amplification method. For example, the assay mixture can include each of the four deoxyribonucleotide 5' triphosphates (dNTPs) at equimolar concentrations, a thermostable polymerase, a divalent cation, and a buffering agent. An assay mixture can include additional ingredients, such as, for example, a separate reverse transcriptase enzyme. Non-natural dNTPs can be used. For instance, dUTP can be substituted for dTTP and used at three-times the concentration of the other dNTPs due to the less efficient incorporation by Taq DNA polymerase.
[0036] An assay also can include reagents that can suppress mispriming. In one embodiment, a reagent capable of suppressing mispriming is a single-stranded oligonucleotides capable of forming a stem-and-loop structure, commonly referred to as a "hairpin" structure such as those described in, for example, U.S. patent application Ser. No. 11/252,506, (referred to as an "ELIXIR®"), which is incorporated by reference herein. FIG. 3 demonstrates the ability of an ELIXIR® to inhibit Taq polymerase, reducing mispriming and increasing generation of target product. FIG. 4 shows the ability of an ELIXIR® to reduce mispriming in a multiplex reaction.
[0037] An assay also can include an amplicon corresponding to a primer pair that is capable of suppressing mispriming. In one embodiment, one or more copies of an amplicon corresponding to a primer pair, where there are less targets present than primer pairs, is (referred to herein as "mono-multiplex"). For example, an assay can have the capacity of amplify any one of several different amplicons, but in any particular assay it is possible that either none or only a few viral target sequences will be present in a sample. Such reactions mono-multiplex reactions can be difficult to construct, because they have to suppress mispriming among the unused primers, while still allowing amplification of the correct product from any pair of primers. To prevent such mis-priming, it can be advantageous to add low copy numbers of synthetic amplicons for each primer pair. In one embodiment, approximately 20 copies of synthetic amplicons per primer pair can be included in an assay. FIG. 5 demonstrates how inclusion of low levels of synthetic amplicons can suppress mispriming in a mono-multiplex reaction. The difference between the design of unsuppressed and "internally suppressed monomultiplex" reaction is illustrated in FIG. 5a and the present and absence of mis-primed products is illustrated in FIG. 5b.
[0038] In another embodiment, reactions that do not contain influenza viral sequences have an internal control that rules out false negatives. This internal control can be observed at a single wavelength. In one embodiment, the internal control can be observed at 25° C. and can be generated by amplification of an internal control target possessing a variant of H3 flanked by the H3 primers. Detection can be accomplished using any suitable prove, including, for example, a mismatch-tolerant probe.
[0039] Amplification products can be detected by an end-point analysis or using a real-time analysis. As used herein, the term "real time," with respect to an amplification reaction, refers to the method by which the amplification reaction is detected. In a "real-time" amplification reaction, accumulation of amplicon or product is measured during the progression of the reaction, as opposed to solely after the reaction is complete, the latter being "end-point" analysis. In one embodiment detection is quantitative.
[0040] The assays can use any suitable means to detect amplification, including, but not limited to dyes, such as intercalating dyes, DNA binding agents, and probe molecules. As used interchangeably herein, the terms "nucleic acid probe", "probe molecule", and "oligonucleotide probe" and "hybridization probe" include defined nucleic acid sequences complementary to a target nucleic acid sequence to be detected such that the probe will hybridize to the target. Probes can be detectably labeled, such that hybridization of a probe to a target sequence can be readily assessed. A "detectable label" includes moieties that provide a signal that can be detected and, in some embodiments, quantified. Such labels are well known to those in the art and include chemiluminescent, radioactive, metal ion, chemical ligand, fluorescent, or colored moieties, or enzymatic groups which, upon incubation with an appropriate substrate, provide a chemiluminescent, fluorescent, radioactive, electrical, or colorimetric signal. Methods of detection of such signals are also well known in the art.
[0041] Probes can be composed of naturally occurring or synthetic oligonucleotides and include labeled primers. Some hybridization probes, for example molecular beacon probes, emit an increased detectable signal upon hybridizing to their complementary sequence without enzymatic action to hydrolyze the probes to generate a signal. We refer to such probes as probes that hybridize to their target and "signal upon hybridization." Other probes, for example TaqMan® dual fluorescently labeled random coil probes are cut, or hydrolyzed, during the amplification reaction, and hydrolysis leads to a detectable signal change. Probes that rely on hydrolysis as part of signal generation are not probes that "signal upon hybridization."
[0042] In one embodiment, an assay uses a "molecular beacon probe," which is a single-stranded oligonucleotide, typically 25-35 bases-long, in which the bases on the 3' and 5' ends are complementary. Molecular beacon probes are discussed in, for example, U.S. Pat. Nos. 5,925,517, 6,037,130, 6,103,476, 6,150,097, and 6,461,817, and U.S. Patent Appl. Pub. No. 2004/0023269A1, all of which are incorporated by reference. A molecular beacon probe can form a hairpin structure at temperatures at and below those used to anneal the primers to the template (typically below about 60° C.). The double-helical stem of the hairpin brings a fluorophore attached to one end (often, but not necessarily the '5 end) of a probe in proximity to a quencher attached to the other end of the probe (typically, but not necessarily, the 3' end). In the hairpin configuration, probe fluorescence is quenched. If a probe is heated above the temperature needed to melt the double stranded stem apart, or a probe is allowed to hybridize to a target oligonucleotide that is complementary to a sequence within the single-strand loop of a probe, fluorophore and quencher are separated, and the resulting conformation shows increased fluorescence. The strength of a fluorescent signal can increases in proportion to the amount of a molecular beacon hybridized to an amplicon. Molecular beacons with different loop sequences can be conjugated to different fluorophores in order to monitor increases in amplicons that differ by as little as one base (Tyagi, S. and Kramer, F. R. (1996) "Molecular Beacons: Probes That Fluoresce Upon Hybridization," Nat. Biotech. 14:303-308; Tyagi, S. et al., (1998) "Multicolor Molecular Beacons for Allele Discrimination." Nat. Biotech. 16: 49-53; Kostrikis, L. G. et al., (1998) "Spectral Genotyping of Human Alleles," Science 279: 1228-1229).
[0043] Any suitable fluorophore/quencher pair can be used in a molecular beacon probe. In one embodiment, four probes are used each with a single fluorophore, wherein the flourophores are texas red, CY3, CY5, and FAM. Any suitable quencher can be used, such as, for example, Black Hole® quenchers, dabsyl, and BHQ1. In one embodiment, an assay include one or more fluorophore/quencher pair, wherein the pair can be any of texas red/dabsyl, CY5/dabsyl, FAM/dabsyl, CY5/BHQ1, and CT3/dabsyl. In another embodiment, an assay uses one or more of the following probes:
TABLE-US-00002 H5 Texas Red-CGCGACTAGGGAACTCGCTCGCG-Dabsyl, Tm = 52.7 (H5N1), 8.0 (H3N2), 24.9(H1N1), 13.0(B) H1 CY3-CGCGGATTGGCTTTTTACTTTCTCACCGCG-Dabsyl, Tm = 7.8(H5N1), 20.1(H3N2), 56.6(H1N1), 12.7(B) N1 FAM-GGCGGATGCTGCTCCCACTACCGCC-Dabsyl, Tm = 56.3(H5N1), 56.3(H1N1), 12.1(H3N2), 25.8(B) H3 CY5-CGCTGAAAGCGTTTCTCGAGGTCCTG-BHQ1, Tm = 9.9(H5N1), 54.5(H3N2), 15.4(H1N1), 9.1(B) B(HA) Beacon Probe 1 Texas Red-GCGAGTTTGCATGTTCTCCTGTCTCGC-Dabsyl, Tm = 19.2(H5N1), 16.2(H3N2), 15.3(H1N1), 52.1(B) Beacon Probe 2 CY5-GCGAGTTTGCATGTTCTCCTGTCTCGC-Dabsyl, Tm = 19.2(H5N1), 16.2(H3N2), 15.3(H1N1), 52.1(B) B(NA) Beacon Probe 1 Texas Red-GCCGCTCCATTGAAACCATTACGCGGC-Dabsyl, Tm = 26.3(H5N1), 27.9(H1N1), 21.2(H3N2), 53.1(B) Beacon Probe 2 ( CY5-GCCGCTCCATTGAAACCATTACGCGGC-Dabsyl, Tm = 26.3(H5N1), 27.9(H1N1), 21.2(H3N2), 53.1(B) M CY3-GCGCTATAGAGAGAACAGCGC-Dabsyl, Tm = 33.8 (H5N1), 33.8(H3N2), 33.8(H1N1), 9.6(B) N2 FAM-GGCCGCCTATTACCTCTCGGCC-Dabsyl, Tm = 30.0(H5N1), 27.7(H1N1), 38.9(H3N2), 20.6(B) H3 Control CY5-CGCTGAAAGCGTTTCTCGAGGTCCTG-BHQ1, Tm = 32.9 vs. modified amplicon sequence CAGGAACTCTAGAAA H5 Delete Region Fluor-stemTCCTCTCTTTTTTCTTCTTCTCTstem-Dabsyl, Tm = 58.9(H5N1), -3.8(H3N2), 20.4(H1N1), 13.4(B)
[0044] In another embodiment, all of the above molecular beacon probes are used in an assay. In a further embodiment, an assay can include nine sequence-specific molecular beacons that are capable of detecting seven influenza virus targets. In a further embodiment, three molecular beacons probes, each detectable at a different wavelength, can form a probe-target hybrid at Tm 45° C. and two additional molecular beacon probes, each detectable at a different single wavelength, can form a probe-target hybrid at Tm 30° C. Further, two additional molecular beacon probes, each detectable a two different wavelengths, can form a probe-target hybrid at Tm 45° C. An additional mis-match tolerant probe can also be used to detect one of the viral targets at 40° C. and a variant of that sequence present in an internal control at 25° C.
[0045] In one embodiment, an assays can use a "Low-Tm Probe." A Low-Tm Probe is discussed in U.S. patent application Ser. No. 10/320,893 and refers to a labeled hybridization probe that signals upon hybridization to its target, which in a LATE-PCR is the Excess Primer-Strand generated by extension of the Excess Primer, and that has a Tm[O]P at least 5° C. below or at least 10° C. below the Tm[0] of the primer that hybridizes to and extends along the Excess Primer-Strand, which in a LATE-PCR is the Limiting Primer. FIG. 7 shows an embodiment of a Low-Tm Probe detection approach.
[0046] As shown in FIG. 8, Low-Tm Probes can be more specific over a wider temperature range and can display lower backgrounds. Low-Tm Probes also show less amplification at higher concentrations than High-Tm Probes.
[0047] In another embodiment, an assay can use a "Super-Low-Tm Probe." This probe also is discussed in U.S. patent application Ser. No. 10/320,893.
[0048] An assay can include more than one probe. In one embodiment, multiple molecular beacon probes are used. In another embodiment, the probes are capable of forming probe-target hybrids are more than one temperature. In a further embodiment, multiple probes can be used, where a first probe forms a probe-target hybrid at a first temperature and a second probe forms a probe-target hybrid at a second temperature. In one embodiment, five molecular beacon probes can form a probe-target hybrid at a temperature of greater than 45° C. and can be detected at 40° C. and two molecular beacon probes can form a probe-target hybrid at 30° C. and can be detected at 25° C.
[0049] An assay can also include mismatch tolerant probes, such as, for example, fluorescent probes. In one embodiment, an assay uses a mismatch tolerant probes. An assay also can detect probe-target hybrids as a sample is cooled after PCR amplification ("anneal down"). This approach can be used in end-point fluorescence detection. This anneal-down approach can be more sensitive and provide better resolution than cooling first and then reading during warm-up (melt-up), because the read-during-cooling approach can minimize formation of hairpin structures in a target sequence. FIG. 9 compares resolution of single nucleotide polymorphism in heterozygous CC, heterozygous CT, and homozygous TT using an anneal down protocol (left) and a melt-up protocol (right). In one embodiment, the temperature of an assay reaction is changed from less than 95° C. to less than 65° C. than 45° C., to less than 25° C.
[0050] An influenza viral assay (or an assay of any RNA virus) can involve reverse transcription (RT) as a first step of a detection reaction. During reverse transcription RNA sequences are converted to complementary DNA (cDNA), providing a cDNA template for PCR amplification.
[0051] An approach to RT-PCR is the use of a "One-Step RT-PCR system." In a system of this type, reagents for both RT and PCR can be added to a sample in a single mixture and the reaction tube can be sealed and placed in a thermocycler. The RT and PCR enzyme-catalyzed reactions are carried out sequentially in the thermocycler, taking advantage of the different thermostabilities of the enzymes involved (typically, a reverse transcriptase and a thermostable DNA polymerase) and by setting an appropriate thermal profile. An initial incubation at non-denaturing temperature allows RT to occur first. The temperature then can be raised to initiate PCR; at this temperature, the reverse transcriptase can be inactivated, but the DNA polymerase is not. When a "hot start" is used, DNA polymerase is kept inactive during the RT step by interaction with a specific antibody. When the temperature is elevated, the antibody can be denatured and the DNA polymerase activated. In one embodiment, a multi-functional enzyme, having both a RTase activity and a DNA polymerase activity, can be used. In a further embodiment, a multi-functional enzyme having RTase activity, DNA polymerase activity, and exonuclease activity can be used, where the exonuclease activity can cleave double-stranded DNA in TaqMan-type detection method.
[0052] The temperature and duration of RT and PCR steps can be readily determined by one of skill in the art. In one embodiment, an RT step can be performed for from less than 2 minutes to more than 60 minutes at a temperature of from approximately 50-60° C. and a DNA-polymerase step can be performed as a thermocycle at approximately 95° C. for several cycles as discussed elsewhere.
[0053] An assay can be performed using any suitable device, such as a thermal cycler. In one embodiment, an assay is performed using a portable device, a man-portable device, or a handheld device, such as, for example, a Bioseeq II. In another embodiment, an assay is performed using a bench-top device, including, for example, an ABI Prism 7700 Sequence Detector (Applied Biosystems, Inc., CA) machine, a Cepheid Smart Cycler, and a Primus PCR thermocycle.
[0054] An assay can be performed in less than or equal to 30 minutes, less than or equal to 20 minutes, less than or equal to 15 minutes, or less than or equal to 10 minutes.
[0055] Assay reagents can be provided as a kit or a consumable. The reagents can be supplied as a lyophilized preparation. Each reagent can be supplied separately or as a mixture of one or more reagents. Reagents also can be supplied on a substrate, such as a bead. A lyophilized reagent can be stable for more than one year.
[0056] An assay can yield single-stranded products for further use, for example as starting material for DNA sequencing or as probes in other reactions, or can be used in other assays. In one embodiment, single stranded DNA produced by an assay (assay product) can be sequenced using any suitable sequencing method, such as, for example, the dideoxy-method or pyrosequencing (Salk et al. (2006) Anal. Biochem. 353:124, incorporated by reference) by diluting a fraction of the assay reaction products into a sequencing reaction mixture. Assay product can be diluted by approximately 1:10, approximately 1:20, approximately 1:50, approximately 1:100, or approximately 1:200 or more for use in a sequencing reaction. FIG. 6 shows a LATE-PCR multiplex reaction, in which one sample is split into five aliquots each spiked with a different sequencing primer, and sequenced.
[0057] An assay can distinguish Influenza Type B and Type A virus. In one embodiment, an assay distinguishes Influenza Type B and Type A virus on the basis of sequences in the HA and NA genes. Within the Type A viruses an assay can distinguish between subtypes H5 (with or without N1 or N2), H1 (with or without N1 or N2), and H3 (with or without N1 or N2). In one embodiment, an N1 target sequence used is conserved for the H5 and H1 subtypes and can be useful for detecting H5N1 and H1N1. In another embodiment, H3N1 can be determined and such a determination can indicate viral reassortment. The N2 target sequence used is characteristic of the H3N2 subtype, thus, detection of H5N2 or H1N2 can indicate viral reassortment. FIGS. 12-14 shows clustal comparisons of influenza virus M, HA, and NA proteins for virus H1N1, H5N1, H3N2, and B. Such analysis is useful in interpreting data obtained from an assay and from subsequent sequencing of assay products. Using information obtaining from an assay, it is possible to monitor mutations in a known virus strain, which allows for detection of and prediction of changes in virulence and infectivity.
[0058] An exemplary avian influenza assay and possible results of this exemplary assay are provided in Table I and FIG. 15. FIG. 16 shows a schematic of an embodiment of an assay and FIG. 17 provides primer, probe sequences, and amplicon sequences that can be used in an embodiment of an influenza virus assay. In one embodiment, an assay include all of the primers and probes of FIG. 17 in a mono-multiplex assay. The features of such a mono-multiplex are summarized in Table I and the 15 possible outcomes of the reaction are illustrated 16.
TABLE-US-00003 TABLE I Position Amplicon Target Probe Tm Primers Sequence Type Color(s) Melting 1 H5 H5 M. Red 45 C. Beacon 2 H1 H1 M. Yellow 45 C. Beacon 3 N1 N1 M. Green 45 C. Beacon 4 H3 H3 EXO-R Blue 45 C. 6 Type A M gene M gene M. Yellow 30 C. Beacon 7 N2 N2 M. Green 30 C. Beacon 4/5 Type B HA Type B HA M. Blue only 45 C. only Beacon Type B HA Type B HA M. Red only 45 C. only Beacon 4/5 Type B NA Type B NA M Blue only 45 C. only Beacon Type B NA Type B NA M. Red only 45 C. only Beacon 4/5 Type B HA + Type B HA + M Blue + NA 45 C. NA Beacon Blue Type B HA + Type B HA + M. Red + NA 45 C. NA Beacon Red 8 H3 int. control mis-matched EX0-R Blue 30 C. H3 H5 int. control no matches no probe H1 int. control no matches no probe N1 int. control no matches no probe N2 int. control no matches no probe M int. control no matches no probe Type B HA i.c. no matches no probe Type B NA i.c. no matches no probe
[0059] The exemplary assay described in this table contains: [0060] 8 pairs of primers [0061] 3 Molecular Beacons with 45° C. [0062] 2 Molecular Beacons with 30° C. [0063] 2 pairs of Molecular Beacons both at 45° C. [0064] Total=9 Molecular Beacons [0065] 1 mismatch-tolerant prove [0066] 1 detectable internal control [0067] 7 undetected internal controls
Example 1
[0068] Starting with samples of purified RNA, the HA RNA (1770 nucleotides long) and the NA RNA (1400 nucleotides long) are both be reverse transcribed in toto using random hexamers in a highly efficient two step RT-procedure. Each reaction also contains low levels of an M-Gene control DNA. The resulting control and cDNA molecules are amplified in two parallel multiplex LATE-PCR assays that each generate six amplicons. The presence of Eurasian H5N1 strain in a sample is established by probing for M, N1 and two different H5 sequences that are likely to be crucial for human-to-human transmission and for virulence. Reactions that do not generate either signal for H5 Eurasian will nevertheless produce a control DNA signal, proving that they are not false negatives. Reactions that do signal the presence of the H5 Eurasian strain from either of two independent probes (one in Multiplex A and one in Multiplex B) also generates a strong M-gene signal in both Multiplex A and Multiplex B. However, some samples may generate a signal for an M protein and only one of two possible HA signals. This is regarded as an indication of viral evolution. All samples that generate either one or two HA signals, or an N1 signal plus an M-gene signal are immediately be processed further for analysis. The amplicons for the all portions of HA and NA already are present in the LATE-PCR multiplex reactions. All 10 HA and NA amplicons are 300-500 by in length and are processed for parallel pyrosequencing sequencing.
Example 2
[0069] This example is directed to an RT-LATE-PCR assay for the quantification of Oct4-specific sequences in embryonic mouse cells. Oct4 is a gene expressed in totipotent and pluripotent cells and, therefore, preimplantation embryos contain considerable levels of Oct4 RNA. In addition, each cell contains two copies of the Oct4 gene (Oct4 genomic DNA). In the experiments presented in this example, Oct4 RNA and DNA are co-purified and co-quantified, according to a method previously published by this laboratory (Hartshorn C, Anshelevich A, Wangh L. J. Rapid, single-tube method for quantitative preparation and analysis of RNA and DNA in samples as small as one cell. BMC Biotechnol 2005; 5:2). Briefly, single embryos at the 8-cell stage are transferred to tiny droplets of dry lysing reagents placed on the lid of PCR tubes. After cell lysis, which occurs very rapidly, the tube is placed on the lid and inverted. One-step RT-PCR is performed by adding the reagents in the same tube already containing the lysed sample. Thus, both RNA and DNA are present in each sample. LATE-PCR primers are designed within an exon, also according to our published strategy, so that amplicons generated by Oct4 cDNA molecules and Oct4 genomic DNA molecules are identical and detected by the same fluorescent probe, a sequence-specific molecular beacon conjugated to the TET fluorescent dye. The final volume of these assays is 50 μl, according to the instruction of the One-Step RT-PCR kit, but the volume can be decreased to 25 μl.
[0070] The RT-LATE-PCR reaction is carried out in an ABI Prism 7700 Sequence Detector (Applied Biosystems, CA) and quantification of "total DNA" (cDNA+genomic DNA) copy numbers for each sample is achieved by comparison with standard scales prepared with serial dilutions of commercially available genomic DNA. (Because the Oct4 primers are designed to amplify equally cDNA and genomic DNA, standard scales of genomic DNA are amplified exactly with the same efficiency as unknown cDNA samples, ensuring accurate quantification.) The total number of Oct4 templates in each 8-cell embryo includes 16 copies of genomic DNA (two copies of the gene per cell, one on each chromosome 17) while all the other copies are due to the presence of cDNA and, thus, reflect the Oct4 RNA content of the embryo.
[0071] Several One-Step RT-PCR kits are tested using this assay and the efficiencies for Oct4 RNA quantification are compared. FIG. 10 shows the effect of temperature on SuperScript III reverse transcriptase (Invitrogen).
[0072] The blue and orange bars in the figure are comparable to the light blue "No RT" bar, indicating that under these temperature conditions RT does not take place and only genomic Oct4 DNA is amplified in the samples (16 copies per embryo, as expected). At 55° C. (green bar), however, RT occurs and cDNA is efficiently generated. Considering that the reverse transcriptase used for these experiments is active in the 42-60° C. range, this narrow window of activity is unexpected. To clarify this point, the thermodynamics of the Oct4 primers during RT is analyzed and compared to their behavior during PCR.
[0073] Visual OMP 5.0 software (VOMP) is used for this analysis and the results are summarized in FIG. 11. The two primers used for a LATE-PCR assay (limiting primer, LP, and excess primer, XP) have different Tms and concentrations. In the Oct4 RT-LATE-PCR assay the most abundant primer (XP) is also the RT primer, being antisense to Oct4 RNA. As shown in FIG. 11, the effective Tm of this primer calculated in the presence of double-stranded DNA during the PCR annealing step (at 55° C.) is of 66° C., very close to the calculated Tm of 67° C. The effective Tm of this same primer, however, drops dramatically to 53° C. in the presence of single-stranded RNA, even if the temperature of RT is also set at 55° C. This change results in a much lower percent of primer hybridized during RT than during the PCR annealing step, although the temperature is the same during the two steps. Although only 50% of the available primer is hybridized to target at 55° C., the primer was present at high concentration (2 μM) which allowed efficient RT. Additional VOMP analyses show that Oct4 XP's effective Tm during RT does not change in the 50-60° C. range, which explains why increasing RT temperature in this case led to RT failure (much less primer was bound to target at 60° C. than at 55° C. and, contrary to the manufacturer's indications, the RTase was completely denatured after the initial 10 minutes at 60° C., see next section). On the other hand, the failure of RT at temperature lower than 55° C. (when, based solely on Tm, more primer should be hybridized) is probably due to increased levels of secondary structure of the target RNA interfering with the ability of the reverse transcriptase to progress along the template strand.
[0074] These results indicate that primers designed for PCR or LATE-PCR also should be analyzed in terms of their thermodynamic modification of a primer's design so that its Tm can meet the necessary requirements during both RT and PCR. In cases where this is not possible due to restraints intrinsic to the sequence, a third primer--designed to hybridize only during the RT step--could be added to the one-step mixture. In addition, the characteristics of LATE-PCR are advantageous to promote RT priming in a one-step assay. In fact, by designating the XP to be also the RT primer we are able to use higher RT primer concentrations than those used under standard conditions in RT-PCR assays.
Example 3
[0075] This example demonstrates optimization of RT reaction parameters.
[0076] Satisfactory RT results are obtained for two different genes shortening the RT step from 30 to 5 minutes, although a slight loss of sensitivity is observed. Further reducing RT to 2 or 3 minutes still yields acceptable results. The reverse transcriptase used was SensiScript by Qiagen. (Raja et al., 2002. Temperature-controlled Primer Limit for Multiplexing of Rapid, Quantitative Reverse Transcription-PCR Assays: Application to Intraoperative Cancer Diagnostics. Clinical Chemistry 48:8, 1329-1337.)
[0077] RT also performed with SuperScript II (Invitrogen) for 5 minutes. (Raja et al., 2005. Technology for Automated, Rapid, and Quantitative PCR or Reverse Transcription-PCR Clinical Testing. Clinical Chemistry 51:5, 882-890.
[0078] RT is successfully carried out for just 1 minute with either MMLV (Moloney Murine Leukemia Virus RT) or SuperScript III. (Stanley and Szewczuk, 2005. Multiplexed tandem PCR: gene profiling from small amounts of RNA using SYBR Green detection. Nucleic Acids Research 33:20, e180.)
[0079] Based on the above studies, a One-Step RT-PCR assay for detection of avian flu is designed that will encompass a RT step of no more than 5 minutes and as low as 1 minute. In doing so, we are aware that the optimal length of the RT reaction depends on several factors, including, but not limited to, efficient primer binding (see Example 2). The intrinsic thermostability of the RT enzyme also comes into play when choosing the temperature for RT, because the half-life of any enzyme sharply decreases at increasing temperatures, although some enzymes are more stable than others.
[0080] A clear example is provided by the following table posted on the web by the manufacturer Invitrogen
Summary of RT Half Lives at 50, 55, and 60° C.
TABLE-US-00004 [0081] SuperScript ® SuperScript ® Temperature II RT (min) III RT (min) 50° C. 6.1 220 55° C. 2.2 24 60° C. ND 2.5
[0082] From this table it follows that, when working with SuperScript III at 60° C. or with SuperScript II at 55° C., the optimal RT step duration is no more than 5 minutes in any case, independently from the primer Tms, because the enzyme is completely denatured in this period of time.
[0083] Newer RTases with broader thermostability ranges are commercially available. For example, StrataScript 5.0 from Stratatgene, has a half-life of 35 minutes at 55° C. There is also a number of polymerases commercialized by Roche and derived from thermophilic bacteria, which have both RTase and DNA polymerase activity.
[0084] We note that it is important to designing gene-specific RT primers with Tms precisely calculated for optimal hybridization to target at a temperature elevated enough to minimize the secondary structure of single-stranded, GC-rich RNA molecules such as those present in viral genomes, but at the same time allowing a sufficient half-life of the chosen enzyme. The importance and the subtleties of this approach are not widely recognized, as shown by the suggestion: "Primers for real-time RT-PCR should be designed according to standard PCR guidelines" (Platinum Quantitative RT-PCR ThermoScript One-Step System instruction sheet, included with product purchased in 2006).
Example 4
[0085] This example demonstrates the use of a Smiths Detection Bio-Seeq II instrument as a portable, point-of-care assay device. The Bio-Seeq II used in this example is comprised of four independently operating thermal cycling units, each encasing a long thin-walled sample tube having a sample volume of 25 ul. The primers and probes provided in FIG. 17 are used. Each sample is viewed using four-color fluorescence optics for dyes that emit at 520 nm, 580 nm, 625 nm, 680 nm. All colors can be viewed simultaneously without moving parts, a feature of the BioSeeq that reduces sampling time and lowers the risk of mechanical failure. To make full use of the broad detection temperature range available in LATE-PCR each unit can ramp up at 10° C./sec between 25-95° C., and is actively cooled at a rate of at least 2.5° C./sec between 95-25° C. The tolerance for thermal variance at any chosen hold temperature is ±1° C. The unit is AC or battery powered.
[0086] Each of the LATE-PCR mono-multiplex assays described below is designed to detect and distinguish any one of 15 possible outcomes in a single closed-tube. See FIGS. 15 and 16. These assays are easy to use "in the field" and provide rapid definitive yes/no answers as to the absence or presence of Influenza Virus sub-types H1N1, H3N2, B and H5N1. The assays also detect the presence of a Type B virus, or Type A influenza virus of unknown sub-type and include internal controls to rule out false negatives.
[0087] Each mono-multiplex reaction includes internal control target sequences, as shown in FIG. 17, at low copy number (approximately 20) to insure that all primer pairs are engaged in amplifying either a viral target sequence or an internal control. Accordingly, the reaction described below utilizes eight pairs of primers and eight internal controls.
[0088] Each mono-multiplex reaction is read at end-point by dropping the temperature to 40° C. and then to 25° C. Nine sequence-specific molecular beacons are used in this reaction to detect 7 of the possible viral targets. Three molecular beacons, each of a single color, form probe-target hybrids at Tm 45° C. Two additional molecular beacons, each of a single color, form probe-target hybrids at Tm 30° C. Two additional molecular beacons, each with two colors, form probe-target hybrids at Tm 45° C.
[0089] One mis-match tolerant probe is used to detect one of the viral targets at 40° C. and a variant of that sequence present in an internal control at 25° C. Seven of eight internal controls go undetected because they possess no targets for any probe.
[0090] Each mono-multiplex reaction is designed to distinguish Influenza Type B and Type A viruses on the basis of sequences in the HA and NA genes. Within the Type A viruses the reaction distinguishes between subtypes H5 (with or without N1 or N2), H1 (with or without N1 or N2), and H3 (with or without N1 or N2). The N1 target sequence used is conserved for the H5 and H1 subtypes and therefore is useful for detecting H5N1 and H1N1. Detection of H3N1 would indicate viral reassortment. The N2 target sequence used is characteristic of the H3N2 subtype. Therefore detection of H5N2 or H1N2 would indicate viral reassortment. The mono-multiplex reaction described here is a one-step RT-LATE-PCR reaction. The chemical features of this one-step process are described elsewhere.
[0091] One assay provides a reliable means of detecting the Eurasian subtype of H5. Specimens that test positive for H5 Eurasian in the field are be sent to an analytical laboratory for complete multiplex analysis and sequencing.
[0092] In a second assay, the H5 amplicon produced in the field includes the region of the RNA known to code for high pathogenicity of the Eurasian sub-type. This region is less conserved, but very important. Under these circumstances the tube that tests positive in the field for Eurasian H5 is sent to the laboratory for immediate sequencing of the H5 amplicon. There is no need to transport the specimen itself or additional amplification
[0093] The next step involves in-depth laboratory analysis of influenza genes using LATE-PCR multiplexing and nucleic acid sequencing. Starting with samples of purified RNA, the HA RNA (1770 nucleotides long) and the NA RNA (1400 nucleotides long) are both be reverse transcribed in toto using random hexamers in a highly efficient two step RT-procedure. Each reaction also contains low levels of the same M-Gene control DNA describes for the BioSeeq POC assays above. The resulting control and cDNA molecules are amplified in two parallel multiplex LATE-PCR assays that each generate six amplicons (FIG. 15).
[0094] The possible presence of Eurasian H5N1 strain in a sample will be established by probing for M, N1 and two different H5 sequences which are likely to be crucial for human-to-human transmission and for virulence. Reactions that do not generate either signal for H5 Eurasian still produce a Control DNA signal, proving that they are not false negatives. Reactions that do signal the presence of the H5 Eurasian strain from either of two independent probes (one in Multiplex A and one in Multiplex B) also generate a strong M-gene signal in both Multiplex A and Multiplex B. However, some samples may generate a signal for the Matrix protein and only one of the two possible HA signals. This is regarded as an indication of viral evolution. All samples that generate either one or two HA signals, or an N1 signal plus an M-gene signal will immediately be processed further for analysis. Amplicons for the all portions of HA and NA are already be present in the LATE-PCR multiplex reactions. All 10 HA and NA amplicons are 300-500 by in length and are processed for parallel pyrosequenceing as described above.
Sequence CWU
1
59125DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 1ggatagacca gctaccatga ttgcc
25225DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2gtggagtaaa attggaatca atagg
25330DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 3cacccgtttc ctatttcttt ggcattattc
30419DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 4ccatgactcc aatgtgaag
19520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5cagcaccgtc tggccaagac
20620DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 6gcaataactg attggtcagg
20733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7cgttgtatga ccagagatct attttagtgt cct
33823DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 8ccatcagatt gaaaaagaat tct
23928DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9caggaggtct atatttggtt ccattggc
281020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10cggtggatta aacaaaagca
201128DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 11cccaatacag gggacatcac atttcttg
281217DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12catgggctga cagtgat
171327DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 13ggtgacagga ttggtcttgt ctttagc
271417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14ctaaccgagg tcgaaac
171525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15gatgcagctt ttgccttcaa cagag
251619DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 16ggtccaaccc taattccaa
191732DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17cctccctcta taaaacctgc tatagctcca aa
321816DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 18cgactgggct cagaaa
161923DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 19cgcgactagg gaactcgctc gcg
232030DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
20cgcggattgg ctttttactt tctcaccgcg
302125DNAArtificial SequenceDescription of Artificial Sequence Synthetic
probe 21ggcggatgct gctcccacta ccgcc
252226DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 22cgctgaaagc gtttctcgag gtcctg
262327DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 23gcgagtttgc atgttctcct gtctcgc
272427DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 24gccgctccat tgaaaccatt acgcggc
272521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
25gcgctataga gagaacagcg c
212622DNAArtificial SequenceDescription of Artificial Sequence Synthetic
probe 26ggccgcctat tacctctcgg cc
222715DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 27caggaactct agaaa
152823DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 28tcctctcttt tttcttcttc tct
2329989DNAInfluenza virus
29tagatattga aagatgagcc ttctaaccga ggtcgaaacg tatgttctct ctatcgttcc
60atcaggcccc ctcaaagccg aaatcgcgca gagacttgaa gatgtctttg ctgggaaaaa
120cacagatctt gaggctctca tggaatggct aaagacaaga ccaatcctgt cacctctgac
180taaggggatt ttggggtttg tgttcacgct caccgtgccc agtgagcgag gactgcagcg
240tagacgcttt gtccaaaatg ccctcaatgg gaatggggat ccaaataaca tggacaaagc
300agttaaactg tatagaaaac ttaagaggga gataacattc catggggcca aagaaatagc
360actcagttat tctgctggtg cacttgccag ttgcatgggc ctcatataca ataggatggg
420ggctgtaacc accgaagtgg catttggcct ggtatgtgca acatgtgaac agattgctga
480ctcccagcac aggtctcata ggcaaatggt ggcaacaacc aatccattaa taaaacatga
540gaacaggatg gttttggcca gcactacagc taaagctatg gagcaaatgg ctggatcaag
600tgagcaggca gcggaggcca tggagattgc tagtcaggcc aggcaaatgg tgcaggcaat
660gagaaccgtt gggactcatc ctagctccag tactggtcta agagatgatc ttcttgaaaa
720tttgcagacc tatcagaaac gaatgggggt gcagatgcaa cgattcaagt gacctgcttg
780ttgttgctgc gagtatcatt gggatcttgc acttgatatt gtggattctt gatcgtcttt
840ttttcaaatg catctatcga ctcttcaaac acggcctgaa aagagggcct tctacggaag
900gagtacctga gtctatgagg gaagaatatc gaaaggaaca gcagaatgct gtggatgctg
960acggcagtca ttttgtcagc atagagctg
98930985DNAInfluenza virus 30atgagtcttc taaccgaggt cgaaacgtac gttctctcta
tcgtcccgtc aggccccctc 60aaagccgaga tcgcacagag acttgaaaat gtctttgctg
gaaagaatac cgatcttgag 120gctctcatgg aatggctaaa gacaagacca atcctgtcac
ctctgactaa ggggatttta 180ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac
tgcagcgtag acgctttgtc 240caaaatgccc ttaatgggaa tggggatcca aataatatgg
acagagcagt taaactgtat 300cgaaagctta agagggagat aacattccat ggggccaaag
aaatagcact cagttattct 360gctggtgcac ttgccagttg tatgggactc atatacaaca
ggatgggggc tgtgaccacc 420gaatcagcat ttggccttat atgcgcaacc tgtgaacaga
ttgccgactc ccagcataag 480tctcataggc aaatggtaac aacaaccaac ccattaataa
gacatgagaa cagaatggtt 540ctggccagca ctacagctaa ggctatggag caaatggctg
gatcgagtga acaagcagct 600gaggccatgg aggttgctag tcaggccagg cagatggtgc
aggcaatgag agccattggg 660actcatccta gctctagcac tggtctgaaa aatgatctcc
ttgaaaattt gcaggcctat 720cagaaacgaa tgggggtgca gatgcaacga ttcaagtgat
cctcttgttg ttgccgcaag 780tataattggg attgtgcacc tgatattgtg gattattgat
cgcctttttt ccaaaagcat 840ttatcgtatc tttaaacacg gtttaaaaag agggccttct
acggaaggag taccagagtc 900tatgagggaa gaatatcgag aggaacagca gaatgctgtg
gatgctgacg atggtcattt 960tgtcagcata gagctggagt aaaaa
985311039DNAInfluenza virus 31agcaaaagca
ggtagatgtt gaaagatgag tcttctaacc gaggtcgaaa cgtacgttct 60ctctatcatc
ccgtcaggcc ccctcaaagc cgagatcgcg cagaaacttg aagatgtctt 120tgcaggaaag
aacaccgatc tcgaggctct catggagtgg ctaaagacaa gaccaatcct 180gtcacctctg
actaaaggga ttttgggatt tgtattcacg ctcaccgtgc ccagtgagcg 240aggactgcag
cgtagacgct ttgtccagaa tgccctaaat ggaaatggag atccaaataa 300tatggataga
gcagtcaagc tatataagaa gctgaaaaga gaaataacat tccatggggc 360taaggaggtc
gcactcagct actcaaccgg tgcacttgcc agttgcatgg gtctcatata 420caacaggatg
ggaacggtga ctacggaagt ggcttttggc ctagtgtgtg ccacttgtga 480gcagattgca
gattcacagc atcggtctca cagacagatg gcaactacca ccaacccact 540aatcagacat
gagaacagaa tggtgctggc cagcactaca gctaaggcta tggagcagat 600ggcaggatca
agtgagcagg cagcggaagc catggagatc gctaatcagg ctaggcagat 660ggtgcaggca
atgaggacaa ttgggactca tcctaactct agtgctggtc tgagagataa 720tcttcttgaa
aatttgcagg cctaccagaa acgaatggga gtgcagatgc agcgattcaa 780gtgatcctat
tgttgttgcc gcaaatatca ttgggatctt gcacttgata ttgtggattc 840ttgatcgtct
tttcttcaaa tgcatttatc gtcgccttaa atacggtttg aaaagagggc 900ctgctacggc
aggggtacct gagtctatga gggaagagta ccggcaggaa cagcagagtg 960ctgtggatgt
tgacgatggt cattttgtca acatagaatt ggagtaaaaa actaccttgt 1020ttctactaat
acggaagac
1039321076DNAInfluenza virus 32atgtcgctgt ttggagacac aattgcctac
ctgctttcat tgacagaaga tggagaaggc 60aaagcagaac tagcagaaaa attacactgt
tggttcggtg ggaaagaatt tgacctagac 120tctgccctgg aatggataaa aaacaaaaga
tgcttaactg atatacaaaa agcactaatt 180ggtgcctcta tctgcttttt aaaacccaaa
gaccaggaaa gaaaaagaag attcatcaca 240gagcctctat caggaatggg aacaacagca
acaaaaaaga aaggcctgat tctagctgag 300agaaaaatga gaagatgtgt gagctttcat
gaagcatttg aaatagcaga aggccatgaa 360agctcagcgc tactatactg tctcatggtc
atgtacctga atcctggaaa ttattcaatg 420caagtaaaac taggaacgct ctgtgctttg
tgcgagaaac aagcatcaca ttcacacagg 480gctcatagca gagcagcgag atcttcagtg
cctggagtga gacgagaaat gcagatggtc 540tcagctatga acacagcaaa aacaatgaat
ggaatgggaa aaggagaaga cgtccaaaaa 600ctggcagaag agctgcaaag caacattgga
gtactgagat ctcttggggc aagtcaaaag 660aatggagaag gaattgcaaa ggatgtaatg
gaagtgctaa agcagagctc tatgggaaat 720tcagctcttg tgaagaaata tctataatgc
tcgaaccatt tcagattctt tcaatttgtt 780cttttatctt atcagctctc catttcatgg
cttggacaat agggcatttg aatcaaataa 840aaagaggagt aaacatgaaa atacgaataa
aaagtccaaa caaagagaca ataaacagag 900aggtatcaat tttgagacac agttaccaaa
aagaaatcca ggccaaagaa acaatgaagg 960aggtactctc tgacaacatg gaggtattga
gtgaccacat aataattgag gggctttctg 1020ccgaagagat aataaaaatg ggtgaaacag
ttttggagat agaagaattg cattaa 1076331736DNAInfluenza virus
33tcatctgtca aatggagaaa atagtgcttc tttttgcaat agtcagtctt gttaaaagtg
60atcagatttg cattggttac catgcaaaca actcgacaga gcaggttgac acaataatgg
120aaaagaacgt tactgttaca catgcccaag acatactgga aaagacacac aacgggaagc
180tctgcgatct agatggagtg aagcctctaa ttttgagaga ttgtagtgta gctggatggc
240tcctcggaaa cccaatgtgt gacgaattca tcaatgtgcc ggaatggtcc tacatagtgg
300agaaggccaa tccagtcaat gacctctgtt acccagggga tttcaatgac tatgaagaat
360tgaaacacct attgagcaga ataaaccatt ttgagaaaat tcagatcatc cccaaaagtt
420cttggtccag tcatgaagcc tcattagggg tgagctcagc atgtccatac cagagaaagt
480cctccttttt cagaaatgtg gtatggctta tcaaaaagaa cagtacatac ccaacaataa
540agaggagcta caataatacc aaccaagaag atcttttggt actgtggggg attcaccatc
600ctaatgatgc ggcagagcag acaaagctct atcaaaaccc aaccacctat atttccgttg
660ggacatcaac actaaaccag agattggtac caagaatagc tactagatcc aaagtaaacg
720ggcaaagtgg aaggatggag ttcttctgga caattttaaa accgaatgat gcaatcaact
780tcgagagtaa tggaaatttc attgctccag aatatgcata caaaattgtc aagaaagggg
840actcaacaat tatgaaaagt gaattggaat atggtaactg caacaccaag tgtcaaactc
900caatgggggc gataaactct agtatgccat tccacaatat acaccctctc accatcgggg
960aatgccccaa atatgtgaaa tcaaacagat tagtccttgc gactgggctc agaaatagcc
1020ctcaaagaga gagaagaaga aaaaagagag gattatttgg agctatagca ggttttatag
1080agggaggatg gcagggaatg gtagatggtt ggtatgggta ccaccatagc aatgagcagg
1140ggagtgggta cgctgcagac aaagaatcca ctcaaaaggc aatagatgga gtcaccaata
1200aggtcaactc gatcattgac aaaatgaaca ctcagtttga ggccgttgga agggaattta
1260acaacttaga aaggagaata gagaatttaa acaagaagat ggaagacggg ttcctagatg
1320tctggactta taatgctgaa cttctggttc tcatggaaaa tgagagaact ctagactttc
1380atgactcaaa tgtcaagaac ctttacgaca aggtccgact acagcttagg gataatgcaa
1440aggaactggg taacggttgt ttcgagttct atcataaatg tgataatgaa tgtatggaaa
1500gtgtaagaaa cggaacgtat gactacccgc agtattcaga agaagcaaga ctaaaaagag
1560aggaaataag tggagtaaaa ttggaatcaa taggaattta ccaaatactg tcaatttatt
1620ctacagtggc gagttcccta gcactggcaa tcatggtagc tggtctatcc ttatggatgt
1680gctccaatgg gtcgttacaa tgcagaattt gcatttaaat ttgtgagttc agattg
1736341692DNAInfluenza virus 34atgaaagcaa aactactggt cctgttatgt
acatttacag ctacatatgc agacacaata 60tgtataggct accatgccaa caactcaacc
gacactgttg acacagtact tgagaagaat 120gtgacagtga cacactctgt caacctactt
gaggacagtc acaacggaaa actatgtcta 180ctaaaaggaa tagccccact acaattgggt
aattgcagcg ttgccggatg gatcttagga 240aacccagaat gcgaattact gatttccaag
gaatcatggt cctacattgt agaaacacca 300aatcctgaga atggaacatg ttacccaggg
tatttcgccg actatgagga actgagggag 360caattgagtt cagtatcttc atttgagaga
ttcgaaatat tccccaaaga aagctcatgg 420cccaaccaca ccgtaaccgg agtatcagca
tcatgctccc ataatgggaa aagcagtttt 480tacagaaatt tgctatggct gacggggaag
aatggtttgt acccaaacct gagcaagtcc 540tatgtaaaca acaaagagaa agaagtcctt
gtactatggg gtgttcatca cccgcctaac 600ataggggacc aaagggccct ctatcataca
gaaaatgctt atgtctctgt agtgtcttca 660cattatagca gaagattcac cccagaaata
gccaaaagac ccaaagtaag agatcaggaa 720ggaagaatca actactactg gactctgctg
gaacctgggg atacaataat atttgaggca 780aatggaaatc taatagcgcc atggtatgct
tttgcactga gtagaggctt tggatcagga 840atcatcacct caaatgcacc aatggatgaa
tgtgatgcga agtgtcaaac acctcaggga 900gctataaaca gcagtcttcc tttccagaat
gtacacccag tcacaatagg agagtgtcca 960aagtatgtca ggagtgcaaa attaaggatg
gttacaggac taaggaacat cccatccatt 1020caatccagag gtttgtttgg agccattgcc
ggtttcattg aaggggggtg gactggaatg 1080gtagatgggt ggtatggtta tcatcatcag
aatgagcaag gatctggcta tgctgcagat 1140caaaaaagta cacaaaatgc cattaacggg
attacaaaca aggtgaattc tgtaattgag 1200aaaatgaaca ctcaattcac agctgtgggc
aaagaattca acaaattgga aagaaggatg 1260gaaaacttaa ataaaaaagt tgatgatggg
tttctagaca tttggacata taatgcagaa 1320ttgttggttc tactggaaaa tgaaaggact
ttggatttcc atgactccaa tgtgaagaat 1380ctgtatgaga aagtaaaaag ccaattaaag
aataatgcca aagaaatagg aaacgggtgt 1440tttgaattct atcacaagtg taacaatgaa
tgcatggaga gtgtgaaaaa tggaacttat 1500gactatccaa aatattccga agaatcaaag
ttaaacaggg agaaaattga tggagtgaaa 1560ttggaatcaa tgggagtcta tcagattctg
gcgatctact caactgtcgc cagttccctg 1620gttcttttgg tctccctggg ggcaatcagc
ttctggatgt gttccaatgg gtctttgcag 1680tgcagaatat gc
1692351718DNAInfluenza virus
35tattaaccat gaagactatc attgctttga gctacattct atgtctggtt ttcgctcaaa
60aacttcccgg aaatgacaac agcacggcaa cgctgtgcct tgggcaccat gcagtaccaa
120acggaacgat agtgaaaaca atcacgaatg accaaattga agttactaat gctactgagc
180tggttcagag ttcctcaaca ggtggaatat gcgacagtcc tcatcagatc cttgatggag
240aaaactgcac actaatagat gctctattgg gagaccctca gtgtgatggc ttccaaaata
300agaaatggga cctttttgtt gaacgcagca aagcctacag caactgttac ccttatgatg
360tgccggatta tgcctccctt aggtcactag ttgcctcatc cggcacactg gagtttaaca
420atgaaagctt caattggact ggagtcactc aaaatggaac aagctctgct tgtaaaagga
480gatctaataa cagtttcttt agtagattga attggttgac ccacttaaaa ttcaaatacc
540cagcattgaa cgtgactatg ccaaacaatg aaaaatttga caaattgtac atttgggggg
600ttcaccaccc gggtacggac aatgaccaaa ttagcctata tgctcaagct tcaggaagaa
660tcacagtctc taccaaaaga agccaacaaa ctgtaatccc gaatatcgga tctagaccca
720gggtaaggga tatccccagc agaataagca tctattggac aatagtaaaa ccgggagaca
780tacttttgat taacagcaca gggaatctaa ttgctcctcg gggttacttc aaaatacgaa
840gtgggaaaag ctcaataatg agatcagatg cacccattgg caaatgcaat tctgaatgca
900tcactccaaa tggaagcatt cccaatgaca aaccatttca aaatgtaaac aggatcacat
960atggggcctg tcccagatat gttaagcaaa acactctgaa attggcaaca gggatgcgaa
1020atgtaccaga gaaacaaact agaggcatat ttggcgcaat cgcgggtttc atagaaaatg
1080gttgggaggg aatggtggat ggttggtacg gtttcaggca tcaaaattct gagggaatag
1140gacaagcagc agatctcaaa agcactcaag cagcaatcaa ccaaatcaat gggaagctga
1200ataggttgat cgggaaaacc aacgagaaat tccatcagat tgaaaaagaa ttctcagaag
1260tagaagggag aattcaggac ctcgagaaat atgttgagga cactaaaata gatctctggt
1320catacaacgc ggagcttctt gttgccctgg agaaccaaca tacaattgat ctaactgact
1380cagaaatgaa caaactgttt gaaagaacaa agaagcaact gagggaaaat gctgaggata
1440tgggcaatgg ttgtttcaaa atataccaca aatgtgacaa tgcctgcata gggtcaatca
1500gaaatggaac ttatgaccat gatgtataca gagatgaagc attaaacaac cggttccaga
1560tcaaaggtgt tgagctgaag tcaggataca aagattggat cctatggatt tcctttgcca
1620tatcatgttt tttgctttgt gttgttttgt tggggttcat catgtgggcc tgccaaaaag
1680gcaacattag gtgcaacatt tgcatttgag tgcattaa
1718361038DNAInfluenza virus 36gatcgaatct gcactgggat aacatcttca
aactcacctc atgtggtcaa aacagctact 60caaggggagg tcaatgtgac tggtgtgata
ccactgacaa caacaccaac aaaatcttat 120tttgcaaatc tcaaaggaac aaggaccaga
gggaaactat gcccagactg tctcaactgt 180acagatctgg atgtggcctt gggcaggcca
atgtgtgtgg ggaccacacc ttctgcgaaa 240gcttcaatac tccacgacct gttacatccg
ggtgctttcc tataatgcac gacagaacaa 300aaatcgaagt caaggcaact agccaatctt
ctcagaggat atgaaaatat caggttatca 360acccaaaacg ttatcgatgc agaaaaggca
ccaggaggac cctacagact tggaacctca 420ggatcttgcc ctaacgctac cagtaaaagc
ggatttttcg caacaatggc ttgggctgtc 480ccaaaggaca acaacaaaaa tgcaacgaac
ccactaacag tagaagtacc atacatttgt 540acagaagggg aagaccaaat tactgtttgg
gggttccatt cagataacaa aacccaaatg 600aagaacctct atggagactc aaatcctcaa
aagttcacct catctgctaa tggagtaacc 660acacattatg tttctcagat tggcggcttc
ccagatcaaa cagaagacgg aggactacca 720caaagcggca gaattgtcgt tgattacatg
atgcaaaaac ctgggaaaac aggaacaatt 780gtctatcaaa gaggtgtttt gttgcctcaa
aaggtgtggt gcgcgagtgg caggagcaaa 840gtaataaaag ggtccttgcc tttaattggt
gaagcagatt gccttcatga aaaatacggt 900ggattaaaca aaagcaagcc ttactacaca
ggagaacatg caaaagccat aggaaattgc 960ccaatatggg tgaaaacacc tttgaagctt
gccaatggaa ccaaatatag acctcctgca 1020aaactattaa aggaaagg
1038371409DNAInfluenza virus
37atgaatccaa atcaaaaaat aataaccatt ggatcaatca gtatagcaat cggaataatt
60agtctaatgt tgcaaatagg aaatattatt tcaatatggg ctagtcactc aatccaaact
120ggaagtcaaa accacactgg agtatgcaac caaagaatca tcacatatga aaacagcacc
180tgggtgaatc acacatatgt taatattaac aacactaatg ttgttgctgg aaaggacaaa
240acttcagtga cattggccgg caattcatct ctttgttcta tcagtggatg ggctatatac
300acaaaagaca acagcataag aattggctcc aaaggagatg tttttgtcat aagagaacct
360ttcatatcat gttctcactt ggaatgcaga accttttttc tgacccaagg tgctctatta
420aatgacaaac attcaaatgg gaccgttaag gacagaagtc cttatagggc cttaatgagc
480tgtcctctag gtgaagctcc gtccccatac aattcaaagt ttgaatcagt tgcatggtca
540gcaagcgcat gccatgatgg catgggctgg ttaacaatcg gaatttctgg tccagacaat
600ggagctgtgg ctgtactaaa atacaacggc ataataactg aaaccataaa aagttggaaa
660aagcgaatat taagaacaca agagtctgaa tgtgtctgtg tgaacgggtc atgtttcacc
720ataatgaccg atggcccgag taatggggcc gcctcgtaca aaatcttcaa gatcgaaaag
780gggaaggtta ctaaatcaat agagttgaat gcacccaatt ttcattatga ggaatgttcc
840tgttacccag acactggcac agtgatgtgt gtatgcaggg acaactggca tggttcaaat
900cgaccttggg tgtcttttaa tcaaaacctg gattatcaaa taggatacat ctgcagtggg
960gtgttcggtg acaatccgcg tcccaaagat ggagagggca gctgtaatcc agtgactgtt
1020gatggagcag acggagtaaa ggggttttca tacaaatatg gtaatggtgt ttggatagga
1080aggactaaaa gtaacagact tagaaagggg tttgagatga tttgggatcc taatggatgg
1140acagataccg acagtgattt ctcagtgaaa caggatgttg tggcaataac tgattggtca
1200gggtacagcg gaagtttcgt tcaacatcct gagttaacag gattggactg tataagacct
1260tgcttctggg ttgagttagt cagaggactg cctagagaaa atacaacaat ctggactagt
1320gggagcagca tttctttttg tggcgtaaat agtgatactg caaactggtc ttggccagac
1380ggtgctgagt tgccattcac cattgacaa
1409381392DNAInfluenza virus 38ttattggtct cagggagcaa aagcaggagt
tcaaaatgaa tccaaataag aagataataa 60ccatcggatc aatctgtatg gtaactggaa
tggttagctt aatgttacaa attgggaact 120tgatctcaat atgggtcagt cattcaattc
acacagggaa tcaacacaaa gctgaaccaa 180tcagcaatac taattttctt actgagaaag
ctgtggcttc agtaaaatta gcgggcaatt 240catctctttg ccccattaat ggatgggctg
tatacagtaa ggacaacagt ataaggatcg 300gttccaaggg ggatgtgttt gttataagag
agccattcat ctcatgctcc cacttggaat 360gcagaacttt ctttttgact cagggagcct
tgctgaatga caagcactcc aatgggactg 420tcaaagacag aagccctcac agaacattaa
tgagttgtcc tgtgggtgag gctccctccc 480catataactc aaggtttgag tctgttgctt
ggtcagcaag tgcttgccat gatggcacca 540gttggttgac aattggaatt tctggcccag
acaatggggc tgtggctgta ttgaaataca 600atggcataat aacagacact atcaagagtt
ggaggaataa catactgaga actcaagagt 660ctgaatgtgc atgtgtaaat ggctcttgct
ttactgtaat gactgacgga ccaagtaatg 720gtcaggcatc acataagatc ttcaaaatgg
aaaaagggaa agtggttaaa tcagtcgaat 780tggatgctcc caattatcac tatgaggaat
gctcctgtta tcctgatgcc ggcgaaatca 840catgtgtgtg cagggataat tggcatggct
caaatcggcc atgggtatct ttcaatcaaa 900atttggagta tcaaatagga tatatatgca
gtggagtttt tggagacaat ccacgcccca 960atgatggaac aggtagttgt ggtccggtgt
cctctaacgg ggcatatggg gtaaaagggt 1020tttcatttaa atacggcaat ggtgtctgga
tcgggagaac aaaaagcact aattccagga 1080gcggctttga aatgatttgg gatccaaatg
ggtggactga aacggacagt agcttttcag 1140tgaaacaaga tatcgtagca ataactgatt
ggtcaggata tagcgggagt tttgtccagc 1200atccagaact gacaggacta gattgcataa
gaccttgttt ctgggttgag ttgatcagag 1260ggcggcccaa agagagcaca atttggacta
gtgggagcag catatctttt tgtggtgtaa 1320atagtgacac tgtgggttgg tcttggccag
acggtgctga attgccattc accattgaca 1380agtagttgtt ca
1392391410DNAInfluenza virus
39atgaatccaa atcaaaagat aataacgatt ggctctgttt ctctcaccat ttccacaata
60tgcttcttca tgcaaattgc catcttgata actactgtaa cattgcattt caagcaatat
120gaattcaact cccccccaaa caaccaagtg atgctgtgtg aaccaacaat aatagaaaga
180aacataacag agatagtgta tctgaccaac accaccatag agaaggaaat atgccccaaa
240ctagcagaat acagaaattg gtcaaagccg caatgtaaca ttacaggatt tgcacctttt
300tctaaggaca attcgattag gctttccgct ggtggggaca tctgggtgac aagagaacct
360tatgtgtcat gcgatcctga caagtgttat caatttgccc ttgggcaggg aacaacacta
420aacaacgtgc attcaaatga cacagtacat gataggaccc cttatcggac cctattgatg
480aatgagttag gtgttccatt tcatctgggg accaagcaag tgtgcatagc atggtccagc
540tcaagttgtc acgatggaaa agcatggctg catgtttgtg taacggggga tgataaaaat
600gcaactgcta gcttcattta caatgggagg cttgtagata gtattgtttc atggtccaaa
660gaaatcctca ggacccagga gtcagaatgc gtttgtatca atggaacttg tacagtagta
720atgactgatg ggagtgcttc aggaaaagct gatactaaaa tactattcat tgaggagggg
780aaaatcgttc atactagcac attgtcagga agtgctcagc atgtcgagga gtgctcctgc
840tatcctcgat atcttggtgt cagatgtgtc tgcagagaca actggaaagg ctccaatagg
900cccatagtag atataaacat aaaggattat agcattgttt ccagttatgt gtgctcagga
960cttgttggag acacacccag aaaaaacgac agctccagca gtagccattg cttggatcct
1020aacaatgaag aaggtggtca tggagtgaaa ggctgggcct ttgatgatgg aaatgacgtg
1080tggatgggaa gaacgatcag cgagaagtta cgctcaggat atgaaacctt caaagtcatt
1140gaaggctggt ccaaccctaa ttccaaattg cagataaata ggcaagtcat agttgacaga
1200ggtaataggt ccggttattc tggtattttc tctgttgaag gcaaaagctg catcaatcgg
1260tgcttttatg tggagttgat aaggggaaga aaagaggaaa ctgaagtctt gtggacctca
1320aacagtattg ttgtgttttg tggcacctca ggtacatatg gaacaggctc atggcctgat
1380ggggcggaca tcaatctcat gcctatataa
1410401463DNAInfluenza virus 40ccaaaatgaa caatgctacc ttcaactata
caaacgttaa ccctatttct cacatcaggg 60ggagtattat tatcactata tgtgtcagct
tcattgtcat acttactata ttcggatata 120ttgctaaaat tcccatcaac agaaattact
gcaccaacaa tgccattgga ttgtgcaaac 180gcatcaaatg ttcaggctgt gaaccgttct
gcaacaaaag gggtgacact tcttctccca 240gaaccggagt ggacataccc gcgtttatct
tgcccgggct caacctttca gaaagcactc 300ctaattagcc ctcatagatt cggagaaacc
aaaggaaact cagctccctt gataataagg 360gaacctttta ttgcttgtgg accaaaggaa
tgcaaacact ttgctctaac ccactatgca 420gcccaaccag ggggatacta caatggaaca
agaggagaca gaaacaagct gaggcatcta 480atttcagtca aattgggcaa aatcccaaca
gtagaaaact ccattttcca catggcagca 540tggagcgggt ccgcatgcca tgatggtaag
gaatggacat atatcggagt tgatggccct 600gacaataatg cattgctcaa aataaaatat
ggagaagcat atactgacac ataccattcc 660tatgcaaaca acatcctaag aacacaagaa
agtgcctgca attgcatcgg gggaaattgt 720tatcttatga taactgatgg ctcagcttca
ggtgttagtg aatgcagatt tcttaagatt 780cgagagggcc gaataataaa agaaatattt
ccaacaggaa gaataaaaca tactgaagaa 840tgcacatgcg gatttgctag caataaaacc
atagaatgtg cctgtagaga taacagttac 900acagcaaaaa gaccctttgt caaattaaac
gtggagactg atacagcaga aataagattg 960atgtgcacag agacttattt ggacaccccc
agaccagatg atggaagcat aacagggcct 1020tgtgaatcta atggggacaa agggagtgga
ggcatcaagg gaggatttgt ccatcaaaga 1080atggcatcca agattggaag gtggtactct
cgaacgatgt ctaaaactaa aaggatgggg 1140atggggctgt atgtcaagta tgatggagac
ccatgggctg acagtgatgc ccttgctttt 1200agtggagtaa tggtttcaat ggaagaacct
ggttggtact cctttggctt cgaaataaaa 1260gacaagaaat gtgatgtccc ctgtattggg
atagagatgg tacatgatgg tggaaaagag 1320acttggcact cagcagctac agccatttac
tgtttaatgg gctcaggaca gctgctgtgg 1380gacactgtca caggtgttaa tatggctctg
taatggagga atggttgagt ctgttctaaa 1440ccctttgttc ctattttgtt tga
146341101DNAArtificial
SequenceDescription of Artificial Sequence Synthetic oligonucleotide
41gtggagtaaa attggaatca ataggaattt accaaatact gtcaatttat tctacagtgg
60cgagttccct agcactggca atcatggtag ctggtctatc c
1014288DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 42gtggagtaaa attggaatca ataggaattt accaaatact
gtcaatttat tctacagtgc 60actggcaatc atggtagctg gtctatcc
884381DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 43ccatgactcc
aatgtgaaga atctgtatga gaaagtaaaa agccaattaa agaataatgc 60caaagaaata
ggaaacgggt g
814461DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 44ccatgactcc aatgtgaaga atctgtataa agaataatgc
caaagaaata ggaaacgggt 60g
6145202DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 45gcaataactg
attggtcagg atatagcggg agttttgtcc agcatccaga actgacagga 60ctagattgca
taagaccttg tttctgggtt gagttgatca gagggcggcc caaagagagc 120acaatttgga
ctagtgggag cagcatatct ttttgtggtg taaatagtga cactgtgggt 180tggtcttggc
cagacggtgc tg
20246187DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46gcaataactg attggtcagg atatagcggg
agttttgtcc agcatccaga actgacagga 60ctagattgca taagaccttg tttctgggtt
gagttgatca gagggcggcc caaagagagc 120acaatttgga catctttttg tggtgtaaat
agtgacactg tgggttggtc ttggccagac 180ggtgctg
1874798DNAArtificial
SequenceDescription of Artificial Sequence Synthetic oligonucleotide
47ccatcagatt gaaaaagaat tctcagaagt agaagggaga attcaggacc tcgagaaata
60tgttgaggac actaaaatag atctctggtc atacaacg
984883DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 48ccatcagatt gaaaaagaat tctcagaagt agaagggaga
atttatgttg aggacactaa 60aatagatctc tggtcataca acg
8349122DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 49cggtggatta
aacaaaagca agccttacta cacaggggaa catgcaaagg ccataggaaa 60ttgcccaata
tgggtgaaaa cacccttgaa gctggccaat ggaaccaaat atagacctcc 120tg
12250105DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50cggtggatta aacaaaagca agccttacta
cggccatagg aaattgccca atatgggtga 60aaacaccctt gaagctggcc aatggaacca
aatatagacc tcctg 10551119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic oligonucleotide
51catgggctga cagtgatgcc cttgctttta gtggagtaat ggtttcaatg gaagaacctg
60gttggtactc ctttggcttc gaaataaaag acaagaaatg tgatgtcccc tgtattggg
11952102DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52catgggctga cagtgatgcc cttgctttta
gtggaagaac ctggttggta ctcctttggc 60ttcgaaataa aagacaagaa atgtgatgtc
ccctgtattg gg 10253152DNAArtificial
SequenceDescription of Artificial Sequence Synthetic oligonucleotide
53ctaaccgagg tcgaaacgta cgttctctct atcatcccgt caggccccct caaagccgag
60atcgcgcaga aacttgaaga tgtctttgca ggaaagaaca ccgatctcga ggctctcatg
120gagtggctaa agacaagacc aatcctgtca cc
15254141DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54ctaaccgagg tcgaaacgta ccatcccgtc
aggccccctc aaagccgaga tcgcgcagaa 60acttgaagat gtctttgcag gaaagaacac
cgatctcgag gctctcatgg agtggctaaa 120gacaagacca atcctgtcac c
14155107DNAArtificial
SequenceDescription of Artificial Sequence Synthetic oligonucleotide
55ggtccaaccc taattccaaa ttgcagataa ataggcaagt catagttgac agaggtaata
60ggtccggtta ttctggtatt ttctctgttg aaggcaaaag ctgcatc
1075687DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56ggtccaaccc taattccaaa ttgcagataa ataggcaagt
catagtttta ttctggtatt 60ttctctgttg aaggcaaaag ctgcatc
875798DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 57ccatcagatt
gaaaaagaat tctcagaagt agaagggaga attcaggaac tctagaaata 60tgttgaggac
actaaaatag atctctggtc atacaacg
985888DNAArtificial SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 58cgactgggct cagaaatagc cctcaaagag agagaagaag
aaaaaagaga ggattatttg 60gagctatagc aggttttata gagggagg
885965DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 59cgactgggct
cagaaatagc cctcaaagag ttatttggag ctatagcagg ttttatagag 60ggagg
65
User Contributions:
Comment about this patent or add new information about this topic: