p16 MEDIATED REGULATION OF NMDA RECEPTORS

Abstract

tein and variants thereof whose activity at the NMDA receptor causes an increased efflux of calcium ions through the channel of said receptor. This activity is downregulated by the NR3A subunit of NMDA. Also discovered are the nucleic acid sequences encoding said novel protein and variants thereof. The discovery is useful for the diagnosing of NMDA receptor dysregulation and the treatment of NMDA receptor dysregulation related disorders. In addition, the discovery is useful for the further discovery of modulators affecting the activity of the novel protein and variants thereof at the NMDA receptor.

Description

PRIORITY APPLICATIONS

[0001]This application is a divisional of U.S. patent application Ser. No. 10/914,669 (now U.S. Pat. No. 7,544,478), which claims the benefit of priority under 35 U.S.C. 119(e) to U.S. Provisional Application No. 60/494,017, filed Aug. 8, 2003. The disclosures of the above referenced applications are incorporated by reference in its entirety herein.

FIELD OF THE INVENTION

[0003]This invention relates to the discovery of a novel protein, termed p16 and variants thereof, and the discovery that when expressed, p16 causes an increased efflux of cations through the NMDA receptor. The invention also relates to the discovery of novel nucleotide sequences that encode p16. The discovery of the current invention is useful for methods for diagnosing, treating and screening to identify agents useful for treating NMDA receptor dysregulation related diseases and pathological conditions and to compositions having an improved therapeutic profile identified using such screening methods.

BACKGROUND OF THE INVENTION

[0004]Ionotropic glutamate receptors activate ligand-gated cation channels that mediate the predominant component of excitatory neurotransmission in the central nervous system (CNS). These receptors have been classified based on their preference for the glutamate-like agonists (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA), kainate (KA), and N-methyl-D-aspartate (NMDA). All three glutamate receptor subtypes are heteromultimeric complexes, and many of the subunits that comprise them have been identified and characterized. To date, six NMDA receptor subunits (NR1, NR2A-2D and NR3A) have been reported.

[0005]The NMDA receptor (NMDAR) has unique properties distinguishing it from the other glutamate receptor subtypes. First, the activation of NMDAR requires the presence of dual agonists, glutamate (or NMDA) and glycine. The ligand-gated ion channel of the NMDA receptor is, thus, under the control of at least two distinct allosteric sites. In addition, the NMDA receptor controls the flow of both divalent (Ca²+) and monovalent (Na.sup.+, K.sup.+) ions into the postsynaptic neural cell through a receptor associated channel. (Foster et al., "Taking apart NMDA receptors", Nature, 329:395-396, 1987; Mayer et al., "Excitatory amino acid receptors, second messengers and regulation of intracellular Ca²+ in mammalian neurons," Trends in Pharmacol. Sci., 11:254-260, 1990). The activation of these receptors is regulated by Mg²+ in a voltage-dependent manner (i.e., the NMDAR is blocked at resting membrane potential and activated when depolarized). Most importantly; however, the NMDAR is extremely permeable to Ca²+, a key regulator of cell function.

[0006]NMDARs are believed to play a pivotal role in the transmission of excitatory signals from primary sensory neurons to the brain through the spinal cord (A. H. Dickenson (1990) Trends Pharmacol. Sci., 11. 307-309). NMDA receptors mediate Ca²+ influx into neurons, and its receptor-gated channel activity is blocked by Mg²+ in a voltage-dependent manner. These unique properties allow NMDARs to play a critical role in development of the nervous system, synaptic plasticity, memory, and other physiological processes in the CNS.

[0007]However, excessive stimulation of NMDARs has also been implicated in many pathological conditions including stroke, ischemia, head and spinal trauma, headache, epilepsy, neuropathic pain syndromes including diabetic neuropathy, glaucoma, depression and anxiety, drug addiction/withdrawal/tolerance, and in chronic neurodegenerative states, such as Alzheimer's disease, Huntington's disease, HIV-associated dementia, Parkinson's disease, multiple sclerosis, and amyotrophic lateral sclerosis (ALS).

[0008]The molecular cloning and functional analysis of expressed NMDAR subunits, coupled with the examination of their temporal and spatial expression patterns in vivo, has led to significant advances in our understanding of NMDAR function at the molecular level. However, the identification of these subunits alone has failed to explain the observed diversity in NMDAR function, particularly in motor neurons. Thus there is a need to further understand the role of NMDAR subunits in regulating these diverse functions.

[0009]Due to its broad-spectrum of neurological involvement, yet non-universal distribution, investigators are interested in the identification and development of drugs acting at the NMDA receptor. Drugs acting on the NMDA receptor are, therefore, expected to have enormous therapeutic potential. For instance, U.S. Pat. No. 4,904,681, issued to Cordi et al. (Cordi I), describes the use of D-Cycloserine, which was known to modulate the NMDA receptor, to improve/enhance memory and to treat cognitive deficits linked to a neurological disorder. D-Cycloserine is described as a glycine agonist which binds to the strychnine-insensitive glycine receptor.

[0010]U.S. Pat. No. 5,061,721, issued to Cordi et al. (Cordi II), describes the use of a combination of D-cycloserine and D-alanine to treat Alzheimer's disease, age-associated memory impairment, learning deficits, and psychotic disorders, as well as to improve memory or learning in healthy individuals.

[0011]U.S. Pat. No. 5,086,072, issued to Trullas et al., describes the use of 1-aminocyclopropanecarboxylic acid (ACPC), which was known to modulate the NMDA receptor as a partial agonist of the strychnine-insensitive glycine binding site, to treat mood disorders including major depression, bipolar disorder, dysthymia and seasonal effective disorder. It is also therein described that ACPC mimics the actions of clinically effective antidepressants in animal models. In addition, a copending U.S. patent application is cited that describes that ACPC and its derivatives may be used to treat neuropharmacological disorders resulting from excessive activation of the NMDA receptor.

[0012]None of the foregoing offers, however, a satisfactory mechanism for modulating NMDA receptor function. Development of drugs targeting the NMDA receptor, although desirous, has been hindered because the molecular pathway surrounding the NMDA receptor has not yet been completely elucidated. As mentioned above, the NMDAR consists of several protein chains (subunits) embedded in the postsynaptic membrane. Subunits NR1A and NR2A-D from a large extracellular region which probably contains most of the allosteric binding sites, several transmembrane regions looped and folded to form a pore or channel which is permeable to Ca²+, and a carboxyl terminal region. It is believed that the channel is in constant motion, alternating between a cation passing (open) and a cation blocking (closed) state. The opening and closing of the channel is regulated by the binding of various ligands to domains of the protein residing on the extracellular surface and separate from the channel. As such, these ligands are all known as allosteric ligands. The binding of two co-agonist ligands--glycine and glutamate--is thought to effect a conformational change in the overall structure of the protein which is ultimately reflected in the channel opening, partially opening, partially closing, or closing. The binding of other allosteric ligands modulates the conformational change caused or effected by glutamate and glycine. The recently characterized subunit NR3A has been found to act in a novel manner, as compared to subunits NR1A-2D. NR3A downmodulates the NMDAR and this downmodulation has been correlated with a decreased unitary current and Ca²+ permeability of the channel. This unique regulatory behavior associated with the NR3A subunit is believed to have therapeutic importance. For example, studies in mice have shown that the NR3A subunit may protect the young nervous system from excitotoxic damage during development. Thus, it is desirable to further understand the NR3A molecular pathway, thereby allowing for the discovery of therapeutic compounds that modulate this same pathway.

SUMMARY OF THE INVENTION

[0013]NR3A represents a dominant-interfering subunit of the conventional NMDA receptors (Das et al., Nature 393:377). NR3A expression is developmentally regulated, with its peak expression occurring during the first two weeks after birth. NR3A expression persists into adulthood at low levels in restricted areas of the brain. Neurons in NR3A knockout mice manifest increased NMDA-induced currents. Therefore, these mice allow us to identify signal transduction pathways downstream to NMDAR hyperactivation. To this end, inventors identified genes whose expression is altered in NR3A-deficient brains using gene microarrays. Briefly, mRNAs were extracted from WT and NR3A-KO brains at postnatal day 15, and genes that displayed different levels of expression between the two samples were identified. Differential expression of these candidate genes was confirmed using real-time PCR and in situ hybridization. One gene identified in this manner encodes an ORF of 150 amino acids, representing a protein with a predicted MW of 16 kD. This gene was tentatively designated p16. Interestingly, p16 expression was up-regulated in NR3A-KO brains. As expected, up-regulation of p16 occurred in brain areas where NR3A expression is usually observed. These areas included the hippocampus; layer V of the cerebral cortex; and the amygdala. Exogenous p16 was then overexpressed in cultured cortical and hippocampal neurons. In the transfected neurons, Inventors observed that p16 protein was localized at synapses, and resulted in an increase in NMDA- but not AMPA- or GABA-induced currents. Intrestingly, p16 is a member of a large gene family. Based on the analysis of the mouse genome sequence, the estimated number of the gene family is 40-60. This gene family was named Takusan; however, in this current document the term "p16" will be used regardless of the actual molecular weight of the gene products. At least 32 different variants of p16 are expressed in the mouse brain. In addition, it is herein demonstrated that p16 can dimerize itself in cells, and, furthermore, select variants of p16 bind to PSD-95, a protein known to associate with NMDAR subunit 2 (NR2), while other variants do not. Therefore, there is a functional diversity among p16 variants.

[0014]Thus, the invention provides nucleotide sequences and amino acid sequences encoding and forming p16 and the variants thereof (hereinafter "p16"). The invention also provides methods for diagnosing and treating abnormalities in the p16:NMDAR molecular pathway. In addition, the invention provides a method of screening for modulators of said pathway which will increase or decrease signaling through an NMDA receptor. In a still further embodiment the invention provides a method of modulating NMDA receptor dysregulation associated with p16 using agents including, but not limited to, peptides, nucleic acids, small molecules and antibodies.

[0015]In one embodiment, the invention provides a method of modulating a cellular response to glycine or glutamate by introducing a nucleic acid molecule encoding a p16 polypeptide or functional fragment into a cell, and expressing the p16 functional fragment encoded by the nucleic acid molecule in the cell. In another embodiment, the invention provides a method of modulating a cellular response to glycine or glutamate by introducing an antisense nucleic acid molecule, a ribozyme molecule or a small interfering RNA (siRNA) molecule into the cell, wherein the molecule hybridizes to a p16 nucleic acid molecule and prevents translation of the encoded p16 polypeptide.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016]FIGS. 1a, 1b and 1c. Expression of p16 enhances NMDA currents in cultured hippocampal neurons. Representative NMDA, AMPA, and GABA currents from a control neuron (EGFP) and a neuron containing p16 (p16-EGFP) are shown in FIGS. 1a and 1b. NMDA, AMPA and GABA current densities in p16-EGFP neurons is shown in FIG. 1c.

[0017]FIGS. 2a, 2b and 2c show that expression of p16 enhances recombinant NR1/NR2A currents in HEK293 cells.

[0018]FIG. 3 shows that p16 expression is upregulated in NR3A knockout mice as compared to wild type using a p16 probe for in-situ hybridization.

[0019]FIGS. 4a and 4b. From the 90 cDNA clones amplified by RT-PCR of the C57BL/6 WT mouse brain (male, 6 week old); 34 variants of p16-related proteins were identified. FIG. 4a shows these 34 amino-acid sequences, (SEQ ID Nos.: 4 through 37). In FIG. 4a, amino acid sequences are aligned against each other for comparison and, thus, are shown in 3 parts; line 1 of 3, line 2 of 3 and line 3 of 3. The nucleotide sequences for all clones are shown in FIG. 4b, (SEQ ID Nos.: 38 through 71). In FIG. 4b, the nucleotide sequences are again aligned for comparison, and, thus, must again be shown in parts. Due to the size of the nucleotide sequences there are 18 parts.

[0020]FIG. 5 is a schematic representation of many of the p16 variants identified in the current invention.

[0021]FIG. 6 is an immunoblot showing that p16 protein can dimerize in cells.

[0022]FIG. 7 is an immunoblot showing that select p16 variants can associate with PSD-95

[0023]FIG. 8 is an illustration of a model for p16 function in a putative positive-feedback loop regulating NMDA receptor activity.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0024]As used herein the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. For example, "a compound" refers to one or more of such compounds, while "the enzyme" includes a particular enzyme as well as other family members and equivalents thereof as known to those skilled in the art.

[0025]As used herein, the terms "polypeptide" and "polypeptides" refer to a genus of polypeptide or peptide fragments that encompass the amino acid sequences identified herein, as well as smaller fragments. Alternatively, a polypeptide may be defined in terms of its antigenic relatedness to any peptide encoded by the nucleic acid sequences of the invention. Thus, in one embodiment, a polypeptide within the scope of the invention is defined as an amino acid sequence comprising a linear or 3-dimensional epitope shared with any peptide encoded by the nucleic acid sequences of the invention. Alternatively, a polypeptide within the scope of the invention is recognized by an antibody that specifically recognizes any peptide encoded by the nucleic acid sequences of the invention.

[0026]As used herein, the term "isolated," in reference to polypeptides or proteins, means that the polypeptide or protein is substantially removed from polypeptides, proteins, nucleic acids, or other macromolecules with which it, or its analogues, occurs in nature. Although the term "isolated" is not intended to require a specific degree of purity, typically, the protein will be at least about 75% pure, more typically at least about 90% pure, preferably at least about 95% pure, and more preferably at least about 99% pure.

[0027]Generally, the nomenclature used hereafter and the laboratory procedures in cell culture, molecular genetics, and nucleic acid chemistry and hybridization described below are those well known and commonly employed in the art. Standard techniques are used for recombinant nucleic acid methods, polynucleotide synthesis, cell culture, and transgene incorporation (e.g., electroporation, microinjection, lipofection). Generally enzymatic reactions, oligonucleotide synthesis, and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references which are provided throughout this document, as well as: Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring Harbor, N.Y.; and Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif., which are incorporated herein by reference. Oligonucleotides can be synthesized on an Applied Bio Systems oligonucleotide synthesizer according to specifications provided by the manufacturer. The procedures are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

[0028]As used herein, the term "agonist" refers to an agent which produces activation of p16 and provides for a substantial increase in NMDAR activation.

[0029]As used herein, the term "antagonist" refers to an agent which opposes the agonist activity of a known agonist of p16.

[0030]The term "candidate compound" refers to any molecule that potentially acts as a ligand, agonist or antagonist in the screening methods disclosed herein. A candidate compound can be a naturally occurring macromolecule, such as a polypeptide, amino acid, nucleic acid, carbohydrate, lipid, or any combination thereof. A candidate compound also can be a partially or completely synthetic derivative, analog or mimetic of such a macromolecule, or a small organic molecule prepared by combinatorial chemistry methods. If desired in a particular assay format, a candidate compound can be detectably labeled or attached to a solid support.

[0031]Methods for preparing large libraries of compounds, including simple or complex organic molecules, metal-containing compounds, carbohydrates, peptides, proteins, peptidomimetics, glycoproteins, lipoproteins, nucleic acids, antibodies, and the like, are well known in the art and are described, for example, in Huse, U.S. Pat. No. 5,264,563; Francis et al., Curr. Opin. Chem. Biol. 2:422-428 (1998); Tietze et al., Curr. Biol., 2:363-371 (1998); Sofia, Mol. Divers. 3:75-94 (1998); Eichler et al., Med. Res. Rev. 15:481-496 (1995); and the like. Libraries containing large numbers of natural and synthetic compounds also can be obtained from commercial sources.

[0032]The number of different candidate compounds to test in the methods of the invention will depend on the application of the method. For example, one or a small number of candidate compounds can be advantageous in manual screening procedures, or when it is desired to compare efficacy among several predicted ligands, agonists or antagonists. However, it is generally understood that the larger the number of candidate compounds, the greater the likelihood of identifying a compound having the desired activity in a screening assay. Additionally, large numbers of compounds can be processed in high-throughput automated screening assays. Therefore, "one or more candidate compounds" can be, for example, 2 or more, such as 5, 10, 15, 20, 50 or 100 or more different compounds, such as greater than about 103, 105 or 107 different compounds, which can be assayed simultaneously or sequentially

[0033]The term "detectable label" refers to any moiety that can be selectively detected in a screening assay. Examples include without limitation, radiolabels, (e.g., ³H, sup.14C, ³5S, ¹²⁵I, ¹³¹I), affinity tags (e.g. biotin/avidin or streptavidin, binding sites for antibodies, metal binding domains, epitope tags, FLASH binding domains--See U.S. Pat. Nos. 6,451,569; 6,054,271; 6,008,378 and 5,932,474-- glutathione or maltose binding domains) fluorescent or luminescent moieties (e.g. fluorescein and derivatives, GFP, rhodamine and derivatives, lanthanides etc.), and enzymatic moieties (e.g. horseradish peroxidase, β-galactosidase, β-lactamase, luciferase, alkaline phosphatase). Such detectable labels can be formed in situ, for example, through use of an unlabeled primary antibody which can be detected by a secondary antibody having an attached detectable label.

[0034]The methods of detecting a p16 nucleic acid molecule or peptide in a sample can be either qualitative or quantitative, and can detect the presence, abundance, integrity or structure of the nucleic acid molecule, as desired for a particular application. Suitable hybridization-based assay methods include, for example, in situ hybridization, Northern blots, RNase protection assays, Western blots and Southern blots, which can be used to determine the copy number and integrity of DNA. A hybridization probe can be labeled with any suitable detectable moiety such as those listed directly above. These methods are well known to those of ordinary skill in the art.

[0035]The term "DNA binding domain" or "DBD" refers to protein domain capable of binding to a specific DNA sequence, and comprising at least one zinc finger sequence.

[0036]The term "functional fragment" refers to a portion of a full-length p16 polypeptide that retains at least one biological activity characteristic of the full-length polypeptide. A functional fragment can contain, for example, at least about 6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 125, 150, 200 or more amino acids of a polypeptide. The remaining amino acid sequence is identical to, or exhibits substantial identity to, the corresponding positions in the naturally-occurring sequence.

[0037]As used herein, the term "functionally expressed" refers to a coding sequence which is transcribed, translated, post-translationally modified (if relevant), and positioned in a cell such that the protein provides the desired function. With reference to a reporter cassette, functional expression generally means production of a sufficient amount of the encoded cell surface reporter protein to provide a statistically significant detectable signal to report transcriptional effects of a reporter polynucleotide.

[0038]As used herein, the term "LBD" or "ligand-binding domain" refers to the protein domain of a receptor, such as a NMDA receptor or other suitable receptor as discussed herein, which binds a physiological ligand and thereupon undergoes a conformational change and/or altered intermolecular interaction with an associated protein so as to confer a detectable activity.

[0039]As used herein, the term "ligand" refers to any biological or chemical compound that binds the recited polypeptide, fragment or receptor with high affinity. High affinity binding refers to binding with a Kd of less than about 10^-3 M, such as less than 10^-5 M, and often less than 10^-7 M. p16 antibodies are examples of ligands of p16. As used herein, antibodies are defined to be "specifically binding'" to a polypeptide if they bind polypeptides of the current invention with a K_a of greater than or equal to about 10⁷ times M^-1.

[0040]A "p16 ligand" can further be an agonist or antagonist of p16, as described below, or can be a compound having little or no effect on p16 biological activity. For example, a ligand without agonistic or antagonistic activity can be used to specifically target a diagnostic or therapeutic moiety to cells and tissues that express an excitatory glycine receptor. Thus, an identified ligand can be labeled with a detectable moiety, such as a radiolabel, fluorochrome, ferromagnetic substance, or luminescent substance, and used to detect normal or abnormal expression of an excitatory glycine receptor in an isolated sample or in in vivo diagnostic imaging procedures. Likewise, an identified ligand can be labeled with a therapeutic moiety, such as a cytotoxic or cytostatic agent or radioisotope, and administered in an effective amount to arrest proliferation or kill a cell or tissue that aberrantly expresses an excitatory glycine receptor for use in therapeutic applications described further below.

[0041]Binding assays, including high-throughput automated binding assays, are well known in the art and can be used in the invention methods. The assay format can employ a cell, cell membrane, artificial membrane system, or purified polypeptide, fragment or receptor, either in solution or attached to a solid phase. If desired, the binding assay can be performed in the presence of a known ligand of p16.

[0042]Suitable assays that can be used for detecting ligand binding include, for example, scintillation proximity assays (SPA) (Alouani, Methods Mol. Biol. 138:135-41 (2000)), UV or chemical cross-linking (Fancy, Curr. Opin. Chem. Biol. 4:28-33 (2000)), competition binding assays (Yamamura et al., Methods in Neurotransmitter Receptor Analysis, Raven Press, New York, 1990), biomolecular interaction analysis (BIA) (Weinberger et al., Pharmacogenomics 1:395-416 (2000)), mass spectrometry (MS) (McLafferty et al., Science 284:1289-1290 (1999) and Degterev, et al., Nature Cell Biology 3:173-182 (2001)), nuclear magnetic resonance (NMR) (Shuker et al., Science 274:1531-1534 (1996), Hajduk et al., J. Med. Chem. 42:2315-2317 (1999), and Chen and Shapiro, Anal. Chem. 71:669 A-675A (1999)), fluorescence polarization assays (FPA) (Degterev et al., supra, 2001); surface plasmon resonance (SPR) (Liparoto et al., J. Mol. Recognit. 12:316-321 (1999)); protein chip proteomic array analysis (e.g. ProteinChip® System from Ciphergen Biosystems, which can be used in tandem with mass spectrometry analysis for sequence or structure determination), and in silico screening, whereby a library of compounds are screened using a computer based platform for an efficient method for filtering large virtual compound libraries.

[0043]An exemplary assay that has been used successfully to identify ligands of an NMDA receptor is phage display (see Li et al., Nature Biotech. 14:986-991 (1996)). A similar phage display approach can be applied to determine p16 ligands and excitatory glycine receptor ligands.

[0044]Exemplary high-throughput receptor binding assays are described, for example, in Mellentin-Micelotti et al., Anal. Biochem. 272:P182-190 (1999); Zuck et al., Proc. Natl. Acad. Sci. USA 96:11122-11127 (1999); and Zhang et al., Anal. Biochem. 268:134-142 (1999). Other suitable methods are well known in the art.

[0045]As used herein, "linked" means in polynucleotide linkage (i.e., phosphodiester linkage) or polypeptide linkage, depending upon the context of usage. "Unlinked" means not linked to another polynucleotide or polypeptide sequence; hence, two sequences are unlinked if each sequence has a free 5' terminus and a free 3' terminus.

[0046]As used herein, the term "modulator" refers to a wide range of candidate compounds, including, but not limited to natural, synthetic or semi-synthetic organic molecules, proteins, oligonucleotides and antisense, that directly or indirectly influence the activity of the p16 and or NR3A pathway. Furthermore, the precursor of a modulator (i.e., a compound that can be converted into a modulator) is also considered to be a modulator. Similarly, a compound which converts a precursor into a modulator is also considered to be a modulator.

[0047]"Naturally fluorescent protein" refers to proteins capable of forming a highly fluorescent, intrinsic chromophore either through the cyclization and oxidation of internal amino acids within the protein or via the enzymatic addition of a fluorescent co-factor. Typically such chromophores can be spectrally resolved from weakly fluorescent amino acids such as tryptophan and tyrosine. Endogenously fluorescent proteins have been isolated and cloned from a number of marine species including the sea pansies Renilla reniformis, R. kollikeri and R. mullerei and from the sea pens Ptilosarcus, Stylatula and Acanthoptilum, as well as from the Pacific Northwest jellyfish, Aequorea victoria; Szent-Gyorgyi et al. (SPIE conference 1999), D. C. Prasher et al., Gene, 111:229-233 (1992) and red and yellow fluorescent proteins from coral. A variety of mutants of the GFP from Aequorea victoria have been created that have distinct spectral properties, improved brightness and enhanced expression and folding in mammalian cells compared to the native GFP, (Green Fluorescent Proteins, Chapter 2, pages 19 to 47, edited Sullivan and Kay, Academic Press, U.S. Pat. Nos. 5,625,048 to Tsien et al., issued Apr. 29, 1997; 5,777,079 to Tsien et al., issued Jul. 7, 1998; and U.S. Pat. No. 5,804,387 to Cormack et al., issued Sep. 8, 1998). In many cases these functional engineered fluorescent proteins have superior spectral properties to wildtype proteins and are preferred for use as reporter genes in the present invention. Preferred naturally fluorescent proteins include without limitation, EGFP, YFP, Renilla GFP and DS red.

[0048]The terms "nucleotide sequence" "nucleic acid" or "nucleic acid molecule," as used herein, refer to a deoxyribonucleotide or ribonucleotide polymer in either single-or-double-stranded form, and unless otherwise limited, would fully encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides.

[0049]Accordingly, a designated sequence identifier, unless specified otherwise, is intended to refer to the single-stranded molecule having the recited sequence, the single-stranded complement of the recited sequence, or a double stranded (or partially double-stranded) molecule in which one strand has the recited sequence. A nucleic acid molecule can optionally include one or more non-native nucleotides, having, for example, modifications to the base, the sugar, or the phosphate portion, or having a modified phosphodiester linkage. Such modifications can be advantageous in increasing the stability of the nucleic acid molecule. Furthermore, a nucleic acid molecule can include, for example, a detectable moiety, such as a radiolabel, a fluorochrome, a ferromagnetic substance, a luminescent tag or a detectable binding agent such as biotin. Such modifications can be advantageous in applications where detection of a hybridizing nucleic acid molecule is desired.

[0050]Some of the nucleic acid molecules of the present invention are derived from DNA or RNA isolated at least once in substantially pure form and in a quantity or concentration enabling identification, manipulation, and recovery of its component nucleotide sequence by standard biochemical methods. Examples of such methods, including methods for PCR, RT-PCR, SSCP analysis and coupled PCR transcription and translation analysis protocols that may be used herein, are disclosed in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989), Ausubel, F. A., et al., eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., New York (1987), and Innis, M., et al. (Eds.) PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, Calif. (1990). Reference to a nucleic acid molecule also includes its complement as determined by the Standard Watson-Crick base-pairing rules, with Uracil (U) in RNA replacing Thymine (T) in DNA, unless the complement is specifically excluded.

[0051]As used herein, the nucleic acid molecules of the invention include DNA in both single-stranded and double-stranded form, as well as the DNA or RNA complement thereof (e.g., sense or antisense). DNA includes, for example, DNA, genomic DNA, chemically synthesized DNA, DNA amplified by PCR, and various combinations thereof. Genomic DNA, including translated, non-translated and control regions, may be isolated by conventional techniques, e.g., using any one of the cDNAs of the invention, or suitable fragments thereof, as a probe to identify a piece of genomic DNA which can then be cloned using methods commonly known in the art.

[0052]Polypeptides encoded by the nucleic acids of the invention are fully encompassed by the invention. As used herein, reference to a nucleic acid "encoding" a protein or a polypeptide encompasses not only cDNAs and other intronless nucleic acids, but also DNAs, such as genomic DNA, with introns, on the assumption that the introns included have appropriate splice donor and acceptor sites that will ensure that the introns are spliced out of the corresponding transcript when the transcript is processed in a eukaryotic cell. Due to the degeneracy of the genetic code, wherein more than one codon can encode the same amino acid, multiple DNA sequences can code for the same polypeptide. Such variant DNA sequences can result from genetic drift or artificial manipulation, such as occurring during PCR amplification or as the product of deliberate mutagenesis of a native sequence. Deliberate mutagenesis of a native sequence can be carried out using numerous techniques well known in the art. For example, oligonucleotide-directed site-specific mutagenesis procedures can be employed, particularly where it is desired to mutate a gene such that predetermined restriction nucleotides or codons are altered by substitution, deletion, or insertion. Exemplary methods of making such alteration are disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, Jan. 12-19, 1985); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); Kunkel (Proc. Natl. Acad. Sci. USA 82:488, 1985); Kunkel et al. (Methods in Enzymol. 154:367, 1987). The present invention thus fully encompasses any nucleic acid capable of encoding a protein of the current invention.

[0053]As used herein, the term "variant" refers to a polypeptide substantially homologous to a native polypeptide, but which has an amino acid sequence different from that encoded by any of the nucleic acid sequences of the invention because of one or more deletions, insertions or substitutions. Variants may be naturally occurring or artificially constructed. Variants can comprise conservatively substituted sequences, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. See Zubay, Biochemistry, Addison-Wesley Pub. Co., (1983).

[0054]It is a well-established principle of protein and peptide chemistry that certain amino acids substitutions, entitled "conservative" amino acid substitutions, can frequently be made in a protein or a peptide without altering either the confirmation or the function of the protein or peptide. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.

[0055]The above-mentioned substitutions are not the only amino acid substitutions that can be considered "conservative." Other substitutions can also be considered conservative, depending on the environment of the particular amino acid. For example, glycine (G) and alanine (A) can frequently be interchangeable, as can be alanine and valine (V). Methionine (M), which is relatively hydrophobic, can frequently be interchanged with leucine and isoleucine, and sometimes with valine. Lysine (K) and arginine (R) are frequently interchangeable in locations in which the significant feature of the amino acid residue is its charge and the differing pKs of these two amino acid residues are not significant. Still other changes can be considered "conservative" in particular environments.

[0056]The effects of such substitutions can be calculated using substitution score matrices such as PAM120, PAM-200, and PAM-250 as discussed in Altschul, (J. Mol. Biol. 219:55565 (1991)). Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known.

[0057]Naturally-occurring and artificially constructed peptide variants are also encompassed by the present invention. Examples of such variants are proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the polypeptides described herein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the polypeptides encoded by the sequences of the invention.

[0058]As used herein, the term "splice variant" refers to a polypeptide generated from one of several RNA transcripts resulting from splicing of a primary transcript. Naturally-occurring and artificially constructed peptide splice variants are also encompassed by the present invention.

[0059]As used herein, the terms "hybridization" and "in situ hybridization" refer to conditions and washes under which nucleotide sequences that are significantly identical or homologous to each other remain bound to each other. Appropriate hybridization conditions can be selected by those skilled in the art with minimal experimentation as exemplified in Ausubel, F. A., et al., eds., Current Protocols in Molecular Biology Vol. 2, John Wiley and Sons, Inc., New York (1995). Additionally, stringency conditions are described in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989). Variations on the conditions for low, moderate, and high stringency are well known in the art and may be used with the current invention.

[0060]As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence using the coding sequence as a template. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, since enhancers generally function when separated from the promoter by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably linked but not contiguous. A structural gene (e.g., a HSV tk gene) which is operably linked to a polynucleotide sequence corresponding to a transcriptional regulatory sequence of an endogenous gene is generally expressed in substantially the same temporal and specific pattern as is the naturally-occurring gene. Methods for operatively linking a nucleic acid to a desired promoter are well known in the art and include, for example, cloning the nucleic acid into a vector containing the desired promoter, or appending the promoter to a nucleic acid sequence using PCR.

[0061]A vector of the invention can include a variety of elements useful for cloning and/or expression of the encoded nucleic acid molecule in the desired host cell, such as promoter and/or enhancer sequences, which can provide for constitutive, inducible or cell-specific RNA transcription; transcription termination and RNA processing signals, including polyadenylation signals, which provide for stability of a transcribed mRNA sequence; an origin of replication, which allows for proper episomal replication; selectable marker genes, such as a neomycin or hygromycin resistance gene, useful for selecting stable or transient transfectants in mammalian cells, or an ampicillin resistance gene, useful for selecting transformants in prokaryotic cells; and versatile multiple cloning sites for inserting nucleic acid molecules of interest.

[0062]Cloning vectors of the invention include, for example, viral vectors such as a bacteriophage, a baculovirus or a retrovirus; cosmids or plasmids; and, particularly for cloning large nucleic acid molecules, bacterial artificial chromosome vectors (BACs) and yeast artificial chromosome vectors (YACs). Such vectors are commercially available, and their uses are well known in the art.

[0063]Thus, an invention nucleic acid molecule operatively linked to a promoter can be used to express p16 transcripts and polypeptides in a desired host cell, or in an in vitro system, such as an extract or lysate that supports transcription and translation.

[0064]For use in the gene therapy applications described further below, a nucleic acid molecule of the invention can be incorporated into suitable gene therapy vector, such as a viral vector or plasmid. Viral based vectors are advantageous in being able to introduce relatively high levels of a heterologous nucleic acid into a variety of cells, including nondividing cells.

[0065]Suitable viral vectors for gene therapy applications are well known in the art, and include, for example, Herpes simplex virus vectors (U.S. Pat. No. 5,501,979), Vaccinia virus vectors (U.S. Pat. No. 5,506,138), Cytomegalovirus vectors (U.S. Pat. No. 5,561,063), Modified Moloney murine leukemia virus vectors (U.S. Pat. No. 5,693,508), adenovirus vectors (U.S. Pat. Nos. 5,700,470 and 5,731,172), adeno-associated virus vectors (U.S. Pat. No. 5,604,090), constitutive and regulatable retrovirus vectors (U.S. Pat. Nos. 4,405,712; 4,650,764 and 5,739,018, 5,646,013, 5,624,820, 5,693,508 and 5,674,703), papilloma virus vectors (U.S. Pat. Nos. 5,674,703 and 5,719,054), lentiviral vectors (Kafri et al., Mol. Ther. 1:516-521 (2000), and the like. For targeting neural cells in the treatment of neuronal diseases, adenoviral vectors, Herpes simplex virus vectors and lentiviral vectors are particularly useful.

[0066]For gene therapy applications, the nucleic acid molecule can be administered to a subject by various routes. For example, local administration at the site of a pathology can be advantageous because there is no dilution effect and, therefore, the likelihood that a majority of the targeted cells will be contacted with the nucleic acid molecule is increased. This is particularly true in the eye, where either intravitreal or intraretinal administration is possible. In addition, administration can be systemic, such as via intravenous or subcutaneous injection into the subject. For example, following injection, viral vectors will circulate until they recognize host cells with the appropriate target specificity for infection.

[0067]Receptor-mediated DNA delivery approaches also can be used to deliver a nucleic acid molecule into cells in a tissue-specific manner using a tissue-specific ligand or an antibody that is non-covalently complexed with the nucleic acid molecule via a bridging molecule. Direct injection of a naked nucleic acid molecule or a nucleic acid molecule encapsulated, for example, in cationic liposomes also can be used for stable gene transfer into non-dividing or dividing cells. In addition, a nucleic acid molecule can be transferred into a variety of tissues using the particle bombardment method.

[0068]Contemplated promoters and expression vectors provide for expression in bacterial cells, yeast cells, insect cells, amphibian cells, plant cells, mammalian cells (including human, non-human primate and rodent cells) and other vertebrate cells. A variety of promoters and expression vectors suitable for such purposes are commercially available, and can be further modified, if desired, to include appropriate regulatory elements to provide for the desired level of expression or replication in the host cell.

[0069]A "reporter gene" includes any gene that directly or indirectly produces a specific reporter gene product, detectable label, enzymatic moiety, or cellular phenotype, such as drug resistance that can be used to monitor transcription of that gene. Preferred reporter genes include proteins with an enzymatic activity that provides enzymatic amplification of gene expression such as β-lactamase, luciferase, β-galactosidase, catalytic antibodies and alkaline phosphatase. Other reporter genes include proteins such as naturally fluorescent proteins or homologs thereof, cell surface proteins or the native or modified forms of an endogenous gene to which a specific assay exists or can be developed in the future. Preferred reporter genes for use in the present invention provide for multiplexed analysis.

[0070]As used herein, the term "sample" is intended to mean any biological fluid, cell, tissue, organ or portion thereof that contains or potentially contains a p16 nucleic acid molecule or polypeptide. For example, a sample can be a histologic section of a specimen obtained by biopsy, or cells that are placed in or adapted to tissue culture. A sample further can be a subcellular fraction or extract, or a crude or substantially pure nucleic acid or protein preparation. A sample can be prepared by methods known in the art suitable for the particular format of the detection method employed.

[0071]As used herein, the phrase "system" refers to an intact organism or a cell-based system containing the various components required for analyzing the p16, NR3A and or p16/NR3A cellular pathway in response to the test compounds described herein.

[0072]The term "serial analysis" means that a test compound is analyzed and ranked based on a single activity. For example, compounds selected based solely on binding affinity, efficacy, ability to promote co-activator recruitment, ability to cause co-repressor dissociation or any other single factor, without reference to any other assay result or characteristic, are considered for the purposes here to be subject to "serial analysis." A compound may be subject to multiple rounds of serial analysis, each round being based on data created from a single activity. For purposes here this analysis strategy is not considered to be equivalent to parallel analysis so long as each analysis or ranking step is completed independently of each other.

[0073]The phrases "substantially identical," "substantial identity," "substantially similar" or "substantial similarity" mean that a relevant sequence is at least 70%, 75%, 80%, 85%, 90%, 92%, 95% 96%, 97%, 98%, or 99% identical to a given sequence. By way of example, such sequences may be allelic variants, sequences derived from various species, sequences derived from various loci within the same species, or they may be derived from the given sequence by truncation, deletion, amino acid substitution or addition. Percent identity between two sequences is determined by standard alignment algorithms such as ClustalX, GAP or BESTFIT when the two sequences are in best alignment according to the alignment algorithm. Preferably, residue positions which are not identical differ by conservative amino acid substitutions. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.

[0074]"Treating" or "treatment" as used herein covers the treatment of a disease-state associated with activity as disclosed herein, and includes: [0075]a) preventing a disease-state associated with p16 activity from occurring; [0076]b) inhibiting a disease-state associated with p16 activity, i.e., arresting its development; or [0077]c) relieving a disease-state associated with p16 activity, i.e., causing regression of the condition.

[0078]The term "transcription activation domain" is used herein refers to a protein, or protein domain with the capacity to enhance transcription of a structural sequence in-trans. The ability to enhance transcription may affect the inducible transcription of a gene, or may effect the basal level transcription of a gene, or both. For example, a reporter polynucleotide may comprise a minimal-promoter driving transcription of a sequence encoding a reporter gene. Such a reporter polypeptide may be transferred to a cell line for use in the creation of a modified host cell. Cloned sequences that silence expression of the reporter gene in cells cultured in the presence of an agonist also may be included (e.g., to reduce basal transcription and ensure detectable inducibility). Numerous other specific examples of transcription regulatory elements, such as specific minimal promoters and response elements are known to those of skill in the art and may be selected for use in the methods and polynucleotide constructs of the invention on the basis of the practitioner's desired application. Literature sources and published patent documents, as well as GenBank and other sequence information data sources can be consulted by those of skill in the art in selecting suitable transcription regulatory elements and other structural and functional sequences for use in the invention. Where necessary, a transcription regulatory element may be constructed by synthesis (and ligation, if necessary) of oligonucleotides made on the basis of available sequence information (e.g., GenBank sequences for a UAS, response element, minimal promoter etc).

[0079]Unless specified otherwise, the lefthand end of single-stranded polynucleotide sequences is the 5' end; the lefthand direction of double-stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".

[0080]As used herein, the term "transcriptional regulatory sequence" refers to a polynucleotide sequence or a polynucleotide segment which, when placed in operable linkage to a transcribable polynucleotide sequence, can produce transcriptional modulation of the operably linked transcribable polynucleotide sequence. A positive transcriptional regulatory element is a DNA sequence which activates transcription alone or in combination with one or more other DNA sequences. Typically, transcriptional regulatory sequences comprise a promoter, or minimal promoter and frequently a response element, and may include other positive and/or negative response elements as are known in the art or as can be readily identified by conventional transcription activity analysis (e.g., with "promoter trap" vectors, transcription rate assays, and the like). Often, transcriptional regulatory sequences include a promoter and a transcription factor recognition site and/or response elements. The term often refers to a DNA sequence comprising a functional promoter and any associated transcription elements (e.g., enhancer, CCAAT box, TATA box, SP1 site, etc.) that are essential for transcription of a polynucleotide sequence that is operably linked to the transcription regulatory region. Enhancers and promoters include, but are not limited to, herpes simplex thymidine kinase promoter, cytomegalovirus (CMV) promoter/enhancer, SV40 promoters, pga promoter, regulatable promoters and systems (e.g., metallothionein promoter, the ecdysone promoter, the Tet on/Tet-off system, the PIP on/PIP off system, etc) adenovirus late promoter, vacinia virus 7.5 K promoter, and the like, as well as any permutations and variations thereof.

[0081]Since the list of technical and scientific terms cannot be all encompassing, any undefined terms shall be construed to have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. Reference to a "restriction enzyme" or a "high fidelity enzyme" may include mixtures of such enzymes and any other enzymes fitting the stated criteria, or reference to the method includes reference to one or more methods for obtaining cDNA sequences which will be known to those skilled in the art or will become known to them upon reading this specification.

[0082]Discovery Cloning and Characterization of a Novel Peptide

[0083]The present invention relates to the cloning and characterization of a novel peptide, termed p16. The present invention also relates to the identification of amino acid sequences and nucleotide sequences comprising p16 and variants thereof (hereinafter "p16"). The present invention also relates to the determination that p16 is involved in the activation of NMDA receptors. The invention provides molecules and methods for screening candidate compounds to discover modulators of p16, NMDAR, NR3A and other proteins involved in the regulation of p16 mediates cation efflux in NMDAR. The invention provides molecules and methods that can be used to prevent or ameliorate conditions in which inappropriate NMDA receptor activation, or inappropriate responses to glycine or glutamate, are involved. The invention also provides molecules and methods used to diagnose conditions related to the dysregulation of p16 mediated cation efflux in NMDAR.

[0084]NR3A represents a dominant-interfering subunit of the conventional NMDA receptors (Das et al., Nature 393:377). NR3A expression is developmentally regulated, with its peak expression occurring during the first two weeks after birth. NR3A expression persists into adulthood at low levels in restricted areas of the brain. Neurons in NR3A knockout mice manifest increased NMDA-induced currents. Therefore, these mice allow Inventors to identify signal transduction pathways downstream to NMDAR hyperactivation. To this end, Inventors searched for genes having altered expression in NR3A-deficient brains. Inventors' selected to search using gene microarrays. Gene chips were obtained from the Ontario Cancer Center for microarray analysis between the NR3A knockout cells and wildtype cells (WT). mRNAs were extracted from WT and NR3A-KO brains at postnatal day 15, and genes that displayed different levels of expression between the two samples were identified. Inventors confirmed differential expression of these candidate genes using real-time PCR and in situ hybridization. One gene that was identified in this manner encodes an ORF of 150 amino acids, representing a protein with a predicted MW of 16 kD. The gene has the following sequence (SEQ ID No.: 1):

TABLE-US-00001 1 ggcttggatc ccagagccca gcctgggagg aaccggggct cctggtgtac catcatcatc 61 cccaacactc ctgttcagaa gatgggtgag gaaagtggaa agtctaacca gtcagccgat 121 gaccagtggg aaaaatgagc tacaagatca cctgatcttc atcagtgaga aagctttgca 181 caagagggtc tgctagaaat acttcaaccc aaaattccaa aatgaccaag aagagatcaa 241 aaataaatga actagaagaa ctgaaattgg atatgaggaa gatcagcaat gacatggagg 301 aaatgtgtgg aatcctgaac ctttacatgt atgaggattt gaactacagg atgaacactg 361 aattcaacat cattaaatca caacatgaga agacaatgtt ggatatgaat aaaatgatcc 421 agtccataat tggttccatg cagtactcca aggaactgat agaagataac tattcctaca 481 gcattaagga ggaccacctc ctccgtgagt gcactcaact caacgaaaac gtaaggatat 541 tactgaatga gaacagaagg ctgctggtgg agcaggctgg ccataagtgt cctgtgggga 601 agaaaagagg ttctgtgagg aggccagcaa gaacatctgt gtcccaagtg ccaaggaaca 661 gcagtgtgat atagtccagc agaaagcaga acatggcaca gaccacgaca tgatctccct 721 caaagagaag tgctggagga agagcactga gtgtgcacag gaaatacacc actgttgcct 781 ctcatcccta ataaccatgg ctgtaatggg ctgtatgctc ctcttttatt ttgtttcttt 841 ggtacgaaca ggccttaatt tcatctagcc tctggcccag gaagagtgca catttaaagg 901 gactcagaga aatgctgaga cacatcaaga gctgctgggc atccaggaag attctgagag 961 tttatattta tcttttcctg atgggtcatc atcaataatt acatggagat cagtcaacaa 1021 aattgtaaaa ccttggatcc aagtctacaa catgtgttct gctttgactt gggaggccat 1081 atccttcaga cccacactcc aaaaggagag tgttgcttaa atttctcctg caaagtttgt 1141 tacctccagg aactactttt ctactaagtt gccaaggaca gccacaggct gtaagtctgt 1201 gctacaaaat gagcagacta agaattttgc tttgcacaac ttttgtggtt tgattttggt 1261 ttgagttttg attagtttag ttatttgttt tttcttgttt tcattcaaag ttttgttatt 1321 tattggttat ttattgttct tttaattaat ttgatatttt gataaggtta tacacagtac 1381 atattgactg tcagctttca gttacaattg agtacattgc attttttctt atgactaaca 1441 cagtgatctc caactcttca ctctaagagc cttgttattt cagttgtgat catgaaatcc 1501 cacagatatc agacccagat ggatctctgc actcttcatg ggacttgggc tccatagttt 1561 cttccgagcc ggacttaact acaaagtcct tcatacattc agtatggaga gtttttctaa 1621 ctgtctgtat aggaacttaa tgatggaaaa cttacccatg ctgcatcgtt gctgtcaaat 1681 atttagctac tgtgaaaatc ctgtggatta tggtgttgaa cgcattaatg gcaaatacat 1741 cagtatttct gtaatagctc tcattaaatc aaagcatagt ctaagggaat aaaaagctgt 1801 cagaaaacac agcagtgtat gcttctgcgt tccttcaaat atacaatcac tggtaattgc 1861 aagtggtttc tgtgggggtc cttcaatgtt cattttatta ctttatgatt cacctgtgcc 1921 tgccaaaaaa catcactcaa aaacaatgaa gattgtaatt aggtatcatc ctataaaatc 1981 ctaacaaatg cc

The ORF within SEQ ID No.: 1 has the following sequence (SEQ ID No.: 2):

TABLE-US-00002 ATGACCAAGAAGAGATCAAAAATAAATGAACTAGAAGAACTGAAATTGG ATATGAGGAAGATCAGCAATGACATGGAGGAAATGTGTGGAATCCTGAAC CTTTACATGTATGAGGATTTGAACTACAGGATGAACACTGAATTCAACAT CATTAAATCACAACATGAGAAGACAATGTTGGATATGAATAAAATGATCC AGTCCATAATTGGTTCCATGCAGTACTCCAAGGAACTGATAGAAGATAAC TATTCCTACAGCATTAAGGAGGACCACCTCCTCCGTGAGTGCACTCAACT CAACGAAAACGTAAGGATATTACTGAATGAGAACAGAAGGCTGCTGGTGG AGCAGGCTGGCCATAAGTGTCCTGTGGGGAAGAAAAGAGGTTCTGTGAGG AGGCCAGCAAGAACATCTGTGTCCCAAGTGCCAAGGAACAGCAGTGTGAT ATAG

The amino acid sequence of the p16 protein corresponding to SEQ ID No.: 2 is as follows (SEQ ID No.: 3):

TABLE-US-00003 MTKKRSKINELEELKLDMRKISNDMEEMCGILNLYMYEDLNYRMNTEFNI IKSQHEKTMLDMNKMIQSIIGSMQYSKELIEDNYSYSIKEDHLLRECTQL NENVRILLNENRRLLVEQAGHKCPVGKKRGSVRRPARTSVSQVPRNSSVI

This gene, ORF and protein were tentatively designated p16; however, as is discussed below, because the discovered variants of this protein do not necessarily share the 16 kD molecular weight with SEQ ID No.: 3, Inventors have selected the more suitable name for the genes, ORFs and proteins of the current discovery: "Takusan". Nonetheless, for this disclosure the term p16 will be used herein to refer to the discovered genes, ORFs and proteins regardless of whether the molecular weight of a protein species is actually 16 kD.

[0085]The Inventors of the current application have discovered that the overexpression of p16 in cells having NMDA receptors (NMDAR) causes hyper-excitation of these cells and an increased efflux of cations through the associated ligand gated cation channel. The overexpression of endogenous p16 was further found to localize to the same areas of the brain where expression of the NMDAR subunit NR3A normally occurs, and p16 expression is up-regulated in NR3A-KO brains. Thus, the up-regulation of p16 occurred in brain areas where NR3A expression is usually observed. These areas included the hippocampus, layer V of the cerebral cortex, and the amygdala. The fact that p16 mRNA is up-regulated in NR3A-KO brains is consistent with the notion that p16 plays a role in the positive-feedback loop that allows sustained activation of NMDARs. Thus, Inventors have discovered a novel molecular pathway allowing for the diagnosis and treatment of NMDAR dysregulation and further providing a method of screening for agents that modulate NMDAR excitation.

[0086]Inventors have overexpressed exogenous p16 in cultured cortical and hippocampal neurons. In the transfected neurons, it is observed that p16 protein localizes at synapses, and results in an increase in NMDA- but not AMPA- or GABA-induced currents.

[0087]Low density primary hippocampal cultures were prepared from newborn rats, and maintained in cell culture for 1-3 weeks. Hippocampi were enzymatically (papain, Worthington Biochemical Corporation (Lakewood, N.J.) Catalogue #3126) and mechanically dissociated into a single cell suspension, and plated onto glass coverslips coated with collagen/poly-D-lysine. Cells were then transfected with pSFV1-EGFP (control) or pSFV1/p16-EGFP (fusion protein between p16 and EGFP). Transfected cells were identified by fluorescence under microscopy. The vector pSFV1 is available from Invitrogen, Corp. (Carlsbad, Calif.) as catalogue no. 18488-019. The procedure to create pSFV1/p16-EGFP or pSFV1/EGFP is as follows: (1) the cDNA fragment corresponding to the coding region of p16 was subcloned into pEGFP-C3 (BD Biosciences Clontech, La Jolla, Calif., catalogue no.: 6082-1) at Xho I/BamH I cloning sites. The resulting construct encodes the EGFP coding region fused at the N-terminal of p16 in frame; (2) the pEGFP-C3/EGFP-p16 was then digested with Nhe I and BamH I, which released a fragment encoding EGFP-p16 fusion protein. The cohesive ends of the fragment were blunted by the Klenow fragment of E. coli DNA polymerase I and then cloned into the Sma I site of the pSFV1 vector. The resulting plasmid is named pSFV1/p16-EGFP. pSFVUEGFP was constructed by the same method without EGFP fused to p16.

[0088]For HEK293 cells, recombinant NR1/NR2A subunits were co-transfected with pSFV1/EGFP, or pSFV1/p16-EGFP. Whole cell recordings were made 18-25 hours after the transfection. NR1 and NR2A subunits were inserted into pcDNA1.1/Amp from Invitrogen (Carlsbad, Calif.). Catalogue number is V46020.

[0089]Whole cell recording of NMDA, AMPA, and GABA currents were made from cultured hippocampal neurons (DIV 8-10), 19 to 27 hours after being transfected with pSFV1/EGFP, or pSFV1/p16-EGFP. The patch pipettes (4-6 M.ohm.) were filled with an internal solution consisting of (in mM): 140 potassium gluconate, 17.5 KCl, 9 NaCl, 1 MgCl₂, 10 Hepes, and 0.2 EGTA, at pH 7.4. The standard external solution contained 150 mM NaCl, 3 mM KCl, 10 mM Hepes, 5 mM glucose, 2 mM CaCl₂, and 1 μM TTX. To isolate NMDA currents, 10 .micro.M CNQX (chemical name: 6-cyano-7-nitroquinoxaline-2,3-dione; which is available from numerous vendors, including A.G. Scientific, Inc., San Diego, Calif. 92121 as catalogue number C1053), 10 .micro.M glycine, and 10 .micro.M biccuculine were added to the solution. To isolate AMPA currents, 50 .micro.M APV and 10 .micro.M biccuculine were added to the solution. To isolate GABA currents, 10 .micro.M CNQX and 50 .micro.M APV were added to the solution. NMDA (100 .micro.M), AMPA (10 .micro.M), or GABA (100 .micro.M) were applied every 15 seconds at a holding potential of -75 mV.

[0090]Solution exchange was made with computer controlled gravity-fed flow tubes, which is essentially comprised of a computer controlled, valve controller (Warner Instrument Co, Hamden Conn., VC-6) controlling 3-way valves (The Lee Co, Essex, Conn., LFAA1203618H). The flow tube is from Polymicro Technologies, Phoenix, Ariz., 2000625). Data acquisition and analysis were made with PClamp 8 (Axon Instruments, Union City, Calif.). Currents were normalized to cell capacitance. Results are expressed as mean±SEM in FIGS. 1a-c. All experiments were performed at room temperature.

[0091]Expression of the p16 protein enhances NMDA currents in cultured hippocampal neurons. Representative NMDA, AMPA, and GABA currents from a control neuron (EGFP) and a neuron containing p16 (p16-EGFP) are shown in FIGS. 1a and 1b. The straight, horizontal line in both FIG. 1a and FIG. 1b indicates the duration of agonist applications. Traces are averages of 4-5 responses. In FIGS. 1a and 1b, the tracing that remains the uppermost tracing during the duration of agonist application represents AMPA, the middle tracing during the duration of agonist application represents NMDA, and the lowermost tracing during the duration of agonist application represent GABA. FIG. 1c shows that NMDA current density, measured in pA/pF, in p16-EGFP neurons (n=10) was significantly larger than that of control neurons having EGFP only (n=10, p<0.05). In contrast, AMPA and GABA currents were not altered by p16 transfection.

[0092]FIG. 2. Expression of p16 enhances recombinant NR1/NR2A currents in HEK293 cells. Representative NMDA currents from a HEK293 cell containing EGFP (FIG. 2a) or p16-EGFP (FIG. 2b) are shown. NMDA current density in cells containing p16-EGFP (n=7) was significantly larger than that of cells containing on EGFP (n=8, p<0.01) (FIG. 2c).

[0093]Electrophysiological methods for detecting monovalent cation currents through an NMDA receptor are well known in the art. Exemplary methods for recording whole-cell and single-channel currents in Xenopus oocytes, brain slices, mammalian cells and cell-free membrane patches are described in Das et al., Nature 393:377-381 (1998); Sakmann and Neher, in Single-Channel Recording, 2nd ed., Ch. 15, pp. 341-355, (1995), edited by Bert Sakmann and Erwin Neher, Plenum Press, New York; Penner, in Single-Channel Recording, 2nd ed., Ch. 1, pp. 3-28; Hamill et al., Pflugers Arch. 391:85-100 (1981); Ilers et al., in Single-Channel Recording, 2nd ed., Ch. 9, pp. 213-229, (1995), edited by Bert Sakmann and Erwin Neher, Plenum Press, New York.

[0094]Ionic currents can also be detected using suitable detectably labeled ion indicators. Ion indicators and methods for their use are known in the art. For example, monovalent cation currents through the NMDA receptor can be detected using Na.sup.+ or K.sup.+ ion indicators, which can be fluorescently labeled or radiolabeled (see, for example, Moore et al., Proc. Natl. Acad. Sci. USA 90:8058-8062 (1993); Paucek et al., J. Biol. Chem. 267:26062-26069 (1992); Xu et al., J. Biol. Chem. 270: 19606-19612 (1995)). Exemplary ion indicators include: SBFI sodium indicator, Sodium Green sodium indicator; CoroNa Red sodium indicator; PBFI potassium indicator; 6-Methoxy-N-(3-sulfopropyl)quinolinium (SPQ) chloride indicator; N-(Ethoxycarbonylmethyl)-6-methoxyquinolinium bromide (MQAE) chloride indicator; 6-Methoxy-N-ethylquinolinium iodide (MEQ) chloride indicator; Lucigenin chloride indicator, which are available from Molecular Probes, Inc.

[0095]Subsequent to NMDA receptor activation and membrane depolarization, an influx of Ca²+ ions occurs if voltage-dependent Ca²+ channels are present in the cell being studied. If the cell of interest does not endogenously express voltage-dependent Ca²+ channels, the cell can be recombinantly engineered to express such channels, using voltage-dependent Ca²+ channel subunit gene sequences and molecular biology methods known in the art. Accordingly, ionic currents through the NMDA receptor can also be detected, indirectly, using detectably labeled Ca²+ ion indicators, which can be fluorescently labeled or radiolabeled. Exemplary Ca²+ ion indicators include FLUO-3 AM, FLUO-4 AM, FURA-2, INDO-1, FURA RED, CALCIUM GREEN, CALCIUM ORANGE, CALCIUM CRIMSON, BTC, and OREGON GREEN BAPTA (see, for example, Grynkiewitz et al., J. Biol. Chem. 260:3440-3450 (1985); Sullivan et al., in Calcium Signal Protocol, Methods in Molecular Biology 114: 125-133, Edited by David G. Lambert, Human Press, Totowa, N.J. (1999); Miyawaki et al., Proc. Natl. Acad. Sci. USA 96:2135-2140 (1999); and Coward et al., Analyt. Biochem. 270:242-248 (1999)).

[0096]FIG. 3 shows that p16 expression is upregulated in NR3A knockout mice. In this example, p16 was used as a hybridization probe to perform an in-situ hybridization. An anti sense RNA probe was used for this in-situ hybridization. The probe sequence (SEQ ID No. 84) was produced from pCRII--TOPO included in TOPO-TA cloning kits (Invitrogen, Carlsbad, Calif., Catalogue # KNM4500-40z). The difference in RNA levels between NR3A KO and WT was visually compared on the pictures taken from the brain tissue sections performed with in situ hybridization. The experiments for both NR3A KO and WT were performed under same conditions and at the same time. The pictures were taken under same exposure conditions. Inventors have identified p16 as a gene whose expression is higher in NR3A knockout mice than WT mice using DNA microarray. The data shown here in FIG. 3 confirms that p16 expression is upregulated in the amygdala, cerebral cortex and hippocampus of NR3A KO mice compared to the NR3A wild type. These three areas (amygdala, cerebral cortex and hippocampus) are where NR3A expression normally occurs for WT mice.

[0097]Inventors' discovery of this novel genes, ORF and protein in the NMDAR molecular pathway presents a variety of uses, including, but not limited to: diagnosing the cause of disorders associated with NMDAR function; treating disorders associated with NMDAR function; and screening for novel agents that modulate the function of p16.

[0098]Screening of Complete Mouse Genome for p16 Loci

[0099]Inventors then examined the completed mouse genome sequence to identify sequences related to p16. Using the coding region (SEQ ID No.: 2) of the discovered p16 DNA sequence (SEQ ID No.: 1) as a query for BLASTN against the mouse genome found at the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov), Inventors discovered 40-60 different loci encoding putative proteins that are highly homologous to p16. Furthermore, a search of Genbank reveals multiple sequences highly related to p16. Some of these sequences are putative transcription units based on the genome sequence. Others are cDNAs isolated by the FANTOM Consortium and the RIKEN Genome Exploration Research. These cDNAs were isolated from embryonic whole body and various organs such as testis, ovary, uterus, mammary tumors and spinal cord. None of the cDNAs had been assigned functions prior to Inventors' current work.

[0100]To determine if any of these p16-related sequences are expressed in the mouse brain, RT-PCR was performed using whole brain of a wild-type C57BL6/J mouse (male, 6 week old). Briefly, total RNA was isolated from the mouse brain using RNA STAT-60 for the RNA extraction (TEL-TEST, INC., Friendswood, Tex.; Catalogue #CS-110) and using RNeasy midi kit for RNA purification (Qiagen, Hilden, Germany; Catalogue #75144). cDNAs were synthesized using Superscript II RNase H^-Reverse Transcriptase (Invitrogen Life Technologies, Carlsbad, Calif., catalogue no.: 18064-022), and PCR was performed using PfuUltra High Fidelity DNA Polymerase (Stratagene, Inc., La Jolla, Calif., catalogue no.: 600384). In order to amplify p16 and its related proteins, primer sequences were designed against the untranslated regions of the genomic and cDNA sequences that were deposited in Genbank. Four different 5' primers and one common 3' primer were used to set up four different PCR reactions. These four PCR reactions were further amplified using nested primers, again having four different 5' primers and one common 3' primer. Thus, reaction 1 used 5' primer CATCCCCAACACTCCTGTTC (SEQ ID No.: 72) and 3' primer GAGGAGCATACAGCCCATTAC (SEQ ID No.: 73), followed by 5' nested primer CTAGCTAGCAAGATGGGTGAGGAAAGTGG (SEQ ID No.: 74) and 3' nested primer CCGCTCGAGTGCACACTCAGTGCTCTTCC (SEQ ID No.: 75). Reaction 2 used 5' primer CAGCTGGAAGATAGCTTTTCTG (SEQ ID No.: 76) and 3' primer SEQ ID No.: 73, followed by 5' nested primer CTAGCTAGCTCCCTCCATCTTCTTCTTGG (SEQ ID No.: 77) and 3' nested primer SEQ ID No.: 75. Reaction 3 used 5' primer CCCCTCAAAAGCACATGAC (SEQ ID No.: 78) and 3' primer SEQ ID No.: 73, followed by 5' nested primer CTAGCTAGCGAAGGAGAGGTTGCCAAAGG (SEQ ID No.: 79) and 3' nested primer SEQ ID No.: 75. Reaction 4 used 5' primer ACTCGTCTCGCCACATGAAC (SEQ ID No.: 80) and 3' primer SEQ ID No.: 73, followed by 5' nested primer CTAGCTAGCTTCACAGAGATGTGAGATGGAG (SEQ ID No.: 81) and 3' nested primer SEQ ID No. 75.

[0101]In order to minimize the occurrence of mutations during the PCR, a DNA polymerase with proof-reading ability (PfuUltra--Stratagene, Inc.) was used and the number of PCR cycles was reduced. In addition, several lines of evidence suggest that most of these variations are authentic and were not introduced by PCR. First, variations occur at certain positions of the PCR products. Second, variations are reproducible from one PCR reaction to another. Third, most of these variations are present in genomic and Riken cDNA sequences that have been deposited to Genbank.

[0102]PCR products were cloned into pcDNA3.1/myc-His (Invitrogen, Corp., Carlsbad, Calif., catalogue number V855-20) and the DNA sequences of the cloned products were determined for both strands using a capillary ABI 3730 sequencer. DNA sequences were determined for 90 cDNA clones, 34 of which encoded different nucleotide sequences in their coding regions. All 34 deduced amino acid sequences are substantially similar to the amino acid sequence of SEQ ID No.: 3. These amino-acid sequences are presented in FIG. 4a, and are listed in the Sequence Listing below as Sequence ID Nos.: 4-37. In this FIG. 4a, the clone identification numbers are listed at the left, the sizes (number of amino acids) of the proteins are at the right. Note that the prototypical p16 starts at the position 56 in this alignment. In other words, there are multiple variants that contain as many as 55 amino acids at the N-termini. As mentioned above, there are 40-60 multiple loci encoding p16 and its related proteins in the mouse genome. Therefore, the multiplicity of these loci is likely a major contributor of the variations among p16 and its related proteins. Another likely source of the variations is alternative splicing, although it appears this occurs frequently via the usage of different acceptors (intronic GT sequences) from a single exon. As a result of these variations, the encoded p16 proteins differ in the following fashions: (1) at the N-terminal, the presence or absence of termination codons at the 5'-UTR creates variations in the starting ATG position; (2) multiple single amino-acid changes are present in the middle of the sequences, although many are conservative and may not alter protein functions; and (3) c-terminals vary in multiple forms, for example, many forms contain -SVI at the C-terminus, which is a motif that is likely to bind to a class I PDZ domain, while other forms contain C-terminal sequences (such as -SVK) that are unlikely to bind to a PDZ domain.

[0103]PDZ domains are regions of sequence homology found in diverse signaling proteins (Cho, K. O. et al. (1992) Neuron 9:929-942; Woods, D. F. and Bryant, P. J. (1993), Mech Dev 44:889, Kim, E. et al. (1995) Nature 378:85-88). The name "PDZ" derives from the first three proteins in which these domains were identified: PSD-95, a protein involved in signaling at the post-synaptic density; DLG, the Drosophila Discs Large protein; and ZO-1, the zonula occludens 1 protein. PDZ domains are also sometimes called DH domains or GLGF repeats.

[0104]These hypotheses were tested, and it has been determined that, indeed, some p16 variants bind to a PDZ-containing protein, while other variants do not (see discussion below).

[0105]FIG. 4b shows the nucleotide sequences for the clones shown in FIG. 4a. Again, the clone identification is on the left; however, the number of nucleic acid residues is along the top. In FIG. 4b, the nucleotide sequences are again aligned for comparison. The nucleotide sequences are also listed in the Sequence Listing below as Sequence ID Nos.: 38-71.

[0106]FIG. 5 is a schematic representation of many of the p16 variants identified in the current invention. The various forms of p16 are shown in modular form, having one or more of six modules. The module sizes are, from n-terminus to c-terminus, 55 aa, 17 aa, 72 aa, 42 aa, 19 aa and 22 aa. The prototypical p16 protein in the C57BL/6 mouse strain is PNN1131 (SEQ ID No.: 21), which has four modules. PNN1155 (SEQ ID No.: 9) is the longest variant having all six modules. Other p16 variants are also shown having different modules, which will vary in size, shape and, thus, interactions. These additional representative p16 variants are PNN1154 (SEQ ID No.: 4), PNN1159 (SEQ ID No.: 10); PNN1179 (SEQ ID No.: 33); PNN1143 (SEQ ID No.: 19); PNN1176 (SEQ ID No.: 13); PNN1101 (SEQ ID No.: 35); PNN1128 (SEQ ID No.: 36); and PNN1103 (SEQ ID No.: 34).

[0107]P16 is predicted to contain a coiled-coil domain, which is often used for self dimerization or oligomerization of proteins. To test if p16 dimerizes, oligomerizes or otherwise associates with a second p16 molecule, the following experiments were performed (see FIG. 6). Prototypical p16 (SEQ ID No.: 21) was tagged with either myc or EGFP. The tagged p16 proteins were transfected separately into COS-7 cells or co-transfected into COS-7 cells. The p16-myc and p16-EGFP proteins were expressed within their respective cells, and following expression, the cells were lysed. Protein lysates were precipitated and the extracts were subjected to western immunoblot using anti-EGFP or anti-myc in a two-stage antibody detection reaction. In FIG. 6, lane 1 represents COS-7 transfected with p16-EGFP, lane 2 represents COS-7 transfected with p16-myc and lane 3 represents COS-7 transfected with both p16-EGFP and p16-myc. Also in FIG. 6, the top and middle panels represent an immunoblot of the cell lysates using anti-EGFP and anti-myc, respectively. In the bottom panel, the immunoprecipitates with anti-EGFP were blotted on the membrane and probed with anti-myc.

[0108]The top and middle panels of FIG. 6 show that p16-EGFP and p16-myc are expressed in COS-7 cells. Lane 3 of the bottom panel of FIG. 6 shows that p16-myc is co-immunoprecipitated with p16-EGFP. Both p16-EGFP and p16-myc stayed in the same complex during the procedure of immunoprecipitation. Before they were subjected to SDS-PAGE for the immunoblot, they were treated with SDS and mercaptoethanol for denaturation. By probing with anti-myc antibody on this blot, the monomerized p16-myc was visualized. The fact that p16-myc is present in the fraction precipitated by anti-GFP suggests p16-myc and p16-EGFP dimerizes, oligomerizes or otherwise associate in cells.

[0109]As discussed above, some p16 variants contain C-terminal sequences that are predicted to bind a class I PDZ domain, while other variants do not. PDZ domains are contained in proteins such as PSD-95, which is known to bind and regulate NMDAR-receptor subunit 2 (NR2). In FIG. 7, the ability of p16 variants to bind PSD-95 was tested in co-immunoprecipitation experiments.

[0110]Six p16 variants were subjected to co-immunoprecipitation experiments with PSD-95. Briefly, six variants (p16-1 to p16-6) were cloned by RT-PCR as described above from NR3A KO mice whose genetic background is 129SV/J. Both DNA (SEQ ID Nos.: 85-90) and deduced-amino-acid sequences (SEQ ID Nos.: 91-96) of these clones are provided in the Sequence Listing, below. The sequences of p16 are slightly divergent from strain to strain, which is not surprising considering the unusual size of this gene family. COS-7 cells were then transfected with PDS-95 alone (lane 1 in FIG. 7), p16-EGFP variants alone (lanes 2-7 in FIG. 7), or the combination of PSD-95 and one of the p16-EGFP variants (Lanes 8-13 in FIG. 7). Based on antigenicity plots, it was determined to raise rabbit antisera against the following two peptides: N-terminal (2-20) TKKRSKINELEELKLDMRK (SEQ ID No.: 82) and C-terminal (123-141) CPVGKKRGSLRRPARTSVS (SEQ ID No.: 83). Antibodies against these peptides were predicted to recognize p16 and its structurally related proteins. The antibodies were produced by ABGENT (San Diego, Calif.). Briefly, the two peptides were synthesized and conjugated to keyhole limpet hematocyanin (KLH). Conjugated peptides were used to immunize two rabbits per peptide. Each rabbit was immunized 8 times with 100-200 mg antigen in the span of 10 weeks. Antisera against C-terminal and N-terminal peptides were named anti-p16N and p16C, respectively. These sera are useful for binding antibody against p16, which in turn is useful for a variety of purposes, including but not limited to immunoblotting and immunohistochemistry. For the immunoblot experiments presented in FIG. 7, a mixture of anti-p16N and p16C sera was used and generally termed "anti-p16". In the top panel of FIG. 7 the lysates were blotted with anti-p16 antibody in a two stage detection reaction to verify the expression of p16 in the transfected COS cells. In the lower panel of FIG. 7 the lysates were immunoprecipitated with anti PSD-95 antibody and then detected using a two stage antibody detection reaction, wherein the first stage was anti p16 and the second stage had a detectable label. Consistent with the predictions made by Scansite 2.0 program (available from Massachusetts Institute of Technology via their website at http://scansite.mit.edu/), the p16 variants that contain the C-terminal sequences such as -SVI (p16-2 (SEQ. ID No.: 92)) and -VVL (p16-5 (SEQ ID No.: 95)) associate with PSD-95, while other p16 variants did not.

[0111]From these data, and without being held to any theory, Inventors have proposed the molecular mechanism presented in FIG. 8. Briefly, p16 is upregulated in NR3A KO mice. The mechanism by which NR3A KO leads to the upregulation of p16 is possibly mediated by the increased Ca²+ permeability through the NMDA receptor. P16, in turn, dimerizes and binds to PSD-95 which is known to associate with NR2. These interactions underlie the mechanisms by which p16 upregulates NMDAR activity. The observation that p16 comes in many variant forms, some of which do not bind PSD-95 adds another layer of regulation diversity in the activity of this molecule.

[0112]Inventors have screened the human genome for a p16 homologue and have discovered that there is not a human homologue of p16. This is remarkable given the extensive expansion of p16 gene family in the rodents. It is possible that mouse and human sequences diverged quickly so that they no longer are homologous. It is also possible that p16 is unique to rodents (rats carry p16 orthologues) and mammals below human. Regardless, since NMDAR and its associated molecules such as PSD-95 are conserved between mouse and human, mouse p16 is still an effective reagent for regulating human NMDAR activity. In fact, the lack of endogenous p16 in human may account for increased efficiency of p16 in NMDAR regulation when applied to the human system, for example, through gene therapy techniques.

[0113]Endogenous p16

[0114]In the methods of the current invention, p16 can be endogenously and/or exogenously expressed in cells. Using NR3A knockout studies, endogenous expression of p16 was shown to occur in the hippocampus, in layer V of the cerebral cortex and in the amygdala. Endogenous expression of p16 can be regulated using modulators (e.g., compounds that either directly or indirectly increase or reduce the expression of p16).

[0115]Exogenous p16

[0116]Exogenous expression of p16 is accomplished using techniques well known in the art. The invention provides an isolated nucleic acid molecule that encodes a functional fragment of a p16 polypeptide. For example, using knowledge of the rat or mouse p16-encoding nucleic acid sequences and polypeptides disclosed herein, those skilled in the art can readily clone p16-encoding nucleic acids from other mammalian or vertebrate species using conventional cDNA or expression library screening methods, or using the polymerase chain reaction (PCR). Additionally, using knowledge of the rat or mouse p16-encoding nucleic acid sequences and polypeptides disclosed herein, those skilled in the art can readily determine cDNA and coding sequences from other species from an analysis of ESTs and genomic sequences present in available databases.

[0117]Interference with p16 Expression

[0118]In addition to the effects a sequence mutation may have on the expression and/or function of p16, one may use a variety of other techniques well known in the art for disrupting p16 activity on the NMDAR, including, but not limited to siRNA, anti-sense RNA and ribozymes.

[0119]a. siRNA

[0120]Small interfering RNAs (siRNAs), which are short duplex RNAs with overhanging 3' ends, directed against p16 can also be effective in preventing or reducing p16 expression. Methods of preparing and using siRNAs are known in the art and described, for example, in Elbashir et al., Nature 411:494-498 (2001).

[0121]b. Anti-Sense

[0122]Antisense nucleotide sequences that are complementary to a nucleic acid molecule encoding a p16 polypeptide can be used to prevent or reduce p16 expression. Therefore, the method can be practiced with an antisense nucleic acid molecule complementary to at least a portion of the nucleotide sequence of p16. For example, the antisense nucleic acid molecule can be complementary to a region within the N-terminus of p16 such as within nucleotides 1-1000, 1-500, 1-100 or 1-18, and can optionally include sequences 5' to the start codon. Methods of preparing antisense nucleic acids molecules and using them therapeutically are known in the art and described, for example, in Galderisi et al., J. Cell Physiol. 181:251-257 (1999).

[0123]c. Ribozyme

[0124]Likewise, ribozymes that bind to and cleave p16 can also be effective in preventing or reducing p16 expression. Methods of preparing ribozymes and DNA encoding ribozymes, including hairpin and hammerhead ribozymes, and using them therapeutically are known in the art and described, for example, in Lewin et al., Trends Mol. Med. 7:221-228 (2001).

SCREENING METHODS AND EXAMPLES

[0125]Applicant's discovery of a novel pathway leading to NMDAR function is useful in a variety of methods for diagnosing and treating disorders and conditions relating to said pathway, and in screening for compounds that modulate said pathway.

[0126]The following non-limiting examples are useful in describing Applicant's discovery, and are in no way meant to limit the current invention. Those of ordinary skill in the art will readily adopt the underlying principles of applicant's discovery to design a variety of screening assays without departing from the spirit of the current invention.

Example One

[0127]A first example shows a method wherein p16 modulators are discovered. Assay methods for identifying compounds (candidate compounds) that modulate p16 activity involve comparison to a control (modulators of p16 alter its biological activity, and can include, but are not limited to those that directly hind to the p16 protein, those that affect p16 gene expression and/or translation, and those that have an indirect effect on p16). For example, identical cells, both expressing p16, are plated in two separate tissue culture wells and one well is exposed to the candidate compound, while the control well is not exposed to the candidate compound. In this situation, the response of the test cell to a candidate compound is compared to the response (or lack of response) of the control cell to the same compound under substantially the same reaction conditions.

[0128]The effect of the candidate compound on the cell lines can be measure using a variety of techniques well known in the art. In the preferred embodiment, NMDAR channel current is measured to indicate the effect of a control compound. Techniques for measuring channel current, including but not limited to that described herein above are well known in the art.

[0129]Candidate compounds shown to have an effect on the channel current of NMDAR (e.g., modulators) are useful in treating the conditions associated with NMDAR dysregulation.

Example Two

[0130]In a further assay, candidate compounds are screened for their ability to bind p16 (e.g., agonists, antagonists, ligands, etc). Assay methods for identifying compounds (candidate compounds) that bind to p16 involve comparison to a control. For example, identical cells, both expressing p16, are plated in two separate tissue culture wells and one well is exposed to the candidate compound, while the control well is not exposed to the candidate compound. In this situation, the response of the test cell to a candidate compound is compared to the response (or lack of response) of the control cell to the same compound under substantially the same reaction conditions.

[0131]The effect of the candidate compound on the cell lines can be measure using a variety of techniques well known in the art. In the current embodiment, ligand binding is measured to indicate the effect of a control compound. Techniques for measuring ligand binding, including but not limited to those described herein above are well known in the art.

[0132]Candidate compounds shown to bind p16 are useful in treating the conditions associated with NMDAR dysregulation.

Example Three

[0133]In a further example, treatments for the prevention and/or amelioration of conditions associated with inappropriate NMDAR activation, or inappropriate responses to glycine or glutamate are discussed.

[0134]Using the methods disclosed herein, it is possible to characterize and treat conditions associated with inappropriate NMDAR activation, or inappropriate responses to glycine or glutamate. For example, it is possible to isolate and sequence p16 from a sample belonging to one suffering from such conditions. It is further possible to screen for NMDA receptor subunits, including NR3A and knock-outs thereof. Nucleotide and/or protein sequence mutation are compared to the library of mutations and associated effects, described above. Alternatively, quantitative studies can be performed to uncover up or down regulation of p16 expression. Such studies are readily performed by those of skill in the art using numerous well known techniques, including but not limited to RT-PCR, Northern Blot or Western Blot. The information is then used to determine a treatment.

[0135]Depending on the results from the sequencing studies, treatment options may include: gene therapy to introduce a functional wild-type p16; or the use of p16 antagonists or agonists, (which may be small molecules, nucleic acids, such as siRNA, anti-sense RNA or the like, proteins or other discovered modulators).

[0136]Those of ordinary skill in the art will uncover a number of treatments using the above disclosed invention. Such treatments are all within the spirit of the current invention.

[0137]P16 Protein and Conditions of NMDAR:

[0138]P16 is a cytoplasmic protein that causes excitation in cells expressing NMDAR. Upregulation of p16 expression, as is observed with the NR3A knockouts is knocked out, or when NMDAR otherwise loses its biological activity, causes NMDAR bearing cells to become hyperexcited, leading to a variety of conditions. Conditions in which inappropriate NMDAR activation, or inappropriate responses to glycine or glutamate, are implicated include, for example, acute neurologic condition, such as cerebral ischemia; stroke; hypoxia; anoxia; poisoning by carbon monoxide, manganese, cyanide or domoic acid; hypoglycemia; mechanical trauma to the nervous system such as trauma to the head or spinal cord; or epileptic seizure. Other conditions include, for example, chronic neurodegenerative disease, such as Huntington's disease; a disorder of photoreceptor degeneration such as retinitis pigmentosa; acquired immunodeficiency syndrome (AIDS) dementia complex (HIV-associated dementia); a neuropathic pain syndrome such as causalgia or a painful peripheral neuropathy; olivopontocerebellar atrophy; Parkinsonism; amyotrophic lateral sclerosis; a mitochondrial abnormality or other biochemical disorder such as MELAS syndrome, MERRF, Leber's disease, Wernicke's encephalopathy, Rett syndrome, homocysteinuria, hyperhomocysteinemia, hyperprolinemia, nonketotic hyperglycinemia, hydroxybutyric aminoaciduria, sulfite oxidase deficiency, combined systems disease, lead encephalopathy, Alzheimer's disease, hepatic encephalopathy, Tourette's syndrome, drug addiction/tolerance/dependency, glaucoma, depression, anxiety, multiple sclerosis and other demyelinating disorders. Other conditions are known in the art and reviewed, for example, in Lipton et al., New Engl. J. Med. 330:613-622 (1994) and Cull-Candy et al., Curr. Opin. Neurobiol. 11:327-335 (2001). Thus, Applicant's current invention is useful in diagnosing and treating disorders and screening for modulating compounds relating to p16.

Pharmaceutical Compositions

[0139]Methods of using the compounds and pharmaceutical compositions of the invention are also provided herein. The methods involve both in vitro and in vivo uses of the compounds and pharmaceutical compositions for altering preferred nuclear receptor activity, in a cell type specific fashion.

[0140]In certain embodiments, the claimed methods involve the discovery and use of modulating compounds including agonists, antagonists, ligands and nucleic acid molecules.

[0141]Once identified as a modulator using a method of the current invention, an agent can be put in a pharmaceutically acceptable formulation, such as those described in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pa. (1990), incorporated by reference herein, to generate a pharmaceutical composition useful for specific treatment of diseases and pathological conditions.

[0142]Agents identified by the methods taught herein can be administered to a patient either by themselves or in pharmaceutical compositions where it is mixed with suitable carriers or excipient(s). In treating a patient exhibiting a disorder of interest, a therapeutically effective amount of agent or agents such as these is administered. A therapeutically effective dose refers to that amount of the agent resulting in amelioration of symptoms or a prolongation of survival in a patient.

[0143]The agents also can be prepared as pharmaceutically acceptable salts. Examples of pharmaceutically acceptable salts include, but are not limited to acid addition salts such as those containing hydrochloride, sulfate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate and quinate. Such salts can be derived using acids such as hydrochloric acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, and quinic acid.

[0144]Pharmaceutically acceptable salts can be prepared by standard techniques. For example, the free base form of the agent is first dissolved in a suitable solvent such as an aqueous or aqueous-alcohol solution, containing the appropriate acid. The salt is then isolated by evaporating the solution. In another example, the salt is prepared by reacting the free base and acid in an organic solvent.

[0145]Carriers or excipients can be used to facilitate administration of the agent, for example, to increase the solubility of the agent. Examples of carriers and excipients include calcium carbonate, calcium phosphate, various sugars or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents.

[0146]For applications that require the compounds and compositions to cross the blood-brain barrier, or to cross the cell membrane, formulations that increase the lipophilicity of the compound are particularly desirable. For example, the compounds of the invention can be incorporated into liposomes (Gregoriadis, Liposome Technology, Vols. I to III, 2nd ed. (CRC Press, Boca Raton Fla. (1993)). Liposomes, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer. Additionally, the therapeutic compound can be conjugated to a peptide that facilitates cell entry, such as penetratin (also known as Antennapedia peptide), other homeodomain sequences, or the HIV protein Tat.

[0147]Toxicity and therapeutic efficacy of such agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Agents which exhibit large therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.

[0148]For any agent identified by the methods taught herein, the therapeutically effective dose can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ as determined in cell culture (i.e., the concentration of the test agent which achieves a half-maximal disruption of the protein complex, or a half-maximal inhibition of the cellular level and/or activity of a complex component). Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by HPLC.

[0149]The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g. Fingl et al., in The Pharmacological Basis of Therapeutics, Ch. 1 p. 1 (1975)). It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity, or to organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity). The magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may also be used in veterinary medicine.

[0150]Depending on the specific conditions being treated, such agents may be formulated and administered systemically or locally. Techniques for formulation and administration may be found in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pa. (1990). Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, just to name a few.

[0151]For injection, the agents may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0152]Use of pharmaceutically acceptable carriers to formulate the agents herein disclosed into dosages suitable for systemic administration is contemplated. With proper choice of carrier and suitable manufacturing practice, these agents, in particular, those formulated as solutions, may be administered parenterally, such as by intravenous injection. The agents can be formulated readily using pharmaceutically acceptable carriers well known in the art into dosages suitable for oral administration. Such carriers enable the agents of the invention to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.

[0153]Agents intended to be administered intracellularly may be administered using techniques well known to those of ordinary skill in the art. For example, such agents may be encapsulated into liposomes, and then administered as described above. Liposomes are spherical lipid bilayers with aqueous interiors. All molecules present in an aqueous solution at the time of liposome formation are incorporated into the aqueous interior. The liposomal contents are both protected from the external microenvironment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. Additionally, due to their hydrophobicity, small organic molecules may be directly administered intracellularly.

[0154]Pharmaceutical compositions suitable for use in the context of the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active agents into preparations which can be used pharmaceutically. The preparations formulated for oral administration may be in the form of tablets, dragees, capsules, or solutions. The pharmaceutical compositions contemplated by the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levitating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0155]Pharmaceutical formulations for parenteral administration include aqueous solutions of the active agents in water-soluble form. Additionally, suspensions of the active agents may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the agents to allow for the preparation of highly concentrated solutions.

[0156]Pharmaceutical preparations for oral use can be obtained by combining the active agents with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0157]Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active agent doses.

[0158]Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active agents may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

[0159]Some methods of delivery that may be used include: [0160]a. encapsulation in liposomes, [0161]b. transduction by retroviral vectors, [0162]c. localization to nuclear compartment utilizing nuclear targeting site found on most nuclear proteins, [0163]d. transfection of cells ex vivo with subsequent reimplantation or administration of the transfected cells, [0164]e. a DNA transporter system.

Sequence CWU 1

9611992DNAMus musculus 1ggcttggatc ccagagccca gcctgggagg aaccggggct cctggtgtac catcatcatc 60cccaacactc ctgttcagaa gatgggtgag gaaagtggaa agtctaacca gtcagccgat 120gaccagtggg aaaaatgagc tacaagatca cctgatcttc atcagtgaga aagctttgca 180caagagggtc tgctagaaat acttcaaccc aaaattccaa aatgaccaag aagagatcaa 240aaataaatga actagaagaa ctgaaattgg atatgaggaa gatcagcaat gacatggagg 300aaatgtgtgg aatcctgaac ctttacatgt atgaggattt gaactacagg atgaacactg 360aattcaacat cattaaatca caacatgaga agacaatgtt ggatatgaat aaaatgatcc 420agtccataat tggttccatg cagtactcca aggaactgat agaagataac tattcctaca 480gcattaagga ggaccacctc ctccgtgagt gcactcaact caacgaaaac gtaaggatat 540tactgaatga gaacagaagg ctgctggtgg agcaggctgg ccataagtgt cctgtgggga 600agaaaagagg ttctgtgagg aggccagcaa gaacatctgt gtcccaagtg ccaaggaaca 660gcagtgtgat atagtccagc agaaagcaga acatggcaca gaccacgaca tgatctccct 720caaagagaag tgctggagga agagcactga gtgtgcacag gaaatacacc actgttgcct 780ctcatcccta ataaccatgg ctgtaatggg ctgtatgctc ctcttttatt ttgtttcttt 840ggtatgaaca ggccttaatt tcatctagcc tctggcccag gaagagtgca catttaaagg 900gactcagaga aatgctgaga cacatcaaga gctgctgggc atccaggaag attctgagag 960tttatattta tcttttcctg atgggtcatc atcaataatt acatggagat cagtcaacaa 1020aattgtaaaa ccttggatcc aagtctacaa catgtgttct gctttgactt gggaggccat 1080atccttcaga cccacactcc aaaaggagag tgttgcttaa atttctcctg caaagtttgt 1140tacctccagg aactactttt ctactaagtt gccaaggaca gccacaggct gtaagtctgt 1200gctacaaaat gagcagacta agaattttgc tttgcacaat ttttgtggtt tgattttggt 1260ttgagttttg attagtttag ttatttgttt tttcttgttt tcattcaaag ttttgttatt 1320tattggttat ttattgttct tttaattaat ttgatatttt gataaggtta tacacagtac 1380atattgactg tcagctttca gttacaattg agtacattgc attttttctt atgactaaca 1440cagtgatctc caactcttca ctctaagagc cttgttattt cagttgtgat catgaaatcc 1500cacagatatc agacccagat ggatctctgc actcttcatg ggacttgggc tccatagttt 1560cttctgagcc ggacttaact acaaagtcct tcatacattc agtatggaga gtttttctaa 1620ctgtctgtat aggaacttaa tgatggaaaa cttacccatg ctgcatcgtt gctgtcaaat 1680atttagctac tgtgaaaatc ctgtggatta tggtgttgaa cgcattaatg gcaaatacat 1740cagtatttct gtaatagctc tcattaaatc aaagcatagt ctaagggaat aaaaagctgt 1800cagaaaacac agcagtgtat gcttctgcgt tccttcaaat atacaatcac tggtaattgc 1860aagtggtttc tgtgggggtc cttcaatgtt cattttatta ctttatgatt cacctgtgtc 1920tgccaaaaaa catcactcaa aaacaatgaa gattgtaatt aggtatcatc ctataaaatc 1980ctaacaaatg cc 19922453DNAMus musculus 2atgaccaaga agagatcaaa aataaatgaa ctagaagaac tgaaattgga tatgaggaag 60atcagcaatg acatggagga aatgtgtgga atcctgaacc tttacatgta tgaggatttg 120aactacagga tgaacactga attcaacatc attaaatcac aacatgagaa gacaatgttg 180gatatgaata aaatgatcca gtccataatt ggttccatgc agtactccaa ggaactgata 240gaagataact attcctacag cattaaggag gaccacctcc tccgtgagtg cactcaactc 300aacgaaaacg taaggatatt actgaatgag aacagaaggc tgctggtgga gcaggctggc 360cataagtgtc ctgtggggaa gaaaagaggt tctgtgagga ggccagcaag aacatctgtg 420tcccaagtgc caaggaacag cagtgtgata tag 4533150PRTMus musculus 3Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Val Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Ile145 1504205PRTMus musculus 4Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu Gln Ala Gly His 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Lys Pro Ala Arg 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val Lys 195 200 2055205PRTMus musculus 5Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu Gln Ala Gly Tyr 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Ala Arg 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val Lys 195 200 2056205PRTMus musculus 6Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu Gln Ala Gly His 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Ala Arg 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val Ile 195 200 2057205PRTMus musculus 7Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu Gln Ala Gly His 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Gly Ser 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val Ile 195 200 2058205PRTMus musculus 8Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Thr Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu Gln Ala Gly His 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Ala Arg 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val Lys 195 200 2059227PRTMus musculus 9Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Met Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Ser Ile Lys 130 135 140Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn Glu Asn Val Arg145 150 155 160Ile Leu Leu Asn Glu Asn Arg Arg Leu Met Val Glu Gln Ala Gly His 165 170 175Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Ala Arg 180 185 190Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Pro Ala Glu Ser Arg 195 200 205Thr Trp His Arg Pro Gly Asn Asp Leu Pro Gln Arg Glu Val Leu Glu 210 215 220Glu Glu His22510171PRTMus musculus 10Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Thr Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Arg Ala Leu 130 135 140Ala Gly Ile Ile Gly Leu Val Gly Val Ala Ser Gln Trp Asn Leu Ala145 150 155 160Gly Asn His Gln Phe Phe Phe Val Asp Gln His 165 17011171PRTMus musculus 11Met Phe Ser Trp Leu Leu Arg Leu Phe Gln Lys Glu Asn Gly Asp Glu1 5 10 15Gly Glu Thr Arg Pro Thr Glu Lys Glu Glu Gly Ile Leu Ser His Glu 20 25 30Lys Gly Arg Arg Lys Ser Phe Trp Arg Arg His Arg Ser Ala Arg Asn 35 40 45Thr Ser Thr Gln Asn Ser Lys Met Thr Lys Lys Arg Ser Lys Ile Asn 50 55 60Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile Ser Asn Asp Met65 70 75 80Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr Glu Asp Leu Asn 85 90 95Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser Gln His Glu Lys 100 105 110Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile Ile Gly Ser Met 115 120 125Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn Tyr Ser Tyr Arg Ala Leu 130 135 140Ala Gly Ile Ile Gly Leu Val Gly Val Ala Ser Gln Trp Asn Leu Ala145 150 155 160Gly Asn His Gln Phe Phe Phe Val Asp Gln His 165 17012156PRTMus musculus 12Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His145 150 15513172PRTMus musculus 13Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Val Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val

Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17014172PRTMus musculus 14Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Ile Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17015172PRTMus musculus 15Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Gly Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Asp 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17016172PRTMus musculus 16Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Val Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17017172PRTMus musculus 17Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Met Pro Asp Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17018172PRTMus musculus 18Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17019150PRTMus musculus 19Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Lys Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Lys Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Lys145 15020193PRTMus musculus 20Met Ala Met Lys Glu Arg Pro Asp Gln Gln Arg Arg Lys Arg Glu Ser1 5 10 15Phe Leu Met Lys Lys Glu Glu Gly Asn His Ser Gly Glu Gly Thr Gly 20 25 30Leu Leu Glu Ile Leu Gln Pro Lys Ile Pro Lys Met Thr Lys Lys Arg 35 40 45Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu Asp Met Arg Lys Ile 50 55 60Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu Asn Leu Tyr Met Tyr65 70 75 80Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe Asn Ile Ile Lys Ser 85 90 95Gln His Glu Lys Thr Met Leu Asp Met Asn Lys Met Ile Gln Ser Ile 100 105 110Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile Glu Asp Asn His Ser 115 120 125Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu Cys Thr Gln Leu Asn 130 135 140Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg Arg Leu Leu Val Glu145 150 155 160Gln Ala Gly Tyr Lys Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg 165 170 175Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro Arg Asn Ser Ser Val 180 185 190Lys 21150PRTMus musculus 21Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Ile145 15022150PRTMus musculus 22Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ser Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Ile145 15023148PRTMus musculus 23Met Thr Lys Gln Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser14524150PRTMus musculus 24Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Pro Gln Val Pro 130 135 140Arg Ser Ser Ser Val Ile145 15025150PRTMus musculus 25Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Val Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Asp Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Thr Ser Val Lys145 15026150PRTMus musculus 26Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Thr Ser Val Lys145 15027150PRTMus musculus 27Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Thr Ser Val Ile145 15028150PRTMus musculus 28Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Thr Ser Val Ile145 15029150PRTMus musculus 29Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys

Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Lys145 15030148PRTMus musculus 30Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Gln Glu His Leu Cys Pro Lys Cys Gln 130 135 140Gly Thr Ala Val14531131PRTMus musculus 31Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Lys Val Leu 13032131PRTMus musculus 32Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Glu 100 105 110Gly Cys Trp Trp Ser Arg Leu Ala Thr Ser Val Leu Trp Gly Arg Lys 115 120 125Glu Val Leu 13033111PRTMus musculus 33Met Thr Lys Lys Arg Ser Lys Arg Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Pro Ala Glu Ser Arg Thr Trp His Arg 85 90 95Pro Gly His Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 100 105 11034146PRTMus musculus 34Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Gly Gly Ile Leu Glu1 5 10 15Leu Tyr Ile Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe Asn 20 25 30Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Glu Met 35 40 45Ile Gln Ser Ile Ile Val Ser Met Gln Tyr Ser Lys Glu Leu Ile Glu 50 55 60Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu Cys65 70 75 80Thr Gln Leu Ser Glu Lys Val Arg Ile Leu Leu Asn Glu Asn Arg Lys 85 90 95Leu Leu Val Glu Gln Ala Gly Thr Gln Leu Ser His Gly Glu Glu Lys 100 105 110Arg Phe Cys Glu Glu Ala Ser Lys Asn Ile Cys Ala Ser Ser Ala Lys 115 120 125Glu Gln Gln Cys Val Asn Ser Ser Arg Asn Arg Asn Met Ala Gln Thr 130 135 140Thr Thr1453571PRTMus musculus 35Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Gly Gly Ile Leu Glu1 5 10 15Leu Tyr Ile Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe Asn 20 25 30Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Glu Met 35 40 45Ile Gln Ser Ile Ile Val Ser Met Gln Tyr Ser Lys Glu Leu Ile Glu 50 55 60Asp Asn Tyr Ser Tyr Ser Val65 7036114PRTMus musculus 36Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu Asp1 5 10 15Leu Tyr Ile Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe Asn 20 25 30Ile Ile Lys Ser Gln His Glu Lys Thr Ile Leu Asp Met Asn Lys Met 35 40 45Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile Glu 50 55 60Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu Cys65 70 75 80Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg Arg 85 90 95Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Arg Lys Val 100 105 110Val Leu3772PRTMus musculus 37Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu Asp1 5 10 15Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe Asn 20 25 30Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys Met 35 40 45Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile Glu 50 55 60Asp Asn Tyr Ser Tyr Ser Val Lys65 7038939DNAMus musculus 38ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggatagaac tagaatcctc tgcgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagaatggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacta agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtactc caaggaactg atagaagata actattccta 660cagcattaag gaggaccacc tcctccgtga gtgcactcaa ctcaacgaaa acgtaaggat 720attactgaat gagaacagaa ggctgctggt ggagcaggct ggccataagt gtcctgtggg 780gaagaaaaga ggttctctga ggaagccagc aagaacatct gtgtcccaag tgccaaggaa 840cagcagtgtg aaatagtcca gcagaaagca gaacacggca cagaccacga catgatctcc 900ctcaaagaga agtgctggag gaagagcact gagtgtgca 93939939DNAMus musculus 39ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggataaaac tagaatcctc tgcgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagaatggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacta agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtactc caaggaactg atagaagata actattccta 660cagcattaag gaggaccacc tcctccgtga gtgcactcaa ctcaacgaaa acgtaaggat 720attactgaat gagaacagaa ggctgctggt ggagcaggct ggctataagt gtcctgtggg 780gaagaaaaga ggttctctga ggaggccagc aagaacatct gtgtcccaag tgccaaggaa 840cagcagtgtg aaatagtcca gctgaaagca gaacatggca cagaccagga catgatctcc 900ctcaaagaga agtgctggag gaagagcact gagtgtgca 93940939DNAMus musculus 40ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggatagaac tagaatcttc tgtgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagaatggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacca agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtactc caaggaactg atagaagata actattccta 660cagcattaag gaggaccacc tcctccgtga gtgcactcaa ctcaacgaaa acgtaaggat 720attactgaat gagaacagaa ggctgctggt ggagcaggct ggccataagt gtcctgtggg 780gaagaaaaga ggttctctga ggaggccagc aagaacatct gtgtcccaag tgccaaggaa 840cagcagtgtg atatagtcca gcagaaagca gaacatggca cagaccacga catgatctcc 900ctcaaagaga agtgctggag gaagagcact gagtgtgca 93941939DNAMus musculus 41ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggatagaac tagaatcctc tgtgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagaatggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacta agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtattc caaggaactg atagaagata actattccta 660cagcattaag gaggaccacc tcctccgtga gtgcactcaa ctcaacgaaa acgtaaggat 720attactgaat gagaacagaa ggctgctggt ggagcaggct ggccataagt gtcctgtggg 780gaagaaaaga ggttctctga ggaggccagg aagtacatct gtgtcccaag tgccaaggaa 840cagcagtgtg atatagtcca gcagaaagca gaacatggca cagaccacgg catgatctcc 900ctcaaagaga agtgctggag gaagagcact gagtgtgca 93942939DNAMus musculus 42ggatcacacg ggtccatgag aagctccagg agaggcaccc cagaaaggga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggatagaac tagaatcctc tgcgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagactggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacca agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtactc caaggaactg atagaagata actattccta 660cagcattaag gaggaccacc tcctccgtga gtgcactcaa ctcaacgaaa acgtaaggat 720attactgaat gagaacagaa ggctgctggt ggagcaggct ggccataagt gtcctgtggg 780gaagaaaaga ggttctctga ggaggccagc aagaacatct gtgtcccaag tgccaaggaa 840cagcagtgtg aaatagtcca acagaaagca gaacatggca cagaccacga catgatctcc 900ctcaaagaga agtgctggag gaagagcact gagtgtgca 93943769DNAMus musculus 43ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctgga 60cagaactagt taacaggaat gttttcctgg ctgctcaggc tatttcagaa agagaatggc 120gatgaaggag agaccagacc aacagagaag gaagagggaa tcctttctca tgaaaaagga 180agaaggaaat cattctggag aaggcacagg tctgctagaa atacttcaac ccaaaattcc 240aaaatgacta agaagagatc aaaaataaat gaactagaag aactgaaatt ggatatgagg 300aagatcagca atgacatgga ggaaatgtgt ggaatcctga acctttacat gtatgaggat 360ttgaactaca ggatgaacac tgaattcaac atcattaaat cacaacatga gaagacaatg 420ttggatatga ataaaatgat ccagtccata attggttcca tgcagtactc catggaactg 480atagaagata actattccta cagcattaag gaggaccacc tcctccgtga gtgcactcaa 540ctcaacgaaa acgtaaggat attactgaat gagaacagaa ggctgatggt ggagcaggct 600ggccataagt gtcctgtggg gaagaaaaga ggttctctga ggaggccagc aagaacatct 660gtgtcccaag tgccaaggaa cagcagtcca gcagaaagca gaacatggca cagaccagga 720aatgatctcc ctcaaagaga agtgctggag gaagagcact gagtgtgca 76944988DNAMus musculus 44ggatcacacg ggtccatgag aagctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggatagaac tagaatcctc tgcgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagactggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaatgacca agaagagatc 420aaaaataaat gaactagaag aactgaaatt ggatatgagg aagatcagca atgacatgga 480ggaaatgtgt ggaatcctga acctttacat gtatgaggat ttgaactaca ggatgaacac 540tgaattcaac atcattaaat cacaacatga gaagacaatg ttggatatga ataaaatgat 600ccagtccata attggttcca tgcagtactc caaggaactg atagaagata actattccta 660cagggccctt gcagggatca taggacttgt aggagtggca agccaatgga atctggctgg 720gaatcaccaa tttttctttg tggatcagca ttaaggagga ccacctcctc cgtgagtgca 780ctcaactcaa cgaaaacgta aggatattac tgaatgagaa cagaaggctg ctggtggagc 840aggctggcca taagtgtcct gtggggaaga aaagaggttc tctgaggagg ccagcaagaa 900catctgtgtc ccaagtgcca aggaacagca gtgtgaaata gtccaacaga aagcagaaca 960tggcacagac cacgacatga tctccctc 98845867DNAMus musculus 45ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacagcagg aatgttttcc tggctgctca ggctatttca gaaagagaat 120ggcgatgaag gagagaccag accaacagag aaggaagagg gaatcctttc tcatgaaaaa 180ggaagaagga aatcattctg gagaaggcac aggtctgcta gaaatacttc aacccaaaat 240tccaaaatga ctaagaagag atcaaaaata aatgaactag aagaactgaa attggatatg 300aggaagatca gcaatgacat ggaggaaatg tgtggaatcc tgaaccttta catgtatgag 360gatttgaact acaggatgaa cactgaattc aacatcatta aatcacaaca tgagaagaca 420atgttggata tgaataaaat gatccagtcc ataattggtt ccatgcagta ttccaaggaa 480ctgatagaag ataactattc ctacagggcc cttgcaggga tcataggact tgtacgagtg 540gcaagccaat ggaatctggc tgggaatcac caatttttct ttgtggatca gcattaagga 600ggaccacctc ctccgtgagt gcactcaact caacgaaaac gtaaggatat tactgaatga 660gaacagaagg ctgctggtgg agcaggctgg ccataagtgt cctgtgggga agaaaagagg 720ttctctgagg aggccaggaa gtacatctgt gtcccaagtg ccaaggaaca gcagtgtgat 780atagtccagc agaaagcaga acatggcaca gaccacggca tgatctccct caaagagaag 840tgctggagga agagcactga gtgtgca 86746631DNAMus musculus 46gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcaa taattggttc catgcagtac tctaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtc cagcagaaag cagaacatgg cactgaccac gacatgatct ccctcaaaga 600gaagtgctgg aggaagagca ctgagtgtgc a 63147756DNAMus musculus 47caggagcagt ggctaaatgt tgaactcttc aaaacttggc gtatgggctg ctggtgtacc 60accatcatcc ccaacactcc tgttcagaag atgggtgagg aaagtggaaa gtctaaccag 120tcagccgatg accagtggga aaaatgagct acaagatcac ctgatcttca

tcagtgagaa 180agctttgcac aagagggtct gctagaaata cttcaaccca aaattccaaa atgactaaga 240agagatcaaa aataaatgaa ctagaagaac tgaaattgga tatgaggaag atcagcaatg 300acatggagga aatgtgtgga atcctgaacg tttacatgta tgaggatttg aactacagga 360tgaacactga attcaacatc attaaatcac aacatgagaa gacaatgttg gatatgaata 420aaatgatcca gtccataatt ggttccatgc agtactccaa ggaactgata gaagataact 480attcctacag cattaaggag gaccacctcc tccgtgagtg cactcaactc cacgaaaacg 540taaggatatt actgaatgag aacagaaggc tgctggtgga gcaggctggc cacaagtgtc 600ctgtggggaa gaaaagaggt tctctgagga ggccagcaag aacatctgtg tcccaagtgc 660caaggaacag cagtccagca gaaagcagaa catggcacag accaggacat gatctccctc 720aaagagaagt gctggaggaa gagcactgag tgtgca 75648631DNAMus musculus 48gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatt 180gaggaaatgt gtggaatcct aaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcaa taattggttc catgcagtac tctaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtc cagcagaaag cagaacatgg cacagaccag gacatgatct ccctcaaaga 600gaagtgctgg aggaagagca ctgagtgtgc a 63149648DNAMus musculus 49aagcctaacc actcagccga tgacaagtgg gaaaaatgcg ctacaagatc acctgatatt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgggtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtcaataa ttggttccat gcagtactct aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgac tgcactcaac 420tccacgaaaa cgtaaggata ttactgaatg agaacagaag gctgctggtg gagcaggctg 480gccacaagtg tcctgtgggg aagaaaagag gttctctgag gaggccagca agaacatctg 540tgtcccaagt gccaaggaac agcagtccag cagaaagcag aacatggcac agaccaggac 600atgatctccc tcaaagagaa gtgctggagg aagagcactg agtgtgca 64850631DNAMus musculus 50gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctgt gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtc cagcagaaag cagaacatgg cacagaccag gacatgatct ccctcaaaga 600gaagtgctgg aggaagagca ctgagtgtgc a 63151648DNAMus musculus 51aagtctaacc agtcagccga tgaccagtgg gaacaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgtgtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttggttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tccacgaaaa cgtaaggata ttactgaatg agaacagaag gctgctggtg gagcaggctg 480gccacaagtg tcctgtgggg aagaaaagag gttctctgag gatgccagat agaacatctg 540tgtcccaagt gccaaggaac agcagtccag cagaaagcag aacatggcac agaccaggac 600atgatctccc tcaaagagaa gtgctggagg aagagcactg agtgtgca 64852637DNAMus musculus 52ggatcacacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacagggtc tgctagaaat acttcaaccc aaaattccaa aatgactaag 120aagagatcaa aaagaaatga actagaagaa ctgaaattgg atatgaggaa gatcagcaat 180gacatggagg aaatgtgtgg aatcctgaac ctttacatgt atgaggattt gaactacagg 240atgaacactg aattcaacat cattaaatca caacatgaga agacaatgtt ggatatgaat 300aaaatgatcc agtccataat tggttccatg cagtattcca aggaactgat agaagataac 360tattcctaca gcattaagga ggaccacctc ctccgtgagt gcactcaact ccacgaaaat 420gtaaggatat tactgaatga gaacagaagg ctgctggtgg agcaggctgg ccacaagtgt 480cctgtgggga agaaaagagg ttctctgagg aggccagcaa gaacatctgt gtcccaagtc 540ccaaggaaca gcagtccagc agaaagcaga acatggcaca gaccaggaca tgatctccct 600caaagagaag tgctggagga agagcactga gtgtgca 63753641DNAMus musculus 53gactcagaat ggtctcccct gcccctgggc cttcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaaagtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaagcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtg tgaaatagtc cagcagaaag cagaacatgg cactgaccac gacatgatct 600ccctcaaaga gaagtgctgg aggaagagca ctgagtgtgc a 64154940DNAMus musculus 54ggatcccacg ggtccatgag aggctccagg agaggcaccc cagaaaagga ccaagctggg 60cagaactagt taacaggtag gtcatggcag ttgctagtga catcatcagt aatgccttcc 120ttggagaatc tcttgtatct aggataaaac tagaatcctc tgcgttgtca cctgtgttgt 180ggtgacagca actgcctgtg gttcatccct tctgtttgct ctgggttcac cagcaggaat 240gttttcctgg ctgctcaggc tatttcagaa agagaatggc gatgaaggag agaccagacc 300aacagagaag gaagagggaa tcctttctca tgaaaaagga agaaggaaat cattctggag 360aaggcacagg tctgctagaa atacttcaac ccaaaattcc aaaaatgact aagaagagat 420caaaaataaa tgaactagaa gaactgaaat tggatatgag gaagatcagc aatgacatgg 480aggaaatgtg tggaatcctg aacctttaca tgtatgagga tttgaactac aggatgaaca 540ctgaattcaa catcattaaa tcacaacatg agaagacaat gttggatatg aataaaatga 600tccagtccat aattggttcc atgcagtact ccaaggaact gatagaagat aaccattcct 660acagcattaa ggaggaccac ctcctccgtg agtgcactca actcaacgaa aacgtaagga 720tattactgaa tgagaacaga aggctgctgg tggagcaggc tggctataag tgtcctgtgg 780ggaagaaaag aggttctctg aggaggccag caagaacatc tgtgtcccaa gtgccaagga 840acagcagtgt gaaatagtcc agctgaaagc agaacatggc acagaccagg acatgatctc 900cctcaaagag aagtgctgga ggaagagcac tgagtgtgca 94055641DNAMus musculus 55gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac caagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtg tgatatagtc cagcagaaag cagaacatgg cacagaccac gacatgatct 600ccctcaaaga gaagtgctgg aggaagagca ctgagtgtgc a 64156641DNAMus musculus 56gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaagaa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagt ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagtg tgatatagtc cagcagaaag cagaacatgg cacagaccac gacatgatct 600ccctcaaaga gaagtgctgg aggaagagca ctgagtgtgc a 64157646DNAMus musculus 57gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca accaaaaatt ccaaaatgac taagcagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacagcagct aagtgtgaaa tagtccagct gaaagcagaa catggcacag accaggacat 600gatctccctc aaagagaagt gctggaggaa gagcactgag tgtgca 64658659DNAMus musculus 58aaagtctaat cagtcagccg atgaccagtg ggaaaaatga gctacaagat cacctgatct 60tcatcagtga gaaagctttg cacaagaggg tctgctagaa atacttcaac ccaaaattcc 120aaaatgacta agaagagatc aaaaataaat gaactagaag aactgaaatt ggatatgagg 180aagatcagca atgacatgga ggaaatgtgt ggaatcctga acctttacat gtatgaggat 240ttgaactaca ggatgaacac tgaattcaac atcattaaat cacaacatga gaagacaatg 300ttggatatga ataaaatgat ccagtccata attggttcca tgcagtactc caaggaactg 360atagaagata actattccta cagcattaag gaggaccacc tcctccgtga gtgcactcaa 420ctccacgaaa acgtaaggat attactgaat gagaacagaa ggctgctggt ggagcaggct 480ggccacaagt gtcctgtggg gaagaaaaga ggttctctga ggaggccagc aagaacatct 540gtgcctcaag tgccaaggag cagcagtgtg atatagtcca gcagaaagca gaacatggca 600cagaccacga catgatctcc ctcaaagaga agtgctggag gaagagcact gagtgtgca 65959658DNAMus musculus 59aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgtgtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttgtttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tccacgaaaa tgtaaggata ttactgaatg agaacagaag gctgctggtg gatcaggctg 480gccacaagtg tcctgtgggg aagaaaagag gttctctgag gaggccagca agaacatctg 540tgtcccaagt gccaaggaac accagtgtga aatagtccag cagaaagcag aacatggcac 600agaccaggac atgatctccc tcaaagagaa gtgctggagg aagagcactg agtgtgca 65860766DNAMus musculus 60caggagcagt ggctaaatgt tgaactcttc aaaacttggc gtatgggctg ctggtgtacc 60accatcatcc ccaacactcc tgttcagaag atgggtgagg aaagtggaaa gtctacccag 120tcagccgatg accagtggga aaaatgagct acaagatcac ctgatcttca tcagtgagaa 180agctttgcac aagagggtct gctagaaata cttcaaccca aaattccaaa atgactaaga 240agagatcaaa aataaatgaa ctagaagaac tgaaattgga tatgaggaag atcagcaatg 300acatggagga aatgtgtgga atcctgaacc tttacatgta tgaggatttg aactacagga 360tgaacactga attcaacatc attaaatcac aacatgagaa gacaatgttg gatatgaata 420aaatgatcca gtccataatt ggttccatgc agtactccaa ggaactgata gaagataact 480attcctacag cattaaggag gaccacctcc tccgtgagtg cactcaactc cacgaaaacg 540taaggatatt actgaatgag aacagaaggc tgctggtgga gcaggctggc cacaagtgtc 600ctgtggggaa gaaaagaggt tctctgagga ggccagcaag aacatctgtg tcccaagtgc 660caaggaacac cagtgtgaaa tagtccagca gaaagcagaa catggcacag accaggacat 720gatctccctc aaagagaagt gctggaggaa gagcactgag tgtgca 76661658DNAMus musculus 61aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatcc aaaagaaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgtgtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttggttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tccacgaaaa cgtaaggata ttactgaatg agaacagaag gctgctggtg gagcaggctg 480gccacaagtg tcctgtgggg aagaaaagag gttctctgag gaggccagca agaacatctg 540tgtcccaagt gccaaggaac accagtgtga tatagtccag cagaaagcag aacatggcac 600agaccacgac atgatctccc tcaaagagaa gtgctggagg aagagcactg agtgtgca 65862641DNAMus musculus 62gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca gcaagaacat ctgtgtccca agtgccaagg 540aacaccagtg tgatatagtc cagcagaaag cagaacatgg cacagaccac gacatgatct 600ccctcaaaga gaagtgctgg aggaagagca ctgagtgtgc a 64163766DNAMus musculus 63caggagcagt ggctaaatgt tgaactcttc aaaacttggc gtatgggctg ctggtgtacc 60accatcatcc ccaacactcc tgttcagaag atgggtgagg aaagtggaaa gtctaatcag 120tcagccgatg accagtggga aaaatgagct acaagatcac ctgatcttca tcagtgagaa 180agctttgcac aagagggtct gctagaaata cttcaaccca aaattccaaa atgactaaga 240agagatcaaa aagaaatgaa ctagaagaac tgaaattgga tatgaggaag atcagcaatg 300acatggagga aatgtgtgga atcctgaacc tttacatgta tgaggatttg aactacagga 360tgaacactga attcaacatc attaaatcac aacatgagaa gacaatgttg gatatgaata 420aaatgatcca gtccataatt ggttccatgc agtattccaa ggaactgata gaagataact 480attcctacag cattaaggag gaccacctcc tccgtgagtg cactcaactc cacgaaaatg 540taaggatatt actgaatgag aacagaaggc tgctggtgga gcaggctggc cacaagtgtc 600ctgtggggaa gaaaagaggt tctctgagga ggccagcaag aacatctgtg tcccaagtcc 660caaggaacag cagtgtgaaa tagtccagca gaaagcagaa catggcacag accaggacat 720gatctccctc aaagagaagt gctggaggaa gagcactgag tgtgca 76664640DNAMus musculus 64gactcagaat ggtctcccct gcccctgggc cttcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac caagaagaga 120tcaaaaagaa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactcaacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccataa gtgtcctgtg 480gggaagaaaa gaggttctct gaggaggcca caagaacatc tgtgtcccaa gtgccaagga 540acagcagtgt gatatagtcc agcagaaagc agaacatggc acagaccacg acatgatctc 600cctcaaagag aagtgctgga ggaagagcac tgagtgtgca 64065640DNAMus musculus 65gactcagaat ggtctcccct gcccctgggc catcaagtat gcaaattctt ttgtgtttac 60ctatctgcag ggtctgctag aaatacttca acccaaaatt ccaaaatgac taagaagaga 120tccaaaagaa atgaactaga agaactgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct gaacctttac atgtatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa gtgtcctgtg 480gggaagaaaa aggttctctg aggaggccag caagaacatc tgtgtcccaa gtgccaagga 540acaccagtgt gatatagtct agcagaaagc agaacatggc acagaccacg acatgatctc 600ccacaaagag aagtgctgga ggaagagcac tgagtgtgca 64066647DNAMus musculus 66aagtctaccc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgtgtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttggttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tccacgaaaa cgtaaggata ttactgaatg agaacgaagg ctgctggtgg agcaggctgg 480ccacaagtgt cctgtgggga agaaaagagg ttctctgagg aggccagcaa gaacatctgt 540gtcccaagtg ccaaggaaca gcagtccagc agaaagcaga acatggcaca gaccaggaca 600tgatctccct caaagagaag tgctggagga agagcactga gtgtgca 64767573DNAMus musculus 67caggagcagt ggctaaatgt tgaactcttc aaaacttggc gtatgggctg ctggtgtacc 60accatcatcc ccaacactcc tgttcagaag atgggtgagg aaagtggaaa gtctaatcag 120tcagccgatg accagtggga aaaatgagct acaagatcac ctgatcttca tcagtgagaa 180agctttgcac aagagggtct gctagaaata cttcaaccca aaattccaaa atgactaaga 240agagatcaaa aagaaatgaa ctagaagaac tgaaattgga tatgaggaag atcagcaatg 300acatggagga aatgtgtgga atcctgaacc tttacatgta tgaggatttg aactacagga 360tgaacactga attcaacatc attaaatcac aacatgagaa gacaatgttg gatatgaata 420aaatgatcca gtccataatt ggttccatgc agtattccaa ggaactgata gaagataact 480attcctacag tccagcagaa agcagaacat ggcacagacc aggacatgat ctccctcaaa 540gagaagtgct ggaggaagag cactgagtgt gca 57368658DNAMus musculus 68aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatcactaa gcagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgggtg gaatcctgga actttacata tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa tgaaatgatc cagtccataa ttgtttccat gcagtactcc

aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tcagcgaaaa agtaaggata ttactgaatg agaacagaaa gctgctagtg gagcaggctg 480gaacgcaatt gtctcatggg gaagaaaaga ggttctgtga ggaggccagc aagaacatct 540gtgcctcaag tgccaaggag cagcagtgtg taaactccag tagaaaccgg aacatggcac 600agaccacgac atgatctccc tcaaagagaa gtgctggagg aggagcactg agtgtgca 65869474DNAMus musculus 69aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatcactaa gcagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgggtg gaatcctgga actttacata tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa tgaaatgatc cagtccataa ttgtttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agtgtgtaaa ctccagtaga aaccggaaca tggcacagac 420cacgacatga tctccctcaa agagaagtgc tggaggaaga gcactgagtg tgca 47470640DNAMus musculus 70gactcagaat ggtctcccct gcgcctgggc catcaagtat gcaaattctt ttgtgtttat 60ctatctgcag ggtctgctag aaatacttca acccagaatt ccaaaatcac taagaagaga 120tcaaaaataa atgaactaga agaattgaaa ttggatatga ggaagatcag caatgacatg 180gaggaaatgt gtggaatcct ggacctttac atatatgagg atttgaacta caggatgaac 240actgaattca acatcattaa atcacaacat gagaagacaa tattggatat gaataaaatg 300atccagtcca taattggttc catgcagtac tccaaggaac tgatagaaga taactattcc 360tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga aaacgtaagg 420atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa gtgtcctgtg 480ggaagaaaag tggttctctg aggaggccag caagaacatc tgtgtcccaa gtgccaagga 540acagcagtgt gaaatagtcc agcagaaagc agaacatggc acagaccagg acatgatctc 600cctcaaagag aagtgctgga ggaagagcac tgagtgtgca 64071475DNAMus musculus 71aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagaggat ctgctagaaa tacttcaacc caaaagtcca 120aaatcactaa gcagaaatca aatataaatg aactagaaga attgaatttg gatatgagga 180agatcagtaa tgacatggag gaaatgtgtg gaatcctgga cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttggttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agtgtgaaat aggcaggcag aaagcagaac atggcacaga 420ccaggacatg atctccctca aagagaagtg ctggaggaag agcactgagt gtgca 4757220DNAArtificial SequenceSynthesized 72catccccaac actcctgttc 207321DNAArtificial SequenceSynthesized 73gaggagcata cagcccatta c 217429DNAArtificial SequenceSynthesized 74ctagctagca agatgggtga ggaaagtgg 297529DNAArtificial SequenceSynthesized 75ccgctcgagt gcacactcag tgctcttcc 297622DNAArtificial SequenceSynthesized 76cagctggaag atagcttttc tg 227729DNAArtificial SequenceSynthesized 77ctagctagct ccctccatct tcttcttgg 297819DNAArtificial SequenceSynthesized 78cccctcaaaa gcacatgac 197929DNAArtificial SequenceSynthesized 79ctagctagcg aaggagaggt tgccaaagg 298020DNAArtificial SequenceSynthesized 80actcgtctcg ccacatgaac 208131DNAArtificial SequenceSynthesized 81ctagctagct tcacagagat gtgagatgga g 318219PRTMus musculus 82Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu Asp1 5 10 15Met Arg Lys8319PRTMus musculus 83Cys Pro Val Gly Lys Lys Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr1 5 10 15Ser Val Ser84644DNAArtificial SequenceSynthesized 84gcatttctct gagtcccttt aaatgtgcac tcttcctggg ccagaggcta gatgaaatta 60aggcctgttc ataccaaaga aacaaaataa aggaggagca tacagcccat tacagccatg 120gttattaggg atgagaggca acagtggtgt atttcctgtg cacactcagt gctcttcctc 180cagcacttct ttttgaggga gatcatgtcg tggtctgtgc cgtgttctgc tttctgctgg 240actatttcac actgctgttc tttggcactt gggacacaga tgttcttgct ggcctcctca 300gagaacctct tttcttcccc acaggacact tgtggccagc ctgctccacc agcagccttc 360tgttctcatt cagaaatatc cttacgtttt cgttgagttg agtgcactca cggaggaggt 420ggtcctcctt aatgctgtag gaatagttat cttctatcag ttccttggag tactgcatgg 480aaccaattat ggactgggat catttttatt catatccaac attgncttct catgttgtga 540tttaatgatg ttgaattcag tgttcatcct gtagttcaaa tcctcataca tgtaaaggtt 600caggattcca cacatttcct ccatgtcatt gctgatcttc ctca 64485653DNAMus musculus 85tcttcttctt gggactcaga atggtctccc ctgcccctgg tccatcaagt atgcaaattc 60ttttgtgttt acctatctgc agggtctgct agaaatactt caacccaaaa ttccaaaatg 120actaagaaga gatcaaaaat aaatgaacta gaagaactga aattggatat gaggaagatc 180agcaatgaca tggaggaaat gtgtggaatc ctgaaccttt acatgtatga ggatttgaac 240tacaggatga acactgaatt caacatcatt aaatcacaac atgagaagac aatgttggat 300atgaataaaa tgatccagtc cataattggt tccatgcagt actccaagga actgatagaa 360gataactatt cctacagcat taaggaggac cacctcctcc gtgagtgcac tcaactcaac 420gaaaacgtaa ggatattact gaatgagaac agaaggctgc tggtggagca ggctggctat 480aagtgtcctg tggggaagaa aagaggttct ctgaggaggc cagcaagaac atctgtgtcc 540caagtgccaa ggaacagcag tgtgaaatag tccagctgaa agcagaacat ggcacagacc 600aggacatgat ctccctcaaa gagaagtgct ggaggaagag cactgagtgt gca 65386652DNAMus musculus 86cttcttcttg ggactcagaa tggtctcccc tgcccctggg ccatcaagta tgcaaattct 60tttgtgttta cctatctgca gggtctgcta gaaatacttc aacccaaaat tccaaaatga 120ccaagaagag atcaaaaata aatgaactag aagaactgaa attggatatg aggaagatca 180gcaatgacat ggaggaaatg tgtggaatcc tgaaccttta catgtatgag gatttgaact 240acaggatgaa cactgaattc aacatcatta aatcacaaca tgagaagaca atgttggata 300tgaataaaat gatccagtca ataattggtt ccatgcagta ctctaaggaa ctgatagaag 360ataactattc ctacagcatt aaggaggacc acctcctccg tgagtgcact caactcaacg 420aaaacgtaag gatattactg aatgagaaca gaaggctgct ggtggagcag gctggccata 480agtgtcctgt ggggaagaaa agaggttctc tgaggaggcc agcaagaaca tctgtgtccc 540aagtgccaag gaacagcagt gtgatatagt ccagcagaaa gcagaacatg gcacagacca 600cgacatgatc tccctcaaag agaagtgctg gaggaagagc actgagtgtg ca 65287784DNAMus musculus 87atgtgagatg gagcaggagc agtggctaaa tgttgaactc ttcaaaactt ggcttatggg 60ctgctggtgt atcaccatca tccccaacac tcctgttcag aagatgggtg aggaaagtgg 120aaagcctaac cactcagccg atgaccagtg ggaaaaatga gctacaagat cacctgatct 180tcatcagtga gaaagctttg cacaagaggg tctgctagaa atacttcaac ccaaaattcc 240aaaatgacca agaagagatc aaaaataaat gaactagaag aactgaaatt ggatatgagg 300aagatcagca atgacatgga ggaaatgtgt ggaatcctga acctttacat gtatgaggat 360ttgaactaca ggatgaacac tgaattcaac atcattaaat cacaacatga gaagacaatg 420ttggatatga ataaaatgat ccagtccata attggttcca tgcagtactc caaggaactg 480atagaagata actattccta cagcattaag gaggaccacc tcctccgtga gtgcactcaa 540ctcaacgaaa acgtaaggat attactgaat gagaacagaa ggctgctggt ggagcaggct 600ggccataagt gtcctgtggg gaagaaaaga ggttctctga ggaggccagc aagaacatct 660gtgtcccaag tgccaaggaa cagcagctaa gtgtgaaata gtccagctga aagcagaaca 720tggcacagac caggacatga tctccctcaa agagaagtgc tggaggaaga gcactgagtg 780tgca 78488643DNAMus musculus 88tcttcttctt gggactcaga atggtctccc ctgcccctgg gccatcaagt atgcaaattc 60ttttgtgttt acctatctgc agggtctgct agaaatactt caacccaaaa ttccaaaatg 120actaagaaga gatcaaaaat aaatgaacta gaagaactga aattggatat gaggaagatc 180agcaatgaca tggaggaaat gtgtggaatc ctgaaccttt acatgtatga ggatttgaac 240tacaggatga acactgaatt caacatcatt aaatcacaac atgagaagac aatgttggat 300atgaataaaa tgatccagtc aataattggt tccatgcagt actctaagga actgatagaa 360gataactatt cctacagcat taaggaggac cacctcctcc gtgagtgcac tcaactccac 420gaaaacgtaa ggatattact gaatgagaac agaaggctgc tggtggagca ggctggccac 480aagtgtcctg tggggaagaa aagaggttct ctgaggaggc cagcaagaac atctgtgtcc 540caagtcccaa ggaacagcag tccagcagaa agcagaacat ggcacagacc aggacatgat 600ctccctcaaa gagaagtgct ggaggaagag cactgagtgt gca 64389650DNAMus musculus 89aaggggatcc cacgggtcca tgagaggctc caggagaggc accccagaaa aggaccaagc 60tgggcagaac tagttaacag ggtctgctag aaatacttca acccaaaatt ccaaaatgac 120taagaagaga tcaaaaataa atgaactaga agaactgaaa ttggatatga ggaagatcag 180caatgacatg gaggaaatgg gtggaatcct gaacctttac atgtatgagg atttgaacta 240caggatgaac actgaattca acatcattaa atcacaacat gagaagacaa tgttggatat 300gaataaaatg atccagtcaa taattggttc catgcagtac tctaaggaac tgatagaaga 360taactattcc tacagcatta aggaggacca cctcctccgt gagtgcactc aactccacga 420aaacgtaagg atattactga atgagaacag aaggctgctg gtggagcagg ctggccacaa 480gtgtcctgtg ggaagaaaag tggttctctg aggaggccag caagaacatc tgtgtcccaa 540gtgccaagga acagcagtgt gaaatagtcc agcagaaagc agaatatggc acagaccacg 600acatgatctc cctcaaagag aggtgctgga ggaagagcac tgagtgtgca 65090657DNAMus musculus 90aagtctaatc agtcagccga tgaccagtgg gaaaaatgag ctacaagatc acctgatctt 60catcagtgag aaagctttgc acaagagggt ctgctagaaa tacttcaacc caaaattcca 120aaatgactaa gaagagatca aaaataaatg aactagaaga actgaaattg gatatgagga 180agatcagcaa tgacatggag gaaatgtgtg gaatcctgaa cctttacatg tatgaggatt 240tgaactacag gatgaacact gaattcaaca tcattaaatc acaacatgag aagacaatgt 300tggatatgaa taaaatgatc cagtccataa ttgtttccat gcagtactcc aaggaactga 360tagaagataa ctattcctac agcattaagg aggaccacct cctccgtgag tgcactcaac 420tcaacgaaaa cgtaaggata ttactgaatg agaacagaag gctgctggtg gagcaggctg 480gccataagtg tcctgtgggg aagaaaagag gttctctgag gaggccacaa gaacatctgt 540gtcccaagtg ccaaggaaca gcagtgtgat atagtccagc agaaagcaga acatggcaca 600gaccacgaca tgatctccct caaagagaag tgctggagga agagcactga gtgtgca 65791150PRTMus musculus 91Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly Tyr Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Lys145 15092150PRTMus musculus 92Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Val Ile145 15093148PRTMus musculus 93Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser14594172PRTMus musculus 94Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Ala Arg Thr Ser Val Ser Gln Val Pro 130 135 140Arg Asn Ser Ser Pro Ala Glu Ser Arg Thr Trp His Arg Pro Gly His145 150 155 160Asp Leu Pro Gln Arg Glu Val Leu Glu Glu Glu His 165 17095131PRTMus musculus 95Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Gly Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Gly Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu His Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Arg Lys 115 120 125Val Val Leu 13096148PRTMus musculus 96Met Thr Lys Lys Arg Ser Lys Ile Asn Glu Leu Glu Glu Leu Lys Leu1 5 10 15Asp Met Arg Lys Ile Ser Asn Asp Met Glu Glu Met Cys Gly Ile Leu 20 25 30Asn Leu Tyr Met Tyr Glu Asp Leu Asn Tyr Arg Met Asn Thr Glu Phe 35 40 45Asn Ile Ile Lys Ser Gln His Glu Lys Thr Met Leu Asp Met Asn Lys 50 55 60Met Ile Gln Ser Ile Ile Val Ser Met Gln Tyr Ser Lys Glu Leu Ile65 70 75 80Glu Asp Asn Tyr Ser Tyr Ser Ile Lys Glu Asp His Leu Leu Arg Glu 85 90 95Cys Thr Gln Leu Asn Glu Asn Val Arg Ile Leu Leu Asn Glu Asn Arg 100 105 110Arg Leu Leu Val Glu Gln Ala Gly His Lys Cys Pro Val Gly Lys Lys 115 120 125Arg Gly Ser Leu Arg Arg Pro Gln Glu His Leu Cys Pro Lys Cys Gln 130 135 140Gly Thr Ala Val145

Claims

1. An isolated nucleic acid comprising the nucleic acid sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No.: 2, SEQ ID No.: 38, SEQ ID No.: 39, SEQ ID No.: 40, SEQ ID No.: 41, SEQ ID No.: 42, SEQ ID No.: 43, SEQ ID No.: 44, SEQ ID No.: 45, SEQ ID No.: 46, SEQ ID No.: 47, SEQ ID No.: 48, SEQ ID No.: 49, SEQ ID No.: 50, SEQ ID No.: 51, SEQ ID No.: 52, SEQ ID No.: 53, SEQ ID No.: 54, SEQ ID No.: 55, SEQ ID No.: 56, SEQ ID No.: 57, SEQ ID No.: 58, SEQ ID No.: 59, SEQ ID No.: 60, SEQ ID No.: 61, SEQ ID No.: 62, SEQ ID No.: 63, SEQ ID No.: 64, SEQ ID No.: 65, SEQ ID No.: 66, SEQ ID No.: 67, SEQ ID No.: 68, SEQ ID No.: 69, SEQ ID No.: 70, SEQ ID No.: 71, SEQ ID No.: 85, SEQ ID No.: 86, SEQ ID No.: 87, SEQ ID No.: 88, SEQ ID No.: 89 and SEQ ID No.: 90.

2. The isolated nucleic acid of claim 1 wherein the nucleic acid is DNA.

3. An isolated nucleic acid that hybridizes to a nucleic acid selected from the group consisting of SEQ ID No. 1, SEQ ID No.: 2, SEQ ID No.: 38, SEQ ID No.: 39, SEQ ID No.: 40, SEQ ID No.: 41, SEQ ID No.: 42, SEQ ID No.: 43, SEQ ID No.: 44, SEQ ID No.: 45, SEQ ID No.: 46, SEQ ID No.: 47, SEQ ID No.: 48, SEQ ID No.: 49, SEQ ID No.: 50, SEQ ID No.: 51, SEQ ID No.: 52, SEQ ID No.: 53, SEQ ID No.: 54, SEQ ID No.: 55, SEQ ID No.: 56, SEQ ID No.: 57, SEQ ID No.: 58, SEQ ID No.: 59, SEQ ID No.: 60, SEQ ID No.: 61, SEQ ID No.: 62, SEQ ID No.: 63, SEQ ID No.: 64, SEQ ID No.: 65, SEQ ID No.: 66, SEQ ID No.: 67, SEQ ID No.: 68, SEQ ID No.: 69, SEQ ID No.: 70, SEQ ID No.: 71, SEQ ID No.: 85, SEQ ID No.: 86, SEQ ID No.: 87, SEQ ID No.: 88, SEQ ID No.: 89 and SEQ ID No.: 90.

4. The isolated nucleic acid of claim 3 wherein there is no more than about a 5% hybridization mismatch.

5. The isolated nucleic acid of claim 4 wherein there is no more than about a 2% hybridization mismatch.

6. The isolated nucleic acid of claim 5 wherein there is no more than about a 1% hybridization mismatch.

7. The isolated nucleic acid of claim 3 wherein the nucleic acid is DNA.

8. The isolated nucleic acid of claim 3 wherein the nucleic acid is RNA.

9. An isolated polypeptide having an amino acid sequence substantially similar to p16, wherein the isolated polypeptide has activity modulating cation efflux through the NMDA receptor.

10. The isolated polypeptide of claim 9 wherein the amino acid sequence substantially similar to p16 is an amino acid sequences selected from the group consisting of SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22, SEQ ID No.: 23, SEQ ID No.: 24, SEQ ID No.: 25, SEQ ID No.: 26, SEQ ID No.: 27, SEQ ID No.: 28, SEQ ID No.: 29, SEQ ID No.: 30, SEQ ID No.: 31, SEQ ID No.: 32, SEQ ID No.: 33, SEQ ID No.: 34, SEQ ID No.: 35, SEQ ID No.: 36, SEQ ID No.: 37, SEQ ID No.: 91, SEQ ID No.: 92, SEQ ID No.: 93, SEQ ID No.: 94, SEQ ID No.: 95 and SEQ ID No.: 96.

11. The isolated polypeptide of claim 9 wherein the amino acid sequence is coded by a nucleotide having a sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No.: 2, SEQ ID No.: 38, SEQ ID No.: 39, SEQ ID No.: 40, SEQ ID No.: 41, SEQ ID No.: 42, SEQ ID No.: 43, SEQ ID No.: 44, SEQ ID No.: 45, SEQ ID No.: 46, SEQ ID No.: 47, SEQ ID No.: 48, SEQ ID No.: 49, SEQ ID No.: 50, SEQ ID No.: 51, SEQ ID No.: 52, SEQ ID No.: 53, SEQ ID No.: 54, SEQ ID No.: 55, SEQ ID No.: 56, SEQ ID No.: 57, SEQ ID No.: 58, SEQ ID No.: 59, SEQ ID No.: 60, SEQ ID No.: 61, SEQ ID No.: 62, SEQ ID No.: 63, SEQ ID No.: 64, SEQ ID No.: 65, SEQ ID No.: 66, SEQ ID No.: 67, SEQ ID No.: 68, SEQ ID No.: 69, SEQ ID No.: 70, SEQ ID No.: 71, SEQ ID No.: 85, SEQ ID No.: 86, SEQ ID No.: 87, SEQ ID No.: 88, SEQ ID No.: 89 and SEQ ID No.: 90.

12. The isolated polypeptide of claim 9 wherein the isolated polypeptide forms a homodimer.

13. The isolated polypeptide of claim 9 wherein the isolated polypeptide forms an association with PSD-95.

14. The isolated polypeptide of claim 9 wherein the isolated polypeptide binds to a class I PDZ domain.

15. The isolated polypeptide of claim 14 wherein the isolated polypeptide further comprises an SVK sequence in the c-terminus.

16. The isolated polypeptide of claim 9 wherein the isolated polypeptide further comprises a coiled-coil domain.

17. The isolated polypeptide of claim 20 wherein a first isolated polypeptide is associated with a second isolated polypeptide.

18. The isolated polypeptide of claim 20 wherein the isolated polypeptide causes an increased efflux of cations through the NMDA receptor.

19. The isolated polypeptide of claim 18 wherein the cation efflux activity caused by the isolated polypeptide is negatively regulated by NR3A subunit of the NMDA receptor.

Images