CARCINOMA HOMING PEPTIDE (CHP), ITS ANALOGS, AND METHODS OF USING

Abstract

A mini-peptide and its analogs have been found to target gene products to tumors. The peptide, named Carcinoma Homing Peptide (CHP), increased the tumor accumulation of the reporter gene products in five independent tumor models, including one human xenogeneic model. A CHP-IL-12 fusion gene was also developed using CHP and the p40 subunit of IL-12. The product from CHP-IL-12 fusion gene therapy increased accumulation of IL-12 in the tumor environment. In three tumor models. CHP-IL-12 gene therapy inhibited distal tumor growth. In a spontaneous lung metastasis model, inhibition of metastatic tumor growth was improved compared to wild-type IL-12 gene therapy, and in a squamous cell carcinoma model, toxic liver lesions were reduced. The receptor for CHP was identified as vimentin. CHP can be used to improve the efficacy and safety of targeted cancer treatments.

Description

[0001] The benefit of the Feb. 11, 2011 filing date of the U.S. provisional patent application Ser. No. 61/441,914 is claimed under 35 U.S. .sctn.119(e).

TECHNICAL FIELD

[0003] This invention pertains to a carcinoma homing peptide and its analogs, compounds, and methods that target tumors, and methods to use these peptides including targeting, decreasing the size of, inhibiting growth of, and identification of mammalian tumors, such as breast adenocarcinoma, squamous cell carcinoma, and colon carcinoma.

BACKGROUND ART

[0004] The cytokine, interleukin 12 (IL-12), discovered by Giorgio Trinchieri in 1989 [1], bridges the innate and adaptive immune responses by inducing interferon-.gamma. (IFN-.gamma.) production primarily from natural killer and T cells. Cancer therapy with IL-12 exploits its natural immune functions to polarize T cells to the T.sub.h1 phenotype, boost effector T cells, downregulate angiogenesis, remodel the extracellular matrix, and alter the levels of immune suppressive cytokines [2]. Due to these activities, IL-12 is one of the most promising cytokines for immunomodulatory cancer therapy.

[0005] The initial clinical trials with IL-12 resulted in grave toxicities including deaths, which severely downgraded the reputation and potential application of this effective cytokine. In reality, most anticancer drugs or biological modalities are associated with systemic toxicity. It is desirable to decrease this toxicity to effectively and safely treat the extremely high numbers of cancer patients [2].

[0006] A popular strategy for sequestering the effects of cytokine therapies in the tumor environment is targeting cellular markers that are upregulated exclusively in the tumor cells or the tumor microenvironment. Indeed, conjugating IL-12 to tumor-specific antibodies, such as L19 [3] and HER2 [4], and tumor vasculature-specific peptides, such as ROD [5] and CNGRC (SEQ ID NO:9) [6], improves the efficacy of treatments; however, the necessarily high frequency of administrations of recombinant cytokines increases the immunogenicity, toxicity, and cost of treatments. A gene therapy approach would reduce these limitations.

[0007] Intratumoral IL-12 gene therapy is able to eradicate 40% of tumors in a murine squamous cell carcinoma model (SCCVII) while systemic delivery via intramuscular administration fails to eradicate any tumors [7]; however, direct injection into tumor sites is rarely available noninvasively or post-surgically. Several methods have been developed to target the IL-12 effect to the tumor after systemic delivery. For example, modifying viral vectors with tissue specific gene promoters such as the CALC-I promoter [8], capsid-expressed tumor-specific peptides [9], and polyethylene glycol or other nanoparticles [10, 11] increases tumor specific expression and decreases systemic expression; however, the fenestrated vasculature of the tumor environment allows for the gene products to leak out of the tumor environment leading to systemic toxicities [12]. Therefore, a gene product that can interact with and remain in the tumor environment will increase the level of therapeutic efficacy and decrease systemic toxicity.

[0008] Tumor targeting can be achieved via the screening of various libraries to select tumor-targeted peptides, DNA/RNA aptamers, antibodies, etc; however, the only mechanism that can be used for homing gene products from systemically injected genes will be tumor-targeted mini-peptides encoding DNA. The small size of these peptides eliminates the concern of immunogenicity, and reduces the effect on the biological function of the gene product, though some minipeptidies may boost or inhibit gene function [20]. The tiny peptide encoding DNA sequences can be easily fused with any therapeutic gene. Finally, these peptides can complement existing tumor targeting approaches such as transcriptional targeting [8], translational targeting [21], and targeted delivery [3-6].

[0009] Currently, most tumor-targeting strategies are based on extremely specific interactions, and the ability to target the tumor environment is constrained to a single cell type or specific type of tumor. Proteins are conjugated with polyunsaturated fatty acids, monoclonal antibodies, folic acid, peptides, and several other chemicals to increase the tumor-targeted ability of the therapeutic protein. Other tumor targeting peptides can deliver small molecules with only one copy for each small-molecule payload but require multiple copies of the peptide to target larger molecules such as a full length cytokine [24].

DISCLOSURE OF THE INVENTION

[0010] We have discovered a new tumor targeting peptide, VNTANST (SEQ ID NO:1), and its analogs. A DNA fragment encoding VNTANST (SEQ ID NO:1) was inserted directly before the stop codon of the p40 subunit of the IL-12 encoding sequence in plasmid DNA. Transfection of this plasmid DNA via intramuscular (i.m.) electroporation (EP) into muscle tissue distal from the tumor site inhibited tumor growth and extended survival in multiple tumor models and two mouse strains and reduced lung metastasis in a spontaneous metastatic model. Due to this broad targeting nature and to simplify the description, the peptide VNTANST (SEQ ID NO:1) was renamed the Carcinoma Homing Peptide (CHP). We discovered that the linear peptide VNTANST (SEQ ID NO:1) increased the tumor accumulation of the reporter gene products in five independent tumor models including one human xenogeneic model. The product from VNTANST-IL-12 fusion gene therapy increased accumulation of IL12 in the tumor environment, and in three tumor models, VNTANST-IL-12 gene therapy inhibited distal tumor growth. In a spontaneous lung metastasis model, inhibition of metastatic tumor growth was improved compared to wild-type (wt) IL-12 gene therapy, and in a squamous cell carcinoma model, toxic liver lesions were reduced. The receptor for VNTANST (SEQ ID NO:1) was identified as vimentin, which is localized on the cell surface of tumor cells but not on normal cells. Vimentin expression in tumors is associated with the epithelial to mesenchymal transition and increased malignancy and metastasis in tumors. Lastly, this gene product-targeted approach minimized the risk of IL-12-induced toxicity. These results show the promise of using VNTANST (SEQ ID NO:1) to as a homing peptide to target therapeutic compounds to tumor cells, for example, to improve delivery of IL-12 treatments.

[0011] We have developed a fully functional tumor targeting IL-12 gene construct that can be delivered systemically for treating distally located neoplastic diseases. We have administered the peptide CHP-IL-12 by direct intravenous injection, and have directly injected the gene construct into tissue followed by electroporation. Inserting peptide-encoding sequences directly prior to the stop codon in the p40 gene of an IL-12 plasmid did not interfere with transcription, translation, post-translational modifications, or therapeutic functionality of the IL-12 gene product. Also, CHP maintained its tumor-targeting ability as seen in IL-12.sup.-/- mice and increased the therapeutic efficacy of systemic IL-12 gene-therapy treatments while decreasing liver toxicity. In fact, CHP-IL-12 may home or target the tumor better than CHP alone.

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] FIG. 1A depicts the peptide-SEAP (secreted alkaline phosphatase) constructs with insertion of the peptide-coding sequence directly before the stop codon (arrow). CMV shows the location of the cytomegalovirus promoter; IVS shows the location of the intron; pA shows the location of the bovine growth hormone polyadenylation signal; SEAP shows the location of the secreted alkaline phosphatase-coding sequence; STOP shows the location of the stop codon.

[0013] FIG. 1B shows TIS SEAP (ratio of the SEAP activity between tumors and serum) levels 72 hours after i.m. EP of several peptide-SEAP plasmid DNAs in syngeneic CT26 (n=3), SCCVII (n=4), AT84 (n=4), and 4T1 (n=4) tumor-bearing mice, as well as xenogeneic MCF7 (n=4) tumor-bearing mice.

[0014] FIG. 1C shows DAB (diaminobenzidine) staining of tumor tissues from CHP-biotin treated mice counterstained with either hematoxylin (left) or eosin (right). The bottom images are larger versions of the areas within the white squares. Bar=100 .mu.m in the top panels and bar=200 .mu.m in the bottom panels.

[0015] FIG. 1D shows DAB staining of tumor tissues from Control-peptide-biotin treated mice counterstained with either hematoxylin (left) or eosin (right). The bottom images are larger versions of the areas within the white squares. Bar=100 .mu.m in the top panels and bar=200 .mu.m in the bottom panels.

[0016] FIG. 2A depicts the CHP-IL-12 construct with insertion of the CHP-coding sequence directly before the stop codon in the p40 subunit of IL-12 (arrow). CMV shows the location of the cytomegalovirus promoter; IVS shows the location of the intron; SEAP shows the location of the SEAP-coding sequence; STOP shows the location of the stop codon; and, pA shows the location of the bovine growth hormone polyadenylation signal.

[0017] FIG. 2B shows expression of IL-12 after in vitro transfection of 4T1 cells with control, wtIL-12, CDGRC-IL-12, and CHP-IL-12 (n=3).

[0018] FIG. 2C shows induction of IFN-.gamma. from splenocytes after transfer of condition medium containing Control, wtIL-12, CDGRC-II-12, or CHP-IL-12 gene products.

[0019] FIG. 2D shows IL-12 accumulation in tumor-bearing IL-12.sup.-/- mice treated with CHP-IL-12 or wtIL-12 determined via an IL-12p70 ELISA. Columns represent the wtIL-12-normalized level of IL-12/protein (pg/mg) in tumor per IL-12/protein (pg/mg) in kidneys, livers, and spleens and IL-12 .mu.g/mL serum (n=4). Error bars represent the standard error of the mean (SEM) (*represent p<0.05 compared to all groups).

[0020] FIG. 3A shows tumor growth following treatments with CHP-IL-12, wtIL-12, and control plasmid DNA in 4T1 tumor-bearing balb/c mice (n=5; *represents p<0.05 at day 30 and p<0.001 from day 33 until day 42 compared to wtIL-12 plasmid DNA and p<0.01 at day 21 and p<0.001 from day 24 to day 33 compared to control plasmid DNA).

[0021] FIG. 3B shows metastatic nodules in the lungs of 4T1 tumor-bearing balb/c mice (n=5) treated with CHP-IL-12, wtIL-12, and control plasmid DNA and sacrificed 17 days after the second treatment (*represents p<0.05 compared to wtIL-12 plasmid DNA; # represents p<0.001 compared to control plasmid DNA).

[0022] FIG. 3C shows Kaplan-Meier survival analysis of the 4T1 tumor-bearing balb/c mice treated with CHP-IL-12, wtIL-12, and control plasmid DNA (*represents p<0.05 compared to wtIL-12 plasmid DNA; # represents p<0.001 compared to control plasmid DNA).

[0023] FIG. 3D shows tumor growth following treatments with CHP-IL-12, wtIL-12, and control plasmid DNA in SCCVII tumor-bearing C3H mice (n=5; *represents p<0.05 on days 17 and 20 compared to wtIL-12 plasmid DNA and control plasmid DNA).

[0024] FIG. 3E shows Kaplan-Meier survival analysis of the SCCVII tumor-bearing C3H mice treated with CHP-IL-12, wtIL-12, and control plasmid DNA (*represents p<0.05 compared to wtIL-12 and control plasmid DNA).

[0025] FIG. 3F shows tumor growth following treatments with CHP-IL-12, wtIL-12, and control plasmid DNA in CT26 tumor-bearing balb/c mice (n=5; *represents p<0.05 compared to wtIL-12 plasmid DNA, n=4, on day 25, and control plasmid DNA, n=3, on days 19 through 25). Black arrows represent treatments, and error bars represent SEM.

[0026] FIG. 4A shows fluorescence-activated cell sorting (FACS) analysis of tumor infiltrating cells isolated from SCCVII tumors from C3H mice following intravenous (i.v.) injection of Control, wtIL-12, or CHP-II-12, with or without depletion of vimentin with a co-injection of purified polyclonal goat anti-vimentin (100 .mu.g) in the same i.v. injection as the peptide-biotin collected 7 days after the second treatment. The top right quadrant of the dot plot representation of cells gated for CD11c.sup.+ represents activated DC (CD81.sup.hi).

[0027] FIG. 4B shows tumor-specific cytotoxic T lymphocyte (CTL) activity from wtIL-12 and CHP-IL-12 fusion gene plasmid DNA treated mice bearing orthotopic EMT6 (a transplantable mouse mammary tumor cell line) tumors collected (*represents p<0.05).

[0028] FIG. 4C shows serum IFN-.gamma. levels from 4T1-tumor bearing Balb/c 3 days after treatments with CHP-IL-12, wtIL-12, and control plasmid. Error bars represent SEM.

[0029] FIG. 5A shows SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) analysis of potential receptors for CHP isolated via affinity chromatography of a pool of cell-surface proteins isolated from SCCVII cells. The only distinct band (arrow) was located in the second fraction, and mass spectrometry identified this band as vimentin. "BSA" represents bovine serum albumin.

[0030] FIG. 5B shows the interaction of CHP-biotin with recombinant vimentin-GST (Vimentin), GST, and coating buffer only (control) coated wells of a polystyrene plate (n=6; *represents p<0.001 compared to both GST and Control, errors bars represent SEM).

[0031] FIG. 5C shows Western blot analysis of vimentin expression in an SCCVII tumor (1) and heart (2), lung (3), liver (4), kidney (5), spleen (6), and serum (7) from SCCVII-tumor bearing C3H mice. "GAPDH" represents glyceraldehyde 3-phosphate dehydrogenase.

[0032] FIG. 5D shows Western blot analysis of vimentin expression in in vitro and ex vivo tumor samples from SCCVII, CT26, 4T-1, and B16F10 tumors.

[0033] FIG. 5E shows accumulation of peptide-biotin in syngeneic SCCVII tumor bearing C3H mice following i.v. injection of either Control-biotin (top left and right) or CHP-biotin (bottom left and right), with (top and bottom right) or without (top and bottom left) depletion of vimentin with a co-injection of purified polyclonal goat anti-vimentin (100 .mu.g) in the same i.v. injection as the peptide-biotin.

[0034] FIG. 6A shows the number of SCCVII tumor-bearing C3H mice with toxic lesions on the liver following two treatments of 1 .mu.g (2.times.1 .mu.g), 2 .mu.g (2.times.2 .mu.g), or 10 .mu.g (2.times.10 .mu.g) or three treatments of 2 .mu.g (3.times.2 .mu.g) of wtIL-12 or CHP-IL-12 (n=12).

[0035] FIG. 6B shows a representative image of a normal liver area from the SCCVII tumor-bearing C3H mice. Scale bar represents 50 .mu.m.

[0036] FIG. 6C shows a representative image of a toxic lesion from the SCCVII tumor-bearing C3H mice. Scale bar represents 50 .mu.m.

[0037] FIG. 6D shows levels of alanine transaminase (ALT), a key indicator of liver function, for both plasmid DNA treatments (wtIL-12 and CHP-IL-12) at all DNA levels and difference time points.

[0038] FIG. 7A shows SEAP activities in the tumors of the same CT26-tumor bearing mice used in FIG. 1B after peptide-SEAP plasmid DNA intramuscular electroporation of several peptides.

[0039] FIG. 7B shows SEAP activities in the serum of the same CT26-tumor bearing mice used in FIG. 1B after peptide-SEAP plasmid DNA intramuscular electroporation of several peptides.

[0040] FIG. 8 shows sections from the hearts, lungs, livers, kidneys, and spleens from the same mice in FIG. 2B, FIG. 2C and FIG. 2D, counterstained with eosin only.

[0041] FIG. 9 shows the level of CHP-specific IgG from EMT6-tumor bearing Balb/c mice treated with wtIL-12 or CHP-IL-12 gene therapy as determined via binding to wells of a microwell plate coated with coating buffer only, control peptide or CHP peptide (n=3).

[0042] FIG. 10 shows the activity of CHP-SEAP when bound to vimentin. The induction of IFN-.gamma. from splenocytes by CHP-IL12 and wtIL12 was compared when in the presence of vimentin or BSA. Error bars represent SEM and n=3.

[0043] FIG. 11 shows the tumor volume in SCCVII tumor-bearing C3H mice at various days after inoculation with various gene constructs, each comprising the named peptide added to the p40 subunit of IL-12 prior to the stop codon.

MODES FOR CARRYING OUT THE INVENTION

[0044] Tumor targeting can be achieved via the screening of various libraries to select tumor-targeted peptides, DNA/RNA aptamers, antibodies, and other known strategies. However, the only mechanism that can be used for homing gene products from systemically injected genes is the use of DNA sequences encoding for tumor-targeted mini-peptides. The small size of these peptides eliminates the concern of immunogenicity, as shown below, and reduces the effect on the biological function of the gene product, though some mini-peptides may boost or inhibit gene function [20]. The peptide-encoding DNA sequences can be easily fused with any therapeutic gene. Finally, the use of the mini-peptides can complement existing tumor targeting approaches such as transcriptional targeting, translational targeting, and targeted delivery].

[0045] We have discovered a tumor-targeting 7-amino-acid peptide, carcinoma homing peptide ("CHP," amino acid sequence of VNTANST (SEQ ID NO: 1)). The peptide VNTANST (SEQ ID NO:1) was previously reported to target normal lungs when present on the surface of virus particles [14]. We have shown that CHP was more effective than the known cyclic tumor-homing peptides such as CNGRC (SEQ ID NO:9) and RGD4C for targeting to tumors, which rely on disulfide bonds to maintain the cyclic structure of the targeting peptides.

[0046] Other tumor targeting peptides have been shown to deliver small molecules with only one copy for each small-molecule payload but require multiple copies of the peptide to target larger molecules such as a full length cytokine [24]. We have shown that fusion of a single copy of CHP-encoding DNA (gtcaacacggctaactcgaca (SEQ ID NO:2)) with the p40 subunit of IL-12 boosted the accumulation of IL-12 in tumors, suggesting one copy of CHP is sufficient to carry one copy of IL-12 to the tumor site.

[0047] Currently, most tumor-targeting strategies are based on extremely specific interactions, and the ability to target the tumor environment is constrained to a single cell type or specific type of tumor. We have shown, as discussed below, that CHP increased the efficacy of IL-12 gene therapy to inhibit tumor growth in the three tumor cell lines (i.e., breast adenocarcinoma, squamous cell carcinoma, and colon carcinoma), and in two different mouse strains. In addition, CHP-IL-12 extended survival more than wtIL-12 treatments in both the breast adenocarcinoma and squamous cell carcinoma cell lines. Similarly, CHP-IL-12 treatments inhibited the development of spontaneous lung metastasis, which is the primary killer of cancer patients. This increase in anti-tumor response was associated with increases in both tumor-specific cytotoxic T lymphocyte (CTL) activity and IL-12 accumulation in tumors. This result was in agreement with the result that intratumoral delivery of IL-12 yields better anti-tumor efficacy than systemic delivery [7]. The discovery of CHP is important since it will allow for systemic delivery to target IL-12 to tumors without the need of intratumoral delivery, which is not realistic for treating internal tumors, metastatic tumors, and residual tumor cells after standard therapy.

[0048] We also identified vimentin as a cell receptor for CHP. Vimentin is an intermediate filament protein conventionally regarded as an intracellular structural protein in cells of mesenchymal origin such as fibroblasts, chondrocytes, and macrophages [15]. Vimentin expression has been reported to be increased in several tumor models, including human prostate, colon [17], hepatocellular [16], and gemcitabine-resistant pancreatic cancers[19], and the tumor stromal cells in human colorectal tumors [18]. The upregulation of vimentin is associated with the epithelial-to-mesenchymal transition (EMT), which is important for motility as well as metastasis in several tumors. In addition, vimentin was recently discovered to be expressed on the cell surface of tumor cells [25] and epithelial cells during angiogenesis [26]. Additionally, some human tumor-initiating cells remaining after treatment overexpress vimentin on the tumor cell surface [27]. Another important aspect of vimentin is the conserved sequences among mouse, rat, dog, and humans [28]. This information along with our result for the tumor/serum SEAP accumulation in the xenogeneic human tumor model indicates that CHP targeting will be effective in human treatments.

[0049] We also confirmed (as discussed below) that vimentin is expressed at very low levels in the heart, liver, kidney, spleen, and serum of C3H mice, yet it is highly expressed in lung tissue. However, since most general expression of vimentin is intracellular [15, 29, 30], this expression should not be a target of CHP. We found that there was no accumulation of CHP-biotin in the lung sections which supports this theory. Conversely, as shown below, vimentin is highly expressed in aggressive murine squamous cell carcinoma (SCCVII) tumors in C3H mice, and CHP-biotin accumulated in the SCCVII tumors. Likewise, the tumor cells and corresponding syngeneic tumors both expressed detectable levels of vimentin. The differences seen between expression in tumor cell lines and the respective tumor tissues was due to the heterogeneous nature and multiple cell types in the tumor microenvironment.

[0050] We have developed a fully functional tumor-targeting IL-12 p40 gene construct based on CHP that can be delivered systemically for treating distally located neoplastic diseases. Inserting peptide-encoding sequences directly prior to the stop codon in the p40 subunit gene of an IL-12 plasmid did not interfere with transcription, translation, post-translational modifications, or therapeutic functionality of the IL-12 gene product. Also, CHP maintained its tumor-targeting ability as seen in IL-12-/- mice and increased the therapeutic efficacy of systemic IL-12 gene-therapy treatments, while decreasing liver toxicity. CHP-IL-12 was found to be more effective in decreasing tumor growth than other mini-peptides linked to the same p40 subunit of IL-12.

[0051] The term "CHP" used herein and in the claims refers to the peptide VNTANST. The term "CHP analogs" is understood to be peptides with consecutive sequences of 3 or more amino acids from VNTANST (SEQ ID NO:1) and that exhibit a qualitatively similar effect to the unmodified VNTANST (SEQ ID NO:1) peptide. Based on the effective size of other mini-peptides, we believe that effective CHP analogs include any three or greater consecutive amino acid sequence found within the CHP sequence, more preferably any four or greater consecutive amino acid sequence found within the CHP sequence, and most preferable any five or six consecutive amino acid sequence found within the CHP sequence. In addition, any DNA sequence that codes for any of the above VNTANST (SEQ ID NO:1) sequence or CHP analog sequences can be used for making tumor targeting constructs. In the experiments below, we used the DNA sequence of gtcaacacggctaactcgaca (SEQ ID NO:2) to encode for CHP, but due to the degeneracy of the DNA code, any DNA sequence that would code for CHP could be used. In addition, any DNA sequence that encodes for the CHP analogs could be used. CHP or CHP analog may be a synthetic or recombinant peptide. With its specific tumor targeting property, CHP peptide or CHP analogs or the DNA encoding for CHP or CHP analogs can carry therapeutic proteins, peptides, drugs, genes, cells, viral or nonviral vectors, bacteria and other modalities into tumor tissues, reducing the toxicity to other organs and increasing the therapeutic efficacy. As a result, a low dose of the peptide or construct may be needed for treating tumors. CHP or CHP analogs or the corresponding DNA encoding for CHP or CHP analogs can also be used to carry therapeutic agents for prevention or treatment of metastatic tumors. Therapeutic agents are well known in the art (e.g., peptides, chemotherapeutic agents, liposomes, nanoparticles) that can be conjugated to a targeted peptide for increased accumulation of the therapeutic agent in the tumor environment.

[0052] CHP and CHP analogs can be used in a variety of applications including exploratory studies to diagnose tumors or tumor metastasis in combination with image tools, to monitor the effect of treatments in combination with image tools, and to deliver therapeutic agents for treating metastatic tumors and tumors localized in internal organs as well as prevent tumor recurrence from residual tumors after standard therapy. The therapeutic agents to be carried by CHP and CHP analogs include anti-tumor drugs, peptides, proteins, genes, cells, viral/nonviral vectors, bacteria and others. For example, the p40 subunit of the protein IL-12 was used below. We have made a new conjugate of CHP and the p40 subunit of IL-12. The sequence of this new construct is found in Table 1, below. The peptide sequence for CHP-IL-12 is SEQ ID NO: 3, and the nucleic acid sequence is SEQ ID NO: 4. Initial work on conjugating other cytokines to CHP, for example IL-15 and PF4, indicate that some increase in efficacy was seen for IL-15, but that in these initial tests, no increase in efficacy was seen in CHP-PF4.

[0053] CHP and CHP analogs can be administered by methods known in the art. In our work, we have used both direct injection of the gene construct into tissue followed by electroporation, and have directly injected the peptide intravenously. As a DNA gene construct, the delivery can be from vectors which may be derived from viruses or from bacterial plasmids. There are many methods to deliver gene constructs to tumors or targeted tissues. Some examples of the various delivery systems can be found in U.S. Pat. Nos: 5,910,488; 7,192,927; and 7,318,919; whose descriptions of such delivery systems are hereby incorporated by reference. In addition, the vector delivery system may incorporate a promoter sequence to initiate transcription of the gene construct.

Sequence CWU 1

1

3317PRTArtificial sequenceSynthesized 1Val Asn Thr Ala Asn Ser Thr 1 5 221DNAArtificial sequenceSynthesized 2gtcaacacgg ctaactcgac a 213344PRTArtificial sequenceSynthesized 3Met Cys Pro Gln Lys Leu Thr Ile Ser Trp Phe Ala Ile Val Leu Leu 1 5 10 15 Val Ser Pro Leu Met Ala Met Trp Glu Leu Glu Lys Asp Val Tyr Val 20 25 30 Val Glu Val Asp Trp Thr Pro Asp Ala Pro Gly Glu Thr Val Asn Leu 35 40 45 Thr Cys Asp Thr Pro Glu Glu Asp Asp Ile Thr Trp Thr Ser Asp Gln 50 55 60 Arg His Gly Val Ile Gly Ser Gly Lys Thr Leu Thr Ile Thr Val Lys 65 70 75 80 Glu Phe Leu Asp Ala Gly Gln Tyr Thr Cys His Lys Gly Gly Glu Thr 85 90 95 Leu Ser His Ser His Leu Leu Leu His Lys Lys Glu Asn Gly Ile Trp 100 105 110 Ser Thr Glu Ile Leu Lys Asn Phe Lys Asn Lys Thr Phe Leu Lys Cys 115 120 125 Glu Ala Pro Asn Tyr Ser Gly Arg Phe Thr Cys Ser Trp Leu Val Gln 130 135 140 Arg Asn Met Asp Leu Lys Phe Asn Ile Lys Ser Ser Ser Ser Ser Pro 145 150 155 160 Asp Ser Arg Ala Val Thr Cys Gly Met Ala Ser Leu Ser Ala Glu Lys 165 170 175 Val Thr Leu Asp Gln Arg Asp Tyr Glu Lys Tyr Ser Val Ser Cys Gln 180 185 190 Glu Asp Val Thr Cys Pro Thr Ala Glu Glu Thr Leu Pro Ile Glu Leu 195 200 205 Ala Leu Glu Ala Arg Gln Gln Asn Lys Tyr Glu Asn Tyr Ser Thr Ser 210 215 220 Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Lys Asn Leu Gln 225 230 235 240 Met Lys Pro Leu Lys Asn Ser Gln Val Glu Val Ser Trp Glu Tyr Pro 245 250 255 Asp Ser Trp Ser Thr Pro His Ser Tyr Phe Ser Leu Lys Phe Phe Val 260 265 270 Arg Ile Gln Arg Lys Lys Glu Lys Met Lys Glu Thr Glu Glu Gly Cys 275 280 285 Asn Gln Lys Gly Ala Phe Leu Val Glu Lys Thr Ser Thr Glu Val Gln 290 295 300 Cys Lys Gly Gly Asn Val Cys Val Gln Ala Gln Asp Arg Tyr Tyr Asn 305 310 315 320 Ser Ser Cys Ser Lys Trp Ala Cys Val Pro Cys Arg Val Arg Ser Val 325 330 335 Asn Thr Ala Asn Ser Thr Lys Leu 340 41035PRTArtificial sequenceSynthesized 4Ala Thr Gly Thr Gly Thr Cys Cys Thr Cys Ala Gly Ala Ala Gly Cys 1 5 10 15 Thr Ala Ala Cys Cys Ala Thr Cys Thr Cys Cys Thr Gly Gly Thr Thr 20 25 30 Thr Gly Cys Cys Ala Thr Cys Gly Thr Thr Thr Thr Gly Cys Thr Gly 35 40 45 Gly Thr Gly Thr Cys Thr Cys Cys Ala Cys Thr Cys Ala Thr Gly Gly 50 55 60 Cys Cys Ala Thr Gly Thr Gly Gly Gly Ala Gly Cys Thr Gly Gly Ala 65 70 75 80 Gly Ala Ala Ala Gly Ala Cys Gly Thr Thr Thr Ala Thr Gly Thr Thr 85 90 95 Gly Thr Ala Gly Ala Gly Gly Thr Gly Gly Ala Cys Thr Gly Gly Ala 100 105 110 Cys Thr Cys Cys Cys Gly Ala Thr Gly Cys Cys Cys Cys Thr Gly Gly 115 120 125 Ala Gly Ala Ala Ala Cys Ala Gly Thr Gly Ala Ala Cys Cys Thr Cys 130 135 140 Ala Cys Cys Thr Gly Thr Gly Ala Cys Ala Cys Gly Cys Cys Thr Gly 145 150 155 160 Ala Ala Gly Ala Ala Gly Ala Thr Gly Ala Cys Ala Thr Cys Ala Cys 165 170 175 Cys Thr Gly Gly Ala Cys Cys Thr Cys Ala Gly Ala Cys Cys Ala Gly 180 185 190 Ala Gly Ala Cys Ala Thr Gly Gly Ala Gly Thr Cys Ala Thr Ala Gly 195 200 205 Gly Cys Thr Cys Thr Gly Gly Ala Ala Ala Gly Ala Cys Cys Cys Thr 210 215 220 Gly Ala Cys Cys Ala Thr Cys Ala Cys Thr Gly Thr Cys Ala Ala Ala 225 230 235 240 Gly Ala Gly Thr Thr Thr Cys Thr Ala Gly Ala Thr Gly Cys Thr Gly 245 250 255 Gly Cys Cys Ala Gly Thr Ala Cys Ala Cys Cys Thr Gly Cys Cys Ala 260 265 270 Cys Ala Ala Ala Gly Gly Ala Gly Gly Cys Gly Ala Gly Ala Cys Thr 275 280 285 Cys Thr Gly Ala Gly Cys Cys Ala Cys Thr Cys Ala Cys Ala Thr Cys 290 295 300 Thr Gly Cys Thr Gly Cys Thr Cys Cys Ala Cys Ala Ala Gly Ala Ala 305 310 315 320 Gly Gly Ala Ala Ala Ala Thr Gly Gly Ala Ala Thr Thr Thr Gly Gly 325 330 335 Thr Cys Cys Ala Cys Thr Gly Ala Ala Ala Thr Thr Thr Thr Ala Ala 340 345 350 Ala Ala Ala Ala Thr Thr Thr Cys Ala Ala Ala Ala Ala Cys Ala Ala 355 360 365 Gly Ala Cys Thr Thr Thr Cys Cys Thr Gly Ala Ala Gly Thr Gly Thr 370 375 380 Gly Ala Ala Gly Cys Ala Cys Cys Ala Ala Ala Thr Thr Ala Cys Thr 385 390 395 400 Cys Cys Gly Gly Ala Cys Gly Gly Thr Thr Cys Ala Cys Gly Thr Gly 405 410 415 Cys Thr Cys Ala Thr Gly Gly Cys Thr Gly Gly Thr Gly Cys Ala Ala 420 425 430 Ala Gly Ala Ala Ala Cys Ala Thr Gly Gly Ala Cys Thr Thr Gly Ala 435 440 445 Ala Gly Thr Thr Cys Ala Ala Cys Ala Thr Cys Ala Ala Gly Ala Gly 450 455 460 Cys Ala Gly Thr Ala Gly Cys Ala Gly Thr Thr Cys Cys Cys Cys Thr 465 470 475 480 Gly Ala Cys Thr Cys Thr Cys Gly Gly Gly Cys Ala Gly Thr Gly Ala 485 490 495 Cys Ala Thr Gly Thr Gly Gly Ala Ala Thr Gly Gly Cys Gly Thr Cys 500 505 510 Thr Cys Thr Gly Thr Cys Thr Gly Cys Ala Gly Ala Gly Ala Ala Gly 515 520 525 Gly Thr Cys Ala Cys Ala Cys Thr Gly Gly Ala Cys Cys Ala Ala Ala 530 535 540 Gly Gly Gly Ala Cys Thr Ala Thr Gly Ala Gly Ala Ala Gly Thr Ala 545 550 555 560 Thr Thr Cys Ala Gly Thr Gly Thr Cys Cys Thr Gly Cys Cys Ala Gly 565 570 575 Gly Ala Gly Gly Ala Thr Gly Thr Cys Ala Cys Cys Thr Gly Cys Cys 580 585 590 Cys Ala Ala Cys Thr Gly Cys Cys Gly Ala Gly Gly Ala Gly Ala Cys 595 600 605 Cys Cys Thr Gly Cys Cys Cys Ala Thr Thr Gly Ala Ala Cys Thr Gly 610 615 620 Gly Cys Gly Thr Thr Gly Gly Ala Ala Gly Cys Ala Cys Gly Gly Cys 625 630 635 640 Ala Gly Cys Ala Gly Ala Ala Thr Ala Ala Ala Thr Ala Thr Gly Ala 645 650 655 Gly Ala Ala Cys Thr Ala Cys Ala Gly Cys Ala Cys Cys Ala Gly Cys 660 665 670 Thr Thr Cys Thr Thr Cys Ala Thr Cys Ala Gly Gly Gly Ala Cys Ala 675 680 685 Thr Cys Ala Thr Cys Ala Ala Ala Cys Cys Ala Gly Ala Cys Cys Cys 690 695 700 Gly Cys Cys Cys Ala Ala Gly Ala Ala Cys Thr Thr Gly Cys Ala Gly 705 710 715 720 Ala Thr Gly Ala Ala Gly Cys Cys Thr Thr Thr Gly Ala Ala Gly Ala 725 730 735 Ala Cys Thr Cys Ala Cys Ala Gly Gly Thr Gly Gly Ala Gly Gly Thr 740 745 750 Cys Ala Gly Cys Thr Gly Gly Gly Ala Gly Thr Ala Cys Cys Cys Thr 755 760 765 Gly Ala Cys Thr Cys Cys Thr Gly Gly Ala Gly Cys Ala Cys Thr Cys 770 775 780 Cys Cys Cys Ala Thr Thr Cys Cys Thr Ala Cys Thr Thr Cys Thr Cys 785 790 795 800 Cys Cys Thr Cys Ala Ala Gly Thr Thr Cys Thr Thr Thr Gly Thr Thr 805 810 815 Cys Gly Ala Ala Thr Cys Cys Ala Gly Cys Gly Cys Ala Ala Gly Ala 820 825 830 Ala Ala Gly Ala Ala Ala Ala Gly Ala Thr Gly Ala Ala Gly Gly Ala 835 840 845 Gly Ala Cys Ala Gly Ala Gly Gly Ala Gly Gly Gly Gly Thr Gly Thr 850 855 860 Ala Ala Cys Cys Ala Gly Ala Ala Ala Gly Gly Thr Gly Cys Gly Thr 865 870 875 880 Thr Cys Cys Thr Cys Gly Thr Ala Gly Ala Gly Ala Ala Gly Ala Cys 885 890 895 Ala Thr Cys Thr Ala Cys Cys Gly Ala Ala Gly Thr Cys Cys Ala Ala 900 905 910 Thr Gly Cys Ala Ala Ala Gly Gly Cys Gly Gly Gly Ala Ala Thr Gly 915 920 925 Thr Cys Thr Gly Cys Gly Thr Gly Cys Ala Ala Gly Cys Thr Cys Ala 930 935 940 Gly Gly Ala Thr Cys Gly Cys Thr Ala Thr Thr Ala Cys Ala Ala Thr 945 950 955 960 Thr Cys Cys Thr Cys Gly Thr Gly Cys Ala Gly Cys Ala Ala Gly Thr 965 970 975 Gly Gly Gly Cys Ala Thr Gly Thr Gly Thr Thr Cys Cys Cys Thr Gly 980 985 990 Cys Ala Gly Gly Gly Thr Cys Cys Gly Ala Thr Cys Cys Gly Thr Cys 995 1000 1005 Ala Ala Cys Ala Cys Gly Gly Cys Thr Ala Ala Cys Thr Cys Gly 1010 1015 1020 Ala Cys Ala Ala Ala Gly Cys Thr Thr Thr Gly Ala 1025 1030 1035 58PRTArtificial sequenceSynthesized 5Cys Gly Phe Glu Leu Glu Thr Cys 1 5 616PRTArtificial sequenceSynthesized 6Asn Gly Tyr Glu Ile Glu Trp Tyr Ser Trp Val Thr His Gly Met Tyr 1 5 10 15 710PRTArtificial sequenceSynthesized 7Thr Ala Ala Ser Gly Val Arg Ser Met His 1 5 10 87PRTArtificial sequenceSynthesized 8Ala Thr Trp Leu Pro Pro Ala 1 5 95PRTArtificial sequenceSynthesized 9Cys Asn Gly Arg Cys 1 5 1012PRTArtificial sequenceSynthesized 10His Thr Met Tyr Tyr His His Tyr Gln His His Leu 1 5 10 117PRTArtificial sequenceSynthesized 11Asn Ser Ser Arg Gly Leu Gly 1 5 129PRTArtificial sequenceSynthesized 12Cys Asp Cys Arg Gly Asp Cys Phe Cys 1 5 135PRTArtificial sequenceSynthesized 13Cys Asp Gly Arg Cys 1 5 1420DNAArtificial sequenceSynthetic primer 14ccaggatcct aaaagggcag 201525DNAArtificial sequenceSynthetic primer 15gtcgaccccg cccaagaact tgcag 251642DNAArtificial sequenceSynthetic primer 16gttcgaatct gcgatggaag atgccagcgc aagaaagaaa ag 421754DNAArtificial sequenceSynthetic primer 17ttatcactcg aggcaagtct ctagctcgaa tccacatgtc tgctcgaagc ggcc 541874DNAArtificial sequenceSynthetic primer 18ttatcagtac ataccgtgag taacccagga gtaccactcg atctcgtaac cgtttgtctg 60ctcgaagcgg ccgg 741956DNAArtificial sequenceSynthetic primer 19ttatcaatgc atactacgga caccactagc agcagttgtc tgctcgaagc ggccgg 562047DNAArtificial sequenceSynthetic primer 20ttatcaagct ggagggagcc acgtagctgt ctgctcgaag cggccgg 472141DNAArtificial sequenceSynthetic primer 21ttatcaacaa cgaccgttac atgtctgctc gaagcggccg g 412262DNAArtificial sequenceSynthetic primer 22ttatcaaagg tgatgctgat agtgatggta atacatagtg tgtgtctgct cgaagcggcc 60gg 622343DNAArtificial sequenceSynthetic primer 23tcgtctagat tatcacagac ttccacccgg gtgcgcggcg tcg 432445DNAArtificial sequenceSynthetic primer 24ttatcaaccg agatccctac tgctgtttgt ctgctcgaag cggcc 452533DNAArtificial sequenceSynthetic primer 25ttatcagcag aaacaatcac cgcggcaatc aca 332658DNAArtificial sequenceSynthetic primer 26actagtttat caaagctttg tcgagttagc cgtgttgacg gatcggaccc tgcaggga 582719DNAArtificial sequenceSynthetic primer 27gaacaaaagc tggtaccgg 19289PRTArtificial sequenceSynthesized 28Val Asn Thr Ala Asn Ser Thr Gly Gly 1 5 2918PRTArtificial sequenceSynthesized 29Cys Thr Ser Thr Ser Pro Leu Pro Pro Pro Ser His Ser Thr Ser Lys 1 5 10 15 Lys Gly 308PRTArtificial sequenceSynthesized 30Asp Phe Lys Leu Phe Ala Val Tyr 1 5 319PRTArtificial sequenceSynthesized 31Cys Pro Cys Phe Leu Leu Gly Cys Cys 1 5 329PRTArtificial sequenceSynthesized 32Cys Gly Asn Lys Arg Thr Arg Gly Cys 1 5 335PRTArtificial sequenceSynthesized 33Ala Pro Arg Pro Gly 1 5

Claims

1. A tumor-targeting conjugate comprising an agent conjugated to a carcinoma homing peptide (CHP) consisting of SEQ ID NO:1.

2. The tumor-targeting conjugate of claim 1, wherein the agent is a reporter peptide or a protein tag or an antitumor therapeutic agent.

3. The tumor-targeting conjugate of claim 2, wherein the reporter protein is secreted alkaline phosphatase.

4. The tumor-targeting conjugate of claim 2, wherein the protein tag is biotin.

5. The tumor-targeting conjugate of claim 2, wherein the anti-tumor therapeutic agent is a cytokine.

6. A composition comprising the tumor targeting conjugate of claim 1.

7. The tumor-targeting conjugate of claim 1, prepared by a method comprising conjugating the agent to the carcinoma homing peptide (CHP) consisting of SEQ ID NO:1.

8. A method for targeting an agent to a vimentin-expressing cell comprising contacting the vimentin-expressing cell with a tumor targeting conjugate comprising the agent conjugated to a carcinoma homing peptide (CHP) consisting of SEQ ID NO:1, wherein the CHP binds to the vimentin.

9. The method of claim 8, wherein the agent is an anti-tumor therapeutic agent.

10. The method of claim 9, wherein the anti-tumor therapeutic agent is a cytokine.

11. The method of claim 9, wherein the cytokine is interleukin 12.

12. The method of claim 9, wherein the anti-tumor therapeutic agent is a p40 subunit of interleukin 12.

13. The method of claim 8, wherein the tumor targeting conjugate comprises an amino acid sequence of SEQ ID NO:3.

14. The method of claim 8, wherein the tumor targeting conjugate is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO:2.

15. A method of determining the presence of a vimentin protein on a surface of a cell comprising: contacting the cell with a tumor targeting conjugate comprising a peptide conjugated to a carcinoma homing peptide (CHP) consisting of SEQ ID NO:1 wherein the tumor targeting conjugate binds to the vimentin protein; and assaying the cell for the presence of a bound tumor targeting conjugate such that the presence of the bound tumor targeting conjugate correlates with the presence of the vimentin protein on the cell.

16. The method of claim 15, wherein the first peptide is a reporter peptide or a protein tag.

17. The method of claim 16, wherein the reporter peptide is secreted alkaline phosphatase.

18. The method of claim 16, wherein the protein tag is biotin.

19. The method of claim 15, wherein the cell is from a biological sample from a mammal.

20. The method of claim 19, further comprising determining an amount of the vimentin protein present on the cell; and comparing the amount of the vimentin protein present on the cell to a control amount of vimentin protein present on a control cell, wherein the presence of an increased amount of the vimentin protein present on the cell as compared with the control amount indicates that the cell is cancerous.