Patent application title: ARRAY FOR DETECTING MICROBES
Inventors:
Gary L. Andersen (Berkeley, CA, US)
Todd Z. Desantis (Livermore, CA, US)
IPC8 Class: AC12Q168FI
USPC Class:
506 16
Class name: Library, per se (e.g., array, mixture, in silico, etc.) library containing only organic compounds nucleotides or polynucleotides, or derivatives thereof
Publication date: 2015-11-26
Patent application number: 20150337363
Abstract:
The present embodiments relate to an array system for detecting and
identifying biomolecules and organisms. More specifically, the present
embodiments relate to an array system comprising a microarray configured
to simultaneously detect a plurality of organisms in a sample at a high
confidence level.Claims:
1. An array system comprising: (a) a microarray configured to
simultaneously detect a plurality of organisms in a sample, wherein the
microarray comprises a plurality of probes attached to a surface
comprising (i) a first probe set comprising a plurality of different
first nucleic acid probes, each of which is complementary to an rRNA or
rDNA sequence that is present in more than one operational taxonomic unit
(OTU) but collectively are present only in a first OTU; and (ii) a second
probe set consisting of different second nucleic acid probes for
detecting a second OTU that is different from the first OTU, wherein the
second nucleic acid probes are complementary to rRNA or rDNA sequences
collectively present in the first OTU and the second OTU; and (b) a
computer system configured to determine the presence of the second OTU
based on hybridization signal intensities from the plurality of probes
according to computer-readable code, wherein the computer-readable code
provides instructions for (i) calculating a first hybridization score for
the first OTU based on signal intensities of the first probe set; (ii)
calculating a second hybridization score for the second OTU based on
signal intensities of the second probe set; and (iii) determining the
presence of the second OTU and the absence of the first OTU when the
second hybridization score is above a threshold value and the first
hybridization score is below the threshold value.
2. The system of claim 1, wherein the OTUs comprise bacteria or archaea.
3. The system of claim 1, wherein the plurality of probes comprise probes for detecting 9000 OTUs.
4. The system of claim 1, wherein the rRNA or rDNA sequence is a 16S rRNA or rDNA sequence.
5. The system of claim 1, wherein the array further comprises a mismatch probe for each of the nucleic acid probes complementary to rRNA or rDNA sequences, wherein each mismatch probe differs from the nucleic acid probe to which it corresponds at one or more nucleotide bases.
6. The system of claim 1, wherein the array further comprises more than one mismatch probe for each of the nucleic acid probes complementary to rRNA or rDNA sequences, wherein each mismatch probe differs from the nucleic acid probe to which it corresponds at one or more nucleotide bases.
7. The system of claim 1, wherein detecting the presence of the second OTU is made with a level of confidence higher than 95%.
8. The system of claim 1, wherein the microarray is configured to simultaneously detect a plurality of organisms in an environmental sample.
9. The system of claim 1, wherein the microarray is configured to simultaneously detect a plurality of organisms in a clinical sample.
10. The system of claim 9, wherein the clinical sample comprises at least one of tissue, skin, bodily fluid, or blood.
11. The system of claim 9, wherein the clinical sample is a lung sample, a gut sample, an ear sample, a nose sample, a throat sample, or a digestive system sample.
12. The system of claim 11, wherein the clinical sample is a gut sample.
13. The system of claim 1, wherein all demarcated bacterial and archaeal orders are represented by the plurality of probes.
14. The system of claim 1, wherein the computer-readable code further provides instructions for quantifying rRNA molecules present in said sample based on the hybridization signal intensities.
15. The system of claim 1, wherein the first probe set or the second probe set comprises between 2 to 200 different nucleic acid probes.
16. The system of claim 1, wherein the first probe set and the second probe set each comprise 11 or more nucleic acid probes.
17. The system of claim 5, wherein the instructions for calculating the first and second hybridization scores comprise instructions for determining a positive fraction representing the fraction of probe pairs assigned to an OTU that are positive, wherein (i) a probe pair consists of a mismatch probe and the nucleic acid probe to which it corresponds, and (ii) a probe pair is scored as positive based on signal intensities of the probes in the probe pair and signal noise of the array.
18. The system of claim 17, wherein the threshold value is a positive fraction of 92%.
19. The system of claim 1, wherein each of the first and second OTUs consists of sequences having up to 3% sequence divergence.
20. The system of claim 1, wherein each probe in the plurality of probes is between 20 to 30 nucleotides in length.
21. An array system comprising: (a) a microarray having a plurality of probes comprising; (i) a first probe set comprising a plurality of different first nucleic acid probes present in a first operational taxon unit (OTU), wherein each of the first nucleic acid probes are complementary to a nucleic acid sequence that is present in more than one operational taxon unit (OTU) but collectively are present only in a first OTU; and (ii) a second probe set for detecting a second OTU and consisting of second nucleic acid probes that are complementary to nucleic acid sequences present in the first OTU and the second OTU, wherein the second OTU is different from the first OTU; and (b) a computer system comprising instructions for determining the presence of the second OTU based on hybridization signal intensities from the plurality of probes by: (i) calculating a first hybridization score for the first OTU based on signal intensities of the first probe set; (ii) calculating a second hybridization score for the second OTU based on signal intensities of the second probe set; and (iii) determining the presence of the second OTU and the absence of the first OTU when the second hybridization score is above a threshold value and the first hybridization score is below the threshold value.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 14/298081, filed Jun. 6, 2014, which is a continatuion of U.S. patent application Ser. No. 12/474,204, filed May 28, 2009, now issued as U.S. Pat. No. 8,771,940, which is in turn a continuation of, and claims the benefit of priority to, PCT Application No. PCT/US2007/024720, filed Nov. 29, 2007, which was written in English, published in English as WO/2008/130394 and designated the United States of America, which claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 60/861,834 filed Nov.30, 2006, both of which are hereby incorporated by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0003] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled SEQLIST.TXT, which is 5.51 KB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present embodiments relate to an array system for detecting and identifying biomolecules and organisms. More specifically, the present embodiments relate to an array system comprising a microarray configured to simultaneously detect a plurality of organisms in a sample at a high confidence level.
[0006] 2. Description of the Related Art
[0007] In the fields of molecular biology and biochemistry, biopolymers such as nucleic acids and proteins from organisms are identified and/or fractionated in order to search for useful genes, diagnose diseases or identify organisms. A hybridization reaction is frequently used as a pretreatment for such process, where a target molecule in a sample is hybridized with a nucleic acid or a protein having a known sequence. For this purpose, microarrays, or DNA chips, are used on which probes such as DNAs, RNAs or proteins with known sequences are immobilized at predetermined positions.
[0008] A DNA microarray (also commonly known as gene or genome chip, DNA chip, or gene array) is a collection of microscopic DNA spots attached to a solid surface, such as glass, plastic or silicon chip forming an array. The affixed DNA segments are known as probes (although some sources will use different nomenclature), thousands of which can be used in a single DNA microarray. Measuring gene expression using microarrays is relevant to many areas of biology and medicine, such as studying treatments, disease, and developmental stages. For example, microarrays can be used to identify disease genes by comparing gene expression in diseased and normal cells.
[0009] Molecular approaches designed to describe organism diversity routinely rely upon classifying heterogeneous nucleic acids amplified by universal 16S RNA gene PCR (polymerase chain reaction). The resulting mixed amplicons can be quickly, but coarsely, typed into anonymous groups using T-/RFLP (Terminal Restriction Fragment Length Polymorphism), SSCP (single-strand conformation polymorphism) or T/DGGE (temperature/denaturing gradient gel. electrophoresis). These groups may be classified through sequencing, but this requires additional labor to physically isolate each 16S RNA type, does not scale well for large comparative studies such as environmental monitoring, and is only suitable for low complexity environments. Also, the number of clones that would be required to adequately catalogue the majority of taxa in a sample is too large to be efficiently or economically handled. As such, an improved array and method is needed to efficiently analyze a plurality of organisms without the disadvantages of the above technologies.
SUMMARY OF THE INVENTION
[0010] Some embodiments relate to an array system including a microarray configured to simultaneously detect a plurality of organisms in a sample, wherein the microarray comprises fragments of 16s RNA unique to each organism and variants of said fragments comprising at least 1 nucleotide mismatch, wherein the level of confidence of species-specific detection derived from fragment matches is about 90% or higher.
[0011] In one aspect, the plurality of organisms comprise bacteria or archaea.
[0012] In another aspect, the fragments of 16s RNA are clustered and aligned into groups of similar sequence such that detection of an organism based on at least 11 fragment matches is possible.
[0013] In yet another aspect, the level of confidence of species-specific detection derived from fragment matches is about 95% or higher.
[0014] In still another aspect, the level of confidence of species-specific detection derived from fragment matches is about 98% or higher.
[0015] In some embodiments, the majority of fragments of 16s RNA unique to each organism have a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0016] In some aspects, every fragment of 16s RNA unique to each organism has a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0017] In other aspects, the fragments are about 25 nucleotides long.
[0018] In some aspects, the sample is an environmental sample.
[0019] In other aspects, the environmental sample comprises at least one of soil, water or atmosphere.
[0020] In yet other aspects, the sample is a clinical sample.
[0021] In still other aspects, the clinical sample comprises at least one of tissue, skin, bodily fluid or blood.
[0022] Some embodiments relate to a method of detecting an organism including applying a sample comprising a plurality of organisms to the array system which includes a microarray that comprises fragments of 16s RNA unique to each organism and variants of said fragments comprising at least 1 nucleotide mismatch, wherein the level of confidence of species-specific detection derived from fragment matches is about 90% or higher; and identifying organisms in the sample.
[0023] In some aspects, the plurality of organisms comprise bacteria or archaea.
[0024] In other aspects, the majority of fragments of 16s RNA unique to each organism have a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0025] In still other aspects, every fragment of 16s RNA unique to each organism has a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0026] In yet other aspects, the fragments are about 25 nucleotides long.
[0027] In some aspects, the organism to be detected is the most metabolically active organism in the sample.
[0028] Some embodiments relate to a method of fabricating an array system including identifying 16s RNA sequences corresponding to a plurality of organisms of interest; selecting fragments of 16s RNA unique to each organism; creating variant RNA fragments corresponding to the fragments of 16s RNA unique to each organism which comprise at least 1 nucleotide mismatch; and fabricating said array system.
[0029] In some aspects, the plurality of organisms comprise bacteria or archaea.
[0030] In other aspects, the majority of fragments of 16s RNA unique to each organism have a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0031] In still other aspects, every fragment of 16s RNA unique to each organism has a corresponding variant fragment comprising at least 1 nucleotide mismatch.
[0032] In yet other aspects, the fragments are about 25 nucleotides long.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1 is a bar graph showing rank-abundance curve of phylotypes within the urban aerosol clone library obtained from San Antonio calendar week 29. Phylotypes were determined by clustering at 99% homology using nearest neighbor joining
[0034] FIG. 2 is a line graph showing that Chao1 and ACE richness estimators are non-asymptotic, indicating an under-estimation of predicted richness based on numbers of clones sequenced.
[0035] FIG. 3 is a graph showing a Latin square assessment of 16S rRNA gene sequence quantitation by microarray.
[0036] FIG. 4 is a graph showing comparison of real-time PCR and array monitoring of Pseudomonas oleovorans density in aerosol samples from San Antonio. Corrected Array Hybridization Score is the ln(intensity) normalized by internal spikes as described under Normalization.
DETAILED DESCRIPTION
[0037] The present embodiments are related to an array system for detecting and identifying biomolecules and organisms. More specifically, the present embodiments relate to an array system comprising a microarray configured to simultaneously detect a plurality of organisms in a sample at a high confidence level.
[0038] In some embodiments, the array system uses multiple probes for increasing confidence of identification of a particular organism using a 16S rRNA gene targeted high density microarray. The use of multiple probes can greatly increase the confidence level of a match to a particular organism. Also, in some embodiments, mismatch control probes corresponding to each perfect match probe can be used to further increase confidence of sequence-specific hybridization of a target to a probe. Probes with one or more mismatch can be used to indicate non-specific binding and a possible non-match. This has the advantage of reducing false positive results due to non-specific hybridization, which is a significant problem with many current microarrays.
[0039] Some embodiments of the invention relate to a method of using an array to simultaneously identify multiple prokaryotic taxa with a relatively high confidence. A taxa is an individual microbial species or group of highly related species that share an average of about 97% 16S rRNA gene sequence identity. The array system of the current embodiments may use multiple confirmatory probes, each with from about 1 to about 20 corresponding mismatch control probes to target the most unique regions within a 16S rRNA gene for about 9000 taxa. Preferably, each confirmatory probe has from about 1 to about 10 corresponding mismatch probes. More preferably, each confirmatory probe has from about 1 to about 5 corresponding mismatch probes. The aforementioned about 9000 taxa represent a majority of the taxa that are currently known through 16S rRNA clone sequence libraries. In some embodiments, multiple targets can be assayed through a high-density oligonucleotide array. The sum of all target hybridizations is used to identify specific prokaryotic taxa. The result is a much more efficient and less time consuming way of identifying unknown organisms that in addition to providing results that could not previously be achieved, can also provide results in hours that other methods would require days to achieve.
[0040] In some embodiments, the array system of the present embodiments can be fabricated using 16s rRNA sequences as follows. From about 1 to about 500 short probes can be designed for each taxonomic group. In some embodiments, the probes can be proteins, antibodies, tissue samples or oligonucleotide fragments. In certain examples, oligonucleotide fragments are used as probes. In some embodiments, from about 1 to about 500 short oligonucleotide probes, preferably from about 2 to about 200 short oligonucleotide probes, more preferably from about 5 to about 150 short oligonucleotide probes, even more preferably from about 8 to about 100 short oligonucleotide probes can be designed for each taxonomic grouping, allowing for the failure of one or more probes. In one example, at least about 11 short oligonucleotide probes are used for each taxonomic group. The oligonucleotide probes can each be from about 5 by to about 100 bp, preferably from about 10 by to about 50 bp, more preferably from about 15 by to about 35 bp, even more preferably from about 20 by to about 30 bp. In some embodiments, the probes may be 5-mers, 6-mers, 7-mers, 8-mers, 9-mers, 10-mers, 11-mers, 12-mers, 13-mers, 14-mers, 15-mers, 16-mers, 17-mers, 18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, 25-mers, 26-mers, 27-mers, 28-mers, 29-mers, 30-mers, 31-mers, 32-mers, 33-mers, 34-mers, 35-mers, 36-mers, 37-mers, 38-mers, 39-mers, 40-mers, 41-mers, 42-mers, 43-mers, 44-mers, 45-mers, 46-mers, 47-mers, 48-mers, 49-mers, 50-mers, 51-mers, 52-mers, 53-mers, 54-mers, 55-mers, 56-mers, 57-mers, 58-mers, 59-mers, 60-mers, 61-mers, 62-mers, 63-mers, 64-mers, 65-mers, 66-mers, 67-mers, 68-mers, 69-mers, 70-mers, 71-mers, 72-mers, 73-mers, 74-mers, 75-mers, 76-mers, 77-mers, 78-mers, 79-mers, 80-mers, 81-mers, 82-mers, 83-mers, 84-mers, 85-mers, 86-mers, 87-mers, 88-mers, 89-mers, 90-mers, 91-mers, 92-mers, 93-mers, 94-mers, 95-mers, 96-mers, 97-mers, 98-mers, 99-mers, 100-mers or combinations thereof.
[0041] Non-specific cross hybridization can be an issue when an abundant 16S rRNA gene shares sufficient sequence similarity to non-targeted probes, such that a weak but detectable signal is obtained. The use of sets of perfect match and mismatch probes (PM-MM) effectively minimizes the influence of cross-hybridization. In certain embodiments, each perfect match probe (PM) has one corresponding mismatch probe (MM) to form a pair that is useful for analyzing a particular 16S rRNA sequence. In other embodiments, each PM has more than one corresponding MM. Additionally, different PMs can have different numbers of corresponding MM probes. In some embodiments, each PM has from about 1 to about 20 MM, preferably, each PM has from about 1 to about 10 MM and more preferably, each PM has from about 1 to about 5 MM.
[0042] Any of the nucleotide bases can be replaced in the MM probe to result in a probe having a mismatch. In one example, the central nucleotide base sequence can be replaced with any of the three non-matching bases. In other examples, more than one nucleotide base in the MM is replaced with a non-matching base. In some examples, 10 nucleotides are replaced in the MM, in other examples, 5 nucleotides are replaced in the MM, in yet other examples 3 nucleotides are replaced in the MM, and in still other examples, 2 nucleotides are replaced in the MM. This is done so that the increased hybridization intensity signal of the PM over the one or more MM indicates a sequence-specific, positive hybridization. By requiring multiple PM-MM probes to have a confirmation interaction, the chance that the hybridization signal is due to a predicted target sequence is substantially increased.
[0043] In other embodiments, the 16S rRNA gene sequences can be grouped into distinct taxa such that a set of the short oligonucleotide probes that are specific to the taxon can be chosen. In some examples, the 16s rRNA gene sequences grouped into distinct taxa are from about 100 by to about 1000 bp, preferably the gene sequences are from about 400 by to about 900 bp, more preferably from about 500 by to about 800 bp. The resulting about 9000 taxa represented on the array, each containing from about 1% to about 5% sequence divergence, preferably about 3% sequence divergence, can represent substantially all demarcated bacterial and archaeal orders.
[0044] In some embodiments, for a majority of the taxa represented on the array, probes can be designed from regions of gene sequences that have only been identified within a given taxon. In other embodiments, some taxa have no probe-level sequence that can be identified that is not shared with other groups of 16S rRNA gene sequences. For these taxonomic groupings, a set of from about 1 to about 500 short oligonucleotide probes, preferably from about 2 to about 200 short oligonucleotide probes, more preferably from about 5 to about 150 short oligonucleotide probes, even more preferably from about 8 to about 100 short oligonucleotide probes can be designed to a combination of regions on the 16S rRNA gene that taken together as a whole do not exist in any other taxa. For the remaining taxa, a set of probes can be selected to minimize the number of putative cross-reactive taxa. For all three probe set groupings, the advantage of the hybridization approach is that multiple taxa can be identified simultaneously by targeting unique regions or combinations of sequence.
[0045] In some embodiments, oligonucleotide probes can then be selected to obtain an effective set of probes capable of correctly identifying the sample of interest. In certain embodiments, the probes are chosen based on various taxonomic organizations useful in the identification of particular sets of organisms.
[0046] In some embodiments, the chosen oligonucleotide probes can then be synthesized by any available method in the art. Some examples of suitable methods include printing with fine-pointed pins onto glass slides, photolithography using pre-made masks, photolithography using dynamic micromirror devices, ink jet printing or electrochemistry. In one example, a photolithographic method can be used to directly synthesize the chosen oligonucleotide probes onto a surface. Suitable examples for the surface include glass, plastic, silicon and any other surface available in the art. In certain examples, the oligonucleotide probes can be synthesized on a glass surface at an approximate density of from about 1,000 probes per μm2 to about 100,000 probes per μm2, preferably from about 2000 probes per μm2 to about 50,000 probes per μm2, more preferably from about 5000 probes per μm2 to about 20,000 probes per μm2. In one example, the density of the probes is about 10,000 probes per μm2. The array can then be arranged in any configuration, such as, for example, a square grid of rows and columns. Some areas of the array can be oligonucleotide 16S rDNA PM or MM probes, and others can be used for image orientation, normalization controls or other analyses. In some embodiments, materials for fabricating the array can be obtained from Affymetrix, GE Healthcare (Little Chalfont, Buckinghamshire, United Kingdom) or Agilent Technologies (Palo Alto, Calif.)
[0047] In some embodiments, the array system is configured to have controls. Some examples of such controls include 1) probes that target amplicons of prokaryotic metabolic genes spiked into the 16S rDNA amplicon mix in defined quantities just prior to fragmentation and 2) probes complimentary to a pre-labeled oligonucleotide added into the hybridization mix. The first control collectively tests the fragmentation, biotinylation, hybridization, staining and scanning efficiency of the array system. It also allows the overall fluorescent intensity to be normalized across all the arrays in an experiment. The second control directly assays the hybridization, staining and scanning of the array system. However, the array system of the present embodiments is not limited to these particular examples of possible controls.
[0048] The accuracy of the array of some embodiments has been validated by comparing the results of some arrays with 16S rRNA gene sequences from approximately 700 clones in each of 3 samples. A specific taxa is identified as being present in a sample if a majority (from about 70% to about 100%, preferably from about 80% to about 100% and more preferably from about 90% to about 100%) of the probes on the array have a hybridization signal about 100 times, 200 times, 300 times, 400 times or 500 times greater than that of the background and the perfect match probe has a significantly greater hybridization signal than its one or more partner mismatch control probe or probes. This ensures a higher probability of a sequence specific hybridization to the probe. In some embodiments, the use of multiple probes, each independently indicating that the target sequence of the taxonomic group being identified is present, increases the probability of a correct identification of the organism of interest.
[0049] Biomolecules, such proteins, DNA, RNA, DNA from amplified products and native rRNA from the 16S rRNA gene, for example can be probed by the array of the present embodiments. In some embodiments, probes are designed to be antisense to the native rRNA so that directly labeled rRNA from samples can be placed directly on the array to identify a majority of the actively metabolizing organisms in a sample with no bias from PCR amplification. Actively metabolizing organisms have significantly higher numbers of ribosomes used for the production of proteins, therefore, in some embodiments, the capacity to make proteins at a particular point in time of a certain organism can be measured. This is not possible in systems where only the 16S rRNA gene DNA is measured which encodes only the potential to make proteins and is the same whether an organism is actively metabolizing or quiescent or dead. In this way, the array system of the present embodiments can directly identify the metabolizing organisms within diverse communities.
[0050] In some embodiments, the array system is able to measure the microbial diversity of complex communities without PCR amplification, and consequently, without all of the inherent biases associated with PCR amplification. Actively metabolizing cells typically have about 20,000 or more ribosomal copies within their cell for protein assembly compared to quiescent or dead cells that have few. In some embodiments, rRNA can be purified directly from environmental samples and processed with no amplification step, thereby avoiding any of the biases caused by the preferential amplification of some sequences over others. Thus, in some embodiments the signal from the array system can reflect the true number of rRNA molecules that are present in the samples, which can be expressed as the number of cells multiplied by the number of rRNA copies within each cell. The number of cells in a sample can then be inferred by several different methods, such as, for example, quantitative real-time PCR, or FISH (fluorescence in situ hybridization.) Then the average number of ribosomes within each cell may be calculated.
[0051] In some embodiments, the samples used can be environmental samples from any environmental source, for example, naturally occurring or artificial atmosphere, water systems, soil or any other sample of interest. In some embodiments, the environmental samples may be obtained from, for example, atmospheric pathogen collection systems, sub-surface sediments, groundwater, ancient water deep within the ground, plant root-soil interface of grassland, coastal water and sewage treatment plants. Because of the ability of the array system to simultaneously test for such a broad range of organisms based on almost all known 16s rRNA gene sequences, the array system of the present embodiments can be used in any environment, which also distinguishes it from other array systems which generally must be targeted to specific environments.
[0052] In other embodiments, the sample used with the array system can be any kind of clinical or medical sample. For example, samples from blood, the lungs or the gut of mammals may be assayed using the array system. Also, the array system of the present embodiments can be used to identify an infection in the blood of an animal. The array system of the present embodiments can also be used to assay medical samples that are directly or indirectly exposed to the outside of the body, such as the lungs, ear, nose, throat, the entirety of the digestive system or the skin of an animal. Hospitals currently lack the resources to identify the complex microbial communities that reside in these areas.
[0053] Another advantage of the present embodiments is that simultaneous detection of a majority of currently known organisms is possible with one sample. This allows for much more efficient study and determination of particular organisms within a particular sample. Current microarrays do not have this capability. Also, with the array system of the present embodiments, simultaneous detection of the top metabolizing organisms within a sample can be determined without bias from PCR amplification, greatly increasing the efficiency and accuracy of the detection process.
[0054] Some embodiments relate to methods of detecting an organism in a sample using the described array system. These methods include contacting a sample with one organism or a plurality of organisms to the array system of the present embodiments and detecting the organism or organisms. In some embodiments, the organism or organisms to be detected are bacteria or archaea. In some embodiments, the organism or organisms to be detected are the most metabolically active organism or organisms in the sample.
[0055] Some embodiments relate to a method of fabricating an array system including identifying 16s RNA sequences corresponding to a plurality of organisms of interest, selecting fragments of 16s RNA unique to each organism and creating variant RNA fragments corresponding to the fragments of 16s RNA unique to each organism which comprise at least 1 nucleotide mismatch and then fabricating the array system.
[0056] The following examples are provided for illustrative purposes only, and are in no way intended to limit the scope of the present invention.
EXAMPLE 1
[0057] An array system was fabricated using 16s rRNA sequences taken from a plurality of bacterial species. A minimum of 11 different, short oligonucleotide probes were designed for each taxonomic grouping, allowing one or more probes to not bind, but still give a positive signal in the assay. Non-specific cross hybridization is an issue when an abundant 16S rRNA gene shares sufficient sequence similarity to non-targeted probes, such that a weak but detectable signal is obtained. The use of a perfect match-mismatch (PM-MM) probe pair effectively minimized the influence of cross-hybridization. In this technique, the central nucleotide is replaced with any of the three non-matching bases so that the increased hybridization intensity signal of the PM over the paired MM indicates a sequence-specific, positive hybridization. By requiring multiple PM-MM probe-pairs to have a positive interaction, the chance that the hybridization signal is due to a predicted target sequence is substantially increased.
[0058] The known 16S rRNA gene sequences larger than 600 by were grouped into distinct taxa such that a set of at least 11 probes that were specific to each taxon could be selected. The resulting 8,935 taxa (8,741 of which are represented on the array), each containing approximately 3% sequence divergence, represented all 121 demarcated bacterial and archaeal orders. For a majority of the taxa represented on the array (5,737, 65%), probes were designed from regions of 16S rRNA gene sequences that have only been identified within a given taxon. For 1,198 taxa (14%) no probe-level sequence could be identified that was not shared with other groups of 16S rRNA gene sequences, although the gene sequence as a whole was distinctive. For these taxonomic groupings, a set of at least 11 probes was designed to a combination of regions on the 16S rRNA gene that taken together as a whole did not exist in any other taxa. For the remaining 1,806 taxa (21%), a set of probes were selected to minimize the number of putative cross-reactive taxa. Although more than half of the probes in this group have a hybridization potential to one outside sequence, this sequence was typically from a phylogenetically similar taxon. For all three probe set groupings, the advantage of the hybridization approach is that multiple taxa can be identified simultaneously by targeting unique regions or combinations of sequence.
EXAMPLE 2
[0059] An array system was fabricated according to the following protocol. 16S rDNA sequences (Escherichia coli base pair positions 47 to 1473) were obtained from over 30,000 16S rDNA sequences that were at least 600 nucleotides in length in the 15 Mar. 2002 release of the 16S rDNA database, "Greengenes." This region was selected because it is bounded on both ends by universally conserved segments that can be used as PCR priming sites to amplify bacterial or archaeal genomic material using only 2 to 4 primers. Putative chimeric sequences were filtered from the data set using computer software preventing them from being misconstrued as novel organisms. The filtered sequences are considered to be the set of putative 16S rDNA amplicons. Sequences were clustered to enable each sequence of a cluster to be complementary to a set of perfectly matching (PM) probes. Putative amplicons were placed in the same cluster as a result of common 17-mers found in the sequence.
[0060] The resulting 8,988 clusters, each containing approximately 3% sequence divergence, were considered operational taxonomic units (OTUs) representing all 121 demarcated prokaryotic orders. The taxonomic family of each OTU was assigned according to the placement of its member organisms in Bergey's Taxonomic Outline. The taxonomic outline as maintained by Philip Hugenholtz was consulted for phylogenetic classes containing uncultured environmental organisms or unclassified families belonging to named higher taxa. The OTUs comprising each family were clustered into sub-families by transitive sequence identity. Altogether, 842 sub-families were found. The taxonomic position of each OTU as well as the accompanying NCBI accession numbers of the sequences composing each OTU are recorded and publicly available.
[0061] The objective of the probe selection strategy was to obtain an effective set of probes capable of correctly categorizing mixed amplicons into their proper OTU. For each OTU, a set of 11 or more specific 25-mers (probes) were sought that were prevalent in members of a given OTU but were dissimilar from sequences outside the given OTU. In the first step of probe selection for a particular OTU, each of the sequences in the OTU was separated into overlapping 25-mers, the potential targets. Then each potential target was matched to as many sequences of the OTU as possible. First, a text pattern was used for a search to match potential targets and sequences, however, since partial gene sequences were included in the reference set additional methods were performed. Therefore, the multiple sequence alignment provided by Greengenes was used to provide a discrete measurement of group size at each potential probe site. For example, if an OTU containing seven sequences possessed a probe site where one member was missing data, then the site-specific OTU size was only six.
[0062] In ranking the possible targets, those having data for all members of that OTU were preferred over those found only in a fraction of the OTU members. In the second step, a subset of the prevalent targets was selected and reverse complimented into probe orientation, avoiding those capable of mis-hybridization to an unintended amplicon. Probes presumed to have the capacity to mis-hybridize were those 25-mers that contained a central 17-mer matching sequences in more than one OTU. Thus, probes that were unique to an OTU solely due to a distinctive base in one of the outer four bases were avoided. Also, probes with mis-hybridization potential to sequences having a common tree node near the root were favored over those with a common node near the terminal branch.
[0063] Probes complementary to target sequences that were selected for fabrication were termed perfectly matching (PM) probes. As each PM probe was chosen, it was paired with a control 25-mer (mismatching probe, MM), identical in all positions except the thirteenth base. The MM probe did not contain a central 17-mer complimentary to sequences in any OTU. The probe complementing the target (PM) and MM probes constitute a probe pair analyzed together.
[0064] The chosen oligonucleotides were synthesized by a photolithographic method at Affymetrix Inc. (Santa Clara, Calif., USA) directly onto a 1.28 cm by 1.28 cm glass surface at an approximate density of 10,000 probes per μm2. Each unique probe sequence on the array had a copy number of roughly 3.2×106 (personal communication, Affymetrix). The entire array of 506,944 features was arranged as a square grid of 712 rows and columns. Of these features, 297,851 were oligonucleotide 16S rDNA PM or MM probes, and the remaining were used for image orientation, normalization controls or other unrelated analyses. Each DNA chip had two kinds of controls on it: 1) probes that target amplicons of prokaryotic metabolic genes spiked into the 16S rDNA amplicon mix in defined quantities just prior to fragmentation and 2) probes complimentary to a pre-labeled oligonucleotide added into the hybridization mix. The first control collectively tested the fragmentation, biotinylation, hybridization, staining and scanning efficiency. It also allowed the overall fluorescent intensity to be normalized across all the arrays in an experiment. The second control directly assayed the hybridization, staining and scanning.
EXAMPLE 3
[0065] A study was done on diverse and dynamic bacterial population in urban aerosols utilizing an array system of certain embodiments. Air samples were collected using an air filtration collection system under vacuum located within six EPA air quality network sites in both San Antonio and Austin, Texas. Approximately 10 liters of air per minute were collected in a polyethylene terephthalate (Celanex), 1.0 μm filter (Hoechst Calanese). Samples were collected daily over a 24 h period. Sample filters were washed in 10 mL buffer (0.1M Sodium Phosphate, 10 mM EDTA, pH 7.4, 0.01% Tween-20), and the suspension was stored frozen until extracted. Samples were collected from 4 May to 29 Aug. 2003.
[0066] Sample dates were divided according to a 52-week calendar year starting Jan. 1, 2003, with each Monday to Sunday cycle constituting a full week. Samples from four randomly chosen days within each sample week were extracted. Each date chosen for extraction consisted of 0.6 mL filter wash from each of the six sampling sites for that city (San Antonio or Austin) combined into a "day pool" before extraction. In total, for each week, 24 filters were sampled.
[0067] The "day pools" were centrifuged at 16,000×g for 25 min and the pellets were resuspended in 4004 sodium phosphate buffer (100 mM, pH 8). The resuspended pellets were transferred into 2 mL silica bead lysis tubes containing 0.9 g of silica/zirconia lysis bead mix (0.3 g of 0.5 mm zirconia/silica beads and 0.6 g of 0.1 mm zirconia/silica beads). For each lysis tube, 300 μL buffered sodium dodecyl sulfate (SDS) (100 mM sodium chloride, 500 mM Tris pH 8, 10% [w/v] SDS), and 300 μL phenol:chloroform:isoamyl alcohol (25:24:1) were added. Lysis tubes were inverted and flicked three times to mix buffers before bead mill homogenization with a Bio101 Fast Prep 120 machine (Qbiogene, Carlsbad, Calif.) at 6.5 m s-1 for 45 s. Following centrifugation at 16,000×g for 5 min, the aqueous supernatant was removed to a new 2 mL tube and kept at -20° C. for 1 hour to overnight. An equal volume of chloroform was added to the thawed supernatant prior to vortexing for 5 s and centrifugation at 16,000×g for 3 min. The supernatant was then combined with two volumes of a binding buffer "Solution 3" (UltraClean Soil DNA kit, MoBio Laboratories, Solana Beach, Calif.). Genomic DNA from the mixture was isolated on a MoBio spin column, washed with "Solution 4" and eluted in 60 μL of 1× Tris-EDTA according to the manufacturer's instructions. The DNA was further purified by passage through a Sephacryl S-200 HR spin column (Amersham, Piscataway, N.J., USA) and stored at 4° C. prior to PCR amplification. DNA was quantified using a PicoGreen fluorescence assay according to the manufacturer's recommended protocol (Invitrogen, Carlsbad, Calif.).
[0068] The 16S rRNA gene was amplified from the DNA extract using universal primers 27F.1, (5' AGRGTTTGATCMTGGCTCAG) (SEQ ID NO: 1) and 1492R, (5' GGTTACCTTGTTACGACTT) (SEQ ID NO: 2). Each PCR reaction mix contained 1× Ex Taq buffer (Takara Bio Inc, Japan), 0.8 mM dNTP mixture, 0.02U/μL Ex Taq polymerase, 0.4 mg/mL bovine serum albumin (BSA), and 1.0 μM each primer. PCR conditions were 1 cycle of 3 min at 95° C., followed by 35 cycles of 30 sec at 95° C., 30 sec at 53° C., and 1 min at 72° C., and finishing with 7 min incubation at 72° C. When the total mass of PCR product for a sample week reached 2 μg (by gel quantification), all PCR reactions for that week were pooled and concentrated to a volume less than 40 μL with a Micron YM100 spin filter (Millipore, Billerica, Mass.) for microarray analysis.
[0069] The pooled PCR product was spiked with known concentrations of syntheticl6S rRNA gene fragments and non-16S rRNA gene fragments according to Table S1. This mix was fragmented using DNAse I (0.02 U/μg DNA, Invitrogen, Calif.) and One-Phor-All buffer (Amersham, N.J.) per Affymetrix's protocol, with incubation at 25° C. for 10 min., followed by enzyme denaturation at 98° C. for 10 min. Biotin labeling was performed using an Enzo® BioArray® Terminal Labeling Kit (Enzo Life Sciences Inc., Farmingdale, N.Y.) per the manufacturer's directions. The labeled DNA was then denatured (99° C. for 5 min) and hybridized to the DNA microarray at 48° C. overnight (>16 hr). The microarrays were washed and stained per the Affymetrix protocol.
[0070] The array was scanned using a GeneArray Scanner (Affymetrix, Santa Clara, Calif., USA). The scan was recorded as a pixel image and analyzed using standard Affymetrix software (Microarray Analysis Suite, version 5.1) that reduced the data to an individual signal value for each probe. Background probes were identified as those producing intensities in the lowest 2% of all intensities. The average intensity of the background probes was subtracted from the fluorescence intensity of all probes. The noise value (N) was the variation in pixel intensity signals observed by the scanner as it read the array surface. The standard deviation of the pixel intensities within each of the identified background cells was divided by the square root of the number of pixels comprising that cell. The average of the resulting quotients was used for N in the calculations described below.
[0071] Probe pairs scored as positive were those that met two criteria: (i) the intensity of fluorescence from the perfectly matched probe (PM) was greater than 1.3 times the intensity from the mismatched control (MM), and (ii) the difference in intensity, PM minus MM, was at least 130 times greater than the squared noise value (>130 N2). These two criteria were chosen empirically to provide stringency while maintaining sensitivity to the amplicons known to be present from sequencing results of cloning the San Antonio week 29 sample. The positive fraction (PosFrac) was calculated for each probe set as the number of positive probe pairs divided by the total number of probe pairs in a probe set. A taxon was considered present in the sample when over 92% of its assigned probe pairs for its corresponding probe set were positive (PosFrac>0.92). This was determined based on empirical data from clone library analyses. Hybridization intensity (hereafter referred to as intensity) was calculated in arbitrary units (a.u.) for each probe set as the trimmed average (maximum and minimum values removed before averaging) of the PM minus MM intensity differences across the probe pairs in a given probe set. All intensities <1 were shifted to 1 to avoid errors in subsequent logarithmic transformations. When summarizing chip results to the sub-family, the probe set producing the highest intensity was used.
[0072] To compare the diversity of bacteria detected with microarrays to a known standard, one sample week was chosen for cloning and sequencing and for replicate microarray analysis. One large pool of SSU amplicons (96 reactions, 50 μL reaction) from San Antonio week 29 was made. One milliliter of the pooled PCR product was gel purified and 768 clones were sequenced at the DOE Joint Genome Institute (Walnut Creek, Calif.) by standard methods. An aliquot of this pooled PCR product was also hybridized to a microarray (three replicate arrays performed). Sub-families containing a taxon scored as present in all three array replicates were recorded. Individual cloned rRNA genes were sequenced from each terminus, assembled using Phred and Phrap (S9, S10, S11), and were required to pass quality tests of Phred 20 (base call error probability <10-2.0) to be included in the comparison.
[0073] Sequences that appeared chimeric were removed using Bellerophon (S2) with two requirements; (1) the preference score must be less than 1.3 and (2) the divergence ratio must be less than 1.1. The divergence ratio is a new metric implemented to weight the likelihood of a sequence being chimeric according to the similarity of the parent sequences. The more distantly related the parent sequences are to each other relative to their divergence from the chimeric sequence, the greater the likelihood that the inferred chimera is real. This metric uses the average sequence identity between the two fragments of the candidate and their corresponding parent sequences as the numerator, and the sequence identity between the parent sequences as the denominator. All calculations are made using a 300 base pair window on either side of the most likely break point. A divergence ratio of 1.1 was empirically determined to be the threshold for classifying sequences as putatively chimeric.
[0074] Similarity of clones to array taxa was calculated with DNADIST (S12) using the DNAML-F84 option assuming a transition:transversion ratio of 2.0 and an A, C, G, T 16S rRNA gene base frequency of 0.2537, 0.2317, 0.3167, 0.1979, respectively. We calculated these parameters empirically from all records of the `Greengenes` 16S rRNA multiple sequence alignment over 1,250 nucleotides in length. The Lane mask (S13) was used to restrict similarity observations to 1,287 conserved columns (lanes) of aligned characters. Cloned sequences from this study were rejected from further analysis when <1,000 characters could be compared to a lane-masked reference sequence. Sequences were assigned to a taxonomic node using a sliding scale of similarity threshold (S14). Phylum, class, order, family, sub-family, or taxon placement was accepted when a clone surpassed similarity thresholds of 80%, 85%, 90%, 92%, 94%, or 97%, respectively. When similarity to nearest database sequence was <94%, the clone was considered to represent a novel sub-family. A full comparison between clone and array analysis is presented in Table S2.
[0075] Primers targeting sequences within particular taxa/sub-families were generated by ARB's probe design feature (S15). Melting temperatures were constrained from 45° C. to 65° C. with G+C content between 40 and 70%. The probes were chosen to contain 3' bases non-complementary to sequences outside of the taxon/sub-family. Primers were matched using Primer3 (S16) to create primer pairs (Table S3). Sequences were generated using the Takara enzyme system as described above with the necessary adjustments in annealing temperatures. Amplicons were purified (PureLink PCR Purification Kit, Invitrogen) and sequenced directly or, if there were multiple unresolved sequences, cloned using a TOPO pCR2.1 cloning kit (Invitrogen, Calif.) according to the manufacturer's instructions. The M13 primer pair was used for clones to generate insert amplicons for sequencing at UC Berkeley's sequencing facility.
[0076] To determine whether changes in 16S rRNA gene concentration could be detected using the array, various quantities of distinct rRNA gene types were hybridized to the array in rotating combinations. We chose environmental organisms, organisms involved in bioremediation, and a pathogen of biodefense relevance. 16S rRNA genes were amplified from each of the organisms in Table S4. Then each of these nine distinct 16S rRNA gene standards was tested once in each concentration category spanning 5 orders of magnitude (0 molecules, 6×107, 1.44×108, 3.46×108, 8.30×108, 1.99×109, 4.78×109, 2.75×1010, 6.61×1010, 1.59×1011) with concentrations of individual 16S rRNA gene types rotating between arrays such that each array contained the same total of 16S rRNA gene molecules. This is similar to a Latin Square design, although with a 9×11 format matrix.
[0077] A taxon (#9389) consisting only of two sequences of Pseudomonas oleovorans that correlated well with environmental variables was chosen for quantitative PCR confirmation of array observed quantitative shifts. Primers for this taxon were designed using the ARB (S 15) probe match function to determine unique priming sites based upon regions detected by array probes. These regions were then imputed into Primer3 (S16) in order to choose optimal oligonucleotide primers for PCR. Primer quality was further assessed using Beacon Designer v3.0 (Premier BioSoft, CA). Primers 9389F2 (CGACTACCTGGACTGACACT) (SEQ ID NO: 3) and 9389R2 (CACCGGCAGTCTCCTTAGAG) (SEQ ID NO: 4) were chosen to amplify a 436 by fragment.
[0078] To test the specificity of this primer pair, we used a nested PCR approach. 16S rRNA genes were amplified using universal primers (27F, 1492R) from pooled aerosol genomic DNA extracts from both Austin and San Antonio, Tex. These products were purified and used as template in PCR reactions using primer set 9389F2-9389R2. Amplicons were then ligated to pCR2.1 and transformed into E.coli TOP10 cells as recommended by the manufacturer (Invitrogen, CA). Five clones were chosen at random for each of the two cities (10 clones total) and inserts were amplified using vector specific primers M13 forward and reverse. Standard Sanger sequencing was performed and sequences were tested for homology against existing database entries (NCBI GenBank, RDPII and Greengenes).
[0079] To assay P. oleovorans 16S rRNA gene copies in genomic DNA extracts, we performed real-time quantitative PCR (qPCR) using an iCycler iQ real-time detection system (BioRad, CA) with the iQ Sybr® Green Supermix (BioRad, CA) kit. Reaction mixtures (final volume, 25 μl) contained 1×iQ Sybr® Green Supermix, 7.5 pmol of each primer, 25 ug BSA, 0.5 μl DNA extract and DNase/RNase free water. Following enzyme activation (95° C., 3 min), up to 50 cycles of 95° C., 30 s; 61° C., 30 s; 85° C., 10 s and 72° C., 45 s were performed. The specific data acquisition step (85° C. for 10 s) was set above the Tm of potential primer dimers and below the Tm of the product to minimize any non-amplicon Sybr Green fluorescence. Copy number of P. oleovorans 16S rRNA gene molecules was quantified by comparing cycle thresholds to a standard curve (in the range of 7.6×10° to 7.6×105 copies μl-1), run in parallel, using cloned P. oleovorans 16S rRNA amplicons generated by PCR using primers M13 forward and reverse. Regression coefficients for the standard curves were typically greater than 0.99, and post amplification melt curve analyses displayed a single peak at 87.5° C., indicative of specific Pseudomonas oleovorans 16S rRNA gene amplification (data not shown).
[0080] To account for scanning intensity variation from array to array, internal standards were added to each experiment. The internal standards were a set of thirteen amplicons generated from yeast and bacterial metabolic genes and five synthetic 16S rRNA-like genes spiked into each aerosol amplicon pool prior to fragmentation. The known concentrations of the amplicons ranged from 4 pM to 605 pM in the final hybridization mix. The intensities resulting from the fifteen corresponding probe sets were natural log transformed. Adjustment factors for each array were calculated by fitting the linear model using the least-squares method. An array's adjustment factor was subtracted from each probe set's ln(intensity).
[0081] For each day of aerosol sampling, 15 factors including humidity, wind, temperature, precipitation, pressure, particulate matter, and week of year were recorded from the U.S. National Climatic Data Center (http://www.ncdc.noaa.gov) or the Texas Natural Resource Conservation Commission (http://www.tceq.state.tx.us). The weekly mean, minimum, maximum, and range of values were calculated for each factor from the collected data. The changes in ln(intensity) for each taxon considered present in the study was tested for correlation against the environmental conditions. The resulting p-values were adjusted using the step-up False Discovery Rate (FDR) controlling procedure (S18).
[0082] Multivariate regression tree analysis (S19, S20) was carried out using the package `mvpart` within the `R` statistical programming environment. A Bray-Curtis-based distance matrix was created using the function `gdist`. The Brady-Curtis measure of dissimilarity is generally regarded as a good measure of ecological distance when dealing with `species` abundance as it allows for non-linear responses to environmental gradients (S19, S21).
[0083] Prior to rarefaction analysis a distance matrix (DNAML homology) of clone sequences was created using an online tool at http://greengenes.lbl.gov/cgi-bin/nph-distance_matrix.cgi following alignment of the sequences using the NAST aligner (http://greengenes.lbl.gov/NAST) (S22). DOTUR (S23) was used to generate rarefaction curves, Chao1 and ACE richness predictions and rank-abundance curves. Nearest neighbor joining was used with 1000 iterations for bootstrapping.
[0084] DNA yields in the pooled weekly filter washes ranged from 0.522 ng to 154 ng. As only an aliquot of the filter washes was extracted we extrapolate the range of DNA extractable from each daily filter to be between 150 ng and 4300 ng assuming 10% extraction efficiency. Using previous estimates of bacterial to fungal ratios in aerosols (49% bacterial, 44% fungal clones; S24) this range is equivalent to 1.2×107 to 3.5×108 bacterial cells per filter assuming a mean DNA content of a bacterial cell of 6 fg (S25).
TABLE-US-00001 TABLE S1 Spike in-controls of functional genes and synthetic 16S rRNA-like genes used for internal array normalization. Molecules applied Description Affymetrix control spikes AFFX-BioB-5_at 5.83 × 1010 E. coli biotin synthetase AFFX-BioB-M_at 5.43 × 1010 E. coli biotin synthetase AFFX-BioC-5_at 2.26 × 1010 E. coli bioC protein AFFX-BioC-3_at 1.26 × 1010 E. coli bioC protein AFFX-BioDn-3_at 1.68 × 1010 E. coli dethiobiotin synthetase AFFX-CreX-5_at 2.17 × 109 Bacteriophage P1 cre recombinase protein AFFX-DapX-5_at 9.03 × 108 B. subtilis dapB, dihydrodipicolinate reductase AFFX-DapX-M_at 3.03 × 1010 B. subtilis dapB, dihydrodipicolinate reductase YFL039C 5.02 × 108 Saccharomyces, Gene for actin (Act1p) protein YER022W 1.21 × 109 Saccharomyces, RNA polymerase II mediator complex subunit (SRB4p) YER148W 2.91 × 109 Saccharomyces, TATA-binding protein, general transcription factor (SPT15) YEL002C 7.00 × 109 Saccharomyces, Beta subunit of the oligosaccharyl transferase (OST) glycoprotein complex (WBP1) YEL024W 7.29 × 1010 Saccharomyces, Ubiquinol-cytochrome-c reductase (RIP1) Synthetic 16S rRNA control spikes SYNM.neurolyt_st 6.74 × 108 Synthetic derivative of Mycoplasma neurolyticum 16S rRNA gene SYNLc.oenos_st 3.90 × 109 Synthetic derivative of Leuconostoc oenos 16S rRNA gene SYNCau.cres8_st 9.38 × 109 Synthetic derivative of Caulobacter crescentus 16S rRNA gene SYNFer.nodosm_st 4.05 × 1010 Synthetic derivative of Fervidobacterium nodosum 16S rRNA gene SYNSap.grandi_st 1.62 × 109 Synthetic derivative of Saprospira grandis 16S rRNA gene
TABLE-US-00002 TABLE S2 Comparison between clone and array results. Clone detection DNAML similarity Array number Comparison detection1 of Array 3/3 clones Chimera checking4 Array and Cloning replicates assigned maximum maximum only Cloning only pass = 1, to sub- maximum preference divergence pass = 1, pass = 1, pass = 1, Sub-families fail = 0 family2 similarity3 score5 ratio6 fail = 0 fail = 0 fail = 0 Bacteria; AD3; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; Acidobacteria; Acidobacteria-10; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Acidobacteria; Acidobacteria-4; 1 1 0 0 Ellin6075/11-25; Unclassified; sf_1 Bacteria; Acidobacteria; Acidobacteria-6; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Acidobacteria; Acidobacteria; 1 3 0.973 1.16 1.06 0 1 0 Acidobacteriales; Acidobacteriaceae; sf_14 Bacteria; Acidobacteria; Acidobacteria; 1 1 0 0 Acidobacteriales; Acidobacteriaceae; sf_16 Bacteria; Acidobacteria; Solibacteres; 1 2 0.960 0.00 0.00 0 1 0 Unclassified; Unclassified; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Acidimicrobiales; Acidimicrobiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Acidimicrobiales; Microthrixineae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 0 1 0.947 0.00 0.00 0 0 1 Acidimicrobiales; Microthrixineae; sf_12 Bacteria; Actinobacteria; Actinobacteria; 1 1 0.961 1.28 1.06 0 1 0 Acidimicrobiales; Unclassified; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0.947 0.00 0.00 0 1 0 Actinomycetales; Acidothermaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Actinomycetaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Actinosynnemataceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 4 0.998 0.00 0.00 0 1 0 Actinomycetales; Brevibacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 2 0.981 1.20 1.08 0 1 0 Actinomycetales; Cellulomonadaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Corynebacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 2 0.999 1.21 1.03 0 1 0 Actinomycetales; Dermabacteraceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Dermatophilaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Dietziaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Frankiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 2 1.000 0.00 0.00 0 1 0 Actinomycetales; Geodermatophilaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Gordoniaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 10 0.999 1.20 1.18 0 1 0 Actinomycetales; Intrasporangiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Kineosporiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 4 0.999 0.00 0.00 0 1 0 Actinomycetales; Microbacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 2 0.985 1.26 1.15 0 1 0 Actinomycetales; Micrococcaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 3 1.000 1.27 1.20 0 1 0 Actinomycetales; Micromonosporaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Mycobacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0.999 0.00 0.00 0 1 0 Actinomycetales; Nocardiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 4 0.994 1.16 1.07 0 1 0 Actinomycetales; Nocardioidaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 1.000 0.00 0.00 0 1 0 Actinomycetales; Nocardiopsaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Promicromonosporaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 3 0.982 1.20 1.05 0 1 0 Actinomycetales; Propionibacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 3 0.999 1.14 1.11 0 1 0 Actinomycetales; Pseudonocardiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Sporichthyaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 3 0.998 1.30 1.14 0 1 0 Actinomycetales; Streptomycetaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 2 0.996 0.00 0.00 0 1 0 Actinomycetales; Streptomycetaceae; sf_3 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Streptosporangiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Thermomonosporaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales; Unclassified; sf_3 Bacteria; Actinobacteria; Actinobacteria; 0 1 0.987 1.18 1.12 0 0 1 Actinomycetales; Williamsiaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Bifidobacteriales; Bifidobacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 13 0.990 1.56 1.05 0 1 0 Rubrobacterales; Rubrobacteraceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Aquificae; Aquificae; Aquificales; 1 1 0 0 Hydrogenothermaceae; sf_1 Bacteria; BRC1; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_2 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0 Bacteroidales; Porphyromonadaceae; sf_1 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0 Bacteroidales; Prevotellaceae; sf_1 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0 Bacteroidales; Rikenellaceae; sf_5 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0 Bacteroidales; Unclassified; sf_15 Bacteria; Bacteroidetes; Flavobacteria; 1 1 0.943 0.00 0.00 0 1 0 Flavobacteriales; Blattabacteriaceae; sf_1 Bacteria; Bacteroidetes; Flavobacteria; 1 1 0 0 Flavobacteriales; Flavobacteriaceae; sf_1 Bacteria; Bacteroidetes; Flavobacteria; 1 1 0 0 Flavobacteriales; Unclassified; sf_3 Bacteria; Bacteroidetes; KSA 1; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; Bacteroidetes; Sphingobacteria; 1 6 0.973 1.22 1.07 0 1 0 Sphingobacteriales; Crenotrichaceae; sf_11 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales; Flammeovirgaceae; sf_5 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales; Flexibacteraceae; sf_19 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales; Sphingobacteriaceae; sf_1 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales; Unclassified; sf_3 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales; Unclassified; sf_6 Bacteria; Bacteroidetes; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_4 Bacteria; Caldithrix; Unclassified; Caldithrales; 1 1 0 0 Caldithraceae; sf_1 Bacteria; Caldithrix; Unclassified; Caldithrales; 1 1 0 0 Caldithraceae; sf_2 Bacteria; Chlamydiae; Chlamydiae; 1 1 0 0 Chlamydiales; Chlamydiaceae; sf_1 Bacteria; Chlorobi; Chlorobia; Chlorobiales; 1 1 0 0 Chlorobiaceae; sf_1 Bacteria; Chlorobi; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; Chlorobi; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_6 Bacteria; Chlorobi; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_9 Bacteria; Chloroflexi; Anaerolineae; 1 1 0.992 0.00 0.00 0 1 0 Chloroflexi-1a; Unclassified; sf_1 Bacteria; Chloroflexi; Anaerolineae; 1 1 0 0 Chloroflexi-1b; Unclassified; sf_2 Bacteria; Chloroflexi; Anaerolineae; 1 1 0 0 Unclassified; Unclassified; sf_9 Bacteria; Chloroflexi; Chloroflexi-3; 1 1 0 0 Roseiflexales; Unclassified; sf_5 Bacteria; Chloroflexi; Dehalococcoidetes; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Chloroflexi; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_12 Bacteria; Coprothermobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Chloroplasts; Chloroplasts; sf_11 Bacteria; Cyanobacteria; Cyanobacteria; 1 3 0.995 0.00 0.00 0 1 0 Chloroplasts; Chloroplasts; sf_5 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Chroococcales; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 0 1 0.954 1.09 1.12 0 0 1 Chroococcidiopsis; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Leptolyngbya; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Nostocales; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Oscillatoriales; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Phormidium; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Plectonema; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Prochlorales; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Pseudanabaena; Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Spirulina; Unclassified; sf_1 Bacteria; Cyanobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_5 Bacteria; Cyanobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_8 Bacteria; Cyanobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_9 Bacteria; DSS1; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_2 Bacteria; Deinococcus-Thermus; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Deinococcus-Thermus; Unclassified; 0 1 0.993 1.19 1.05 0 0 1 Unclassified; Unclassified; sf_3 Bacteria; Firmicutes; Bacilli; Bacillales; 1 2 0.963 1.14 1.15 0 1 0 Alicyclobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 151 1.000 1.37 1.23 0 1 0 Bacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 6 0.997 1.15 1.07 0 1 0 Halobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 14 0.999 1.19 1.07 0 1 0 Paenibacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 2 0.999 1.12 1.04 0 1 0 Sporolactobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 6 0.999 1.30 1.06 0 1 0 Staphylococcaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1 6 0.999 1.15 1.09 0 1 0 Thermoactinomycetaceae; sf_1 Bacteria; Firmicutes; Bacilli; Exiguobacterium; 0 1 0.998 0.00 0.00 0 0 1 Unclassified; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 6 0.998 1.23 1.26 0 1 0 Aerococcaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Carnobacteriaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 3 0.999 1.32 1.08 0 1 0 Enterococcaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Lactobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Leuconostocaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Streptococcaceae; sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Unclassified; sf_1 Bacteria; Firmicutes; Catabacter; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; Firmicutes; Catabacter; Unclassified; 1 1 0.954 0.00 0.00 0 1 0 Unclassified; sf_4 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 14 0.998 1.45 1.15 0 1 0 Clostridiaceae; sf_12 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0 0 Eubacteriaceae; sf_1 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 2 0.990 1.12 1.12 0 1 0 Lachnospiraceae; sf_5 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 4 0.980 1.12 1.16 0 1 0 Peptococc/Acidaminococc; sf_11 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0.976 1.21 1.04 0 1 0 Peptostreptococcaceae; sf_5
Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0 0 Syntrophomonadaceae; sf_5 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0 0 Unclassified; sf_17 Bacteria; Firmicutes; Clostridia; Unclassified; 1 1 0 0 Unclassified; sf_3 Bacteria; Firmicutes; Desulfotomaculum; 1 3 0.984 1.14 1.04 0 1 0 Unclassified; Unclassified; sf_1 Bacteria; Firmicutes; Mollicutes; 1 1 0 0 Acholeplasmatales; Acholeplasmataceae; sf_1 Bacteria; Firmicutes; Symbiobacteria; 1 1 0 0 Symbiobacterales; Unclassified; sf_1 Bacteria; Firmicutes; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_8 Bacteria; Firmicutes; gut clone group; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Gemmatimonadetes; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_5 Bacteria; Natronoanaerobium; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Nitrospira; Nitrospira; Nitrospirales; 1 1 0 0 Nitrospiraceae; sf_1 Bacteria; OD1; OP11-5; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; OP8; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_3 Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0 Planctomycetales; Anammoxales; sf_2 Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0 Planctomycetales; Anammoxales; sf_4 Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0 Planctomycetales; Pirellulae; sf_3 Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0 Planctomycetales; Planctomycetaceae; sf_3 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.943 0.00 0.00 0 1 0 Acetobacterales; Acetobacteraceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 6 0.980 1.24 1.17 0 1 0 Acetobacterales; Roseococcaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.947 1.12 1.10 0 1 0 Azospirillales; Azospirillaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Azospirillales; Magnetospirillaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Azospirillales; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.951 1.13 1.08 0 1 0 Bradyrhizobiales; Beijerinck/Rhodoplan/Methylocyst; sf_3 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Bradyrhizobiales; Bradyrhizobiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Bradyrhizobiales; Hyphomicrobiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.999 0.00 0.00 0 1 0 Bradyrhizobiales; Methylobacteriaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 4 0.982 1.15 1.11 0 1 0 Bradyrhizobiales; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Bradyrhizobiales; Xanthobacteraceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.968 0.00 0.00 0 1 0 Caulobacterales; Caulobacteraceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.951 0.00 0.00 0 1 0 Consistiales; Caedibacteraceae; sf_3 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Consistiales; Caedibacteraceae; sf_4 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Consistiales; Caedibacteraceae; sf_5 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Consistiales; Unclassified; sf_4 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.976 1.18 1.05 0 1 0 Devosia; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Ellin314/wr0007; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Ellin329/Riz1046; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Fulvimarina; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Bartonellaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Beijerinck/Rhodoplan/Methylocyst; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Bradyrhizobiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Brucellaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Hyphomicrobiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Phyllobacteriaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.981 1.27 1.26 0 1 0 Rhizobiales; Rhizobiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhodobacterales; Hyphomonadaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 6 0.985 1.13 1.11 0 1 0 Rhodobacterales; Rhodobacteraceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rickettsiales; Anaplasmataceae; sf_3 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rickettsiales; Rickettsiaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rickettsiales; Unclassified; sf_2 Bacteria; Proteobacteria; Alphaproteobacteria; 1 9 0.994 1.23 1.10 0 1 0 Sphingomonadales; Sphingomonadaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 6 0.990 1.13 1.06 0 1 0 Sphingomonadales; Sphingomonadaceae; sf_15 Bacteria; Proteobacteria; Alphaproteobacteria; 0 3 0.997 1.20 1.08 0 0 1 Sphingomonadales; Unclassified; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.954 0.00 0.00 0 1 0 Unclassified; Unclassified; sf_6 Bacteria; Proteobacteria; Betaproteobacteria; 1 3 1.000 1.35 1.07 0 1 0 Burkholderiales; Alcaligenaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 12 1.000 0.00 0.00 0 1 0 Burkholderiales; Burkholderiaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Burkholderiales; Comamonadaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 2 0.996 0.00 0.00 0 1 0 Burkholderiales; Oxalobacteraceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Burkholderiales; Ralstoniaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 MND1 clone group; Unclassified; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Methylophilales; Methylophilaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Neisseriales; Unclassified; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Nitrosomonadales; Nitrosomonadaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Rhodocyclales; Rhodocyclaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Unclassified; Unclassified; sf_3 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 AMD clone group; Unclassified; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Bdellovibrionales; Unclassified; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfobacterales; Desulfobulbaceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfobacterales; Nitrospinaceae; sf_2 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfobacterales; Unclassified; sf_4 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfovibrionales; Desulfohalobiaceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfovibrionales; Desulfovibrionaceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Desulfovibrionales; Unclassified; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 EB1021 group; Unclassified; sf_4 Bacteria; Proteobacteria; Deltaproteobacteria; 0 1 0.974 0.00 0.00 0 0 1 Myxococcales; Myxococcaceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Myxococcales; Polyangiaceae; sf_3 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Myxococcales; Unclassified; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Syntrophobacterales; Syntrophobacteraceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 Unclassified; Unclassified; sf_9 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 dechlorinating clone group; Unclassified; sf_1 Bacteria; Proteobacteria; Epsilonproteobacteria; 1 1 0 0 Campylobacterales; Campylobacteraceae; sf_3 Bacteria; Proteobacteria; Epsilonproteobacteria; 1 1 0 0 Campylobacterales; Helicobacteraceae; sf_3 Bacteria; Proteobacteria; Epsilonproteobacteria; 1 1 0 0 Campylobacterales; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Aeromonadales; Aeromonadaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Alteromonadales; Alteromonadaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Alteromonadales; Pseudoalteromonadaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Alteromonadales; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Chromatiales; Chromatiaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Chromatiales; Ectothiorhodospiraceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Chromatiales; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Ellin307/WD2124; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 3 0.995 1.12 1.04 0 1 0 Enterobacteriales; Enterobacteriaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Enterobacteriales; Enterobacteriaceae; sf_6 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 GAO cluster; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Legionellales; Coxiellaceae; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Legionellales; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Legionellales; Unclassified; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Methylococcales; Methylococcaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Oceanospirillales; Alcanivoraceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Oceanospirillales; Halomonadaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Oceanospirillales; Unclassified; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Pasteurellales; Pasteurellaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 2 0.996 1.16 1.10 0 1 0 Pseudomonadales; Moraxellaceae; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 2 0.998 1.18 1.03 0 1 0 Pseudomonadales; Pseudomonadaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 SUP05; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Shewanella; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Symbionts; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Thiotrichales; Francisellaceae; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Thiotrichales; Piscirickettsiaceae; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Thiotrichales; Thiotrichaceae; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 Unclassified; Unclassified; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 2 0.997 0.00 0.00 0 1 0 Xanthomonadales; Xanthomonadaceae; sf_3 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 aquatic clone group; Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 uranium waste clones; Unclassified; sf_1 Bacteria; Proteobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_20 Bacteria; Spirochaetes; Spirochaetes; 1 1 0 0 Spirochaetales; Leptospiraceae; sf_3 Bacteria; Spirochaetes; Spirochaetes; 1 1 0 0 Spirochaetales; Spirochaetaceae; sf_1 Bacteria; Spirochaetes; Spirochaetes; 1 1 0 0 Spirochaetales; Spirochaetaceae; sf_3 Bacteria; TM7; TM7-3; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; TM7; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; Verrucomicrobia; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_4 Bacteria; Verrucomicrobia; Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_5 Bacteria; Verrucomicrobia; Verrucomicrobiae; 1 1 0 0 Verrucomicrobiales; Unclassified; sf_3 Bacteria; Verrucomicrobia; Verrucomicrobiae; 1 1 0 0
Verrucomicrobiales; Verrucomicrobia subdivision 5; sf_1 Bacteria; Verrucomicrobia; Verrucomicrobiae; 1 1 0 0 Verrucomicrobiales; Verrucomicrobiaceae; sf_6 Bacteria; Verrucomicrobia; Verrucomicrobiae; 1 1 0 0 Verrucomicrobiales; Verrucomicrobiaceae; sf_7 Bacteria; WS3; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; marine group A; mgA-1; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; marine group A; mgA-2; Unclassified; 1 1 0 0 Unclassified; sf_1 Totals 238 67 178 60 7 Array Clone Array Array Clone sub- sub- only and only families families sub- clone sub- families sub- families families 1A sub-family must have at least one taxon present above the positive probe threshold of 0.92 (92%) in all three replicates to be considered present. 2For a clone to be assigned to a sub-family its DNAML similarity must be above the 0.94 (94%) threshold defined for sub-families. 3This is the maximum DNAML similarity measured. 4Both maximum preference score and maximum divergence ratio must pass the criteria below for a clone to be considered non-chimeric. 5Bellerophon preference score, a ratio of 1.3 or greater has been empirically shown to demonstrate a chimeric molecule. 6Bellerophon divergence ratio. This is a new metric devised to aid chimera detection, a score greater than 1.1 indicates a potential chimera.
TABLE-US-00003 TABLE S3 Confirmation of array sub-family detections by taxon-specific PCR and sequencing. Genbank accession number of Closest BLAST homolog SEQ retrieved Sub-family (sf) GenBank accession number ID Tm Ta sequence verified (% identity) NO. Primer Sequences (5' to 3') ° C. ° C. DQ236248 Actinobacteria, Actinokineospora diospyrosa, 5 For - ACCAAGGCTACGACGGGTA 60.5 67.0 Actinosynnemataceae, AF114797 (94.3%) 6 Rev - ACACACCGCATGTCAAACC 60.4 sf_1 DQ515230 Actinobacteria, Bifidobacterium adolescentis, 7 For - GGGTGGTAATGCCSGATG 60.0 62.0 Bifidobacteriaceae, AF275881 (99.6 %) 8 Rev - CCRCCGTTACACCGGGAA 64.0 sf_1 DQ236245 Actinobacteria, Actinomycetaceae SR 11, 9 For- CAATGGACTCAAGCCTGATG 53.5 53.0 Kineosporiaceae, sf_1 X87617 (97.7%) 10 Rev- CTCTAGCCTGCCCGTTTC 53.9 DQ236250 Chloroflexi, penguin droppings clone KD4-96, 11 For - GAGAGGATGATCAGCCAG 54.0 61.7 Anaerolineae, sf_9 AY218649 (90%) 12 Rev - 57.0 TACGGYTACCTTGTTACGACTT DQ236247 Cyanobacteria, Geitlerinema sp. PCC 7105, 13 For - 62.2 55.0 Geitlerinema, sf_1 AB039010 (89.3%) TCCGTAGGTGGCTGTTCAAGTCTG 14 Rev - 61.7 GCTTTCGTCCCTCAGTGTCAGTTG DQ236246 Cyanobacteria, Thermosynechococcus elongatus 15 For - 58.7 55.0 Thermosynechococcus, BP-1, TGTCGTGAGATGTTGGGTTAAGTC sf_1 BA000039 (96.0%) 16 Rev - 58.8 TGAGCCGTGGTTTAAGAGATTAGC DQ129654 Gammaproteobacteria, Pseudoalteromonas sp. S511-1, 17 For - GCCTCACGCCATAAGATTAG 53.1 50.0 Pseudoaltermonadaceae, AB029824 (99.1%) 18 Rev - 53.0 sf_1 GTGCTTTCTTCTGTAAGTAACG DQ129656 Nitrospira Nitrospira moscoviensis, 19 For - TCGAAAAGCGTGGGG 57.6 47.0 Nitrospiraceae, sf_1 X82558 (98.5%) 20 Rev - CTTCCTCCCCCGTTC 54.4 DQ129666 Planctomycetes, Planctomyces brasiliensis, 21 For - GAAACTGCCCAGACAC 50.0 60.0 Plantomycetaceae, AJ231190 (94%) 22 Rev - AGTAACGTTCGCACAG 48.0 sf_3 DQ515231 Proteobacteria, Uncultured Arcobacter sp. clone 23 For - GGATGACACTTTTCGGAG 54.0 48.0 Campylobacteraceae, DS017, sf_3 DQ234101 (98 %) 24 Rev - AATTCCATCTGCCTCTCC 55.0 DQ129662 Spirochaetes, Leptospira borgpetersenii, 25 For - GGCGGCGCGTTTTAAGC 57.0 58.7 Leptospiracea, sf_3 X17547 (90.9%) DQ129661 Spirochaetes, Spirochaeta asiatica, 26 Rev - ACTCGGGTGGTGTGACG 57.0 Spirochaetaceae, sf_1 X93926 (90.0%) DQ129660 Spirochaetes, Spirochaetaceae, Borrelia sf_3 hermsii M72398 (91.0 %) DQ236249 TM7, TM7-3, sf_1 oral clone EW096, 27 For - AYTGGGCGTAAAGAGTTGC 58.0 66.3 AY349415 (88.8%) 28 Rev - 57.0 TACGGYTACCTTGTTACGACTT Tm = Melting temperature; Ta = Optimal annealing temperature used in PCR reaction.
TABLE-US-00004 TABLE S4 Bacteria and Archaea used for Latin square hybridization assays. Organism Phylum/Sub-phylum ATCC Arthrobacter oxydans Actinobacteria 14359a Bacillus anthracis AMES Firmicutes -- b pX01- pX02- Caulobacter crescentus CB15 Alpha-proteobacteria 19089 Dechloromonas agitata CKB Beta-proteobacteria 700666 c Dehalococcoides ethenogenes 195 Chloroflexi -- d Desulfovibrio vulgaris Delta-proteobacteria 29579e Hildenborough Francisella tularensis Gamma-proteobacteria 6223 Geobacter metallireducens GS-15 Delta-proteobacteria 53774 c Geothrix fermentans H-5 Acidobacteria 700665 c Sulfolobus solfataricus Crenarchaeota 35092 aStain obtained from Hoi-Ying Holman, LBNL. b Strain obtained from Arthur Friedlander USAMRID. c Strain obtained from John Coates, UC Berkeley. d Strain obtained from Lisa Alvarez-Cohen, UC Berkeley. eStrain obtained from Terry Hazen, LBNL.
TABLE-US-00005 TABLE S5 Correlations between environmental/temporal parameters. Sub- family- mean max min range mean mean max max range level week TEMP MAXTEMP MINTEMP MINTEMP WDSP SLP VISIB PM2.5 PM2.5 richness Austin week 1.000 mean TEMP 0.703 1.000 max MAXTEMP 0.471 0.665 1.000 min MINTEMP 0.685 0.691 0.073 1.000 range MINTEMP -0.267 -0.149 0.571 -0.777 1.000 mean WDSP -0.540 -0.053 -0.038 -0.195 0.136 1.000 mean SLP 0.607 0.145 0.162 0.352 -0.188 -0.380 1.000 max VISIB 0.486 0.311 0.400 0.230 0.063 -0.498 0.318 1.000 max PM2.5 -0.529 -0.219 -0.331 -0.162 -0.075 0.617 -0.409 -0.817 1.000 range PM2.5 -0.507 -0.219 -0.366 -0.117 -0.134 0.613 -0.407 -0.829 0.989 1.000 Sub-family-level -0.074 -0.104 0.098 -0.460 0.440 0.251 -0.182 -0.066 -0.058 -0.063 1.000 richness San Antonio week 1.000 mean TEMP 0.452 1.000 max MAXTEMP 0.189 0.553 1.000 min MINTEMP 0.570 0.622 0.044 1.000 range MINTEMP -0.318 -0.116 0.630 -0.749 1.000 mean WDSP -0.523 -0.014 -0.015 -0.014 0.001 1.000 mean SLP 0.722 0.029 -0.088 0.300 -0.291 -0.495 1.000 max VISIB 0.420 0.169 0.298 -0.054 0.240 -0.234 0.501 1.000 max PM2.5 -0.508 -0.157 -0.197 -0.022 -0.114 0.189 -0.420 -0.830 1.000 range PM2.5 -0.515 -0.164 -0.201 0.000 -0.134 0.255 -0.455 -0.843 0.991 1.000 Sub-family-level 0.125 -0.016 -0.050 0.024 -0.051 -0.419 0.175 -0.054 -0.064 -0.102 1.000 richness Underlined font indicates a significant positive correlation, while italic font indicates a significant negative correlation at a 95% confidence interval.
TABLE-US-00006 TABLE S6 Sub-families detected in Austin or San Antonio correlating significantly with environmental parameters. All of the below are in the Domain of Bacteria BH Sub- taxon and representative Environ. Correl. p adjusted Phylum Class Order Family family organism name factor Coeff. value p.value a Actino- Actino- Actinomycetales Unclassified sf_3 1114 clone PENDANT- max 0.64 4.05E-05 2.49E-02 bacteria bacteria 38 TEMP Actino- Actino- Actinomycetales Unclassified sf_3 1114 clone PENDANT- mean 0.66 2.16E-05 2.01E-02 bacteria bacteria 38 TEMP Actino- Actino Actinomycetales Unclassified sf_3 1114 clone PENDANT- week 0.63 6.73E-05 3.18E-02 bacteria bacteria 38 Actino- Actino- Actinomycetales Gordoniaceae sf_1 1116 Gordona terrae week 0.61 1.18E-04 3.68E-02 bacteria bacteria Actino- Actino- Actinomycetales Actinosynnemataceae sf_1 1125 Actinokineospora max 0.6 1.53E-04 4.30E-02 bacteria bacteria diospyrosa str. TEMP NRRL B-24047T Actino- Actino- Actinomycetales Actinosynnemataceae sf_1 1125 Actinokineospora week 0.63 7.42E-05 3.38E-02 bacteria bacteria diospyrosa str. NRRL B-24047T Actino- Actino- Actinomycetales Streptomycetaceae sf_1 1128 Streptomyces sp. week 0.7 3.75E-06 1.18E-02 bacteria bacteria str. YIM 80305 Actino- Actino- Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya mean 0.61 1.42E-04 4.21E-02 bacteria bacteria polymorpha TEMP Actino- Actino- Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya min 0.61 1.50E-04 4.27E-02 bacteria bacteria polymorpha MINTEMP Actino- Actino- Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya week 0.7 4.39E-06 1.18E-02 bacteria bacteria polymorpha Actino- Actino- Actinomycetales Microbacteriaceae sf_1 1264 Waste-gas biofilter mean 0.61 1.47E-04 4.25E-02 bacteria bacteria clone BIhi33 TEMP Actino- Actino- Actinomycetales Microbacteriaceae sf_1 1264 Waste-gas biofilter week 0.69 7.62E-06 1.18E-02 bacteria bacteria clone BIhi33 Actino- Actino- Actinomycetales Streptomycetaceae sf_1 1344 Streptomyces max 0.64 5.42E-05 2.84E-02 bacteria bacteria species TEMP Actino- Actino- Actinomycetales Streptomycetaceae sf_1 1344 Streptomyces mean 0.62 9.56E-05 3.63E-02 bacteria bacteria species TEMP Actino- Actino- Actinomycetales Thermomonosporaceae sf_1 1406 Actinomadura week 0.65 2.91E-05 2.29E-02 bacteria bacteria kijaniata Actino- Actino- Actinomycetales Kineosporiaceae sf_1 1424 Actinomycetaceae max 0.6 1.70E-04 4.59E-02 bacteria bacteria SR 139 VISIB Actino- Actino- Actinomycetales Kineosporiaceae sf_1 1424 Actinomycetaceae week 0.62 8.03E-05 3.50E-02 bacteria bacteria SR 139 Actino- Actino- Actinomycetales Intrasporangiaceae sf_1 1445 Ornithinimicrobium week 0.62 9.46E-05 3.63E-02 bacteria bacteria humiphilum str. DSM 12362 HKI 124 Actino- Actino- Actinomycetales Unclassified sf_3 1514 uncultured human week 0.69 7.08E-06 1.18E-02 bacteria bacteria oral bacterium A11 Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia max 0.64 5.10E-05 2.79E-02 bacteria bacteria thermophila str. TEMP IMSNU 20112T Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia mean 0.66 1.99E-05 1.97E-02 bacteria bacteria thermophila str. TEMP IMSNU 20112T Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia min 0.61 1.10E-04 3.63E-02 bacteria bacteria thermophila str. MINTEMP IMSNU 20112T Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia min 0.6 1.82E-04 4.73E-02 bacteria bacteria thermophila str. TEMP IMSNU 20112T Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia week 0.73 1.15E-06 5.92E-03 bacteria bacteria thermophila str. IMSNU 20112T Actino- Actino- Actinomycetales Cellulomonadaceae sf_1 1592 Lake Bogoria week 0.61 1.15E-04 3.63E-02 bacteria bacteria isolate 69B4 Actino- Actino- Actinomycetales Corynebacteriaceae sf_1 1642 Corynebacterium max 0.62 8.87E-05 3.63E-02 bacteria bacteria otitidis TEMP Actino- Actino- Actinomycetales Corynebacteriaceae sf_1 1642 Corynebacterium mean 0.64 4.12E-05 2.49E-02 bacteria bacteria otitidis TEMP Actino- Actino- Actinomycetales Corynebacteriaceae sf_1 1642 Corynebacterium min 0.62 1.07E-04 3.63E-02 bacteria bacteria otitidis MINTEMP Actino- Actino- Actinomycetales Corynebacteriaceae sf_1 1642 Corynebacterium week 0.63 5.53E-05 2.84E-02 bacteria bacteria otitidis Actino- Actino- Actinomycetales Dermabacteraceae sf_1 1736 Brachybacterium max 0.63 6.17E-05 3.09E-02 bacteria bacteria rhamnosum TEMP LMG 19848T Actino- Actino- Actinomycetales Dermabacteraceae sf_1 1736 Brachybacterium mean 0.6 1.91E-04 4.90E-02 bacteria bacteria rhamnosum TEMP LMG 19848T Actino- Actino- Actinomycetales Dermabacteraceae sf_1 1736 Brachybacterium week 0.64 4.47E-05 2.62E-02 bacteria bacteria rhamnosum LMG 19848T Actino- Actino- Actinomycetales Streptomycetaceae sf_3 1743 Streptomyces week 0.6 1.60E-04 4.38E-02 bacteria bacteria scabiei str. DNK-G01 Actino- Actino- Actinomycetales Nocardiaceae sf_1 1746 Nocardia week 0.66 2.48E-05 2.21E-02 bacteria bacteria corynebacteroides Actino- Actino- Actinomycetales Unclassified sf_3 1806 French Polynesia: max 0.65 3.37E-05 2.29E-02 bacteria bacteria Tahiti clone 23 TEMP Actino- Actino- Actinomycetales Unclassified sf_3 1806 French Polynesia: mean 0.66 1.97E-05 1.97E-02 bacteria bacteria Tahiti clone 23 TEMP Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora max 0.61 1.10E-04 3.63E-02 bacteria bacteria subsp. citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora mean 0.61 1.22E-04 3.72E-02 bacteria bacteria subsp. citrea str. MINTEMP IMSNU 22008T Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora mean 0.67 1.76E-05 1.97E-02 bacteria bacteria subsp. citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora min 0.7 4.92E-06 1.18E-02 bacteria bacteria subsp. citrea str. MINTEMP IMSNU 22008T Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora min 0.65 2.68E-05 2.29E-02 bacteria bacteria subsp. citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821 Catellatospora week 0.62 8.24E-05 3.52E-02 bacteria bacteria subsp. citrea str. IMSNU 22008T Actino- Actino- Rubrobacterales Rubrobacteraceae sf_1 1892 Start arid zone soil min 0.62 8.51E-05 3.56E-02 bacteria bacteria clone 0319-7H2 MINTEMP Actino- Actino- Rubrobacterales Rubrobacteraceae sf_1 1892 Start arid-zone soil week 0.68 9.19E-06 1.18E-02 bacteria bacteria clone 0319-7H2 Actino- Actino- Actinomycetales Actinosynnemataceae sf_1 1984 Saccharothrix max 0.68 8.01E-06 1.18E-02 bacteria bacteria tangerinus TEMP str. MK27-91F2 Actino- Actino- Actinomycetales Actinosynnemataceae sf_1 1984 Saccharothrix mean 0.67 1.64E-05 1.97E-02 bacteria bacteria tangerinus TEMP str. MK27-91F2 Actino- Actino- Actinomycetales Actinosynnemataceae sf_1 1984 Saccharothrix week 0.7 3.54E-06 1.18E-02 bacteria bacteria tangerinus str. MK27-91F2 Actino- Actino- Actinomycetales Nocardiaceae sf_1 1999 Rhodococcus max 0.61 1.14E-04 3.63E-02 bacteria bacteria fascians TEMP str. DFA7 Actino- Actino- Actinomycetales Propionibacteriaceae sf_1 2023 Propionibacterium week 0.62 9.19E-05 3.63E-02 bacteria bacteria propionicum str. DSM 43307T Actino- Actino- Actinomycetales Streptosporangiaceae sf_1 2037 Nonomuraea week 0.61 1.13E-04 3.63E-02 bacteria bacteria terrinata str. DSM 44505 Firmicutes Bacilli Bacillales Thermoactino- sf_1 3619 Thermoactinomyces range 0.65 3.41E-05 2.29E-02 mycetaceae intermedius str. MINTEMP ATCC 33205T Cyano- Cyano- Symploca Unclassified sf_1 5165 Symploca atlantica week 0.63 6.84E-05 3.18E-02 bacteria bacteria str. PCC 8002 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 5491 Austria: Lake mean 0.61 1.15E-04 3.63E-02 roidetes bacteria Gossenkoellesee TEMP clone GKS2-106 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 5491 Austria: Lake week 0.63 6.62E-05 3.18E-02 roidetes bacteria Gossenkoellesee clone GKS2-106 Bacte- Sphingo- Sphingobacteriales Flexibacteraceae sf_19 5866 Taxeobacter week 0.62 1.08E-04 3.63E-02 roidetes bacteria ocellatus str. Myx2105 Bacte- Bacte- Bacteroidales Prevotellaceae sf_1 6047 deep marine week 0.62 9.52E-05 3.63E-02 roidetes roidetes sediment clone MB-A2-107 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio spartinae max -0.62 9.95E-05 3.63E-02 roidetes bacteria str. AS1.1762 PM2.5 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio spartinae max 0.62 1.09E-04 3.63E-02 roidetes bacteria str. AS1.1762 VISIB Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio spartinae range -0.65 2.86E-05 2.29E-02 roidetes bacteria str. AS1.1762 PM2.5 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio spartinae week 0.61 1.25E-04 3.76E-02 roidetes bacteria str. AS1.1762 Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 6808 PCB-polluted soil mean 0.63 7.73E-05 3.45E-02 bacteria proteo- clone WD267 TEMP bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 6808 PCB-polluted soil week 0.69 5.54E-06 1.18E-02 bacteria proteo- clone WD267 bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7132 Sphingomonas sp. min 0.64 5.16E-05 2.79E-02 bacteria proteo- K101 SLP bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7132 Sphingomonas sp. week 0.75 2.74E-07 2.81E-03 bacteria proteo- K101 bacteria Proteo- Alpha- Bradyrhizobiales Unclassified sf_1 7255 Pleomorphomonas max 0.65 3.57E-05 2.29E-02 bacteria proteo- oryzae str. B-32 TEMP bacteria Proteo- Alpha- Bradyrhizobiales Unclassified sf_1 7255 Pleomorphomonas mean 0.64 4.62E-05 2.63E-02 bacteria proteo- oryzae str. B-32 TEMP bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7344 rhizosphere soil week 0.68 8.96E-06 1.18E-02 bacteria proteo- RSI-21 bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7411 Sphingomonas min 0.66 2.01E-05 1.97E-02
bacteria proteo- adhaesiva SLP bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7411 Sphingomonas week 0.74 6.42E-07 4.39E-03 bacteria proteo- adhaesiva bacteria Proteo- Alpha- Rhodobacterales Rhodobacteraceae sf_1 7527 clone CTD56B mean 0.61 1.44E-04 4.23E-02 bacteria proteo- TEMP bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1 7555 derived microbial week 0.6 1.60E-04 4.38E-02 bacteria proteo- `pearl`-community bacteria clone sipK48 Proteo- Alpha- Bradyrhizobiales Methylobacteriaceae sf_1 7593 Methylobacterium max 0.65 3.53E-05 2.29E-02 bacteria proteo- organophilum TEMP bacteria Proteo- Alpha- Bradyrhizobiales Methylobacteriaceae sf_1 7593 Methylobacterium mean 0.62 9.87E-05 3.63E-02 bacteria proteo- organophilum TEMP bacteria Proteo- Alpha- Bradyrhizobiales Methylobacteriaceae sf_1 7593 Methylobacterium week 0.68 8.06E-06 1.18E-02 bacteria proteo- organophilum bacteria Proteo- Alpha- Devosia Unclassified sf_1 7626 Devosia neptuniae week 0.6 1.80E-04 4.73E-02 bacteria proteo- str. J1 bacteria Proteo- Beta- Burkholderiales Comamonadaceae sf_1 7786 unidentified alpha mean 0.65 3.45E-05 2.29E-02 bacteria proteo- proteobacterium TEMP bacteria Proteo- Beta- Burkholderiales Burkholderiaceae sf_1 7899 Burkholderia week 0.65 3.43E-05 2.29E-02 bacteria proteo- andropogonis bacteria Proteo- Gamma- Unclassified Unclassified sf_3 8759 Agricultural soil max 0.6 1.74E-04 4.63E-02 bacteria proteo- SC-I-87 TEMP bacteria Proteo- Gamma- Pseudomonadales Pseudomonadaceae sf_1 9389 Pseudomonas min 0.68 8.57E-06 1.18E-02 bacteria proteo- oleovorans SLP bacteria Proteo- Gamma- Pseudomonadales Pseudomonadaceae sf_1 9389 Pseudomonas week 0.83 1.03E-09 2.11E-05 bacteria proteo- oleovorans bacteria a P-value is adjusted for multiple comparisons using false discovery rate controlling procedure (S18).
TABLE-US-00007 TABLE S7 Bacterial sub-families detected (92% or greater of probes in probe set positive) most frequently over 17 week study. Most frequently detected 16S rRNA gene sequences AU SA Bacteria; Acidobacteria; Acidobacteria; Acidobacteriales; Acidobacteriaceae; sf_14 17 17 Bacteria; Acidobacteria; Acidobacteria-6; Unclassified; Unclassified; sf_1 16 17 Bacteria; Acidobacteria; Solibacteres; Unclassified; Unclassified; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Cellulomonadaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Corynebacteriaceae; sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Gordoniaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Kineosporiaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Microbacteriaceae; sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Micrococcaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Micromonosporaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Mycobacteriaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Nocardiaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Promicromonosporaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Pseudonocardiaceae; sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Streptomycetaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Thermomonosporaceae; sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Actinomycetales; Unclassified; sf_3 17 17 Bacteria; Actinobacteria; Actinobacteria; Rubrobacterales; Rubrobacteraceae; sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Unclassified; Unclassified; sf_1 16 17 Bacteria; Actinobacteria; BD2-10 group; Unclassified; Unclassified; sf_2 17 16 Bacteria; Bacteroidetes; Sphingobacteria; Sphingobacteriales; Unclassified; sf_3 16 17 Bacteria; Chloroflexi; Anaerolineae; Chloroflexi-la; Unclassified; sf_1 16 17 Bacteria; Chloroflexi; Anaerolineae; Unclassified; Unclassified; sf_9 16 17 Bacteria; Chloroflexi; Dehalococcoidetes; Unclassified; Unclassified; sf_1 16 17 Bacteria; Cyanobacteria; Cyanobacteria; Chloroplasts; Chloroplasts; sf_5 17 17 Bacteria; Cyanobacteria; Cyanobacteria; Plectonema; Unclassified; sf_1 16 17 Bacteria; Cyanobacteria; Unclassified; Unclassified; Unclassified; sf_5 16 17 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; sf_1 17 17 Bacteria; Firmicutes; Bacilli; Bacillales; Halobacillaceae; sf_1 17 17 Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; sf_1 16 17 Bacteria; Firmicutes; Bacilli; Lactobacillales; Enterococcaceae; sf_1 17 17 Bacteria; Firmicutes; Bacilli; Lactobacillales; Streptococcaceae; sf_1 16 17 Bacteria; Firmicutes; Catabacter; Unclassified; Unclassified; sf_1 16 17 Bacteria; Firmicutes; Clostridia; Clostridiales; Clostridiaceae; sf_12 17 17 Bacteria; Firmicutes; Clostridia; Clostridiales; Lachnospiraceae; sf_5 17 17 Bacteria; Firmicutes; Clostridia; Clostridiales; Peptococc/Acidaminococc; sf_11 17 17 Bacteria; Firmicutes; Clostridia; Clostridiales; Peptostreptococcaceae; sf_5 17 17 Bacteria; Firmicutes; Clostridia; Clostridiales; Unclassified; sf_17 16 17 Bacteria; Firmicutes; Unclassified; Unclassified; Unclassified; sf_8 16 17 Bacteria; Nitrospira; Nitrospira; Nitrospirales; Nitrospiraceae; sf_1 17 16 Bacteria; OP3; Unclassified; Unclassified; Unclassified; sf_4 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Acetobacterales; Acetobacteraceae; sf_1 17 16 Bacteria; Proteobacteria; Alphaproteobacteria; Azospirillales; Unclassified; sf_1 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales; Beijerinck/Rhodoplan/Methylocyst; sf_3 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales; Bradyrhizobiaceae; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales; Hyphomicrobiaceae; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales; Methylobacteriaceae; sf_1 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Ellin314/wr0007; Unclassified; sf_1 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Bradyrhizobiaceae; sf_1 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Phyllobacteriaceae; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Unclassified; sf_1 16 17 Bacteria; Proteobacteria; Alphaproteobacteria; Rhodobacterales; Rhodobacteraceae; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Rickettsiales; Unclassified; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; sf_1 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; sf_15 17 17 Bacteria; Proteobacteria; Alphaproteobacteria; Unclassified; Unclassified; sf_6 17 17 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Alcaligenaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Burkholderiaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Comamonadaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Oxalobacteraceae; sf_1 17 17 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Ralstoniaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Methylophilales; Methylophilaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Rhodocyclales; Rhodocyclaceae; sf_1 16 17 Bacteria; Proteobacteria; Betaproteobacteria; Unclassified; Unclassified; sf_3 17 17 Bacteria; Proteobacteria; Deltaproteobacteria; Syntrophobacterales; Syntrophobacteraceae; sf_1 16 17 Bacteria; Proteobacteria; Epsilonproteobacteria; Campylobacterales; Campylobacteraceae; sf_3 17 17 Bacteria; Proteobacteria; Epsilonproteobacteria; Campylobacterales; Helicobacteraceae; sf_3 17 17 Bacteria; Proteobacteria; Epsilonproteobacteria; Campylobacterales; Unclassified; sf_1 17 17 Bacteria; Proteobacteria; Gammaproteobacteria; Alteromonadales; Alteromonadaceae; sf_1 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Chromatiales; Chromatiaceae; sf_1 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; sf_1 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; sf_6 17 17 Bacteria; Proteobacteria; Gammaproteobacteria; Legionellales; Unclassified; sf_1 17 17 Bacteria; Proteobacteria; Gammaproteobacteria; Legionellales; Unclassified; sf_3 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Moraxellaceae; sf_3 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; sf_1 16 17 Bacteria; Proteobacteria; Gammaproteobacteria; Unclassified; Unclassified; sf_3 17 17 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales; Xanthomonadaceae; sf_3 17 17 Bacteria; TM7; TM7-3; Unclassified; Unclassified; sf_1 16 17 Bacteria; Unclassified; Unclassified; Unclassified; Unclassified; sf_148 16 17 Bacteria; Unclassified; Unclassified; Unclassified; Unclassified; sf_160 17 17 Bacteria; Verrucomicrobia; Verrucomicrobiae; Verrucomicrobiales; Verrucomicrobiaceae; sf_7 17 17 Number of sub-families detected in all samples over 17 week period 43 80 Italic text indicates sub-families not found in all 17 weeks. AU = Austin, SA = San Antonio.
TABLE-US-00008 TABLE S8 Bacterial sub-families containing pathogens of public health and bioterrorism significance and their relatives that were detected in aerosols over the 17 week monitoring period. Austin San Antonio Weeks % of Weeks % of Pathogens and relatives taxon # detected weeks detected weeks Bacillus anthracis Bacillus cohnii, B. psychrosaccharolyticus, 3439 17 100.0 17 100.0 B. benzoevorans Bacillus megaterium 3550 11 64.7 12 70.6 Bacillus horikoshii 3904 9 52.9 14 82.4 Bacillus litoralis, B. macroides, B. 3337 5 29.4 8 47.1 psychrosaccharolyticus Staphylococcus saprophyticus, S. xylosus, S. 3659 7 41.2 15 88.2 cohnii Bacillus anthracis, cereus, thuringiensis, 3262 0 0.0 1 5.9 mycoides + others Rickettsia prowazekii - rickettsii Rickettsia australis, R. eschlimannii, R. typhi, 7556 2 11.8 5 29.4 R. tarasevichiae + others Rickettsia prowazekii 7114 0 0.0 0 0.0 Rickettsia rickettsii, R. japonica, R. honei + 6809 4 23.5 10 58.8 others Burkholderia mallei - pseudomallei Burkholderia pseudomallei, B. thailandensis 7870 10 58.8 14 82.4 Burkholderia mallei 7747 10 58.8 8 47.1 Burkholderia pseudomallei, Burkholderia 8097 13 76.5 15 88.2 cepacia, B. tropica, B. gladioli, B. stabilis, B. plantarii + others Clostridum botulinum - perfringens Clostridium butyricum, C. baratii, C. 4598 3 17.6 10 58.8 sardiniense + others Clostridium botulinum type C 4587 2 11.8 4 23.5 Clostridium perfringens 4576 1 5.9 1 5.9 Clostridium botulinum type G 4575 3 17.6 7 41.2 Clostridium botulinum types B and E 4353 0 0.0 0 0.0 Francisella tularensis Tilapia parasite 9554 1 5.9 2 11.8 Francisella tularensis 9180 0 0.0 0 0.0
TABLE-US-00009 TABLE S9 Distribution of array taxa among Bacterial and Archaeal phyla. Numbers of taxa in phylum Phyla represented on array Archaea Crenarchaeota 79 Euryarchaeota 224 Korarchaeota 3 YNPFFA 1 Archaeal taxa subtotal 307 Bacteria 1959 group 1 Acidobacteria 98 Actinobacteria 810 AD3 1 Aquificae 19 Bacteroidetes 880 BRC1 3 Caldithrix 2 Chlamydiae 27 Chlorobi 21 Chloroflexi 117 Chrysiogenetes 1 Coprothermobacteria 3 Cyanobacteria 202 Deferribacteres 5 Deinococcus-Thermus 18 Dictyoglomi 5 DSS1 2 EM3 2 Fibrobacteres 4 Firmicutes 2012 Fusobacteria 29 Gemmatimonadetes 15 LD1PA group 1 Lentisphaerae 8 marine group A 5 Natronoanaerobium 7 NC10 4 Nitrospira 29 NKB19 2 OD1 4 OD2 6 OP1 5 OP10 12 OP11 20 OP3 5 OP5 3 OP8 8 OP9/JS1 12 OS-K 2 OS-L 1 Planctomycetes 182 Proteobacteria 3170 SPAM 2 Spirochaetes 150 SR1 4 Synergistes 19 Termite group 1 6 Thermodesulfobacteria 4 Thermotogae 15 TM6 5 TM7 45 Unclassified 329 Verrucomicrobia 78 WS1 2 WS3 7 WS5 1 WS6 4 Bacterial taxa subtotal 8434 Total taxa 8741
EQUIVALENTS
[0085] The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the present embodiments. The foregoing description and Examples detail certain preferred embodiments and describes the best mode contemplated by the inventors. It will be appreciated, however, that no matter how detailed the foregoing may appear in text, the present embodiments may be practiced in many ways and the present embodiments should be construed in accordance with the appended claims and any equivalents thereof.
[0086] The term "comprising" is intended herein to be open-ended, including not only the recited elements, but further encompassing any additional elements.
Sequence CWU
1
1
28120DNAArtificial SequenceArtificially Synthesized Primer 1agrgtttgat
cmtggctcag
20219DNAArtificial SequenceArtificially Synthesized Primer 2ggttaccttg
ttacgactt
19320DNAArtificial SequenceArtificially Synthesized Primer 3cgactacctg
gactgacact
20420DNAArtificial SequenceArtificially Synthesized Primer 4caccggcagt
ctccttagag
20519DNAArtificial SequenceArtificially Synthesized Primer 5accaaggcta
cgacgggta
19619DNAArtificial SequenceArtificially Synthesized Primer 6acacaccgca
tgtcaaacc
19718DNAArtificial SequenceArtificially Synthesized Primer 7gggtggtaat
gccsgatg
18818DNAArtificial SequenceArtificially Synthesized Primer 8ccrccgttac
accgggaa
18920DNAArtificial SequenceArtificially Synthesized Primer 9caatggactc
aagcctgatg
201018DNAArtificial SequenceArtificially Synthesized Primer 10ctctagcctg
cccgtttc
181118DNAArtificial SequenceArtificially Synthesized Primer 11gagaggatga
tcagccag
181222DNAArtificial SequenceArtificially Synthesized Primer 12tacggytacc
ttgttacgac tt
221324DNAArtificial SequenceArtificially Synthesized Primer 13tccgtaggtg
gctgttcaag tctg
241424DNAArtificial SequenceArtificially Synthesized Primer 14gctttcgtcc
ctcagtgtca gttg
241524DNAArtificial SequenceArtificially Synthesized Primer 15tgtcgtgaga
tgttgggtta agtc
241624DNAArtificial SequenceArtificially Synthesized Primer 16tgagccgtgg
tttaagagat tagc
241720DNAArtificial SequenceArtificially Synthesized Primer 17gcctcacgcc
ataagattag
201822DNAArtificial SequenceArtificially Synthesized Primer 18gtgctttctt
ctgtaagtaa cg
221915DNAArtificial SequenceArtificially Synthesized Primer 19tcgaaaagcg
tgggg
152015DNAArtificial SequenceArtificially Synthesized Primer 20cttcctcccc
cgttc
152116DNAArtificial SequenceArtificially Synthesized Primer 21gaaactgccc
agacac
162216DNAArtificial SequenceArtificially Synthesized Primer 22agtaacgttc
gcacag
162318DNAArtificial SequenceArtificially Synthesized Primer 23ggatgacact
tttcggag
182418DNAArtificial SequenceArtificially Synthesized Primer 24aattccatct
gcctctcc
182517DNAArtificial SequenceArtificially Synthesized Primer 25ggcggcgcgt
tttaagc
172617DNAArtificial SequenceArtificially Synthesized Primer 26actcgggtgg
tgtgacg
172719DNAArtificial SequenceArtificially Synthesized Primer 27aytgggcgta
aagagttgc
192822DNAArtificial SequenceArtificially Synthesized Primer 28tacggytacc
ttgttacgac tt 22
User Contributions:
Comment about this patent or add new information about this topic: