Methods and Compositions for Increasing Protein Production

Abstract

The disclosure provides methods and materials for increasing the expression of a protein of interest such as an antibody by a cell. ABC50 expression or activity is increased which increases expression of the protein or antibody of interest. The disclosure also provides methods and materials for increasing the sensitivity of a cell to an endoplasmic reticulum stress agent such as Econozole by decreasing the level of ABC50.

Description

RELATED APPLICATIONS

[0001] The present application is a continuation of copending U.S. patent application Ser. No. 13/318,985, filed Nov. 4, 2011, which is a National stage entry of International Application No. PCT/CA2010/000681, filed May 5, 2010, which claims priority to U.S. Provisional Patent Application 61/175,642 filed May 5, 2009, each of these applications being incorporated herein in their entirety by reference.

INCORPORATION OF SEQUENCE LISTING

[0002] A computer readable form of the Sequence Listing "10723-P34775US02_SL.txt" (34,155 bytes), submitted via EFS-WEB and created on Feb. 26, 2014, is herein incorporated by reference.

FIELD OF THE DISCLOSURE

[0003] The disclosure relates to methods and compositions for protein production and specifically to methods and compositions for increasing hybridoma antibody production.

BACKGROUND OF THE DISCLOSURE

[0004] ABC50 (aka ABCF1) is a member of the ATP Binding Cassette (ABC) family of proteins. ABC50 was first identified as a Tumor Necrosis Factor α-inducible gene in synoviocytes¹, and then re-discovered as a protein that purifies with the translation initiation factor elF2². Biochemically, ABC50 stimulates formation of complexes between elF2, GTP and Met-tRNA, implicating it in translation initiation and control. ABC50 is a unique member of the ABC family in that it lacks transmembrane domains. Recently Paytubi et al. showed that the N-terminal region was responsible for elF2 binding³. Binding was found to be regulated by Casein Kinase 2 phosphorylation in this domain. Overexpression of ABC50 into HEK293 cells was not observed to boost protein expression³.

[0005] Econazole (Ec) is an imidazole antifungal that also induces endoplasmic reticulum (ER) stress by promoting ER Ca²+ depletion. Ec's mechanism of action involves both Ca²+ influx blockade and stimulation of ER Ca²+ release⁴. The latter effect is mediated by reactive oxygen species (ROS) generation at the mitochondria⁵. Some cancer cells are extraordinarily sensitive to Ec^6,7.

[0006] The market for therapeutic proteins is currently on the order of $60 Billion worldwide. The largest component of this market is recombinant monoclonal antibodies but also includes other protein classes such as cytokines, growth factors such as insulin, coagulation factors, vaccine subunits and therapeutic enzymes. The diagnostic market is similarly estimated to be $40 Billion worldwide and a significant fraction of this market employs recombinant proteins including monoclonal antibodies. Finally, recombinant proteins for research purposes also represent a large and growing use for recombinant proteins.

[0007] It was recently estimated that about half of the 140 recombinant proteins on the market are produced in mammalian cells⁸. Given the requirement for large amounts of protein, particularly in the therapeutic setting, there is clearly a need for optimizing natural and recombinant protein production.

SUMMARY OF THE DISCLOSURE

[0008] An aspect of the disclosure includes a method of producing a protein of interest in a cell comprising increasing the expression or activity of a ABC50 protein or a fragment thereof having eIF2 binding activity; and effecting the expression of the protein of interest.

[0009] In an aspect, the disclosure provides a method of producing a heterologous protein of interest in a cell comprising increasing the expression or activity of a ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity; and effecting the expression of the protein of interest.

[0010] In another aspect, the disclosure provides a method of producing an antibody of interest or fragment thereof in a cell capable of expressing an antibody comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0011] Another aspect relates to a method of increasing expression of a heterologous protein of interest in a cell expressing the protein of interest, comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0012] Yet another aspect relates to a method of increasing expression of an antibody of interest in a cell expressing the antibody of interest, comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0013] In an embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased by introducing a heterologous ABC50 polynucleotide encoding ABC50 protein or a fragment thereof operatively linked to a promoter.

[0014] In another embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased by contacting the cell with increasing concentrations of Econozole (Ec), and detecting increased expression or activity of ABC50 protein.

[0015] In an embodiment, the cell comprises a heterologous polynucleotide encoding the protein of interest operatively linked to a promoter.

[0016] In another embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased and the expression of the protein of interest is effected by introducing a vector comprising a polynucleotide encoding ABC50 protein or a fragment thereof, and a heterologous polynucleotide of the protein of interest, wherein the polynucleotides are operatively linked to one or more promoters.

[0017] In another embodiment, effecting the expression of the protein of interest comprises contacting the cell with an inducer that induces expression of the protein of interest or induces expression of ABC50.

[0018] In a further embodiment, the ABC50 protein comprises SEQ ID NO: 1, 2 or 5; or a protein with at least 90%, 95%, 99% or 99.5% identity with SEQ ID NO:1, 2 or 5.

[0019] In an embodiment, the method results in increased specific cellular expression and/or production of the protein of interest in comparison to a control cell expressing the protein of interest wherein the control cell does not have increased expression of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0020] In another embodiment, the method results in increased specific cellular expression and/or production of the antibody of interest in comparison to a control cell expressing the antibody of interest wherein the control cell does not have increased expression of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0021] In a further embodiment, wherein the increase in expression and/or production is about 5% to about 10%, about 11% to about 20%, about 31% to about 40%, about 41% to about 50%, 51% to about 60%, 61% to about 70%, 71% to about 80%, about 81% to about 90%, about 91% to about 100%, about 150% to about 199%, about 200% to about 299%, about 300% to about 499%, or about 500% to about 1000%.

[0022] In an embodiment, the cell is a eukaryotic cell selected from a yeast, plant, worm, insect, avian, fish, reptile and mammalian cell. In another embodiment, the mammalian cell is a myeloma cell, a spleen cell, or a hybridoma cell. In yet a further embodiment, the mammalian cell is a leukemia cell, such as HL-60; or a hybridoma cell such as Sp2; or a chinese hamster ovary (CHO) cell.

[0023] The protein of interest or antibody of interest is, in an embodiment, a secreted protein, an intracellular protein, or a membrane protein.

[0024] In another embodiment, the protein of interest is an antibody or antibody fragment or derivative thereof. In an embodiment, the antibody is monoclonal, polyclonal, mammalian, murine, chimeric, humanized, primatized, primate, or human. In another embodiment, the antibody is a fragment or derivative thereof selected from antibody immunoglobulin light chain, immunoglobulin heavy chain, immunoglobulin light and heavy chains, Fab, F(ab')2, Fc, Fc-Fc fusion proteins, Fv, single chain Fv, single domain Fv, tetravalent single chain Fv, disulfide-linked Fv, domain deleted, minibody, diabody, a fusion protein of one of the above fragments with another peptide or protein or Fc-peptide fusion.

[0025] In an embodiment, the method further comprises isolating the protein of interest or the antibody of interest. Where, for example, the protein or antibody of interest is secreted, the method in an embodiment, further comprises isolating the secreted protein or secreted antibody of interest. Where, for example, the protein or antibody of interest is intracellular, the method further comprises in an embodiment, lysing the cell and isolating the intracellular protein or antibody of interest. In another embodiment, where the protein or antibody of interest is membrane or surface bound, the method in an embodiment, further comprises solubilizing the cell membrane and isolating the membrane protein or surface antibody of interest.

[0026] A further aspect provides a process for the production of a protein of interest comprising: culturing a cell, wherein the cell produces the protein of interest, increasing the expression or activity of a ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity, which enhances protein production; culturing the cell until the protein of interest accumulates, and isolating the protein of interest.

[0027] Another aspect provides a process for the production of a protein of interest comprising: culturing a cell wherein the cell comprises an expression vector that encodes the protein of interest and an expression vector that encodes a ABC50 protein under conditions that permit expression of the protein of interest and the ABC50 protein; culturing the cell until the protein of interest accumulates and isolating the protein of interest.

[0028] In an embodiment, the process provides for the production of a protein of interest, wherein the protein of interest is an antibody or antibody fragment.

[0029] Another aspect relates to a method of decreasing ABC50 levels in a cell comprising expressing an antisense agent that inhibits expression of ABC50 in the cell.

[0030] A further aspect provides a method of increasing sensitivity of a cell to ER stress agents comprising expressing an antisense agent that inhibits expression of ABC50 in the cell.

[0031] In an embodiment, the antisense agent is a siRNA, shRNA or an antisense oligonucleotide.

[0032] In a further embodiment, the shRNA comprises SEQ ID NO: 3 or 4.

[0033] In an embodiment, the ER stress agent is selected from EC, thapsigargin and tunicamycin.

[0034] Another aspect provides an isolated protein of interest produced according to a method described herein.

[0035] In an embodiment, the isolated protein produced according to a method described herein is an antibody or antibody fragment.

[0036] A further aspect provides an expression vector comprising a polynucleotide encoding an ABC50 polynucleotide and a polynucleotide comprising a protein of interest.

[0037] A further aspect relates to a cell comprising an expression vector described herein.

[0038] Yet a further aspect provides a cell comprising a heterologous ABC50 gene.

[0039] Another aspect relates to a composition comprising an isolated protein, vector or cell described herein.

[0040] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] An embodiment of the disclosure will now be discussed in relation to the drawings in which:

[0042] FIG. 1 Enhanced expression of ABC50 in Ec-resistant E2R2 cells. A: Reverse Northern analysis of genes identified by Differential Display as performed as described in Materials and Methods. Clone 002B, identified in this analysis as having increased expression was sequenced and found to be the ABC50 gene. B: Western blot of ABC50 in HL60 vs E2R2 cells. Actin expression was also evaluated to allow normalization between the two samples.

[0043] FIG. 2 ABC50 knockdown partially reverses resistance to Ec in E2R2 cells. A: Western blot of ABC50 expression in E2R2 cells infected with vector control or ABC50 shRNA. B: Apoptosis induction by Ec in E2R2 vector control and ABC50 knockdown cells. Cells were exposed to 15 μM Ec for 2 hours followed by overnight recovery as described in Materials and Methods. The following day, cells were stained with PI and AnnexinV and analysed by flow cytometry. AnnexinV positive, PI negative cells represent early apoptotic cells, AnnexinV positive, PI positive cells represent late apoptotic or necrotic cells.

[0044] FIG. 3 ABC50 knockdown alters growth rate and sensitivity to Ec in HL60 cells. A: Western blot of ABC50 expression in HL60 cells infected with vector control or ABC50 shRNA. B: Cell growth kinetics of control and ABC50 knocked-down cells. Values are means and standard errors determined from triplicate cultures and is representative measurement from a series of three independent experiments. ***indicates p<0.001 at 48 hours for ABC50 KD cells vs control. C: Apoptosis induction by serum withdrawal (SW), Ec, Tg, Tu and etoposide (Eto) in HL60 vector control and ABC50 knockdown cells. Cells were exposed to 15 μM Ec for 2 hours followed by overnight recovery as described in Materials and Methods. Cells were incubated overnight in the absence of serum, 200 nM Tg, 1 μM Tu or 5 μM etoposide. The following day, cells were stained with PI and AnnexinV and analysed by flow cytometry. AnnexinV positive, PI negative cells represent early apoptotic cells, AnnexinV positive, PI positive cells represent late apoptotic or necrotic cells. Plotted is early and late apoptotic cells combined. *p<0.05, **p<0.01 comparing knockdown or overexpressing cells to their vector control.

[0045] FIG. 4 Effect of ABC50 overexpression on growth rate and sensitivity to ER stress agents in HL60 cells. A: Western blot of ABC50 expression in HL60 cells infected with vector control or ABC50 OE vector. B: Cell growth kinetics of control and ABC50 overexpressing cells. Values are means and standard errors determined from triplicate cultures and is representative measurement from a series of three independent experiments. C: Apoptosis induction by serum withdrawal (SW), Ec, Tg, Tu and etoposide (Eto) in HL60 vector control and ABC50 overexpressing cells. Cells were exposed to 15 μM Ec for 2 hours followed by overnight recovery as described in Materials and Methods. Cells were incubated overnight in the absence of serum, 200 nM Tg, 1 μM Tu or 5 μM etoposide. The following day, cells were stained with PI and AnnexinV and analysed by flow cytometry. AnnexinV positive, PI negative cells represent early apoptotic cells, AnnexinV positive, PI positive cells represent late apoptotic or necrotic cells. Plotted is early and late apoptotic cells combined. *p<0.05, **p<0.01 comparing knockdown or overexpressing cells to their vector control.

[0046] FIG. 5 Effect of ABC50 knockdown or overexpression on ER Ca²+ stores and influx in HL60 cells. HL60 cells were loaded with the Ca²+-sensitive dye Indo-1 as described in Materials and Methods. Cells were incubated (or not) in 5 mM Ni²+ to non-specifically block all Ca²+ influx and then exposed to thapsigargin to release ER Ca²+ and stimulate Ca²+ influx. Cytoplasmic Ca²+ levels were followed over time. Tg releases ER Ca²+ in all cases but subsequent store-operated Ca²+ influx is blocked in cells pre-incubated with Ni²+. A: HL60 cells infected with vector control or ABC50 shRNA treated with Tg. B: HL60 cells infected with vector control or ABC50 shRNA pre-incubated in Ni²+ to block influx, and then treated with Tg. C: HL60 cells infected with vector control or ABC50 overexpressing virus treated with Tg. D: HL60 cells infected with vector control or ABC50 overexpressing virus pre-incubated in Ni²+ to block influx, and then treated with Tg.

[0047] FIG. 6. ABC50 knockdown or overexpression alters the ER stress response. Vector controls, knockdown (A, B) or overexpressing cells (C, D) were exposed to Ec (15 μM), Tg (200 nM) or Tu (200 ng/ml) for 60 minutes. The cells were collected, lysed in RIPA buffer, resolved by SDS-PAGE and analysed with anti-sera specific for A, C: ser51-phosphorylated elF2α or total elF2α, B, D: BiP or actin. Numbers represent relative expression levels compared to control normalized to either total elF2α or actin. The blots are representative of two independent experiments.

[0048] FIG. 7 Effect of ABC50 knockdown or overexpression on ribosomal RNA and Protein content. Ribosomes were purified as described in the Materials and Methods. A: Total ribosomal proteins obtained from 2 independent cultures and extractions were analyzed by electrophoresis on a 12% SDS-PAGE gel. The gel was then stained with Coomassie Brilliant Blue to visualize the protein bands. B: rRNA and rProtein content as measured by absorbance.

[0049] FIG. 8 Effect of ABC50 knockdown or overexpression on global protein synthesis. Cells were incubated with 15 μM Ec for 15 minutes, pulse-labelled with 3H-leucine and incorporation was measured as described in Materials and Methods. A: Vector control vs ABC50 knock-down. B: Vector control vs ABC50 overexpression. The values are averages and standard errors from 4 replicates. This experiment was repeated six times. *p<0.05, **p<0.01 comparing knockdown or overexpressing cells to their vector control.

[0050] FIG. 9 ABC50 overexpression increases IgG production in hybridoma GK1.5. A: GK1.5 cells were infected with empty vector control or ABC50 overexpressing virus, then sorted for GFP expression. GFP expression levels were measured by flow cytometry. B: Control or ABC50 overexpressing cells were seeded at 1×10⁶ cells/ml, cultured for 24 hours, the cells were pelleted, lysed in RIPA buffer with protease inhibitors and cell lysates were resolved by SDS-PAGE and blotted with rabbit anti-sera specific for heavy and light chains. H: antibody heavy chain, L: antibody light chain. The numbers in brackets represent the ratio of band intensities (as determined by densitometry) for ABC50 overexpressing vs control. The ratio is the average of three independent measurements. C: Cell supernatants were collected at 24 and 48 hours and IgG levels were measured by ELISA. The values are averages of two determinations. This experiment was repeated three times. *p<0.05 comparing overexpressing cells to their vector control.

[0051] FIG. 10. Generation of Ec-resistant sp2 cells. Sp2 cells were exposed to increasing concentrations of Econazole. Cells remaining after treatment were expanded and subjected to additional rounds of selection. A: cell viability for unselected (U) and selected (S) cells. Exposure to Econazole was for 2 hours in low serum medium, followed by a recovery period of 24 hours in full growth medium. Cells were exposed to Thapsigargin (Tg) and Tunicamycin (Tu) overnight. Cell viability was determined by Trypan Blue staining of 200 cells. B: Western blot of ABC50 expression in sp2 cells selected for resistance to Ec showing increased expression. C: Quantitation of expression normalized to actin. **p<0.01, ***p<0.001 comparing selected vs unselected.

DETAILED DESCRIPTION OF THE DISCLOSURE

I. Definitions

[0052] The term "ABC50" also known as ABCF1 refers to a member of the ATP Binding Cassette (ABC) family of proteins which lacks a transmembrane domain and includes for example human ABC50 with accession number AF027302 (SEQ ID NO:1)¹, mouse ABC50 (e.g. SEQ ID NO:5), rat ABC50 with accession number AF293383 (SEQ ID NO:2) (see for example, http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&Term ToSearch=85493&ordinalpos=3&itool=EntrezSystem2.PEntrez.Gene.Gene_Res ultsPanel.Gene_RVDocSum), as well as yeast homologs yeast elongation factor 3 (YEF3 Accession number NC_--001144 geneID:850951) and GCN20 (Accession number NC_--001138, geneID:850561). Other homologs are also contemplated including other mammalian homologs, including but not limited to mouse (SEQ ID NO:5; Accession number NM_--013854), hamster, including Chinese hamster ABC50 and insect homologs. Species homologs can be identified for example using Blast basic local alignment search tool. In a preferred embodiment, the ABC50 is human ABC50.

[0053] The term "activity of an ABC50 protein" as used herein means a protein synthesis increasing activity of ABC50 protein (e.g. protein synthesis increasing activity) which may be mediated for example by increasing translation initiation complex formation between elF2, GTP and/or Met-tRNA and/or by binding to elF2.

[0054] The term "Econozole" or Ec refers to an antifungal agent of the imidazole class having IUPAC name 1-[2-[(4-chlorophenyl)methoxy]-2-(2,4-dichlorophenyl)ethyl]-1H-imidazole, formula C₁₈H₁₅Cl.sub.3N₂O and sold for example with brand names Spectazole® (US), Ecostatin® (Canada) and Pevaryl® (Western Europe), Endix-G® (Asia) Ecosone® (Thailand).

[0055] The term "antibody" as used herein is intended to include monoclonal antibodies, polyclonal antibodies, and chimeric antibodies as well as surface immunoglobulins. The antibody is optionally mammalian, murine, chimeric, humanized, primatized, primate, or human and can be a single chain antibody or multichain antibody. The antibody may be from recombinant sources and/or produced in transgenic animals.

[0056] The term "antibody fragment" as used herein is intended to include Fab, Fab', F(ab')₂, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof and bispecific antibody fragments. Antibodies can be fragmented using conventional techniques. For example, F(ab')₂ fragments can be generated by treating the antibody with pepsin. The resulting F(ab')₂ fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab')₂, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques.

[0057] The term "cell" as used in methods for expressing a protein of interest or increasing expression of a protein of interest refers to an eukaryotic cell, for example a yeast cell, fungi, plant cell or mammalian cell, and also includes a fused cell such as hybridoma cell.

[0058] The term "a cell" includes a single cell as well as a plurality or population of cells. Contacting a cell or administering a composition to a cell includes in vivo, ex vivo and in vitro contact.

[0059] The term "protein" as used herein refers to a molecule comprised of amino acid residues, including for example single chain polypeptides, as well as a single chain of a multichain protein, multichain proteins such as traditional antibodies, recombinant polypeptides including for example fusion proteins, tagged proteins, mutant proteins and fragments, typically active fragments, of full length proteins. Protein and polypeptide are herein used interchangeably.

[0060] The term "protein of interest" refers to a protein being produced or whose expression is sought to be produced, by a method or process described herein, and includes for example but is not limited to therapeutic proteins such as cytokines, growth factors such as insulin, coagulation factors, vaccine subunits and therapeutic enzymes, and antibodies or fragments thereof, including recombinant or natural proteins.

[0061] The term "antibody of interest" refers to an antibody or antibody fragment being produced or whose expression is sought to be produced, by a method or process disclosed herein. For example, the antibody of interest can be an antibody produced by a hybridoma whose expression is sought to be increased by ABC50 overexpression.

[0062] The term "isolated protein" refers to a protein substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.

[0063] A "conservative amino acid substitution" as used herein, is one in which one amino acid residue is replaced with another amino acid residue without abolishing the protein's desired properties.

[0064] The phrase "conservative substitution" also includes the use of a chemically derivatized residue in place of a non-derivatized residue provided that such polypeptide displays the requisite activity.

[0065] In the context of a polypeptide, the term "derivative" as used herein refers to a polypeptide having one or more residues chemically derivatized by reaction of a functional side group. Such derivatized molecules include for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Also included as derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For examples: 4-hydroxyproline may be substituted for proline; 5 hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.

[0066] The term "polynucleotide" or alternatively "nucleic acid molecule" as used herein refers to a linked series of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugars and intersugar (backbone) linkages, including for example cDNA, vectors and recombinant polynucleotides. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof, which function similarly. Such modified or substituted nucleic acid molecules may be preferred over naturally occurring forms because of properties such as enhanced cellular uptake, or increased stability in the presence of nucleases. The term also includes chimeric nucleic acid molecules that contain two or more chemically distinct regions. For example, chimeric nucleic acid molecules may contain at least one region of modified nucleotides that confer beneficial properties (e.g. increased nuclease resistance, increased uptake into cells), or two or more nucleic acid molecules described herein may be joined to form a chimeric nucleic acid molecule. The polynucleotides may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The sequences may also contain modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine and uracil; and xanthine and hypoxanthine. Also, the term "nucleic acid" can be either double stranded or single stranded, and represents the sense or antisense strand. Further, the term "nucleic acid" includes the complementary nucleic acid sequences.

[0067] The term "isolated polynucleotide" and/or alternatively "isolated nucleic acid molecule" as used herein refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized. An isolated polynucleotide is also substantially free of residues which naturally flank the nucleic acid (i.e. residues located at the 5' and 3' ends of the nucleic acid) from which the nucleic acid is derived.

[0068] The term "complementary" in reference to a nucleic acid as used herein refers to the property of a double stranded nucleic acid including DNA and RNA and DNA:RNA hybrids to base-pair according to the standard Watson-Crick complementary rules, e.g. the capacity to hybridize to a particular nucleic acid segment under stringent conditions and/or to a nucleic acid single stand that has this property e.g. is complementary to a specific nucleic acid or portion thereof.

[0069] By "stringent hybridization conditions" it is meant that conditions are selected which promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization may occur to all or a portion of a nucleic acid sequence molecule. The hybridizing portion is typically at least 15 (e.g. 20, 25, 30, 40 or 50) nucleotides in length. Those skilled in the art will recognize that the stability of a nucleic acid duplex, or hybrids, is determined by the Tm, which in sodium containing buffers is a function of the sodium ion concentration and temperature (Tm=81.5° C.-16.6 (Log 10 [Na+])+0.41(%(G+C)-600/I), or similar equation). Accordingly, the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature. In order to identify molecules that are similar, but not identical, to a known nucleic acid molecule a 1% mismatch may be assumed to result in about a 1° C. decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5° C. Based on these considerations those skilled in the art will be able to readily select appropriate hybridization conditions. In preferred embodiments, stringent hybridization conditions are selected. By way of example the following conditions may be employed to achieve stringent hybridization: hybridization at 5× sodium chloride/sodium citrate (SSC)/5×Denhardt's solution/1.0% SDS at Tm--5° C. based on the above equation, followed by a wash of 0.2×SSC/0.1% SDS at 60° C. Moderately stringent hybridization conditions include a washing step in 3×SSC at 42° C. It is understood, however, that equivalent stringencies may be achieved using alternative buffers, salts and temperatures. Additional guidance regarding hybridization conditions may be found in: Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 2002, and in: Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001.

[0070] The term "control cell" as used herein refers a cell that does not have increased expression of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0071] The term "fragment thereof having protein synthesis increasing activity" in reference to ABC50 refers to a portion of ABC50 that retains the ability to increase protein synthesis for example, by at least 5%, at least 10% or more, for example by stimulating translation initiation complex formation between eIF2, GTP and/or Met-tRNA and/or binding to eIF2.

[0072] The term "fragment thereof having eIF2 binding activity" in relation to ABC50 refers to an active fragment of ABC50 that binds ABC50 and retains the ability to increase protein synthesis.

[0073] The terms "transformed with", "transfected with", "transformation" "transduced" and "transfection" are intended to encompass introduction of nucleic acid (e.g. a vector) into a cell by a variety of techniques known in the art. The term "transformed cell" as used herein is intended to also include cells capable of glycosylation that have been transformed with a recombinant expression vector disclosed herein.

[0074] The term "antisense agent" as used herein means a nucleotide polynucleotide that comprises a sequence of residues that is complementary to and binds a target RNA and decreases translation of its target RNA. For example, "antisense agents" include antisense oligonucleotides, as well as small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs). The nucleic acid can comprise DNA, RNA or a chemical analog, that binds to the messenger RNA produced by the target gene. Binding of the antisense agent presents translation and thereby inhibits or reduces target protein expression.

[0075] The term "siRNA" refers to a short inhibitory RNA duplex that can be used to silence gene expression of a specific gene by RNA interference (RNAi). A person skilled in the art will understand that RNAi technology uses paired oligonucleotides. Wherein a single strand sequence is identified by SEQ ID NO, a person skilled in the art using the rules of base pairing will readily determine the appropriate corresponding oligonucleotide.

[0076] The term "shRNA" refers to a short hairpin RNA. Typically shRNAs are approximately about 50, 60 or 70 nucleotides long, or any number in between, for example 54 nucleotides long and can give to miRNAs. The term "miRNA" refers to microRNAs which are single stranded RNAs, for example 22 nucleotides, that are processed from hairpin RNA precursors, for example about 50, 60 or 70 nucleotides long. miRNAs can inhibit gene expression through targeting homologous mRNAs. siRNAs and shRNAs activate a cellular degradation pathway directed at mRNAs corresponding to the siRNA or shRNA. Methods of designing specific siRNA and shRNA molecules and administering them are described herein and known to a person skilled in the art. For example siRNAs can comprise two 21-23 nucleotide strands forming a double stranded RNA molecule, wherein one strand is complementary to a target region in a gene of interest (e.g. comprises a sense strand homologous to the target mRNA). It is known in the art that efficient silencing is obtained with siRNA duplex complexes paired to have a two nucleotide 3' overhang. Adding two thymidine nucleotides is thought to add nuclease resistance. A person skilled in the art will recognize that other nucleotides can also be added.

[0077] The term "subject", as used herein includes all members of the animal kingdom, especially mammals, including human. The subject or patient is suitably a human.

II. Methods

[0078] ABC50 is a member of the ATP binding cassette protein family. Biochemically, ABC50 stimulates the formation of translation initiation complexes between eIF2, GTP and Met-tRNA implicating it in translation initiation and control for both Cap-dependent and -independent translation. Econazole (Ec) is an imidazole anti-fungal that induces endoplasmic reticulum (ER) stress in mammalian cells by promoting ER Ca²+ depletion and sustained inhibition of protein synthesis. A previous characterization of HL60 cells selected for resistance to Ec found that the cells exhibited a phenotype of multi-drug resistance associated specifically with ER stress inducers. Differential Display Analysis of these cells identified ABC50 as a gene overexpressed in resistant cells. A similar selection process applied to sp2 cells also resulted in ER stress resistance and ABC50 overexpression. Knockdown of ABC50 in HL60 cells increased sensitivity to Ec in both parental HL60 and an Ec-resistant variant. ABC50 also altered sensitivity to the ER stress agents thapsigargin and tunicamycin. ABC50 knockdown increased ER Ca²+ stores and thapsigargin-stimulated influx. Knockdown significantly suppressed protein synthesis levels while overexpression increased them. ABC50 overexpression also increased antibody production in the hybridoma GK1.5 indicating that ABC50 overexpression is useful for the overproduction of specific proteins. Taken together, these results indicate that ABC50 modulates sensitivity to Ec and other ER stress agents primarily through its effects on protein synthesis.

[0079] Accordingly, an aspect of the disclosure provides a method of producing a protein of interest comprising effecting expression of the protein of interest in a cell comprising an increased expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity.

[0080] In an embodiment, the method comprises increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity in a cell; and effecting the expression of the protein of interest.

[0081] In another embodiment, the method comprises effecting expression of the protein of interest in a cell comprising an increased expression or activity of an ABC50 protein or a fragment thereof having eIF2 binding activity.

[0082] In yet another embodiment, the method comprises increasing the expression or activity of an ABC50 protein or a fragment thereof having eiF2 binding activity; and effecting the expression of the protein of interest.

[0083] In an embodiment, the protein of interest is a heterologous protein.

[0084] Accordingly, in an embodiment, the method comprises producing a heterologous protein of interest comprises effecting expression of the protein of interest in a cell comprising an increased expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0085] In another embodiment, the method comprises producing a heterologous protein of interest comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity; and effecting the expression of the protein of interest.

[0086] In an embodiment, the protein of interest is produced by a cell.

[0087] In an embodiment, the protein of interest is an antibody or antibody fragment.

[0088] Accordingly, another aspect includes a method of producing an antibody (e.g. an antibody of interest) or fragment thereof by a cell capable of expressing an antibody or fragment thereof comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity in the cell.

[0089] In an embodiment, the method comprises effecting expression of the antibody or fragment thereof in a cell comprising an increased expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0090] In an embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased by expressing a heterologous ABC50 polynucleotide encoding an ABC50 protein or a fragment thereof wherein the ABC50 polynucleotide is operatively linked to a promoter.

[0091] Effecting expression can for example be accomplished by culturing a cell under conditions suitable for protein expression, including for example culturing the cell at a growth permissive temperature, in a suitable culture medium, a sufficient time etc. that depend for example on the cell and desired expression level.

[0092] Another aspect relates to a method of increasing expression of a heterologous protein of interest by a cell expressing the protein of interest, comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity, wherein the increased expression or activity of the ABC50 protein or fragment increases the expression of the heterologous protein. In an embodiment, the method comprises introducing a polynucleotide encoding the heterologous protein and/or introducing a polynucleotide encoding the ABC50 protein or fragment into the cell, for example by transfection, transduction or infection.

[0093] In an embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased and the expression of the protein of interest is effected by introducing a polynucleotide encoding the ABC50 protein or a fragment thereof, and a polynucleotide encoding the protein of interest, wherein the polynucleotides are operatively linked to one or more promoters and optionally comprised in one or more vectors.

[0094] A further aspect relates to a method of increasing expression of an antibody or fragment thereof in a cell expressing or capable of expressing the antibody or fragment of interest, comprising increasing the expression or activity of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0095] Cells capable of producing antibodies and/or fragments thereof may be prepared using techniques known in the art such as those described by Kohler and Milstein, Nature 256, 495 (1975) and in U.S. Pat. Nos. RE 32,011; 4,902,614; 4,543,439; and 4,411,993, which are incorporated herein by reference. (See also Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), 1980, and Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988, which are also incorporated herein by reference). Within the context of the disclosure, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, and F(ab')₂) and recombinantly produced binding partners.

[0096] For producing monoclonal antibodies the technique involves hyperimmunization of an appropriate donor with the immunogen, generally a mouse, and isolation of splenic antibody producing cells. These cells are fused to a cell, having immortality, such as a myeloma cell, to provide a fused cell hybrid which has immortality and secretes the required antibody. The cells are then cultured, in bulk, and the monoclonal antibodies harvested from the culture media for use.

[0097] For producing recombinant antibodies (see generally Huston et al., 1991; Johnson and Bird, 1991; Mernaugh and Mernaugh, 1995), messenger RNAs from antibody producing B-lymphocytes of animals, or hybridoma are reverse-transcribed to obtain complimentary DNAs (CDNAs). Antibody cDNA, which can be full or partial length, is amplified and cloned into a phage or a plasmid. The cDNA can be a partial length of heavy and light chain cDNA, separated or connected by a linker. The antibody, or antibody fragment, is expressed using a suitable expression system to obtain recombinant antibody. Antibody cDNA can also be obtained by screening pertinent expression libraries.

[0098] As disclosed herein, ABC50 expression and/or activity can be increased by selecting for Econozlole resistant cells. Accordingly, in another embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased by contacting the cell with increasing concentrations of Econozole (Ec), and detecting increased expression or activity of ABC50 protein. For example, Ec resistance can be induced by contacting the cell with a sufficient concentration of Econozole (Ec) to increase expression or activity of an ABC50 protein and selecting cells that maintain increased ABC50 expression and/or activity.

[0099] ABC50 expression and/or activity can be increased by introducing a heterologous ABC50 polynucleotide into a cell that is expressed. Accordingly in another embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased by introducing a heterologous ABC50 polynucleotide encoding ABC50 protein or a fragment thereof operatively linked to a promoter, into the cell.

[0100] In another embodiment, the cell already comprises a heterologous polynucleotide encoding the protein of interest operatively linked to a promoter.

[0101] In a further embodiment, polynucleotides encoding ABC50 and the protein or interest are cointroduced into a cell. Accordingly, in an embodiment, the expression or activity of ABC50 protein or a fragment thereof is increased and the expression of the protein of interest is effected by introducing a vector comprising a polynucleotide encoding ABC50 protein or a fragment thereof, and a heterologous polynucleotide of the protein of interest, wherein the polynucleotides are operatively linked to one or more promoters. For example, expression of two polynucelotides can be achieved using an internal ribosomal entry site (IRES).

[0102] The polynucleotides may be incorporated in a known manner into an appropriate expression vector, which ensures good expression of the polypeptides. Various constructs can be used. For example retroviral constructs such as lentiviral constructs are useful for expressing physiological levels of protein. Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno-associated viruses), so long as the vector is compatible with the host cell used. The expression vectors are "suitable for transformation of a host cell", which means that the expression vectors contain a nucleic acid molecule and regulatory sequences selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid molecule. Operatively linked is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.

[0103] The disclosure therefore includes use of a recombinant expression vector containing a polynucleotide molecule disclosed herein, or a fragment thereof, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence.

[0104] Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes (For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)). Selection of appropriate regulatory sequences is dependent on the host cell chosen as discussed below, and may be readily accomplished by one of ordinary skill in the art. Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other sequences, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector.

[0105] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule disclosed herein. Examples of selectable marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, β-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG. Transcription of the selectable marker gene is monitored by changes in the concentration of the selectable marker protein such as β-galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. If the selectable marker gene encodes a protein conferring antibiotic resistance such as neomycin resistance transformant cells can be selected with G418. Cells that have incorporated the selectable marker gene will survive, while the other cells die. This makes it possible to visualize and assay for expression of the recombinant expression vectors disclosed herein and in particular to determine the effect of a mutation on expression and phenotype. It will be appreciated that selectable markers can be introduced on a separate vector from the nucleic acid of interest.

[0106] Other selectable markers include for example, dihydrofolate reductase (DHFR) and glutamine synthetase (GS) for examples for use in CHO of NS0 cells, respectively. Selection occurs in the absence of the metabolites e.g. glycine, hypoxanthine and thymidine for DHFR and glutamine for GS. Cells surviving selection comprise one or more copies of the transfected plasmid in the cell's genome. Further amplification of the copy number of the integrated DNA can be achieved by exposure of the selected cells to increasing levels of methotrexate (MTX) or methioninen sulphoximine (MSX) respectively⁸. The recombinant expression vectors may also contain genes which encode a fusion moiety which provides increased expression of the recombinant protein; increased solubility of the recombinant protein; and aid in the purification of the target recombinant protein by acting as a ligand in affinity purification. For example, a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMal (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the recombinant protein.

[0107] Transcription of the protein of interest and/or ABC50 can be under the control of an inducible expression system. Accordingly, in an embodiment, effecting the expression of the protein of interest and/or ABC50 comprises contacting the cell with an inducer that induces expression of the protein of interest and/or ABC50. Examples of inducible expression systems include the Tet-on or Tet-off inducible expression systems.

[0108] Recombinant expression vectors can be introduced into host cells to produce a recombinant cell by one of many possible techniques known in the art. For example, a polynucleotide can be introduced by transforming a cell (e.g. electroporating a prokaryotic cell), transfecting a cell (e.g. using lipofectin) or transducing a cell (e.g. using a retrovirus). Prokaryotic cells can be transformed with a polynucleotide by, for example, electroporation or calcium-chloride mediated transformation. For example, polynucleotide can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, 2001), and other laboratory textbooks.

[0109] In other embodiments, the cells are optionally transduced with retroviral constructs that drive expression of ABC50 and/or the protein or antibody of interest. Methods of transducing cells are well known in the art. Methods of transducing/infecting cells with lentiviral vectors are also described herein.

[0110] Different ABC50 proteins can be used with the methods disclosed herein. For example, human ABC50, rat ABC50 and/or yeast ABC50 homolog can be used. Also, the ABC50 protein employed is optionally, the same species as the cell in which it is expressed (e.g. human ABC50, and human cell). Alternatively, the ABC50 protein employed is from a different species from the cell (e.g. human ABC50, yeast cell). Nucleic acids encoding human ABC50 were utilized in transfection/transduction experiments described herein and mouse Sp2 cells were treated with Ec selection. Ec selection of mouse Sp2 resulted in increased ABC50 expression as described indicating that different ABC50 molecules (e.g. proteins and nucleic acids) are useful in the methods of the disclosure. Mus musculus sequence is for example 88% identical and 91% similar to human ABC50 according to a BLAST comparison.

[0111] In an embodiment, the ABC50 protein comprises SEQ ID NO: 1, 2 or 5; or a protein with at least 85%, 88%, 90%, 95%, 99% or 99.5% sequence identity with SEQ ID NO:1, 2 or 5.

[0112] In an embodiment, the ABC50 polynucleotide comprises SEQ ID NO:6, 7 or 8; or a polynucleotide with at least 85%, 88%, 90%, 95%, 99% or 99.5% sequence identity with SEQ ID NO:6, 7 or 8.

[0113] In an embodiment, the method results in increased specific cellular expression and/or production of the protein of interest in comparison to a control cell expressing the protein of interest wherein the control cell does not have increased expression (e.g. has wildtype levels) of an ABC50 protein or a fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity.

[0114] In an embodiment, the method results in increased specific cellular expression and/or production of the antibody of interest in comparison to a control cell expressing the antibody of interest wherein the control cell does not have increased expression of an ABC50 protein or a fragment thereof having protein synthesis inducing activity and/or eIF2 binding activity.

[0115] In an embodiment, the increase in expression and/or production of the protein or antibody of interest is about 5% to about 10%, about 11% to about 20%, about 31% to about 40%, about 41% to about 50%, 51% to about 60%, 61% to about 70%, 71% to about 80%, about 81% to about 90%, about 91% to about 100%, about 150% to about 199%, about 200% to about 299%, about 300% to about 499%, or about 500% to about 1000%. In an embodiment, the increase is at least 5%. In another embodiment, the increase is at least 10%.

[0116] The level of ABC50 protein and/or fragment expression and/or activity is increased for example by an amount sufficient to increase expression of the protein of interest. The increase in ABC50 protein or active fragment thereof expression or activity is in an embodiment, about 5% to about 10%, about 11% to about 20%, about 31% to about 40%, about 41% to about 50%, 51% to about 60%, 61% to about 70%, 71% to about 80%, about 81% to about 90%, about 91% to about 100%, about 150% to about 199%, about 200% to about 299%, about 300% to about 499%, or about 500% to about 1000%. In an embodiment, the increase in ABC50 protein or active fragment thereof expression or activity is at least 10%, at least 20%, at least 30% at least 40%, at least 50%, at least 60%, at least 65% or at least 70%.

[0117] Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the polynucloetides and constructs that encode proteins or antibodies of interest may be expressed in bacterial cells such as E. coli. Other suitable host cells can be found in Goeddel (Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. 1990).

[0118] More particularly, bacterial host cells suitable for carrying out the present disclosure include E. coli, B. subtilis, Salmonella typhimurium, and various species within the genus Pseudomonas, Streptomyces, and Staphylococcus, as well as many other bacterial species well known to one of ordinary skill in the art. Suitable bacterial vectors preferably comprise a promoter which functions in the host cell, one or more selectable phenotypic markers, and a bacterial origin of replication. Representative promoters include the β-lactamase (penicillinase) and lactose promoter system (see Chang et al. Chang et al., Nature 275:615 (1978)), the trp promoter (Nichols and Yanofsky, Meth. in Enzymology 101:155, 1983) and the tac promoter (Russell et al., Gene 20: 231, 1982). Representative selectable markers include various antibiotic resistance markers such as the kanamycin or ampicillin resistance genes. Suitable expression vectors include but are not limited to bacteriophages such as lambda derivatives or plasmids such as pBR322 (see Bolivar et al. (Bolivar et al., Gene 2:9S, 1977)), the pUC plasmids pUC18, pUC19, pUC118, pUC119 (see Messing (Messing, Meth in Enzymology 101:20-77, 1983) and Vieira and Messing (Vieira and Messing, Gene 19:259-268 (1982)), and pNH8A, pNH16a, pNH18a, and Bluescript M13 (Stratagene, La Jolla, Calif.). Typical fusion expression vectors which may be used are discussed above, e.g. pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.). Examples of inducible non-fusion expression vectors include pTrc (Amann et al., Gene 69:301-315 (1988)) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif., 60-89 (1990)).

[0119] The protein of interest can be expressed in any eukaryotic cell, including but not limited to insect cells (using baculovirus), yeast cells or mammalian cells. Yeast and fungi host cells suitable for use include, but are not limited to Saccharomyces cerevisiae, Schizosaccharomyces pombe, the genera Pichia or Kluyveromyces and various species of the genus Aspergillus. Examples of vectors for expression in yeast S. cerivisiae include pYepSec1 (Baldari et al., Embo J. 6:229-234 (1987)), pMFa (Kurjan and Herskowitz, Cell 30:933-943 (1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.). Protocols for the transformation of yeast and fungi are well known to those of ordinary skill in the art (see Hinnen et al. (Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929 (1978)); Itoh et al. (Itoh et al., J. Bacteriology 153:163 (1983)), and Cullen et al. (Cullen et al. Bio/Technology 5:369 (1987)).

[0120] Mammalian cells suitable for use include, among others:HL60, COS (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g. ATCC No. CRL 6281), CHO (ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2), 293 (ATCC No. 1573) and NS-1 cells. Suitable expression vectors for directing expression in mammalian cells generally include a promoter (e.g., derived from viral material such as polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40), as well as other transcriptional and translational control sequences. Examples of mammalian expression vectors include pCDM8 (36) and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)).

[0121] Given the teachings provided herein, promoters, terminators, and methods for introducing expression vectors of an appropriate type into plant, avian, and insect cells may also be readily accomplished. For example, within one embodiment, the polypeptides disclosed herein may be expressed from plant cells (see Sinkar et al., J. Biosci (Bangalore) 11:47-58 (1987), which reviews the use of Agrobacterium rhizogenes vectors; see also Zambryski et al., Genetic Engineering, Principles and Methods, Hollaender and Setlow (eds.), Vol. VI, pp. 253-278, Plenum Press, New York (1984), which describes the use of expression vectors for plant cells, including, among others, PAPS2022, PAPS2023, and PAPS2034).

[0122] Suitable insect cells include cells and cell lines from Bombyx, Trichoplusia or Spodotera species. Baculovirus vectors available for expression of proteins in cultured insect cells (SF 9 cells) include the pAc series (Smith et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Luckow, V. A., and Summers, M. D., Virology 170:31-39 (1989).

[0123] Alternatively, proteins and antibodies of interest may also be expressed in non-human transgenic animals such as rats, rabbits, sheep and pigs (Hammer et al. Nature 315:680-683 (1985); Palmiter et al. Science 222:809-814 (1983); Brinster et al. Proc. Natl. Acad. Sci. USA 82:4438-4442 (1985); Palmiter and Brinster Cell 41:343-345 (1985) and U.S. Pat. No. 4,736,866).

[0124] Accordingly, in an embodiment protein of interest is expressed by a eukaryotic cell. In an embodiment, the eukaryotic cell is selected from a yeast, plant, worm, insect, avian, fish, reptile and mammalian cell. In an embodiment, the cell is a mammalian cell. In another embodiment, the mammalian cell is a myeloma cell, a spleen cell, or a hybridoma cell producing a specific antibody. In a further embodiment, the cell is a Sp2, a NS0, a CHO, a Per.c6, a L cell. In a further embodiment, the mammalian cell is a leukemia cell, such as HL-60. In the case of increasing expression of an antibody or fragment thereof, the ABC50 protein or activity level can be increased in one or both the hybridoma fusion partners and/or in the fused hybridoma cell. In another embodiment, the hybridoma cell is GK1.5. In a further embodiment, the cell is an Ec resistant cell. In another embodiment, the cell is an Ec resistant Sp2 cell, NS0, CHO, Per.c6, or L cell. In an embodiment, the cell is a suspension culture adapted CHO cell. In a further embodiment, the Ec resistant Sp2 cell is fused to an antibody producing spleen cell. In an embodiment, the cell is not a HEK-293 cell.

[0125] A person skilled in the art will recognize that hybridomas expressing different monoclonal antibodies can be used and/or made using the methods of the disclosure.

[0126] In an embodiment, the protein of interest or antibody of interest is a secreted protein, an intracellular protein, or a membrane protein. In an embodiment, the protein of interest is a secreted protein.

[0127] Examples are provided for example in Hacker et al BioPharm International incorporated herein by reference⁸. In an embodiment, the protein of interest is an antibody or antibody fragment or derivative thereof. For example, yeast cells and plant cells have been engineered to produce recombinant proteins such as recombinant monoclonal antibodies (for example see Nature Protocols 1, 755-768 (2006); Hiatt A, Ma J, Lehner T and Mostov K. Method for producing imunoglobulins containing protection proteins in plants and their use 2004 U.S. Pat. No. 6,303,341; Hein M, Hiatt A and Ma J. Transgenic crops expressing assembled secretory antibodies 2006 U.S. Pat. No. 6,995,014; Ma J K, Lehner T, Stabila P, Fux C I and Hiatt A. Assembly of monoclonal antibodies with IgG1 and IgA heavy chain domains in transgenic tobacco plants. Eur J Immunol. 1994 January; 24(1):131-8; Ma J K, Hiatt A, Hein M, Vine N D, Wang F, Stabila P, van Dolleweerd C, Mostov K and Lehner T. Generation and assembly of secretory antibodies in plants. Science 1995, 268(5211), 716-9; Ma J K, Hikmat B Y, Wycoff K, Vine N D, Chargelegue D, Yu L, Hein M B and Lehner T. Characterization of a recombinant plant monoclonal secretory antibody and preventive immunotherapy in humans. Nat Med. 1998, 4(5), 601-6, each of which are herein incorporated by reference).

[0128] In an embodiment, the antibody is monoclonal, polyclonal, mammalian, murine, chimeric, humanized, primatized, primate, or human.

[0129] In an embodiment, the antibody is a fragment or derivative thereof selected from antibody immunoglobulin light chain, immunoglobulin heavy chain, immunoglobulin light and heavy chains, Fab, F(ab')2, Fc, Fc-Fc fusion proteins, Fv, single chain Fv, single domain Fv, tetravalent single chain Fv, disulfide-linked Fv, domain deleted, minibody, diabody, a fusion protein of one of the above fragments with another peptide or protein or Fc-peptide fusion.

[0130] The antibody is in an embodiment, an IgG, IgM, IgA, IgD or IgE antibody. In a preferred embodiment, the antibody is an IgG antibody. In a further embodiment, the antibody is IgG such as IgG1, IgG2, IgG3 or IgG4.

[0131] In another embodiment, the method further comprises isolating the protein of interest or the antibody of interest.

[0132] A variety of methods are known for isolating proteins and antibodies. The method of isolation chosen can be affected by whether the protein is secreted, membrane bound or intracellular. In an embodiment, wherein the protein or antibody of interest is secreted, for example into a culture medium, the method further comprising isolating the secreted protein or secreted antibody of interest, for example from the culture supernatant. For example, the culture supernatant is collected and optionally fractionated. In another embodiment, wherein the protein or antibody of interest is intracellular, the method further comprising pelleting and/or lysing the cell and isolating the intracellular protein or antibody of interest. In an embodiment, wherein the protein or antibody of interest is membrane or surface bound, the method further comprising solubilizing the cell membrane and isolating the membrane protein or surface antibody of interest. For example for antibodies, binding to antigen can be used to isolate antibodies. The most common method is protein A columns. Other methods of purification include ammonium sulphate precipitation, ion exchange, gel filtration and hydrophobic interaction columns.

[0133] The disclosure also provides a process comprising the methods or aspects described herein. Accordingly, another aspect provides a process for the production of a protein of interest comprising: culturing a cell under suitable culture conditions (e.g. temperature, ambient environment, culture medium, length of time etc), wherein the cell produces the protein or antibody of interest, increasing the expression or activity of a ABC50 protein or a fragment thereof having elF2 binding activity sufficiently to enhance protein production; culturing the cell until the protein of interest accumulates, and isolating the protein of interest. The protein of interest is an embodiment, a heterologous protein.

[0134] Another aspect provides a process for the production of a protein of interest comprising: culturing a cell, wherein the cell comprises an expression vector that encodes the protein of interest and an expression vector that encodes a ABC50 protein, under suitable culture conditions (e.g. temperature, ambient environment, culture medium etc) that permit expression of the protein of interest and the ABC50 protein; culturing the cell until the protein of interest accumulates and isolating the protein of interest.

[0135] As mentioned previously, in an embodiment protein of interest is an antibody or fragment thereof.

[0136] In an embodiment, the cell is a hybridoma cell and/or a hybridoma fusion partner.

[0137] It is also disclosed herein that decreasing ABC50 levels can be useful. Accordingly, another aspect provides a method of decreasing ABC50 levels in a cell comprising expressing an antisense agent that inhibits expression of ABC50 in the cell.

[0138] For example, decreasing ABC50 levels increases sensitivity to ER stress agents. Accordingly, another aspect provides a method of increasing sensitivity of a cell to ER stress agents comprising expressing an antisense agent that inhibits expression of ABC50 in the cell.

[0139] In an embodiment, the antisense agent is a siRNA, shRNA or an antisense oligonucleotide. In an embodiment, the antisense agent comprises SEQ ID NO:3. In another embodiment, the antisense agent comprises SEQ ID NO:4. The shRNA is in an embodiment, comprised in a lentiviral vector or virus.

[0140] In an embodiment, the shRNA comprises SEQ ID NO: 3 or 4.

[0141] In an embodiment, the decrease in ABC50 level is about 10% to about 20%, about 21% to about 30%, about 31% to about 40%, about 41% to about 50%, 51% to about 60%, 61% to about 70%, 71% to about 80%, 81% to about 90% or about 91% to about 100%.

[0142] In another embodiment, the ER stress agent is selected from EC, thapsigargin and tunicamycin.

III. Proteins and Expression Constructs

[0143] The disclosure also provides for isolated proteins produced using a method or process described herein. Accordingly, an aspect provides an isolated protein of interest produced according to the method or process described herein.

[0144] The isolated protein is in an embodiment, an antibody or antibody fragment.

[0145] The disclosure also provides in another embodiment, an expression vector comprising a polynucleotide encoding an ABC50 polynucleotide and optionally a polynucleotide comprising a protein of interest. Suitable vectors are described for example above and in the examples below.

[0146] In an embodiment, the vector comprises a polynucleotide encoding an ABC50 polynucleotide and optionally a polynucleotide encoding a protein of interest, wherein the polynucleotide(s) is/are operably linked to one or more promoters. In an embodiment, the vector is a retroviral vector, optionally a lentiviral vector.

IV. Cells

[0147] Another aspect provides a recombinant and/or isolated cell. In an embodiment, the recombinant cell comprises a vector described herein. In another embodiment, the recombinant cell comprises a heterologous ABC50 gene. In yet a further embodiment, the cell comprises an EC resistant cell comprising increased ABC50 expression or activity.

[0148] In and embodiment, the cell comprises a heterologous ABC50 polynucleotide operably linked to a promoter or an Ec resistant cell wherein the Ec resistant cell has increased ABC50 protein levels or activity compared to a non-Ec resistant control cell, wherein the cell is suitable and/or adapted for expression of a protein of interest. For example, a hybridoma fusion partner cell is such a suitable cell as a hybridoma fusion partner cell expressing the increased ABC50 is useful for fusing with any antibody cell to produce a hybridoma with increased antibody production compared to a hybridoma cell not comprising increased ABC50 expression. As another example, any eukaryotic cell that is transfectable, transduceable or infectable and that is useful for expressing proteins, for example in large amounts, is also a suitable cell.

[0149] In an embodiment, the EC resistant cell is an Ec resistant SP2 cell, CHO cell, NS0 cell, a Per.c6 or L cell.

[0150] Suitable host cells are described above. In an embodiment, the cell is selected from a yeast, plant, worm, insect, avian, fish, reptile, mammalian, hybridoma, a myeloma cell or a spleen cell.

[0151] A further aspect provides a system for increasing expression of a protein of interest, the system comprising a cell comprising increased expression or activity of ABC50. For example, the cell can be a frozen cell or a lyophilized cell. In an embodiment the system further comprises an expression vector in which can be introduced a polynucleotide encoding a protein of interest. In an embodiment, the ABC50 expression or activity increase results from introduction of a heterologous polynucleotide encoding ACB50. In another embodiment, the ABC50 expression or activity increase results from selection with Ec. In a further embodiment, the system comprises Ec such as in a form suitable for administration to a cell to maintain selective pressure, for example as a stock solution in DMSO for administering to cells at a concentration of for example 5, 10, 15, 20 or 25 microM.

V. Compositions

[0152] In another aspect, the isolated protein, vector or recombinant cell is comprised in a composition. In yet a further embodiment, the composition comprises a polynucleotide comprising SEQ ID NO:3. In another embodiment, the composition comprises a polynucleotide comprising SEQ ID NO:4. In a further embodiment, the composition comprises a carrier. In another embodiment, the carrier is a pharmaceutically acceptable carrier. In a further aspect, the composition is for decreasing the level of ABC50.

[0153] The following non-limiting examples are illustrative of the present disclosure:

EXAMPLES

Example 1

[0154] Recently, the inventor showed that transformation by the c-myc oncogene sensitizes cells to Ec by enhancing ROS generation at the mitochondria⁹ providing at least one mechanism by which cancer cells exhibit sensitivity to Ec.

[0155] Previously, the inventor generated and characterized variants of HL60 cells that were resistant to Ec¹⁰. Although selected for resistance to Ec, the cells also displayed resistance to other ER stress agents including thapsigargin, tunicamycin, DTT and cycloheximide, thus defining a novel phenotype of multi-drug resistance associated with ER stress. Resistance was found to be associated with increased store-operated Ca²+ influx capability and sustained protein synthesis after exposure to Ec. Microarray analysis of a resistant clone revealed increased expression of ribosomal protein genes. Biochemical analysis showed that this increased gene expression was associated with increased ribosomal content. Ribosome inactivating toxins partially reversed resistance to ER stress suggesting that the increased ribosomal content and function contributed to resistance.

[0156] To further identify genes associated with resistance and sensitivity to Ec, the inventor performed differential display analysis¹¹ comparing the Ec-resistant cell line E2R2 with parental HL60 cells. This analysis identified ABC50 as a gene overexpressed in Ec-resistant cells. ABC50 contributes to Ec-resistance.

Results

Differential Display of Ec-Resistant Vs Sensitive HL60 Cells.

[0157] In order to identify additional genes associated with Ec resistance, Differential Display analysis was performed¹¹ comparing Ec-resistant E2R2 cells with parental HL60 cells. This analysis identified approximately 200 gene fragments that appeared to be overexpressed in E2R2 cells compared to Wild Type. These gene fragments were cloned and Reverse Northern analysis was employed to confirm differential expression. 50 of the 200 genes had expression levels above the detection limit of the Reverse Northern. Of the 50, 15 genes were confirmed to be differentially expressed. Sequence analysis identified these genes as follows: Two of the 15 encoded ribosomal protein genes, three encoded Alu-containing sequences, two were mitochondrial genes and one gene encoded the integrin CD11a. Two genes were identified that are classified as TNFα inducible. These were HLA gene (Bw-62), and ABC50 (NM_--001090; aka ABCF1), a member of the ATP binding cassette family (FIG. 1A). Two additional genes of unknown function with no known homology or similarity to any other gene (AC114546, AC012358) were identified. One codes for hypothetical protein FLJ12363 (XP_--043979) with no known function. The final gene identified in this screen was polyubiquitin C (AB009010). The protein and nucleic acid sequence of the aformentioned genes referred to by accession number, are herein specifically incorporated by reference.

ABC50 Protein Levels in E2R2 Cells.

[0158] ABC50 was investigated. It was first confirmed that ABC50 was overexpressed in E2R2 cells. As shown in FIG. 1B, increased levels of ABC50 protein were detected in E2R2 cells compared to HL60 cells. Densitometric analysis of Western blots indicated a 65% increased expression (relative to actin) of ABC50 in E2R2 compared to HL60 cells.

ABC50 Knockdown (KD) in E2R2 Cells.

[0159] The association of ABC50 with the Ec-resistance phenotype of E2R2 cells was further investigated by knocking down its expression in these cells. The cells were infected with a lentiviral vector expressing shRNA specific for ABC50 and sorted based on GFP expression. As shown in FIG. 2A, ABC50 knockdown was successful in these cells (36% relative decrease compared to vector control). Furthermore, as shown in FIG. 2B, ABC50 knockdown in E2R2 cells partially reversed their resistance to Ec (21.4% combined early and late apoptosis compared to 7.6% combined early and late apoptosis in the control cells), consistent with a role for ABC50 in the Ec resistance phenotype.

ABC50 Knockdown in HL60 Cells Increases Sensitivity to ER Stress Agents.

[0160] To investigate further the consequences of manipulating ABC50 levels in cells, parental HL60 cells were infected with the lentiviral vector expressing shRNA specific for ABC50 and sorted infected cells based on GFP expression. As shown in FIG. 3A, the shRNA knocked down expression of ABC50 by 89% compared to vector control. Light microscopic observation revealed that the cells had no obvious morphological differences. It was also found that the knocked-down cells grew at a rate that was not significantly different from the control cells (FIG. 3B).

[0161] The effect of ABC50 knockdown on sensitivity to Ec and other apoptosis-inducing agents was next investigated. Tg is a classic inducer of ER stress and HL60 cells selected for resistance to Ec were also found to be resistant to Tg. Sensitivity to Tunicamycin (Tu), an inhibitor of protein glycosylation and another classic inducer of ER stress was also tested. As shown in FIG. 3C, ABC50 knockdown significantly increased the sensitivity of HL60 cells to Ec, Tg and Tu. In contrast, ABC50 KD did not affect sensitivity to serum withdrawal or the topoisomerase inhibitor etoposide. This observation suggests that ABC50 knockdown specifically increases sensitivity to ER stress-inducing agents.

ABC50 Overexpression in HL60 Cells Decreases Sensitivity to ER Stress Agents.

[0162] The observation of increased ABC50 expression in the Ec-resistant E2R2 cells suggested that overexpression of the gene might promote resistance. To investigate this possibility, HL60 cells were infected with a lentiviral vector expressing the full ABC50 coding sequence, infected cells were sorted as above using the GFP marker, and the cell phenotype was analysed. As shown in FIG. 4A, infection with the ABC50 lentiviral vector significantly increased expression of the protein (42% relative increase compared to vector control). Cell growth properties were measured and it was found that the ABC50 overexpressing cells had no significant differences in growth kinetics compared to control HL60 cells infected with vector alone (FIG. 4B). However as shown in FIG. 4C, ABC50 overexpressing cells displayed decreased sensitivity to the ER stress agents Ec, Tg and Tu whereas their sensitivity to serum withdrawal or etoposide was unchanged compared to control cells. Taken together, these results demonstrate that ABC50 expression levels specifically affect sensitivity to ER stress.

ER Ca²+ Content and Influx in ABC50 Knockdown and Overexpressing Cells.

[0163] It was previously demonstrated that the Ec resistance phenotype of E2R2 cells was associated with altered Ca²+ physiology. Specifically, E2R2 cells displayed unchanged ER Ca²+ store content, but increased Ca²+ influx in response to ER Ca²+ store depletion by the ATPase ER Ca²+ pump inhibitor thapsigargin¹⁰. To investigate the effect of altered ABC50 expression on Ca²+ physiology, ER Ca²+ content and influx was measured in ABC50 knockdown and overexpressing cells. As shown in FIG. 5, no differences in either ER Ca²+ content (FIG. 5B, D) or Tg-stimulated Ca²+ influx (FIG. 5A, C) were observed in ABC50 KD or overexpressing cells. These observations indicate that ABC50 does not directly affect Ca²+ physiology in HL60 cells.

ER Stress Response in ABC50 Knockdown or Overexpressing Cells.

[0164] Ec, Tg and Tu are all potent inducers of ER stress. To compare the ER stress response of cells with altered ABC50 expression, cells were treated for 60 minutes with the ER stress agents and levels of phosphorylated eIF2α and the chaperone BiP, two classic indicators of ER stress, were determined by Western blot. As shown in FIG. 6A, increased levels of phosphorylated eIF2α were observed in treated ABC50 knockdown cells compared to vector control. Ec and Tg were particularly effective at inducing increased levels of eIF2α. Induction of BiP expression by ER stress agents was not affected by ABC50 knockdown (FIG. 6B) although basal levels were slightly increased compared to control. In contrast, ABC50 overexpressing cells displayed reduced levels of phosphorylated eIF2α when exposed to Ec, Tg and Tu (FIG. 6C). BiP expression was little changed in response to the ER stress agents compared to control (FIG. 6D) with no observed difference in background expression. Taken together, the divergence of response between eIF2α phosphorylation and BiP induction suggests that the effect of ABC50 is specific for the eIF2α response.

Ribosomal Content and Protein Synthesis in ABC50 Knockdown or Overexpressing Cells.

[0165] Two major biochemical differences observed previously in Ec-resistant cells were increased ribosomal content and sustained protein synthesis in response to Ec¹⁰. As shown in FIGS. 7A and B, a trend was observed toward decreased ribosomal RNA and Protein in ABC50 knockdown cells and increased levels in ABC50 overexpressing cells. To test the effect of altered ABC50 expression on protein synthesis, ABC50 knock-down or overexpressing cells were exposed to Ec and global protein synthesis rates were measured. As shown in FIG. 8A, exposure of control cells to Ec resulted in a significant decrease in protein synthesis levels. Interestingly, ABC50 knock down cells displayed a lower base rate of protein synthesis compared to control. Addition of Ec reduced protein synthesis rates even further. In contrast, ABC50 overexpressing cells displayed a slightly higher level of protein synthesis compared to control cells and this level was significantly less reduced after exposure to Ec (FIG. 8B). Taken together, these observations indicate that altered ABC50 expression affects ribosomal content, basal protein synthesis and modifies the cellular response to Ec on protein synthesis.

Enhanced IgG Production in ABC50 Overexpressing Hybridoma Cells.

[0166] The observation that ABC50 expression influenced global protein synthesis levels suggested that it might also affect expression of individual proteins. This property might be of utility in enhancing production of useful proteins, particularly in cells expressing high amounts of specific proteins such as hybridomas. To test this possibility, hybridoma cell line GK1.5 was infected with the ABC50-expressing lentivirus, infected cells were sorted using GFP expression as a marker of infection (FIG. 9A) and antibody production was measured by Western blotting and ELISA. As shown in FIG. 9B, GK1.5 cells infected with the ABC50 expressing virus produced significantly more antibody heavy and light chains compared to vector control. ELISA analysis of antibody concentrations secreted into the supernatant indicated that antibody production was 44% higher at 48 h in ABC50 overexpressing cells compared to control cultures. (FIG. 9C). This result suggests that ABC50 is useful in boosting protein expression of specific gene products like antibody heavy and light chains.

Selection for Ec Resistance in Sp2 Cells Results in Multidrug Resistance and Increased ABC50 Expression.

[0167] Sp2 cells are commonly used as fusion partners for creating hybridomas. The ability to generate sp2 cells that are generally resistant to ER stress and overexpress ABC50 would therefore be of use in the process of hybridoma generation. To this end, sp2 cells were exposed to increasing concentrations of Ec as described above for HL60 cells. Their sensitivity to ER stress agents was then characterized. As shown in FIG. 10a, Ec-resistant sp2 cells were also found to be relatively resistant to the other ER stress agents Tg and Tu. Furthermore, expression analysis (FIGS. 10B,C) indicates that ABC50 is also overexpressed in these cells. These observations therefore indicate that Ec selection is useful for selecting ER stress resistant and ABC50 overexpressing cells.

Discussion

[0168] Ec induces ER stress and cell death through the sustained depletion of ER Ca²+ stores. This is caused by blocking Ca²+ influx at the plasma membrane and stimulating ER Ca²+ release through ROS generation at the mitochondria. One consequence of this Ca²+ depletion effect is profound inhibition of protein synthesis. The generation and characterization of Ec-resistant mutants further supported the importance of Ca²+ depletion and protein synthesis inhibition by demonstrating increased influx and increased ribosomal content and function in resistant cells. A role for the protein ABC50 in Ec resistance is disclosed. ABC50 is herein identified as an overexpressed gene in Ec-resistant E2R2 cells. Western blot analysis demonstrated that protein levels were increased by 65% compared to WT cells. Sp2 cells similarly selected for Ec resistance were also observed to be multi-drug resistant and to overexpress ABC50. Knockdown of ABC50 in both HL60 and E2R2 cells increased sensitivity to Ec indicating that ABC50 contributes to resistance. ABC50 was also found to modulate sensitivity to Tg and Tu, other ER stress agents but not serum withdrawal or etoposide. ABC50 knockdown had no effect on ER Ca²+ content and influx, but reduced ribosomal content and protein synthesis in knock-down cells and increased ribosomal content and protein synthesis in HL60 cells overexpressing the protein. Taken together, these results indicate that ABC50 affects sensitivity to Ec and other ER stress agents, likely through its effects on protein synthesis.

[0169] It is of interest to contrast the effect of ABC50 knock-down with ABC50 overexpression. While the knock-down significantly increased ER stress indicators eIF2α and BiP, decreased protein synthesis and increased sensitivity to Ec, overexpression only slightly relieved ER stress indicators and increased protein synthesis and had only a modest effect on Ec sensitivity. The observation of effects on protein synthesis through ABC50 overexpression differs from the recent work of Paytubi et al. who observed a lack of effect on protein synthesis after overexpressing ABC50 in HEK293 cells³. Without wishing to be bound by theory, these observations indicate that a reduction in its protein level may make ABC50 rate-limiting for protein synthesis while the modest effect from overexpression indicates that ABC50 is not normally rate-limiting. As well, while ABC50 overexpression did partially prevent full inhibition of protein synthesis by Ec, this effect was insufficient to provide significant protection from Ec-induced apoptosis. This observation may indicate that full resistance to Ec requires both altered Ca²+ influx as well as increased protein synthesis.

[0170] Manipulating ABC50 expression levels was shown to also alter sensitivity to the classic ER stress inducers Tg and Tu. Tg, like Ec, depletes the ER of Ca²+. However unlike Ec, which blocks Ca²+ influx, ER depletion by Tg overstimulates influx resulting in very high cytoplasmic Ca²+ levels (FIGS. 5A,C). This Ca²+ overload response likely contributes significantly to Tg-induced apoptosis, as documented previously in mast cells⁴. Therefore the partial effect of ABC50 knockdown on Tg sensitivity may reflect the relative importance of Ca²+ overload compared to ER stress in Tg toxicity. Tu is a glycosylation inhibitor and induces ER stress through the Unfolded Protein Stress Response^12,13. Since one consequence of ER stress induction is suppression of protein synthesis, it is possible that ABC50 knockdown promotes Tu toxicity through a combined effect on protein synthesis. Nevertheless, the fact that ABC50 overexpression partially protects cells from Ec, Tg and Tu indicates that its overexpression contributed to the multi-drug resistance phenotype of E2R2 cells.

[0171] As shown in FIG. 6, increased phosphorylation of eIF2α was observed in response to ER stress when ABC50 was knocked down, and decreased levels when ABC50 was overexpressed. Tyzack et al.² previously commented that they did not observe any effect of ABC50 on eIF2α phosphorylation by RNA PK in vitro. Without wishing to be bound to therory, the observation that eIF2 phosphorylation is modulated by ABC50 may reflect the unique environment of ER stressed cells. Alternatively, the effects of ABC50 on eIF2a phosphorylation may be an indirect effect associated with altered cellular stress due to insufficient (or excess) ABC50. The fact that BiP induction is little changed when ABC50 expression is altered argues against a general effect on ER stress.

[0172] Ribosomal biogenesis is tightly regulated during growth through the mTOR pathway^14,15. Cellular stress can also influence ribosome biogenesis through both mTOR and JNK-mediated phosphorylation of the TIF-IA transcription factor¹⁶, resulting in inhibition of rDNA transcription. The observation of reduced and increased ribosomal content in ABC50 KD or overexpressing cells respectively is unlikely to reflect growth conditions, since growth rate in both cases appeared to be similar to WT. It is possible that altered ribosomal content reflects differences in basal stress levels, as indicated by increased BiP and phospho-eIF2α levels in ABC50KD cells.

[0173] Although modest, the increased level of protein synthesis due to ABC50 overexpression translated into a significant increase in antibody production by the hybridoma GK1.5. Therefore, increasing ABC50 expression is useful for boosting expression of specific proteins of interest such as antibody heavy and light chains. Interestingly, Ota et al.¹⁷ recently identified a genetic linkage between the ABC50 gene locus and increased susceptibility to auoimmune pancreatitis. Since the phenotype of these patients includes increased serum titers of IgG₄, it is possible that ABC50 polymorphisms may contribute to this disease by enhancing antibody production.

[0174] ABC50 contributes significantly to Ec resistance. Its mechanism of action appears to be primarily through its modulation of protein synthesis.

Materials and Methods

Cells and Cell Culture

[0175] Human HL60 promyelocytic leukemia cells, their E2R2 derivative and GK1.5 hybridoma cells¹⁸ were cultured in RPMI 1640 medium supplemented with 10% FBS and antibiotics.

Growth Curves

[0176] Cells were grown in duplicate cultures at the initial concentration of 0.4×10⁶ in RPMI containing 10% FCS. Cells were collected and counted at the 24, 48 and 72 hour time intervals.

Apoptosis

[0177] To measure apoptosis induced by Econazole (Ec; Sigma-Aldrich, St. Louis, Mo.), cells were treated with Ec in RPMI containing 1% FBS for 2 hours at 37° C. then further incubated overnight in RPMI containing 10% FBS. Apoptosis induced by thapsigargin (Tg; Sigma-Aldrich) or Tunicamycin (Tu; Sigma-Aldrich) was determined after overnight incubation in RPMI containing 1% FBS. The cells were washed with PBS and stained with Annexin V-cy5 Apoptosis Detection kit (Biovision. Inc., Mountain View, Calif.)/PI and analysed by flow cytometry.

Differential Display

[0178] Differential Display¹¹ comparing mRNA from HL60 vs Ec-resistant E2R2 cells was performed using the Delta Differential Display Kit from Clontech. All procedures were performed according to the manufacturer's instructions and involved using pairwise combinations of 10 Arbitrary primers with 9 Oligo dT primers. Differentially expressed bands were excised from the gel, re-amplified, TA-cloned and sequenced.

Reverse Northern Analysis

[0179] 3 μg of plasmid DNA from each sample was boiled, rapidly placed on ice, then dotted through a dot blot manifold onto duplicate pre-soaked nylon membranes. The membranes were U.V. cross-linked, incubated in pre-hybridization solution (5×SSC, 5×Denhardt's solution, 50 mM PBS (pH 7.0), 0.2% SDS, 500 μg/ml salmon sperm DNA, 50% formamide). The membranes were hybridized in hybridization solution (5×SSC, 5×Denhardt's solution, 50% formamide) containing 6.5×10⁷ cpm of ³²PdCTP-labelled reverse-transcribed cDNA probe from either HL60 or E2R2 total RNA. The blots were hybridized overnight, washed in 2×SSC and then 2×SSC, 0.1% SDS until background radiation was reduced. The blots were exposed to x-ray film for visualization.

Construction of Lentivirus Vectors

[0180] The empty lentivirus vector pLEN (H1GFP), in which the H1 promoter drives expression of shRNA sequences was a gift from Dr. John Dick (University Health Network, Toronto, Canada). The sequences of the oligos used to knock down ABC50 expression were: 5'TAAGCTGTCATCTGGCTTAATAAGGATCCTTATTAAGCCAGATGA CAGCTTTTT3' (SEQ ID NO:3) and 5'CTAGAAAAAGCTGTCATCTGGCTTAATAAGGATCCTTATTAAGCCAGATGA CAGCTTAAT3' (SEQ ID NO:4). Each pair of oligos were mixed and annealed by incubating at 95° C. for 5 min and cooling slowly. The annealed mixture was ligated into pLEN vector that had been digested with Pacl and Xbal.

Construction of Lentivirus Over-Expressing ABC50

[0181] The ABC50 clone 7 (obtained from Dr. A. Beaulieu, University of Laval, Quebec, Canada, missing 4 nt from the 5' end) (GenBank Accession number: AF027302; gi: 2522533) was used as the template for cloning the ABC50 structural gene by PCR amplification. To add the 4 nt at the 5', two primers were used: Forward: 5'-AT CCCGGG ATGC CGA AGG CGC CCA AGC AGC AGC-3' (SEQ ID NO:9)(contains Xmal site); Reverse: 5'-AT CTCGAG TCAC TCT CGG GGC CGG CTG ACC-3' (SEQ ID NO:10) (contains Xhol site). The amplified ABC50 structural gene was first cloned into pCR4Blunt-TOPO vector (Invitrogen) then subcloned into the pCE lentivirus expression vector (Dr. John Dick, U H N, Toronto) that has been digested with Xmal and Xhol. The whole ABC50 gene was sequenced to confirm the lack of mutations.

Generation of the Infective Lentivirus

[0182] Lentivirus vectors harboring human ABC50 shRNA or the ABC50 structural gene were produced by transient transfection into 293T cells as previously described¹⁹. Briefly, the backbone plasmid vector construct (10 μg) was mixed with the accessory plasmids VSVG (3.5 μg), pRRE (6.5 μg) and pREV (2.5 μg) and transfected into 293T cells with the Calphos Mammalian Transfection Kit (Clontech, Mountain View, Calif.). The cell supernatant was replaced with 4 ml fresh Iscove MEM (10% FCS) at 24 hours and virus was harvested at 48 hours after the plasmid transfection.

Lentiviral Infection

[0183] A total of 0.1×10⁶ HL60 cells were infected with 2 ml lentivirus culture supernatant (˜2×10⁶ virus particles) in the presence of 8 μg/ml polybrene (Sigma-Aldrich, St. Louis, Mo.) for 4 days. Up to 94% of cells were positive for GFP expression. GFP positive cells were sorted by fluorecence activated cell sorting and grown in RPMI (10% FBS) for further analysis.

Western Blot

[0184] Cells were washed with PBS and lysed with Triple lysis buffer (50 mM Tris pH7.0, 150 mM NaCl, 0.1% SDS, 1% NP-40 and 0.5% DOC). Proteinase inhibitor (Boehringer) was added to 10 ml lysis buffer before use. Protein concentration was determined with the Pierce BCA kit. 20 μg of total protein was loaded onto 10% SDS-PAGE, transferred onto filters and blotted with rabbit anti-human ABC50 polyconal serum (kind gift from Dr. C. Proud, Vancouver, Canada). eIF2α and its phosphorylated form (Ser51) were detected with rabbit polyclonal antibodies from Cell Signalling (Danvers, Mass.). Mouse anti-BiP/GRP78 antibodies were obtained from BD Biosciences (San Jose, Calif.) Anti-actin (pan Ab-5, Clone ACTN05) (Labvision/Neomarker, Fremont, Calif.) was used as a loading control.

Ca²+ Measurement

[0185] [Ca²+]_c measurements were performed by flow cytometry. Cells (5×10⁵ cells/ml) were serum-deprived for ˜2 hours in Tyrode's buffer [HEPES (10 mM), NaCl (100 mM), KCl (5 mM), CaCl₂ (1.4 mM), MgCl₂ (1 mM), glucose (5.6 mM), BSA (0.05%)]. Cells were then incubated in Indo-1 loading buffer (30 min, 37° C.; 5 μM Indo-1AM, 0.03% pluronic F-127 in Tyrode's buffer), washed (2 times) and incubated at room temperature (greater than 15 min) to allow for the complete removal and/or conversion of Indo-1AM to Ca²+-sensitive Indo-1. Measurements were performed using a laser tuned to 338 nm while monitoring emissions at 405 nm and 450 nm. The concentration of intracellular free Ca²+ was calculated according to the following formula²⁰:

[Ca²+]_i=K_d×(F_min/F_max)×(R-R_min- )/(R_max-R),

where R is the ratio of the fluorescence intensities measured at 405 nm and 450 nm during the experiments and F is the fluorescence intensity measured at 450 nm. R_min, R_max, F_min and F_max were determined from in situ calibration of unlysed cells using 4 μM ionomycin in the absence (R_min and F_min; 10 mM EGTA) and presence of (R_max and F_max) of Ca²+. K_d (250 nM) is the dissociation constant for Indo-1 at 37° C. R_min, R_max, F_min and F_max varied depending upon settings and were determined at the beginning of each experimental procedure.

Protein Synthesis

[0186] Cells (2×10⁵/sample) were collected, washed with PBS and then re-suspended in RPMI supplemented with fatty acid-free bovine serum albumin (BSA; 0.05%; Sigma). Cells were treated with Ec (0, 15 μM) for 15 min. After centrifugation (2,500 rpm; 5 min), cells were pulse-labeled with [³H]-leucine (50 μCi/ml) for 10 min (37° C.; 5% CO₂) in leucine-free RPMI. After two washes in RPMI, pellets were lysed with Triton X-100 (0.5% in PBS) followed by trichloroacetic acid (TCA, 10% w/v; 4° C.). Samples were washed in TCA (5% w/v), and the protein pellets were re-suspended in microscintillant (Packard, Conn., USA) and measured using a microplate scintillation counter (Packard).

Ribosomal Purification

[0187] 5×10⁷ HL-60 cells growing in log phase were collected, washed with cold PBS, and fractionated according to the method described by Greco and Madjar²¹. The ribosomal fraction was isolated through centrifugation of post mitochondrial supernatants on top of a 1 M sucrose cushion at 245,000×g to pellet the ribosomes. The ribosome pellets were resuspended in 300 μl of RIPA buffer and disrupted by incubation in 60 mM EDTA on ice for 30 min. The concentration of the total ribosomal protein was calculated based on the absorbance of the samples (A280). Ribosomal RNAs were extracted with TRIzol and the concentration was measured by a spectrophotometer at A260.

IgG Measurements

[0188] IgG levels produced by the rat hybridoma GK1.5 (ATCC no. TIB-207) were measured by Western blotting and ELISA. For Western blotting, cells were plated at a concentration of 1×10⁶ cells/ml in growth medium for 24 hours. The cells were then collected, counted, pelleted and cell lysates were prepared in RIPA buffer with protease inhibitors (Sigma). Lysates and cell supernatants were resolved on 10% SDS-PAGE and transferred to PVDF membranes. Antibody heavy and light chains were detected with HRP-conjugated rabbit anti-rat IgG (H+L) (Zymed; San Franciso, Calif.). For ELISA measurements, Goat anti-rat IgG or normal control IgG from Goat serum (Sigma) were diluted to 5 μg/ml in coating buffer (50 mM Tris, 150 mM NaCl, pH9.5), placed into a 96 well ELISA plate in 50 μl volume and incubated for 40 min at room temperature. The plate was washed for 8 times with distilled water and incubated with 50 μl of PBS containing 3% FBS for additional 40 min at room temperature. Empty vector and ABC50 over-expressed lentivirus transfected GK1.5 hybridoma cells were grown in Iscove's Modified Dulbecco's Medium (IMDM) containing 10% FBS. Cell culture supernatant was collected and diluted in same media and 50 μl diluted samples were added into the 96-well plate. Normal rat IgG from rat serum (Sigma) was used for determining the standard curve. After incubating for 2 hours at room temperature, the wells were washed 8 times with distilled water. HRP conjugated Goat anti-rat IgG (Sigma) was diluted 1:2000 in IMDM and 50 μl reagent was added, incubated for another 40 min. and washed as described above. 100 μl of substrate 3,3,5,5-Tetramethylbenzidine (TMB) (Sigma) was added and the reaction was stopped with 0.5 M H₂SO₄ when a yellow color developed (5 to 10 min). The plate was read at 450 nM with an ELISA reader.

Statistical Analysis

[0189] Where indicated, statistical significance was determined using the Student's t-test. p<0.05 (*), p<0.01 (**) and p<0.001 (***) were as indicated.

Example 2

Methods of Producing a Protein of Interest

[0190] There are various methods to effect expression of a protein of interest. For example, a cell expressing a protein of interest, endogenous or heterologous can be transfected/transduced with an expression vector or infected with a virus to introduce a ABC50 polynucleotide encoding a ABC50 protein or fragment having protein synthesis increasing activity. For example, a method can comprise:

[0191] Transfect/transduce cells expressing a protein of interest with the ABC50 expression vector. Cells could be selected using a drug-resistance marker, or by expression of a co-transduced marker like GFP.

[0192] Alternatively, cells overexpressing ABC50 can be made to express the protein of interest. For example, a method can comprise the following:

[0193] Overexpress ABC50 in cells, then transfect them with the recombinant protein of interest.

[0194] In a further alternative, the protein of interest and ABC50 protein or fragment, can be coexpressed for example by transfect/transduce cells with ABC50 and the protein of interest together.

[0195] Further Ec selection can be used to increase ABC50 levels in a cell expressing a protein of interest and/or in a cell into which a polynucleotide encoding a protein of interest is introduced. For example such a method could comprise: select cells that are resistant to Ec and then use them as recipients for further transfection with a protein of interest.

Table: Sequences

1. Examples of Human ABC50 Molecules

[0196] A human ABC50 amino acid sequence is provided in SEQ ID NO:1 A human ABC50 nucleotide sequence is provided in SEQ ID NO:6

2. Examples of Rat ABC50 Molecules

[0197] A rat ABC50 amino acid sequence is provided in SEQ ID NO:2 A rat ABC50 nucleotide sequence is provided in SEQ ID NO:7

3. Examples of Mouse ABC50 Molecules

[0198] A mouse ABC50 amino acid sequence is provided in SEQ ID NO: 5 A mouse ABC50 nucleotide sequence is provided in SEQ ID NO: 8

4. Examples of Antisense Agents

TABLE-US-00001

[0199] (SEQ ID NO: 3) 5'TAAGCTGTCATCTGGCTTAATAAGGATCCTTATTAAGCCAGATGA CAGCTTTTT3' (SEQ ID NO: 4) 5'CTAGAAAAAGCTGTCATCTGGCTTAATAAGGATCCTTATTAAGCCAGA TGACAGCTTAAT3'

5. Examples of Primers for Cloning ABC50

TABLE-US-00002

[0200] (SEQ ID NO: 9) 5'-AT CCCGGG ATGC CGA AGG CGC CCA AGC AGC AGC-3' (contains XmaI site); (SEQ ID NO: 10) 5'-AT CTCGAG TCAC TCT CGG GGC CGG CTG ACC-3' (contains XhoI site)

[0201] While the present disclosure has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0202] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

FULL CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATION

[0203] 1. Richard M, Drouin R, Beaulieu A D. ABC50, a novel human ATP-binding cassette protein found in tumor necrosis factor-alpha-stimulated synoviocytes. Genomics. 1998; 53:137.

[0204] 2. Tyzack J K, Wang X, Belsham G J, Proud C G. ABC50 interacts with eukaryotic initiation factor 2 and associates with the ribosome in an ATP-dependent manner. J Biol Chem. 2000; 275:34131.

[0205] 3. Paytubi S, Morrice N A, Boudeau J, Proud CG. The N-terminal region of ABC50 interacts with eukaryotic initiation factor eIF2 and is a target for regulatory phosphorylation by CK2. Biochem J. 2008; 409:223.

[0206] 4. Soboloff J, Berger S A. Sustained ER Ca2+ Depletion Suppresses Protein Synthesis and Induces Activation-enhanced Cell Death in Mast Cells. J Biol Chem. 2002; 277:13812.

[0207] 5. Zhang Y, Soboloff J, Zhu Z, Berger SA. Inhibition of Ca2+ influx is required for mitochondrial reactive oxygen species-induced endoplasmic reticulum Ca2+ depletion and cell death in leukemia cells. Mol Pharmacol. 2006; 70:1424.

[0208] 6. Soboloff J, Zhang Y, Minden M, Berger S. Sensitivity of myeloid leukemia cells to calcium influx blockade. Application to bone marrow purging. Exp Hematol. 2002; 30:1219.

[0209] 7. Zhang Y, Crump M, Berger S A. Purging of contaminating breast cancer cells from hematopoietic progenitor cell preparations using activation enhanced cell death. Breast Cancer Res Treat. 2002; 72:265.

[0210] 8. Hacker D L, Nallet S, Wurm F M. Recombinant Protein Production Yields from Mammalian Cells: Past, Present, and Future. BioPharm International. 2008

[0211] 9. Yu Y, Niapour M, Zhang Y, Berger S A. Mitochondrial regulation by c-Myc and hypoxia-inducible factor-1 alpha controls sensitivity to econazole. Mol Cancer Ther. 2008; 7:483.

[0212] 10. Zhang Y, Berger S A. Increased calcium influx and ribosomal content correlate with resistance to endoplasmic reticulum stress-induced cell death in mutant leukemia cell lines. J Biol Chem. 2004; 279:6507.

[0213] 11. Prashar Y, Weissman S M. Analysis of differential gene expression by display of 3' end restriction fragments of cDNAs. Proc Natl Acad Sci USA. 1996; 93:659.

[0214] 12. Moenner M, Pluquet O, Bouchecareilh M, Chevet E. Integrated endoplasmic reticulum stress responses in cancer. Cancer Res. 2007; 67:10631.

[0215] 13. Zhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature. 2008; 454:455.

[0216] 14. Mayer C, Zhao J, Yuan X, Grummt I. mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability. Genes Dev. 2004; 18:423.

[0217] 15. Xiao L, Grove A. Coordination of Ribosomal Protein and Ribosomal RNA Gene Expression in Response to TOR Signaling. Curr Genomics. 2009; 10:198.

[0218] 16. Mayer C, Bierhoff H, Grummt I. The nucleolus as a stress sensor: JNK2 inactivates the transcription factor TIF-IA and down-regulates rRNA synthesis. Genes Dev. 2005; 19:933.

[0219] 17. Ota M, Katsuyama Y, Hamano H, Umemura T, Kimura A, Yoshizawa K, Kiyosawa K, Fukushima H, Bahram S, Inoko H, Kawa S. Two critical genes (HLA-DRB1 and ABCF1) in the HLA region are associated with the susceptibility to autoimmune pancreatitis. Immunogenetics. 2007; 59:45.

[0220] 18. Wilde D B, Marrack P, Kappler J, Dialynas D P, Fitch F W. Evidence implicating L3T4 in class II MHC antigen reactivity; monoclonal antibody GK1.5 (anti-L3T4a) blocks class II MHC antigen-specific proliferation, release of lymphokines, and binding by cloned murine helper T lymphocyte lines. J Immunol. 1983; 131:2178.

[0221] 19. Dull T, Zufferey R, Kelly M, Mandel R J, Nguyen M, Trono D, Naldini L. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998; 72:8463.

[0222] 20. Grynkiewcz G, Poenie M, Tsien R Y. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem. 1985; 260:3440.

[0223] 21. Greco A, Madjar J J. Cell Biology: A Laboratory Handbook, Vol. 2. J E Celis. 1998

[0224] 22. Lievremont J P, Rizzuto R, Hendershot L, Meldolesi J. BiP, a major chaperone protein of the endoplasmic reticulum lumen, plays a direct and important role in the storage of the rapidly exchanging pool of Ca2+. J Biol Chem. 1997; 272:30873.

Sequence CWU 1

1

101845PRTHomo sapiens 1Met Pro Lys Ala Pro Lys Gln Gln Pro Pro Glu Pro Glu Trp Ile Gly 1 5 10 15 Asp Gly Glu Ser Thr Ser Pro Ser Asp Lys Val Val Lys Lys Gly Lys 20 25 30 Lys Asp Lys Lys Ile Lys Lys Thr Phe Phe Glu Glu Leu Ala Val Glu 35 40 45 Asp Lys Gln Ala Gly Glu Glu Glu Lys Val Leu Lys Glu Lys Glu Gln 50 55 60 Gln Gln Gln Gln Gln Gln Gln Gln Gln Lys Lys Lys Arg Asp Thr Arg 65 70 75 80 Lys Gly Arg Arg Lys Lys Asp Val Asp Asp Asp Gly Glu Glu Lys Glu 85 90 95 Leu Met Glu Arg Leu Lys Lys Leu Ser Val Pro Thr Ser Asp Glu Glu 100 105 110 Asp Glu Val Pro Ala Pro Lys Pro Arg Gly Gly Lys Lys Thr Lys Gly 115 120 125 Gly Asn Val Phe Ala Ala Leu Ile Gln Asp Gln Ser Glu Glu Glu Glu 130 135 140 Glu Glu Glu Lys His Pro Pro Lys Pro Ala Lys Pro Glu Lys Asn Arg 145 150 155 160 Ile Asn Lys Ala Val Ser Glu Glu Gln Gln Pro Ala Leu Lys Gly Lys 165 170 175 Lys Gly Lys Glu Glu Lys Ser Lys Gly Lys Ala Lys Pro Gln Asn Lys 180 185 190 Phe Ala Ala Leu Asp Asn Glu Glu Glu Asp Lys Glu Glu Glu Ile Ile 195 200 205 Lys Glu Lys Glu Pro Pro Lys Gln Gly Lys Glu Lys Ala Lys Lys Ala 210 215 220 Glu Gln Gly Ser Glu Glu Glu Gly Glu Gly Glu Glu Glu Glu Glu Glu 225 230 235 240 Gly Gly Glu Ser Lys Ala Asp Asp Pro Tyr Ala His Leu Ser Lys Lys 245 250 255 Glu Lys Lys Lys Leu Lys Lys Gln Met Glu Tyr Glu Arg Gln Val Ala 260 265 270 Ser Leu Lys Ala Ala Asn Ala Ala Glu Asn Asp Phe Ser Val Ser Gln 275 280 285 Ala Glu Met Ser Ser Arg Gln Ala Met Leu Glu Asn Ala Ser Asp Ile 290 295 300 Lys Leu Glu Lys Phe Ser Ile Ser Ala His Gly Lys Glu Leu Phe Val 305 310 315 320 Asn Ala Asp Leu Tyr Ile Val Ala Gly Arg Arg Tyr Gly Leu Val Gly 325 330 335 Pro Asn Gly Lys Gly Lys Thr Thr Leu Leu Lys His Ile Ala Asn Arg 340 345 350 Ala Leu Ser Ile Pro Pro Asn Ile Asp Val Leu Leu Cys Glu Gln Glu 355 360 365 Val Val Ala Asp Glu Thr Pro Ala Val Gln Ala Val Leu Arg Ala Asp 370 375 380 Thr Lys Arg Leu Lys Leu Leu Glu Glu Glu Arg Arg Leu Gln Gly Gln 385 390 395 400 Leu Glu Gln Gly Asp Asp Thr Ala Ala Glu Arg Leu Glu Lys Val Tyr 405 410 415 Glu Glu Leu Arg Ala Thr Gly Ala Ala Ala Ala Glu Ala Lys Ala Arg 420 425 430 Arg Ile Leu Ala Gly Leu Gly Phe Asp Pro Glu Met Gln Asn Arg Pro 435 440 445 Thr Gln Lys Phe Ser Gly Gly Trp Arg Met Arg Val Ser Leu Ala Arg 450 455 460 Ala Leu Phe Met Glu Pro Thr Leu Leu Met Leu Asp Glu Pro Thr Asn 465 470 475 480 His Leu Asp Leu Asn Ala Val Ile Trp Leu Asn Asn Tyr Leu Gln Gly 485 490 495 Trp Arg Lys Thr Leu Leu Ile Val Ser His Asp Gln Gly Phe Leu Asp 500 505 510 Asp Val Cys Thr Asp Ile Ile His Leu Asp Ala Gln Arg Leu His Tyr 515 520 525 Tyr Arg Gly Asn Tyr Met Thr Phe Lys Lys Met Tyr Gln Gln Lys Gln 530 535 540 Lys Glu Leu Leu Lys Gln Tyr Glu Lys Gln Glu Lys Lys Leu Lys Glu 545 550 555 560 Leu Lys Ala Gly Gly Lys Ser Thr Lys Gln Ala Glu Lys Gln Thr Lys 565 570 575 Glu Ala Leu Thr Arg Lys Gln Gln Lys Cys Arg Arg Lys Asn Gln Asp 580 585 590 Glu Glu Ser Gln Glu Ala Pro Glu Leu Leu Lys Arg Pro Lys Glu Tyr 595 600 605 Thr Val Arg Phe Thr Phe Pro Asp Pro Pro Pro Leu Ser Pro Pro Val 610 615 620 Leu Gly Leu His Gly Val Thr Phe Gly Tyr Gln Gly Gln Lys Pro Leu 625 630 635 640 Phe Lys Asn Leu Asp Phe Gly Ile Asp Met Asp Ser Arg Ile Cys Ile 645 650 655 Val Gly Pro Asn Gly Val Gly Lys Ser Thr Leu Leu Leu Leu Leu Thr 660 665 670 Gly Lys Leu Thr Pro Thr His Gly Glu Met Arg Lys Asn His Arg Leu 675 680 685 Lys Ile Gly Phe Phe Asn Gln Gln Tyr Ala Glu Gln Leu Arg Met Glu 690 695 700 Glu Thr Pro Thr Glu Tyr Leu Gln Arg Gly Phe Asn Leu Pro Tyr Gln 705 710 715 720 Asp Ala Arg Lys Cys Leu Gly Arg Phe Gly Leu Glu Ser His Ala His 725 730 735 Thr Ile Gln Ile Cys Lys Leu Ser Gly Gly Gln Lys Ala Arg Val Val 740 745 750 Phe Ala Glu Leu Ala Cys Arg Glu Pro Asp Val Leu Ile Leu Asp Glu 755 760 765 Pro Thr Asn Asn Leu Asp Ile Glu Ser Ile Asp Ala Leu Gly Glu Ala 770 775 780 Ile Asn Glu Tyr Lys Gly Ala Val Ile Val Val Ser His Asp Ala Arg 785 790 795 800 Leu Ile Thr Glu Thr Asn Cys Gln Leu Trp Val Val Glu Glu Gln Ser 805 810 815 Val Ser Gln Ile Asp Gly Asp Phe Glu Asp Tyr Lys Arg Glu Val Leu 820 825 830 Glu Ala Leu Gly Glu Val Met Val Ser Arg Pro Arg Glu 835 840 845 2839PRTRattus norvegicus 2Met Pro Lys Gly Pro Lys Gln Gln Pro Pro Glu Pro Glu Trp Ile Gly 1 5 10 15 Asp Gly Glu Gly Thr Ser Pro Ala Asp Lys Val Val Lys Lys Gly Lys 20 25 30 Lys Asp Lys Lys Thr Lys Lys Thr Phe Phe Glu Glu Leu Ala Val Glu 35 40 45 Asp Lys Gln Ala Gly Glu Glu Glu Lys Leu Gln Lys Glu Lys Glu Gln 50 55 60 Gln Gln Gln Gln Gln Gln Gln Lys Lys Lys Arg Asp Thr Arg Lys Gly 65 70 75 80 Arg Arg Lys Lys Asp Val Asp Asp Asp Asp Asp Gly Asp Glu Arg Val 85 90 95 Leu Met Glu Arg Leu Lys Gln Leu Ser Val Pro Ala Ser Asp Glu Glu 100 105 110 Asp Glu Val Pro Val Pro Val Pro Arg Gly Arg Lys Lys Ala Lys Gly 115 120 125 Gly Asn Val Phe Glu Ala Leu Ile Gln Asp Glu Ser Glu Glu Glu Lys 130 135 140 Glu Glu Glu Glu Glu Lys Pro Val Leu Lys Pro Ala Lys Pro Glu Lys 145 150 155 160 Asn Arg Ile Asn Lys Ala Val Ala Glu Glu Pro Pro Gly Leu Arg Asn 165 170 175 Lys Lys Gly Lys Glu Glu Lys Ser Lys Gly Lys Ala Lys Asn Lys Pro 180 185 190 Ser Ala Thr Asp Ser Glu Gly Glu Asp Asp Glu Asp Met Thr Lys Glu 195 200 205 Lys Glu Pro Pro Arg Pro Gly Lys Asp Lys Asp Lys Lys Gly Ala Glu 210 215 220 Gln Gly Ser Glu Glu Glu Lys Glu Glu Lys Glu Gly Glu Val Lys Ala 225 230 235 240 Asn Asp Pro Tyr Ala His Leu Ser Lys Lys Glu Lys Lys Lys Leu Lys 245 250 255 Lys Gln Met Asp Tyr Glu Arg Gln Val Glu Ser Leu Lys Ala Ala Asn 260 265 270 Ala Ala Glu Asn Asp Phe Ser Val Ser Gln Ala Glu Val Ser Ser Arg 275 280 285 Gln Ala Met Leu Glu Asn Ala Ser Asp Ile Lys Leu Glu Lys Phe Ser 290 295 300 Ile Ser Ala His Gly Lys Glu Leu Phe Val Asn Ala Asp Leu Tyr Ile 305 310 315 320 Val Ala Gly Arg Arg Tyr Gly Leu Val Gly Pro Asn Gly Lys Gly Lys 325 330 335 Thr Thr Leu Leu Lys His Ile Ala Asn Arg Ala Leu Ser Ile Pro Pro 340 345 350 Asn Ile Asp Val Leu Leu Cys Glu Gln Glu Val Val Ala Asp Glu Thr 355 360 365 Pro Ala Val Gln Ala Val Leu Arg Ala Asp Thr Lys Arg Leu Arg Leu 370 375 380 Leu Glu Glu Glu Lys Arg Leu Gln Gly Gln Leu Glu Gln Gly Asp Asp 385 390 395 400 Thr Ala Ala Glu Lys Leu Glu Lys Val Tyr Glu Glu Leu Arg Ala Thr 405 410 415 Gly Ala Ala Ala Ala Glu Ala Lys Ala Arg Arg Ile Leu Ala Gly Leu 420 425 430 Gly Phe Asp Pro Glu Met Gln Asn Arg Pro Thr Gln Lys Phe Ser Gly 435 440 445 Gly Trp Arg Met Arg Val Ser Leu Ala Arg Ala Leu Phe Met Glu Pro 450 455 460 Thr Leu Leu Met Leu Asp Glu Pro Thr Asn His Leu Asp Leu Asn Ala 465 470 475 480 Val Ile Trp Leu Asn Asn Tyr Leu Gln Gly Trp Arg Lys Thr Leu Leu 485 490 495 Ile Val Ser His Asp Gln Gly Phe Leu Asp Asp Val Cys Thr Asp Ile 500 505 510 Ile His Leu Asp Thr Gln Arg Leu His Tyr Tyr Arg Gly Asn Tyr Met 515 520 525 Thr Phe Lys Lys Met Tyr Gln Gln Lys Gln Lys Glu Leu Leu Lys Gln 530 535 540 Tyr Glu Lys Gln Glu Lys Lys Leu Lys Glu Leu Lys Ala Gly Gly Lys 545 550 555 560 Ser Thr Lys Gln Ala Glu Lys Gln Thr Lys Glu Val Leu Thr Arg Lys 565 570 575 Gln Gln Lys Cys Arg Arg Lys Asn Gln Asp Glu Glu Ser Gln Asp Pro 580 585 590 Pro Glu Leu Leu Lys Arg Pro Arg Glu Tyr Thr Val Arg Phe Thr Phe 595 600 605 Pro Asp Pro Pro Pro Leu Ser Pro Pro Val Leu Gly Leu His Gly Val 610 615 620 Thr Phe Gly Tyr Glu Gly Gln Lys Pro Leu Phe Lys Asn Leu Asp Phe 625 630 635 640 Gly Ile Asp Met Asp Ser Arg Ile Cys Ile Val Gly Pro Asn Gly Val 645 650 655 Gly Lys Ser Thr Leu Leu Leu Leu Leu Thr Gly Lys Leu Thr Pro Thr 660 665 670 Asn Gly Glu Met Arg Lys Asn His Arg Leu Lys Ile Gly Phe Phe Asn 675 680 685 Gln Gln Tyr Ala Glu Gln Leu His Met Glu Glu Thr Pro Thr Glu Tyr 690 695 700 Leu Gln Arg Gly Phe Asn Leu Pro Tyr Gln Asp Ala Arg Lys Cys Leu 705 710 715 720 Gly Arg Phe Gly Leu Glu Ser His Ala His Thr Ile Gln Ile Cys Lys 725 730 735 Leu Ser Gly Gly Gln Lys Ala Arg Val Val Phe Ala Glu Leu Ala Cys 740 745 750 Arg Glu Pro Asp Val Leu Ile Leu Asp Glu Pro Thr Asn Asn Leu Asp 755 760 765 Ile Glu Ser Ile Asp Ala Leu Gly Glu Ala Ile Asn Glu Tyr Lys Gly 770 775 780 Ala Val Ile Val Val Ser His Asp Ala Arg Leu Ile Thr Glu Thr Asn 785 790 795 800 Cys Gln Leu Trp Val Val Glu Glu Gln Ser Val Ser Gln Ile Asp Gly 805 810 815 Asp Phe Asp Asp Tyr Lys Arg Glu Val Leu Glu Ala Leu Gly Glu Val 820 825 830 Met Val Asn Arg Pro Arg Asp 835 354DNAArtificial SequenceSynthetic construct 3taagctgtca tctggcttaa taaggatcct tattaagcca gatgacagct tttt 54460DNAArtificial SequenceSynthetic construct 4ctagaaaaag ctgtcatctg gcttaataag gatccttatt aagccagatg acagcttaat 605837PRTMus musculus 5Met Pro Lys Gly Pro Lys Gln Gln Pro Pro Glu Pro Glu Trp Ile Gly 1 5 10 15 Asp Gly Glu Gly Thr Ser Pro Ala Asp Lys Val Val Lys Lys Gly Lys 20 25 30 Lys Asp Lys Lys Thr Lys Lys Thr Phe Phe Glu Glu Leu Ala Val Glu 35 40 45 Asp Lys Gln Ala Gly Glu Glu Glu Lys Leu Gln Lys Glu Lys Glu Gln 50 55 60 Gln Gln Gln Gln Gln Gln Gln Lys Lys Lys Arg Asp Thr Arg Lys Gly 65 70 75 80 Arg Arg Lys Lys Asp Val Asp Asp Asp Ser Asp Glu Arg Val Leu Met 85 90 95 Glu Arg Leu Lys Gln Leu Ser Val Pro Ala Ser Asp Glu Glu Asp Glu 100 105 110 Val Pro Ala Pro Ile Pro Arg Gly Arg Lys Lys Ala Lys Gly Gly Asn 115 120 125 Val Phe Glu Ala Leu Ile Gln Asp Asp Ser Glu Glu Glu Glu Glu Glu 130 135 140 Glu Glu Asn Arg Val Leu Lys Pro Ala Lys Pro Glu Lys Asn Arg Ile 145 150 155 160 Asn Lys Ala Val Ala Glu Glu Pro Pro Gly Leu Arg Ser Lys Lys Gly 165 170 175 Lys Glu Glu Lys Ser Lys Gly Lys Ala Lys Ser Lys Pro Ala Ala Ala 180 185 190 Asp Ser Glu Gly Glu Glu Glu Glu Glu Asp Thr Ala Lys Glu Lys Glu 195 200 205 Pro Pro Gln Gln Gly Lys Asp Arg Asp Lys Lys Glu Ala Glu Gln Gly 210 215 220 Ser Gly Glu Glu Lys Glu Glu Lys Glu Gly Asp Leu Lys Ala Asn Asp 225 230 235 240 Pro Tyr Ala Asn Leu Ser Lys Lys Glu Lys Lys Lys Leu Lys Lys Gln 245 250 255 Met Asp Tyr Glu Arg Gln Val Glu Ser Leu Lys Ala Ala Asn Ala Ala 260 265 270 Glu Asn Asp Phe Ser Val Ser Gln Ala Glu Val Ser Ser Arg Gln Ala 275 280 285 Met Leu Glu Asn Ala Ser Asp Ile Lys Leu Glu Lys Phe Ser Ile Ser 290 295 300 Ala His Gly Lys Glu Leu Phe Val Asn Ala Asp Leu Tyr Ile Val Ala 305 310 315 320 Gly Arg Arg Tyr Gly Leu Val Gly Pro Asn Gly Lys Gly Lys Thr Thr 325 330 335 Leu Leu Lys His Ile Ala Asn Arg Ala Leu Ser Ile Pro Pro Asn Ile 340 345 350 Asp Val Leu Leu Cys Glu Gln Glu Val Val Ala Asp Glu Thr Pro Ala 355 360 365 Val Gln Ala Val Leu Arg Ala Asp Thr Lys Arg Leu Arg Leu Leu Glu 370 375 380 Glu Glu Arg Arg Leu Gln Gly Gln Leu Glu Gln Gly Asp Asp Thr Ala 385 390 395 400 Ala Glu Lys Leu Glu Lys Val Tyr Glu Glu Leu Arg Ala Thr Gly Ala 405 410 415 Ala Ala Ala Glu Ala Lys Ala Arg Arg Ile Leu Ala Gly Leu Gly Phe 420 425 430 Asp Pro Glu Met Gln Asn Arg Pro Thr Gln Lys Phe Ser Gly Gly Trp 435 440 445 Arg Met Arg Val Ser Leu Ala Arg Ala Leu Phe Met Glu Pro Thr Leu 450 455 460 Leu Met Leu Asp Glu Pro Thr Asn His Leu Asp Leu Asn Ala Val Ile 465 470 475 480 Trp Leu Asn Asn Tyr Leu Gln Gly Trp Arg Lys Thr Leu Leu Ile Val 485 490 495 Ser His Asp Gln Gly Phe Leu Asp Asp Val Cys Thr Asp Ile Ile His 500 505 510 Leu Asp Thr Gln Arg Leu His Tyr Tyr Arg Gly Asn Tyr Met Thr Phe 515 520 525 Lys Lys Met Tyr Gln Gln Lys Gln Lys Glu Leu Leu Lys Gln Tyr Glu 530 535 540 Lys Gln Glu Lys Lys Leu Lys Glu Leu Lys Ala Gly Gly Lys Ser Thr 545 550 555 560 Lys Gln Ala Glu Lys Gln Thr Lys Glu Val Leu Thr Arg Lys Gln Gln 565 570 575 Lys Cys Arg Arg Lys Asn Gln Asp Glu Glu Ser Gln Glu Pro

Pro Glu 580 585 590 Leu Leu Lys Arg Pro Lys Glu Tyr Thr Val Arg Phe Thr Phe Pro Asp 595 600 605 Pro Pro Pro Leu Ser Pro Pro Val Leu Gly Leu His Gly Val Thr Phe 610 615 620 Gly Tyr Glu Gly Gln Lys Pro Leu Phe Lys Asn Leu Asp Phe Gly Ile 625 630 635 640 Asp Met Asp Ser Arg Ile Cys Ile Val Gly Pro Asn Gly Val Gly Lys 645 650 655 Ser Thr Leu Leu Leu Leu Leu Thr Gly Lys Leu Thr Pro Thr Asn Gly 660 665 670 Glu Met Arg Lys Asn His Arg Leu Lys Ile Gly Phe Phe Asn Gln Gln 675 680 685 Tyr Ala Glu Gln Leu His Met Glu Glu Thr Pro Thr Glu Tyr Leu Gln 690 695 700 Arg Ser Phe Asn Leu Pro Tyr Gln Asp Ala Arg Lys Cys Leu Gly Arg 705 710 715 720 Phe Gly Leu Glu Ser His Ala His Thr Ile Gln Ile Cys Lys Leu Ser 725 730 735 Gly Gly Gln Lys Ala Arg Val Val Phe Ala Glu Leu Ala Cys Arg Glu 740 745 750 Pro Asp Val Leu Ile Leu Asp Glu Pro Thr Asn Asn Leu Asp Ile Glu 755 760 765 Ser Ile Asp Ala Leu Gly Glu Ala Ile Asn Asp Tyr Lys Gly Ala Val 770 775 780 Ile Val Val Ser His Asp Ala Arg Leu Ile Thr Glu Thr Asn Cys Gln 785 790 795 800 Leu Trp Val Val Glu Glu Gln Gly Val Ser Gln Ile Asp Gly Asp Phe 805 810 815 Asp Asp Tyr Lys Arg Glu Val Leu Glu Ala Leu Gly Glu Val Met Val 820 825 830 Asn Arg Pro Arg Asp 835 62538DNAHomo sapiens 6atgccgaagg cgcccaagca gcagccgccg gagcccgagt ggatcgggga cggagagagc 60acgagcccat cagacaaagt ggtgaagaaa gggaagaagg acaagaagat caaaaaaacg 120ttctttgaag agctggcagt agaagataaa caggctgggg aagaagagaa agtgctcaag 180gagaaggagc agcagcagca gcaacagcaa cagcagcaaa aaaaaaagcg agatacccga 240aaaggcaggc ggaagaagga tgtggatgat gatggagaag agaaagagct catggagcgt 300cttaagaagc tctcagtgcc aaccagtgat gaggaggatg aagtacccgc cccaaaaccc 360cgcggaggga agaaaaccaa gggtggtaat gtttttgcag ccctgattca ggatcagagt 420gaggaagagg aggaggaaga aaaacatcct cctaagcctg ccaagccgga gaagaatcgg 480atcaataagg ccgtatctga ggaacagcag cctgcactca agggcaaaaa gggaaaggaa 540gagaagtcaa aagggaaggc taagcctcaa aataaattcg ctgctctgga caatgaagag 600gaggataaag aagaagaaat tataaaggaa aaggagcctc ccaaacaagg gaaggagaag 660gccaagaagg cagagcaggg ttcagaggaa gaaggagaag gggaagaaga ggaggaggaa 720ggaggagagt ctaaggcaga tgatccctat gctcatctta gcaaaaagga gaagaaaaag 780ctgaaaaaac agatggagta tgagcgccaa gtggcttcat taaaagcagc caatgcagct 840gaaaatgact tctccgtgtc ccaggcggag atgtcctccc gccaagccat gttagaaaat 900gcatctgaca tcaagctgga gaagttcagc atctccgctc atggcaagga gctgttcgtc 960aatgcagacc tgtacattgt agccggccgc cgctacgggc tggtaggacc caatggcaag 1020ggcaagacca cactcctcaa gcacattgcc aaccgagccc tgagcatccc tcccaacatt 1080gatgtgttgc tgtgtgagca ggaggtggta gcagatgaga caccagcagt ccaggctgtt 1140cttcgagctg acaccaagcg attgaagctg ctggaagagg agcggcggct tcagggacag 1200ctggaacaag gggatgacac agctgctgag aggctagaga aggtgtatga ggaattgcgg 1260gccactgggg cggcagctgc agaggccaaa gcacggcgga tcctggctgg cctgggcttt 1320gaccctgaaa tgcagaatcg acccacacag aagttctcag ggggctggcg catgcgtgtc 1380tccctggcca gggcactgtt catggagccc acactgctga tgctggatga gcccaccaac 1440cacctggacc tcaacgctgt catctggctt aataactacc tccagggctg gcggaagacc 1500ttgctgatcg tctcccatga ccagggcttc ttggatgatg tctgcactga tatcatccac 1560ctcgatgccc agcggctcca ctactatagg ggcaattaca tgaccttcaa aaagatgtac 1620cagcagaagc agaaagaact gctgaaacag tatgagaagc aagagaaaaa gctgaaggag 1680ctgaaggcag gcgggaagtc caccaagcag gcggaaaaac aaacgaagga agccctgact 1740cggaagcagc agaaatgccg acggaaaaac caagatgagg aatcccagga ggcccctgag 1800ctcctgaagc gccctaagga gtacactgtg cgcttcactt ttccagaccc cccaccactc 1860agccctccag tgctgggtct gcatggtgtg acattcggct accagggaca gaaaccactc 1920tttaagaact tggattttgg catcgacatg gattcaagga tttgcattgt gggccctaat 1980ggtgtgggga agagtacgct actcctgctg ctgactggca agctgacacc gacccatggg 2040gaaatgagaa agaaccaccg gctgaaaatt ggcttcttca accagcagta tgcagagcag 2100ctgcgcatgg aggagacgcc cactgagtac ctgcagcggg gcttcaacct gccctaccag 2160gatgcccgca agtgcctggg ccgcttcggc ctggagagtc acgcccacac catccagatc 2220tgcaaactct ctggtggtca gaaggcgcga gttgtgtttg ctgagctggc ctgtcgggaa 2280cctgatgtcc tcatcttgga cgagccaacc aataacctgg acatagagtc tattgatgct 2340ctaggggagg ccatcaatga atacaagggt gctgtgatcg ttgtcagcca tgatgcccga 2400ctcatcacag aaaccaattg ccagctgtgg gtggtggagg agcagagtgt tagccaaatc 2460gatggtgact ttgaagacta caagcgggag gtgttggagg ccctgggtga agtcatggtc 2520agccggcccc gagagtga 253872990DNARattus norvegicus 7atggacaaag tagtgaagaa aggcaaaaaa gacaagaaga ccaaaaagac gttctttgag 60gaactggcag tggaagacaa gcaagccggg gaagaggaga aactgcagaa ggagaaggag 120cagcagcagc agcagcagca acagaagaaa aagcgagaca ccaggaaagg tcgtcggaag 180aaggatgtgg atgatgatga tgatggtgat gagagagtgc tcatggagcg ccttaagcag 240ctgtctgtgc cagccagtga tgaggaagat gaggtacctg tccccgtgcc ccgaggacgg 300aagaaggcaa agggcggaaa tgtttttgaa gccctgattc aggatgaaag tgaggaggaa 360aaagaagagg aggaagaaaa gcctgttctc aagcctgcca agccagagaa gaatcgcatc 420aataaggccg tggctgagga gcctcctggg ctccgaaata aaaagggaaa ggaggagaaa 480tcgaaaggga aagccaagaa taaaccgtct gctacagaca gtgaagggga agatgatgag 540gacatgacta aagaaaagga gcctcccagg ccagggaagg acaaagacaa aaagggagct 600gagcagggtt cagaggaaga gaaagaagag aaggaggggg aggtgaaggc gaatgatccc 660tatgcccacc ttagcaaaaa ggaaaagaaa aagctgaaga aacagatgga ttatgaacgc 720caggtggaat cattaaaggc agctaatgct gcagaaaatg acttctctgt gtcccaggca 780gaggtgtctt cccgccaggc aatgttagaa aatgcatctg acattaagtt ggaaaagttc 840agcatctcgg cccacggcaa ggagctgttt gtcaatgctg acctgtacat cgtggctggc 900cgccgctatg ggctggtggg gcccaacggc aagggcaaga ccacacttct gaagcacatt 960gccaaccgtg ccctgagtat cccccctaac attgatgtgc tgctgtgcga gcaggaggtg 1020gtggctgatg aaacaccagc cgtgcaagct gttcttcgtg cagacacaaa gcgactgagg 1080ttgctagagg aggagaaacg gcttcaggga cagctggagc agggggatga tactgccgct 1140gagaaactag aaaaggtata tgaggaactg cgagctactg gggcagcagc tgcagaggcc 1200aaggcacggc ggatcctggc tggcttgggc tttgaccctg agatgcagaa tcggcccaca 1260cagaagttct ctgggggttg gcgaatgcgt gtctccctgg ccagggcact gttcatggaa 1320cccacactgc tgatgctgga cgagcctacc aatcacctgg acctcaatgc cgtcatctgg 1380ctcaataact accttcaggg ctggaggaag acactgctga tcgtctccca cgaccagggc 1440tttctggatg atgtctgcac cgatatcatc cacctggaca ctcagcggct ccattactac 1500aggggcaatt acatgacctt caagaagatg taccagcaga agcagaagga gctgctgaag 1560cagtacgaga aacaggagaa gaagctgaag gagctgaagg ctgggggcaa gtccaccaag 1620caagcggaaa agcaaacaaa ggaagtcctg actcgaaaac agcagaaatg ccgaaggaaa 1680aaccaggatg aggagtctca ggatccccct gagcttctga agcgccccag ggagtacact 1740gtgcgattca ccttcccaga ccccccacct ctcagcccac ctgtcctggg gctgcatggt 1800gtgacgtttg gctacgaggg gcagaagcca ctctttaaga acctggattt cggcatcgac 1860atggactccc gaatttgcat tgtgggtccc aatggtgtgg ggaagagcac actactcctg 1920ttgctgactg gcaagctgac accgaccaac ggggaaatga ggaagaacca tcggctgaaa 1980atcggcttct ttaaccagca gtatgcagag cagctgcaca tggaggagac gcccaccgag 2040tacctgcagc ggggcttcaa cctgccctat caggatgccc ggaagtgctt gggccgcttc 2100ggcctggaga gccacgccca caccatccag atctgcaaac tctcgggcgg gcagaaagcc 2160cgagttgtgt ttgcggagct ggcctgtcgg gagcctgatg tcctcatctt ggatgaacca 2220accaataact tggacataga gtccatcgat gccctgggag aggccatcaa cgagtacaag 2280ggagctgtga tcgttgtcag ccatgatgca cgcctcatca cagaaaccaa ctgccagttg 2340tgggtcgtgg aggagcagag tgtcagtcaa attgatggtg actttgatga ctacaagcga 2400gaggtgttgg aggccctggg tgaagtcatg gtcaaccgac ctcgggattg agttcttctg 2460gaagcctgct gtgacaagct cctatggctg gaatctaggc catctcttta tccaccaaga 2520agcctgctgt gtctgctgcc agctgcagcc acatgggcca agaagtggcg tgttgccttg 2580atgtgtgtga gagcatcctt ccatgtgaac tgtgtccttc tcactgaagg actgtgttcc 2640cttgaggtaa ctgagctggc ttgcccacac tggcttagtc tctattcaga caggtgacct 2700ttgctgtggt gggttccccc tcagacctaa ttaaggtggc ctcttgtctc gagacttttg 2760ccactcagaa ctgaccctgg tccctccttt tggaagggta ctactgactc gctgacataa 2820acagccagaa cctcagggct ggaggcaagt gtctgagacc tgtactgtct cacccaagat 2880ctggtgcctg tgatcccttg tctcatgggg acttgagggc aggaaaggaa gctcctgaac 2940tgaagtctcc tttacaaggg aggaataaag gagtgggtgc tgatacatgt 299083207DNAMus musculus 8gcgccgctgg aggactctta actgccgccg cgatgccgaa gggtcccaag caacagccgc 60ccgagcccga gtggatcggg gacggcgagg gcacgagccc cgcggacaaa gtagtgaaga 120aaggaaaaaa ggacaagaag accaaaaaga cgttctttga agagctggca gtagaggaca 180aacaagctgg ggaagaggaa aaattgcaga aggagaagga gcagcaacag caacagcagc 240aacagaagaa aaagcgagac accaggaaag gccgtcggaa aaaggatgtg gacgatgata 300gtgatgagag agtgctcatg gagcgactta agcaactgtc tgtgccagcc agtgatgagg 360aagatgaggt gcctgccccc ataccccgag gacggaagaa ggccaagggt ggaaatgttt 420ttgaagccct gattcaggat gacagtgagg aggaggaaga ggaggaagaa aaccgtgttc 480tcaagcccgc caagccagag aagaatcgca tcaataaagc cgtggctgag gaacctcctg 540ggctcaggag taaaaaggga aaggaggaga aatcaaaagg gaaagccaag agtaaacctg 600ctgctgcaga cagtgaaggg gaagaggagg aggaggacac agctaaagaa aaggagcctc 660ctcagcaagg gaaggacaga gacaaaaagg aggctgagca gggctcaggg gaagagaagg 720aagagaaaga aggggacttg aaggcaaacg atccctatgc caaccttagc aaaaaggaaa 780agaaaaagct aaagaaacag atggattatg aacgacaggt ggagtcattg aaagcagcta 840atgctgcaga aaacgacttc tctgtgtccc aggcagaggt gtcttcccgc caggcaatgt 900tagaaaatgc atctgacatt aagttggaaa agttcagcat ctccgcccac ggcaaggagc 960tattcgtcaa tgctgacctg tacatagtag ccggccgccg ctatgggctg gtgggaccca 1020acggcaaagg caaaaccacg cttctgaagc acattgccaa ccgtgccctg agcatccccc 1080ctaacattga cgtgctgctg tgcgagcagg aggtggtggc tgatgaaaca ccagccgtgc 1140aagctgtcct tcgagcagat accaagcgac tgaggttgct agaggaggag agacggcttc 1200agggacagct ggagcagggg gatgacactg ctgctgagaa actagaaaag gtgtatgagg 1260aactgcgagc taccggggca gcagctgcag aggccaaggc acggcggatc ctggctggct 1320tgggcttcga ccctgagatg cagaatcggc ccacacagaa gttctctggg ggttggagaa 1380tgcgtgtctc cctggccagg gcactgttca tggagccaac gctgctgatg ttggatgagc 1440ccactaacca cctggacctc aacgccgtca tctggctcaa taactacctt cagggctgga 1500ggaagacgtt gctgattgtc tcccacgacc agggctttct ggatgacgtt tgcactgata 1560tcatccacct ggacacccag cggctccatt actacagggg caattacatg accttcaaga 1620agatgtacca gcagaagcag aaagagctgc taaagcagta cgagaagcag gagaagaaac 1680tgaaggagct gaaggctggg ggcaagtcca ccaagcaagc ggaaaagcaa acaaaggaag 1740tcctgactcg aaaacagcag aagtgccgac ggaaaaacca ggatgaagag tctcaggagc 1800cccctgagct cctgaagcgt cccaaggagt acaccgtgcg cttcaccttc ccagaccccc 1860cgcctctcag cccacctgtg ctgggcctgc acggtgtgac gtttggctac gaggggcaga 1920agccactctt taagaatcta gatttcggca tcgacatgga ctcccggatt tgcatcgtgg 1980gtcccaatgg tgtggggaag agcacactac tcctgctgct gactggcaag ctgacaccga 2040ccaacgggga gatgaggaag aaccatcggc tgaaaatcgg cttctttaac cagcagtacg 2100cagagcagct gcacatggag gagacgccca ctgagtacct gcagcggagc ttcaatctgc 2160cctaccagga tgcccggaag tgcttgggcc gctttggcct ggagagccac gcccacacca 2220tccagatctg caaactctcc ggtgggcaga aagcccgagt tgtgtttgcg gagctggcct 2280gtcgggagcc tgatgtcctc atcttggatg aaccaaccaa taacttggac atagagtcca 2340tcgatgccct gggggaggcc atcaacgact acaagggggc tgtgatcgtt gtcagccacg 2400atgcgcgcct catcacagaa accaactgcc agttgtgggt ggtggaggag cagggtgtca 2460gtcagatcga cggcgacttt gatgactaca agcgagaggt gttggaggcc ctgggtgagg 2520tcatggtcaa ccgtcctcgg gattgagctc cctcctggaa gctgctgcaa ccagctccta 2580tggctggagt ctaggccgtc tcccctcatc cacctagaag cctgctgcaa ccagctccta 2640cggctggagt ctaggccgtc tcccctcatc cacctagaag cctgccatgg ctgctgccag 2700ctgcagcagc cacataggcc atgaaggtgg cgtgttgcct tgatgtgtgt gagagcatcc 2760atccgtgtgg attgtgtcct tctcaatgaa ggactgtgtt ccccttgagg taactgagct 2820ggcttgccca cactggctca gtctcttcag aaagaggtga cctttgctgt gctgggttcc 2880cctcaggcct agttaaggtg gcctcttgtc tcaagacctt tgccactcag aactgaccct 2940ggtccctcct tttggaaggg tactactgac tcactgacac aaacagccag aacctcaggg 3000ctggaggcaa gtgtctgaga cctggactgt ttcaccaaag atctggtgcc tgtggtccct 3060tgtctcgtgg ggacttgagg gcaggaaagg agaactctag aactgaagtc tcctttacag 3120gggaggaaat aaagtagtgg ggtgctgaca aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3180aaaaaaaaaa aaaaaaaaaa aaaaaaa 3207933DNAArtificial SequenceSynthetic construct 9atcccgggat gccgaaggcg cccaagcagc agc 331030DNAArtificial SequenceSynthetic construct 10atctcgagtc actctcgggg ccggctgacc 30

Claims

1.-28. (canceled)

29. A process for the production of a protein of interest comprising: a) increasing production of a protein of interest in a eukaryotic cell according to claim 46; b) culturing the eukaryotic cell under suitable conditions permitting the expression of the protein of interest and the ABC50 protein or fragment; culturing the cell until the protein of interest accumulates and isolating the protein of interest.

30. The process of claim 29 wherein the protein of interest is an antibody or fragment thereof.

31.-33. (canceled)

34. A vector comprising a polynucleotide encoding an ABC50 polynucleotide and optionally a polynucleotide encoding a protein of interest, wherein the polynucleotide(s) is/are operably linked to one or more promoters.

35. The vector of claim 34, wherein the vector is a retroviral vector, optionally a lentiviral vector.

36. A eukaryotic cell a) comprising the vector of claim 34 expressing increased ABC50 protein and/or activity compared to a control cell not comprising said vector; or b) resistant to Econozole (Ec), wherein the Ec resistant cell has increased ABC50 protein levels and/or activity compared to a non-Ec resistant control cell, wherein the eukaryotic cell is suitable and/or adapted for expression of a protein of interest.

37. (canceled)

38. The cell of claim 36, wherein the eukaryotic cell is selected from a yeast, plant, worm, insect, avian, fish, reptile, mammalian, hybridoma, a myeloma cell or a spleen cell.

39. A system for heterologous protein expression comprising the eukaryotic cell of claim 36 b) and an expression vector comprising a multicloning site for receiving a heterologous polynucleotide encoding the heterologous protein to be expressed.

40.-42. (canceled)

43. The method of claim 42, wherein the shRNA comprises SEQ ID NO: 3 and/or 4.

44. The method of claim 41 wherein the ER stress agent is selected from EC, thapsigargin and tunicamycin.

45. A composition comprising: a polynucleotide comprising SEQ ID NO:3 and/or 4, an isolated vector comprising a polynucleotide encoding an ABC50 polynucleotide and optionally a polynucleotide encoding a protein of interest, wherein the polynucleotide(s) is/are operably linked to one or more promoters, a eukaryotic cell comprising said vector or a eukaryotic cell that is Ec resistant and has increased protein levels and/or activity compared to a non-Ec resistant control cell, and/or an isolated protein produced according to the method of claim 46.

46. A method for increasing the production of a protein of interest, said method comprising: I) a) introducing into a eukaryotic cell a polynucleotide encoding an ABC50 protein or active fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity and optionally encoding a selectable marker into a eukaryotic cell, wherein said eukaryotic cell expresses a protein of interest or wherein after the introduction of the polynucleotide encoding an ABC50 protein or active fragment the eukaryotic cell is fused to a second eukaryotic cell expressing a protein of interest, thus producing a eukaryotic cell expressing ABC50 protein or active fragment thereof and the protein of interest, and b) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest in the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein; II) a), chemically inducing the expression of endogenous ABC50 protein in a eukaryotic cell, wherein said eukaryotic cell expresses a protein of interest or wherein after the chemical induction of the polynucleotide encoding an ABC50 protein the eukaryotic cell is fused to a second eukaryotic cell expressing a protein of interest, thus producing a eukaryotic cell expressing ABC50 protein and a protein of interest, and b) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest in the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein; III) a) introducing into a eukaryotic cell a polynucleotide encoding a protein of interest and optionally encoding a selectable marker, wherein said eukaryotic cell expresses an ABC50 protein or active fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity, wherein said ABC50 protein or active fragment thereof is recombinantly expressed in the eurkaryotic cell after the introduction of the polynucleotide encoding an ABC50 protein or active fragment thereof, thus producing a eukaryotic cell expressing ABC50 protein or active fragment thereof and a protein of interest, and b) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest in the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein; IV) a) introducing into a eukaryotic cell a polynucleotide encoding a protein of interest and optionally encoding a selectable marker, wherein said eukaryotic cell expresses an ABC50 protein, wherein said ABC50 protein is expressed by chemically inducing the expression of endogenous ABC50 protein in the eukaryotic cell, thus producing a eukaryotic cell expressing ABC50 protein or active fragment thereof and a protein of interest, and b) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest in the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein; V) a) introducing into a eukaryotic cell a polynucleotide encoding an ABC50 protein or active fragment thereof having protein synthesis increasing activity and/or eIF2 binding activity and optionally encoding a selectable marker into a eukaryotic cell, b) introducing into the eukaryotic cell produced in step a) a polynucleotide encoding a protein of interest and optionally encoding a selectable marker, thus producing a eukaryotic cell expressing ABC50 protein or active fragment thereof and a protein of interest, and c) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest in the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein; or VI) a) chemically inducing the expression of endogenous ABC50 protein in a eukaryotic cell, and b) introducing into the eukaryotic cell produced in step a) a polynucleotide encoding a protein of interest and optionally encoding a selectable marker, thus producing a eukaryotic cell expressing ABC50 protein or active fragment thereof and a protein of interest, and c) incubating the eukaryotic cell under suitable conditions for a suitable length of time to produce the protein of interest and the presence of the ABC50 protein such that the protein of interest is produced at higher levels than in the absence of the ABC50 protein.

47. The method of claim 46, wherein the protein of interest is a heterologous protein.

48. The method of claim 46, wherein the method further comprises isolating the protein of interest, optionally wherein protein of interest is secreted and is secreted into a culture medium, the method further comprising isolating the secreted protein from the culture medium, or wherein the protein of interest is intracellular, the method further comprising lysing the cell and isolating the intracellular protein of interest, or wherein the protein of interest is membrane or surface bound, the method further comprising solubilizing the cell membrane and isolating the membrane protein or surface bound protein of interest.

49. The method of claim 46, wherein the ABC50 protein comprises SEQ ID NO: 1, 2 or 5; or a protein with at least 85%, 88%, 90%, 95%, 99% or 99.5% sequence identity with SEQ ID NO:1, 2 or 5.

50. The method of claim 46, wherein the increased expression is about 5% to about 10%, about 11% to about 20%, about 21% to about 30%, about 31% to about 40%, about 41% to about 50%, 51% to about 60%, 61% to about 70%, 71% to about 80%, about 81% to about 90%, about 91% to about 100%, about 150% to about 199%, about 200% to about 299%, about 300% to about 499%, or about 500% to about 1000%.

51. The method of claim 46, wherein the eukaryotic cell is selected from a yeast, plant, worm, insect, avian, fish, reptile and mammalian cell.

52. The method of claim 46, wherein the selectable marker is selected from β-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, an antibiotic resistance gene neomycin and hygromycin, dihydrofolate reductase (DHFR) and glutamine synthetase (GS) and optionally wherein selection comprises amplification of the integrated DNA by exposure of the selected cells to methotrexate (MTX) or methionine sulphoximine (MSX).

53. The method of claim 52, wherein the antibiotic resistance gene is selected from neomycin and hygromycin.

54. The method of claim 46, wherein the ABC50 protein is chemically increased by induction of econazole resistance and selecting for ABC50 expressing cells.