Patent application title: HUMANIZED COLLAGEN ANTIBODIES AND RELATED METHODS
Inventors:
Jeffry D. Watkins (Encinitas, CA, US)
Jeffry D. Watkins (Encinitas, CA, US)
William D. Huse (Del Mar, CA, US)
Ying Tang (San Diego, CA, US)
Daniel Broek (Los Angeles, CA, US)
Peter Brooks (Carmel, NY, US)
Assignees:
CELLMATRIX
IPC8 Class: AA61K4900FI
USPC Class:
424 91
Class name: Drug, bio-affecting and body treating compositions in vivo diagnosis or in vivo testing
Publication date: 2010-12-02
Patent application number: 20100303726
Claims:
1. An antibody, or antigen-binding fragment thereof, having a heavy chain
variable region and a light chain variable region in which one or more
complementarity determining regions (CDRs) differ in amino acid sequence
from the corresponding CDRs of monoclonal antibody HUI77, and having
higher binding affinity for denatured collagen type I or IV over native
collagen type I or IV,said antibody, or antigen-binding fragment thereof,
comprising:a heavy chain CDR1 referenced as SEQ ID NO: 38 or SEQ ID NO:
38 having one or more substitutions therein;a heavy chain CDR2 referenced
as SEQ ID NO: 40 or SEQ ID NO: 40 having one or more substitutions
therein;a heavy chain CDR3 referenced as SEQ ID NO: 42 or SEQ ID NO: 42
having one or more substitutions therein;a light chain CDR1 referenced as
SEQ ID NO: 32 or SEQ ID NO: 32 having one or more substitutions therein;a
light chain CDR2 referenced as SEQ ID NO: 34 or SEQ ID NO: 34 having one
or more substitutions therein; anda light chain CDR3 referenced as SEQ ID
NO: 36 or SEQ ID NO: 36 having one or more substitutions therein.
2. An antigen-binding fragment of claim 1, that is a Fv, a Fab, a F(ab')2 or a scFv fragment.
3. A nucleic acid encoding the antibody or antigen-binding fragment thereof of claim 1.
4. The antibody, or antigen-binding fragment thereof, of claim 1, further comprising a therapeutic moiety.
5. The antibody, or antigen-binding fragment thereof, of claim 1, further comprising a detectable moiety.
6. The antibody or antigen-binding fragment thereof, of claim 1, wherein said heavy chain CDRs are grafted into a VHIII/JH6 heavy chain variable region framework referenced as SEQ ID NO: 8.
7. The antibody or antigen-binding fragment thereof, of claim 1, comprising two substitutions in one or more of the CDRs.
8. The antibody or antigen-binding fragment thereof, of claim 1, comprising three substitutions in one or more of the CDRs.
9. The antibody or antigen-binding fragment thereof, of claim 1, comprising four substitutions in one or more of the CDRs.
10. The antibody or antigen-binding fragment thereof, of claim 1, comprising five or more substitutions in one or more of the CDRs.
11. A method of targeting angiogenic vasculature, inhibiting angiogenesis, targeting a tumor or inhibiting tumor growth, comprising administering an antibody, or antigen-binding fragment thereof, of claim 1 to a patient in need thereof.
12. The method of claim 11, wherein said antibody, or antigen-binding fragment thereof, further comprises a therapeutic moiety.
13. The method of claim 11, wherein said antibody, or antigen-binding fragment thereof, further comprises a detectable moiety.
14. A method of detecting angiogenic vasculature, comprising contacting angiogenic vasculature with an antibody, or antigen-binding fragment thereof, of claim 1.
15. The method of claim 14, wherein said antibody, or antigen-binding fragment thereof, further comprises a detectable moiety.
16. The method of claim 14, wherein said antibody, or antigen-binding fragment thereof, further comprises a therapeutic moiety.
17. A grafted antibody, or antigen-binding fragment thereof, having a heavy chain variable region and a light chain variable region in which one or more complementarity determining regions (CDRs) differ in amino acid sequence from the corresponding CDRs of monoclonal antibody HUI77, and having higher binding affinity for denatured collagen type I or IV over native collagen type I or IV,said antibody, or antigen-binding fragment thereof, comprising:a heavy chain CDR1 referenced as SEQ ID NO: 38 or SEQ ID NO: 38 having one or more substitutions therein;a heavy chain CDR2 referenced as SEQ ID NO: 40 or SEQ ID NO: 40 having one or more substitutions therein;a heavy chain CDR3 referenced as SEQ ID NO: 42 or SEQ ID NO: 42 having one or more substitutions therein;a light chain CDR1 referenced as SEQ ID NO: 32 or SEQ ID NO: 32 having one or more substitutions therein;a light chain CDR2 referenced as SEQ ID NO: 34 or SEQ ID NO: 34 having one or more substitutions therein; anda light chain CDR3 referenced as SEQ ID NO: 36 or SEQ ID NO: 36 having one or more substitutions therein.
18. The grafted antibody or antigen-binding fragment thereof, of claim 17, wherein said heavy chain CDRs are grafted into a VHIII/JH6 heavy chain variable region.
19. The grafted antibody, or antigen-binding fragment thereof, of claim 17, further comprising a therapeutic moiety.
20. The grafted antibody, or antigen-binding fragment thereof, of claim 17, further comprising a detectable moiety.
21. The antigen-binding fragment of claim 17, that is a Fv, a Fab, a F(ab')2 or a scFv fragment.
22. A nucleic acid encoding the grafted antibody, or antigen-binding fragment thereof, of claim 17.
23. The grafted antibody or antigen-binding fragment thereof, of claim 17, comprising two substitutions in one or more of the CDRs.
24. The grafted antibody or antigen-binding fragment thereof, of claim 17, comprising three substitutions in one or more of the CDRs.
25. The grafted antibody or antigen-binding fragment thereof, of claim 17, comprising four substitutions in one or more of the CDRs.
26. The grafted antibody or antigen-binding fragment thereof, of claim 17, comprising five or more substitutions in one or more of the CDRs.
27. A method of targeting angiogenic vasculature, inhibiting angiogenesis, targeting a tumor or inhibiting tumor growth, comprising administering a grafted antibody, or antigen-binding fragment thereof, of claim 17.
28. The method of claim 27, wherein said grafted antibody, or antigen-binding fragment thereof, further comprises a therapeutic moiety.
29. The method of claim 27, wherein said grafted antibody, or antigen-binding fragment thereof, further comprises a detectable moiety.
30. A method of detecting angiogenic vasculature, comprising contacting angiogenic vasculature with a grafted antibody, or antigen-binding fragment thereof, of claim 17.
31. The method of claim 30, wherein said grafted antibody, or antigen-binding fragment thereof, further comprises a detectable moiety.
32. The method of claim 30, wherein said grafted antibody, or antigen-binding fragment thereof, further comprises a therapeutic moiety.
Description:
CROSS-REFERENCE
[0001]This application is a continuation application of Ser. No. 12/117,642, filed May 8, 2008, which is a continuation of Ser. No. 10/011,250, filed Dec. 6, 2001, which is a continuation-in-part application of Ser. No. 09/995,529, filed Nov. 26, 2001, each of which is incorporated herein in its entirety by reference.
BACKGROUND OF THE INVENTION
[0002]The present invention relates generally to immunology and more specifically to humanized antibodies and uses thereof.
[0003]The extracellular matrix (ECM) plays a fundamental role in the regulation of normal and pathological processes. The most abundantly expressed component found in the ECM is collagen. Triple helical collagen is known to be highly resistant to proteolytic cleavage except by members of the matrix metalloproteinase (MMP) family of enzymes.
[0004]Angiogenesis and tumor growth depend on cellular interactions with the extracellular matrix. During angiogenesis and tumor invasion, both endothelial cells as well as tumor cells proteolytically remodel their extracellular microenvironment. The invasive cells then interact with this newly remodeled extracellular matrix followed by migration and invasion. To this end, a major component of the basement membrane surrounding blood vessels is collagen-IV. Moreover, collagen-I is the major component of the interstitial matrix.
[0005]One of the major detrimental consequences of the progression of cancer is metastasis beyond the site of the primary tumor. Such metastasis often requires more aggressive therapies, and once metastasis has occurred, the prognosis for survival of a cancer patient decreases dramatically.
[0006]The growth of all solid tumors requires new blood vessel growth for continued expansion of the tumors, particularly beyond a minimal size. Because angiogenesis is required for tumor growth, inhibiting angiogenesis is one approach to inhibiting tumor growth. It is therefore desirable to identify molecules that can target angiogenic vasculature. Particularly attractive molecules for targeting angiogenic vasculature are antibodies that can bind specifically to angiogenic vasculature. However, since most antibodies are developed in non-human animals such as mice, these antibodies often have undesirable immunogenic activity that limits their effectiveness for human therapy.
[0007]One approach to overcoming the detrimental properties of non-human antibodies is to humanize the antibodies by using human antibody framework region sequences spliced together with the binding domains that confer binding specificity. However, grafting of these binding domains, referred to as complementarity determining regions (CDRs), into human frameworks has often resulted in the loss of binding affinity.
[0008]Thus, there exists a need to identify antibodies specific for angiogenic vasculature and to humanize and optimize the antibodies for therapeutic purposes. The following invention satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
[0009]The invention provides a grafted antibody, or functional fragment thereof, comprising one or more complementarity determining regions (CDRs) having at least one amino acid substitution in one or more CDRs of a heavy chain CDR, where the grafted antibody or functional fragment thereof has specific binding activity for a cryptic collagen epitope. The invention also provides methods of using an antibody having specific binding activity for a cryptic collagen epitope, including methods of inhibiting angiogenesis, tumor growth, and metastasis.
INCORPORATION BY REFERENCE
[0010]All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0012]FIG. 1 shows the sequences of primers used to clone nucleic acids encoding HUIV26 and HUI77 antibodies. FIG. 1A shows a set of 5' primers for the signal peptide of mouse antibody light chain (SEQ ID NOS: 184 192). FIG. 1B shows a set of 5' primers for the signal peptide of mouse antibody heavy chain (SEQ ID NOS: 193-211). FIG. 1C shows a set of primers for the constant region of mouse heavy and light chains. Primer 2650 (SEQ ID NO:212) is the 3' primer for mouse kappa light chain constant region (amino acids 123-115). Primer 2656 (SEQ ID NO:213) is the 3' primer for mouse IgM CH1 region (amino acids 121-114). Primer 2706 (SEQ ID NO:214) is the 3' primer for mouse IgM CH1 region (amino acids 131-124).
[0013]FIG. 2 shows the sequence of the variable region of anti-cryptic collagen site antibody HUIV26. FIG. 2A shows the nucleotide sequence of HUIV26 variable region light chain (SEQ ID NO:1). FIG. 2B shows the nucleotide sequence of HUIV26 variable region heavy chain (SEQ ID NO:3). FIG. 2C shows an alignment of the amino acid sequence of HUIV26 light chain (VK) domain of HUIV26 (SEQ ID NO:2) with a human variable region fusion, VKIV/JK2 (SEQ ID NO:6) and an alignment of HUIV26 heavy chain (VH) domain (SEQ ID NO:4) with a human variable region fusion VHIII/JH6 (SEQ ID NO:8), with CDRs underlined. Amino acids in the framework region that differ between the aligned sequences are indicated by lines.
[0014]FIG. 3 shows the sequence of the variable region of anti-cryptic collagen site antibody HUI77. FIG. 3A shows the nucleotide sequence of HUI77 variable region light chain (SEQ ID NO:9). FIG. 3B shows the nucleotide sequence of HUI77 variable region heavy chain (SEQ ID NO:11). FIG. 3C shows an alignment of the amino acid sequence of HUI77 light chain (VK) domain of HUI77 (SEQ ID NO:10) with a human variable region fusion, VKII/JK1 (SEQ ID NO:14) and an alignment of HUI77 heavy chain (VH) domain (SEQ ID NO:12) with a human variable region fusion VHIII/JH6 (SEQ ID NO:16), with CDRs underlined. Amino acids in the framework region that differ between the aligned sequences are indicated by lines. FIG. 3D shows an alignment of the nucleotide sequence of HUI77 variable region with the sequence of the human framework fusion of DPK13 and JK1 (SEQ ID NO:17).
[0015]FIG. 4 shows beneficial CDR mutations for anti-cryptic collagen site antibody HUIV26. FIG. 4A shows a set of primers used to generate random mutations in LCDR3 and HCDR3 of HUIV26 (HUIV26 LCDR3 primers, SEQ ID NOS:224-232; HUIV26 HCDR3 primers, SEQ ID NOS:233 243). FIG. 4B shows a set of primers used to generate random mutations in LCDR1a (SEQ ID NOS:266-273), LCDR1b (SEQ ID NOS:274-282), LCDR2 (SEQ ID NOS:283-289), HCDR1 (SEQ ID NOS:290-294), HCDR2a (SEQ ID NOS:295-303) and HCDR2b (SEQ ID NOS:304-311) of HUIV26. FIG. 4C shows beneficial CDR mutations of the HUIV26 antibody.
[0016]FIG. 5 shows beneficial CDR mutations for anti-cryptic collagen site antibody HUI77. FIG. 5A shows a set of primers used to generate random mutations in LCDR3 and HCDR3 of HUI77. FIG. 5B shows a set of primers used to generate random mutations in LCDR1a (SEQ ID NOS:312-319), LCDR1b (SEQ ID NOS:320-327), LCDR2 (SEQ ID NOS:328-334), HCDR1 (SEQ ID NOS:335-341), HCDR2a (SEQ ID NOS:342-349) and HCDR2b (SEQ ID NOS:350-357) of HUI77. FIG. 5C shows beneficial CDR mutations of the HUI77 antibody.
[0017]FIG. 6 shows mutations in combinatorial variants of the HUIV26 antibody. The position of amino acids are shown, with mutations different than wild type shown in bold. The relative activity of combinatorial variants is shown as "SPEKon" and "SPEKoff" (last column). Primers used to create the combinatorial libraries are also shown (SEQ ID NOS:163 173).
[0018]FIG. 7 shows mutations in combinatorial variants of the HUI77 antibody. The position of amino acids are shown, with mutations different than wild type shown in bold. The relative activity of combinatorial variants is shown as "SPEKon" and "SPEKoff" (last column). Primers used to create the combinatorial libraries are also shown (SEQ ID NOS:174 183).
[0019]FIG. 8 shows the activity and specificity of HUIV26 variants. The binding of purified Fabs of IX IV26, containing wild type HUIV26 CDRs, and the HUIV26 variants 2D4H1-C3 and DhuG5 is shown for denatured collagen IV (FIG. 8A), denatured collagen I (FIG. 8B) and native collagen IV (FIG. 8C).
[0020]FIG. 9 shows the activity and specificity of HUI77 variants. The binding of purified Fabs of IX-177, containing wild type HUI77 CDRs, and HUI77 variants Qh2b-B7 and QhuD9 is shown for denatured collagen I (FIG. 9A), denatured collagen IV (FIG. 9B) and native collagen I (FIG. 9C).
[0021]FIG. 10 shows the binding activity of the HUIV26 variant DhuH8. The binding activity of the Fab form and the IgG form of the antibody to denatured (d-IV) and native (n-IV) human collagen IV is shown.
[0022]FIG. 11 shows the effect of the HUI77 variant QH2b on B16 melanoma cell proliferation. B16 melanoma cells grown in culture were not treated (control; squares) or treated with the IgG form of the QH2b variant (circles).
DETAILED DESCRIPTION OF THE INVENTION
[0023]The invention provides antibodies specific for a cryptic collagen site, which is exposed during angiogenesis and tumor cell invasion through collagenous tissue and thus serves as an antibody that can target angiogenic vasculature. The antibodies are optimized for binding activity to a cryptic collagen site. The antibodies can be used to target angiogenic vasculature for diagnostic or therapeutic purposes. The antibodies can also be used to inhibit tumor growth.
[0024]As used herein, the term "CDR" or "complementarity determining region" is intended to mean the non-contiguous antigen combining sites found within the variable region of both heavy and light chain polypeptides. These particular regions have been described by Kabat et al., J. Biol. Chem. 252:6609-6616 (1977); Kabat et al., U.S. Dept. of Health and Human Services, "Sequences of proteins of immunological interest" (1991); by Chothia et al., J. Mol. Biol. 196:901-917 (1987); and MacCallum et al., J. Mol. Biol. 262:732-745 (1996), where the definitions include overlapping or subsets of amino acid residues when compared against each other. Nevertheless, application of either definition to refer to a CDR of an antibody or grafted antibodies or variants thereof is intended to be within the scope of the term as defined and used herein. The amino acid residues which encompass the CDRs as defined by each of the above cited references are set forth below in Table 1 as a comparison.
TABLE-US-00001 TABLE 1 CDR Definitions Kabat1 Chothia2 MacCallum3 VH CDR1 31-35 26-32 30-35 VH CDR2 50-65 53-55 47-58 VH CDR3 95-102 96-101 93-101 VL CDR1 24-34 26-32 30-36 VL CDR2 50-56 50-52 46-55 VL CDR3 89-97 91-96 89-96 1Residue numbering follows the nomenclature of Kabat et al., supra 2Residue numbering follows the nomenclature of Chothia et al., supra 3Residue numbering follows the nomenclature of MacCallum et al., supra
[0025]As used herein, the term "framework" when used in reference to an antibody variable region is intended to mean all amino acid residues outside the CDR regions within the variable region of an antibody. A variable region framework is generally between about 100-120 amino acids in length but is intended to reference only those amino acids outside of the CDRs. As used herein, the term "framework region" is intended to mean each domain of the framework that is separated by the CDRs.
[0026]As used herein, the term "donor" is intended to mean a parent antibody molecule or fragment thereof from which a portion is derived from, given to or contributes to another antibody molecule or fragment thereof so as to confer either a structural or functional characteristic of the parent molecule onto the receiving molecule. For the specific example of CDR grafting, the parent molecule from which the grafted CDRs are derived is a donor molecule. The donor CDRs confer binding affinity of the parent molecule onto the receiving molecule. The donor molecule can be a different species or the same species as the receiving molecule. If the donor and receiving molecules are of the same species, it is understood that it, is sufficient that the donor is a separate and distinct molecule from the receiving molecule.
[0027]As used herein, the term "acceptor" is intended to mean an antibody molecule or fragment thereof which is to receive the donated portion from the parent or donor antibody molecule or fragment thereof. An acceptor antibody molecule or fragment thereof is therefore imparted with the structural or functional characteristic of the donated portion of the parent molecule. For the specific example of CDR grafting, an acceptor molecule, including framework and/or other antibody fragments, is the receiving molecule into which the CDRs are grafted. The acceptor antibody molecule or fragment is imparted with the binding affinity of the donor CDRs or parent molecule. As with a donor molecule, it is understood that an acceptor molecule can be the same or a different species as the donor.
[0028]A "variable region" when used in reference to an antibody or a heavy or light chain thereof is intended to mean the amino terminal portion of an antibody which confers antigen binding onto the molecule and which is not the constant region. The term is intended to include functional fragments thereof which maintain some of all of the binding function of the whole variable region. Therefore, the term "heteromeric variable region binding fragments" is intended to mean at least one heavy chain variable region and at least one light chain variable regions or functional fragments thereof assembled into a heteromeric complex. Heteromeric variable region binding fragments include, for example, functional fragments such as Fab, F(ab)2, Fv, single chain Fv (scFv) and the like. Such functional fragments are well known to those skilled in the art. Accordingly, the use of these terms in describing functional fragments of a heteromeric variable region is intended to correspond to the definitions well known to those skilled in the art. Such terms are described in, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1989); Molec. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, R. A. (ed.), New York: VCH Publisher, Inc.); Huston et al., Cell Biophysics, 22:189-224 (1993); Pluckthun and Skerra, Meth. Enzymol., 178:497-515 (1989); and in Day, E. D., Advanced Immunochemistry, Second Ed., Wiley-Liss, Inc., New York, N.Y. (1990).
[0029]As used herein, the term "population" is intended to refer to a group of two or more different molecules. A population can be as large as the number of individual molecules currently available to the user or able to be made by one skilled in the art. Populations can be as small as 2-4 molecules or as large as 1013 molecules. Generally, a population will contain two or more, three or more, five or more, nine or more, ten or more, twelve or more, fifteen or more, or twenty or more different molecules. A population can also contain tens or hundreds of different molecules or even thousands of different molecules. For example, a population can contain about 20 to about 100,000 different molecules or more, for example about 25 or more, 30 or more, 40 or more, 50 or more, 75 or more, 100 or more, 150 or more, 200 or more, 300 or more, 500 or more, or 1000 or more different molecules, and can contain 10,000, 100,000 or even 1×106 or more different molecules. Those skilled in the art will know what size and diversity of a population is suitable for a particular application.
[0030]As used herein, the term "altered" when used in reference to an antibody variable region is intended to mean a heavy or light chain variable region that contains one or more amino acid changes in a framework region, a CDR or both compared to the parent amino acid sequence at the same position. Where an altered variable region is derived from or composed of donor and acceptor regions, the changed amino acid residues within the altered species are to be compared to their respective amino acid positions within the parent donor and acceptor regions.
[0031]As used herein, the term "nucleic acid" or "nucleic acids" is intended to mean a single- or double-stranded DNA or RNA molecule. A nucleic acid molecule of the invention can be of linear, circular or branched configuration, and can represent either the sense or antisense strand, or both, of a nucleic acid molecule. The term also is intended to include nucleic acid molecules of both synthetic and natural origin. A nucleic acid molecule of natural origin can be derived from any animal, such as a human, non-human primate, mouse, rat, rabbit, bovine, porcine, ovine, canine, feline, or amphibian, or from a lower eukaryote, such as Drosophila, C. elegans, yeast, and the like. A synthetic nucleic acid includes, for example, chemical and enzymatic synthesis. The term "nucleic acid" or "nucleic acids" is similarly intended to include analogues of natural nucleotides which have similar functional properties as the referenced nucleic acid and which can be utilized in a manner similar to naturally occurring nucleotides and nucleosides.
[0032]As used herein, the term "antibody" is used in its broadest sense to include polyclonal and monoclonal antibodies, as well as antigen binding fragments of such antibodies. An antibody useful in the invention, or antigen binding fragment of such an antibody, is characterized by having specific binding activity for a polypeptide or a peptide portion thereof of at least about 1×105 M-1. Thus, Fab, F(ab')2, Fd, Fv, single chain Fv (scFv) fragments of an antibody and the like, which retain specific binding activity for a polypeptide, are included within the definition of an antibody. Specific binding activity of an antibody for a polypeptide can be readily determined by one skilled in the art, for example, by comparing the binding activity of an antibody to a particular polypeptide versus a control polypeptide that is not the particular polypeptide. Methods of preparing polyclonal or monoclonal antibodies are well known to those skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988)).
[0033]In addition, the term "antibody" as used herein includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen-binding fragments thereof. Such non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al. (Science 246:1275-1281 (1989)). These and other methods of making functional antibodies are well known to those skilled in the art (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546 (1989); Harlow and Lane, supra, 1988); Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press 1995)).
[0034]As used herein, specific binding means binding that is measurably different from a non specific interaction. Specific binding can be measured, for example, by determining binding of a molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity, for example, an antibody that binds a distinct epitope or antigen. Specificity of binding also can be determined, for example, by competition with a control molecule, for example, competition with an excess of the same molecule. In this case, specific binding is indicated if the binding of a molecule is competitively inhibited by itself. Thus, specific binding between an antibody and antigen is measurably different from a non specific interaction and occurs via the antigen binding site of the antibody.
[0035]As used herein, selective binding refers to a binding interaction that is both specific and discriminating between molecules, for example, an antibody that binds to a single molecule or closely related molecules. For example, an antibody can exhibit specificity for an antigen that can be both specific and selective for the antigen if the epitope is unique to a molecule. Thus, a molecule having selective binding can differentiate between molecules, as exemplified by an antibody having specificity for an epitope unique to one molecule or closely related molecules. Alternatively, an antibody can have specificity for an epitope that is common to many molecules, for example, a carbohydrate that is expressed on a number of molecules. Such an antibody has specific binding but is not selective for one molecule or closely related molecules.
[0036]As used herein the term "binding affinity" is intended to mean the strength of a binding interaction and includes both the actual binding affinity as well as the apparent binding affinity. The actual binding affinity is a ratio of the association rate over the disassociation rate. Therefore, conferring or optimizing binding affinity includes altering either or both of these components to achieve the desired level of binding affinity. The apparent affinity can include, for example, the avidity of the interaction. For example, a bivalent heteromeric variable region binding fragment can exhibit altered or optimized binding affinity due to its valency.
[0037]As used herein, the term "substantially the same" when used in reference to binding affinity is intended to mean similar or identical binding affinities where one molecule has a binding affinity that is similar to another molecule within the experimental variability of the affinity measurement. The experimental variability of the binding affinity measurement is dependent upon the specific assay used and is known to those skilled in the art.
[0038]As used herein, the term "optimizing" when used in reference to a variable region or a functional fragment thereof is intended to mean that the functional activity of the variable region has been modified compared to the activity of a parent variable region or a donor variable region, resulting in a desirable change in activity. A variable region or functional fragment thereof exhibiting optimized activity can exhibit, for example, higher affinity or lower affinity binding, or increased or decreased association or dissociation rates compared to an unaltered variable region. A variable region or functional fragment thereof exhibiting optimized activity also can exhibit increased stability such as increased half-life in a particular organism. For example, an antibody activity can be optimized to increase stability by decreasing susceptibility to proteolysis. An antibody exhibiting optimized activity also can exhibit lower affinity binding, including decreased association rates or increased dissociation rates, if desired. An optimized variable region exhibiting lower affinity binding is useful, for example, for penetrating a solid tumor. In contrast to a higher affinity variable region, which would bind to the peripheral regions of the tumor but would be unable to penetrate to the inner regions of the tumor due to its high affinity, a lower affinity variable region would be advantageous for penetrating the inner regions of the tumor. As with optimization of binding affinities above, optimization of a catalytic variable region can be, for example, increased or decreased catalytic rates, disassociation constants or association constants.
[0039]As used herein, a "cryptic collagen site" or "cryptic collagen epitope" refers to an epitope of a collagen molecule that is less accessible to binding of an antibody, or functional fragment thereof, in native collagen than in denatured collagen. An antibody having binding activity for a cryptic collagen epitope preferentially recognizes denatured collagen over native collagen, that is, has a higher binding affinity for denatured over native collagen. For example, such an antibody can have at least about a 2-fold or greater preference, that is, at least about 2 fold higher binding activity, for denatured collage over native collagen, and can exhibit about a 3 fold or greater preference, about a 5 fold or greater preference, about a 10-fold or greater preference, about a 15-fold or greater preference, about a 20-fold or greater preference, about a 25-fold or greater preference, about a 50-fold or greater preference, about a 100-fold or greater preference, or even a higher preference for denatured over native collagen.
[0040]Native collagen herein refers to a molecule where three alpha-chains are organized in a triple helical molecule. Native collagen can be of different stages of post-translational processing such as pro collagen and any intermediates in the generation of a mature tissue form of collagen, or collagen molecules isolated by limited proteolysis of tissues under conditions where the triple-helical structure of collagen is not disrupted. Thus, native collagen can be an intact collagen molecule or can contain non-triple-helical sequences flanking triple-helical regions, so long as the triple-helical is not disrupted. Denatured collagen herein refers to collagen where the triple helix is completely or partially disrupted such that a cryptic epitope is made accessible. Denaturation of collagen can occur in situ by the action of proteinases, for example, matrix metalloproteinases, that cleave collagen within triple helical regions, rendering the resulting fragments of the triple helix unstable. Denaturation of collagen can be induced in vitro by thermal or chemical denaturation of native collagen. Denatured collagen can also be prepared in vitro by treatment of native collagen with proteinases capable of cleaving a triple helical region(s), which are commonly referred to as collagenolytic enzymes, at temperatures where the resulting fragments of the triple helix are thermally unstable. Denatured collagen can be obtained by denaturation of native collagens of different stages of post-translational processing or denaturation of native collagen isolated from tissues by limited proteolysis. One skilled in the art will know a variety of methods for isolation of native collagens and a variety of methods to denature a triple helix that contains a cryptic collagen epitope.
[0041]An antibody of the invention can have binding activity for a cryptic collagen epitope that is the same as the respective parental mouse antibody. For example, an antibody of the invention having CDRs derived from HUIV26 can have essentially the same binding specificity as the mouse HUIV26 antibody described by Xu et al., Hybridoma 19:375-385 (2000); Xu et al., J. Cell Biol. 154:1069-1079 (2001); and WO 00/40597, each of which is incorporated herein by reference. Similarly, an antibody of the invention having CDRs derived from HUI77 can have essentially the same binding specificity as the mouse HUI77 antibody described by Xu et al., supra, 2000; Xu et al., supra, 2001; and WO 00/40597. Such binding specificity can be tested by the methods disclosed herein, for example, by comparing the activity of an antibody of the invention to the corresponding parental mouse antibody. For example, an antibody of the invention derived from HUIV26 can be compared to a corresponding mouse antibody having the variable region amino acid sequence shown in FIG. 2C (SEQ ID NOS:2 and 4). Similarly, an antibody of the invention derived from HUI77 can be compared to a corresponding mouse antibody having the variable region amino acid sequence shown in FIG. 3C (SEQ ID NOS:10 and 12). Similar binding specificity can be determined, for example, by competitive binding with the corresponding parental antibody. It is understood that an antibody of the invention can have essentially the same specificity as the corresponding parental antibody or can have altered specificity so long as the antibody has binding activity for a cryptic collagen epitope.
[0042]The invention provides antibodies having specific binding activity for a cryptic collagen epitope. The antibodies contain at least one CDR having at least one amino acid substitution in a CDR of the antibodies HUIV26 and HUI77, which are antibodies that bind to a cryptic collagen site. The invention also provides nucleic acids encoding these antibodies. The invention further provides methods using the antibodies.
[0043]Highly specific monoclonal antibodies have been developed that recognize a cryptic domain of human collagen, designated HUIV26 and HUI77 (see Xu et al., Hybridoma 19:375-385 (2000); Xu et al., J. Cell Biol. 154:1069-1079 (2001); WO 00/40597, each of which is incorporated herein by reference). Monoclonal antibody HUIV26 recognizes a cryptic domain of human collagen-IV, and HUI77 recognizes a cryptic domain of human collagen-I and IV that is also common to collagens II, III and V. This cryptic domain(s) is less accessible under most normal physiological conditions but becomes accessible following proteolytic remodeling of the collagen triple helix in vivo. Thus, cryptic collagen epitope(s) can become more accessible during invasive cellular processes. Importantly, the cryptic domain(s) defined by these antibodies was shown to be exposed within the basement membrane of tumor associated angiogenic blood vessels from human tumors including, breast, bladder and melanoma tumors. However, this cryptic domain was less exposed within the vessels or normal tissues tested. Therefore, the antibodies HUIV26 and HUI77 represent important and specific markers of angiogenic blood vessels. These cryptic domain(s) plays an important role in regulating angiogenesis and tumor growth since the monoclonal antibodies HUIV26 and HUI77 potently inhibit angiogenesis and human tumor growth in the chick embryo, rat and mouse models following systemic administration (Xu et al., supra, 2001). Thus, these monoclonal antibodies and the antibodies of the invention having specific binding activity for these cryptic collagen site(s) represent a highly potent and effective new therapeutic reagent for the treatment for diseases characterized by aberrant neovascularization.
[0044]A nucleic acid sequence of the invention can include a sequence that is the same or substantially the same as a specifically recited SEQ ID NO. Similarly, an amino acid sequence of the invention can include a sequence that is the same or substantially the same as a specifically recited SEQ ID NO. As used herein, the term "substantially" or "substantially the same" when used in reference to a nucleotide or amino acid sequence is intended to mean that the nucleotide or amino acid sequence shows a considerable degree, amount or extent of sequence identity when compared to a reference sequence, for example, the sequence of a parent antibody. Such a considerable degree, amount or extent of sequence identity is further considered to be significant and meaningful and therefore exhibit characteristics which are definitively recognizable or known. Thus, a nucleotide sequence which is substantially the same nucleotide sequence as a heavy or light chain of an antibody of the invention, including fragments thereof, refers to a sequence which exhibits characteristics that are definitively known or recognizable as encoding or as being the amino acid sequence as the parent antibody sequence. Minor modifications thereof are included so long as they are recognizable as a parent antibody sequence. Similarly, an amino acid sequence which is substantially the same amino acid sequence as a heavy or light chain of an antibody of the invention, or functional fragment thereof, refers to a sequence which exhibits characteristics that are definitively known or recognizable as representing the amino acid sequence of parent antibody and minor modifications thereof. When determining whether a nucleotide or amino acid sequence is substantially the same as a parent antibody, consideration is given to the number of changes relative to the parent antibody together with whether the function is maintained, for example, whether the function of binding to a cryptic collagen site is maintained for antibodies of the invention.
[0045]Minor modification of these nucleotide sequences and/or amino acids are intended to be included as heavy and light chain encoding nucleic acids and their functional fragments. Such minor modifications include, for example, those which do not change the encoded amino acid sequence due to the degeneracy of the genetic code as well as those which result in only a conservative substitution of the encoded amino acid sequence. Conservative substitutions of encoded amino acids include, for example, amino acids which belong within the following groups: (1) non-polar amino acids (Gly, Ala, Val, Leu, and Ile); (2) polar neutral amino acids (Cys, Met, Ser, Thr, Asn, and Gln); (3) polar acidic amino acids (Asp and Glu); (4) polar basic amino acids (Lys, Arg and His); and (5) aromatic amino acids (Phe, Trp, Tyr, and His). Other minor modifications are included within the nucleic acids encoding heavy and light chain polypeptides of the invention so long as the nucleic acid or encoded polypeptides retain some or all of their function as described herein.
[0046]To generate antibodies of the invention having specific binding activity for a cryptic collagen epitope, the heavy and light chain variable regions of the antibodies HUIV26 and HUI77 were cloned and sequenced (see Example I and FIGS. 2 and 3). CDRs of the heavy and light chain variable regions were identified. Exemplary heavy and light chain CDRs, as determined by the numbering of Kabat, are shown in FIGS. 2C and 3C (underlined). Exemplary heavy and light chain CDRs of HUIV26 include, for example, VL CDR1, KSSQSLLNSGNQKNYLA (SEQ ID NO:20); VL CDR2, GASTRES (SEQ ID NO:22); VL CDR3, QNDHSYPYT (SEQ ID NO:24); VH CDR1, GFDFSRYWMS (SEQ ID NO:26); VH CDR2, EINPDSSTINYTPSLKD (SEQ ID NO:28); and VH CDR3, PVDGYYDAMDY (SEQ ID NO:30). Exemplary heavy and light chain CDRs of HUI77 include, for example, VL CDR1, RSSQSIVHSNGNTYLE (SEQ ID NO:32); VL CDR2, KVSNRFS (SEQ ID NO:34); VL CDR3, FQGSHVPWT (SEQ ID NO:36); VH CDR1, GFSLSTSGMGVG (SEQ ID NO:38); VH CDR2, DIWWDDNKYYNPSLKS (SEQ ID NO:40); and VH CDR3, RANYGNPYYAMDY (SEQ ID NO:42).
[0047]Libraries of CDR variants containing single amino acid substitutions were generated (Example II). The libraries were screened for binding to a cryptic collagen site, and single amino acid mutations having beneficial activity were identified. Combinatorial mutants, in which two or more variant CDRs containing at least one amino acid substitution relative to parental HUIV26 or HUI77 CDRs were combined and screened for activity (Example III). A number of combinatorial mutants having optimized activity for binding to a cryptic collagen site were identified.
[0048]The antibodies of the invention having binding activity for a cryptic collagen epitope. As disclosed herein, the collagen can be denatured by any of a variety of methods so long as an antigenic determinant is exposed that was less accessible in native collagen. Such methods include, for example, proteolytic digestion, heat or thermal denaturation, chemical denaturation, and the like. One skilled in the art will know a variety of methods suitable for denaturing a collagen molecule to reveal a cryptic collagen site or epitope. Furthermore, the method of denaturation can be a combination of two or more denaturation methods, for example, proteolytic digestion combined with chemical and/or thermal denaturation. For example, proteolytic digestion can be used to cleave collagen, resulting in a collagen molecule that is more susceptible to thermal or chemical denaturation. An exemplary protease that can be used to denature collagen is matrix metalloproteinase, which can be used in vitro and can function in vivo to cleave collagen within triple helical regions and at body temperature in a mammal.
[0049]The invention provides grafted antibodies of the HUIV26 and HUI77 antibodies. In one embodiment, the invention provides a grafted antibody of HUIV26. The grafted antibody, or functional fragment thereof, comprises one or more complementarity determining regions (CDRs) having at least one amino acid substitution in one or more CDRs of a heavy chain CDR selected from the group consisting of SEQ ID NOS:26, 28 and 30 or a light chain CDR selected from the group consisting of SEQ ID NOS:20, 22 and 24, the grafted antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0050]In another embodiment, the invention provides a grafted antibody of HUI77. The grafted antibody, or functional fragment thereof, comprises one or more complementarity determining regions (CDRs) having at least one amino acid substitution in one or more CDRs of a heavy chain CDR selected from the group consisting of SEQ ID NOS:38, 40 and 42 or a light chain CDR selected from the group consisting of SEQ ID NOS:32, 34 and 36, the grafted antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0051]The invention additionally provides antibodies, or functional fragments thereof, containing specifically recited CDRs, where the antibody or functional fragment thereof has specific binding activity for a cryptic collagen epitope. Such antibodies include those having at least a single amino acid substitution and which retain binding activity for a cryptic collagen epitope. Included among such CDR variants are those described in FIGS. 4 and 5.
[0052]Exemplary CDRs of the invention having a single amino acid substitution in a CDR of HUIV26 include, for example, those described below, in which the position of the amino acid mutation in the numbering of Kabat is indicated along with the amino acid substitution from wild type to mutant (wild type→mutant). Such exemplary CDRs include HuIV26 VH CDR1 31R→H(SEQ ID NO:43); HuIV26 VH CDR1 34M→I (SEQ ID NO:44); HuIV26 VH CDR1 35S→T (SEQ ID NO:45); HuIV26 VH CDR1 35S→A (SEQ ID NO:46); HuIV26 VH CDR1 35S→G (SEQ ID NO:47); HuIV26 VH CDR2 57I→A (SEQ ID NO:48); HuIV26 VH CDR2 57I→S (SEQ ID NO:49); HuIV26 VH CDR2 62S→Y (SEQ ID NO:50); HuIV26 VH CDR2 62S→A (SEQ ID NO:51); HuIV26 VH CDR2 62S→H (SEQ ID NO:52); HuIV26 VH CDR2 62S→G (SEQ ID NO:53); HuIV26 VH CDR2 64K→Q (SEQ ID NO:54); HuIV26 VH CDR2 65D→S (SEQ ID NO:55); HuIV26 VH CDR3 97D→P (SEQ ID NO:56); HuIV26 VH CDR3 97D→G (SEQ ID NO:57); HuIV26 VH CDR3 97D→T (SEQ ID NO:58); HuIV26 VH CDR3 97D→A (SEQ ID NO:59); HuIV26 VH CDR3 98G→P (SEQ ID NO:60); HuIV26 VH CDR3 98G→A (SEQ ID NO:61); HuIV26 VH CDR3 98G→H (SEQ ID NO:62); HuIV26 VH CDR3 102Y→P (SEQ ID NO:63); HuIV26 VH CDR3 102Y→N (SEQ ID NO:64); HuIV26 VL CDR1 27Q→R (SEQ ID NO:65); HuIV26 VL CDR1 27Q→S (SEQ ID NO:66); HuIV26 VL CDR1 27dN→S (SEQ ID NO:67); HuIV26 VL CDR1 27eS→Y (SEQ ID NO:68); HuIV26 VL CDR1 27eS→W (SEQ ID NO:69); HuIV26 VL CDR1 27eS→H (SEQ ID NO:70); HuIV26 VL CDR1 27eS→R (SEQ ID NO:71); HuIV26 VL CDR1 27fG→Y (SEQ ID NO:72); HuIV26 VL CDR1 27fG→R (SEQ ID NO:73); HuIV26 VL CDR1 27fG→H (SEQ ID NO:74); HuIV26 VL CDR1 27fG→I (SEQ ID NO:75); HuIV26 VL CDR1 29Q→K (SEQ ID NO:76); HuIV26 VL CDR3 93S→Q (SEQ ID NO:77); HuIV26 VL CDR3 93S→G (SEQ ID NO:78); HuIV26 VL CDR3 93S→L (SEQ ID NO:79); HuIV26 VL CDR3 93S→A (SEQ ID NO:80); HuIV26 YL CDR3 93S→T (SEQ ID NO:81); HuIV26 VL CDR3 93S→V (SEQ ID NO:82); HuIV26 VL CDR3 94Y→N (SEQ ID NO:83); HuIV26 VL CDR3 94Y→S (SEQ ID NO:84); HuIV26 VL CDR3 94Y→P (SEQ ID NO:85); HuIV26 VL CDR3 94Y→M (SEQ ID NO:86); and HuIV26 VL CDR2 57I→V (SEQ ID NO:162).
[0053]Exemplary CDRs of the invention having a single amino acid substitution in a CDR of HUI77 include, for example, those described below, in which the position of the amino acid mutation in the numbering of Kabat is indicated along with the amino acid substitution from wild type to mutant (wild type→mutant). Such exemplary CDRs include HUI77 VH CDR1 32S→P (SEQ ID NO:87); HUI77 VH CDR1 32S→W (SEQ ID NO:88); HUI77 VH CDR1 35bG→W (SEQ ID NO:89); HUI77 VH CDR1 35bG→L (SEQ ID NO:90); HUI77 VH CDR1 35bG→A (SEQ ID NO:91); HUI77 VH CDR2 59Y→S (SEQ ID NO:92); HUI77 VH CDR2 59Y→A (SEQ ID NO:93); HUI77 VH CDR2 59Y→P (SEQ ID NO:94); HUI77 VH CDR2 64K→P (SEQ ID NO:95); HUI77 VH CDR3 95R→P (SEQ ID NO:96); HUI77 VH CDR3 95R→Q (SEQ ID NO:97); HUI77 VH CDR3 95R→L (SEQ ID NO:98); HUI77 VH CDR3 95R→T (SEQ ID NO:99); HUI77 VH CDR3 95R→V (SEQ ID NO:100); HUI77 VH CDR3 100N→V (SEQ ID NO:101); HUI77 VH CDR3 100N→W (SEQ ID NO:102); HUI77 VH CDR3 100eM→Q (SEQ ID NO:103); HUI77 VH CDR3 100eM→N (SEQ ID NO:104); HUI77 VH CDR3 100eM→T (SEQ ID NO:105); HUI77 VH CDR3 102Y→K (SEQ ID NO:106); HUI77 VH CDR3 102Y→T (SEQ ID NO:107); HUI77 VH CDR3 102Y→M (SEQ ID NO:108); HUI77 VH CDR3 102Y→H (SEQ ID NO:109); HUI77 VL CDR1 27cV→P (SEQ ID NO:110); HUI77 VL CDR1 27cV→W (SEQ ID NO:111); HUI77 VL CDR1 27dH→L (SEQ ID NO:112); HUI77 VL CDR1 27dH→S (SEQ ID NO:113); HUI77 VL CDR1 27eS→W (SEQ ID NO:114); HUI77 VL CDR1 28N→Y (SEQ ID NO:115); HUI77 VL CDR1 28N→W (SEQ ID NO:116); HUI77 VL CDR1 30N→Y (SEQ ID NO:117); HUI77 VL CDR1 33L→F (SEQ ID NO:118); HUI77 VL CDR1 33L→V (SEQ ID NO:119); HUI77 VL CDR2 50K→S (SEQ ID NO:120); HUI77 VL CDR2 51V→A (SEQ ID NO:121); HUI77 VL CDR2 53N→S (SEQ ID NO:122); HUI77 VL CDR2 54R→L (SEQ ID NO:123); HUI77 VL CDR2 56S→W (SEQ ID NO:124); HUI77 VL CDR2 56S→F (SEQ ID NO:125); HUI77 VL CDR3 89F→V (SEQ ID NO:126); HUI77 VL CDR3 89F→H (SEQ ID NO:127); HUI77 VL CDR3 90Q→R (SEQ ID NO:128); HUI77 VL CDR3 90Q→W (SEQ ID NO:129); HUI77 VL CDR3 91G→S (SEQ ID NO:130); HUI77 VL CDR3 92S→W (SEQ ID NO:131); HUI77 VL CDR3 92S→E (SEQ ID NO:132); HUI77 VL CDR3 93H→L (SEQ ID NO:133); HUI77 VL CDR3 93H→T (SEQ ID NO:134); HUI77 VL CDR3 93H→S (SEQ ID NO:135); HUI77 VL CDR3 93H→A (SEQ ID NO:136); HUI77 VL CDR3 93H→Q (SEQ ID NO:137); HUI77 VL CDR3 94V→T (SEQ ID NO:138); HUI77 VL CDR3 97T→A (SEQ ID NO:139); HUI77 VL CDR3 97T→R (SEQ ID NO:140); HUI77 VL CDR3 97T→H (SEQ ID NO:141); HUI77 VL CDR3 97T→K (SEQ ID NO:142); HUI77 VL CDR3 97T→I (SEQ ID NO:143); HUI77 VH CDR2 59Y→T (SEQ ID NO:144); HUI77 VL CDR3 94V→F (SEQ ID NO:145); and HUI77 VL CDR1 28N→Q (SEQ ID NO:146).
[0054]In addition to CDRs having single amino acid substitutions, the invention additionally provides HUIV26 and HUI77 CDRs having two or more amino acid substitutions. Exemplary CDRs having two or more amino acid substitutions in HUIV26 include, for example, HUIV26 VH CDR2 57I→A/62S→A (SEQ ID NO:154); HUIV26 VH CDR2 57I→A/62S→Y (SEQ ID NO:155); HUIV26 VH CDR2 57I→A/62S→H (SEQ ID NO:156); HUIV26 VL CDR1 27eS→W/27fG→Y (SEQ ID NO:157); HUIV26 VL CDR1 27eS→Y/27fG→Y (SEQ ID NO:158); HUIV26 VL CDR1 27eS→Y/27fG→H (SEQ ID NO:159); HUIV26 VL CDR1 27eS→R/27fG→Y (SEQ ID NO:160); and HUIV26 VL CDR1 27eS→W/27fG→H (SEQ ID NO:161) (see FIG. 6). Exemplary CDRs having two or more amino acid substitutions in HUI77 include, for example, HUI77 VH CDR1 32S→P/35bG→W (SEQ ID NO:147); HUI77 VH CDR1 32S→P/35bG→A (SEQ ID NO:148); HUI77 VL CDR1 27dH→S/28N→W (SEQ ID NO:149); HUI77 VL CDR1 27dH→S/28N→Y (SEQ ID NO:150); HUI77 VL CDR1 27dH→S/28N→Q (SEQ ID NO:151); HUI77 VL CDR1 28N→Q/33L→F (SEQ ID NO:152); and HUI77 VL CDR1 27H→S/28N→W/33L→F (SEQ ID NO:153) (see FIG. 7).
[0055]The invention provides an antibody having at least one of the above variant CDR sequences. It is understood that any combination of HUIV26 CDRs can be combined with mutant and/or wild type CDRs to generate an HUIV26 grafted antibody, so long as binding activity to a cryptic collagen site is maintained. Similarly, any combination of HUI77 CDRs can be combined with mutant and/or wild type CDRs to generate a HUI77 grafted antibody so long as binding activity to a cryptic collagen site is maintained. Thus, any combination of single amino acid substitutions can be combined with other CDR mutants to generate an antibody having at least two variant CDRs. Furthermore, any single mutation at different positions within the same CDR can be combined to generate a CDR having 2 or more amino acid substitutions at two or more positions. Any of the single or multiple mutations can be combined so long as binding activity to a cryptic collagen site is maintained.
[0056]Thus, the invention provides an antibody, or functional fragment thereof, comprising one or more CDRs selected from the group consisting of CDRs referenced as SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78; SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, and SEQ ID NO:162, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0057]The invention additionally provides an antibody, or functional fragment thereof, comprising one or more CDRs selected from the group consisting of CDRs referenced as SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151, SEQ ID NO:152, and SEQ ID NO:153, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0058]The invention further provides an antibody, or functional fragment thereof, comprising a heavy chain polypeptide comprising one or more CDRs having at least one amino acid substitution in one or more heavy chain CDRs, the heavy chain CDRs selected from the group consisting of a heavy chain CDR1 selected from the group consisting of CDRs referenced as SEQ ID NOS:26, 43, 44, 45, 46, and 47; a heavy chain CDR2 selected from the group consisting of CDRs referenced as SEQ ID NOS:28, 48, 49, 50, 51, 52, 53, 54, and 55; and a heavy chain CDR3 selected from the group consisting of CDRs referenced as SEQ ID NOS:30, 56, 57, 58, 59, 60, 61, 62, 63, and 64, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0059]The invention also provides an antibody, or functional fragment thereof, comprising a light chain polypeptide comprising one or more CDRs having at least one amino acid substitution in one or more light chain CDRs, the light chain CDRs selected from the group consisting of a light chain CDR1 selected from the group consisting of CDRs referenced as SEQ ID NOS:20, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, and 76; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 selected from the group consisting of CDRs referenced as SEQ ID NOS:24, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0060]The invention further provides an antibody, or functional fragment thereof, comprising a heavy chain polypeptide comprising one or more CDRs having at least one amino acid substitution in one or more heavy chain CDRs, the heavy chain CDRs selected from the group consisting of a heavy chain CDR1 selected from the group consisting of CDRs referenced as SEQ ID NOS:38, 87, 88, 89, 90, 91, 147 and 148; a heavy chain CDR2 selected from the group consisting of CDRs referenced as SEQ ID NOS:40, 92, 93, 94, 95 and 144; and a heavy chain CDR3 selected from the group consisting of CDRs referenced as SEQ ID NOS:42, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108 and 109, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0061]Additionally provided is an antibody, or functional fragment thereof, comprising a light chain polypeptide comprising one or more CDRs having at least one amino acid substitution in one or more light chain CDRs, the light chain CDRs selected from the group consisting of a light chain CDR1 selected from the group consisting of CDRs referenced as SEQ ID NOS:32, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 146, 149, 150, 151, 152 and 153; a light chain CDR2 referenced as SEQ ID NOS:34, 120, 121, 122, 123, 124 and 125; and a light chain CDR3 selected from the group consisting of CDRs referenced as SEQ ID NOS:36, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, and 145, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope.
[0062]As described above, an antibody of the invention can be generated from any combination of the variant and/or wild type CDRs, so long as binding activity to a cryptic collagen site is maintained. As disclosed herein, a variety of combinatorial antibodies containing multiple CDRs having at least a single amino acid substitution were identified having binding activity for a cryptic collagen site. In addition to antibodies containing any combination of the respective CDRs disclosed herein, the following specific combinations of CDRs are also provided by the invention.
[0063]Exemplary HUIV26 variants include, for example, the following antibodies:
[0064]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:28; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:20; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (4.1-2D4).
[0065]An antibody comprises a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:28; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:72; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (L1b-F11).
[0066]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:48; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:20; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (H2a-G8).
[0067]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:154; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:157; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomA2).
[0068]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:158; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomA4).
[0069]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:46; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:159; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomB1).
[0070]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:48; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:160; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomD2).
[0071]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:72; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomD3).
[0072]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:157; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomD6).
[0073]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:160; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomE3).
[0074]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:46; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:160; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomG2).
[0075]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:162; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:158; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomA7).
[0076]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:156; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:157; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomB10).
[0077]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:26; a heavy chain CDR2 referenced as SEQ ID NO:154; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:157; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomC8).
[0078]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:45; a heavy chain CDR2 referenced as SEQ ID NO:155; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:157; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomD7).
[0079]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:46; a heavy chain CDR2 referenced as SEQ ID NO:154; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:161; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomD11).
[0080]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:46; a heavy chain CDR2 referenced as SEQ ID NO:156; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:161; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (DcomE11).
[0081]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:46; a heavy chain CDR2 referenced as SEQ ID NO:28; a heavy chain CDR3 referenced as SEQ ID NO:63; a light chain CDR1 referenced as SEQ ID NO:20; a light chain CDR2 referenced as SEQ ID NO:22; and a light chain CDR3 referenced as SEQ ID NO:77 (2D4H1-C3).
[0082]Exemplary HUI77 variants include, for example, the following antibodies:
[0083]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:38; a heavy chain CDR2 referenced as SEQ ID NO:40; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:32; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (12F10Q).
[0084]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:38; a heavy chain CDR2 referenced as SEQ ID NO:92; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:32; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (QH2b-A3).
[0085]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:92; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:149; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1B6).
[0086]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:92; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:150; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1B8).
[0087]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:149; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1C3).
[0088]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:144; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:149; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1D3).
[0089]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:151; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1E3).
[0090]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain. CDR2 referenced as SEQ ID NO:92; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:151; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom1H6).
[0091]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:152; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:145 (Qcom1H7).
[0092]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:148; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:150; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom2A4).
[0093]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:115; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom2B11).
[0094]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:40; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:153; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom2C1).
[0095]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:92; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:116; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom2D9).
[0096]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:147; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:116; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qcom2E3).
[0097]An antibody comprising a heavy chain CDR1 referenced as SEQ ID NO:38; a heavy chain CDR2 referenced as SEQ ID NO:93; a heavy chain CDR3 referenced as SEQ ID NO:103; a light chain CDR1 referenced as SEQ ID NO:32; a light chain CDR2 referenced as SEQ ID NO:34; and a light chain CDR3 referenced as SEQ ID NO:36 (Qh2b-B7).
[0098]The invention also provides grafted antibodies containing CDRs derived from HUIV26 and HUI77, respectively. Such grafted CDRs include humanized antibodies, in which CDRs from HUIV26 or HUI77 have been grafted or in which a CDR containing one or more amino acid substitutions is grafted. The CDRs can be,grafted directly into a human framework, as disclosed herein. If desired, framework changes can also be incorporated by generating framework libraries. The optimization of CDRs and/or framework sequences can be performed independently and sequentially combined or can be performed simultaneously, as described in more detail below.
[0099]Thus, the invention additionally provides a grafted antibody in which HUIV26 CDRs (SEQ ID NOS:20, 22, 24, 26, 28 and 30) are grafted into a human framework sequence. Also provided is a grafted antibody in which HUI77 CDRs (SEQ ID NOS:32, 34, 36, 38, 40 and 42) are grafted into a human framework.
[0100]To generate grafted antibodies, donor CDRs of collagen-specific antibodies are grafted onto an antibody acceptor variable region framework. Methods for grafting antibodies and generating CDR variants to optimize activity have been described previously (WO 98/33919; WO 00/78815; WO 01/27160). The procedure can be performed to achieve grafting of donor CDRs and affinity reacquisition in a simultaneous process. The methods similarly can be used, either alone or in combination with CDR grafting, to modify or optimize the binding affinity of a variable region. The methods for conferring donor CDR binding affinity onto an acceptor variable region are applicable to both heavy and light chain variable regions and as such can be used to simultaneously graft and optimize the binding affinity of an antibody variable region.
[0101]The donor CDRs can be altered to contain a plurality of different amino acid residue changes at all or selected positions within the donor CDRs. For example, random or biased incorporation of the twenty naturally occurring amino acid residues, or preselected subsets, can be introduced into the donor CDRs to produce a diverse population of CDR species. Inclusion of CDR variant species into the diverse population of variable regions allows for the generation of variant species that exhibit optimized binding affinity for a predetermined antigen.
[0102]A range of possible changes can be made in the donor CDR positions. Some or all of the possible changes that can be selected for change can be introduced into the population of grafted donor CDRs. A single position in a CDR can be selected to introduce changes or a variety of positions having altered amino acids can be combined and screened for activity.
[0103]One approach is to change all amino acid positions along a CDR by replacement at each position with, for example, all twenty naturally occurring amino acids. The replacement of each position can occur in the context of other donor CDR amino acid positions so that a significant portion of the CDR maintains the authentic donor CDR sequence, and therefore, the binding affinity of the donor CDR. For example, an acceptor variable region framework, either a native or altered framework, can be grafted with a population of CDRs containing single position replacements at each position within the CDRs. Similarly, an acceptor variable region framework can be targeted for grafting with a population of CDRs containing more than one position changed to incorporate all twenty amino acid residues, or a subset of amino acids. One or more amino acid positions within a CDR, or within a group of CDRs to be grafted, can be altered and grafted into an acceptor variable region framework to generate a population of grafted antibodies. It is understood that a CDR having one or more altered positions can be combined with one or more other CDRs having one or more altered positions, if desired.
[0104]A population of CDR variant species having one or more altered positions can be combined with any or all of the CDRs which constitute the binding pocket of a variable region. Therefore, an acceptor variable region framework can be targeted for the simultaneous incorporation of donor CDR variant populations at one, two or all three recipient CDR locations in a heavy or light chain. The choice of which CDR or the number of CDRs to target with amino acid position changes will depend on, for example, if a full CDR grafting into an acceptor is desired or whether the method is being performed for optimization of binding affinity.
[0105]Another approach for selecting donor CDR amino acids to change for conferring donor CDR binding affinity onto an antibody acceptor variable region framework is to select known or readily identifiable CDR positions that are highly variable. For example, the variable region CDR3 is generally highly variable. This region therefore can be selectively targeted for amino acid position changes during grafting procedures to ensure binding affinity reacquisition or augmentation, either alone or together with relevant acceptor variable framework changes, as described herein.
[0106]If desired, CDR variant populations having one or more altered amino acid positions can be advantageously combined with a framework variant population having one or more altered amino acid positions. Such a combination can result in beneficial combinations of changes, which are identified by screening for an optimized activity.
[0107]The resultant population of CDR grafted variable regions therefore contain a species corresponding to the authentic parent amino acid residue at each position as well as a diverse number of different species which correspond to the possible combinations and permutations of the authentic parent amino acid residues together with the variant residues at each of the selected CDR positions. Such a diverse population of CDR grafted variable regions are screened for an altered variable region species which retains donor CDR binding activity, or which has optimized binding activity.
[0108]An acceptor can be selected so that it is closely similar to the variable region amino acid sequence harboring the donor CDRs. In addition, a variety of acceptors less closely related to the donor antibody can be used. Alternatively, a library of all possible or relevant changes in the acceptor framework can be made and then screened for those variable regions, or heteromeric binding fragments thereof, that maintain or exhibit increased binding affinity compared to the donor molecule. The donor CDRs can be grafted into a variety of naturally occurring acceptor frameworks or altered frameworks having one or more changes or even a library containing changes at one or more positions. Therefore, the applicability is not preconditioned on the availability or search for an acceptor framework variable region similar to that of the donor.
[0109]The methods for conferring donor CDR binding affinity onto a variable region can involve identifying the relevant amino acid positions in the acceptor framework that are known or predicted to influence a CDR conformation, or that are known or predicted to influence the spacial context of amino acid side chains within the CDR that participate in binding, and then generating a population of altered variable region species that incorporate a plurality of different amino acid residues at those positions. For example, the different amino acid residues at those positions can be incorporated either randomly or with a predetermined bias and can include all of the twenty naturally occurring amino acid residues at each of the relevant positions. Subsets, including less than all of the naturally occurring amino acids can additionally be chosen for incorporation at the relevant framework positions. Including a plurality of different amino acid residues at each of the relevant framework positions ensures that there will be at least one species within the population that will have framework changes which allows the CDRs to reacquire their donor binding affinity in the context of the acceptor framework variable region.
[0110]For humanizing an antibody, any of a variety of human frameworks can be selected for CDR grafting. For example, CDRs of HUIV26 or HUI77 can be cloned into a variety of human framework sequences. The frameworks can be generated using human germline genes encoding heavy and light chain variable regions as well as J regions to obtain human framework sequences for CDR grafting. Exemplary human framework nucleotide sequences include, for example, the framework sequences of DPK24 (VKIV) (SEQ ID NO:5), DP-54 (VHIII) (SEQ ID NO:7), DPK13 (VKII) (SEQ ID NO:13), DP-28 (VHII) (SEQ ID NO:15), as well as J regions JK1 (SEQ ID NO:217), JK2 (SEQ ID NO:218) and JH6 (SEQ ID NO:219). It is understood that framework regions from any available germline sequence can be combined with any available J sequence, as desired, to generate a human framework for grafting CDRs. For example, an alignment of mouse variable regions of HUIV26 and HUI77 with an exemplary human framework is shown in FIGS. 2C and 3C, respectively. A fusion of VKIV/JK2 light chain variable region and VHIII/JH6 heavy chain variable region are aligned with HUIV26 (FIG. 2C). A fusion of VKII/JK1 light chain variable region and VHIII/JH6 heavy chain variable region are aligned with HUI77 (FIG. 3C). An exemplary fusion of a germline and J region is shown in FIG. 3D, which is aligned with the HUI77 light chain. It is understood that any available human framework can be selected for CDR grafting and, if desired, optimized by the methods disclosed herein. As disclosed herein, CDRs having beneficial mutations can be grafted into a variety of frameworks and have retained or improved activity (see Example III).
[0111]Selection of the relevant framework amino acid positions to alter depends on a variety of criteria well known to those skilled it the art. One criteria for selecting relevant framework amino acids to change can be the relative differences in amino acid framework residues between the donor and acceptor molecules. Selection of relevant framework positions to alter using this approach is simple and has the advantage of avoiding any subjective bias in residue determination or any bias in CDR binding affinity contribution by the residue.
[0112]Another criteria that can be used for determining the relevant amino acid positions to change can be, for example, selection of framework residues that are known to be important or to contribute to CDR conformation. For example, canonical framework residues are important for CDR conformation or structure. Targeting of a canonical framework residue as a relevant position to change can identify a more compatible amino acid residue in context with its associated donor CDR sequence.
[0113]The frequency of an amino acid residue at a particular framework position is another criteria which can be used for selecting relevant framework amino acid positions to change. For example, comparison of the selected framework with other framework sequences within its subfamily can reveal residues that occur at minor frequencies at a particular position or positions. Such positions harboring less abundant residues are similarly applicable for selection as a position to alter in the acceptor variable region framework.
[0114]The relevant amino acid positions to change also can be selected, for example, based on proximity to a CDR. In certain contexts, such residues can participate in CDR conformation or antigen binding. Moreover, this criteria can similarly be used to prioritize relevant positions selected by other criteria described herein. Therefore, differentiating between residues proximal and distal to one or more CDRs is an efficient way to reduce the number of relevant positions to change.
[0115]Other criteria for selecting relevant amino acid framework positions to alter include, for example, residues that are known or predicted to reside in three dimensional space near the antigen-CDR interface or predicted to modulate CDR activity. Similarly, framework residues that are known or predicted to form contacts between the heavy (VH) and light (VL) chain variable region interface can be selected. Such framework positions can affect the conformation or affinity of a CDR by modulating the CDR binding pocket, antigen interaction or the VH and VL interaction. Therefore, selection of these amino acid positions for constructing a diverse population for screening of binding activity can be used to identify framework changes which replace residues having detrimental effects on CDR conformation or compensate for detrimental effects of residues occurring elsewhere in the framework.
[0116]Other framework residues that can be selected for alteration include amino acid positions that are inaccessible to solvent. Such residues are generally buried in the variable region and are therefore capable of influencing the conformation of the CDR or VH and VL interactions. Solvent accessibility can be predicted, for example, from the relative hydrophobicity of the environment created by the amino acid side chains of the polypeptide or by known three-dimensional structural data.
[0117]Following selection of relevant amino acid positions in the donor CDRs, as well as any relevant amino acid positions in the framework regions desired to be varied, amino acid changes at some or all of the selected positions can be incorporated into encoding nucleic acids for the acceptor variable region framework and donor CDRs. Altered framework or CDR sequences can be individually made and tested, or can be simultaneously combined and tested, if desired.
[0118]The variability at any or all of the altered positions can range from a few to a plurality of different amino acid residues, including all twenty naturally occurring amino acids or functional equivalents and analogues thereof.
[0119]Selection of the number and location of the amino acid positions to vary is flexible and can depend on the intended use and desired efficiency for identification of the altered variable region having a desirable activity such as substantially the same or greater binding affinity compared to the donor variable region. In this regard, the greater the number of changes that are incorporated into a altered variable region population, the more efficient it is to identify at least one species that exhibits a desirable activity, for example, substantially the same or greater binding affinity as the donor. Alternatively, where the user has empirical or actual data to the affect that certain amino acid residues or positions contribute disproportionally to binding affinity, then it can be desirable to produce a limited population of altered variable regions which focuses on changes within or around those identified residues or positions.
[0120]For example, if CDR grafted variable regions are desired, a large, diverse population of altered variable regions can include all the non-identical framework region positions between the donor and acceptor framework and all single CDR amino acid position changes. Alternatively, a population of intermediate diversity can include subsets, for example, of only the proximal non-identical framework positions to be incorporated together with all single CDR amino acid position changes. The diversity of the above populations can be further increased by, for example, additionally including all pairwise CDR amino acid position changes. In contrast, populations focusing on predetermined residues or positions which incorporate variant residues at as few as one framework and/or one CDR amino acid position can similarly be constructed for screening and identification of an altered antibody variable region of the invention. As with the above populations, the diversity of such focused populations can be further increased by additionally expanding the positions selected for change to include other relevant positions in either or both of the framework and CDR regions. There are numerous other combinations ranging from few changes to many changes in either or both of the framework regions and CDRs that can additionally be employed, all of which will result in a population of altered variable regions that can be screened for the identification of at least one CDR grafted altered variable region having desired activity, for example, binding activity to a cryptic collagen site. Those skilled in the art will know, or can determine, which selected residue positions in the framework or donor CDRs, or subsets thereof, can be varied to produce a population for screening and identification of an altered antibody of the invention given the teachings and guidance provided herein.
[0121]Simultaneous incorporation of all of the CDR encoding nucleic acids and all of the selected amino acid position changes can be accomplished by a variety of methods known to those skilled in the art, including for example, recombinant and chemical synthesis. For example, simultaneous incorporation can be accomplished by, for example, chemically synthesizing the nucleotide sequence for the acceptor variable region, fused together with the donor CDR encoding nucleic acids, and incorporating at the positions selected for harboring variable amino acid residues a plurality of corresponding amino acid codons.
[0122]One such method well known in the art for rapidly and efficiently producing a large number of alterations in a known amino acid sequence or for generating a diverse population of variable or random sequences is known as codon-based synthesis or mutagenesis. This method is the subject matter of U.S. Pat. Nos. 5,264,563 and 5,523,388 and is also described in Glaser et al. J. Immunology 149:3903 (1992). Briefly, coupling reactions for the randomization of, for example, all twenty codons which specify the amino acids of the genetic code are performed in separate reaction vessels and randomization for a particular codon position occurs by mixing the products of each of the reaction vessels. Following mixing, the randomized reaction products corresponding to codons encoding an equal mixture of all twenty amino acids are then divided into separate reaction vessels for the synthesis of each randomized codon at the next position. For the synthesis of equal frequencies of all twenty amino acids, up to two codons can be synthesized in each reaction vessel.
[0123]Variations to these synthesis methods also exist and include for example, the synthesis of predetermined codons at desired positions and the biased synthesis of a predetermined sequence at one or more codon positions. Biased synthesis involves the use of two reaction vessels where the predetermined or parent codon is synthesized in one vessel and the random codon sequence is synthesized in the second vessel. The second vessel can be divided into multiple reaction vessels such as that described above for the synthesis of codons specifying totally random amino acids at a particular position. Alternatively, a population of degenerate codons can be synthesized in the second reaction vessel such as through the coupling of NNG/T nucleotides where N is a mixture of all four nucleotides. Following synthesis of the predetermined and random codons, the reaction products in each of the two reaction vessels are mixed and then redivided into an additional two vessels for synthesis at the next codon position.
[0124]A modification to the above-described codon based synthesis for producing a diverse number of variant sequences can similarly be employed for the production of the variant populations described herein. This modification is based on the two vessel method described above, which biases synthesis toward the parent sequence and allows the user to separate the variants into populations containing a specified number of codon positions that have random codon changes.
[0125]Briefly, this synthesis is performed by continuing to divide the reaction vessels after the synthesis of each codon position into two new vessels. After the division, the reaction products from each consecutive pair of reaction vessels, starting with the second vessel, is mixed. This mixing brings together the reaction products having the same number of codon positions with random changes. Synthesis proceeds by then dividing the products of the first and last vessel and the newly mixed products from each consecutive pair of reaction vessels and redividing into two new vessels. In one of the new vessels, the parent codon is synthesized and in the second vessel, the random codon is synthesized. For example, synthesis at the first codon position entails synthesis of the parent codon in one reaction vessel and synthesis of a random codon in the second reaction vessel. For synthesis at the second codon position, each of the first two reaction vessels is divided into two vessels yielding two pairs of vessels. For each pair, a parent codon is synthesized in one of the vessels and a random codon is synthesized in the second vessel. When arranged linearly, the reaction products in the second and third vessels are mixed to bring together those products having random codon sequences at single codon positions. This mixing also reduces the product populations to three, which are the starting populations for the next round of synthesis. Similarly, for the third, fourth and each remaining position, each reaction product population for the preceding position are divided and a parent and random codon synthesized.
[0126]Following the above modification of codon-based synthesis, populations containing random codon changes at one, two, three and four positions as well as others can be conveniently separated out and used based on the need of the individual. Moreover, this synthesis scheme also allows enrichment of the populations for the randomized sequences over the parent sequence since the vessel containing only the parent sequence synthesis is similarly separated out from the random codon synthesis.
[0127]Other methods well known in the art for producing a large number of alterations in a known amino acid sequence or for generating a diverse population of variable or random sequences include, for example, degenerate or partially degenerate oligonucleotide synthesis. Codons specifying equal mixtures of all four nucleotide monomers, represented as NNN, results in degenerate synthesis. Whereas partially degenerate synthesis can be accomplished using, for example, the NNG/T codon described previously. Other methods well known in the art can alternatively be used such as the use of statistically predetermined, or varigated, codon synthesis, which is the subject matter of U.S. Pat. Nos. 5,223,409 and 5,403,484.
[0128]Once the populations of altered variable region encoding nucleic acids have been constructed as described above, they can be expressed to generate a population of altered variable region polypeptides that can be screened for binding affinity. For example, the altered variable region encoding nucleic acids can be cloned into an appropriate vector for propagation, manipulation and expression. Such vectors are known or can be constructed by those skilled in the art and should contain all expression elements sufficient for the transcription, translation, regulation, and if desired, sorting and secretion of the altered variable region polypeptides. The vectors can be suitable for expression in either procaryotic or eukaryotic host systems so long as the expression and regulatory elements function in the respective host system. The expression vectors can additionally include regulatory elements for inducible or cell type-specific expression. One skilled in the art will know which host systems are compatible with a particular vector and which regulatory or functional elements are sufficient to achieve expression of the polypeptides in soluble, secreted or cell surface forms.
[0129]Appropriate host cells, include for example, bacteria and corresponding bacteriophage expression systems, yeast, avian, insect and mammalian cells. Methods for recombinant expression, screening and purification of populations of altered variable regions or altered variable region polypeptides within such populations in various host systems are well known in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1992) and in Ausubel et al., Current Protocols in Molecular Biology, (Supplement 54), John Wiley & Sons, New York (2001). The choice of a particular vector and host system for expression and screening of altered variable regions are known to those skilled in the art and will depend on the preference of the user. Moreover, expression of diverse populations of hetereomeric receptors in either soluble or cell surface form using filamentous bacteriophage vector/host systems is well known in the art and is the subject matter of U.S. Pat. No. 5,871,974.
[0130]The expressed population of altered variable region polypeptides can be screened for the identification of one or more altered variable region species exhibiting optimized binding activity, for example, binding affinity substantially the same or greater than the donor CDR variable region. Screening can be accomplished using various methods well known in the art for determining the binding affinity of a polypeptide or compound. Additionally, methods based on determining the relative affinity of binding molecules to their partner by comparing the amount of binding between the altered variable region polypeptides and the donor CDR variable region can similarly be used for the identification of species exhibiting binding affinity substantially the same or greater than the donor CDR variable region. All of such methods can be performed, for example, in solution or in solid phase. Moreover, various formats of binding assays are well known in the art and include, for example, immobilization to filters such as nylon or nitrocellulose; two-dimensional arrays, enzyme linked immunosorbant assay (ELISA), radioimmunoassay (RIA), panning and plasmon resonance. Such methods can be found described in, for example, Harlow and Lane, supra, 1988.
[0131]For the screening of populations of polypeptides such as the altered variable region populations produced by the methods of the invention, immobilization of the populations of altered variable regions to filters or other solid substrate can be advantageous because large numbers of different species can be efficiently screened for antigen binding. Such filter lifts allow for the identification of altered variable regions that exhibit substantially the same or greater binding affinity compared to the donor CDR variable region. Alternatively, if the populations of altered variable regions are expressed on the surface of a cell or bacteriophage, panning on immobilized antigen can be used to efficiently screen for variants having antigen binding activity or to determine the relative binding affinity of species within the population.
[0132]Another affinity method for screening populations of altered variable regions polypeptides is a capture lift assay that is useful for identifying a binding molecule having selective affinity for a ligand (Watkins et. al., (1997); WO 99/06834). This method employs the selective immobilization of altered variable regions to a solid support and then screening of the selectively immobilized altered variable regions for selective binding interactions against the cognate antigen or binding partner. Selective immobilization functions to increase the sensitivity of the binding interaction being measured since initial immobilization of a population of altered variable regions onto a solid support reduces non specific binding interactions with irrelevant molecules or contaminants which can be present in the reaction.
[0133]Another method for screening populations or for measuring the affinity of individual altered variable region polypeptides is through surface plasmon resonance (SPR). This method is based on the phenomenon which occurs when surface plasmon waves are excited at a metal/liquid interface. Light is directed at, and reflected from, the side of the surface not in contact with sample, and SPR causes a reduction in the reflected light intensity at a specific combination of angle and wavelength. Biomolecular binding events cause changes in the refractive index at the surface layer, which are detected as changes in the SPR signal. The binding event can be either binding association or disassociation between a receptor-ligand pair. The changes in refractive index can be measured essentially instantaneously and therefore allows for determination of the individual components of an affinity constant. More specifically, the method enables accurate measurements of association rates (kon) and disassociation rates (koff).
[0134]Measurements of kon and koff values can be used identify altered variable regions or optimized variable regions that are therapeutically more efficacious. For example, an altered variable region, or heteromeric binding fragment thereof, can be more efficacious because it has, for example, a higher kon valued compared to variable regions and heteromeric binding fragments that exhibit similar binding affinity. Increased efficacy is conferred because molecules with higher kon values can specifically bind and inhibit their target at a faster rate. Similarly, a molecule of the invention can be more efficacious because it exhibits a lower koff value compared to molecules having similar binding affinity. Increased efficacy observed with molecules having lower koff rates can be observed because, once bound, the molecules are slower to dissociate from their target. Although described with reference to the altered variable regions and optimized variable regions of the invention, the methods described above for measuring association and dissociation rates are applicable to essentially any antibody or fragment thereof for identifying more effective binders for therapeutic or diagnostic purposes.
[0135]Methods for measuring the affinity, including association and dissociation rates using surface plasmon resonance are well known in the art and can be found described in, for example, Jonsson and Malmquist, Advances in Biosensors, 2:291-336 (1992) and Wu et al. Proc. Natl. Acad. Sci. USA, 95:6037-6042 (1998). Moreover, one apparatus well known in the art for measuring binding interactions is a BIAcore 2000 instrument which is commercially available through Pharmacia Biosensor, (Uppsala, Sweden).
[0136]Using any of the above described screening methods, as well as others well known in the art, an altered variable region having optimized binding activity, for example, binding affinity substantially the same or greater than the donor CDR variable region is identified by detecting the binding of at least one altered variable region within the population to its antigen or cognate ligand. In addition to optimizing for antigen binding activity, catalytic activity can also be included in an invention antibody and optimized using the methods disclosed herein for binding affinity optimization. Accordingly, the above methods can be modified to include the addition of substrate and reactants to screen for optimized catalytic activity. Comparison, either independently or simultaneously in the same screen, with the donor variable region will identify those binders that have substantially the same or greater binding affinity as the donor. Those skilled in the art will know, or can determine using the donor variable region, binding conditions which are sufficient to identify selective interactions over non-specific binding.
[0137]Detection methods for identification of binding species within the population of altered variable regions can be direct or indirect and can include, for example, the measurement of light emission, radioisotopes, colorimetric dyes and fluorochromes. Direct detection includes methods that function without intermediates or secondary measuring procedures to assess the amount of bound antigen or ligand. Such methods generally employ ligands that are themselves labeled with a detectable moiety, for example, a radioactive, light emitting, fluorescent, colorimetric or enzyme moiety. In contrast, indirect detection includes methods that function through an intermediate or secondary measuring procedure. These methods generally employ molecules that specifically react with the antigen or ligand and can themselves be directly labeled with a detectable moiety or detected by a secondary reagent. For example, an antibody specific for a ligand can be detected using a secondary antibody capable of interacting with the first antibody specific for the ligand, again using the detection methods described above for direct detection. Moreover, for the specific example of screening for catalytic antibodies, the disappearance of a substrate or the appearance of a product can be used as an indirect measure of binding affinity or catalytic activity.
[0138]Isolated variable regions exhibit binding affinity as single chains, in the absence of assembly into a heteromeric structure with their respective VH or VL subunits. As such, populations of VH and VL altered variable regions polypeptides can be expressed alone and screened for binding activity, for example, optimized activity having substantially the same or greater binding affinity compared to the CDR donor VH or VL variable region. Alternatively, populations of VH and VL altered variable regions polypeptides can be coexpressed so that they self-assemble into heteromeric altered variable region binding fragments. The heteromeric binding fragment population can then be screened for species exhibiting binding affinity substantially the same or greater than the CDR donor variable region binding fragment.
[0139]Employing the methods for simultaneously grafting and optimizing, or for optimizing, it is possible to generate heteromeric variable region binding fragments having increases in affinities of greater than about 2-fold, 3-fold, 4-fold, 5-fold, 8-fold or 10-fold. In particular, heteromeric variable region binding fragments can be generated having increases in affinities of greater than 12-fold, 15-fold, 20-fold, and 25-fold as well as affinities greater than 50-fold, 100-fold, 200-fold, 500-fold or 1000-fold compared to the donor or parent molecule.
[0140]Additionally, the methods described herein for optimizing are also are applicable for producing catalytic heteromeric variable region fragments or for optimizing their catalytic activity. Catalytic activity can be optimized by changing, for example, the on or off rate of substrate binding, the substrate binding affinity, the transition state binding affinity, the turnover rate (kcat) or the Km. Methods for measuring these characteristics are well known in the art (see, for example Segel, Enzyme Kinetics, John Wiley & Sons, New York (1975)). Such methods can be employed in the screening steps of the methods described above when used for optimizing the catalytic activity of a heteromeric variable region binding fragment.
[0141]Additionally, the methods for conferring donor CDR binding affinity onto an antibody acceptor variable region framework are applicable for grafting CDRs as described by Kabat et al., supra, Chothia et al., supra or MacCallum et al., supra. The methods similarly can be used for grafting into an acceptor framework overlapping regions or combinations of CDRs as described in Kabat et al., supra, Chothia et al., supra or MacCallum et al., supra. Generally, variable region CDRs are grafted by identifying the boundaries described by one of the CDR definitions known in the art and set forth herein. However, because the methods are directed to constructing and screening populations of CDR grafted altered variable regions, which can incorporate relevant amino acid position changes in both the framework and CDR regions, and such variations can, for example, compensate or augment amino acid changes elsewhere in the variable region, the exact boundary of a particular CDR or set of variable region CDRs can be varied. Therefore, the exact CDR region to graft, whether it is the region described by Kabat et al., Chothia et al. or MacCallum et al., or any combination thereof, will essentially depend on the preference of the user.
[0142]Similarly, the methods described previously for optimizing the binding affinity of an antibody also are applicable for use with essentially any variable region for which an encoding nucleic acid is, or can be made, available. As with the methods for conferring donor CDR binding affinity, many applications of the methods for optimizing binding affinity will be for modifying the binding affinity of CDR grafted variable regions having human frameworks. Again, such molecules are significantly less antigenic in human patients and therefore therapeutically valuable in the treatment of human diseases. However, the methods of the invention for optimizing the binding affinity of a variable region are applicable to all species of variable regions. Therefore, the invention includes binding affinity optimization of variable regions derived from human, mouse, rat, rabbit, goat and chicken, or any other desired species.
[0143]The methods of the invention have been described with reference to variable regions and heteromeric variable region binding fragments. Those skilled in the art will understand that all of such methods are applicable to whole antibodies and functional fragments thereof as well as to regions and functional domains other than the antigen binding variable region of antibodies, if desired.
[0144]An association rate can be determined in any non-equilibrium mixture including, for example, one formed by rapidly contacting a binding polypeptide and ligand or by rapidly changing temperature. A non-equilibrium mixture can be a pre-equilibrium mixture. A pre-equilibrium mixture can be formed, for example, by contacting a soluble binding polypeptide and soluble ligand in a condition where the amount of total ligand and total binding polypeptide in the detection chamber are constant. Measurements of association rates in pre-equilibrium mixtures can be made in formats providing rapid mixing of binding polypeptide with ligand and rapid detection of changing properties of the binding polypeptide or ligand on a timescale of milliseconds or faster. Stopped flow and rapid quench flow instruments such as those described below provide a convenient means to measure non-equilibrium kinetics. The association rate can also be measured in non-equilibrium mixtures including, for example, solutions containing insoluble species of binding polypeptide, ligand or binding polypeptide bound to ligand, or solutions containing variable concentrations of total ligand or total binding polypeptide. Measurement of an association rate in a non-equilibrium mixture can be made in formats providing attachment of a ligand to a surface and continuous flow of a solution containing the binding polypeptide over the surface, or vice-versa, combined with rapid detection of changing properties of the binding polypeptide, ligand or surface such that measurements are made on a timescale of milliseconds or faster. Examples of formats providing non-equilibrium measurement of association rates include surface plasmon resonance instruments and evanescent wave instruments.
[0145]Association rate measurements can be made by detecting the change in a property of the binding polypeptide or ligand that exists between the bound and unbound state or by detecting a change in the surrounding environment when binding polypeptide and ligand associate. Properties of the binding polypeptide or ligand that can change upon association and that can be used to measure association rates include, for example, absorption and emission of heat, absorption and emission of electromagnetic radiation, affinity for a receptor, molecular weight, density, mass, electric charge, conductivity, magnetic moment of nuclei, spin state of electrons, polarity, molecular shape, or molecular size. Properties of the surrounding environment that can change when binding polypeptide associates with ligand include, for example, temperature and refractive index of surrounding solvent.
[0146]Formats for measuring association rates in pre-equilibrium mixtures include, for example, stopped flow kinetic instruments and rapid quench flow instruments. A stopped flow instrument can be used to push solutions containing a binding polypeptide and ligand from separate reservoirs into a mixing chamber just prior to passage into a detection cell. The instrument can then detect a change in one or more of the above described properties to monitor progress of the binding event. A rapid quench flow instrument can be used to rapidly mix a solution containing a binding polypeptide with a solution containing a ligand followed by quenching the binding reaction after a finite amount of time. A change in one or more of the above described properties can then be detected for quenched mixtures produced by quenching at different times following mixing. Quenching can be performed for example by freezing or addition of a chemical quenching agent so long as the quenching step does not inhibit detection of the property relied upon for measurement of binding rate. Thus, a rapid quench instrument can be useful, for example, in situations where spectroscopic detection is not convenient. A variety of instruments are commercially available from vendors such as KinTek Corp. (State College, Pa.) and Hi-Tech Scientific (Salisbury, UK).
[0147]Formats for measuring association rates in non-equilibrium mixtures include, for example, surface plasmon resonance and evanescent wave instruments. Surface plasmon resonance and evanescent wave technology utilize a ligand or binding polypeptide attached to a biosensor surface and a solution containing either the binding polypeptide or ligand respectively that is passed over the biosensor surface. The change in refractive index of the solution that occurs at the surface of a chip when binding polypeptide associates with ligand can be measured in a time dependent fashion. For example, surface plasmon resonance is based on the phenomenon which occurs when surface plasmon waves are excited at a metal/liquid interface. Light is directed at, and reflected from, the side of the surface not in contact with sample, and SPR causes a reduction in the reflected light intensity at a specific combination of angle and wavelength. Biomolecular binding events cause changes in the refractive index at the surface layer, which are detected as changes in the SPR signal. The binding event can be either binding association or disassociation between a receptor-ligand pair. The changes in refractive index can be measured essentially instantaneously and therefore allows for determination of the individual components of an affinity constant. More specifically, the method enables accurate measurements of association rates (kon) and disassociation rates (koff). Surface plasmon resonance instruments are available in the art including, for example, the BIAcore instrument, IBIS system, SPR-CELLIA system, Spreeta, and Plasmon SPR and evanescent wave technology is available in the Iasys system as described, for example, in Rich and Myszka, Curr. Opin. Biotech. 11:54-61 (2000).
[0148]Another method for measuring binding affinity includes comparative ELISA. As disclosed herein, an approximation of changes in affinity based on shifts in half-maximal binding was used to identify kon and koff values relative to wild type (Example III). Such a method is particularly useful for screening large numbers of variants, whereas the above-described methods can be used for detailed analysis of binding activity.
[0149]The association rate can be determined by measuring a change in a property, of a ligand or binding polypeptide at one or more discreet time intervals during the binding event using, for example, the methods described above. Measurements determined at discreet time intervals during the binding event can be used to determine a quantitative measure of association rate or a relative measure of association rate. Quantitative measures of association rate can include, for example, an association rate value or kon value. Quantitative values of association rate or kon can be determined from a mathematical or graphical analysis of a time dependent measurement. Such analyses are well known in the art and include algorithms for fitting data to a sum of exponential or linear terms or algorithms for computer simulation to fit data to a binding model as described for example in Johnson, Cur. Opin. Biotech. 9:87-89 (1998), which is incorporated herein by reference.
[0150]Association rates can be determined from mixtures containing insoluble species or variable concentrations of total ligand or total binding polypeptide using mathematical and graphical analyses such as those described above if effects of mass transport are accounted for in the reaction. One skilled in the art can account for mass transport by comparing association rates under conditions having similar limitations with respect to mass transport or by adjusting the calculated association rate according to models available in the art including, for example those described in Myszka et al., Biophys. J. 75:583-594 (1998), which is incorporated herein by reference.
[0151]A higher value of either the association rate or kon is generally indicative of improved therapeutic potency. Thus, quantitative determinations provide an advantage by allowing comparison between an association rate of a binding polypeptide and a therapeutic control determined by different methods so long as the methods used are understood by one skilled in the art to yield consistent results.
[0152]A relative measure of association rate can include, for example, comparison of association rate for two or more binding polypeptides binding to ligand under similar conditions or comparison of association rate for a binding polypeptide binding to ligand with a predefined rate. Comparison of association rate for two or more binding polypeptides can include a standard of known association rate or a molecule of known therapeutic effect. A predefined rate used for comparison can be determined by calibrating the measurement relative to a previously measured rate including, for example, one available in the scientific literature or in a database. An example of a comparison with a predefined rate is selection of the species of binding polypeptide bound to ligand at a discreet time interval defined by the predefined rate by using a time actuated selection device.
[0153]For purposes of comparison, the association rate of a binding polypeptide and ligand can be determined relative to association rate for a therapeutic control and the same ligand. A comparison can also be made according to a quantitative association rate for binding polypeptide and ligand compared to a quantitative association rate for a therapeutic control and ligand. Relative or quantitative association rates can be determined by the methods described above. Determination of association rates for a binding polypeptide associating with a ligand can be performed simultaneously with a binding polypeptide and therapeutic control or at separate times, provided conditions are sufficiently similar in each assay to allow valid comparison. Thus, association rate determined for a binding polypeptide can be compared to a previously measured association rate for a therapeutic control.
[0154]A binding polypeptide having improved therapeutic potency can be distinguished from a binding polypeptide that has an increased Ka for a ligand but not improved therapeutic potency. Methods for identifying a therapeutic binding polypeptide based on Ka rely on an equilibrium measurement which, absent time dependent measurements made in a non-equilibrium condition, are inaccurate for identifying a binding polypeptide having increased association rate and therefore improved therapeutic potency. According to the relationship Ka=kon/koff, an increased Ka for association of a binding polypeptide and ligand can be due to changes in kon or koff. For example, a binding polypeptide having improved therapeutic potency can have a reduced Ka if a reduction in Koff occurs that over compensates for an increase in kon. Thus, changes in Ka, being influenced by changes in koff, do not unambiguously correlate with changes in therapeutic potency since binding polypeptides having improved therapeutic potency can display either reduced or increased Ka.
[0155]For optimization of binding activity of an antibody of the invention, the fold increase in association rate can be indicated by an increase in kon. Therefore, kon can be about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10 fold or more using methods described herein. The kon can be at least about 1×102 M-1s-1, 2×102 M-1s-1, 5×102 M-1s-1, 1×103 M-1s-1, 2×103 M-1s-1, 5×103 M-1s-1, 1×104 M-1s-1, 2×104 M-1s-1, 5×104 M-1s-1, 1×105 M-1s-1, 2×105 M-1s-1, or 3×105 M-1s-1. The kon can also be increased to at least about 5×105 M-1s-1, 7×105 M-1s-1, 9×105 M-1s-1, 1×106 M-1s-1, 3×106 M-1s-1, 5×106 M-1s-1, 7×106 M-1s-1, 9×106 M-1s-1 or 1×107 M-1s-1 or more. Furthermore, the increase in kon resulting in improved therapeutic potency can be independent of an effect of a change in Ka for the binding polypeptide. The binding polypeptide having an increase in kon can have a Ka value similar to Ka for its parent polypeptide or a Ka value lower than Ka for its parent polypeptide.
[0156]The invention also provides nucleic acids encoding the antibodies and CDRs of the invention. The invention further provides nucleic acids encoding the mouse antibodies HUIV26 (SEQ ID NOS:1 and 3) and HUI77 (SEQ ID NOS:5 and 7) (see FIGS. 2 and 3). Further provided are nucleic acids encoding HUIV26 CDRs (SEQ ID NOS:20, 22, 24, 26, 28 and 30) and encoding HUI77 CDRs (SEQ ID NOS:32, 34, 36, 38, 40 and 42). Such nucleic acids include nucleic acids having degenerate codons encoding any or all of the amino acids in the CDRs. For example, the invention provides nucleic acids encoding HUIV26 CDRs: VL CDR1, SEQ ID NOS:19; VL CDR2, SEQ ID NO:21; VL CDR3, SEQ ID NO:23; VH CDR1, SEQ ID NO:25; VH CDR2, SEQ ID NO:27; and VH CDR3, SEQ ID NO:29. The invention also provides nucleic acids encoding HUI77 CDRs: VL CDR1, SEQ ID NOS:31; VL CDR2, SEQ ID NO:33; VL CDR3, SEQ ID NO:35; VH CDR1, SEQ ID NO:37; VH CDR2, SEQ ID NO:39; and VH CDR3, SEQ ID NO:41. Also included are degenerate versions of such nucleic acids such that they encode the amino acid sequences referenced as SEQ ID NOS:20, 22, 24, 26, 28 and 30 for HUIV26 and SEQ ID NOS:32, 34, 36, 38, 40 and 42 for HUI77.
[0157]Further provided are nucleic acids encoding a HUIV26 or HUI77 CDR containing one or more amino acid substitutions. For example, the invention provides nucleic acids encoding the CDRs of HUIV26 and HUI77 having single or multiple amino acid substitutions, as disclosed herein. If a nucleic acid encoding a CDR having one or more amino acid substitution is derived, for example, from one of SEQ ID NOS:19, 21, 23, 25, 27 or 29 for HUIV26 or SEQ ID NOS:31, 33, 35, 37, 39 or 41 for HUI77, the amino acid substitutions can be encoded by any of the corresponding degenerate codons for that amino acid. Nucleic acids encoding such CDR variants can also include degenerate codons at any or all of the wild type amino acid positions.
[0158]Throughout the application, various nucleic acids and oligonucleotide primers, in addition to the naturally occurring nucleotides A, C; G, T or U, refer to standard abbreviations: R=G or A; Y=T/U or C; M=A or C; K=G or T/U; S=G or C; W=A or T/U; B=G, C or T/U; D=A, G or T/U; H=A, C or T/U; V=A, G or C; N=any nucleotide.
[0159]The antibodies of the invention have binding activity for a cryptic collagen epitope. The HUIV26 and HUI77 antibodies have been shown to target to angiogenic vasculature (see Xu et al., supra, 2001; WO 00/40597). Accordingly, the grafted HUIV26 and HUI77 antibodies of the invention, which specifically bind to a cryptic collagen epitope, similarly can target to angiogenic vasculature. One of the most significant and important aspects of the monoclonal antibodies HUIV26 and HUI77, and the grafted forms thereof disclosed herein, is that of their specificity. It is expected that systemic administration of antibodies of the invention will have minimal if any toxic side effects since the cryptic epitope(s) that is recognized by the HUIV26 and HUI77 antibodies is/are not exposed in mature native triple helical collagen but is only exposed upon denaturation, for example, heat denaturation or proteolytic denaturation. Thus, little, if any, binding under normal physiological conditions is expected.
[0160]Moreover, the cryptic collagen domain(s) to which HUIV26 and HUI77 bind represents a novel therapeutic target for the treatment of numerous neovascular diseases including tumor growth and metastasis, diabetic retinopathy and other related ocular diseases such as macular degeneration, psoriasis, and rheumatoid arthritis. Other exemplary diseases associated with angiogenesis include, but are not limited to, inflammatory disorders such as immune and non-immune inflammation, chronic articular rheumatism and psoriasis, disorders associated with inappropriate or inopportune invasion of vessels such as diabetic retinopathy, neovascular glaucoma, restenosis, capillary proliferation in atherosclerotic plaques and osteoporosis, and cancer associated disorders, such as solid tumors, solid tumor metastases, angiofibromas, retrolental fibroplasia, hemangiomas, Kaposi's sarcoma and the like cancers which require neovascularization to support tumor growth. Other exemplary tumors include melanoma, carcinoma, sarcoma, fibrosarcoma, glioma and astrocytoma, and the like.
[0161]Thus, the methods of the invention can be used to treat an individual having a disease associated with angiogenesis, including those described above. The methods can be used to ameliorate a sign or symptom associated with a disease. For example, in the case of cancer treatment, the methods can be used to inhibit tumor growth. One skilled in the art will know or can readily determine an appropriate sign or symptom associated with a disease suitable for determining the effectiveness of a therapeutic application using an antibody of the invention.
[0162]The antibodies of the invention can also be used as an important diagnostic and imaging reagent for the early detection of aberrant neovascularization associated with invasive tumor growth and metastasis. The antibodies of the invention can also be used in staging and grading of tumors since invasive tumor in contrast to benign lesions are likely to be associated with degradation of the surrounding basement membrane.
[0163]Thus, the invention provides a method of targeting angiogenic vasculature, comprising administering an antibody, or functional fragment thereof, the antibody or functional fragment thereof having specific binding activity for a cryptic collagen epitope, wherein the antibody or functional fragment is an antibody of the invention. For example, the antibodies can comprise one or more CDRs, including wild type CDRs or variants thereof, of the HUIV26 and HUI77 antibodies, as disclosed herein. The methods of targeting angiogenic vasculature can be used for therapeutic and/or diagnostic purposes.
[0164]For therapeutic purposes, the antibody, or functional fragment thereof, can be administered as a therapeutic agent itself or can further comprise a therapeutic moiety. In the case of a therapeutic moiety, the moiety can be a drug such as a chemotherapeutic agent, cytotoxic agent, toxin, or anti angiogenic agent, which refers to a molecule that reduces or inhibits angiogenesis. For example, a cytotoxic agent can be a radionuclide or chemical compound. Exemplary radionuclides useful as therapeutic agents include, for example, X-ray or γ-ray emitters. In addition, a moiety can be a drug delivery vehicle such as a chambered microdevice, a cell, a liposome or a virus, which can contain an agent such as a drug or a nucleic acid.
[0165]Exemplary therapeutic agents include, for example, the anthracyclin, doxorubicin, which has been linked to antibodies and the antibody/doxorubicin conjugates have been therapeutically effective in treating tumors (Sivam et al., Cancer Res. 55:2352-2356 (1995); Lau et al., Bioorg. Med. Chem. 3:1299-1304 (1995); Shih et al., Cancer Immunol. Immunother. 38:92-98 (1994)). Similarly, other anthracyclins, including idarubicin and daunorubicin, have been chemically conjugated to antibodies, which have delivered effective doses of the agents to tumors (Rowland et al., Cancer Immunol. Immunother. 37:195-202 (1993); Aboud-Pirak et al., Biochem. Pharmacol. 38:641-648 (1989)).
[0166]In addition to the anthracyclins, alkylating agents such as melphalan and chlorambucil have been linked to antibodies to produce therapeutically effective conjugates (Rowland et al., Cancer Immunol. Immunother. 37:195-202 (1993); Smyth et al., Immunol. Cell Biol. 65:315-321 (1987)), as have vinca alkaloids such as vindesine and vinblastine (Aboud-Pirak et al., supra, 1989; Starling et al., Bioconj. Chem. 3:315-322 (1992)). Similarly, conjugates of antibodies and antimetabolites such as 5-fluorouracil, 5 fluorouridine and derivatives thereof have been effective in treating tumors (Krauer et al., Cancer Res. 52:132-137 (1992); Henn et al., J. Med. Chem. 36:1570-1579 (1993)). Other chemotherapeutic agents, including cis-platinum (Schechter et al., Int. J. Cancer 48:167-172 (1991)), methotrexate (Shawler et al., J. Biol. Resp. Mod. 7:608 618 (1988); Fitzpatrick and Garnett, Anticancer Drug Des. 10:11-24 (1995)) and mitomycin-C (Dillman et al., Mol. Biother. 1:250-255 (1989)) also are therapeutically effective when administered as conjugates with various different antibodies. A therapeutic agent can also be a toxin such as ricin.
[0167]A therapeutic agent can also be a physical, chemical or biological material such as a liposome, microcapsule, micropump or other chambered microdevice, which can be used, for example, as a drug delivery system. Generally, such microdevices, should be nontoxic and, if desired, biodegradable. Various moieties, including microcapsules, which can contain an agent, and methods for linking a moiety, including a chambered microdevice, to an antibody of the invention are well known in the art and commercially available (see, for example, "Remington's Pharmaceutical Sciences" 18th ed. (Mack Publishing Co. 1990), chapters 89-91; Harlow and Lane, Antibodies: A laboratory manual (Cold Spring Harbor Laboratory Press 1988)).
[0168]For diagnostic purposes the antibody, or functional fragment thereof, can further comprise a detectable moiety. A detectable moiety can be, for example, a radionuclide, fluorescent, magnetic, colorimetric moiety, and the like. For in vivo diagnostic purposes, a moiety such as a gamma ray emitting radionuclide, for example, indium-111 or technitium 99, can be linked to an antibody of the invention and, following administration to a subject, can be detected using a solid scintillation detector. Similarly, a positron emitting radionuclide such as carbon-11 or a paramagnetic spin label such as carbon-13 can be linked to the molecule and, following administration to a subject, the localization of the moiety can be detected using positron emission transaxial tomography or magnetic resonance imaging, respectively. Such methods can identify a primary tumor as well as a metastatic lesion.
[0169]For diagnostic purposes, the antibodies of the invention can be used to determine the levels of denatured collagen in a tissue or in a bodily fluid. The level of denatured collagen can be determined in a tissue sample obtained from an individual, for example, by tissue biopsy. Exemplary bodily fluids include, but are not limited to, serum, plasma, urine, synovial fluid, and the like.
[0170]The invention also provides a method of inhibiting angiogenesis by administering an antibody, or functional fragment thereof, where the antibody or functional fragment thereof has specific binding activity for a cryptic collagen epitope, where the antibody comprises one or more CDRs of the invention. For example, an antibody of the invention can be administered so that angiogenesis is inhibited in a tissue of an individual. The invention further provides a method of targeting a tumor by administering an invention antibody. The invention also provides a method of inhibiting tumor growth by administering an antibody, or functional fragment thereof, of the invention.
[0171]The antibodies of the invention can also be used for in vivo or in vitro diagnostic applications. Thus, the invention provides a method of detecting angiogenic vasculature by contacting angiogenic vasculature with an antibody, or functional fragment thereof, of the invention. Angiogenic vasculature can be imaged in vivo by administering an antibody of the invention, either alone or attached to a detectable moiety, to an individual. The angiogenic vasculature can thus be detected in vivo. Alternatively, the antibody can be administered to a tissue obtained from an individual, for example, a tissue biopsy, such that an antibody of the invention can be used in vitro for diagnostic purposes to detect angiogenic vasculature.
[0172]A therapeutic or detectable moiety can be coupled to an antibody of the invention, or functional fragment thereof, by any of a number of well known methods for coupling or conjugating moieties. It is understood that such coupling methods allow the attachment of a therapeutic or detectable moiety without interfering or inhibiting the binding activity of the antibody, that is, the ability to bind a cryptic collagen site. Methods for conjugating moieties to an antibody of the invention, or functional fragment thereof, are well known to those skilled in the art (see, for example, Hermanson, Bioconjugate Techniques, Academic Press, San Diego (1996)).
[0173]When administered to a subject, the antibody of the invention is administered as a pharmaceutical composition containing, for example, the antibody and a pharmaceutically acceptable carrier. As disclosed herein, the antibody can be coupled to a therapeutic or detectable moiety. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions such as water or physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, oils such as olive oil or injectable organic esters.
[0174]A pharmaceutically acceptable carrier can contain physiologically acceptable compounds that act, for example, to stabilize or to increase the absorption of the conjugate. Such physiologically acceptable compounds include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients. One skilled in the art will know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the composition. The pharmaceutical composition also can contain an agent such as a cancer therapeutic agent.
[0175]One skilled in the art will know that a pharmaceutical composition containing an antibody of the invention can be administered to a subject by various routes including, for example, orally or parenterally, such as intravenously. The composition can be administered by injection or by intubation. The pharmaceutical composition also can be an antibody linked to liposomes or other polymer matrices, which can have incorporated therein, for example, a drug such as a chemotherapeutic agent (Gregoriadis, Liposome Technology, Vols. I to III, 2nd ed. (CRC Press, Boca Raton, Fla. (1993), which is incorporated herein by reference). Liposomes, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.
[0176]For diagnostic or therapeutic methods disclosed herein, an effective amount of the antibody and therapeutic moiety is administered to the subject. As used herein, the term "effective amount" means the amount of the pharmaceutical composition that produces the desired effect. An effective amount often will depend on whether the antibody itself is administered or whether the antibody is linked to a moiety and the type of moiety. Thus, a lesser amount of a radiolabeled molecule can be required for imaging as compared to the amount of a radioactive drug/antibody conjugate administered for therapeutic purposes. An effective amount of a particular antibody/moiety for a specific purpose can be determined using methods well known to those in the art. One skilled in the art can readily determine an appropriate dose of an antibody of the invention for an effective amount for therapeutic or diagnostic purposes.
[0177]For therapeutic or in vivo diagnostic purposes, it is understood that any of a variety of methods of administration can be used so long as the administration is effective for a desired purpose. Such methods of administration include, for example, intravenous, transdermal, intrasynovial, intramuscular, intratumoral, intraocular, intranasal, intrathecal, topical, oral, or the like. One skilled in the art can readily determine an appropriate mode of administration depending on the desired therapeutic effect or desired diagnostic purpose.
[0178]Furthermore, it is understood that for therapeutic or diagnostic applications, an antibody of the invention in general is administered to a mammal, for example, a human. Applications of an antibody of the invention for domestic animals or agricultural purposes include other mammals, for example, a non-human primate, pig, cow, horse, goat, sheep, mule, donkey, dog, cat, rabbit, mouse, rat, and the like.
[0179]It is understood that any of the therapeutic methods disclosed herein using an antibody of the invention can be used in combination with other therapeutic methods. For example, an antibody of the invention, either the antibody itself or an antibody attached to a therapeutic agent, can be administered simultaneously or sequentially with other therapeutic treatment regimens. For example, an antibody of the invention can be administered alone or in combination with another therapeutic treatment, including any of the therapeutic drugs disclosed herein as well as other drugs well known to those skilled in the art for treating a particular disease. For example, in the case of treating a cancer, an antibody of the invention can be administered simultaneously or sequentially with another chemotherapeutic agent such as a drug or radionuclide. Similarly, an antibody of the invention can be combined with other treatment regimens such as surgery by administering the antibody before, during or after surgery. One skilled in the art will know or can readily determine a desirable therapeutic treatment to be used in combination with an antibody of the invention, as desired. Thus, an antibody of the invention can be administered in conjunction with other therapeutic regimens, including but not limited to chemotherapy, radiation therapy, surgery, and the like.
[0180]The invention additionally provides a method of inhibiting metastasis using an antibody of the invention. The method can include the step of administering an antibody, or functional fragment thereof, having binding activity for a cryptic collagen epitope. The antibody can be, for example, an antibody comprising one or more CDRs having a least one amino acid substitution in one or more heavy or light chain CDRs of antibodies HUIV26 and HUI77. As used herein, inhibiting metastasis refers to decreasing the number and/or size of metastatic sites remote from a primary tumor site. The method of inhibiting metastasis can involve using an antibody of the invention that blocks adhesion of tumor cells to a cryptic collagen epitope that is exposed after remodeling of tissues by the action of collagen-degrading enzymes secreted by tumor cells.
[0181]As disclosed herein, a variant of HUI77 having one or more amino acid substitutions in one or more CDRs inhibited proliferation of melanoma cells in vitro (see Example VI). An antibody of the invention can block access to or inhibit binding of a survival or proliferative signal delivered to a tumor cell. Thus, the invention also provides a method of targeting a tumor cell by administration of an antibody of the invention having binding activity for a cryptic collagen epitope that blocks access to a survival or proliferative signal delivered to the tumor cell by a cryptic collagen site.
[0182]For methods of inhibiting angiogenesis, the angiogenic vasculature can be associated with a tumor. The methods of the invention can also be used to inhibit tumor growth directly, alone or in combination with inhibiting angiogenic vasculature of the tumor. The methods of the invention can additionally be used to inhibit metastasis, alone or in combination with inhibiting tumor angiogenic vasculature and/or tumor growth. Exemplary tumors include, but are not limited to, those disclosed herein, including melanoma, carcinoma, sarcoma, fibrosarcoma, glioma, astrocytoma, and the like. Methods for testing the effect a HUIV26 or HUI77 variant for inhibition of angiogenesis or inhibition of tumor growth can be performed as described previously using, for example, assays such as the rat corneal micropocket angiogenesis assay, chick embryo tumor growth assay, or SCID mouse tumor growth assay, as described in Xu et al., supra, 2001, or any other well known assays for measuring inhibition of angiogenesis, inhibition of tumor growth, or inhibition of metastasis.
[0183]The methods of the invention can also be applied to inhibiting nontumor angiogenic vasculature. Such applications to non-tumor angiogenic vasculature can include tissue that is inflamed and in which angiogenesis is occurring. Exemplary non-tumor diseases associated with angiogenic vasculature suitable for treatment with an antibody of the invention include, but are not limited to, those disclosed herein, including arthritis, ocular disease, retinal disease, hemangioma, and the like. The antibodies of the invention can also be used to inhibit psoriasis, macular degeneration, restenosis, and the like, or any tumor or non-tumor disease associated with increased accessibility of a cryptic collagen epitope for which an antibody of the invention has binding activity.
[0184]It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also provided within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.
Example I
Cloning of Heavy and Light Chain Variable Regions of HUIV26 and HUI77 Antibodies
[0185]This example describes the cloning of HUIV26 and HUI77 antibody variable regions.
[0186]The variable regions of the HUIV26 and HUI77 antibodies were cloned from hybridomas expressing these mouse monoclonal antibodies and sequenced. Briefly, total mRNA was isolated from the respective mouse hybridoma cells using Oligotex® Direct mRNA Micro kit (Qiagen; Valencia, Calif.). First strand cDNA was synthesized from the mRNA using SuperScript Preamplification System (GibcoBRL/Invitrogen; Carlsbad, Calif.). Antibody variable region sequences were amplified by PCR using a set of 5' primers designed for signal sequences of mouse light chains or heavy chains to pair with single 3' primer to mouse kappa chain constant region for VL or IgM CH1 region for VH sequences. The sequences of the 5' primers for the signal peptide of mouse antibody heavy and light chain as well as constant region primers are shown in FIG. 1. The 3' primer for mouse kappa light chain constant region (primer 2650; SEQ ID NO:212) corresponds to amino acids 115-123. The 3' primer for mouse IgM CH1 region (primer 2656; SEQ ID NO:213) corresponds to amino acids 121-114. The 3' primer for mouse IgM CH1 region (primer 2706; SEQ ID NO:214) corresponds to amino acids 131-124.
[0187]The DNA fragments were isolated from PCR reactions, with a main product of about 400 bp in length. The DNA fragments were cloned into the pCR2.1 vector. The inserted DNA fragments were sequenced with both forward and reversed M13 primers. The DNA sequences were compared with an antibody sequence database. The N-terminal amino acid sequence of the HUIV26 and HUI77 antibodies were determined, and the sequences of the DNA fragments were also compared to the N-terminal amino acid sequences of the corresponding antibody.
[0188]The HUIV26 VL encoding nucleic acid was cloned with 5' primer mK2 (primer 2664; SEQ ID NO:185) and 3' primer 2650 (SEQ ID NO:212). A partial sequence of HUIV25 VL is ATCTTCTTGCTGTTCTGGGTATCTGGAACCTGTGGG (SEQ ID NO:215), with the MK2 primer underlined and the partial sequence coding for mouse signal peptide in italics. The HUIV26 VH encoding nucleic acid was cloned with 5' primer MH12 (primer 2731; SEQ ID NO:203) and 3' primer 2706 (SEQ ID NO:214).
[0189]The HUI77 VL encoding nucleic acid was cloned with 5' primer mK1 (primer 2663; SEQ ID NO:184) and 3' primer 2650 (SEQ ID NO:212). A partial sequence of HUI77 VL is TTGGTGCTGATGTTCTGGATTCCTGCTTCCAGCAGT (SEQ ID NO:216), with the mK1 primer underlined and the partial sequence coding for mouse signal peptide in italics. The HUI77 encoding nucleic acid was cloned with 5' primers MH115 (primer 2734; SEQ ID NO:206) or MH16 (primer 2735; SEQ ID NO:207) and 3' primer 2656 (SEQ ID NO:213).
[0190]The sequences of the heavy and light chain nucleotide and amino acid sequences for HUIV26 and HUI77 are shown in FIGS. 2 and 3, respectively. Using the numbering system of Kabat, supra, the CDRs of the heavy and light chains were identified for each of the HUIV26 and HUI77 antibodies (underlined in FIGS. 2C and 3C).
[0191]An alignment of the HUI77 VL nucleotide sequence (SEQ ID NO:9) with the nucleotide sequence of the human framework fusion DPK13/JK1 (SEQ ID NO:17) is shown in FIG. 3D. The corresponding light chain amino acid sequences are referenced as SEQ ID NO:10 and SEQ ID NO:18 for HUI77 and DPK13/JK1, respectively.
[0192]This example describes the cloning and the sequence of mouse antibodies HUIV26 and HUI77.
Example II
Generation of CDR Variant Libraries of HUIV26 and HUI77 Antibodies
[0193]This example describes the generation of CDR variant libraries of HUIV26 and HUI77 antibodies for CDR optimization.
[0194]The CDR3 regions of antibodies HUIV26 and HUI77 were optimized by generating a library of CDR variants. Primers for light chain CDR3 and heavy chain CDR3 were used to generate a library of CDR3 variants, where the primer was synthesized to encode more than one amino acid one or more positions in CDR3. Following synthesis of primers encoding CDR3 variants, the variant CDR3 regions were assembled into light chain (VL) and heavy chain (VH) regions.
[0195]Briefly, humanized VL and VH genes of HUI77 and HUIV26 antibodies were assembled with the primers shown in FIGS. 4A and 5A, respectively, using PCR or primer-elongation-ligation. Variable region genes containing CDR3 mutations were assembled by replacing the wild type CDR3 primer (IV26-17, IV26-h7, 177-17 or I77-h7) with the group of mutant primers corresponding to that CDR. The assembled variable regions were then amplified and asymmetrically biotinylated on plus strand by PCR using primers B-pelB and 224 for VL and B-phA and 1200a for HV genes. The primers for amplification of humanized VL and VH sequences and the isolation of minus strand DNA were: B-pelB, Biotin-TTA CTC GCT GCC CAA CCA GCC ATG GCC (SEQ ID NO:220); 224, GAC AGA TGG TGC AGC CAC AGT (SEQ ID NO:221); B-phoA, Biotin-TTA CTG TTT ACC CCT GTG ACA AAA GCC (SEQ ID NO:222); and 1200a, GAA GAC CGA TGG GCC CTT GGT (SEQ ID NO:223).
[0196]The assembled VL and VH regions were introduced into a Fab expression vector by mutagenesis. Briefly, the non-biotinylated minus strands were isolated after binding the PCR products to NeutrAvidin-conjugated magnetic beads and introduced into the Fab expression vector IX-104CSA by hybridization mutagenesis (Kristensson et al., Vaccines 95, pp. 39-43, Cold Spring Harbor Laboratory, Cold Spring Harbor (1995); Kunkel, Proc. Natl. Acad. Sci. USA 82:488-492 (1985); Wu et al., J. Mol. Bio. 294:151-162 (1999)).
[0197]Three humanization-CDR3-mutation libraries were constructed for each the HUI77 and HUIV26 antibodies. The three libraries introduced random mutations but differed in CDR3 mutations. One library had mutations only in LCDR3, the second library had mutations only in HCDR3, and the third library had mutations in both LCDR3 and HCDR3.
[0198]Methods essentially the same as those described above for CDR3 mutagenesis were also performed on CDR1 and CDR2 of the HUIV26 and HUI77 antibodies. After assembling into a Fab expression vector, the Fabs containing HUIV26 and HUI77 variant CDRs were expressed in bacteria and tested for binding to denatured collagen. The mutant libraries were screened with filter lift screening and ELISA. The assays were performed essentially as described previously (Huse et al., J. Immunol. 149:3914-3920 (1992); Watkins et al., Anal. Biochem. 253:37-45 (1997)). Briefly, nitrocellulose membranes were pre-coated with heat-denatured human collagen I or IV and used to lift E. coli-expressed variant FABs from phage plates. The membranes were then incubated with antibodies, either anti-human kappa chain or anti-hemaglutinin (HA) tag conjugated to alkaline phosphatase to detect bound variant Fabs. Positive clones were screened again by single point ELISA (Watkins et al., supra, 1997) for binding to denatured-biotinylated human collagen I and IV, correspondingly. Beneficial variants were characterized for binding to both collagens in native and heat-denatured forms by ELISA. Beneficial mutations were determined as those having higher affinity binding to denatured collagen relative to the corresponding wild type Fab, as demonstrated by ELISA.
[0199]Shown in FIGS. 4B and 5B is a summary of beneficial CDR mutations in the HUIV26 and HUI77 antibodies, respectively. FIG. 4B summarizes beneficial single amino acid mutations in heavy chain CDR1, CDR2, and CDR3 and light chain CDR1 and CDR3 of HUIV26. An exemplary HUIV26 variant having a single amino acid substitution is the 12F10Q variant, which exhibited kon of 0.055 and koff of 0.049 as estimated by the fold improvement based on shifts in half-maximal binding obtained from ELISA titrations.
[0200]FIG. 5B summarizes beneficial single amino acid mutations in heavy chain CDR1, CDR2 and CDR3 and light chain CDR1, CDR2 and CDR3 of HUI77. As can be seen, numerous single amino acid mutations in various CDRs were found to maintain or enhance binding to a cryptic collagen site.
[0201]This example describes CDR variants of HUIV26 and HUI77 having beneficial mutations.
Example III
Identification of Combinatorial Variants of HUIV26 and HUI77 Antibodies Having Enhanced Activity
[0202]This example describes the generation and identification of combinatorial variants incorporating various beneficial CDR mutations in HUIV26 and HUI77.
[0203]To further optimize HUIV26 and HUI77 antibody CDR variants, combinatorial variants, which incorporate at least two CDRs containing one or more mutations, were generated and tested for binding to a cryptic collagen site. Combinatorial variants were synthesized using primers with one or more positions encoding variant amino acids as described in Example II. The primers used are shown in FIGS. 6 and 7.
[0204]Shown in FIGS. 6 and 7 is a summary of the beneficial combinatorial variants of HUIV26 and HUI77 antibodies, respectively. The kon and koff values shown in FIGS. 6 and 7 ("SPEKon" and "SPEKoff") were estimated as the fold improvement of variants based on shifts in half-maximal binding obtained from ELISA titrations. Also shown are several variants having the same beneficial CDR mutations but having different framework sequences. These results show that beneficial CDR mutations can be grafted into a variety of frameworks and can retain or have improved binding activity.
[0205]This example shows the generation of combinatorial CDR variants of HUIV26 and HUI77. A number of variants were identified having increased affinity relative to wild type forms of the respective antibodies.
Example IV
Binding Activity and Specificity of HUIV26 and HUI77 Variants
[0206]This example describes the binding activity and specificity of HUIV26 and HUI77 antibodies on native and denatured collagen.
[0207]The activity and specificity of wild type and selected exemplary HUIV26 and HUI77 variants were determined. As shown in FIG. 8, the activity and specificity of IX-IV26, a Fab containing wild type HUIV26 CDRs, and the HUIV26 variants 2D4H1-C3 and DhuG5 were determined. The antibodies were tested for binding to denatured collagen IV (FIG. 8A), denatured collagen I (FIG. 8B), and native collagen IV (FIG. 8C). None of the antibodies had significant binding activity for native collagen IV (FIG. 8C). All three antibodies exhibited binding activity for denatured collagen IV (FIG. 8A). However, the 2D4H1-C3 and DhuG5 variants exhibited significantly increased binding activity relative to IX-IV26 (FIG. 8A). IX-IV26 did not exhibit significant binding activity to denatured collagen I, and 2D4H1-C3 and DhuG5 exhibited low binding activity at the highest measured concentration of antibody (FIG. 8B). These results indicate that the HUIV26 variants have similar binding activity and specificity as that of wild type HUIV26 and maintain activity and specificity for a cryptic collagen epitope. These results further show that variants having mutated CDRs can have maintained or increased binding affinity relative to wild type.
[0208]As shown in FIG. 9, the activity and specificity of IX-177, a Fab containing wild type HUI77 CDRs, and the HUI77 variants Qh2b-B7 and QhuD9 were determined. The antibodies were tested for binding to denatured collagen I (FIG. 9A), denatured collagen IV (FIG. 9B) and native collagen I (FIG. 9C), and the results indicate that these variants exhibited similar binding specificities as wild type. Neither IX-177 nor Qhu2b-B7 exhibited significant binding activity for native collagen I, although the variant QhuD9 exhibited modest binding activity to native collagen at higher concentrations of antibody. The antibodies all exhibited binding activity for denatured collagen I (FIG. 9A) and denatured collagen IV (FIG. 9B). However, the Qhu2b-B7 and QhuD9 variants exhibited significantly increased binding activity relative to IX-177 on both denatured collagen I and IV. These results indicate that variants having mutated CDRs can have maintained or increased binding affinity relative to wild type.
[0209]To further examine the effect of CDR mutations on binding activity, the HUIV26 variant DhuH8 was selected and expressed in two forms, as a Fab and immunoglobulin (IgG). The binding activity of these two forms was determined for native (n-IV) and denatured (d IV) human collagen IV. As shown in FIG. 10, neither the Fab nor IgG form of the Dhu8 variant exhibited significant binding to native collagen IV. The Fab form exhibited binding activity for denatured collagen IV, and the binding affinity was significantly increased for the IgG form. These results indicate that a HUIV26 variant having one or more CDR amino acid substitutions relative to wild type can exhibit binding to a cryptic collagen epitope and that the binding affinity can be significantly increased in the IgG form relative to the Fab form of the antibody variant.
[0210]These results indicate that HUIV26 and HUI77 variants having one or more CDR amino acid substitutions can exhibit similar binding specificity and increased binding affinity relative to wild type.
Example V
Generation of Grafted HUIV26 and HUI77 Antibodies Having Optimized CDRs
[0211]This example describes the generation of humanized HUIV26 and HUI77 antibodies incorporating beneficial CDR mutations.
[0212]A CDR variant have a beneficial mutation is identified as described in Examples II and III. Once a beneficial CDR variant is identified, the CDR variant is grafted into a human framework sequence. In addition to the CDR variant having a beneficial mutation, other CDRs can be a wild type sequence of the respective antibody or one or more variant CDRs. At least one of the CDRs will be a variant containing a beneficial mutation. For example, if the grafted antibody contains a heavy and light chain, at least one of the heavy or light chain CDRs will have at least one amino acid mutation relative to the corresponding wild type CDR.
[0213]A human framework sequence is selected as the recipient for grafting. The human framework can be closely related to the donor antibody framework sequence or can be relatively divergent from the parental donor antibody. Once a human framework is selected for grafting, overlapping oligonucleotides are synthesized encoding the selected human framework and the appropriate donor CDRs, including at least one variant CDR containing at least one beneficial mutation. The overlapping oligonucleotides are used to assemble a nucleic acid encoding a variable region including the selected human framework, the CDR variant, and appropriate other CDRs to generate an antibody or fragment having binding activity for a cryptic collagen site.
[0214]The assembled variable region is cloned into an expression vector, for example, a Fab expression vector such as described in Example II, and binding activity to denatured collagen is tested, as described in Examples II and III.
[0215]This example describes the generation of humanized antibodies containing beneficial CDR mutations of HUIV26 and HUI77 antibodies.
Example VI
Inhibition of B16 Melanoma Cell Proliferation by a Variant HUI77 Antibody
[0216]This example describes the effect of the HUI77 variant QH2b on B16 melanoma cell proliferation.
[0217]The humanized Fab designated QH2b, which is the QH2b-B7 variant of the HUI77 antibody, was engineered into a full length IgG1 antibody (QH2b-IgG1). The QH2b-IgG1 antibody was expressed in mammalian cell culture in NSO cells and purified.
[0218]The purified QH2b-IgG1 antibody was used in a cell proliferation assay in vitro. B16 melanoma cells were plated on denatured human Type I collagen. QH2b IgG1 (100 μg/ml/day) was added to one set of culture dishes and cell numbers were determined at the indicated times (FIG. 11). As a control, the cells were not treated with antibody.
[0219]As shown in FIG. 11, B16 melanoma cells proliferated on denatured collagen type-I, as indicated by the increase in cell numbers over 3 days. The B16 melanoma cell cultures treated with QH2b-IgG1 exhibited essentially no cell growth over a period of 3 days, indicating that the melanoma cells did not proliferate in the presence of the HUI77 variant QH2b-IgG1.
[0220]These results indicate that a HUI77 variant having one or more CDR amino acid substitutions can inhibit cell proliferation of B16 melanoma cells.
[0221]Throughout this application various publications have been referenced. The disclosures of these publications in their entireties are hereby incorporated by reference in this application in order to more fully describe the state of the art to which this invention pertains. Although the invention has been described with reference to the examples provided above, it should be understood that various modifications can be made without departing from the spirit of the invention.
[0222]While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
Sequence CWU
1
3801339DNAMus musculusCDS(1)..(339) 1gac att gtg atg aca cag tct cca tct
ttg ttg agt gtg tca gca gga 48Asp Ile Val Met Thr Gln Ser Pro Ser
Leu Leu Ser Val Ser Ala Gly1 5 10
15gag aag gtc act atg agc tgc aag tcc agt cag agt ctg tta aac
agt 96Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn
Ser 20 25 30gga aat caa aag
aac tac ttg gcc tgg tac cag cag aaa cca ggg cag 144Gly Asn Gln Lys
Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35
40 45cct cct aaa ctg ttg atc tat ggg gca tcc act agg
gaa tct ggg gtc 192Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg
Glu Ser Gly Val 50 55 60cct gat cgc
ttc aca ggc agt gga tct gga acc gat ttc act ctt atc 240Pro Asp Arg
Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ile65 70
75 80atc agc agt gtg cag gct gaa gac
ctg gca gtt tat tac tgt cag aat 288Ile Ser Ser Val Gln Ala Glu Asp
Leu Ala Val Tyr Tyr Cys Gln Asn 85 90
95gat cat agt tat ccg tac acg ttc gga ggg ggg acc aag ctg
gaa ata 336Asp His Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu
Glu Ile 100 105 110aaa
339Lys2113PRTMus
musculus 2Asp Ile Val Met Thr Gln Ser Pro Ser Leu Leu Ser Val Ser Ala
Gly1 5 10 15Glu Lys Val
Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20
25 30Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln 35 40
45Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50
55 60Pro Asp Arg Phe Thr Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Ile65 70 75
80Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn 85 90 95Asp His
Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 100
105 110Lys3360DNAMus musculusCDS(1)..(360)
3gag gtg aag ctt ctc gag tct gga ggt ggc ctg gtg cag cct gga gga
48Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15tcc ctg aaa ctc tcc tgt
gca gcc tca gga ttc gat ttt agt aga tac 96Ser Leu Lys Leu Ser Cys
Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr 20 25
30tgg atg agt tgg gtc cgg cag gct cca ggg aaa ggg cta
gaa tgg att 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Ile 35 40 45gga gaa att
aat cca gat agc agt acg ata aac tat acg cca tct cta 192Gly Glu Ile
Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser Leu 50
55 60aag gat aaa ttc atc atc tcc aga gac aac gcc aaa
aat acg ctg tac 240Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys
Asn Thr Leu Tyr65 70 75
80ctg caa atg agc aaa gtg aga tct gag gac aca gcc ctt tat tac tgt
288Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95gca aga ccg gtt gat ggt
tac tac gat gct atg gac tac tgg ggt caa 336Ala Arg Pro Val Asp Gly
Tyr Tyr Asp Ala Met Asp Tyr Trp Gly Gln 100
105 110gga acc tca gtc acc gtc tcc tca
360Gly Thr Ser Val Thr Val Ser Ser 115
1204120PRTMus musculus 4Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10
15Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr
20 25 30Trp Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Ile 35 40
45Gly Glu Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser
Leu 50 55 60Lys Asp Lys Phe Ile Ile
Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr65 70
75 80Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr
Ala Leu Tyr Tyr Cys 85 90
95Ala Arg Pro Val Asp Gly Tyr Tyr Asp Ala Met Asp Tyr Trp Gly Gln
100 105 110Gly Thr Ser Val Thr Val
Ser Ser 115 1205305DNAHomo sapiens 5gacatcgtga
tgacccagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60atcaactgca
agtccagcca gagtgtttta tacagctcca acaataagaa ctacttagct 120tggtaccagc
agaaaccagg acagcctcct aagctgctca tttactgggc atctacccgg 180gaatccgggg
tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240atcagcagcc
tgcaggctga agatgtggca gtttattact gtcagcaata ttatagtact 300cctcc
3056113PRTHomo
sapiens 6Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly1
5 10 15Glu Arg Ala Thr
Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20
25 30Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln
Gln Lys Pro Gly Gln 35 40 45Pro
Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50
55 60Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr65 70 75
80Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln
Gln 85 90 95Asp His Ser
Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile 100
105 110Lys7294DNAHomo sapiens 7gaggtgcagc
tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttagt agctattgga tgagctgggt ccgccaggct 120ccagggaagg
ggctggagtg ggtggccaac ataaagcaag atggaagtga gaaatactat 180gtggactctg
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat 240ctgcaaatga
acagcctgag agccgaggac acggctgtgt attactgtgc gaga 2948120PRTHomo
sapiens 8Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20
25 30Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu Trp Val 35 40 45Ala
Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val 50
55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ala Lys Asn Ser Leu Tyr65 70 75
80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Pro
Asp Tyr Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln 100
105 110Gly Thr Thr Val Thr Val Ser Ser
115 1209336DNAMus musculusCDS(1)..(336) 9gat gtt ttg atg
acc caa act cca ctc tcc ctg cct gtc agt ctt gga 48Asp Val Leu Met
Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5
10 15gat caa gcc tcc atc tct tgc aga tct agt
cag agc att gta cat agt 96Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser
Gln Ser Ile Val His Ser 20 25
30aat gga aac acc tat tta gaa tgg tac ctg cag aaa cca ggc cag tct
144Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45cca aag ctc ctg atc tac aaa gtt
tcc aac cga ttt tct ggt gtc cca 192Pro Lys Leu Leu Ile Tyr Lys Val
Ser Asn Arg Phe Ser Gly Val Pro 50 55
60gac agg ttc agt ggc agt gga tca ggg aca gat ttc aca ctc aag atc
240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65
70 75 80agc aga gtg gag gct
gag gat ctg gga gtt tat tac tgc ttt caa ggt 288Ser Arg Val Glu Ala
Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85
90 95tca cat gtt ccg tgg acg ttc ggt gga ggc acc
aag ctg gaa atc aaa 336Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr
Lys Leu Glu Ile Lys 100 105
11010112PRTMus musculus 10Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro
Val Ser Leu Gly1 5 10
15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser
20 25 30Asn Gly Asn Thr Tyr Leu Glu
Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val
Pro 50 55 60Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70
75 80Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr
Tyr Cys Phe Gln Gly 85 90
95Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 11011369DNAMus
musculusCDS(1)..(369) 11cag gtt act ctg aaa gag act ggc cct ggg ata ttg
cag ccc tcc cag 48Gln Val Thr Leu Lys Glu Thr Gly Pro Gly Ile Leu
Gln Pro Ser Gln1 5 10
15acc ctc agt ctg act tgt tct ttc tct ggg ttt tca ctg agc act tct
96Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30ggt atg ggt gta ggc tgg att
cgt cag cct tca gga gag ggt cta gag 144Gly Met Gly Val Gly Trp Ile
Arg Gln Pro Ser Gly Glu Gly Leu Glu 35 40
45tgg ctg gca gac att tgg tgg gat gac aat aag tac tat aac cca
tcc 192Trp Leu Ala Asp Ile Trp Trp Asp Asp Asn Lys Tyr Tyr Asn Pro
Ser 50 55 60ctg aag agc cgg ctc aca
atc tcc aag gat acc tcc agc aac cag gta 240Leu Lys Ser Arg Leu Thr
Ile Ser Lys Asp Thr Ser Ser Asn Gln Val65 70
75 80ttc ctc aag atc acc agt gtg gac act gca gat
act gcc act tac tac 288Phe Leu Lys Ile Thr Ser Val Asp Thr Ala Asp
Thr Ala Thr Tyr Tyr 85 90
95tgt gct cga aga gct aac tat ggt aac ccc tac tat gct atg gac tac
336Cys Ala Arg Arg Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr
100 105 110tgg ggt caa gga acc tca
gtc acc gtc tcc tca 369Trp Gly Gln Gly Thr Ser
Val Thr Val Ser Ser 115 12012123PRTMus musculus
12Gln Val Thr Leu Lys Glu Thr Gly Pro Gly Ile Leu Gln Pro Ser Gln1
5 10 15Thr Leu Ser Leu Thr Cys
Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25
30Gly Met Gly Val Gly Trp Ile Arg Gln Pro Ser Gly Glu
Gly Leu Glu 35 40 45Trp Leu Ala
Asp Ile Trp Trp Asp Asp Asn Lys Tyr Tyr Asn Pro Ser 50
55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser
Ser Asn Gln Val65 70 75
80Phe Leu Lys Ile Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr
85 90 95Cys Ala Arg Arg Ala Asn
Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr 100
105 110Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser
115 12013305DNAHomo sapiens 13gatattgtga tgacccagac
tccactctcc ctgcccgtca cccctggaga gccggcctcc 60atctcctgca ggtctagtca
gagcctcttg gatagtgatg atggaaacac ctatttggac 120tggtacctgc agaagccagg
gcagtctcca cagctcctga tctatacgct ttcctatcgg 180gcctctggag tcccagacag
gttcagtggc agtgggtcag gcactgattt cacactgaaa 240atcagcaggg tggaggctga
ggatgttgga gtttattact gcatgcaacg tatagagttt 300ccttc
30514111PRTHomo sapiens
14Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Thr Pro Gly1
5 10 15Glu Pro Ala Ser Ile Ser
Cys Arg Ser Ser Gln Ser Leu Leu Asp Ser 20 25
30Asp Gly Asn Thr Tyr Leu Asp Trp Tyr Leu Gln Lys Pro
Gly Gln Ser 35 40 45Pro Gln Leu
Leu Ile Tyr Thr Leu Ser Tyr Arg Ala Ser Gly Val Pro 50
55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75
80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser
85 90 95His Val Pro Trp Thr Phe
Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105
11015288DNAHomo sapiens 15caggtcacct tgaaggagtc tggtcctgcg
ctggtgaaac ccacacagac cctcacactg 60acctgcacct tctctgggtt ctcactcagc
actagtggaa tgcgtgtgag ctggatccgt 120cagcccccag ggaaggccct ggagtggctt
gcacgcattg attgggatga tgataaattc 180tacagcacat ctctgaagac caggctcacc
atctccaagg acacctccaa aaaccaggtg 240gtccttacaa tgaccaacat ggaccctgtg
gacacagcca cgtattac 28816123PRTHomo sapiens 16Gln Val Thr
Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5
10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser
Gly Phe Ser Leu Ser Thr Ser 20 25
30Gly Met Arg Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45Trp Leu Ala Arg Ile Asp Trp
Asp Asp Asp Lys Phe Tyr Ser Thr Ser 50 55
60Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val65
70 75 80Val Leu Thr Met
Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85
90 95Cys Ala Arg Arg Ala Asn Tyr Tyr Tyr Tyr
Tyr Tyr Ala Met Asp Val 100 105
110Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115
12017340DNAHomo sapiensCDS(1)..(339) 17gat att gtg atg acc cag act cca
ctc tcc ctg ccc gtc acc cct gga 48Asp Ile Val Met Thr Gln Thr Pro
Leu Ser Leu Pro Val Thr Pro Gly1 5 10
15gag ccg gcc tcc atc tcc tgc agg tct agt cag agc ctc ttg
gat agt 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu
Asp Ser 20 25 30gat gat gga
aac acc tat ttg gac tgg tac ctg cag aag cca ggg cag 144Asp Asp Gly
Asn Thr Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln 35
40 45tct cca cag ctc ctg atc tat acg ctt tcc tat
cgg gcc tct gga gtc 192Ser Pro Gln Leu Leu Ile Tyr Thr Leu Ser Tyr
Arg Ala Ser Gly Val 50 55 60cca gac
agg ttc agt ggc agt ggg tca ggc act gat ttc aca ctg aaa 240Pro Asp
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys65
70 75 80atc agc agg gtg gag gct gag
gat gtt gga gtt tat tac tgc atg caa 288Ile Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Met Gln 85 90
95cgg ttc aca tgt tcc gtg gac gtt cgg cca agg gac caa
ggt gga aat 336Arg Phe Thr Cys Ser Val Asp Val Arg Pro Arg Asp Gln
Gly Gly Asn 100 105 110caa a
340Gln18113PRTHomo sapiens 18Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu
Pro Val Thr Pro Gly1 5 10
15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu Asp Ser
20 25 30Asp Asp Gly Asn Thr Tyr Leu
Asp Trp Tyr Leu Gln Lys Pro Gly Gln 35 40
45Ser Pro Gln Leu Leu Ile Tyr Thr Leu Ser Tyr Arg Ala Ser Gly
Val 50 55 60Pro Asp Arg Phe Ser Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys65 70
75 80Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val
Tyr Tyr Cys Met Gln 85 90
95Arg Phe Thr Cys Ser Val Asp Val Arg Pro Arg Asp Gln Gly Gly Asn
100 105 110Gln1951DNAMus
musculusCDS(1)..(51) 19aag tcc agt cag agt ctg tta aac agt gga aat caa
aag aac tac ttg 48Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln
Lys Asn Tyr Leu1 5 10
15gcc
51Ala2017PRTMus musculus 20Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn
Gln Lys Asn Tyr Leu1 5 10
15Ala2121DNAMus musculusCDS(1)..(21) 21ggg gca tcc act agg gaa tct
21Gly Ala Ser Thr Arg Glu Ser1
5227PRTMus musculus 22Gly Ala Ser Thr Arg Glu Ser1
52327DNAMus musculusCDS(1)..(27) 23cag aat gat cat agt tat ccg tac acg
27Gln Asn Asp His Ser Tyr Pro Tyr Thr1
5249PRTMus musculus 24Gln Asn Asp His Ser Tyr Pro Tyr Thr1
52530DNAMus musculusCDS(1)..(30) 25gga ttc gat ttt agt aga tac
tgg atg agt 30Gly Phe Asp Phe Ser Arg Tyr
Trp Met Ser1 5 102610PRTMus musculus
26Gly Phe Asp Phe Ser Arg Tyr Trp Met Ser1 5
102751DNAMus musculusCDS(1)..(51) 27gaa att aat cca gat agc agt acg
ata aac tat acg cca tct cta aag 48Glu Ile Asn Pro Asp Ser Ser Thr
Ile Asn Tyr Thr Pro Ser Leu Lys1 5 10
15gat
51Asp2817PRTMus musculus 28Glu Ile Asn Pro Asp Ser Ser Thr Ile
Asn Tyr Thr Pro Ser Leu Lys1 5 10
15Asp2933DNAMus musculusCDS(1)..(33) 29ccg gtt gat ggt tac tac
gat gct atg gac tac 33Pro Val Asp Gly Tyr Tyr
Asp Ala Met Asp Tyr1 5 103011PRTMus
musculus 30Pro Val Asp Gly Tyr Tyr Asp Ala Met Asp Tyr1 5
103148DNAMus musculusCDS(1)..(48) 31aga tct agt cag agc
att gta cat agt aat gga aac acc tat tta gaa 48Arg Ser Ser Gln Ser
Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu1 5
10 153216PRTMus musculus 32Arg Ser Ser Gln Ser Ile
Val His Ser Asn Gly Asn Thr Tyr Leu Glu1 5
10 153321DNAMus musculusCDS(1)..(21) 33aaa gtt tcc aac
cga ttt tct 21Lys Val Ser Asn
Arg Phe Ser1 5347PRTMus musculus 34Lys Val Ser Asn Arg Phe
Ser1 53527DNAMus musculusCDS(1)..(27) 35ttt caa ggt tca cat
gtt ccg tgg acg 27Phe Gln Gly Ser His
Val Pro Trp Thr1 5369PRTMus musculus 36Phe Gln Gly Ser His
Val Pro Trp Thr1 53736DNAMus musculusCDS(1)..(36) 37ggg ttt
tca ctg agc act tct ggt atg ggt gta ggc 36Gly Phe
Ser Leu Ser Thr Ser Gly Met Gly Val Gly1 5
103812PRTMus musculus 38Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Gly1
5 103948DNAMus musculusCDS(1)..(48) 39gac
att tgg tgg gat gac aat aag tac tat aac cca tcc ctg aag agc 48Asp
Ile Trp Trp Asp Asp Asn Lys Tyr Tyr Asn Pro Ser Leu Lys Ser1
5 10 154016PRTMus musculus 40Asp Ile
Trp Trp Asp Asp Asn Lys Tyr Tyr Asn Pro Ser Leu Lys Ser1 5
10 154139DNAMus musculusCDS(1)..(39)
41aga gct aac tat ggt aac ccc tac tat gct atg gac tac
39Arg Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr1 5
104213PRTMus musculus 42Arg Ala Asn Tyr Gly Asn Pro Tyr
Tyr Ala Met Asp Tyr1 5
104310PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 43Gly Phe Asp Phe Ser His Tyr Trp Met Ser1 5
104410PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 44Gly Phe Asp Phe Ser Arg Tyr Trp Ile
Ser1 5 104510PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 45Gly
Phe Asp Phe Ser Arg Tyr Trp Met Thr1 5
104610PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 46Gly Phe Asp Phe Ser Arg Tyr Trp Met Ala1 5
104710PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 47Gly Phe Asp Phe Ser Arg Tyr Trp Met
Gly1 5 104817PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 48Glu
Ile Asn Pro Asp Ser Ser Thr Ala Asn Tyr Thr Pro Ser Leu Lys1
5 10 15Asp4917PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 49Glu
Ile Asn Pro Asp Ser Ser Thr Ser Asn Tyr Thr Pro Ser Leu Asp1
5 10 15Lys5017PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 50Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Tyr Leu Lys1
5 10 15Asp5117PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 51Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ala Leu Lys1
5 10 15Asp5217PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 52Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro His Leu Lys1
5 10 15Asp5317PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 53Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Gly Leu Lys1
5 10 15Asp5417PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 54Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser Leu Gln1
5 10 15Asp5517PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 55Glu
Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser Leu Lys1
5 10 15Ser5611PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 56Pro
Val Pro Gly Tyr Tyr Asp Ala Met Asp Tyr1 5
105711PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 57Pro Val Gly Gly Tyr Tyr Asp Ala Met Asp Tyr1
5 105811PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 58Pro Val Thr Gly Tyr Tyr Asp Ala Met Asp
Tyr1 5 105911PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 59Pro
Val Ala Gly Tyr Tyr Asp Ala Met Asp Tyr1 5
106011PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 60Pro Val Asp Pro Tyr Tyr Asp Ala Met Asp Tyr1
5 106111PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 61Pro Val Asp Ala Tyr Tyr Asp Ala Met Asp
Tyr1 5 106211PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 62Pro
Val Asp His Tyr Tyr Asp Ala Met Asp Tyr1 5
106311PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 63Pro Val Asp Gly Tyr Tyr Asp Ala Met Asp Pro1
5 106411PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 64Pro Val Asp Gly Tyr Tyr Asp Ala Met Asp
Asn1 5 106517PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 65Lys
Ser Ser Arg Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala6617PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 66Lys
Ser Ser Ser Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala6717PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 67Lys
Ser Ser Gln Ser Leu Leu Ser Ser Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala6817PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 68Lys
Ser Ser Gln Ser Leu Leu Asn Tyr Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala6917PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 69Lys
Ser Ser Gln Ser Leu Leu Asn Trp Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7017PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 70Lys
Ser Ser Gln Ser Leu Leu Asn His Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7117PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 71Lys
Ser Ser Gln Ser Leu Leu Asn Arg Gly Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7217PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 72Lys
Ser Ser Gln Ser Leu Leu Asn Ser Tyr Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7317PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 73Lys
Ser Ser Gln Ser Leu Leu Asn Ser Arg Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7417PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 74Lys
Ser Ser Gln Ser Leu Leu Asn Ser His Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7517PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 75Lys
Ser Ser Gln Ser Leu Leu Asn Ser Ile Asn Gln Lys Asn Tyr Leu1
5 10 15Ala7617PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 76Lys
Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Lys Lys Asn Tyr Leu1
5 10 15Ala779PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 77Gln
Asn Asp His Gln Tyr Pro Tyr Thr1 5789PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 78Gln
Asn Asp His Gly Tyr Pro Tyr Thr1 5799PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 79Gln
Asn Asp His Leu Tyr Pro Tyr Thr1 5809PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 80Gln
Asn Asp His Ala Tyr Pro Tyr Thr1 5819PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 81Gln
Asn Asp His Thr Tyr Pro Tyr Thr1 5829PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 82Gln
Asn Asp His Val Tyr Pro Tyr Thr1 5839PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 83Gln
Asn Asp His Ser Asn Pro Tyr Thr1 5849PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 84Gln
Asn Asp His Ser Ser Pro Tyr Thr1 5859PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 85Gln
Asn Asp His Ser Pro Pro Tyr Thr1 5869PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 86Gln
Asn Asp His Ser Met Pro Tyr Thr1 58712PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 87Gly
Phe Ser Leu Ser Thr Pro Gly Met Gly Val Gly1 5
108812PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 88Gly Phe Ser Leu Ser Thr Trp Gly Met Gly Val Gly1
5 108912PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 89Gly Phe Ser Leu Ser Thr
Ser Gly Met Gly Val Trp1 5
109012PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 90Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Leu1
5 109112PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 91Gly Phe Ser Leu Ser Thr Ser
Gly Met Gly Val Ala1 5
109216PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 92Asp Ile Trp Trp Asp Asp Asn Lys Tyr Ser Asn Pro Ser Leu Lys
Ser1 5 10
159316PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 93Asp Ile Trp Trp Asp Asp Asn Lys Tyr Ala Asn Pro Ser Leu Lys
Ser1 5 10
159416PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 94Asp Ile Trp Trp Asp Asp Asn Lys Tyr Pro Asn Pro Ser Leu Lys
Ser1 5 10
159516PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 95Asp Ile Trp Trp Asp Asp Asn Lys Tyr Tyr Asn Pro Ser Leu Pro
Ser1 5 10
159613PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 96Pro Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr1
5 109713PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 97Gln Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Met Asp Tyr1 5
109813PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 98Leu Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr1
5 109913PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 99Thr Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Met Asp Tyr1 5
1010013PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 100Val Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Tyr1
5 1010113PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 101Arg Ala Asn Tyr Gly Val Pro
Tyr Tyr Ala Met Asp Tyr1 5
1010213PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 102Arg Ala Asn Tyr Gly Trp Pro Tyr Tyr Ala Met Asp Tyr1
5 1010313PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 103Arg Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Gln Asp Tyr1 5
1010413PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 104Arg Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Asn Asp Tyr1
5 1010513PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 105Arg Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Thr Asp Tyr1 5
1010613PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 106Arg Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Lys1
5 1010713PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 107Arg Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Met Asp Thr1 5
1010813PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 108Arg Ala Asn Tyr Gly Asn Pro Tyr Tyr Ala Met Asp Met1
5 1010913PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 109Arg Ala Asn Tyr Gly Asn Pro
Tyr Tyr Ala Met Asp His1 5
1011016PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 110Arg Ser Ser Gln Ser Ile Pro His Ser Asn Gly Asn Thr Tyr
Leu Glu1 5 10
1511116PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 111Arg Ser Ser Gln Ser Ile Trp His Ser Asn Gly Asn Thr Tyr
Leu Glu1 5 10
1511216PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 112Arg Ser Ser Gln Ser Ile Val Leu Ser Asn Gly Asn Thr Tyr
Leu Glu1 5 10
1511316PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 113Arg Ser Ser Gln Ser Ile Val Ser Ser Asn Gly Asn Thr Tyr
Leu Glu1 5 10
1511416PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 114Arg Ser Ser Gln Ser Ile Val His Trp Asn Gly Asn Thr Tyr
Leu Glu1 5 10
1511516PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 115Arg Ser Ser Gln Ser Ile Val His Ser Tyr Gly Asn Thr Tyr
Leu Glu1 5 10
1511616PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 116Arg Ser Ser Gln Ser Ile Val His Ser Trp Gly Asn Thr Tyr
Leu Glu1 5 10
1511716PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 117Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Tyr Thr Tyr
Leu Glu1 5 10
1511816PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 118Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr
Phe Glu1 5 10
1511916PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 119Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr
Val Glu1 5 10
151207PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 120Ser Val Ser Asn Arg Phe Ser1
51217PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 121Lys Ala Ser Asn Arg Phe Ser1
51227PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 122Lys Val Ser Ser Arg Phe Ser1
51237PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 123Lys Val Ser Asn Leu Phe Ser1
51247PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 124Lys Val Ser Asn Arg Phe Trp1
51257PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 125Lys Val Ser Asn Arg Phe Phe1
51269PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 126Val Gln Gly Ser His Val Pro Trp Thr1
51279PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 127His Gln Gly Ser His Val Pro Trp Thr1
51289PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 128Phe Arg Gly Ser His Val Pro Trp Thr1
51299PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 129Phe Trp Gly Ser His Val Pro Trp Thr1
51309PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 130Phe Gln Ser Ser His Val Pro Trp Thr1
51319PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 131Phe Gln Gly Trp His Val Pro Trp Thr1
51329PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 132Phe Gln Gly Glu His Val Pro Trp Thr1
51339PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 133Phe Gln Gly Ser Leu Val Pro Trp Thr1
51349PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 134Phe Gln Gly Ser Thr Val Pro Trp Thr1
51359PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 135Phe Gln Gly Ser Ser Val Pro Trp Thr1
51369PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 136Phe Gln Gly Ser Ala Val Pro Trp Thr1
51379PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 137Phe Gln Gly Ser Gln Val Pro Trp Thr1
51389PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 138Phe Gln Gly Ser His Thr Pro Trp Thr1
51399PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 139Phe Gln Gly Ser His Val Pro Trp Ala1
51409PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 140Phe Gln Gly Ser His Val Pro Trp Arg1
51419PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 141Phe Gln Gly Ser His Val Pro Trp His1
51429PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 142Phe Gln Gly Ser His Val Pro Trp Lys1
51439PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 143Phe Gln Gly Ser His Val Pro Trp Ile1
514416PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 144Asp Ile Trp Trp Asp Asp Asn Lys Tyr Thr Asn Pro Ser Leu
Lys Ser1 5 10
151459PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 145Phe Gln Gly Ser His Phe Pro Trp Thr1
514616PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 146Arg Ser Ser Gln Ser Ile Val His Ser Gln Gly Asn Thr Tyr
Leu Glu1 5 10
1514712PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 147Gly Phe Ser Leu Ser Thr Pro Gly Met Gly Val Trp1
5 1014812PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 148Gly Phe Ser Leu Ser Thr Pro
Gly Met Gly Val Ala1 5
1014916PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 149Arg Ser Ser Gln Ser Ile Val Ser Ser Trp Gly Asn Thr Tyr
Leu Glu1 5 10
1515016PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 150Arg Ser Ser Gln Ser Ile Val Ser Ser Tyr Gly Asn Thr Tyr
Leu Glu1 5 10
1515116PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 151Arg Ser Ser Gln Ser Ile Val Ser Ser Gln Gly Asn Thr Tyr
Leu Glu1 5 10
1515216PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 152Arg Ser Ser Gln Ser Ile Val His Ser Gln Gly Asn Thr Tyr
Phe Glu1 5 10
1515316PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 153Arg Ser Ser Gln Ser Ile Val Ser Ser Trp Gly Asn Thr Tyr
Phe Glu1 5 10
1515417PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 154Glu Ile Asn Pro Asp Ser Ser Thr Ala Asn Tyr Thr Pro Ala
Leu Lys1 5 10
15Asp15517PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 155Glu Ile Asn Pro Asp Ser Ser Thr Ala Asn Tyr Thr
Pro Tyr Leu Lys1 5 10
15Asp15617PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 156Glu Ile Asn Pro Asp Ser Ser Thr Ala Asn Tyr Thr
Pro His Leu Lys1 5 10
15Asp15717PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 157Lys Ser Ser Gln Ser Leu Leu Asn Trp Tyr Asn Gln
Lys Asn Tyr Leu1 5 10
15Ala15817PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 158Lys Ser Ser Gln Ser Leu Leu Asn Tyr Tyr Asn Gln
Lys Asn Tyr Leu1 5 10
15Ala15917PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 159Lys Ser Ser Gln Ser Leu Leu Asn Tyr His Asn Gln
Lys Asn Tyr Leu1 5 10
15Ala16017PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 160Lys Ser Ser Gln Ser Leu Leu Asn Arg Tyr Asn Gln
Lys Asn Tyr Leu1 5 10
15Ala16117PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 161Lys Ser Ser Gln Ser Leu Leu Asn Trp His Asn Gln
Lys Asn Tyr Leu1 5 10
15Ala16217PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 162Glu Ile Asn Pro Asp Ser Ser Thr Val Asn Tyr Thr
Pro Ser Leu Lys1 5 10
15Asp16339DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 163tctctggaga tggtgaattt acgtactgct atctggatt
3916441DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 164ctaagtagtt cttttggttg
ttataacaga ctctggctgg a 4116551DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
165tggagcctgg cggacccagg hcatccaata tctactaaag gtgaatccag a
5116665DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 166tctctggaga tggtgaatyt atcctttagg gmtggcgtat agttggccgt
actgctatct 60ggatt
6516765DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 167tctctggaga tggtgaatyt atcctttagg
trtggcgtat agttggccgt actgctatct 60ggatt
6516846DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
168ctaagtagtt cttttggttg trgtrgytta acagactctg gctgga
4616946DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 169ctaagtagtt cttttggttg csgtrgytta acagactctg gctgga
4617046DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 170ctaagtagtt cttttggttg trgckgytta
acagactctg gctgga 4617146DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
171ctaagtagtt cttttggttg csgckgytta acagactctg gctgga
4617246DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 172ctaagtagtt cttttggttg trccagytta acagactctg gctgga
4617346DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 173ctaagtagtt cttttggttg csccagytta
acagactctg gctgga 4617440DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
174cttctgcagg taccattcgt tatacaatgc tctgactaga
4017557DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 175tgggggctga cggatccacm acacacccat tccacragtg ctgagtgaga
acccaga 5717657DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 176tgggggctga cggatccags ccacacccat
tccacractg ctgagtgaga acccaga 5717740DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
177gctcttcaga gatgggttag vgtatttatt gtcatcccac
4017860DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 178cttctgcagg taccattcma aataggtgtt tccccaactc ratacaatgc
tctgactaga 6017960DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 179cttctgcagg taccattcma aataggtgtt
tccgtaactc ratacaatgc tctgactaga 6018060DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
180cttctgcagg taccattcma aataggtgtt tccctgactc ratacaatgc tctgactaga
6018160DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 181cttctgcagg taccattcma aataggtgtt tccccaactg tgtacaatgc
tctgactaga 6018260DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 182cttctgcagg taccattcma aataggtgtt
tccctaactg tctacaatgc tctgactaga 6018360DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
183cttctgcagg taccattcma aataggtgtt tccctcactg tgtacaatgc tctgactaga
6018418DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 184ttggtgctga tgttctgg
1818518DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 185atcttcttgc tgttctgg
1818618DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 186tgggtgctgc tgctctgg
1818718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
187gggctgcttg tgctctgg
1818818DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 188ggaatcttgt tgctctgg
1818918DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 189rtrttsctgc tgctrtgg
1819018DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 190ggtctcctgt tgctctgt
1819118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
191atatttctac tgctctgt
1819218DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 192gtcataatrt ccagagga
1819317DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 193ctgagctgtg tattcct
1719417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 194ctcarmttga ttttcct
1719517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
195tggrtcatst tcttcct
1719617DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 196tksrtctttc tcttcct
1719717DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 197tgtatcatsc tcttctt
1719817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 198tggrtctttc tcttttt
1719917DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
199ttaaactggg tttttct
1720017DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 200gkgctgytcy tctgcct
1720118DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 201ttaagtcttc tgtacctg
1820220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 202tcagtaactg caggtgtcca
2020320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
203ttttaaaagg tgtccagtgt
2020420DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 204gcaacagcta caggtgtcca
2020520DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 205cagctacagr tgtccactcc
2020622DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 206atttccaagc tgtgtcctgt cc
2220723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
207ctcctgtcag gaactgcagg tgt
2320823DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 208cagtggttac aggggtcaat tca
2320921DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 209ctgttsacag cchttcckgg t
2121021DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 210ctgatggcag ctgcccaaag t
2121120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
211tttatcaagg tgtgcattgt
2021227DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 212tcactggatg gtgggaagat ggataca
2721324DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 213gacatttggg aaggactgac tctc
2421424DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 214cagggggctc tcgcaggaga cgag
2421536DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
215atcttcttgc tgttctgggt atctggaacc tgtggg
3621636DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 216ttggtgctga tgttctggat tcctgcttcc agcagt
3621738DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 217gtggacgttc ggccaaggga ccaaggtgga
aatcaaac 3821839DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
218tgtacacttt tggccagggg accaagctgg agatcaaac
3921963DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 219attactacta ctactacggt atggacgtct ggggccaagg gaccacggtc
accgtctcct 60cag
6322027DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 220ttactcgctg cccaaccagc catggcc
2722121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 221gacagatggt gcagccacag t
2122227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
222ttactgttta cccctgtgac aaaagcc
2722321DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 223gaagaccgat gggcccttgg t
2122466DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 224cttggtcccc tggccaaaag tgtacggata
actatgatca ttmnnacagt aataaactgc 60cacatc
6622566DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
225cttggtcccc tggccaaaag tgtacggata actatgatcm nnctgacagt aataaactgc
60cacatc
6622666DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 226cttggtcccc tggccaaaag tgtacggata actatgmnna ttctgacagt
aataaactgc 60cacatc
6622766DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 227cttggtcccc tggccaaaag tgtacggata
actmnnatca ttctgacagt aataaactgc 60cacatc
6622866DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
228cttggtcccc tggccaaaag tgtacggata mnnatgatca ttctgacagt aataaactgc
60cacatc
6622966DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 229cttggtcccc tggccaaaag tgtacggmnn actatgatca ttctgacagt
aataaactgc 60cacatc
6623066DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 230cttggtcccc tggccaaaag tgtamnnata
actatgatca ttctgacagt aataaactgc 60cacatc
6623166DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
231cttggtcccc tggccaaaag tmnncggata actatgatca ttctgacagt aataaactgc
60cacatc
6623266DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 232cttggtcccc tggccaaamn ngtacggata actatgatca ttctgacagt
aataaactgc 60cacatc
6623369DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 233cgtggttcct tgcccccagt agtccatagc
atcgtagtaa ccatcaacmn ntctcgcaca 60gtaatacac
6923469DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
234cgtggttcct tgcccccagt agtccatagc atcgtagtaa ccatcmnncg gtctcgcaca
60gtaatacac
6923569DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 235cgtggttcct tgcccccagt agtccatagc atcgtagtaa ccmnnaaccg
gtctcgcaca 60gtaatacac
6923669DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 236cgtggttcct tgcccccagt agtccatagc
atcgtagtam nnatcaaccg gtctcgcaca 60gtaatacac
6923769DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
237cgtggttcct tgcccccagt agtccatagc atcgtamnna ccatcaaccg gtctcgcaca
60gtaatacac
6923869DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 238cgtggttcct tgcccccagt agtccatagc atcmnngtaa ccatcaaccg
gtctcgcaca 60gtaatacac
6923969DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 239cgtggttcct tgcccccagt agtccatagc
mnngtagtaa ccatcaaccg gtctcgcaca 60gtaatacac
6924069DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
240cgtggttcct tgcccccagt agtccatmnn atcgtagtaa ccatcaaccg gtctcgcaca
60gtaatacac
6924169DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 241cgtggttcct tgcccccagt agtcmnnagc atcgtagtaa ccatcaaccg
gtctcgcaca 60gtaatacac
6924269DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 242cgtggttcct tgcccccagt amnncatagc
atcgtagtaa ccatcaaccg gtctcgcaca 60gtaatacac
6924369DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
243cgtggttcct tgcccccamn ngtccatagc atcgtagtaa ccatcaaccg gtctcgcaca
60gtaatacac
6924466DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 244cttggtgccc tggccgaacg tccacggaac atgtgaacct tgmnngcagt
aataaactcc 60aacatc
6624566DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 245cttggtgccc tggccgaacg tccacggaac
atgtgaaccm nnaaagcagt aataaactcc 60aacatc
6624666DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
246cttggtgccc tggccgaacg tccacggaac atgtgamnnt tgaaagcagt aataaactcc
60aacatc
6624766DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 247cttggtgccc tggccgaacg tccacggaac atgmnnacct tgaaagcagt
aataaactcc 60aacatc
6624866DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 248cttggtgccc tggccgaacg tccacggaac
mnntgaacct tgaaagcagt aataaactcc 60aacatc
6624966DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
249cttggtgccc tggccgaacg tccacggmnn atgtgaacct tgaaagcagt aataaactcc
60aacatc
6625066DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 250cttggtgccc tggccgaacg tccamnnaac atgtgaacct tgaaagcagt
aataaactcc 60aacatc
6625166DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 251cttggtgccc tggccgaacg tmnncggaac
atgtgaacct tgaaagcagt aataaactcc 60aacatc
6625266DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
252cttggtgccc tggccgaamn nccacggaac atgtgaacct tgaaagcagt aataaactcc
60aacatc
6625375DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 253cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccatagt
tagcmnntcg 60agcacagtaa tacgt
7525475DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 254cgtggttcct tgcccccagt agtccatagc
atagtagggg ttaccatagt tmnntcttcg 60agcacagtaa tacgt
7525575DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
255cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccatamn nagctcttcg
60agcacagtaa tacgt
7525675DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 256cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccmnngt
tagctcttcg 60agcacagtaa tacgt
7525775DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 257cgtggttcct tgcccccagt agtccatagc
atagtagggg ttmnnatagt tagctcttcg 60agcacagtaa tacgt
7525875DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
258cgtggttcct tgcccccagt agtccatagc atagtagggm nnaccatagt tagctcttcg
60agcacagtaa tacgt
7525975DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 259cgtggttcct tgcccccagt agtccatagc atagtamnng ttaccatagt
tagctcttcg 60agcacagtaa tacgt
7526075DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 260cgtggttcct tgcccccagt agtccatagc
atamnngggg ttaccatagt tagctcttcg 60agcacagtaa tacgt
7526175DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
261cgtggttcct tgcccccagt agtccatagc mnngtagggg ttaccatagt tagctcttcg
60agcacagtaa tacgt
7526275DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 262cgtggttcct tgcccccagt agtccatmnn atagtagggg ttaccatagt
tagctcttcg 60agcacagtaa tacgt
7526375DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 263cgtggttcct tgcccccagt agtcmnnagc
atagtagggg ttaccatagt tagctcttcg 60agcacagtaa tacgt
7526475DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
264cgtggttcct tgcccccagt amnncatagc atagtagggg ttaccatagt tagctcttcg
60agcacagtaa tacgt
7526575DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 265cgtggttcct tgcccccamn ngtccatagc atagtagggg ttaccatagt
tagctcttcg 60agcacagtaa tacgt
7526660DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 266gttcttttgg tttccgcwgt ttaacagact
ctggctggam nngcagttga tggtggccct 6026760DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
267gttcttttgg tttccgcwgt ttaacagact ctggctmnnc ttgcagttga tggtggccct
6026860DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 268gttcttttgg tttccgcwgt ttaacagact ctgmnnggac ttgcagttga
tggtggccct 6026960DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 269gttcttttgg tttccgcwgt ttaacagact
mnngctggac ttgcagttga tggtggccct 6027060DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
270gttcttttgg tttccgcwgt ttaacagmnn ctggctggac ttgcagttga tggtggccct
6027160DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 271gttcttttgg tttccgcwgt ttaamnnact ctggctggac ttgcagttga
tggtggccct 6027260DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 272gttcttttgg tttccgcwgt tmnncagact
ctggctggac ttgcagttga tggtggccct 6027360DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
273gttcttttgg tttccgcwmn ntaacagact ctggctggac ttgcagttga tggtggccct
6027463DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 274tggtttctgc tggtaccaag ctaagtagtt cttttggttt ccmnngttta
acagactctg 60gct
6327563DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 275tggtttctgc tggtaccaag ctaagtagtt
cttttggttm nngcwgttta acagactctg 60gct
6327663DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
276tggtttctgc tggtaccaag ctaagtagtt cttttgmnnt ccgcwgttta acagactctg
60gct
6327763DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 277tggtttctgc tggtaccaag ctaagtagtt cttmnngttt ccgcwgttta
acagactctg 60gct
6327863DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 278tggtttctgc tggtaccaag ctaagtagtt
mnnttggttt ccgcwgttta acagactctg 60gct
6327963DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
279tggtttctgc tggtaccaag ctaagtamnn cttttggttt ccgcwgttta acagactctg
60gct
6328063DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 280tggtttctgc tggtaccaag ctaamnngtt cttttggttt ccgcwgttta
acagactctg 60gct
6328163DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 281tggtttctgc tggtaccaag cmnngtagtt
cttttggttt ccgcwgttta acagactctg 60gct
6328263DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
282tggtttctgc tggtaccamn ntaagtagtt cttttggttt ccgcwgttta acagactctg
60gct
6328357DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 283gaatcggtca gggaccccgg attccctggt agatgcmnng taaatgagca
gcttagg 5728457DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 284gaatcggtca gggaccccgg attccctggt
agamnncccg taaatgagca gcttagg 5728557DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
285gaatcggtca gggaccccgg attccctggt mnntgccccg taaatgagca gcttagg
5728657DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 286gaatcggtca gggaccccgg attccctmnn agatgccccg taaatgagca
gcttagg 5728757DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 287gaatcggtca gggaccccgg attcmnnggt
agatgccccg taaatgagca gcttagg 5728857DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
288gaatcggtca gggaccccgg amnncctggt agatgccccg taaatgagca gcttagg
5728957DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 289gaatcggtca gggaccccmn nttccctggt agatgccccg taaatgagca
gcttagg 5729051DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 290tggagcctgg cggacccagc tcatccaata
mnnactaaag gtgaatccag a 5129151DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
291tggagcctgg cggacccagc tcatccamnn tctactaaag gtgaatccag a
5129251DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 292tggagcctgg cggacccagc tcatmnnata tctactaaag gtgaatccag a
5129351DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 293tggagcctgg cggacccagc tmnnccaata
tctactaaag gtgaatccag a 5129451DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
294tggagcctgg cggacccamn ncatccaata tctactaaag gtgaatccag a
5129567DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 295tagagatggc gtatagttta tcgtactgct atctggattt atmnngccaa
yccactccag 60ccctttc
6729667DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 296tagagatggc gtatagttta tcgtactgct
atctggattm nnttcgccaa yccactccag 60ccctttc
6729767DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
297tagagatggc gtatagttta tcgtactgct atctggmnnt atttcgccaa yccactccag
60ccctttc
6729867DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 298tagagatggc gtatagttta tcgtactgct atcmnnattt atttcgccaa
yccactccag 60ccctttc
6729967DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 299tagagatggc gtatagttta tcgtactgct
mnntggattt atttcgccaa yccactccag 60ccctttc
6730067DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
300tagagatggc gtatagttta tcgtactmnn atctggattt atttcgccaa yccactccag
60ccctttc
6730167DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 301tagagatggc gtatagttta tcgtmnngct atctggattt atttcgccaa
yccactccag 60ccctttc
6730267DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 302tagagatggc gtatagttta tmnnactgct
atctggattt atttcgccaa yccactccag 60ccctttc
6730367DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
303tagagatggc gtatagttmn ncgtactgct atctggattt atttcgccaa yccactccag
60ccctttc
6730467DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 304cgttgtctct ggagatgrtg aatytatcct ttagagatgg cgtatamnnt
atcgtactgc 60tatctgg
6730567DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 305cgttgtctct ggagatgrtg aatytatcct
ttagagatgg cgtmnngttt atcgtactgc 60tatctgg
6730667DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
306cgttgtctct ggagatgrtg aatytatcct ttagagatgg mnnatagttt atcgtactgc
60tatctgg
6730767DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 307cgttgtctct ggagatgrtg aatytatcct ttagagamnn cgtatagttt
atcgtactgc 60tatctgg
6730867DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 308cgttgtctct ggagatgrtg aatytatcct
ttagmnntgg cgtatagttt atcgtactgc 60tatctgg
6730967DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
309cgttgtctct ggagatgrtg aatytatcct tmnnagatgg cgtatagttt atcgtactgc
60tatctgg
6731067DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 310cgttgtctct ggagatgrtg aatytatcmn ntagagatgg cgtatagttt
atcgtactgc 60tatctgg
6731167DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 311cgttgtctct ggagatgrtg aatytmnnct
ttagagatgg cgtatagttt atcgtactgc 60tatctgg
6731258DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
312ataggtgttt ccattactat gtacaatgct ctgactagam nngcaggaga tggaggcc
5831358DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 313ataggtgttt ccattactat gtacaatgct ctgactmnnc ctgcaggaga
tggaggcc 5831458DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 314ataggtgttt ccattactat gtacaatgct
ctgmnnagac ctgcaggaga tggaggcc 5831558DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
315ataggtgttt ccattactat gtacaatgct mnnactagac ctgcaggaga tggaggcc
5831658DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 316ataggtgttt ccattactat gtacaatmnn ctgactagac ctgcaggaga
tggaggcc 5831758DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 317ataggtgttt ccattactat gtacmnngct
ctgactagac ctgcaggaga tggaggcc 5831858DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
318ataggtgttt ccattactat gmnnaatgct ctgactagac ctgcaggaga tggaggcc
5831958DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 319ataggtgttt ccattactmn ntacaatgct ctgactagac ctgcaggaga
tggaggcc 5832060DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 320tggcttctgc aggtaccatt ccaaataggt
gtttccattm nnatgtacaa tgctctgact 6032160DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
321tggcttctgc aggtaccatt ccaaataggt gtttccmnna ctatgtacaa tgctctgact
6032260DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 322tggcttctgc aggtaccatt ccaaataggt gttmnnatta ctatgtacaa
tgctctgact 6032360DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 323tggcttctgc aggtaccatt ccaaataggt
mnntccatta ctatgtacaa tgctctgact 6032460DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
324tggcttctgc aggtaccatt ccaaatamnn gtttccatta ctatgtacaa tgctctgact
6032560DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 325tggcttctgc aggtaccatt ccaamnnggt gtttccatta ctatgtacaa
tgctctgact 6032660DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 326tggcttctgc aggtaccatt cmnnataggt
gtttccatta ctatgtacaa tgctctgact 6032760DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
327tggcttctgc aggtaccamn ncaaataggt gtttccatta ctatgtacaa tgctctgact
6032857DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 328gaacctgtct gggactccag aaaaccggtt ggaaacmnna tagatcagga
gctgtgg 5732957DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 329gaacctgtct gggactccag aaaaccggtt
ggamnnttta tagatcagga gctgtgg 5733057DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
330gaacctgtct gggactccag aaaaccggtt mnnaacttta tagatcagga gctgtgg
5733157DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 331gaacctgtct gggactccag aaaaccgmnn ggaaacttta tagatcagga
gctgtgg 5733257DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 332gaacctgtct gggactccag aaaamnngtt
ggaaacttta tagatcagga gctgtgg 5733357DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
333gaacctgtct gggactccag amnnccggtt ggaaacttta tagatcagga gctgtgg
5733457DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 334gaacctgtct gggactccmn naaaccggtt ggaaacttta tagatcagga
gctgtgg 5733557DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 335tgggggctga cggatccagc ccacacccat
tccagamnng ctgagtgaga acccaga 5733657DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
336tgggggctga cggatccagc ccacacccat tccmnnagtg ctgagtgaga acccaga
5733757DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 337tgggggctga cggatccagc ccacacccat mnnagaagtg ctgagtgaga
acccaga 5733857DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 338tgggggctga cggatccagc ccacaccmnn
tccagaagtg ctgagtgaga acccaga 5733957DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
339tgggggctga cggatccagc ccacmnncat tccagaagtg ctgagtgaga acccaga
5734057DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 340tgggggctga cggatccagc cmnnacccat tccagaagtg ctgagtgaga
acccaga 5734157DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 341tgggggctga cggatccamn ncacacccat
tccagaagtg ctgagtgaga acccaga 5734260DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
342cagagatggg ttgtagtatt tattgtcatc ccaccaaatm nntgcaagcc actccagggc
6034360DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 343cagagatggg ttgtagtatt tattgtcatc ccaccamnng tctgcaagcc
actccagggc 6034460DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 344cagagatggg ttgtagtatt tattgtcatc
ccamnnaatg tctgcaagcc actccagggc 6034560DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
345cagagatggg ttgtagtatt tattgtcatc mnnccaaatg tctgcaagcc actccagggc
6034660DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 346cagagatggg ttgtagtatt tattgtcmnn ccaccaaatg tctgcaagcc
actccagggc 6034760DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 347cagagatggg ttgtagtatt tattmnnatc
ccaccaaatg tctgcaagcc actccagggc 6034860DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
348cagagatggg ttgtagtatt tmnngtcatc ccaccaaatg tctgcaagcc actccagggc
6034960DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 349cagagatggg ttgtagtamn nattgtcatc ccaccaaatg tctgcaagcc
actccagggc 6035060DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 350cttggagatg gtgagcctgc tcttcagaga
tgggttgtam nntttattgt catcccacca 6035160DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
351cttggagatg gtgagcctgc tcttcagaga tgggttmnng tatttattgt catcccacca
6035260DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 352cttggagatg gtgagcctgc tcttcagaga tggmnngtag tatttattgt
catcccacca 6035360DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 353cttggagatg gtgagcctgc tcttcagaga
mnngttgtag tatttattgt catcccacca 6035460DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
354cttggagatg gtgagcctgc tcttcagmnn tgggttgtag tatttattgt catcccacca
6035560DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 355cttggagatg gtgagcctgc tcttmnnaga tgggttgtag tatttattgt
catcccacca 6035660DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 356cttggagatg gtgagcctgc tmnncagaga
tgggttgtag tatttattgt catcccacca 6035760DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
357cttggagatg gtgagcctmn ncttcagaga tgggttgtag tatttattgt catcccacca
603589PRTArtificial SequenceDescription of Artificial Sequence Synthetic
peptide 358Phe Gln Ser Ser His Phe Pro Trp Thr1
535966DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 359cttggtgccc tggccgaacg tccacggaac atgtgaacct tgmnngcagt
aataaactcc 60aacatc
6636066DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 360cttggtgccc tggccgaacg tccacggaac
atgtgaaccm nnaaagcagt aataaactcc 60aacatc
6636166DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
361cttggtgccc tggccgaacg tccacggaac atgtgamnnt tgaaagcagt aataaactcc
60aacatc
6636266DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 362cttggtgccc tggccgaacg tccacggaac atgmnnacct tgaaagcagt
aataaactcc 60aacatc
6636366DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 363cttggtgccc tggccgaacg tccacggaac
mnntgaacct tgaaagcagt aataaactcc 60aacatc
6636466DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
364cttggtgccc tggccgaacg tccacggmnn atgtgaacct tgaaagcagt aataaactcc
60aacatc
6636566DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 365cttggtgccc tggccgaacg tccamnnaac atgtgaacct tgaaagcagt
aataaactcc 60aacatc
6636666DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 366cttggtgccc tggccgaacg tmnncggaac
atgtgaacct tgaaagcagt aataaactcc 60aacatc
6636766DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
367cttggtgccc tggccgaamn nccacggaac atgtgaacct tgaaagcagt aataaactcc
60aacatc
6636875DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 368cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccatagt
tagcmnntcg 60agcacagtaa tacgt
7536975DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 369cgtggttcct tgcccccagt agtccatagc
atagtagggg ttaccatagt tmnntcttcg 60agcacagtaa tacgt
7537075DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
370cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccatamn nagctcttcg
60agcacagtaa tacgt
7537175DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 371cgtggttcct tgcccccagt agtccatagc atagtagggg ttaccmnngt
tagctcttcg 60agcacagtaa tacgt
7537275DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 372cgtggttcct tgcccccagt agtccatagc
atagtagggg ttmnnatagt tagctcttcg 60agcacagtaa tacgt
7537375DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
373cgtggttcct tgcccccagt agtccatagc atagtagggm nnaccatagt tagctcttcg
60agcacagtaa tacgt
7537475DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 374cgtggttcct tgcccccagt agtccatagc atagtamnng ttaccatagt
tagctcttcg 60agcacagtaa tacgt
7537575DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 375cgtggttcct tgcccccagt agtccatagc
atamnngggg ttaccatagt tagctcttcg 60agcacagtaa tacgt
7537675DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
376cgtggttcct tgcccccagt agtccatagc mnngtagggg ttaccatagt tagctcttcg
60agcacagtaa tacgt
7537775DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 377cgtggttcct tgcccccagt agtccatmnn atagtagggg ttaccatagt
tagctcttcg 60agcacagtaa tacgt
7537875DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 378cgtggttcct tgcccccagt agtcmnnagc
atagtagggg ttaccatagt tagctcttcg 60agcacagtaa tacgt
7537975DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
379cgtggttcct tgcccccagt amnncatagc atagtagggg ttaccatagt tagctcttcg
60agcacagtaa tacgt
7538075DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 380cgtggttcct tgcccccamn ngtccatagc atagtagggg ttaccatagt
tagctcttcg 60agcacagtaa tacgt
75
User Contributions:
Comment about this patent or add new information about this topic: