Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: POLYNUCLEOTIDE MARKERS

Inventors:  Johannes Jacobus Ludgerus Gielen (Bouloc, FR)  Thomas Kraft (Lund, SE)  Pierre Pin (Malmo, SE)
Assignees:  Syngenta Participations AG
IPC8 Class: AC12Q168FI
USPC Class: 435 6
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving nucleic acid
Publication date: 2010-08-19
Patent application number: 20100209919



polynucleotides that are closely linked to the bolting gene or B gene within the sugar beet genome and can be used for the development of molecular markers. The invention further relates to molecular markers and kits comprising said markers that can be used for mapping, identification and isolation of the bolting gene or S gene in the sugar beet genome and to discriminate between the annual and bienniai genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype. The invention also relates to assays and methods of breeding sugar beet plants involving said markers.

Claims:

1-63. (canceled)

64. An isolated nucleic acid molecule having at least 95%, 90%, 85%, 80% or 75% sequence identity to SEQ ID NO: 52, wherein the nucleic acid encodes a polypeptide associated with bolting in sugar beet.

65. The isolated nucleic acid molecule of claim 64, wherein the nucleic acid comprises SEQ ID NO: 52.

66. An isolated nucleic acid molecule encoding a polypeptide having at least 95%, 90%, 85%, 80% or 75% sequence identity to SEQ ID NO: 6, wherein the polypeptide is associated with bolting in sugar beet.

67. The isolated nucleic acid molecule of claim 66, wherein the nucleic acid molecule encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 6.

68. An expression vector comprising a nucleic acid molecule comprising the nucleic acid sequence of claim 64.

69. An amplicon or informative fragment thereof comprising the nucleic acid sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 51, SEQ ID NO: 52 or any allelic variations thereof, wherein the amplicon or informative fragment can be used to identify the absence or presence of an allele associated with annuality in a sugar beet plant.

70. A polynucleotide including an informative fragment thereof, comprising a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5 or variants thereof, wherein said variants comprise a nucleotide sequence selected from the group of nucleotide sequences consisting of:a) a sequence having a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, an A at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 1; orb) a sequence having a G at position 3695, an A at position 3827, an A at position 3954, a C at position 5284, a T at position 5714, an A at position 10954, a G at position 11043, a C at position 11143, a C at position 11150, a C at position 11220, a C at position 11238, a T at position 11299, a G at position 11391, an A at position 12053, a G at position 12086, a C at position 12127, a G at position 12193, a G at position 12337, and an A at position 12837, representing biennial allele 7.

71. A method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, the method comprising:a) obtaining a genomic sample from a sugar beet plant;b) contacting the genomic sample comprising DNA with a pair of primers that, when used in a nucleic-acid amplification reaction with genomic DNA from sugar beet; produces an amplicon that can be used to identify the absence or presence of an allele associated with annuality.c) amplifying a fragment from said genomic sample using the primer pair of b) wherein the primer pair is complementary and binds to the nucleotide sequence of b)d) detecting the amplicon that can be used to identify the absence or presence of an allele associated with annuality in a sugar beet plant.

72. The method of claim 71, wherein the genomic region from which the fragment is amplified comprises SEQ ID NO: 5 or any allelic variations thereof.

73. The method of claim 71, wherein said amplicon comprises a polymorphism that is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial or annual genotype.

74. The method of claim 73, wherein the polymorphism is located at position 3827, 3954, 5284, 5714, 10954, 11220, 11391, 12053, 12127, or 12837 in the B locus of the sugar beet genome.

75. The method of claim 73, wherein the primer pair amplifies an informative fragment from a coding region of the BVPRR7 gene comprising a single nucleotide polymorphism comprising a A/C. SNP at position 3827, a A/T SNP at position 3954, a T/G SNP at position 5714, a C/A SNP at position 11220, a G/A SNP at position 11391, a A/G SNP at position 12053, or a C/T SNP at position 12127

76. The method of claim 71, wherein the amplified fragment from said genomic sample comprises the nucleic acid sequence or informative fragments selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 51, SEQ ID NO: 52.

77. The method of claim 71, wherein the primer pair is complementary and binds to a nucleotide sequence present in the promoter region of the BvPRRR7 gene as depicted in SEQ ID NO: 51.

78. The method of claim 71, wherein the method is used to identify annual seed contaminations in commercial biennial sugar beet seed.

79. The method of claim 71, wherein the primer pair comprises the nucleic acid sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 27, or SEQ ID NO: 28.

80. A method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant the method comprising:a) obtaining a genomic sample from a sugar beet plant;e) contacting the genomic sample comprising DNA with a probe, wherein the probe hybridizes under high stringency conditions with genomic DNA from sugar beet and can identify the absence or presence of an allele associated with annuality.b) Subjecting the sample and probe to high stringency hybridization conditions; andc) Detecting the hybridization of the probe to the DNA wherein the presence or absence of hybridization can be used to identify the absence or presence of an allele associated with annuality in a sugar beet plant.

81. The method of claim 80, wherein the genomic region for which the probe hybridizes under high stringency conditions comprises SEQ ID NO: 5 or allelic variations thereof.

82. An allelic discrimination assay for detecting a polymorphism in a genomic region of the sugar beet genome co-segregating with the annuality phenotype, wherein the polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype comprising a molecular marker, the assay comprising:a) obtaining a genomic sample from a sugar beet plant;b) contacting the genomic sample comprising DNA with a pair of primers that, when used in a nucleic-acid amplification reaction with genomic DNA from sugar beet; produces an amplicon that can be used to identify the absence or presence of an allele associated with annuality.c) amplifying a fragment from said genomic sample using the primer pair of b) wherein the primer pair is complementary and binds to the nucleotide sequence of b)d) detecting the amplicon that can be used to identify the absence or presence of an allele associated with annuality in a sugar beet plant.

83. The assay of claim 82, wherein the primer pair comprises the nucleic acid sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 27, or SEQ ID NO: 28.

84. A pair of primers which anneals to a nucleotide sequence within the coding region of the BvPRR7 gene as depicted in SEQ ID NO: 5 and amplifies an informative fragment from said coding sequence comprising a polymorphism, wherein the polymorphism comprises at least one of the SNPs selected from the group consisting of a A/C SNP at position #3827, an A/T SNP at position #3954, a T/G SNP at position #5714, a C/A SNP at position #11220, a G/A SNP at position #11391, a A/G SNP at position #12053, or a C/T SNP at position #12127.

85. The pair of primers of claim 84 comprising a forward primer F3806 as depicted in SEQ ID NO 27 and a reverse primer R3807 as depicted in SEQ ID NO 28 for amplifying a fragment comprising SNP #3827.

86. The pair of primers of claim 84 comprising a forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8 for amplifying a fragment comprising SNP #160.

Description:

[0001]The present invention is in the area of marker-assisted breeding and quality control of sugar beet seed. In particular, the invention relates to polynucleotides that are closely linked to or residing within the bolting gene or B gene within the sugar beet genome and can be used for the development of molecular markers. The invention further relates to molecular markers and kits comprising said markers that can be used for mapping, identification and isolation of the bolting gene or B gene in the sugar beet genome and to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype. The invention further relates to transgenic approaches, wherein transgenic plants are provided with the B gene either being overexpressed or down-regulated.

[0002]The cultivated sugar beet (Beta vulgaris ssp. vulgaris L.) is a biennial plant which forms a storage root and a leaf rosette in the first year. Shoot elongation (bolting) and flower formation starts after a period of low temperature. In contrast, many wild beets of the genus B. vulgaris ssp. maritime show an annual growing habit due to the presence of the bolting gene B at the B locus, which was mapped to the central region of chromosome II. The dominant allele of locus B. is abundant in wild beets and causes bolting under long days without the cold requirement usually essential for biennial cultivars (Abe et al., 1997) carrying the recessive allele.

[0003]Bolting (stem elongation) is the first step clearly visible in the transition from vegetative to reproductive growth.

[0004]In cultivated sugar beet, bolting is an undesirable phenomenon, as it results in reduction of yield and gives rise to problems during harvesting and sugar extraction. Owing to the incomplete penetrance of the B allele and its environmental dependence, closely linked molecular markers are needed to screen its presence in breeding lines.

[0005]Commercial seed productions for sugar beet are often done in regions, where annual weed beets are growing, which can cause pollen contamination in the seed productions, resulting in annuals in the commercial seed. This is not acceptable to the customers. To identify contaminations with annuals, commercial seed lots are grown in regions where no wild annual beets are growing directly after harvesting the seed. The plants are not vernalized and contaminations are identified by the presence of bolters. Replacing this test with a marker-based screening assay would be highly desirable, as results could be obtained earlier, which would lead to cost savings in seed processing.

[0006]A marker-based approach could also be advantageously used in sugar beet breeding, e.g., to speed up the breeding process, or to introduce new variation from wild sea beets. In these cases, it is important to have a marker tightly linked to the B gene to be able to select annuals or biennials accurately.

[0007]The present invention now provides the means to develop such markers.

[0008]In particular, the present invention relates to a polynucleotide, particularly an isolated polynucleotide, identified in the sugar beet genome including variants and derivatives thereof, which polynucleotide is genetically closely linked to, or, preferably, located within the bolting gene or B gene. The invention further relates to the use of said polynucleotide for the development of markers that can be used for mapping, identification and isolation of the bolting gene or B gene in the sugar beet genome.

[0009]In one aspect of the invention, the polynucleotide according to the invention shows perfect co-segregation with the bolting gene (B gene) associated phenotype in sugar beet.

[0010]In one embodiment, the invention relates to a polynucleotide including informative fragments thereof according to the invention and as described herein before, which polynucleotide is obtainable from a genomic DNA region that maps at a distance of 1 cM upstream of markers MP0176 and GJQI and co-segregates with marker GJ131, shows perfect co-segregation with the bolting gene (B gene) associated phenotype in sugar beet.

[0011]In another embodiment, the invention relates to a polynucleotide including informative fragments thereof, particularly an isolated polynucleotide, according to the invention and as described herein before which is obtainable from a genomic DNA located in the interval delimited by markers a GJ131 and GJ01.

[0012]In one embodiment of the invention, a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, is provided which polynucleotide is obtainable from a genomic sugar beet DNA genetically linked to the bolting gene or B gene in the sugar beet genome and comprises one or more of the following elements: [0013]a) an intronic region that yields an amplification product of approximately 0.5 kb in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template, particularly a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 2, 3 or 4, or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein; [0014]b) a polynucleotide fragment comprising a nucleotide sequence which has 70%, particularly 75%, more particularly 80%, even more particularly 85%, but especially 90% and up to 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO:1 or SEQ ID NO: 52; [0015]c) a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 5 or a sequence which has 70%, particularly 75%, more particularly 80%, even more particularly 85%, but especially 90% and up to 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 5 or SEQ ID NO: 51; [0016]d) a polynucleotide fragment which, after splicing, encodes a polypeptide which has at least 80%, particularly at least 85%, more particularly at least 90%, even more particularly at least 95%, but especially at least 98% and up to 100% sequence identity with a nucleotide sequence shown in SEQ ID NO: 6 and, optionally, in addition [0017]e) a highly conserved portion encoding a Pseudo Response Regulator Receiver Domain motif (PRR) near the NH2-terminus and a CCT motif at the COOH-terminus.

[0018]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising an intronic region that yields an amplification product of approximately 0.5 kb in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template.

[0019]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 1, or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85% but especially at least 90% and up to at least 95%-99% sequence identity therein.

[0020]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 2, 3 or 4, or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein.

[0021]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, which, after splicing, encodes a polypeptide which has at least 80%, particularly at least 85%, more particularly at least 90%, even more particularly at least 95%, but especially at least 98% and up to 100% sequence identity with a nucleotide sequence shown in SEQ ID NO: 6

[0022]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 5 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 5.

[0023]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 51 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO 51.

[0024]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 52 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 52.

[0025]All individual numerical values, which fall into the range from between 70%-99% as mentioned herein before, i.e., 71%, 72%, 73%, 74%, 75%, . . . 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% should likewise be covered by the present invention.

[0026]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 1, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0027]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 2, 3 or 4 particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0028]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 5, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0029]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 51, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0030]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence which encodes a polypeptide having an amino acid sequence as depicted in SEQ ID NO: 6, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0031]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 52, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.

[0032]In one embodiment of the invention, a polynucleotide is provided including an informative fragment thereof, particularly an isolated polynucleotide, which polynucleotide is obtainable from a genomic sugar beet DNA genetically linked to the bolting gene or B gene in the sugar beet genome [0033]a) by screening a BAC library developed from the biennial commercial cultivar H20 using forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO 7 and SEQ ID NO 8, respectively, in a PCR reaction, particularly under the following conditions: [0034]primary denaturation at 95° C. for 5 min; followed by [0035]35 amplification cycles of 30 seconds at 95° C., [0036]30 seconds at 60° C.; [0037]30 seconds at 72° C.; and followed by [0038]5 min at 72° C. [0039]b) selecting BAC SBA079-L24 comprising two non-overlapping contigs both sharing sequence homology with EST CV301305 as given in SEQ ID NO: 1 and combining them into one single sequence; [0040]c) obtaining the gene structure of the beet BvPRR7 gene comprising introns and exons based on the alignment of the BAC sequence contigs to EST CV301305 as given in SEQ ID NO:1 and on sequence homology to the PRR7 gene from Arabidopsis.

[0041]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 1.

[0042]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 2.

[0043]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 3.

[0044]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO 4.

[0045]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5.

[0046]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 51.

[0047]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 52.

[0048]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, an A at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 1.

[0049]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a T at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, an A at position 11238, an T at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, a G at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 2.

[0050]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a G at position 11043, a T at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at, position 11391, a G at position 12053, a G at position 12086, a T at position 12127, a G at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 3.

[0051]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a T at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 4.

[0052]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391, a G at position 12053, an A at position 12086, a T at position 12127, an A at position 12193, an A at position 12337, and a G at position 12837, representing annual allele 5.

[0053]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, an A at position 12337, and a G at position 12837, representing annual allele 6.

[0054]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, an A at position 3827, an A at position 3954, a C at position 5284, a T at position 5714, an A at position 10954, a G at position 11043, a C at position 11143, a C at position 11150, a C at position 11220, a C at position 11238, a T at position 11299, a G at position 11391, an A at position 12053, a G at position 12086, a C at position 12127, a G at position 12193, a G at position 12337, and an A at position 12837, representing biennial allele 7.

[0055]In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence which encodes a polypeptide having an amino acid sequence as depicted in SEQ ID NO: 6.

[0056]In one embodiment, the invention relates to an amplification product of approximately 0.5 kb including an informative fragment, which is obtainable in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template.

[0057]In a specific embodiment of the invention, a set of polynucleotide markers is provided comprising a plurality of individual markers which markers are developed based on a polynucleotide as depicted in SEQ ID NO: 5 including any of its allelic variants 1 to 7 as disclosed herein before and are capable of detecting the various SNPs at the nucleotide positions given in Table 5, wherein said set of markers is capable of identifying the different alleles and thus of differentiating between annual and biennial sugar beet lines.

[0058]In one embodiment, the invention relates to one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially one or a plurality of primer pairs consisting of a forward primer and a reverse primer, which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, but particularly to a region within the B gene, and which comprises a polynucleotide according to the invention and as described herein before including an informative fragment thereof, wherein said fragment comprises a polymorphism, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial or annual genotype.

[0059]In one embodiment of the invention, a polynucleotide marker is provided which can be developed from a polynucleotide molecule or an informative fragment thereof selected from the group of polynucleotides as depicted in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 51, SEQ ID NO: 52 and a polynucleotide encoding a polypeptide comprising a amino acid sequence as depicted in SEQ ID NO: 6, wherein said polynucleotide comprises one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0060]In a specific embodiment of the invention, a polynucleotide marker is provided which is developed based on a polynucleotide as depicted in SEQ ID NO: 2, which marker is capable of detecting at least one of the following SNPs in the 3rd intron of the BvPRR7 gene: [0061]a) a cytosine or a thymine at position 87 [0062]b) a cytosine or thymine at position 160 [0063]c) an adenine or a guanine at position 406and thus of differentiating between annual and biennial haplotypes.

[0064]In one embodiment, said polynucleotide marker is represented by one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene and exhibits the nucleotide sequences as shown in SEQ ID NO:2 and of amplifying an informative fragment thereof, wherein said fragment comprises one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP as shown, for example, in Table 1, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0065]In a specific embodiment, a pair of primers is provided according to the invention and as described herein before, which anneals to a nucleotide sequence within the 3rd intron as depicted in SEQ ID NO: 2 and amplifies an informative fragment from said region comprising a polymorphism, particularly a polymorphism comprising a C/T SNP at position #87 and/or a UT SNP at position #160 and/or an A/G SNP at position #406.

[0066]In particular, a pair of primers comprises a forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8 for amplifying a fragment comprising the SNP #160, SNP #87 and SNP #406.

[0067]In one embodiment, the polynucleotide marker according to the invention is represented by one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, particularly to a nucleotide sequence within the B gene, particularly to a nucleotide sequence as shown in SEQ ID NO 5 and of amplifying an informative fragment thereof, wherein said fragment comprises one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP as shown, for example, in Table 5, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0068]In a specific embodiment, a pair of primers is provided according to the invention and as described herein before, which anneals to a nucleotide sequence within the coding region of the BvPRR7 gene as depicted in SEQ ID NO: 5 and amplifies an informative fragment from said coding sequence comprising a polymorphism, particularly a polymorphism comprising an A/C SNP at position #3827 and/or an A/T SNP at position #3954 and/or a T/G SNP at position #5714 and/or a C/A SNP at position #11220, and/or a G/A SNP at position #11391, and/or an A/G SNP at position #12053, and/or a C/T SNP at position #12127.

[0069]In particular, a first pair of primers comprises a forward primer F3806 as depicted in [0070]SEQ ID NO 27 and a reverse primer R3807 as depicted in SEQ ID NO 28 for amplifying a fragment comprising the SNP #3827 and SNP #3954.

[0071]A second pair of primers comprises a forward primer F3768 as depicted in SEQ ID NO 21 and a reverse primer R3769 as depicted in SEQ ID NO 22 for amplifying a fragment comprising the SNP #5714.

[0072]A third pair of primers comprises a forward primer F3857 as depicted in SEQ ID NO 37 and a reverse primer R3858 as depicted in SEQ ID NO 38 for amplifying a fragment comprising the SNP #11220.

[0073]A fourth pair of primers comprises a forward primer F3859 as depicted in SEQ ID NO 39 and a reverse primer R3860 as depicted in SEQ ID NO 40 for amplifying a fragment comprising the SNP #11391.

[0074]A fifth pair of primers comprises a forward primer F3861 as depicted in SEQ ID NO 41 and a reverse primer R3862 as depicted in SEQ ID NO 42 for amplifying a fragment comprising the SNP #12053 and SNP #12127.

[0075]In one embodiment, the polynucleotide marker according to the invention is represented by one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, particularly to a nucleotide sequence within the B gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene as shown in SEQ ID NO: 5 and SEQ ID NO: 51, respectively, and of amplifying an informative fragment thereof, which is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0076]In a specific embodiment of the invention, a polynucleotide marker is provided which is represented by a primer pair selected from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as template, but does not provide amplification for the annual lines.

[0077]Said informative fragment may further comprise one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0078]The invention further relates to one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, particularly to a nucleotide sequence within the B gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene as shown in SEQ ID NO: 5 and SEQ ID NO: 51, respectively, and of amplifying an informative fragment thereof, which is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.

[0079]In another specific embodiment of the invention, a primer pair is provided selected from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as template, but does not provide amplification for the annual lines.

[0080]The above probe molecules and/or primers can be used in a method of identifying annual contaminations in commercial sugar beet seed.

[0081]In one embodiment, the invention relates to a set of probe polynucleotides comprising at least two separate probe molecules that are complementary to a sub-region within an informative polynucleotide fragment according to the invention and as described herein before comprising a polymorphic site and amplify partially overlapping fragments which differ only by one or two base mismatches in the area of overlap, wherein a first probe, particularly a probe labelled with a first fluorescent dye, more particularly with a first fluorescent dye and a quencher represents one allele and a second probe, particularly a probe labelled with a second fluorescent dye, which is not identical with the first dye, more particularly with a second fluorescent dye and a quencher, represents the other allele.

[0082]In a specific embodiment of the invention, said informative polynucleotide fragment comprises a polymorphism, wherein said polymorphism is based on SNP #3827, within the Pseudo-receiver domain of the PRR7 gene depicted in SEQ ID NO: 5 and the first probe molecule labelled with a first fluorescent dye, has a nucleotide sequence as shown in SEQ ID NO: 47 and the second probe molecule labelled with a second fluorescent dye, has a nucleotide sequence as shown in SEQ ID NO: 48.

[0083]In one embodiment, the invention relates to the use of a polynucleotide according to the invention and as described herein before, or any informative fragment thereof, for developing a marker that may be used in an allelic discrimination assay for detecting a polymorphism in the sugar beet genome, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype or for mapping the B gene to the sugar beet genome.

[0084]In a specific embodiment, the invention relates to the use of one or a plurality of primers, particularly one or a plurality of primer pairs, according to the invention and as described herein before in an allelic discrimination assay for detecting a polymorphism in the sugar beet genome, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype.

[0085]In another specific embodiment of the invention, a set of probe molecules according to the invention and as described herein before may in addition be employed in said allelic discrimination assay.

[0086]In one embodiment, the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising [0087]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0088]b) analyzing the nucleotide sequence of the genomic region of the sugar beet genome that is genetically closely linked to the B gene and complementary to or comprises the sequence of a polynucleotide according to the invention and as described herein before, and [0089]c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively.

[0090]In one embodiment, the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising [0091]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0092]b) amplifying a fragment from said sample DNA using a primer, particularly a primer pair, that is complementary and binds to a nucleotide sequence present in the promoter region of the BvPRR7 gene, particularly the BvPRR7 as disclosed in SEQ ID NO: 51, and [0093]c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype but not with the annual phenotype.

[0094]In one embodiment, the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising [0095]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0096]b) probing said sample DNA with a probe molecule comprising an allele-specific sequence, particularly an allele-specific sequence form the promoter region of the BvPRR7 gene, particularly the BvPRR7 as disclosed in SEQ ID NO: 51, known to be present in the biennial allele but not in the annual allele.

[0097]In a specific embodiment of the invention, a primer pair is used in said method selected from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as template, but does not provide amplification for the annual lines.

[0098]In one embodiment, the invention relates to a method of identifying a specific haplotype within a plant grouping of sugar beet plants exhibiting a biennial genotype comprising [0099]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0100]b) analyzing the nucleotide sequence of the genomic region of the sugar beet genome that is genetically closely linked to the B gene and complementary to or comprises the sequence of a polynucleotide according to the invention and as described herein before, and [0101]c) comparing said sequence with an allelic sequence known to be associated with a specific haplotype.

[0102]In a specific embodiment, the sequence analysis is carried out using a molecular marker based on a polynucleotide or an informative fragment thereof or on one or a plurality of primers, particularly on one or a plurality of primer pairs, but especially on one or a plurality of primer pairs consisting of a forward primer and a reverse primer according to the invention and as described herein before.

[0103]In another specific embodiment, a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant is provided comprising [0104]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0105]b) analyzing the nucleotide sequence of an intronic region obtainable from the sugar beet genome by PCR amplification based on forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8, and [0106]c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively.

[0107]In one embodiment, the intronic region has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with the nucleotide sequence depicted in SEQ ID NO: 2.

[0108]In still another specific embodiment the intronic region has a nucleotide sequence as shown in SEQ ID NO: 2.

[0109]In another specific embodiment, a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant is provided, comprising [0110]a) obtaining a genomic sample from a sugar beet plant to be analyzed, [0111]b) analyzing the nucleotide sequence of a genomic region comprising a nucleotide sequence as given in SEQ ID NO: 5, and [0112]c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively, and [0113]d) determining whether said genomic sample is from a genome representing an annual or a biennial phenotype.

[0114]In still another specific embodiment, a method is provided wherein within a genomic sample from a sugar beet plant the intronic region of a polynucleotide according to the invention and as described herein before is analyzed using a forward and a reverse primer flanking a sub-region within said intronic region known to comprise a polymorphic site, amplifying said sub-region and comparing the amplified fragment with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively.

[0115]In another specific embodiment, a method is provided as described herein before, wherein a set of probe polynucleotides is designed based on said SNP comprising two separate probe molecules which differ by at least one mismatch, particularly by two or more mismatches located at adjacent sites, but especially by one single mismatch, wherein a first probe molecule, particularly a labelled probe molecule, more particularly a probe molecule labelled with a first fluorescent dye and a quencher, represents one allele and a second probe molecule, particularly a labelled probe molecule, more particularly a probe molecule labelled with a second fluorescent dye and a quencher, which is not identical with the first dye, represents the other allele, and wherein said set of probe polynucleotides is used for discriminating between the two allelic variants.

[0116]In particular, the markers according to the present invention can be used in an allelic discrimination assay, particularly in an assay for discriminating between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype. Said assay is based on a set of probe polynucleotides comprising two separate probe molecules that are complementary, for example, to a subregion of the BvPRR7 gene obtainable by PCR amplification based on forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, which probe molecules differ only by one base mismatch, particularly a base mismatch at position #631.

[0117]A first probe molecule, particularly a probe molecule which has a sequence as depicted in SEQ ID NO: 9 and is labelled with a first fluorescent dye such as, for example, FAM, more particularly with a first fluorescent dye and a quencher, represents one allele and a second probe molecule, particularly a probe molecule which has a sequence as depicted in SEQ ID NO: 10 and is labelled with a second fluorescent dye, which is not identical with the first dye, such as, for example VIC, more particularly with a second fluorescent dye and a quencher, represents the other allele.

[0118]In one embodiment, an allelic discrimination assay is provided for detecting a polymorphism in a genomic region of the sugar beet genome co-segregating with the annuality phenotype, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype, comprising a molecular marker developed based on a polynucleotide according to the invention and as described herein before or any informative fragment thereof.

[0119]In a specific embodiment, said molecular marker comprises a pair of primers according to the invention and as described herein before.

[0120]In another specific embodiment, an allelic discrimination assay is provided for detecting a single-base polymorphism in an intronic region obtainable from the sugar beet genome by PCR amplification based on forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8, comprising a set of primers and/or probe polynucleotides according to the invention and as described herein before.

[0121]In one embodiment, the intronic region has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with the nucleotide sequence depicted in SEQ ID NO: 2.

[0122]In still another specific embodiment the intronic region has a nucleotide sequence as shown in SEQ ID NO: 2.

[0123]In one embodiment, the invention relates to the use of a polynucleotide according to the invention and as described herein before for the development of a molecular marker to be used for identifying the absence or presence of an allele associated with annuality in a sugar beet genome, comprising [0124]a) identifying in said polynucleotide polymorphic sites [0125]b) associating said polymorphisms with the absence or presence of an allele associated with annuality in sugar beet by [0126]c) designing a probe molecule or a plurality of probe molecules, particularly a primer or a plurality of primers, particularly a pair of primers or a plurality of primer pairs, but especially a forward and reverse primer recognizing a nucleotide sequence flanking this polymorphic site for amplification of a polynucleotide comprising said polymorphic site that can be used in an allelic discrimination assay.

[0127]In one embodiment, the invention relates to a method of identifying annual contaminations in commercial seed using a polynucleotide according to the invention and as described herein before or an informative fragment thereof as a marker for determining the presence or absence of the annuality allele in a plant sample.

[0128]In particular, the invention relates to a method of identifying annual contaminations in commercial seed using a polynucleotide according to the invention and as described herein before or an informative fragment thereof as a marker for identifying annual contaminations in commercial seed.

[0129]In one embodiment, the invention relates to a method of identifying annual contaminations in commercial seed using a marker-based allelic discrimination assay according to the invention and as described herein before.

[0130]The invention further relates to the use of the B gene, particularly the BvPRR7 gene, in a transgenic approach for producing plants exhibiting an annual or an non-bolting phenotype.

[0131]In particular, the invention relates to chimeric constructs comprising an expression cassette comprising the coding sequence of the B gene, particularly the BvPRR7 coding sequence as depicted in SEQ ID NO:1, but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein under the control of regulatory elements, particularly under the control of regulatory elements functional in plants.

[0132]In one embodiment, the invention provides chimeric constructs comprising an expression cassette comprising the coding sequence of the B gene, particularly the BvPRR7 coding sequence as depicted in SEQ ID NO:1, but particularly in SEQ ID NO 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein under the control of annual promoter and terminator sequences such as those provided in the PRR7 gene, particularly the PRR7 gene of Beta vulgaris.

[0133]In one embodiment of the invention, the chimeric construct as described hereinbefore may further contain a selection marker gene which allows discriminating between transformed and non-transformed plant material in a selection procedure.

[0134]In one embodiment, the chimeric construct of the invention comprises a negative selection marker, particularly a selection marker encoding a resistance to plant toxic compounds such as antibiotics or herbicides.

[0135]In one embodiment, the chimeric construct of the invention comprises a positive selection marker, particularly a selection marker encoding an enzyme that provides the transformed plant with a selective advantage over the non-transformed plants, particularly a nutritional advantage such as, for example, a phosphomannose isomerase gene, a xylose isomerase gene.

[0136]In one embodiment of the invention, a transformation vector and/or an expression vector is provided, particularly a plant transformation vector and/or an expression vector, comprising the chimeric construct of the invention as described herein before.

[0137]In one embodiment of the invention a plant cell is provided, particularly a plant cell of a sugar beet plant, comprising a chimeric polynucleotide construct or a vector molecule according to the invention and as described herein before.

[0138]In one embodiment of the invention a plant is provided, particularly a sugar beet plant, comprising a plant cell of the invention and expressing the B gene protein, particularly the BvPRR7 protein such that the plant exhibits an annual phenotype.

[0139]In one embodiment of the invention, a polynucleotide construct is provided for transgenic suppression of BvPRR7 gene expression, particularly through an antisense or an RNAi approach.

[0140]In one embodiment of the invention, a polynucleotide construct is provided comprising a nucleotide sequence encoding a dsRNA which is capable of targetting mRNAs produced by transcription of the DNA sequence encoding the B gene protein, particularly the BvPRR7 protein, for degradation.

[0141]In one embodiment, a polynucleotide construct is provided comprising a nucleotide sequence encoding a dsRNA which is substantially identical with at least a region of the coding sequence of the B gene, particularly the coding region of the BvPRR7 gene as depicted in SEQ ID NO:1, but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein.

[0142]In one embodiment of the invention, a polynucleotide construct is provided comprising a fragment of the coding region of the B gene, particularly a fragment of the coding region of the BvPRR7 gene as depicted in SEQ ID NO:1, but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 96%-99% sequence identity therein, assembled into an RNAi cassette under the control of the constitutive promoter such as, for example, the Ubi3 promoter from Arabidopsis.

[0143]In one embodiment of the invention, a transformation vector and/or an RNAi expression vector is provided, particularly a plant transformation vector and/or an expression vector, comprising the polynucleotide construct of the invention as described herein before.

[0144]In one embodiment of the invention, a plant cell is provided, comprising a polynucleotide construct or a vector molecule according to the invention and as described herein before.

[0145]In one embodiment of the invention, a plant is provided, particularly a sugar beet plant, comprising a plant cell of the invention and expressing the dsRNA such that bolting is suppressed and the plant exhibits a non-bolting phenotype.

BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCES

[0146]FIGURES

[0147]FIG. 1 shows an amino acid sequence comparison of the REC domains between different species and the putative REC domain of sugar beet EST CV301305. Identical amino acids are in black; conserved in grey; weakly similar in light grey and non-similar in white. Bb, Bordetella bronchiseptica; Bs, Bacillus subtilis; Bv, Beta vulgaris; Ec, Escherichia coil; Kp, Klebsiella pneumoniae; Pa, Pseudomonas aeruginosa; Rc, Rhodobacter capsulatus; Sc, Streptomyces coelicolor; Sf, Shigella flexneri; St, Salmonella typhimurium.

[0148]FIG. 2: Amino acid sequence comparison of the Arabidopsis PRR7 protein and the predicted partial protein from sugar beet EST CV301305. Identical amino acids are in black; similar in grey and non-similar in white.

[0149]FIG. 3: Sequence alignment between the genomic and mRNA sequences of the Arabidopsis PRR7 gene and sugar beet EST CV301305. Conserved nucleotides between Arabidopsis and Beta vulgaris L. are in grey. Introns are represented by strings of dashes.

[0150]FIG. 4: Genetic map of sugar beet chromosome II. Marker names are given at the right of the chromosome, at the left the cumulative genetic distance is indicated.

[0151]FIG. 5: Schematic representation of the gene structure of the BvPRR7 gene showing putative exons and introns. The region covered by EST CV301305 is shown by the block arrow.

[0152]FIG. 6: Amino acid sequence comparison of the Arabidopsis PRR gene family members and the BvPRR7 protein. Identical amino acids are in black; conserved in grey; weakly similar in light grey and non-similar in white. The REC and CCT motifs are boxed.

[0153]FIG. 7: Phylogenetic relationship between BvPRR7 and related proteins from other flowering plants. The predicted amino acid sequence of BvPRR7 was aligned to the proteins listed below using ClustaiW and an unrooted phylogenetic tree was constructed. The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 352 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 software (Tamura et al., 2007). At PRR3, Arabidopsis Mariana PRR3 (NP--568919); At PRR5, Arabidopsis thaliana PRR5 (NP--568446); At PRR7, Arabidopsis thaliana PRR7 (NP--568107); At PRR9, Arabidopsis thaliana PRR9 (NP--566085); At TOC1, Arabidopsis thaliana TOC1/PRR1 (NP--200946); Hv PPD-H1, Hordeum vulgare PPD-H1 (AAY17586); Os PRR37, Oryza sativa PRR37 (Q0D3B6); Ta PPD-D1, Triticum aestivum PPD-D1 (ABL09477).

[0154]FIG. 8: Gene expression profile of BvPRR7 in biennial sugar beet plant grown in long days (16 h light, 8 h dark) and at constant temperature 18° C. Values are expressed as relative expression levels normalized against the BvBTU and BvICDH reference genes by geometric averaging analysis (Vandesompele et al., 2002).

[0155]FIG. 9. Plasmid map of the binary vector for the transformation of the BvPRR7 cDNA under the control of the annual BvPRR7 promoter fragment. The selectable marker consists of the PMI gene under the control of the HSP80 promoter (Brunke and Wilson, 1993).

[0156]FIG. 10. Plasmid map of the binary vector for the transgenic suppression of BvPRR7 by means of RNAi. The inverted repeat for BvPRR7 consists of a 0.6 Kb cDNA fragment that was cloned between the Ubi3 promoter (Norris at al, 1993) and Nos terminator in both the antisense and sense orientation, separated by the second intron of the StLS1 gene from potato (Eckes et al, 1986, Vancanneyt at al, 1990). The selectable marker consists of the PMI gene under the control of the HSP80 promoter (Brunke and Wilson, 1993).

SEQUENCES

[0157]SEQ ID NO 1 depicts the nucleotide sequence of EST CV301305 [0158]SEQ ID NO: 2 depicts the nucleotide sequence of Intron 3 of BvPRR7 and its allelic variability for mapping [0159]SEQ ID NO: 3 depicts the nucleotide sequence of Intron 3 of allelic variant 1 of BvPRR7 (haplotype #1) [0160]SEQ ID NO: 4 depicts the nucleotide sequence of Intron 3 of allelic variant 2 of BvPRR7 (haplotype #2) [0161]SEQ ID NO: 5 depicts the genomic nucleotide sequence of BvPRR7 [0162]SEQ ID NO: 6 depicts the putative amino acid sequence of BvPRR7 [0163]SEQ ID NO: 7 depicts the nucleotide sequence of primer PRR7-F [0164]SEQ ID NO: 8 depicts the nucleotide sequence of primer PRR7-R [0165]SEQ ID NO: 9 depicts the nucleotide sequence of probe PRR7(T1)-FAM [0166]SEQ ID NO: 10 depicts the nucleotide sequence of probe PRR7(T1)-VIC [0167]SEQ ID NO: 11 depicts the nucleotide sequence of forward primer BvPRR7 [0168]SEQ ID NO: 12 depicts the nucleotide sequence of reverse primer BvPRR7 [0169]SEQ ID NO: 13 depicts the nucleotide sequence of forward primer BvBTU [0170]SEQ ID NO: 14 depicts the nucleotide sequence of reverse primer BvBTU [0171]SEQ ID NO 15 depicts the nucleotide sequence of forward primer BvICDH [0172]SEQ ID NO: 16 depicts the nucleotide sequence of reverse primer BvICDH [0173]SEQ ID NO 17 depicts the nucleotide sequence of primer F3766 [0174]SEQ ID NO: 18 depicts the nucleotide sequence of primer R3767 [0175]SEQ ID NO: 19 depicts the nucleotide sequence of primer F3354 [0176]SEQ ID NO: 20 depicts the nucleotide sequence of primer R3355 [0177]SEQ ID NO: 21 depicts the nucleotide sequence of primer F3768 [0178]SEQ ID NO: 22 depicts the nucleotide sequence of primer R3769 [0179]SEQ ID NO: 23 depicts the nucleotide sequence of primer F3782 [0180]SEQ ID NO: 24 depicts the nucleotide sequence of primer R3783 [0181]SEQ ID NO: 25 depicts the nucleotide sequence of primer F3784 [0182]SEQ ID NO: 26 depicts the nucleotide sequence of primer R3785 [0183]SEQ ID NO: 27 depicts the nucleotide sequence of primer F3806 [0184]SEQ ID NO: 28 depicts the nucleotide sequence of primer R3807 [0185]SEQ ID NO: 29 depicts the nucleotide sequence of primer F3808 [0186]SEQ ID NO: 30 depicts the nucleotide sequence of primer R3809 [0187]SEQ ID NO: 31 depicts the nucleotide sequence of primer F3810 [0188]SEQ ID NO: 32 depicts the nucleotide sequence of primer R3811 [0189]SEQ ID NO: 33 depicts the nucleotide sequence of primer F3853 [0190]SEQ ID NO 34 depicts the nucleotide sequence of primer F3854 [0191]SEQ ID NO: 35 depicts the nucleotide sequence of primer F3855 [0192]SEQ ID NO: 36 depicts the nucleotide sequence of primer R3856 [0193]SEQ ID NO: 37 depicts the nucleotide sequence of primer F3857 [0194]SEQ ID NO: 38 depicts the nucleotide sequence of primer R3858 [0195]SEQ ID NO: 39 depicts the nucleotide sequence of primer F3859 [0196]SEQ ID NO 40 depicts the nucleotide sequence of primer R3860 [0197]SEQ ID NO: 41 depicts the nucleotide sequence of primer F3861 [0198]SEQ ID NO: 42 depicts the nucleotide sequence of primer R3862 [0199]SEQ ID NO 43 depicts the nucleotide sequence of primer F3863 [0200]SEQ ID NO: 44 depicts the nucleotide sequence of primer R3864 [0201]SEQ ID NO: 45 depicts the nucleotide sequence of primer F3865 [0202]SEQ ID NO: 46 depicts the nucleotide sequence of primer R3866 [0203]SEQ ID NO: 47: depicts the nucleotide sequence of probe PRR7(#3827)-FAM [0204]SEQ ID NO: 48: depicts the nucleotide sequence of probe PRR7(#3827)-VIC [0205]SEQ ID NO: 49: depicts the nucleotide sequence of forward primer BvPRR7 used for gene expression analysis [0206]SEQ ID NO: 50: depicts the nucleotide sequence of reverse primer BvPRR7 used for gene expression analysis [0207]SEQ ID NO: 51: depicts the nucleotide sequence of genomic nucleotide sequence of BvPRR7 including about 13 kb of the promoter region. [0208]SEQ ID NO 52: depicts the nucleotide sequence of the coding region of BvPRR7.

DEFINITIONS

[0209]The technical terms and expressions used within the scope of this application are generally to be given the meaning commonly applied to them in the pertinent art of plant molecular biology if not otherwise indicated herein below.

[0210]As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes one or more plants, and reference to "a cell" includes mixtures of cells, tissues, and the like.

[0211]"Sugar beet" refers to all species and subspecies within, the genus Beta as well as all kinds of cultivated beets of Beta vulgar/s. Cultivated beets have been separated into four groups: leaf beet, garden beet, fodder beet and sugar beet. "Sugar beet" refers also to all cultivated beets including those grown for other purposes than the production of sugar, such as ethanol, plastics or industrial products. In particular, "Sugar beet" refers to fodder beet and sugar beet, but especially to sugar beet.

[0212]An "annual sugar beet line" refers to a sugar beet plant containing the dominant allele b at the B locus in a heterozygous or homozygous state.

[0213]A "biennial sugar beet line" refers to a sugar beet plant containing the recessive allele b at the B locus in a homozygous state

[0214]"Bolting" refers to the transition from the vegetative rosette stage to the inflorescence or reproductive growth stage.

[0215]"B gene" as used herein refers to a gene that is responsible for early bolting in sugarbeet. Plants carrying the dominant allele make shoot elongation followed by flowering without prior exposure to cold temperatures.

[0216]"Vernalization" refers to the process by which floral induction in some plants is promoted by exposing the plants to chilling for certain duration.

[0217]An "allele" is understood within the scope of the invention to refer to alternative forms of various genetic units associated with different forms of a gene or of any kind of identifiable genetic element, which are alternative in inheritance because they are situated at the same locus in homologous chromosomes. In a diploid cell or organism, the two alleles of a given gene (or marker) typically occupy corresponding loci on a pair of homologous chromosomes.

[0218]As used herein, the term "breeding", and grammatical variants thereof, refer to any process that generates a progeny individual. Breedings can be sexual or asexual, or any combination thereof. Exemplary non-limiting types of breedings include crossings, selfings, doubled haploid derivative generation, and combinations thereof.

[0219]"Locus" is understood within the scope of the invention to refer to a region on a chromosome, which comprises a gene or any other genetic element or factor contributing to a trait.

[0220]As used herein, the phrase "genetic marker" refers to a feature of an individual's genome (e.g., a nucleotide or a polynucleotide sequence that is present in an individual's genome) that is associated with one or more loci of interest. In some embodiments, a genetic marker is polymorphic in a population of interest, or the locus occupied by the polymorphism, depending on context. Genetic markers include, for example, single nucleotide polymorphisms (SNIPs), indels (i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples, Genetic markers can, for example, be used to locate genetic loci containing alleles that contribute to variability in expression of phenotypic traits on a chromosome. The phrase "genetic marker" can also refer to a polynucleotide sequence complementary to a genomic sequence, such as a sequence of a nucleic acid used as probes.

[0221]A genetic marker can be physically located in a position on a chromosome that is within or outside of to the genetic locus with which it is associated (i.e., is intragenic or extragenic, respectively). Stated another way, whereas genetic markers are typically employed when the location on a chromosome of the gene that corresponds to the locus of interest has not been identified and there is a non-zero rate of recombination between the genetic marker and the locus of interest, the presently disclosed subject matter can also employ genetic markers that are physically within the boundaries of a genetic locus (e.g., inside a genomic sequence that corresponds to a gene such as, but not limited to a polymorphism within an intron or an exon of a gene). In some embodiments of the presently disclosed subject matter, the one or more genetic markers comprise between one and ten markers, and in some embodiments the one or more genetic markers comprise more than ten genetic markers.

[0222]As used herein, the phrase "informative fragment" refers to a polynucleotide fragment with an information content that is a retrievable and can assist in the determination and/or characterization of a genetic locus of interest. This information content may be represented by a polymorphism which is associated with said locus of interest such as, for example, a single nucleotide polymorphisms (SNPs), indels (i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples and may be used for the development of a genetic marker. The information content of such an "informative fragment" may also be represented by a specific sequence that can be detected by a corresponding probe molecule.

[0223]As used herein, the phrase "phenotypic trait" refers to the appearance or other detectable characteristic of an individual, resulting from the interaction of its genome with the environment.

[0224]"Marker-based selection" is understood within the scope of the invention to refer to the use of genetic markers to detect one or more nucleic acids from the plant, where the nucleic acid is associated with a desired trait to identify plants that carry genes for desirable (or undesirable) traits, so that those plants can be used (or avoided) in a selective breeding program.

[0225]"Microsatellite or SSRs (Simple sequence repeats) (Marker)" is understood within the scope of the invention to refer to a type of genetic marker that consists of numerous repeats of short sequences of DNA bases, which are found at loci throughout the plant's DNA and have a likelihood of being highly polymorphic.

[0226]"PCR (Polymerase chain reaction)" is understood within the scope of the invention to refer to a method of producing relatively large amounts of specific regions of DNA, thereby making possible various analyses that are based on those regions.

[0227]"PCR primer" is understood within the scope of the invention to refer to rrelatively short fragments of single-stranded DNA used in the PCR amplification of specific regions of DNA.

[0228]"Phenotype" is understood within the scope of the invention to refer to a distinguishable characteristic(s) of a genetically controlled trait.

[0229]"Polymorphism" is understood within the scope of the invention to refer to the presence in a population of two or more different forms of a gene, genetic marker, or inherited trait.

[0230]"Selective breeding" is understood within the scope of the invention to refer to a program of breeding that uses plants that possess or display desirable traits as parents.

[0231]The term "polynucleotide" is understood herein to refer to polymeric molecule of high molecular weight which can be single-stranded or double-stranded, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine. A "polynucleotide fragment" is a fraction of a given polynucleotide molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. A "genome" is the entire body of genetic material contained in each cell of an organism. The term "polynucleatide" thus refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. Unless otherwise indicated, a particular nucleic acid sequence of this invention also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., 1991; Ohtsuka et 1985; Rossolini et al., 1994). The term polynucleotide is used interchangeably with nucleic acid, nucleotide sequence and may include genes, cDNAs, and mRNAs encoded by a gene, etc.

[0232]The polynucleotide of the invention is understood to be provided in isolated form. The term "isolated" means that the polynucleotide disclosed and claimed herein is not a polynucleotide as it occurs in its natural context, if it indeed has a naturally occurring counterpart. Accordingly, the other compounds of the invention described further below are understood to be isolated. If claimed in the context of a plant genome, the polynucleotide of the invention is distinguished over naturally occurring counterparts by the insertion side in the genome and the flanking sequences at the insertion side.

[0233]As used herein, the phrase "nucleic acid" refers to any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g., a typical DNA or RNA polymer), modified oligonucleotides (e.g., oligonucleotides comprising bases that are not typical to biological RNA or DNA, such as 2'-O-methylated oligonucleotides), and the like. In some embodiments, a nucleic acid can be single-stranded, double-stranded, multi-stranded, or combinations thereof. Unless otherwise indicated, a particular nucleic acid sequence of the presently disclosed subject matter optionally comprises or encodes complementary sequences, in addition to any sequence explicitly indicated.

[0234]The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. For example, gene refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

[0235]A "marker gene" encodes a selectable or screenable trait.

[0236]The term "chimeric gene" refers to any gene that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.

[0237]A "transgene" refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.

[0238]The terms "protein," "peptide" and "polypeptide" are used interchangeably herein.

[0239]"Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions. An "intron" is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.

[0240]"Promoter" refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.

[0241]The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3° direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.

[0242]Promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters." In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. A "minimal or core promoter" thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator.

[0243]"Constitutive expression" refers to expression using a constitutive or regulated promoter. "Conditional" and "regulated expression" refer to expression controlled by a regulated promoter.

[0244]"Constitutive promoter" refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant. Each of the transcription-activating elements do not exhibit an absolute tissue-specificity, but mediate transcriptional activation in most plant parts at a level of ≦1% of the level reached in the part of the plant in which transcription is most active.

[0245]"Regulated promoter" refers to promoters that direct gene expression not constitutively, but in a temporally- and/or spatially-regulated manner, and includes both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered, numerous examples may be found in the compilation by Okamuro et at (1989). Typical regulated promoters useful in plants include but are not limited to safener-inducible promoters, promoters derived from the tetracycline-inducible system, promoters derived from salicylate-inducible systems, promoters derived from alcohol-inducible systems, promoters derived from glucocorticoid-inducible system, promoters derived from pathogen-inducible systems, and promoters derived from ecdysome-inducible systems.

[0246]"Tissue-specific promoter" refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated, such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.

[0247]"Inducible promoter" refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.

[0248]"Operably-linked" refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.

[0249]"Expression" refers to the transcription and/or translation of an endogenous gene, ORF or portion thereof, or a transgene in plants. For example, in the case of antisense constructs, expression may refer to the transcription of the antisense DNA only. In addition, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein

[0250]"Overexpression" refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in normal or untransformed (nontransgenic) cells or organisms.

[0251]"Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene.

[0252]"Gene silencing" refers to homology-dependent suppression of viral genes, transgenes, or endogenous nuclear genes. Gene silencing may be transcriptional, when the suppression is due to decreased transcription of the affected genes, or post-transcriptional, when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes (English et al., 1996). Gene silencing includes virus-induced gene silencing (Ruiz et al, 1998).

[0253]The term "hybridize" as used herein refers to conventional hybridization conditions, preferably to hybridization conditions at which 5×SSPE, 1% SDS, 1×Denhardts solution is used as a solution and/or hybridization temperatures are between 35° C. and 70° C., preferably 65° C. After hybridization, washing is preferably carried out first with 2×SSC, 1% SDS and subsequently with 0.2×SSC at temperatures between 35° C. and 75° C., particularly between 45° C. and 65° C., but especially at 59° C. (regarding the definition of SSPE, SSC and Denhardts solution see Sambrook et al. loc. cit.). High stringency hybridization conditions as for instance described in Sambrook at al, supra, are particularly preferred. Particularly preferred stringent hybridization conditions are for instance present if hybridization and washing occur at 65° C. as indicated above. Non-stringent hybridization conditions for instance with hybridization and washing carried out at 45° C. are less preferred and at 35° C. even less.

[0254]"Sequence Homology or Sequence Identity" is used herein interchangeably. The terms "identical" or percent "identity" in the context of two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. If two sequences which are to be compared with each other differ in length, sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence which are identical with the nucleotide residues of the longer sequence. Sequence identity can be determined conventionally with the use of computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, Wis. 53711). Bestfit utilizes the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, in order to find the segment having the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has for instance 95% identity with a reference sequence of the present invention, the parameters are preferably so adjusted that the percentage of identity is calculated over the entire length of the reference sequence and that homology gaps of up to 5% of the total number of the nucleotides in the reference sequence are permitted. When using Bestfit, the so-called optional parameters are preferably left at their preset ("default") values. The deviations appearing in the comparison between a given sequence and the above-described sequences of the invention may be caused for instance by addition, deletion, substitution, insertion or recombination. Such a sequence comparison can preferably also be carried out with the program "fasta20u66" (version 2.0u66, September 1998 by William R. Pearson and the University of Virginia; see also Pearson, 1990, appended examples and http://workbench.sdsc.edu/). For this purpose, the "default" parameter settings may be used.

[0255]Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase: "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.

[0256]"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen P., 1993 Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, N.Y. Generally, highly stringent hybridization and wash conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. Typically, under "stringent conditions" a probe will hybridize to its target subsequence, but to no other sequences.

[0257]The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42.degree C., with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.15M NaCl at 72.degree C. for about 15 minutes. An example of stringent wash conditions is a 0.2×SSC wash at 65.degree C. for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1 time.SSC at 45 degree C. for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6×SSC at 40.degree C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.0M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30.degree C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2× (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

[0258]A "plant" is any plant at any stage of development, particularly a seed plant.

[0259]A "plant cell" is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whole plant.

[0260]"Plant cell culture" means cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development.

[0261]"Plant material" refers to leaves, sterns, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.

[0262]A "plant organ" is a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower bud, or embryo.

[0263]"Plant tissue" as used herein means a group of plant cells organized into a structural and functional unit. Any tissue of a plant in plants or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture and any groups of plant cells organized into structural and/or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.

[0264]The present invention discloses polynucleotides identified in the sugar beet genome including variants and derivatives thereof, which polynucleotides were demonstrated to show perfect co-segregation with the bolting gene (B gene) associated phenotype in sugar beet, and the use of said polynucleotides for the development of markers that can be used for mapping and identification of the bolting gene or B gene. The polynucleotide markers according to the invention may also be used for quality control of commercial seed lots by screening of commercial biennial sugar beet seed for annual contaminants and for identifying annuals/biennials in breeding programs, which use the annual trait to speed up the breeding process, or when the annual trait is introduced together with new sources of genetic variation.

[0265]The polynucleotides according to the invention and described herein before, can further be used in a transgenic approach for producing transgenic sugar beet plants comprising said polynucleotides stably integrated into the sugar beet genome. In particular, upon expression from the genome, the expression product can be used to modulate the vernalization response of the sugar beet plant.

[0266]In one aspect of the invention the vernalization response will be delayed by suppressing or down-regulating expression of the B gene.

[0267]In another aspect of the invention, early bolting without cold treatment will be induced upon overexpression of the B gene.

[0268]The present invention provides a polynucleotide which maps at or in close vicinity to the B locus, particularly at a distance of 1 cM upstream of markers MP0176 and GJO1 and co-segregates with marker GJ131 (Mohring S. et al, 2004; Gaafar R. M. et al, 2005) (FIG. 5).

[0269]In one embodiment, the invention relates to a polynucleotide including an informative fragment thereof according to the invention and as described herein before, which is obtainable from a genomic DNA region that maps at a distance of less than 1 cM, particularly of less than 0.75 cM, more particularly of less than 0.5 cM, even more particularly of less than 0.3 cM, but especially of less than 0.25 cM relative to the B gene.

[0270]The polynucleotide according to the invention can further be used to fully characterize the region around the B locus including the B gene and to identify further putative flowering time control candidate genes.

[0271]A BAC library has been established with DNA from the biennial commercial sugar beet cultivar H20. Partially (HindIII) digested HMW DNA of fragments in the size of 100-400 kb were size selected two times. The DNA fragments were ligated into the vector pBeloBAC-Kan. The library contains 57,600 clones with an average insert size of approximately 120 kb, corresponding to an 8× coverage of the beet genome. The redundancy has been tested by screening with single-copy probes and the frequency of clones from mitochondrial or plastid DNA was estimated to be lower than 1

[0272]This BAC library was used to recover the full-length genomic sequence of the sugar beet PRR7 gene.

[0273]In particular, primers PRR7-F and PRR7-R were used to screen the sugar beet BAC library using standard PCR techniques well known to those skilled in the art. The PCR conditions for the screening of the DNA pools were as follows: primary denaturation was accomplished at a temperature of between 90° C. and 98° C., particularly at about 95° C. for 2 to 10 min, particularly for about 5 min followed by between 30 and 40 amplification cycles of between 25 and 35 seconds, particularly about 35 amplification cycles of about 30 seconds at a temperature of between 90° C. and 98° C., particularly at about 95° C., between 25 and 35 seconds, particularly 30 seconds at a temperature of between 55° C. and 65° C., particularly at about 60° C. and between 25 and 35 seconds, particularly 30 seconds at a temperature of between 68° C. and 75° C., particularly at about 72° C. and followed by between 2 and 8 min, particularly about 5 min, at a temperature of between 68° C. and 75° C., particularly at about 72° C. PCR experiments are carried out using an appropriate reaction mix including a suitable polymerase, particularly a Tag polymerase. Subsequent screenings of the DNA pools for fragment BvPRR7 resulted in the positive identification of a BAC clone carrying the respective fragment.

[0274]In order to obtain the full-length sequence of the BvPRR7 gene, the previously identified BAC clone is sequenced using standard sequencing technology such as, for example, the pyrosequencing technology developed by 454 Life Sciences. Two non-overlapping contigs that both share sequence homology with EST CV301305 can then be combined into one single sequence (SEQ ID NO 5). Based on the alignment of the BAC sequence contigs to EST CV301305 and on sequence homology to the PRR7 gene from Arabidopsis, the putative gene structure of the beet BvPRR7 gene comprising introns and exons can be predicted as shown in FIG. 5. Based on this prediction the genomic sequence can be shown to span the entire BvPRR7 gene with 3.6 Kb of sequence upstream of the ATO stop codon and 2.2 Kb downstream of the coding region. The corresponding amino acid sequence of BvPRR7 is shown under SEQ ID NO 6. Alignment of the amino acid sequence of BvPRR7 to all members of the PRR gene family from Arabidopsis including TOC1 (PRR1), PRR3, PRR5, PRR7 and PRR9 illustrates the strong conservation of the Pseudo Response Regulator receiver domain (PRR) motif (pfam00072) near the NH2-terminus and the CCT motif (pfam06203) at the COOH-terminus (FIG. 6). In addition to the PRR gene family from Arabidopsis, BvPRR7 also shares strong homology to the PRR7 homologue in cereals as illustrated by the phylogenetic tree shown in FIG. 7. The PRR7 homologue in cereals, better known as Ppd, was shown to represent the major determinant of the photoperiod response (Turner et al, 2005; Beales at al, 2007). A function in the vernalization response as in sugar beet could not yet be demonstrated.

[0275]Based on their homology to known flowering-time control genes or their putative regulatory function as suggested by the presence of conserved domains representative of regulatory proteins, few genes can be identified as potential candidates for the B gene. These genes need further validation by allelic variability and/or gene expression studies between annual and biennial genotypes, or by means of complementation or knockout experiments using transgenic approaches. The B gene may be used in a transgenic approach for producing transgenic sugar beet plants comprising said polynucleotides stably integrated into the sugar beet genome. In particular, upon expression from the genome, the expression product can be used to modulate the vernalization response of the sugar beet plant.

[0276]In one aspect of the invention the vernalization response may be delayed by suppressing or down-regulating expression of the B gene.

[0277]In another aspect of the invention, early bolting without cold treatment may be induced upon overexpression of the B gene.

[0278]In the past molecular marker techniques have been developed which can be used for genetic mapping, gene cloning, marker assisted plant breeding and for genome fingerprinting and investigating genetic relationships. Genetic markers are based on DNA polymorphisms in the nucleotide sequences of genomic regions and can either be detected by restriction enzymes, or by means of two priming sites.

[0279]There are several types of molecular markers that may be used in marker-based selection including restriction fragment length polymorphism (RFLP), random amplification of polymorphic DNA (RAPD), amplified restriction fragment length polymorphism (AFLP), single sequence repeats (SSR) and single nucleotide polymorphisms SNPs.

[0280]The information content of the different types of markers may be different depending on the method that was used to obtain the marker data and the population in which the markers were scored. For example, it is not always possible to distinguish genome fragments that are present in homozygous condition from heterozygous fragments. In a heterogeneous population like an F2, co-dominant markers like restriction fragment length polymorphisms (RFLPs, Botstein et al., 1980) and co-dominantly scored amplified fragment length polymorphisms (AFLPs, Vos et al., 1995) yield more information than dominant markers like random amplified polymorphic DNAs (RAPDs, Welsh and McCleland, 1990) and dominantly scored AFLPs. RFLPs are co-dominant and are able to identify a unique locus. RFLP involves the use of restriction enzymes to cut chromosomal DNA at specific short restriction sites, polymorphisms result from duplications or deletions between the sites or mutations at the restriction sites.

[0281]AFLP requires digestion of cellular DNA with a restriction enzyme before using PCR and selective nucleotides in the primers to amplify specific fragments. With this method up to 100 polymorphic loci can be measured and only relatively small DNA sample are required for each test.

[0282]The most preferred method of achieving such amplification of nucleotide fragments that span a polymorphic region of the plant genome employs the polymerase chain reaction ("PCR") (Mullis et al. 1986), using primer pairs involving a backward primer and a forward primer that are capable of hybridizing to the proximal sequences that define a polymorphism in its double-stranded form.

[0283]In contrast to RFLPs, PCR-based techniques require only a small percentage (approximately 10%) of the DNA amount as template to produce large quantities of the target sequence by PCR amplification.

[0284]One such PCR based technique is RAPD, which utilizes low stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. The method requires only tiny DNA samples and analyses a large number of polymorphic loci. However, the unpredictable behaviour of short primers which is affected by numerous reaction conditions, inheritance in a dominant manner, and population specificity are the main disadvantages of RAPDs.

[0285]Microsatellites, or simple sequence repeats (SSRs), simple sequence length polymorphisms (SSLPs), short tandem repeats (STRs), simple sequence motifs (SSMs), and sequence target microsatellites (STMs) represent a class of repetitive sequences which are widely dispersed throughout the genome of eukaryotes. The variation in number and length of the repeats is a source of polymorphism even between closely related individuals, SSR analysis is based on these (short-repeat) sequences which are selectively amplified to detect variations in simple sequence repeats. Such microsatellite sequences can be easily amplified by PCR using a pair of flanking locus-specific oligonucleotides as primers and detect DNA length polymorphisms (Litt and Luty, 1989; Weber and May, 1989).

[0286]Mutations at a single nucleotide position resulting in substitutions, deletions or insertions give rise to single nucleotide polymorphisms or SNPs, which occur approximately every 1.3 kb in human (Cooper et al., 1985; Kwok et al., 1996). Most polymorphisms of this type have only two alleles and are also called biallelic loci.

[0287]Positional cloning based on SNPs may accelerate the identification of disease traits and a range of biologically informative mutations (Wang et al., 1998).

[0288]PCR extension assays that efficiently pick up point mutations may be used to detect SNPs. The procedure requires little DNA per sample. Three widely used types of SNP detection assays using PCR method are cleaved amplified polymorphic sequences (CAPS) (Konieczny and Ausubel, 1993; Thiel et al., 2004), derived CAPS (dCAPS) (Michaels and Amasino, 1998; Neff at al, 1998), and single strand conformation polymorphism (SSCP) (Orita et al., 1989).

[0289]CAPS polymorphisms are differences in restriction fragment lengths caused by SNPs or INDELs that create or abolish restriction endonuclease recognition sites in PCR amplicons produced by locus-specific oligonucleotide primers. CAPS assays are performed by digesting locus-specific PCR amplicons with one or more restriction enzymes and then separating the digested DNA on agarose or polyacrylamide gels.

[0290]dCAPS is a modification of the CAPS technique that allows detection of most single-nucleotide changes by utilizing mismatched PCR primers. Using the method, a restriction enzyme recognition site that includes the SNP is introduced into the PCR product by a primer containing one or more mismatches to template DNA. The PCR product modified in this manner is then subjected to restriction enzyme digestion, and the presence or absence of the SNP is determined by the resulting restriction pattern.

[0291]The SSCP technique separates denatured double stranded DNA on a non-denaturing gel, and thus allows the secondary structure, as well as the molecular weight, of single stranded DNA to determine gel mobility.

[0292]The ARMS (amplification refractory mutation system)-PCR procedure (Ye et al., 2001) involves the use of a single PCR for SNP genotyping (Fan et al., 2003; Chiapparino et al., 2004). A tetra-primer, employing two primer pairs, is used to amplify two different alleles of a SNP in a single PCR reaction.

[0293]Alternative methods may be employed to amplify such fragments, such as the "Ligase Chain Reaction" ("LCR") (Barony, F., 1991)), which uses two pairs of oligonucleotide probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides are selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase. As with POR, the resulting products thus serve as a template in subsequent cycles and an exponential amplification of the desired sequence is obtained.

[0294]LCR can be performed with oliganucleotides having the proximal and distal sequences of the same strand of a polymorphic site. In one embodiment, either oligonucleotide will be designed to include the actual polymorphic site of the polymorphism. In such an embodiment, the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the polymorphic site present on the oligonucleotide. Alternatively, the oligonucleotides may be selected such that they do not include the polymorphic site (see, Segev, POT Application WO 90/01069).

[0295]A further method that may alternatively be employed is the "Oligonucleotide Ligation Assay" ("OLA") (Landegren et al, 1988). The OLA protocol uses two oligonucleotides that are designed to be capable of hybridizing to abutting sequences of a single strand of a target. OLA, like LCR, is particularly suited for the detection of point mutations. Unlike LCR, however, OLA results in "linear" rather than exponential amplification of the target sequence.

[0296]Nickerson et al., 1990 have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson et al., 1990). In this method, POR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. In addition to requiring multiple, and separate, processing steps, one problem associated with such combinations is that they inherit all of the problems associated with PCR and OLA.

[0297]Schemes based on ligation of two for more) oligonucleotides in the presence of a nucleic acid having the sequence of the resulting "di-oligonucleotide," thereby amplifying the di-oligonucleotide, are also known (Wu and Wallace, 1989), and may be readily adapted to the purposes of the present invention.

[0298]Different assays based on the gene sequence according to the invention and as described herein above can thus be developed and used to screen plant material for the presence or absence of the annuality allele.

[0299]Molecular markers, preferentially End point TaqMan®, can be developed based on SNPs characterized from sequenced PCR products that are amplified from annual and biennial plants. Here, several PCR amplifications will be performed in order to cover the whole sequence of the gene.

[0300]New molecular markers will then be tested within different annual and biennial genetic backgrounds to evaluate the robustness of the molecular test.

[0301]In one embodiment, a molecular marker is a DNA fragment amplified by PCR, a SSR marker or a RAPD marker. In one embodiment, the presence or absence of an amplified DNA fragment is indicative of the presence or absence of the trait itself or of a particular allele of the trait. In one embodiment, a difference in the length of an amplified DNA fragment is indicative of the presence of a particular allele of a trait, and thus enables to distinguish between different alleles of a trait.

[0302]In a specific embodiment of the invention simple sequence repeat (SSR) markers are used to identify invention-relevant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.

[0303]In another specific embodiment of the invention a marker based on a single nucleotide polymorphism is used to identify invention-relevant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.

[0304]In still another embodiment of the invention a marker based on a deletion or an insertion ("INDEL") of at least one nucleotide is used to identify invention-relevant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.

[0305]These markers can be developed based on the sequence of the polynucleotides according to the invention and as described herein before.

[0306]In one aspect of the invention, markers may be developed and used which are not explicitly disclosed herein or markers even yet to be identified. Based on the information provided in this application it will be possible, for a skilled person, to identify or develop markers not explicitly disclosed herein but genetically closely linked to, or, preferably, located within the bolting gene or B gene or linked to the markers disclosed herein. The skilled person knows that other markers may provide at least equal utility in screening assays and marker assisted selection.

[0307]There are several methods or approaches available, known to those skilled in the art, which can be used to identify and/or develop markers in linkage disequilibrium and/or linked to and/or located in the B gene region, as well as markers that represent the actual causal mutations responsible for the biennial genotype. Without being fully exhaustive some approaches, known by those skilled in the art, include: [0308]use of disclosed sequences/markers in hybridization approaches to identify other sequence in the region of interest: primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein may be used as (hybridization) probes in isolating nucleic acid sequences/genes flanking the markers and/or linked and/or associated and/or specific for the B gene region from a genomic nucleic acid sample and/or RNA or cDNA sample or pool of samples (for example screening of genomic resources like BAC libraries or gDNA or cDNA library screening). [0309]use of disclosed sequences/markers in PCR approaches to identify other sequence in the region of interest: primer sequences as disclosed herein and/or marker/(candidate)gene sequences (or part thereof) that can be determined using the primer sequences as disclosed may be used as (PCR) amplification primers to amplify a nucleic acid sequence/gene flanking and/or linked to and/or associated with and/or specific for the QTL region from a genomic nucleic acid sample and/or RNA or cDNA sample or pool of samples either or not isolated from a specific plant tissue and/or after specific treatment of the plant and from sugar beet or in principal any other organism with sufficient homology. [0310]use of disclosed sequences/markers in PCR approaches to identify other sequence in the region of interest: the nucleotide sequences/genes of one or more markers can be determined after internal primers for said marker sequences may be designed and used to further determine additional flanking sequence/genes within the B gene region and/or genetically linked and/or associated with the trait. [0311]use of disclosed sequences/markers in mapping and/or comparative mapping approaches to identify markers in the same region(s) (positioning of the B-gene on other maps): based on positional information and/or marker information as disclosed herein, markers, of any type, may be identified by genetic mapping approaches, eventually (if already needed) by positioning of the disclosed markers (by genetic mapping or extrapolation based on common markers across maps) on a (high density) genetic map(s), and/or integrated genetic or consensus map(s). Markers already known and/or new markers genetically linked and/or positioned in the vicinity of the disclosed markers and/or B gene region may be identified and/or obtained and eventually used in B gene (fine-) mapping and/or B gene cloning and/or MAS breeding applications. [0312]use of disclosed sequences/markers in `in-siloco` approaches to identify additional sequences/markers/(candidate)genes in Bene region(s): primer sequences as disclosed herein and/or marker/(candidate)gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein or based on linked markers may be used in `in-silico` methods to search sequence or protein databases (e.g., BLAST) for (additional) flanking and/or homolog sequences/genes and/or allelic diversity (both genomic and/or cDNA sequences or even proteins and both originating from capsicum and/or any other organism) genetically linked and/or associated with the traits as described herein and/or located in the B gene region. [0313]use of disclosed sequences/markers in physical mapping approaches (positioning of B-gene on physical map or genome sequence): primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein or using other markers genetically linked to the markers disclosed herein and/or located in the B gene region may be positioned on a physical map and/or (whole) genome sequence in principal of any organism with sufficient homology to identify (candidate) sequences/markers/-genes applicable in B gene (fine-mapping) and/or B gene cloning and/or MAS breeding applications. [0314]use of disclosed sequences/markers to position B-gene on other (physical) maps or genomes (across species for pepper other Solanaceae as tomato and potato are of first interest of course but model species like Arabidopsis may be used): primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein may be used in comparative genome or syntheny mapping approaches to identify homolog region and homolog and/or ortholog sequences/(candidate genes genetically linked and/or positioned in the B gene region and applicable in B gene (fine-mapping) and/or B gene cloning and/or MAS breeding applications. [0315]use of disclosed sequences/markers to select the appropriate individuals allowing the identification of markers in region of interest by genetic approaches: primer sequences and/or markers as disclosed herein may be used to select individuals with different/contrasting B gene alleles. Genetic association approaches and/or bulk segregant analysis (BSA, Michelmore et al. 1991) can be used to identify markers/genes in the specific region (B gene region) of interest and/or associated or genetically linked to the described traits. [0316]use of disclosed information to search for (positional) candidate genes: the disclosed information may be used to identify positional and/or functional candidate genes which may be associated with the described traits and/or genetically linked.

[0317]In particular, the markers according to the present invention can be used in an allelic discrimination assay, particularly in an assay for discriminating between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype. Said assay is based on a set of probe polynucleotides comprising two separate probe molecules that are complementary, for example, to a subregion of the BvPRR7 gene obtainable by PCR amplification based on forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, which probe molecules differ only by one base mismatch, particularly a base mismatch at position #631.

[0318]In another aspect of the invention, an assay is provided involving markers that can discriminate specifically between annual plants and biennial plants and can thus be used, for example, for quality control of seed lots.

[0319]In particular, the invention relates to an assay, which is based on a set of probe polynucleotides comprising two separate probe molecules that are complementary, for example, to a to a subregion of the BvPRR7 gene obtainable by PCR amplification based on forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO 8, respectively, which probe molecules differ only by one base mismatch, particularly a base mismatch at position #631.

[0320]The majority of commercial seed productions for sugar beet are done in southern France and northern Italy. In both regions, the presence of annual weed beets can cause pollen contamination in the seed productions, resulting in annuals in the commercial seed. This is not acceptable to a customer, and therefore all commercial seed lots are grown in regions, such as Argentina where no wild beets are growing directly after harvesting the seed. The plants are not vernalized and the presence of bolters is used to identify seed lots contaminated with annuals.

[0321]The annual plant habit conferred by the B gene behaves as a single dominant trait; the requirement for vernalization in biennial plants accordingly is recessive. The transformation of an annual allele of BvPRR7 into a biennial genotype thus is predicted to bestow the annual flowering behavior onto the biennial acceptor genotype. To verify this hypothesis, the coding sequence of an annual allele of BvPRR7 under the control of an annual promoter and terminator fragment is transformed into biennial genotype such as, for example G018. Transformation can be accomplished by methods known in art such as that disclosed by Chang et al, 2002 using sugar beet meristems as explant material and the phosphomannose isomerase (PMI) gene as selectable marker . . . . Transgenic shoots are checked for expression of the selection marker such as, for example, PMI activity (Joersbo et al, 1998) and subsequently rooted, potted in soil and transferred to the greenhouse. Negative controls consist of non-transgenic shoots that are subjected to the same in vitro regeneration procedure, but without Agrobacterium infection and selection. Plants are grown in growth chambers at a constant temperature of 18° C. and a photoperiod of 17 hours light and 7 hours dark. Under these conditions none of the non-transgenic controls are supposed to show any signs of bolting during the observation period, whereas annual control plants are supposed to bolt normally within 8 weeks. Contrary to the non-transgenic biennial control plants, a substantial number of transgenic events should start bolting within four to ten weeks and basically behave as annual plants despite their biennial genetic background. Transgenic plants that bolted and flowered are cross-pollinated with a biennial maintainer line to produce offspring. Progeny plants are tested for selection marker activity and subsequently monitored for bolting and flowering without vernalization. Most progenies should show a one to one segregation ratio and a perfect correlation between PMI activity and the annual habit. These data will equivocally confirm the causal relationship between BvPRR7 and vernalization-independent flowering in sugar beet.

[0322]BvPRR7 plays a key role in the vernalization response in sugar beet and can thus be used for engineering bolting resistance into sugar beet plants by suppressing the vernalization response. To this purpose a BvPRR7 cDNA fragment such as, for example the 0.6 Kb fragment depicted in SEC) ID NO. 1, is assembled into an RNAi cassette under the control of a constitutive promoter. Suitable constitutive promoters are, for example, the Ubi3 promoter from Arabidopsis (Norris et al, 1993), the CaMV 355 promoter, or any other promoter known to promote constitutive expression in sugar beet. The expression cassette further contains a selectable marker gene under the control of a suitable promoter. Particularly, the marker gene encodes a positive selection marker such as phosphomannose isomerase or a xylose isomerase. The inverted repeat of the BvPRR7 fragment may be separated by the second intron from the potato StLS1 gene (Eckes et al, 1986; Vancanneyt at al, 1990) to stabilize the RNAi cassette, but also to improve the efficiency of the RNAi phenomenon (Wang and Waterhouse, 2001; Smith et al, 2000).

[0323]The RNAi cassette can then be transformed into a biennial sugar beet genotype such as, for example, G018 as described herein previously. Transgenic shoots are checked for expression of the selection marker such as, for example, PMI activity (Joersbo at al, 1998). Positive shoots and non-transgenic controls are rooted and transferred to the greenhouse for an acclimatization period of two weeks minimum at 18° C. prior to the vernalization treatment. Once well-established, the transgenic plants are exposed to the vernalization treatment consisting of a period of 14 weeks at a constant temperature of 6° C. and 12 hours low artificial light. Prior to applying bolting-inductive conditions, vernalized plants are slowly acclimatized for two weeks in climate chambers by stepwise increasing the temperature from 10 to 18° C. Plants are subsequently repotted into to larger pots (2 liter), and monitored for bolting while exposed to a constant temperature of 18° C. and a long-day photoperiod of 17 hours light/7 hours dark. Non-transgenic control plants routinely start bolting between four to six weeks post vernalization. Transgenic plants suppressed for BvPRR7 frequently show a delay in bolting ranging from only two weeks to more than two months. A few events never bolted under the conditions applied in the greenhouse. Apart from the delay in bolting and flowering, transgenic plants develop normally and show no phenotypic aberrations. In general, plants delayed in bolting show a higher leaf number at the time of bolting as a result of the prolonged vegetative stage.

[0324]Obtaining sufficient levels of transgene expression in the appropriate plant tissues is an important aspect in the production of genetically engineered crops. Expression of heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed.

[0325]For example, if overexpression is desired, a plant promoter fragment may be employed which will direct expression of the gene in all tissue; of a regenerated plant. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill. Such genes include for example, the AP2 gene, ACTI1 from Arabidopsis (Huang et al. Plant Mol. Biol. 33:125-139 (1996)), Cat3 from Arabidopsis (GenBank No. U43147, Zhong et al., Mol. Gen. Genet. 251:196-203 (1996)), the gene encoding stearoyl-acyl carrier protein desaturase from Brassica napus (Genbank No. X74782, Solocornbe et al. Plant Physiol. 104:1167-1176 (1994)), GPc1 from maize (GenBank No X15596, Martinez et al. J. Mol. Biol 208:551-565 (1989)), and Gpc2 from maize (GenBank No. U45855, Manjunath et al., Plant Mol. Biol. 33:97-112 (1997)).

[0326]Alternatively, the plant promoter may direct expression of the nucleic acid molecules of the invention in a specific tissue or may be otherwise under more precise environmental or developmental control. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions, elevated temperature, or the presence of light. Such promoters are referred to here as "inducible" or "tissue-specific" promoters. One of skill will recognize that a tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue. Thus, as used herein a tissue-specific promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other tissues as well.

[0327]Examples of promoters under developmental control include promoters that initiate transcription only (or primarily only) in certain tissues, such as fruit, seeds, or flowers. Promoters that direct expression of nucleic acids in ovules, flowers or seeds are particularly useful in the present invention. As used herein a seed-specific or preferential promoter is one which directs expression specifically or preferentially in seed tissues, such promoters may be, for example, ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed coat-specific, or some combination thereof. Examples include a promoter from the ovule-specific BEL1 gene described in Reiser et al. Cell 83:735-742 (1995) (GenBank No. U39944). Other suitable seed specific promoters are derived from the following genes: MAC1 from maize (Sheridan et al. Genetics 142:1009-1020 (1996), Cat3 from maize (GenBank No. L05934, Abler et al. Plant Mol. Biol. 22:10131-1038 (1993), the gene encoding oleosin 18 kD from maize (GenBank No, J05212, Lee et al. Plant Mol. Biol. 26:1981-1987 (1994)), vivparous-1 from Arabidopsis (Genbank No. U93215), the gene encoding oleosin from Arabidopsis (Genbank No. Z17657), Atmycl from Arabidopsis (Urao et al. Plant Mol. Biol, 32:571-576 (1996), the 2s seed storage protein gene family from Arabidopsis (Conceicao et al. Plant 5:493-505 (1994)) the gene encoding oleosin 20 kD from Brassica napus (GenBank No. M63985), napA from Brassica napus (GenBank No. J02798, Josefsson et al. JBL 26:12196-1301 (1987), the napin gene family from Brassica napus (Sjodahl et al. Planta 197:264-271 (1995), the gene encoding the 25 storage protein from Brassica napus (Dasgupta et al. Gene 133:301-302 (1993)), the genes encoding oleosin A (Genbank No. U09118) and oleosin B (Genbank No. U09119) from soybean and the gene encoding low molecular weight sulphur rich protein from soybean (Choi et al. Mot Gen, Genet. 246:266-268 (1995)).

[0328]Alternatively, particular sequences which provide the promoter with desirable expression characteristics, or the promoter with expression enhancement activity, could be identified and these or similar sequences introduced into the sequences via mutation. It is further contemplated that one could mutagenize these sequences in order to enhance their expression of transgenes in a particular species.

[0329]Furthermore, it is contemplated that promoters combining elements from more than one promoter may be useful. For example, U.S. Pat. No. 6,491,288 discloses combining a Cauliflower Mosaic Virus promoter with a histone promoter. Thus, the elements from the promoters disclosed herein may be combined with elements from other promoters.

[0330]A variety of 5' and 3' transcriptional regulatory sequences are available for use in the present invention. Transcriptional terminators are responsible for the termination of transcription and correct mRNA polyadenylation. The 3' nontranslated regulatory DNA sequence preferably includes from about 50 to about 1,000, more preferably about 100 to about 1,000, nucleotide base pairs and contains plant transcriptional and translational termination sequences. Appropriate transcriptional terminators and those which are known to function in plants include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator, the terminator for the 17 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato, although other 3' elements known to those of skill in the art can also be employed. Alternatively, one also could use a gamma coixin, oleosin 3 or other terminator from the genus Coix.

[0331]Preferred 3' elements include those from the nopaline synthase gene of Agrobacterium tumefaciens (Bevan et al., 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato.

[0332]As the DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can influence gene expression, one may also wish to employ a particular leader sequence. Preferred leader sequences are contemplated to include those which include sequences predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will be most preferred.

[0333]Other sequences that have been found to enhance gene expression in transgenic plants include intron sequences (e.g., from Adh1, bronze 1, actin1, actin 2 (WO 00/760067), or the sucrose synthase intron) and viral leader sequences (e.g., from TMV MCMV and AMV). For example, a number of non-translated leader sequences derived from viruses are known to enhance expression. Specifically, leader sequences from Tobacco Mosaic Virus (TMV), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown to be effective in enhancing expression (e.g., Gallie at 1987; Skuzeski et al., 1990). Other leaders known in the art include but are not limited to: Picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5 noncoding region) (Elroy-Stein at al., 1989); Potyvirus leaders, for example, TEV leader (Tobacco Etch Virus); MDMV leader (Maize Dwarf Mosaic Virus); Human immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak et al., 1991); Untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), (Jobling et al., 1987; Tobacco mosaic virus leader (TMV), (Gallie et al., 1989; and Maize Chlorotic Mottle Virus leader (MCMV) (Lommel et al., 1991. See also, Della-Ciappa et al., 1987.

[0334]Regulatory elements such as Adh intron 1 (CaIlls et al., 1987), sucrose synthase intron (Vasil at al., 1989) or TMV omega element (Gallie, et al., 1989), may further be included where desired.

[0335]Examples of enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis el al., 1987), the rice actin I gene, the maize alcohol dehydrogenase gene (Callis et al., 1987), the maize shrunken I gene (Vasil et al., 1989), TMV Omega element (Gallie et al., 1989) and promoters from non-plant eukaryotes (e.g., yeast; Ma et al., 1988).

[0336]Two principal methods for the control of expression are known, viz.: overexpression and underexpression. Overexpression can be achieved by insertion of one or more than one extra copy of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as well as overexpression. For underexpression there are two principle methods which are commonly referred to in the art as "antisense downregulation" and "sense downregulation" (sense downregulation is also referred to as "cosuppression"). Generically these processes are referred to as "gene silencing". Both of these methods lead to an inhibition of expression of the target gene.

[0337]Within the scope of the present invention, the alteration in expression of the nucleic acid molecule of the present invention may be achieved in one of the following ways:

"Sense" Suppression

[0338]Alteration of the expression of a nucleotide sequence of the present invention, preferably reduction of its expression, is obtained by "sense" suppression (referenced in e.g., Jorgensen et al. (1996) Plant Mol. Biol. 31, 957-973). In this case, the entirety or a portion of a nucleotide sequence of the present invention is comprised in a DNA molecule. The DNA molecule is preferably operatively linked to a promoter functional in a cell comprising the target gene, preferably a plant cell, and introduced into the cell, in which the nucleotide sequence is expressible. The nucleotide sequence is inserted in the DNA molecule in the "sense orientation", meaning that the coding strand of the nucleotide sequence can be transcribed. In a preferred embodiment, the nucleotide sequence is fully translatable and all the genetic information comprised in the nucleotide sequence, or portion thereof, is translated into a polypeptide. In another preferred embodiment, the nucleotide sequence is partially translatable and a short peptide is translated. In a preferred embodiment, this is achieved by inserting at least one premature stop codon in the nucleotide sequence, which brings translation to a halt. In another more preferred embodiment, the nucleotide sequence is transcribed but no translation product is being made. This is usually achieved by removing the start codon, e.g., the "ATG", of the polypeptide encoded by the nucleotide sequence. In a further preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In another preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule.

[0339]In transgenic plants containing one of the DNA molecules described immediately above, the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.

"Anti-Sense" Suppression

[0340]In another preferred embodiment, the alteration of the expression of a nucleotide sequence of the present invention, preferably the reduction of its expression is obtained by "anti-sense" suppression. The entirety or a portion of a nucleotide sequence of the present invention is comprised in a DNA molecule. The DNA molecule is preferably operatively linked to a promoter functional in a plant cell, and introduced in a plant cell, in which the nucleotide sequence is expressible. The nucleotide sequence is inserted in the DNA molecule in the "anti-sense orientation", meaning that the reverse complement (also called sometimes non-coding strand) of the nucleotide sequence can be transcribed. In a preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In another preferred embodiment the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule. Several publications describing this approach are cited for further illustration (Green, P. J. et al., Ann. Rev. Biochem. 55:569-597 (1986); van der Krol, A. R. et al, Antisense Nuc. Acids & Proteins, pp. 125-141 (1991); Abel, P. P. et al., Proc. Natl. Acad. Sci. USA 86:6949-6952 (1989); Ecker, J. R. et al., Proc. Natl. Acad. Sci. USA 83:5372-5376 (August 1986)).

[0341]In transgenic plants containing one of the DNA molecules described immediately above, the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.

Homologous Recombination

[0342]In another preferred embodiment, at least one genomic copy corresponding to a nucleotide sequence of the present invention is modified in the genome of the plant by homologous recombination as further illustrated in Paszkowski et al., EMBO Journal 7:4021-26 (1988). This technique uses the property of homologous sequences to recognize each other and to exchange nucleotide sequences between each by a process known in the art as homologous recombination. Homologous recombination can occur between the chromosomal copy of a nucleotide sequence in a cell and an incoming copy of the nucleotide sequence introduced in the cell by transformation. Specific modifications are thus accurately introduced in the chromosomal copy of the nucleotide sequence. In one embodiment, the regulatory elements of the nucleotide sequence of the present invention are modified. Such regulatory elements are easily obtainable by screening a genomic library using the nucleotide sequence of the present invention, or a portion thereof, as a probe. The existing regulatory elements are replaced by different regulatory elements, thus altering expression of the nucleotide sequence, or they are mutated or deleted, thus abolishing the expression of the nucleotide sequence. In another embodiment, the nucleotide sequence is modified by deletion of a part of the nucleotide sequence or the entire nucleotide sequence, or by mutation. Expression of a mutated polypeptide in a plant cell is also contemplated in the present invention. More recent refinements of this technique to disrupt endogenous plant genes have been described (Kempin et al., Nature 389:802-803 (1997) and Miao and Lam, Plant J., 7:359-365 (1995).

[0343]In another preferred embodiment, a mutation in the chromosomal copy of a nucleotide sequence is introduced by transforming a cell with a chimeric oligonucleotide composed of a contiguous stretch of RNA and DNA residues in a duplex conformation with double hairpin caps on the ends. An additional feature of the oligonucleotide is for example the presence of 2'-O-methylation at the RNA residues. The RNA/DNA sequence is designed to align with the sequence of a chromosomal copy of a nucleotide sequence of the present invention and to contain the desired nucleotide change. For example, this technique is further illustrated in U.S. Pat. No. 5,501,967 and Zhu et al. (1999) Proc. Natl. Acad. Sci. USA 96: 8768-773.

Ribozymes

[0344]In a further embodiment, the RNA coding for a polypeptide of the present invention is cleaved by a catalytic RNA, or ribozyme, specific for such RNA. The ribozyme is expressed in transgenic plants and results in reduced amounts of RNA coding for the polypeptide of the present invention in plant cells, thus leading to reduced amounts of polypeptide accumulated in the cells. This method is further illustrated in U.S. Pat. No. 4,987,071.

Dominant-Negative Mutants

[0345]In another preferred embodiment, the activity of the polypeptide encoded by the nucleotide sequences of this invention is changed. This is achieved by expression of dominant negative mutants of the proteins in transgenic plants, leading to the loss of activity of the endogenous protein.

Aptamers

[0346]In a further embodiment, the activity of polypeptide of the present invention is inhibited by expressing in transgenic plants nucleic acid ligands, so-called aptamers, which specifically bind to the protein. Aptamers are preferentially obtained by the SELEX (Systematic Evolution of Ligands by EXponential Enrichment) method. In the SELEX method, a candidate mixture of single stranded nucleic acids having regions of randomized sequence is contacted with the protein and those nucleic acids having an increased affinity to the target are partitioned from the remainder of the candidate mixture. The partitioned nucleic acids are amplified to yield a ligand enriched mixture. After several iterations a nucleic acid with optimal affinity to the polypeptide is obtained and is used for expression in transgenic plants. This method is further illustrated in U.S. Pat. No. 5,270,163.

Zinc Finger Proteins

[0347]A zinc finger protein that binds a nucleotide sequence of the present invention or to its regulatory region is also used to alter expression of the nucleotide sequence. Preferably, transcription of the nucleotide sequence is reduced or increased. Zinc finger proteins are for example described in Beerli et al. (1998) PNAS 95:14628-14633, or in WO 95/19431, WO 98/54311, or WO 96/06166, all incorporated herein by reference in their entirety.

[0348]dsRNA

[0349]Alteration of the expression of a nucleotide sequence of the present invention is also obtained by dsRNA interference as described for example in WO 99/32619, WO 99/53050 or WO 99/61631, all incorporated herein by reference in their entirety.

Insertion of a DNA Molecule (Insertional Mutagenesis)

[0350]In another preferred embodiment, a DNA molecule is inserted into a chromosomal copy of a nucleotide sequence of the present invention, or into a regulatory region thereof. Preferably, such DNA molecule comprises a transposable element capable of transposition in a plant cell, such as e.g, Ac/Ds, Em/Spm, mutator. Alternatively, the DNA molecule comprises a T-DNA border of an Agrobacterium T-DNA. The DNA molecule may also comprise a recombinase or integrase recognition site which can be used to remove part of the DNA molecule from the chromosome of the plant cell. An example of this method is set forth in Example 2. Methods of insertional mutagenesis using T-DNA, transposons, oligonucleotides or other methods known to those skilled in the art are also encompassed. Methods of using T-DNA and transposon for insertional mutagenesis are described in Winkler et al. (1989) Methods Mol. Biol. 82:129-136 and Martienssen (1998) PNAS 95:2021-2026, incorporated herein by reference in their entireties.

Deletion Mutagenesis

[0351]In yet another embodiment, a mutation of a nucleic acid molecule of the present invention is created in the genomic copy of the sequence in the cell or plant by deletion of a portion of the nucleotide sequence or regulator sequence. Methods of deletion mutagenesis are known to those skilled in the art. See, for example, Miao et al, (1995) Plant J. 7:359.

[0352]In yet another embodiment, this deletion is created at random in a large population of plants by chemical mutagenesis or irradiation and a plant with a deletion in a gene of the present invention is isolated by forward or reverse genetics. Irradiation with fast neutrons or gamma rays is known to cause deletion mutations in plants (Silverstone et al, (1998) Plant Cell, 10:155-169; Bruggemann et al., (1996) Plant J., 10:755-760; Redei and Koncz in Methods in Arabidopsis Research, World Scientific Press (1992), pp. 16-82). Deletion mutations in a gene of the present invention can be recovered in a reverse genetics strategy using PCR with pooled sets of genomic DNAs as has been shown in C. elegans (Liu et al., (1999), Genome Research, 9:859-867.). A forward genetics strategy would involve mutagenesis of a line displaying PTGS followed by screening the M2 progeny for the absence of PTGS. Among these mutants would be expected to be some that disrupt a gene of the present invention. This could be assessed by Southern blot or PCR for a gene of the present invention with genomic DNA from these mutants.

Overexpression in a Plant Cell

[0353]In yet another preferred embodiment, a nucleotide sequence of the present invention encoding the B gene, particularly the BvPRR7 gene, in a plant cell is overexpressed. Examples of nucleic acid molecules and expression cassettes for overexpression of a nucleic acid molecule of the present invention are described above. Methods known to those skilled in the art of over-expression of nucleic acid molecules are also encompassed by the present invention.

[0354]In still another embodiment, the expression of the nucleotide sequence of the present invention is altered in every cell of a plant. This is for example obtained though homologous recombination or by insertion in the chromosome. This is also for example obtained by expressing a sense or antisense RNA, zinc finger protein or ribozyme under the control of a promoter capable of expressing the sense or antisense RNA, zinc finger protein or ribozyme in every cell of a plant. Constitutive expression, inducible, tissue-specific or developmentally-regulated expression are also within the scope of the present invention and result in a constitutive, inducible, tissue-specific or developmentally-regulated alteration of the expression of a nucleotide sequence of the present invention in the plant cell. Constructs for expression of the sense or antisense RNA, zinc finger protein or ribozyme, or for overexpression of a nucleotide sequence of the present invention, are prepared and transformed into a plant cell according to the teachings of the present invention, e.g., as described infra.

[0355]The invention hence also provides sense and anti-sense nucleic acid molecules corresponding to the open reading frames identified in the SEQ ID NO: 1 of the Sequence Listing as well as their orthologs.

[0356]The genes and open reading frames according to the present invention which are substantially similar to a nucleotide sequence encoding a polypeptide as given in SEQ ID NO: 6 including any corresponding anti-sense constructs can be operably linked to any promoter that is functional within the plant host including the promoter sequences according to the invention or mutants thereof.

[0357]Once completed, the polynucleotide construct of the invention comprising an expression cassette or an RNAi cassette may be mobilized into a suitable vector for plant transformation, such as, for example, a binary vector, which may then be mobilized to sugar beet using one of the well known transformation techniques such as, for example, Agrobacterium-mediated transformation.

[0358]Transgenic plants (or plant cells, or plant explants, or plant tissues) incorporating and expressing the polynucleotide or dsRNA of the invention can be produced by a variety of well established techniques. Following construction of the polynucleotide construct of the invention comprising an expression cassette or an RNAI cassette incorporating a polynucleotide sequence according to the invention and as described herein before, standard techniques can be used to introduce the polynucleotide into a plant, a plant cell, a plant explant or a plant tissue of interest. Optionally, the plant cell, explant or tissue can be regenerated to produce a transgenic plant. The plant can be any higher plant, including gymnosperms, monocotyledonous and dicotyledonous plants. Suitable protocols are available for Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, rapeseed, broccoli, etc.), Curcurbitaceae (melons and cucumber), Gramineae (wheat, corn, rice, barley, millet, etc.), Solanaceae (potato, tomato, tobacco, peppers, etc.), and various other crops. See protocols described in Ammirato et eds., (1984) Handbook of Plant Cell Culture--Crop Species, Macmillan Publ. Co., New York, N.Y.; Shimamoto et al. (1989) Nature 338: 274 276; Fromm et al. (1990) Bio/Technol. 8: 833 839; and Vasil et al. (1990) Bio/Technol. 8: 429 434. Transformation and regeneration of both monocotyledonous and dicotyledonous plant cells is now routine, and the selection of the most appropriate transformation technique will be determined by the practitioner. The choice of method will vary with the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types. Suitable methods can include, but are not limited to: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant cells; micro-projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium tumefaciens mediated transformation.

[0359]Transformation of plants can be undertaken with a single DNA molecule or multiple DNA molecules (i.e., co-transformation), and both these techniques are suitable for use with the polynucleotide constructs of the present invention. Numerous transformation vectors are available for plant transformation, and the expression cassettes of this invention can be used in conjunction with any such vectors. The selection of vector will depend upon the preferred transformation technique and the target species for transformation.

[0360]A variety of techniques are available and known to those skilled in the art for introduction of constructs into a plant cell host. These techniques generally include transformation with DNA employing A. tumefaciens or A. rhizogenes as the transforming agent, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA uptake, microprojectile bombardment, particle acceleration, and the like (See, for example, EP 295959 and EP 138341) (see below). However, cells other than plant cells may be transformed with the polynucleotide construct of the invention. The general descriptions of plant expression vectors and reporter genes, and Agrobacterium and Agrobacterium-mediated gene transfer, can be found in Gruber et al. (1993).

[0361]Expression vectors containing a polynucleotide sequence according to the invention can be introduced into protoplasts or into intact tissues or isolated cells. Preferably expression vectors are introduced into intact tissue. General methods of culturing plant tissues are provided for example by Maki et al., (1993), and by Phillips et al. (1988). Preferably, expression vectors are introduced into maize or other plant tissues using a direct gene transfer method such as microprojectile-mediated delivery, DNA injection, electroporation and the like. More preferably expression vectors are introduced into plant tissues using the microprojectile media delivery with the biolistic device. See, for example, Tomes et al. (1995). The vectors of the invention can not only be used for expression of structural genes but may also be used in exon-trap cloning, or promoter trap procedures to detect differential gene expression in varieties of tissues, (Lindsey et al., 1993; Auch & Reth et al.).

[0362]It is particularly preferred to use the binary type vectors of Ti and Ri plasmids of Agrobacterium spp. Ti-derived vectors transform a wide variety of higher plants, including monocotyledonous and dicotyledonous plants, such as soybean, cotton, rape, tobacco, and rice (Pacciotti at, 1985: Byrne et al., 1987; Sukhapinda et al., 1987; Lorz et al., 1985; Potrykus, 1985; Park et al., 1985: Hiei et al., 1994). The use of T-DNA to transform plant cells has received extensive study and is amply described (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An et al., 1985). For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples.

[0363]Those skilled in the art will appreciate that the choice of method might depend on the type of plant, i.e., monocotyledonous or dicotyledonous, targeted for transformation. Suitable methods of transforming plant cells include, but are not limited to, microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium-mediated transformation (Hinchee et al., 1988), direct gene transfer (Paszkowski et al., 1984), and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis. And BioRad, Hercules, Calif. (see, for example, Sanford et al., U.S. Pat. No. 4,945,050; and McCabe et al., 1988). Also see, Weissinger et al., 1988; Sanford et a/, 1987 (onion); Christou at al., 1988 (soybean); McCabe et al., 1988 (soybean); Datta et al., 1990 (rice); Klein et al., 1988 (maize); Klein et al., 1988 (maize); Klein et al., 1988 (maize); Fromm et al. 1990 (maize); and Gordon-Kamm at al., 1990 (maize); Svab et al., 1990 (tobacco chloroplast); Koziel et al., 1993 (maize); Shimamoto et al., 1989 (rice); Christou at al., 1991 (rice); European Patent Application EP 0 332 581 (orchardgrass and other Pooideae); Vasil et al., 1993 (wheat); Weeks et al., 1993 (wheat). In one embodiment, the protoplast transformation method for maize is employed (European Patent Application EP 0 292 435, U.S. Pat. No. 5,350,689).

[0364]The main focus of the present invention is on transformation of sugar beet. The experimental procedures for the transformation of sugar beet are well known to those skilled in the art such as that disclosed by Chang at al, 2002 using sugar beet meristems as explant material.

[0365]After transformed plant cells or plants are selected and grown to maturity, those plants showing the trait of interest are identified. The trait can be any of those traits described above. Additionally, to confirm that the trait of interest is due to the expression of the introduced polynucleotide of interest under control of the regulatory nucleotide according to the invention, expression levels or activity of the polypeptide or polynucleotide of interest can be determined by analyzing mRNA expression using Northern blots, RT-PCR or microarrays, or protein expression using immunoblots or Western blots or gel shift assays.

[0366]The invention thus relates to plant cells and tissues, to plants derived from such cells and tissues, respectively, to plant material, to the progeny and to seeds derived from such plants, and to agricultural products including processed plant products with improved properties obtainable by, for example, any one of the transformation methods described below.

[0367]Once an expression cassette according the present invention and as described herein before comprising a polynucleotide sequence according to the invention in association with a polynucleotide of interest has been transformed into a particular plant species, it may be propagated in that species or moved into other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques. Preferred plants of the invention include gymnosperms, monocots, and dicots, especially agronomically important crop plants, such as rice, wheat, barley, rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.

[0368]The genetic properties engineered into the transgenic plants described above are passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants. Generally said maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting. Specialized processes such as hydroponics or greenhouse technologies can also be applied. Use of the advantageous genetic properties of the transgenic plants according to the invention can further be made in plant breeding that aims at the development of plants with improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value, increased yield, or improved structure causing less loss from lodging or shattering. The various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending on the desired properties different breeding measures are taken. The relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc. Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines. Thus, the transgenic plants according to the invention can be used for the breeding of improved plant lines that for example increase the effectiveness of conventional methods such as herbicide or pesticide treatment or allow to dispense with said methods due to their modified genetic properties. Alternatively new crops with improved stress tolerance can be obtained that, due to their optimized genetic "equipment", yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions.

[0369]In one embodiment, a polynucleotide sequence is provided as given in SEQ ID NO: 5, SEQ ID NO: 51 and SEQ ID NO: 52, which encodes a protein which is functionally equivalent to the B gene.

EXAMPLES

[0370]The following Examples provide illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently claimed subject matter.

Example 1

Characterization of the Sugar Beet PRR7 Gene

Example 1.1

Characterization of the Putative PRR7 Homologue from Sugar Beet

[0371]Based on a candidate gene approach for the identification and characterization of putative bolting control genes in sugar beet, the EST sequence with accession number CV301305 was identified as the putative beet homologue of PRR7 by means of homology searches using BLAST. SEQ ID 1 shows the nucleotide sequence of EST CV301305. The corresponding amino acid sequence shows the partial presence of a Pseudo Response Regulator receiver (PRR, pfam00072) or Signal Receiver (REC, cd00156) domain (FIG. 1), a hallmark of the PRR gene family that appear to be crucial for certain circadian-associated events (Nakamichi et al, 2005). FIG. 2 shows the alignment of the amino acid sequence of CV301305 with PRR7, its closest Arabidopsis homologue, which has been described as a component of the temperature-sensitive circadian system (Nakamichi et al, 2007; Salome and McClung 2005). The circadian clock is known to control several developmental processes in plants including flowering time (i.e; bolting) control (Imaizumi and Kay, 2006; Zhou et al, 2007).

[0372]Based on the above observations, the putative gene structure of the partial beet PRR7 fragment was deduced using the alignment between the genomic sequence and the mRNA of the Arabidopsis PRR7 gene (AT5G02810 and NM-- 120359 respectively) to the BvPRR7 sugar beet EST (CV301305), which revealed the presence of several putative intronic regions (FIG. 3). Primers PRR7-F and -R (SEQ ID NO 2 and 3) encompassing the third putative intronic region delivered an amplification product of approximately 0.5 Kb when using genomic beet DNA as template. The PCR conditions for the amplification reaction were as follows: primary denaturation at 95° C. for 5 min followed by 35 amplification cycles of 30 seconds at 95° C., 30 seconds at 60° C. and 30 seconds at 72° C. and followed by 5 min at 72° C. PCR experiments were run at a GeneAMP PCR System 9600 instrument from Applied Biosystems Inc. using Platinum Tag DNA polymerase and the corresponding reaction mix from Invitrogen Corporation as recommended by the supplier. Sequence analysis of the PCR product enabled the reconstruction of the genomic sequence around intron 3 of the BvPRR7 gene fragment, and confirmed the presence of an intron of 296 base pairs in length (SEQ ID NO 4).

Example 12

Mapping of the BvPRR7 Gene

[0373]Using the PRR7-F and PRR7-R primers described above, the genomic fragment of the BvPRR7 gene was amplified and sequenced across a panel of sugar beet parental lines consisting of 15 biennial and one annual line. All biennial lines revealed monomorphic for BvPRR7 as only two different haplotypes were observed: one biennial allele and one annual allele (Table 1). In order to map BvPRR7 in a population segregating for the annual habit, an assay was developed targeting the SNP at position #160 (SEQ ID NO 4) using the EndPoint TagMan® technology. Table 2 summarizes the nucleotide sequences of the primers and probes designed for the PRR7(T1) TagMan® assay targeting SNP at position #160; the reactions further consisted of the TaoMan® Universal PCR Master Mix, No AmpErase® UNG (2×) from Applied Biosystems Inc. according to the manufacturers recommendations. The PCR amplification was performed as follows: 95° C. for 10 min followed by 40 cycles of 95° C. for 15 sec and 60° C. for 1 min, using an ABI PRISM 7700 Sequence Detector instrument. Endpoint measurement was performed using the Sequence Detection System 2.0 software.

[0374]Using the above PRR7(T1) assay, the BvPRR7 gene was mapped in a F2 population of 198 individuals derived from a cross between the annual line and a biennial line polymorphic for the SNP at position #160. BvPRR7 maps at chromosome H at an approximate distance of 1 cM downstream of the GJ131 marker (FIG. 4), a region known to contain the B gene for vernalization-independent flowering (Mohring et al, 2004; Gaafar et al, 2005). The results of the PRR7(T1) assay show a perfect match between the predicted genotype of the B gene and the genotype of the BvPRR7 gene. The genotype of the B gene was predicted based on phenotypic evaluation of the F3 populations derived from the individual F2 plants for vernalization-independent flowering. Table 3 summarizes the graphical representation of the fine-map of the B gene region for 9 individual progeny plants comprising the closest recombination events. The combination of its map position and its biological function relating to the temperature-sensitive circadian rhythm (Salome and McClung, 2005) obviously make BvPRR7 a strong candidate for the B gene.

Example 1.3

Recovery of the Full-Length Genomic Sequence of BvPRR7

[0375]Using the primers PRR7-F and PRR7-R, a sugar beet BAC library was screened by means of PER. The library was developed from the biennial commercial cultivar H20 and calculated to represent 6 genome equivalents with an average insert size of 120 Kb (McGrath et al, 2004). DNA pools for this library are distributed by Amplicon Express, Pullman W A. The PCR conditions for the screening of the DNA pools were as follows: primary denaturation at 95° C. for 5 min followed by 35 amplification cycles of 30 seconds at 95° C., 30 seconds at 60° C. and 30 seconds at 72° C. and followed by 5 min at 72° C. PCR experiments were run at a GeneAMP PCR System 9700 instrument from Applied Biosystems Inc, using Platinum Taq DNA polymerase and the corresponding reaction mix from Invitrogen Corporation as recommended by the supplier. Subsequent screenings of the DNA pools for the presence of the BvPRR7 fragment according to the supplier's instructions resulted in the positive identification of BAC SBA079-L24.

[0376]In order to obtain the full-length sequence of the BvPRR7 gene, BAC SBA079-L24 was sent to MWG Biotech AG, Germany for sequence analysis by means of the 454 sequencing technology. Where necessary, gaps between the obtained contigs were filled by regular Sanger sequencing to yield one single genomic sequence for the BvPRR7 gene (SEQ ID NO 5). Based on the alignment of the genomic sequence to EST CV301305 and on sequence homology to the PRR7 gene from Arabidopsis, the putative gene structure of the beet BvPRR7 gene comprising introns and exons was predicted as shown in FIG. 5. Based on this prediction, the genomic sequence spans the entire BvPRR7 gene with 3.6 Kb of sequence upstream of the ATG start codon and 2.2 Kb downstream of the coding region. The corresponding amino acid sequence of BvPRR7 is shown under SEQ ID NO 6. Alignment of the amino acid sequence of BvPRR7 to all members of the PRR gene family from Arabidopsis including TOC1 (PRR1), PRR3, PRR5, PRR7 and PRR9 illustrates the strong conservation of the Pseudo Response Regulator receiver domain (PRR) motif (pfam00072) near the NH2-terminus and the CCT motif (pfam06203) at the COOH-terminus (FIG. 6). In addition to the PRR gene family from Arabidopsis, BvPRR7 also shares strong homology to the PRR7 homologue in cereals as illustrated by the phylogenetic tree shown in FIG. 7. Surprisingly, the PRR7 homologue in cereals, better known as Ppd, is known to represent a major determinant of the photoperiod response (Turner et al, 2005; Beales at al, 2007) rather than the vernalization response as suggested here for sugar beet.

Example 1.4

Gene Expression Analysis of BvPRR7

[0377]For gene expression analysis, seedlings from biennial vernalized plants were grown in controlled environment chambers at a constant temperature of 18° C. and a photoperiod of 16 h day and 8 h night. Leaf samples were harvested every two hours over a period of 24 hours and total RNA was isolated using the RNAqueous®-4PCR Kit commercialized by Ambion, basically following the supplier's instructions. Plant RNA Isolation Aid (Ambion) was added to the RNA isolation steps to remove contaminants such as polysaccharides and polyphenolics and the RNA samples were treated with DNase I (Ambion) for removal of DNA residues. The RNA samples were converted to cDNA using the RETROscript® Kit (Ambion) starting from 1 μg of total RNA as template. The expression of the BvPRR7 gene was measured by means of quantitative PCR (qPCR) using the Power SYBR® Green FOR Master Mix (Applied Biosystems Inc.) on an ABI PRISM 7700 Sequence Detector instrument. The PCR conditions were as follows: primary denaturation at 95° C. for 10 min followed by 40 amplification cycles of 15 seconds at 95° C. and 1 min at 60° C. The nucleotide sequences of the forward and reverse primer for BvPRR7 are as follows: 5'-TTGGAGGAGGTGTCACAGTTCTAG-3'' (SEQ ID NO: 49) and 5'-TGTCATTGTCCGACTCTTCAGC-3' (SEQ ID NO: 50), respectively. The beta tubulin (BvBTU) and isocitrate dehydrogenase (BvICDH) genes were used as reference genes for normalizing the expression of BvPRR7. The primer sequences designed for these two reference genes consisted of 5'-TTGTTGAAAATGCAGACGAGTGT-3' (SEQ ID NO: 13) and 5-AAGATCGCCAAAGCTTGGTG-3' for 8vBTU (AWO63029) (SEQ ID NO: 14) and 5'-CACACCAGATGAAGGCCGT-3' (SEQ ID NO 15) and 5'-CCCTGAAGACCGTGCCAT-3' (SEQ ID NO: 16) for BvICDH (AF173666). All time points were run on biological triplicates and each qPCR experiment was repeated twice. Data were analysed using the Sequence Detection System 2.0 software (Applied Biosystems Inc.) and the GenEx software (MuIUD Analyses). As illustrated in FIG. 8, the expression profile of BvPRR7 gene shows a circadian oscillation with a peak of expression 7 h after dawn. This experiment confirms the rhythmic and circadian expression of BvPRR7 as described for most of the clock-associated genes identified thus far (McClung, 2006).

Example 1.5

Allelic Variability and Association to the Vernalization Requirement

[0378]Using several primer pairs (Table 4) the entire coding region of the BvPRR7 gene was amplified and sequenced across a panel of 16 biennial and 14 annual plants. The PCR conditions for the amplifications were as follows: primary denaturation at 95° C. for 5 min followed by 35 amplification cycles of 30 seconds at 95° C., 30 seconds at 60° C. and 30 seconds at 72° C. and followed by 5 min at 72° C. PCR experiments were run at a GeneAMP PCR System 9600 instrument from Applied Biosystems Inc. using Platinum Taq DNA polymerase and the corresponding reaction mix from Invitrogen Corporation as recommended by the supplier. The graphical representation of the observed genotypes shows 7 distinct alleles; 6 annual and 1 biennial allele (Table 5). The biennial allele is unique for the biennial lines and is never found in the annual entries, which suggest a strong correlation between the allelic variation observed for BvPRR7 and the annual or biennial plant habit. This observation further strengthens the causal relationship between BvPRR7 and the B locus for vernalization independent flowering in sugar beet. Amongst the 19 SNPs characterized in the coding regions, 7 of them lead to amino acid changes in the predicted protein sequence between the annual and the biennial alleles. According to the haplotypes illustrated in Table 5, any of the SNPs at positions #3827, #3954, #5284, #5714, #10954, #11220, #11391, #12053, #12127, and #12837 can be used to distinguish all annual alleles from the biennial allele by means of molecular markers targeting one or more of these SNPs.

[0379]Besides the coding region of the PRR7 gene, the promoter region also revealed polymorphic between annual and biennial lines. Using primers F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30), an amplification product of 0.6 Kb is obtained when using genomic DNA from biennial lines as template, but no amplification for the annual lines. The PCR conditions for the amplification reaction were as follows: primary denaturation at 95° C. for 5 min followed by 35 amplification cycles of 30 seconds at 95° C., 30 seconds at 60° C. and 30 seconds at 72° C. and followed by 5 min at 72° C. PCR experiments were run at a GeneAMP PCR System 9600 instrument from Applied Biosystems Inc. using Platinum Taq DNA polymerase and the corresponding reaction mix from Invitrogen Corporation as recommended by the supplier. This primer pair thus specifically amplifies the biennial alleles, but not the annual alleles. Similar results were obtained for primer pairs F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) or F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding amplifications products of 1.0 Kb and 0.8 Kb respectively in biennial lines, but no amplification in annuals. The person skilled in the art would know that the choice of discriminative polymorphisms is not limited to those listed herein above, but can also be identified in other parts of the non-coding or flanking regions such as the terminator and the introns.

Tables

TABLE-US-00001 [0380]TABLE 1 Polymorphisms observed between 1 annual and 15 biennial sugar beet lines for the BvPRR7 gene fragment spanning intron 3. SEQ ID NO 4 pos. 87 160 406 haplotype#1 T T G annual haplotype#2 C C A biennial

[0381]The header row indicates the nucleotide position at the genomic sequence of the BvPRR7 gene fragment (SEC) ID NO 5). The remaining rows represent the 2 haplotypes observed across the panel of 16 lines.

TABLE-US-00002 TABLE 2 Nucleotide sequences of primers and probes cor- responding to the TaqMan assay PRR7(T1) for the genotyping of SNP #160 precursor names sequence (5' to 3') PRR7(T1)-F GAGGTGTCACAGTGTAAGTGTCT PRR7(T1)-R AAAGACTGCTACACGAACCACTAAG PRR7(T1)-FAM FAM-CTGATGAAAAGCTG-MGB-NFQ PRR7(T1)-VIC VIC-CTGATGGAAAGCTG-MGB-NFQ

TABLE-US-00003 TABLE 3 Genotypes for a number of markers including PRR7(T1) mapping around the B gene across nine F2 plants showing recombination events at either side of the B gene. PRR7(T1), as well as 9_27(T2) marker, show a perfect match to the predicted genotype of the B gene. The genotype of the B gene is based on phenotypic evaluation of the F3 populations derived from the individual F2 plants. No. of recombinations 98775103 98775161 98775167 98775176 98775206 98775214 98775153 98775237 98775245 E8M4:193 -5 B A H H A H H A H E05M16:24 -3 B A H H A B A A H E15M4:162 -2 B A H H A B A H H E15M4:159 -2 B A H H A B A H H GJ131 -2 B A H H A B A H H 9_27 0 B H B H A B A H H PRR7 0 B H B H A B A H H B gene 0 B H B H A B A H H GJ01 3 H H B A H B A H H MP0176 3 H H B A H B A H H E13M4-196 3 H H B A H B A H H E09M08-113 3 H H B A H B A H H E09M08-124 3 H H B A H B A H H E09M08:03 3 H H B A H B A H H E13M04:36 3 H H B A H B A H H MS0278 3 H H B A H B A H H E09M08-588 3 H H B A H B A H H E8M4:174 3 H H B A H B A H H E13M04:50 3 H H B A H B A H H E16M16:19 4 H H B A H B A H B E16M16:17 4 H H B A H B A H B E16M16:20 4 H H B A H B A H B

TABLE-US-00004 TABLE 4 Nucleotide sequences of the PCR primers used to amplify and sequence all exons of BvPRR7 and part of the introns and promoter or terminator regions. precursor names sequence (5' to 3') location SEQ ID NO F3766 TTTGATGCTTTTTTCAGGCCA intron 1 SEQ ID NO: 17 R3767 TTTTCTTATAGGCTTCACCAGAAAGTC exon 3 SEQ ID NO: 18 F3354 ATGTCATCTCATGATTCGATGGG exon 3 SEQ ID NO: 19 R3355 TCAGCCCTCTTGCTTCCTATG exon 4 SEQ ID NO: 20 F3768 TTTCCTCATTCTTTTTTTAGTCTAGTGGT intron SEQ ID NO: 21 3/exon 4 R3769 AATATGTGTGAGAAAATGGTGGCA intron 4 SEQ ID NO: 22 F3782 TCYGAATGGGAAAGGATTTG exon 6 SEQ ID NO: 23 R3783 AATTTCGGGTGGTGCATCAG exon 6 SEQ ID NO: 24 F3784 GCCCCCAACCACAGTCTACA exon 5 SEQ ID NO: 25 R3785 GGTCCATTTAGCCGTGAATCTG exon 6 SEQ ID NO: 26 F3806 TTTTTGCATACCGAAGGCGT promoter SEQ ID NO: 27 R3807 CATTTGTTGAAGTAGGTGATAAGGACAA intron 1 SEQ ID NO: 28 F3808 TTAGATCCTCTCCCTTAGACTCTTCTGT promoter SEQ ID NO: 29 R3809 TCACCAATTCTTTATATCATATCATGACA promoter SEQ ID NO: 30 F3810 GAGAAAAGGGTTTTAGATGGTAAGTTTT promoter SEQ ID NO: 31 R3811 AACTTTAACGGATCATGTGTTTTCAAC promoter SEQ ID NO: 32 F3853 AACTGGACACTTGGATTTCAAGTCA promoter SEQ ID NO: 33 R3854 TTATGGGAAAAAACTCTCGGTATTCT promoter SEQ ID NO: 34 F3855 GAACCCCATTTTAGTATTGACATTTCT promoter SEQ ID NO: 35 R3856 AATTAGATGAATAAAAAGACAAATGAGGAA promoter SEQ ID NO: 36 F3857 TCCATTTGAGGAGTAGGTATGATGAG intron 4 SEQ ID NO: 37 R3858 CTTCGACGATCATTTTCCTGGT exon 6 SEQ ID NO: 38 F3859 GGAAAACCAATATTCACAGTTAGACCT exon 6 SEQ ID NO: 39 R3860 TCTTGAGCTGCTGATCCACGT exon 7 SEQ ID NO: 40 F3861 CTGCATCTGGTAAGCCTGGTG exon 7 SEQ ID NO: 41 R3862 CGTACCTGGCGCACGAAT exon 8 SEQ ID NO: 42 F3863 AATTTGGCCATTTCTTGCTTGTAT intron 7 SEQ ID NO: 43 R3864 AATGTGACGCGTAAACGCCT terminator SEQ ID NO: 44 F3865 GGTGTGATGCATATAATCTTGTTTGG terminator SEQ ID NO: 45 R3866 AGCAAGCCTGCGCTGG terminator SEQ ID NO: 46

TABLE-US-00005 TABLE 5 Haplotypes and polymorphisms observed in the coding region of BvPRR7 amongst 16 biennial and 14 annual lines ##STR00001##

[0382]The Table shows the 19 polymorphisms identified in the coding regions when comparing the annual and biennial alleles. Polymorphisms in the Pseudo-receiver and CCT domains are indicated by bolded lines. Amino acid substitutions are indicated by small stars. Amino acid changes specific for the biennial allele are indicated by big stars. The SNP position indicated in the header row are numbered according to SEQ ID NO 5.

Example 2

Transgenic Validation of BvPRR7 by Means of a Complementation Study

[0383]The annual plant habit conferred by the B gene behaves as a single dominant trait; the requirement for vernalization in biennial plants accordingly is recessive. The transformation of an annual allele of BvPRR7 into a biennial genotype thus is predicted to bestow the annual flowering behavior onto the biennial acceptor genotype. To verify this hypothesis, the coding sequence of an annual allele of BvPRR7 under the control of an annual promoter and terminator fragment is transformed into biennial genotype G018. The experimental procedure for the transformation of sugar beet is essentially as disclosed by Chang et al, 2002 using sugar beet meristems as explant material and the phosphomannose isomerase (PMI) gene as selectable marker. The plasmid map of the binary vector carrying the gene cassettes for both the PMI selectable marker gene and the annual BvPRR7 allele is shown in FIG. 9. Transgenic shoots are checked for PMI activity (Joersbo et al, 1998) and subsequently rooted, potted in soil and transferred to the greenhouse. Negative controls consist of non-transgenic shoots that underwent the same in vitro regeneration procedure, but without Agrobacterium infection and mannose selection. Plants are grown in growth chambers at a constant temperature of 18° C. and a photoperiod of 17 hours light and 7 hours dark. Under these conditions none of the non-transgenic controls are supposed to show any signs of bolting during the observation period, whereas annual control plants are supposed to bolt normally within 8 weeks. Contrary to the non-transgenic biennial control plants, a substantial number of transgenic events should start bolting within four to ten weeks and basically behaved as annual plants despite their biennial genetic background. Transgenic plants that bolted and flowered are cross-pollinated with a biennial maintainer line to produce offspring. Progeny plants are tested for PMI activity and subsequently monitored for bolting and flowering without vernalization. Most progenies should show a one to one segregation ratio and a perfect correlation between PMI activity and the annual habit. These data will equivocally confirm the causal relationship between E3vPRR7 and vernalization-independent flowering in sugar beet.

Example 3

Transgenic Suppression of BvPRR7 Confers Bolting Resistance

[0384]Since BvPRR7 plays a key role in the vernalization response in sugar beet, BvPRR7 represents an obvious candidate for engineering bolting resistance by suppressing the vernalization response. To this purpose a BvPRR7 cDNA fragment of 0.6 Kb (SEQ ID NO. 1) is assembled into an RNAi cassette under the control of the constitutive Ubi3 promoter from Arabidopsis (Norris et 1993). The inverted repeat of the BvPRR7 fragment is separated by the second intron from the potato StLS1 gene (Eckes et al, 1986; Vancanneyt et al, 1990) to stabilize the RNAi cassette, but also to improve the efficiency of the RNAi phenomenon (Wang and Waterhouse, 2001; Smith et al, 2000). The plasmid map of the binary vector carrying the RNAi gene cassette for BvPRR7 and the PMI selectable marker gene is shown in FIG. 10. The RNAi cassette is transformed into the biennial genotype G018 as described in the previous example. PMI-positive shoots and non-transgenic controls are rooted and transferred to the greenhouse for an acclimatization period of two weeks minimum at 18° C. prior to the vernalization treatment. Once well-established, the transgenic plants are exposed to the vernalization treatment consisting of a period of 14 weeks at a constant temperature of 6° C. and 12 hours low artificial light. Prior to applying bolting-inductive conditions, vernalized plants are slowly acclimatized for two weeks in climate chambers by stepwise increasing the temperature from 10 to 18° C. Plants are subsequently repotted into to larger pots (2 liter), and monitored for bolting while exposed to a constant temperature of 18° C. and a long-day photoperiod of 17 hours light 7 hours dark. Non-transgenic control plants routinely start bolting between four to six weeks post vernalization. Transgenic plants suppressed for BvPRR7 frequently show a delay in bolting ranging from only two weeks to more than two months. A few events may never bolt under the conditions applied in the greenhouse. Apart from the delay in bolting and flowering, transgenic plants develop normally and show no phenotypic aberrations. In general, plants delayed in bolting show a higher leaf number at the time of bolting as a result of the prolonged vegetative stage.

REFERENCES

[0385]Abe J., Guan G.-P. and Shimamoto Y., 1997. A gene complex for annual habit in sugar beet (Beta vulgaris L.). Euphytica 94: 129-135. [0386]Barany F., 1991. Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase. Proc. Natl. Acad. Sci. USA, 88:189-93. [0387]Batzer M A, Carlton J. E. and Deininger P. L., 1991. Enhanced evolutionary PCR using oligonucleotides with inosine at the 3'-terminus. Nucleic Acids Res. 19:5081. [0388]Beales J., Turner A., Griffiths S., Snape J. W. and Laurie D. A., 2007. A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-Dle mutant of wheat (Triticum aestivum L.). Theor. Appl. Genet. 115: 721-733. [0389]Botstein D., White R. L., Skolnick M. and Davis R. W., 1980. Construction of genetic linkage map in man using restriction length polymorphisms. Am. J. Hum. Genet., 32: 314-331. [0390]Brunke K. J. and Wilson S. L., 1993. Brassica hsp80 promoter. EP0559603 [0391]Chang Y.-F., Zhou H., Dunder E. M., Rouse S. N., Gu W. and Boutreau E., 2002. Methods for stable transformation of plants. WO 02/14523 [0392]Chiapparino E, Lee D. and Donini P., 2004. Genotyping single nucleotide polymorphisms in barley by tetra-primer ARMS-PCR. Genome 47414-420. [0393]Cooper D. N., Smith B. A., Cooke H. J. et al, 1985. An estimate of unique DNA sequence heterozygosity in the human genome. Hum. Genet. 69:201-205. [0394]Eckes P., Rosahl S., Schell J. and Willmitzer L., 1986, Isolation and characterization of a light-inducible, organ-specific gene from potato and analysis of its expression after tagging and transfer into tobacco and potato shoots. Mol Gen Genet 205, 14-22. [0395]English J. J., Mueller E. and Baulcombe D. C., 1996. Suppression of virus accumulation in transgenic plants exhibiting silencing of nuclear genes. Plant Cell 8:179-188. [0396]Fan J. B., Oliphant A., Shen R., Kermani B. G., Garcia F., Gunderson K. L., Hansen M., et al., 2003, Highly parallel SNP genotyping. Cold Spring Herb Symp Quant Bid 68:69-78. [0397]Felsenstein J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791. [0398]Gaafar R. M., Hohmann U. and Jung C., 2005. Bacterial artificial chromosome-derived molecular markers for early bolting in sugar beet. Theor. Appl. Genet, 110, Number 6: 1027-1037. [0399]Imaizumi T. and Kay S. A., 2006. Photoperiodic control of flowering: not only by coincidence. Trends Plant Science 11: 550-557. [0400]Joersbo M, Donaldson I., Kreiberg K., Petersen S. G., Brunstedt J. and Okkels F. T., 1998. Analysis of mannose selection used for transformation of sugar beet. Mol Breeding 4:111-117. [0401]Konieczny A. and Ausubel F. M., 1993. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers, Plant J. 4, pp. 403-410. [0402]Kwok P. Y., Deng Q., Zakeri H., Taylor S. L. and Nickerson D. A., 1996. Increasing the information content of STS-based genome maps: Identifying polymorphisms in mapped STSs. Genomics 31: 123-126. [0403]Landegren U., Kaiser R., Sanders J. and Hood L, 1988. A ligase-mediated gene detection technique. Science 241 4869, pp. 1077-1080. [0404]Litt M. and Luty J. A., 1989. Hypervariable microsatellite revealed by in-vitro amplification of a dinucleotide repeat in the cardiac muscle actin gene. Am J Hum Genet 44: 397-401. [0405]McClung C. R., 2006. Plant circadian rhythms. Plant Cell 18: 792-803. [0406]McGrath J. M., Shaw R. S., de los Reyes B. G. and Weiland J. J., 2004. Construction of a Sugar Beet BAC Library from a Hybrid with diverse Traits. Plant Mol Biol Rep 22: 23-28. [0407]Michaels S. D. and Amasino R. M., 1998. A robust method for detecting single-nucleotide changes as polymorphic markers by PCR. The Plant Journal 14(3): 381-385. [0408]Mohring S., Salamini F. and Schneider K., 2005. Multiplexed, linkage group-specific SNP marker sets for rapid genetic mapping and fingerprinting of sugar beet (Beta vulgaris L.). Molecular Breeding, Volume 14, Number 4: 475-488. [0409]Mullis K B., Faloona F. A., Scharf S., Saiki R., Horn G. and Erlich H., 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp Quant Biol 51:263-273. [0410]Nakamichi N., Kita M., Ito S., Sato E., Yamashino T. and Mizuno T., 2005. PSEUDO-RESPONSE REGULATORS, PRR9, PRR7 and PRR5, together play essential roles close to the circadian dock of Arabidopsis thaliana. Plant Cell Physiol., 46: 686-698. [0411]Neff M. M., Neff J. D., Chory J. and Pepper A. E., 1998. dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J 14: 387-392. [0412]Nickerson D. A., Kaiser R., Lappin S., Stewart J., Hood L. and Landegren U., 1990. Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay. Proc. Natl. Acad. Sci. USA. 1990 November; 87(22):8923-7. [0413]Norris S. R., Meyer S. E and Cailis J., 1993. The intron of Arabidopsis thaliana polyubiquitin genes is conserved in location and is a quantitative determinant of chimeric gene expression. Plant Mol Bid 21: 895-906. [0414]Ohtsuka E., Matsuki S., Ikehara M. Takahashi Y. and Matsubara K., 1985. An alternative approach to deoxyoligonucleotides as hybridization probes by insertion of deoxyinosine at ambiguous codon positions, J. Biol., Chem. 260(5):2605-2608. [0415]Okamuro J. K. and Goldberg R. B., 1989. Regulation of Plant Gene Expression: General Principles. Biochemistry of Plants, vol. 15:1-82. [0416]Orita M., Suzuki Y., Sekiya T. and Hayashi K., 1989. Rapid and sensitive detection of point mutations and DNA polymorphism using the polymerase chain reaction. Genomics 5:874-879. [0417]Pearson W. R., 1990. Rapid and Sensitive Sequence Comparison with FASTP and FASTA. Methods in Enzymology 183, 63-98 [0418]Rossolini G. M., Cresti S., Ingianni A., Cattani P., Riccio M. L. and Satta G., 1994. Use of deoxyinosine-containing primers vs degenerate primers for polymerase chain reaction based on ambiguous sequence information, Mol. Cell Probes 8 (1994), pp. 91-98 [0419]Ruiz M. T., Voinnet O. and Baulcombe D. C., 1998. Initiation and maintenance of virus-induced gene silencing. Plant Cell 10, 937-946. [0420]Salome RA. and McClung C. R., 2005. PSEUDO-RESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock, Plant Cell 17: 791-803. [0421]Saitou N. and Nei M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-425. [0422]Segev D., 1990. PCT Pub. No. WO 90/01069. [0423]Smith N. A., Singh S. P., Wang M. B., Stoutjesdijk P. A. Green A. G. and Waterhouse P. M, 2000. Total silencing by intron-spliced hairpin RNAs. Nature 407: 319-320. [0424]Smith T. F. and Waterman M. S., 1981. Advances in Applied Mathematics, 2, 482-489. [0425]Tamura K., Dudley J., Nei M. and Kumar S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599. [0426]Thiel T, Kota R., Grosse I., Stein N. and Graner A., 2004. SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development. Nucleic Acids Res 32(1): e5. [0427]Tijssen P., 1993. Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, N.Y. [0428]Turner A., Beales J., Faure S., Dunford R. P. and Laurie D. A., 2005. The Pseudo-Response Regulator Ppd-H1 provides adaptation to photoperiod in barley. Science 310: 1031-1034. [0429]Vancanneyt G., Schmidt R., O'Connor-Sanchez A., Willmitzer L. and Rocha-Sosa M., 1990. Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol. Gen. Genet. 220: 245-250. [0430]Vandesompele J., De Preter K., Pattyn F., Poppe B, Van Roy N., De Paepe A. and Speleman F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3: 1-11. [0431]Vos P., Hogers R., Bleeker M., et al. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23(21):4407-4414. [0432]Wang D. G., Fan J. B., Siao C. J. et al., 1998. Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 15, 1077-82. [0433]Wang M. B. and Waterhouse P. M., 2001. Application of gene silencing in plants. Curr. Opin. Plant Biol 5:124-150. [0434]Weber J. L. and May P. E., 1989. Abundant class of human DNA polymorhisms which can be typed using the polymerare chain reaction. Am. J. Hum. Genet. 44, 388-396. [0435]Welsh J. and McCleland M., 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18 (24):7213-7218. [0436]Wu D. Y. and Wallace R. B., 1989. Genomics 4560-569. [0437]Ye S., Dhillon S., Ke X., Collins A. R. and Day I.N., 2001. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res., 29, E88-E88. [0438]Zhou Y., Sun X.-D. and Ni M., 2007. Timing of photoperiodic flowering: light perception and circadian clock. J. Integrative Plant Biol. 49: 28-34. [0439]Zuckerkandl E and Pauling L, 1965. Evolutionary divergence and convergence in proteins, pp. 97-166 in Evolving Genes and Proteins, edited by V. Bryson and H. J. Vogel. Academic Press, New York.

Sequence CWU 1

521840DNABeta vulgaris 1gctcctgtca ttatgatgtc atctcatgat tcgatgggtt tagtcttaaa gtgcttatcc 60aagggcgctg ttgactttct ggtgaagcct ataagaaaaa acgaacttaa aaacctttgg 120cagcatgttt ggaggaggtg tcacagttct agtggtagtg gaagtgaaag ctgtgtaagg 180aatggaaaat ccataggaag caagagggct gaagagtcgg acaatgacac tgacatcaat 240gaggaagatg ataacagaag cattggttta caagctcggg atggaagtga caatggaagt 300gggacccaga gttcatggac aaaaagggct gcagaagttg agagccccca accacagtct 360acatgggagc aagcaactga tccacctgat agcacttgtg ctcaggtcat ttatccaatg 420tctgaggcat ttgccagcag ctggatgcct ggatccatgc aggaacttga tggacaggat 480catcaatatg acaatgtccc aatgggaaag gatttggaga ttggagtacc tagaatttca 540gattcacggc taaatggacc aaacaaaacg gttaagttag caactactgc tgaggaaaac 600caatattcac agttagacct caaccaggaa aatgatggtc gaagttttga tgaagagaac 660ctggagatga ataatgataa acctaaaagt gagtggatta aacaggctat gaactcacca 720ggaaaagttg aagaacatcg tagaggaaat aaagtatctg atgcaccacc cgaaatttca 780aaataaagga caaaggcatg caacatgtcg aggatatgcc ttctcttgtg ctcagtctga 8402493DNABeta vulgaris 2atgtcatctc atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac 60tttctggtga agcctataag aaaaaaygaa cttaaaaacc tttggcagca tgtttggagg 120aggtgtcaca gtgtaagtgt ctttacattt tccagcttty catcagctta gtggttcgtg 180tagcagtctt tcarattttc gaactttcta gcacatatga caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat tcgttttttt gtttttattt ttaattttaa ttttartttt tcctcattct 420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa tccataggaa 480gcaagagggc tga 4933493DNABeta vulgaris 3atgtcatctc atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac 60tttctggtga agcctataag aaaaaatgaa cttaaaaacc tttggcagca tgtttggagg 120aggtgtcaca gtgtaagtgt ctttacattt tccagctttt catcagctta gtggttcgtg 180tagcagtctt tcaaattttc gaactttcta gcacatatga caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat tcgttttttt gtttttattt ttaattttaa ttttagtttt tcctcattct 420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa tccataggaa 480gcaagagggc tga 4934493DNABeta vulgaris 4atgtcatctc atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac 60tttctggtga agcctataag aaaaaatgaa cttaaaaacc tttggcagca tgtttggagg 120aggtgtcaca gtgtaagtgt ctttacattt tccagctttt catcagctta gtggttcgtg 180tagcagtctt tcagattttc gaactttcta gcacatatga caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat tcgttttttt gtttttattt ttaattttaa ttttaatttt tcctcattct 420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa tccataggaa 480gcaagagggc tga 493515037DNABeta vulgaris 5attattgtac atayawgacy atttacgtaa ctaaattaaa aaaagtttta aaaatgcaaa 60acagaaaata aaatcaaata tcgacatttg gaaatttata atagaaatga ataaaaataa 120gggagaaata aatgaagaac aaaataaatg agaaagagaa ttaaaatggt tcttgaaaaa 180taaatgagag agaaaaggag ggaatgagtg agtgatgaga gagaaagagc tggcccactt 240tcaaaaattc tgccaaaagc ctgccaaatt ttggccctcc taaaagcatc aaaactacgt 300agttttggcc aaggtgtagg atgctcatcc tacacctccg tgcaggatct aaattgcgct 360tagaaatagg gtctcctaat atttctctac tagcattttt tgcacgcgat gcgtgcttga 420atttttttca agatagaaac tcgatttttt tcgacgtatg taaaagtcaa aatttaaaca 480ttagacatac aaagtataat tgtttttagt tacaaaattt aattggttta gtctctgtaa 540cttgagtttc tcaccagtct tttttttttt tttttttttt tttactttca aagttaaatt 600ctatgaacaa aatagaaatt ttattgaatt tatctatgat ttctaatatt actccctccg 660acccaaaata tagttcccat ttcccttttt tcacggtaat ttatgcaaat agaatataag 720agggatagta aagatttttt gtttatttaa ataaatgttg tatgggaaaa gatgatttta 780ggagagaaag tagagaataa ttggtgaaag agtattaatt gtaacatttt ggttgaataa 840acaaaggaaa aaacaaaatt caagaagcaa ataaatgaga attgtttcct tgaataatgc 900aaaagtgggt tttaattccc aaaatatgcc caaaaataaa aaaattccct gtgtaccgtc 960cacgtaagac ggcacgcgag attttttttt cctacttcaa tacaaccgct acttaaagta 1020gcggtttact gatttttttt tttatctact taggtaaaac cttggcgctg agtgatataa 1080ctcgctactt caagtagcga tttactgaaa tccccaactc catagtttga tatgtgcttg 1140caacattttg cccaggtaaa ccgctactca gggtagcggt ttatgtgtat aaaccgctac 1200ttaaagtagc ggtttatttt aatataaacc actattgtga gtagcggttt acgtgggcaa 1260aaacaaaaaa aaaaatagtt tctcgcgtgt cgtcctacgt ggacggtacg cagggaattt 1320tttaattttt gggcatattt tgggaactaa aacccacttt tgcattattc aaggaaaaaa 1380ttcaaataaa tgatgggaca cggtttttct agacaaatta cgaaaaaatg tggaactaaa 1440tatgaaaatg gaaactatat tttgggacac ccaaaatgga aatgggaatt atattttggg 1500acggagggag tataattttt tagttgattt ttgaattaag tatactactt catatattgt 1560taagaaactg gacacttgga tttcaagtca aatttttgtg agtatgtatt gacgttgtag 1620tgtattggtt gtagtttgta agttaatttt tgtttttgta aagtttactc atttgagtga 1680tttgtataat gtaaattatg caattctatg attttagttg acttgtgagt gattgttata 1740attttatttc cattattttt atttgaatct ccctttggtt tgtatgtgaa tttgtaattt 1800agaaaggcaa aggggtaaaa tagtctcttc attcgggaac accatagttc ccctccttcc 1860cttatataat aaagatgatg atgatttttg ataataatga tttgtaagtg aattatgtga 1920atgtttttgt atgtattgac gtcctagtat attagtttta gtttgtaagt taattttttt 1980gtttttgtaa agtttcccga tcatttgagt gattttcgtg attttttgtg attttctcaa 2040ttctatgagt gatttgtaaa gtttcttgat ataagtgatt tctgagtggt gttgaattaa 2100tttccggtgg ctttgttaga accccatttt agtattgaca tttcttttgt aatttagaaa 2160gggaaagggg ggtaaaatag gcatttcaaa aaaggacacc attgctcccc ccttccctta 2220tgtaattgag atatcttaaa agaataccga gagttttttc ccataaagga gtattttttt 2280taaaattttt tccataaagg agtatttatt agtaccaagt tgatttccca aatcattatc 2340cttgcgcaaa ttgcataatg gagatatttg gtgttgacgt gtgaatatgg ggccataata 2400ataggaggtc aaaaacaaaa ctacaagggt taaaatcgtc acaatattaa acaagcatct 2460cacattctca ctggtcactt ttttttaacc tattaaaaga acaaaccttt aactctcctc 2520acaatctgac acgtgtcgaa tattgattta ctgagatcaa tttagatcct ctcccttaga 2580ctcttctgtc ttctcagtac agctttagat ctcaacctcc atgtcagcaa agttacctta 2640cgtgtcatcc tacgtggcct ctccttctac ccctcactcc tccacgtcaa cattttcctc 2700caaaattaaa aaatcatttt tttattatat ttacttgaat gtatataata atgtctactg 2760atcttcttct ttagaactat ctccttctct cattggaacc tcaaaatcat tcttatttta 2820tttcgagaaa aggaaaaaaa agcacatctt ttttgaagat taatttgtgg attattattg 2880agcttcatcg tattaaaaaa catagtaaaa gttctttcct catttgtctt tttattcatc 2940taattttttt tagtgaagaa ccctaatttt gtttgtgaat tctcaagttc aagttttgat 3000ttgggtattt tttttgatga aatttgtgca gctgtaggat gttatcgtgc tgagaaaagg 3060gttttagatg gtaagttttt ttttctttga tttctctctc ctactttttt ttttgttttg 3120ctttagataa tactgtcatg atatgatata aagaattggt gatttgggta gtttatttaa 3180cctatgatta tgtgttattt gttttgatct ttcaatttat ctggtgctgt gtgtatatat 3240gttttgtttt tcttcaagta tttggttatt attgaagtgg gtaattagga atttgctact 3300aatctatgga tttgggttct gttgtgatta atttactata gatttgaggt ttaatttatg 3360ttttataggt tagaaaagga aatcaatgat ttgtttgtgg atttgagtag attgtttgtt 3420agtgtgtgta tgatgatatt aacttccatt attcttcccc aaattagggg taattgatgg 3480ttttttgcat accgaaggcg tattctcttt gatgatggag tgattgttga aaagacatga 3540tgggttaaag ttgcaggatt atttcatttc aataaacata attgatcaat ttggatctgt 3600tgaatgaggt tgattcacaa aaatgaagat gggcccggtg ttgccaagtc ggtggcagag 3660cttaatcaac atatagttgc tgtgaaaaaa gaaggtaggg gtagggttgc aggtgaaggg 3720caggggcttt ccgaggagga cgaactgaga attattgagg atggtgaaga tgcaaacagc 3780aggcgttctt tgagttctgt tcagcttcca gttcatactc acaggcatca gccacaagta 3840caaccccagg ggagagtctg ttgggagagg tttctccctg ttggatctcc taaggttttg 3900ctcgtagaaa gtgatgactc aactcgtcat attgttagtg ctttgctacg gaaatgtagc 3960tatgaaggtg atttgatctg ttttaatccc atatatgcaa tgtcttgtcc ttatcaccta 4020cttcaacaaa tgattaagag aattgtactc cctcgttcca aaataatagc aacacttagc 4080cttcccgtag actttaggga gcgtttggtt catattatgg tatgggtttg gaattaggaa 4140tgaaaccaag gtggtatggg gttggaactt gatacttaat accttgtatt tggtttcatt 4200taggaatgaa aaaatttctt ttatttgata cctagaggta aggtatgagc catacccacc 4260tccccccatg ggtttctaaa ccccatacct tatgggtttg aggtatgggt ttaaaattta 4320aaaataagtt aaacaaacac taggtatgtg ttttgttcat tccaaaccca tacctcatac 4380ctaaaactag tgaaccaaac acccccttaa ggatcttggg acaaagggaa tccattacta 4440gatctggtga cattaatacc taagtttaca tcagtttcac ttaaatcctt cgttttaaaa 4500aaagtaaaaa aacctgttag tctgagtaag tttactaatt tttgttctaa aattcaacac 4560attatctaca tgcaagcact tactagtaca atacaactca aacaatatat gcatcctatc 4620tgttcacaat gaaccgaaaa ctaatctttt catacccttg tttgatgctt ttttcaggcc 4680atacaaattt ctttaaccta aattgcctcc tcagtcactg ttcaaaattg cagttttaac 4740atcctcaaga ccatgtgatg tactgttaga ttatattaag accctattgt aaataaagca 4800tgtatagtgg aataaaatgc atgtcttcct actttttttt gggggtcatg aactcattgt 4860ttgatatttt gcagttgtag gggtgccaaa tggcatagaa gcatggaaaa tcttagaaga 4920tttgagcaat cagattgacc tagttttaac tgaggtagtc acatcaggac tctctggtat 4980aggtcttctg tccaagataa tgagtcacaa aagctgccag aatactcctg tcattagtga 5040gctttcgttc cttgttgtat tagtgtatgt tctgtatttg attttctttc tttgtgcata 5100tcttgccttg ttttttacaa ttatttagat tttagatgaa aatgtatact cattttatgg 5160tctttagctg caacatttga ttattttgtg tgcagtgatg tcatctcatg attcgatggg 5220tttagtctta aagtgcttat ccaagggcgc tgttgacttt ctggtgaagc ctataagaaa 5280aaacgaactt aaaaaccttt ggcagcatgt ttggaggagg tgtcacagtg taagtgtctt 5340tacattttcc agctttccat cagcttagtg gttcgtgtag cagtctttca aattttcgaa 5400ctttctagca catatgacaa attaaacctg catgctaatt cccgattaga taatggaata 5460agctctttca gctggtcttt tacttctttc tcttctcctc ttatgaaaaa ctggtatgcc 5520actatgcatc ttgttccagg tgtttgttta gtgtttcttt cctttattcg tttttttgtt 5580tttattttta attttaattt taatttttcc tcattctttt tttagtctag tggtagtgga 5640agtgaaagct gtgtaaggaa tggaaaatcc ataggaagca agagggctga agagtcggac 5700aatgacactg acatcaatga ggaagatgat aacagaagca ttggtttaca agctcgggat 5760ggaagtgaca atggaagtgg gacccaggta gtgctaaccc ctgtaatatt aaacttccta 5820tagtaggtgt ggttaatgtg acgctgttaa ggccttttgg gtggttgctt ctagttcact 5880aaggataata agaaatagct cgctattgat agttagggca cctcaatatc acctcctctt 5940gtatgtttgt tgaactacat ttttagccag acttgagtat tttatcctga aggatagaac 6000aggtgcattt ttggttgcgg ttgttagttg ttactgttat gcaaagacta ttgccaccat 6060tttctcacac atatttaaca tggaagtgtc ctaaccaccc cccaacccaa aaaatgggag 6120ggagaaatta ctggagatgg gaaagaagtt acataaaaag ttagtcgttt gggtcatgat 6180tgtttgttgt atttgcaaag ttagcgcgtt ctcttcctgg atgcttcaaa ataagctgat 6240gcaccataaa gtaccactct tggcttcacc tgttggtgtg gacccaacca atgtaccctt 6300gttgatctcg agatagacaa agaggaagtt taatttctct ttatatgtta tctctcttca 6360atttgttagc agctatgtct ctttcgtgga catttagaac ccatgttagg ttcatattta 6420tagttaggtg attgtatcaa aattgccatc acaataaaca gaacattaat ttctattggg 6480aaggattcaa ggatcaaata tacaggaaag agcagtgtag gagatatcat cttgttgaac 6540aacaaaagaa acattaacat caactggtga taatctttgc aagattggat gacaaaatga 6600ggagtcgatc taatataaaa caaattggga actgtcagct atatcctgca tatcaagaat 6660ggagaccttt aagaaaagta agaccatttt ttgttgggaa gtcaagccat tgtcccagtt 6720tccttgtgaa atttagttca tcttagcttt cttctaccaa catgaattct ctttcctttc 6780agcccttgca aacttggttt tatgctaatt atcagtgttt ccttcattta gtacgctgag 6840agggtttatt tggttgatca aagaatactt gatgaccttg aggtagatgc tctacatgga 6900gaagttcctc taagtgtaca aagaatctag ttcgaccaac tttgatttag gaagagataa 6960cacgatcacc tcgtggtcta gactctggag aggtcaaagt gtgcaaaagg gtatttttga 7020aagacaatgg cttgttgatt catgactgaa attggatggt cgtgactgag catatactat 7080tagtggttct cttctaaggt gatataagta tgtgataacc caatcctgta tatttcttcg 7140aggacatcaa ttgtgctact attctagggt gctggagacc catacatata gagccattga 7200caattaacac aaacttcaac cacttatttt tatttcattt aagctatcaa tccctaagaa 7260agagcccatc caagctcctg ctttaggtgc atcccctccc ttttcagcta gtgcacaaaa 7320aatgaacttt cgagatagac tgctaaattt gctttgtcaa gaagacaaaa ttttgataca 7380caactgtaat tgcattttat gacacttacg ctgatatatc tgcaagtgaa gttgatatgc 7440aaaaactatg tagcctcctt cgtctacggt aatagatctc cgtcaatgtg atgcttgtgt 7500gccatcataa aatgatattg ggtctttaga ctctgttact ctacagctga aggatcttag 7560ccttggcatt tatatccttt ttatccaaaa gttaaaaaaa gcggaccgtt tgacccatgt 7620aaggaaaaag gaaaggaatc gagaaagaca aaggagggga aagaagttaa atctcctaaa 7680aagcttgttt tgtgcggtga gagagggagc gacttgaaat tgccattgat gatgattggt 7740tcacaattgt aatcgaaatc aaactcactc tctctctctc tctctctctt atcacccccc 7800tcaaactata acatcacagt cctttaaacg tgactgtttc gggggatagt gactggtagg 7860gatgggcaag ggtcgggtct ggctggaccc tagacccgga ccctaatttt tttttgtaga 7920cccaaacccg gaccctaagg gtctgaaaaa attggacctt gacccagacc cttagggtct 7980gaagggtcta gagggtcagg agggtccagg cttaaatttt ttattttgcc aaatttttag 8040cattattaat atcaataatc atttgaaatt cgcatgaaac aaacacaaaa aaaaatcgca 8100tgaatcaaac acaaaaattc gcatgaaaca aacactaaca tataaattga aaaaaacgaa 8160acaaacacaa acttataaac gaaaaaaatt gaaacaaaca caattccaaa catataaact 8220gaaaaaaaaa acgaaacaaa cacaaatata caaactgaaa aaaagaagaa acaaacacaa 8280cttacataag agttcagaat gggtgttata gtttatgttt tagtcattta gaaaatcaat 8340ttgttttttt tttaaagtta aaatgtatat attaaataag tttagggtct aaggtgttgg 8400aacatttata gggtaatggg tttgaaactc atatgggtat gtactagaag aggaggaggt 8460ctagtatgca aaaggttaga gtgcatcaag tggtaacaac gcgcattgtt ataccaatgt 8520cgcgagtcgc gacaggcgtc gcgggtcgcg accagcgcct cgcgagcttc ttcgcatgtc 8580gcgacgcgtc ttctgccttg gaatgcgaaa aaatgcctcg gcggttttat atccgttgtg 8640atgctttgtt gatcatttta atgactttta aggtctttta atcagtagat taaaggcctt 8700tgatgagtga ttaagatggg ggttatgtga ttaacctctc tagtcaatga aatgttgatt 8760atgcttatat aacctttgga ttcctatgag tgaggagtta gaagaaaatc agaattttct 8820atactctctc aaaagtcttc ttgcttagct taagagaaac cttgcaatct tctcttgagt 8880gttcttcaca aacacaaaac acaagttctt gttgattcac ttagaagatc atctaagtgg 8940attgtttctc tccattgtat ctcattagtt atttcgtgtt aacccggtga tcctagaggg 9000gcgaaattaa actaattgga aagcgtagtt tccgtgcctt ggagtgggat atccggttct 9060ctcattgatc acaagcctaa cataagggtc gggtctgggt ccaaatttta agacccggac 9120ccggacccta aaaaattcac ttggacccag acccggaccc ggactcttag ggtctgaaaa 9180agttggaccc aaacccttaa attagggtcg ggtccaacag ggtccgggta gggtcttgga 9240cccatgccca tccctagtga ttgggtagcc cattgcagaa tattgagaac gcaatataaa 9300ggggtgttga gaaagagggt tttgagtgta ttgtttaaga aagttgggaa aggaatgaga 9360gatgaagtac agaagaaaac gtctagaaag tgaagcatgg gagtctgttt cttttctttt 9420tcctaaagtt tcccaccaaa tgtcccttaa gtggttcagc cacgcctttg gacaagctta 9480ccaccaagct ccccatccca gatcatattt gaatcaaaca tctttctttt tttagaatat 9540tctttttttg tgcatgaaag ccaattccat gagatatgta ccttatattt ctctaaaata 9600tataaataat tgatgaagca attttcagat cattagataa gcgttctaca aaagaaccat 9660ctttttttgc ttccttgtgt acttggaaaa tgtagttccc atatataatt ttaccatggc 9720agtacttcta tagaccacta agttcttcgc ttgtgcaacc tatagtgcat ttaagagggt 9780ttaggtatag acagccttca ctttcaattg gttagagtct acctccagta tcactgacag 9840aattttcaat aggaacttct gtcataactt aattcgcaga aagcactaac taaacaaccc 9900cttagttctt tagttaagcg cttgattggt cacatccagc ttttagtttt tagtatggag 9960atttataaag tagtatgact tgagttgaat agtgaacgta agattagaca tatttatata 10020gtcgtgttaa ttttggaaac tgacaggagt gactagaaac cacttttttt gtgtccaaaa 10080tttccatata ttgtttttta aaaaaactgc taaatcacga tgataacaaa caaaccttac 10140acaggtaccg gaatgatatt gaaacaaatt gaggttagtg ataagccata atcccttacc 10200ttgaaattca gaggctgtct gctgcagtct ctatcatctt cttatttcac taaatcaatt 10260attacctgct tcaacctcaa cggtccgagg cttagacatt gtgtctttga tagtatcatc 10320acagctgaaa attaatgtgt actttcttct atttaaatac catttgagag tgcctttggt 10380agtcattatg aatgtcgtga gatcacaatc cgtgaaatat agttttcatc acattcttac 10440ctgcatgtgt aaggaaaagt atagcgttag tgttcaatct tttgctactt ctggtgactg 10500gtcaatggtc aaagtatgca gcatgatttt gtgtttgtca gtttcttctt taaataagtg 10560tgaactgctc tagtctaagt tgctcgaact cttaaaaagt gttggacttg ttagttgtta 10620catgtataca atgttgattg ggtgggcttt tccatatatt attatatttg ttgaatcaca 10680atgaagtacc tatttccatt tgaggagtag gtatgatgag gttagtaggg agtttgagtg 10740ttaaaggtta tgtgaagatg taaaaattca ctgacaatga gaccttagta tccgacggtc 10800ggaattttac caattttatt gccttgttac ctttctattt ttacttagta tttccttttc 10860ataaattttt gtgatctaga gttcatggac aaaaagggct gcagaagttg agagccccca 10920accacagtct acatgggagc aagcaactga tccacctgat agcacttgtg ctcaggtcat 10980ttatccaatg tctgaggcat ttgccagcag ctggatgcct ggatccatgc aggaacttga 11040tggacaggat catcaatatg gtatgtggta ctgtatttga tagaagttac aataatgtgt 11100aaactgaaac cacttaatga cctagtatcc atctgtatca gacaatgtcc caatgggaaa 11160ggatttggag attggagtac ctagaatttc agattcacgg ctaaatggac caaacaaaac 11220ggttaagtta gcaactactg ctgaggaaaa ccaatattca cagttagacc tcaaccagga 11280aaatgatggt cgaagttttg atgaagagaa cctggagatg aataatgata aacctaaaag 11340tgagtggatt aaacaggcta tgaactcacc aggaaaagtt gaagaacatc gtagaggaaa 11400taaagtatct gatgcaccac ccgaaatttc caaaataaag gacaaaggca tgcaacatgt 11460cgaggatatg ccttctcttg tgctcagtct gaagaggttg ggtgatattg cagacacgag 11520cactaatgtc tcagaccaga atattgttgg gcgttcagag ctttcagcct tcaccaggta 11580tgctagagaa ggtgaaactt gaatttatat aatggacaag tggacaatat ctcattttta 11640aattgttgca ggtacaattc aggcacaact ggtaaccagg gtcaaacagg taatgttggc 11700agttgctctc caccaaataa tagttcagaa gcagcaaagc agtcccattt tgatgctcca 11760catcaaattt cgaatagcag tagtaacaat aacaatatgg gctctactac taataagttc 11820ttcaaaaagc ctgctatgga cattgataag acacctgcaa aatcaacagt caactgttct 11880catcattcac atgtgtttga gccagtgcaa agttcccata tgtctaataa taaccttact 11940gcatctggta agcctggtgt tggctccgta aatggtatgc tgcaagaaaa cgtaccagta 12000aatgctgttc tgccgcaaga aaataacgtg gatcagcagc tcaagattca gcaccaccat 12060cactaccatc attacgatgt ccatagtgta cagcagctac caaaggtttc tgttcaacat 12120aatatgccca aaagcaagga tgtgacagca cccccacagt gtgggtcttc aaacacttgt 12180agatcgccaa ttgaagcaaa tgttgccaat tgcagtttga atggaagtgg tagtggaagc 12240aatcatggga gcaatttcct taatggaagt agtgctgctg tgaatgttga aggaacaaac 12300atggtcaatg atagtgggat agctgcaaaa gatggtgctg aaaatggaag tggtagtgga 12360agtggaagtg gtagtggtag tggtgttggt gtggatcaaa gtcgatcagc tcaacgagaa 12420gctgccttga ataaattccg tctcaagcgt aaagaaagat gctttgacaa aaaggtaata 12480ctccaaattc tctccagaat

gtttatactt ggacatctag tatgtacatc cttgaatcta 12540aactgtaaaa gctgaatttc agaataaaaa acacaaatta tatcaagtat gaaggcagag 12600tattgtagta attatagttt ttctggtatg gaattagtac ttacatttac cagaagcctg 12660ctgtcacaag ccataatttg atcatcaagc aacaataatt tggccatttc ttgcttgtat 12720tgaaagtgag atgacttcaa acttatttgt gtatcatcac atcaggtgcg atatcaaagc 12780agaaagaagt tagcagatca aagacctcgt gttcgtgggc aattcgtgcg ccaggtacga 12840gaaaacaaag gaaggaatac cgatagctaa caccaattct ttccacaagt tgctgccaag 12900atcatttatg ccactctgat gtcagctgtc ttcatatgta caaatttcga attttatgtg 12960tgcatgaggt gctaaatact gtcaaacctc agtgattctg tttggtttag gctgtagaaa 13020gacatctttt cctttgtgtt ttcatggttc ttattttgag ctgtgttcac tactttttat 13080aacatggtag cccctggttg cctttggaaa taagcttttc cttaaaggtg tgatgcatat 13140aatcttgttt ggtgttagat tatatgatca tttcttcagg cgtttacggg tcacattttc 13200cggaatcctt tcaaacgcga ttccggaaac aatggctcat attttctttt ggtttcaagg 13260agaaggctat ttaaaacaga aaagatttag gttacagaaa tcagtgatga agcaatgagt 13320ttcattatag aataggtaga agtagggggt gttttttccg tactcttgag atagaaagtg 13380gggatagatt ctttggactc gtcagaaagg aataatatag ttgtctacct ttttcatttt 13440tagttcttgt aggagtttta ttccacttcc atttttgtaa aatttaggag ttgtaaggac 13500gtgtaaagag aatctgccat ccagatttta accgacggta aatttgttct tttcatgttt 13560tctcaagtaa ctataatgtt ttcatcgaat ctatagggat tttctaatgt gtacctgata 13620gaggcacaca gtaacaataa tataagtaca tatattcttt aagaataatg acatagtaat 13680tatattttta atacaaataa aagatgtcct tatgtaatga aacaaataac ttttccttga 13740aggtatgcca taattaatta ctttattttg aagatatttt atatttagtt tgggtagtgg 13800aactactaaa taaaaatatg gttatagtaa catgtactca tgtgcgaacc gaaaaaaacc 13860ctatgctttc tctaaaagtt cccaaaccct tgagcttata gccccgacgg cccagcgcag 13920gcttgctgga gcgccgcgtc gctcaccctg tcgccgacga gcctgcatgt cgtatcgttc 13980ggtcttctga aggtttagtt ttccctgttc ctctttgtgt tattcatcgt tcccatcccc 14040catgtctccc cttcccctgt cagtggttgt cggcctcccc ttcccctatt aatggttgtc 14100ggcctcccct tccctttccc ctaatagtgg ttgttggtct ccccttcccc tttcatgttg 14160tcaagttgtt cctttccccg ttctcccttt tcctagtcct cttttggtgt tcttgttgtt 14220gttagtttag tggctttggt tggttagttc ggctgagtgc ttcgtcgtcg tatgcccttc 14280cttgttcccc tatttggttt tggttatgtt ggggtttcgg ttaaccccgt tcccatgctt 14340aaacgtggga gggcctcagg atttagatat aaaggtcatc attctcgcgc ttagacgtga 14400gagggattaa gtgttcaggg ataagggctc cgttcctgcg cttaaacgtg ggagaactta 14460aaggttctag gttttacagg agttttggga ttggaaagta tatgaactct gtttggcaga 14520agatgacagt gcaatgtggg gattaatcat ttcgttttct tcctttttaa taagttagtc 14580tcttattatg agagttttct attagttcta atccccttaa tttcttgtag gggttgtaag 14640tctagtttgt cgttgtttag tatatctagt tcgagaagct cgaaagtttg aggttgtgga 14700aaaatgtact tactggttgc agatcaagaa tattaagacg aatgtttgac ttcaatttac 14760tattgcatca ggtaggaaat atggtgagtc atcgaatatc cattatggtt ggaatagtac 14820catatcatgg aagcggtttc gaagcgtgta tattagtaaa atagatgaag atattcaaat 14880cgatgtttta gattatcttt tatgtacgta agggtcatta ttgttgtaga tgttgtatgg 14940ttttttaatt taatgataat ttttccttat tcccacttaa aagtaaacaa tgcattcatg 15000tgcacatatt agtacatata tttgtatata catctcg 150376788PRTBeta vulgaris 6Met Arg Leu Ile His Lys Asn Glu Asp Gly Pro Gly Val Ala Lys Ser1 5 10 15Val Ala Glu Leu Asn Gln His Ile Val Ala Val Lys Lys Glu Gly Arg 20 25 30Gly Arg Val Ala Gly Glu Gly Gln Gly Leu Ser Glu Glu Asp Glu Leu 35 40 45Arg Ile Ile Glu Asp Gly Glu Asp Ala Asn Ser Arg Arg Ser Leu Ser 50 55 60Ser Val Gln Leu Pro Val His Thr His Arg His Gln Pro Gln Val Gln65 70 75 80Pro Gln Gly Arg Val Cys Trp Glu Arg Phe Leu Pro Val Gly Ser Pro 85 90 95Lys Val Leu Leu Val Glu Ser Asp Asp Ser Thr Arg His Ile Val Ser 100 105 110Ala Leu Leu Arg Lys Cys Ser Tyr Glu Val Val Gly Val Pro Asn Gly 115 120 125Ile Glu Ala Trp Lys Ile Leu Glu Asp Leu Ser Asn Gln Ile Asp Leu 130 135 140Val Leu Thr Glu Val Val Thr Ser Gly Leu Ser Gly Ile Gly Leu Leu145 150 155 160Ser Lys Ile Met Ser His Lys Ser Cys Gln Asn Thr Pro Val Ile Met 165 170 175Met Ser Ser His Asp Ser Met Gly Leu Val Leu Lys Cys Leu Ser Lys 180 185 190Gly Ala Val Asp Phe Leu Val Lys Pro Ile Arg Lys Asn Glu Leu Lys 195 200 205Asn Leu Trp Gln His Val Trp Arg Arg Cys His Ser Ser Ser Gly Ser 210 215 220Gly Ser Glu Ser Cys Val Arg Asn Gly Lys Ser Ile Gly Ser Lys Arg225 230 235 240Ala Glu Glu Ser Asp Asn Asp Thr Asp Ile Asn Glu Glu Asp Asp Asn 245 250 255Arg Ser Ile Gly Leu Gln Ala Arg Asp Gly Ser Asp Asn Gly Ser Gly 260 265 270Thr Gln Ser Ser Trp Thr Lys Arg Ala Ala Glu Val Glu Ser Pro Gln 275 280 285Pro Gln Ser Thr Trp Glu Gln Ala Thr Asp Pro Pro Asp Ser Thr Cys 290 295 300Ala Gln Val Ile Tyr Pro Met Ser Glu Ala Phe Ala Ser Ser Trp Met305 310 315 320Pro Gly Ser Met Gln Glu Leu Asp Gly Gln Asp His Gln Tyr Asp Asn 325 330 335Val Pro Met Gly Lys Asp Leu Glu Ile Gly Val Pro Arg Ile Ser Asp 340 345 350Ser Arg Leu Asn Gly Pro Asn Lys Thr Val Lys Leu Ala Thr Thr Ala 355 360 365Glu Glu Asn Gln Tyr Ser Gln Leu Asp Leu Asn Gln Glu Asn Asp Gly 370 375 380Arg Ser Phe Asp Glu Glu Asn Leu Glu Met Asn Asn Asp Lys Pro Lys385 390 395 400Ser Glu Trp Ile Lys Gln Ala Met Asn Ser Pro Gly Lys Val Glu Glu 405 410 415His Arg Arg Gly Asn Lys Val Ser Asp Ala Pro Pro Glu Ile Ser Lys 420 425 430Ile Lys Asp Lys Gly Met Gln His Val Glu Asp Met Pro Ser Leu Val 435 440 445Leu Ser Leu Lys Arg Leu Gly Asp Ile Ala Asp Thr Ser Thr Asn Val 450 455 460Ser Asp Gln Asn Ile Val Gly Arg Ser Glu Leu Ser Ala Phe Thr Arg465 470 475 480Tyr Asn Ser Gly Thr Thr Gly Asn Gln Gly Gln Thr Gly Asn Val Gly 485 490 495Ser Cys Ser Pro Pro Asn Asn Ser Ser Glu Ala Ala Lys Gln Ser His 500 505 510Phe Asp Ala Pro His Gln Ile Ser Asn Ser Ser Ser Asn Asn Asn Asn 515 520 525Met Gly Ser Thr Thr Asn Lys Phe Phe Lys Lys Pro Ala Met Asp Ile 530 535 540Asp Lys Thr Pro Ala Lys Ser Thr Val Asn Cys Ser His His Ser His545 550 555 560Val Phe Glu Pro Val Gln Ser Ser His Met Ser Asn Asn Asn Leu Thr 565 570 575Ala Ser Gly Lys Pro Gly Val Gly Ser Val Asn Gly Met Leu Gln Glu 580 585 590Asn Val Pro Val Asn Ala Val Leu Pro Gln Glu Asn Asn Val Asp Gln 595 600 605Gln Leu Lys Ile Gln His His His His Tyr His His Tyr Asp Val His 610 615 620Ser Val Gln Gln Leu Pro Lys Val Ser Val Gln His Asn Met Pro Lys625 630 635 640Ser Lys Asp Val Thr Ala Pro Pro Gln Cys Gly Ser Ser Asn Thr Cys 645 650 655Arg Ser Pro Ile Glu Ala Asn Val Ala Asn Cys Ser Leu Asn Gly Ser 660 665 670Gly Ser Gly Ser Asn His Gly Ser Asn Phe Leu Asn Gly Ser Ser Ala 675 680 685Ala Val Asn Val Glu Gly Thr Asn Met Val Asn Asp Ser Gly Ile Ala 690 695 700Ala Lys Asp Gly Ala Glu Asn Gly Ser Gly Ser Gly Ser Gly Ser Gly705 710 715 720Ser Gly Ser Gly Val Gly Val Asp Gln Ser Arg Ser Ala Gln Arg Glu 725 730 735Ala Ala Leu Asn Lys Phe Arg Leu Lys Arg Lys Glu Arg Cys Phe Asp 740 745 750Lys Lys Val Arg Tyr Gln Ser Arg Lys Lys Leu Ala Asp Gln Arg Pro 755 760 765Arg Val Arg Gly Gln Phe Val Arg Gln Val Arg Glu Asn Lys Gly Arg 770 775 780Asn Thr Asp Ser785723DNAArtificialprimer PRR7(T1)-F 7gaggtgtcac agtgtaagtg tct 23825DNAArtificialprimer PRR7(T1)-R 8aaagactgct acacgaacca ctaag 25914DNAArtificialprobe PRR7(T1)-FAM 9ctgatgaaaa gctg 141014DNAArtificialprobe PRR7(T1)-VIC 10ctgatggaaa gctg 141123DNAArtificialprimer BvPRR7 11atgtcatctc atgattcgat ggg 231221DNAArtificialprimer BvPRR7 12tcagccctct tgcttcctat g 211323DNAArtificialprimer BvBTU 13ttgttgaaaa tgcagacgag tgt 231420DNAArtificialprimer BvBTU 14aagatcgcca aagcttggtg 201519DNAArtificialprimer BvlCDH 15cacaccagat gaaggccgt 191618DNAArtificialprimer BvICDH 16ccctgaagac cgtgccat 181721DNAArtificialprimer F3766 17tttgatgctt ttttcaggcc a 211827DNAArtificialprimer R3767 18ttttcttata ggcttcacca gaaagtc 271923DNAArtificialprimer F3354 19atgtcatctc atgattcgat ggg 232021DNAArtificialprimer R3355 20tcagccctct tgcttcctat g 212129DNAArtificialprimer F3768 21tttcctcatt ctttttttag tctagtggt 292224DNAArtificialprimer R3769 22aatatgtgtg agaaaatggt ggca 242320DNAArtificialprimer F3782 23tcycaatggg aaaggatttg 202420DNAArtificialprimer R3783 24aatttcgggt ggtgcatcag 202520DNAArtificialprimer F3784 25gcccccaacc acagtctaca 202622DNAArtificialprimer R3785 26ggtccattta gccgtgaatc tg 222720DNAArtificialprimer F3806 27tttttgcata ccgaaggcgt 202828DNAArtificialprimer vR3807 28catttgttga agtaggtgat aaggacaa 282928DNAArtificialprimer F3808 29ttagatcctc tcccttagac tcttctgt 283029DNAArtificialprimer R3809 30tcaccaattc tttatatcat atcatgaca 293128DNAArtificialprimer F3810 31gagaaaaggg ttttagatgg taagtttt 283227DNAArtificialprimer R3811 32aactttaacc catcatgtct tttcaac 273325DNAArtificialprimer F3853 33aactggacac ttggatttca agtca 253426DNAArtificialprimer R3854 34ttatgggaaa aaactctcgg tattct 263527DNAArtificialprimer F3855 35gaaccccatt ttagtattga catttct 273630DNAArtificialprimer R3856 36aattagatga ataaaaagac aaatgaggaa 303726DNAArtificialprimer F3857 37tccatttgag gagtaggtat gatgag 263822DNAArtificialprimer R3858 38cttcgaccat cattttcctg gt 223927DNAArtificialprimer F3859 39ggaaaaccaa tattcacagt tagacct 274021DNAArtificialprimer R3860 40tcttgagctg ctgatccacg t 214121DNAArtificialprimer F3861 41ctgcatctgg taagcctggt g 214218DNAArtificialprimer R3862 42cgtacctggc gcacgaat 184324DNAArtificialprimer F3863 43aatttggcca tttcttgctt gtat 244420DNAArtificialprimer R3864 44aatgtgaccc gtaaacgcct 204526DNAArtificialprimer F3865 45ggtgtgatgc atataatctt gtttgg 264616DNAArtificialprimer R3866 46agcaagcctg cgctgg 164713DNAArtificialprobe PRR7(#3827)-FAM 47acaggcatca gcc 134815DNAArtificialprobe PRR7(#3827)-VIC 48tcacaggcct cagcc 154924DNAArtificialforward primer BvPRR7 used for gene expression analysis 49ttggaggagg tgtcacagtt ctag 245022DNAArtificialreverse primer BvPRR7 used for gene expression analysis 50tgtcattgtc cgactcttca gc 225124128DNABeta vulgaris 51maaacgttgt gatcatctaa tattattgaa tatattatct ccataactta tcctaatatt 60atttagttta ttacacttga tcgaggacaa aatccttcaa tctcccactt gtctaagaac 120aagtgtgtaa ccttcaaact ccttaagtcg cttaatgtct aacttgatga catgataaca 180tcatatgttc atcataacaa tattcaagtc gttccttgaa atctgagttt gaactgtcga 240aacaaatgat taacttctta atccatttga gcacggccat gcattttcag ttctcactct 300tcaagaggcc aagacaccaa tcctaactct taggaggact tatccaatct tgtatgacca 360aagctcccac tcaattcata gcagttccaa tcgctgcttt tataacctcc ttttacggca 420cggcgttttg cagcgtcaag aacatactaa tccttaagta agaacagttt catactcatg 480tcaaaggaat ccactaaata tattaataag agtctcataa accttttaga gaactcccac 540taggtctgcc cagcgtgtat caactataca agcctatgca aatgactaga catctccatg 600tccctatagc ccatgaaact gcgctatcaa tcaacttgca atctagtcca tgaaattgaa 660tcatttacgt tcaacttaat gattcgaact agggactaag gtatattata actcctgttc 720actggataga gttccattcg tcaaatcacg tatttgacaa ttctatcaaa cgttataaaa 780tactttgaac gttttattta atactaaacc aagattaaat aagaacaaaa cttttattga 840taaacataaa cataacatat caaagcgagt aattataact gtgaactaat taaaagtaaa 900tagtacacaa ttaaacccac tctcctatat gcttaagccc tatagcccta gtatgactct 960catgcttggg ctgtggcaaa ggtttagtca aaggatcagc gacattacta tccgtatgaa 1020ccttgcaaac tattacatcc tttctctcaa cgatttctcg aatgagatga aactttctaa 1080gtacatgttt acatctttga tgtgatcttg gttccttaga ctgagctatg gcaccattgt 1140tatcacaatg taaaacaata ccatctccaa cactaggcac tactcctagc tccagaatga 1200acttcttcat ccaaacggct tcctttgctg catctgctgc agcaatatac tcagcttctg 1260tcgtagaatc agcgacagtg ctttgctttg aacttttcca gctcactgcc cctccattta 1320gacaaaagat gaaaccagat tgggatcgga aatcatcttt gtcagtttgg aaacttgcat 1380ctgtgtaacc ctcaacaatt aacttacttt tacctccata cactaagaaa ttatccttag 1440tccttctcaa gtactttagg atattcttag ctgcactcca gtgtgcgtca cctggatttg 1500attggaatct gctacacatg ctcaaggcat atgaaacatc tgggcgagta caaatcatgg 1560agtacataat ggagcctata gctgacgcat aaggaacatt actcattcgc ttaatctcat 1620caggcccaga aggacactga gtcttgctaa gcgacactcc atgttgcatg ggtaggaagc 1680ctctcttaga gttttccatg ttgaacttag tgacgatctt atctatataa gttcgttggc 1740taagtccgat catcctctta gacctatccc tatagatctt gatccccaaa atatactcgg 1800cgttttcgag gtctttcata gaaaaacaac tttttaacca ttccttgact gactcaagca 1860tgggaatgtt gtttcctatg agaagtatgt catctacata caagaccaag aagactatgt 1920tactcccact ttccttcttg taaacacaag actcttctcc atttttaaga aaaccaaact 1980ctttgattgc ctcatcaaaa cgaagattcc aactccgtga tgcttgcttc aatccataaa 2040tggatttttg aagcttacat accctcctag gattttctgg atccacaaaa ccctccggct 2100gtgtcatata cacatcctct ttcaagaacc cattcaagaa agcggttttg acatccattt 2160gccaaatctc gtaatcatag aaggcggcga tcgctaggag tatccgaacg gatttaagca 2220tggctaccgg tgaaaaggtt tcgtcatagt ctataccatg aacttgcttg aacccttttg 2280caaccaacct tgctttgtaa acctgaatat taccatcctt gtctgttttc actttgaaaa 2340cccatttgca accaataggt gtgatcccat cgggcaaatc taccaagtcc catacttgat 2400tttcagacat ggatgccatt tcggacctca tggcttcgag ccatttttcg gagtcttcac 2460tcatcaaagc ttgcttgtaa gtagtaggtt cctcaaattc taaaatcatt atctcagaat 2520tttcagttaa caagaaatca acaaacctct tggttggtat tcttgttcta ctagacttac 2580gaggggctgc aacaggagaa attttcttct caacaatatg agaattttcg cacgaattag 2640attcgagtgg gacaatagga ggttcgtgta cgggatgcac gtcctccaac acttggtcag 2700ttatgggaga agattcctcc aaaggaggaa ctacttcaag cccaacatct ggctcttgtg 2760tcgttgtctc taacatagga tgaactatgt ccatttgttg atcttctcga acttcttcga 2820gaaatacatt actcccactt gcctttttgg aaataaaatc tttttccaaa aagacaccac 2880gacgagcaac aaacactttg ccctcagtgc gattgtagaa gtaatagccc ttggtttcct 2940ttggataacc cacaaagaaa cacttatctg atttaggggc gagtttatct gaaagtaaac 3000gctttacata aacctcacat ccccaaatac gtagaaaaga caagtttgga acttttccac 3060tccatatctc atatggtgtc ttatctactg cctttgatgg agttctatta agtgtgaaag 3120tagcagtttc gagagcatat ccccagaagg atattggaag atcagcaaaa ctcatcatag 3180accgaaccat atcaagtaga gttcgattcc tcctttccga aacaccattc aactgaggtg 3240ttccaggcgg agtgagttgt gaaagaattc cacaactctt caagtgatca ttaaactctt 3300ggctcaaata ttcaccacca cgatcggatc gcagtgcttt gattgttttg ccaagctggt 3360tttggacttc attttggaat tctttgaatt tttcaaatga ttccgactta tgcttcatta 3420aatagacata tccatatcta cttaaatcgt ccgtaaaagt aatgaagtat ccaaaccctc 3480ccctagcttt tgtgctcatt ggtccacata catcagtatg tattaggccc aatagatcac 3540tgaccttttc accctttcca gtaaaaggtg actttgtcat tttacccatt aaacatgatt 3600cacacacatc aaatggctca aagtcaaaag

atgttagaag tccatcttta tgcaacttct 3660gaatgcgttt cgcgtttatg tgtcctaaac gacaatgcca taagtaagta ggattagtat 3720cgcttgttct atgttttttg ttgtctatgt taaggacatc tttgtctaag tctaggtaat 3780atagaccatt agacctctta gcagtggcat aaaacattga attcaaataa acagagaaac 3840aacctttctc aattgtaaat gaaaaccctt cattatccaa aacaggaata gaaataatgt 3900ttttggtaat agcaggaacg taataacaat tattaagctc taatattaat ccagaaggca 3960aaggtagact ataagtccca actgcaacgg cggcaactct tgcaccattt ccaactcgca 4020gttccacctc tcctttagcc aaggttctac tccttcttag tccctgcaca ttcgaagtaa 4080tgtgagaaac acaaccggta tcaaataccc aagaagtaga tgttgctaaa ttaatgtcaa 4140tgacatagat acctgaagaa gaagccccag acttcttatc cttcaagtac tttgggcagt 4200tacgcttcca atgacctatt tgatcacaat agaagcactt ggcatttgcg gccacctttg 4260gctttgcctt tgcctgtggc ttaatagcag tcttagtggc aacttgcttg cccttatctt 4320gctttttctt gccagcccat tccttcttaa aacccttttc cttttgaacc ataagaactt 4380ccttcttagg tgcaatagtg atgttttgct cggcagtcat gagcatccca tgcaactcag 4440caagggtttt cgacacccca ttcatattga aattcaatcg aaacgtattg aaccccttat 4500gaagtgagtg cagaatgatg tcagtagcca actcttggct ataaggaaag cccaacctct 4560ccatggcttc aaaataacca atcatttcga agacatgagt ggcgaccggc ttgccttcaa 4620ctaacgaaca ctcaagaata gccttgtgag tttcatacct ctctatccga gcttgttgtt 4680gaaacatggt tttcaactgt cggataatgc tataggcatc caagcttgca aacctctttt 4740gaaggcttgg ttccatagcc gctagcataa ggcaagtaac aattactgac ctttctgcaa 4800cggccttatg ggcctctttc tcagcatcag tagaggtagt agttaaaact gggatcggtg 4860tttcaagaac atcctctcga ccttcggacc taagaacaat tcttagattc ctttcccaat 4920caaggaagtt gttcccgttc aatttatcct tctcaaggat tgaacgtaag ttaaaaggtg 4980aattattgtt gttaccagac atgatatcta catagaagat gcaaaaagta taagtatgtt 5040tatcataata gcttttaaca aattttaaac actttaaaat aaaagctatg cacttgacca 5100attttaatgt gtcccttttg aatcaagtgg ttctaagatc ctatcaaaca tgatttataa 5160gtggactttg gcctcaactt aaaaccaagt ttaaaaggta agtaaactcc tttactaatt 5220acaacaattg taactcttag ttaatgggtg attgctaagg tgattacgct cccaggtaag 5280gaagttaccc acaacgttgg ggagagcctt cctaatccta gacagagcat gtcacccaaa 5340cacaaaaacc cataaacttt gctacaaaat ccaaaaccgt tttgatgatt ttgttgggcc 5400aaaccaaact aaacttgcaa atttcggaaa tttactctac ttagcccaag attgaaagta 5460atactctgct ttggcagaac ctattactaa cgatcaagtt ttagtaggtg tttatttgga 5520atagcaaaaa cccaatattt tatttaaggg acctaagtaa attattatgt tgatttaatt 5580gctagtgaac atttaaataa ttaaatcaca agcataataa acttagaaag catttaaaag 5640caatatttaa atgcataaaa ttaaatatga tcctagtatg gcccctaaac ctaaagacta 5700ctctttaaga ctcccttgtt gaatcaccat ggatctccat ccttgtgctt cataggataa 5760gattgaatca ccattcttct tattaatact tgaataaata ttttttgaaa ttataaacta 5820aaaaattaca aaaaatacca acgatgcgta gatcgtattt agattacaaa aatacattaa 5880cgatacgcat atcgtatttt ctatccaagt tttgggccat actagtcacc gcatgcattc 5940ataatatcat atatacaaaa acatgcattt taatcaacta ttaaaataaa ttatcatgtt 6000ttaacaactt taaaacataa taacaccatg aagatttaat cacacattaa atcctatggt 6060tggtacctta agacaaaatt taatcatatt agaatttcgt ctcacaaagg ctttaaaata 6120ttaatctaac aaatttaatc atattaaact taaagaaaaa ttaaagcaat tgtaggcacc 6180acatataatt taatcatatt aaaaacaaaa acttaacatg atgactaacc acataaaaag 6240ggcatgaaag aattaatcaa ctattaatac taacaaccta acatgtaatt aacatcataa 6300aaaaataata atagttacta actccttagt aacccccttt aaaattaact agtcaattat 6360cacatataat taactaataa aattaaagct cattatttaa ttcaattatg acttaaatat 6420aaaattaatc accattaatt aatttatttg caaattggaa tatactcaaa aacaagaaaa 6480agaaagaaaa aaaaaaaaaa agcaggctgc caaggcagca gtgtacactg ccacctcagt 6540gccggccacc tgcgcgacca ccagaaacga ccagaacctg ccaccgcgtc gctggccacg 6600gcgaccagca ccggcagcac tgcagcgcag gcagcaggcc gcgccaacag cagcgcccag 6660cgcaggaagc tcgcgccgcg cgagccacca cgacgccggc cacagtccgg cggcacgcca 6720gccaccatgt cggtcgaatt ccggtggacc ttcccccttt ccctttcaat tatcatcaac 6780ccttgtgcat aattgaatga aagttacaac aaattgattt ggggaaaaaa ttagggttca 6840tatcaatttt gttttaaaaa aaamcatgaa ctaacacaaa aaatctgata ttttgtgatg 6900tgagatttca attttgagta taatatatat ttatatatat acatwaaaat ccaattttta 6960tgtttccaat caattaatat cataatatca attatgcaaa taaattcata tataaagccc 7020tcccttaatt gaattaaaaa atgaaataaa acatgcatca acatgatcat attaatctat 7080gcaataggct aactgatacc actgtaggaa cttagatgca taatgcggaa aatcaagtat 7140caaatacttg tacatctatc ccaagatcat tgcataaatt agtatgaatc aaacaatagt 7200atagaattat acctttgatg cgtatgttcc tcttgtcacc aaacttctag tggagatcac 7260cttagaacgt caagcgccgt tcctctaatg ttggtccacg aacaacactt ggatcaccac 7320gtatgctagt acggaagaga gaaaaacact ctcttacttt tgtggtgagg gccgaaaatg 7380agtgtgaaaa gactaaggga aaaatcagat ttttcactct agaagttgta aaagtgtata 7440tccacctttg taaccccata tcaatatata aggtggttac aaaagaggtg tttcatgagg 7500ctttatttts cctcataatg tcatacatta tgagtctaat aaactcatga gttacaactc 7560ttcccatcca tcatcaaacc gcgcaaccca tttcacaaat ggatttggat aaatatccaa 7620gtgtcattac ttgtgtgacc tcataggact caatgatatt agtagttggc cctaatcata 7680ttagtccaac aaaccacaat tagcttctag caaaacgttg tgatcatcta atattattga 7740atatattatc tccataactt atcctaatat tatttagttt attacacttg atcgaggaca 7800aaatccttca caaatgcata tggtttgatg tacaataata tacgagtgta catttgggta 7860ttttcaatga tcaaagtaat gaccatcagt gtacattgtg atttatcctt atttacgttg 7920gttgcggtac ctttttatta ttattattag ctccacctac agttgcatgt acatgcacgt 7980acctagcatg tacactttgt tgacattcat gtacattaac cgggttaacg ttacaattat 8040gttgttatgt gttgaccttt tgttttaata ctcgtattga gttttttttg ttttgtttgt 8100gtctatatca caaggattgt actttggatg tctattattg ttcattgtgt gttattgacg 8160attttatggg gggatgtcat tgtgcatttt gattttgtta atgaacaacc acgaagccaa 8220gaatgtacaa agaaacataa tagaataaaa gtaacccaat tcctaaagct gatgtcaagt 8280gagtaatttg caatctttgt acactggtgt gttgatgttt gttcgcttat gaaattcaat 8340atgtacaatt atagtcatat acctcatagt gctccaggtg ccacaaaaaa aactcaatat 8400gggtattaaa acaaaaggtc aatacataac aacatgattg caacccagtt aatgtacatg 8460aatgtcaaca aagtgtacat gcaaggtacg tgcatgtaca tgcaactgta tgtggagcta 8520ataataaaaa aaggtaccgc aaccaacgta aataaggata aatcacaatg tacactgatg 8580gtcattactt tgatcactga aaataaggat acattattgt ttgattgaat gttcactgga 8640tatgactcaa tgtacaaata ttctagcaag attgttcaat tattaagcct gaatgtacaa 8700tgttgttatg actgaatgtt caagttattt tatagagctg actttgttct gtgtacatta 8760aagttgcgtt aatgatcatt gtgtatgact aaatatacat tagcttcact aacatgcgtg 8820cataacatat tctatagaca caaacaaaac aaaaaaaaac tcaatatggg tactagatta 8880aaaggtcaac acataacaac ctgattgtaa cccagttaat gtacatgaat gtcaacaaag 8940tgtacatgca aggtacgtgc atgtacatgc aactgtagat ggagctaata ataaaaaaaa 9000ggttccacaa ccaacgtaaa taaggataaa tcacaatgta cactgatggt cattactttg 9060atcactgaaa atacccaaat gtacactcgt atattattgt acatcaaacc atatgcattt 9120gttacattaa aaaaagtttt aaaaatgcaa aacagaaaat aaaatcaaat atcgacattt 9180ggaaatttat aatagaaatg aataaaaata agggagaaat aaatgaagaa caaaataaat 9240gagaaagaga attaaaatgg ttcttgaaaa ataaatgaga gagaaaagga gggaatgagt 9300gagtgatgag agagaaagag ctggcccact ttcaaaaatt ctgccaaaag cctgccaaat 9360tttggccctc ctaaaagcat caaaactacg tagttttggc caaggtgtag gatgctcatc 9420ctacacctcc gtgcaggatc taaattgcgc ttagaaatag ggtctcctaa tatttctcta 9480ctagcatttt ttgcacgcga tgcgtgcttg aatttttttc aagatagaaa ctcgattttt 9540ttcgacgtat gtaaaagtca aaatttaaac attagacata caaagtataa ttgtttttag 9600ttacaaaatt taattggttt agtctctgta acttgagttt ctcaccagtc tttttttttt 9660tttttttttt ttttactttc aaagttaaat tctatgaaca aaatagaaat tttattgaat 9720ttatctatga tttctaatat tactccctcc gacccaaaat atagttccca tttccctttt 9780ttcacggtaa tttatgcaaa tagaatataa gagggatagt aaagattttt tgtttattta 9840aataaatgtt gtatgggaaa agatgatttt aggagagaaa gtagagaata attggtgaaa 9900gagtattaat tgtaacattt tggttgaata aacaaaggaa aaaacaaaat tcaagaagca 9960aataaatgag aattgtttcc ttgaataatg caaaagtggg ttttaattcc caaaatatgc 10020ccaaaaataa aaaaattccc tgtgtaccgt ccacgtaaga cggcacgcga gatttttttt 10080tcctacttca atacaaccgc tacttaaagt agcggtttac tgattttttt ttttatctac 10140ttaggtaaaa ccttggcgct gagtgatata actcgctact tcaagtagcg atttactgaa 10200atccccaact ccatagtttg atatgtgctt gcaacatttt gcccaggtaa accgctactc 10260agggtagcgg tttatgtgta taaaccgcta cttaaagtag cggtttattt taatataaac 10320cactattgtg agtagcggtt tacgtgggca aaaacaaaaa aaaaaatagt ttctcgcgtg 10380tcgtcctacg tggacggtac gcagggaatt ttttaatttt tgggcatatt ttgggaacta 10440aaacccactt ttgcattatt caaggaaaaa attcaaataa atgatgggac acggtttttc 10500tagacaaatt acgaaaaaat gtggaactaa atatgaaaat ggaaactata ttttgggaca 10560cccaaaatgg aaatgggaat tatattttgg gacggaggga gtataatttt ttagttgatt 10620tttgaattaa gtatactact tcatatattg ttaagaaact ggacacttgg atttcaagtc 10680aaatttttgt gagtatgtat tgacgttgta gtgtattggt tgtagtttgt aagttaattt 10740ttgtttttgt aaagtttact catttgagtg atttgtataa tgtaaattat gcaattctat 10800gattttagtt gacttgtgag tgattgttat aattttattt ccattatttt tatttgaatc 10860tccctttggt ttgtatgtga atttgtaatt tagaaaggca aaggggtaaa atagtctctt 10920cattcgggaa caccatagtt cccctccttc ccttatataa taaagatgat gatgattttt 10980gataataatg atttgtaagt gaattatgtg aatgtttttg tatgtattga cgtcctagta 11040tattagtttt agtttgtaag ttaatttttt tgtttttgta aagtttcccg atcatttgag 11100tgattttcgt gattttttgt gattttctca attctatgag tgatttgtaa agtttcttga 11160tataagtgat ttctgagtgg tgttgaatta atttccggtg gctttgttag aaccccattt 11220tagtattgac atttcttttg taatttagaa agggaaaggg gggtaaaata ggcatttcaa 11280aaaaggacac cattgctccc cccttccctt atgtaattga gatatcttaa aagaataccg 11340agagtttttt cccataaagg agtatttttt ttaaaatttt ttccataaag gagtatttat 11400tagtaccaag ttgatttccc aaatcattat ccttgcgcaa attgcataat ggagatattt 11460ggtgttgacg tgtgaatatg gggccataat aataggaggt caaaaacaaa actacaaggg 11520ttaaaatcgt cacaatatta aacaagcatc tcacattctc actggtcact tttttttaac 11580ctattaaaag aacaaacctt taactctcct cacaatctga cacgtgtcga atattgattt 11640actgagatca atttagatcc tctcccttag actcttctgt cttctcagta cagctttaga 11700tctcaacctc catgtcagca aagttacctt acgtgtcatc ctacgtggcc tctccttcta 11760cccctcactc ctccacgtca acattttcct ccaaaattaa aaaatcattt ttttattata 11820tttacttgaa tgtatataat aatgtctact gatcttcttc tttagaacta tctccttctc 11880tcattggaac ctcaaaatca ttcttatttt atttcgagaa aaggaaaaaa aagcacatct 11940tttttgaaga ttaatttgtg gattattatt gagcttcatc gtattaaaaa acatagtaaa 12000agttctttcc tcatttgtct ttttattcat ctaatttttt ttagtgaaga accctaattt 12060tgtttgtgaa ttctcaagtt caagttttga tttgggtatt ttttttgatg aaatttgtgc 12120agctgtagga tgttatcgtg ctgagaaaag ggttttagat ggtaagtttt tttttctttg 12180atttctctct cctacttttt tttttgtttt gctttagata atactgtcat gatatgatat 12240aaagaattgg tgatttgggt agtttattta acctatgatt atgtgttatt tgttttgatc 12300tttcaattta tctggtgctg tgtgtatata tgttttgttt ttcttcaagt atttggttat 12360tattgaagtg ggtaattagg aatttgctac taatctatgg atttgggttc tgttgtgatt 12420aatttactat agatttgagg tttaatttat gttttatagg ttagaaaagg aaatcaatga 12480tttgtttgtg gatttgagta gattgtttgt tagtgtgtgt atgatgatat taacttccat 12540tattcttccc caaattaggg gtaattgatg gttttttgca taccgaaggc gtattctctt 12600tgatgatgga gtgattgttg aaaagacatg atgggttaaa gttgcaggat tatttcattt 12660caataaacat aattgatcaa tttggatctg ttgaatgagg ttgattcaca aaaatgaaga 12720tgggcccggt gttgccaagt cggtggcaga gcttaatcaa catatagttg ctgtgaaaaa 12780agaaggtagg ggtagggttg caggtgaagg gcaggggctt tccgaggagg acgaactgag 12840aattattgag gatggtgaag atgcaaacag caggcgttct ttgagttctg ttcagcttcc 12900agttcatact cacaggcatc agccacaagt acaaccccag gggagagtct gttgggagag 12960gtttctccct gttggatctc ctaaggtttt gctcgtagaa agtgatgact caactcgtca 13020tattgttagt gctttgctac ggaaatgtag ctatgaaggt gatttgatct gttttaatcc 13080catatatgca atgtcttgtc cttatcacct acttcaacaa atgattaaga gaattgtact 13140ccctcgttcc aaaataatag caacacttag ccttcccgta gactttaggg agcgtttggt 13200tcatattatg gtatgggttt ggaattagga atgaaaccaa ggtggtatgg ggttggaact 13260tgatacttaa taccttgtat ttggtttcat ttaggaatga aaaaatttct tttatttgat 13320acctagaggt aaggtatgag ccatacccac ctccccccat gggtttctaa accccatacc 13380ttatgggttt gaggtatggg tttaaaattt aaaaataagt taaacaaaca ctaggtatgt 13440gttttgttca ttccaaaccc atacctcata cctaaaacta gtgaaccaaa caccccctta 13500aggatcttgg gacaaaggga atccattact agatctggtg acattaatac ctaagtttac 13560atcagtttca cttaaatcct tcgttttaaa aaaagtaaaa aaacctgtta gtctgagtaa 13620gtttactaat ttttgttcta aaattcaaca cattatctac atgcaagcac ttactagtac 13680aatacaactc aaacaatata tgcatcctat ctgttcacaa tgaaccgaaa actaatcttt 13740tcataccctt gtttgatgct tttttcaggc catacaaatt tctttaacct aaattgcctc 13800ctcagtcact gttcaaaatt gcagttttaa catcctcaag accatgtgat gtactgttag 13860attatattaa gaccctattg taaataaagc atgtatagtg gaataaaatg catgtcttcc 13920tacttttttt tgggggtcat gaactcattg tttgatattt tgcagttgta ggggtgccaa 13980atggcataga agcatggaaa atcttagaag atttgagcaa tcagattgac ctagttttaa 14040ctgaggtagt cacatcagga ctctctggta taggtcttct gtccaagata atgagtcaca 14100aaagctgcca gaatactcct gtcattagtg agctttcgtt ccttgttgta ttagtgtatg 14160ttctgtattt gattttcttt ctttgtgcat atcttgcctt gttttttaca attatttaga 14220ttttagatga aaatgtatac tcattttatg gtctttagct gcaacatttg attattttgt 14280gtgcagtgat gtcatctcat gattcgatgg gtttagtctt aaagtgctta tccaagggcg 14340ctgttgactt tctggtgaag cctataagaa aaaacgaact taaaaacctt tggcagcatg 14400tttggaggag gtgtcacagt gtaagtgtct ttacattttc cagctttcca tcagcttagt 14460ggttcgtgta gcagtctttc aaattttcga actttctagc acatatgaca aattaaacct 14520gcatgctaat tcccgattag ataatggaat aagctctttc agctggtctt ttacttcttt 14580ctcttctcct cttatgaaaa actggtatgc cactatgcat cttgttccag gtgtttgttt 14640agtgtttctt tcctttattc gtttttttgt ttttattttt aattttaatt ttaatttttc 14700ctcattcttt ttttagtcta gtggtagtgg aagtgaaagc tgtgtaagga atggaaaatc 14760cataggaagc aagagggctg aagagtcgga caatgacact gacatcaatg aggaagatga 14820taacagaagc attggtttac aagctcggga tggaagtgac aatggaagtg ggacccaggt 14880agtgctaacc cctgtaatat taaacttcct atagtaggtg tggttaatgt gacgctgtta 14940aggccttttg ggtggttgct tctagttcac taaggataat aagaaatagc tcgctattga 15000tagttagggc acctcaatat cacctcctct tgtatgtttg ttgaactaca tttttagcca 15060gacttgagta ttttatcctg aaggatagaa caggtgcatt tttggttgcg gttgttagtt 15120gttactgtta tgcaaagact attgccacca ttttctcaca catatttaac atggaagtgt 15180cctaaccacc ccccaaccca aaaaatggga gggagaaatt actggagatg ggaaagaagt 15240tacataaaaa gttagtcgtt tgggtcatga ttgtttgttg tatttgcaaa gttagcgcgt 15300tctcttcctg gatgcttcaa aataagctga tgcaccataa agtaccactc ttggcttcac 15360ctgttggtgt ggacccaacc aatgtaccct tgttgatctc gagatagaca aagaggaagt 15420ttaatttctc tttatatgtt atctctcttc aatttgttag cagctatgtc tctttcgtgg 15480acatttagaa cccatgttag gttcatattt atagttaggt gattgtatca aaattgccat 15540cacaataaac agaacattaa tttctattgg gaaggattca aggatcaaat atacaggaaa 15600gagcagtgta ggagatatca tcttgttgaa caacaaaaga aacattaaca tcaactggtg 15660ataatctttg caagattgga tgacaaaatg aggagtcgat ctaatataaa acaaattggg 15720aactgtcagc tatatcctgc atatcaagaa tggagacctt taagaaaagt aagaccattt 15780tttgttggga agtcaagcca ttgtcccagt ttccttgtga aatttagttc atcttagctt 15840tcttctacca acatgaattc tctttccttt cagcccttgc aaacttggtt ttatgctaat 15900tatcagtgtt tccttcattt agtacgctga gagggtttat ttggttgatc aaagaatact 15960tgatgacctt gaggtagatg ctctacatgg agaagttcct ctaagtgtac aaagaatcta 16020gttcgaccaa ctttgattta ggaagagata acacgatcac ctcgtggtct agactctgga 16080gaggtcaaag tgtgcaaaag ggtatttttg aaagacaatg gcttgttgat tcatgactga 16140aattggatgg tcgtgactga gcatatacta ttagtggttc tcttctaagg tgatataagt 16200atgtgataac ccaatcctgt atatttcttc gaggacatca attgtgctac tattctaggg 16260tgctggagac ccatacatat agagccattg acaattaaca caaacttcaa ccacttattt 16320ttatttcatt taagctatca atccctaaga aagagcccat ccaagctcct gctttaggtg 16380catcccctcc cttttcagct agtgcacaaa aaatgaactt tcgagataga ctgctaaatt 16440tgctttgtca agaagacaaa attttgatac acaactgtaa ttgcatttta tgacacttac 16500gctgatatat ctgcaagtga agttgatatg caaaaactat gtagcctcct tcgtctacgg 16560taatagatct ccgtcaatgt gatgcttgtg tgccatcata aaatgatatt gggtctttag 16620actctgttac tctacagctg aaggatctta gccttggcat ttatatcctt tttatccaaa 16680agttaaaaaa agcggaccgt ttgacccatg taaggaaaaa ggaaaggaat cgagaaagac 16740aaaggagggg aaagaagtta aatctcctaa aaagcttgtt ttgtgcggtg agagagggag 16800cgacttgaaa ttgccattga tgatgattgg ttcacaattg taatcgaaat caaactcact 16860ctctctctct ctctctctct tatcaccccc ctcaaactat aacatcacag tcctttaaac 16920gtgactgttt cgggggatag tgactggtag ggatgggcaa gggtcgggtc tggctggacc 16980ctagacccgg accctaattt ttttttgtag acccaaaccc ggaccctaag ggtctgaaaa 17040aattggacct tgacccagac ccttagggtc tgaagggtct agagggtcag gagggtccag 17100gcttaaattt tttattttgc caaattttta gcattattaa tatcaataat catttgaaat 17160tcgcatgaaa caaacacaaa aaaaaatcgc atgaatcaaa cacaaaaatt cgcatgaaac 17220aaacactaac atataaattg aaaaaaacga aacaaacaca aacttataaa cgaaaaaaat 17280tgaaacaaac acaattccaa acatataaac tgaaaaaaaa aacgaaacaa acacaaatat 17340acaaactgaa aaaaagaaga aacaaacaca acttacataa gagttcagaa tgggtgttat 17400agtttatgtt ttagtcattt agaaaatcaa tttgtttttt ttttaaagtt aaaatgtata 17460tattaaataa gtttagggtc taaggtgttg gaacatttat agggtaatgg gtttgaaact 17520catatgggta tgtactagaa gaggaggagg tctagtatgc aaaaggttag agtgcatcaa 17580gtggtaacaa cgcgcattgt tataccaatg tcgcgagtcg cgacaggcgt cgcgggtcgc 17640gaccagcgcc tcgcgagctt cttcgcatgt cgcgacgcgt cttctgcctt ggaatgcgaa 17700aaaatgcctc ggcggtttta tatccgttgt gatgctttgt tgatcatttt aatgactttt 17760aaggtctttt aatcagtaga ttaaaggcct ttgatgagtg attaagatgg gggttatgtg 17820attaacctct ctagtcaatg aaatgttgat tatgcttata taacctttgg attcctatga 17880gtgaggagtt agaagaaaat cagaattttc tatactctct caaaagtctt cttgcttagc 17940ttaagagaaa ccttgcaatc ttctcttgag tgttcttcac aaacacaaaa cacaagttct 18000tgttgattca cttagaagat catctaagtg gattgtttct ctccattgta tctcattagt 18060tatttcgtgt taacccggtg atcctagagg ggcgaaatta aactaattgg aaagcgtagt 18120ttccgtgcct tggagtggga tatccggttc tctcattgat cacaagccta acataagggt 18180cgggtctggg tccaaatttt aagacccgga cccggaccct aaaaaattca cttggaccca 18240gacccggacc cggactctta gggtctgaaa aagttggacc caaaccctta aattagggtc 18300gggtccaaca gggtccgggt agggtcttgg acccatgccc atccctagtg attgggtagc 18360ccattgcaga atattgagaa cgcaatataa aggggtgttg agaaagaggg ttttgagtgt 18420attgtttaag aaagttggga aaggaatgag agatgaagta cagaagaaaa cgtctagaaa 18480gtgaagcatg ggagtctgtt tcttttcttt ttcctaaagt ttcccaccaa atgtccctta 18540agtggttcag ccacgccttt ggacaagctt accaccaagc tccccatccc agatcatatt 18600tgaatcaaac atctttcttt ttttagaata ttcttttttt gtgcatgaaa gccaattcca 18660tgagatatgt accttatatt tctctaaaat

atataaataa ttgatgaagc aattttcaga 18720tcattagata agcgttctac aaaagaacca tctttttttg cttccttgtg tacttggaaa 18780atgtagttcc catatataat tttaccatgg cagtacttct atagaccact aagttcttcg 18840cttgtgcaac ctatagtgca tttaagaggg tttaggtata gacagccttc actttcaatt 18900ggttagagtc tacctccagt atcactgaca gaattttcaa taggaacttc tgtcataact 18960taattcgcag aaagcactaa ctaaacaacc ccttagttct ttagttaagc gcttgattgg 19020tcacatccag cttttagttt ttagtatgga gatttataaa gtagtatgac ttgagttgaa 19080tagtgaacgt aagattagac atatttatat agtcgtgtta attttggaaa ctgacaggag 19140tgactagaaa ccactttttt tgtgtccaaa atttccatat attgtttttt aaaaaaactg 19200ctaaatcacg atgataacaa acaaacctta cacaggtacc ggaatgatat tgaaacaaat 19260tgaggttagt gataagccat aatcccttac cttgaaattc agaggctgtc tgctgcagtc 19320tctatcatct tcttatttca ctaaatcaat tattacctgc ttcaacctca acggtccgag 19380gcttagacat tgtgtctttg atagtatcat cacagctgaa aattaatgtg tactttcttc 19440tatttaaata ccatttgaga gtgcctttgg tagtcattat gaatgtcgtg agatcacaat 19500ccgtgaaata tagttttcat cacattctta cctgcatgtg taaggaaaag tatagcgtta 19560gtgttcaatc ttttgctact tctggtgact ggtcaatggt caaagtatgc agcatgattt 19620tgtgtttgtc agtttcttct ttaaataagt gtgaactgct ctagtctaag ttgctcgaac 19680tcttaaaaag tgttggactt gttagttgtt acatgtatac aatgttgatt gggtgggctt 19740ttccatatat tattatattt gttgaatcac aatgaagtac ctatttccat ttgaggagta 19800ggtatgatga ggttagtagg gagtttgagt gttaaaggtt atgtgaagat gtaaaaattc 19860actgacaatg agaccttagt atccgacggt cggaatttta ccaattttat tgccttgtta 19920cctttctatt tttacttagt atttcctttt cataaatttt tgtgatctag agttcatgga 19980caaaaagggc tgcagaagtt gagagccccc aaccacagtc tacatgggag caagcaactg 20040atccacctga tagcacttgt gctcaggtca tttatccaat gtctgaggca tttgccagca 20100gctggatgcc tggatccatg caggaacttg atggacagga tcatcaatat ggtatgtggt 20160actgtatttg atagaagtta caataatgtg taaactgaaa ccacttaatg acctagtatc 20220catctgtatc agacaatgtc ccaatgggaa aggatttgga gattggagta cctagaattt 20280cagattcacg gctaaatgga ccaaacaaaa cggttaagtt agcaactact gctgaggaaa 20340accaatattc acagttagac ctcaaccagg aaaatgatgg tcgaagtttt gatgaagaga 20400acctggagat gaataatgat aaacctaaaa gtgagtggat taaacaggct atgaactcac 20460caggaaaagt tgaagaacat cgtagaggaa ataaagtatc tgatgcacca cccgaaattt 20520ccaaaataaa ggacaaaggc atgcaacatg tcgaggatat gccttctctt gtgctcagtc 20580tgaagaggtt gggtgatatt gcagacacga gcactaatgt ctcagaccag aatattgttg 20640ggcgttcaga gctttcagcc ttcaccaggt atgctagaga aggtgaaact tgaatttata 20700taatggacaa gtggacaata tctcattttt aaattgttgc aggtacaatt caggcacaac 20760tggtaaccag ggtcaaacag gtaatgttgg cagttgctct ccaccaaata atagttcaga 20820agcagcaaag cagtcccatt ttgatgctcc acatcaaatt tcgaatagca gtagtaacaa 20880taacaatatg ggctctacta ctaataagtt cttcaaaaag cctgctatgg acattgataa 20940gacacctgca aaatcaacag tcaactgttc tcatcattca catgtgtttg agccagtgca 21000aagttcccat atgtctaata ataaccttac tgcatctggt aagcctggtg ttggctccgt 21060aaatggtatg ctgcaagaaa acgtaccagt aaatgctgtt ctgccgcaag aaaataacgt 21120ggatcagcag ctcaagattc agcaccacca tcactaccat cattacgatg tccatagtgt 21180acagcagcta ccaaaggttt ctgttcaaca taatatgccc aaaagcaagg atgtgacagc 21240acccccacag tgtgggtctt caaacacttg tagatcgcca attgaagcaa atgttgccaa 21300ttgcagtttg aatggaagtg gtagtggaag caatcatggg agcaatttcc ttaatggaag 21360tagtgctgct gtgaatgttg aaggaacaaa catggtcaat gatagtggga tagctgcaaa 21420agatggtgct gaaaatggaa gtggtagtgg aagtggaagt ggtagtggta gtggtgttgg 21480tgtggatcaa agtcgatcag ctcaacgaga agctgccttg aataaattcc gtctcaagcg 21540taaagaaaga tgctttgaca aaaaggtaat actccaaatt ctctccagaa tgtttatact 21600tggacatcta gtatgtacat ccttgaatct aaactgtaaa agctgaattt cagaataaaa 21660aacacaaatt atatcaagta tgaaggcaga gtattgtagt aattatagtt tttctggtat 21720ggaattagta cttacattta ccagaagcct gctgtcacaa gccataattt gatcatcaag 21780caacaataat ttggccattt cttgcttgta ttgaaagtga gatgacttca aacttatttg 21840tgtatcatca catcaggtgc gatatcaaag cagaaagaag ttagcagatc aaagacctcg 21900tgttcgtggg caattcgtgc gccaggtacg agaaaacaaa ggaaggaata ccgatagcta 21960acaccaattc tttccacaag ttgctgccaa gatcatttat gccactctga tgtcagctgt 22020cttcatatgt acaaatttcg aattttatgt gtgcatgagg tgctaaatac tgtcaaacct 22080cagtgattct gtttggttta ggctgtagaa agacatcttt tcctttgtgt tttcatggtt 22140cttattttga gctgtgttca ctacttttta taacatggta gcccctggtt gcctttggaa 22200ataagctttt ccttaaaggt gtgatgcata taatcttgtt tggtgttaga ttatatgatc 22260atttcttcag gcgtttacgg gtcacatttt ccggaatcct ttcaaacgcg attccggaaa 22320caatggctca tattttcttt tggtttcaag gagaaggcta tttaaaacag aaaagattta 22380ggttacagaa atcagtgatg aagcaatgag tttcattata gaataggtag aagtaggggg 22440tgttttttcc gtactcttga gatagaaagt ggggatagat tctttggact cgtcagaaag 22500gaataatata gttgtctacc tttttcattt ttagttcttg taggagtttt attccacttc 22560catttttgta aaatttagga gttgtaagga cgtgtaaaga gaatctgcca tccagatttt 22620aaccgacggt aaatttgttc ttttcatgtt ttctcaagta actataatgt tttcatcgaa 22680tctataggga ttttctaatg tgtacctgat agaggcacac agtaacaata atataagtac 22740atatattctt taagaataat gacatagtaa ttatattttt aatacaaata aaagatgtcc 22800ttatgtaatg aaacaaataa cttttccttg aaggtatgcc ataattaatt actttatttt 22860gaagatattt tatatttagt ttgggtagtg gaactactaa ataaaaatat ggttatagta 22920acatgtactc atgtgcgaac cgaaaaaaac cctatgcttt ctctaaaagt tcccaaaccc 22980ttgagcttat agccccgacg gcccagcgca ggcttgctgg agcgccgcgt cgctcaccct 23040gtcgccgacg agcctgcatg tcgtatcgtt cggtcttctg aaggtttagt tttccctgtt 23100cctctttgtg ttattcatcg ttcccatccc ccatgtctcc ccttcccctg tcagtggttg 23160tcggcctccc cttcccctat taatggttgt cggcctcccc ttccctttcc cctaatagtg 23220gttgttggtc tccccttccc ctttcatgtt gtcaagttgt tcctttcccc gttctccctt 23280ttcctagtcc tcttttggtg ttcttgttgt tgttagttta gtggctttgg ttggttagtt 23340cggctgagtg cttcgtcgtc gtatgccctt ccttgttccc ctatttggtt ttggttatgt 23400tggggtttcg gttaaccccg ttcccatgct taaacgtggg agggcctcag gatttagata 23460taaaggtcat cattctcgcg cttagacgtg agagggatta agtgttcagg gataagggct 23520ccgttcctgc gcttaaacgt gggagaactt aaaggttcta ggttttacag gagttttggg 23580attggaaagt atatgaactc tgtttggcag aagatgacag tgcaatgtgg ggattaatca 23640tttcgttttc ttccttttta ataagttagt ctcttattat gagagttttc tattagttct 23700aatcccctta atttcttgta ggggttgtaa gtctagtttg tcgttgttta gtatatctag 23760ttcgagaagc tcgaaagttt gaggttgtgg aaaaatgtac ttactggttg cagatcaaga 23820atattaagac gaatgtttga cttcaattta ctattgcatc aggtaggaaa tatggtgagt 23880catcgaatat ccattatggt tggaatagta ccatatcatg gaagcggttt cgaagcgtgt 23940atattagtaa aatagatgaa gatattcaaa tcgatgtttt agattatctt ttatgtacgt 24000aagggtcatt attgttgtag atgttgtatg gttttttaat ttaatgataa tttttcctta 24060ttcccactta aaagtaaaca atgcattcat gtgcacatat tagtacatat atttgtatat 24120acatctcg 24128522367DNABeta vulgaris 52atgaggttga ttcacaaaaa tgaagatggg cccggtgttg ccaagtcggt ggcagagctt 60aatcaacata tagttgctgt gaaaaaagaa ggtaggggta gggttgcagg tgaagggcag 120gggctttccg aggaggacga actgagaatt attgaggatg gtgaagatgc aaacagcagg 180cgttctttga gttctgttca gcttccagtt catactcaca ggcatcagcc acaagtacaa 240ccccagggga gagtctgttg ggagaggttt ctccctgttg gatctcctaa ggttttgctc 300gtagaaagtg atgactcaac tcgtcatatt gttagtgctt tgctacggaa atgtagctat 360gaagttgtag gggtgccaaa tggcatagaa gcatggaaaa tcttagaaga tttgagcaat 420cagattgacc tagttttaac tgaggtagtc acatcaggac tctctggtat aggtcttctg 480tccaagataa tgagtcacaa aagctgccag aatactcctg tcattatgat gtcatctcat 540gattcgatgg gtttagtctt aaagtgctta tccaagggcg ctgttgactt tctggtgaag 600cctataagaa aaaacgaact taaaaacctt tggcagcatg tttggaggag gtgtcacagt 660tctagtggta gtggaagtga aagctgtgta aggaatggaa aatccatagg aagcaagagg 720gctgaagagt cggacaatga cactgacatc aatgaggaag atgataacag aagcattggt 780ttacaagctc gggatggaag tgacaatgga agtgggaccc agagttcatg gacaaaaagg 840gctgcagaag ttgagagccc ccaaccacag tctacatggg agcaagcaac tgatccacct 900gatagcactt gtgctcaggt catttatcca atgtctgagg catttgccag cagctggatg 960cctggatcca tgcaggaact tgatggacag gatcatcaat atgacaatgt cccaatggga 1020aaggatttgg agattggagt acctagaatt tcagattcac ggctaaatgg accaaacaaa 1080acggttaagt tagcaactac tgctgaggaa aaccaatatt cacagttaga cctcaaccag 1140gaaaatgatg gtcgaagttt tgatgaagag aacctggaga tgaataatga taaacctaaa 1200agtgagtgga ttaaacaggc tatgaactca ccaggaaaag ttgaagaaca tcgtagagga 1260aataaagtat ctgatgcacc acccgaaatt tccaaaataa aggacaaagg catgcaacat 1320gtcgaggata tgccttctct tgtgctcagt ctgaagaggt tgggtgatat tgcagacacg 1380agcactaatg tctcagacca gaatattgtt gggcgttcag agctttcagc cttcaccagg 1440tacaattcag gcacaactgg taaccagggt caaacaggta atgttggcag ttgctctcca 1500ccaaataata gttcagaagc agcaaagcag tcccattttg atgctccaca tcaaatttcg 1560aatagcagta gtaacaataa caatatgggc tctactacta ataagttctt caaaaagcct 1620gctatggaca ttgataagac acctgcaaaa tcaacagtca actgttctca tcattcacat 1680gtgtttgagc cagtgcaaag ttcccatatg tctaataata accttactgc atctggtaag 1740cctggtgttg gctccgtaaa tggtatgctg caagaaaacg taccagtaaa tgctgttctg 1800ccgcaagaaa ataacgtgga tcagcagctc aagattcagc accaccatca ctaccatcat 1860tacgatgtcc atagtgtaca gcagctacca aaggtttctg ttcaacataa tatgcccaaa 1920agcaaggatg tgacagcacc cccacagtgt gggtcttcaa acacttgtag atcgccaatt 1980gaagcaaatg ttgccaattg cagtttgaat ggaagtggta gtggaagcaa tcatgggagc 2040aatttcctta atggaagtag tgctgctgtg aatgttgaag gaacaaacat ggtcaatgat 2100agtgggatag ctgcaaaaga tggtgctgaa aatggaagtg gtagtggaag tggaagtggt 2160agtggtagtg gtgttggtgt ggatcaaagt cgatcagctc aacgagaagc tgccttgaat 2220aaattccgtc tcaagcgtaa agaaagatgc tttgacaaaa aggtgcgata tcaaagcaga 2280aagaagttag cagatcaaag acctcgtgtt cgtgggcaat tcgtgcgcca ggtacgagaa 2340aacaaaggaa ggaataccga tagctaa 2367



Patent applications by Johannes Jacobus Ludgerus Gielen, Bouloc FR

Patent applications by Pierre Pin, Malmo SE

Patent applications by Thomas Kraft, Lund SE

Patent applications by Syngenta Participations AG

Patent applications in class Involving nucleic acid

Patent applications in all subclasses Involving nucleic acid


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Images included with this patent application:
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and imagePOLYNUCLEOTIDE MARKERS diagram and image
POLYNUCLEOTIDE MARKERS diagram and image
Similar patent applications:
DateTitle
2008-10-23Polynucleotide ligation reactions
2008-10-23Polynucleotide primers
2011-02-03Polynucleotide primers
2011-06-02Polynucleotide primers and probes
2009-03-26Polynucleotide for target gene
New patent applications in this class:
DateTitle
2011-06-30Apparatus and method of authenticating product using polynucleotides
2011-06-30Cyanine compounds, compositions including these compounds and their use in cell analysis
2011-06-30Method for detecting multiple small nucleic acids
2011-06-30Solid-phase chelators and electronic biosensors
2011-06-30Cell-based screening assay to identify molecules that stimulate ifn-alpha/beta target genes
New patent applications from these inventors:
DateTitle
2012-06-07Transgenic sugar beet event gm rz13
2011-09-22Engineering of bolting resistance in sugar beet by means of the transgenic expression of the beet homologue of flowering time control gene ft
2011-06-09Transgenic sugar beet plants
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Marshall Medoff
2Anthony P. Burgard
3Mark J. Burk
4Robin E. Osterhout
5Rangarajan Sampath
Website © 2025 Advameg, Inc.