Compositions and Methods for Detecting Certain Flaviviruses, Including Members of the Japanese Encephalitis Virus Serogroup

Abstract

vides rapid and accurate methods, primers, probes and kits for identifying the presence of a certain flaviviruses in a sample. Flaviviruses that can be detected include members of the Japanese encephalitis virus serogroup, Dengue virus, St. Louis encephalitis virus, Montana myotis leukoencephalitis virus, Modoc virus, and Yellow Fever virus. The primers and probes of the invention can hybridize to regions in the 3' untranslated region of the viral genomes to be detected.

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[0001]The present application is a continuation of U.S. patent application Ser. No. 10/815,480, filed Mar. 31, 2004, which claims benefit of priority to the following applications: U.S. Provisional Patent Application No. 60/459,491, filed Mar. 31, 2003; U.S. Provisional Patent Application No. 60/552,454, filed Mar. 12, 2004; and U.S. Provisional Patent Application No. 60/555,530 filed Mar. 22, 2004, each of which is incorporated by reference in their entirety for any purpose.

BACKGROUND OF THE INVENTION

[0002]The family Flaviviridae and genus Flavivirus encompasses a number of viruses that are potentially lethal human pathogens. Such viruses include Dengue virus, Yellow Fever virus, Modoc virus, and viruses of the Japanese encephalitis virus serogroup. The Japanese encephalitis virus serogroup includes several closely related viruses, such as Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus, Murray Valley encephalitis virus, and Kunjin virus. Kunjin virus is often referred to as a variant of WNV because of the degree of sequence conservation between these two viruses. Characterized WNV strains have been divided into two groups, lineage I and lineage II, based on sequence analysis.

[0003]In 1999, the first case of human WNV infection in the U.S. was reported. Since then, annual epidemics have occurred. In August 2002, transmission of WNV via routes other than mosquito bites was confirmed when four organ recipients were infected by a single organ donor. The virus has since been found to be transmissible by transfusion of blood products (21 confirmed cases) and by breast milk.

[0004]Detection of active WNV infection is difficult, as symptoms are non-specific and virus-specific antibodies can usually be detected only after the viremic phase. Furthermore, WNV-specific IgM can persist for more than a year, making it difficult to differentiate between active infection and past exposure. More sensitive detection methods, such as direct detection of viral nucleic acids, are needed. Detection of viral nucleic acids presents a more sensitive method for the early detection of infection by WNV and other flaviviruses than serological methods currently in use.

[0005]Other flaviviruses, including members of the Japanese encephalitis virus serogroup, are also human pathogens. These pathogens include Japanese encephalitis serogroup members such as Japanese encephalitis virus, St. Louis encephalitis virus (SLEV), and Murray Valley encephalitis virus, and other flaviviruses such as Dengue virus, Yellow Fever virus, and Modoc virus. Transmission of members of the Japanese encephalitis virus serogroup other than WNV via blood products remains undocumented. However, such transmissions are possible, and increasingly likely to occur as these viruses become more widespread. Therefore, new, sensitive, and specific assays that are capable of detecting these flaviviruses that are human pathogens are highly desirable. Furthermore, a single assay that is capable of detecting several members of the Japanese encephalitis serogroup would also be very desirable.

BRIEF SUMMARY OF THE INVENTION

[0006]The present invention provides compositions, methods, and kits for detecting the presence of a nucleic acid of certain flaviviruses, including several members of the Japanese encephalitis virus serogroup. The compositions and methods of the present invention are based, in part, on the discovery of oligonucleotides that can be used e.g., as primers and probes to detect the presence of members of the Japanese encephalitis virus serogroup. For example, West Nile virus, Kunjin virus, Japanese encephalitis virus, St Louis encephalitis virus (SLEV) and Murray Valley encephalitis virus can be detected with the oligonucleotides of the invention. Further, the oligonucleotides of the invention can be used to detect flaviviruses outside the Japanese encephalitis virus serogroup, including, for example, Dengue virus, Montana myotis leukoencephalitis virus, Modoc virus, and Yellow Fever virus. The oligonucleotides of the invention can be used as primers and probes to detect these flaviviruses according to the methods described herein.

[0007]In certain aspects, the invention provides a method for detecting a nucleic acid of several members of the Japanese encephalitis virus serogroup. In the method, a detectably-labeled oligonucleotide of the invention, described in detail below, is used as a probe to detect a nucleic acid of several members of the Japanese encephalitis virus serogroup. The probe hybridizes to a nucleic acid of SEQ ID NO.: 16 or the complement thereof, which is a sequence of a conserved region in the 3' untranslated region of flaviviral nucleic acids that can be detected according to the present invention. In certain embodiments of the invention, a template-dependent nucleic acid polymerase with 5'-3' exonuclease activity fragments the probe, wherein fragmentation of the detectably-labeled probe indicates the presence of the nucleic acid of a member of the Japanese encephalitis serogroup.

[0008]In certain embodiments, the methods comprise amplifying the nucleic acid of a member of the Japanese encephalitis virus serogroup in the presence of a detectably-labeled oligonucleotide, wherein the detectably-labeled oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In other embodiments, the methods comprise amplifying the nucleic acid of a member of the Japanese encephalitis virus serogroup in the presence of a detectably-labeled oligonucleotide, wherein the detectably-labeled oligonucleotide comprises SEQ ID NO.: 18, or the complement thereof. SEQ ID NO.: 18 is an oligonucleotide sequence that hybridizes to a conserved region of currently known flaviviral nucleic acids that can be detected according to the present invention. In still other embodiments, the methods comprise amplifying the nucleic acid of a member of the Japanese encephalitis virus serogroup in the presence of a detectably-labeled nucleic acid probe, wherein the detectably-labeled probe comprises SEQ ID NO.: 28, or the complement thereof. SEQ ID NO.: 28 is a specific probe nucleic acid sequence that can be used to detect flaviviruses according to the present invention.

[0009]In certain embodiments, the probe comprises a detectable moiety. The detectable moiety can be any detectable moiety known to one of skill in the art without limitation. For example, the detectable moiety can be a fluorescent moiety. In certain embodiments, the fluorescent moiety can be selected from the group consisting of fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, and BODIPY®-family dyes. In a preferred embodiment, the fluorescent moiety is 6-carboxyfluorescein.

[0010]In certain embodiments, the probe comprises a quencher moiety. The quencher moiety can be any quencher moiety known to one of skill in the art without limitation. In certain embodiments, the quencher moiety can be selected from the group consisting of fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, BODIPY®-family dyes, and non-fluorescent quencher moieties. In certain embodiments, the non-fluorescent quencher moieties can be BHQ®-family dyes, Iowa Black®, or Dabcyl. In a preferred embodiment, the quencher moiety is Cy5®.

[0011]In certain aspects, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected with an oligonucleotide of the invention. In certain embodiments, a first oligonucleotide that hybridizes to a nucleic acid of SEQ ID NO.:1 can be used as a primer to amplify a nucleic acid of a member of the Japanese encephalitis virus serogroup. SEQ ID NO.: 1 is based on the discovery of sequences conserved among members of the Japanese encephalitis virus serogroup that can be detected according to the present invention. In certain embodiments, the first primer comprises at least 16 consecutive nucleotides of SEQ ID NO.: 2. In other embodiments, the first primer comprises SEQ ID NO.: 3. SEQ ID NO.: 3 is a primer sequence based on the discovery of a conserved region of all currently known sequences from Japanese encephalitis virus serogroup members that can be detected according to the present invention. In still other embodiments, the first primer comprises SEQ ID NO.: 8. SEQ ID NO.: 8 is a specific primer sequence that can be used to amplify Japanese encephalitis serogroup member nucleic acids according to the present invention.

[0012]In certain embodiments, a second oligonucleotide that hybridizes to a nucleic acid of SEQ ID NO.: 9 can be used as a primer to amplify a nucleic acid of a member of the Japanese encephalitis virus serogroup. SEQ ID NO.: 9 is a consensus sequence based on the discovery of sequences conserved among members of the Japanese encephalitis virus serogroup that can be detected according to the present invention. In certain embodiments, the second primer comprises at least 16 consecutive nucleotides of SEQ ID NO.: 10, SEQ ID NO.: 10 is the complement to SEQ ID NO.: 9. In other embodiments, the second primer comprises SEQ ID NO.: 11. SEQ ID NO.: 11 is a primer sequence based on the discovery of a conserved region of all currently known sequences from Japanese encephalitis virus serogroup members that can be detected according to the present invention. In yet other embodiments, the second primer comprises SEQ ID NO.: 15 or SEQ ID NO:74. SEQ ID NO.: 15 and SEQ ID NO:74 are specific primer sequences that can be used to amplify Japanese encephalitis serogroup member nucleic acids according to the present invention. In certain embodiments, the first and second primers can be used together in methods of detecting a nucleic acid of a member of the Japanese encephalitis serogroup.

[0013]In certain embodiments, the methods comprise amplifying the nucleic acid of a member of the Japanese encephalitis virus serogroup in the presence of a detectably-labeled nucleic acid probe which comprises a fluorescent moiety and a quencher moiety. In certain embodiments, fragmentation of the detectably-labeled probe by a template-dependent nucleic acid polymerase with 5'-3' nuclease activity separates the fluorescent moiety from the quencher moiety. In certain embodiments, the fragmentation of the probe and thus the presence of the nucleic acid of the a member of the Japanese encephalitis virus serogroup can be detected by monitoring emission of fluorescence.

[0014]In certain embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected by hybridizing the nucleic acid to a primer or probe of the invention that is covalently linked to a solid support. In certain embodiments, the nucleic acid can be detected by hybridizing a detectably-labeled primer or probe to the nucleic acid. In other embodiments, the nucleic acid can be directly detected by incorporating detectable moieties into the nucleic acid.

[0015]In other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a nanoparticle with two or more primers or probes of the invention covalently linked thereto. In still other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a rolling circle amplification assay with primers and/or probes of the invention. In yet other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a Strand Displacement Amplification assay with two primers of the invention. In still other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a transcription-mediated amplification assay using primers and/or probes of the invention. In yet another embodiment, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a nucleic acid sequence-based amplification (NASBA) assay, using the primers and/or probes of the invention. In yet another embodiment, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using diagnostic PCR with primers and/or probes of the invention.

[0016]In certain embodiments, the first and second primers and a probe of the invention can be used together in methods of detecting a member of the Japanese encephalitis serogroup. In certain embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a probe of the invention that comprises a molecular beacon. In other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a nucleic acid sequenced-based amplification assay with primers and/or probes of the invention. In yet other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected by amplifying the nucleic acid with two primers of the invention, then detecting the nucleic acid with a detectably-labeled probe of the invention. In certain embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a dot blot assay with primers and/or probes of the invention. In other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a reverse dot blot assay with primers and/or probes of the invention. In still other embodiments, a nucleic acid of a member of the Japanese encephalitis serogroup can be detected using a multivalent probe such as a dendrimer.

[0017]In addition to the foregoing methods, the present invention further provides nucleic acid primers and probes for detecting a nucleic acid of a member of the Japanese encephalitis serogroup. In certain aspects, the invention provides a nucleic acid primer for detecting a member of the Japanese encephalitis virus serogroup. In certain embodiments, the primer comprises a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 1. In certain embodiments, the nucleic acid primer comprises at least 16 consecutive nucleotides of SEQ ID NO.: 2. In other embodiments, the nucleic acid primer comprises SEQ ID NO.: 3. In still other embodiments, the nucleic acid primer comprises SEQ ID NO.: 8.

[0018]In certain embodiments, the nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 24 of SEQ ID NO.: 8. In a specific embodiment, the nucleic acid primer comprises N⁶-methyl-deoxyadenosine at position 24 of SEQ ID NO.: 8. In certain embodiments, the nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 25 of SEQ ID NO.: 8. In a specific embodiment, the nucleic acid primer comprises N⁶-tert-butyl-benzyl-deoxyadenosine at position 25 of SEQ ID NO.: 8. In certain embodiments, the nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at positions 24 and 25 of SEQ ID NO.: 8. In still another specific embodiment, the nucleic acid primer comprises N⁶-methyl-deoxyadenosine at position 24 of SEQ ID NO.: 8 and N⁶-tert-butyl-benzyl-deoxyadenosine at position 25 of SEQ ID NO.: 8.

[0019]In certain embodiments, the invention provides a nucleic acid primer for detecting a member of the Japanese encephalitis virus serogroup. In certain embodiments, the primer comprises a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 9. In other embodiments, the nucleic acid primer comprises at least 16 consecutive nucleotides of SEQ ID NO.: 10. In still other embodiments, the nucleic acid primer comprises SEQ ID NO.: 11. In yet other embodiments, the nucleic acid primer comprises SEQ ID NO.: 15 or SEQ ID NO:74. In certain embodiments, the nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 23 of SEQ ID NO.: 15 or at position 25 of SEQ ID NO:74. In a specific embodiment, the nucleic acid primer comprises N⁶-tert-butyl-benzyl-deoxyadenosine at position 23 of SEQ ID NO.: 15 or at position 25 of SEQ ID NO:74.

[0020]In other aspects, the invention provides a nucleic acid probe for detecting a nucleic acid of a flavivirus. Flavivirus nucleic acids that can be detect with the probe include, for example, members of the Japanese encephalitis virus serogroup, Dengue virus, Yellow Fever virus, Montana myotis leukencephalitis virus, and Modoc virus. In certain embodiments, the probe comprises a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 16, or the complement thereof. In certain embodiments, the nucleic acid probe comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In other embodiments, the nucleic acid probe comprises SEQ ID NO.: 18, or the complement thereof. In still other embodiments, the nucleic acid probe comprises SEQ ID NO.: 28, or the complement thereof.

[0021]In certain embodiments, the invention provides a nucleic acid probe comprising a fluorescent moiety and a quencher moiety. In certain embodiments, the fluorescent moiety is positioned relative to the quencher moiety such that a photon emitted by the fluorescent moiety is absorbed by the quencher moiety when the probe is intact. Fragmentation of the probe by an enzyme with 5' nuclease activity separates the fluorescent moiety from the quencher moiety such that a photon emitted by the fluorescent moiety can be detected.

[0022]In other aspects, the invention provides a kit for the detection of a nucleic acid of a member of the Japanese encephalitis virus serogroup. In certain embodiments, the kit comprises an oligonucleotide of the invention. In further embodiments, the kit comprises a combination of one or more of the primers and probes of the invention. For example, in one embodiment the kit comprises a first nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 1; a second nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 9; and a nucleic acid probe that hybridizes to a nucleic acid of SEQ ID NO.: 16, or the complement thereof.

[0023]In certain embodiments, the first nucleic acid primer of the kits of the invention comprises at least 16 consecutive nucleotides of SEQ ID NO.: 2. In other embodiments, the first nucleic acid primer comprises SEQ ID NO.: 3. In yet other embodiments, the first nucleic acid primer comprises SEQ ID NO.: 8. In certain embodiments, the first nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 24 of SEQ ID NO.: 8. In a specific embodiment, the first nucleic acid primer comprises N⁶-methyl-deoxyadenosine at position 24 of SEQ ID NO.: 8. In certain embodiments, the first nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 25 of SEQ ID NO.: 8. In a specific embodiment, the first nucleic acid primer comprises N⁶-tert-butyl-benzyl-deoxyadenosine at position 25 of SEQ ID NO.: 8. In certain embodiments, the first nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at positions 24 and 25 of SEQ ID NO.: 8. In still another specific embodiment, the first nucleic acid primer comprises N⁶-methyl-deoxyadenosine at position 24 of SEQ ID NO.: 8 and N⁶-tert-butyl-benzyl-deoxyadenosine at position 25 of SEQ ID NO.: 8.

[0024]In certain embodiments, the second nucleic acid primer of the kits of the invention comprises at least 16 consecutive nucleotides of SEQ ID NO.: 10. In other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 11. In still other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 15 or SEQ ID NO:74. In certain embodiments, the second nucleic acid primer comprises N⁶-alkyl-deoxyadenosine at position 23 of SEQ ID NO.: 15 or at position 25 of SEQ ID NO:74. In a specific embodiment, the second nucleic acid primer comprises N⁶-tert-butyl-benzyl-deoxyadenosine at position 23 of SEQ ID NO.: 15 or at position 25 of SEQ ID NO:74.

[0025]In certain embodiments, the nucleic acid probe of the kits of the invention comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In other embodiments, the nucleic acid probe comprises SEQ ID NO.: 18, or the complement thereof. In still other embodiments, the nucleic acid probe comprises SEQ ID NO.: 28, or the complement thereof.

[0026]In certain embodiments, the kits of the invention comprise an oligonucleotide useful as a nucleic acid probe, wherein one or more detectable moieties is attached to the nucleic acid probe. In certain embodiments, the one or more detectable moieties is a fluorescent moiety. In certain embodiments, the fluorescent moiety can be selected from the group consisting of fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, and BODIPY®-family dyes. In a preferred embodiment, the fluorescent moiety is 6-carboxyfluorescein.

[0027]In certain embodiments, the kits of the invention comprise an oligonucleotide useful as a nucleic acid probe, wherein at least one quencher moiety is attached to the nucleic acid probe. In certain embodiments, the quencher moiety can be selected from the group consisting of fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, BODIPY®-family dyes, and non-fluorescent quencher moieties. In certain embodiments, the non-fluorescent quencher moieties can be BHQ®-family dyes, Iowa Black®, or Dabcyl. In a preferred embodiment, the quencher moiety is Cy5®. In other embodiments, the probe comprises at least one detectable moiety, e.g. a fluorescent moiety and at least one quencher moiety.

[0028]In certain embodiments, the kits of invention comprise a thermostable DNA polymerase. In certain embodiments, the thermostable DNA polymerase has reverse transcription activity. In certain embodiments, the kits of the invention additionally comprise instructions for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup according to the methods of the invention.

[0029]The present invention also provides isolated polynucleotides comprising SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40.

[0030]The present invention also provides vectors comprising a polynucleotide comprising SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40.

[0031]The present invention also provides oligonucleotides comprising a sequence of at least 10 contiguous nucleotides that hybridizes to SEQ ID NO:29 or a complement thereof, SEQ ID NO:30 or a complement thereof, SEQ ID NO:31 or a complement thereof, SEQ ID NO:32 or a complement thereof, SEQ ID NO:33 or a complement thereof, SEQ ID NO:34 or a complement thereof, SEQ ID NO:35 or a complement thereof, SEQ ID NO:36 or a complement thereof, SEQ ID NO:37 or a complement thereof, SEQ ID NO:38 or a complement thereof, SEQ ID NO:39 or a complement thereof, SEQ ID NO:40 or a complement thereof. In some embodiments, the oligonucleotide hybridizes to SEQ ID NO: 68 or a complement of SEQ ID NO:69. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide has fewer than 100 nucleotides.

[0032]The present invention also provides reaction mixtures comprising an oligonucleotide comprising a nucleotide sequence that hybridizes to SEQ ID NO:29 or a complement thereof, SEQ ID NO:30 or a complement thereof, SEQ ID NO:31 or a complement thereof, SEQ ID NO:32 or a complement thereof, SEQ ID NO:33 or a complement thereof, SEQ ID NO:34 or a complement thereof, SEQ ID NO:35 or a complement thereof, SEQ ID NO:36 or a complement thereof, SEQ ID NO:37 or a complement thereof, SEQ ID NO:38 or a complement thereof, SEQ ID NO:39 or a complement thereof, SEQ ID NO:40 or a complement thereof.

[0033]In some embodiments, the oligonucleotide hybridizes to SEQ ID NO: 68 or a complement of SEQ ID NO:69. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67.

[0034]In some embodiments, the reaction mixtures comprise an oligonucleotide selected from the group consisting of SEQ ID NO:64 and SEQ ID NO:65; and an oligonucleotide selected from the group consisting of SEQ ID NO:66 and SEQ ID NO:67. In some embodiments, the oligonucleotide has fewer than 100 nucleotides. In some embodiments, the reaction mixtures further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO: 16 or a complement thereof.

[0035]In some embodiments, the reaction mixture comprises a DNA polymerase.

[0036]In some embodiments, the detectably-labeled oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises SEQ ID NO.:28, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises a fluorescent moiety. In some embodiments, the detectably-labeled oligonucleotide further comprises a quencher moiety.

[0037]The present invention also provides methods of detecting a St. Louis encephalitis virus. In some embodiments, the methods comprise amplifying a nucleic acid of St. Louis encephalitis virus with at least one oligonucleotide comprising a nucleotide sequence that hybridizes to SEQ ID NO:29 or a complement thereof, SEQ ID NO:30 or a complement thereof, SEQ ID NO:31 or a complement thereof, SEQ ID NO:32 or a complement thereof, SEQ ID NO:33 or a complement thereof, SEQ ID NO:34 or a complement thereof, SEQ ID NO:35 or a complement thereof, SEQ ID NO:36 or a complement thereof, SEQ ID NO:37 or a complement thereof, SEQ ID NO:38 or a complement thereof, SEQ ID NO:39 or a complement thereof, or SEQ ID NO:40 or a complement thereof, under conditions to allow for initiation of amplification of at least part of the nucleotide sequence from the oligonucleotide; and detecting the amplified nucleic acid, thereby detecting a St. Louis encephalitis virus.

[0038]In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide hybridizes to SEQ ID NO:68 or a complement of SEQ ID NO:69. In some embodiments, the oligonucleotide has fewer than 100 nucleotides.

[0039]In some embodiments, the nucleic acid of St. Louis encephalitis virus is amplified with a primer selected from the group consisting of SEQ ID NO:64 and SEQ ID NO:65; and a primer selected from the group consisting of SEQ ID NO:66 and SEQ ID NO:67.

[0040]In some embodiments, the detecting step comprises hybridizing a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO: 16 to the amplified nucleic acid of the nucleic acid of St. Louis encephalitis virus; and detecting hybridization of the probe to the amplified nucleic acid.

[0041]In some embodiments, the detectably-labeled oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises SEQ ID NO.:28, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises a fluorescent moiety. In some embodiments, the detectably-labeled oligonucleotide further comprises a quencher moiety.

[0042]In some embodiments, the quantity of amplified nucleic acid is determined during the amplifying step, thereby quantifying the virus in the sample.

[0043]In some embodiments, the amplifying step is performed in an amplification reaction mixture comprising a template-dependent nucleic acid polymerase with 5'-3' exonuclease activity under conditions that allow the template-dependent nucleic acid polymerase to fragment the detectably-labeled oligonucleotide; and the method further comprises detecting fragmentation of the detectably-labeled nucleic acid oligonucleotide.

[0044]The present invention also provides kits for detecting St. Louis encephalitis virus. In some embodiments, the kits comprise a oligonucleotide comprising a nucleotide sequence that hybridizes to SEQ ID NO:29 or a complement thereof, SEQ ID NO:30 or a complement thereof, SEQ ID NO:31 or a complement thereof, SEQ ID NO:32 or a complement thereof, SEQ ID NO:33 or a complement thereof, SEQ ID NO:34 or a complement thereof, SEQ ID NO:35 or a complement thereof, SEQ ID NO:36 or a complement thereof, SEQ ID NO:37 or a complement thereof, SEQ ID NO:38 or a complement thereof, SEQ ID NO:39 or a complement thereof, or SEQ ID NO:40 or a complement thereof.

[0045]In some embodiments, the oligonucleotide hybridizes to SEQ ID NO:68 or the complement of SEQ ID NO:69. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67.

[0046]In some embodiments, the kits comprise an oligonucleotide selected from the group consisting of SEQ ID NO:64 and SEQ ID NO:65; and an oligonucleotide selected from the group consisting of SEQ ID NO:66 and SEQ ID NO:67. In some embodiments, the oligonucleotide has fewer than 100 nucleotides. In some embodiments, the kits further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 or a complement thereof.

[0047]The present invention also provides oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63.

[0048]The present invention also provides reaction mixtures comprising an oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63.

[0049]In some embodiments, the reaction mixtures further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:25 or a complement thereof. In some embodiments, the reaction mixtures further comprise a detectably-labeled oligonucleotide comprising FGGTCTAGAIGGTTAGAGGAGACCCTCCAG (SEQ ID NO:75), wherein F is CY5 and I is FAM. In some embodiments, the reaction mixtures further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 or a complement thereof.

[0050]In some embodiments, the reaction mixture comprises a DNA polymerase. In some embodiments, the reaction mixtures comprise at least one upstream primer and at least one downstream primer.

[0051]The present invention also provides methods of detecting a yellow fever virus. In some embodiments, the methods comprise amplifying a nucleic acid of yellow fever virus with at least one oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63 under conditions to allow for initiation of amplification of at least part of the nucleotide sequence from the oligonucleotide; and detecting the amplified nucleic acid, thereby detecting a yellow fever virus.

[0052]In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63. In some embodiments, the detecting step comprises hybridizing a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:25, or a complement thereof, to the amplified nucleic acid of the nucleic acid of yellow fever virus; and detecting hybridization of the detectably-labeled oligonucleotide to the amplified nucleic acid.

[0053]In some embodiments, the detectably-labeled oligonucleotide comprises FGGTCTAGAIGGTTAGAGGAGACCCTCCAG (SEQ ID NO:75), wherein F is CY5 and I is FAM. In some embodiments, the detecting step comprises hybridizing a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16, or a complement thereof, to the amplified nucleic acid of the nucleic acid of yellow fever virus; and detecting hybridization of the detectably-labeled oligonucleotide to the amplified nucleic acid.

[0054]In some embodiments, the detectably-labeled oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO.:17, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises SEQ ID NO.:28, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises a fluorescent moiety. In some embodiments, the detectably-labeled oligonucleotide further comprises a quencher moiety.

[0055]In some embodiments, the oligonucleotide has fewer than 100 nucleotides. In some embodiments, the quantity of amplified nucleic acid is determined during the amplifying step, thereby quantifying the virus in the sample.

[0056]In some embodiments, the amplifying step is performed in an amplification reaction mixture comprising a template-dependent nucleic acid polymerase with 5'-3' exonuclease activity under conditions that allow the template dependent nucleic acid polymerase to fragment the detectably-labeled oligonucleotide; and the method further comprises detecting fragmentation of the detectably-labeled oligonucleotide.

[0057]The present invention also provides kits for detecting yellow fever virus. The kit comprises an oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63.

[0058]In some embodiments, the kits further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 or a complement thereof. In some embodiments, the kits further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:25 or a complement thereof. In some embodiments, the kits further comprise a detectably-labeled oligonucleotide comprising FGGTCTAGAIGGTTAGAGGAGACCCTCCAG (SEQ ID NO:75), wherein F is CY5 and I is FAM.

[0059]In some embodiments, the reaction mixture comprises a DNA polymerase. In some embodiments, the reaction mixtures comprise at least one upstream primer and at least one downstream primer.

[0060]The present invention also provides oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0061]The present invention also provides reaction mixtures comprising an oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0062]In some embodiments, the reaction mixtures further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 or a complement thereof. In some embodiments, the reaction mixture comprises a DNA polymerase. In some embodiments, the reaction mixtures comprise at least one upstream primer and at least one downstream primer.

[0063]The present invention also provides methods of detecting a Dengue fever virus. In some embodiments, the methods comprise amplifying a nucleic acid of Dengue fever virus with at least one oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55 under conditions to allow for initiation of amplification of at least part of the nucleotide sequence from the oligonucleotide; and detecting the amplified nucleic acid, thereby detecting a Dengue fever virus.

[0064]In some embodiments, the method further comprises hybridizing a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 to the amplified Dengue fever virus nucleic acid; and detecting hybridization of the oligonucleotide to the amplified nucleic acid. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0065]In some embodiments, the nucleic acid is amplified with at least one upstream primer and at least one downstream primer. In some embodiments, the detectably-labeled oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO.: 17, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises SEQ ID NO.:28, or the complement thereof. In some embodiments, the detectably-labeled oligonucleotide comprises a fluorescent moiety. In some embodiments, the detectably-labeled oligonucleotide further comprises a quencher moiety.

[0066]In some embodiments, the oligonucleotide has fewer than 100 nucleotides. In some embodiments, the quantity of amplified nucleic acid is determined during the amplifying step, thereby quantifying the virus in the sample. In some embodiments, the amplifying step is performed in an amplification reaction mixture comprising a template-dependent nucleic acid polymerase with 5'-3' exonuclease activity under conditions that allow the template dependent nucleic acid polymerase to fragment the detectably-labeled oligonucleotide; and the method further comprises detecting fragmentation of the detectably-labeled nucleic acid oligonucleotide.

[0067]The present invention also provides kits for detecting Dengue virus. In some embodiments, the kit comprises an oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55. In some embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0068]In some embodiments, the kits further comprise a detectably-labeled oligonucleotide that hybridizes to SEQ ID NO:16 or a complement thereof. In some embodiments, the reaction mixture comprises a DNA polymerase.

[0069]In some embodiments, quantification step is performed using either an internal or an external control nucleic acid. See U.S. Pat. Nos. 5,476,774 and 5,219,727, which are incorporated by reference in their entirety.

BRIEF DESCRIPTION OF THE DRAWINGS

[0070]FIG. 1 presents a region of conserved sequence, identified as SEQ ID NO.: 1, in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention and that can be bound by a primer of the invention. SEQ ID NO.: 2 represents the complement of SEQ ID NO.: 1. The conserved region in the 3' untranslated region of the genomes of the flaviviruses=SEQ ID NOS:71 and 81-241, respectively.

[0071]FIG. 2 presents a region of conserved sequence, identified as SEQ ID NO.: 9, in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention and that can be bound by a primer of the invention. SEQ ID NO.: 10 represents the complement of SEQ ID NO.: 9. The conserved region in the 3' untranslated region of the genomes of the flaviviruses=SEQ ID NOS:72 and 242-315, respectively.

[0072]FIG. 3 presents a region of conserved sequence, identified as SEQ ID NO.: 16, in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention and that can be bound by a probe of the invention. SEQ ID NO.: 17 represents the complement of SEQ ID NO.: 16. The conserved region in the 3' untranslated region of the genomes of the flaviviruses=SEQ ID NO:73 and 316-605, respectively.

[0073]FIG. 4 presents an alignment of the nucleic acid sequences of the oligonucleotides of the invention with nucleic acid sequences of Japanese encephalitis virus serogroup members (SEQ ID NOS:7, 606-670, 7, 671-736, 15, 737-788, 16 and 789-839, respectively).

[0074]FIG. 5 presents an alignment of the nucleic acid sequences of the oligonucleotides of the invention with nucleic acid sequences of detectable flaviviruses that are not members of the Japanese encephalitis virus serogroup (SEQ ID NOS:16, 840-909, 16 and 910-919, respectively).

[0075]FIG. 6 presents a plot of normalized fluorescence versus number of amplification cycles showing detection of serially diluted extracted WNV RNA using the oligonucleotides of the invention.

[0076]FIG. 7 presents the sequence of the 3' untranslated region of the genomes of a number of SLEV isolates that can be detected using the compositions and methods of the present invention and that can be bound by a primer of the invention. Sequences for the following isolates are depicted: BFS1750 (SEQ ID NO:29), 1750-Std (SEQ ID NO:30), TD6-4G (SEQ ID NO:31), CoaV750 (SEQ ID NO:32), L695121.05 (SEQ ID NO:33), TNM771K (SEQ ID NO:34), MSI-7 (SEQ ID NO:35), Kern217 (SEQ ID NO:36), CoaV608 (SEQ ID NO:37), TBH-28 (SEQ ID NO:38), VR1265 (SEQ ID NO:39), and CoaV353 (SEQ ID NO:40).

DETAILED DESCRIPTION OF THE INVENTION

1. Abbreviations

[0077]The abbreviations used throughout the specification to refer to nucleic acids comprising specific nucleotide sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless otherwise specified, nucleic acid sequences that are represented as a series of one-letter abbreviations are presented in the 5'->3' direction.

2. Definitions

[0078]An "amplification reaction" refers to any reaction (e.g., chemical, enzymatic, or other type of reaction) that results in increased copies of a template nucleic acid sequence or increased signal indicating the presence of the template. Amplification reactions include, e.g., the polymerase chain reaction (PCR) and ligase chain reaction (LCR) (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990)), strand displacement amplification (SDA) (Walker, et al. Nucleic Acids Res. 20(7): 1691-6 (1992); Walker PCR Methods Appl 3(1): 1-6 (1993)), transcription-mediated amplification (Phyffer, et al., J. Clin. Microbiol. 34:834-841 (1996); Vuorinen, et al., J. Clin. Microbiol. 33:1856-1859 (1995)), nucleic acid sequence-based amplification (NASBA) (Compton, Nature 350(6313):91-2 (1991), rolling circle amplification (RCA) (Lisby, Mol. Biotechnol. 12(1):75-99 (1999)); Hatch et al., Genet. Anal. 15(2):35-40 (1999)) branched DNA signal amplification (bDNA) (Iqbal et al., Mol. Cell. Probes 13(4):315-320 (1999)) and Q-Beta Replicase (Lizardi et al., Bio/Technology 6:1197 (1988)).

[0079]As used herein, a "sample" refers to any substance containing or presumed to contain nucleic acid. The sample can be of natural or synthetic origin and can be obtained by any means known to those of skill in the art. The sample can be a sample of tissue or fluid isolated from an individual or individuals, including, but not limited to, for example, skin, plasma, serum, whole blood, spinal fluid, semen, seminal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumors, bronchio-alveolar lavage, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components). A nucleic acid can be obtained from a biological sample by any procedure known in the art.

[0080]As used herein, the terms "nucleic acid," "polynucleotide" and "oligonucleotide" refer to primers, probes, oligomer fragments to be detected, oligomer controls and unlabeled blocking oligomers and is generic to linear polymers of polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases.

[0081]A nucleic acid, polynucleotide or oligonucleotide can comprise phosphodiester linkages or modified linkages including, but not limited to phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages.

[0082]A nucleic acid, polynucleotide or oligonucleotide can comprise the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil) and/or bases other than the five biologically occurring bases. These bases may serve a number of purposes, e.g., to stabilize or destabilize hybridization; to promote or inhibit probe degradation; or as attachment points for detectable moieties or quencher moieties. For example, a polynucleotide of the invention can contain one or more modified, non-standard, or derivatized base moieties, including, but not limited to, N⁶-methyl-adenine, N⁶-tert-butyl-benzyl-adenine, imidazole, substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acidmethylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)_w, 2,6-diaminopurine, and 5-propynyl pyrimidine. Other examples of modified, non-standard, or derivatized base moieties may be found in U.S. Pat. Nos. 6,001,611, 5,955,589, 5,844,106, 5,789,562, 5,750,343, 5,728,525, and 5,679,785, each of which is incorporated herein by reference in its entirety.

[0083]Furthermore, a nucleic acid, polynucleotide or oligonucleotide can comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and a hexose.

[0084]It is not intended that the present invention be limited by the source of a nucleic acid, polynucleotide or oligonucleotide. A nucleic acid, polynucleotide or oligonucleotide can be from a human or non-human mammal, or any other organism, or derived from any recombinant source, synthesized in vitro or by chemical synthesis. A nucleic acid, nucleotide, polynucleotide or oligonucleotide may be DNA, RNA, cDNA, DNA-RNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), a hybrid or any mixture of the same, and may exist in a double-stranded, single-stranded or partially double-stranded form. A nucleic acid may also be a derivative nucleic acid as described in U.S. Pat. No. 5,696,248, which is hereby incorporated by reference in its entirety. The nucleic acids of the invention include both nucleic acids and fragments thereof, in purified or unpurified forms, including genes, chromosomes, plasmids, the genomes of biological material such as microorganisms, e.g., bacteria, yeasts, viruses, viroids, molds, fungi, plants, animals, humans, and the like.

[0085]There is no intended distinction in length between the terms nucleic acid, polynucleotide and oligonucleotide, and these terms will be used interchangeably. These terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. Oligonucleotides of the invention may be used as primers and/or probes. Thus oligonucleotides referred to herein as "primers" may act as probes and oligonucleotides referred to as "probes" may act as primer in some embodiments.

[0086]The term "residue" as used herein refers to a nucleotide or base within a nucleic acid as defined above. A residue can be any nucleotide known to one of skill in the art without limitation, including all of the biologically occurring nucleotides and non-biologically occurring nucleotides described above.

[0087]The term "primer" refers to an oligonucleotide which is capable of acting as a point of initiation of polynucleotide synthesis along a template nucleic acid strand when placed under conditions that permit synthesis of a primer extension product that is complementary to the template strand. The primer can be obtained from a recombinant source, as in a purified restriction fragment, or produced synthetically. Primer extension conditions typically include the presence of four different deoxyribonucleoside triphosphates and an agent with polymerization activity such as DNA polymerase or reverse transcriptase, in a suitable buffer (a "buffer" can include substituents which are cofactors, or which affect pH, ionic strength, etc.), and at a suitable temperature. The primer is preferably single-stranded for maximum efficiency in amplification. Primers of the invention may be, e.g., between 5 to 500 nucleotides, and in some embodiments will have at least 10, 20, 30, 25, 30, 40, 50, 75, or 100 nucleotides and/or have fewer than 500, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 25, or 20 nucleotides.

[0088]The term "hybridize" refers to binding of a single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid to another single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid having a complementary sequence. As one of skill in the art is aware, it is not necessary for two nucleic acid strands to be entirely complementary to hybridize to each other. Depending on the hybridization conditions, a nucleic acid can hybridize to its complement even if there are few, some, or many mismatches, deletions, or additions in one or both strands. In certain embodiments, the primers and probes of the invention can hybridize to an at least partially complementary nucleic acid selectively, as defined below. In certain embodiments, the primers and probes of the invention can hybridize to an at least partially complementary sequence under stringent conditions, as defined below.

[0089]The terms "stringent" or "stringent conditions", as used herein, denote hybridization conditions of low ionic strength and high temperature, as is well known in the art; see for example Maniatis et al., 1989, Molecular Cloning: A Laboratory Manual, 2d Edition; Current Protocols in Molecular Biology, 1988, ed. Ausubel et al., J. Wiley & Sons publ., New York, and Tijssen, 1993, Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays," each of which is hereby incorporated by reference. Generally, stringent conditions are selected to be about 5-30° C. lower than the thermal melting point (Tm) for the specified sequence at a defined ionic strength and pH. Alternatively, stringent conditions are selected to be about 5-15° C. lower than the thermal melting point (Tm) for the specified sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). For example, stringent hybridization conditions will be those in which the salt concentration is less than about 1.0 M sodium (or other salts) ion, typically about 0.01 to about 1 M sodium ion concentration at about pH 7.0 to about pH 8.3 and the temperature is at least about 25° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 55° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be modified with the addition of hybridization destabilizing agents such as formamide.

[0090]The terms "selective" or "selective conditions", as used herein, denote hybridization conditions for the primers and/or probes of the invention that permit amplification, detection and/or quantification of a detectable flavivirus nucleic acid in a sample that may contain additional nucleic acids not derived from the detectable flavivirus, or derived from unrelated regions of the flaviviral genome. Detectable flaviviruses are described below.

[0091]The "complement" of a nucleic acid sequence, as used herein, refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in anti-parallel association. The complement of a nucleic acid sequence need not exactly match every nucleotide of the sequence; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability by empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength, and incidence of mismatched base pairs.

[0092]Stability of a nucleic acid duplex is measured by the melting temperature, or "T_m". The T_m of a particular nucleic acid duplex under specified conditions is the temperature at which half of the potential base pairs are disassociated.

[0093]As used herein, the term "probe" refers to an oligonucleotide which can form a duplex structure with a region of a nucleic acid, due to complementarity of at least one sequence in the probe with a sequence in the region. The probe, preferably, does not contain a sequence complementary to sequence(s) of a primer. As discussed below, the probe can be labeled or unlabeled. The 3' terminus of the probe can be "blocked" to prohibit incorporation of the probe into a primer extension product. "Blocking" can be achieved by using non-complementary bases or by adding a chemical moiety such as biotin or a phosphate group to the 3' hydroxyl of the last nucleotide, which may, depending upon the selected moiety, serve a dual purpose by also acting as a label for subsequent detection or capture of the nucleic acid attached to the label. Blocking can also be achieved by removing the 3' hydroxyl or by using a nucleotide that lacks a 3' hydroxyl such as a dideoxynucleotide.

[0094]The term "detectable moiety" as used herein refers to any atom or molecule which can be used to provide a detectable (optionally quantifiable) signal, and which can be attached to a nucleic acid or protein. Detectable moieties may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. Convenient detectable moieties for the present invention include those that facilitate detection of the size of an oligonucleotide fragment.

[0095]The term "fluorescent moiety" as used herein refers to a chemical moiety that can emit light under conditions appropriate for the particular moiety. Typically, a particular fluorescent moiety can emit light of a particular wavelength following absorbance of light of shorter wavelength. The wavelength of the light emitted by a particular fluorescent moiety is characteristic of that moiety. Thus, a particular fluorescent moiety can be detected by detecting light of an appropriate wavelength following excitation of the fluorescent moiety with light of shorter wavelength. Examples of fluorescent moieties that can be used in the methods and compositions of the present invention include, but are not limited to, fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, and BODIPY®-family dyes.

[0096]The term "quencher moiety" as used herein refers to a chemical moiety that can absorb energy emitted by a fluorescent moiety when the quencher moiety is sufficiently close to the fluorescent moiety, for example, when both the quencher and fluorescent moiety are linked to a common polynucleotide. This phenomenon is generally known in the art as fluorescent resonance energy transfer ("FRET"). A quencher moiety can re-emit the energy absorbed from a fluorescent moiety in a signal characteristic for that quencher moiety, and thus a quencher can also be a "fluorescent moiety." Alternatively, a quencher moiety may dissipate the energy absorbed from a fluorescent moiety as heat.

[0097]As defined herein, "5' to 3' nuclease activity" or "5' nuclease activity" refers to that activity of an enzyme whereby nucleotides are removed from the 5' end of an oligonucleotide in a sequential manner. The 5' nuclease activity can be a 5' to 3' exonuclease activity or a 5' to 3' endonuclease activity. For example, many template-specific nucleic acid polymerases exhibit a 5' to 3' exonuclease activity that is traditionally associated with some DNA polymerases, (i.e., E. Coli DNA polymerase I has this activity whereas the Klenow fragment of E. Coli/DNA polymerase I does not). The 5' to 3' exonuclease activity can also cleave a substrate nucleic acid more than one phosphodiester bond (nucleotide) from the 5' end of the substrate. Although not intending to be bound by any particular theory of operation, it is believed that this aspect of 5' to 3' exonuclease activity associated with DNA polymerases, which leads to release of cleaved oligonucleotide fragments from probes, can depend upon the particular nucleotide composition of the probe. For instance, the number of matches or mismatches between nucleotides of the oligonucleotide and template nucleic acid, particularly at the 5' end of the oligonucleotide, can influence this activity, as described, for example, by Holland et al., 1991, Proc. Natl. Acad. Sci. USA 88:7276-80, which is incorporated herein by reference in its entirety.

[0098]The term "control 5' nuclease reaction" as used herein refers to a 5' nuclease reaction performed as described below on a known amount, e.g., copy number, of a nucleic acid of a detectable flavivirus. The amount of fluorescence emitted by such a reaction can be compared to a reaction performed on a sample with an unknown quantity of a nucleic acid of a Japanese encephalitis virus serogroup to assess the amount of such nucleic acid present in the sample.

[0099]The term "adjacent" as used herein refers to the positioning of the primer with respect to the probe on the same or the complementary strand of the template nucleic acid. The primer and probe may be separated by more than about 150 nucleotides, more than about 125 nucleotides, more than about 100 nucleotides, more than about 80 nucleotides, more than about 60 nucleotides, more than about 50 nucleotides, more than about 40 nucleotides, more than about 30 nucleotides, more than about 20 nucleotides, by about 1 to about 20 nucleotides, by about 1 to about 10 nucleotides, or may directly abut one another. If it is desired to detect a flavivirus nucleic acid with a polymerization-independent process, the probe is preferably separated from the probe by about 1 to about 10 nucleotides. In the polymerization-dependent process, for example, a PCR amplification and detection methods as taught herein, the probe may hybridize to the detectable nucleic acid anywhere within the sequence to be amplified that is downstream of a primer, thus allowing primer extension to position the polymerase so that the probe is fragmented.

[0100]The term "thermostable nucleic acid polymerase" refers to an enzyme which is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli and which catalyzes the polymerization of nucleoside triphosphates. Generally, such enzymes are obtained from organisms considered by those in the art to be thermophilic organisms. Generally, the enzyme will initiate synthesis at the 3' end of a primer annealed to the primer binding sequence, and will continue synthesis of a new strand toward the 5' end of the template. If the polymerase possesses a 5' to 3' nuclease activity, it can hydrolyze intervening probes annealed to the template to release both labeled and unlabeled probe fragments, until polymerization terminates or all probe fragments dissociate from the nucleic acid to be detected. A representative thermostable enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR is described in Saiki et al., 1988, Science 239:487-91. Another representative thermostable enzyme includes Thermus species Z05 DNA polymerase. See, e.g., U.S. Pat. No. 5,674,738."

[0101]Taq DNA polymerase has a DNA synthesis-dependent, strand replacement 5'-3' exonuclease activity (see Gelfand, "Taq DNA Polymerase" in PCR Technology Principles and Applications for DNA Amplification, Erlich, Ed., Stockton Press, N.Y. (1989), Chapter 2). Thus, Taq DNA polymerase does not degrade the probe when it is unbound to template DNA.

[0102]The term "5' nuclease reaction" of a nucleic acid primer or probe refers to the degradation of a probe hybridized to the nucleic acid when the primer is extended by a nucleic acid polymerase having 5' to 3' nuclease activity, as defined above and described in detail below. Such reactions are based on those described in U.S. Pat. Nos. 6,214,979, 5,804,375, 5,487,972 and 5,210,015, each of which is hereby incorporated by reference in its entirety.

[0103]To determine "percent complementarity" or "percent identity" of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first nucleic acid sequence for optimal alignment with a second nucleic acid sequence). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by a complementary nucleotide as the corresponding position in the second sequence, then the molecules are complementary at that position. Likewise, when a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent complementarity (or percent identity) between the two sequences is a function of the number of complementary positions (or identical positions) shared by the sequences divided by the total number of positions compared (i.e., % complementarity=number of complementary overlapping positions/total number of positions of the shorter nucleotide×100%; and % identity=number of identical overlapping positions/total number of positions of the shorter nucleotide×100%).

[0104]The determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST program of Altschul et al., 1990, J. Mol. Biol. 215:403.

[0105]The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology and recombinant DNA techniques, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins, eds., 1984); A Practical Guide to Molecular Cloning (B. Perbal, 1984); and a series, Methods in Enzymology (Academic Press, Inc.).

3. Nucleic Acid Primers and Probes for Detecting a Nucleic Acid of A Member of the Japanese Encephalitis Serogroup and Certain Other Flaviviruses

[0106]The present invention provides oligonucleotides useful as primers and probes to detect the presence of a nucleic acid of a member of the Japanese encephalitis virus serogroup and certain other members of the genus Flavivirus, and methods of their use. These primers and probes are described in detail below. It is noted that while the primers discussed herein may be designated as particularly useful for amplifying a particular virus type (e.g., West Nile virus, SLEV, Dengue virus, yellow fever virus, etc.), the primers an be useful for amplifying other viruses as well.

[0107]The oligonucleotides useful in the methods of the invention may be designed to comprise nucleotide sequences, or complements thereof, that are conserved between different strains of Flaviviruses or that are conserved between two or more members of the Japanese encephalitis virus serogroup or other members of the genus Flavivirus. Oligonucleotides that comprise sequences conserved between different strains or members of a serogroup or genus may be useful, for example, as primers or probes that may be employed to detect the different strains or members, thereby reducing the number of primers or probes necessary to detect the different strains or members. Conserved sequences may include, for example, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, or more contiguous nucleotides that are completely (i.e., 100%) or substantially identical between the two or more strains or two or more members of the Japanese encephalitis virus serogroup or other members of the genus Flavivirus. Substantially identical sequences include those that are, e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical between the two or more strains across the above-listed contiguous nucleotides.

[0108]3.1. Nucleic Acid Primers

[0109]Primers Based on SEQ ID NO:1

[0110]In one aspect, the invention provides nucleic acid primers that can be used in methods of detecting members of the Japanese encephalitis virus serogroup. In certain embodiments, a first nucleic acid primer that can be used to detect a member of the Japanese encephalitis virus serogroup comprises a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 1 or a complement thereof. SEQ ID NO.: 1, as presented in FIG. 1, represents a region of conserved sequence in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention. SEQ ID NO.: 2 represents the complement to SEQ ID NO.: 1.

[0111]In such embodiments of the invention, the first nucleic acid primer has a nucleotide composition, i.e., chemical structure, that allows it to hybridize under the defined conditions to a nucleic acid of SEQ ID NO.: 1. In some cases, each nucleotide of a primer that hybridizes to a nucleic acid will form base-pair complements with a nucleotide of the nucleic acid. For example, a primer containing a standard nucleotide that hybridizes to a C residue in the nucleic acid of SEQ ID NO.: 1 should have a G residue in the corresponding position. Thus, hybridization to the nucleic acid of SEQ ID NO.: 1 defines the nucleotide sequence and therefore the exact chemical structure of the primer. In addition, the first nucleic acid primer can also comprise non-standard nucleotides according to the definitions of oligonucleotide and primers recited above. Certain of such non-standard nucleotides can also bind to other standard or non-standard nucleotides to form a base-pair. For example, the nonstandard nucleotide inosine can pair with uracil, cytosine, and adenine. Given the known correlation between hybridization and chemical structure, one of skill in the art can easily recognize the standard features of the primers of the invention. Exemplary embodiments are described in detail below.

[0112]In certain embodiments, the first nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 1 can be as short as about 6 nucleotides. In other embodiments, the first nucleic acid primer can be as long as about 80 nucleotides. In certain embodiments, the first nucleic acid primer comprises about 10, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, or about 40 nucleotides. In some embodiments, the first nucleic acid primer will comprise fewer than 100, 80, 70, 60, 50, 40, 30, 25, 21 or 20 nucleotides.

[0113]The length and composition of the primer can be chosen to give sufficient thermodynamic stability to ensure hybridization of the primer to the flaviviral nucleic acid under the appropriate reaction conditions, which depend on the detection method to be performed. For example, primers with modified, non-standard, or derivatized nucleotides may be longer or shorter than those with conventional nucleotides while having similar thermodynamic hybridization properties. Examples of such non-standard bases may be found in U.S. Pat. Nos. 6,320,005, 6,174,998, 6,001,611, and 5,990,303, each of which is hereby incorporated by reference in its entirety. As another example, primers with G/C-rich sequences may anneal to target sequences at higher temperatures that a primer of similar length with A/T-rich sequences. Thus, in certain embodiments, the first nucleic acid primer comprises modified, non-standard, or derivatized bases, as defined above.

[0114]In certain embodiments, the first nucleic acid primer comprises at least about 16 consecutive nucleotides of SEQ ID NO.: 2. SEQ ID NO.: 2 is the complement to SEQ ID NO.: 1, as shown in FIG. 1. In other embodiments, the first nucleic acid primer comprises at least about 18 consecutive nucleotides of SEQ ID NO.: 2. In still other embodiments, the first nucleic acid primer comprises at least about 20 consecutive nucleotides of SEQ ID NO.: 2. In yet other embodiments, the first nucleic acid primer comprises at least about 22 consecutive nucleotides of SEQ ID NO.: 2. In still other embodiments, the first nucleic acid primer comprises at least about 24 consecutive nucleotides of SEQ ID NO.: 2.

[0115]In certain embodiments, the invention provides nucleic acid primers that can be used to detect a member of the Japanese encephalitis virus serogroup. These primers can be structurally defined by reference to their nucleic acid sequences, as presented in Table 1.

TABLE-US-00001 TABLE 1 SEQ ID NO.: 3 GN²AAN⁵CCN⁸N⁹N¹⁰CN¹²N¹³AN¹⁵CN.sup- .17 Japanese N¹⁸N¹⁹N²⁰TCGGN²⁵N²⁶ Wherein N² encephalitis virus is T or A; N⁵ is G or C; N⁸ is serogroup Primer 1 T or absent; N at position 9 is C or G; N¹⁰ is T or C; N¹² is A or G; N¹³ is G or A; N¹⁵ is A or C; N¹⁷ is C or T; N¹⁸ is G or C; N¹⁹ is T or C; N²⁰ is C or T; N²⁵ is A or G; and N²⁶ is A or T. SEQ ID NO.: 4 GTAAGCCN⁸CN¹⁰CAGAACCGN¹⁹N²⁰TCGGA West Nile virus A Wherein N⁸ is absent or T; N¹⁰ Primer 1 is T or C; N¹⁹ is T or C; and N²⁰ is C or T. SEQ ID NO.: 5 GAAAN⁵CCN⁸CTCN¹²N¹³AAC N¹⁷GTN²⁰T Japanese CGGAA Wherein N⁵ is G or C; N⁸ encephalitis virus is absent; N¹² is A or G; N¹³ is Primer 1 G or A; N¹⁷ is C or T; and N²⁰ is C or T. SEQ ID NO.: 6 GAAAGCCTCCCAGAN¹⁵CCGTN²⁰TCGGAA Murray Valley Wherein N¹⁵ is A or C; and N²⁰ encephalitis virus is C or T. Primer 1 SEQ ID NO.: 7 GTAAGCCCTCAGAACCGTCTCGGAA Koutango virus Primer 1 SEQ ID NO.: 8 GTAAGCCCTCAGAACCGTCTCGGAA Example Primer 1 SEQ ID NO.: 11 N¹CCN⁴AN⁶TN⁸TN¹⁰N¹¹N¹²N¹³CCAGGT Japanese N²⁰TCAA Wherein N¹ is T or C; N⁴ encephalitis virus is C or T; N⁶ is G or C; N⁸ is C serogroup Primer 2 or A; N¹⁰ is A or T; N¹¹ is absent or T; N¹² is T or C; N¹³ is C or T; and N²⁰ is G or A. SEQ ID NO.: 12 N¹CCTAGTCTATCCCAGGTN²⁰TCAA West Nile virus Wherein N¹ is T or C and N²⁰ is Primer 2 G or A. SEQ ID NO.: 13 CCCN⁴AN⁶TN⁸TATN¹²N¹³CCAGGTGTCAA Japanese Wherein N⁴ is C or T; N⁶ is G or encephalitis virus C; N⁸ is C or A; N¹² is T or C; Primer 2 and N¹³ is C or T. SEQ ID NO.: 14 TCCTAGTCTTTTCCCAGGTGTCAA Murray Valley encephalitis virus Primer 2 SEQ ID NO.: 15 TCCTAGTCTATCCCAGGTGTCAA Example Primer 2 SEQ ID NO.: 74 TCTCCTAGTCTATCCCAGGTGTCAA Example Primer 2

[0116]In certain embodiments, the first nucleic acid primer comprises any of SEQ ID NOS.: 3-8. In certain embodiments of the invention, in order to improve primer specificity, the primers can comprise one or more alkylated nucleotides at or near its 3' end. For instance, in certain embodiments, first nucleic acid primer comprises SEQ ID NO.: 8, wherein the residue at position 23 is N⁶-alkyl-deoxyadenosine. In a specific embodiment, the first nucleic acid primer comprises SEQ ID NO.: 8, wherein the residue at position 23 is N⁶-methyl-deoxyadenosine. In certain embodiments, the first nucleic acid comprises SEQ ID NO.: 8, wherein the residue at position 24 is N⁶-alkyl-deoxyadenosine. In a specific embodiment, the first nucleic acid comprises SEQ ID NO.: 8, wherein the residue at position 24 is N⁶-tert-butyl-benzyl-deoxyadenosine. In certain embodiments, the first nucleic acid primer comprises SEQ ID NO.: 8, wherein the residue at position 23 is N⁶-alkyl-deoxyadenosine and the residue at position 24 is N⁶-alkyl-deoxyadenosine. In yet another specific embodiment, the first nucleic acid primer comprises SEQ ID NO.: 8, wherein the residue at position 23 is N⁶-methyl-deoxyadenosine and the residue at position 24 is N⁶-tert-butyl-benzyl-deoxyadenosine. U.S. Pat. No. 6,001,611, incorporated by reference above, describes N⁶-alkyl-deoxyadenosine as well as the identity of the alkyl moieties that can be used with such non-standard nucleotides. For example, in certain embodiments, the alkyl moiety comprises C₁ to about C₁₀ branched or unbranched alkyl. In other embodiments, the alkyl moiety comprises C₁ to about C₂₀ branched or unbranched alkyl.

[0117]In another aspect, the invention provides a second nucleic acid primer for detecting a member of the Japanese encephalitis virus serogroup comprising a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 9 a complement thereof. SEQ ID NO.: 9, as presented in FIG. 2, represents a region of conserved sequence in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention. FIG. 2 also shows that SEQ ID NO.: 10 represents the complement to SEQ ID NO.: 9.

[0118]In such embodiments of the invention, the second nucleic acid primer has a nucleotide composition, i.e., chemical structure, that allows it to hybridize to a nucleic acid of SEQ ID NO.: 9. For example, a primer containing a standard nucleotide that hybridizes to a C residue in the nucleic acid of SEQ ID NO.: 9 should have a G residue in the corresponding position. Thus, hybridization to the nucleic acid of SEQ ID NO.: 9 defines the nucleotide sequence and therefore the exact chemical structure of the primer. In addition, the second nucleic acid primer can also comprise non-standard nucleotides according to the definitions of oligonucleotides and primers recited above. Certain of such non-standard nucleotides can also bind to other standard or non-standard nucleotides to form a base-pair. For example, the nonstandard nucleotide inosine can pair with uracil, cytosine, and adenine. Given the known correlation between hybridization and chemical structure, one of skill in the art can easily recognize the standard features of the primers of the invention. Exemplary embodiments are described in detail below.

[0119]In certain embodiments, the second nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 9 can be as short as about 6 nucleotides. In other embodiments, the second nucleic acid primer can be as long as about 80 nucleotides. In certain embodiments, the second nucleic acid primer comprises about 10, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, or about 40 nucleotides.

[0120]The length and composition of the second primer can be chosen to give sufficient thermodynamic stability to ensure hybridization of the primer to the flaviviral nucleic acid under the appropriate reaction conditions, which depend on the detection method to be performed. For example, primers with modified, non-standard, or derivatized nucleotides may be longer or shorter than those with conventional nucleotides while having similar thermodynamic hybridization properties. Examples of such non-standard bases may be found in U.S. Pat. Nos. 6,320,005, 6,174,998, 6,001,611, and 5,990,303, each of which is hereby incorporated by reference in its entirety. As another example, primers with G/C-rich sequences may anneal to target sequences at higher temperatures that a primer of similar length with A/T-rich sequences. Thus, in certain embodiments, the second nucleic acid primer comprises modified, non-standard, or derivatized bases as defined above.

[0121]In certain embodiments, the second nucleic acid primer comprises at least 16 consecutive nucleotides of SEQ ID NO.: 10. SEQ ID NO.: 10 represents the complement of SEQ ID NO.: 9, as shown in FIG. 2. In other embodiments, the second nucleic acid primer comprises at least about 18 consecutive nucleotides of SEQ ID NO.: 10. In still other embodiments, the second nucleic acid primer comprises at least about 20 consecutive nucleotides of SEQ ID NO.: 10. In yet other embodiments, the second nucleic acid primer comprises at least about 22 consecutive nucleotides of SEQ ID NO.: 10. In still other embodiments, the second nucleic acid primer comprises at least about 24 consecutive nucleotides of SEQ ID NO.: 10.

[0122]In certain embodiments, the second nucleic acid primer comprises SEQ ID NO.: 11. In other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 12. In yet other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 13. In still other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 14. In yet other embodiments, the second nucleic acid primer comprises SEQ ID NO.: 15 or SEQ ID NO:74. In certain embodiments, the second nucleic acid primer comprises non-standard or derivatized nucleotides. In other embodiments, the second nucleic acid primer can comprise one or more alkylated nucleotides at or near the 3' end. In certain embodiments, the second nucleic acid primer comprises SEQ ID NO.: 15 or SEQ ID NO:74, wherein the residue at position 23 of SEQ ID NO: 15 or position 25 of SEQ ID NO:74 is N⁶-alkyl-deoxyadenosine. In certain embodiments, the alkyl moiety comprises C₁ to about C₁₀ branched or unbranched alkyl. In other embodiments, the alkyl moiety comprises C₁ to about C₂₀ branched or unbranched alkyl. In a specific embodiment, the second nucleic acid primer comprises SEQ ID NO.: 15 or SEQ ID NO:74, wherein the residue at position 23 of SEQ ID NO: 15 or position 25 of SEQ ID NO:74 is N⁶-tert-butyl-benzyl-deoxyadenosine.

[0123]The nucleic acid primers of the invention may additionally comprise nucleic acid sequences that are not complementary and/or do not hybridize to a member of the Japanese encephalitis virus serogroup. These additional sequences can be selected by one of skill in the art to, for example, assist in the detection of the member of the Japanese encephalitis virus serogroup. Methods of detecting a nucleic acid, including a nucleic acid of a member of the Japanese encephalitis virus serogroup are extensively described in Sections 4.2 and 4.3, below. These methods describe both the additional nucleic acid sequences that can be present in the nucleic acid primers of the invention as well as methods of using these additional sequences to detect a member of the Japanese encephalitis virus serogroup.

[0124]The nucleic acid primers may be prepared by any suitable method known to one of skill in the art without limitation. Methods for preparing oligonucleotides of defined sequence are well-known to the art, and include, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. Chemical synthesis methods may include, for example, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68:90, the phosphodiester method disclosed by Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoramidate method disclosed in Beaucage et al., 1981, Tetrahedron Letters 22:1859, and the solid support method disclosed in U.S. Pat. No. 4,458,066. In addition, modifications to the above-described methods of synthesis may be used to desirably impact enzyme behavior with respect to the synthesized oligonucleotides. For example, incorporation of modified phosphodiester linkages (e.g., phosphorothioate, methylphosphonates, phosphoamidate, or boranophosphate) or linkages other than a phosphorous acid derivative into an oligonucleotide may be used to prevent cleavage at a selected site. In addition, the use of 2'-amino modified sugars tends to favor displacement over digestion of the oligonucleotide when hybridized to a nucleic acid that is also the template for synthesis of a new nucleic acid strand.

[0125]Dengue Virus Primers

[0126]Additional primers of the invention hybridize to the Dengue virus 3' UTR. Exemplary primers useful for amplifying and/or detecting Dengue viruses nucleic acids include those depicted in Table 2.

TABLE-US-00002 TABLE 2 SEQ ID Sequence Comments NO: GAGCCCCGTCCAAGGACGTAAAA Dengue virus consensus 41 AGAA upstream primer. GAGCCCCGTCCAAGGACGTAAAA Dengue virus consensus 42 AGAJ upstream primer. GAGCCCCGTCCAAGGACGTAAAA Dengue virus consensus 43 AGEJ upstream primer. GAGCCCCGTCCAAGGACGTAAAAT Dengue virus type I 44 GAA upstream primer. GAGCCCCGTCCAAGGACGTAAAAT Dengue virus type I 45 GAJ upstream primer. GAGCCCCGTCCAAGGACGTAAAAT Dengue virus type I 46 GEJ upstream primer. GAGCCCCGTCCAAGGACGTTAAAA Dengue virus types 47 GAA II & Ill upstream primer. GAGCCCCGTCCAAGGACGTTAAAA Dengue virus types 48 GAJ II & Ill upstream primer. GAGCCCCGTCCAAGGACGTTAAAA Dengue virus types 49 GEJ II & Ill upstream primer. ATTGAAGTCAGGCCACTTGTGCCA Dengue virus type IV 50 upstream primer. ATTGAAGTCAGGCCACTTGTGCCJ Dengue virus type IV 51 upstream primer. ATTGAAGTCAGGCCACTTGTGCUJ Dengue virus type IV 52 upstream primer. GATCTCTGGTCTTTCCCAGCGTCA Dengue virus 53 downstream primer. GATCTCTGGTCTTTCCCAGCGTCA Dengue virus 54 J downstream primer. GATCTCTGGTCTTTCCCAGCGTCE Dengue virus 55 J downstream primer. Definition of primer suffixes: J = t-butyl-benzyl-dA, E = methyl-dA; U = ethyl-dC

[0127]In some embodiments, one "upstream" primers and a "downstream" primer are used in combination to amplify a Dengue virus nucleic acid. In some embodiments more than one upstream primer is used in combination with at least one downstream primer to detect one or more Dengue virus nucleic acids. The use of multiple upstream primers in a single amplification reaction allows for the amplification and/or detection of different Dengue virus nucleic acid variants. For example, in some embodiments, a first upstream primer (selected from SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43) and a second upstream primer (selected from SEQ ID NO:50, SEQ ID NO:51, and SEQ ID NO:52) are used in combination with a Dengue virus downstream primer (e.g., selected from a primer comprising SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55). These embodiments are useful, e.g., to detect any the Dengue virus types 1, 2, 3, or 4.

[0128]Yellow Fever Virus Primers

[0129]Additional primers of the invention hybridize to the yellow fever virus 3' UTR. Exemplary primers useful for amplifying and/or detecting Dengue virus nucleic acids include those depicted in Table 3.

TABLE-US-00003 TABLE 3 SEQ ID Sequence Comments NO: AACCGGGATAAAAACTACGGGTG Yellow fever virus 56 GAGAA upstream primer. AACCGGGATAAAAACTACGGGTG Yellow fever virus 57 GAGAJ upstream primer. AACCGGGATAAAAACTACGGGTG Yellow fever virus 58 GAGEJ upstream primer. ATAAAAACTACGGGTGGAGAACCG Yellow fever virus 59 GA upstream primer. ATAAAAACTACGGGTGGAGAACCG Yellow fever virus 60 GJ upstream primer. ACTCCGGTCTTTCCCTGGCGTCAA Yellow fever virus 61 downstream primer. ACTCCGGTCTTTCCCTGGCGTCAJ Yellow fever virus 62 downstream primer. ACTCCGGTCTTTCCCTGGCGTCEJ Yellow fever virus 63 downstream primer.

[0130]In some embodiments, one "upstream" primers and a "downstream" primer are used in combination to amplify a yellow fever virus nucleic acid. In some embodiments more than one upstream primer is used in combination with at least one downstream primer to detect one or more yellow fever virus nucleic acids. Multiple upstream primers may be used in a single amplification reaction. For example, in some embodiments, a first upstream primer (e.g., selected from SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58) and a second upstream primer (e.g., selected from SEQ ID NO:59, SEQ ID NO:60, and SEQ ID NO:61) are used in combination with a yellow fever virus downstream primer (e.g., selected from a primer comprising SEQ ID NO:62 and SEQ ID NO:63).

[0131]Primers Based on the Sequences of FIG. 7

[0132]Additional primers of the invention hybridize to any of the sequences depicted in FIG. 7 (e.g., SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40), or a complement thereof, under conditions to allow for priming of an amplification reaction. In some cases, these primers are useful for amplifying and/or detecting nucleic acids from SLEV.

[0133]Like the primers that hybridize to SEQ ID NO:1 described above, primers that hybridize to any of the sequences depicted in FIG. 7 can also comprise non-standard nucleotides according to the definitions of oligonucleotide and primers recited above.

[0134]The length and composition of the primers that hybridize to any of the sequences depicted in FIG. 7 can be chosen to give sufficient thermodynamic stability to ensure hybridization of the primer to the flaviviral nucleic acid under the appropriate reaction conditions, which depend on the detection method to be performed. For example, primers with modified, non-standard, or derivatized nucleotides may be longer or shorter than those with conventional nucleotides while having similar thermodynamic hybridization properties. Thus, in certain embodiments, the second nucleic acid primer comprises modified, non-standard, or derivatized bases as defined above. Primers that hybridize to any of the sequences depicted in FIG. 7 can comprise at least, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50 or more contiguous nucleotides of any of the sequences depicted in FIG. 7 or a complement thereof.

[0135]Those of skill in the art will appreciate that primer pairs can be designed using SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 to amplify desired sequences from the 3'UTR region of SLEV. In some embodiments, a first primer of the invention hybridizes to TTGACACCTGGAAAGACAGGAGA (SEQ ID NO: 68 and a second primer hybridizes to the complement of CAAAGCCCCTCATTCCGACTCGGG (SEQ ID NO: 69) under conditions to allow for priming of an amplification reaction.

[0136]Exemplary primers for detecting and/or amplifying SLEV include those depicted in Table 4.

TABLE-US-00004 TABLE 4 SEQ ID Sequence Comments NO: CAAAGCCCCTCATTCCGACTCGGG St. Louis encephalitis 64 A virus upstream primer. CAAAGCCCCTCATTCCGACTCGGG St. Louis encephalitis 65 J virus upstream primer. TCTCCTGTCTTTCCAGGTGTCAA St. Louis encephalitis 66 virus downstream primer. TCTCCTGTCTTTCCAGGTGTCAJ St. Louis encephalitis 67 virus downstream primer.

[0137]3.2. Nucleic Acid Probes

[0138]In another aspect, the invention provides a probe for the detection of a nucleic acid of certain flaviviruses. Flaviviral nucleic acids that can be detected with the probes of the invention are described in Sections 3.3 and 3.4, below. The probe can be any nucleic acid probe that can be used to identify the presence of a nucleic acid of a detectable flavivirus known to one of skill in the art without limitation. Typically, the probe comprises a nucleotide sequence that hybridizes to a region in a nucleic acid of a flavivirus to be detected.

[0139]The probe nucleotide sequence can be of any length sufficient to specifically bind a nucleic acid of a flavivirus to be detected. In certain embodiments, the probe comprises at least about 6 nucleotides. In certain embodiments, the probe comprises fewer than about 140 nucleotides. In certain embodiments, the probe can be about 18 to about 25, about 25 to about 35, or about 35 to about 45 nucleotides in length. The length and composition of the probe can be chosen to give sufficient thermodynamic stability to ensure hybridization of the probe to the flaviviral nucleic acid under the appropriate reaction conditions, which depend on the detection method to be performed. For example, probes with modified, non-standard, or derivatized nucleotides may be longer or shorter than those with conventional nucleotides while having similar thermodynamic hybridization properties. Examples of such non-standard bases may be found in U.S. Pat. Nos. 6,320,005, 6,174,998, 6,001,611, and 5,990,303, each of which is hereby incorporated by reference in its entirety. As another example, probes with G/C-rich sequences may anneal to target sequences at higher temperatures that a probe of similar length with A/T-rich sequences.

[0140]Typically, the portion of the probe nucleotide sequence that hybridizes to the detectable nucleic acid is identical or complementary to the region of the detectable nucleic acid to which the probe hybridizes. However, this portion of the probe can have less than 100% sequence identity or complementarity to the region of the detectable viral nucleic acid to which the probe hybridizes. In certain embodiments of the invention, nucleotide sequence of the portion of the probe that hybridizes to the detectable viral nucleic acid can have about 99%, about 98%, about 97%, about 96%, about 95%, about 90%, about 85% or about 80% complementarity or identity to the region of the detectable viral nucleic acid to which the probe hybridizes.

[0141]In certain embodiments, the invention provides a probe for detecting a member of the Japanese encephalitis virus serogroup comprising a nucleic acid that hybridizes to a nucleic acid of SEQ ID NO.: 16. SEQ ID NO.: 16, as presented in FIG. 3, represents a region of conserved sequence in the 3' untranslated region of the genomes of the flaviviruses that can be detected using the compositions and methods of the present invention. FIG. 3 also shows that SEQ ID NO.: 17 represents the complement to SEQ ID NO.: 16.

[0142]In such embodiments of the invention, the probe has a nucleotide composition, i.e., chemical structure, that allows it to hybridize under the defined conditions to a nucleic acid of SEQ ID NO.: 16. For example, a probe containing a standard nucleotide that hybridizes to a C residue in the nucleic acid of SEQ ID NO.: 16 must have a G residue in the corresponding position. Thus, hybridization to the nucleic acid of SEQ ID NO.: 16 defines the nucleotide sequence and therefore the exact chemical structure of the probe. In addition, the probe can also comprise non-standard nucleotides according to the definitions of oligonucleotide and primers recited above. Certain of such non-standard nucleotides can also bind to other standard or non-standard nucleotides to form a base-pair. For example, the nonstandard nucleotide inosine can pair with uracil, cytosine, and adenine. Given the known correlation between hybridization and chemical structure, one of skill in the art can easily recognize the standard features of the probes of the invention. Exemplary embodiments are described in detail below.

[0143]In certain embodiments, the probes that can hybridize to SEQ ID NO.: 16 comprise about 10, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 32, about 34, about 36, about 38, about 40, about 42, about 44, about 46, about 48, about 50, about 55, about 60, about 65, about 70, about 75, or about 80 nucleotides. In certain embodiments, the probe comprises modified, non-standard, or derivatized bases, as defined above.

[0144]In certain embodiments, the probe comprises at least about 20 consecutive nucleotides of SEQ ID NO.: 17. In other embodiments, the probe comprises at least about 22 consecutive nucleotides of SEQ ID NO.: 17. In still other embodiments, the probe comprises at least about 24 consecutive nucleotides of SEQ ID NO.: 17. In yet other embodiments, the probe comprises at least about 26 consecutive nucleotides of SEQ ID NO.: 17. In still other embodiments, the probe comprises at least about 28 consecutive nucleotides of SEQ ID NO.: 17. In yet other embodiments, the probe comprises at least about 30 consecutive nucleotides of SEQ ID NO.: 17. In still other embodiments, the probe comprises at least about 32 consecutive nucleotides of SEQ ID NO.: 17. In yet other embodiments, the probe comprises at least about 34 consecutive nucleotides of SEQ ID NO.: 17. In still other embodiments, the probe comprises at least about 36 consecutive nucleotides of SEQ ID NO.: 17. In yet other embodiments, the probe comprises at least about 38 consecutive nucleotides of SEQ ID NO.: 17. In still other embodiments, the probe comprises at least about 40 consecutive nucleotides of SEQ ID NO.: 17.

[0145]In certain embodiments, the invention provides particular nucleic acid probes that can be used to detect a member of the Japanese encephalitis virus serogroup, as well as certain other flaviviruses. These probes can be structurally defined by reference to their nucleic acid sequences, as presented in Table 5.

TABLE-US-00005 TABLE 5 SEQ ID NO.: 18 GGN³CTAGN⁸GGTTAGAGGAGACCCN²⁴ Probe for Detecting N²⁵N²⁶N²⁷N²⁸ Wherein N³ is A Flaviviruses or T; N⁸ is A or T; N²⁴ is C or T; N²⁵ is G, C, T, A, or absent; N²⁶ is C, T, G, or absent; N²⁷ is G, C, A, T, or absent; and N²⁸ is G, C, A, T, or absent. SEQ ID NO.: 19 GGACTAGN⁸GGTTAGAGGAGACCCCN²⁵ Probe for Detecting N²⁶N²⁷N²⁸ Wherein N⁸ is A or Japanese Encephalitis T; N²⁵ is G or A; N²⁶ is C or Virus Serogroup T; N²⁷ is G or T; and N²⁸ is Members G or T. SEQ ID NO.: 20 GGACTAGN⁸GGTTAGAGGAGACCCCN²⁵ Probe for Detecting CGN²⁸ Wherein N⁸ is A or T; West Nile Virus N²⁵ is G or A; and N²⁸ is G or T. SEQ ID NO.: 21 GGACTAGAGGTTAGAGGAGACCCCGN²⁶ Probe for Detecting GG Wherein N²⁶ is C or T. Japanese Encephalitis Virus SEQ ID NO.: 22 GGACTAGAGGTTAGAGGAGACCCCACTC Probe for Detecting Murray Valley Encephalitis Virus SEQ ID NO.: 23 AATAN⁵GTGGATTACATGAN¹⁹TTCAN²⁴ Probe for Detecting TGAAG Wherein N⁵ is T or C; Kunjin Virus N¹⁹ is G or C; and N²⁴ is T or C. SEQ ID NO.: 24 GGACTAGAGGTTAGAGGAGACCCCN²⁵ Probe for Detecting N²⁶N²⁷N²⁸ Wherein N²⁵ is C or Dengue Virus T; N²⁶ is C or G; N²⁷ is C or G; and N²⁸ is G, C or A. SEQ ID NO.: 25 GGTCTAGAGGTTAGAGGAGACCCTCCAG Probe for Detecting Yellow Fever Virus SEQ ID NO.: 26 GGACTAGAGGTTAGAGGAGACCCCTTCC Probe for Detecting Montana Myotis Leukencephalitis Virus SEQ ID NO.: 27 GGACTAGAGGTTAGAGGAGACCCCCGGC Probe for Detecting Modoc Virus SEQ ID NO.: 28 GGACTAGAGGTTAGAGGAGACCCCGCGG Example Probe 1 SEQ ID NO.: 70 GGGTCTCCTCTAACCTCTAGTCCTTCCC Flavivirus anti-sense CC probe

[0146]In certain embodiments of the invention, the probe comprises any of SEQ ID NOS.: 18-28 or 70, or complements thereof.

[0147]The nucleic acid probes of the invention can additionally comprise other nucleic acid sequences that are not derived from and/or do not hybridize to a nucleic acid of a member of the Japanese encephalitis virus serogroup or another flavivirus that can be detected with the disclosed probes. These additional nucleic acid sequences can be selected by one of skill in the art to provide desired functionality to the probes. For example, the nucleic acid probes can comprise additional sequences that allow improved methods of detection. Examples of probes that can comprise additional nucleic acid sequences or can otherwise be adapted for use in the probes, methods, and kits of the invention can be found in U.S. Pat. Nos. 6,323,337, 6,248,526, 6,150,097, 6,117,635, 6,090,552, 5,866,336, and 5,723,591, each of which is hereby incorporated by reference in its entirety. Further, methods of detecting a nucleic acid, including a nucleic acid of a member of the Japanese encephalitis virus serogroup or other detectable flaviviruses are extensively described in Sections 4.2 and 4.3, below. Certain of these methods also use additional nucleic acid sequences that can be present in the nucleic acid primers of the invention; such additional nucleic acid sequences and methods of using these additional sequences to detect a member of the Japanese encephalitis virus serogroup are described below.

[0148]The nucleic acid probes of the invention can be prepared by any method known to one of skill in the art without limitation. In particular, the methods used to prepare the nucleic acid primers of the invention described above may also be used to prepare the nucleic acid probes of the invention.

[0149]In addition to the probe nucleotide sequence, the probe can comprise additional nucleotide sequences or other moieties that do not inhibit the methods of the instant invention. In convenient embodiments of the invention, the probe can comprise additional nucleotide sequences or other moieties that facilitate the methods of the instant invention. For instance, the probe can be blocked at its 3' terminus to prevent undesired nucleic acid polymerization priming by the probe. Also, moieties may be present within the probe that stabilize or destabilize hybridization of the probe or probe fragments with the nucleotide sequence. The probes of the invention can also comprise modified, non-standard, or derivatized nucleotides as defined above.

[0150]In certain embodiments of the invention, the probe can comprise a detectable moiety. The detectable moiety can be any detectable moiety known by one of skill in the art without limitation. Further, the detectable moiety can be detectable by any means known to one of skill in the art without limitation. For example, the detectable moiety can be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.

[0151]A variety of detectable moieties that can be used to detect the probes of the invention, as well as methods for their linkage to the probe, are known to the art and include, but are not limited to, enzymes (e.g., alkaline phosphatase and horseradish peroxidase) and enzyme substrates, radioactive moieties, fluorescent moieties, chromophores, chemiluminescent labels, electrochemiluminescent labels, such as Origin® (Igen, Rockville, Md.), ligands having specific binding partners, or any other labels that may interact with each other to enhance, alter, or diminish a signal. Of course, should a 5' nuclease reaction be performed using a thermostable DNA polymerase at elevated temperatures, the detectable moiety should not be degraded or otherwise rendered undetectable by such elevated temperatures.

[0152]In certain embodiments, the detectable moiety can be a fluorescent moiety. The fluorescent moiety can be any fluorescent moiety known to one of skill in the art without limitation. In general, fluorescent moieties with wide Stokes shifts are preferred, allowing the use of fluorometers with filters rather than monochromometers and increasing the efficiency of detection. In certain embodiments, the fluorescent moiety can be selected from the group consisting of fluorescein-family dyes (Integrated DNA Technologies, Inc., Coralville, Iowa), polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes (Molecular Probes, Inc., Eugene, Or), rhodamine-family dyes (Integrated DNA Technologies, Inc.), cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, and BODIPY®-family dyes (Molecular Probes, Inc.). In a preferred embodiment, the fluorescent moiety is 6-carboxyfluorescein (FAM®)(Integrated DNA Technologies, Inc.). Other examples of fluorescent moieties that can be used in the probes, methods, and kits of the invention can be found in U.S. Pat. Nos. 6,406,297, 6,221,604, 5,994,063, 5,808,044, 5,880,287, 5,556,959, and 5,135,717, each of which is hereby incorporated by reference in its entirety.

[0153]In other embodiments, the detectable moiety can be a detectable moiety other than a fluorescent moiety. Among radioactive moieties, ³²P-labeled compounds are preferred. Any method known to one of skill in the art without limitation may be used to introduce ³²P into a probe. For example, a probe may be labeled with ³²P by 5' labeling with a kinase or by random insertion by nick translation. Detectable moieties that are enzymes can typically be detected by their activity. For example, alkaline phosphatase can be detected by measuring fluorescence produced by action of the enzyme on appropriate substrate compounds. Where a member of specific binding partners are used as detectable moieties, the presence of the probe can be detected by detecting the specific binding of a molecule to the member of the specific binding partner. For example, an antigen can be linked to the probe, and a monoclonal antibody specific for that antigen can be used to detect the presence of the antigen and therefore the probe. Other specific binding partners that can be used as detectable moieties include biotin and avidin or streptavidin, IgG and protein A, and numerous other receptor-ligand couples well-known to the art. Still other examples of detectable moieties that are not fluorescent moieties can be found in U.S. Pat. Nos. 5,525,465, 5,464,746, 5,424,414, and 4,948,882, each of which is hereby incorporated by reference in its entirety.

[0154]The above description of detectable moieties is not meant to categorize the various labels into distinct classes, as the same label may serve in several different modes. For example, ¹²⁵I may serve as a radioactive moiety or as an electron-dense reagent. Horseradish peroxidase may serve as enzyme or as antigen for a monoclonal antibody. Further, one may combine various detectable moieties for desired effect. For example, one might label a probe with biotin, and detect its presence with avidin labeled with ¹²⁵I, or with an anti-biotin monoclonal antibody labeled with horseradish peroxidase. Other permutations and possibilities will be readily apparent to those of ordinary skill in the art, and are considered as equivalents within the scope of the instant invention.

[0155]The method of linking or conjugating the detectable moiety to the probe depends, of course, on the type of detectable moiety or moieties used and the position of the detectable moiety on the probe.

[0156]The detectable moiety may be attached to the probe directly or indirectly by a variety of techniques. Depending on the precise type of detectable moiety used, the detectable moiety can be located at the 5' or 3' end of the probe, located internally in the probe's nucleotide sequence, or attached to spacer arms of various sizes and compositions to facilitate signal interactions. Using commercially available phosphoramidite reagents, one can produce oligonucleotides containing functional groups (e.g., thiols or primary amines) at either terminus via an appropriately protected phosphoramidite, and can attach a detectable moiety thereto using protocols described in, for example, PCR Protocols: A Guide to Methods and Applications, ed. by Innis et al., Academic Press, Inc., 1990.

[0157]Methods for introducing oligonucleotide functionalizing reagents to introduce one or more sulfhydryl, amino or hydroxyl moieties into the oligonucleotide probe sequence, typically at the 5' terminus are described in U.S. Pat. No. 4,914,210. A 5' phosphate group can be introduced as a radioisotope by using polynucleotide kinase and [gamma-³²P]ATP to provide a reporter group. Biotin can be added to the 5' end by reacting an aminothymidine residue or alkylamino linker, introduced during synthesis, with an N-hydroxysuccinimide ester of biotin. Other methods of attaching a detectable moiety, including a fluorescent moiety, to the probe can be found in U.S. Pat. No. 5,118,802, which is hereby incorporated by reference in its entirety.

[0158]It is also possible to attach a detectable moiety at the 3' terminus of the probe by employing, for example, polynucleotide terminal transferase to add a desired moiety, such as, for example, cordycepin ³⁵S-dATP, and biotinylated dUTP.

[0159]Oligonucleotide derivatives are also detectable moieties that can be used in the probes, methods and kits of the present invention. For example, etheno-dA and etheno-A are known fluorescent adenine nucleotides which can be incorporated into an oligonucleotide probe. Similarly, etheno-dC is another analog that could be used in probe synthesis. The probes containing such nucleotide derivatives can be degraded to release mononucleotides that are much more strongly fluorescent than the intact probe by, for example, a polymerase's 5' to 3' nuclease activity.

[0160]In certain embodiments of the invention, a probe can be labeled with more than one detectable moiety. In certain of such embodiments, each detectable moiety can be individually attached to different bases of the probe. In other embodiments, more than one detectable moiety can be attached to the same base of the probe.

[0161]In certain embodiments, the detectable moiety can be attached to the 5' end of the probe. In other embodiments, the detectable moiety can be attached to the probe at a residue that is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, about 35, or about 40 residues from the 5' end of the probe. In certain embodiments, the detectable moiety can be attached to the 3' end of the probe. In other embodiments, the detectable moiety can be attached to the probe at a residue that is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, about 35, or about 40 residues from the 3' end of the probe. The detectable moiety can be attached to any portion of a residue of the probe. For example, the detectable moiety can be attached to a sugar, phosphate, or base moiety of a nucleotide in the probe. In other embodiments, the detectable moiety can be attached between two residues of the probe.

[0162]In certain embodiments of the invention, the probe can comprise a fluorescent moiety and a quencher moiety. In such embodiments, the fluorescent moiety can be any fluorescent moiety known to one of skill in the art, as described above. Further, the quencher moiety can be any quencher moiety known to one of skill in the art without limitation. In certain embodiments, the quencher moiety can be selected from the group consisting of fluorescein-family dyes, polyhalofluorescein-family dyes, hexachlorofluorescein-family dyes, coumarin-family dyes, rhodamine-family dyes, cyanine-family dyes, oxazine-family dyes, thiazine-family dyes, squaraine-family dyes, chelated lanthanide-family dyes, BODIPY®-family dyes, and non-fluorescent quencher moieties. In certain embodiments, the non-fluorescent quencher moieties can be BHQ®-family dyes (including the quenchers described in WO 01/86001), Iowa Black®, or Dabcyl (Integrated DNA Technologies, Inc.). Other examples of specific quencher moieties include, for example, but not by way of limitation, TAMRA (N,N,N',N'-tetramethyl-6-carboxyrhodamine) (Molecular Probes, Inc.), DABCYL (4-(4'-dimethylaminophenylazo)benzoic acid), Iowa Black® (Integrated DNA Technologies, Inc.), Cy3® (Integrated DNA Technologies, Inc.) or Cy5® (Integrated DNA Technologies, Inc.). In a preferred embodiment, the quencher moiety is Cy5®. Other examples of quencher moieties that can be used in the probes, methods, and kits of the invention can be found in U.S. Pat. Nos. 6,399,392, 6,348,596, 6,080,068, and 5,707,813, each of which is hereby incorporated by reference in its entirety.

[0163]In certain embodiments, the quencher moiety can be attached to the 5' end of the probe. In other embodiments, the quencher moiety can be attached to the probe at a residue that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, about 35, or about 40 residues from the 5' end of the probe. In certain embodiments, the quencher moiety can be attached to the 3' end of the probe. In other embodiments, the quencher moiety can be attached to the probe at a residue that is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, about 35, or about 40 residues from the 3' end of the probe. In some embodiments, the quencher moiety is attached to the 5' end of the probe and the fluorescent moiety is attached to a residue that is within about 10 residues of the 5' end of the probe. The quencher moiety can be attached to any portion of a residue of the probe. For example, the quencher moiety can be attached to a sugar, phosphate, or base moiety of a nucleotide in the probe. In other embodiments, the quencher moiety can be attached between two residues of the probe.

[0164]While not intending to be bound to any particular theory or mechanism of action, it is believed that when the probe is intact, a photon emitted by the fluorescent moiety can be absorbed and thus quenched by the quencher moiety. The quencher moiety then either releases the energy of the photon as a photon of different wavelength or as heat. Thus, the quencher moiety can also be a fluorescent moiety. As described above, this phenomenon is termed fluorescence resonance energy transfer ("FRET"). Cleaving the probe between the fluorescent moiety and quencher results in a reduction in quenching of the fluorescent moiety's emitted fluorescence by the quencher moiety.

[0165]Generally, transfer of energy between the fluorescent moiety and the quencher moiety depends on the distance between the fluorescent moiety and the quencher moiety and the critical transfer distance of the particular fluorescent moiety-quencher moiety pair. The critical transfer distance is both characteristic and constant for a given fluorescent moiety paired with a given quencher moiety. Further, the spatial relationship of the fluorescent moiety in reference to the quencher moiety can be more sensitively determined when the critical transfer distance of the fluorescent moiety-quencher moiety pair is close to the distance between the fluorescent moiety and the quencher moiety. Accordingly, the skilled practitioner can select the fluorescent moiety and the quencher moiety to have a critical transfer distance that is close to the distance separating the fluorescent moiety from the quencher moiety on the probe. Critical transfer distances of particular fluorescent moiety-quencher moiety pairs are well known in the art and can be found, for example, in an article by Wu and Brand, 1994, Anal. Biochem. 218:1-13, which is hereby incorporated by reference in its entirety.

[0166]Other criteria for section of particular fluorescent moiety-quencher moiety pairs include, for example, the quantum yield of fluorescent emission by the fluorescent moiety; the wavelength of fluorescence emitted by the fluorescent moiety; the extinction coefficient of the quencher moiety; the wavelength of fluorescence, if any, emitted by the quencher moiety; and the quantum yield of fluorescent emission, if any, by the quencher moiety. In addition, if the quencher moiety is also a fluorescent moiety, the quencher moiety and the fluorescent moiety can preferably be selected so that fluorescence emitted by one can easily be distinguished from fluorescence emitted by the other. Further guidance on the selection of particular fluorescent moiety-quencher moiety pairs may be found in a review article by Klostermeier and Millar, 2002, Biopolymers 61:159-179, which is hereby incorporated by reference in its entirety.

[0167]Exemplary combinations of fluorescent moieties and quencher moieties that can be used in this aspect of the invention include, but are not limited to the fluorescent moiety rhodamine 590 and the quencher moiety crystal violet. A preferred combination of fluorescent and quencher moieties is the fluorescent moiety 6-carboxyfluorescein and the quencher moiety Cy5®. Other examples of fluorescent moiety-quencher moiety pairs that can be used in the probes, methods, and kits of the invention can be found in U.S. Pat. No. 6,245,514, which is hereby incorporated by reference in its entirety.

[0168]Examples of molecules that can be used as both fluorescent or quencher moieties in FRET include fluorescein, 6-carboxyfluorescein, 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein, rhodamine, 6-carboxyrhodamine, 6-carboxy-X-rhodamine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS). Whether a fluorescent moiety is a donor or an acceptor is defined by its excitation and emission spectra, and the fluorescent moiety with which it is paired. For example, FAM® is most efficiently excited by light with a wavelength of 488 nm, and emits light with a spectrum of 500 to 650 nm, and an emission maximum of 525 nm. Accordingly, FAM® is a suitable fluorescent moiety for use with, for example, with TAMRA as quencher moiety, which has at its excitation maximum 514 nm.

[0169]In some embodiments, the following probe variants are used:

TABLE-US-00006 FGGACTAGAIGGTTAGAGGAGACCCCGCGGP; (SEQ ID NO:76, which is a variant of SEQ ID NO:28) FGGAEUAGAIGGUUAGAGGAGAEEEEGEGGP; (SEQ ID NO:77, which is a variant of SEQ ID NO:28) FGGGTCTCCITCTAACCTCTAGTCCTTCCCCCP; (SEQ ID NO:78, which is a variant of SEQ ID NO:70) FGGGUEUEEIUEUAACCTCTAGTCCTTCCCCCP; (SEQ ID NO:79, which is a variant of SEQ ID NO:70) and FGGTCTAGAIGGTTAGAGGAGACCCTCCAGP. (SEQ ID NO:80, which is a variant of SEQ ID NO:25) In all of the above probes, F = CY5; I = FAM; P = PO4; U = propynyl dU; E = 5-methyl-dC).

[0170]3.3. Nucleic Acids of Detectable Members of the Japanese Encephalitis Virus Serogroup

[0171]The primers, probes, methods, and kits of the invention are useful for the detection of certain members of the genus Flavivirus. In particular, the primers, probes, methods, and kits are useful for detecting members of the Japanese encephalitis virus serogroup. For example, the members of the Japanese encephalitis virus serogroup that can be detected according to the present invention include, but are not limited to, Japanese encephalitis virus, West Nile virus, Murray Valley encephalitis virus, SLEV, and Kunjin virus. In several instances, the complete sequence of at least one strain of some of these viruses has been determined. These sequences may be found by reference to the GenBank accession numbers presented in FIG. 4, which presents an alignment of nucleic acid sequences of Japanese encephalitis virus serogroup members with the oligonucleotides of the invention. The nucleic acid sequences of each flaviviral genome identified by accession number in FIG. 4 is hereby incorporated by reference in its entirety.

[0172]The complete nucleic acid sequences of the genomes of other members of the Japanese encephalitis virus serogroup, e.g., Cacipacore virus, St. Louis encephalitis virus, Usutu virus, and Youende virus, have not yet been determined. Nonetheless, it is believed that the primers and probes of the present invention hybridize to sequences that have a high degree of conservation with all members of the Japanese encephalitis virus serogroup. Further, one of skill in the art can easily recognize that the primers and probes can hybridize to a nucleic acid from one of the as yet unsequenced members following determination of the nucleic acid sequences of these viral genomes.

[0173]In certain embodiments, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected. In other embodiments, a nucleic acid of Japanese encephalitis virus can be detected. In yet other embodiments, a nucleic acid of West Nile virus can be detected. In still other embodiments, a nucleic acid of Kunjin virus can be detected. In yet other embodiments, a nucleic acid of Murray Valley encephalitis virus can be detected. In yet other embodiments, a nucleic acid of SLEV can be detected. In still other embodiments, a nucleic acid of Japanese encephalitis virus, West Nile virus, SLEV or Murray Valley encephalitis virus can be detected.

[0174]The nucleic acid to be detected can be any nucleic acid from a detectable flavivirus as described herein. Typically, the nucleic acid will be a single-stranded RNA, as the flaviviruses to be detected have plus-strand single stranded RNA genomes. However, the nucleic acid to be detected can also be DNA corresponding in sequence to an RNA genome of a flavivirus that can be detected. Such DNA can be prepared, for example, by reverse-transcribing the viral RNA as described in Section 4.1, below.

[0175]The presence of a nucleic acid of a detectable flavivirus can be detected in a sample from any source known to one of skill in the art without limitation. For example, the viral nucleic acid can be detected in a biological sample, as defined above. The viral nucleic acid can be detected in a sample from any natural source, including a vertebrate animal, such as a fish, amphibian, reptile, bird, or mammal, and an invertebrate animal, such as insects, crustaceans, arachnids, etc. In addition, the sample to be tested can be from a non-living source, such as a water or soil sample or a swipe sample, such as is derived from testing a surface.

[0176]It certain embodiments of the invention, the nucleic acid to be detected can be amplified according to methods known to those of skill in the art. The amplification can be performed prior to detection according to the methods described herein or the amplification can be performed concurrently with detection as described herein. Methods of amplifying a nucleic acid are described below and in, for example, Saiki et al., 1988, Science 239:487-91, the contents of which are hereby incorporated by reference in their entirety.

[0177]3.4. Nucleic Acids of Other Detectable Flaviviruses

[0178]The probes, methods and kits of the invention can also be used to detect a nucleic acid from other flaviviruses, including, but not limited to, Dengue virus, Montana myotis leukoencephalitis virus, Modoc virus, and Yellow Fever virus. As with members of the Japanese encephalitis virus serogroup, the nucleic acid sequences of at least one strain of some of these viruses has been determined. These sequences may be found by reference to the accession numbers presented in FIG. 5, which presents an alignment of nucleic acid sequences of these detectable flaviviruses with SEQ ID NO: 16. The nucleic acid sequences of each flaviviral genome identified by GenBank accession number in FIG. 5 is hereby incorporated by reference in its entirety.

[0179]As discussed herein, primers SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55 are useful for amplifying and/or detecting Dengue virus and primers SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO:63 are useful for amplifying and/or detecting yellow fever virus.

[0180]3.5. Multiplex Amplification Reactions to Detect Different Virus Variants or Different Viruses

[0181]The primers and probes of the invention can be combined in reactions to detect more than one viral nucleic acid. For example, in some cases, multiple upstream and/or multiple downstream primers are combined in one reaction mixture for use in detecting different viral variants (e.g., that would not be detected, or would only be poorly detected by a single primer or primer pair). In some embodiments, multiple upstream and/or multiple downstream primers are combined in one reaction mixture to detect more than one virus. In such embodiments, primers specific for each virus to be detected are included in the reaction mixture, thereby allowing for amplification of each viral nucleic acid present in a sample. For example, any combination of primers for amplification of West Nile Virus, SLEV, Dengue virus and yellow fever virus can be included depending on what virus is desired to be detected. Detection of multiple viruses using a single reaction is useful, for example, when screening the blood supply or in other cases where contamination with any virus is all that needs to be detected.

[0182]Probes of the invention can be used in the reactions described above. Depending on what result is desired, a single probe capable of detecting any possible viral nucleic acid product can be used. Alternatively, a different probe that specifically hybridizes to each possible viral nucleic acid product can be used. In such cases, it can be useful to employ a different detectable label with each probe, thereby allowing for differentiation of viral nucleic acid products.

[0183]In some embodiments, multiplex PCR can be used to detect multiple viral nucleic acids using the components described above. Multiplex PCR allows for amplification and/or detection of multiple polynucleotide fragments in the same reaction. See, e.g., PCR PRIMER, A LABORATORY MANUAL (Dieffenbach, ed. 1995) Cold Spring Harbor Press, pages 157-171.

[0184]In some embodiments, primers for the detection of both West Nile virus and SLEV are used. In some embodiments, primers for the detection of West Nile virus, SLEV, and Dengue virus are used. In some embodiments, primers for the detection of West Nile virus, SLEV, and yellow fever virus are used. In some embodiments, primers for the detection of West Nile virus, SLEV, yellow fever and Dengue virus are used. In some cases, the multiplex reactions further comprise at least one probe as described herein.

4. Methods for Detecting and/or Quantifying a Nucleic Acid of a Member of the Japanese Encephalitis Serogroup and Certain Other Flaviviruses

[0185]In certain aspects, the present invention provides methods for using nucleic acid primers and probes to detect a nucleic acid of certain flaviviruses. In other aspects, the present invention provides methods for using nucleic acid primers and probes to quantify a nucleic acid of certain flaviviruses in a sample. Any method for using nucleic acid primers and probes to detect a nucleic acid known to one of skill in the art without limitation can be used to detect a nucleic acid of a detectable flavivirus, as described above. In certain embodiments, the methods provide using a primer and a probe to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. In other embodiments, the methods provide using two primers and a probe to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. In still other embodiments, the methods provide using a probe to detect certain flaviviruses, as described below.

[0186]4.1. 5' Nuclease Reaction-Based Assays for Detecting and/or Quantifying a Nucleic Acid of a Member of the Japanese Encephalitis Serogroup

[0187]In certain aspects of the invention, the methods comprise detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup with a primer and a probe. These methods generally comprise contacting a primer hybridized to a nucleic acid of a member of the Japanese encephalitis virus serogroup with an enzyme with 5' nuclease activity. The enzyme with 5' nuclease activity then fragments a probe hybridized to the nucleic acid of the member of the Japanese encephalitis virus serogroup in a 5' nuclease reaction. The probe can be labeled with a detectable moiety that enables detection of fragmentation of the probe. Such methods are based on those described in U.S. Pat. Nos. 6,214,979, 5,804,375, 5,487,972 and 5,210,015, each of which is hereby incorporated by reference in its entirety.

[0188]In a 5' nuclease reaction, the nucleic acid, primer and probe can be contacted with any enzyme known by one of skill in the art to have 5' to 3' nuclease activity without limitation. The conditions are preferably chosen to permit the polymerase to cleave the probe and release a plurality of fragments of the probe from the nucleic acid. Preferred enzymes with 5' nuclease activity include template-dependent nucleic acid polymerases. Known native and recombinant forms of such polymerases include, for example, E. coli DNA polymerase I (Fermentas, Inc., Hanover, Md.), Bacillus stearothermophilus DNA polymerase, and Thermococcus littoralis DNA polymerase.

[0189]In preferred embodiments, the enzymes with 5' nuclease activity are thermostable and thermoactive nucleic acid polymerases. Such thermostable polymerases include, but are not limited to, native and recombinant forms of polymerases from a variety of species of the eubacterial genera Thermus, Thermatoga, and Thermosipho. For example, Thermus species polymerases that can be used in the methods of the invention include Thermus aquaticus (Taq) DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus species Z05 (Z05) DNA polymerase, and Thermus species sps17 (sps17), as described in U.S. Pat. Nos. 5,405,774, 5,352,600, 5,079,352, 4,889,818, 5,466,591, 5,618,711, 5,674,738, and 5,795,762, each of which is incorporated herein by reference in its entirety. Thermatoga polymerases that can be used in the methods of the invention include, for example, Thermatoga maritima DNA polymerase and Thermatoga neapolitana DNA polymerase, while an example of a Thermosipho polymerase that can be used is Thermosipho africanus DNA polymerase. The sequences of Thermatoga maritima and Thermosipho africanus DNA polymerases are published in International Patent Application No. PCT/US91/07035 with Publication No. WO 92/06200, which is incorporated herein by reference in its entirety. The sequence of Thermatoga neapolitana may be found in International Patent Publication No. WO 97/09451, which is incorporated herein by reference in its entirety.

[0190]A 5' nuclease reaction comprises contacting the nucleic acid to be detected with a primer, a probe, and an enzyme having 5' to 3' nuclease activity, under conditions in which the primer and the probe hybridize to the nucleic acid. Components of a 5' nuclease reaction can contact the nucleic acid to be detected in any order, e.g., the primer can contact the nucleic acid to be detected first, followed by the probe and enzyme with 5' nuclease activity, or alternatively the enzyme with 5' nuclease activity can contact the nucleic acid to be detected first, followed by the probe and primer. In certain embodiments, more than one primer or probe may be added to a 5' nuclease reaction. In certain preferred embodiments, a pair of primers can contact the nucleic acid in a 5' nuclease reaction. The primer can be any primer capable of priming a DNA synthesis reaction. Where only one primer is used, the primer should hybridize to the nucleic acid upstream of the probe, i.e., the 3' end of the primer should point toward the 5' end of the probe. The 3' end of the primer can hybridize adjacent to the 5' end of the probe, or the 3' end of the primer can hybridize further upstream of the 5' end of the probe. Where more than one primer is used, at least one primer should hybridize to the nucleic acid to be detected upstream of the probe, as described above.

[0191]Certain embodiments of the 5' nuclease reactions of the present invention are based on several 5' nuclease reactions that are known to those of skill in the art. Examples of such reactions are described in detail, for instance, in U.S. Pat. No. 5,210,015, the content of which is hereby incorporated by reference in its entirety.

[0192]Briefly, in a 5' nuclease reaction, a target nucleic acid is contacted with a primer and a probe under conditions in which the primer and probe hybridize to a strand of the nucleic acid. The nucleic acid, primer and probe are also contacted with an enzyme, for example a nucleic acid polymerase, having 5' to 3' nuclease activity. Nucleic acid polymerases possessing 5' to 3' nuclease activity can cleave the probe hybridized to the nucleic acid downstream of the primer. The 3' end of the primer provides a substrate for extension of a new nucleic acid as based upon the template nucleic acid by the nucleic acid polymerase. As the polymerase extends the new nucleic acid, it encounters the 5' end of the probe and begins to cleave fragments from the probe.

[0193]The primer and probe can be designed such that they hybridize to the target nucleic acid in close proximity to each other such that binding of the nucleic acid polymerase to the 3' end of the primer puts it in contact with the 5' end of the probe. In this process, nucleic acid extension is not required to bring the nucleic acid polymerase into position to accomplish the cleavage. The term "polymerization-independent cleavage" refers to this process.

[0194]Alternatively, if the primer and probe anneal to more distantly spaced regions of the nucleic acid, nucleic acid extension must occur before the nucleic acid polymerase encounters the 5' end of the probe. As the polymerization continues, the polymerase progressively cleaves fragments from the 5' end of the probe. This cleaving continues until the remainder of the probe has been destabilized to the extent that it dissociates from the template molecule. The term "polymerization-dependent cleavage" refers to this process.

[0195]One advantage of polymerization-independent cleavage lies in the elimination of the need for amplification of the nucleic acid. In the absence of primer extension, the strand of the nucleic acid is substantially single-stranded. Provided the primer and probe are adjacently bound to the nucleic acid, sequential rounds of oligonucleotide annealing and cleavage of fragments can occur. Thus, sufficient amounts of the probe can be fragmented to yield a detectable signal, thereby permitting detection in the absence of polymerization.

[0196]In either process, a sample is provided which contains the nucleic acid. If the nucleic acid is double-stranded, it should first be denatured, e.g., the strands of the nucleic acid separated from each other. Any suitable denaturing method, including physical, chemical, or enzymatic means, known to one of skill in the art without limitation can be used to separate the nucleic acid strands. A preferred physical means for strand separation is heating the nucleic acid until it is completely (>99%) denatured. Typical heat denaturation involves temperatures ranging from about 80° C. to about 105° C., for about 10 seconds to about 10 minutes. As an alternative to denaturation, the nucleic acid may exist in a single-stranded form in the sample, such as, for example, single stranded RNA or DNA viruses.

[0197]It should be noted that the viruses that can be detected with the primers, probes, methods, and kits of the invention are single stranded plus-strand RNA viruses. Accordingly, denaturation of the native viral genome is not required to detect an unamplified viral genome. However, if the native viral genome is reverse-transcribed into DNA according to certain embodiments of the invention, described below, denaturation of the amplified viral nucleic acids is necessary prior to detection with the primers and probes of the invention.

[0198]If the nucleic acid to be detected is RNA, the RNA can either be used as an RNA template for a 5' nuclease reaction as described above, or the RNA can be used as a template for reverse-transcription into cDNA, or both simultaneously. In certain embodiments, the RNA can be detected without reverse-transcription into cDNA using the methods of the invention. Polymerization-independent cleavage methods as described above are particularly well-suited for such embodiments. In other embodiments, the RNA can be first reverse-transcribed into cDNA in the absence of a probe, and then the cDNA product can be detected according to the methods of the invention. In still other embodiments, the RNA can be reverse-transcribed in the presence of a probe, simultaneously producing cDNA that can subsequently be amplified and/or detected and detecting the presence of the RNA by assessing fragmentation of the probe as described herein.

[0199]Where the RNA is reverse-transcribed in the absence of a probe, the RNA can be reverse transcribed into cDNA by any method known to one of skill in the art. The products of such reverse transcription can then be detected like any detectable nucleic acid according to the methods described herein.

[0200]Where the RNA is reverse-transcribed in the presence of a probe, the RNA can be reverse-transcribed by a DNA polymerase with 5'-3' nuclease activity that can use RNA as a template for DNA strand synthesis. As with all known DNA polymerase synthesis activities, such synthesis requires the presence of a primer, such as those described herein. The DNA polymerase that can use RNA is a template is preferably thermostable, so that multiple cycles of denaturation and DNA synthesis can occur without destroying the polymerase. Further, the DNA polymerase used for reverse transcription can preferably also synthesize DNA using a DNA template. Such polymerases are described in, for example, U.S. Pat. Nos. 6,468,775 (Carboxydothermus hydrogenformans DNA polymerase), 5,968,799 (Thermosipho africanus DNA polymerase), 5,736,373 (Bacillus pallidus DNA polymerase), 5,674,738 (Thermus species Z05 DNA polymerase), and 5,407,800 (Thermus aquaticus and Thermus thermophilus DNA polymerases), each of which is incorporated herein by reference in its entirety. In addition, methods and compositions for reverse transcribing an RNA using a thermostable DNA polymerase with reverse transcription activity are described in U.S. Pat. Nos. 5,693,517, 5,561,058, 5,405,774, 5,352,600, 5,310,652, and 5,079,352, each of which is incorporated herein by reference in its entirety.

[0201]Whether RNA or DNA, the denatured nucleic acid strand is then contacted with a primer and a probe under hybridization conditions, which enable the primer and probe to bind to the nucleic acid strand. In certain embodiments, two primers can be used to amplify the nucleic acid. In such embodiments, the two primers can be selected so that their relative positions along the nucleic acid are such that an extension product synthesized from one primer, after the extension produce is separated from its template (complement), can serve as a template for the extension of the other primer to yield an amplified product of defined length. The length of the product depends on the length of the sequence between the two primers and the length of the two primers themselves.

[0202]Because the complementary strands are typically longer than either the probe or primer, the strands have more points of contact and thus a greater chance of finding and binding each other over any given period of time. A high molar excess of probe and primer helps shift the equilibrium toward primer and probe annealing rather than template reannealing.

[0203]The primer should be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact length and composition of the primer can depend on many factors, including temperature of the annealing reaction, source and composition of the primer, proximity of the probe annealing site to the primer annealing site, and ratio of primer:probe concentration. For example, depending on the complexity of the sequence, an oligonucleotide primer typically contains about 15-30 nucleotides, although it may contain fewer or more nucleotides. The primers must be sufficiently complementary to selectively anneal to their respective strands and form stable duplexes.

[0204]Each primer can be selected to be "substantially" complementary to a strand of the nucleic acid. The primers need not reflect the exact sequence of the template, but must be sufficiently complementary to selectively hybridize to their respective strands under the appropriate reaction conditions. Non complementary bases or longer sequences can be interspersed into the primer or located at the ends of the primer, provided the primer retains sufficient complementarity with its template strand to form a stable duplex therewith. The non-complementary nucleotide sequences of the primers may include restriction enzyme sites. Any non-complementary nucleotide sequences are preferably not at the 3' end of the primer.

[0205]The probe preferably hybridizes to the nucleic acid to be detected before the polymerase binds the nucleic acid and primer and begins to extend the new nucleic acid strand from the primer based upon the template of the detectable nucleic acid. It is possible for the polymerase to bind the primer and nucleic acid to be detected before the probe contacts the detectable nucleic acid; however, this arrangement can result in decreased probe fragmentation unless multiple cycles of primer extension are performed, as in a preferred PCR based 5' nuclease reaction as described below. Accordingly, it is preferable that the probe hybridize to the nucleic acid to be detected before primer extension by the polymerase begins.

[0206]A variety of techniques known to one of skill in the art can be employed to enhance the likelihood that the probe will hybridize to the detectable nucleic acid before primer extension polymerization reaches this duplex region, or before the polymerase attaches to the upstream oligonucleotide in the polymerization-independent process. For example, short primer molecules generally require cooler temperature to form sufficiently stable hybrid complexes with the nucleic acid. Therefore, the probe can be designed to be longer than the primer so that the probe anneals preferentially to the nucleic acid at higher temperatures relative to primer annealing.

[0207]One can also use primers and probes having differential thermal stability based upon their nucleotide composition. For example, the probe can be chosen to have greater G/C content and, consequently, greater thermal stability than the primer. Alternatively or additionally, one or more modified, non-standard or derivatized DNA bases may be incorporated into primers or probes to result in either greater or lesser thermal stability in comparison to primers or probes having only conventional DNA bases. Examples of such modified, non-standard or derivatized bases may be found in U.S. Pat. Nos. 6,320,005, 6,174,998, 6,001,611, and 5,990,303, each of which is hereby incorporated by reference in its entirety.

[0208]Further, the temperature of the reaction can also be varied to take advantage of the differential thermal stability of the probe and primer. For example, following denaturation at high temperatures as described above, the reaction can be incubated at an intermediate temperature which permits probe but not primer binding, followed by a further temperature reduction to permit primer annealing and subsequent extension.

[0209]A high molar excess of probe to primer concentration can also be used to preferentially favor binding of the probe before the primer. Such probe concentrations are typically in the range of about 2 to 20 times higher than the respective primer concentration, which is generally 0.5-5×10^-7 M.

[0210]Template-dependent extension of the oligonucleotide primer(s) is catalyzed by a DNA polymerase in the presence of adequate amounts of the four deoxyribonucleoside triphosphates (dATP, dGTP, dCTP, and dTTP) or analogs, e.g., dUTP, as discussed above, in a reaction medium which is comprised of the appropriate salts, metal cations, and pH buffering system. Suitable polymerizing agents are enzymes known to catalyze primer and template-dependent DNA synthesis and possess the 5' to 3' nuclease activity. Such enzymes include, for example, Escherichia coli DNA polymerase I, Thermus thermophilus DNA polymerase, Bacillus stearothermophilus DNA polymerase, Thermococcus littoralis DNA polymerase, Thermus aquaticus DNA polymerase, Thermatoga maritima DNA polymerase and Thermatoga neapolitana DNA polymerase and Z05 DNA polymerase. Further, the reaction conditions for performing DNA synthesis using these DNA polymerases are well known in the art. To be useful in the methods of the present invention, the polymerizing agent should possess 5' nuclease activity that can efficiently cleave the oligonucleotide and release labeled fragments so that a detectable signal is directly or indirectly generated.

[0211]The products of the synthesis are duplex molecules consisting of the template strands and the primer extension strands. Byproducts of this synthesis are probe fragments which can consist of a mixture of mono-, di- and oligo-nucleotide fragments. In preferred embodiments, repeated cycles of denaturation, probe and primer annealing, and primer extension and cleavage of the probe can be performed, resulting in exponential accumulation of the amplified region defined by the primers and exponential generation of labeled fragments. Such repeated thermal cycling is generally known in the art as the polymerase chain reaction (PCR). Sufficient cycles can be performed to achieve fragment a sufficient amount of the probe to distinguish positive reactions, i.e., the nucleic acid to be detected is present, from negative reactions, i.e., the nucleic acid to be detected is not present. Generally, positive reactions will exhibit a signal that is several orders of magnitude greater than a negative reaction.

[0212]In certain preferred embodiments, the PCR reaction is carried out as an automated process which utilizes a thermostable enzyme. In this process the reaction mixture is cycled through a denaturing step, a probe and primer annealing step, and a synthesis step, whereby cleavage and displacement occur simultaneously with primer dependent template extension. A thermal cycler, such as the ABI 3700 (Applied Biosystems, Inc., Foster City, Calif.), which is specifically designed for use with a thermostable enzyme, may be employed. In certain of such embodiments of the invention, the nucleic acids to be detected can be amplified in the absence of a detectably-labeled probe, followed by detection of the amplification product in a separate reaction. Alternatively, the nucleic acids to be detected can be amplified in the presence of the probe, allowing amplification and detection in a single reaction.

[0213]Temperature stable polymerases are preferred in this automated process because the preferred way of denaturing the double stranded extension products is by exposing them to a high temperature (about 95° C.) during the PCR cycle. For example, U.S. Pat. No. 4,889,818 discloses a representative thermostable enzyme isolated from Thermus aquaticus. Additional representative temperature stable polymerases include, e.g., polymerases extracted from the thermostable bacteria Thermus flavus, Thermus ruber, Thermus thermophilus, Bacillus stearothermophilus (which has a somewhat lower temperature optimum than the others listed), Thermus lacteus, Thermus rubens, Thermotoga maritima, Thermococcus littoralis, Methanothermus fervidus, and Pyrococcus furiosus (Stratagene, La Jolla, Calif.). As described above, certain of these thermostable polymerases can synthesize DNA from an RNA template. Where an RNA molecule is to be detected according to the methods of the invention, a DNA polymerase that can synthesize DNA from an RNA template, i.e., with reverse transcription activity, should be used.

[0214]In other aspects, the methods of the present invention can also be used to quantify an amount of a nucleic acid of a member of the Japanese encephalitis virus serogroup in a sample. In such methods, a 5' nuclease reaction as described above is performed, and the amount of fluorescence produced is quantified. The amount of fluorescence can be quantified by any method known to one of skill in the art without limitation. In certain embodiments, the amount of fluorescence emitted can be quantified with a fluorometer. This amount of fluorescence can be compared to the amount of fluorescence emitted by a control reaction. The control reaction is preferably performed with the same reagents and at the same time as the reaction performed with the sample with a known amount of nucleic acid of a member of the Japanese encephalitis virus serogroup. Alternatively, the amount of fluorescence emitted by the fluorescent moiety can be compared to a standard curve plotting fluorescence against viral nucleic acid concentration. A representative standard curve is presented in FIG. 6. Further guidance in quantifying an amount of a nucleic acid of a member of the Japanese encephalitis virus serogroup can be found in published U.S. Patent Application Publication No. 2002/0058262 and European Patent Nos. 1 138 780, 1 138 783, and 1 138 784.

[0215]4.2. Other Methods for Detecting a Nucleic Acid of a Member of the Japanese Encephalitis Serogroup that Use One or More Primers and a Probe

[0216]In addition to the 5' nuclease reactions described above, the invention further provides other methods can be used to be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup, as described below.

[0217]In certain embodiments, any method known by one of skill in the art that uses two nucleic acid primers and a nucleic acid probe to detect a nucleic acid can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. The nucleic acid primers and probes described Sections 3.1 and 3.2 can be used in any such method known to one of skill in the art, without limitation. Exemplary amplification reactions that can be used to detect the viral nucleic acids include, e.g., polymerase chain reaction (PCR) and ligase chain reaction (LCR) (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990)), strand displacement amplification (SDA) (Walker, et al. Nucleic Acids Res. 20(7): 1691-6 (1992); Walker PCR Methods Appl 3(1): 1-6 (1993)), transcription-mediated amplification (Phyffer, et al, J. Clin. Microbiol. 34:834-841 (1996); Vuorinen, et al., J. Clin. Microbiol. 33:1856-1859 (1995)), nucleic acid sequence-based amplification (NASBA) (Compton, Nature 350(6313):91-2 (1991), rolling circle amplification (RCA) (Lisby, Mol. Biotechnol. 12(1):75-99 (1999)); Hatch et al., Genet. Anal. 15(2):35-40 (1999)) branched DNA signal amplification (bDNA) (see, e.g., Iqbal et al., Mol. Cell. Probes 13(4):315-320 (1999)) and Q-Beta Replicase (Lizardi et al., Bio/Technology 6:1197 (1988)).

[0218]One example of such methods is amplifying a nucleic acid of a member of the Japanese encephalitis serogroup and detecting the presence of the nucleic acid with a probe that is a molecular beacon. Such probes contain a target recognition sequence that can hybridize to a flanked by complementary sequences that can form a hairpin. The molecular beacon has a fluorescent moiety and a quencher moiety on opposite ends of the probe. Hybridization of the molecular beacon to the nucleic acid of a member of the Japanese encephalitis serogroup separates the fluorescent moiety from the quencher moiety allowing detection of the fluorescent moiety, and thus revealing the presence of the nucleic acid of a member of the Japanese encephalitis serogroup. Any probe of the invention may be used in such methods with the addition of several residues on the 5' and 3' ends of the probe that one of skill in the art recognizes as capable of forming a hairpin structure. Further guidance in selection and use of molecular beacons may be found in an article by Tyagi and Kramer, 1996, Nat. Biotechnol. 14:303-308, which is hereby incorporated by reference in its entirety.

[0219]In still another example, two primers and a probe of the invention may be used to detect a nucleic acid of a member of the Japanese encephalitis serogroup using nucleic acid sequence-based amplification. Nucleic acid sequence-based amplification (NASBA) is a robust amplification technology that can be used to detect a nucleic acid of a member of the Japanese encephalitis serogroup. In NASBA methods, three enzymes are used, including reverse transcriptase, T7 RNA polymerase, and RNase H. The final amplification product is single-stranded RNA with a polarity opposite that of the nucleic acid to be detected. The amplified RNA product can be detected through the use of a target-specific capture probe bound to magnetic particles in conjunction with a ruthenium-labeled detector probe and an instrument (NucliSens Reader; bioMerieux) capable of measuring electrochemiluminescence (ECL). Alternatively, RNA amplified by NASBA can specifically be detected in real time by including molecular beacon probes in the amplification reaction, as described above. Further guidance on use of the primers and probes of the invention may be found in articles by Compton, 1991, Nature 350:91-92 and Kievits et al., 1991, J. Virol. Methods 35:273-86, each of which is hereby incorporated by reference in its entirety.

[0220]Other examples of such methods include the 5' nuclease reactions described extensively above. Another example of such methods include amplification of a nucleic acid of a member of the Japanese encephalitis serogroup with two primers of the invention, followed by detection of the amplified nucleic acid with a probe of the invention. Still other examples of such methods that may be used or adapted by one of skill in the art to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup may be found in U.S. Pat. Nos. 6,403,339, 6,329,152, 5,952,202, and 5,387,510, each of which is hereby incorporated by reference in its entirety.

[0221]In other embodiments, any method known by one of skill in the art that uses a nucleic acid primer and a nucleic acid probe to detect a nucleic acid can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. The nucleic acid primers and probes described Sections 3.1 and 3.2 can be used in any such method known to one of skill in the art, without limitation. In certain of these methods, one of skill in the art will recognize that a primer of the invention may also be used as a probe, and a probe of the invention used as a primer.

[0222]For example, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be hybridized to a primer of the invention that is bound to a solid support. A detectably-labeled probe of the invention can then be hybridized to the nucleic acid to be detected, thereby indicating the presence of the nucleic acid. Alternatively, the probe can be bound to the solid support and used to capture the nucleic acid, and then the primer can be detectably labeled and hybridized to the nucleic acid, thereby indicating the presence of the nucleic acid.

[0223]Another example of methods that use a nucleic acid primer and a probe to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup involves the use of nanoparticles. In such methods, two oligonucleotides, such as a primer or probe of the invention, that can hybridize to different regions of a nucleic acid to be detected are covalently linked to a nanoparticle. The nanoparticles are contacted with a nucleic acid of a member of the Japanese encephalitis virus serogroup under hybridization conditions. If the nucleic acid is present, the nucleic acid will bind to the oligonucleotides attached to the nanoparticles, producing a large molecular weight complex that can be detected. The complex can be detected by any method known to one of skill in the art without limitation. In certain embodiments, the complex is detected by precipitation of the complex. Further guidance on methods of using nanoparticles in connection with the primers and probes of the invention may be found in Taton et al., 2000, Science 289(5485):1757-60 and U.S. Pat. Nos. 6,506,564, 6,495,324, 6,417,340, 6,399,303, and 6,361,944.

[0224]In yet another example, rolling circle amplification ("RCA") can be used as part of a method for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup. In certain embodiments of RCA methods, a DNA circle is amplified by polymerase extension of a complementary primer. Any of the primers or probes of the invention can be used in such methods. Methods of circularizing DNA are well known in the art, and include, for example, ligating the ends of a DNA molecule together under conditions which favor intramolecular ligation. The single-stranded product concatamer product can then be detected by any method of detecting a nucleic acid known to one of skill in the art without limitation. For example, the concatamer product can be detected using a detectably-labeled probe of the invention. Other examples of methods of detecting a nucleic acid of known sequence are extensively described herein. In other embodiments of RCA, a second primer can be used that is complementary to the concatamer product. This primer allows exponential amplification of the sequences present in the circular DNA template. The products of the amplification can still be detected, for example, by using a detectably-labeled probe of the invention. Further guidance on using the primers and probes of the invention in RCA methods for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup may be found in U.S. Pat. Nos. 6,344,329, 6,350,580, 6,221,603, 6,210,884, 5,648,245, and 5,714,320 and international patent publication no. WO95/35390, each of which is hereby incorporated by reference in its entirety.

[0225]Still another example of such methods is the polymerization-independent 5' nuclease reaction described above. Still other examples of methods of using a primer and a probe that can be used or adapted by one of skill in the art to detect a member of the Japanese encephalitis virus serogroup are described in U.S. Pat. Nos. 6,316,200, 6,268,128, 6,180,338, 5,716,784, and 5,573,906, each of which is hereby incorporated by reference in its entirety.

[0226]In certain embodiments, any assay known by one of skill in the art that uses two nucleic acid primers that can amplify a nucleic acid to detect the nucleic acid can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. The nucleic acid primers described in Section 3.1 can be used in any such method known to one of skill in the art, without limitation. In addition, one of skill in the art will recognize that a probe of the invention may also be used as a primer in certain of these methods.

[0227]In one example of such methods, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected by amplifying the nucleic acid with at least one primer that comprises a hairpin structure containing a fluorescent moiety and a quencher moiety at the 5' end of the molecule. Incorporation of the primer into the amplification product can then separate the fluorescent moiety from the quencher moiety, allowing detection of the fluorescent moiety. Detection of the fluorescent moiety reveals the presence of the nucleic acid of a member of the Japanese encephalitis virus serogroup. One of skill in the art will easily recognize the use of the primers or probes of the invention in such methods by incorporating additional residues in the primer or probe to form the necessary hairpin structure. Further guidance in design and selection of such primers and probes may be found in Nazerenko et al., 1997, Nucleic Acids Res. 25:2516-2521 and in Thelwell et al., 2000, Nucleic Acids Res. 28:3752-3761, each of which is hereby incorporated by reference in its entirety.

[0228]In another example of such methods, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected using Strand Displacement Amplification ("SDA"). In such methods, amplified Japanese encephalitis virus serogroup nucleic acids are detected by incorporation of a single-stranded primer that comprises a fluorescent moiety, a quencher moiety, and an engineered restriction site separating the two moieties. One of skill in the art can easily recognize how to modify any of the primers or probes of the invention for use in SDA.

[0229]In a first amplification reaction used in SDA, the primer is used to amplify the nucleic acid of a member of the Japanese encephalitis serogroup in the presence of, for example, thio-dCTP, thereby incorporating the primer into the amplification product. Then, a restriction endonuclease can be used to nick the restriction site in the primer. The restriction endonuclease cannot cut both strands of the amplification product because of the incorporation of thio-dCTP in the amplification product. Finally, the 3' end of the primer created by the nick can be used to prime a new polymerization reaction, thereby displacing the portion of the strand 3' to the nick from the template strand. Displacement of the strand separates the fluorescent moiety from the quencher moiety, thereby preventing quenching of fluorescence emitted by the fluorescent moiety. The nucleic acid of a member of the Japanese encephalitis serogroup can thereby be detected and/or quantified by measuring the presence and/or amount of fluorescence. Further guidance on selection and modification of primers and probes for use in SDA may be found in Little et al., 1999, Clin. Chem. 45-777-784 and U.S. Pat. Nos. 6,528,254 and 6,528,632, each of which is hereby incorporated by reference in its entirety.

[0230]In another example, a nucleic acid of a member of the Japanese encephalitis serogroup may be detecting using transcription-mediated amplification ("TMA"). TMA is an RNA transcription amplification system that uses RNA polymerase and reverse transcriptase to amplify the nucleic acids to be detected. In the method, a primer of the invention with a promoter for RNA polymerase is used to prime reverse transcription of an RNA of a member of the Japanese encephalitis virus serogroup. The RNAse activity of reverse transcriptase then degrades the RNA template, releasing the cDNA strand. Second strand synthesis is primed with a second primer of the invention and catalyzed by reverse transcriptase. RNA polymerase then recognizes the promoter synthesized in the second strand and catalyzes multiple cycles of RNA transcription from the second strand. The RNA product can then be detected or can serve as template for another round of amplification.

[0231]The RNA product of TMA can then be detected by any method known to one of skill in the art. In certain embodiments, the RNA product can be detected with a probe of the invention. In other embodiments, the RNA product can be detected with a probe of the invention that has been labeled with an acridine-ester label (Gen-Probe, Inc., San Diego, Calif.). Such labels can be chemically removed from unhybridized probe while labels on hybridized probes remain undisturbed. Thus, in such embodiments, presence of a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected by detecting the presence of the acridine-ester label. Further guidance in using the primers and probes of the invention in TMA-based methods may be found in Arnold et al., 1989, Clin. Chem. 35:1588-1594, Miller et al., 1994, J. Clin. Microbiol. 32-393-397, and U.S. Pat. Nos. 6,335,166 and 6,294,338, each of which is hereby incorporated by reference in its entirety.

[0232]In yet another example, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected using diagnostic PCR. In such methods, the presence of a nucleic acid to be detected is indicated by the successful template-dependent amplification of a PCR product. Generally, the identity of the PCR product can be determined from the size of the PCR product; successful amplification of the nucleic acid to be detected will generally result in a PCR product of known size. Methods for determining the size of a nucleic acid, such as a PCR product, are well-known to the art and include, for example, gel and capillary electrophoresis, among others.

[0233]Other methods of detecting successful amplification of a PCR product thereby revealing the presence of a member of the Japanese encephalitis serogroup include using non-specific DNA binding dyes. For example, SYBR® Green (Molecular Probes, Inc., Eugene, Oreg.) can be included in the amplification reaction, which allows the detection and quantification of any double-stranded DNA generated during PCR. Examples of such methods may be found in U.S. Pat. Nos. 6,323,337 and 5,863,753, each of which is incorporated by reference in its entirety.

[0234]Finally, other methods that can be used or adapted by one of skill in the art to use the primers and probes of the invention to detect a member of the Japanese encephalitis virus serogroup are described in U.S. Pat. Nos. 6,528,632, 6,475,729, 6,361,944, 6,329,152, 6,270,967, 6,258,546, 6,063,603, 6,057,099, 6,040,166, 5,914,230, 5,843,650, 5,747,255, 5,747,251, 5,731,146, 5,712,386, 5,635,347, 5,554,517, 5,409,818, 5,384,242, 4,965,188, 4,868,104, 4,800,159, and 4,683,195, each of which is hereby incorporated by reference in its entirety.

[0235]In other embodiments, any assay known by one of skill in the art that uses a single nucleic acid primer or probe that can hybridize to a nucleic acid to detect the nucleic acid can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup. The nucleic acid primers and probes described in Section 3.1 and 3.2 can be used in any such method known to one of skill in the art, without limitation. In addition, one of skill in the art will recognize that a primer of the invention may also be used as a probe, and a probe of the invention used as a primer in certain of the described methods.

[0236]For example, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected using a primer to initiate a primer extension reaction. Successful extension of the primer by a nucleic acid polymerase indicates the presence of the nucleic acid of a member of the Japanese encephalitis virus serogroup. A primer extension product that indicates the presence of a member of the Japanese encephalitis virus serogroup can be detected by any method known to one of skill in the art. For example, the primer extension reaction can incorporate ³²P-labeled or fluorescently-labeled nucleotides.

[0237]Other examples of single primer or probe detection methods that describe methods that can be used as described or adapted by one of skill in the art to detect a member of the Japanese encephalitis virus serogroup can be found in U.S. Pat. Nos. 6,440,707, 6,379,888, 6,368,803, 6,365,724, 6,361,944, 6,352,827, 6,326,145, 6,312,906, 6,268,128, 6,261,784, 6,177,249, 6,140,055, 6,130,047, 6,124,090, 6,121,001, 6,110,677, 6,054,279, 6,022,686, 5,981,176, 5,958,700, 5,945,283, 5,935,791, 5,919,630, 5,888,739, 5,888,723, 5,882,867, 5,876,924, 5,866,336, 5,856,092, 5,853,990, 5,846,726, 5,814,447, 5,808,036, 5,800,989, 5,795,718, 5,792,614, 5,710,028, 5,683,875, 5,683,872, 5,679,510, 5,641,633, 5,597,696, 5,595,890, 5,571,673, 5,547,861, 5,525,462, 5,514,546, 5,491,063, 5,437,977, 5,294,534, 5,118,605, 5,102,784, 4,994,373, 4,851,331, 4,767,700, and 4,683,194, each of which is hereby incorporated by reference in its entirety.

[0238]Certain of the above-referenced U.S. patents disclose methods that can use either one or two primers, or either one or two primers and a probe. The above description is not meant to categorize such methods. Methods of detecting a nucleic acid using, for example, two primers provided in a U.S. patent that is described as providing a method for detecting a nucleic acid using a single primer are also incorporated by reference and can be used with the primers, probes, and kits of the invention.

[0239]4.3. Methods for Detecting a Nucleic Acid of a Member of the Japanese Encephalitis Serogroup and Certain Other Flaviviruses using a Probe

[0240]In addition to the assays for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup described above, the invention further provides methods for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup and certain other flaviviruses. The flaviviruses that can be detected according to these methods are described in Section 3.4, above.

[0241]In certain embodiments, any method known to one of skill in the art that uses a nucleic acid probe to detect a nucleic acid can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup and certain other flaviviruses. Nucleic acid probes that can be used to detect nucleic acids of members of the Japanese encephalitis virus serogroup and certain other flaviviruses are described in Section 3.2, above.

[0242]In certain embodiments, the probes of the invention can be used to determine if viral sequences of nucleic acids of members of the Japanese encephalitis virus serogroup and certain other flaviviruses are present in a sample by determining if the probes bind to the viral sequences present in the sample. For example, the detection can be accomplished using a dot blot format. In the dot blot format, the unlabeled amplified sample is bound to a solid support, such as a membrane, the membrane incubated with labeled probe under suitable hybridization conditions, the unhybridized probe removed by washing, and the filter monitored for the presence of bound probe. When multiple samples are analyzed with a single probe, the dot blot format is quite useful. Many samples can be immobilized at discrete locations on a single membrane and hybridized simultaneously by immersing the membrane in a solution of probe.

[0243]An alternate method that is quite useful when large numbers of different probes are to be used is a "reverse" dot blot format, in which the amplified sequence contains a label, and the probe is bound to the solid support. This format would be useful if the assay methods of the present invention were used as one of a battery of methods to be performed simultaneously on a sample. In this format, the unlabeled probes are bound to the membrane and exposed to the labeled sample under appropriately stringent hybridization conditions. Unhybridized labeled sample is then removed by washing under suitably stringent conditions, and the filter is then monitored for the presence of bound sequences.

[0244]Both the forward and reverse dot blot assays can be carried out conveniently in a microtiter plate; see U.S. patent application Ser. No. 695,072, filed May 3, 1991, which is a CIP of U.S. patent application Ser. No. 414,542, filed Sep. 29, 1989, now abandoned, each of which is incorporated herein by reference in its entirety. The probes can be attached to bovine serum albumen (BSA), for example, which adheres to the microliter plate, thereby immobilizing the probe.

[0245]Another example of a method of using a probe of the invention to detect a nucleic acid of members of the Japanese encephalitis virus serogroup and certain other flaviviruses is described in U.S. Pat. No. 6,383,756, which provides a method for detecting a nucleic acid bound to a membrane, and which is hereby incorporated by reference in its entirety.

[0246]In another example, a nucleic acid of a member of the Japanese encephalitis virus serogroup can be detected using branched-DNA-based methods. In such methods, a dendrimer monomer is constructed of two DNA strands that share a region of sequence complementarity located in the central portion of each strand. When the two strands anneal to form the monomer the resulting structure has a central double-stranded center bordered by four single-stranded ends. A dendrimer can be assembled from monomers by hybridization of the single stranded ends of the monomers to each other, while still leaving many single-stranded ends free. These free single-stranded ends can have the sequences of any of the primers or probes of the invention. A dendrimer can be detectably-labeled with any detectable moiety known to one of skill in the art without limitation, as described above in connection with the probes of the invention.

[0247]Dendrimers can then be used as a probe, in, for example, the "dot blot" assays described below. In addition, a dendrimer can be used as a probe in any method known to one of skill in the art in which the probe is directly detected. A probe is directly detected when the presence of the probe can be determined without any subsequent reaction or modification, such as a dot blot or Southern hybridization. Further guidance on the selection and use of dendrimers as probes to detect a nucleic acid of a member of the Japanese encephalitis serogroup or other detectable flaviviruses may be found in U.S. Pat. No. 6,261,779 and in Nilsen et al., 1997, J. Theoretical Biology 187:273-284, Capaldi et al., 2000, Nucleic. Acids Res., 28(7):21e, Wang et al., 1998, J. Am. Chem. Soc. 120:8281-8282, and Wang et al., 1998, Electroanalysis 10(8):553-556, each of which is hereby incorporated by reference in its entirety.

[0248]One of skill in the art will recognize that the probes of the invention can be used in combination with any primer that selectively hybridizes to a virus that can be detected with the probes of the invention. Accordingly, it is intended that methods of detecting a detectable flavivirus with a probe of the invention in combination with any primers that selectively hybridize to a detectable flavivirus fall within the scope of the present invention.

[0249]Any method that uses a single primer or probe that can be used to detect a nucleic acid of a member of the Japanese encephalitis virus serogroup described in Section 4.2, above, can be used with a probe of the invention to detect other flaviviruses described in Section 3.4, above.

5. Kits

[0250]In another aspect, the present invention provides kits that can be used to detect a nucleic acid of a Japanese encephalitis virus serogroup member and/or certain other flaviviruses. The members of the Japanese encephalitis virus serogroup that can be detected with the kits of the invention are described in Section 3.3, above, while the nucleic acids of other flaviviruses that can be detected with the kits of the invention are described in Section 3.4, above.

[0251]In certain embodiments, the kit comprises a probe of the invention. In some embodiments, the kit comprises a primer of the invention. In some embodiments, the kit comprises a combination of one or more of the primers and probes of the invention.

[0252]For example, in one embodiment the kit comprises a first nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 1 and a second nucleic acid primer that hybridizes to a nucleic acid of SEQ ID NO.: 9. In other embodiments, the kits comprise a primer (e.g., at least one upstream and/or one downstream primer) comprising a polynucleotide that hybridizes to SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or a complement thereof. Exemplary primers may be selected from, e.g., SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67.

[0253]In some embodiments, the kits comprise at least one upstream and/or one downstream primer selected from SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, or SEQ ID NO:55.

[0254]In other embodiments, the kits comprise at least one upstream and/or one downstream primer selected from SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO:63.

[0255]In some of the above-described embodiments, the kits also comprise a nucleic acid probe that hybridizes to a nucleic acid of SEQ ID NO.: 16, or the complement thereof, as described herein.

[0256]In certain embodiments, the kits comprise two nucleic acid primers and a nucleic acid probe for detecting a nucleic acid of a member of the Japanese encephalitis virus serogroup. The nucleic acid primers that can be a component of the kits of the invention are extensively described in Section 3.1, above, while the nucleic acid probes that can be a component of the kits of the invention are described in Section 3.2, above. The probes can optionally be labeled as described above. In certain embodiments, the kits comprise a thermostable DNA polymerase. In certain embodiments, the thermostable DNA polymerase has reverse transcription activity. In certain embodiments, the kits comprise instructions for detecting a nucleic acid of a detectable flavivirus according to the methods of the invention. In other embodiments, the kits comprise instructions for detecting a member of the Japanese encephalitis virus serogroup. In other embodiments, the kits comprise one or more containers to hold the components of the kit.

[0257]In certain embodiments, the kits can contain a composition comprising a primer of the invention. The kits can also contain a composition comprising a probe of the invention. The kits can further contain a composition comprising a thermostable DNA polymerase. In some embodiments, the thermostable DNA polymerase is selected from the group of Carboxydothermus hydrogenformans DNA polymerase, Thermosipho africanus DNA polymerase, Bacillus pallidus DNA polymerase, Thermus species Z05 DNA polymerase, Thermus aquaticus DNA polymerase, Thermus thermophilus DNA polymerase, Thermatoga maritima DNA polymerase, Thermatoga neapolitana DNA polymerase and Thermus sps17 DNA polymerase The compositions comprising a primer or probe of the invention or a thermostable DNA polymerase can further comprise additional reagents. For example, the compositions can comprise suitable preservatives prevent degradation of the composition, suitable buffers to modulate the pH of the composition, suitable diluents to alter the viscosity of the compositions, and the like.

[0258]The kits can additionally comprise other reagents for carrying out a 5' nuclease reactions, as described above. In addition, the kits can comprise reagents to facilitate the detection of a fragmented probe that indicates the presence of a nucleic acid of a Japanese encephalitis virus serogroup member. Kits that can be used to detect a nucleic acid of defined sequence are described in U.S. Pat. Nos. 6,514,736, 6,197,563, 6,040166, and 5,641,864, each of which is incorporated herein by reference in its entirety. One of skill in the art can easily use the primers and probes of the invention to modify the disclosures of these U.S. patents to design additional kits that are also within the scope of the present invention.

EXAMPLES

Example 1

Amplification and Detection of West Nile Virus RNA

[0259]A lysate of virus-infected cell culture supernatant was received from Dr. R. Lanciotti of the Centers for Disease Control and Prevention. Nucleic acids were purified from the lysate using reagents from the QIAamp Viral RNA Mini Kit (Qiagen Inc., Valencia, Calif.) according to the manufacturer's instructions. Serial 10-fold dilutions (10^-2-10^-7) of the purified nucleic acids were made. Fifty microliters of each dilution were amplified in 5' nuclease reaction assays using TaqMan® reagents and methods by RT-PCR in 100 μl reactions containing 1 μM primers (each of SEQ ID NO:8 and SEQ ID NO:15), 55 mM Tricine (pH 7.7), 450 μM dNTPs (each of dATP, dCTP, dGTP, and dUTP), 2.7 mM manganese acetate, 135 mM potassium acetate, 7% (v/v) DMSO, 6% (V/V) glycerol, 5 units uracil-N-glycosylase, 40 units ZO5 DNA polymerase, and 0.15 μM probe (SEQ ID NO:28, labeled with FAM and CY5). Reverse transcription/PCR was performed in a COBAS TaqMan® Instrument (Roche Diagnostics, Pleasanton, Calif.) using the following thermalcycling parameters: 4 minutes at 50° C.→30 minutes at 59° C.→2 cycles of 15 seconds at 95° C., 50 seconds at 58° C.→60 cycles of 15 seconds at 91° C., 50 seconds at 58° C.→2 minutes at 40° C. An example of the amplification results is shown in FIG. 6.

[0260]Various embodiments of the invention have been described. The descriptions and examples are intended to be illustrative of the invention rather than limiting. Indeed, it will be apparent to those of skill in the art that modifications may be made to the various embodiments of the invention described without departing from the spirit of the invention or scope of the appended claims set forth below.

[0261]Each reference cited herein is hereby incorporated by reference in its entirety.

Sequence CWU 1

919125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genomes of flaviviruses 1gtaagccctc agaaccgtct cggaa 25225DNAArtificial Sequencecomplement to SEQ ID NO1 2ttccgagacg gttctgaggg cttac 25326DNAArtificial SequenceJapanese encephalitis virus serogroup Primer 1 3gwaasccnsy crramcysyy tcggrw 26426DNAArtificial SequenceWest Nile virus Primer 1 4gtaagccncy cagaaccgyy tcggaa 26525DNAArtificial SequenceJapanese encephalitis virus Primer 1 5gaaasccctc rraacygtyt cggaa 25626DNAArtificial SequenceMurray Valley encephalitis virus Primer 1 6gaaagcctcc cagamccgty tcggaa 26725DNAArtificial SequenceKoutango virus Primer 1, region of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus serogroup, KY1129 7gtaagccctc agaaccgtct cggaa 25825DNAArtificial SequenceExample Primer 1, Japanese encephalitis virus serogroup amplification primer 8gtaagccctc agaaccgtct cggaa 25925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genomes of flaviviruses, consensus sequence 9tctcctagtc tatcccaggt gtcaa 251025DNAArtificial Sequencecomplement to SEQ ID NO9 10agaggatcag atagggtcca cagtt 251124DNAArtificial SequenceJapanese encephalitis virus serogroup Primer 2 11yccyastmtw nyyccaggtr tcaa 241223DNAArtificial SequenceWest Nile virus Primer 2 12ycctagtcta tcccaggtrt caa 231324DNAArtificial SequenceJapanese encephalitis virus Primer 2 13cccyastmta tyyccaggtg tcaa 241424DNAArtificial SequenceMurray Valley encephalitis virus Primer 2 14tcctagtctt ttcccaggtg tcaa 241523DNAArtificial SequenceExample Primer 2, Japanese encephalitis virus serogroupamplification primer, region of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus serogroup, KY1129 15tcctagtcta tcccaggtgt caa 231628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of flaviviruses, KY1129 16ggactagagg ttagaggaga ccccgcgg 281728DNAArtificial Sequencecomplement to SEQ ID NO16 17ccgcggggtc tcctctaacc tctagtcc 281828DNAArtificial Sequenceprobe for detecting flaviviruses, oligonucleotide that hybridizes to conserved region of flaviviral nucleic acid 18ggwctagwgg ttagaggaga cccynnnn 281928DNAArtificial Sequenceprobe for detecting Japanese encephalitis virus serogroup members 19ggactagwgg ttagaggaga ccccrykk 282028DNAArtificial Sequenceprobe for detecting West Nile virus 20ggactagwgg ttagaggaga ccccrcgk 282128DNAArtificial Sequenceprobe for detecting Japanese encephalitis virus 21ggactagagg ttagaggaga ccccgygg 282228DNAArtificial Sequenceprobe for detecting Murray Valley encephalitis virus 22ggactagagg ttagaggaga ccccactc 282329DNAArtificial Sequenceprobe for detecting Kunjin virus 23aataygtgga ttacatgast tcaytgaag 292428DNAArtificial Sequenceprobe for detecting Dengue virus 24ggactagagg ttagaggaga ccccyssv 282528DNAArtificial Sequenceprobe for detecting yellow fever virus 25ggtctagagg ttagaggaga ccctccag 282628DNAArtificial Sequenceprobe for detecting Montana myotis leukencephalitis virus 26ggactagagg ttagaggaga ccccttcc 282728DNAArtificial Sequenceprobe for detecting Modoc virus 27ggactagagg ttgagggaga cccccggc 282828DNAArtificial SequenceExample Probe 1, Japanese encephalitis virus serogroup amplification primer 28ggactagagg ttagaggaga ccccgcgg 2829418DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate BFS1750 29ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctagcac 120gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgcaac 300ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 41830342DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate 1750-Std 30ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctagcac 120gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgcgcaact 300tggcaaggcc caaacccgct cgaagctgta gagacggggg aa 34231418DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate TD6-4G 31ttgccaccgg atgtcaggta aacggtgctg cctgtaacct ggccccaggt gactgggtta 60tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgcaac 300tcggcaaggc ccaaacccgc tcgaagctgt agagatgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 41832342DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate CoaV750 32ttgccaccgg atgtcaggta aacggtgctg cctgtaacct ggccccaggt gactgggtta 60ccaaagccaa tctggctgag tgcaaagccc ctcgttccga ttcgggaggg tccctggcac 120gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgcgcaact 300tggcaaggcc aaaacccgct cgaagctgta gagatggggg aa 34233418DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate L695121.05 33ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60tcaaagccaa tccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcat 120gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 41834418DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate TNM771K 34ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtca 60tcaaagccaa tctggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag agcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaanaacagc atattgacac ctggaaagac aggagatc 41835418DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate MSI-7 35ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggc gactgggtta 60tcaaagccaa tccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300ttggcaaggc ccaaacccgc tcaaagctgt agagacgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 41836405DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate Kern217 36ccggatgtca ggtaaacggt gctgtctgta acctggcccc aggtcactgg gttatcaaag 60ccaacccggc tgggtgcaaa gcccctcatt ccgactcggg agggtccctg gcacgtaggc 120tggagaggac gcacaagtca gaccagaaat gccacctgaa agcatgctaa aggtgctgtc 180tgtacatgcc ccaggaggac tgggttaaca aagcttaaca gccccagcgg cccaaaccat 240ggagtgcgtg accatggcgt aaggactaga ggttagagga gaccccgctg taacttggca 300aggcccaaac ccgctcaaag ctgtagagac gggggaagga ctagaggtta gaggagaccc 360cttgccgtta acgcaaacaa cagcatattg acacctggaa agaca 40537375DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate CoaV608 37cccaggcgac tgggttatca aagccaatcc ggctgggtgc aaagcccctc attccgactc 60gggagggtcc ctggcacgta ggctggagag gacgcacaag tcagaccaga aatgccacct 120gaaagcatgc taaaggtgct gtctgtacat gccccaggag gactgggtta acaaagctta 180acagccccag cggcccaaac catggagtgc gtgaccatgg cgtaaggact agaggttaga 240ggagaccccg ctgtaacttg gcaaggccca aacccgctca aagctgtaga gacgggggaa 300ggactagagg ttagaggaga ccccttgccg ttaacgcaaa caacagcata ttgacacctg 360gaaagacagg agatc 37538411DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate TBH-28 38ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60tcaaagccaa cccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120gtaggccgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaat 300ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac a 41139402DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate VR1265 39ccggaagtca ggtaaacggt gctgtctgta acctggcccc aggtgactgg gttatcaaag 60ccaatctggc tgggtgcaaa gcccctcatt ccgactcggg agggtccctg gcacgtaggc 120tggagcggac gcacaagtca gaccagaaat gccacctgaa agcatgctaa aggtgctgtc 180tgtacatgcc ccaggaggac tgggttaaca aagcttaaca gccccagcgg cccaaaccat 240ggagtgcgtg accatggcgt aaggactaga ggttagagga gaccccgctg taacttggca 300aggcccaaac ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc 360cttgccgtca acgcaaacaa cagcatattg acacctggaa ag 40240374DNASt. Louis encephalitis virus3' untranslated region of the genome of St. Louisencephalitis virus (SLEV) isolate CoaV353 40cccaggtgac tgggttatca aagccaatct agctgagtgc aaagcccctc attccgactc 60gggagggtcc ctggcacgta ggctggagag gacgcaaaag tcagaccaga aatgccacct 120gaaagcatgc taaaggtgct gtctgtacat gccccaggag gactgggtta acaaagctta 180acagccccag cggcccaaac catggagtgc gtgaccatgg cgtaaggact agaggttaga 240ggagaccccg ctgcaacttg gcaaggccca aacccgctcg aagctgtaga gacgggggaa 300ggactagagg ttagaggaga ccccttgccg ttaacgcaaa caacagcata ttgacacctg 360gaaagacagg agat 3744127DNAArtificial SequenceDengue virus consensus upstream primer 41gagccccgtc caaggacgta aaaagaa 274227DNAArtificial SequenceDengue virus consensus upstream primer 42gagccccgtc caaggacgta aaaagan 274327DNAArtificial SequenceDengue virus consensus upstream primer 43gagccccgtc caaggacgta aaaagnn 274427DNAArtificial SequenceDengue virus type I upstream primer 44gagccccgtc caaggacgta aaatgaa 274527DNAArtificial SequenceDengue virus type I upstream primer 45gagccccgtc caaggacgta aaatgan 274627DNAArtificial SequenceDengue virus type I upstream primer 46gagccccgtc caaggacgta aaatgnn 274727DNAArtificial SequenceDengue virus types II and III upstream primer 47gagccccgtc caaggacgtt aaaagaa 274827DNAArtificial SequenceDengue virus types II and III upstream primer 48gagccccgtc caaggacgtt aaaagan 274927DNAArtificial SequenceDengue virus types II and III upstream primer 49gagccccgtc caaggacgtt aaaagnn 275024DNAArtificial SequenceDengue virus type IV upstream primer 50attgaagtca ggccacttgt gcca 245124DNAArtificial SequenceDengue virus type IV upstream primer 51attgaagtca ggccacttgt gccn 245224DNAArtificial SequenceDengue virus type IV upstream primer 52attgaagtca ggccacttgt gcnn 245325DNAArtificial SequenceDengue virus downstream primer 53gatctctggt ctttcccagc gtcaa 255425DNAArtificial SequenceDengue virus downstream primer 54gatctctggt ctttcccagc gtcan 255525DNAArtificial SequenceDengue virus downstream primer 55gatctctggt ctttcccagc gtcnn 255628DNAArtificial Sequenceyellow fever virus upstream primer 56aaccgggata aaaactacgg gtggagaa 285728DNAArtificial Sequenceyellow fever virus upstream primer 57aaccgggata aaaactacgg gtggagan 285828DNAArtificial Sequenceyellow fever virus upstream primer 58aaccgggata aaaactacgg gtggagnn 285926DNAArtificial Sequenceyellow fever virus upstream primer 59ataaaaacta cgggtggaga accgga 266026DNAArtificial Sequenceyellow fever virus upstream primer 60ataaaaacta cgggtggaga accggn 266124DNAArtificial Sequenceyellow fever virus downstream primer 61actccggtct ttccctggcg tcaa 246224DNAArtificial Sequenceyellow fever virus downstream primer 62actccggtct ttccctggcg tcan 246324DNAArtificial Sequenceyellow fever virus downstream primer 63actccggtct ttccctggcg tcnn 246425DNAArtificial SequenceSt Louis encephalitis virus upstream primer 64caaagcccct cattccgact cggga 256525DNAArtificial SequenceSt Louis encephalitis virus upstream primer 65caaagcccct cattccgact cgggn 256623DNAArtificial SequenceSt Louis encephalitis virus downstream primer 66tctcctgtct ttccaggtgt caa 236723DNAArtificial SequenceSt Louis encephalitis virus downstream primer 67tctcctgtct ttccaggtgt can 236823DNAArtificial SequenceSt. Louis encephalitis virus (SLEV) first primer complement 68ttgacacctg gaaagacagg aga 236924DNAArtificial SequenceSt. Louis encephalitis virus (SLEV) second primer 69caaagcccct cattccgact cggg 247030DNAArtificial Sequenceflavivirus anti-sense probe 70gggtctcctc taacctctag tccttccccc 307198DNAWest Nile virusWest Nile virus strain AF196835 region of conserved sequence in 3' untranslated region 71caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9872105DNAWest Nile virusWest Nile virus strain AF196835 region of conserved sequence in 3' untranslated region 72tgactgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 10573121DNAWest Nile virusWest Nile virus strain AF196835 region of conserved sequence in 3' untranslated region 73cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60gactgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 1217425DNAArtificial SequenceExample Primer 2, Japanese encephalitis virus serogroup amplification primer 74tctcctagtc tatcccaggt gtcaa 257520DNAArtificial Sequencedetectably-labeled oligonucleotide 75ngttagagga gaccctccag 207620DNAArtificial Sequencefluorescent moiety-quencher moiety pair in probevariant of SEQ ID NO28 76ngttagagga gaccccgcgn

207720DNAArtificial Sequencefluorescent moiety-quencher moiety pair in probevariant of SEQ ID NO28 77ngnnagagga gannnngngn 207822DNAArtificial Sequencefluorescent moiety-quencher moiety pair in probevariant of SEQ ID NO70 78nctaacctct agtccttccc cn 227922DNAArtificial Sequencefluorescent moiety-quencher moiety pair in probevariant of SEQ ID NO70 79nnnaacctct agtccttccc cn 228020DNAArtificial Sequencefluorescent moiety-quencher moiety pair in probevariant of SEQ ID NO25 80ngttagagga gaccctccan 208198DNAWest Nile virusWest Nile virus strain AF260968 region of conserved sequence in 3' untranslated region 81caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988298DNAWest Nile virusWest Nile virus strain AF260969 region of conserved sequence in 3' untranslated region 82caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988398DNAWest Nile virusWest Nile virus strain AF481864 region of conserved sequence in 3' untranslated region 83caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988498DNAWest Nile virusWest Nile virus strain M12294 region of conserved sequence in 3' untranslated region 84caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 988598DNAWest Nile virusWest Nile virus strain AF206518 region of conserved sequence in 3' untranslated region 85caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988698DNAWest Nile virusWest Nile virus strain AF317203 region of conserved sequence in 3' untranslated region 86caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988798DNAWest Nile virusWest Nile virus strain AF202541 region of conserved sequence in 3' untranslated region 87caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988898DNAWest Nile virusWest Nile virus strain AF404757 region of conserved sequence in 3' untranslated region 88caaccccagg aggactgggt gaacaaagcc gtgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 988998DNAWest Nile virusWest Nile virus strain AF404753 region of conserved sequence in 3' untranslated region 89caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989098DNAWest Nile virusWest Nile virus strain AF404754 region of conserved sequence in 3' untranslated region 90caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989198DNAWest Nile virusWest Nile virus strain AF404755 region of conserved sequence in 3' untranslated region 91caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989298DNAWest Nile virusWest Nile virus strain AF404756 region of conserved sequence in 3' untranslated region 92caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989398DNAWest Nile virusWest Nile virus strain AF017254 region of conserved sequence in 3' untranslated region 93caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989498DNAWest Nile virusWest Nile virus strain L48977 region of conserved sequence in 3' untranslated region 94caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag caggacccca cgtgctttag cctcaaag 989598DNAWest Nile virusWest Nile virus strain AF196536 region of conserved sequence in 3' untranslated region 95caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 989698DNAWest Nile virusWest Nile virus strain AF196537 region of conserved sequence in 3' untranslated region 96caaccccagg aggactgggt gaacaaagct gcggagcgat ccatgtaagc cctcagaacc 60gtctcggaag taggacccca catgttgtag ctccaaag 989798DNAWest Nile virusWest Nile virus strain AF196538 region of conserved sequence in 3' untranslated region 97caaccccagg aggactgggt gaacaaagct gcggagcgat ccatgtaagc cctcagaacc 60gtctcggaag taggacccca catgttgtag ttccaaag 989898DNAWest Nile virusWest Nile virus strain AF196540 region of conserved sequence in 3' untranslated region 98caaccccagg aggactgggt gaacaaagct gcggagcgat ccatgtaagc cctcagaacc 60gtctcggaag taggacccca catgttgtag ttccaaag 989998DNAWest Nile virusWest Nile virus strain AF196541 region of conserved sequence in 3' untranslated region 99caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810098DNAWest Nile virusWest Nile virus strain AF196542 region of conserved sequence in 3' untranslated region 100caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810198DNAWest Nile virusWest Nile virus strain AF196543 region of conserved sequence in 3' untranslated region 101caaccccagg aggactgggt taccaaagcc gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaaa gaggacccca cgtgttttag cctcaagg 9810298DNAWest Nile virusWest Nile virus strain AF297840 region of conserved sequence in 3' untranslated region 102caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9810398DNAWest Nile virusWest Nile virus strain AF458343 region of conserved sequence in 3' untranslated region 103caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc ccccagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaagg 9810498DNAWest Nile virusWest Nile virus strain AF458344 region of conserved sequence in 3' untranslated region 104caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810598DNAWest Nile virusWest Nile virus strain AF458347 region of conserved sequence in 3' untranslated region 105caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810698DNAWest Nile virusWest Nile virus strain AF458348 region of conserved sequence in 3' untranslated region 106caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810798DNAWest Nile virusWest Nile virus strain AF458350 region of conserved sequence in 3' untranslated region 107caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9810898DNAWest Nile virusWest Nile virus strain AF458352 region of conserved sequence in 3' untranslated region 108caaccccagg aggactgggt gaacaaagct gcggagcgat ccatgtaagc cctcagaacc 60gcctcggaag taggacccca catgttgtag ttycaaag 9810998DNAWest Nile virusWest Nile virus strain AF458353 region of conserved sequence in 3' untranslated region 109caaccccagg aggactgggt gaacaaagct gcggagcgat ccatgtaagc cctcagaacc 60gtctcggaag taggacccca catgttgtag ttccaaag 9811098DNAWest Nile virusWest Nile virus strain AF458355 region of conserved sequence in 3' untranslated region 110caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9811198DNAWest Nile virusWest Nile virus strain AF458358 region of conserved sequence in 3' untranslated region 111caaccccagg aggactgggt taccaaagcc gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaaa gaggacccca cgtgttttag cctcaagg 9811298DNAWest Nile virusWest Nile virus strain AF458360 region of conserved sequence in 3' untranslated region 112caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9811398DNAWest Nile virusWest Nile virus strain AF458361 region of conserved sequence in 3' untranslated region 113caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9811498DNAWest Nile virusWest Nile virus strain AF208017 region of conserved sequence in 3' untranslated region 114caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9811598DNAWest Nile virusWest Nile virus strain AF196539 region of conserved sequence in 3' untranslated region 115caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9811698DNAWest Nile virusWest Nile virus strain AF196535 region of conserved sequence in 3' untranslated region 116caaccccagg aggactgggt gaccaaagcc gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaagg 9811798DNAWest Nile virusWest Nile virus strain AF458359 region of conserved sequence in 3' untranslated region 117caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9811898DNAWest Nile virusWest Nile virus strain AF458357 region of conserved sequence in 3' untranslated region 118caaccccagg aggactgggt gaccaaagcc gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9811998DNAWest Nile virusWest Nile virus strain AF458354 region of conserved sequence in 3' untranslated region 119caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9812098DNAWest Nile virusWest Nile virus strain AF458349 region of conserved sequence in 3' untranslated region 120caaccccagg aggactgggt gaccaaacct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9812198DNAWest Nile virusWest Nile virus strain AF458345 region of conserved sequence in 3' untranslated region 121caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag gaggacccca cgtgctttag cctcaaag 9812299DNAWest Nile virusWest Nile virus strain AF458346 region of conserved sequence in 3' untranslated region 122caaccccagg aggactgggt gaccaaagct gcgaggtgat ccacgtaagc ctctcagaac 60cgtttcggaa ggaggacccc acgtgcttta gccccaaag 9912398DNAWest Nile virusWest Nile virus strain AF533540 region of conserved sequence in 3' untranslated region 123caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812498DNAWest Nile virusWest Nile virus strain AY187012 region of conserved sequence in 3' untranslated region 124caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812598DNAWest Nile virusWest Nile virus strain AY187013 region of conserved sequence in 3' untranslated region 125caaccccagg aggactgggt gaacaaagcc gcgaggtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812698DNAWest Nile virusWest Nile virus strain AY187014 region of conserved sequence in 3' untranslated region 126caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812798DNAWest Nile virusWest Nile virus strain AY187015 region of conserved sequence in 3' untranslated region 127caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812898DNAWest Nile virusWest Nile virus strain AY262283 region of conserved sequence in 3' untranslated region 128caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9812992DNAWest Nile virusWest Nile virus strain AY277251 region of conserved sequence in 3' untranslated region 129caaccccagg aggactggga tatcaaagcc atggagcgat ccacgtaagc cctcaatacc 60gtttcggaac gaggacccca cgtgttgtag ct 9213098DNAWest Nile virusWest Nile virus strain AY277252 region of conserved sequence in 3' untranslated region 130caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813198DNAWest Nile virusWest Nile virus strain AY278441 region of conserved sequence in 3' untranslated region 131caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813298DNAWest Nile virusWest Nile virus strain AY278442 region of conserved sequence in 3' untranslated region 132caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813398DNAWest Nile virusWest Nile virus strain AY268132 region of conserved sequence in 3' untranslated region 133caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcaaaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813498DNAWest Nile virusWest Nile virus strain AY268133 region of conserved sequence in 3' untranslated region 134caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813598DNAWest Nile virusWest Nile virus strain AY490240 region of conserved sequence in 3' untranslated region 135caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaag gaggacccca catgttgtaa cttcaaag 9813698DNAKunjin virusKunjin virus strain D00246 region of conserved sequence in 3' untranslated region 136caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9813798DNAKunjin virusKunjin virus strain AY274504 region of conserved sequence in 3' untranslated region 137caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9813898DNAKunjin virusKunjin virus strain AY274505 region of conserved sequence in 3' untranslated region 138caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9813998DNAKunjin virusKunjin virus strain L49311 region of conserved sequence in 3' untranslated region 139caaccccagg aggactgggt gaacaaagct gcgaggtgat ccacgtaagc cctcagaacc 60gtctcggaag aaggacccca cgtgttttag cctcaagg 9814098DNAKunjin virusKunjin virus strain L48978 region of conserved sequence in 3' untranslated region 140caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814198DNAKunjin virusKunjin virus strain L48979 region of conserved sequence in 3' untranslated region 141caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814298DNAKunjin virusKunjin virus strain AF297840 region of conservedsequence in 3' untranslated region 142caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9814398DNAKunjin virusKunjin virus strain AF297841 region of conservedsequence in 3' untranslated region 143caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814498DNAKunjin virusKunjin virus strain AF297842 region of conservedsequence in 3' untranslated region 144caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814598DNAKunjin virusKunjin virus strain AF297843 region of conservedsequence in 3' untranslated region 145caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814698DNAKunjin virusKunjin virus strain AF297844 region of conservedsequence in 3' untranslated region 146caaccccagg aggactgggt gaacaaagct gcgaagtgat

ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814798DNAKunjin virusKunjin virus strain AF297845 region of conservedsequence in 3' untranslated region 147caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9814898DNAKunjin virusKunjin virus strain AF297846 region of conservedsequence in 3' untranslated region 148caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca cattttgtag cttcaagg 9814998DNAKunjin virusKunjin virus strain AF297847 region of conservedsequence in 3' untranslated region 149caaccccagg atgactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9815098DNAKunjin virusKunjin virus strain AF297848 region of conservedsequence in 3' untranslated region 150caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9815198DNAKunjin virusKunjin virus strain AF297849 region of conservedsequence in 3' untranslated region 151caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9815298DNAKunjin virusKunjin virus strain AF297850 region of conservedsequence in 3' untranslated region 152caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9815398DNAKunjin virusKunjin virus strain AF297851 region of conservedsequence in 3' untranslated region 153caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcgggta gaggacgcga catgttgtag cagcaagc 9815498DNAKunjin virusKunjin virus strain AF297852 region of conservedsequence in 3' untranslated region 154caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9815598DNAKunjin virusKunjin virus strain AF297853 region of conservedsequence in 3' untranslated region 155caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9815698DNAKunjin virusKunjin virus strain AF297854 region of conservedsequence in 3' untranslated region 156caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaaga 9815798DNAKunjin virusKunjin virus strain AF297855 region of conservedsequence in 3' untranslated region 157caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9815898DNAKunjin virusKunjin virus strain AF297856 region of conservedsequence in 3' untranslated region 158caaccccagg gggactgggt gatcaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9815998DNAKunjin virusKunjin virus strain AF297857 region of conservedsequence in 3' untranslated region 159caaccccagg aggactgggt gaacaaagcc gcgaagtgat ccatgtaagc cgtcagaacc 60gtctcggaaa gaggacccca ccctttgtag attcaagg 9816098DNAKunjin virusKunjin virus strain AF297858 region of conservedsequence in 3' untranslated region 160caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9816198DNAKunjin virusKunjin virus strain AF297859 region of conservedsequence in 3' untranslated region 161caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9816298DNAKunjin virusKunjin virus strain AF458351 region of conservedsequence in 3' untranslated region 162caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcgggaa gaggacccca catgttgtag cttcaagg 9816398DNAKunjin virusKunjin virus strain AF458356 region of conservedsequence in 3' untranslated region 163caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gcctcggaaa gaggacccca catgttgtag cttcaagg 9816498DNAKunjin virusKunjin virus strain L24512 region of conservedsequence in 3' untranslated region 164caaccccagg aggactgggt gaacaaagct gcgaagtgat ccatgtaagc cctcagaacc 60gtctcggaaa gaggacccca catgttgtag cttcaagg 9816599DNAJapanese encephalitis virusJapanese encephalitis virus strain AB051292 region of conserved sequence in 3' untranslated region 165cagttccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gcaggtccct gcgcaccgga agttgaaag 9916699DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014160 region of conserved sequence in 3' untranslated region 166cagtcccagg aggactgggt taacaaatct gacaatagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9916799DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014161 region of conserved sequence in 3' untranslated region 167cagtcccagg aggactgggt taacaaatct gacaatagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9916899DNAJapanese encephalitis virusJapanese encephalitis virus strain AF045551 region of conserved sequence in 3' untranslated region 168cagttccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcaccgga agttgaaag 9916999DNAJapanese encephalitis virusJapanese encephalitis virus strain AF069076 region of conserved sequence in 3' untranslated region 169cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9917099DNAJapanese encephalitis virusJapanese encephalitis virus strain AF075723 region of conserved sequence in 3' untranslated region 170cagtcccagg cggactgggt taacaaatct gacaacagag agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaaag 9917199DNAJapanese encephalitis virusJapanese encephalitis virus strain AF080251 region of conserved sequence in 3' untranslated region 171cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcggaac 60cgtctcggaa gtaggtccct gctcaccgga agttgaaag 9917299DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098735 region of conserved sequence in 3' untranslated region 172cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9917399DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098736 region of conserved sequence in 3' untranslated region 173cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaaag 9917499DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098737 region of conserved sequence in 3' untranslated region 174cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9917599DNAJapanese encephalitis virusJapanese encephalitis virus strain AF217620 region of conserved sequence in 3' untranslated region 175cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9917699DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221499 region of conserved sequence in 3' untranslated region 176cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9917799DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221500 region of conserved sequence in 3' untranslated region 177cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9917899DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254452 region of conserved sequence in 3' untranslated region 178cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9917999DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254453 region of conserved sequence in 3' untranslated region 179cagtcccaga aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9918099DNAJapanese encephalitis virusJapanese encephalitis virus strain AF315119 region of conserved sequence in 3' untranslated region 180cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60tgtctcggaa gtaggtccct gctcactgga agttgaaag 9918199DNAJapanese encephalitis virusJapanese encephalitis virus strain AF416457 region of conserved sequence in 3' untranslated region 181cagtcccagg aggactgggt taacaaatct gacaacaaaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918299DNAJapanese encephalitis virusJapanese encephalitis virus strain AF486638 region of conserved sequence in 3' untranslated region 182cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcactgga agttgaagg 9918399DNAJapanese encephalitis virusJapanese encephalitis virus strain U14163 region of conserved sequence in 3' untranslated region 183cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918499DNAJapanese encephalitis virusJapanese encephalitis virus strain U15763 region of conserved sequence in 3' untranslated region 184cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918599DNAJapanese encephalitis virusJapanese encephalitis virus strain L48961 region of conserved sequence in 3' untranslated region 185cagtcccagg aggactgggt taacaaatct gacaacggaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918699DNAJapanese encephalitis virusJapanese encephalitis virus strain U47032 region of conserved sequence in 3' untranslated region 186cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918799DNAJapanese encephalitis virusJapanese encephalitis virus strain M18370 region of conserved sequence in 3' untranslated region 187cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918899DNAJapanese encephalitis virusJapanese encephalitis virus strain M55506 region of conserved sequence in 3' untranslated region 188cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9918999DNAJapanese encephalitis virusJapanese encephalitis virus strain D90195 region of conserved sequence in 3' untranslated region 189cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9919099DNAJapanese encephalitis virusJapanese encephalitis virus strain D90194 region of conserved sequence in 3' untranslated region 190cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9919199DNAJapanese encephalitis virusJapanese encephalitis virus strain AF311748 region of conserved sequence in 3' untranslated region 191cagtcccagg aggactgggt taacaaatct gacaacagaa agtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcactgga agttgaaag 9919299DNAJapanese encephalitis virusJapanese encephalitis virus strain AF092550 region of conserved sequence in 3' untranslated region 192cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919399DNAJapanese encephalitis virusJapanese encephalitis virus strain AF092552 region of conserved sequence in 3' untranslated region 193cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919499DNAJapanese encephalitis virusJapanese encephalitis virus strain AF092553 region of conserved sequence in 3' untranslated region 194cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919599DNAJapanese encephalitis virusJapanese encephalitis virus strain AF139531 region of conserved sequence in 3' untranslated region 195cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919699DNAJapanese encephalitis virusJapanese encephalitis virus strain AF148900 region of conserved sequence in 3' untranslated region 196cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919752DNAJapanese encephalitis virusJapanese encephalitis virus strain AF148901 region of conserved sequence in 3' untranslated region 197cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag cc 5219899DNAJapanese encephalitis virusJapanese encephalitis virus strain AF148902 region of conserved sequence in 3' untranslated region 198cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9919999DNAJapanese encephalitis virusJapanese encephalitis virus strain AF218068 region of conserved sequence in 3' untranslated region 199cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9920099DNAJapanese encephalitis virusJapanese encephalitis virus strain AF289816 region of conserved sequence in 3' untranslated region 200cagtcccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttgaaag 9920199DNAJapanese encephalitis virusJapanese encephalitis virus strain AF318291 region of conserved sequence in 3' untranslated region 201cagtcccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttgaaag 9920299DNAJapanese encephalitis virusJapanese encephalitis virus strain L48967 region of conserved sequence in 3' untranslated region 202cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9920399DNAJapanese encephalitis virusJapanese encephalitis virus strain L48968 region of conserved sequence in 3' untranslated region 203cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaac ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9920499DNAJapanese encephalitis virusJapanese encephalitis virus strain AY184212 region of conserved sequence in 3' untranslated region 204cagtcccagg aggactgggt caacaaatct gacaacggag agtgagaaag ccctcagaac 60cgtctcggaa gaaggtccct gctcactgga tgttggaag 9920599DNAJapanese encephalitis virusJapanese encephalitis virus strain AY251616 region of conserved sequence in 3' untranslated region 205cagtcccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttgaaag 9920699DNAJapanese encephalitis virusJapanese encephalitis virus strain AY278556 region of conserved sequence in 3' untranslated region 206cagttccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gcaggtccct gctcaccgga agttgaaag 9920799DNAJapanese encephalitis virusJapanese encephalitis virus strain AY316157 region of conserved sequence in 3' untranslated region 207cagttccagg aggactgggt taacaaatct gacaacggaa ggtgggaaag ccctcaaaac 60cgtctcggaa gcaggtccct gctcaccgga agttgaaag 9920899DNAJapanese encephalitis virusJapanese encephalitis virus strain L54067 region of conserved sequence in 3' untranslated region 208cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9920999DNAJapanese encephalitis virusJapanese encephalitis virus strain L54068 region of conserved sequence in 3' untranslated region 209cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921099DNAJapanese encephalitis virusJapanese encephalitis virus strain L54069 region of conserved sequence in 3' untranslated region 210cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921199DNAJapanese encephalitis virusJapanese

encephalitis virus strain L54070 region of conserved sequence in 3' untranslated region 211cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921299DNAJapanese encephalitis virusJapanese encephalitis virus strain L54071 region of conserved sequence in 3' untranslated region 212cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921399DNAJapanese encephalitis virusJapanese encephalitis virus strain L54072 region of conserved sequence in 3' untranslated region 213cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921499DNAJapanese encephalitis virusJapanese encephalitis virus strain L54122 region of conserved sequence in 3' untranslated region 214cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921599DNAJapanese encephalitis virusJapanese encephalitis virus strain L54123 region of conserved sequence in 3' untranslated region 215cagttccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcagaac 60cgtctcggaa gtaggtccct gctcaccgga agttggaag 9921699DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306514 region of conserved sequence in 3' untranslated region 216cagttccagg aggactgggt taacaaattt gacaacggaa ggtgggaaag ccctcagaac 60cgtctcggaa gctcctccct tctcaccgga agttgaaag 9921799DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306515 region of conserved sequence in 3' untranslated region 217cagtcccagg aggagtgggt caacaaattt gacaacagaa agtgagaaag ccctcagaac 60cgtttcggaa gtaggtccct tctcactgga agttgaaag 9921899DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306516 region of conserved sequence in 3' untranslated region 218cattcccagg aggactgggt taacaaattt gacaacagaa agtgagaaag ccctcagaac 60cgtttcggaa gtaggtccct tctcactgga agttgaaag 9921999DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306517 region of conserved sequence in 3' untranslated region 219cagtcccagg aggactgggt taacaaatct gacaacagaa ggtgagaaag ccctcaaaac 60cgtttcggaa gtaggtccct tctcactgga agttgaaag 9922097DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain BFS1750-C region of conserved sequence in 3' untranslated region 220tggccccagg tgactgggtt atcaaagcca atctggccga gtgcaaagcc cctcattccg 60actcgggagg gtccctagca cgtaggctgg agaggac 9722197DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain 1750-Std region of conserved sequence in 3' untranslated region 221tggccccagg tgactgggtt atcaaagcca atctggccga gtgcaaagcc cctcattccg 60actcgggagg gtccctagca cgtaggctgg agaggac 9722297DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TD6-4G-C region of conserved sequence in 3' untranslated region 222tggccccagg tgactgggtt atcaaagcca atctggccga gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agaggac 9722397DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TD6-4G-20 region of conserved sequence in 3' untranslated region 223tggccccagg tgactgggtt atcaaagcca atctggccga gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agaggac 9722497DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV750 region of conserved sequence in 3' untranslated region 224tggccccagg tgactgggtt accaaagcca atctggctga gtgcaaagcc cctcgttccg 60attcgggagg gtccctggca cgtaggctgg agaggac 9722597DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain L695121.05 region of conserved sequence in 3' untranslated region 225tggccccagg tgactgggtt atcaaagcca atccggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca tgtaggctgg agaggac 9722697DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TNM771K-C region of conserved sequence in 3' untranslated region 226tggccccagg tgactgggtc atcaaagcca atctggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agaggac 9722797DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain MSI-7-C region of conserved sequence in 3' untranslated region 227tggccccagg cgactgggtt atcaaagcca atccggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agaggac 9722897DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain Kern217 region of conserved sequence in 3' untranslated region 228tggccccagg cgactgggtt atcaaagcca acccggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agaggac 9722993DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV608 region of conserved sequence in 3' untranslated region 229cccaggcgac tgggttatca aagccaatcc ggctgggtgc aaagcccctc attccgactc 60gggagggtcc ctggcacgta ggctggagag gac 9323097DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TBH-28 region of conserved sequence in 3' untranslated region 230tggccccagg tgactgggtt atcaaagcca acccggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggccgg agaggac 9723197DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain VR1265 region of conserved sequence in 3' untranslated region 231tggccccagg tgactgggtt atcaaagcca atctggctgg gtgcaaagcc cctcattccg 60actcgggagg gtccctggca cgtaggctgg agcggac 9723293DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV353 region of conserved sequence in 3' untranslated region 232cccaggtgac tgggttatca aagccaatct agctgagtgc aaagcccctc attccgactc 60gggagggtcc ctggcacgta ggctggagag gac 93233100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain VR77 region of conserved sequence in 3' untranslated region 233caaccccagg aggactgggt taccaaagct gattctccac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc ctgccaacaa tggagatgaa 100234100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain AF161266 region of conserved sequence in 3' untranslated region 234caaccccagg aggactgggt taccaaagct gattctccac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc ctgccaacaa tggagatgaa 100235100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain M35172 region of conserved sequence in 3' untranslated region 235caaccccagg aggactgggt taccaaagct gattctccac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc ctgccaacaa tggagatgaa 100236100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain L48972 region of conserved sequence in 3' untranslated region 236caaccccagg aggactgggt taccaaagct gattctccac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc ctcccaacaa tggagatgaa 100237100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain L48973 region of conserved sequence in 3' untranslated region 237caaccccagg aggactgggt taccaaagct gattttccac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc ctgccaacaa tggagatgaa 100238100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain L48974 region of conserved sequence in 3' untranslated region 238caaccccagg aggactgggt taccaaagct gactctctac ggttggaaag cctcccagac 60ccgtctcgga agaggagccc ctgccaacaa tggagatgaa 100239100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain L48975 region of conserved sequence in 3' untranslated region 239caaccccagg aggactgggt taccaaaact gactctctac ggttggaaag cctcccagaa 60ccgtctcgga agaggagtcc cttccaacaa tggagatgaa 100240100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain L48976 region of conserved sequence in 3' untranslated region 240caaccccagg aggactgggt taccaaagct gattctccac ggttggaaag cctcccagaa 60ccgtttcgga agaggagtcc ctgctaacaa tggagatgaa 10024198DNAKoutango virusKoutango virus strain L48980 region of conserved sequence in 3' untranslated region 241caaccccagg aggactgggt caacaaatct gcgaggagat ccacgtaatc cctcagaacc 60gtctcggaag gaggacccca cgtgttttat tctcaaag 98242105DNAWest Nile virusWest Nile virus strain AF260967 region of conserved sequence in 3' untranslated region 242tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105243105DNAWest Nile virusWest Nile virus strain AF260968 region of conserved sequence in 3' untranslated region 243tgactgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105244105DNAWest Nile virusWest Nile virus strain AF260969 region of conserved sequence in 3' untranslated region 244tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105245105DNAWest Nile virusWest Nile virus strain AF481864 region of conserved sequence in 3' untranslated region 245tgactgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105246103DNAWest Nile virusWest Nile virus strain M12294 region of conserved sequence in 3' untranslated region 246tggctgaagc tgtaagccaa gggaaggact agaggttaga ggagaccccg tgccaaaaac 60accaaaagaa acagcatatt gacacctggg atagactagg gga 103247105DNAWest Nile virusWest Nile virus strain AF206518 region of conserved sequence in 3' untranslated region 247tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105248105DNAWest Nile virusWest Nile virus strain AF317203 region of conserved sequence in 3' untranslated region 248tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105249105DNAWest Nile virusWest Nile virus strain AF202541 region of conserved sequence in 3' untranslated region 249tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105250105DNAWest Nile virusWest Nile virus strain AF404757 region of conserved sequence in 3' untranslated region 250tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105251105DNAWest Nile virusWest Nile virus strain AF404753 region of conserved sequence in 3' untranslated region 251tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105252105DNAWest Nile virusWest Nile virus strain AF404754 region of conserved sequence in 3' untranslated region 252tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105253105DNAWest Nile virusWest Nile virus strain AF404755 region of conserved sequence in 3' untranslated region 253tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105254105DNAWest Nile virusWest Nile virus strain AF404756 region of conserved sequence in 3' untranslated region 254tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105255105DNAWest Nile virusWest Nile virus strain AF017254 region of conserved sequence in 3' untranslated region 255tgactgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgatacctg ggatagacta ggaga 105256105DNAWest Nile virusWest Nile virus strain AF533540 region of conserved sequence in 3' untranslated region 256tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105257105DNAWest Nile virusWest Nile virus strain AY262283 region of conserved sequence in 3' untranslated region 257tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccgcaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105258105DNAWest Nile virusWest Nile virus strain AY278441 region of conserved sequence in 3' untranslated region 258tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105259105DNAWest Nile virusWest Nile virus strain AY268132 region of conserved sequence in 3' untranslated region 259tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105260105DNAWest Nile virusWest Nile virus strain AY268133 region of conserved sequence in 3' untranslated region 260tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccacaaaa 60caccacaaca aaacagcata ttgacacctg ggatagacta ggaga 105261105DNAKunjin virusKunjin virus strain AY274504 region of conservedsequence in 3' untranslated region 261tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccgcaaaa 60caccacaaca acacagcata ttgacacctg ggatagacta ggaga 105262105DNAKunjin virusKunjin virus strain AY274505 region of conservedsequence in 3' untranslated region 262tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccgcaaaa 60caccacaaca acacagcata ttgacacctg ggatagacta ggaga 105263105DNAKunjin virusKunjin virus strain L24512 region of conservedsequence in 3' untranslated region 263tggctgaagc tgtaggtcag gggaaggact agaggttagt ggagaccccg tgccgcaaaa 60caccacaaca acacagcata ttgacacctg ggatagacta ggaga 10526499DNAJapanese encephalitis virusJapanese encephalitis virus strain AB051292 region of conserved sequence in 3' untranslated region 264cccctcgaag ctgtggagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaaacagc atattgacac ctgggaatag actgggaga 9926598DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014160 region of conserved sequence in 3' untranslated region 265cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9826698DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014161 region of conserved sequence in 3' untranslated region 266cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9826799DNAJapanese encephalitis virusJapanese encephalitis virus strain AF045551 region of conserved sequence in 3' untranslated region 267cccctcgaag ctgtagagga ggtgtaagga atagaggtta gaggagaccc cgcaatttgc 60atcaaacagc atattgacac ctgggaatag agtgggaga 9926898DNAJapanese encephalitis virusJapanese encephalitis virus strain AF069076 region of conserved sequence in 3' untranslated region 268cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9826998DNAJapanese encephalitis virusJapanese encephalitis virus strain AF075723 region of conserved sequence in 3' untranslated region 269cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827098DNAJapanese encephalitis virusJapanese encephalitis virus strain AF080251 region of conserved sequence in 3' untranslated region 270cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827198DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098735 region of conserved sequence in 3' untranslated region 271ctcctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827298DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098736 region of conserved sequence in 3' untranslated region 272cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827398DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098737 region of conserved sequence in 3' untranslated region 273cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tggagataga ctgggaga 9827498DNAJapanese encephalitis virusJapanese encephalitis virus strain AF217620 region of conserved sequence in 3' untranslated region 274ttcctcgaag ctgtagagga agtggaagga ctagaggtta

gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827598DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221499 region of conserved sequence in 3' untranslated region 275ctcctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827698DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221500 region of conserved sequence in 3' untranslated region 276ctcctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827798DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254452 region of conserved sequence in 3' untranslated region 277cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827898DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254453 region of conserved sequence in 3' untranslated region 278cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9827998DNAJapanese encephalitis virusJapanese encephalitis virus strain AF315119 region of conserved sequence in 3' untranslated region 279cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828098DNAJapanese encephalitis virusJapanese encephalitis virus strain AF416457 region of conserved sequence in 3' untranslated region 280cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828198DNAJapanese encephalitis virusJapanese encephalitis virus strain AF486638 region of conserved sequence in 3' untranslated region 281cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaatata ctgggaga 9828298DNAJapanese encephalitis virusJapanese encephalitis virus strain U14163 region of conserved sequence in 3' untranslated region 282cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828398DNAJapanese encephalitis virusJapanese encephalitis virus strain U15763 region of conserved sequence in 3' untranslated region 283cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828498DNAJapanese encephalitis virusJapanese encephalitis virus strain L48961 region of conserved sequence in 3' untranslated region 284ctcctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828598DNAJapanese encephalitis virusJapanese encephalitis virus strain U47032 region of conserved sequence in 3' untranslated region 285cccctcgaag ctgtagagga ggtggaggga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctaggaga 9828698DNAJapanese encephalitis virusJapanese encephalitis virus strain M18370 region of conserved sequence in 3' untranslated region 286cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828798DNAJapanese encephalitis virusJapanese encephalitis virus strain M55506 region of conserved sequence in 3' untranslated region 287cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828898DNAJapanese encephalitis virusJapanese encephalitis virus strain L78128 region of conserved sequence in 3' untranslated region 288cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9828998DNAJapanese encephalitis virusJapanese encephalitis virus strain D90195 region of conserved sequence in 3' untranslated region 289cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829098DNAJapanese encephalitis virusJapanese encephalitis virus strain D90194 region of conserved sequence in 3' untranslated region 290cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829198DNAJapanese encephalitis virusJapanese encephalitis virus strain AF311748 region of conserved sequence in 3' untranslated region 291cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829298DNAJapanese encephalitis virusJapanese encephalitis virus strain AY184212 region of conserved sequence in 3' untranslated region 292cccttcgaag ctgtagaaga ggtggaagga ctagaggtta gaggagaccc cgcatctgca 60tcaaacagca tattgacacc tgggaataga ctaggaga 9829399DNAJapanese encephalitis virusJapanese encephalitis virus strain AY316157 region of conserved sequence in 3' untranslated region 293cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcaatttgc 60atcaaacagc atattgacac ctgggaatag actgggaga 9929499DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306514 region of conserved sequence in 3' untranslated region 294cccctcgaag ctgtagagga ggtgtaagga atagaggtta gaggagaccc cgcaatttgc 60atcaaacagc atattgacac ctgggaatag agtgggaga 9929598DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306515 region of conserved sequence in 3' untranslated region 295cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829698DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306516 region of conserved sequence in 3' untranslated region 296cccctcgaag ctgtagaggg ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829798DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306517 region of conserved sequence in 3' untranslated region 297cccctcgaag ctgtagagga ggtggaagga ctagaggtta gaggagaccc cgcatttgca 60tcaaacagca tattgacacc tgggaataga gtgggaga 9829898DNAJapanese encephalitis virusJapanese encephalitis virus strain D00037 region of conserved sequence in 3' untranslated region 298cctcttgtag cttttgaggt ggttgaaggt cttgaggttt gaggagtccc cgtctttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 9829998DNAJapanese encephalitis virusJapanese encephalitis virus strain M14933 region of conserved sequence in 3' untranslated region 299cctcttgtag cttttgaggt ggttgaaggt cttgaggttt gaggagtccc cgtctttgca 60tcaaacagca tattgacacc tgggaataga ctgggaga 98300100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain BFS1750-C region of conserved sequence in 3' untranslated region 300ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 10030127DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain 1750-Std region of conserved sequence in 3' untranslated region 301ccgctcgaag ctgtagagac gggggaa 27302100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TD6-4G-C region of conserved sequence in 3' untranslated region 302ccgctcgaag ctgtagagat gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 100303100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TD6-4G-20 region of conserved sequence in 3' untranslated region 303ccgctcgaag ctgtagagat gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 10030427DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV750 region of conserved sequence in 3' untranslated region 304ccgctcgaag ctgtagagat gggggaa 27305100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain L695121.05 region of conserved sequence in 3' untranslated region 305ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 100306100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TNM771K-C region of conserved sequence in 3' untranslated region 306ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaanaa cagcatattg acacctggaa agacaggaga 100307100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain MSI-7-C region of conserved sequence in 3' untranslated region 307ccgctcaaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 10030895DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain Kern217 region of conserved sequence in 3' untranslated region 308ccgctcaaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agaca 95309100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV608 region of conserved sequence in 3' untranslated region 309ccgctcaaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 10031095DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TBH-28 region of conserved sequence in 3' untranslated region 310ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agaca 9531192DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain VR1265 region of conserved sequence in 3' untranslated region 311ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtca 60acgcaaacaa cagcatattg acacctggaa ag 92312100DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV353 region of conserved sequence in 3' untranslated region 312ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc cttgccgtta 60acgcaaacaa cagcatattg acacctggaa agacaggaga 100313104DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain VR77 region of conserved sequence in 3' untranslated region 313tcgccgaagc tgtaaggcgg gtggacggac tagaggttag aggagacccc actctcaaaa 60gcatcaaaca acagcatatt gacacctggg aaaagactag gaga 104314104DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain AF161266 region of conserved sequence in 3' untranslated region 314tcgccgaagc tgtaaggcgg gtggacggac tagaggttag aggagacccc actctcaaaa 60gcatcaaaca acagcatatt gacacctggg aaaagactag gaga 104315100DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain M35172 region of conserved sequence in 3' untranslated region 315tcgccgaagc tgtaaggcgg gtggacggac tagaggttag aggagacccc actctcaaaa 60gcatcaaaca acagcatatt gacacctggg aaaagactag 100316121DNAWest Nile virusWest Nile virus strain AF260967 region of conserved sequence in 3' untranslated region 316cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121317121DNAWest Nile virusWest Nile virus strain AF260968 region of conserved sequence in 3' untranslated region 317cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60gactgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121318121DNAWest Nile virusWest Nile virus strain AF260969 region of conserved sequence in 3' untranslated region 318cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121319121DNAWest Nile virusWest Nile virus strain AF481864 region of conserved sequence in 3' untranslated region 319cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60gactgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121320120DNAWest Nile virusWest Nile virus strain M12294 region of conserved sequence in 3' untranslated region 320cagggagaag ggactagagg ttagaggaga ccccgcgtaa aaaagtgcac ggcccaactt 60ggctgaagct gtaagccaag ggaaggacta gaggttagag gagaccccgt gccaaaaaca 120321121DNAWest Nile virusWest Nile virus strain AF206518 region of conserved sequence in 3' untranslated region 321cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121322121DNAWest Nile virusWest Nile virus strain AF317203 region of conserved sequence in 3' untranslated region 322cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121323121DNAWest Nile virusWest Nile virus strain AF202541 region of conserved sequence in 3' untranslated region 323cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121324121DNAWest Nile virusWest Nile virus strain AF404757 region of conserved sequence in 3' untranslated region 324cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagagcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121325121DNAWest Nile virusWest Nile virus strain AF404753 region of conserved sequence in 3' untranslated region 325cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121326121DNAWest Nile virusWest Nile virus strain AF404754 region of conserved sequence in 3' untranslated region 326cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121327121DNAWest Nile virusWest Nile virus strain AF404755 region of conserved sequence in 3' untranslated region 327cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121328121DNAWest Nile virusWest Nile virus strain AF404756 region of conserved sequence in 3' untranslated region 328cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121329121DNAWest Nile virusWest Nile virus strain AF017254 region of conserved sequence in 3' untranslated region 329cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60gactgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 12133087DNAWest Nile virusWest Nile virus strain AF208017 region of conserved sequence in 3' untranslated region 330cagggagaag ggactagtgg ttagaggaga ccccacgtta aaaagtgcac ggcccaactt 60ggctgaagct gtaagccaag ggaagga 87331121DNAWest Nile virusWest Nile virus strain AF533540 region of conserved sequence in 3' untranslated region 331cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121332121DNAWest Nile virusWest Nile virus strain AY262283 region of conserved sequence in 3' untranslated region 332cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccgcaaaac 120a 12133395DNAWest Nile virusWest Nile virus strain AY277251 region of conserved sequence in 3' untranslated region 333caaggagaag ggactagagg ttagcggaga ccctgcgcat atagaaagag aggcacggcc 60cagcctgaca gaagctgtaa gtcaggggaa ggact 95334118DNAWest Nile virusWest Nile virus strain AY277252 region of conserved sequence in 3' untranslated region 334cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccatggc 60tgaagctgta ggtcagggga aggactagag gttagtggag accccgtgcc acaaaaca

11833559DNAWest Nile virusWest Nile virus strain AY278441 region of conserved sequence in 3' untranslated region 335cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccagcc 59336115DNAWest Nile virusWest Nile virus strain AY278442 region of conserved sequence in 3' untranslated region 336cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggctggctga 60agctgtaggt caggggaagg actagaggtt agtggagacc ccgtgccaca aaaca 115337121DNAWest Nile virusWest Nile virus strain AY268132 region of conserved sequence in 3' untranslated region 337cagggcgaaa ggactagagg ttagaggaga ccccgcggtt tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacaaaac 120a 121338121DNAWest Nile virusWest Nile virus strain AY268133 region of conserved sequence in 3' untranslated region 338cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcct 60gactgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccacagaac 120a 12133959DNAWest Nile virusWest Nile virus strain AY490240 region of conserved sequence in 3' untranslated region 339cagggcgaaa ggactagagg ttagaggaga ccccgcggtt taaagtgcac ggcccagcc 59340121DNAKunjin virusKunjin virus strain AY274504 region of conservedsequence in 3' untranslated region 340cagagtgaaa ggactagagg ttagaggaga ccccgcgttc tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccgcaaaac 120a 121341121DNAKunjin virusKunjin virus strain AY274505 region of conservedsequence in 3' untranslated region 341cagagtgaaa ggactagagg ttagaggaga ccccgcgttc tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccgcaaaac 120a 121342121DNAKunjin virusKunjin virus strain L24512 region of conservedsequence in 3' untranslated region 342cagagtgaaa ggactagagg ttagaggaga ccccgcgttc tgaagtgcac ggcccagcct 60ggctgaagct gtaggtcagg ggaaggacta gaggttagtg gagaccccgt gccgcaaaac 120a 121343125DNAJapanese encephalitis virusJapanese encephalitis virus strain AB051292 region of conserved sequence in 3' untranslated region 343ctaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacattat gcggcccaag 60ccccctcgaa gctgtggagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125344125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014160 region of conserved sequence in 3' untranslated region 344cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125345125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF014161 region of conserved sequence in 3' untranslated region 345cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125346125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF045551 region of conserved sequence in 3' untranslated region 346ttaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaaaattat gcggcccaag 60ccccctcgaa gctgtagagg aggtgtaagg aatagaggtt agaggagacc ccgcaatttg 120catca 125347125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF069076 region of conserved sequence in 3' untranslated region 347cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125348125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF075723 region of conserved sequence in 3' untranslated region 348cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa ataacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125349125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF080251 region of conserved sequence in 3' untranslated region 349cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125350125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098735 region of conserved sequence in 3' untranslated region 350cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60cctcctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125351125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098736 region of conserved sequence in 3' untranslated region 351cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125352125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF098737 region of conserved sequence in 3' untranslated region 352cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125353125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF217620 region of conserved sequence in 3' untranslated region 353cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaatat gcggcccaag 60cttcctcgaa gctgtagagg aagtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125354125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221499 region of conserved sequence in 3' untranslated region 354cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaataacat gcggcccaag 60cctcctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125355125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF221500 region of conserved sequence in 3' untranslated region 355cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaataacat gcggcccaag 60cctcctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125356125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254452 region of conserved sequence in 3' untranslated region 356cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125357125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF254453 region of conserved sequence in 3' untranslated region 357cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125358125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF315119 region of conserved sequence in 3' untranslated region 358cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125359125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF416457 region of conserved sequence in 3' untranslated region 359cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125360125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF486638 region of conserved sequence in 3' untranslated region 360cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125361125DNAJapanese encephalitis virusJapanese encephalitis virus strain U14163 region of conserved sequence in 3' untranslated region 361cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125362125DNAJapanese encephalitis virusJapanese encephalitis virus strain U15763 region of conserved sequence in 3' untranslated region 362cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125363125DNAJapanese encephalitis virusJapanese encephalitis virus strain L48961 region of conserved sequence in 3' untranslated region 363cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60cctcctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125364125DNAJapanese encephalitis virusJapanese encephalitis virus strain U47032 region of conserved sequence in 3' untranslated region 364cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaggg actagaggtt agaggagacc ccgcatttgc 120atcaa 125365125DNAJapanese encephalitis virusJapanese encephalitis virus strain M18370 region of conserved sequence in 3' untranslated region 365cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaatat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125366125DNAJapanese encephalitis virusJapanese encephalitis virus strain M55506 region of conserved sequence in 3' untranslated region 366cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125367125DNAJapanese encephalitis virusJapanese encephalitis virus strain L78128 region of conserved sequence in 3' untranslated region 367cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125368125DNAJapanese encephalitis virusJapanese encephalitis virus strain D90195 region of conserved sequence in 3' untranslated region 368cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaatat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125369125DNAJapanese encephalitis virusJapanese encephalitis virus strain D90194 region of conserved sequence in 3' untranslated region 369cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125370125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF311748 region of conserved sequence in 3' untranslated region 370cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125371125DNAJapanese encephalitis virusJapanese encephalitis virus strain AY184212 region of conserved sequence in 3' untranslated region 371cgagatgtaa ggactagagg ttagaggaga ccccgtggaa acaacaacat gcggcccaag 60ccccttcgaa gctgtagaag aggtggaagg actagaggtt agaggagacc ccgcatctgc 120atcaa 125372125DNAJapanese encephalitis virusJapanese encephalitis virus strain AY316157 region of conserved sequence in 3' untranslated region 372ctaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaacatcat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcaatttg 120catca 125373125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306514 region of conserved sequence in 3' untranslated region 373ttaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaaaattat gcggcccaag 60ccccctcgaa gctgtagagg aggtgtaagg aatagaggtt agaggagacc ccgcaatttg 120catca 125374125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306515 region of conserved sequence in 3' untranslated region 374cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaaaaaaat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125375125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306516 region of conserved sequence in 3' untranslated region 375cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaaaaaaat gcggcccaag 60ccccctcgaa gctgtagagg gggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125376125DNAJapanese encephalitis virusJapanese encephalitis virus strain AF306517 region of conserved sequence in 3' untranslated region 376cgaggtgtaa ggactagagg ttagaggaga ccccgtggaa acaaaaaaat gcggcccaag 60ccccctcgaa gctgtagagg aggtggaagg actagaggtt agaggagacc ccgcatttgc 120atcaa 125377122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain BFS1750 region of conserved sequence in 3' untranslated region 377catggcgtaa ggactagagg ttagaggaga ccccgctgca acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 12237885DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain 1750-Std region of conserved sequence in 3' untranslated region 378catggcgtaa ggactagagg ttagaggaga ccccgckgca acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaa 85379122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TD6-4G region of conserved sequence in 3' untranslated region 379catggcgtaa ggactagagg ttagaggaga ccccgctgca actcggcaag gcccaaaccc 60gctcgaagct gtagagatgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 12238085DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV750 region of conserved sequence in 3' untranslated region 380catggcgtaa ggactagagg ttagaggaga ccccgckgca acttggcaag gccaaaaccc 60gctcgaagct gtagagatgg gggaa 85381122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain L695121.05 region of conserved sequence in 3' untranslated region 381catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122382122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TNM771K region of conserved sequence in 3' untranslated region 382catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122383122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain MSI-7 region of conserved sequence in 3' untranslated region 383catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcaaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122384122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain Kern217 region of conserved sequence in 3' untranslated region 384catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcaaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122385122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV608 region of conserved sequence in 3' untranslated region 385catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcaaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122386122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain TBH-28 region of conserved sequence in 3' untranslated region 386catggcgtaa ggactagagg ttagaggaga ccccgctgta atttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc

122387122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain VR1265 region of conserved sequence in 3' untranslated region 387catggcgtaa ggactagagg ttagaggaga ccccgctgta acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgtcaac 120gc 122388122DNASt. Louis encephalitis virusSt. Louis encephalitis virus strain CoaV353 region of conserved sequence in 3' untranslated region 388catggcgtaa ggactagagg ttagaggaga ccccgctgca acttggcaag gcccaaaccc 60gctcgaagct gtagagacgg gggaaggact agaggttaga ggagacccct tgccgttaac 120gc 122389119DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain VR77 region of conserved sequence in 3' untranslated region 389cccggcgaag gactagaggt tagaggagac cctgcggaag aaatgagtgg cccaagctcg 60ccgaagctgt aaggcgggtg gacggactag aggttagagg agaccccact ctcaaaagc 119390119DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain AF161266 region of conserved sequence in 3' untranslated region 390cccggcgaag gactagaggt tagaggagac cctgcggaag aaatgagtgg cccaagctcg 60ccgaagctgt aaggcgggtg gacggactag aggttagagg agaccccact ctcaaaagc 119391119DNAMurray Valley encephalitis virusMurray Valley encephalitis virus strain M35172 region of conserved sequence in 3' untranslated region 391cccggcgaag gactagaggt tagaggagac cctgcggaag aaatgagtgg cccaagctcg 60ccgaagctgt aaggcgggtg gacggactag aggttagagg agaccccact ctcaaaagc 119392131DNADengue virus type 1Dengue virus type 1 strain U88537 region of conserved sequence in 3' untranslated region 392atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131393131DNADengue virus type 1Dengue virus type 1 strain U88536 region of conserved sequence in 3' untranslated region 393atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131394131DNADengue virus type 1Dengue virus type 1 strain U88535 region of conserved sequence in 3' untranslated region 394atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131395131DNADengue virus type 1Dengue virus type 1 strain M87512 region of conserved sequence in 3' untranslated region 395atggggtagc agactagtgg ttagaggaga cccctcccaa aacataacgc agcagcgggg 60cccaacacca ggggaagctg tatcctggtg gtaaggacta gaggttagag gagacccccg 120gcataacaat a 131396131DNADengue virus type 1Dengue virus type 1 strain AY206457 region of conserved sequence in 3' untranslated region 396atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131397101DNADengue virus type 1Dengue virus type 1 strain AY145123 region of conserved sequence in 3' untranslated region 397atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaagacta gaggttagag gagacccccc gcacaacaac a 101398131DNADengue virus type 1Dengue virus type 1 strain AY145122 region of conserved sequence in 3' untranslated region 398atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaagccag gaggaagctg tactcctggt ggaaggacta gaggttagag gagacccccc 120gcacaacaac a 131399131DNADengue virus type 1Dengue virus type 1 strain AY145121 region of conserved sequence in 3' untranslated region 399atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaagccag gaggaagctg tactcctggt ggaaggacta gaggttagag gagacccccc 120gcacaacaac a 131400131DNADengue virus type 1Dengue virus type 1 strain AF514889 region of conserved sequence in 3' untranslated region 400atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131401131DNADengue virus type 1Dengue virus type 1 strain AF514885 region of conserved sequence in 3' untranslated region 401atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcataacaac a 131402131DNADengue virus type 1Dengue virus type 1 strain AF514883 region of conserved sequence in 3' untranslated region 402atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcataacaac a 131403131DNADengue virus type 1Dengue virus type 1 strain AF514878 region of conserved sequence in 3' untranslated region 403atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131404131DNADengue virus type 1Dengue virus type 1 strain AF514876 region of conserved sequence in 3' untranslated region 404atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcataacaac a 131405131DNADengue virus type 1Dengue virus type 1 strain AF513110 region of conserved sequence in 3' untranslated region 405atggggtagc agactagtgg ttagaggaga cccctcccaa gacataacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131406131DNADengue virus type 1Dengue virus type 1 strain AF350498 region of conserved sequence in 3' untranslated region 406atggggtagc agactagtgg ttagaggaga cccctcccaa aacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131407131DNADengue virus type 1Dengue virus type 1 strain AF311958 region of conserved sequence in 3' untranslated region 407atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gctcaacaac a 131408131DNADengue virus type 1Dengue virus type 1 strain AF311957 region of conserved sequence in 3' untranslated region 408atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131409131DNADengue virus type 1Dengue virus type 1 strain AF311956 region of conserved sequence in 3' untranslated region 409atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 13141097DNADengue virus type 1Dengue virus type 1 strain AF310148 region of conserved sequence in 3' untranslated region 410atggggtagc agactagtgg ttagaggaga cccctcccaa gacataacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaagga 97411131DNADengue virus type 1Dengue virus type 1 strain AF310147 region of conserved sequence in 3' untranslated region 411atggggtagc agactagtgg ttagaggaga cccctcccaa aacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131412131DNADengue virus type 1Dengue virus type 1 strain AF310146 region of conserved sequence in 3' untranslated region 412atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131413131DNADengue virus type 1Dengue virus type 1 strain AF309641 region of conserved sequence in 3' untranslated region 413atggggtagc agactagtgg ttagaggaga cccctcccga aacataacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131414131DNADengue virus type 1Dengue virus type 1 strain AF298808 region of conserved sequence in 3' untranslated region 414atggggtagc agactagtgg ttagaggaga cccctcccaa aacacaacgc agcagcgggg 60cccaacacta ggggatgctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131415131DNADengue virus type 1Dengue virus type 1 strain AF298807 region of conserved sequence in 3' untranslated region 415atggggtagc agactagtgg ttagaggaga cccctcccaa aacataacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131416131DNADengue virus type 1Dengue virus type 1 strain AF226687 region of conserved sequence in 3' untranslated region 416atggggtagc agactagtgg ttagaggaga cccctcccaa gacataacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131417131DNADengue virus type 1Dengue virus type 1 strain AF226686 region of conserved sequence in 3' untranslated region 417atggggtagc agactagtgg ttagaggaga cccctcccaa gacataacgc agcagcgggg 60cccaacacca ggggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131418131DNADengue virus type 1Dengue virus type 1 strain AF226685 region of conserved sequence in 3' untranslated region 418atggggtagc agactagtgg ttagaggaga cccctcccta gacataacgc agcagcgggg 60cccaacacca tgggaagctg taccttggtg gtaaggacta gaggttagag gagacccccc 120gcacaacaac a 131419131DNADengue virus type 1Dengue virus type 1 strain AF180818 region of conserved sequence in 3' untranslated region 419atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcgtaacaat a 131420131DNADengue virus type 1Dengue virus type 1 strain AF180817 region of conserved sequence in 3' untranslated region 420atggggtagc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcgtaacaat a 131421131DNADengue virus type 1Dengue virus type 1 strain AB074761 region of conserved sequence in 3' untranslated region 421atggggttgc agactagtgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca gggaaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataataat a 131422131DNADengue virus type 1Dengue virus type 1 strain AB074760 region of conserved sequence in 3' untranslated region 422atggggtagc agactagtgg ttagaggaga cccctcccaa aacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131423131DNADengue virus type 1Dengue virus type 1 strain VR344-3 region of conserved sequence in 3' untranslated region 423atggggtagc agactaatgg ttagaggaga cccctcccaa gacacaacgc agcagcgggg 60cccaacacca ggggaagctg taccctggtg gtaaggacta gaggttagag gagacccccc 120gcataacaat a 131424133DNADengue virus type 2Dengue virus type 2 strain AF022434 region of conserved sequence in 3' untranslated region 424atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca gaa 133425133DNADengue virus type 2Dengue virus type 2 strain AF022435 region of conserved sequence in 3' untranslated region 425atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133426133DNADengue virus type 2Dengue virus type 2 strain AF022436 region of conserved sequence in 3' untranslated region 426atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133427133DNADengue virus type 2Dengue virus type 2 strain AF022437 region of conserved sequence in 3' untranslated region 427atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133428133DNADengue virus type 2Dengue virus type 2 strain AF022438 region of conserved sequence in 3' untranslated region 428atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133429133DNADengue virus type 2Dengue virus type 2 strain AF022439 region of conserved sequence in 3' untranslated region 429atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga atagaggtta gaggagaccc 120ccccgaaaca aaa 133430133DNADengue virus type 2Dengue virus type 2 strain AF022440 region of conserved sequence in 3' untranslated region 430atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133431133DNADengue virus type 2Dengue virus type 2 strain AF022441 region of conserved sequence in 3' untranslated region 431atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133432133DNADengue virus type 2Dengue virus type 2 strain AF038402 region of conserved sequence in 3' untranslated region 432atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133433133DNADengue virus type 2Dengue virus type 2 strain AF038403 region of conserved sequence in 3' untranslated region 433atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133434133DNADengue virus type 2Dengue virus type 2 strain AF100145 region of conserved sequence in 3' untranslated region 434atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaata aaa 133435133DNADengue virus type 2Dengue virus type 2 strain AF100146 region of conserved sequence in 3' untranslated region 435atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaagca aaa 133436133DNADengue virus type 2Dengue virus type 2 strain AF100147 region of conserved sequence in 3' untranslated region 436atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133437133DNADengue virus type 2Dengue virus type 2 strain AF100148 region of conserved sequence in 3' untranslated region 437atggtgtagt ggactagcgg ttagaggaga cccctccctt tcagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133438133DNADengue virus type 2Dengue virus type 2 strain AF100149 region

of conserved sequence in 3' untranslated region 438atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagcctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133439133DNADengue virus type 2Dengue virus type 2 strain AF100150 region of conserved sequence in 3' untranslated region 439atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133440133DNADengue virus type 2Dengue virus type 2 strain AF100151 region of conserved sequence in 3' untranslated region 440atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaagaca aaa 133441134DNADengue virus type 2Dengue virus type 2 strain AF100458 region of conserved sequence in 3' untranslated region 441atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaac aaaa 134442133DNADengue virus type 2Dengue virus type 2 strain AF100459 region of conserved sequence in 3' untranslated region 442atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133443133DNADengue virus type 2Dengue virus type 2 strain AF100460 region of conserved sequence in 3' untranslated region 443atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133444133DNADengue virus type 2Dengue virus type 2 strain AF100461 region of conserved sequence in 3' untranslated region 444atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133445133DNADengue virus type 2Dengue virus type 2 strain AF100462 region of conserved sequence in 3' untranslated region 445atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133446133DNADengue virus type 2Dengue virus type 2 strain AF100463 region of conserved sequence in 3' untranslated region 446atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133447133DNADengue virus type 2Dengue virus type 2 strain AF100464 region of conserved sequence in 3' untranslated region 447atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg caagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133448133DNADengue virus type 2Dengue virus type 2 strain AF100465 region of conserved sequence in 3' untranslated region 448atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaagaca aaa 133449133DNADengue virus type 2Dengue virus type 2 strain AF100466 region of conserved sequence in 3' untranslated region 449atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaata aaa 133450134DNADengue virus type 2Dengue virus type 2 strain AF100467 region of conserved sequence in 3' untranslated region 450atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaaa caaa 134451134DNADengue virus type 2Dengue virus type 2 strain AF100468 region of conserved sequence in 3' untranslated region 451atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaaa caaa 134452133DNADengue virus type 2Dengue virus type 2 strain AF100469 region of conserved sequence in 3' untranslated region 452atggcgtagt ggactagcgg ttagaggaga cccctccctt tcagatcgca gcaacaatgg 60gggcccatgg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133453133DNADengue virus type 2Dengue virus type 2 strain AF119661 region of conserved sequence in 3' untranslated region 453atggcgtagg ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gattagaccc 120ccccaaaaca aaa 133454133DNADengue virus type 2Dengue virus type 2 strain AF169687 region of conserved sequence in 3' untranslated region 454atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133455133DNADengue virus type 2Dengue virus type 2 strain AF169678 region of conserved sequence in 3' untranslated region 455atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133456133DNADengue virus type 2Dengue virus type 2 strain AF169688 region of conserved sequence in 3' untranslated region 456atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133457133DNADengue virus type 2Dengue virus type 2 strain AF169679 region of conserved sequence in 3' untranslated region 457atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaaag tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133458133DNADengue virus type 2Dengue virus type 2 strain AF169680 region of conserved sequence in 3' untranslated region 458atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gcttgaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133459133DNADengue virus type 2Dengue virus type 2 strain AF169681 region of conserved sequence in 3' untranslated region 459atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133460133DNADengue virus type 2Dengue virus type 2 strain AF169682 region of conserved sequence in 3' untranslated region 460atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133461133DNADengue virus type 2Dengue virus type 2 strain AF169683 region of conserved sequence in 3' untranslated region 461atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133462133DNADengue virus type 2Dengue virus type 2 strain AF169684 region of conserved sequence in 3' untranslated region 462atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133463133DNADengue virus type 2Dengue virus type 2 strain AF169685 region of conserved sequence in 3' untranslated region 463atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133464133DNADengue virus type 2Dengue virus type 2 strain AF169686 region of conserved sequence in 3' untranslated region 464atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133465133DNADengue virus type 2Dengue virus type 2 strain AF204177 region of conserved sequence in 3' untranslated region 465atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133466133DNADengue virus type 2Dengue virus type 2 strain AF204178 region of conserved sequence in 3' untranslated region 466atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133467133DNADengue virus type 2Dengue virus type 2 strain AF208496 region of conserved sequence in 3' untranslated region 467atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133468133DNADengue virus type 2Dengue virus type 2 strain AF276619 region of conserved sequence in 3' untranslated region 468atggcgtagt ggactagcgg ttagaggaga cccctccctt gcaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133469133DNADengue virus type 2Dengue virus type 2 strain AF309950 region of conserved sequence in 3' untranslated region 469atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133470133DNADengue virus type 2Dengue virus type 2 strain AF309951 region of conserved sequence in 3' untranslated region 470atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaacgg 60gggcccaagg tgagataaag ctgtagtctc accggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133471133DNADengue virus type 2Dengue virus type 2 strain AF305592 region of conserved sequence in 3' untranslated region 471atggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaatggg 60ggcccaaggt gtgttgaagc tgtagccaca ctggaaggac cagaggttag aggagacccc 120cccagacaaa aaa 133472134DNADengue virus type 2Dengue virus type 2 strain AF309953 region of conserved sequence in 3' untranslated region 472gtggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaaatgg 60gggcccaagg tgtgttgaag ctgtagccac actggaagga ctagaggtta gaggagaccc 120ccccagacaa aaaa 134473134DNADengue virus type 2Dengue virus type 2 strain AF309954 region of conserved sequence in 3' untranslated region 473atggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaaatgg 60gggcccaagg tgtgttgaag ctgtagccac actggaagga ctagaggtta gaggagaccc 120ccccagacaa aaaa 134474133DNADengue virus type 2Dengue virus type 2 strain AF309955 region of conserved sequence in 3' untranslated region 474atggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaattgg 60ggcccaaggt gtgttgaagc tgtagccaca ctggaaggac cagaggttag aggagacccc 120cccagacaaa aaa 133475133DNADengue virus type 2Dengue virus type 2 strain AF309956 region of conserved sequence in 3' untranslated region 475atggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaatggg 60ggcccaaggt gtgttgaagc tgtagccaca ctggaaggac cagaggttag aggagacccc 120cccagacaaa aaa 133476133DNADengue virus type 2Dengue virus type 2 strain AF309957 region of conserved sequence in 3' untranslated region 476atggtgtagt ggactagcgg ttagaggaga cccctccctt aagaatcgca gcaaaatggg 60ggcccaaggt gtgttgaagc tgtagccaca ctggaaggac cagaggttag aggagacccc 120cccagacaaa aaa 133477133DNADengue virus type 2Dengue virus type 2 strain AF309958 region of conserved sequence in 3' untranslated region 477atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133478133DNADengue virus type 2Dengue virus type 2 strain AF309959 region of conserved sequence in 3' untranslated region 478atggtgtagt ggactagcgg ttagaggaga cccctccctt aaaaatcgca gcaaaaatgg 60gggcccaagg tgtggtgaag ctgtagccac attggaagga ctagaggtta gaggagaccc 120ccccagacaa aaa 133479133DNADengue virus type 2Dengue virus type 2 strain AF309960 region of conserved sequence in 3' untranslated region 479atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133480132DNADengue virus type 2Dengue virus type 2 strain AF309961 region of conserved sequence in 3' untranslated region 480atggtgtagt ggactagcgg ttagaggaga cccctccctt aaggatcgca gcaaaatggg 60ggcccaaggt gtggtgaagc tgtagccaca ctggaaggac tagaggttag aggagacccc 120cccacaaata at 132481133DNADengue virus type 2Dengue virus type 2 strain AF309962 region of conserved sequence in 3' untranslated region 481atggcgtagt ggactagcgg ttagaggaga cccctccctt gcaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133482133DNADengue virus type 2Dengue virus type 2 strain AF309963 region of conserved sequence in 3' untranslated region 482atggcgtagt ggactagcgg ttagaggaga cccctccctt acaagtcgca gcagcaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133483133DNADengue virus type 2Dengue virus type 2 strain AF309964 region of conserved sequence in 3' untranslated region 483atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133484133DNADengue virus type 2Dengue virus type 2 strain AF309965 region of conserved sequence in 3' untranslated region 484atggcgtagt ggactagcgg ttagaggaga cccctccctt tcagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133485133DNADengue virus type 2Dengue virus type 2 strain AF359579 region of conserved sequence in 3' untranslated region 485atggcgtagt ggactagcgg ttagaggaga cccctccctt gcaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133486133DNADengue virus type 2Dengue virus type 2 strain AF489932 region of conserved sequence in 3' untranslated region 486atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133487133DNADengue virus type 2Dengue virus type 2 strain AJ487271 region of conserved sequence in 3' untranslated region 487atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133488133DNADengue virus type 2Dengue virus type 2 strain AY037116 region of conserved sequence in 3' untranslated region 488atggcgtagt

ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actgaaagga ctagaggtta gaggagaccc 120ccccgaaata aaa 133489133DNADengue virus type 2Dengue virus type 2 strain M19197 region of conserved sequence in 3' untranslated region 489atggcgtagt ggactagcgg ttagaggaga cccctccctt acagatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133490133DNADengue virus type 2Dengue virus type 2 strain M20558 region of conserved sequence in 3' untranslated region 490atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaacgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133491133DNADengue virus type 2Dengue virus type 2 strain M29095 region of conserved sequence in 3' untranslated region 491atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg tgagatgaag ctgtagtctc actggaagga ctagaggtta gaggagaccc 120ccccaaaaca aaa 133492133DNADengue virus type 2Dengue virus type 2 strain M84727 region of conserved sequence in 3' untranslated region 492atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133493133DNADengue virus type 2Dengue virus type 2 strain M84728 region of conserved sequence in 3' untranslated region 493atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133494133DNADengue virus type 2Dengue virus type 2 strain U61245 region of conserved sequence in 3' untranslated region 494atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca gaa 133495133DNADengue virus type 2Dengue virus type 2 strain U61246 region of conserved sequence in 3' untranslated region 495atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133496133DNADengue virus type 2Dengue virus type 2 strain U61247 region of conserved sequence in 3' untranslated region 496atggcgtagt ggactagcgg ttagaggaga cccctccctc acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133497133DNADengue virus type 2Dengue virus type 2 strain U61248 region of conserved sequence in 3' untranslated region 497atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133498133DNADengue virus type 2Dengue virus type 2 strain U87411 region of conserved sequence in 3' untranslated region 498atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133499133DNADengue virus type 2Dengue virus type 2 strain U87412 region of conserved sequence in 3' untranslated region 499atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtctc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133500133DNADengue virus type 2Dengue virus type 2 strain VR345-2 region of conserved sequence in 3' untranslated region 500atggcgtagt ggactagcgg ttagaggaga cccctccctt acaaatcgca gcaacaatgg 60gggcccaagg cgagatgaag ctgtagtccc gctggaagga ctagaggtta gaggagaccc 120ccccgaaaca aaa 133501130DNADengue virus type 3Dengue virus type 3 strain AF310149 region of conserved sequence in 3' untranslated region 501acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130502130DNADengue virus type 3Dengue virus type 3 strain M93130 region of conserved sequence in 3' untranslated region 502acggtgtagc agactagtgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttata ggagaccccc 120cgcaaacaaa 130503130DNADengue virus type 3Dengue virus type 3 strain AF317645 region of conserved sequence in 3' untranslated region 503acggtgtagc agactagtgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttata ggagaccccc 120cgcaaacaaa 130504130DNADengue virus type 3Dengue virus type 3 strain AY099336 region of conserved sequence in 3' untranslated region 504acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130505130DNADengue virus type 3Dengue virus type 3 strain AY099337 region of conserved sequence in 3' untranslated region 505acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130506130DNADengue virus type 3Dengue virus type 3 strain AY099343 region of conserved sequence in 3' untranslated region 506acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130507130DNADengue virus type 3Dengue virus type 3 strain AY099344 region of conserved sequence in 3' untranslated region 507acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130508130DNADengue virus type 3Dengue virus type 3 strain AY099345 region of conserved sequence in 3' untranslated region 508acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130509130DNADengue virus type 3Dengue virus type 3 strain AY099346 region of conserved sequence in 3' untranslated region 509acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130510130DNADengue virus type 3Dengue virus type 3 strain AY099347 region of conserved sequence in 3' untranslated region 510acggtgtagc agactagcgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttaga ggagaccccc 120cgcaaataaa 130511130DNADengue virus type 3Dengue virus type 3 strain VR1256-3 region of conserved sequence in 3' untranslated region 511acggtgtagc agactagtgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttata ggagaccccc 120cgcaaacaaa 130512130DNADengue virus type 3Dengue virus type 3 strain VR1256-5 region of conserved sequence in 3' untranslated region 512acggtgtagc agactagtgg ttagaggaga cccctcccat gacacaacgc agcagcgggg 60cccgagcact gagggaagct gtacctcctt gcaaaggact agaggttata ggagaccccc 120cgcaaacaaa 130513135DNADengue virus type 4Dengue virus type 4 strain M14931 region of conserved sequence in 3' untranslated region 513gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaa 135514138DNADengue virus type 4Dengue virus type 4 strain AF289029 region of conserved sequence in 3' untranslated region 514gtggcatatt ggactagcgg ttagaggaga cccctcccat caccaacaaa acgcagcaaa 60aaagggggcc cgaagccagg aggaagctgt actcctggtg gaaggactag aggttagagg 120agaccccccc aacacaaa 138515104DNADengue virus type 4Dengue virus type 4 strain AF310150 region of conserved sequence in 3' untranslated region 515gtggcatatt ggactagtgg ttagaggaga cccctcccat tatcaacaaa cgcagcacaa 60agggggcccg aagtcaggat gaagctgtac tcctgatgga agga 104516104DNADengue virus type 4Dengue virus type 4 strain AF310152 region of conserved sequence in 3' untranslated region 516gtggcatatt ggactagtgg ttagaggaga cccctcccat tatcaacaaa cgcagcacaa 60agggggcccg aagtcaggat gaagctgtac tcctgatgga agga 104517136DNADengue virus type 4Dengue virus type 4 strain AF310153 region of conserved sequence in 3' untranslated region 517gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136518136DNADengue virus type 4Dengue virus type 4 strain AF326573 region of conserved sequence in 3' untranslated region 518gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136519136DNADengue virus type 4Dengue virus type 4 strain AF326825 region of conserved sequence in 3' untranslated region 519gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgataaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136520105DNADengue virus type 4Dengue virus type 4 strain AF326826 region of conserved sequence in 3' untranslated region 520gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggccca agactagagg ttagaggaga cccccccaac acaaa 105521105DNADengue virus type 4Dengue virus type 4 strain AF326827 region of conserved sequence in 3' untranslated region 521gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggccca agactagagg ttagaggaga cccccccaac acaaa 105522136DNADengue virus type 4Dengue virus type 4 strain AF375822 region of conserved sequence in 3' untranslated region 522gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136523136DNADengue virus type 4Dengue virus type 4 strain AY152039 region of conserved sequence in 3' untranslated region 523gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136524136DNADengue virus type 4Dengue virus type 4 strain AY152043 region of conserved sequence in 3' untranslated region 524gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136525136DNADengue virus type 4Dengue virus type 4 strain AY152047 region of conserved sequence in 3' untranslated region 525gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136526136DNADengue virus type 4Dengue virus type 4 strain AY152051 region of conserved sequence in 3' untranslated region 526gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136527136DNADengue virus type 4Dengue virus type 4 strain AY152055 region of conserved sequence in 3' untranslated region 527gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136528136DNADengue virus type 4Dengue virus type 4 strain AY152059 region of conserved sequence in 3' untranslated region 528gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136529136DNADengue virus type 4Dengue virus type 4 strain AY152063 region of conserved sequence in 3' untranslated region 529gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136530136DNADengue virus type 4Dengue virus type 4 strain AY152067 region of conserved sequence in 3' untranslated region 530gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136531136DNADengue virus type 4Dengue virus type 4 strain AY152071 region of conserved sequence in 3' untranslated region 531gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136532136DNADengue virus type 4Dengue virus type 4 strain AY152075 region of conserved sequence in 3' untranslated region 532gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136533136DNADengue virus type 4Dengue virus type 4 strain AY152079 region of conserved sequence in 3' untranslated region 533gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136534136DNADengue virus type 4Dengue virus type 4 strain AY152083 region of conserved sequence in 3' untranslated region 534gtggcatatt ggactagcgg ttagaggaga cccctcccac cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136535136DNADengue virus type 4Dengue virus type 4 strain AY152087 region of conserved sequence in 3' untranslated region 535gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136536136DNADengue virus type 4Dengue virus type 4 strain AY152091 region of conserved sequence in 3' untranslated region 536gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136537136DNADengue virus type 4Dengue virus type 4 strain AY152095 region of conserved sequence in 3' untranslated region 537gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136538136DNADengue virus type 4Dengue virus type 4 strain AY152099 region of conserved sequence in 3' untranslated region 538gtggcatatt ggactagcgg ttagaggaga cccctcccat cactaacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136539137DNADengue virus type 4Dengue virus type 4 strain AY152103 region of conserved sequence in 3' untranslated region 539gtggcatatt

ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60aagggggccc gaagccagga ggaagctgta ctcctggtgg aaggactaga ggttagagga 120gaccccccca acacaaa 137540136DNADengue virus type 4Dengue virus type 4 strain AY152107 region of conserved sequence in 3' untranslated region 540gtggtatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136541136DNADengue virus type 4Dengue virus type 4 strain AY152111 region of conserved sequence in 3' untranslated region 541gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136542136DNADengue virus type 4Dengue virus type 4 strain AY152115 region of conserved sequence in 3' untranslated region 542gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136543136DNADengue virus type 4Dengue virus type 4 strain AY152119 region of conserved sequence in 3' untranslated region 543gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136544136DNADengue virus type 4Dengue virus type 4 strain AY152123 region of conserved sequence in 3' untranslated region 544gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136545136DNADengue virus type 4Dengue virus type 4 strain AY152127 region of conserved sequence in 3' untranslated region 545gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136546136DNADengue virus type 4Dengue virus type 4 strain AY152131 region of conserved sequence in 3' untranslated region 546gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136547136DNADengue virus type 4Dengue virus type 4 strain AY152135 region of conserved sequence in 3' untranslated region 547gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136548136DNADengue virus type 4Dengue virus type 4 strain AY152139 region of conserved sequence in 3' untranslated region 548gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136549135DNADengue virus type 4Dengue virus type 4 strain AY152143 region of conserved sequence in 3' untranslated region 549gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaa 135550136DNADengue virus type 4Dengue virus type 4 strain AY152147 region of conserved sequence in 3' untranslated region 550gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136551136DNADengue virus type 4Dengue virus type 4 strain AY152151 region of conserved sequence in 3' untranslated region 551gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136552137DNADengue virus type 4Dengue virus type 4 strain AY152155 region of conserved sequence in 3' untranslated region 552gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60aagggggccc gaagccagga ggaagctgta ctcctggtgg aaggactaga ggttagagga 120gaccccccca acacaaa 137553136DNADengue virus type 4Dengue virus type 4 strain AY152159 region of conserved sequence in 3' untranslated region 553gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136554136DNADengue virus type 4Dengue virus type 4 strain AY152163 region of conserved sequence in 3' untranslated region 554gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136555136DNADengue virus type 4Dengue virus type 4 strain AY152167 region of conserved sequence in 3' untranslated region 555gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136556136DNADengue virus type 4Dengue virus type 4 strain AY152175 region of conserved sequence in 3' untranslated region 556gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136557136DNADengue virus type 4Dengue virus type 4 strain AY152179 region of conserved sequence in 3' untranslated region 557gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136558136DNADengue virus type 4Dengue virus type 4 strain AY152183 region of conserved sequence in 3' untranslated region 558gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136559136DNADengue virus type 4Dengue virus type 4 strain AY152187 region of conserved sequence in 3' untranslated region 559gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136560136DNADengue virus type 4Dengue virus type 4 strain AY152191 region of conserved sequence in 3' untranslated region 560gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136561136DNADengue virus type 4Dengue virus type 4 strain AY152195 region of conserved sequence in 3' untranslated region 561gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136562136DNADengue virus type 4Dengue virus type 4 strain AY152199 region of conserved sequence in 3' untranslated region 562gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttataggag 120acccccccaa cacaaa 136563136DNADengue virus type 4Dengue virus type 4 strain AY152203 region of conserved sequence in 3' untranslated region 563gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136564136DNADengue virus type 4Dengue virus type 4 strain AY152207 region of conserved sequence in 3' untranslated region 564gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136565136DNADengue virus type 4Dengue virus type 4 strain AY152211 region of conserved sequence in 3' untranslated region 565gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136566136DNADengue virus type 4Dengue virus type 4 strain AY152215 region of conserved sequence in 3' untranslated region 566gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136567136DNADengue virus type 4Dengue virus type 4 strain AY152219 region of conserved sequence in 3' untranslated region 567gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136568136DNADengue virus type 4Dengue virus type 4 strain AY152223 region of conserved sequence in 3' untranslated region 568gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136569136DNADengue virus type 4Dengue virus type 4 strain AY152227 region of conserved sequence in 3' untranslated region 569gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136570136DNADengue virus type 4Dengue virus type 4 strain AY152231 region of conserved sequence in 3' untranslated region 570gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136571136DNADengue virus type 4Dengue virus type 4 strain AY152235 region of conserved sequence in 3' untranslated region 571gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136572136DNADengue virus type 4Dengue virus type 4 strain AY152239 region of conserved sequence in 3' untranslated region 572gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136573136DNADengue virus type 4Dengue virus type 4 strain AY152243 region of conserved sequence in 3' untranslated region 573gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136574136DNADengue virus type 4Dengue virus type 4 strain AY152247 region of conserved sequence in 3' untranslated region 574gtggcatatt ggactagtgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136575136DNADengue virus type 4Dengue virus type 4 strain AY152251 region of conserved sequence in 3' untranslated region 575gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136576136DNADengue virus type 4Dengue virus type 4 strain AY152255 region of conserved sequence in 3' untranslated region 576gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136577136DNADengue virus type 4Dengue virus type 4 strain AY152259 region of conserved sequence in 3' untranslated region 577gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136578136DNADengue virus type 4Dengue virus type 4 strain AY152263 region of conserved sequence in 3' untranslated region 578gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136579136DNADengue virus type 4Dengue virus type 4 strain AY152267 region of conserved sequence in 3' untranslated region 579gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136580136DNADengue virus type 4Dengue virus type 4 strain AY152271 region of conserved sequence in 3' untranslated region 580gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136581136DNADengue virus type 4Dengue virus type 4 strain AY152275 region of conserved sequence in 3' untranslated region 581gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136582137DNADengue virus type 4Dengue virus type 4 strain AY152279 region of conserved sequence in 3' untranslated region 582gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60aagggggccc gaagccagga ggaagctgta ctcctggtgg aaggactaga ggttagagga 120gaccccccca acacaaa 137583136DNADengue virus type 4Dengue virus type 4 strain AY152283 region of conserved sequence in 3' untranslated region 583gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136584136DNADengue virus type 4Dengue virus type 4 strain AY152287 region of conserved sequence in 3' untranslated region 584gtggcatatt ggactagcgg ttagaggaga cccctcccat gactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136585136DNADengue virus type 4Dengue virus type 4 strain AY152291 region of conserved sequence in 3' untranslated region 585gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136586136DNADengue virus type 4Dengue virus type 4 strain AY152295 region of conserved sequence in 3' untranslated region 586gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa aacgcagcag 60aagggggccc gaagccagga ggaagctgta ctcctggtgg aaggactaga ggttagagga 120gaccccccca acacaa 136587136DNADengue virus type 4Dengue virus type 4 strain AY152299 region of conserved sequence in 3' untranslated region 587gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136588136DNADengue virus type 4Dengue virus type 4 strain AY152303 region of conserved sequence in 3' untranslated region 588gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136589136DNADengue virus type 4Dengue virus type 4 strain AY152307 region of conserved sequence in 3' untranslated region 589gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg

aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136590136DNADengue virus type 4Dengue virus type 4 strain AY152311 region of conserved sequence in 3' untranslated region 590gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136591136DNADengue virus type 4Dengue virus type 4 strain AY152315 region of conserved sequence in 3' untranslated region 591gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136592136DNADengue virus type 4Dengue virus type 4 strain AY152319 region of conserved sequence in 3' untranslated region 592gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136593135DNADengue virus type 4Dengue virus type 4 strain AY152323 region of conserved sequence in 3' untranslated region 593gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaa 135594135DNADengue virus type 4Dengue virus type 4 strain AY152327 region of conserved sequence in 3' untranslated region 594gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaa 135595136DNADengue virus type 4Dengue virus type 4 strain AY152331 region of conserved sequence in 3' untranslated region 595gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136596136DNADengue virus type 4Dengue virus type 4 strain AY152335 region of conserved sequence in 3' untranslated region 596gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136597136DNADengue virus type 4Dengue virus type 4 strain AY152339 region of conserved sequence in 3' untranslated region 597gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136598136DNADengue virus type 4Dengue virus type 4 strain AY152343 region of conserved sequence in 3' untranslated region 598gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136599136DNADengue virus type 4Dengue virus type 4 strain AY152347 region of conserved sequence in 3' untranslated region 599gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136600136DNADengue virus type 4Dengue virus type 4 strain AY152351 region of conserved sequence in 3' untranslated region 600gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136601136DNADengue virus type 4Dengue virus type 4 strain AY152355 region of conserved sequence in 3' untranslated region 601gtggtatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136602136DNADengue virus type 4Dengue virus type 4 strain AY152359 region of conserved sequence in 3' untranslated region 602gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136603136DNADengue virus type 4Dengue virus type 4 strain AY152363 region of conserved sequence in 3' untranslated region 603gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136604136DNADengue virus type 4Dengue virus type 4 strain AY152171 region of conserved sequence in 3' untranslated region 604gtggcatatt ggactagcgg ttagaggaga cccctcccat cactgacaaa acgcagcaaa 60agggggcccg aagccaggag gaagctgtac tcctggtgga aggactagag gttagaggag 120acccccccaa cacaaa 136605137DNADengue virus type 4Dengue virus type 4 strain VR217-1 region of conserved sequence in 3' untranslated region 605gtggcatatt ggactagcgg ttagaggaga cccctcccat cactaacaaa acgcagcaaa 60aggggggccc gaagccagga ggaagctgta ctcctggtgg aaggactaga ggttagagga 120gaccccccca acacaaa 13760625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF317203 606gtaagccctc agaaccgtct cggaa 2560725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196835 607gtaagccctc agaaccgtct cggaa 2560825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260967 608gtaagccctc agaaccgtct cggaa 2560925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260968 609gtaagccctc agaaccgtct cggaa 2561025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260969 610gtaagccctc agaaccgtct cggaa 2561125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF481864 611gtaagccctc agaaccgtct cggaa 2561225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus M12294 612gtaagccctc agaaccgtct cggaa 2561325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF206518 613gtaagccctc agaaccgtct cggaa 2561425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF317203 614gtaagccctc agaaccgtct cggaa 2561525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF202541 615gtaagccctc agaaccgtct cggaa 2561625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404757 616gtaagccctc agaaccgtct cggaa 2561725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404753 617gtaagccctc agaaccgtct cggaa 2561825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404754 618gtaagccctc agaaccgtct cggaa 2561925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404755 619gtaagccctc agaaccgtct cggaa 2562025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404756 620gtaagccctc agaaccgtct cggaa 2562125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF017254 621gtaagccctc agaaccgtct cggaa 2562225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus L48977 622gtaagccctc agaaccgtct cggaa 2562325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196536 623gtaagccctc agaaccgtct cggaa 2562425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196537 624gtaagccctc agaaccgtct cggaa 2562525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196538 625gtaagccctc agaaccgtct cggaa 2562625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196540 626gtaagccctc agaaccgtct cggaa 2562725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196541 627gtaagccctc agaaccgtct cggaa 2562825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196542 628gtaagccctc agaaccgtct cggaa 2562925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196543 629gtaagccctc agaaccgtct cggaa 2563025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458343 630gtaagccccc agaaccgtct cggaa 2563125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458344 631gtaagccctc agaaccgtct cggaa 2563225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458347 632gtaagccctc agaaccgtct cggaa 2563325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458348 633gtaagccctc agaaccgtct cggaa 2563425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458350 634gtaagccctc agaaccgtct cggaa 2563525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458352 635gtaagccctc agaaccgcct cggaa 2563625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458353 636gtaagccctc agaaccgtct cggaa 2563725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458355 637gtaagccctc agaaccgtct cggaa 2563825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458358 638gtaagccctc agaaccgtct cggaa 2563925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458360 639gtaagccctc agaaccgtct cggaa 2564025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458361 640gtaagccctc agaaccgtct cggaa 2564125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF208017 641gtaagccctc agaaccgtct cggaa 2564225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196539 642gtaagccctc agaaccgtct cggaa 2564325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196535 643gtaagccctc agaaccgtct cggaa 2564425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458359 644gtaagccctc agaaccgtct cggaa 2564525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458357 645gtaagccctc agaaccgtct cggaa 2564625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458354 646gtaagccctc agaaccgtct cggaa 2564725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458349 647gtaagccctc agaaccgtct cggaa 2564825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458345 648gtaagccctc agaaccgtct cggaa 2564926DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF458346 649gtaagcctct cagaaccgtt tcggaa 2665025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF533540 650gtaagccctc agaaccgtct cggaa 2565125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AB051292 651gaaagccctc agaaccgtct cggaa 2565225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014160 652gaaagccctc agaaccgtct cggaa 2565325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014161 653gaaagccctc agaaccgtct cggaa 2565425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF045551 654gaaagccctc agaaccgtct cggaa 2565525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF069076 655gaaagccctc agaaccgtct cggaa 2565625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF075723 656gaaagccctc agaaccgtct cggaa 2565725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF080251 657gaaagccctc ggaaccgtct cggaa 2565825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098735 658gaaagccctc agaaccgtct cggaa 2565925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098736 659gaaagccctc agaaccgtct cggaa 2566025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098737 660gaaagccctc agaaccgtct cggaa 2566125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF217620 661gaaagccctc agaaccgtct cggaa 2566225DNAArtificial Sequenceregion of conserved sequence

in 3' untranslated region of the genome of Japanese encephalitis virus AF221499 662gaaagccctc agaaccgtct cggaa 2566325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF221500 663gaaagccctc agaaccgtct cggaa 2566425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254452 664gaaagccctc agaaccgtct cggaa 2566525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254453 665gaaagccctc agaaccgtct cggaa 2566625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF315119 666gaaagccctc agaactgtct cggaa 2566725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF416457 667gaaagccctc agaaccgtct cggaa 2566825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF486638 668gaaagccctc agaaccgtct cggaa 2566925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U14163 669gaaagccctc agaaccgtct cggaa 2567025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U15763 670gaaagccctc agaaccgtct cggaa 2567125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L48961 671gaaagccctc agaaccgtct cggaa 2567225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U47032 672gaaagccctc agaaccgtct cggaa 2567325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M18370 673gaaagccctc agaaccgtct cggaa 2567425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M55506 674gaaagccctc agaaccgtct cggaa 2567525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L78128 675gaaagccctc agaaccgtct cggaa 2567625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90195 676gaaagccctc agaaccgtct cggaa 2567725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90194 677gaaagccctc agaaccgtct cggaa 2567825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF311748 678gaaagccctc agaaccgtct cggaa 2567925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF092550 679gaaagccctc agaaccgtct cggaa 2568025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF092552 680gaaagccctc agaaccgtct cggaa 2568125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF092553 681gaaagccctc agaaccgtct cggaa 2568225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF139531 682gaaagccctc agaaccgtct cggaa 2568325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF148900 683gaaagccctc agaaccgtct cggaa 2568425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF148902 684gaaagccctc agaaccgtct cggaa 2568525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF218068 685gaaagccctc agaaccgtct cggaa 2568625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF289816 686gaaagccctc agaaccgtct cggaa 2568725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF318291 687gaaagccctc agaaccgtct cggaa 2568825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L48967 688gaaagccctc agaaccgtct cggaa 2568925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L48968 689gaaacccctc agaaccgtct cggaa 2569025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54067 690gaaagccctc agaaccgtct cggaa 2569125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54068 691gaaagccctc agaaccgtct cggaa 2569225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54069 692gaaagccctc agaaccgtct cggaa 2569325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54070 693gaaagccctc agaaccgtct cggaa 2569425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54071 694gaaagccctc agaaccgtct cggaa 2569525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54070 695gaaagccctc agaaccgtct cggaa 2569625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54122 696gaaagccctc agaaccgtct cggaa 2569725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L54123 697gaaagccctc agaaccgtct cggaa 2569825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306514 698gaaagccctc agaaccgtct cggaa 2569925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306515 699gaaagccctc agaaccgttt cggaa 2570025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306516 700gaaagccctc agaaccgttt cggaa 2570125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306517 701gaaagccctc aaaaccgttt cggaa 2570226DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus AF161266 702gaaagcctcc cagaaccgtc tcggaa 2670326DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus M35172 703gaaagcctcc cagaaccgtc tcggaa 2670426DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus L48972 704gaaagcctcc cagaaccgtc tcggaa 2670526DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus L48973 705gaaagcctcc cagaaccgtc tcggaa 2670626DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus L48974 706gaaagcctcc cagacccgtc tcggaa 2670726DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus L48975 707gaaagcctcc cagaaccgtc tcggaa 2670826DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus L48976 708gaaagcctcc cagaaccgtt tcggaa 2670925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF458351 709gtaagccctc agaaccgtct cggga 2571025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF458356 710gtaagccctc agaaccgcct cggaa 2571125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297840 711gtaagccctc agaaccgcct cggaa 2571225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297841 712gtaagccctc agaaccgtct cggaa 2571325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297842 713gtaagccctc agaaccgtct cggaa 2571425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297843 714gtaagccctc agaaccgtct cggaa 2571525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297844 715gtaagccctc agaaccgtct cggaa 2571625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297845 716gtaagccctc agaaccgtct cggaa 2571725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297846 717gtaagccctc agaaccgcct cggaa 2571825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297847 718gtaagccctc agaaccgcct cggaa 2571925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297848 719gtaagccctc agaaccgtct cggaa 2572025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297849 720gtaagccctc agaaccgtct cggaa 2572125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297850 721gtaagccctc agaaccgcct cggaa 2572225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297851 722gtaagccctc agaaccgcct cgggt 2572325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297852 723gtaagccctc agaaccgcct cggaa 2572425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297853 724gtaagccctc agaaccgcct cggaa 2572525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297854 725gtaagccctc agaaccgtct cggaa 2572625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297855 726gtaagccctc agaaccgtct cggaa 2572725DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297856 727gtaagccctc agaaccgtct cggaa 2572825DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297857 728gtaagccgtc agaaccgtct cggaa 2572925DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297858 729gtaagccctc agaaccgtct cggaa 2573025DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus AF297859 730gtaagccctc agaaccgtct cggaa 2573125DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L48978 731gtaagccctc agaaccgtct cggaa 2573225DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L49311 732gtaagccctc agaaccgtct cggaa 2573325DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus D00246 733gtaagccctc agaaccgtct cggaa 2573425DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L48979 734gtaagccctc agaaccgtct cggaa 2573525DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L24512 735gtaagccctc agaaccgtct cggaa 2573625DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Koutango virus L48980 736gtaatccctc agaaccgtct cggaa 2573723DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196835 737tcctagtcta tcccaggtgt caa 2373823DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260967 738tcctagtcta tcccaggtgt caa 2373923DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260968 739tcctagtcta tcccaggtgt caa 2374023DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260969 740tcctagtcta tcccaggtgt caa 2374123DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF481864 741tcctagtcta tcccaggtgt caa 2374223DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus M12294 742ccctagtcta tcccaggtgt caa 2374323DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF206518 743tcctagtcta tcccaggtgt caa 2374423DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF317203 744tcctagtcta tcccaggtgt caa 2374523DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF202541

745tcctagtcta tcccaggtgt caa 2374623DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404757 746tcctagtcta tcccaggtgt caa 2374723DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404753 747tcctagtcta tcccaggtgt caa 2374823DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404754 748tcctagtcta tcccaggtgt caa 2374923DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404755 749tcctagtcta tcccaggtgt caa 2375023DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404756 750tcctagtcta tcccaggtgt caa 2375123DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF017254 751tcctagtcta tcccaggtat caa 2375223DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L24512 752tcctagtcta tcccaggtgt caa 2375324DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AB051292 753tcccagtcta ttcccaggtg tcaa 2475424DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014160 754tcccagtcta ttcccaggtg tcaa 2475524DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014161 755tcccagtcta ttcccaggtg tcaa 2475624DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF045551 756tcccactcta ttcccaggtg tcaa 2475724DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF069076 757tcccagtcta ttcccaggtg tcaa 2475824DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF075723 758tcccagtcta ttcccaggtg tcaa 2475924DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF080251 759tcccagtcta ttcccaggtg tcaa 2476024DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098735 760tcccagtcta ttcccaggtg tcaa 2476124DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098736 761tcccagtcta ttcccaggtg tcaa 2476224DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098737 762tcccagtcta tctccaggtg tcaa 2476324DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF217620 763tcccagtcta ttcccaggtg tcaa 2476424DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF221499 764tcccagtcta ttcccaggtg tcaa 2476524DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF221500 765tcccagtcta ttcccaggtg tcaa 2476624DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254452 766tcccagtcta ttcccaggtg tcaa 2476724DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254453 767tcccagtcta ttcccaggtg tcaa 2476824DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF315119 768tcccagtcta ttcccaggtg tcaa 2476924DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF416457 769tcccagtcta ttcccaggtg tcaa 2477024DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF486638 770tcccagtata ttcccaggtg tcaa 2477124DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U14163 771tcccagtcta ttcccaggtg tcaa 2477224DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U15763 772tcccagtcta ttcccaggtg tcaa 2477324DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L48961 773tcccagtcta ttcccaggtg tcaa 2477424DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U47032 774tcctagtcta ttcccaggtg tcaa 2477524DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M18370 775tcccagtcta ttcccaggtg tcaa 2477624DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M55506 776tcccagtcta ttcccaggtg tcaa 2477724DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L78128 777tcccagtcta ttcccaggtg tcaa 2477824DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90195 778tcccagtcta ttcccaggtg tcaa 2477924DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90194 779tcccagtcta ttcccaggtg tcaa 2478024DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF311748 780tcccagtcta ttcccaggtg tcaa 2478124DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306514 781tcccactcta ttcccaggtg tcaa 2478224DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306515 782tcccagtcta ttcccaggtg tcaa 2478324DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306516 783tcccagtcta ttcccaggtg tcaa 2478424DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306517 784tcccactcta ttcccaggtg tcaa 2478524DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D00037 785tcccagtcta ttcccaggtg tcaa 2478624DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M14933 786tcccagtcta ttcccaggtg tcaa 2478724DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus AF161266 787tcctagtctt ttcccaggtg tcaa 2478824DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus M35172 788tcctagtctt ttcccaggtg tcaa 2478928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF196835 789ggactagagg ttagaggaga ccccgcgg 2879028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260967 790ggactagagg ttagaggaga ccccgcgg 2879128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260968 791ggactagagg ttagaggaga ccccgcgg 2879228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF260969 792ggactagagg ttagaggaga ccccgcgg 2879328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF481864 793ggactagagg ttagaggaga ccccgcgg 2879428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus M12294 794ggactagagg ttagaggaga ccccgcgt 2879528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF206518 795ggactagagg ttagaggaga ccccgcgg 2879628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF317203 796ggactagagg ttagaggaga ccccgcgg 2879728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF202541 797ggactagagg ttagaggaga ccccgcgg 2879828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404757 798ggactagagg ttagaggaga ccccgcgg 2879928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404753 799ggactagagg ttagaggaga ccccgcgg 2880028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404754 800ggactagagg ttagaggaga ccccgcgg 2880128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404755 801ggactagagg ttagaggaga ccccgcgg 2880228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF404756 802ggactagagg ttagaggaga ccccgcgg 2880328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF017254 803ggactagagg ttagaggaga ccccgcgg 2880428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of West Nile virus AF208017 804ggactagtgg ttagaggaga ccccacgt 2880528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Kunjin virus L24512 805ggactagagg ttagaggaga ccccgcgt 2880628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AB051292 806ggactagagg ttagaggaga ccccgtgg 2880728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014160 807ggactagagg ttagaggaga ccccgtgg 2880828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF014161 808ggactagagg ttagaggaga ccccgtgg 2880928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF045551 809ggactagagg ttagaggaga ccccgtgg 2881028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF069076 810ggactagagg ttagaggaga ccccgtgg 2881128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF075723 811ggactagagg ttagaggaga ccccgtgg 2881228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF080251 812ggactagagg ttagaggaga ccccgtgg 2881328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098735 813ggactagagg ttagaggaga ccccgtgg 2881428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098736 814ggactagagg ttagaggaga ccccgtgg 2881528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF098737 815ggactagagg ttagaggaga ccccgtgg 2881628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF217620 816ggactagagg ttagaggaga ccccgtgg 2881728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF221499 817ggactagagg ttagaggaga ccccgtgg 2881828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF221500 818ggactagagg ttagaggaga ccccgtgg 2881928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254452 819ggactagagg ttagaggaga ccccgtgg 2882028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF254453 820ggactagagg ttagaggaga ccccgtgg 2882128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF315119 821ggactagagg ttagaggaga ccccgtgg 2882228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF416457 822ggactagagg ttagaggaga ccccgtgg 2882328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF486638 823ggactagagg ttagaggaga ccccgtgg 2882428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U14163 824ggactagagg ttagaggaga ccccgtgg 2882528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U15763 825ggactagagg ttagaggaga ccccgtgg 2882628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L48961 826ggactagagg ttagaggaga ccccgtgg 2882728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus U47032 827ggactagagg ttagaggaga ccccgtgg 2882828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus M18370 828ggactagagg ttagaggaga ccccgtgg 2882928DNAArtificial Sequenceregion of conserved sequence in

3' untranslated region of the genome of Japanese encephalitis virus M55506 829ggactagagg ttagaggaga ccccgtgg 2883028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus L78128 830ggactagagg ttagaggaga ccccgtgg 2883128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90195 831ggactagagg ttagaggaga ccccgtgg 2883228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus D90194 832ggactagagg ttagaggaga ccccgtgg 2883328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF311748 833ggactagagg ttagaggaga ccccgtgg 2883428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306514 834ggactagagg ttagaggaga ccccgtgg 2883528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306515 835ggactagagg ttagaggaga ccccgtgg 2883628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306516 836ggactagagg ttagaggaga ccccgtgg 2883728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Japanese encephalitis virus AF306517 837ggactagagg ttagaggaga ccccgtgg 2883828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus AF161266 838ggactagagg ttagaggaga ccccactc 2883928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Murray Valley encephalitis virus M35172 839ggactagagg ttagaggaga ccccactc 2884028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF226685 840ggactagagg ttagaggaga ccccccgc 2884128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF311956 841ggactagagg ttagaggaga ccccccgc 2884228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF311957 842ggactagagg ttagaggaga ccccccgc 2884328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF311958 843ggactagagg ttagaggaga ccccccgc 2884428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AY145121 844ggactagagg ttagaggaga ccccccgc 2884528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AY145122 845ggactagagg ttagaggaga ccccccgc 2884628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF514878 846ggactagagg ttagaggaga ccccccgc 2884728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF514885 847ggactagagg ttagaggaga ccccccgc 2884828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF514889 848ggactagagg ttagaggaga ccccccgc 2884928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF489932 849ggactagagg ttagaggaga ccccccca 2885028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF226687 850ggactagagg ttagaggaga ccccccgc 2885128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224213 851ggactagagg ttagaggaga cccccccg 2885228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224215 852ggactagagg ttagaggaga cccccccg 2885328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224217 853ggactagagg ttagaggaga cccccccg 2885428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224219 854ggactagagg ttagaggaga cccccccg 2885528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224225 855ggactagagg ttagaggaga cccccccg 2885628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224227 856ggactagagg ttagaggaga ccccccgc 2885728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224233 857ggactagagg ttagaggaga ccccccgc 2885828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AB074760 858ggactagagg ttagaggaga ccccccgc 2885928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AB074761 859ggactagagg ttagaggaga ccccccgc 2886028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 A75711 860ggactagagg ttagaggaga cccccggc 2886128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224221 861ggactagagg ttagaggaga cccccccg 2886228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224223 862ggactagagg ttagaggaga cccccccg 2886328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 U87412 863ggactagagg ttagaggaga cccccccg 2886428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 U61246 864ggactagagg ttagaggaga cccccccg 2886528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 U61247 865ggactagagg ttagaggaga cccccccg 2886628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100465 866ggactagagg ttagaggaga ccccccca 2886728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100466 867ggactagagg ttagaggaga ccccccca 2886828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AX224209 868ggactagagg ttagaggaga ccccccgc 2886928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF180818 869ggactagagg ttagaggaga ccccccgc 2887028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 AF326573 870ggactagagg ttagaggaga ccccccca 2887128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF350498 871ggactagagg ttagaggaga ccccccgc 2887228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF359579 872ggactagagg ttagaggaga cccccccg 2887328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AY037116 873ggactagagg ttagaggaga cccccccg 2887428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309950 874ggactagagg ttagaggaga cccccccg 2887528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309953 875ggactagagg ttagaggaga ccccccca 2887628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309954 876ggactagagg ttagaggaga ccccccca 2887728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309959 877ggactagagg ttagaggaga ccccccca 2887828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309962 878ggactagagg ttagaggaga cccccccg 2887928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309963 879ggactagagg ttagaggaga cccccccg 2888028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309964 880ggactagagg ttagaggaga cccccccg 2888128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF309965 881ggactagagg ttagaggaga ccccccca 2888228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 AF289029 882ggactagagg ttagaggaga ccccccca 2888328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF208496 883ggactagagg ttagaggaga ccccccca 2888428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF310146 884ggactagagg ttagaggaga ccccccgc 2888528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 3 AF310149 885ggactagagg ttagaggaga ccccccgc 2888628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 AF310153 886ggactagagg ttagaggaga ccccccca 2888728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 AF226686 887ggactagagg ttagaggaga ccccccgc 2888828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF276619 888ggactagagg ttagaggaga cccccccg 2888928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169678 889ggactagagg ttagaggaga cccccccg 2889028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169679 890ggactagagg ttagaggaga cccccccg 2889128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169680 891ggactagagg ttagaggaga cccccccg 2889228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169681 892ggactagagg ttagaggaga cccccccg 2889328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169682 893ggactagagg ttagaggaga cccccccg 2889428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169683 894ggactagagg ttagaggaga cccccccg 2889528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169684 895ggactagagg ttagaggaga cccccccg 2889628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169685 896ggactagagg ttagaggaga cccccccg 2889728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169686 897ggactagagg ttagaggaga cccccccg 2889828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169687 898ggactagagg ttagaggaga cccccccg 2889928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF169688 899ggactagagg ttagaggaga cccccccg 2890028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100145 900ggactagagg ttagaggaga ccccccca 2890128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100467 901ggactagagg ttagaggaga ccccccca 2890228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100468 902ggactagagg ttagaggaga ccccccca 2890328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF100149 903ggactagagg ttagaggaga ccccccca 2890428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 M20558 904ggactagagg ttagaggaga ccccccca 2890528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 M29095 905ggactagagg ttagaggaga ccccccca 2890628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 M19197 906ggactagagg ttagaggaga ccccccca 2890728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 M14931 907ggactagagg ttagaggaga ccccccca 2890828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 U87411 908ggactagagg ttagaggaga cccccccg 2890928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 U88536 909ggactagagg ttagaggaga ccccccgc 2891028DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 1 U88537 910ggactagagg ttagaggaga ccccccgc 2891128DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 2 AF038403 911ggactagagg ttagaggaga ccccccca 2891228DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 AF326826 912ggactagagg ttagaggaga ccccccca

2891328DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Dengue virus type 4 AF326827 913ggactagagg ttagaggaga ccccccca 2891428DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Montana myotis leukoencephalitis virus NC_004119 914ggactagagg ttagaggaga ccccttcc 2891528DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of Modoc virus NC_003635 915ggactagagg ttagaggaga cccccggc 2891628DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of yellow fever virus X03700 916ggtctagagg ttagaggaga ccctccag 2891728DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of yellow fever virus U52393 917ggtctagagg ttagaggaga ccctccag 2891828DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of yellow fever virus U52407 918ggtctagagg ttagaggaga ccctccag 2891928DNAArtificial Sequenceregion of conserved sequence in 3' untranslated region of the genome of yellow fever virus AF052448 919ggtctagagg ttagaggaga ccctccag 28

Claims

1. A kit for detecting and amplifying a flavivirus nucleic acid sequence, the kit comprising a first oligonucleotide that hybridizes to a sequence or complement thereof selected from the group consisting of: SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, and SEQ ID NO:40; anda detectably-labeled oligonucleotide probe.

2. The kit of claim 1, wherein the kit further comprises a second oligonucleotide that hybridizes to a sequence or complement thereof selected from the group consisting of: SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, and SEQ ID NO:40.

3. The kit of claim 1, wherein the kit further comprises a second oligonucleotide that hybridizes to SEQ ID NO:9.

4. The kit of claim 1, wherein the kit further comprises a second oligonucleotide that comprises SEQ ID NO:11.

5. The kit of claim 1, wherein the kit further comprises a second oligonucleotide that comprises SEQ ID NO:15.

6. The kit of claim 2, wherein the first oligonucleotide is selected from the group consisting of SEQ ID NO:64, and SEQ ID NO:65, and wherein the second oligonucleotide is selected from the group consisting of SEQ ID NO:66, and SEQ ID NO:67.

7. The kit of claim 2, wherein the first oligonucleotide hybridizes to SEQ ID NO:68, and the second oligonucleotide hybridizes to a complement of SEQ ID NO:69.

8. The kit of claim 1, wherein the first oligonucleotide comprises at least 20 contiguous nucleic acid residues from a sequence or complement thereof selected from the group consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, and SEQ ID NO:40.

9. The kit of claim 8, wherein the kit further comprises a second oligonucleotide that hybridizes to SEQ ID NO:9.

10. The kit of claim 8, wherein the kit further comprises a second oligonucleotide that comprises SEQ ID NO:11.

11. The kit of claim 8, wherein the kit further comprises a second oligonucleotide that comprises SEQ ID NO:15.

12. The kit of claim 1, wherein the detectably-labeled oligonucleotide probe hybridizes to SEQ ID NO:16, or a complement thereof.

13. The kit of claim 1, wherein the detectably labeled oligonucleotide probe comprises SEQ ID NO:20.

14. The kit of claim 1, wherein the detectably labeled oligonucleotide probe comprises SEQ ID NO:28.

15. The kit of claim 1, wherein the detectably-labeled oligonucleotide probe comprises a fluorescent moiety.

16. The kit of claim 5, wherein at least one nucleotide in SEQ ID NO:15 is non-standard or derivatized.

17. A method for determining the presence or absence of a flavivirus nucleic acid in a sample, the method comprising:contacting the sample with a nucleic acid polymerase and the oligonucleotides set forth in claim 1;submitting the sample with the oligonucleotides and the polymerase to conditions allowing for amplification of a fragment of the flavivirus nucleic acid by the polymerase, thereby generating an amplified nucleic acid if the flavivirus nucleic acid is present in the sample, anddetecting the amplified nucleic acid, thereby determining the presence or absence of the flavivirus nucleic acid in the sample

18. A kit for the detection of a nucleic acid of a flavivirus, comprising:a) a first oligonucleotide that hybridizes to the complement of SEQ ID NO:1;b) a second oligonucleotide; andc) a detectably-labeled oligonucleotide that hybridizes to the complement of SEQ ID NO:16.

19. The kit of claim 18, wherein the second oligonucleotide hybridizes to SEQ ID NO:9.

20. The kit of claim 18, wherein the second oligonucleotide comprises SEQ ID NO:11.

21. The kit of claim 18, wherein the second oligonucleotide comprises SEQ ID NO:15.

22. The kit of claim 18, wherein the first oligonucleotide comprises SEQ ID NO.:4.

23. The kit of claim 18, wherein the first oligonucleotide comprises SEQ ID NO:8.

24. The kit of claim 18, wherein the detectably-labeled oligonucleotide comprises SEQ ID NO:20.

25. The kit of claim 18, wherein the detectably-labeled oligonucleotide comprises SEQ ID NO:28.

26. The kit of claim 23, wherein at least one nucleotide in SEQ ID NO:8 is non-standard or derivatized.

27. A method for determining the presence or absence of a flavivirus nucleic acid in a sample, the method comprising:contacting the sample with a nucleic acid polymerase and the oligonucleotides set forth in claim 18;submitting the sample with the oligonucleotides and the polymerase to conditions allowing for amplification of a fragment of the flavivirus nucleic acid by the polymerase, thereby generating an amplified nucleic acid if the flavivirus nucleic acid is present in the sample, anddetecting the amplified nucleic acid, thereby determining the presence or absence of the flavivirus nucleic acid in the sample.

Images