Identification and characterization of racemases, definition of protein signatures, and a test for detecting D-amino acid and for screening molecules capable of inhibiting the activity of racemase, especially proline racemase

Abstract

dentification and characterization of racemases and definition of protein signatures of these racemases. This invention also provides identification of nucleic acid molecules encoding a peptide consisting of a motif characteristic of the protein signatures, and to the peptides consisting of these motifs. Antibodies specific for the peptides and to immune complexes of these antibodies with the peptides are also provided. Further, the invention relates to methods and kits for detecting racemases using the nucleic acid molecules of the invention, as well as the peptides consisting of the motifs and antibodies to these peptides.

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001]This application is based on and claims the benefit of U.S. Provisional Application Ser. No. 60/446,263, filed Feb. 11, 2003 (Attorney Docket No. 03495.6087). The entire disclosure of this Provisional application is relied upon and incorporated by reference herein

BACKGROUND OF THE INVENTION

[0002]This invention relates to the identification and characterization of racemases and definition of protein signatures of these racemases. More particularly, this invention relates to the identification of nucleic acid molecules encoding a peptide consisting of a motif characteristic of the protein signatures, and to the peptides consisting of these motifs. This invention also relates to antibodies specific for the peptides and to immune complexes of these antibodies with the peptides. Further, the invention relates to methods and kits for detecting racemases using the nucleic acid molecules of the invention, as well as the peptides consisting of the motifs and antibodies to these peptides.

[0003]D-amino acids have long been described in the cell wall of gram-positive and especially gram-negative bacteria, where they constitute essential elements of the peptidoglycan and as substitutes of cell wall techoic acids (1). Moreover, various types of D-amino acids were discovered in a number of small peptides made by a variety of microorganisms through non-ribosomal protein synthesis (2), that function mainly as antibiotic agents. However, these examples were considered exceptions to the rule of homochirality and a dogma persisted that only L-amino acid enantiomers were present in eukaryotes, apart from a very low level of D-amino acids from spontaneous racemization due to aging (3).

[0004]Recently, an increasing number of studies have reported the presence of various D-amino acids (D-aa) either as protein bound (4) or under free forms (5) in a wide variety of organisms, including mammals. The origin of free D-aa, is less clear than that of protein bound D-aa. For instance, in mammals, free D-aa may originate from exogenous sources (as described in (6), but the recent discovery of amino acid racemases in eukaryotes has also uncovered an endogenous production of D-aa, questioning their specific functions. Thus, the level of D-aspartate is developmentally regulated in rat embryos (7); the binding of D-serine to NMDA mouse brain receptors promotes neuromodulation (8),(9), and D-aspartate appears to be involved in hormonal regulation in endocrine tissues (10).

[0005]All amino acid racemases require pyridoxal phosphate as a cofactor, except proline and hydroxyproline racemases, which are cofactor-independent enzymes. For example, two reports have been published addressing the biochemical and enzymatic characteristics of the proline racemase from the gram-positive bacterium Clostridium sticklandii (11,12). A reaction mechanism was proposed whereby the active site Cys²⁵⁶ forms a half-reaction site with the corresponding cysteine of the other monomer in the active, homodimeric enzyme.

[0006]Although a variety of racemases and epimerases has been demonstrated in bacteria and fungi, the first eukaryotic amino acid (proline) racemase isolated from the infective metacyclic forms of the parasitic protozoan Trypanosoma cruzi, the causative agent of Chagas' disease in humans (13), was recently described. This parasite-secreted proline racemase (TcPRAC) was shown to be a potent mitogen for host B cells and to play an important role in T. cruzi immune evasion and persistence through polyclonal lymphocyte activation (13). This protein, previously annotated as TcPA45, with monomer size of 45 kDa, is only expressed and released by infective metacyclic forms of the parasite (13).

[0007]The genomic organization and transcription of TcPRAC proline racemase gene indicated the presence of two homologous genes per haploid genome (TcPRACA and TcPRACB). Furthermore, localization studies using specific antibodies directed to 45 kDa-TcPRAC protein revealed that an intracellular and/or membrane associated isoform, with monomer size of 39 kDa is expressed in non-infective epimastigote forms of the parasite.

[0008]Computer-assisted analysis of the TcPRACA gene sequence suggested that it could give rise to both isoforms (45 kDa and 39 kDa) of parasite proline racemases through a mechanism of alternative trans-splicing, one of which would contain a signal peptide (13). In addition, preliminary analysis of putative TcPRACB gene sequences had revealed several differences that include point mutations as compared to TcPRACA, but that also suggest that TcPRACB gene could only encode an intracellular isoform of the enzyme as the gene lacks the export signal sequence. Any of these molecular mechanisms per se would ensure the differential expression of intracellular and extracellular isoforms of proline racemases produced in different T. cruzi developmental stages.

[0009]The process of production of a D-amino acid by using a L-amino acid source comprises the use of an amino acid racemase specific for the amino acid of interest, the racemase being produced from a recombinant expression system containing a vector having a polynucleotide sequence encoding the enzyme. In prokaryotic hosts, the racemases are known to be implicated in the synthesis of D-amino acids and/or in the metabolism of L-amino acids. For instance, the presence of free D-amino acids in tumors and in progressive autoimmune and degenerative diseases suggests the biological importance of eukaryotic amino acid racemases. It is well known that proteins or peptides containing D-amino acids are resistant to proteolysis by host enzymes. In addition, such proteins containing D-amino acids, at least one D-amino acid residue, can display antibiotic or immunogenic properties.

[0010]There is a growing interest in the biological role of D-amino acids, either as free molecules or within polypeptide chains in human brain, tumors, anti-microbial and neuropeptides, suggesting widespread biological implications. Research on D-amino acids in living organisms has been hampered by their difficult detection. There exists a need in the art for the identification of racemases and the identification of their enzymatic properties and their specificity for other compounds.

[0011]Although much progress has been made concerning prophylaxis of Chagas' disease, particularly vector eradication, additional cases of infection and disease development still occur every day throughout the world. Whilst infection was largely limited in the past to vector transmission in endemic areas of Latin America, its impact has increased in terms of congenital and blood transmission, transplants and recrudescence following immunosuppressive states. Prevalence of Chagas' disease in Latin America may reach 25% of the population, as is the case of Bolivia, or yet 1%, as observed in Mexico. From the 18-20 million people already infected with the parasite Trypanosoma cruzi, more than 60% live in Brazil and WHO estimates that 90 million individuals are at risk in South and Central America.

[0012]Some figures obtained from a recent census in USA, for instance, revealed that the net immigration from Mexico is about 1000 people/day, of those 5-10 individuals are infected by Chagas' disease. The disease can lie dormant for 10-30 years and as an example of many other progressive chronic pathologies it is characterized by being "asymptomatic". Although at the 1990's, blood banks increased their appeals to Hispanics (50% of Bolivian blood is contaminated), panels of Food and Drug Administration (FDA) have recommended that all donated blood be screened for Chagas. Today, FDA has not yet approved an `accurate` blood test to screen donor blood samples. This allegation seriously contrasts with the more than 30 available tests used in endemic countries. Additionally, recent reports on new insect vectors adapted to the parasite and domestic animals infected in more developed countries like USA, and the distributional predictions based on Genetic Algorithm for Rule-set Prediction models indicate a potentially broad distribution for these species and suggest additional areas of risk beyond those previously reported emphasizing the continuing worldwide public health issue.

[0013]To date, two drugs are particularly used to treat Trypanosoma cruzi infections. Nifurtimox (3-methyl-4-5'-nitrofurfurylidene-amino tetrahydro 4H-1,4-thiazine-1,1-dioxide), a nitrofurane from Bayer, known as Lampit, was the first drug to be used since 1967. After 1973, Benznidazol, a nitroimidazol derivative, known as Rochagan or Radanyl (N-benzyl-2-nitro-1-imidazol acetamide) was produced by Hoffman-La-Roche and is consensually the drug of choice. Both drugs are trypanosomicides and act against intracellular or extracellular forms of the parasite. Adverse side-effects include a localized or generalized allergic dermopathy, peripheral sensitive polyneuropathy, leucopenia, anorexia, digestive manifestations and rare cases of convulsions which are reversible by interruption of treatment. The most serious complications include agranulocytosis and trombocytopenic purpura.

[0014]Unquestionably, the treatment is efficient and should be applied in acute phases of infection, in children, and in cases where reactivation of parasitaemia is observed following therapy with immunosuppressive drugs or organ transplantation procedures. Some experts recommend that patients in indeterminate and chronic phases should also be treated. However, close to a hundred years after the discovery of the infection and its consequent disease, researchers still maintain divergent points of view concerning therapy against the chronic phases of the disease. As one of the criteria of cure is based on the absence of the parasite in the blood, it is very difficult to evaluate the efficacy of the treatment in indeterminate or chronic phases. Because the indeterminate form is asymptomatic, it is impossible to clinically evaluate the cure. Furthermore, a combination of serology and more sensitive advanced molecular techniques will be required and still may not be conclusive. The follow-up of patients for many years is then inevitable to objectively ascertain the cure.

[0015]Chagas' disease was recently considered as a neglected disease and DND-initiative (Drug for Neglected Diseases Initiative, DNDi) wishes to support drug discovery projects focused on the development of effective, safe and affordable new drugs against trypanosomiasis. Since current therapies remain a matter of debate, may be inadequate in some circumstances, are rather toxic and may be of limited effectiveness, the characterization of new formulations and the discovery of parasite molecules capable of eliciting protective immunity are absolutely required and must be considered as priorities.

SUMMARY OF THE INVENTION

[0016]This invention aids in fulfilling these needs in the art. It has been discovered that the TcPRAC genes in T. cruzi encode functional intracellular or secreted versions of the enzyme exhibiting distinct kinetic properties that may be relevant for their relative catalytic efficiency. While the K_M of the enzyme isoforms were of a similar order of magnitude (29-75 mM), V_max varied between 2×10^-4 to 5.3×10^-5 mol of L-proline/sec/0.125 μM of homodimeric recombinant protein. Studies with the enzyme specific inhibitor and abrogation of enzymatic activity by site-directed mutagenesis of the active site Cys³³⁰ residue, reinforced the potential of proline racemase as a critical target for drug development against Chagas' disease.

[0017]This invention provides a purified nucleic acid molecule encoding a peptide consisting of a motif selected from SEQ ID NOS: 1, 2, 3, or 4.

[0018]This invention also provides a purified nucleic acid molecule that hybridizes to either strand of a denatured, double-stranded DNA comprising this nucleic acid molecule under conditions of moderate stringency.

[0019]In addition, this invention provides a recombinant vector that directs the expression of a nucleic acid molecule selected from these purified nucleic acid molecules.

[0020]Further, this invention provides a purified polypeptide encoded by a nucleic acid molecule selected from the group consisting of a purified nucleic acid molecule coding for: [0021](a) a purified polypeptide consisting of Motif I (SEQ ID NO:1); [0022](b) a purified polypeptide consisting of Motif II (SEQ ID NO:2); [0023](c) a purified polypeptide consisting of Motif III (SEQ ID NO:3); and [0024](d) a purified polypeptide consisting of Motif III* (SEQ ID NO:4).

[0025]Purified antibodies that bind to these polypeptides are provided. The purified antibodies can be monoclonal antibodies. An immunological complex comprises a polypeptide and an antibody that specifically recognizes the polypeptide of the invention.

[0026]A host cell transfected or transduced with the recombinant vector of the invention is provided.

[0027]A method for the production of a polypeptide consisting of SEQ ID NOS: 1, 2, 3, or 4, comprises culturing a host cell of the invention under conditions promoting expression, and recovering the polypeptide from the host cell or the culture medium. The host cell can be a bacterial cell, parasite cell, or eukaryotic cell.

[0028]A method of the invention for detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4, comprises: [0029](a) contacting the nucleotide sequence with a primer or a probe, which hybridizes with the nucleic acid molecule of the invention; [0030](b) amplifying the nucleotide sequence using the primer or the probe; and [0031](c) detecting a hybridized complex formed between the primer or probe and the nucleotide sequence.

[0032]This invention provides a method of detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4. The method comprises: [0033](a) contacting the racemase with antibodies of the invention; and [0034](b) detecting the resulting immunocomplex.

[0035]A kit for detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4, comprises: [0036](a) a polynucleotide probe or primer, which hybridizes with the polynucleotide of the invention; and [0037](b) reagents to perform a nucleic acid hybridization reaction.

[0038]This invention also provides a kit for detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4. The kit comprises: [0039](a) purified antibodies of the invention; [0040](b) standard reagents in a purified form; and [0041](c) detection reagents.

[0042]An in vitro method of screening for an active molecule capable of inhibiting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4, comprises: [0043](a) contacting the active molecule with the racemase; [0044](b) testing the capacity of the active molecule, at various concentrations, to inhibit the activity of the racemase; and [0045](c) choosing the active molecule that provides an inhibitory effect of at least 80% on the activity of any proline racemase.

[0046]In a preferred embodiment of the invention the racemase is a proline racemase.

[0047]An immunizing composition of the invention contains at least a purified polypeptide of the invention, capable of inducing an immune response in vivo, and a pharmaceutical carrier.

BRIEF DESCRIPTION OF THE DRAWINGS

[0048]This invention will be understood with reference to the drawings in which:

[0049]FIG. 1: Comparative analysis of sequences of T. cruzi TcPRACA and TcPRACB proline racemase isoforms. A. Alignment of TcPRACA (Tc-A) and TcPRACB (Tc-B) nucleotide sequences: non coding sequences are shown in italics; trans-splicing signals are underlined and putative spliced leader acceptor sites are double-underlined; the region encoding the computer-predicted signal peptide is indicated by double-headed arrow; initiation of translation for TcPRACA and TcPRACB are shown by single-headed arrows; nucleotides shaded in light and dark grey, represent respectively silent mutations or point mutations; box, proline racemase active site; UUA triplets are underlined in bold and precede polyadenylation sites that are double-underlined. B. Schematic representation of amino acid sequence alignments of T. cruzi TcPRACA (Tc-A), TcPRACB (Tc-B) proline racemases. The common scale is in amino acid residue positions along the linear alignment and represent the initiation codons for TcPRACA and TcPRACB proteins, respectively; ∇ represents an alternative TcPRACA putative initiation codon; Amino acid differences are indicated above and below the vertical lines and their positions in the sequence are shown in parenthesis. SP: signal peptide; the N-terminal domain of TcPRACA extends from positions 1 to 69; SPCGT: conserved active sites of TcPRACA and TcPRACB proline racemases; N-terminus and C-terminus are indicated for both proteins. C. Hydrophobicity profile of TcPRACA: dotted line depicts the cleavage site as predicted by Von Heijne's method (aa 31-32). D. Ethidium bromide-stained gel of chromosomal bands of T. cruzi CL Brener clone after separation by PFGE (lane 1) and Southern blot hybridization with TcPRAC probe (lane 2). The sizes (Mb) of chromosomal bands are indicated, as well as the region chromosome numbers in roman numerals.

[0050]FIG. 2: Biochemical characterization of T. cruzi proline racemase isoforms and substrate specificities. A. SDS-PAGE analysis of purified rTcPRACA (lane 1) and rTcPRACB (lane 2) recombinant proteins. A 8% polyacrylamide gel was stained with Coomassie blue. Right margin, molecular weights. B. Percent of racemization of L-proline, D-proline, L-hydroxy (OH) proline and D-hydroxy (OH) proline substrates by rTcPRACB (open bar) as compared to rTcPRACA (closed bar). Racemase activity was determined with 0.25 μM of each isoform of proline racemase and 40 mM substrate in sodium acetate buffer pH 6.0. C. Percent of racemization as a function of pH: Racemase assays were performed in buffer containing 0.2 M Tris-HCl (squares), sodium acetate (triangles) and sodium phosphate (circles), 40 mM L-proline and 0.25 μM of purified rTcPRACA (closed symbols) and rTcPRACB (open symbols). After 30 min at 37° C., the reaction was stopped by heat inactivation and freezing. D. 39 kDa intracellular isoform was isolated from soluble (Ese) extracts of non-infective epimastigote forms of the parasite. Western-blots of serial dilutions of the soluble suspension was compared to known amounts of rTcPRACB protein and used for protein quantitation using Quantity One® software. Racemase assays were performed in sodium acetate buffer pH6, using 40 mM L-proline and the equivalent depicted amounts of 39 kDa (ng) contained in Ese extract.

[0051]FIG. 3: Kinetic parameters of L-proline racemization catalyzed by rTcPRACA and rTcPRACB proline racemase isoforms. The progress of racemization reaction was monitored polarimetrically, as previously described (13). A. The determination of the linear part of the curve was performed at 37° C. in medium containing 0.2 M sodium acetate, pH 6.0; 0.25 μM purified enzyme and 40 mM L-proline. rTcPRACA reactions are represented by black squares and rTcPRACB reactions by white squares. B. Initial rate of racemase activity was assayed at 37° C. in medium containing 0.2 M sodium acetate, pH 6.0, 0.125 μM of rTcPRACA (solid squares) or rTcPRACB (open squares) purified enzymes and different concentrations of L-proline. Lineweaver-Burk double reciprocal plots were used to determine values for K_M and V_max where 1/V is plotted in function of 1/[S] and the slope of the curve represents K_M/V_max. Values obtained were confirmed by using the Kaleidagraph® program and Michaelis-Menten equation. The values are representative of six experiments with different enzyme preparations. C. Double reciprocal plot kinetics of 0.125 μM rTcPRACA proline racemase isoform in the presence (open) squares or absence (solid) squares of 6.7 μM PAC competitive inhibitor in function of L-proline concentration. For comparison: K_M reported for the proline racemase of C. sticklandii was 2.3 mM; kinetic assays using the native protein obtained from a soluble epimastigote fraction revealed a K_M of 10.7 mM and a K_i of 1.15 μM.

[0052]FIG. 4: Size exclusion chromatography of rTcPRACA protein using a Superdex 75 column. Fractions were eluted by HPLC at pH 6.0, B2 and B4 peaks correspond to rTcPRACA dimer and monomer species respectively. B1 and B5 eluted fractions were reloaded into the column (bold, see inserts) using the same conditions and compared to previous elution profile (not bold).

[0053]FIG. 5: Site-directed mutagenesis of TcPRACA proline racemase. Schematic representation of the active site mutagenesis of proline racemase of TcPRACA gene.

[0054]FIG. 6: Sequence alignments of proteins (Clustal X) obtained by screening SWISS-PROT and TrEMBL databases using motifs I, II and III. Amino acids involved in MI, MII and III are shaded in dark grey and light grey figures the 13-14 unspecific amino acids involved in M II. SWISS-PROT accession numbers of the sequences are in Table IV.

[0055]FIG. 7: Cladogram of protein sequences obtained by T-coffee alignment radial tree. See Table IV for SWISS-PROT protein accession numbers.

[0056]FIG. 8 shows the percent of racemisation inhibition of different L-proline concentrations (ranging from 10-40 mM) using the D-AAO (D-AAO/L-) microtest as compared to conventional detection using a polarimeter (Pol/L-).

[0057]FIG. 9 shows the comparison of D-MO/HRP reaction using D-Proline alone or an equimolar mixture of D- and L-Proline as standard.

[0058]FIG. 10 shows optical density at 490 nm as a function of D-proline concentration under the following conditions.

[0059]FIG. 11 is a Graph obtained with the serial dilutions of D-proline, as positive reaction control Obs: OD of wells (-) average of OD obtained from blank wells.

[0060]FIG. 12 shows the loss of the enzymatic activity of proline racemase after mutagenesis of the residue Cys¹⁶⁰ or the residue Cys³³⁰.

DETAILED DESCRIPTION OF THE INVENTION

[0061]Proline racemase catalyses the interconversion of L- and D-proline enantiomers and has to date been described in only two species. Originally found in the bacterium Clostridium sticklandii, it contains cysteine residues in the active site and does not require co-factors or other known coenzymes. The first eukaryotic amino acid (proline) racemase, after isolation and cloning of a gene from the pathogenic human parasite Trypanosoma cruzi, has been described. While this enzyme is intracellularly located in replicative non-infective forms of T. cruzi, membrane-bound and secreted forms of the enzyme are present upon differentiation of the parasite into non-dividing infective forms. The secreted isoform of proline racemase is a potent host B-cell mitogen supporting parasite evasion of specific immune responses.

[0062]Primarily it was essential to elucidate whether TcPRACB gene could encode a functional proline racemase. To answer this question, TcPRACA and TcPRACB paralogue genes were expressed in Escherichia coli and detailed studies were performed on biochemical and enzymatic characteristics of the recombinant proteins. This invention demonstrates that TcPRACB indeed encodes a functional proline racemase that exhibits slightly different kinetic parameters and biochemical characteristics when compared to TcPRACA enzyme. Enzymatic activities of the respective recombinant proteins showed that the 39 kDa intracellular isoform of proline racemase produced by TcPRACB construct is more stable and has higher rate of D/L-proline interconversion than the 45 kDa isoform produced by TcPRACA. Additionally, the dissociation constant of the enzyme-inhibitor complex (K_i) obtained with pyrrole-2-carboxylic acid, the specific inhibitor of proline racemases, is lower for the recombinant TcPRACB enzyme.

[0063]Moreover, this invention demonstrates that Cys³³⁰ and Cys¹⁶⁰ are key amino acids of the proline racemase active site since the activity of the enzyme is totally abolished by site-direct mutagenesis of these residues.

Also, multiple alignment of proline racemase amino acid sequences allowed the definition of protein signatures that can be used to identify putative proline racemases in other microorganisms. The significance of the presence of proline racemase in eukaryotes, particularly in T. cruzi, is discussed, as well as the consequences of this enzymatic activity in the biology and infectivity of the parasite.

[0064]This invention provides amino acid motifs, which are useful as signatures for proline racemaces. These amino acid motifs are as follows:

TABLE-US-00001 MOTIF I [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XG [SEQ ID NO:1] MOTIF II [NSM][VA][EP][AS][FY]X(13, 14) [SEQ ID NO:2] [GK]X[IVL]XXD[IV][AS][YwF]GGX[FWY] MOTIF III DRSPXGXGXXAXXA [SEQ ID NO:3] MOTIF III* DRSPCGXGXXAXXA [SEQ ID NO:4]

where X is an amino acid in each of these sequences.

[0065]This invention also provides polynucleotides encoding amino acid motifs, which are also referred to herein as the "polynucleotides of the invention" and the "polypeptides of the invention."

[0066]Databases were screened using these polynucleotide or polypeptide sequences of TcPRACA. Motifs I to III were searched. M I corresponds to [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of [NSM][VA][EP][AS][FY]X(13,14)[GK]X[IVL]XXD[IV][AS][YWF] GGX[FWY] M III to DRSPXGXGXXAXXA and M III* to DRSPCGXGXX AXXA. Sequences presented in the annex, where the conserved regions of 2 Cysteine residues of the active site are squared, are presented in Table V in bold with corresponding Accession numbers. The two cysteine residues are Cys³³⁰ and its homologue Cys¹⁶⁰, where residue Cys¹⁶⁰ mutation by a serine by site directed mutagenesis also induces a drastic loss of the enzymatic activity as for residue Cys³³⁰.

[0067]Proline racemase, an enzyme previously only described in protobacterium Clostridium sticklandii (11), was shown to be encoded also by the eukaryote Trypanosoma cruzi, a highly pathogenic protozoan parasite (13). The Trypanosoma cruzi proline racemase (TcPRAC), formerly called TcPA45, is an efficient mitogen for host B cells and is secreted by the metacyclic forms of the parasite upon infection, contributing to its immune-evasion and persistence through non-specific polyclonal lymphocyte activation (13). Previous results suggested that TcPRAC is encoded by two paralogous genes per haploid genome. Protein localization studies have also indicated that T. cruzi can differentially express intracellular and secreted versions of TcPRAC during cell cycle and differentiation, as the protein is found in the cytoplasm of non-infective replicative (epimastigote) forms of the parasite, and bound to the membrane or secreted in the infective, non-replicative (metacyclic trypomastigote) parasites (13).

[0068]This invention characterizes the two TcPRAC paralogues and demonstrates that both TcPRACA and TcPRACB give rise to functional isoforms of co-factor independent proline racemases, which display different biochemical properties that may well have important implications in the efficiency of the respective enzymatic activities. As suggested before by biochemical and theoretical studies for the bacterial proline racemase (11,17,18), TcPRAC activities rely on two monomeric enzyme subunits that perform interconversion of L- and/or D-proline enantiomers by a two base mechanism reaction in which the enzyme removes an α-hydrogen from the substrate and donates a proton to the opposite side of the α-carbon. It has been predicted that each subunit of the homodimer furnishes one of the sulphydryl groups (18).

[0069]The present invention demonstrates that TcPRAC enzymatic activities are bona fide dependent on the Cys³³⁰ residue of the active site, as site-specific ³³⁰Cys>Ser mutation totally abrogates L- and D-proline racemization, in agreement with a previous demonstration that TcPRAC enzymatic activity is abolished through alkylation with iodoacetate or iodoacetamide (13), similarly to the Clostridium proline racemase, where carboxymethylation was shown to occur specifically with the two cysteines of the reactive site leading to enzyme inactivation (12). The present invention demonstrates also that the residue Cys¹⁶⁰ is also a critical residue of the active site and that TcPRAC possesses two active sites in its homodimer. These observations make it possible to search for inhibitors by means of assays based on the native and mutated sequences.

[0070]While gene sequence analysis predicted that, by a mechanism of alternative splicing, TcPRACA could generate both intracellular and secreted versions of parasite proline racemase, the present invention demonstrates that TcPRACB gene sequence per se codes for a protein lacking the amino acids involved in peptide signal formation and an extra N-terminal domain present in TcPRACA protein, resembling more closely the CsPR. Thus, TcPRACB can only generate an intracellular version of TcPRAC proline racemase. This discovery makes it possible to carry out a search of one putative inhibitor of an intracellular enzyme should penetrate the cell.

[0071]Interestingly, the presence of two homologous copies of TcPRAC genes in the T. cruzi genome, coding for two similar polypeptides but with distinct specific biochemical properties, could reflect an evolutionary mechanism of gene duplication and a parasite strategy to ensure a better environmental flexibility. This assumption is comforted by the potential of TcPRACA gene to generate two related protein isoforms by alternative splicing, a mechanism that is particularly adept for cells that must respond rapidly to environmental stimuli. Primarily, trans-splicing appears indeed to be an ancient process that may constitute a selective advantage for split genes in higher organisms (19) and alternative trans-splicing was only recently proven to occur in T. cruzi (20). As an alternative for promoter selection, the regulated production of intracellular and/or secreted isoforms of proline racemase in T. cruzi by alternative trans-splicing of TcPRACA gene would allow the stringent conservation of a constant protein domain and/or the possibility of acquisition of an additional secretory region domain. As a matter of fact, recent investigations using RT-PCR based strategy and a common 3' probe to TcPRACA and TcPRACB sequences combined to a 5' spliced leader oligonucleotide followed by cloning and sequencing of the resulting fragments have indeed proved that an intracellular version of TcPRAC may also originate from the TcPRACA gene, corroborating this hypothesis.

[0072]Gene duplication is a relatively common event in T. cruzi that adds complexity to parasite genomic studies. Moreover, TcPRAC chromosomal mapping revealed two chromosomal bands that possess more than 3 chromosomes each and that may indicate that proline racemase genes are mapped in size-polymorphic homologous chromosomes, an important finding for proline racemase gene family characterization. Preliminary results have, for instance, revealed that T. cruzi DM28c type I strain maps proline racemase genes to the same chromoblot regions identified with T. cruzi CL type II strain used in the present invention.

[0073]It is well known that proline constitutes an important source of energy for several organisms, such as several hemoflagellates (21),(22),(23), and for flight muscles in insects (24). Furthermore, a proline oxidase system was suggested in trypanosomes (25) and the studies reporting the abundance of proline in triatominae guts (26) have implicated proline in metabolic pathways of Trypanosoma cruzi parasites as well as in its differentiation in the digestive tract of the insect vector (27). Thus, it is well accepted that T. cruzi can use L-proline as a principal source of carbon (25).

[0074]Moreover, preliminary results using parasites cultured in defined media indicate that both epimastigotes, found in the vector, and infective metacyclic trypomastigote forms can efficiently metabolize L- or D-proline as the sole source of carbon. While certain reports indicate that biosynthesis of proline occurs in trypanosomes, i.e. via reduction of glutamate carbon chains or transamination reactions, an additional and direct physiological regulation of proline might exist in the parasite to control amino acid oxidation and its subsequent degradation or yet to allow proline utilization. In fact, a recent report showed two active proline transporter systems in T. cruzi (28). T. cruzi proline racemase may possibly play a consequential role in the regulation of intracellular proline metabolic pathways, or else, it could participate in mechanisms of post-translational addition of D-amino acid to polypeptide chains.

[0075]On one hand, these hypotheses would allow for an energy gain and, on the other hand, would permit the parasite to evade host responses. In this respect, it was reported that a single D-amino acid addition in the N-terminus of a protein is sufficient to confer general resistance to lytic reactions involving host proteolytic enzymes (29). The expression of proteins containing D-amino acids in the parasite membrane would benefit the parasite inside host cell lysosomes, in addition to the contribution to the initiation of polyclonal activation, as already described for polymers composed of D-enantiomers (30), (31). Although D-amino acid inclusion in T. cruzi proteins would benefit the parasite, this hypothesis remains to be proven and direct evidence is technically difficult to obtain.

[0076]It is worth noting that metacyclogenesis of epimastigotes into infective metacyclic forms involves parasite morphologic changes that include the migration of the kinetoplast, a structure that is physically linked to the parasite flagellum, and many other significant metabolic alterations that combine to confer infectivity/virulence to the parasite (13,32). Proline racemase was shown to be preferentially localized in the flagellar pocket of infective parasite forms after metacyclogenesis (13), as are many other known proteins secreted and involved in early infection (33).

[0077]It is also conceivable that parasite proline racemase may function as an early mediator for T. cruzi differentiation through intracellular modification of internalized environmental free proline, as suggested above and already observed in some bacterial systems. As an illustration, exogenous alanine has been described as playing an important role in bacterial transcriptional regulation by controlling an operon formed by genes coding for alanine racemase and a smaller subunit of bacterial dehydrogenase (34).

[0078]In bacteria, membrane alanine receptors are responsible for alanine and proline entry into the bacterial cell (35). It can then be hypothesized that the availability of proline in the insect gut milieu associated to a mechanism of environmental sensing by specific receptors in the parasite membrane would stand for parasite proline uptake and its further intracellular racemization. Proline racemase would then play a fundamental role in the regulation of parasite growth and differentiation by its participation in both metabolic energetic pathways and the expression of proteins containing D-proline, as described above, consequently conferring parasite infectivity and its ability to escape host specific responses.

[0079]Thus far, and contrasting to the intracellular isoform of TcPRAC found in epimastigote forms of T. cruzi, the ability of metacyclic and bloodstream forms of the parasite to express and secrete proline racemase may have further implications in host/parasite interaction. In fact, the parasite-secreted isoform of proline racemase participates actively in the induction of non-specific polyclonal B-cell responses upon host infection (13) and favors parasite evasion, thus ensuring its persistence in the host.

[0080]As described for other mitogens and parasite antigens (36), (37), (38), and in addition to its mitogenic property, TcPRAC could also be involved in modifications of host cell targets enabling better parasite attachment to host cell membranes in turn assuring improved infectivity. Since several reports associate accumulation of L-proline with muscular dysfunction (39) and inhibition of muscle contraction (40), the release of proline racemase by intracellular parasites could alternatively contribute to the maintenance of infection through regulation of L-proline concentration inside host cells, as proline was described as essential for the integrity of muscular cell targets. Therefore, it has recently been demonstrated that transgenic parasites hyperexpressing TcPRACA or TcPRACB genes, but not functional knock outs, are 5-10 times more infective to host target cells pointing to a critical role of proline racemases in the ongoing of the infectious process. Likewise, previous reports demonstrated that genetic inactivation of Lysteria monocytogenes alanine racemase and D-amino acid oxidase genes abolishes bacterial pathogenicity, since the presence of D-alanine is required for the synthesis of the mucopeptide component of the cell wall that protects virtually all bacteria from the external milieu (41).

[0081]Present analysis using identified critical conserved residues in TcPRAC and C. sticklandii proline racemase genes and the screening of SWISS-PROT and TrEMBL databases led to the discovery of a minimal signature for proline racemases, DRSPXGX[GA]XXAXXA, and to confirm the presence of putative proteins in at least 10 distinct organisms. Screening of unfinished genome sequences showed highly homologous proline racemase candidate genes in an additional 8 organisms, amongst which are the fungus Aspergillus fumigatus and the bacteria Bacillus anthracis and Clostridium botulinum. This is of particular interest, since racemases, but not proline racemases, are widespread in bacteria and only recently described in more complex organisms such as T. cruzi, 42,43). These findings may possibly reflect cell adaptative responses to extracellular stimuli and uncover more general mechanisms for the regulation of gene expression by D-amino acids in eukaryotes. The finding of similar genes in human and mouse genome databases using less stringent signatures for proline racemase is striking. However, the absence of the crucial amino acid cysteine in the putative active site of those predicted proteins suggests a different functionality than that of a proline racemase.

[0082]This invention shows that TcPRAC isoforms are highly stable and have the capacity to perform their activities across a large spectrum of pH. In addition, the affinity of pyrrol-carboxylic acid, a specific inhibitor of proline racemase, is higher for TcPRAC enzymes than for CsPR.

[0083]The invention also provides amino acid or nucleic acid sequences substantially similar to specific sequences disclosed herein.

[0084]The term "substantially similar" when used to define either amino acid or nucleic acid sequences means that a particular subject sequence, for example, a mutant sequence, varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which is to retain activity. Alternatively, nucleic acid subunits and analogs are "substantially similar" to the specific DNA sequences disclosed herein if: (a) the DNA sequence is derived from a region of the invention; (b) the DNA sequence is capable of hybridization to DNA sequences of (a) and/or which encodes active molecules; or DNA sequences that are degenerate as a result of the genetic code to the DNA sequences defined in (a) or (b) and/or which encode active molecules.

[0085]In order to preserve the activity, deletions and substitutions will preferably result in homologously or conservatively substituted sequences, meaning that a given residue is replaced by a biologically similar residue. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another, or substitution of one polar residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn. Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known. When said activity is proline racemase activity, Cys³³⁰ and Cys¹⁶⁰ must be present.

[0086]The polynucleotides of the invention can be used as probes or to select nucleotide primers notably for an amplification reaction. PCR is described in the U.S. Pat. No. 4,683,202 granted to Cetus Corp. The amplified fragments can be identified by agarose or polyacrylamide gel electrophoresis, or by a capillary electrophoresis, or alternatively by a chromatography technique (gel filtration, hydrophobic chromatography, or ion exchange chromatography). The specificity of the amplification can be ensured by a molecular hybridization using as nucleic acid probes the polynucleotides of the invention, oligonucleotides that are complementary to these polynucleotides, or their amplification products themselves.

[0087]Amplified nucleotide fragments are useful as probes in hybridization reactions in order to detect the presence of one polynucleotide according to the present invention or in order to detect the presence of a gene encoding racemase activity, such as in a biological sample. This invention also provides the amplified nucleic acid fragments ("amplicons") defined herein above. These probes and amplicons can be radioactively or non-radioactively labeled using, for example, enzymes or fluorescent compounds.

[0088]Other techniques related to nucleic acid amplification can also be used alternatively to the PCR technique. The Strand Displacement Amplification (SDA) technique (Walker et al., 1992) is an isothermal amplification technique based on the ability of a restriction enzyme to cleave one of the strands at a recognition site (which is under a hemiphosphorothioate form), and on the property of a DNA polymerase to initiate the synthesis of a new strand from the 3' OH end generated by the restriction enzyme, and on the property of this DNA polymerase to displace the previously synthesized strand being localized downstream.

[0089]The SDA amplification technique is more easily performed than PCR (a single thermostated water bath device is necessary), and is faster than the other amplification methods. Thus, the present invention also comprises using the nucleic acid fragments according to the invention (primers) in a method of DNA or RNA amplification, such as the SDA technique.

[0090]The polynucleotides of the invention, especially the primers according to the invention, are useful as technical means for performing different target nucleic acid amplification methods, such as:

[0091]TAS (Transcription-based Amplification System), described by Kwoh et al. in 1989;

[0092]SR (Self-Sustained Sequence Replication), described by Guatelli et al. in 1990;

[0093]NASBA (Nucleic acid Sequence Based Amplification), described by Kievitis et al. in 1991; and

[0094]TMA (Transcription Mediated Amplification).

[0095]The polynucleotides of the invention, especially the primers according to the invention, are also useful as technical means for performing methods for amplification or modification of a nucleic acid used as a probe, such as:

[0096]LCR (Ligase Chain Reaction), described by Landegren et al. in 1988 and improved by Barany et al. in 1991, who employ a thermostable ligase;

[0097]RCR (Repair Chain Reaction), described by Segev et al. in 1992;

[0098]CPR (Cycling Probe Reaction), described by Duck et al. in 1990; and

[0099]Q-beta replicase reaction, described by Miele et al. in 1983 and improved by Chu et al. in 1986, Lizardi et al. in 1988, and by Burg et al. and Stone et al. in 1996.

[0100]When the target polynucleotide to be detected is RNA, for example mRNA, a reverse transcriptase enzyme can be used before the amplification reaction in order to obtain a cDNA from the RNA contained in the biological sample. The generated cDNA can be subsequently used as the nucleic acid target for the primers or the probes used in an amplification process or a detection process according to the present invention.

[0101]The oligonucleotide probes according to the present invention hybridize specifically with a DNA or RNA molecule comprising all or part of the polynucleotide of the invention under stringent conditions. As an illustrative embodiment, the stringent hybridization conditions used in order to specifically detect a polynucleotide according to the present invention are advantageously the following:

[0102]Prehybridization and hybridization are performed as follows in order to increase the probability for heterologous hybridization: [0103]The prehybridization and hybridization are done at 50° C. in a solution containing 5×SSC and 1×Denhardt's solution.

[0104]The washings are performed as follows: [0105]2×SSC at 60° C. 3 times during 20 minutes each.

[0106]The non-labeled polynucleotides of the invention can be directly used as probes. Nevertheless, the polynucleotides can generally be labeled with a radioactive element (³²P, ³5S, ³H, ¹25I) or by a non-isotopic molecule (for example, biotin, acetylaminofluorene, digoxigenin, 5-bromodesoxyuridin, fluorescein) in order to generate probes that are useful for numerous applications. Examples of non-radioactive labeling of nucleic acid fragments are described in the French Patent No. FR 78 10975 or by Urdea et al. or Sanchez-Pescador et al. 1988.

[0107]Other labeling techniques can also be used, such as those described in the French patents 2 422 956 and 2 518 755. The hybridization step can be performed in different ways. A general method comprises immobilizing the nucleic acid that has been extracted from the biological sample on a substrate (nitrocellulose, nylon, polystyrene) and then incubating, in defined conditions, the target nucleic acid with the probe. Subsequent to the hybridization step, the excess amount of the specific probe is discarded, and the hybrid molecules formed are detected by an appropriate method (radioactivity, fluorescence, or enzyme activity measurement).

[0108]Advantageously, the probes according to the present invention can have structural characteristics such that they allow signal amplification, such structural characteristics being, for example, branched DNA probes as those described by Urdea et al. in 1991 or in the European Patent No. 0 225 807 (Chiron).

[0109]In another advantageous embodiment of the present invention, the probes described herein can be used as "capture probes", and are for this purpose immobilized on a substrate in order to capture the target nucleic acid contained in a biological sample. The captured target nucleic acid is subsequently detected with a second probe, which recognizes a sequence of the target nucleic acid that is different from the sequence recognized by the capture probe.

[0110]The oligonucleotide probes according to the present invention can also be used in a detection device comprising a matrix library of probes immobilized on a substrate, the sequence of each probe of a given length being localized in a shift of one or several bases, one from the other, each probe of the matrix library thus being complementary to a distinct sequence of the target nucleic acid. Optionally, the substrate of the matrix can be a material able to act as an electron donor, the detection of the matrix positions in which hybridization has occurred being subsequently determined by an electronic device. Such matrix libraries of probes and methods of specific detection of a target nucleic acid are described in European patent application No. 0 713 016, or PCT Application No. WO 95 33846, or also PCT Application No. WO 95 11995 (Affymax Technologies), PCT Application No. WO 97 02357 (Affymetrix Inc.), and also in U.S. Pat. No. 5,202,231 (Drmanac), said patents and patent applications being herein incorporated by reference.

[0111]The present invention also pertains to recombinant plasmids containing at least a nucleic acid according to the invention. A suitable vector for the expression in bacteria, and in particular in E. coli, is pET-28 (Novagen), which allows the production of a recombinant protein containing a 6×His affinity tag. The 6×His tag is placed at the C-terminus or N-terminus of the recombinant polypeptide.

[0112]The polypeptides according to the invention can also be prepared by conventional methods of chemical synthesis, either in a homogenous solution or in solid phase. As an illustrative embodiment of such chemical polypeptide synthesis techniques, the homogenous solution technique described by Houbenweyl in 1974 may be cited.

[0113]The polypeptides of the invention are useful for the preparation of polyclonal or monoclonal antibodies that recognize the polypeptides (SEQ ID NOS: 1, 2, 3, and 4) or fragments thereof. The monoclonal antibodies can be prepared from hybridomas according to the technique described by Kohler and Milstein in 1975. The polyclonal antibodies can be prepared by immunization of a mammal, especially a mouse or a rabbit, with a polypeptide according to the invention, which is combined with an adjuvant, and then by purifying specific antibodies contained in the serum of the immunized animal on a affinity chromatography column on which has previously been immobilized the polypeptide that has been used as the antigen.

[0114]A method of detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NOS: 1, 2, 3, or 4.

[0115]Consequently, the invention is also directed to a method for detecting specifically the presence of a polypeptide according to the invention in a biological sample. The method comprises: [0116]a) bringing into contact the biological sample with an antibody according to the invention; and [0117]b) detecting antigen-antibody complex formed.

[0118]Also part of the invention is a diagnostic kit for in vitro detecting the presence of a polypeptide according to the present invention in a biological sample. The kit comprises: [0119]a polyclonal or monoclonal antibody as described above, optionally labeled; and [0120]a reagent allowing the detection of the antigen-antibody complexes formed, wherein the reagent carries optionally a label, or being able to be recognized itself by a labeled reagent, more particularly in the case when the above-mentioned monoclonal or polyclonal antibody is not labeled by itself.

[0121]The present invention is also directed to bioinformatic searches in data banks using the whole sequences of the polypeptides using the whole sequences of the polypeptides (SEQ ID NOS: 1, 2, 3, or 4). In this case the method detects the presence of at least a subsequence encoding a peptide selected from SEQ ID NOS: 1, 2, 3, or 4 wherein the said at least subsequence is indicative of a racemase.

[0122]The invention also pertains to:

[0123]A purified polypeptide or a peptide fragment having at least 10 amino acids, which is recognized by antibodies directed against a polynucleotide or peptide sequence according to the invention.

[0124]A monoclonal or polyclonal antibody directed against a polypeptide or a peptide fragment encoded by the polynucleotide sequences according to the invention.

[0125]A method of detecting a racemase in a biological sample comprising: [0126]a) contacting DNA or RNA of the biological sample with a primer or a probe from a polynucleotide according to the invention, which hybridizes with a nucleotide sequence; [0127]b) amplifying the nucleotide sequence using the primer or said probe; and [0128]c) detecting the hybridized complex formed between the primer or probe with the DNA or RNA.

[0129]A kit for detecting the presence of a racemase in a biological sample, comprises: [0130]a) a polynucleotide primer or probe according to the invention; and [0131]b) reagents necessary to perform a nucleic acid hybridization reaction.

[0132]An in vitro method of screening for an active molecule capable of inhibiting a racemase encoded by a nucleic acid containing a polynucleotide according to the invention, wherein the inhibiting activity of the molecule is tested on at least said racemase, comprises: [0133]a) providing racemase containing a polypeptide according to the invention; [0134]b) contacting the active molecule with said racemase; [0135]c) testing the capacity of the active molecule, at various concentrations, to inhibit the activity of the racemase; and [0136]d) choosing the active molecule that provides an inhibitory effect of at least 80% on the activity of the racemase.

[0137]The term "recombinant" as used herein means that a protein or polypeptide employed in the invention is derived from recombinant (e.g., microbial or mammalian) expression systems. "Microbial" refers to recombinant proteins or polypeptides made in bacterial or fungal (e.g., yeast) expression systems. As a product, "recombinant microbial" defines a protein or polypeptide produced in a microbial expression system, which is essentially free of native endogenous substances. Proteins or polypeptides expressed in most bacterial cultures, e.g. E. coli, will be free of glycan. Proteins or polypeptides expressed in yeast may have a glycosylation pattern different from that expressed in mammalian cells.

[0138]The polypeptide or polynucleotide of this invention can be in isolated or purified form. The terms "isolated" or "purified", as used in the context of this specification to define the purity of protein or polypeptide compositions, means that the protein or polypeptide composition is substantially free of other proteins of natural or endogenous origin and contains less than about 1% by mass of protein contaminants residual of production processes. Such compositions, however, can contain other proteins added as stabilizers, excipients, or co-therapeutics. These properties similarly apply to polynucleotides of the invention.

[0139]The platform of the invention relates to reagents, systems and devices for performing the process of screening of D-amino acid tests.

[0140]Appropriate carriers, diluents, and adjuvants can be combined with the polypeptides and polynucleotides described herein in order to prepare the compositions of the invention. The compositions of this invention contain the polypeptides or polynucleotides together with a solid or liquid acceptable nontoxic carrier. Such carriers can be sterile liquids, such as water an oils, including those of petroleum, animal, vegetable, or synthetic origin. Examples of suitable liquids are peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier. Physiological solutions can also be employed as liquid carriers.

[0141]This invention will now be described with reference to the following Examples.

Example 1

Cloning and Automated Sequencing

[0142]Lambda phage and plasmid DNA were prepared using standard techniques and direct sequencing was accomplished with the Big dye Terminator Kit (Perkin Elmer, Montigny-le Bretonneux, France) according to the manufacturer's instructions. Extension products were run for 7 h in an ABI 377 automated sequencer. Briefly, to obtain the full length of the TcPRAC gene, ³²P-labeled 239 bp PCR product was used as a probe to screen a T. cruzi clone CL-Brener lamba Fix II genomic library (see details in (13)). There were isolated 4 independent positive phages. Restriction analysis and Southern blot hybridization showed two types of genomic fragments, each represented by 2 phages. Complete sequence and flanking regions of representative phages for each pattern was done. Complete characterization of TcPRACA gene, representing the first phage type, was previously described in (13). Full sequence of the putative TcPRACB gene, representing the second phage type was then performed and primers internal to the sequence were used for sequencing, as described before (13).

Example 2

Chromoblots

[0143]Epimastigote forms T. cruzi (clone CL Brener) are maintained by weekly passage in LIT medium. Agarose (0.7%) blocks containing 1×10⁷ cultured parasites were lysed with 0.5 M EDTA/10 mM Tris/1% sarcosyl pH 8.0, digested by proteinase K and washed in 10 mM Tris/1 mM EDTA, pH 8.0. Pulsed-field-gel electrophoresis (PFGE) was carried out at 18° C. using the Gene Navigator apparatus (Pharmacia, Upsala, Sweden) in 0.5×TBE. Electrophoresis were performed, as described in (14). Gels were then stained with ethidium bromide, photographed, exposed to UV light (265 nm) for 5 min and further blotted under alkaline conditions to a nylon filter (HybondN.sup.+, Amersham Life Science Inc., Cleveland, USA). DNA probe, obtained by PCR amplification of TcPRACA gene with Hi-45 (5' CTC TCC CAT GGG GCA GGA AAA GCT TCT G 3') [SEQ ID NO:5] and Bg-45 (5' CTG AGC TCG ACC AGA T(CA)T ACT GC 3') [SEQ ID NO:6] oligonucleotides (as described in (13)) was labelled with αdATP³² using Megaprime DNA labelling system (Amersham). The chromoblot was hybridized overnight in 2×Denhart's/5×SSPE/1.5% SDS at 55° C. and washed in 2×SSPE/0.1% SDS followed by 1×SSPE at 60° C. Autoradiography was obtained by overnight exposure of the chromoblot using a Phosphorimager cassette (Molecular Dynamics, UK).

Example 3

Plasmid Construction and Protein Purification

[0144]TcPRACA gene fragment starting at codon 30 was obtained by PCR, using Hi- and Bg45 primers, and cloned in frame with a C-terminal six-histidine tag into the pET28b(+) expression vector (Novagen-Tebu, Le Perray en Yvelines, France). The fragment encoding for the TcPRACB consisted of a HindIII digestion of TcPRACB gene fragment obtained by similar PCR and cloned in frame with a C-terminal six-histidine tag into the pET28b(+) expression vector. Respective recombinant proteins TcPRACA and TcPRACB were produced in E. coli BL21 (DE3) (Invitrogen, Cergy Pontoise, France) and purified using Immobilized Metal Affinity Chromatography on nickel columns (Novagen-Tebu, Le Parrayen Yvelines, France) following the manufacturer's instructions.

Example 4

Size Exclusion Chromatography

[0145]rTcPRACA and rTcPRACB proteins were purified as described here above and dialysed against PBS pH 7.4 or 0.2 M NaOAc pH 6.0 elution buffers in dialysis cassettes (Slide-A-lyzer 7K Pierce), overnight at 4° C. The final protein concentration was adjusted to 2 mg/ml and 0.5 ml of the solution were loaded onto Pharmacia Superdex 75 column (HR10×30), previously calibrated with a medium range protein calibration kit (Pharmacia). Size exclusion chromatography (SEC) was carried out using an FPLC system (AKTA Purifier, Pharmacia). Elution was performed at a constant flow rate of 0.5 ml/min, protein fractions of 0.5 ml were collected and the absorbance was monitored at 280 nm. Each fraction was assayed in racemization assays as described here below. Fractions B1 and B5, were reloaded in the Superdex 75 column and submitted to a further SEC to verify the purity of the fractions.

Example 5

Racemization Assays

[0146]The percent of racemization with different concentrations of L-proline, D-proline, L-hydroxy (OH)-proline, D-hydroxy (OH)-proline was calculated, as described in (13), by incubating a 500 μl mixture of 0.25 μM of dimeric protein and 40 mM substrate in 0.2 M sodium acetate pH 6.0 for 30 min or 1 h at 37° C. The reaction was stopped by incubating for 10 min at 80° C. and freezing. Water (1 ml) was then added, and the optical rotation was measured in a polarimeter 241 MC (Perkin Elmer, Montigny le Bretonneux, France) at a wavelength of 365 nm, in a cell with a path length of 10 cm, at a precision of 0.001 degree. The percent of racemization of 40 mM L-proline as a function of pH was determined using 0.2 M sodium acetate, potassium phosphate and Tris-HCl buffers; reactions were incubated 30 min at 37° C., as described above. All reagents were purchased from Sigma.

Example 6

Kinetic Assays

[0147]Concentrations of L- and D-proline were determined polarimetrically from the optical rotation of the solution at 365 nm in a cell of 10 cm path length, thermostated at 37° C. Preliminary assays were done with 40 mM of L-proline in 0.2 M sodium acetate pH 6 in a final volume of 1.5 ml. Optical rotation was measured every 5 sec during 10 min and every 5 min to 1 hour. After determination of the linear part of the curve, velocity in 5-160 mM substrate was measured every 30 sec during 10 min to determine K_M and V_max. Calculations were done using the Kaleidagraph program. Inhibition assays were done by incubating 0.125 μM dimeric protein, 6.7 μM-6 mM pyrrole-2-carboxylic acid (PAC), 20 to 160 mM L-proline, as described above. Graphic representation and linear curve regression allowed the determination of K_i as [PAC]/[(slope with PAC/slope without PAC)-1]. All reagents were purchased from Sigma.

Example 7

Site-Directed Mutagenesis of .sup.C330STcPRACA

[0148]Site-directed mutagenesis was performed by PCR, adapting the method of Higuchi et al. (15). Briefly, mutation of Cys³³⁰ of the proline racemase active site was produced by two successive polymerase chain reactions based on site-directed mutagenesis using two overlapping mutagenic primers: (act-1) 5' GCG GAT CGC TCT CCA AGC GGG ACA GGC ACC 3' [SEQ ID NO:7] and (act-2) 5' GGT GCC TGT CCC GCT TGG AGA GCG ATC CGC 3', [SEQ ID NO:8] designed to introduce a single codon mutation in the active site by replacement of the cysteine (TGT) at the position 330 by a serin (AGC). A first step standard PCR amplification was performed using the TcPRACA DNA as template and a mixture of act-1 primer and the reverse C-terminus primer (Bg-45) 5' CTG AGC TCG ACC AGA T(CA)T ACT GC 3' (codon 423), or a mixture of act-2 primer and the forward N-terminus primer (Hi-45) 5' CTC TCC CAT GGG GCA GGA AAA GCT TCT G 3' (codon-53) (see FIG. 5). Resulting amplified fragments of, respectively, 316 bp and 918 bp were purified by Qiagen PCR extraction kit (Qiagen, Courtaboeuf, France), as prescribed, and further ligated by T4 ligase to generate a template consisting of the full length of a potentially mutated TcPRACA* coding sequence used for the second step PCR. Amplification of this template was performed using forward Hi-45 and reverse Bg-45 primers and the resulting TcPRACA* fragment encoding for the mature proline racemase was purified and cloned in pCR®2.1-TOPO® vector (Invitrogen). TOP10 competent E. coli were transformed with the pCR®2.1-TOPO®-TcPRACA* construct and plasmid DNA isolated from individual clones prepared for DNA sequencing. Positive mutants were then sub-cloned in frame with a C-terminal six-histidine tag into the Nco I/Sac I sites of the pET 28b(+) expression vector (Novagen-Tebu, Le Parrayen Yvelines, France). Sub-clones of pET28b(+)-TcPRACA* produced in E. coli (DH5α) were sequenced again to confirm the presence of the mutation. Soluble recombinant .sup.C330STcPRACA protein was produced in E. coli BL21 (DE3) (Invitrogen) and purified using a nickel column (Novagen-Tebu), according the manufacturer's instructions.

Example 8

Mutagenesis

[0149]To verify the implication of the residue Cys160 in the reaction mechanism of the proline racemase, a site specific mutagenesis was performed to replace the residue Cys160 by a Serine, similarly to mutation described for Cys330 residue (see Example 7). Briefly, the site specific mutagenesis was performed by PCR using the following primers:

TABLE-US-00002 Ser160-Forward: ⁵'GGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG³' Ser160-Reverse: ⁵'CGCTGCAATTGAGTTATGTCCAGACATATTTAAATAGC³'

[0150]The presence of the mutation Cystein-Serine was verified by sequencing of the respective plasmids containing the PCR products, as shown here below. The plasmid pET-C160S was used to transform E. coli BL21 (DE3) and to produce the corresponding recombinant mutated protein.

TABLE-US-00003 139 M D T C G Y L N M C G H N G I A A 145 PET-TcPRAC 499 ATCGATACCGCTGGCTATTTAAATATGTGTGGACATAACTCAATTGCAGCG 550 Ser160-F/R CGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG 550 pET-C160S 499 ATGGATACCGGTGGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG 550 pET-C330S 499 ATGGATACCGGTGGCTATTTAAATATGTGTCGACATAACTCAATTGCAGCG 550 139 M D T C G Y L N M S G H N G I A A 145 318 V I F C N R Q A D R S P C G T C T 334 pET-TcPRAC 999 GTGATATTTCGCAATCGCCAGCCGGATCGCTCTCCATGTGGGACAGGCACC 1050 Ser330-F/R GCGGATCGCTCTCCAACCGGGACAGGCACC 1050 pET-C160S 999 CTCATATTTCCCAATCGCCAGCCCCATCGCTCTCCATCTGGGACACCCACC 1050 pET-C330S 999 CTGATATTTCGCAATCCCCAGGCGGATCGCTCTCCAACCCCGACACGCACC 1050 318 V I F G N R Q A D R S P S G T C T 334

[0151]Underlined are the primer sequences used for the site specific mutageneses. The mutations Cys→Ser are represented in bold and underlined for both Cys160 and Cys330 residues.

Example 9

Expression of a Functional Intracellular Isoform of Proline Racemase

[0152]Previously characterized was a TcPRAC gene from T. cruzi, and it was demonstrated in vivo and in vitro that it encodes a proline racemase enzyme (13). Analysis of the genomic organization and transcription of the TcPRAC gene indicated the presence of two paralogue gene copies per haploid genome, named TcPRACA¹ and TcPRACB². It was shown that TcPRACA encodes a functional co-factor independent proline racemase, closely resembling the C. sticklandii proline racemase (CsPR) (11). Now sequenced was the full length of TcPRACB and, as can be observed in FIG. 1A, TcPRACA and TcPRACB genes both possess the characteristic trypanosome polypyrimidine-rich motifs in the intergenic region that are crucial trans-splicing signals when located upstream of an (AG)-dinucleotide used as acceptor site. As in other T. cruzi genes, UUA triplets are found at the end of the 3' untranslated region preceding the polyadenylation site. Comparison between the two sequences revealed 14 point mutations (resulting in 96% identity) giving rise to 7 amino acid differences. When expressed, the TcPRACB is predicted to produce a shorter protein (39 kDa) whose translation would start at the ATG codon at position 274 located downstream of the (AG)-spliced leader acceptor site (at position 175). In comparison, TcPRACA has an open reading frame that encodes a peptide with an apparent molecular mass of 45 kDa. The schematic protein sequence alignment of the two proteins TcPRACA and TcPRACB depicted in FIG. 18 reveals that TcPRACB proline racemase lacks the amino acid sequence corresponding to the signal peptide observed in the TcPRACA protein (hatched box in the figure; see predicted cleavage site in FIG. 1C). Therefore the TcPRACB would produce a 39 kDa, intracellular and non-secreted isoform of the protein. As with CsPR (11) and TcPRACA (13 and FIG. 1B), the active site of proline racemase is conserved in TcPRACB sequence. Furthermore, while differing by only 7 amino acids, both the TcPRACA and TcPRACB sequences display around 50% homology to the CsPR (13). In accordance with other protein-coding genes in T. cruzi, TcPRAC genes are located on two different chromosomal bands of which one contains three or more chromosomes of similar size, see FIG. 1D. Thus, hybridization of blots containing T. cruzi CL Brener chromosomal bands separated by pulsed field gel electrophoresis revealed that sequences recognized by an homologous probe to both TcPRACA and TcPRACB are mapped in neighboring migrating bands of approximately 0.9 Mb and 0.8 Mb, corresponding respectively to regions VII and V, according to Cano et al. numbering system (14).

[0153]In order to verify if the TcPRACB gene could encode a functional proline racemase, both T. cruzi paralogues were expressed in E. coli to produce C-terminal His₆-tagged recombinant proteins. After purification by affinity chromatography on nickel-nitrilotriacetic acid agarose column, recombinant proteins were separated by SDS gel electrophoresis revealing single bands with the expected sizes of 45.8 and 40.1 kDa, respectively, for the rTcPRACA and rTcPRACB proteins (FIG. 2A). To determine whether rTcPRACB displays proline racemase enzymatic activity, biochemical assays were employed to measure the shift in optical rotation of L- and D-proline substrates, as described (13). As can be seen in FIG. 2B, rTcPRACB racemizes both L- and D-proline but not L-hydroxy-proline, like rTcPRACA. In a similar manner, rTcPRACB is a co-factor independent proline racemase as described for CsPR (11) and rTcPRACA (13) proline racemases. The rate of conversion of L- into D-proline was measured at various pH values using both recombinant enzymes. As illustrated in FIG. 2C, rTcPRACA activity clearly shows a pH dependency with an optimal activity from pH 5.5 to 7.0. In contrast, the optimum activity of rTcPRACB can be observed in a large pH spectrum varying from pH 4.5 to 8.5. These results revealed that translation of the open reading frame of both TcPRAC genes copies result in functional proline racemase isoforms. As previously described, Western blot analysis of non-infective epimastigote parasite extracts using antibodies raised against the 45 kDa secreted proline racemase had previously revealed a 39 kDa protein mostly in the soluble cellular fraction, only weakly in the cellular insoluble fraction and absent from culture medium (13). To demonstrate that the intracellular 39 kDa isoform of the protein was equally functional in vivo, soluble cellular extracts were obtained from 5×10⁸ epimastigotes, non-infective parasites and the levels of 39 kDa soluble protein quantified by Western blot comparatively to known amounts of rTcPRACB enzyme. As can be observed in FIG. 2D, the intracellular isoform of the protein is indeed functional in vivo, since proline racemase enzymatic activity was displayed and levels of racemization were dependent on protein concentration. This discovery is useful for specific inhibitors reaching the intracellular compartment.

Example 10

Functional Analysis and Kinetic Properties of Recombinant T. cruzi Proline Racemases

[0154]Since the TcPRAC gene copies encode for secreted and non-secreted isoforms of proline racemase with distinct pH requirements for activity, our investigation was made to determine whether other biochemical properties differ between rTcPRACA and rTcPRACB proteins. Such differences might reflect the cellular localization of the protein during parasite differentiation and survival in the host. Both rTcPRACA and rTcPRACB enzyme activities are maximal at 37° C. and can be abolished by heating for 5 min at 80° C. However, the stability of the two recombinant enzymes differs considerably, when analyzed under different storage conditions. Thus, as shown in Table 1, purified rTcPRACB is highly stable, since its activity is maintained for at least 10 days at room temperature in 0.5 M imidazol buffer pH 8.0, as compared to rTcPRACA that loses 84% of its activity under such conditions. In contrast, most of the enzymatic activity of rTcPRACA is maintained at 4° C. (65%), compared to that of rTcPRACB (34%). Both enzymes can be preserved in 50% glycerol at -20° C., or diluted in sodium acetate buffer at pH 6.0, but under these storage conditions rTcPRACA activity is impaired. However, best preservation of both recombinant proline racemases was undoubtedly obtained when proteins were kept at -20° C. as ammonium sulfate precipitates. Preservation is important for a kit.

TABLE-US-00004 TABLE I Stability of recombinant TcPRACA and TcPRACB proline racemases under different storage conditions % of preservation of proline racemase activity NaOAc Column pH 6 (NH₄)₂SO₄ Protein CTRL RT +4° C. Gly/-20° C. 4° C. 4° C. -20° C. rTcPRACA 100.0 16.0 66.5 62.9 31.0 53.9 100.0 rTcPRACB 100.0 100.0 34.0 93.6 77.6 98.4 100.0

[0155]After purification on nickel-nitrilotriacteic acid agarose column, recombinant proteins were kept for 10 days in nickel column buffer (20 mM Tris/500 mM NaCl/500 mM imidazol, pH 8.0) at room temperature (RT) or at +4° C., or either diluted in 50% glycerol and maintained at -20° C. (Gly/-20° C.) or in optimum pH buffer (NaOAc, pH 6.0) at 4° C. Recombinant enzymes were precipitated in (NH₄)₂SO₄ and kept in solution at 4° C. or pellet dried at -20° C. Racemase assays were performed for 30 min at 37° C. Percent of preservation was determined polarimetrically using 0.25 μM of either purified rTcPRACA or rTcPRACB enzymes and 40 mM of L-proline, as compared to results obtained with freshly purified proteins (CTRL). These results are representative of at least two independent experiments.

[0156]Both recombinant enzymes exhibited Michaelis-Menten kinetics (FIG. 3A) and rTcPRACB had a higher activity than rTcPRACA. Indeed, as can be observed in FIG. 3B, analysis of L>D conversion of serial dilutions of L-proline catalyzed by a constant amount of each enzyme showed that rTcPRACB enzyme (K_M of 75 mM and V_max of 2×10^-4 molsec.sup.-) has a higher velocity as compared to rTcPRACA (K_M of 29 mM and V_max of 5.3×10^-5 molsec^-1). In order to determine the K_i values for pyrrole-2-carboxylic acid (PAC), the specific and competitive inhibitor of CsPR (16), assays were performed with both recombinant proteins. These assays revealed that PAC is comparably effective as inhibitor of rTcPRACA (FIG. 3c) and rTcPRACB, and K_i values obtained were, respectively, 5.7 μM and 3.6 μM. The difference in K_i values reflects almost perfectly the difference in K_M values reported for both enzymes, which are similar to that of the native protein. These K_i values indicate that the affinity of PAC inhibitor is higher for rTcPRACA and rTcPRACB than for CsPR (K_i of 18 μM). The K_m and K_i values are important for an inhibitor.

Example 11

Requirement of a Dimeric Structure for Proline Racemase Activity

[0157]When rTcPRACA was submitted to size exclusion chromatography on a Superdex 75 column at pH 6.0, two peaks of protein were eluted, respectively, around 80 kDa (B2 fraction) and 43 kDa (B4 fraction), presumably corresponding to dimeric and monomeric forms of the enzyme (FIG. 4). Western blot analysis of whole T. cruzi epimastigote extracts using non-denaturing PAGE had previously indicated a molecular mass of 80 kDa for the native protein while a 45 kDa band was obtained by SDS-PAGE (13). In order to eliminate cross-contamination, B1 and B5 fractions, eluted, respectively, at the start and at the end of the predicted dimer (B2) or monomer (B4) peaks, were reloaded on the column and the profiles obtained (see FIG. 4 inserts) confirmed the purity of the fractions. Enzyme activity resides in the 80 kDa peak, but not in the 43 kDa peak (Table II). These results corroborated that two subunits of the protein are necessary for racemase activity. At neutral pH (7.4 or above), the rTcPRACA gives rise to high molecular weight aggregates which are not observed with rTcPRACB, consistently with its broader optimal pH spectrum. The enzyme should be in optimal pH conditions for a kit buffer, for example.

TABLE-US-00005 TABLE II Racemase activity of recombinant TcPRACA fractions after size exclusion chromatography Fractions A15 B1 B2 B3 B4 B5 B6 B7 % racemization 1.3 35.5 62.9 42.8 0.7 0 0 0

[0158]After elution from Superdex 75 column, 20 μl of each peak (A15 to B7, see FIG. 4) corresponding to 1 μg of protein were incubated 1 h at 37° C. with 40 mM of L-proline in 0.2 M NaOAc, pH 6.0. Optical rotation was measured and % of racemization was determined as described in Example 5.

Example 11

Abrogation of Proline Racemase Activity by Mutation of Cys³³⁰ and Alternately Cys¹⁶⁰ of the Catalytic Site

[0159]C. sticklandii proline racemase is described as a homodimeric enzyme with subunits of 38 kDa and a single proline binding site for every two subunits, where two cysteines at position 256 might play a crucial role in catalysis by the transfer of protons from and to the bound substrate (12). It has previously been shown that mitogenic properties of the T. cruzi proline racemase are dependent on the integrity of the enzyme active site, as inhibition of B-cell proliferation is obtained by substrate competition and specific use of analogues (PAC) resembling the structure assumed by the substrate proline in its transition state (16). To verify the potential role of the cysteine residues at the active site of the T. cruzi proline racemase, Cys³³⁰ and alternately Cys¹⁶⁰ were replaced by a serine residue through site specific mutation of TcPRACA. The choice of serine as the substituting amino acid was made to avoid further major disturbances on three dimensional structure of the protein (see strategy in FIG. 5 above). After confirmation of the single codon mutation through sequencing of the construct, the C³³⁰S or C¹⁶⁰S rTcPRACA mutant proline racemase was expressed in E. coli and purified in the same manner as wild type rTcPRACA. Then used were C³³⁰S or C¹⁶⁰s rTcPRACA in racemization assays to verify the effects of the mutation on the enzymatic activity of the protein. As can be observed in Table III (and in FIG. 12) a total loss of proline racemase activity is observed as compared to the wild type enzyme, establishing that proton transfer during proline racemization is specifically dependent on the presence of the cysteine residue in the active site.

TABLE-US-00006 TABLE III Loss of racemase enzymatic activity in the site direct .sup.C330SrTcPRACA Data set rTcPRACA .sup.C330SrTcPRACA Time (min) 0 10 30 60 0 10 30 60 Optical rotation -0.385 -0.300 -0.162 -0.088 -0.385 -0.382 -0.391 -0.387 % racemization 0 22 58 77 0 0 0 0

[0160]After purification, 5 μg of rTcPRACA or .sup.C330SrTcPRACA were incubated at 37° C. with 40 mM of L-proline in NaOAc buffer, pH 6.0. Optical rotation was measured at different times and % of racemization was determined as described in Example 5.

Example 12

Proline Racemase Protein Signatures and Putative Proline Racemases in Sequence Databases

[0161]The conservation of critical residues between parasite and bacterial proline racemases prompted a search for similarities between TcPRAC and other protein sequences in SWISS-PROT and TrEMBL databases. Twenty one protein sequences yielded significant homologies, from 11 organisms, such as several proteobacteria of the alpha subdivision (Agrobacterium, Brucella, Rhizobium) and gamma subdivision (Xanthomonas and Pseudomonas), as well as of the fermicutes (Streptomyces and Clostridium). Within the eukaryota, besides in T. cruzi, homologous genes were detected in the human and mouse genomes, where predicted proteins show overall similarities with proline racemase. Except for Clostridium sticklandii and Xantomonas campestri, each other organism encodes 2 paralogues, and Agrobacterium tumefaciens contains 3 genes. The multiple alignment also allowed for the definition of three signatures of proline racemase, which are described here in PROSITE format. As can be seen in Table IV, when using a minimal motif of proline racemase protein (M I), [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, located immediately after the start codon at position 79, the inventors obtained 9 hits. A second motif (M II), consisting of [NSM][VA][EP][AS][FY]X(13,14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY], starting at position 218, gave 14 hits; however, the first or the second half of this motif is not sufficiently stringent to be restrictive for putative proline racemases, but gives hits for different protein families. A third motif (M III), from positions 326 to 339, namely DRSPXGX[GA]XXAXXA, was considered as a minimal pattern. Note that in position 330, the cysteine of the active site was replaced by an X. As shown in Table IV, this minimal pattern yields all 21 hits. Curiously, both genes in human as well as in mouse encode threonine instead of cysteine at the X position in motif III, while in Brucella, Rhizobium and Agrobacterium species each encode one protein with C and one with T in this position. One cannot hypothesize the implications of this substitution for the functionality of these putative proteins. If the residue at position 330 is maintained as a cysteine in motif III, a reduced number of 12 hits from 9 organisms is thus obtained, which can probably be considered as true proline racemases. The alignment of the 21 protein sequences and derived cladogram are shown in FIG. 6 and FIG. 7, respectively, the three boxes depicted correspond to motifs I, II and III described here above. This invention thus shows that DRSPCGXGXXAXXA is the minimal signature for proline racemases. Blast searches against unfinished genomes yielded, at present, an additional 13 predicted protein sequences from 8 organisms, with high similarity to proline racemases, all containing motif III. Organisms are Clostridium difficile, C. botulinum, Bacillus anthracis, Brucella suis, Pseudomonas putida, Rhodobacter sphaeroides, Burkholderia pseudomallei, B. mallei, and the fungus Aspergillus fumigatus. These results indicate that proline racemases might be quite widespread.

TABLE-US-00007 TABLE IV SWISS-PROT and TrEMBL databases screening using PROSITE motifs Motif M M M Organism Seq Access. nb M I II III III* Agrobacterium tumefaciens 1 Q8UIA0 + + + + Agrobacterium tumefaciens 2 Q8U6X2 - - + - Agrobacterium tumefaciens 3 Q8U8Y5 - - + - Brucella melitensis 1 Q8YJ29 - + + + Brucella melitensis 2 Q8YFD6 + - + - Clostridium stickilandii Q9L4Q3 - + + + Homo sapiens 1 Q96EM0 + + + - Homo sapiens 2 Q96LJ5 + + + - Mus musculus 1 Q9CXA2 + + + - Mus musculus 2 Q99KB5 + + + - Pseudomonas aeruginosa 1 Q9I476 - + + + Pseudomonas aeruginosa 2 Q9I489 - - + + Rhizobium loti 1 Q98F20 - + + + Rhizobium loti 2 Q988B5 + + + - Rhizobium meliloti 1 Q92WR9 - - + - Rhizobium meliloti 2 Q92WS1 - + + + Streptomyces coelicolor Q93RX9 + - + + Trypanosoma cruzi 1 Q9NCP4 + + + + Trypanosoma cruzi 2 + + + + Xanthomonas axonopodis 1 Q8PJI1 - + + + Xanthomonas axonopodis 2 Q8PKE4 - - + + Xanthomonas campestris Q8P833 - + + + Bacillus anthracis (Ames) 1 Q81UH1 + - + + Bacillus anthracis (Ames) 2 Q81PH1 - - + + Bacillus cereus 1 Q81HB1 + - + + Bacillus cereus 2 Q81CD7 - - + + Brucella suis 1 Q8FYSO + + + + Brucella suis 2 Q8G213 + - + - Chromobacterium violaceum Q7NU77 + + + + Photorhabdus luminescens Q7N4S6 + + + + Pseudomonas putida Q88NF3 + + + + Rhodopirella baltica Q7UWF3 - - + + Streptomyces avermitilis Q82MDO + - + + Vibrio parahaemolyticus Q87Q20 + + + + SWISS-PROT and TrEMBL databases were screened using motifs I to III (M I, M II and M III). M I corresponds to [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of [NSM][VA] [EP][AS][FY]X(13, 14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY] M III to DRSPXGXGXXAXXA and M III* to DRSPCGXGXXAXXA. Access. nb, SWISS-PROT accession number of the sequence; seq, sequence number according to FIG. 6; + and -, presence or absence respectively of hit using the corresponding motif.

[0162]Finally, Table V summarizes the genes in which the proline racemase signature has been identified and the sequences including both crucial residues Cys³³⁰ and Cys¹⁶⁰ of the catalytic site are present.

TABLE-US-00008 TABLE V Results of screening using nucleotide or peptide sequence of TcPRACA Motifs common M III* MCGH sequence Organism Accession number Database M I M II M III Cys³³⁰ Cys¹⁶⁰ EPRGH Aspergillus fumigatus Af0787f05.p1c TIGR + - + - + + TIGR 5085 TIGR + + + + ? + Bacillus anthracis str. Ames AE017027 EMBL + + + + + + Bacillus anthracis str. Ames AE017033 EMBL + + + + + + (minus strand) TIGR 1392 TIGR + + + + + + Bacillus cereus ATCC14579 AE017007 EMBL + + + + + + (minus strand) Brucella suis 1330 (minus AE014469 EMBL + + + + + + strand) TIGR 29461 TIGR + + + + + + Burkholderia mallei contig: 33162: b_mallei TIGR + + + + + EPRGSD TIGR 13373 TIGR + ? + + + EPRGSD SANGER 28450 Sanger + ? + + + EPRGSD Cbot12g05.q1c Sanger ? + + + + + SANGER 36826 Sanger + + + + + + Clostridium difficile Clostridium difficile Sanger ? + + + + + 630 SANGER 1496 Sanger + + + + + + Clostridium sticklandii CST130879 EMBL + + + + + + LM16BINcontig2054 Sanger ? + + + + EPRGND LM16W5b02.q1c Sanger ? + ? ? + EPRGND Pseudomonas putida KT2440 AE016778 EMBL + + + + + EPRGND KT2440 TIGRpputida TIGR + ? + + + EPRGND 13538 UTHSC 1063 UTHSC + ? - - + + TbKIX28b06.qlc Sanger ? + ? ? + + TbKIX28b06.plc Sanger ? + ? ? + + Tviv655d02 Sanger ? + + + ? ? Tviv380d6 Sanger + ? ? ? + + congo208e06 Sanger ? + + + ? ? AP005077 EMBL + + + + + + Databases were screened using nucleotide or peptide sequences of TcPRACA. Motifs I to III (M I, M II and M III) were searched. M I corresponds to [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of [NSM][VA] [EP][AS][FY]X(13, 14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY] M III to DRSPXGXGXXAXXA and M III* to DRSPCGXGXXAXXA. Access. nbs, TIGR, EMBL or SANGER accession numbers of the sequence; + and -, presence or absence respectively of the corresponding motif. Others, extremely conserved regions outside the motifs, including NMCGH which contains one of the active site cysteine. Sequences presented in annexe pages where the conserved regions of 2 Cysteine residues of the active site are squared, are presented in the table in bold with corresponding Accession numbers.

[0163]A variety of free D-amino acids can be found in different mammalian tissues in naturally occurring conditions. Some examples include the presence of D-serine in mammalian brain, peripheral and physiological fluids, or else D-asp that can be also detected in endocrine glands, testis, adrenals and pituitary gland. D-pro and D-leu levels are also very high in some brain regions, pineal and pituitary glands. Some reports attribute to D-amino acids a crucial role as neuromodulators (receptor-mediated neurotransmission), as is the case of D-ser, or as regulators of hormonal secretion, oncogeny and differentiation (i.e. D-asp). It is believed that the most probable origin of naturally occurring D-amino acids in mammalian tissues and fluids is the synthesis by direct racemization of free L-enantiomers present in situ. However, a part from the cloning of serine racemase genes from rat brain and human no other amino acid racemases were identified until now in man. Some others report that D-amino acids present in mammalian tissues are derived from nutrition and bacteria.

[0164]The increasing number of reports associating the presence of D-amino acids and pathological processes indicate that the alteration of their level in biological samples would be of some diagnostic value as, for instance, the identification of changes in free levels of D-asp and D-Ala in brain regions of individuals presenting Alzheimer. The amounts of D-asp seems to decrease in brain regions bearing neuropathological changes and is paralleled by an increase of D-ala. Overall, total amounts of D-amino acids increase in the brain of individuals presenting memory deficits in Alzheimer, as compared to normal brains, offering new insights towards the development of new simple methods of D-amino acid detection. In the same line, D-ser concentrations in the brain are altered in Parkinson disease and schizophrenia but other findings clearly associate significant higher concentrations of D-amino acids in plasma of patients with renal diseases or else in plasma of elderly people.

[0165]Previous results determined that the polyclonal B cell activation by parasite mitogens contributes to the mechanisms leading to parasite evasion and persistence in the mammalian host. It has also been demonstrated that TcPRAC is a potent B cell mitogen released by the infective forms of the parasite. The TcPRAC inhibition by pyrrole carboxylic acid induces a total loss of TcPRAC B cell mitogenic ability.

[0166]It has also been shown that the overexpression of TcPRACA and TcPRACB genes by mutant parasites are able to confer to these mutants a better invasion ability of host cells in vitro. This contrasts to the inability of para sites to survive if these TcPRAC genes are inactivated by genetic manipulation. In addition, the immunization of mice with sub-mitogenic doses of TcPRAC, or with appropriate TcPRAC-DNA vector vaccine preparations, was shown to trigger high levels of specific antibody responses directed to TcPRAC and high levels of immunoprotection against an infectious challenge with live Trypanosoma cruzi.

[0167]Altogether, these data suggest that TcPRAC enzyme isoforms are essential elements for parasite survival and fate and also support that parasite proline racemase is a good target for both vaccination and chemotherapy. In fact, the addition of pyrrole carboxylic acid at TcPRAC neutralizing doses to non-infected monkey cell cultures do not interfere with cellular growth. Besides, the utilization of a proline racemase inhibitor in humans would be a priori possible since the absence of the two critical active site cysteine residues (Cys 330 and Cys 160) for the PRAC enzyme activity has been observed in the single sequence that displays some peptide homologies with TcPRAC that was identified by blasting the Human Genome available data with the TcPRAC gene sequence.

[0168]As observed by data mining using TcPRAC gene sequences, it has been possible to identify putative proline racemases in other microorganisms of medical and agricultural interest. As can be seen in FIG. 8, the presence of MI, MII and most particularly MIII stringent motif (the signature for proline racemases) indicates the potentiality of those proteins to be functional proline racemases. On the one hand, it can be observed that critical residues necessary for the enzyme activity are displayed in those sequences and, on the other hand, that the open reading frames (ORF) are highly homologous to the ORF of the parasite PRAC.

[0169]In order to search for putative molecules that could be used as inhibitors of TcPRAC, or other proline racemases, it would be necessary to develop a microtest able to specifically reveal the inhibition of proline racemization performed by TcPRAC and consequently the blockage of a given proline stereoisomer generation. For instance, this could be done by analysing the ability of any potential inhibitory molecule to hinder the generation of D-proline in a reaction where L-proline is submitted to TcPRAC enzymatic activity.

[0170]At present, the available analyses to detect D- (or L-) amino acids are very challenging and methods to differentiate L-stereoisomers from D-stereoisomers are time-consuming, i.e. gas chromatography, thin layer chromatography using chiral plates, high-performance capillary electrophoretic methods, HPLC, and some enzymatic methods. Some of those techniques also require the use of columns and/or heavy equipment, such as polarimeters or fluorescence detectors.

[0171]With the aim of developing a simple test that is useful to rapidly screen putative inhibitors of TcPRAC, TcPRAC constructs allowing for the production of high amounts of the recombinant active enzyme were used together with the knowledge of a specific inhibitor of proline racemases (pyrrole carboxylic acid, PAC) to develop a medium/high throughput microplate test that can be used to easily screen a high number of inhibitor candidates (i.e. 100-1000). Such a test is based on colorimetric reactions that are certainly a simpler alternative to polarimetry and other time-consuming tests. Thus, the evaluation of light deviation of L- or D-proline enantiomers by a polarimeter to quantify the inhibition of proline racemization to test such an elevated number of molecules is impracticable, offers a low sensibility, and would require greater amounts of reagents as compared to a microplate test that would additionally be of an affordable price.

[0172]Accordingly, this invention is based on the detection of D-proline originated through racemization of L-proline by TcPRAC, in the presence or in the absence of known concentrations of PAC inhibitor as positive and negative controls of racemization, respectively. For that purpose, this invention utilizes another enzyme, D-amino acid oxidase (D-AAO), that has the ability to specifically oxidize D-amino acids in the presence of a donor/acceptor of electrons and yield hydrogen peroxide. The advantage of this strategy is that hydrogen peroxide can be classically quantified by peroxidase in a very sensitive reaction involving ortho-phenylenediamine, for example, ultimately offering a chromogenic reaction that is visualized by colorimetry at 490 nm.

[0173]Since D-amino acid oxidase reacts indiscriminately with any "D-amino acid", and not with their L-stereoisomers, such a test is not only helpful to identify proline racemase inhibitors, but also applicable, if slightly modified, to detect any alterations in levels of free D-aa in various fluids to make a diagnosis of some pathogenic processes.

I--Basics for a D-Amino-Acid Quantitative Test

[0174]The following method of the invention allows detection and quantitation of D-Amino acids. A first reaction involves a D-amino-oxidase. This enzyme specifically catalyses an oxidative deamination of D-amino-acids, together with a prosthetic group, either Flavin-Adenin-Dinucleotide (FAD) or Flavin-Mononucleotide (FMN), according to the origin of the Enzyme. (Obs. FAD if the enzyme comes from porcine kidney).

[0175]The general reaction is as follows:

##STR00001##

In (1), the D-amino acid is deaminated and oxidized, releasing ammonia and the reduced prosthetic group. If the amino group is not a primary group, the amino group remains untouched and no ammonia is released.In (2), the reduced prosthetic group reduces oxygen, and generates hydrogen peroxide. Either a catalase or a peroxidase can decompose hydrogen peroxide.A catalase activity is written as:

##STR00002##

whereas a peroxidase activity is

##STR00003##

[0176]wherein K is any carbon chain

[0177]Thus, detection of hydrogen peroxide can be done with the use of catalase and a reagent sensitive to oxygen such as by destaining reduced methylene blue for instance with oxygen or with the use of peroxidase with a change in color of the reagent indicated by:

##STR00004##

II--Application of Such a Test for Evaluating the T. cruzi Racemase Activity and the Inhibition of this Racemase.

[0178]II-1--Test for Racemase Activity

[0179]The T. cruzi racemase activity converts reversibly L-Pro into D-Pro. Since these two forms can induce polarized light deviation, this conversion can be measured by optical polarized light deviation. But the presence of the D-form allows also the use of D-amino-acid oxidase in order to assess the amount of D-Proline in racemase kinetics. In this test the following reactions are involved:

1) Proline-Racemase Activity.

##STR00005##

[0180]2) D-Amino-Acid Oxidase

##STR00006##

[0181](Obs: There is no ammonia formed in the case of Proline, because the nitrogen of Proline is involved in a secondary amine.)

##STR00007##

3) Detection of Hydrogen Peroxide with Peroxidase

##STR00008##

[0182]The chromogenic reagent can be, for example, orthophenylenediamine (OPD), or 3,3',5,5' tetramethyl benzidine (TMB), or 5-aminosalicylic acid (ASA).

[0183]These reactions can be carried out using the following exemplary, but preferred, materials and methods.

II-1-1--Materials

TABLE-US-00009 [0184]Materials Comments Proline-racemase (TcPRAC) (1 mg/ml Stock) L-Proline, Sigma, Ref. P-0380 (1M Stock) An equimolar of D- and L-Proline is made by D-Proline, Aldrich, ref. 85 891-9 (1M Stock) mixing equal volumes of 2M D-Proline with 2M L- Proline Orthophenylenediamine (OPD) Sigma refP-8287 10 mg tablets. Extemporaneously used as a lot 119H8200 20 mg/ml stock solution in water. D-AAO from swine kidney (Sigma) ref. A-5222 lot Powder dissolved into 1 ml Buffer* + 1 ml 100% 102K1287 glycerol. The resulting activity is 50 U/ml. Stored at -20° C. Horse radish peroxidase (HRP) Sigma ref P8375 Powder dissolved into 2.5 ml Buffer* + 2.5 ml 100% lot 69F95002 glycerol. The resulting activity is 5042 U/ml. Stored at -20° C. Sodium acetate 0.2M Ph 6.0 Flavine-adenine-dinucleotide (FAD) (Sigma) ref. Stock solution of 10^-1M in water. Stored at -20° C. F-6625 Used as a 10^-3M sub-stock solution. Sodium pyrophosphate (Pop) 0.235M Not soluble at a higher concentration. Must be stored at 4° C. and gently heated before use in order to solubilize crystals which may occur. Buffer* = 10 ml of 0.2M sodium acetate The final pH is 8.3. buffer pH 6.0 + 680 μl 0.235M Pop Microplates (96 wells) With adhesive coverlid ELISA reader for microplates With a wavelength filter at 490 nm for OPD substrate.

II-1-2--Methods

II-1-2.1--Racemisation in Microplates:

[0185](1) The volumes are indicated for a single well, but duplicates are mandatory. Leave enough raws of the microplate empty for standard and controls to be used in further steps. Distribute the following volumes per well reactions

a) without inhibitor (Vol=QS 81 μl)

TABLE-US-00010 TcPRAC 1 mg/ml 2 μl 2 μl 2 μl 2 μl L-Proline 0.1M 32 μl 16 μl 8 μl 4 μl Proline Final (40 mM) (20 mM) (10 mM) (5 mM) concentration Sodium acetate 47 μl 63 μl 71 μl 75 μl buffer 0.2M pH 6

b) with inhibitor (Vol=QS 81 μl)

[0186]A range of concentrations between 5 mM and 1 mM can be planned for the inhibitor. It should be diluted in sodium acetate buffer 0.2 M pH 6.0. Hence, the volume of inhibitor is subtracted from the volume of buffer added in order to reach a final volume of 81 μl. For instance, 50% inhibition of racemisation of 10 mM L-proline is obtained with 45 μM Pyrrole carboxylic acid (PAC, specific inhibitor of proline racemase), when 36.5 μl PAC+44.5 μl buffer are used (see results in FIG. 8).

[0187]Table VI is provided for 10 mM L-Proline as a substrate.

TABLE-US-00011 TABLE IV TcPrac 1 mg/ml 2 μl 2 μl 2 μl 2 μl 2 μl 2 μl 2 μl 2 μl 2 μl 2 μl L-Proline 0.1M 8 μl 8 μl 8 μl 8 μl 8 μl 8 μl 8 μl 8 μl 8 μl 8 μl PAC 0 μl 5.4 μl 11 μl 22 μl 43 μl 9 μl** 17 μl** 35 μl** 69 μl** 14 μl*** 0.1 mM/1 mM**/ 10 mM*** Final concentration (μM) 0 6.7 13.5 27 54 107 214 429 858 1715 Sodium acetate buffer 71 μl 65.6 μl 60 μl 49 μl 28 μl 62 μl 54 μl 36 μl 2 μl 57 μl 0.2 M pH6 QS 81 μl

(2) Cover the microplate with an adhesive coverlid and leave for 30 nm at 37° C.(3) At the end of racemisation, 5.5 μl of 0.235M Pop are added in each reaction well of the microplate in order to shift pH from pH6.0 to pH 8.3.

II-1-2.1-2--Quantitation of Formed D-Proline: Standards and Controls.

[0188](1) Prepare standard and controls:

[0189]Standard: An equimolar mixture of L- and D-Proline is used as a standard in a range from 0.05 mM to 50 mM (final concentration in the assay). It is used for assessing the amount of D-Proline formed after racemization. The standard range is made in microtubes, as follows:

[0190]In tube 1, mix Proline and buffer according to the described proportions.

[0191]Then, add 500 μl of the obtained mixture to 500 μl of buffer in next tube, and so on.

TABLE-US-00012 ##STR00009##

Negative control is prepared in an other microtube, as follows:

TABLE-US-00013 L-Proline (1M) 200 μl Buffer* 800 μl Final concentration 40 ml Blank = Buffer*.

(2) Dispense in the empty wells of the microplate (see step II-1-2.1):

TABLE-US-00014 Buffer* 67 μl Standard dilutions 20 μl or negative control Obs: For the blank dispense 87 μl of Buffer* only

(3) Prepare a mixture containing the enzymes (D-AAO/HRP Mix), as follows:The amounts are given for one well, provided that the final volume will be 100 μl with the racemase products or the substrate:

TABLE-US-00015 For 13 μl: Buffer* 6.5 μl D-AAO 50 U/ml 1.7 μl OPD (20 mg/ml) 2.5 μl HRP 5000 U/ml 0.75 μl FAD 10^-3M (4.5 μl 10^-1M + 446 μl buffer) 1.5 μl

This mixture is kept in the ice until use.(4) The quantitation reaction starts when 13 μl of D-AAO/HRP mix is added to the reaction well.(5) The microplate is covered with an adhesive coverlid and it is left in the dark at 37° C. between 30 nm and 2 hours. The reaction can be monitored by eye whenever a color gradient matches the D-amino acid concentration of the standard dilutions.(6) The microplate is read with a microplate spectrophotometer using a filter of at 490 nm.

Example 13

D-AOO Microplate Test is More Sensitive than D-Amino Acid Detection by Detection in Polarimeter

[0192]In order to compare the D-Proline quantitation by polarimeter and by D-amino-oxidase/HRP a comparison was performed between the two tests using different concentrations of L-proline and different concentrations of PAC, the specific inhibitor of proline racemases. FIG. 8 shows the percent of racemisation inhibition of different L-proline concentrations (ranging from 10-40 mM) using the D-AAO (D-AA0/L-) microtest as compared to conventional detection using a polarimeter (Pol/L-).

[0193]With the polarimeter, there seems to be no difference of PAC inhibition of TcPRAC with the three concentrations of L-Proline. Therefore, 50% inhibition is obtained with 1 mM PAC, whether 10 mM or 40 mM L-Proline is used. In contrast, when using D-MO/HRP test, it can be seen that inhibition by PAC is somewhat higher with a low concentration of L-Proline (10 mM for example) than with an increased one (20 mM or 40 mM). Therefore, 50% inhibition is obtained:

[0194]with 50 μM PAC when 10 mM L-Proline is used,

[0195]with 170 μM PAC when 20 mM L-Proline is used and

[0196]with 220 μM PAC when 40 mM L-Proline is used.

[0197]In conclusion, D-AAO/HRP evaluation is more sensitive since it can discriminate PAC inhibition at a lower concentration than evaluation with the polarimeter. Furthermore, inhibition is logically conversely proportional to L-Proline concentration, which can be assessed with the D-AAO/HRP method, but not with the polarimeter measurement. Such a test is useful for the screening of new inhibitors of TcPRAC in a medium/high throughput test.

[0198]A preferred technological platform to perform the above test and to select appropriate inhibitors contains at least the following products:

[0199]L-Proline, D-Proline, a proline-racemase

[0200]A peroxidase, a substrate of a peroxidase

[0201]A D-amino-acid oxidase

[0202]And optionally a battery of potential inhibitory molecules.

Example 14

L-Proline Inhibits D-Amino-Oxidase Activity

[0203]FIG. 9 shows the comparison of D-AAO/HRP reaction using D-Proline alone or an equimolar mixture of D- and L-Proline as standard. It can be seen that the amount of D-Proline required to obtain a given optical density is higher when a mixture of L- and D-Proline are used as compared to a standard using D-proline alone. Since Proline-racemase activity ends when both L- and D-Proline are in equal amounts, it was also adequate to use an equimolar mixture of both enantiomers of Proline as standard for D-Proline determination.

Example 15

PAC does not Interfere with DAAO/HRP Activity

[0204]FIG. 10 shows optical density at 490 nm as a function of D-proline concentration under the following conditions.

[0205]Conditions in μl wells,

TABLE-US-00016 [D-Proline]range between 0.1 mM and 40 mM [D-AAO] 0.89 U/ml [HRP} 37.5 U/ml [OPD] 0.5 U/ml [FAD] 1.5 × 10^-5M Buffer*

[0206]The presence of PAC does not influence DAAO/HRP reaction.

Example 16

A Medium/High Throughput Test Using the D-AAO Microplate Test

[0207]Table VII is an Example of a medium/high throughput test using the D-AAO microplate test. [0208]Blue: D-proline standard (column 1) [0209]Green: Positive control of racemization using avec 10 mM substrate (column 2, line A and B) [0210]Orange: control for inhibition of racemization reaction by PAC using 10 mM substrate (column 2, line C and D) [0211]Blank 1: mix with racemase (column 2, line E) [0212]Blank 2: mix without racemase (column 2, line F) [0213]Yellow: Negative control for specificity of (without racemase+40 mM L-proline) (column 2, line G and H) [0214]Other wells: with Inhibitors (T1, T2, T3, . . . T40): in duplicates

TABLE-US-00017 [0214] TABLE VII 1 D-Pro (mM) 2 3 4 5 6 7 8 9 10 11 12 A 10 L-Pro T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 L-Pro '' '' '' '' '' '' '' '' Pro PAC T11 T12 T13 T14 T15 T16 T17 T18 T19 T20 Pro PAC '' '' '' '' '' '' '' '' '' '' Blanc 1 T21 T22 T23 T24 T25 T26 T27 T28 T29 T30 Blanc 2 '' '' '' '' '' '' '' '' '' L-Pro T31 T32 T33 T34 T35 T36 T37 T38 T39 T40 H 0.07 L-Pro '' '' '' '' '' '' '' ''

Example 17

Application of Such a Test for General Detection of D-Amino Acids in Samples

[0215]The use of a microplate test based on D-amino-acid oxidase together with a peroxidase, such as horseradish peroxidase, can be used to detect and quantitate any D-amino acid in any biological or chemical sample. For example, since D-amino acids are described to be involved in several pathological processes or neurological diseases, such as Alzheimer disease, Parkinson, or renal diseases, their detection can be an important marker or parameter for the diagnosis and the follow-up of these pathologies. This technology can be also extended to the detection and quantification of D-amino acids in eukaryotic organisms, such as plants or fungi, and in bacteria.

[0216]The D-MO/HRP test described here above can also be used for this purpose with slight modifications. For that purpose, the racemase reaction step should be skipped and the microplate test should start straightforward at the II-1-2.1-2 step described above with the following remarks:

[0217]1) Standard: It should not be an equimolar mixture of D- and L-amino acid, but rather a serial dilution of D-Amino acids. The choice of amino acid is made according to the interest of the D-amino acid under investigation. The final volume in wells should be of 87 μl.

[0218]2) Negative control: It is made with the L-enantiomer of the D-amino acid under investigation. The final volume should be 87 μl.

[0219]3) Blank: It is made with 87 μl buffer*. (See paragraph II.1.1 Materials.)

[0220]4) Samples: The samples to be tested should be adjusted to pH 8.3 with buffer* and their final volumes should be of 87 μl per well.

[0221]Obs: Standards, negative controls, samples to test and blanks should be made in duplicates. They are dispensed into the wells of the microplate.

[0222]5) Then, the procedure follows steps 3) to 6), as above.

[0223]Several D-amino acids and their L-counterparts have been tested using the microplate test described above. Tables VIII and IX show that D-forms of Tyrosine, Valine, Threonine, Glutamic acid, Lysine and Tryptophane are indeed substrates for the D-AA0/HRP and are detected by the test, as described for D-Proline. The results also show that no L-amino acid is detected by such a methodology.

TABLE-US-00018 TABLE VIII A Blank 49.5 24.75 12.37 6.19 3.09 1.55 0.77 0.39 0.19 0.09 0.05 D-pro B Blank 49.5 24.75 12.37 6.19 3.09 1.55 0.77 0.39 0.19 0.09 0.05 mM C Blank L-Tyr L-Val L-Thr L-Glu L-Lys L-Try D Blank 12.5 12.5 12.5 12.5 12.5 12.5 mM E Blank D-Tyr D-Val D-Thr D-Glu D-Lys D-Try F Blank 6.25 6.25 6.25 6.25 6.25 6.25 mM

Optical densities at 490 nm obtained after D-AAO reaction. (raw OD data).

TABLE-US-00019 TABLE IX A 0.105 1.961 1.757 1.814 1.983 1.716 1.234 0.809 0.496 0.308 0.213 0.173 D-pro B 0.118 2.004 1.885 1.976 1.949 1.879 1.221 0.824 0.504 0.32 0.215 0.159 mM C 0.123 0.193 0.135 0.124 0.131 0.125 0.131 L- D 0.125 0.141 0.129 0.128 0.141 0.131 0.138 L- E 0.120 1.317 1.683 0.215 0.147 0.243 0.615 D- F 0.105 0.991 1.612 0.157 0.116 0.157 0.662 D-

[0224]Template of microplate, where, a serial dilution of D-Proline (mM) was made as positive control of the D-AAO reaction. Blank wells containing buffer* are shown. Different L- and D-amino acids were tested, namely Tyrosine (Tyr), Valine (Val), Threonine (Thr), Glutamic acid (Glu), Lysine (Lys) and Tryptophan (Try). To highlight the sensitivity of the D-AAO microtest, higher concentrations of L-enantiomers (12.5 mM) were used in the reactions as compared to the concentrations used for D-enantiomers (6.25 mM):

[0225]FIG. 11 is a Graph obtained with the serial dilutions of D-proline, as positive reaction control Obs: OD of wells (-) average of OD obtained from blank wells.

[0226]A preferred platform to search and quantitate the presence of a D-Amino acid in samples contains at least the following products:

[0227]A D-amino acid,

[0228]A peroxidase and a substrate of a peroxidase

[0229]A D-amino-acid oxidase

[0230]And optionally, a L-amino acid enantiomer, as control.

[0231]Finally, this invention relates to a method for screening a molecule, which can modulate a racemase activity, wherein the method comprises: [0232](A) modulating a racemase activity by means of a molecule being tested in the presence of an equimolar mixture of a L- and D-amino acid and of a racemase to be modulated; [0233](B) oxidatively deaminating the D-amino acid generated in step (A) by means of a D-amino oxidase in a prosthetic group; and [0234](C) detecting the hydrogen peroxide generated by the oxidative deamination;wherein modulation of the hydrogen peroxide is indicative of the capability of the tested molecule to modulate racemase activity. Preferably the molecule inhibits racemase activity, and more preferably the racemase is a proline racemase, for example, Tripanosoma cruzi proline racemase. A molecule identified by a method is also part of this invention.

[0235]Further, this invention relates to technological platform and all reagents and devices necessary to perform the methods of the invention. The technological platform comprises: [0236]a) L-amino acid, D-amino acid, and a racemase; [0237]b) a peroxydase and a substrate of a peroxydase, or a catalase and a reagent sensitive to oxygen; [0238]c) a D-amino acid oxidase; and [0239]d) optionally, one or more molecules to be screened for inhibitory activity of said racemase.

[0240]Preferably, the racemase is a proline racemase and the L-amino acid and D-amino acid are L-proline and D-proline, respectively.

[0241]A molecule inhibits a proline racemase containing a subsequence selected from the SEQ ID NO: 1, 2, 3 or 4.

REFERENCES

[0242]The following references are incorporated by reference, in their entirety, herein. [0243]1. Lamzin, V. S., Dauter, Z., and Wilson, K. S. (1995) Curr Opin Struct Biol 5, 830-836. [0244]2. Kleinkauf, H., and von Dohren, H. (1987) Annu. Rev. Microbiol. 41, 259-289 [0245]3. Fisher, G. H. (1998) Exs 85, 109-118 [0246]4. Nagata, Y., Fujiwara, T., Kawaguchi-Nagata, K., Fukumori, Y., and Yamanaka, T. (1998) Biochim Biophys Acta 1379, 76-82. [0247]5. Nagata, Y., Tanaka, K., Iida, T., Kera, Y., Yamada, R., Nakajima, Y., Fujiwara, T., Fukumori, Y., Yamanaka, T., Koga, Y., Tsuji, S., and Kawaguchi-Nagata, K. (1999) Biochim Biophys Acta 1435, 160-166. [0248]6. Oguri, S., Kumazaki, M., Kitou, R., Nonoyama, H., and Tooda, N. (1999) Biochim Biophys Acta 1472, 107-114. [0249]7. Neidle, A., and Dunlop, D. S. (1990) Life sci. 46, 1512-1522 [0250]8. Schell, M. J., Molliver, M. E., and Snyder, S. H. (1995) Proc. Nat. Acad. Sci. 92, 3948-3952 [0251]9. Wolosker, H., Blackshaw, S., and Snyder, S. H. (1999) Proc Natl Acad Sci USA 96, 13409-13414. [0252]10. Nagata, Y., Homma, H., Matsumoto, M., and Imai, K. (1999) FEBS 454, 317-320 [0253]11. Cardinale, G. J., and Abeles, R. H. (1968) Biochemistry 7, 3970-3978 [0254]12. Rudnick, G., and Abeles, R. H. (1975) Biochemistry 14, 4515-4522 [0255]13. Reina-San-Martin, B., Degrave, W., Rougeot, C., Cosson, A., Charmond, N., Cordeiro-da-Silva, A., Arala-Chaves, M., and Minoprio, P. (2000) Nature Medicine 6, 890-897 [0256]14. Cano, M. I., Gruber, A., Vazquez, M., Cortes, A., Levin, M. J., Gonzalez, A., Degrave, W., Rondinelli, E., Zingales, B., Ramirez, J. L., Alonso, C., Requena, J. M., and Silveira, J. F. d. (1995) Mol. Bio. Par. 71, 273-278 [0257]15. Higuchi, R., Krummel, B., and Saiki, K. K. (1988) Nuc. Ac. Res. 16, 7351-7367 [0258]16. Keenan, M. V., and Alworth, W. L. (1974) Biochem Biophys Res Commun 57, 500-504. [0259]17. Fisher, L. M., Albery, W. J., and Knowles, J. R. (1986) Biochemistry 25, 2529-2537. [0260]18. Albery, W. J., and Knowled, J. R. (1986) Biochemistry 25, 2572-2577. [0261]19. Breitbart, R. E., Andreadis, A., and Nadal-Ginard, B. (1987) Annu. Rev. Biochem. 56, 467-495 [0262]20. Manning-Cela, R., Gonzalez, A., and Swindle, J. (2002) Infect. Immun. 70, 4726-4728 [0263]21. Krassner, S. M., and Flory, B. (1972) J. Protozool. 19, 917-920 [0264]22. Bowman, I. B. R., Srivastava, H. K., and Flynn, I. W. (1972) Adaptation in oxidative metabolism during the transformation of Trypanosoma rhodesiense from bloodstream into culture forms, Van den Bossche H. Ed. Comparative Biochemistry of parasites, Academic Press, New York [0265]23. Evans, D. A., and Brown, R. C. (1972) J. Protozool. 19, 686-690 [0266]24. Auerswald, L., Schneider, P., and Gade, G. (1998) J. Exp. Biol. 201, 2333-2342 [0267]25. Sylvester, D., and Krassner, S. M. (1976) Comp. Biochem. Physiol. 55B, 443-447 [0268]26. de Isola, E. L., Lammel, E. M., Katzin, V. J., and Gonzalez Cappa, S. M. (1981) J. Parasitol. 67, 53-58 [0269]27. Contreras, V. T., Salles, J. M., Thomas, N., Morel, C. M., and Goldenberg, S. (1985) Mol. Biochem. Parasitol. 16, 315-327 [0270]28. Silber, A. M., Tonelli, R. R., Martinelli, M., Colli, W., and Alves, M. J. (2002) J. Eukaryot. Microbiol. 49, 441-446 [0271]29. Janeway, C. A., and Humphrey, J. H. (1970) Folia Biol. 16, 156-172 [0272]30. Mozes, E., Kohn, L. D., Hakim, F., and Singer, D. S. (1993) Science 261, 91-92 [0273]31. Sela, M., and Zisman, E. (1997) FASEB J. 11, 449-456 [0274]32. Contreras, V. T., Morel, C. M., and Goldenberg, S. (1985) Mol Biochem Parasitol 14, 83-96 [0275]33. Souto-Padron, T., Reyes, M. B., Leguizamon, S., Campetella, O. E., Frash, A. C., and de Souza, W. (1989) Eur. J. Cell Biol. 50, 272-278 [0276]34. Janes, B. K., and Bender, R. A. (1998) J Bacteriol 180, 563-570. [0277]35. de Jong, M. H., van der Drift, C., and Vogels, G. D. (1975) J. Bacteriol. 123, 824-827 [0278]36. Shakibaei, M., and Frevert, U. (1996) J. Exp. Med. 184, 1699-1711 [0279]37. Burleigh, B. A., and Andrews, N. W. (1998) Cur. Op. Microbiol. 1, 461-465 [0280]38. Gao, W., Wortis, H. H., and Pereira, M. A. (2002) Internat. Immunol. 14, 299-308 [0281]39. Martin, D., Ault, B., and Nadler, J. V. (1992) Eur. J. Pharmacol. 21 9, 59-66 [0282]40. Van Harreveld, A. (1980) J. Neurobiol. 11, 519-529 [0283]41. Thompson, R. J., Bouwer, H. G., Portnoy, D. A., and Frankel, F. R. (1998) Infect Immun 66, 3552-3561. [0284]42. Wolosker, H., Sheth, K. N., Takahashi, M., Mothet, J. P., Brady, R. O., Jr., Ferris, C. D., and Snyder, S. H. (1999) Proc Natl Acad Sci USA 96, 721-725. [0285]43. Watanabe, T., Shibata, K., Kera, Y., and Yamada, R. (1998) Amino Acids 14, 353-360 [0286]¹ GenBank accession number AF195522 [0287]² GenBank accession number AY140947 [0288]³ EMBL accession number E10199. [0289]⁴The proline racemase/B-cell mitogen of Trypanosoma cruzi is a virulence factor whose mRNA is differentially regulated through development by alternative splicing. N. Chamond, N. Coatnoan, J. C. Barale, A. Cosson, A. Bernenian, W. Degrave and P. Minoprio. Manuscript in preparation.

BIBLIOGRAPHY RELATED TO THE MICROTEST USING D-AMINO ACID OXIDASE ACCORDING TO THE INVENTION

[0289] [0290]1. Reina-San-Martin B., Degrave W., Rougeot C., Cosson A., Chamond N., Cordeiro-da-Silva A., Arala-Chaves M. & Minoprio P. (2000) A B-cell mitogen from a pathogenic trypanosome is a eukaryotic proline racemase. Nature Medicine, 6, 890. [0291]2. Chamond N., Gregoire C., Coatnoan N., Rougeot C., Freitas-Junior L. H., da Silveira J. F., Degrave W. M. & Minoprio P. (2003) Biochemical characterization of proline racemases from the human protozoan parasite Trypanosoma cruzi and definition of putative protein signatures. J Biol Chem, 278, 15484. [0292]3. Chamond N., Coatnoan N. & Minoprio P. (2002) Immunotherapy of Trypanosoma cruzi infections. Current Drug Targets, 2, 247. [0293]4. Rassi A. & Luquetti A. O. (1992) Therapy of Chagas Disease In: Chagas Disease (American Trypanosomiasis): its impact on transfusion and clinical medicine (ed. S. Wendel, Z. Brener, M. E. Camargo & A. Rassi), p. 237. ISBT Brazil '92--SBHH, Sao Paulo. [0294]5. Cancado J. R. (1999) Criteria of Chagas disease cure. Mem Inst Oswaldo Cruz, 94 Suppl 1, 331. [0295]6. Urbina J. A. (2001) Specific treatment of Chagas disease: current status and new developments. Curr Opin Infect Dis, 14, 733. [0296]7. Urbina J. A. (2002) Chemotherapy of Chagas disease. Curr Pharm Des, 8, 287. [0297]8. Donald, G.& McNeil Jr. (2003) Rare Infection Threatens to Spread in Blood Supply, in New York Times, Nov. 18, 2003 [0298]9. Beard, C., Pye, G. Steurer, F. J., Rodriguez, R., Campman, R., Townsend Peterson, A., Ramsey, J., Wirtz, R. A. & Robinson, L. E. Chagas Disease in a Domestic Transmission Cycle, Southern Texas, USA. (2003) Emerging Infectious Diseases, 9, 103. [0299]10. Hamase K., Morikawa A. & Zaitsu K. (2002) D-amino acids in mammals and their diagnostic value. J Chromatogr B Analyt Technol Biomed Life Sci, 781, 73. [0300]11. D'Aniello A., Lee J. M., Petrucelli L. & Di Fiore M. M. (1998) Regional decreases of free D-aspartate levels in Alzheimer's disease. Neurosci Lett, 250, 131. [0301]12. D'Aniello A., Di Fiore M. M., Fisher G. H., Milone A., Seleni A., D'Aniello S., Perna A. F. & Ingrosso D. (2000) Occurrence of D-aspartic acid and N-methyl-D-aspartic acid in rat neuroendocrine tissues and their role in the modulation of luteinizing hormone and growth hormone release. FASEB J, 14, 699. [0302]13. Fisher G. H., D'Aniello A., Vetere A., Padula L., Cusano G. P. & Man E. H. (1991) Free D-aspartate and D-alanine in normal and Alzheimer brain. Brain Res Bull, 26, 983. [0303]14. Fisher G. H., Torres D., Bruna J., Cerwinski S., Martin T., Bergljung C., Gruneiro A., Chou S. J., Man E. H. & Pappatheodorou S. (1995) Presence of D-aspartate and D-glutamate in tumor proteins. Cancer Biochem Biophys, 15, 79. [0304]15. Fisher G., Lorenzo N., Abe H., Fujita E., Frey W. H., Emory C., Di Fiore M. M. & A D. A. (1998) Free D- and L-amino acids in ventricular cerebrospinal fluid from Alzheimer and normal subjects. Amino Acids, 15, 263. [0305]16. Fisher G. H. (1998) Appearance of D-amino acids during aging: D-amino acids in tumor proteins. Exs, 85, 109. [0306]17. Nagata Y., Akino T., Ohno K., Kataoka Y., Ueda T., Sakurai T., Shiroshita K. & Yasuda T. (1987) Free D-amino acids in human plasma in relation to senescence and renal diseases. Clin Sci (Colch), 73, 105. [0307]18. Nagata Y., Masui R. & Akino T. (1992) The presence of free D-serine, D-alanine and D-proline in human plasma. Experientia, 48, 986. [0308]19. Chouinard M. L., Gaitan D. & Wood P. L. (1993) Presence of the N-methyl-D-aspartate-associated glycine receptor agonist, D-serine, in human temporal cortex: comparison of normal, Parkinson, and Alzheimer tissues. J Neurochem, 61, 1561. [0309]20. Kumashiro S., Hashimoto A. & Nishikawa T. (1995) Free D-serine in post-mortem brains and spinal cords of individuals with and without neuropsychiatric diseases. Brain Res, 681, 117. [0310]21. Wellner D. and L. A. Lichtenberg, (1968), Assay of Amino acid oxidase, Methods in Enzymology XVII, "metabolism of Amino acids", 593 [0311]22. Scannone H., D. WelIner and A. Novogrodsky, (1964), A study of amino acid oxidase specificity, using a new sensitive assay, Biochemistry, 3, 1742. [0312]23. Kishimoto M. and Takahashi T., (2001), A spectrophotometric microplate Assay for L-amino acid oxidase, Analytical Biochemistry, 298, 136. [0313]24. Wolosker H., Sheth K. N., Takahashi M., Mothet J.-P., Brady R. O. Jr, Ferris, C.D. and Snyder S. H., (1999), Purification of serine racemase: Biosynthesis of the neuromodulator D-Serine, Proc. Nat. Acad. Sci. USA, 96, 721

Sequence CWU 1

129115PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 1Xaa Xaa Xaa His Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly 1 5 10 15232PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 2Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Xaa Gly Gly Xaa Xaa 20 25 30314PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 3Asp Arg Ser Pro Xaa Gly Xaa Gly Xaa Xaa Ala Xaa Xaa Ala 1 5 10414PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 4Asp Arg Ser Pro Cys Gly Xaa Gly Xaa Xaa Ala Xaa Xaa Ala 1 5 10528DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 5ctctcccatg gggcaggaaa agcttctg 28623DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 6ctgagctcga ccagatmtac tgc 23730DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 7gcggatcgct ctccaagcgg gacaggcacc 30830DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 8ggtgcctgtc ccgcttggag agcgatccgc 30939DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 9ggctatttaa atatgtctgg acataactca attgcagcg 391038DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 10cgctgcaatt gagttatgtc cagacatatt taaatagc 381151DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 11atg gat acc ggt ggc tat tta aat atg tgt gga cat aac tca att gca 48Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala 1 5 10 15gcg 51Ala1217PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 12Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala 1 5 10 15Ala1339DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 13ggctatttaa atatgtctgg acataactca attgcagcg 391451DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 14atg gat acc ggt ggc tat tta aat atg tct gga cat aac tca att gca 48Met Asp Thr Gly Gly Tyr Leu Asn Met Ser Gly His Asn Ser Ile Ala 1 5 10 15gcg 51Ala1551DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 15atggataccg gtggctattt aaatatgtgt ggacataact caattgcagc g 511617PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 16Met Asp Thr Gly Gly Tyr Leu Asn Met Ser Gly His Asn Ser Ile Ala 1 5 10 15Ala1751DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 17gtg ata ttt ggc aat cgc cag gcg gat cgc tct cca tgt ggg aca ggc 48Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly 1 5 10 15acc 51Thr1817PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 18Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly 1 5 10 15Thr1930DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 19gcggatcgct ctccaagcgg gacaggcacc 302051DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 20gtgatatttg gcaatcgcca ggcggatcgc tctccatgtg ggacaggcac c 512151DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 21gtg ata ttt ggc aat cgc cag gcg gat cgc tct cca agc ggg aca ggc 48Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Ser Gly Thr Gly 1 5 10 15acc 51Thr2217PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 22Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Ser Gly Thr Gly 1 5 10 15Thr2316PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 23Xaa Xaa Xaa His Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly 1 5 10 152414PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 24Asp Arg Ser Pro Xaa Gly Xaa Xaa Xaa Xaa Ala Xaa Xaa Ala 1 5 10255PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 25Glu Pro Arg Gly His 1 5266PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 26Glu Pro Arg Gly Ser Asp 1 5276PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 27Glu Pro Arg Gly Asn Asp 1 5281598DNATrypanosoma cruzi 28cctttttctt tttaaaaaca aaaaaaattc cggggggaat atggaacagg gtatatgcgt 60aaaagtgtct gtcccaaaca aaaatttttt ttttccgcct tcccattttt tttttttttt 120tgtgtgtttc ccttgatctc tcgaacaggg caggaaaagc ttctgtttga ccaaaaatat 180aaaattatta agggcgagaa aaaagaaaag aaaaaaaatc aacgagcaaa caggagagaa 240caccaacaaa aaagggaaat tatgcgattt aagaaatcat tcacatgcat cgacatgcat 300acggaaggtg aagcagcacg gattgtgacg agtggtttgc cacacattcc aggttcgaat 360atggcggaga agaaagcata cctgcaggaa aacatggatt atttgaggcg tggcataatg 420ctggaaccac gtggtcatga tgatatgttt ggagcctttt tatttgaccc tattgaagaa 480ggcgctgact tgggcatggt attcatggat accggtggct atttaaatat gtgtggacat 540aactcaattg cagcggttac ggcggcagtt gaaacgggaa ttgtgagcgt gccggcgaag 600gcaacaaatg ttccggttgt cctggacaca cctgcggggt tggtgcgcgg tacggcacac 660cttcagagtg gtactgagag tgaggtgtca aatgcgagta ttatcaatgt accctcattt 720ttgtatcagc aggatgtggt ggttgtgttg ccaaagccct atggtgaagt acgggttgat 780attgcatttg gaggcaattt tttcgccatt gttcccgcgg agcagttggg aattgatatc 840tccgttcaaa acctctccag gctgcaggag gcaggagaac ttctgcgtac tgaaatcaat 900cgcagtgtga aggttcagca ccctcagctg ccccatatta acactgtgga ctgtgttgag 960atatacggtc cgccaacgaa cccggaggca aactacaaga acgttgtgat atttggcaat 1020cgccaggcgg atcgctctcc atgtgggaca ggcaccagcg ccaagatggc aacactttat 1080gccaaaggcc agcttcgcat cggagagact tttgtgtacg agagcatact cggctcactc 1140ttccagggca gggtacttgg ggaggagcga ataccggggg tgaaggtgcc ggtgaccaaa 1200gatgccgagg aagggatgct cgttgtaacg gcagaaatta ctggaaaggc ttttatcatg 1260ggtttcaaca ccatgctgtt tgacccaacg gatccgttta agaacggatt cacattaaag 1320cagtagatct ggtagagcac agaaactatt ggggaacacg tgcgaacagg tgctgctacg 1380tgaagggtat tgaatgaatc gttttttttt atttttattt tttattttta ttagtgcatt 1440attattaaat tttttttttg ttttggggtt tcaacggtac cgcgttggga gcagggaagc 1500gatagcggcc ggacaatttt ttgcttttat tttcattttc atcttcctac ccaaccccct 1560tggttccacc ggtcgcggcg gggtcttgtg ggtggagg 1598291582DNATrypanosoma cruzi 29gtgtgttcaa cagttttgtt tccttttttc tctttttctc tttccatcat acatacatac 60atacatacat atatatatct gcgtagatat gcacatgcgt atatgcgtga agagtgtctg 120tcccaacatt tttttttttt ttttgtgtgt tttcccttga ttcccgaacg ggcaggaaaa 180gcttctgttt gaccaaaaat ataaaattat taagggcgag aaaagaaaaa aaaaatcaac 240cgaggagaca acaccaacaa aaaagggaaa ttatgcgatt taagaaatca ttgacatgca 300tcgacatgca tacggaaggt gaagcagcac ggattgtgac gagtggtttg ccacacattc 360caggttcgaa tatggcggag aagaaagcat acctgcagga aaacatggat tatttgaggc 420gtggcataat gctggagcca cgtggtcatg atgatatgtt tggagccttt ttatttgacc 480ctattgaaga aggcgctgac ttgggcatcg tattcatgga taccggtggc tatttaaata 540tgtgtggaca taactcaatt gcagcggtta cggcggcagt ggaaacggga attttgagcg 600tgccggcgaa ggcaacaaat gttccggttg tcctggacac acctgcgggg ttggtgcgcg 660gtacggcaca ccttcagagt ggtactgaga gtgaggtgtc aaatgcgagt attatcaatg 720tgccctcatt tttgtatcag caggatgtgg tgattgtttt gccaaagccc tatggtgagg 780tacgggttga tattgcattt ggaggcaatt ttttcgccat tgttcccgcg gagcacttgg 840gaattgatat ctccgttcaa aacctctcca ggctgcagga ggcaggagaa cttctgcgta 900ctgaaatcaa tcgcagtgtg aaggttcagc accctcagct gccccatatt aacactgtgg 960actgtgttga gatatacggt ccgccaacga acccggaggc aaaatacaag aacgttgtga 1020tatttggcaa tcgccaggcg gatcgctctc catgtgggac aggcaccagc gccaagatgg 1080caacacttta tgccaaaggc cagcttcgca tcggagagac ttttgtgtac gagagcatac 1140tcggctcact cttccagggc agggtacttg gggaggagcg aataccgggg gtgaaggtgc 1200cggtgaccaa agatgccgag gaagggatgc tcgttgtaac gacagaaatt actggaaagg 1260cttttatcat gggtttcaac accatgctgt ttgacccaac ggatccgttc ttaaacggat 1320tcacactaaa gcggtagatc tggtagagca cagaaactat tggggaacac gtgcgaacag 1380gtgctgctac gtaaagggta ttgaatgaat cgtttttttt tttttttttt tattagtgca 1440ttattttttt ttttttttgt tttggggttt caacggtacc acgttgggag cagggaaacg 1500atagcggccg gacaattttt tacttttatt ttcattttca ccttcctacc caaccccctt 1560ggttccaccg gtcgcggcgg gg 158230423PRTTrypanosoma cruzi 30Met Arg Lys Ser Val Cys Pro Lys Gln Lys Phe Phe Phe Ser Ala Phe 1 5 10 15Pro Phe Phe Phe Phe Phe Cys Val Phe Pro Leu Ile Ser Arg Thr Gly 20 25 30Gln Glu Lys Leu Leu Phe Asp Gln Lys Tyr Lys Ile Ile Lys Gly Glu 35 40 45Lys Lys Glu Lys Lys Lys Asn Gln Arg Ala Asn Arg Arg Glu His Gln 50 55 60Gln Lys Arg Glu Ile Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp 65 70 75 80Met His Thr Glu Gly Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro 85 90 95His Ile Pro Gly Ser Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu 100 105 110Asn Met Asp Tyr Leu Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His 115 120 125Asp Asp Met Phe Gly Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala 130 135 140Asp Leu Gly Met Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys145 150 155 160Gly His Asn Ser Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile 165 170 175Val Ser Val Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr 180 185 190Pro Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu 195 200 205Ser Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro Ser Phe Leu Tyr 210 215 220Gln Gln Asp Val Val Val Val Leu Pro Lys Pro Tyr Gly Glu Val Arg225 230 235 240Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu 245 250 255Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu 260 265 270Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln 275 280 285His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr 290 295 300Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe305 310 315 320Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala 325 330 335Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr 340 345 350Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu 355 360 365Gly Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val Thr Lys Asp Ala 370 375 380Glu Glu Gly Met Leu Val Val Thr Ala Glu Ile Thr Gly Lys Ala Phe385 390 395 400Ile Met Gly Phe Asn Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Lys 405 410 415Asn Gly Phe Thr Leu Lys Gln 42031354PRTTrypanosoma cruzi 31Met Arg Phe Lys Lys Ser Leu Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val 115 120 125Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu Ser Glu Val Ser Asn 130 135 140Ala Ser Ile Ile Asn Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val145 150 155 160Ile Val Leu Pro Lys Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe 165 170 175Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu His Leu Gly Ile Asp 180 185 190Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu 195 200 205Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu Pro 210 215 220His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Asn Ala Thr Asn225 230 235 240Pro Glu Ala Lys Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln Ala 245 250 255Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr Leu 260 265 270Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu Ser 275 280 285Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu Arg Ile 290 295 300Pro Gly Val Lys Val Pro Val Thr Lys Asp Ala Glu Glu Gly Met Leu305 310 315 320Val Val Thr Thr Glu Ile Thr Gly Lys Ala Phe Ile Met Gly Phe Asn 325 330 335Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Leu Asn Gly Phe Thr Leu 340 345 350Lys Arg32335PRTClostridium sticklandii 32Met Lys Phe Ser Lys Gly Ile His Ala Ile Asp Ser His Thr Met Gly 1 5 10 15Glu Pro Thr Arg Ile Val Val Gly Gly Ile Pro Gln Ile Asn Gly Glu 20 25 30Thr Met Ala Asp Lys Lys Lys Tyr Leu Glu Asp Asn Leu Asp Tyr Val 35 40 45Arg Thr Ala Leu Met His Glu Pro Arg Gly His Asn Asp Met Phe Gly 50 55 60Ser Ile Ile Thr Ser Ser Asn Asn Lys Glu Ala Asp Phe Gly Ile Ile 65 70 75 80Phe Met Asp Gly Gly Gly Tyr Leu Asn Met Cys Gly His Gly Ser Ile 85 90 95Gly Ala Ala Thr Val Ala Val Glu Thr Gly Met Val Glu Met Val Glu 100 105 110Pro Val Thr Asn Ile Asn Met Glu Ala Pro Ala Gly Leu Ile Lys Ala 115 120 125Lys Val Met Val Glu Asn Glu Lys Val Lys Glu Val Ser Ile Thr Asn 130 135 140Val Pro Ser Phe Leu Tyr Met Glu Asp Ala Lys Leu Glu Val Pro Ser145 150 155 160Leu Asn Lys Thr Ile Thr Phe Asp Ile Ser Phe Gly Gly Ser Phe Phe 165 170 175Ala Ile Ile His Ala Lys Glu Leu Gly Val Lys Val Glu Thr Ser Gln 180 185 190Val Asp Val Leu Lys Lys Leu Gly Ile Glu Ile Arg Asp Leu Ile Asn 195 200 205Glu Lys Ile Lys Val Gln His Pro Glu Leu Glu His Ile Lys Thr Val 210 215 220Asp Leu Val Glu Ile Tyr Asp Glu Pro Ser Asn Pro Glu Ala Thr Tyr225 230 235 240Lys Asn Val Val Ile Phe Gly Gln Gly Gln Val Asp Arg Ser Pro Cys 245 250 255Gly Thr Gly Thr Ser Ala Lys Leu Ala Thr Leu Tyr Lys Lys Gly His 260 265 270Leu Lys Ile Asp Glu Lys Phe Val Tyr Glu Ser Ile Thr Gly Thr Met 275 280 285Phe Lys Gly Arg Val Leu Glu Glu Thr Lys Val Gly Glu Phe Asp Ala 290 295 300Ile Ile Pro Glu Ile Thr Gly Gly Ala Tyr Ile Thr Gly Phe Asn His305 310 315 320Phe Val Ile Asp Pro Glu Asp Pro Leu Lys Tyr Gly Phe Thr Val 325 330 33533354PRTHomo sapiens 33Met Glu Ser Ala Leu Ala Val Pro Trp Leu Pro Pro His Asp Pro Gly 1 5 10 15Thr Pro Val Leu Ser Val Val Asp Met His Thr Gly Gly Glu

Pro Leu 20 25 30Arg Ile Val Leu Ala Gly Cys Pro Glu Val Ser Gly Pro Thr Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp His Val Arg Arg Arg 50 55 60Leu Met Phe Glu Pro Arg Gly His Arg Asp Met Tyr Gly Ala Val Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His Leu Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly Leu Val Pro Ala Pro Pro Ala Gly Thr 115 120 125Arg Glu Ala Arg Val Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Ala Cys Glu Asp Gly Arg Ser His Gly Pro Val Arg Phe His145 150 155 160Ser Val Pro Ala Phe Val Leu Ala Thr Asp Leu Met Val Asp Val Pro 165 170 175Gly His Gly Lys Val Met Val Asp Ile Ala Tyr Gly Gly Ala Phe Tyr 180 185 190Ala Phe Val Thr Ala Glu Lys Leu Gly Leu Asp Ile Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala Val Thr Glu Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro Asp Ser Glu Asp Leu Ala Phe Leu225 230 235 240Tyr Gly Thr Ile Leu Thr Asp Gly Lys Asp Ala Tyr Thr Lys Glu Pro 245 250 255Thr Thr Asn Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280 285Leu Leu Glu Leu Asn Gln Met Arg Ala Phe Lys Ser Ser Ala Thr Gly 290 295 300Ser Val Phe Thr Gly Lys Ala Val Arg Glu Ala Lys Cys Gly Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ser Gly Gln Ala His Tyr Thr Gly Thr 325 330 335Ala Ser Phe Ile Ile Glu Asp Asp Asp Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys34354PRTHomo sapiens 34Met Glu Ser Ala Leu Ala Val Pro Arg Leu Pro Pro His Asp Pro Gly 1 5 10 15Thr Pro Val Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro Leu 20 25 30Arg Ile Val Leu Ala Gly Cys Pro Glu Val Ser Gly Pro Thr Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp His Val Arg Arg Arg 50 55 60Leu Met Phe Glu Pro Arg Gly His Arg Asp Met Tyr Gly Ala Val Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His Leu Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly Leu Val Pro Ala Pro Pro Ala Gly Thr 115 120 125Arg Glu Ala Arg Val Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Ala Cys Glu Asp Gly Arg Ser His Gly Pro Val Arg Phe His145 150 155 160Ser Val Pro Ala Phe Val Leu Ala Thr Asp Leu Met Val Asp Val Pro 165 170 175Gly His Gly Lys Val Met Val Asp Ile Ala Tyr Gly Gly Ala Phe Tyr 180 185 190Ala Phe Val Thr Ala Glu Lys Leu Gly Leu Asp Ile Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala Val Thr Glu Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro Asp Ser Glu Asp Leu Ala Phe Leu225 230 235 240Tyr Gly Thr Ile Leu Thr Asp Gly Lys Asp Ala Tyr Thr Lys Glu Pro 245 250 255Thr Thr Asn Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280 285Leu Leu Glu Leu Asn Gln Met Arg Ala Phe Lys Ser Ser Ala Thr Gly 290 295 300Ser Val Phe Thr Gly Lys Ala Val Arg Glu Ala Lys Cys Gly Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ser Gly Gln Ala His Tyr Thr Gly Thr 325 330 335Ala Ser Phe Ile Ile Glu Asp Asp Asp Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys35354PRTMus musculus 35Met Glu Ala Ala Leu Ala Val Thr Arg Leu Pro Pro Asn Asp Pro Arg 1 5 10 15Thr Pro Ala Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro Leu 20 25 30Arg Ile Val His Ala Gly Cys Pro Glu Val Ala Gly Pro Thr Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp Tyr Ile Arg Arg Arg 50 55 60Leu Val Phe Glu Pro Arg Gly His Arg Asp Met Tyr Gly Ala Ile Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His Leu Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly Leu Val Pro Ala Pro Pro Lys Gly Ala 115 120 125Arg Glu Ala Gln Val Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Glu Cys Glu Gly Gly Arg Ser Cys Gly Pro Val Arg Phe His145 150 155 160Ser Val Pro Ala Phe Val Leu Ala Ser Asp Leu Thr Val Asp Val Pro 165 170 175Gly His Gly Lys Val Leu Val Asp Ile Ala Tyr Gly Gly Ala Phe Tyr 180 185 190Ala Phe Val Ser Ala Glu Lys Leu Gly Leu Asp Val Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala Leu Thr Gly Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro Glu Ser Glu Asp Leu Gly Phe Leu225 230 235 240Tyr Gly Ser Ile Leu Thr Asp Gly Lys Asp Ala Tyr Ser Glu Glu Ala 245 250 255Thr Thr Asn Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280 285Leu Leu Gln Leu Asn Gln Thr Arg Ala Phe Lys Ser Ser Ala Thr Gly 290 295 300Ser Val Phe Thr Gly Cys Ala Val Arg Glu Ala Lys Cys Gly Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ala Gly Gln Ala His Tyr Thr Gly Thr 325 330 335Ala Asn Leu Thr Val Glu Asp Gly Asp Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys36354PRTMus musculus 36Met Glu Ala Ala Leu Ala Val Thr Arg Leu Pro Pro His Asp Ser Arg 1 5 10 15Thr Pro Ala Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro Leu 20 25 30Arg Ile Val His Ala Gly Cys Pro Glu Val Ala Gly Pro Thr Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp Tyr Ile Arg Arg Arg 50 55 60Leu Val Phe Glu Pro Arg Gly His Arg Asp Met Tyr Gly Ala Ile Leu 65 70 75 80Met Pro Ser Glu Leu Pro Asp Ala His Leu Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly Leu Val Pro Ala Pro Pro Glu Gly Ala 115 120 125Arg Glu Ala Gln Val Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Glu Cys Glu Gly Gly Arg Ser Cys Gly Pro Val Arg Phe His145 150 155 160Ser Val Pro Ala Phe Val Leu Ala Ser Asp Leu Thr Val Asp Val Pro 165 170 175Gly His Gly Lys Val Leu Val Asp Ile Ala Tyr Gly Gly Ala Phe Tyr 180 185 190Ala Phe Val Ser Ala Glu Lys Leu Gly Leu Asp Val Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala Leu Thr Gly Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro Glu Ser Glu Asp Leu Gly Phe Leu225 230 235 240Tyr Gly Ser Ile Leu Thr Asp Gly Lys Asp Ala Tyr Ser Glu Glu Ala 245 250 255Thr Thr Asn Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280 285Leu Leu Gln Leu Asn Gln Thr Arg Ala Phe Lys Ser Ser Ala Thr Gly 290 295 300Ser Val Phe Thr Gly Cys Ala Val Arg Glu Ala Lys Cys Gly Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ala Gly Gln Ala His Tyr Thr Gly Thr 325 330 335Ala Asn Leu Thr Val Glu Asp Gly Asp Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys37333PRTRhizobium loti 37Met Ala Lys Lys Ser Phe Phe Cys Ile Asp Gly His Thr Cys Gly Asn 1 5 10 15Pro Val Arg Leu Val Ala Gly Gly Gly Pro Leu Leu Glu Gly Ser Thr 20 25 30Met Met Glu Arg Arg Ala His Phe Leu Ala Glu Tyr Asp Trp Ile Arg 35 40 45Thr Gly Leu Met Phe Glu Pro Arg Gly His Asp Val Met Ser Gly Ser 50 55 60Ile Leu Tyr Pro Pro Thr Arg Glu Asp Cys Asp Ile Ala Ile Leu Phe 65 70 75 80Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly 85 90 95Thr Val Thr Met Ala Ile Glu His Gly Leu Ile Lys Pro Lys Thr Pro 100 105 110Gly Val Leu Arg Leu Asp Thr Pro Ala Gly Leu Val Ile Ala Glu Tyr 115 120 125Lys Gln Val Gly Glu Tyr Val Glu Glu Val Arg Ile Thr Asn Val Pro 130 135 140Ser Phe Leu His Ala Glu Gly Leu Thr Val Glu Cys Pro Gly Leu Gly145 150 155 160Glu Ile Thr Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile Val 165 170 175Glu Pro Gln Glu Asn Tyr Arg Asp Met Ala Asp His Ser Ala Gly Asp 180 185 190Leu Ile Ala Trp Ser Pro Val Val Arg Gln Arg Leu Asn Glu Lys Tyr 195 200 205Ser Phe Val His Pro Glu Asn Pro Gly Ile Asn Arg Leu Ser His Met 210 215 220Leu Trp Thr Gly Lys Pro Thr Val Glu Gly Ala Asp Ala Arg Asn Ala225 230 235 240Val Phe Tyr Gly Asp Lys Ala Ile Asp Arg Ser Pro Cys Gly Thr Gly 245 250 255Thr Ser Ala Arg Met Ala Gln Leu His Ala Lys Gly Lys Leu Lys Ala 260 265 270Gly Asp Ala Phe Val His Glu Ser Ile Ile Gly Ser Leu Phe Lys Gly 275 280 285Lys Val Glu Lys Glu Val Thr Val Ala Gly Lys Pro Ala Ile Ile Pro 290 295 300Ser Ile Gly Gly Trp Ala Arg Leu Thr Gly Leu Asn Thr Ile Phe Ile305 310 315 320Asp Asp Arg Asp Pro Phe Ala His Gly Phe Val Val Thr 325 33038333PRTBrucella melitensis 38Met Ala Arg His Ser Phe Phe Cys Val Asp Gly His Thr Cys Gly Asn 1 5 10 15Pro Val Arg Leu Val Ala Gly Gly Gly Pro Asn Leu Asn Gly Ser Thr 20 25 30Met Met Glu Lys Cys Ala His Phe Leu Ala Glu Tyr Asp Trp Ile Arg 35 40 45Thr Gly Leu Met Phe Glu Pro Arg Gly His Asp Met Met Ser Gly Ser 50 55 60Ile Leu Tyr Pro Pro Thr Arg Pro Asp Cys Asp Val Ala Val Leu Phe 65 70 75 80Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly 85 90 95Thr Val Thr Met Ala Ile Glu Gln Gly Leu Val Thr Pro Lys Thr Pro 100 105 110Gly Lys Leu Asn Leu Asp Thr Pro Ala Gly Leu Val Ala Ile Glu Tyr 115 120 125Glu Gln Asp Gly Gln Tyr Val Glu Arg Val Arg Leu Thr Asn Val Pro 130 135 140Ala Phe Leu Tyr Ala Glu Gly Leu Glu Val Glu Cys Pro Asp Leu Gly145 150 155 160Pro Ile Lys Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile Val 165 170 175Glu Pro Gln Glu Asn Tyr Thr Asp Met Asp Asp Tyr Ser Ala Leu Gln 180 185 190Leu Ile Ala Trp Ser Pro Val Leu Arg Gln Arg Leu Asn Glu Lys Tyr 195 200 205Lys Phe Gln His Pro Glu Leu Pro Asp Ile Asn Arg Leu Ser His Ile 210 215 220Leu Trp Thr Gly Lys Pro Lys His Pro Gln Ala His Ala Arg Asn Ala225 230 235 240Val Phe Tyr Gly Asp Lys Ala Ile Asp Arg Ser Pro Cys Gly Thr Gly 245 250 255Thr Ser Ala Arg Met Ala Gln Leu Ala Ala Lys Gly Lys Leu Lys Pro 260 265 270Gly Asp Glu Phe Ile His Glu Ser Ile Ile Gly Ser Leu Phe His Gly 275 280 285Arg Val Glu Arg Ala Ala Glu Val Ala Gly Arg Pro Ala Ile Val Pro 290 295 300Ser Ile Ala Gly Trp Ala Arg Met Thr Gly Tyr Asn Thr Ile Phe Ile305 310 315 320Asp Asp Arg Asp Pro Phe Ala His Gly Phe Ser Ala Ala 325 33039333PRTRhizobium meliloti 39Met Ala Thr His Thr Phe Ser Cys Ile Asp Gly His Thr Cys Gly Asn 1 5 10 15Pro Val Arg Leu Val Ser Gly Gly Gly Pro Arg Leu Glu Gly Ala Asn 20 25 30Met Leu Glu Lys Arg Ala His Phe Leu Lys Glu Phe Asp Trp Ile Arg 35 40 45Thr Gly Leu Met Phe Glu Pro Arg Gly His Asp Met Met Ser Gly Ser 50 55 60Ile Leu Tyr Pro Pro Thr Arg Pro Asp Cys Asp Val Ala Val Leu Phe 65 70 75 80Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly 85 90 95Thr Ile Thr Met Gly Ile Glu Asn Gly Leu Ile Thr Pro Arg Glu Pro 100 105 110Gly Lys Leu Ser Ile Asp Ala Pro Ala Gly Lys Val Asp Ile Thr Tyr 115 120 125Arg Gln Glu Gly Arg Phe Val Glu Glu Val Arg Leu Thr Asn Val Pro 130 135 140Ser Phe Leu Tyr Ala Glu Gly Leu Ala Ala Glu Val Glu Gly Leu Gly145 150 155 160Glu Ile Val Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile Val 165 170 175Glu Pro Gln Lys Asn Phe Arg Asp Met Ala Asp His Thr Ala Gly Glu 180 185 190Leu Val Gly Trp Ser Pro Lys Leu Arg Ala Ala Leu Asn Ala Lys Tyr 195 200 205Glu Phe Val His Pro Glu His Pro Glu Ile Arg Gly Leu Ser His Ile 210 215 220Gln Trp Thr Gly Lys Pro Thr Gln Pro Glu Ala His Ala Arg Asn Ala225 230 235 240Val Phe Tyr Gly Glu Lys Ala Ile Asp Arg Ser Pro Cys Gly Thr Gly 245 250 255Thr Ser Ala Arg Ile Ala Gln Leu Ala Ala Lys Gly Lys Leu Lys Val 260 265 270Gly Asp Glu Phe Val His Glu Ser Ile Ile Gly Ser Leu Phe Lys Gly 275 280 285Arg Val Glu Ala Ala Ala Lys Val Ala Asp Arg Asp Ala Ile Ile Pro 290 295 300Ser Ile Ala Gly Trp Ala Arg Met Thr Gly Ile Asn Thr Ile Phe Ile305 310 315 320Asp Asp Arg Asp Pro Phe Ala His Gly Phe Val Val Arg 325 33040332PRTAgrobacterium tumefaciens 40Met Arg His Ser Phe Phe Cys Ile Asp Ser His Thr Cys Gly Asn Pro 1 5 10 15Val Arg Leu Val Ala Gly Gly Gly Pro Leu Leu Pro His Leu Pro Ile 20 25 30Ser Glu Arg Arg Asp Leu Phe Val Arg Asn His Asp Trp Val Arg Gln 35 40 45Ala Leu Met Phe Glu Pro Arg Gly His Asp Ile Met Ser Gly Ala Val 50 55 60Ile Tyr Pro Ala Tyr Arg Asp Asp Cys Asp Phe Ala Val Ile Phe

Ile 65 70 75 80Glu Val Ser Gly Cys Leu Pro Met Cys Gly Ala Gly Thr Ile Gly Leu 85 90 95Val Thr Ala Ala Ile Glu Glu Gly Leu Val Thr Pro Arg Ile Pro Gly 100 105 110Arg Leu Ser Ile Glu Thr Pro Ala Gly Lys Val Asp Ile Gln Tyr Asp 115 120 125Lys Pro Gly Glu Phe Val Glu Ser Val Arg Ile Phe Asn Val Ala Ser 130 135 140Tyr Leu His Ala Ala Asp Val Glu Val Asn Val Pro Gly Leu Gly Lys145 150 155 160Leu Val Val Asp Ile Ala Tyr Gly Gly Asn Tyr Tyr Ala Val Ile Glu 165 170 175Pro Gln Val Gly Trp Pro Gly Leu Asp Gly Met Thr Ala Gly Asp Val 180 185 190Val Asp Leu Ser Gln Lys Leu Arg Asp Ala Leu Gly Thr Ile Cys Asp 195 200 205Pro Val His Pro Asp Asp Glu Arg Ile Arg Gly Val His His Ala Ile 210 215 220Trp Cys Asp Arg Pro Val Ser Ala Glu Ala Asp Gly Arg Gly Ala Val225 230 235 240Phe Tyr Gly Asp Lys Ala Ile Asp Arg Ser Pro Gly Gly Thr Gly Thr 245 250 255Ser Ala Arg Met Ala Gln Leu His Gly Lys Gly Arg Leu Lys Ala Gly 260 265 270Glu Thr Phe Arg Gln Glu Ser Leu Ile Gly Thr Ile Phe Glu Gly Lys 275 280 285Val Glu Glu Glu Thr Thr Val Gly Ser Phe Ser Gly Ile Arg Pro Ser 290 295 300Ile Gly Gly Trp Ala Arg Ile Ile Gly His Asn Thr Ile Phe Val Asp305 310 315 320Asp Arg Asp Pro Leu Ala His Gly Phe Gln Val Arg 325 33041312PRTXanthomonas campestris 41Met His Thr Ile Asp Val Ile Asp Ser His Thr Ala Gly Glu Pro Thr 1 5 10 15Arg Val Val Leu Ala Gly Phe Pro Asp Leu Gly Asp Gly Asp Leu Ala 20 25 30Gln Cys Arg Glu Arg Phe Arg Ser Asp Phe Asp His Trp Arg Ser Ala 35 40 45Ile Ala Cys Glu Pro Arg Gly Ser Asp Thr Met Val Gly Ala Leu Leu 50 55 60Leu Pro Pro Arg Asp Pro Ser Ala Cys Thr Gly Val Ile Phe Phe Asn 65 70 75 80Asn Val Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Val Val 85 90 95Arg Thr Leu Ala Glu Leu Gly Arg Ile Ala Pro Gly Gln His Arg Ile 100 105 110Glu Thr Pro Val Gly Thr Val Gly Val Ala Leu Ala Asp Asp Gly Thr 115 120 125Val Ser Ile Asp Asn Val Glu Ser Tyr Arg His Ala Ala Gly Val Glu 130 135 140Val Asp Val Pro Gly His Gly Arg Val Arg Gly Asp Val Ala Trp Gly145 150 155 160Gly Asn Trp Phe Phe Ile Thr Glu Gln Ala Pro Cys Ala Leu Gly Leu 165 170 175Ala Gln Gln Arg Glu Leu Thr Ala Tyr Thr Glu Ala Ile Arg Leu Ala 180 185 190Leu Glu Ala Ala Gly Ile Thr Gly Glu Ala Gly Gly Glu Ile Asp His 195 200 205Ile Glu Ile Ser Gly Val Ala Pro Asp Gly Ser Gly Ala Ala Arg Asn 210 215 220Phe Val Leu Cys Pro Gly Leu Ala Tyr Asp Arg Ser Pro Cys Gly Thr225 230 235 240Gly Thr Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp Gly Lys Leu Ala 245 250 255Glu Gly Glu Arg Trp Leu Gln Gln Gly Ile Leu Gly Ser Ala Phe Glu 260 265 270Gly Ser Tyr Arg His Ser Gly Arg Gly Ile Ala Pro Arg Ile Ser Gly 275 280 285His Ala Phe Ile Thr Ala Arg Ser Gln Leu Leu Ile Asp Pro Ala Asp 290 295 300Pro Phe Ala Trp Gly Ile Val Ala305 31042312PRTXanthomonas axonopodis 42Met His Thr Ile Asp Val Ile Asp Ser His Thr Ala Gly Glu Pro Thr 1 5 10 15Arg Val Val Leu Ser Gly Phe Pro Asp Leu Gly Asp Gly Asp Leu Ala 20 25 30Gln Cys Arg Glu Arg Phe Arg Ser Glu Phe Asp His Trp Arg Ser Ala 35 40 45Ile Ala Cys Glu Pro Arg Gly Ser Asp Thr Met Val Gly Ala Leu Leu 50 55 60Leu Pro Pro Arg Asp Pro Ser Ala Cys Thr Gly Val Ile Phe Phe Asn 65 70 75 80Asn Val Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Val Val 85 90 95Arg Thr Leu Ala Glu Leu Gly Arg Ile Ala Pro Gly Gln His Arg Ile 100 105 110Glu Thr Pro Val Gly Thr Val Gly Val Glu Leu Ala Asp Asp Gly Thr 115 120 125Val Ser Val Asp Asn Val Glu Ser Tyr Arg Phe Ala Ser Gly Val Glu 130 135 140Val Glu Val Pro Gly His Gly Arg Val Cys Gly Asp Val Ala Trp Gly145 150 155 160Gly Asn Trp Phe Phe Ile Thr Glu His Ala Pro Cys Ala Leu Asp Leu 165 170 175Ala His Gln Arg Glu Leu Thr Ala Tyr Thr Glu Ala Ile Arg Leu Ala 180 185 190Leu Glu Ala Ala Gly Ile Thr Gly Glu Ala Gly Gly Glu Ile Asp His 195 200 205Ile Glu Val Asn Gly Ala Ala Pro Asp Gly Ser Gly Val Ala Arg Asn 210 215 220Phe Val Leu Cys Pro Gly Leu Ala Tyr Asp Arg Ser Pro Cys Gly Thr225 230 235 240Gly Thr Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp Gly Lys Leu Ala 245 250 255Glu Gly Glu Arg Trp Val Gln Gln Gly Ile Leu Gly Ser Ala Phe Glu 260 265 270Gly Asn Tyr Arg Leu Ser Gly Arg Gly Ile Ala Pro Arg Ile Ser Gly 275 280 285Arg Ala Tyr Ile Thr Ala Arg Ala Gln Leu Val Ile Asp Pro Ala Asp 290 295 300Pro Phe Ala Trp Gly Ile Val Ala305 31043314PRTPseudomonas aeruginosa 43Met Gln Arg Ile Arg Ile Ile Asp Ser His Thr Gly Gly Glu Pro Thr 1 5 10 15Arg Leu Val Ile Gly Gly Phe Pro Asp Leu Gly Gln Gly Asp Met Ala 20 25 30Glu Arg Arg Arg Leu Leu Gly Glu Arg His Asp Ala Trp Arg Ala Ala 35 40 45Cys Ile Leu Glu Pro Arg Gly Ser Asp Val Leu Val Gly Ala Leu Leu 50 55 60Cys Ala Pro Val Asp Pro Glu Ala Cys Ala Gly Val Ile Phe Phe Asn 65 70 75 80Asn Ser Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Leu Val 85 90 95Ala Ser Leu Ala His Leu Gly Arg Ile Gly Pro Gly Val His Arg Ile 100 105 110Glu Thr Pro Val Gly Glu Val Glu Ala Thr Leu His Glu Asp Gly Ser 115 120 125Val Ser Val Arg Asn Val Pro Ala Tyr Arg Tyr Arg Arg Gln Val Ser 130 135 140Val Glu Val Pro Gly Ile Gly Arg Val Ser Gly Asp Ile Ala Trp Gly145 150 155 160Gly Asn Trp Phe Phe Leu Val Ala Gly His Gly Gln Arg Leu Ala Gly 165 170 175Asp Asn Leu Asp Ala Leu Thr Ala Tyr Thr Val Ala Val Gln Gln Ala 180 185 190Leu Asp Asp Gln Asp Ile Arg Gly Glu Asp Gly Gly Ala Ile Asp His 195 200 205Ile Glu Leu Phe Ala Asp Asp Pro His Ala Asp Ser Arg Asn Phe Val 210 215 220Leu Cys Pro Gly Lys Ala Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr225 230 235 240Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp Gly Lys Leu Leu Pro Gly 245 250 255Gln Pro Trp Arg Gln Ala Ser Val Ile Gly Ser Gln Phe Glu Gly Arg 260 265 270Tyr Glu Trp Leu Asp Gly Gln Pro Gly Gly Pro Ile Val Pro Thr Ile 275 280 285Arg Gly Arg Ala His Val Ser Ala Glu Ala Thr Leu Leu Leu Ala Asp 290 295 300Asp Asp Pro Phe Ala Trp Gly Ile Arg Arg305 31044344PRTPseudomonas aeruginosa 44Met Arg Ser Gln Arg Ile Val His Ile Val Ser Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Ala Ala Pro Pro Gly Ala 20 25 30Thr Leu Trp Glu Gln Ser Arg Trp Ile Ala Arg Asp Gln Asp Leu Arg 35 40 45Asn Phe Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg His Ala Asn 50 55 60Leu Leu Val Pro Ala Lys Asp Pro Arg Ala Gln Met Gly Trp Ile Ile 65 70 75 80Met Glu Pro Ala Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Leu Cys 85 90 95Val Ala Thr Val Leu Leu Asp Ser Gly Ile Leu Pro Met Arg Glu Pro 100 105 110Leu Thr Arg Leu Leu Leu Glu Ala Pro Gly Gly Leu Ile Glu Ala Arg 115 120 125Ala Glu Cys Arg Asp Gly Lys Ala Glu Arg Val Glu Ile Arg Asn Val 130 135 140Pro Ser Phe Ala Asp Arg Leu Asp Ala Trp Ile Glu Val Glu Gly Leu145 150 155 160Gly Ser Leu Gln Val Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Ala Asp Ala Arg Arg Leu Gly Phe Ala Leu Arg Ala Asp Glu Ala Ala 180 185 190Glu Leu Val Ala Thr Gly Leu Lys Ile Thr His Ala Ala Asn Glu Gln 195 200 205Leu Gly Phe Arg His Pro Thr Asn Pro Asp Trp Asp His Leu Ser Phe 210 215 220Cys Gln Leu Ala Ala Pro Pro Glu Arg Arg Asp Gly Val Leu Gly Ala225 230 235 240Asn Asn Ala Val Val Ile Arg Pro Gly Lys Ile Asp Arg Ser Pro Cys 245 250 255Gly Thr Gly Cys Ser Ala Arg Met Ala Val Leu Gln Ala Lys Gly Gln 260 265 270Leu Arg Val Gly Glu Arg Phe Val Gly Arg Ser Ile Ile Gly Ser Glu 275 280 285Phe His Cys His Ile Glu Ser Leu Thr Glu Leu Gly Gly Arg Pro Ala 290 295 300Ile Leu Pro Cys Leu Ser Gly Arg Ala Trp Ile Thr Gly Ile His Gln305 310 315 320Tyr Leu Leu Asp Pro Asp Asp Pro Trp Pro Gln Gly Tyr Arg Leu Ser 325 330 335Asp Thr Trp Pro Gly Gly His Cys 34045342PRTBrucella melitensis 45Met Arg Ser Thr Lys Val Ile His Ile Val Gly Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Ala Pro Pro Pro Gly Glu 20 25 30Thr Val Trp Glu Gln Ser Arg Phe Ile Ala Asn Asp Glu Thr Leu Arg 35 40 45Asn Phe Val Leu Asn Lys Pro Arg Gly Gly Val Phe Arg His Val Asn 50 55 60Leu Leu Val Pro Pro Lys Asp Pro Arg Ala Gln Met Gly Phe Ile Ile 65 70 75 80Met Glu Pro Ala Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Ile Cys 85 90 95Val Ser Thr Val Leu Leu Asp Ser Gly Ile Ile Ala Met Gln Glu Pro 100 105 110Val Thr His Met Val Leu Glu Ala Pro Gly Gly Ile Ile Glu Val Glu 115 120 125Ala Glu Cys Arg Asn Gly Lys Ala Glu Arg Ile Ser Val Arg Asn Val 130 135 140Pro Ser Phe Ala Asp Arg Leu Asp Ala Pro Leu Asp Val Thr Gly Leu145 150 155 160Gly Thr Ile Met Val Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Val Asp Ala Ala Gln Ile Gly Met Lys Ile Glu Pro Gly Gln Ala Arg 180 185 190Glu Leu Ala Glu Ile Gly Val Lys Ile Thr Lys Ala Ala Asn Glu Gln 195 200 205Leu Gly Phe Arg His Pro Glu Arg Asp Trp Arg His Ile Ser Phe Cys 210 215 220Gln Ile Thr Glu Pro Val Thr Arg Glu Gly Asp Val Leu Thr Gly Val225 230 235 240Asn Thr Val Ala Ile Arg Pro Ala Lys Phe Asp Arg Ser Pro Thr Gly 245 250 255Thr Gly Cys Ser Ala Arg Met Ala Val Leu His Ala Lys Gly Gln Met 260 265 270Lys Ala Gly Glu Arg Phe Ile Gly Lys Ser Val Leu Gly Thr Glu Phe 275 280 285His Cys Arg Leu Asp Lys Val Leu Glu Leu Gly Gly Lys Pro Ala Ile 290 295 300Ser Pro Ile Ile Ser Gly Arg Ala Trp Val Thr Gly Thr Ser Gln Leu305 310 315 320Met Leu Asp Pro Ser Asp Pro Phe Pro His Gly Tyr Arg Leu Ser Asp 325 330 335Thr Trp Pro Arg Asp Glu 34046342PRTAgrobacterium tumefaciens 46Met Arg Ser Ile Lys Thr Val His Val Ile Ser Ala His Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Lys Pro Pro Pro Gly Glu 20 25 30Thr Ile Trp Glu Gln Ser Arg Phe Ile Ala Arg Asp Glu Thr Leu Arg 35 40 45Asn Phe Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg His Val Asn 50 55 60Leu Leu Val Pro Pro Lys His Pro Asp Ala Asp Ala Ala Phe Ile Ile 65 70 75 80Met Glu Pro Glu Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Ile Cys 85 90 95Val Ser Thr Val Leu Leu Asp Gly Gly Ile Val Pro Met Gln Glu Pro 100 105 110Glu Thr His Met Leu Leu Glu Ala Pro Gly Gly Leu Val Lys Val Arg 115 120 125Ala Glu Cys Arg Asn Gly Lys Ala Glu Arg Ile Phe Val Gln Asn Leu 130 135 140Pro Ser Phe Ala Ala Lys Leu Asp Ala Glu Leu Glu Val Glu Gly Leu145 150 155 160Gly Lys Leu Lys Val Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Val Asp Ala Glu Ala Met Gly Phe Ser Leu Lys Pro Glu Glu Ala His 180 185 190Glu Ile Ala Arg Leu Gly Val Arg Ile Thr Asn Ala Ala Asn Lys Ala 195 200 205Leu Gly Phe Asp His Pro Glu Asn Pro Asp Trp Arg His Phe Ser Phe 210 215 220Cys Leu Phe Ala Gly Lys Val Glu Arg Thr Ala Glu Gly Leu Arg Ala225 230 235 240Gly Ala Ala Val Ala Ile Gln Pro Gly Lys Val Asp Arg Ser Pro Thr 245 250 255Gly Thr Ala Leu Ser Ala Arg Met Ala Val Leu His Ala Arg Gly Glu 260 265 270Met Lys Glu Gly Glu Thr Leu Thr Ala Val Ser Leu Ile Gly Ser Thr 275 280 285Phe Thr Gly Arg Ile Leu Gly Thr Thr Thr Val Gly Asp Arg Pro Ala 290 295 300Ile Leu Pro Glu Ile Ser Gly Arg Gly Trp Ile Thr Gly Ile His Gln305 310 315 320His Met Leu Asp Pro Ser Asp Pro Trp Pro Glu Gly Tyr Arg Leu Thr 325 330 335Asp Thr Trp Gly Ala Arg 34047342PRTRhizobium meliloti 47Met Arg Ser Thr Lys Thr Ile His Val Ile Ser Ala His Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Ala Pro Pro Pro Gly Asp 20 25 30Thr Ile Trp Glu Gln Ser Arg Trp Ile Ala Arg Glu Gln Thr Leu Arg 35 40 45Asn Phe Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg His Val Asn 50 55 60Leu Leu Val Pro Pro Lys His Pro Asp Ala Asp Ala Ala Phe Ile Ile 65 70 75 80Met Glu Pro Glu Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Ile Cys 85 90 95Val Ser Thr Val Leu Leu Asp Ser Gly Ile Leu Pro Met Lys Glu Pro 100 105 110Val Thr Glu Ile Thr Leu Glu Ala Pro Gly Gly Leu Val Arg Val Arg 115 120 125Ala Glu Cys Arg Asp Gly Lys Ala Glu Arg Ile Phe Val Glu Asn Leu 130 135 140Pro Ser Phe Ala Glu Arg Leu Asp Ala Lys Leu Glu Val Glu Gly Leu145 150 155 160Gly Thr Leu Thr Val Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Val Asp Ala Ala Ala Met Gly Phe Ala Leu Lys Pro Asp Glu Ala His 180 185 190Asp Ile Ala Arg Leu Gly Val Arg Ile Thr Asn Ala Ala Asn Ala Lys 195 200 205Leu Gly Phe His His Pro Glu Asn Pro Asp Trp Arg His Phe Ser Phe 210 215 220Cys Leu Phe Ala Gly Pro Val Glu Arg Thr Ala Glu

Gly Leu Arg Ala225 230 235 240Gly Ala Ala Val Ala Ile Gln Pro Gly Lys Val Asp Arg Ser Pro Thr 245 250 255Gly Thr Ala Leu Ser Ala Arg Met Ala Val Leu His Ala Arg Gly Gln 260 265 270Met Gly Leu Ser Asp Arg Leu Thr Ala Val Ser Leu Ile Gly Ser Thr 275 280 285Phe Ser Gly Arg Ile Leu Gly Thr Thr Glu Val Gly Gly Arg Pro Ala 290 295 300Val Leu Pro Glu Ile Ser Gly Arg Ala Trp Ile Thr Gly Thr His Gln305 310 315 320His Met Leu Asp Pro Ser Asp Pro Trp Pro Glu Gly Tyr Arg Leu Thr 325 330 335Asp Thr Trp Gly Ala Arg 34048346PRTRhizobium loti 48Met Arg Ser Lys Thr Ser Ile Arg Val Val Gly Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Ile Gly Gly Val Leu Pro Pro Ala Gly Arg 20 25 30Thr Met Met Asp Lys Met Ile Thr Met Glu Arg Asp His Asp His Ile 35 40 45Arg Arg Met Leu Ile Cys Glu Pro Arg Gly Ser Val Ala Arg His Val 50 55 60Asn Leu Leu Val Pro Ser Thr Arg Glu Asp Cys Ala Ala Gly Ala Ile 65 70 75 80Ile Met Glu Pro Thr Glu Tyr Pro Pro Met Ser Gly Ser Asn Thr Ile 85 90 95Cys Val Ala Thr Val Leu Leu Glu Thr Gly Met Val Pro Met Gln Glu 100 105 110Pro Glu Thr Arg Phe Lys Leu Asp Met Pro Gly Gly Val Ile Glu Val 115 120 125Arg Ala Gln Cys Arg Asp Gly Lys Cys Val Ser Ile Thr Leu Arg Asn 130 135 140Ala Pro Ala Phe Val Asp Arg Leu Asp Ala Ser Ile Glu Val Glu Gly145 150 155 160Leu Gly Thr Leu Thr Val Asp Ile Ala Tyr Gly Gly Met Phe Tyr Ala 165 170 175Ile Val Asp Ala Lys Ala Leu Gly Phe Ser Ile Ala Pro Asp Glu Ala 180 185 190Arg Glu Leu Ala Val Ala Gly Glu Lys Ile Arg Arg Ala Ala Arg Glu 195 200 205Gln Leu Asp Val Val His Pro Gln Phe Asp His Val Arg Gly Val Ser 210 215 220Ile Val Gln Phe Ala Met Pro Phe Gln Gly Pro Gly Asn Val Thr Arg225 230 235 240Asn Thr Cys Ile Val Ser Pro Gly Arg Ser Asp Arg Ser Pro Thr Gly 245 250 255Thr Gly Thr Ser Ala Arg Met Ala Val Leu Gln Ala Arg Gly Leu Met 260 265 270Gly Val Gly Asp Val Leu Ile His Glu Ser Ile Ile Gly Ser Arg Phe 275 280 285Thr Gly Arg Ile Val Glu Leu Ala Glu Ile Ala Gly Arg Lys Ala Ile 290 295 300Val Pro Glu Ile Thr Gly Arg Ala Trp Ile Thr Gly Glu His Ser Tyr305 310 315 320Tyr Leu Asp Pro Thr Asp Pro Tyr Pro Gln Gly Tyr Val Leu Ser Asp 325 330 335Thr Trp Gly Thr Ser Thr Ser Val Lys Gln 340 34549339PRTXanthomonas axonopodis 49Met Arg Trp Ser Lys Gln Phe Ser Val Val Asp Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Lys Val Ile Val Gly Gly Val Gly Asn Ile Pro Gly Thr 20 25 30Thr Met Phe Glu Lys Lys Leu Tyr Leu Glu Gln His Arg Asp Asp Ile 35 40 45Arg Lys Leu Val Leu Gln Glu Pro Arg Gly Ala Thr Trp His Asn Ala 50 55 60Asn Ile Ile Leu Pro Pro Ser His Pro Glu Ala Ser Met Gly Phe Val 65 70 75 80Ile Leu Glu Ala Thr Glu Tyr Pro Ala Met Ser Gly Ser Asn Thr Ile 85 90 95Cys Val Ala Thr Val Leu Leu Glu Thr Gly Ile Leu Pro Met Gln Glu 100 105 110Pro Ile Thr Asp Leu Val Leu Glu Ala Pro Ala Gly Leu Ile Arg Val 115 120 125Arg Cys Asp Cys Lys Asp Gly Lys Val Thr Arg Val Lys Leu Val Asn 130 135 140Gln Pro Ala Phe Val Tyr His Leu Asp Ala Lys Val Glu Val Ala Gly145 150 155 160Ile Gly Thr Val Ser Ala Asp Ile Ala Phe Gly Gly Met Thr Phe Ala 165 170 175Leu Val Asp Ala Ser Ser Leu Gly Phe Glu Ile Val Pro Ala Glu Ala 180 185 190Arg Glu Leu Cys Glu Tyr Gly Gln Lys Ile Lys Ala Ala Ala Ala Glu 195 200 205Gln Leu Asp Val Ala Phe Pro Gly Asn Pro Asp Met Pro Gly Ile Thr 210 215 220Met Thr Gln Phe Thr Gly Pro Leu Ser Arg Ala Asp Gly Lys Phe Phe225 230 235 240Ser Arg Asn Thr Thr Ile Val Ser Pro Gly Arg Cys Asp Arg Ser Pro 245 250 255Cys Gly Ala Gly Ser Ser Ala Arg Leu Ala Ala Leu His Ala Lys Gly 260 265 270Val Leu Ala Lys Gly Asp Thr Leu Val His Glu Ser Ile Ile Gly Ser 275 280 285Arg Phe Glu Cys Gly Ile Glu Asp Met Ser Asn Val Gly Asp Tyr Pro 290 295 300Ala Val Val Pro Ser Ile Ala Gly Gln Ala Trp Ile Ser Gly Leu Ser305 310 315 320Gln Leu Gly Leu Asp Pro Ser Asp Pro Tyr Ala Glu Gly Phe Thr Leu 325 330 335Ala Asp Arg50333PRTStreptomyces coelicolor 50Met Arg Ser Thr Val Cys Tyr His Ala Val Asp Ser His Thr Glu Gly 1 5 10 15Met Pro Thr Arg Val Ile Thr Gly Gly Val Gly Val Leu Pro Gly Ala 20 25 30Thr Met Phe Glu Arg Arg Gln Arg Phe Val Ala Glu Arg Asp His Leu 35 40 45Arg Thr Leu Leu Met Cys Glu Pro Arg Gly His Ala Ser Met Ser Gly 50 55 60Ala Ile Leu Gln Pro Pro Thr Arg Pro Asp Ala Asp Tyr Gly Val Leu 65 70 75 80Phe Ile Glu Val Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile 85 90 95Gly Val Ala Thr Val Leu Val Glu Thr Gly Met Val Glu Val Thr Glu 100 105 110Pro Glu Thr Thr Val Arg Leu Asp Thr Pro Ala Gly Leu Val Thr Ala 115 120 125Arg Val Arg Val Arg Asp Gly His Ala Glu Ser Val Thr Leu Glu Asn 130 135 140Val Ala Ser Tyr Ser His Ala Leu Asp Gln Val Val Asp Val Pro Gly145 150 155 160His Gly Glu Val Arg Tyr Asp Ile Ala Tyr Gly Gly Asn Phe Tyr Ala 165 170 175Phe Val Arg Thr Asp Asp Leu Gly Ile Pro Phe Glu Arg Ala His Lys 180 185 190Gln Pro Leu Leu Asp Ala Gly Leu Ala Val Met Asp Ala Ile Asn Lys 195 200 205Gln Asn Pro Val Ser His Pro Glu Asn Pro Asp Ile Asp Val Cys His 210 215 220His Val Tyr Leu Glu Ala Pro Gly Ser Thr Ala Glu His Ser Arg His225 230 235 240Ala Met Ala Ile His Pro Gly Trp Phe Asp Arg Ser Pro Cys Gly Thr 245 250 255Gly Thr Ser Ala Arg Met Ala Gln Leu His Ala Arg Gly Leu Leu Pro 260 265 270Ala Gly Arg Asp Phe Val Asn Glu Ser Phe Ile Gly Ser Arg Phe Val 275 280 285Gly Arg Val Leu Gly Glu Thr Thr Val Gly Gly Arg Pro Ala Val Leu 290 295 300Pro Ser Val Thr Gly Arg Ala Trp Ile Thr Gly Thr Ala Gln Tyr Leu305 310 315 320Leu Asp Pro Ser Asp Pro Tyr Pro Ala Gly Phe Thr Leu 325 33051345PRTAgrobacterium tumefaciens 51Met Arg Trp Lys Arg Thr Leu Gln Leu Leu Asp Val His Cys Glu Gly 1 5 10 15Glu Ile Gly Arg Val Val Thr Gly Gly Ala Pro Lys Ile Pro Gly Asn 20 25 30Thr Val Ala Glu Gln Leu His Trp Met Asn Thr Asp Pro Gln Gly Glu 35 40 45Ala Leu Arg Arg Phe Leu Thr Leu Glu Pro Arg Gly Thr Pro Met Gly 50 55 60Ser Val Asp Leu Leu Leu Pro Pro Lys His Pro Asp Ala His Ala Ala 65 70 75 80Phe Val Ile Leu Gln Pro Asp Gln Ala His Ala Ser Ser Gly Ser Asn 85 90 95Ser Ile Cys Ala Thr Thr Ala Leu Leu Glu Ser Gly Met Val Glu Met 100 105 110Gln Glu Pro Glu Thr Val Ile Ile Leu Glu Thr Ala Ala Gly Leu Val 115 120 125Lys Ala Thr Ala Thr Cys Arg Asp Gly Arg Cys Glu Lys Val Lys Leu 130 135 140Thr Met Val Pro Ser Phe Val His Glu Leu Asp Val Ser Ile Asp Thr145 150 155 160Pro Glu Trp Gly Arg Val Thr Met Asp Ile Ser Tyr Gly Gly Ile Phe 165 170 175Tyr Ala Leu Val Asp Val Arg Gln Ile Gly Leu Thr Ile Glu Lys Ala 180 185 190Asn Ala Ala Lys Leu Val Ala Ala Gly Met Thr Leu Lys Asp Leu Val 195 200 205Asn Arg Glu Met Thr Val Val His Pro Glu Ile Pro Ala Ile Ser Gly 210 215 220Val Ala Tyr Val Met Phe Arg Asp Val Asp Ala Asp Gly Ser Ile Arg225 230 235 240Thr Cys Thr Thr Met Trp Pro Gly Arg Ala Asp Arg Ser Pro Cys Gly 245 250 255Thr Gly Asn Ser Ala Asn Leu Ala Thr Leu Tyr Ala Arg Gly Lys Val 260 265 270Lys Val Gly Asp Glu Tyr Lys Ser Arg Ser Ile Ile Gly Ser Glu Phe 275 280 285Asp Val Gly Leu Ser Ala Val Thr Glu Val Ala Gly Arg Pro Ala Val 290 295 300Ile Pro Thr Ile Ala Gly Arg Gly Phe Thr Phe Gly Leu His Gln Val305 310 315 320Gly Leu Asp Pro Phe Asp Pro Leu Gly Asp Gly Phe Ala Met Thr Asp 325 330 335Val Trp Gly Pro Glu Ala Gly Asn Ile 340 34552354PRTTrypanosoma cruzi 52Met Arg Phe Lys Lys Ser Leu Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val 115 120 125Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu Ser Glu Val Ser Asn 130 135 140Ala Ser Ile Ile Asn Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val145 150 155 160Ile Val Leu Pro Lys Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe 165 170 175Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu His Leu Gly Ile Asp 180 185 190Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu 195 200 205Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu Pro 210 215 220His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn225 230 235 240Pro Glu Ala Lys Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln Ala 245 250 255Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr Leu 260 265 270Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu Ser 275 280 285Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu Arg Ile 290 295 300Pro Gly Val Lys Val Pro Val Thr Lys Asp Ala Glu Glu Gly Met Leu305 310 315 320Val Val Thr Thr Glu Ile Thr Gly Lys Ala Phe Ile Met Gly Phe Asn 325 330 335Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Leu Asn Gly Phe Thr Leu 340 345 350Lys Arg5315DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 53tct cca tgt ggg aca 15Ser Pro Cys Gly Thr 1 5545PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 54Ser Pro Cys Gly Thr 1 55515DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 55tct cca agc ggg aca 15Ser Pro Ser Gly Thr 1 5565PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 56Ser Pro Ser Gly Thr 1 557146PRTTrypanosoma cruzi 57Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile 1 5 10 15Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 20 25 30Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser 35 40 45Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys 50 55 60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn 65 70 75 80Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln 115 120 125Gly Arg Val Leu Gly Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val 130 135 140Thr Lys14558146PRTBacillus anthracis 58Gly Thr Val Glu Ala Asp Ile Ala Tyr Gly Gly Asn Phe Tyr Ala Ile 1 5 10 15Ile Asp Ala Lys Ser Val Gly Leu Glu Leu Val Pro Glu His Ala Ser 20 25 30Thr Ile Ile Asp Lys Ala Ile His Ile Arg Asn Ile Ile Asn Glu Arg 35 40 45Phe Glu Ile Ile His Pro Glu Tyr Ser Phe Ile Arg Gly Leu Thr His 50 55 60Val Glu Phe Tyr Thr Asp Pro Thr His Glu Ser Ala His Val Lys Asn 65 70 75 80Thr Val Val Val Pro Pro Gly Gly Ile Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Leu Ala Val Leu Tyr Ala Asn Gln Lys Ile Glu 100 105 110Met Asn Glu Glu Phe Val His Glu Ser Ile Val Gly Ser Leu Phe Lys 115 120 125Gly Cys Val Ile Asn Thr Thr Asn Val Ala Asn Met Glu Ala Val Val 130 135 140Thr Lys14559117PRTTrypanosoma cruzi 59Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val 11560117PRTBacillus anthracis 60Met Arg Thr Gln Lys Val Phe Thr Thr Ile Asp Thr His Thr Gly Gly 1 5 10 15Asn Pro Thr Arg Thr Leu Ile Ser Gly Leu Pro Lys Leu Leu Gly Glu 20 25 30Thr Met Ala Glu Lys Met Leu His Met Lys Lys Glu Tyr Asp Trp Ile 35 40 45Arg Lys Leu Leu Met Asn Glu Pro Arg Gly His Asp Val Met Ser Gly 50 55 60Ala Leu Leu Thr Asp Pro Cys His Pro Asp Ala Asp Ile Gly Val Ile 65 70 75 80Tyr Ile Glu Thr Gly Gly Tyr Leu Pro Met Cys Gly His Asp Thr Ile 85 90 95Gly Val Cys Thr Ala Leu Ile Glu Ser Gly Leu Ile Pro Val Val Glu 100 105 110Pro

Ile Thr Ser Leu 11561145PRTTrypanosoma cruzi 61Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val 1 5 10 15Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser Arg 20 25 30Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val 35 40 45Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val 50 55 60Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val 65 70 75 80Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly 85 90 95Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile 100 105 110Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly 115 120 125Arg Val Leu Gly Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val Thr 130 135 140Lys14562145PRTBacillus anthracis 62Glu Phe Gln Val Asp Ile Ala Phe Gly Gly Ala Phe Tyr Ala Val Val 1 5 10 15Asp Ser Lys Glu Phe Gly Leu Lys Val Asp Phe Lys Asp Leu Ser Ala 20 25 30Ile Gln Gln Trp Gly Gly Lys Ile Lys His Tyr Ile Glu Ser Lys Met 35 40 45Glu Val Lys His Pro Leu Glu Glu Gly Leu Lys Gly Ile Tyr Gly Val 50 55 60Ile Phe Ser Asp Asp Pro Lys Gly Glu Gly Ala Thr Leu Arg Asn Val 65 70 75 80Thr Ile Phe Ala Asp Gly Gln Val Asp Arg Ser Pro Cys Gly Thr Gly 85 90 95Thr Ser Ala Arg Ile Ala Thr Leu Phe Glu Lys Gly Ile Leu Gln Lys 100 105 110Gly Glu Ile Phe Ile His Glu Cys Ile Thr Asp Gly Glu Phe Glu Gly 115 120 125Glu Val Leu Ser Val Thr Ala Val His Thr Tyr Glu Ala Val Val Pro 130 135 140Lys14563113PRTTrypanosoma cruzi 63Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala 100 105 110Lys64113PRTBacillus anthracis 64Met Lys Val Ser Lys Val Tyr Thr Thr Ile Asp Ala His Val Ala Gly 1 5 10 15Glu Pro Leu Arg Ile Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu 20 25 30Thr Gln Leu Glu Arg Arg Trp Tyr Cys Met Glu His Leu Asp Tyr Leu 35 40 45Arg Glu Val Leu Met Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly 50 55 60Cys Ile Ile Thr Pro Pro Ala Ser Ala His Ala Asp Phe Gly Val Leu 65 70 75 80Phe Met His Asn Glu Gly Trp Ser Thr Met Cys Gly His Gly Ile Ile 85 90 95Ala Val Ile Thr Val Gly Ile Glu Thr Gly Met Phe Glu Thr Lys Gln 100 105 110Lys65138PRTTrypanosoma cruzi 65Tyr Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala 1 5 10 15Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu 20 25 30Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg 35 40 45Ser Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp 50 55 60Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys 65 70 75 80Asn Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly 85 90 95Thr Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu 100 105 110Arg Ile Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe 115 120 125Gln Gly Arg Val Leu Gly Glu Glu Arg Ile 130 13566138PRTClostridium botulinum 66Tyr Gly Lys Leu Thr Leu Asp Ile Ser Phe Gly Gly Ser Phe Phe Ala 1 5 10 15Met Val Asp Ala Glu Lys Val Gly Ile Asp Ile Ser Pro Ala Asn Ser 20 25 30Gln Lys Leu Asn Asp Leu Gly Met Lys Ile Val His Ala Val Asn Glu 35 40 45Gln Val Glu Ile Lys His Pro Val Leu Glu His Ile Lys Thr Val Asp 50 55 60Leu Cys Glu Phe Tyr Gly Pro Ala Lys Ser Glu Asp Ala Asp Val Gln 65 70 75 80Asn Val Val Val Phe Gly Gln Gly Gln Val Asp Arg Ser Pro Cys Gly 85 90 95Thr Gly Thr Ser Ala Lys Met Ala Leu Leu Tyr Ala Gln Gly Lys Met 100 105 110Lys Val Gly Glu Glu Ile Val Asn Glu Ser Ile Ile Cys Thr Lys Phe 115 120 125Lys Gly Lys Ile Leu Glu Glu Thr Lys Val 130 13567118PRTTrypanosoma cruzi 67Ile Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu 1 5 10 15Gly Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly 20 25 30Ser Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr 35 40 45Leu Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe 50 55 60Gly Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met 65 70 75 80Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser 85 90 95Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro 100 105 110Ala Lys Ala Thr Asn Val 11568118PRTClostridium botulinum 68Ile Met Arg Ala Ile Lys Thr Ile Gln Thr Ile Glu Ser His Thr Met 1 5 10 15Gly Glu Pro Thr Arg Ile Val Ile Gly Gly Leu Pro Lys Val Pro Gly 20 25 30Lys Thr Met Ala Glu Lys Met Glu Tyr Leu Glu Glu Asn Asn Asp Ser 35 40 45Leu Arg Thr Met Leu Met Ser Glu Pro Arg Gly His Asn Asp Met Phe 50 55 60Gly Ala Ile Tyr Thr Glu Pro Ala Asp Glu Thr Ala Asp Leu Gly Ile 65 70 75 80Ile Phe Met Asp Gly Gly Gly Tyr Leu Asn Met Cys Gly His Gly Ser 85 90 95Ile Gly Ala Ala Thr Cys Ala Val Glu Met Gly Ile Val Lys Val Glu 100 105 110Glu Pro Tyr Thr Asn Ile 11569224PRTTrypanosoma cruzi 69Ala Asp Leu Gly Ile Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met 1 5 10 15Cys Gly His Asn Ser Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly 20 25 30Ile Leu Ser Val Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp 35 40 45Thr Pro Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser Gly Thr 50 55 60Glu Ser Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro Ser Phe Leu 65 70 75 80Tyr Gln Gln Asp Val Val Ile Val Leu Pro Lys Pro Tyr Gly Glu Val 85 90 95Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val Pro Ala 100 105 110Glu His Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser Arg Leu Gln 115 120 125Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val Lys Val 130 135 140Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val Glu Ile145 150 155 160Tyr Gly Asn Ala Thr Asn Pro Glu Ala Lys Tyr Lys Asn Val Val Ile 165 170 175Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser 180 185 190Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu 195 200 205Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val 210 215 22070218PRTClostridium botulinum 70Ala Asp Leu Gly Ile Ile Phe Met Asp Gly Gly Gly Tyr Leu Asn Met 1 5 10 15Cys Gly His Gly Ser Ile Gly Ala Ala Thr Cys Ala Val Glu Met Gly 20 25 30Ile Val Lys Val Glu Glu Pro Tyr Thr Asn Ile Lys Leu Glu Ala Pro 35 40 45Ala Gly Met Ile Asn Ala Arg Val Lys Val Glu Asp Gly Lys Ala Lys 50 55 60Glu Thr Ser Ile Val Asn Val Pro Ala Phe Leu Tyr Lys Lys Asp Val 65 70 75 80Glu Ile Asp Val Pro Asp Tyr Gly Lys Leu Thr Leu Asp Ile Ser Phe 85 90 95Gly Gly Ser Phe Phe Ala Met Val Asp Ala Glu Lys Val Gly Ile Asp 100 105 110Ile Ser Pro Ala Asn Ser Gln Lys Leu Asn Asp Leu Gly Met Lys Ile 115 120 125Val His Ala Val Asn Glu Gln Val Glu Ile Lys His Pro Val Leu Glu 130 135 140His Ile Lys Thr Val Asp Leu Cys Glu Phe Tyr Gly Pro Ala Lys Ser145 150 155 160Glu Asp Ala Asp Val Gln Asn Val Val Val Phe Gly Gln Gly Gln Val 165 170 175Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Leu Leu 180 185 190Tyr Ala Gln Gly Lys Met Lys Val Gly Glu Glu Ile Val Asn Glu Ser 195 200 205Ile Ile Cys Thr Lys Phe Lys Gly Lys Ile 210 2157172PRTTrypanosoma cruzi 71Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn 1 5 10 15Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met 20 25 30Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val 35 40 45Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu 50 55 60Glu Arg Ile Pro Gly Val Lys Val 65 707272PRTAspergillus fumigatus 72Pro Asp Asp Val Gln Gly Ala Glu Thr Gly Leu Cys Tyr Phe Ala Glu 1 5 10 15Asn Gln Ile Asp Arg Ser Pro Thr Gly Ser Cys Val Ile Ala Arg Met 20 25 30Ala Leu Ala Tyr Ala Lys Gly Leu Arg Ser Leu Gly Gln Arg Trp Ala 35 40 45Tyr Asn Ser Leu Val Ser Asn Arg Phe Gly Thr Gly Ala Phe Ser Ala 50 55 60Glu Ile Val Glu Glu Val Thr Ile 65 707334PRTTrypanosoma cruzi 73Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg 1 5 10 15Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala 20 25 30Phe Leu7434PRTAspergillus fumigatus 74Leu Leu Glu Gln Arg Asp Gln Ala Lys Gln His His Asp His Ile Arg 1 5 10 15Lys Cys Leu Met Leu Glu Pro Arg Gly His Asn Gly Met Tyr Gly Ala 20 25 30Ile Ile7529PRTTrypanosoma cruzi 75Cys Ile Asp Met His Thr Glu Gly Glu Ala Ala Arg Ile Val Thr Ser 1 5 10 15Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys 20 257629PRTAspergillus fumigatus 76Cys Ile Asp Met His Thr Thr Gly Glu Pro Thr Arg Ile Ile Tyr Ser 1 5 10 15Gly Phe Pro Pro Leu Ser Gly Thr Leu Leu Glu Gln Arg 20 257727PRTTrypanosoma cruzi 77Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu 1 5 10 15Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu 20 257827PRTAspergillus fumigatus 78Leu Asp Ile Ser Tyr Gly Gly Ala Phe Tyr Ala Ile Val Gln Ala Ser 1 5 10 15Glu Leu Gly Phe Ser Gly Gly Leu Arg Asp Leu 20 257920PRTTrypanosoma cruzi 79Ser Ser Ile Gly Ser Asn Lys Lys Ala Pro Asn Ile Ser Ser Pro Arg 1 5 10 15Gly Ser Ser Ile 208020PRTAspergillus fumigatus 80Ser Ser Val Ser Gly Arg Met Met Ala Pro Tyr Ile Pro Leu Pro Arg 1 5 10 15Gly Ser Ser Ile 2081146PRTTrypanosoma cruzi 81Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile 1 5 10 15Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 20 25 30Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser 35 40 45Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys 50 55 60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn 65 70 75 80Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln 115 120 125Gly Arg Val Leu Gly Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val 130 135 140Thr Lys14582146PRTClostridium difficile 82Gly Thr Val Lys Phe Asp Ile Ser Phe Gly Gly Ser Phe Phe Ala Ile 1 5 10 15Ile His Ala Ser Gln Leu Gly Leu Lys Ile Glu Pro Gln Asn Ala Gly 20 25 30Lys Leu Thr Glu Leu Ala Met Lys Leu Arg Asp Ile Ile Asn Glu Lys 35 40 45Ile Glu Ile Gln His Pro Thr Leu Ala His Ile Lys Thr Val Asp Leu 50 55 60Val Glu Ile Tyr Asp Glu Pro Thr His Pro Glu Ala Thr Tyr Lys Asn 65 70 75 80Val Val Ile Phe Gly Gln Gly Gln Val Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Leu Ala Thr Leu His Ala Lys Gly Glu Leu Lys 100 105 110Val Gly Glu Lys Phe Val Tyr Glu Ser Ile Leu Gly Thr Leu Phe Lys 115 120 125Gly Glu Ile Val Glu Glu Thr Lys Val Ala Asp Phe Asn Ala Val Val 130 135 140Pro Lys14583117PRTTrypanosoma cruzi 83Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val 11584117PRTClostridium difficile 84Met Lys Phe Ser Arg Ser Ile Gln Ala Ile Asp Ser His Thr Ala Gly 1 5 10 15Glu Ala Thr Arg Ile Val Val Gly Gly Ile Pro Asn Ile Lys Gly Asn 20 25 30Ser Met Pro Glu Lys Lys Glu Tyr Leu Glu Glu Asn Leu Asp Tyr Leu 35 40 45Arg Thr Ala Ile Met Leu Glu Pro Arg Gly His Asn Asp Met Phe Gly 50 55 60Ser Val Met Thr Gln Pro Cys Cys Pro Asp Ala Asp Phe Gly Ile Ile 65 70 75 80Phe Met Asp Gly Gly Gly Tyr Leu Asn Met Cys Gly His Gly Thr Ile 85 90 95Gly Ala Met Thr Ala Ala Ile Glu Thr Gly Val Val Pro Ala Val Glu 100 105 110Pro Val Thr His Val 11585139PRTTrypanosoma cruzi 85Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile 1 5 10 15Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 20 25

30Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser 35 40 45Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys 50 55 60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn 65 70 75 80Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln 115 120 125Gly Arg Val Leu Gly Glu Glu Arg Ile Pro Gly 130 13586139PRTBrucella suis 86Gly Pro Ile Lys Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile 1 5 10 15Val Glu Pro Gln Glu Asn Tyr Thr Asp Met Asp Asp Tyr Ser Ala Leu 20 25 30Gln Leu Ile Ala Trp Ser Pro Val Leu Arg Gln Arg Leu Asn Glu Lys 35 40 45Tyr Lys Phe Gln His Pro Glu Leu Pro Asp Ile Asn Arg Leu Ser His 50 55 60Ile Leu Trp Thr Gly Lys Pro Lys His Pro Gln Ala His Ala Arg Asn 65 70 75 80Ala Val Phe Tyr Gly Asp Lys Ala Ile Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Arg Met Ala Gln Leu Ala Ala Lys Gly Lys Leu Lys 100 105 110Pro Gly Asp Glu Phe Ile His Glu Ser Ile Ile Gly Ser Leu Phe His 115 120 125Gly Arg Val Glu Arg Ala Ala Glu Val Ala Gly 130 13587106PRTTrypanosoma cruzi 87Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly Glu Ala Ala 1 5 10 15Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala 20 25 30Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly 35 40 45Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu 50 55 60Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe Met Asp 65 70 75 80Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val 85 90 95Thr Ala Ala Val Glu Thr Gly Ile Val Ser 100 10588106PRTBrucella suis 88Arg His Ser Phe Phe Cys Val Asp Gly His Thr Cys Gly Asn Pro Val 1 5 10 15Arg Leu Val Ala Gly Gly Gly Pro Asn Leu Asn Gly Ser Thr Met Met 20 25 30Glu Lys Arg Ala His Phe Leu Ala Glu Tyr Asp Trp Ile Arg Thr Gly 35 40 45Leu Met Phe Glu Pro Arg Gly His Asp Met Met Ser Gly Ser Ile Leu 50 55 60Tyr Pro Pro Thr Arg Pro Asp Cys Asp Val Ala Val Leu Phe Ile Glu 65 70 75 80Thr Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly Thr Val 85 90 95Thr Met Ala Ile Glu Gln Gly Leu Val Thr 100 10589109PRTTrypanosoma cruzi 89Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser 100 10590109PRTRhodobacter sphaeroides 90Met Arg Val Gln Asp Val Tyr Asn Val Ile Tyr Thr His Thr Glu Gly 1 5 10 15Glu Pro Leu Cys Ile Ile Tyr Ser Gly Val Pro Tyr Pro Ala Gly Ser 20 25 30Thr Ile Leu Glu Lys Arg Ala Phe Leu Glu Glu Asn Tyr Asp Trp Leu 35 40 45Arg Lys Ala Leu Met Arg Glu Pro Arg Gly His Ala Asp Met Phe Gly 50 55 60Val Phe Leu Thr Pro Pro Ser Ser Arg Asp Tyr Asp Ala Gly Leu Ile 65 70 75 80Tyr Ile Asp Gly Lys Glu Tyr Ser His Met Cys Gly His Gly Thr Ile 85 90 95Ala Val Ala Met Ala Met Val Ala Asn Gly Leu Val Ala 100 1059147PRTTrypanosoma cruzi 91Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val 1 5 10 15Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val 20 25 30Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr 35 40 459247PRTRhodobacter sphaeroides 92Lys Ser Ser Thr Pro Thr Glu Ala His Ile Asn Asn Leu Asn Phe Val 1 5 10 15Thr Leu Trp His Lys Pro Pro Ser Arg Gly Trp Leu Tyr Lys Asn Val 20 25 30His Cys Phe Leu Glu Gly Gln Leu Asp Arg Leu Pro Gly Gly Thr 35 40 4593118PRTTrypanosoma cruzi 93Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly Glu 1 5 10 15Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn 20 25 30Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg 35 40 45Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala 50 55 60Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe 65 70 75 80Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala 85 90 95Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala Lys 100 105 110Ala Thr Asn Val Pro Val 11594118PRTBurkholderia pseudomallei 94Arg Asp Met Lys His Ile His Ile Ile Asp Ser His Thr Gly Gly Glu 1 5 10 15Pro Thr Arg Val Val Val Ser Gly Phe Pro Ala Leu Gly Gly Gly Thr 20 25 30Met Ala Glu Arg Leu Ala Val Leu Ala Arg Glu His Asp Arg Tyr Arg 35 40 45Ala Ala Cys Ile Leu Glu Pro Arg Gly Ser Asp Val Leu Val Gly Ala 50 55 60Leu Leu Cys Glu Pro Val Ser Ala Gly Ala Ala Ala Gly Val Ile Phe 65 70 75 80Phe Asn Asn Ala Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly 85 90 95Leu Val Arg Thr Leu His His Met Gly Arg Ile Gly Pro Gly Val His 100 105 110Arg Ile Glu Thr Pro Val 1159563PRTTrypanosoma cruzi 95Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln 1 5 10 15Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr 20 25 30Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu 35 40 45Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu 50 55 609663PRTBurkholderia pseudomallei 96Asp Pro Glu Tyr Asp Ser Arg Ser Phe Val Leu Cys Pro Gly His Ala 1 5 10 15Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Leu Ala Cys 20 25 30Leu Ala Ala Asp Gly Lys Leu Ala Ala Gly Val Thr Trp Arg Gln Ala 35 40 45Ser Val Ile Gly Ser Val Phe Ser Ala Ser Tyr Ala Ala Ala Glu 50 55 6097118PRTTrypanosoma cruzi 97Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly Glu 1 5 10 15Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn 20 25 30Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg 35 40 45Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala 50 55 60Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe 65 70 75 80Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala 85 90 95Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala Lys 100 105 110Ala Thr Asn Val Pro Val 11598118PRTBurkholderia mallei 98Arg Asp Met Lys His Ile His Ile Ile Asp Ser His Thr Gly Gly Glu 1 5 10 15Pro Thr Arg Val Val Val Ser Gly Phe Pro Ala Leu Gly Gly Gly Thr 20 25 30Met Ala Glu Arg Leu Ala Val Leu Ala Arg Glu His Asp Arg Tyr Arg 35 40 45Ala Ala Cys Ile Leu Glu Pro Arg Gly Ser Asp Val Leu Val Gly Ala 50 55 60Leu Leu Cys Glu Pro Val Ser Ala Gly Ala Ala Ala Gly Val Ile Phe 65 70 75 80Phe Asn Asn Ala Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly 85 90 95Leu Val Arg Thr Leu His His Met Gly Arg Ile Gly Pro Gly Val His 100 105 110Arg Ile Glu Thr Pro Val 1159963PRTTrypanosoma cruzi 99Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln 1 5 10 15Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr 20 25 30Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu 35 40 45Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu 50 55 6010063PRTBurkholderia mallei 100Asp Pro Glu Tyr Asp Ser Arg Ser Phe Val Leu Cys Pro Gly His Ala 1 5 10 15Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Leu Ala Cys 20 25 30Leu Ala Ala Asp Gly Lys Leu Val Ala Gly Val Thr Trp Arg Gln Ala 35 40 45Ser Val Ile Gly Ser Val Phe Ser Ala Ser Tyr Ala Ala Ala Glu 50 55 60101115PRTTrypanosoma cruzi 101Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly Glu Ala Ala Arg 1 5 10 15Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu 20 25 30Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile 35 40 45Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe 50 55 60Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe Met Asp Thr 65 70 75 80Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr 85 90 95Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala Lys Ala Thr Asn 100 105 110Val Pro Val 115102115PRTPseudomonas putida 102Lys Gln Ile His Val Ile Asp Ser His Thr Gly Gly Glu Pro Thr Arg 1 5 10 15Leu Val Met Lys Gly Phe Pro Gln Leu Arg Gly Arg Ser Met Ala Glu 20 25 30Gln Arg Asp Glu Leu Arg Glu Leu His Asp Arg Trp Arg Arg Ala Cys 35 40 45Leu Leu Glu Pro Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys 50 55 60Pro Pro Val Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn Asn 65 70 75 80Ala Gly Tyr Leu Asn Met Cys Gly His Gly Thr Ile Gly Leu Val Ala 85 90 95Ser Leu Gln His Met Gly Leu Ile Thr Pro Gly Val His Lys Ile Asp 100 105 110Thr Pro Val 11510358PRTTrypanosoma cruzi 103Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln 1 5 10 15Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr 20 25 30Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu 35 40 45Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg 50 5510458PRTPseudomonas putida 104Asp Pro Asn Ala Asp Ser Arg Asn Phe Val Met Cys Pro Gly Lys Ala 1 5 10 15Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Leu Ala Cys 20 25 30Leu Ala Ala Asp Gly Lys Leu Ala Glu Gly Gln Thr Trp Val Gln Ala 35 40 45Ser Ile Thr Gly Ser Gln Phe His Gly Arg 50 55105180PRTTrypanosoma cruzi 105Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys Lys Ala 1 5 10 15Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met Leu Glu 20 25 30Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe Asp Pro Ile 35 40 45Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp Thr Gly Gly Tyr 50 55 60Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr Ala Ala Val 65 70 75 80Glu Thr Gly Ile Val Ser Val Pro Ala Lys Ala Thr Asn Val Pro Val 85 90 95Val Leu Asp Thr Pro Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln 100 105 110Ser Gly Thr Glu Ser Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro 115 120 125Ser Phe Leu Tyr Gln Gln Asp Val Val Val Val Leu Pro Lys Pro Tyr 130 135 140Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile145 150 155 160Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 165 170 175Arg Leu Gln Glu 180106164PRTLeishmania major 106Thr Gly Phe Pro Glu Leu Ala Gly Glu Thr Ile Ala Asp Lys Leu Asp 1 5 10 15Asn Leu Arg Thr Gln His Asp Gln Trp Arg Arg Ala Cys Leu Leu Glu 20 25 30Pro Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys Ala Pro Val 35 40 45Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn Asn Ala Gly Tyr 50 55 60Leu Gly Met Cys Gly His Gly Thr Ile Gly Leu Val Ala Ser Leu His 65 70 75 80His Leu Gly Arg Ile Ala Pro Gly Val His Lys Ile Asp Thr Pro Val 85 90 95Gly Pro Val Ser Ala Thr Leu His Ala Asp Gly Ala Val Thr Leu Arg 100 105 110Asn Val Pro Ala Tyr Arg Tyr Arg Gln Gln Val Pro Val Asp Val Pro 115 120 125Gly His Gly Arg Val Tyr Gly Asp Ile Ala Trp Gly Gly Asn Trp Phe 130 135 140Phe Leu Val Ser Asp His Gly Gln Ala Leu Gln Met Asp Asn Val Glu145 150 155 160Ala Leu Thr Asp10768PRTTrypanosoma cruzi 107Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn 1 5 10 15Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met 20 25 30Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe Val 35 40 45Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu 50 55 60Glu Arg Ile Pro 6510868PRTLeishmania major 108Pro Thr Thr Pro Thr Pro Thr Ala Thr Ser Ser Cys Ala Gln Gly Lys 1 5 10 15Ala Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr Asn Ala Lys Leu Ala 20 25 30Cys Leu Ala Gly Asp Ser Lys Leu Ala Ala Gly Glu Pro Trp Leu Gln 35 40 45Val Thr Ile Thr Cys Arg Gln Phe Lys Arg Ser Tyr Gln Trp Glu Cys 50 55 60Lys Arg Val Pro 6510928PRTTrypanosoma cruzi 109Val Thr Ala Glu Ile Thr Gly Lys Ala Phe Ile Met Gly Phe Asn Thr 1 5 10 15Met Leu Phe Asp Pro Thr Asp Pro Phe Lys Asn Gly 20 2511027PRTLeishmania major 110Val Pro Pro Ser Ile Thr Arg Arg Ala Tyr Met Thr Ala Asp Ser Thr 1 5 10 15Leu Leu Ile Asp Gln Asp Pro Phe Ala Trp Gly 20 25111182PRTTrypanosoma cruzi 111Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys 1 5 10

15Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met 20 25 30Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe Asp 35 40 45Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp Thr Gly 50 55 60Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr Ala 65 70 75 80Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala Lys Ala Thr Asn Val 85 90 95Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val Arg Gly Thr Ala His 100 105 110Leu Gln Ser Gly Thr Glu Ser Glu Val Ser Asn Ala Ser Ile Ile Asn 115 120 125Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val Val Val Leu Pro Lys 130 135 140Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe145 150 155 160Ala Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn 165 170 175Leu Ser Arg Leu Gln Glu 180112166PRTLeishmania major 112Val Met Thr Gly Phe Pro Glu Leu Ala Gly Glu Thr Ile Ala Asp Lys 1 5 10 15Leu Asp Asn Leu Arg Thr Gln His Asp Gln Trp Arg Arg Ala Cys Leu 20 25 30Leu Glu Pro Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys Ala 35 40 45Pro Val Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn Asn Ala 50 55 60Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Leu Val Ala Ser 65 70 75 80Leu His His Leu Gly Arg Ile Ala Pro Gly Val His Lys Ile Asp Thr 85 90 95Pro Val Gly Pro Val Ser Ala Thr Leu His Ala Asp Gly Ala Val Thr 100 105 110Leu Arg Asn Val Pro Ala Tyr Arg Tyr Arg Gln Gln Val Pro Val Asp 115 120 125Val Pro Gly His Gly Arg Val Tyr Gly Asp Ile Ala Trp Gly Gly Asn 130 135 140Trp Phe Phe Leu Val Ser Asp His Gly Gln Ala Leu Gln Met Asp Asn145 150 155 160Val Glu Ala Leu Thr Asp 165113142PRTTrypanosoma cruzi 113Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala 1 5 10 15Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly 20 25 30Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu 35 40 45Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp 50 55 60Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val 65 70 75 80Thr Ala Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala Lys Ala Thr 85 90 95Asn Val Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val Arg Gly Thr 100 105 110Ala His Leu Gln Ser Gly Thr Glu Ser Glu Val Ser Asn Ala Ser Ile 115 120 125Ile Asn Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val Ile 130 135 140114137PRTTrypanosoma brucei 114Arg Ile Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu Thr Gln Leu 1 5 10 15Glu Arg Arg Ala Tyr Cys Met Glu His Leu Asp Tyr Leu Arg Glu Ile 20 25 30Leu Met Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly Cys Ile Ile 35 40 45Thr Pro Pro Ala Ser Ala His Ala Asp Phe Gly Val Leu Phe Met His 50 55 60Asn Glu Gly Trp Ser Thr Met Cys Gly His Gly Ile Ile Ala Val Ile 65 70 75 80Thr Val Gly Ile Glu Thr Gly Met Phe Glu Val Lys Gly Glu Lys Gln 85 90 95Asn Phe Ile Ile Asp Ser Pro Ala Gly Glu Val Ile Ala Tyr Ala Lys 100 105 110Tyr Asn Gly Ser Glu Val Glu Ser Val Ser Phe Glu Asn Val Pro Ser 115 120 125Phe Val Tyr Lys Lys Asp Val Pro Ile 130 135115140PRTTrypanosoma cruzi 115Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys 1 5 10 15Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met 20 25 30Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe Asp 35 40 45Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp Thr Gly 50 55 60Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr Ala 65 70 75 80Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala Lys Ala Thr Asn Val 85 90 95Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val Arg Gly Thr Ala His 100 105 110Leu Gln Ser Gly Thr Glu Ser Glu Val Ser Asn Ala Ser Ile Ile Asn 115 120 125Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val Ile 130 135 140116135PRTTrypanosoma brucei 116Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu Thr Gln Leu Glu Arg 1 5 10 15Arg Ala Tyr Cys Met Glu His Leu Asp Tyr Leu Arg Glu Ile Leu Met 20 25 30Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly Cys Ile Ile Thr Pro 35 40 45Pro Ala Ser Ala His Ala Asp Phe Gly Val Leu Phe Met His Asn Glu 50 55 60Gly Trp Ser Thr Met Cys Gly His Gly Ile Ile Ala Val Ile Thr Val 65 70 75 80Gly Ile Glu Thr Gly Met Phe Glu Val Lys Gly Glu Lys Gln Asn Phe 85 90 95Ile Ile Asp Ser Pro Ala Gly Glu Val Ile Ala Tyr Ala Lys Tyr Asn 100 105 110Gly Ser Glu Val Glu Ser Val Ser Phe Glu Asn Val Pro Ser Phe Val 115 120 125Tyr Lys Lys Asp Val Pro Ile 130 135117103PRTTrypanosoma cruzi 117Phe Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu Gln Leu Gly Ile 1 5 10 15Asp Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu 20 25 30Leu Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu 35 40 45Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr 50 55 60Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln 65 70 75 80Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr 85 90 95Leu Tyr Ala Lys Gly Gln Leu 10011895PRTTrypanosoma congolense 118Trp Gly Gly Asn Trp Phe Phe Leu Val Ser Asp His Gly His Glu Leu 1 5 10 15Gln Met Asp Asn Val Glu Ala Leu Thr Asp Tyr Thr Trp Ala Met Leu 20 25 30Asn Ala Leu Glu Ala Gln Gly Ile Arg Gly Ala Asp Gly Ala Leu Ile 35 40 45Asp His Ile Glu Leu Phe Ala Asp Asp Ala His Ala Asp Ser Arg Asn 50 55 60Phe Val Met Cys Pro Gly Lys Ala Tyr Asp Arg Ser Pro Cys Gly Thr 65 70 75 80Gly Thr Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp Ala Lys Leu 85 90 9511955PRTTrypanosoma cruzi 119Asn Val Pro Ser Phe Leu Tyr Gln Gln Asp Val Val Val Val Leu Pro 1 5 10 15Lys Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe 20 25 30Phe Ala Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln 35 40 45Asn Leu Ser Arg Leu Gln Glu 50 5512052PRTTrypanosoma congolense 120His Val Pro Ala Tyr Arg Tyr Arg Lys Gln Val Pro Val Glu Val Pro 1 5 10 15Gly His Gly Val Val Leu Gly Asp Ile Ala Trp Gly Gly Asn Trp Phe 20 25 30Phe Leu Val Ser Asp His Gly His Glu Leu Gln Met Asp Asn Val Glu 35 40 45Ala Leu Thr Asp 50121117PRTTrypanosoma cruzi 121Leu Pro Lys Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly 1 5 10 15Asn Phe Phe Ala Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser 20 25 30Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr 35 40 45Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu Pro His Ile 50 55 60Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu 65 70 75 80Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg 85 90 95Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala 100 105 110Lys Gly Gln Leu Arg 115122116PRTTrypanosoma vivax 122Leu Pro His Pro Tyr Gly Lys Tyr Ala Val Ile Ser Phe Gly Gly Ser 1 5 10 15Phe Phe Ala Leu Ile Asp Ala Ala Gln Leu Gln Leu Thr Val Asp Lys 20 25 30Gly His Leu Ser Thr Leu Gln His Val Gly Gly Leu Leu Arg Asp Thr 35 40 45Leu Asn Arg Asn Val Ser Val Gln His Pro Gln Leu Pro His Ile Asn 50 55 60Arg Ile Asp Cys Val Glu Ile Tyr Asp Pro Pro Thr Asn Pro Ala Ala 65 70 75 80Ser Cys Lys Asn Val Val Ile Phe Gly Asn Ser Gln Val Asp Arg Ser 85 90 95Pro Cys Gly Thr Gly Thr Cys Ala Lys Met Ala Leu Leu Tyr Ala Lys 100 105 110Gly Lys Leu Lys 115123106PRTTrypanosoma cruzi 123Arg Glu Ile Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His 1 5 10 15Thr Glu Gly Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile 20 25 30Pro Gly Ser Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met 35 40 45Asp Tyr Leu Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp 50 55 60Met Phe Gly Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu 65 70 75 80Gly Met Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His 85 90 95Asn Ser Ile Ala Ala Val Thr Ala Ala Val 100 105124106PRTTrypanosoma vivax 124Arg Val Val Met Gln Phe Thr Gly Thr Met Thr Cys Ile Asp Met His 1 5 10 15Thr Ala Gly Glu Pro Ala Arg Ile Val Thr Ser Gly Phe Pro Asn Ile 20 25 30Pro Gly Ala Ser Leu Val Glu Lys Arg Asp His Leu Gln Arg His Met 35 40 45Asp His Ile Arg Arg Arg Val Met Leu Glu Pro Arg Gly His Asp Asn 50 55 60Met Phe Gly Ala Phe Leu Phe Tyr Pro Leu Thr Asp Gly Ala Asp Phe 65 70 75 80Ser Val Ile Phe Met Asp Ala Gly Gly Tyr Leu Asn Met Cys Gly His 85 90 95Asn Ser Ile Ala Ile Ala Thr Ala Ala Val 100 105125357PRTTrypanosoma cruzi 125Lys Arg Glu Ile Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met 1 5 10 15His Thr Glu Gly Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His 20 25 30Ile Pro Gly Ser Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn 35 40 45Met Asp Tyr Leu Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp 50 55 60Asp Met Phe Gly Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp 65 70 75 80Leu Gly Met Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly 85 90 95His Asn Ser Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val 100 105 110Ser Val Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr Pro 115 120 125Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu Ser 130 135 140Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro Ser Phe Leu Tyr Gln145 150 155 160Gln Asp Val Val Val Val Leu Pro Lys Pro Tyr Gly Glu Val Arg Val 165 170 175Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val Pro Ala Glu Gln 180 185 190Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala 195 200 205Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His 210 215 220Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly225 230 235 240Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly 245 250 255Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys 260 265 270Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe 275 280 285Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val Leu Gly 290 295 300Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val Thr Lys Asp Ala Glu305 310 315 320Glu Gly Met Leu Val Val Thr Ala Glu Ile Thr Gly Lys Ala Phe Ile 325 330 335Met Gly Phe Asn Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Lys Asn 340 345 350Gly Phe Thr Leu Lys 355126337PRTVibrio parahaemolyticus 126Lys Glu Arg Lys Met Arg Gln Gly Thr Phe Phe Cys Ile Asp Ala His 1 5 10 15Thr Cys Gly Asn Pro Val Arg Leu Val Ala Gly Gly Val Pro Pro Leu 20 25 30Glu Gly Asn Thr Met Ser Glu Lys Arg Gln Tyr Phe Leu Glu His Tyr 35 40 45Asp Trp Ile Arg Gln Ala Leu Met Phe Glu Pro Arg Gly His Ser Met 50 55 60Met Ser Gly Ser Val Val Leu Pro Pro Cys Ser Asp Asn Ala Asp Ala 65 70 75 80Ser Ile Leu Phe Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His 85 90 95Gly Thr Ile Gly Thr Val Thr Thr Ala Ile Glu Asn Arg Leu Ile Thr 100 105 110Pro Lys Glu Glu Gly Arg Leu Ile Leu Asp Val Pro Ala Gly Gln Ile 115 120 125Glu Val His Tyr Gln Thr Lys Gly Asp Lys Val Thr Ser Val Lys Ile 130 135 140Phe Asn Val Pro Ala Tyr Leu Ala His Gln Asp Val Thr Val Glu Ile145 150 155 160Glu Gly Leu Gly Glu Ile Thr Val Asp Val Ala Tyr Gly Gly Asn Tyr 165 170 175Tyr Val Ile Val Asp Pro Gln Glu Asn Tyr Ala Gly Leu Glu His Tyr 180 185 190Ser Pro Asp Glu Ile Leu Met Leu Ser Pro Lys Val Arg Thr Ala Val 195 200 205Ser Lys Ala Val Glu Cys Ile His Pro Asn Asp Pro Thr Val Cys Gly 210 215 220Val Ser His Val Leu Trp Thr Gly Lys Pro Thr Gln Glu Gly Ala Thr225 230 235 240Ala Arg Asn Ala Val Phe Tyr Gly Asp Lys Ala Leu Asp Arg Ser Pro 245 250 255Cys Gly Thr Gly Thr Ser Ala Arg Met Ala Gln Trp His Ala Lys Gly 260 265 270Lys Leu Lys Ser Gly Glu Asp Phe Val His Glu Ser Ile Ile Gly Ser 275 280 285Leu Phe Asn Gly Arg Ile Glu Gly Ile Thr Glu Val Asn Gly Gln Thr 290 295 300Ala Ile Leu Pro Ser Ile Glu Gly Trp Ala Gln Val Tyr Gly His Asn305 310 315 320Thr Ile Trp Val Asp Asp Glu Asp Pro Tyr Ala Tyr Gly Phe Glu Val 325 330 335Lys12714PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 127Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala 1 5 101285PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide motif 128Asn Met Cys Gly His 1 51296PRTArtificial SequenceDescription of Artificial Sequence Synthetic 6xHis tag 129His His His His His His 1 5

Claims

1. A purified nucleic acid molecule encoding a peptide consisting of a motif selected from SEQ ID NOS: 1, 2, 3, or 4.

2. A purified nucleic acid molecule that hybridizes to either strand of a denatured, double-stranded DNA comprising the nucleic acid molecule of claim 1 under conditions of moderate stringency.

3. A recombinant vector that directs the expression of a nucleic acid molecule selected from the group consisting of the purified nucleic acid molecules of claims 1 or 2.

4. A purified polypeptide encoded by a nucleic acid molecule selected form the group consisting of the purified nucleic acid molecules of claims 1 or 2.

5. A purified polypeptide consisting of Motif I (SEQ ID NO:1).

6. A purified polypeptide consisting of Motif II (SEQ ID NO:2).

7. A purified polypeptide consisting of Motif III (SEQ ID NO:3).

8. A purified polypeptide consisting of Motif III* (SEQ ID NO:4).

9. Purified antibodies that bind to a polypeptide of claim 4.

10. Purified antibodies according to claim 9, wherein the antibodies are monoclonal antibodies.

11. Purified antibodies that bind to a polypeptide of claim 5.

12. Purified antibodies according to claim 11, wherein the antibodies are monoclonal antibodies.

13. Purified antibodies that bind to a polypeptide of claim 6.

14. Purified antibodies according to claim 13, wherein the antibodies are monoclonal antibodies.

15. Purified antibodies that bind to a polypeptide of claim 7.

16. Purified antibodies according to claim 15, wherein the antibodies are monoclonal antibodies.

17. Purified antibodies that bind to a polypeptide of claim 8.

18. Purified antibodies according to claim 17, wherein the antibodies are monoclonal antibodies.

19. A host cell transfected or transduced with the recombinant vector of claim 3.

20. A method for the production of a polypeptide consisting of SEQ ID NOS: 1, 2, 3, or 4, comprising culturing a host cell of claim 17 under conditions promoting expression, and recovering the polypeptide from the host cell or the culture medium.

21. The method of claim 20, wherein the host cell is selected from the group consisting of bacterial cells, parasite cells, and eukaryotic cells.

22. An immunological complex comprising a polypeptide of claim 4 and an antibody that specifically recognizes said polypeptide.

23. A method of detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected form SEQ ID NO: 1, 2, 3, or 4, said method comprising:(a) contacting the nucleotide sequence with a primer or a probe, which hybridizes with the nucleic acid molecule of claim 1;(b) amplifying the nucleotide sequence using said primer or said probe; and(c) detecting a hybridized complex formed between said primer or probe and the nucleotide sequence.

24. A method of detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected from SEQ ID NO: 1, 2, 3, or 4, said method comprising:(a) contacting the product encoded by a nucleotide sequence racemase with antibodies according to any one of claims 9 to 18; and(b) detecting the resulting immunocomplex.

25. A kit for detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected form SEQ ID NO: 1, 2, 3, or 4, said kit comprising:(a) a polynucleotide primer or probe, which hybridizes with the polynucleotide sequence of claim 1; and(b) reagents to perform a nucleic acid hybridization reaction.

26. A kit for detecting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected form SEQ ID NO: 1, 2, 3, or 4, said kit comprising:(a) purified antibodies according to any one of claims 9 or 10;(b) standard reagents in a purified form; and(c) detection reagents.

27. An in vitro method of screening for an active molecule capable of inhibiting a racemase encoded by a nucleotide sequence containing a subsequence encoding a peptide selected form SEQ ID NO: 1, 2, 3, OR 4, said method comprising:(a) contacting the active molecule with said racemase;(b) testing the capacity of the active molecule, at various concentrations, to inhibit the activity of the racemase; and(c) choosing the active molecule that provides an inhibitory effect of at least 80% on the activity of the racemase.

28. An immunizing composition containing at least a purified polypeptide according to claim 4, capable of inducing an immune response in vivo, and a pharmaceutical carrier.

29. A method for detecting a D-amino acid, wherein the method comprises:(A) providing a reaction medium containing the D-amino acid;(B) reacting the D-amino acid with a D-amino oxidase with a prosthetic group to form a reduced prosthetic group by oxidative deamination of the D-amino acid with a primary amine or oxidation of the D-amino acid with a secondary amine;(C) reacting the reduced prosthetic group with oxygen to form hydrogen peroxide; and(D) detecting the hydrogen peroxide thus formed.

30. The method as claimed in claim 29, wherein the prosthetic group is flavin-adenin-dinucleotide (FAD) or flavin-mononucleotide (FMN).

31. The method as claimed in claim 30, wherein the hydrogen peroxide is detected by reaction with a catalase.

32. The method as claimed in claim 29, wherein the D-amino acid is a D-Proline, D-Tyrosine, D-Valine, D-Threonine, D-Glutamic acid, D-Lysine, or D-Tryptophane.

33. The method as claimed in claim 30, wherein the hydrogen peroxide is detected by reaction with a peroxidase.

34. The method as claimed in any one of claims 29-33, comprising quantifying the D-amino acid in the reaction medium after the formation of the hydrogen peroxide.

35. The method as claimed in claim 29, wherein the reaction medium comprises a biological sample from a subject afflicted with Alzheimer's disease, Parkinson's disease, renal disease, or schizophrenia.

36. The method as claimed in claim 34, wherein the biological sample comprises a fluid or tissue sample from the subject.

37. The method as claimed in claim 34, wherein the biological sample comprises cells from the subject.

38. A method for detecting racemase activity in a reaction medium, wherein the method comprises:(A) providing a reaction medium containing a D-amino acid specific to the racemase to be detected;(B) reacting the D-amino acid with a D-amino oxidase with a prosthetic group to form a reduced prosthetic group by oxidation of the D-amino acid;(C) reacting the reduced prosthetic group with oxygen to form hydrogen peroxide; and(D) detecting the hydrogen peroxide thus formed;wherein the detection of hydrogen peroxide indicates racemase activity tin the reaction medium.

39. The method as claimed in claim 38 wherein the hydrogen peroxide is detected by reaction with catalase.

40. The method as claimed in claim 38, wherein the hydrogen peroxide is detected with a chromogenic reagent.

41. The method as claimed in claim 39, wherein the chromogenic reagent is orthophenylalaninediamine (OPD), 3,3',5,5'-tetrimethylbenzadine (TMB), or 5-aminosalicyclic acid (ASA).

42. A kit for screening for inhibitors of TcPRAC, wherein the kit comprises:(A) L-proline, D-proline, and a proline-racemase;(B) a peroxidase and a substrate of a peroxidase, or a catalase and a reagent sensitive to oxygen;(C) a D-amino acid oxidase; and(D) optionally, one or more molecules to be screened for inhibitory activity of TcPRAC.

43. A kit for detecting a D-amino acid in a sample, wherein the kit comprises:(A) a D-amino acid;(B) a peroxidase and a substrate of a peroxidase;(C) a D-amino acid oxidase; and(D) optionally, a L-amino acid enantiomer as control.

44. A method for detecting a D-amino acid in a sample, wherein the method comprises:(A) oxidatively deaminating a D-amino acid by reaction with a D-amino acid oxidase in a prosthetic group; and(B) detecting the hydrogen peroxide generated by the oxidative deamination;wherein the presence of hydrogen peroxide is indicative of the presence of a D-amino acid in the sample.

45. The method as claimed in claim 43, wherein the D-amino acid is D-Proline, D-Tyrosine, D-Valine, D-Threonine, D-Glutamic acid, D-Lysine, or D-Tryptophane.

46. A method for screening a molecule, which can modulate a racemase activity, wherein the method comprises:(A) modulating a racemase activity by means of a molecule being tested in the presence of an equimolar mixture of a L- and D-amino acid an of a racemase to be modulated;(B) oxidatively deaminating the D-amino acid generated in step (A) by means of a D-amino oxidase in a prosthetic group; and(C) detecting the hydrogen peroxide generated by the oxidative deamination;wherein modulation of the hydrogen peroxide is indicative of the capability of the tested molecule to modulate racemase activity.

47. The method as claimed in claim 46, wherein said molecule inhibits said racemase activity.

48. The method as claimed in claim 46, wherein said racemase is a proline racemase.

49. The method as claimed in claim 47, wherein said proline racemase is Tripanosoma cruzi proline racemase.

50. A molecule identified by a method as claimed in claims 45 to 48.

51. A technological platform and all reagents and devices necessary to perform the method of claims 29 to 41 and 44 to 49.

52. The technological platform as claimed in claim 50, comprisinga) L-amino acid, D-amino acid, and a racemase;b) a peroxydase and a substrate of a peroxydase, or a catalase and a reagent sensitive to oxygen;c) a D-amino acid oxidase; andd) optionally, one or more molecules to be screened for inhibitory activity of said racemase.

53. The technological platform as claimed in claim 51, wherein said racemase is a proline racemase and said L-amino acid and D-amino acid are L-proline and D-proline, respectively.

54. A molecule inhibiting a proline racemase containing a subsequence selected form the SEQ ID NO: 1, 2, 3, or 4.

55. A purified nucleic acid molecule encoding a polypeptide consisting of an amino acid sequence that is substantially similar to SEQ ID NO: 1, 2, 3, or 4.

56. The purified nucleic acid molecule of claim 55, wherein the purified nucleic acid molecule hybridizes to either strand of a denatured, double-stranded nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence SEQ ID NO: 1, 2, 3, or 4, wherein the hybridization conditions comprise incubating the nucleic acids at 50.degree. C. in a solution containing 5.times.SSC and 1.times.Denhardt's solution and three washes for twenty minutes each in 2.times.SSC at 60.degree. C.

57. A recombinant vector that directs the expression of the nucleic acid molecule as claimed in claim 55.

58. An isolated host cell transfected or transduced with the recombinant vector as claimed in claim 57.

59. A method for the production of a polypeptide consisting of an amino acid sequence substantially similar to SEQ ID NO: 1, 2, 3, or 4, comprising culturing the host cell of claim 58 under conditions promoting expression, and recovering the polypeptide from the host cell or the culture medium.

60. The method of claim 59, wherein the host cell is selected from the group consisting of bacterial cells, parasite cells, and eukaryotic cells.

61. A purified nucleic acid molecule consisting of nucleotides encoding a polypeptides consisting of an amino acid sequence that is substantially similar to SEQ ID NO: 1, 2, 3, or 4.

62. A duplex nucleic acid molecule comprising a single strand of a denatured, double-stranded DNA hybridized to either strand of a denatured, double-stranded DNA comprising the nucleic acid molecule of claim 55 or 61, wherein the hybridization conditions comprise incubating the nucleic acids at 50.degree. C. in a solution containing 5.times.SSC and 1.times.Denhardt's solution and three washes for twenty minutes each in 2.times.SSC at 60.degree. C.

63. The purified nucleic acid molecule of claim 61, wherein the purified nucleic acid molecule hybridizes to either strand of a denatured, double-stranded nucleic acid molecule consisting of nucleotides encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4, wherein the hybridization conditions comprise incubating the nucleic acids at 50.degree. C. in a solution containing 5.times.SSC and 1.times.Denhardt's solution and three washes for twenty minutes each in 2.times.SSC at 60.degree. C.

64. A recombinant vector that directs the expression of the nucleic acid molecule as claimed in claim 61.

65. An isolated host cell transfected or transduced with the recombinant vector of claim 64.

66. A method for the production of a polypeptide consisting of an the amino acid sequence substantially similar to SEQ ID NO: 1, 2, 3, or 4, comprising culturing the host cell of claim 65 under conditions promoting expression, and recovering the polypeptide from the host cell or the culture medium.

67. The method of claim 66, wherein the host cell is selected from the group consisting of bacterial cells, parasite cells, and eukaryotic cells.

68. A kit for detecting a racemase encoded by a nucleotide sequence having a subsequence encoding the peptide SEQ ID NO: 1, 2, 3, or 4, said kit comprising:(a) a polynucleotide primer or probe consisting of the polynucleotide sequence of claim 55 or 61; and(b) reagents to perform a nucleic acid hybridization reaction.

Images