Patent application title: NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
Inventors:
Kalyani Nambiar (Cambridge, MA, US)
James M. Wilson (Philadelphia, PA, US)
James M. Wilson (Philadelphia, PA, US)
IPC8 Class: AA61K4800FI
USPC Class:
Class name:
Publication date: 2022-08-11
Patent application number: 20220249705
Abstract:
Provided herein are novel AAV capsids and rAAV comprising the same. In
one embodiment, vectors employing a novel AAV capsid show increased
transduction of a selected target tissue as compared to a prior art AAV.Claims:
1. (canceled)
2. A recombinant adeno-associated virus (rAAV) having a capsid comprising capsid proteins produced by expression of the AAV capsid sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, or a sequence sharing at least 90% identity with any of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, and having packaged in said capsid a vector genome comprising a heterologous nucleic acid sequence.
3. (canceled)
4. The rAAV according to claim 2, further comprising a 5' AAV inverted terminal repeat (ITR) and a 3' AAV ITR and a heterologous nucleic acid sequence operably linked to regulatory sequences which direct expression of a product encoded by the heterologous nucleic acid sequence in a target cell.
5. (canceled)
6. The rAAV according to claim 4, wherein the ITR sequences are from AAV2.
7. The rAAV according to claim 2, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2, a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 589 to 2199 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 589 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 197 to 733 of SEQ ID NO: 2, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 2 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
8. The rAAV according to claim 7, wherein the nucleic acid sequence encoding the proteins is SEQ ID NO: 1, or a sequence at least 80% identical to SEQ ID NO: 1 which encodes the amino acid sequence of SEQ ID NO: 2.
9. (canceled)
10. The rAAV according to claim 2, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4, vp1 proteins produced from SEQ ID NO: 3, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 3 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4, a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2184 of SEQ ID NO: 3, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4, vp3 proteins produced from a sequence comprising at least nucleotides 595 to 2184 of SEQ ID NO: 3, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 595 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 4, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 199 to 728 of SEQ ID NO: 4, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 4 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
11. The rAAV according to claim 10, wherein the nucleic acid sequence encoding the proteins is SEQ ID NO: 3, or a sequence at least 80% identical to SEQ ID NO: 3 which encodes the amino acid sequence of SEQ ID NO: 4.
12. (canceled)
13. The rAAV according to claim 2, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6, vp1 proteins produced from SEQ ID NO: 5, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 5 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6, a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 5, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 6, a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2199 of SEQ ID NO: 5, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 6, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 733 of SEQ ID NO: 6, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 6 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
14. The rAAV according to claim 13, wherein the nucleic acid sequence encoding the proteins is SEQ ID NO: 5, or a sequence at least 80% identical to SEQ ID NO: 5 which encodes the amino acid sequence of SEQ ID NO: 6.
15-16. (canceled)
17. The rAAV according to claim 7, wherein the ITR sequences are from AAV2.
18. A composition comprising at least the rAAV according to claim 2 and a physiologically compatible carrier, buffer, adjuvant, and/or diluent.
19-23. (canceled)
24. An rAAV production system useful for producing the rAAV according to claim 2, wherein the production system comprises: (a) a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, 4, or 6; (b) a nucleic acid molecule suitable for packaging into an AAV capsid, said nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell; and (c) sufficient AAV rep functions and helper functions to permit packaging of the nucleic acid molecule into the rAAV capsid.
25. The system according to claim 24, wherein the nucleic acid sequence of (a) comprises (a) at least SEQ ID NO: 1, or a sequence at least 70% to at least 99% identical to SEQ ID NO: 1 which encodes the amino acid sequence of SEQ ID NO: 2; (b) at least SEQ ID NO: 3, or a sequence at least 70% identical to SEQ ID NO: 3 which encodes the amino acid sequence of SEQ ID NO: 4; or (c) at least SEQ ID NO: 5, or a sequence at least 70% identical to SEQ ID NO: 5 which encodes the amino acid sequence of SEQ ID NO: 6.
26. The system according to claim 24, wherein the cell culture comprises human embryonic kidney 293 cells.
27. (canceled)
28. The system according to claim 24, wherein the AAV rep is from AAV2.
29. A host cell transduced with the rAAV according to claim 2.
30. A method of delivering a transgene to a cell, said method comprising the step of contacting the cell with the rAAV according to claim 2, wherein said rAAV comprises the transgene.
31. A nucleic acid molecule comprising a nucleic acid sequence encoding an AAV capsid protein, the nucleic acid sequence comprising (a) at least SEQ ID NO: 1, or a sequence at least 70% identical to SEQ ID NO: 1 which encodes the amino acid sequence of SEQ ID NO: 2; (b) at least SEQ ID NO: 3, or a sequence at least 70% identical to SEQ ID NO: 3 which encodes the amino acid sequence of SEQ ID NO: 4; or (c) at least SEQ ID NO: 5, or a sequence at least 70% identical to SEQ ID NO: 5 which encodes the amino acid sequence of SEQ ID NO: 6.
32. The nucleic acid molecule according to claim 31, wherein said molecule is a plasmid.
33. A host cell transfected with the nucleic molecule according to claim 31.
34. A method of generating a rAAV comprising the steps of culturing a host cell containing: (a) a nucleic acid molecule encoding an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 2, 4, or 6; (b) a functional rep gene; (c) a minigene comprising a AAV 5' ITR, a AAV 3' ITR, and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into an AAV capsid.
Description:
BACKGROUND OF THE INVENTION
[0001] Adeno-associated viruses (AAV) hold great promise in human gene therapy and have been widely used to target liver, muscle, heart, brain, eye, kidney, and other tissues in various studies due to their ability to provide long-term gene expression and lack of pathogenicity. AAVs belong to the parvovirus family and each contains a single strand DNA flanked by two inverted terminal repeats. Dozens of naturally occurring AAV capsids have been reported; their unique capsid structures enable them to recognize and transduce different cell types and organs.
[0002] Since the first trial started in 1981, there has not been any vector-related toxicity reported in clinical trials of AAV vector-based gene therapy. The ever-accumulating safety records of AAV vectors in clinical trials, combined with demonstrated efficacy, show that AAV is a promising platform for gene delivery. Another attractive feature is that AAV is relatively easily manipulated since it is a single-stranded DNA virus with a small genome (.about.4.7 kb) and simple genetic components--inverted terminal repeats (ITRs) along with the Rep and Cap genes. Only the ITRs and AAV capsid protein are required in AAV vectors, with the ITRs serving as replication and packaging signals for vector production and the capsid proteins not only forming a capsid to accommodate vector genome DNA, but determining tissue tropism to deliver the vector genome into target cells and tissues.
[0003] AAVs are among the most effective vector candidates for gene therapy due to their low immunogenicity and non-pathogenic nature. However, despite allowing for efficient gene transfer, the AAV vectors currently used in the clinic can be hindered by preexisting immunity to the virus and restricted tissue tropism. New and more effective AAV vectors are needed.
SUMMARY OF THE INVENTION
[0004] In one embodiment, provided herein is a recombinant adeno-associated virus (rAAV) having an AAV capsid comprising a capsid protein comprising the amino acid sequence SEQ ID NO: 2 (AAVrh.92), SEQ ID NO: 4 (AAVrh.93), or SEQ ID NO: 6 (AAVrh.91.93), and having packaged in the capsid a vector genome comprising a heterologous nucleic acid sequence. In certain embodiments, the rAAV has a capsid comprising capsid proteins produced by expression of the AAV capsid sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, or a sequence sharing at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identity with SEQ SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, and having packaged in the capsid a vector genome comprising a heterologous nucleic acid sequence.
[0005] In certain embodiments, provided herein is an rAAV, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2; a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2; a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 589 to 2199 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 589 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 197 to 733 of SEQ ID NO: 2, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 2 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
[0006] In certain embodiments, provided herein is an rAAV, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4, vp1 proteins produced from SEQ ID NO: 3, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 3 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4; a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2184 of SEQ ID NO: 3, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4; a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4, vp3 proteins produced from a sequence comprising at least nucleotides 595 to 2184 of SEQ ID NO: 3, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 595 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 4, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 199 to 728 of SEQ ID NO: 4, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 4 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
[0007] In certain embodiments, provided herein is an rAAV, wherein the AAV capsid comprises AAV capsid proteins comprising: (1) a heterogeneous population of vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6, vp1 proteins produced from SEQ ID NO: 5, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 5 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6; a heterogeneous population of vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 5, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO: 6; a heterogeneous population of vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2199 of SEQ ID NO: 5, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 6, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 733 of SEQ ID NO: 6, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 6 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change.
[0008] In another embodiment, provided herein is a composition comprising at least a rAAV and a physiologically compatible carrier, buffer, adjuvant, and/or diluent. In certain embodiments, the composition is formulated for intrathecal delivery and the vector genome comprises a nucleic acid sequence encoding a gene product for delivery to the central nervous system. In yet another embodiment, the composition is formulated for intravenous delivery, intranasal, and/or intramuscular delivery.
[0009] In certain embodiments, a system useful for producing a rAAV is provided. The system comprises: (a) a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, 4, or 6; (b) a nucleic acid molecule suitable for packaging into an AAV capsid, wherein the nucleic acid molecule comprises at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell; and (c) sufficient AAV rep functions and helper functions to permit packaging of the nucleic acid molecule into the rAAV capsid.
[0010] In certain embodiments, a method of generating a rAAV comprising an AAV capsid is provided. The method comprises the steps of culturing a host cell containing: (a) a nucleic acid molecule encoding an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 2, 4, or 6; (b) a functional rep gene; (c) a minigene comprising a AAV 5' ITR, a AAV 3' ITR, and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into an AAV capsid.
[0011] In yet another embodiment, a host cell containing a rAAV, expression cassette, or nucleic acid molecule described herein is provided.
[0012] In certain embodiments, a method of delivering a transgene to a cell is provided. The method includes the step of contacting the cell with an rAAV as described herein, wherein the rAAV comprises the transgene.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1 shows a diagram for an AAV-SGA workflow. Genomic DNA was isolated from rhesus macaque tissue samples and screened for the presence of AAV capsid genes. AAV-positive DNA was endpoint diluted and subjected to a further round of PCR. According to a Poisson distribution, the DNA dilution that yields PCR products in no more than 30% of wells contains one amplifiable DNA template per positive PCR 80% of the time. Positive amplicons were sequenced using the Illumina MiSeq 2.times.150 or 2.times.250 paired end sequencing platforms and resulting reads were de novo assembled using the SPAdes assembler.
[0014] FIG. 2 is a diagram showing the neighbor-joining phylogeny of DNA genome sequences of novel AAV natural isolates and representative clade controls.
[0015] FIG. 3A-FIG. 3D show an alignment for nucleic acid sequences for AAVrh.92 (SEQ ID NO: 1), AAVrh.93 (SEQ ID NO: 3), AAVrh91.93 (SEQ ID NO: 5) and AAV7 (SEQ ID NO: 7) capsids.
[0016] FIG. 4A and FIG. 4B shows an alignment of the amino acid sequences for AAVrh.92 (SEQ ID NO: 2), AAVrh.93 (SEQ ID NO: 4), AAVrh91.93 (SEQ ID NO: 6) and AAV7 (SEQ ID NO: 8) capsids.
[0017] FIG. 5A-FIG. 5D show eGFP transgene biodistribution in mouse tissues 14 days post injection. (FIG. 5A and FIG. 5B) C57BL/6 mice were injected IV at a dose of 1e12 GC per mouse with AAV capsids containing a CB7.CI.eGFP.WPRE.RBG transgene (n=5). (FIG. 5C and FIG. 5D) C57BL/6 mice were injected intracerebroventricularly ICV at a dose of 1e11 GC per mouse with various AAV capsids (clade A vectors dosed at 6.9e10 GC/mouse) containing a CB7.CI.eGFP.WPRE.RBG transgene (n=5). Values are expressed as mean.+-.SD; *p<0.01, **p<0.001.
[0018] FIG. 6A and FIG. 6B show analysis of LacZ expression in muscle following IM delivery of AAV vectors. Mice were administered 3e9 GC of vectors having various capsids and expressing LacZ under the CMV promoter. On day 20, muscle tissue was harvested, and transgene expression was evaluated by X-gal staining.
[0019] FIG. 7 shows levels of mAb in serum following IM delivery of various AAV vectors. B6 mice were administered 1e11 GC of vectors expressing the 3D6 antibody under the tMCK promoter.
[0020] FIG. 8 shows yields (relative to AAV8) for vectors expressing 3D6 or LacZ transgenes.
[0021] FIG. 9 shows experimental designs for the pooled barcoded vector studies in NHP (data shown in FIG. 10A-FIG. 10C). Five novel capsids and five controls (AAVrh.90, AAVrh9.1, AAVrh.92, AAVrh.93, AAVrh.91.93, AAV8, AAV6.2, AAVrh32.33, AAV7, and AAV9) were packaged with a modified ATG-depleted GFP transgene with unique 6 bp barcodes. Vectors were pooled at equal quantities and injected IV or ICM in cynomologus macaques (total doses: 2e13 GC/kg IV and 3e13 GC ICM). The IV injected animal was seronegative for AAV6, AAV8, and AAVrh32.33, at baseline and had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively.
[0022] FIG. 10A-FIG. 10C are graphs showing RNA expression analysis of barcoded capsids after IV delivery (FIG. 10A and FIG. 10B) and ICM delivery (FIG. 10C). IV Administration--2e13 GC/kg total dose, necropsy at day 30 (This animal had low levels of AAV7 and AAV9 Nabs at baseline). ICM Administration--3e13 GC/animal, necropsy at day 30. Barcode frequencies in each tissue RNA sample were normalized to frequencies in injection input material such that each barcode had an equivalent representation (10%) in the mixtures. Input quantities of ten vectors ranged from 8.5-12%. Values are expressed as mean.+-.SEM, **p<0.001.
[0023] FIG. 11 is a bar graph showing small scale prep titers of various AAV capsids used in the NHP barcode study. Each dot represents an individual small-scale preparation.
[0024] FIG. 12A and FIG. 12B show the effects of targeted Ly6 expression in brain endothelial cells on PHP.B transduction in BALB/C Rag-/- mice. (FIG. 12A) Experimental design-mice were administered (IV 1e12 GC/mouse) AAVrh.92 containing transgenes for expression of Ly6a or Ly6c1 and then on day 7, were administered AAV9 or AAV9PHP.B expressing eGFP. (FIG. 12B) eGFP detection to evaluate delivery of the transgene to brain tissue.
[0025] FIG. 13 show histological analysis of mouse brain showing AAVrh92.CB7.CI.eGFP.WPRE.RBG transduction in vasculature 14 days after IV injection, 1e12 GC per C57BL/6 mouse. dark staining: anti-GFP; Scale bars: 100 .mu.m
DETAILED DESCRIPTION OF THE INVENTION
[0026] The genetic variation of AAVs in their natural mammalian hosts was explored by using AAV single genome amplification, a technique used to accurately isolate individual AAV genomes from within a viral population (FIG. 1). Described herein is the isolation of novel AAV sequences from rhesus macaque tissues that can be categorized in various clades. We assessed the biological properties of the natural isolate-derived AAV vectors in mice after intravenous (IV) and intracerebroventricular (ICV) delivery, and in NHP following IV and intra-cisterna magna (ICM) delivery. The results identified both clade-specific and variable transduction patterns of the new AAV variants when compared to their prototypical clade member controls.
[0027] Provided herein is a recombinant AAV vector having an AAVrh.92, AAVrh.93, or AAVrh91.93 capsid and a nucleic acid encoding a transgene under the control of regulatory sequences, which direct expression thereof following delivery to a subject. Compositions containing these vectors are provided. The methods described herein are directed to use of rAAV to target tissues of interest for treatment of various conditions.
[0028] Interestingly, AAVrh.92 showed high levels of transduction in CD31-positive brain vascular endothelial cells after IV delivery. The potent transduction of this cell type has the potential for the treatment of a variety of neurovascular diseases. In certain embodiments, provided herein is a vector comprising an AAVrh.92 capsid well suited for delivery to the neurovasculature. In certain embodiments, intrathecal delivery is desired, including, e.g., delivery to the brain via ICM delivery. In certain embodiments, vectors comprising the capsid described herein are well suited for delivery to the heart (smooth muscle). In other embodiments, vectors comprising the capsid described herein are well suited for delivery to skeletal (striated) muscle. The vectors may be delivered systemically or targeted via a route of administration suitable to target these tissues.
[0029] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The following definitions are provided for clarity only and are not intended to limit the claimed invention. As used herein, the terms "a" or "an", refers to one or more, for example, "a host cell" is understood to represent one or more host cells. As such, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein. As used herein, the term "about" means a variability of 10% from the reference given, unless otherwise specified. While various embodiments in the specification are presented using "comprising" language, under other circumstances, a related embodiment is also intended to be interpreted and described using "consisting of" or "consisting essentially of" language.
[0030] With regard to the following description, it is intended that each of the compositions herein described, is useful, in another embodiment, in the methods of the invention. In addition, it is also intended that each of the compositions herein described as useful in the methods, is, in another embodiment, itself an embodiment of the invention.
[0031] A "recombinant AAV" or "rAAV" is a DNAse-resistant viral particle containing two elements, an AAV capsid and a vector genome containing at least non-AAV coding sequences packaged within the AAV capsid. Unless otherwise specified, this term may be used interchangeably with the phrase "rAAV vector". The rAAV is a "replication-defective virus" or "viral vector", as it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate progeny. In certain embodiments, the only AAV sequences are the AAV inverted terminal repeat sequences (ITRs), typically located at the extreme 5' and 3' ends of the vector genome in order to allow the gene and regulatory sequences located between the ITRs to be packaged within the AAV capsid.
[0032] As used herein, a "vector genome" refers to the nucleic acid sequence packaged inside the rAAV capsid which forms a viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs). In the examples herein, a vector genome contains, at a minimum, from 5' to 3', an AAV 5' ITR, coding sequence(s), and an AAV 3' ITR. In certain embodiments, the ITRs are from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs may be used. Further, the vector genome contains regulatory sequences which direct expression of the gene products. Suitable components of a vector genome are discussed in more detail herein. The vector genome is sometimes referred to herein as the "minigene".
[0033] The term "expression cassette" refers to a nucleic acid molecule which comprises a transgene sequences and regulatory sequences therefore (e.g., promoter, enhancer, polyA), which cassette may be packaged into the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for generating a viral vector contains the transgene sequences flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. For example, for an AAV viral vector, the packaging signals are the 5' inverted terminal repeat (ITR) and the 3' ITR. In certain embodiments, the term "transgene" may be used interchangeably with "expression cassette". In other embodiments, the term "transgene" refers solely to the coding sequences for a selected gene.
[0034] A rAAV is composed of an AAV capsid and a vector genome. An AAV capsid is an assembly of a heterogeneous population of vp1, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein when used to refer to vp capsid proteins, the term "heterogeneous" or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vp1, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
[0035] As used herein, the term "heterogeneous population" as used in connection with vp1, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vp1, vp2 and vp3 proteins within a capsid. The AAV capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine-glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
[0036] As used herein, a "subpopulation" of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified. For example, a "subpopulation" of vp1 proteins may be at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified. A "subpopulation" of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vp1 proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid. In another example, vp1, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine-glycine pairs.
[0037] Unless otherwise specified, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position. Such percentages may be determined using 2D-gel, mass spectrometry techniques, or other suitable techniques.
[0038] Without wishing to be bound by theory, the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues. Efficient capsid assembly of the majority of deamidation vp1 proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vp1, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics. Extensive deamidation in the VP1-unique (VP1-u) region (.about.aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly.
[0039] Without wishing to be bound by theory, the deamidation of N may occur through its C-terminus residue's backbone nitrogen atom conducts a nucleophilic attack to the Asn's side chain amide group carbon atom. An intermediate ring-closed succinimide residue is believed to form. The succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below.
##STR00001##
[0040] As provided herein, each deamidated N in the VP1, VP2 or VP3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof. Any suitable ratio of .alpha.- and isoaspartic acid may be present. For example, in certain embodiments, the ratio may be from 10:1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic:isoaspartic, or about 1:3 aspartic:isoaspartic, or another selected ratio.
[0041] In certain embodiments, one or more glutamine (Q) may deamidates to glutamic acid (Glu), i.e., .alpha.-glutamic acid, .gamma.-glutamic acid (Glu), or a blend of .alpha.- and .gamma.-glutamic acid, which may interconvert through a common glutarinimide intermediate. Any suitable ratio of .alpha.- and .gamma.-glutamic acid may be present. For example, in certain embodiments; the ratio may be from 10:1 to 1:10 .alpha. to .gamma., about 50:50 .alpha.:.gamma., or about 1:3 .alpha.:.gamma., or another selected ratio.
##STR00002##
[0042] Thus, an rAAV includes subpopulations within the rAAV capsid of vp1, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, modifications may include an amidation at an Asp position.
[0043] In certain embodiments, an AAV capsid contains subpopulations of vp1, vp2 and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10%, at least 10 to 25%, at least 25 to 50%, at least 50 to 70%, at least 70 to 100%, at least 75 to 100%, at least 80-100% or at least 90-100% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
[0044] As used herein, "encoded amino acid sequence" refers to the amino acid which is predicted based on the translation of a known DNA codon of a referenced nucleic acid sequence being translated to an amino acid. The following table illustrates DNA codons and twenty common amino acids, showing both the single letter code (SLC) and three letter code (3LC).
TABLE-US-00001 Amino Acid SLC 3LC DNA codons Isoleucine I Ile ATT, ATC, ATA Leucine L Leu CTT, CTC, CTA, CTG, TTA, TTG Valine V Val GTT, GTC, GTA, GTG Phenylalanine F Phe TTT, TTC Methionine M Met ATG Cysteine C Cys TGT, TGC Alanine A Ala GCT, GCC, GCA, GCG Glycine G Gly GGT, GGC, GGA, GGG Proline P Pro CCT, CCC, CCA, CCG Threonine T Thr ACT, ACC, ACA, ACG Serine S Ser TCT, TCC, TCA, TCG, AGT, AGC Tyrosine Y Tyr TAT, TAC Tryptophan W Trp TGG Glutamine Q Gln CAA, CAG Asparagine N Asn AAT, AAC Histidine H His CAT, CAC Glutamic acid E Glu GAA, GAG Aspartic acid D Asp GAT, GAC Lysine K Lys AAA, AAG Arginine R Arg CGT, CGC, CGA, CGG, AGA, AGG Stop codons Stop TAA, TAG, TGA
[0045] In certain embodiments, a rAAV has an AAV capsid having vp1, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four, five or more deamidated residues at the positions set forth in the tables provided herein and incorporated herein by reference.
[0046] Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of 1e5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z. Survey scans were acquired at a resolution of 120,000 at m/z 200. Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest. Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra. Examples of suitable proteases may include, e.g., trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule+0.984 Da (the mass difference between --OH and --NH.sub.2 groups). The percent deamidation of a particular peptide is determined by mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It will be understood by one of skill in the art that a number of variations on these illustrative methods can be used. For example, suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitably liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series). Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online Jun. 16, 2017.
[0047] In addition to deamidations, other modifications may occur do not result in conversion of one amino acid to a different amino acid residue. Such modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.
[0048] Modulation of Deamidation: In certain embodiments, the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation. In other embodiments, the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups). As used herein, amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine-glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates. Additionally, or alternatively one or more other amide amino acids may be changed to a non-amide amino acid to reduce deamidation of the AAV. In certain embodiments, a mutant AAV capsid as described herein contains a mutation in an asparagine-glycine pair, such that the glycine is changed to an alanine or a serine. A mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs. In certain embodiments, an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs. In certain embodiments, a mutant AAV capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP1-unique region. In certain embodiments, one of the mutations is in the VP1-unique region. Optionally, a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
[0049] In certain embodiments, a method of increasing the potency of a rAAV vector is provided which comprises engineering an AAV capsid which eliminating one or more of the NGs in the wild-type AAV capsid. In certain embodiments, the coding sequence for the "G" of the "NG" is engineered to encode another amino acid. In certain examples below, an "S" or an "A" is substituted. However, other suitable amino acid coding sequences may be selected.
[0050] These amino acid modifications may be made by conventional genetic engineering techniques. For example, a nucleic acid sequence containing modified AAV vp codons may be generated in which one to three of the codons encoding glycine in asparagine-glycine pairs are modified to encode an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing modified asparagine codons may be engineered at one to three of the asparagine-glycine pairs, such that the modified codon encodes an amino acid other than arginine. Each modified codon may encode a different amino acid. Alternatively, one or more of the altered codons may encode the same amino acid. In certain embodiments, these modified AAVrh.92, AAVrh.93, or AAVrh.91.93 nucleic acid sequences may be used to generate a mutant rAAV having a capsid with lower deamidation than the native AAVrh.92, AAVrh.93, or AAVrh.91.93 capsid. Such mutant rAAV may have reduced immunogenicity and/or increase stability on storage, particularly storage in suspension form.
[0051] Also provided herein are nucleic acid sequences encoding the AAV capsids having reduced deamidation. It is within the skill in the art to design nucleic acid sequences encoding this AAV capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA). Such nucleic acid sequences may be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization may be performed using methods which are available on-line (e.g., GeneArt), published methods, or a company which provides codon optimizing services, e.g., DNA2.0 (Menlo Park, Calif.). One codon optimizing method is described, e.g., in International Patent Publication No. WO 2015/012924, which is incorporated by reference herein in its entirety. See also, e.g., US Patent Publication No. 2014/0032186 and US Patent Publication No. 2006/0136184. Suitably, the entire length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. By using one of these methods, one can apply the frequencies to any given polypeptide sequence and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide. A number of options are available for performing the actual changes to the codons or for synthesizing the codon-optimized coding regions designed as described herein. Such modifications or synthesis can be performed using standard and routine molecular biological manipulations well known to those of ordinary skill in the art. In one approach, a series of complementary oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair. The single-stranded ends of each pair of oligonucleotides are designed to anneal with the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO.RTM. vector available from Invitrogen Corporation, Carlsbad, Calif. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pair fragments ligated together, i.e., fragments of about 500 base pairs, are prepared, such that the entire desired sequence is represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector, and sequenced. Additional methods would be immediately apparent to the skilled artisan. In addition, gene synthesis is readily available commercially.
[0052] In certain embodiments, AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) which contain multiple highly deamidated "NG" positions. In certain embodiments, the highly deamidated positions are in the locations identified below, with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced "NG" is ablated and a mutant "NG" is engineered into another position.
[0053] As used herein, the terms "target cell" and "target tissue" can refer to any cell or tissue which is intended to be transduced by the subject AAV vector. The term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart. In one embodiment, the target tissue is liver. In another embodiment, the target tissue is the heart. In another embodiment, the target tissue is brain. In another embodiment, the target tissue is muscle.
[0054] As used herein, the term "mammalian subject" or "subject" includes any mammal in need of the methods of treatment described herein or prophylaxis, including particularly humans. Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc. The subject may be male or female.
[0055] As used herein, the term "host cell" may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term "host cell" may refer to the target cell in which expression of the transgene is desired.
A. THE AAV CAPSID
[0056] Provided herein are novel AAV capsid proteins having vp1 sequences set forth in the sequence listing: AAVrh.92 (SEQ ID NO: 2), AAVrh.93 (SEQ ID NO: 4), or AAVrh.91.93 (SEQ ID NO: 6). The AAV capsid consists of three overlapping coding sequences, which vary in length due to alternative start codon usage. These variable proteins are referred to as VP1, VP2 and VP3, with VP1 being the longest and VP3 being the shortest. The AAV particle consists of all three capsid proteins at a ratio of .about.1:1:10 (VP1:VP2:VP3). VP3, which is comprised in VP1 and VP2 at the N-terminus, is the main structural component that builds the particle. The capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VP1 numbering, which starts with aa 1 for the first residue of VP1. However, the capsid proteins described herein include VP1, VP2 and VP3 (used interchangeably herein with vp1, vp2 and vp3). The numbering of the variable proteins of the capsids are as follows:
[0057] Nucleotides (nt)
[0058] AAVrh.92: vp1-nt 1 to 2199; vp2-nt 412 to 2199; vp3-nt 589 to 2199 of SEQ ID NO: 1;
[0059] AAVrh.93: vp1-nt 1 to 2184; vp2-nt 412 to 2184; vp3-nt 595 to 2184 of SEQ ID NO: 3;
[0060] AAVrh.91.93: vp1-nt 1 to 2199; vp2-nt 412 to 2199; vp3-nt 607 to 2199 of SEQ ID NO: 5.
[0061] An alignment of the capsids described herein, along with AAV7 (SEQ ID NO: 7), is shown in FIG. 3A-FIG. 3D.
[0062] Amino acids (aa)
[0063] AAVrh.92: aa vp1-1 to 733; vp2-aa 138 to 733; vp3-aa 197 to 733 of SEQ ID NO: 2;
[0064] AAVrh.93: aa vp1-1 to 728; vp2-aa 138 to 728; vp3-aa 199 to 728 of SEQ ID NO: 4;
[0065] AAVrh.91.93: aa vp1-1 to 733; vp2-aa 138 to 733; vp3-aa 203 to 733 of SEQ ID NO: 6.
[0066] An alignment of the capsids described herein, along with AAV7 (SEQ ID NO: 8), is shown in FIG. 4A-FIG. 4B.
[0067] Included herein are rAAV comprising at least one of the vp1, vp2 and the vp3 of any of AAVrh.92 (SEQ ID NO: 2), AAVrh.93 (SEQ ID NO: 4), or AAVrh.91.93 (SEQ ID NO: 6). Also provided herein are rAAV comprising AAV capsids encoded by at least one of the vp1, vp2 and the vp3 of any of AAVrh.92 (SEQ ID NO: 1), AAVrh.93 (SEQ ID NO:3), or AAVrh.91.93 (SEQ ID NO: 5). In certain embodiments, the vp1, vp2 and/or vp3 is the full-length capsid protein of AAVrh.92 (SEQ ID NO: 2), AAVrh.93 (SEQ ID NO: 4), or AAVrh.91.93 (SEQ ID NO: 6). In other embodiments, the vp1, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
[0068] In one embodiment, a composition is provided which includes a mixed population of recombinant adeno-associated virus (rAAV), each of said rAAV comprising: (a) an AAV capsid comprising about 60 capsid proteins made up of vp1 proteins, vp2 proteins and vp3 proteins, wherein the vp1, vp2 and vp3 proteins are: a heterogeneous population of vp1 proteins which are produced from a nucleic acid sequence encoding a selected AAV vp1 amino acid sequence, a heterogeneous population of vp2 proteins which are produced from a nucleic acid sequence encoding a selected AAV vp2 amino acid sequence, a heterogeneous population of vp3 proteins which produced from a nucleic acid sequence encoding a selected AAV vp3 amino acid sequence, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in the AAV capsid and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (b) a vector genome in the AAV capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product operably linked to sequences which direct expression of the product in a host cell.
[0069] In certain embodiments, the deamidated asparagines are deamidated to aspartic acid, isoaspartic acid, an interconverting aspartic acid/isoaspartic acid pair, or combinations thereof. In certain embodiments, the capsid further comprises deamidated glutamine(s) which are deamidated to (.alpha.)-glutamic acid, .gamma.-glutamic acid, an interconverting (.alpha.)-glutamic acid/.gamma.-glutamic acid pair, or combinations thereof.
[0070] In certain embodiments, a novel isolated AAVrh.92 capsid is provided. The nucleic acid sequence encoding the AAVrh.92 capsid is provided in SEQ ID NO: 1 and the encoded amino acid sequence is provided in SEQ ID NO: 2. Provided herein is an rAAV comprising at least one of the vp1, vp2 and the vp3 of AAVrh.92 (SEQ ID NO: 2). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vp1, vp2 and the vp3 of AAVrh.92 (SEQ ID NO: 1).
[0071] In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVrh.92 capsid comprising one or more of: (1) AAVrh.92 capsid proteins comprising: a heterogeneous population of AAVrh.92 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 2, a heterogeneous population of AAVrh.92 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, a heterogeneous population of AAVrh.92 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 589 to 2199 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 589 to 2199 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 197 to 733 of SEQ ID NO: 2; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 1, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 197 to 733 of SEQ ID NO: 2, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 2 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVrh.92 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product operably linked to sequences which direct expression of the product in a host cell.
[0072] In certain embodiments, an AAVrh.92 capsid comprises: a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 197 to 733 of SEQ ID NO: 2.
[0073] In certain embodiments, the nucleic acid sequence encoding the AAVrh.92 vp1 capsid protein is provided in SEQ ID NO: 1. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 1 may be selected to express the AAVrh.92 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 1. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 2 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 1 which encodes SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2199 of SEQ ID NO: 1 which encodes the vp2 capsid protein (about aa 138 to 733) of SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 589 to about nt 2199 of SEQ ID NO: 1 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 589 to about nt 2199 of SEQ ID NO: 1 which encodes the vp3 capsid protein (about aa 197 to 733) of SEQ ID NO: 2.
[0074] The invention also encompasses nucleic acid sequences encoding mutant AAVrh.92, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant rAAVrh.92 capsids.
[0075] In certain embodiments, a novel isolated AAVrh.93 capsid is provided. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 3 and the encoded amino acid sequence is provided in SEQ ID NO: 4. Provided herein is an rAAV comprising at least one of the vp1, vp2 and the vp3 of AAVrh.93 (SEQ ID NO: 4). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vp1, vp2 and the vp3 of AAVrh.93 (SEQ ID NO: 3).
[0076] In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVrh.93 capsid comprising one or more of: (1) AAVrh.93 capsid proteins comprising: a heterogeneous population of AAVrh.93 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4, vp1 proteins produced from SEQ ID NO: 3, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 3 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 4, a heterogeneous population of AAVrh.93 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2184 of SEQ ID NO: 3, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, a heterogeneous population of AAVrh.93 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4, vp3 proteins produced from a sequence comprising at least nucleotides 595 to 2184 of SEQ ID NO: 3, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 595 to 2184 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 199 to 728 of SEQ ID NO: 4; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 4, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 199 to 728 of SEQ ID NO: 4, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 4 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVrh.93 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product operably linked to sequences which direct expression of the product in a host cell.
[0077] In certain embodiments, an AAVrh.93 capsid comprises: a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 4, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 728 of SEQ ID NO: 4, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 199 to 728 of SEQ ID NO: 4.
[0078] In certain embodiments, the nucleic acid sequence encoding the AAVrh.93 vp1 capsid protein is provided in SEQ ID NO: 3. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 3 may be selected to express the AAVrh.93 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 3. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 4 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 3 or a sequence at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 3 which encodes SEQ ID NO: 4. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 3 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2184 of SEQ ID NO: 3 which encodes the vp2 capsid protein (about aa 138 to 728) of SEQ ID NO: 4. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 595 to about nt 2184 of SEQ ID NO: 3 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical nt 595 to about nt 2184 of SEQ ID NO: 3 which encodes the vp3 capsid protein (about aa 199 to 728) of SEQ ID NO: 4.
[0079] The invention also encompasses nucleic acid sequences encoding mutant AAVrh.93, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant rAAVrh.93 capsids.
[0080] In certain embodiments, a novel AAVrh.91.93 capsid is provided. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 5 and the encoded amino acid sequence is provided in SEQ ID NO: 6. Provided herein is an rAAV comprising at least one of the vp1, vp2 and the vp3 of AAVrh.91.93 (SEQ ID NO: 6). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vp1, vp2, and the vp3 of AAVrh.91.93 (SEQ ID NO: 5).
[0081] In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVrh.91.93 capsid comprising one or more of: (1) AAVrh.91.93 capsid proteins comprising: a heterogeneous population of AAVrh.91.93 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6, vp1 proteins produced from SEQ ID NO: 5, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 5 which encodes the predicted amino acid sequence of 1 to 733 of SEQ ID NO: 6, a heterogeneous population of AAVrh.91.93 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2199 of SEQ ID NO: 5, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, a heterogeneous population of AAVrh.91.93 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2199 of SEQ ID NO: 5, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2199 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 203 to 733 of SEQ ID NO: 6; and/or (2) a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 6, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 5, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 733 of SEQ ID NO: 6, wherein: the vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 6 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVrh.91.93 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product operably linked to sequences which direct expression of the product in a host cell.
[0082] In certain embodiments, an AAVrh.91.93 capsid comprises: a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 6, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 733 of SEQ ID NO: 6, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 733 of SEQ ID NO: 6.
[0083] In certain embodiments, the nucleic acid sequence encoding the AAVrh.91.93 vp1 capsid protein is provided in SEQ ID NO: 5. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 5 may be selected to express the AAVrh.91.93 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 5. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 6 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 5 or a sequence at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 5 which encodes SEQ ID NO: 6. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 5 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2199 of SEQ ID NO: 5 which encodes the vp2 capsid protein (about aa 138 to 733) of SEQ ID NO: 6. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2199 of SEQ ID NO: 5 or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99%, identical to nt 607 to about nt 2199 SEQ ID NO: 5 which encodes the vp3 capsid protein (about aa 203 to 733) of SEQ ID NO: 6.
[0084] The invention also encompasses nucleic acid sequences encoding mutant AAVrh.91.93, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant rAAVrh.91.93 capsids.
[0085] In certain embodiments, provided herein is a nucleic acid molecule having the sequence of SEQ ID NO: 1 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 1 which encodes the vp1 amino acid sequence of SEQ ID NO: 2 with a modification (e.g., deamidated amino acid) as described herein. In certain embodiments, provided herein is a nucleic acid molecule having the sequence of SEQ ID NO: 3 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 3 which encodes the vp1 amino acid sequence of SEQ ID NO: 4 with a modification (e.g., deamidated amino acid) as described herein. In certain embodiments, provided herein is a nucleic acid molecule having the sequence of SEQ ID NO: 5 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 5 which encodes the vp1 amino acid sequence of SEQ ID NO: 6 with a modification (e.g., deamidated amino acid) as described herein. In certain embodiments, a plasmid having a nucleic acid sequence described herein is provided.
[0086] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.
[0087] The term "percent (%) identity", "sequence identity", "percent sequence identity", or "percent identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
[0088] Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences. A suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids. Generally, when referring to "identity", "homology", or "similarity" between two different sequences, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
[0089] Identity may be determined by preparing an alignment of the sequences and through the use of a variety of algorithms and/or computer programs known in the art or commercially available [e.g., BLAST, ExPASy; ClustalO; FASTA; using, e.g., Needleman-Wunsch algorithm, Smith-Waterman algorithm]. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the "Clustal Omega" "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).
[0090] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include, "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "BLAST", "MAP", and "MEME", which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta.TM., a program in GCG Version 6.1. Fasta.TM. provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta.TM. with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
B. RAAV VECTORS AND COMPOSITIONS
[0091] In another aspect, described herein are molecules which utilize the AAV capsid sequences described herein, including fragments thereof, for production of viral vectors useful in delivery of a heterologous gene or other nucleic acid sequences to a target cell. In one embodiment, the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV capsid as described herein, e.g., an AAVrh.92, AAVrh.93, or AAVrh.91.93 capsid, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all an AAVrh.92, AAVrh.93, or AAVrh.91.93 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV which differs from the wild type AAV providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in U.S. Pat. No. 7,282,199, which is incorporated by reference herein. Optionally, the vectors further contain a minigene comprising a selected transgene which is flanked by AAV 5' ITR and AAV 3' ITR. In another embodiment, the AAV is a self-complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference). Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes. Because scAAV have no need to convert the single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) prior to expression, they are more efficient vectors. However, the trade-off for this efficiency is the loss of half the coding capacity of the vector, ScAAV are useful for small protein-coding genes (up to .about.55 kd) and any currently available RNA-based therapy.
[0092] Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful herein. For illustrative purposes, AAV vectors utilizing an AAVrh.92, AAVrh.93, or AAVrh.91.93 capsid as described herein, with AAV2 ITRs are used in the examples described below. See, Mussolino et al, cited above. Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein, may be individually selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In one desirable embodiment, the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
[0093] The rAAV described herein also comprise a vector genome. The vector genome is composed of, at a minimum, a non-AAV or heterologous nucleic acid sequence (the transgene), as described below, and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell.
[0094] The transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell. The heterologous nucleic acid sequence (transgene) can be derived from any organism. The AAV may comprise one or more transgenes.
[0095] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding erythropoietin (EPO). In certain embodiments, the transgene encodes a canine or feline EPO gene. Such recombinant vectors are suitable, for example, for use in a regimen for treating chronic kidney disease and other conditions in a subject characterized by a decrease in the amount of circulating red blood cells.
[0096] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding an anti-nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes a canine or feline anti-NGF antibody. Such recombinant vectors are suitable, for example, for use in a regimen for treating osteoarthritis pain in a subject.
[0097] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding an anti-nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes a canine or feline anti-NGF antibody. Such recombinant vectors are suitable, for example, for use in a regimen for treating osteoarthritis pain in a subject.
[0098] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes a canine or feline GLP-1. Such recombinant vectors are suitable, for example, for use in a regimen for treating type II diabetes in a subject.
[0099] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes a canine or feline GLP-1. Such recombinant vectors are suitable, for example, for use in a regimen for treating type II diabetes in a subject.
[0100] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding insulin. In certain embodiments, the transgene encodes a canine or feline insulin. Such recombinant vectors are suitable, for example, for use in a regimen for treating type I diabetes or type II diabetes in a subject.
[0101] In certain embodiments, provided herein is a AAVrh.92, AAVrh.93, or AAVrh.91.93 vector that includes a transgene comprising a sequence encoding an antagonist for IgE, IL-32, or the interleukin-4 receptor alpha (IL-4Ra) subunit of IL-4/IL-13 receptors, including, e.g., antibodies and receptor-IgG fusion proteins. In certain embodiments, the transgene encodes an antagonist for a canine or feline IgE, IL-32, or IL-4Ra subunit. Such recombinant vectors are suitable, for example, for use in a regimen for treating atopic dermatitis in a subject.
[0102] The composition of the transgene sequence will depend upon the use to which the resulting vector will be put. For example, one type of transgene sequence includes a reporter sequence, which upon expression produces a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding .beta.-lactamase, .beta.-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), enhanced GFP (EGFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
[0103] These coding sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
[0104] However, desirably, the transgene is a non-marker sequence encoding a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, dominant negative mutants, or catalytic RNAs. Desirable RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNAs, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNAs. One example of a useful RNA sequence is a sequence which inhibits or extinguishes expression of a targeted nucleic acid sequence in the treated animal. Typically, suitable target sequences include oncologic targets and viral diseases. See, for examples of such targets the oncologic targets and viruses identified below in the section relating to immunogens.
[0105] The transgene may be used to correct or ameliorate gene deficiencies, which may include deficiencies in which normal genes are expressed at less than normal levels or deficiencies in which the functional gene product is not expressed. Alternatively, the transgene may provide a product to a cell which is not natively expressed in the cell type or in the host. A preferred type of transgene sequence encodes a therapeutic protein or polypeptide which is expressed in a host cell. The invention further includes using multiple transgenes. In certain situations, a different transgene may be used to encode each subunit of a protein, or to encode different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunit is large, e.g., for an immunoglobulin, the platelet-derived growth factor, or a dystrophin protein. In order for the cell to produce the multi-subunit protein, a cell is infected with the recombinant virus containing each of the different subunits. Alternatively, different subunits of a protein may be encoded by the same transgene. In this case, a single transgene includes the DNA encoding each of the subunits, with the DNA for each subunit separated by an internal ribozyme entry site (IRES). This is desirable when the size of the DNA encoding each of the subunits is small, e.g., the total size of the DNA encoding the subunits and the IRES is less than five kilobases. As an alternative to an IRES, the DNA may be separated by sequences encoding a 2A peptide, which self-cleaves in a post-translational event. See, e.g., M. L. Donnelly, et al, J. Gen. Virol., 78(Pt 1):13-21 (January 1997); Furler, S., et al, Gene Ther., 8(11):864-873 (June 2001); Klump H., et al., Gene Ther., 8(10):811-817 (May 2001). This 2A peptide is significantly smaller than an IRES, making it well suited for use when space is a limiting factor. More often, when the transgene is large, consists of multi-subunits, or two transgenes are co-delivered, rAAV carrying the desired transgene(s) or subunits are co-administered to allow them to concatamerize in vivo to form a single vector genome. In such an embodiment, a first AAV may carry an expression cassette which expresses a single transgene and a second AAV may carry an expression cassette which expresses a different transgene for co-expression in the host cell. However, the selected transgene may encode any biologically active product or other product, e.g., a product desirable for study.
[0106] Examples of suitable transgenes or gene products include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases. Examples of such rare disease may include spinal muscular atrophy (SMA), Huntingdon's Disease, Rett Syndrome (e.g., methyl-CpG-binding protein 2 (MeCP2); UniProtKB-P51608), Amyotrophic Lateral Sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia (e.g., frataxin), ATXN2 associated with spinocerebellar ataxia type 2 (SCA2)/ALS; TDP-43 associated with ALS, progranulin (PRGN) (associated with non-Alzheimer's cerebral degenerations, including, frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA) and semantic dementia), among others. See, e.g., www.orpha.net/consor/cgi-bin/Disease_Search_List.php; rarediseases.info.nih.gov/diseases.
[0107] Useful therapeutic products encoded by the transgene include hormones and growth and differentiation factors including, without limitation, insulin, glucagon, glucagon-like peptide 1 (GLP-1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor .alpha. (TGF.alpha.), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one of the transforming growth factor .beta. superfamily, including TGF .beta., activins, inhibins, or any of the bone morphogenic proteins (BMP) BMPs 1-15, any one of the heregluin/neuregulin/ARIA/neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell line derived neurotrophic factor (GDNF), neurturin, agrin, any one of the family of semaphorins/collapsins, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydroxylase.
[0108] Other useful transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-25 (including, IL-2, IL-4, IL-12, and IL-18), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors .alpha. and .beta., interferons .alpha., .beta., and .gamma., stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2 and CD59.
[0109] Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The invention encompasses receptors for cholesterol regulation, including the low density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low density lipoprotein (VLDL) receptor, and the scavenger receptor. The invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.
[0110] Other useful gene products include, carbamoyl synthetase I, ornithine transcarbamylase, arginosuccinate synthetase, arginosuccinate lyase, arginase, fumarylacetacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, factor VIII, factor IX, cystathione beta-synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, a cystic fibrosis transmembrane regulator (CFTR) sequence, and a dystrophin sequence or functional fragment thereof. Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme. For example, enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encodes .beta.-glucuronidase (GUSB)). In another example, the gene product is ubiquitin protein ligase E3A (UBE3A). Still useful gene products include UDP Glucuronosyltransferase Family 1 Member A1 (UGT1A1).
[0111] Other useful gene products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions or amino acid substitutions. For example, single-chain engineered immunoglobulins could be useful in certain immunocompromised patients. Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a target.
[0112] Reduction and/or modulation of expression of a gene is particularly desirable for treatment of hyperproliferative conditions characterized by hyperproliferating cells, as are cancers and psoriasis. Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1A and folate binding polypeptides.
[0113] Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce self-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by T cell receptors (TCRs) that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases.
[0114] Still other useful gene products include those used for treatment of hemophilia, including hemophilia B (including Factor IX) and hemophilia A (including Factor VIII and its variants, such as the light chain and heavy chain of the heterodimer and the B-deleted domain; U.S. Pat. Nos. 6,200,560 and 6,221,349). In some embodiments, the minigene comprises first 57 base pairs of the Factor VIII heavy chain which encodes the 10 amino acid signal sequence, as well as the human growth hormone (hGH) polyadenylation sequence. In alternative embodiments, the minigene further comprises the A1 and A2 domains, as well as 5 amino acids from the N-terminus of the B domain, and/or 85 amino acids of the C-terminus of the B domain, as well as the A3, C1 and C2 domains. In yet other embodiments, the nucleic acids encoding Factor VIII heavy chain and light chain are provided in a single minigene separated by 42 nucleic acids coding for 14 amino acids of the B domain [U.S. Pat. No. 6,200,560].
[0115] Further illustrative genes which may be delivered via the rAAV include, without limitation, glucose-6-phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin-dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodevelopmental impairment; galactose-1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxyacid Oxidase 1 (GO/HAO1) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH, BCKDH-E2, BAKDH-E1a, and BAKDH-E1b, associated with Maple syrup urine disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; medium chain acyl CoA dehydrogenase, associated with medium chain acetyl CoA deficiency; ornithine transcarbamylase (OTC), associated with ornithine transcarbamylase deficiency; argininosuccinic acid synthetase (ASS1), associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; amethylmalonic acidemia (MMA); NPC1 associated with Niemann-Pick disease, type C1); propionic academia (PA); TTR associated with Transthyretin (TTR)-related Hereditary Amyloidosis; low density lipoprotein receptor (LDLR) protein, associated with familial hypercholesterolemia (FH), LDLR variant, such as those described in WO 2015/164778; PCSK9; ApoE and ApoC proteins, associated with dementia; UDP-glucouronosyltransferase, associated with Crigler-Najjar disease; adenosine deaminase, associated with severe combined immunodeficiency disease; hypoxanthine guanine phosphoribosyl transferase, associated with Gout and Lesch-Nyan syndrome; biotimidase, associated with biotimidase deficiency; alpha-galactosidase A (a-Gal A) associated with Fabry disease); beta-galactosidase (GLB1) associated with GM1 gangliosidosis; ATP7B associated with Wilson's Disease; beta-glucocerebrosidase, associated with Gaucher disease type 2 and 3; peroxisome membrane protein 70 kDa, associated with Zellweger syndrome; arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, galactocerebrosidase (GALC) enzyme associated with Krabbe disease, alpha-glucosidase (GAA) associated with Pompe disease; sphingomyelinase (SMPD1) gene associated with Nieman Pick disease type A; argininosuccsinate synthase associated with adult onset type II citrullinemia (CTLN2); carbamoyl-phosphate synthase 1 (CPS1) associated with urea cycle disorders; survival motor neuron (SMN) protein, associated with spinal muscular atrophy; ceramidase associated with Farber lipogranulomatosis; b-hexosaminidase associated with GM2 gangliosidosis and Tay-Sachs and Sandhoff diseases; aspartylglucosaminidase associated with aspartyl-glucosaminuria; .alpha.-fucosidase associated with fucosidosis; .alpha.-mannosidase associated with alpha-mannosidosis; porphobilinogen deaminase, associated with acute intermittent porphyria (AIP); alpha-1 antitrypsin for treatment of alpha-1 antitrypsin deficiency (emphysema); erythropoietin for treatment of anemia due to thalassemia or to renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor pathway inhibitor for the treatment of occluded blood vessels as seen in, for example, atherosclerosis, thrombosis, or embolisms; aromatic amino acid decarboxylase (AADC), and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; the beta adrenergic receptor, anti-sense to, or a mutant form of, phospholamban, the sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2), and the cardiac adenylyl cyclase for the treatment of congestive heart failure; a tumor suppressor gene such as p53 for the treatment of various cancers; a cytokine such as one of the various interleukins for the treatment of inflammatory and immune disorders and cancers; dystrophin or minidystrophin and utrophin or miniutrophin for the treatment of muscular dystrophies; and, insulin or GLP-1 for the treatment of diabetes.
[0116] Alternatively, or in addition, the vectors of the invention may contain AAV sequences of the invention and a transgene encoding a peptide, polypeptide or protein which induces an immune response to a selected immunogen. For example, immunogens may be selected from a variety of viral families. Example of desirable viral families against which an immune response would be desirable include, the picornavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera enteroviruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera apthoviruses, which are responsible for foot and mouth diseases, primarily in non-human animals. Within the picornavirus family of viruses, target antigens include the VP1, VP2, VP3, VP4, and VPG. Another viral family includes the calcivirus family, which encompasses the Norwalk group of viruses, which are an important causative agent of epidemic gastroenteritis. Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus. The flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick borne encephalitis viruses. Other target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non-A, B or C hepatitis. Within the coronavirus family, target antigens include the E1 (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin-elterose) glycoprotein (not present in all coronaviruses), or N (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the N protein. The family filoviridae, which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens. The paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus. The influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the N1 protein). The bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses. The arenavirus family provides a source of antigens against LCM and Lassa fever virus. The reovirus family includes the genera reovirus, rotavirus (which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado Tick fever, Lebombo (humans), equine encephalosis, blue tongue).
[0117] The retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLVII, lentivirinal (which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal). Between the HIV and SIV, many suitable antigens have been described and can readily be selected. Examples of suitable HIV and SIV antigens include, without limitation the gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, as well as various fragments thereof. In addition, a variety of modifications to these antigens have been described. Suitable antigens for this purpose are known to those of skill in the art. For example, one may select a sequence encoding the gag, pol, Vif, and Vpr, Env, Tat and Rev, amongst other proteins. See, e.g., the modified gag protein which is described in U.S. Pat. No. 5,972,596. See, also, the HIV and SIV proteins described in D. H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R. R. Amara, et al, Science, 292:69-74 (6 Apr. 2001). These proteins or subunits thereof may be delivered alone, or in combination via separate vectors or from a single vector.
[0118] The papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma). The adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis. The parvovirus family feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The herpesvirus family includes the sub-family alphaherpesvirinae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesvirinae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesvirinae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus. The poxvirus family includes the sub-family chordopoxvirinae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxvirinae. The hepadnavirus family includes the Hepatitis B virus. One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus. Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The alphavirus family includes equine arteritis virus and various Encephalitis viruses.
[0119] The present invention may also encompass immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell. Examples of bacterial pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci. Pathogenic gram-negative cocci include meningococcus; gonococcus. Pathogenic enteric gram-negative bacilli include enterobacteriaceae; Pseudomonas, acinetobacteria and Eikenella; melioidosis; Salmonella; Shigella; Haemophilus; Moraxella; H. ducreyi (which causes chancroid); brucella; Franisella tularensis (which causes tularemia); Yersinia (Pasteurella); Streptobacillus moniliformis and spirillum; Gram-positive bacilli include Listeria monocytogenes; Erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B. anthraces (anthrax); donovanosis (Granuloma inguinale); and bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis. Other infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis. Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox. Examples of mycoplasma and chlamydial infections include: Mycoplasma pneumoniae; Lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
[0120] Many of these organisms and/or toxins produced thereby have been identified by the Centers for Disease Control [(CDC), Department of Health and Human Services, USA], as agents which have potential for use in biological attacks. For example, some of these biological agents, include, Bacillus anthraces (anthrax), Clostridium botulinum and its toxin (botulism), Yersinia pestis (plague), variola major (smallpox), Francisella tularensis (tularemia), and viral hemorrhagic fever, all of which are currently classified as Category A agents; Coxiella burnetti (Q fever); Brucella species (brucellosis), Burkholderia mallei (glanders), Ricinus communis and its toxin (ricin toxin), Clostridium perfringens and its toxin (epsilon toxin), Staphylococcus species and their toxins (enterotoxin B), all of which are currently classified as Category B agents; and Nipan virus and hantaviruses, which are currently classified as Category C agents. In addition, other organisms, which are so classified or differently classified, may be identified and/or used for such a purpose in the future. It will be readily understood that the viral vectors and other constructs described herein are useful to deliver antigens from these organisms, viruses, their toxins or other by-products, which will prevent and/or treat infection or other adverse reactions with these biological agents.
[0121] Administration of the vectors of the invention to deliver immunogens against the variable region of the T cells elicit an immune response including CTLs to eliminate those T cells. In rheumatoid arthritis (RA), several specific variable regions of T cell receptors (TCRs) which are involved in the disease have been characterized. These TCRs include V-3, V-14, V-17 and V.alpha.-17. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in RA. In multiple sclerosis (MS), several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-7 and V.alpha.-10. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in MS. In scleroderma, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-6, V-8, V-14 and V.alpha.-16, V.alpha.-3C, V.alpha.-7, V.alpha.-14, V.alpha.-15, V.alpha.-16, V.alpha.-28 and V.alpha.-12. Thus, delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.
[0122] In one embodiment, the transgene is selected to provide optogenetic therapy. In optogenetic therapy, artificial photoreceptors are constructed by gene delivery of light-activated channels or pumps to surviving cell types in the remaining retinal circuit. This is particularly useful for patients who have lost a significant amount of photoreceptor function, but whose bipolar cell circuitry to ganglion cells and optic nerve remains intact. In one embodiment, the heterologous nucleic acid sequence (transgene) is an opsin. The opsin sequence can be derived from any suitable single- or multicellular-organism, including human, algae and bacteria. In one embodiment, the opsin is rhodopsin, photopsin, L/M wavelength (red/green)-opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.
[0123] In another embodiment, the transgene is selected for use in gene augmentation therapy, i.e., to provide replacement copy of a gene that is missing or defective. In this embodiment, the transgene may be readily selected by one of skill in the art to provide the necessary replacement gene. In one embodiment, the missing/defective gene is related to an ocular disorder. In another embodiment, the transgene is NYX, GRM6, TRPM1L or GPR179 and the ocular disorder is Congenital Stationary Night Blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan. 10; 92(1):67-75. Epub 2012 Dec. 13 which is incorporated herein by reference. In another embodiment, the transgene is RPGR.
[0124] In another embodiment, the transgene is selected for use in gene suppression therapy, i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels. This can be accomplished using short hairpin RNA (shRNA) or other techniques well known in the art. See, e.g., Sun et al, Int J Cancer. 2010 Feb. 1; 126(3):764-74 and O'Reilly M, et al. Am J Hum Genet. 2007 July; 81(1):127-35, which are incorporated herein by reference. In this embodiment, the transgene may be readily selected by one of skill in the art based upon the gene which is desired to be silenced.
[0125] In another embodiment, the transgene comprises more than one transgene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more AAV each carrying one or more heterologous sequences. In one embodiment, the AAV is used for gene suppression (or knockdown) and gene augmentation co-therapy. In knockdown/augmentation co-therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is accomplished using two or more co-administered vectors. See, Millington-Ward et al, Molecular Therapy, April 2011, 19(4):642-649 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
[0126] In another embodiment, the transgene is selected for use in gene correction therapy. This may be accomplished using, e.g., a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. See, e.g., Ellis et al, Gene Therapy (epub January 2012) 20:35-42 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
[0127] In one embodiment, the capsids described herein are useful in the CRISPR-Cas dual vector system described in U.S. Provisional Patent Application Nos. 61/153,470, 62/183,825, 62/254,225 and 62/287,511, each of which is incorporated herein by reference. The capsids are also useful for delivery homing endonucleases or other meganucleases.
[0128] In another embodiment, the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding .beta.-lactamase, .beta.-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
[0129] These coding sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
[0130] Desirably, the transgene encodes a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, or catalytic RNAs. Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs. One example of a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in the treated animal.
[0131] The regulatory sequences include conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
[0132] Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters, are known in the art and may be utilized.
[0133] The regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/enhancer sequence and the gene. One desirable intron sequence is derived from SV-40, and is a 100 bp mini-intron splice donor/splice acceptor referred to as SD-SA. Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910). PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
[0134] Another regulatory component of the rAAV useful in the methods described herein is an internal ribosome entry site (IRES). An IRES sequence, or other suitable systems, may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell. An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells. Preferably, the IRES is located 3' to the transgene in the rAAV vector.
[0135] In one embodiment, the AAV comprises a promoter (or a functional fragment of a promoter). The selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell. In one embodiment, the target cell is an ocular cell. The promoter may be derived from any species, including human. Desirably, in one embodiment, the promoter is "cell specific". The term "cell-specific" means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell tissue. In one embodiment, the promoter is specific for expression of the transgene in muscle cells. In another embodiment, the promoter is specific for expression in lung. In another embodiment, the promoter is specific for expression of the transgene in liver cells. In another embodiment, the promoter is specific for expression of the transgene in airway epithelium. In another embodiment, the promoter is specific for expression of the transgene in neurons. In another embodiment, the promoter is specific for expression of the transgene in heart.
[0136] The expression cassette typically contains a promoter sequence as part of the expression control sequences, e.g., located between the selected 5' ITR sequence and the immunoglobulin construct coding sequence. In one embodiment, expression in liver is desirable. Thus, in one embodiment, a liver-specific promoter is used. Tissue specific promoters, constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In another embodiment, expression in muscle is desirable. Thus, in one embodiment, a muscle-specific promoter is used. In one embodiment, the promoter is an MCK based promoter, such as the dMCK (509-bp) or tMCK (720-bp) promoters (see, e.g., Wang et al, Gene Ther. 2008 November; 15(22):1489-99. doi: 10.1038/gt.2008.104. Epub 2008 Jun. 19, which is incorporated herein by reference). Another useful promoter is the SPcS-12 promoter (see Rasowo et al, European Scientific Journal June 2014 edition vol. 10, No. 18, which is incorporated herein by reference). In one embodiment, the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 or CAG promoter is used. CB7 is a chicken .beta.-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liver-specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu/LSPD, alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J. Virol., 71:5124 32 (1997), humAlb; and hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002 9 (1996)]. TTR minimal enhancer/promoter, alpha-antitrypsin promoter, LSP (845 nt)25 (requires intron-less scAAV).
[0137] The promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
[0138] The expression cassette may contain at least one enhancer, i.e., CMV enhancer. Still other enhancer elements may include, e.g., an apolipoprotein enhancer, a zebrafish enhancer, a GFAP enhancer element, and brain specific enhancers such as described in WO 2013/1555222, woodchuck post hepatitis post-transcriptional regulatory element. Additionally, or alternatively, other, e.g., the hybrid human cytomegalovirus (HCMV)-immediate early (IE)-PDGR promoter or other promoter-enhancer elements may be selected. Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 December; 9(12):1015-23), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
[0139] In addition to a promoter, an expression cassette and/or a vector may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A variety of suitable polyA are known. In one example, the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank #V00882.1). In other embodiments, an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected. In certain embodiments, an intron is included. One suitable intron is a chicken beta-actin intron. In one embodiment, the intron is 875 bp (GenBank #X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected. In one embodiment, spacers are included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, spacers are included such that the vector genome is approximately 4.7 kb. See, Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 January; 18(1): 80-86, which is incorporated herein by reference.
[0140] Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and expression control sequences will function equally well to express all of the transgenes as described herein. However, one of skill in the art may make a selection among these, and other, expression control sequences without departing from the scope of this invention.
[0141] In certain embodiments, the expression cassette contains at least one miRNA target sequence that is a miR-183 target sequence. In certain embodiments, the vector genome or expression cassette contains an miR-183 target sequence that includes AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 13), where the sequence complementary to the miR-183 seed sequence is underlined. In certain embodiments, the vector genome or expression cassette contains more than one copy (e.g. two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, a miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, a miR-183 target sequence contains a sequence with partial complementarity to SEQ ID NO: 13 and, thus, when aligned to SEQ ID NO: 13, there are one or more mismatches. In certain embodiments, a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 13, where the mismatches may be non-contiguous. In certain embodiments, a miR-183 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity includes a sequence with 100% complementarity to the miR-183 seed sequence. In certain embodiments, the remainder of a miR-183 target sequence has at least about 80% to about 99% complementarity to miR-183. In certain embodiments, the expression cassette or vector genome includes a miR-183 target sequence that comprises a truncated SEQ ID NO: 13, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5' or 3' ends of SEQ ID NO: 13. In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-183 target sequence. In yet other embodiments, the expression cassette or vector genome comprises at least two, three or four miR-183 target sequences.
[0142] In certain embodiments, the expression cassette contains at least one miRNA target sequence that is a miR-182 target sequence. In certain embodiments, the vector genome or expression cassette contains an miR-182 target sequence that includes AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 14). In certain embodiments, the vector genome or expression cassette contains more than one copy (e.g. two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, a miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, a miR-182 target sequence contains a sequence with partial complementarity to SEQ ID NO: 14 and, thus, when aligned to SEQ ID NO: 14, there are one or more mismatches. In certain embodiments, a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 14, where the mismatches may be non-contiguous. In certain embodiments, a miR-182 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity includes a sequence with 100% complementarity to the miR-182 seed sequence. In certain embodiments, the remainder of a miR-182 target sequence has at least about 80% to about 99% complementarity to miR-182. In certain embodiments, the expression cassette or vector genome includes a miR-182 target sequence that comprises a truncated SEQ ID NO: 14, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5' or 3' ends of SEQ ID NO: 14. In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-182 target sequence. In yet other embodiments, the expression cassette or vector genome comprises at least two, three or four miR-182 target sequences.
[0143] The term "tandem repeats" is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be continuous, i.e., located directly after one another such that the 3' end of one is directly upstream of the 5' end of the next with no intervening sequences, or vice versa. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.
[0144] As used herein, as "spacer" is any selected nucleic acid sequence, e.g., of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length which is located between two or more consecutive miRNA target sequences. In certain embodiments, the spacer is 1 to 8 nucleotides in length, 2 to 7 nucleotides in length, 3 to 6 nucleotides in length, four nucleotides in length, 4 to 9 nucleotides, 3 to 7 nucleotides, or values which are longer. Suitably, a spacer is a non-coding sequence. In certain embodiments, the spacer may be of four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.
[0145] In certain embodiments, the tandem repeats contain two, three, four or more of the same miRNA target sequence. In certain embodiments, the tandem repeats contain at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeats may contain two or three of the same miRNA target sequence and a fourth miRNA target sequence which is different.
[0146] In certain embodiments, there may be at least two different sets of tandem repeats in the expression cassette. For example, a 3' UTR may contain a tandem repeat immediately downstream of the transgene, UTR sequences, and two or more tandem repeats closer to the 3' end of the UTR. In another example, the 5' UTR may contain one, two or more miRNA target sequences. In another example the 3' may contain tandem repeats and the 5' UTR may contain at least one miRNA target sequence.
[0147] In certain embodiments, the expression cassette contains two, three, four or more tandem repeats which start within about 0 to 20 nucleotides of the stop codon for the transgene. In other embodiments, the expression cassette contains the miRNA tandem repeats at least 100 to about 4000 nucleotides from the stop codon for the transgene.
[0148] See, PCT/US19/67872, filed Dec. 20, 2019, which is incorporated by reference herein and which claims priority to US Provisional U.S. Patent Application No. 62/783,956, filed Dec. 21, 2018, which is hereby incorporated by reference.
[0149] In another embodiment, a method of generating a recombinant adeno-associated virus is provided. A suitable recombinant adeno-associated virus (AAV) is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein as described herein, or fragment thereof; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a heterologous nucleic acid sequence encoding a desirable transgene; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
[0150] Also provided herein are host cells transfected with an AAV as described herein. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art. In another embodiment, the host cell comprises a nucleic acid molecule as described herein.
[0151] The minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV described herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, 1993 J. Virol., 70:520-532 and U.S. Pat. No. 5,478,745, among others. These publications are incorporated by reference herein.
[0152] Also provided herein, are plasmids for use in producing the vectors described herein. Such plasmids are described in the Examples section.
C. PHARMACEUTICAL COMPOSITIONS AND ADMINISTRATION
[0153] In one embodiment, the recombinant AAV containing the desired transgene and promoter for use in the target cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for administration to a subject in need thereof. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in U.S. Pat. No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid). The vector is formulated in a buffer/carrier suitable for infusion in human subjects. The buffer/carrier should include a component that prevents the rAAV from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
[0154] In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered to the subject intramuscularly (IM). In other embodiments, the pharmaceutical composition is administered by intravenously (IV). In other embodiments, the pharmaceutical composition is administered by intracerebroventricular (ICV) injection. In other embodiments, the pharmaceutical composition is administered by intra-cisterna magna (ICM) injection. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
[0155] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of administration via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital/intracisternal, and/or C1-2 puncture. For example, material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture. In another example, injection may be into the cisterna magna.
[0156] As used herein, the terms "intracisternal delivery" or "intracisternal administration" refer to a route of administration directly into the cerebrospinal fluid of the cisterna magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cisterna magna or via permanently positioned tube.
[0157] The composition may be delivered in a volume of from about 0.1 .mu.L to about 10 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 .mu.L. In another embodiment, the volume is about 70 .mu.L. In another embodiment, the volume is about 100 .mu.L. In another embodiment, the volume is about 125 .mu.L. In another embodiment, the volume is about 150 .mu.L. In another embodiment, the volume is about 175 .mu.L. In yet another embodiment, the volume is about 200 .mu.L. In another embodiment, the volume is about 250 .mu.L. In another embodiment, the volume is about 300 .mu.L. In another embodiment, the volume is about 450 .mu.L. In another embodiment, the volume is about 500 .mu.L. In another embodiment, the volume is about 600 .mu.L. In another embodiment, the volume is about 750 .mu.L. In another embodiment, the volume is about 850 .mu.L. In another embodiment, the volume is about 1000 .mu.L. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.
[0158] An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the regulatory sequences desirably ranges from about 10.sup.7 and 10.sup.14 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)). In one embodiment, the rAAV vector genomes are measured by real-time PCR. In another embodiment, the rAAV vector genomes are measured by digital PCR. See, Lock et al, Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 April; 25(2):115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb. 14, which are incorporated herein by reference. In another embodiment, the rAAV infectious units are measured as described in S. K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference.
[0159] Preferably, the concentration is from about 1.5.times.10.sup.9 vg/mL to about 1.5.times.10.sup.13 vg/mL, and more preferably from about 1.5.times.10.sup.9 vg/mL to about 1.5.times.10.sup.11 vg/mL. In one embodiment, the effective concentration is about 1.4.times.10.sup.8 vg/mL. In one embodiment, the effective concentration is about 3.5.times.10.sup.10 vg/mL. In another embodiment, the effective concentration is about 5.6.times.10.sup.11 vg/mL. In another embodiment, the effective concentration is about 5.3.times.10.sup.12 vg/mL. In yet another embodiment, the effective concentration is about 1.5.times.10.sup.12 vg/mL. In another embodiment, the effective concentration is about 1.5.times.10.sup.13 vg/mL. All ranges described herein are inclusive of the endpoints.
[0160] In one embodiment, the dosage is from about 1.5.times.10.sup.9 vg/kg of body weight to about 1.5.times.10.sup.13 vg/kg, and more preferably from about 1.5.times.10.sup.9 vg/kg to about 1.5.times.10.sup.11 vg/kg. In one embodiment, the dosage is about 1.4.times.10.sup.8 vg/kg. In one embodiment, the dosage is about 3.5.times.10.sup.10 vg/kg. In another embodiment, the dosage is about 5.6.times.10.sup.11 vg/kg. In another embodiment, the dosage is about 5.3.times.10.sup.12 vg/kg. In yet another embodiment, the dosage is about 1.5.times.10.sup.12 vg/kg. In another embodiment, the dosage is about 1.5.times.10.sup.13 vg/kg. In another embodiment, the dosage is about 3.0.times.10.sup.13 vg/kg. In another embodiment, the dosage is about 1.0.times.10.sup.14 vg/kg. All ranges described herein are inclusive of the endpoints.
[0161] In one embodiment, the effective dosage (total genome copies delivered) is from about 10' to 10.sup.13 vector genomes. In one embodiment, the total dosage is about 10.sup.8 genome copies. In one embodiment, the total dosage is about 10.sup.9 genome copies. In one embodiment, the total dosage is about 10.sup.10 genome copies. In one embodiment, the total dosage is about 10.sup.11 genome copies. In one embodiment, the total dosage is about 10.sup.12 genome copies. In one embodiment, the total dosage is about 10.sup.13 genome copies. In one embodiment, the total dosage is about 10.sup.14 genome copies. In one embodiment, the total dosage is about 10.sup.15 genome copies.
[0162] It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular disorder and the degree to which the disorder, if progressive, has developed. Intravenous delivery, for example may require doses on the order of 1.5.times.10.sup.13 vg/kg.
D. METHODS
[0163] In another aspect, a method of transducing a target tissue is provided. In one embodiment, the method includes administering an AAV having an AAVrh.92, AAVrh.93, or AAVrh.91.93 capsid as described herein. As shown in the examples below, the inventors have shown that the AAV termed AAVrh.92 effectively transduces CNS (brain). Therefore, provided herein is a method of transducing brain comprising administering an rAAV having the AAVrh.92 capsid. In one embodiment, intravenous administration is employed. In another embodiment, ICV administration is employed. In yet another embodiment, ICM administration is employed.
[0164] Also provided herein is a method of delivering a transgene to a brain cell. The method includes contacting the cell with an rAAV having the AAVrh.92 capsid, wherein said rAAV comprises the transgene. In another aspect, the use of an rAAV having the AAVrh.92 capsid is provided for delivering a transgene to brain. In one embodiment, the rAAV is delivered using ICM delivery.
[0165] Single Genome Amplification
[0166] AAV genomes have been traditionally isolated from within whole mammalian genomic DNA using PCR based methods: primers are used to detect conserved regions that flank the majority of the diverse VP1 (capsid) gene. The PCR products are then cloned into plasmid backbones and individual clones are sequenced using the Sanger method. Traditional PCR and molecular cloning based viral isolation methods are effective for recovering novel AAV genomes but the genomes recovered can be influenced by PCR-mediated recombination and polymerase errors. In addition, currently available next-generation sequencing technologies have allowed us to sequence viral genomes with unparalleled accuracy compared to the previously used Sanger technology. Provided herein is a novel, higher-throughput, PCR and next-generation sequencing based method of accurately isolating individual AAV genomes from within a viral population. This method, AAV-Single Genome Amplification (AAV-SGA), can be used to improve our knowledge of AAV diversity within mammalian hosts. Moreover, it has allowed us to identify novel capsids for use as vectors for gene therapy.
[0167] AAV-SGA has been validated and optimized to effectively recover individual AAV sequences from samples that contain a population of genomes. This technique has been previously used to isolate single HIV and HCV genomes from within human and nonhuman primate hosts. The genomic DNA samples that screen positive for AAV by capsid detection PCR are endpoint-diluted. The dilution at which PCR amplification yields less than 30% positive reactions, according to a Poisson distribution, with 80% confidence, contains a single amplifiable AAV genome. This procedure allows for the PCR amplification of viral genomes with a reduced chance of PCR-mediated recombination caused by template switching of the polymerase. The AAV-SGA PCR amplicons are sequenced using the Illumina MiSeq platform using 2.times.150 or 2.times.250 paired-end sequencing. This method allows for accurate de novo assembly of full length AAV VP1 sequences without concern of convergence of sequencing reads from a single sample containing multiple viruses that have regions of high homology.
[0168] The AAV-SGA technique has been successful for isolation of multiple novel AAV capsid sequences from rhesus macaque tissues. Interestingly, multiple viruses from different clades of AAV have been identified from single samples; this demonstrates that a population of AAVs can exist in the host tissues. For example, capsids with sequence similarity to clades D, E, and the outlying "fringe" viruses were isolated from a single liver tissue sample.
[0169] While SGA had been previously applied to isolate other viruses, the application to AAV discovery is novel. It addresses the template switching and polymerase error issues which can result in invalid AAV genome sequences. Additionally, the quality of the isolated genome is self-evident when the same sequence is recovered repeated from the same host sample as single isolates.
[0170] The following Examples are provided to illustrate various embodiments of the present invention. The Examples are not intended to limit the invention in any way.
E. EXAMPLES
Example 1: Materials and Methods
Detection and Isolation of AAV Sequences
Nonhuman Primate Tissue Sources
[0171] Rhesus macaques from the University of Pennsylvania colony were captive-bred and were of Chinese or Indian origin. Liver tissue samples of rhesus macaques were kindly provided by Gene Therapy Program and the laboratory of Timothy H. Lucas, University of Pennsylvania.
Novel AAV Isolation
[0172] Genomic DNA was extracted (QIAmp DNA Mini Kit, QIAGEN) and analyzed for the presence of AAV DNA by using a PCR strategy to amplify a 3.1-kb full-length Cap fragment from NHP liver tissue specimens. A 5' primer within a conserved region of the AAV Rep gene was used (AV1NS, 5'-GCTGCGTCAACTGGACCAATGAGAAC-3') (SEQ ID NO: 9) in combination with a 3' primer located in a conserved region downstream of the AAV Cap gene (AV2CAS, 5'-CGCAGAGACCAAAGTTCAACTGAAACGA-3') (SEQ ID NO: 10) for amplification of full-length AAV Cap amplicons. Q5 High-Fidelity Hot Start DNA Polymerase (New England Biolabs) was used to amplify AAV DNA using the following cycling conditions: 98.degree. C. for 30 s; 98.degree. C. for 10 s, 59.degree. C. for 10 s, 72.degree. C. for 93 s, 50 cycles; and a 72.degree. C. extension for 120 s.
[0173] Template genomic DNA samples that resulted in a positive PCR reaction were subjected to AAV-Single Genome Amplification (AAV-SGA). Genomic DNA was endpoint diluted in 96-well plates such that fewer than 29 PCR reactions, using the same primers mentioned above, out of 96 yielded an amplification product. According to a Poisson distribution, the DNA dilution that yields PCR products in no more than 30% of wells contains one amplifiable AAV DNA template per positive PCR more than 80% of the time. AAV DNA amplicons from positive PCR reactions was sequenced using the Illumina MiSeq 2.times.150 or 2.times.250 paired end sequencing platforms and resulting reads were de novo assembled using the SPAdes assembler (cab.spbu.ru/software/spades/). Sequence analysis was performed using NCBI BLASTn (blast.ncbi.nlm.nih.gov/) and the Vector NTI AlignX software (Thermo Fisher).
Vector Production Using Novel AAV Capsids
[0174] AAV capsid gene DNA sequences from PCR products of interest were TOPO-cloned and amplified (Invitrogen). Amplified capsid genes were further cloned into AAV transplasmid backbones containing the AAV2 Rep gene and other associated plasmid elements.
[0175] AAV vectors were produced and titrated by the Penn Vector Core as described before (see, e.g., Lock, M., et al. (2010) Hum. Gene Ther. 21:1259-71). HEK293 cells were triple transfected then the cell culture supernatant was harvested, concentrated, and purified with an iodixanol gradient. The purified vectors were titrated with droplet digital PCR using primers targeting the rabbit beta-globin polyA sequence as described before (see, e.g., Lock, M., et al. (2014) Hum. Gene Ther. Methods 25:115-125).
In Vivo Characterization of Novel AAV Capsids in Rodents
Animals
[0176] All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. C56BL/6J mice were purchased from the Jackson Laboratory. For GFP reporter gene experiments, adult (6-8 weeks old) males were injected. Animals were housed in standard caging of two to five animals per cage. Cages, water bottles, and bedding substrates were autoclaved in the barrier facility, and cages were changed once per week. An automatically controlled 12-h light or dark cycle was maintained. Each dark period began at 7:00 p.m. (.+-.30 min). Irradiated laboratory rodent food was provided ad libitum.
Test Articles and Study Design
[0177] Mice received 1.times.10.sup.12 GC per mouse of each vector in 0.1 mL intravenously (IV) via the lateral tail vein or were injected intracerebroventricularly (ICV) into the lateral ventricle of the brain at a dose of 1.times.10.sup.11 GC in 5 uL per mouse. Three or five mice were dosed for each group.
[0178] Mice were euthanized by inhalation of CO.sub.214 days post injection. Tissues were collected, snap-frozen on dry ice for biodistribution analysis or were immersion-fixed in 10% neutral formalin, cryo-preserved in sucrose, frozen in OCT, and sectioned with a cryostat for GFP direct observation. Tissues used for endothelial cell transduction analysis were paraffin-embedded after necropsy.
Vector Biodistribution
[0179] Tissue genomic DNA was extracted with QIAamp DNA Mini Kit (QIAGEN), and AAV vector genomes were quantified by real-time PCR using Taqman reagents (Applied Biosystems, Life Technologies) with primers/probe targeting the EGFP sequence of the vectors.
Reporter Gene Visualization
[0180] To observe direct GFP fluorescence, tissue samples were fixed in formalin for about 24 hours, briefly washed in PBS, equilibrated sequentially in 15% and 30% sucrose in PBS until they reached maximum density, and were then frozen in OCT embedding medium for the preparation of cryosections. Sections were mounted in Fluoromount G containing DAPI (Electron Microscopy Sciences, Hatfield, Pa.) as nuclear counterstain.
[0181] GFP immunohistochemistry was performed on paraffin-embedded tissue samples. Sections were deparaffinized with ethanol and xylene, boiled for 6 min in 10 mM citrate buffer (pH 6.0) for antigen retrieval, treated sequentially with 2% H.sub.2O.sub.2 for 15 min, avidin/biotin blocking reagents for 15 min each (Vector Laboratories), and blocking buffer (1% donkey serum in PBS+0.2% Triton) for 10 min. This was followed by incubation with primary antibodies for 1 hour and biotinylated secondary antibodies in blocking buffer for 45 min (Jackson Immunoresearch). The primary antibody, chicken anti-GFP (Abcam ab13970) and rabbit anti-CD31 (Abcam ab28364) endothelial cell marker, were used. A Vectastain Elite ABC kit (Vector Laboratories) was used following the manufacturer's instructions, with DAB as substrate, to visualize bound antibodies as brown precipitate.
[0182] For immunofluorescence, paraffin sections were deparaffinized and blocked after antigen retrieval with 1% donkey serum in PBS+0.2% Triton for 15 min followed by sequential incubation with primary (1 h) and fluorescence-labeled secondary antibodies (45 min, Jackson Immunoresearch) diluted in blocking buffer. Antibodies used were chicken anti-GFP (Abcam ab13970), rabbit anti-CD31 (Abcam ab28364), and mouse anti-NF-200 (clone RT97, Millipore CBL212). The primary antibodies were mixed together and the GFP and NF-200 antibodies were detected via FITC- and TRITC-labeled secondary antibodies, respectively. The signal for the rabbit antibody against CD31 was enhanced using a VectaFluor.TM. Excel Amplified DyLight.RTM. 488 Anti-Rabbit IgG kit according to the manufacturer's protocol (Vector Labs). Fluorescence and brightfield microscopy images were taken with a Nikon Eclipse TiE microscope.
Nonhuman Primate Transduction Evaluation of Barcoded Vector Transgenes
Test Articles and Study Design
[0183] Five novel capsids and five control capsids (AAVrh90, AAVrh91, AAVrh92, AAVrh93, AAVrh91.93, AAV8, AAV6.2, AAVrh32.33, AAV7, and AAV9) were used to package modified ATG-depleted self-complementary eGFP (dGFP) transgenes. Each unique capsid preparation contained the dGFP transgene with a corresponding unique 6 bp barcode prior to the polyadenylation sequence of the vector genome. The transgene contained a CB8 promoter and an SV40 polyadenylation sequence (AAVsc.CB8.dGFP.barcode.SV40). AAV vectors were produced and titrated by the Penn Vector Core as described before (see, e.g., Lock, M., et al. (2010) Hum. Gene Ther. 21:1259-71). HEK293 cells were triple transfected then the cell culture supernatant was harvested, concentrated, and purified with an iodixanol gradient. The purified vectors were titrated with droplet digital PCR using primers targeting the SV40 polyA sequence as described before (see, e.g., Lock, M., et al. (2014) Hum. Gene Ther. Methods 25:115-25).
[0184] The ten purified vectors were pooled at equal genome copy quantities for injection into two separate animals: total doses delivered were 2e13 GC/kg via IV delivery and 3e13 GC/animal via intra-cisterna magna (ICM) delivery into the intrathecal space. Animals were sacrificed at 30 days post injection and all tissues were harvested in RNAlater (QIAGEN) for downstream transgene RNA expression analysis.
Animals
[0185] All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Cynomolgus macaques (Macaca fascicularis) were donated from Bristol Meyers Squibb (USA). Animals were housed in an Association for Assessment and Accreditation of Laboratory Animal Care International-accredited Nonhuman Primate Research Program facility at the Children's Hospital of Philadelphia, Philadelphia, Pa. in stainless-steel squeeze back cages. Animals received varied enrichments such as food treats, visual and auditory stimuli, manipulatives, and social interactions.
[0186] A 10-year-old, male, 8 kg animal was used for the ICM study. A 6-year-old, male, 6.98 kg animal was used for the IV study. This animal was screened for the presence of AAV-neutralizing antibodies and was seronegative for AAV6, AAV8, and AAVrh32.33, at baseline. At baseline, this animal had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively.
ICM Injection Procedure
[0187] The anesthetized macaque was placed on an X-ray table in the lateral decubitus position with the head flexed forward. Aseptic technique was used to advance a 21G-27G, 1- to 1.5-inch Quincke spinal needle (Becton Dickinson, Franklin Lakes, N.J., USA) into the suboccipital space until the flow of CSF was observed. 1 mL of CSF was collected for baseline analysis. The correct placement of needle was verified by fluoroscopy (OEC 9800 C-arm; GE Healthcare, Little Chalfont, UK) in order to avoid potential injury of the brainstem. After CSF collection, a Luer access extension or a small-bore T port extension set catheter was connected to the spinal needle to facilitate dosing of 180 mg/mL Iohexol contrast media (GE Healthcare, Little Chalfont, UK). After verifying needle placement, a syringe containing the test article (volume equivalent to 1 mL plus the syringe volume and linker dead space) was connected to the flexible linker and injected over 30.+-.5 s. The needle was removed, and direct pressure was applied to the puncture site.
IV Injection Procedure
[0188] The macaque was administered with 10 mL of vector test article into a peripheral vein at a rate of 1 mL/min via an infusion pump (Harvard Apparatus, Holliston, Mass.).
Transgene Expression Analysis
[0189] Whole tissue RNA was extracted from all RNALater-treated tissues using TRIzol according to the manufacturer's specifications (Life Technologies). Extracted RNA was treated with DNase I according to the manufacturer's protocol (Roche, Basel, Switzerland). RNA was purified using the RNeasy Mini Kit (QIAGEN). Reverse transcription synthesis of cDNA was performed using the Applied Biosystems High Capacity cDNA Reverse Transcriptase Kit (Life Technologies). Primers targeting regions flanking the 6 bp unique barcode were used to PCR amplify a 117 bp amplicon (forward primer: GGCGAACAGCGGACACCGATATGAA (SEQ ID NO: 11), reverse primer: GGCTCTCGTCGCGTGAGAATGAGAA (SEQ ID NO: 12)) and Q5 High-Fidelity Hot Start DNA Polymerase (New England Biolabs) was used to perform the reactions using the following cycling conditions: 98.degree. C. for 30 s; 98.degree. C. for 10 s, 72.degree. C. for 17 s, 25 cycles; and a 72.degree. C. extension for 120 s. Amplicons were sequenced using the MiSeq Standard 2.times.150 bp sequencing platform (Illumina).
[0190] Barcode reads were analyzed using the fastq-join program from the Expression Analysis package (github.com/ExpressionAnalysis/ea-utils), cutadapt (cutadapt.readthedocs.io/en/stable/), the fastx toolkit package (hannonlab.cshl.edu/fastx toolkit/), and R version 3.3.1. (cran.r-project.org/bin/windows/base/old/3.3.1/). Barcode expression count data from tissue samples were normalized to barcode counts from the sequenced injection vector material for each animal and barcode proportions from each tissue sample were plotted using GraphPad Prism version 7.04.
Example 2: AAV-SGA
[0191] Adeno-associated viruses (AAVs) are single-stranded DNA parvoviruses that are non-pathogenic and weakly immunogenic which make them effective candidates as vectors for gene therapy. Since the discovery of the first generation of AAVs (AAV1-6), our lab has led the effort to isolate a large number of viruses from a variety of higher primate species. This second generation of AAVs identified here were isolated using bulk PCR-based techniques using primers against conserved regions that were specific for primate-derived AAV genomes. Using AAV-SGA we have explored the genetic variation of AAVs in their natural mammalian hosts (FIG. 1).
[0192] AAV-SGA is a powerful technique that can be used to isolate single viral genomes from within a mixed population with high accuracy. In this study, we used AAV-SGA to identify novel AAV genomes from rhesus macaque tissue specimens. The novel viral isolates were genetically diverse and can be classified into clades D, E, and the Fringe clade (FIG. 2). Our mouse studies showed that the novel capsids demonstrate clade-specific transduction patterns.
Example 3: Transduction Evaluation of Novel AAV Natural Isolates in Nonhuman Primates Using a Barcoded Transgene System
[0193] Adeno-associated virus (AAV) vectors have been shown to be safe and effective gene transfer vehicles in clinical applications yet they can be hindered by preexisting immunity to the virus and can have restricted tissue tropism. We demonstrated that a barcoded transgenes method is effective to compare transduction of various tissues in a single animal by multiple AAV serotypes simultaneously. This technique reduces number of animals used and prevents foreign transgene-related immune responses. Accordingly, the novel capsids and their respective prototypical clade member controls (AAV6.2, AAV7, AAV8, AAVrh32.33, and AAV9) were made into vectors containing a modified eGFP transgene and unique six base pair barcodes prior to the polyA signal of the transcript (FIG. 9). The transgene was modified by deletion of ATG sequence motifs to prevent polypeptide translation and consequent immune response towards a foreign protein. Vectors were pooled at equal quantities and injected IV or ICM in cynomologus macaques (total doses: 2e13 GC/kg IV and 3e13 GC ICM) to assess systemic and central nervous system transduction patterns of the novel capsids. The IV injected animal was seronegative for AAV6, AAV8, and AAVrh32.33 at baseline and had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively.
[0194] AAVrh92 vector with CB7.CI.eGFP.WPRE.RBG showed transduction of brain vasculature 14 days after IV injection in mice (FIG. 13). Evaluation of yields from small-scale preps of the novel and control capsids indicated that AAVrh.92 and AAVrh.93 showed comparable yields to other previously identified capsids, including AAV8. (FIG. 11).
Example 4: Targeted Expression of Ly6 Genes in Brain Endothelial Cells
[0195] AAVrh.92 was used to deliver Ly6a and Ly6c1 genes to the blood-brain barrier (BBB) in BALB/c Rag-/- mice (FIG. 12A). The Ly6a gene product has been shown to bind to IV delivered AAV.PHP.B and facilitate its transfer across the BBB in c57BL/6 but not BALB/c mice (see Hordeaux, J., et al., Molecular Therapy, 2019, 27:912-21). We aimed to use the endothelial targeting properties of AAVrh.92 to deliver Ly6a genes to the BBB in Ly6a-deficient BALB/c Rag-/- mice, followed by delivery of AAV.PHP.B carrying an eGFP transgene, in order to recapitulate its BBB crossing capabilities. The findings showed adequate AAVrh92.Ly6a transduction in the brains of the mice by vector genome biodistribution analysis. However, expression of Ly6a did not result in enhanced AAV.PHP.B crossing of the BBB or subsequent transduction of the brain parenchyma (FIG. 12B). There was no difference in transduction of AAV9 or AAVPHP.B after introducing Ly6a to the BBB in BALB/c Rag-/- mice via AAVrh92 delivery.
Sequence Listing Free Text
[0196] The following information is provided for sequences containing free text under numeric identifier <223>.
TABLE-US-00002 SEQ ID NO Free Text under <223> 5 <223> synthetic hybrid of AAVrh.91 and AAVrh.93 <220> <221> CDS <222> (1) . . . (2202) 6 <223> Synthetic Construct 9 <223> primer sequence 10 <223> primer sequence 11 <223> primer sequence 12 <223> primer sequence 13 <223> miRNA target sequence 14 <223> miRNA target sequence
[0197] All documents cited in this specification are incorporated herein by reference. U.S. Provisional Patent Application No. 62/924,095, filed Oct. 21, 2019, U.S. Provisional Patent Application No. 62/913,314, filed Oct. 10, 2019, and U.S. Provisional Patent Application No. 62/840,184, filed Apr. 29, 2019, are incorporated by reference in their entireties, together with their sequence listings. The sequence listing filed herewith named "19-8901PCT3_ST25.txt" and the sequences and text therein are incorporated by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
Sequence CWU
1
1
1412202DNAadeno-associated virus rh.92CDS(1)..(2202) 1atg gct gcc gat ggt
tat ctt cca gat tgg ctc gag gac aac ctc tct 48Met Ala Ala Asp Gly
Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5
10 15gag ggc att cgc gag tgg tgg gac ctg aaa cct
gga gcc ccc aag ccc 96Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro
Gly Ala Pro Lys Pro 20 25
30aag gcc aac cag cag aag cag gac gac ggc cgg ggt ctg gtg ctt cct
144Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro
35 40 45ggc tac aag tac ctc gga ccc ttc
aac gga ctc gac aag ggg gag ccc 192Gly Tyr Lys Tyr Leu Gly Pro Phe
Asn Gly Leu Asp Lys Gly Glu Pro 50 55
60gtc aac gag gcg gac gcc gcg gcc ctc gag cac gac aag gcc tac gac
240Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65
70 75 80cag cag ctc aaa gcg
ggt gac aat ccg tac ctg cgg tat aac cac gcc 288Gln Gln Leu Lys Ala
Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85
90 95gac gcc gag ttt cag gag cgt ctg caa gaa gat
acg tct ttt ggg ggc 336Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105
110aac ctc ggg cga gca gtc ttc cag gcc aag aag agg gta ctc gaa cct
384Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro
115 120 125ctg ggc ctg gtt gaa gaa ggt
gct aag acg gct cct gga aag aag aga 432Leu Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135
140ccg tta gag tca cca caa gag cca gac tcc tcc tcg gga atc ggc aaa
480Pro Leu Glu Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys145
150 155 160aaa ggc aaa caa
cca gcc aaa aag aga ctc aac ttt gaa gag gac act 528Lys Gly Lys Gln
Pro Ala Lys Lys Arg Leu Asn Phe Glu Glu Asp Thr 165
170 175gga gcc gga gac gga ccc cct gaa gga tca
gat acc agc gcc atg tct 576Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser
Asp Thr Ser Ala Met Ser 180 185
190tca gac att gaa atg cgt gca gca ccg ggc gga aat gct gtc gat gcg
624Ser Asp Ile Glu Met Arg Ala Ala Pro Gly Gly Asn Ala Val Asp Ala
195 200 205gga caa ggt tcc gat gga gtg
ggt aat gcc tcg ggt gat tgg cat tgc 672Gly Gln Gly Ser Asp Gly Val
Gly Asn Ala Ser Gly Asp Trp His Cys 210 215
220gat tcc acc tgg tct gag ggc aag gtc aca aca acc tcg acc aga acc
720Asp Ser Thr Trp Ser Glu Gly Lys Val Thr Thr Thr Ser Thr Arg Thr225
230 235 240tgg gtc ttg ccc
acc tac aac aac cac ctg tac ctg cgg ctc gga aca 768Trp Val Leu Pro
Thr Tyr Asn Asn His Leu Tyr Leu Arg Leu Gly Thr 245
250 255aca tca aac agc aac acc tac aac gga ttc
tcc acc ccc tgg gga tac 816Thr Ser Asn Ser Asn Thr Tyr Asn Gly Phe
Ser Thr Pro Trp Gly Tyr 260 265
270ttt gac ttt aac aga ttc cac tgt cac ttc tca cca cgt gac tgg caa
864Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln
275 280 285aga ctc atc aac aac aac tgg
gga cta cga cca aaa gcc atg cgc gtt 912Arg Leu Ile Asn Asn Asn Trp
Gly Leu Arg Pro Lys Ala Met Arg Val 290 295
300aaa atc ttc aat atc caa gtt aag gag gtc aca acg tcg aac ggc gag
960Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu305
310 315 320act acg gtc gct
aat aac ctt acc agc acg gtt cag ata ttt gcg gac 1008Thr Thr Val Ala
Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp 325
330 335tcg tcg tat gag ctc ccg tac gtg atg gac
gct gga caa gag ggg agc 1056Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp
Ala Gly Gln Glu Gly Ser 340 345
350ctg cct cct ttc ccc aat gac gtc ttt atg gtg cct caa tat ggc tac
1104Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr Gly Tyr
355 360 365tgt ggc atc gtg act ggc gag
aat cag aac cag acg gac aga aat gcc 1152Cys Gly Ile Val Thr Gly Glu
Asn Gln Asn Gln Thr Asp Arg Asn Ala 370 375
380ttc tac tgc ctg gag tat ttt cct tca caa atg ttg aga act ggc aac
1200Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn385
390 395 400aac ttt gaa atg
gct tac aac ttt gag aag gtg ccg ttc cac tca atg 1248Asn Phe Glu Met
Ala Tyr Asn Phe Glu Lys Val Pro Phe His Ser Met 405
410 415tat gct cac agc cag agc ctg gac aga ctg
atg aat ccc ctc ctg gac 1296Tyr Ala His Ser Gln Ser Leu Asp Arg Leu
Met Asn Pro Leu Leu Asp 420 425
430cag tac ctg tgg cac tta cag tcg act acc tct gga ggg act ctg aat
1344Gln Tyr Leu Trp His Leu Gln Ser Thr Thr Ser Gly Gly Thr Leu Asn
435 440 445caa ggc aat gca gca acc aca
ttt gga aaa atc agg agt gga gac ttt 1392Gln Gly Asn Ala Ala Thr Thr
Phe Gly Lys Ile Arg Ser Gly Asp Phe 450 455
460gcc ttt tac aga aag aac tgg ctg cct ggg cct tgt gtt aag cag cag
1440Ala Phe Tyr Arg Lys Asn Trp Leu Pro Gly Pro Cys Val Lys Gln Gln465
470 475 480aga ttc tca aag
act gcc agt caa aac tac aag att cct gcc agc ggg 1488Arg Phe Ser Lys
Thr Ala Ser Gln Asn Tyr Lys Ile Pro Ala Ser Gly 485
490 495ggc gac gct ctg tta aag tat gac acc cac
tat acc tta aac aac cgg 1536Gly Asp Ala Leu Leu Lys Tyr Asp Thr His
Tyr Thr Leu Asn Asn Arg 500 505
510tgg agc aac atc gcg ccc gga cct cca atg gcc aca gcc gga cct tcg
1584Trp Ser Asn Ile Ala Pro Gly Pro Pro Met Ala Thr Ala Gly Pro Ser
515 520 525gat ggg gac ttc agt aac gcc
cag ctt ata ttc cct gga cca tct gtt 1632Asp Gly Asp Phe Ser Asn Ala
Gln Leu Ile Phe Pro Gly Pro Ser Val 530 535
540acc gga aat aca aca act tca gcc aac aat ctg ttg ttt aca tca gaa
1680Thr Gly Asn Thr Thr Thr Ser Ala Asn Asn Leu Leu Phe Thr Ser Glu545
550 555 560gaa gaa att gct
gcc acc aac cca aga gac acg gac atg ttt ggc cag 1728Glu Glu Ile Ala
Ala Thr Asn Pro Arg Asp Thr Asp Met Phe Gly Gln 565
570 575att gct gac aat aat cag aat gct aca act
gct ccc ata acc ggc aac 1776Ile Ala Asp Asn Asn Gln Asn Ala Thr Thr
Ala Pro Ile Thr Gly Asn 580 585
590gtg act gct atg gga gtg ctg cct ggc atg gtg tgg caa aac aga gac
1824Val Thr Ala Met Gly Val Leu Pro Gly Met Val Trp Gln Asn Arg Asp
595 600 605att tac tac caa ggg cca att
tgg gcc aag atc cca cac gcg gac gga 1872Ile Tyr Tyr Gln Gly Pro Ile
Trp Ala Lys Ile Pro His Ala Asp Gly 610 615
620cat ttt cat cct tca ccg ctg att ggt ggg ttt gga ctg aaa cac ccg
1920His Phe His Pro Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His Pro625
630 635 640cct ccc cag ata
ttc atc aag aac act ccc gta cct gcc aat cct gcg 1968Pro Pro Gln Ile
Phe Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Ala 645
650 655aca acc ttc act gca gcc aga gtg gac tct
ttc att aca caa tac agc 2016Thr Thr Phe Thr Ala Ala Arg Val Asp Ser
Phe Ile Thr Gln Tyr Ser 660 665
670acc ggc cag gtc gct gtt cag att gaa tgg gaa att gaa aag gaa cgc
2064Thr Gly Gln Val Ala Val Gln Ile Glu Trp Glu Ile Glu Lys Glu Arg
675 680 685tcc aaa cgc tgg aat cct gaa
gtg cag ttt act tca aac tat ggg aac 2112Ser Lys Arg Trp Asn Pro Glu
Val Gln Phe Thr Ser Asn Tyr Gly Asn 690 695
700cag tct tct atg ttg tgg gct cct gat aca act ggg aag tat aca gag
2160Gln Ser Ser Met Leu Trp Ala Pro Asp Thr Thr Gly Lys Tyr Thr Glu705
710 715 720ccg cgg gtt att
ggc tct cgt tat ttg act aat cat ttg taa 2202Pro Arg Val Ile
Gly Ser Arg Tyr Leu Thr Asn His Leu 725
7302733PRTadeno-associated virus rh.92 2Met Ala Ala Asp Gly Tyr Leu Pro
Asp Trp Leu Glu Asp Asn Leu Ser1 5 10
15Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro
Lys Pro 20 25 30Lys Ala Asn
Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35
40 45Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu
Asp Lys Gly Glu Pro 50 55 60Val Asn
Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65
70 75 80Gln Gln Leu Lys Ala Gly Asp
Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90
95Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser
Phe Gly Gly 100 105 110Asn Leu
Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115
120 125Leu Gly Leu Val Glu Glu Gly Ala Lys Thr
Ala Pro Gly Lys Lys Arg 130 135 140Pro
Leu Glu Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys145
150 155 160Lys Gly Lys Gln Pro Ala
Lys Lys Arg Leu Asn Phe Glu Glu Asp Thr 165
170 175Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser Asp Thr
Ser Ala Met Ser 180 185 190Ser
Asp Ile Glu Met Arg Ala Ala Pro Gly Gly Asn Ala Val Asp Ala 195
200 205Gly Gln Gly Ser Asp Gly Val Gly Asn
Ala Ser Gly Asp Trp His Cys 210 215
220Asp Ser Thr Trp Ser Glu Gly Lys Val Thr Thr Thr Ser Thr Arg Thr225
230 235 240Trp Val Leu Pro
Thr Tyr Asn Asn His Leu Tyr Leu Arg Leu Gly Thr 245
250 255Thr Ser Asn Ser Asn Thr Tyr Asn Gly Phe
Ser Thr Pro Trp Gly Tyr 260 265
270Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln
275 280 285Arg Leu Ile Asn Asn Asn Trp
Gly Leu Arg Pro Lys Ala Met Arg Val 290 295
300Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly
Glu305 310 315 320Thr Thr
Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp
325 330 335Ser Ser Tyr Glu Leu Pro Tyr
Val Met Asp Ala Gly Gln Glu Gly Ser 340 345
350Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr
Gly Tyr 355 360 365Cys Gly Ile Val
Thr Gly Glu Asn Gln Asn Gln Thr Asp Arg Asn Ala 370
375 380Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu
Arg Thr Gly Asn385 390 395
400Asn Phe Glu Met Ala Tyr Asn Phe Glu Lys Val Pro Phe His Ser Met
405 410 415Tyr Ala His Ser Gln
Ser Leu Asp Arg Leu Met Asn Pro Leu Leu Asp 420
425 430Gln Tyr Leu Trp His Leu Gln Ser Thr Thr Ser Gly
Gly Thr Leu Asn 435 440 445Gln Gly
Asn Ala Ala Thr Thr Phe Gly Lys Ile Arg Ser Gly Asp Phe 450
455 460Ala Phe Tyr Arg Lys Asn Trp Leu Pro Gly Pro
Cys Val Lys Gln Gln465 470 475
480Arg Phe Ser Lys Thr Ala Ser Gln Asn Tyr Lys Ile Pro Ala Ser Gly
485 490 495Gly Asp Ala Leu
Leu Lys Tyr Asp Thr His Tyr Thr Leu Asn Asn Arg 500
505 510Trp Ser Asn Ile Ala Pro Gly Pro Pro Met Ala
Thr Ala Gly Pro Ser 515 520 525Asp
Gly Asp Phe Ser Asn Ala Gln Leu Ile Phe Pro Gly Pro Ser Val 530
535 540Thr Gly Asn Thr Thr Thr Ser Ala Asn Asn
Leu Leu Phe Thr Ser Glu545 550 555
560Glu Glu Ile Ala Ala Thr Asn Pro Arg Asp Thr Asp Met Phe Gly
Gln 565 570 575Ile Ala Asp
Asn Asn Gln Asn Ala Thr Thr Ala Pro Ile Thr Gly Asn 580
585 590Val Thr Ala Met Gly Val Leu Pro Gly Met
Val Trp Gln Asn Arg Asp 595 600
605Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys Ile Pro His Ala Asp Gly 610
615 620His Phe His Pro Ser Pro Leu Ile
Gly Gly Phe Gly Leu Lys His Pro625 630
635 640Pro Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro
Ala Asn Pro Ala 645 650
655Thr Thr Phe Thr Ala Ala Arg Val Asp Ser Phe Ile Thr Gln Tyr Ser
660 665 670Thr Gly Gln Val Ala Val
Gln Ile Glu Trp Glu Ile Glu Lys Glu Arg 675 680
685Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn Tyr
Gly Asn 690 695 700Gln Ser Ser Met Leu
Trp Ala Pro Asp Thr Thr Gly Lys Tyr Thr Glu705 710
715 720Pro Arg Val Ile Gly Ser Arg Tyr Leu Thr
Asn His Leu 725
73032187DNAadeno-associated virus rh.93CDS(1)..(2187) 3atg gct gcc gat
ggt tat ctt cca gat tgg ctc gag gac aac ctc tct 48Met Ala Ala Asp
Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5
10 15gag ggc att cgc gag tgg tgg gcg ctg aaa
cct gga gcc ccg aaa ccc 96Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys
Pro Gly Ala Pro Lys Pro 20 25
30aaa gcc aac cag caa aag cag gac gac ggc cgg ggt ctg gtg ctt cct
144Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro
35 40 45ggc tac aag tac ctc gga ccc ttc
aac gga ctc gac aag ggg gag ccc 192Gly Tyr Lys Tyr Leu Gly Pro Phe
Asn Gly Leu Asp Lys Gly Glu Pro 50 55
60gtc aac gcg gcg gac gca gcg gcc ctc gag cac gac aag gcc tac gac
240Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65
70 75 80cag cag ctg cag gcg
ggt gac aat ccg tac ctg cgg tat aac cac gcc 288Gln Gln Leu Gln Ala
Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85
90 95gac gcc gag ttt cag gag cgt ctg caa gaa gat
acg tct ttt ggg ggc 336Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105
110aac ctc ggg cga gca gtc ttc cag gcc aag aag cgg gtt ctc gaa cct
384Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro
115 120 125ctc ggt ctg gtt gag gaa ggc
gct aaa acg gct cct gga aag aag aga 432Leu Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135
140ccc gta gac tct cca gac tcc tcc acg ggc atc ggc aag aaa ggc cag
480Pro Val Asp Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln145
150 155 160cag ccc gcg aaa
aag aag ctc aac ttt ggg cag act ggc gac tca gag 528Gln Pro Ala Lys
Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu 165
170 175tca gtc ccc gac cct caa cct ctc tca gaa
cct cca gca gcg ccc act 576Ser Val Pro Asp Pro Gln Pro Leu Ser Glu
Pro Pro Ala Ala Pro Thr 180 185
190agt gtg gga tct ggt aca gtg gct gca ggc agt ggc gca cca atg gca
624Ser Val Gly Ser Gly Thr Val Ala Ala Gly Ser Gly Ala Pro Met Ala
195 200 205gac aat aac gaa ggt gcc gac
gga gtg ggt aat gcc tca gga aat tgg 672Asp Asn Asn Glu Gly Ala Asp
Gly Val Gly Asn Ala Ser Gly Asn Trp 210 215
220cat tgc gat tcc aca tgg ctg ggc gac aga gtc atc acc acc agc acc
720His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr225
230 235 240cga acc tgg gcc
ctg ccc acc tac aac aac cac ctc tac aag caa atc 768Arg Thr Trp Ala
Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile 245
250 255tcc agt cag agc ggg gct acc aac gac aac
cac ttc ttt ggc tac agc 816Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn
His Phe Phe Gly Tyr Ser 260 265
270acc ccc tgg ggg tat ttt gac ttc aac aga ttc cac tgc cac ttc tca
864Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser
275 280 285cca cgt gac tgg cag cga ctc
atc aac aac aac tgg gga ttc cgg ccc 912Pro Arg Asp Trp Gln Arg Leu
Ile Asn Asn Asn Trp Gly Phe Arg Pro 290 295
300aag aag ctg cgg ttc aag ctc ttc aac atc caa gtc aaa gag gtt acg
960Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr305
310 315 320acg aac gac ggc
gtc aca acc atc gct aat aac ctt acc agc acg att 1008Thr Asn Asp Gly
Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile 325
330 335cag gtt ttc tcg gac tcg gag tac cag ctg
ccg tac gtc ctc ggc tct 1056Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu
Pro Tyr Val Leu Gly Ser 340 345
350gcg cac cag ggc tgc ctc cct ccg ttc ccg gcg gac gtc ttc atg att
1104Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile
355 360 365cct cag tac ggc tac ctg acg
ctc aac aac ggt agt cag tct gtg ggt 1152Pro Gln Tyr Gly Tyr Leu Thr
Leu Asn Asn Gly Ser Gln Ser Val Gly 370 375
380cgt tct tcc ttc tac tgc ctg gaa tat ttc ccc tct caa atg ctg aga
1200Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg385
390 395 400acg ggc aac aac
ttt gaa ttc agt tac acc ttc gag gat gtg cct ttc 1248Thr Gly Asn Asn
Phe Glu Phe Ser Tyr Thr Phe Glu Asp Val Pro Phe 405
410 415cac agc agc tac gcg cat agc cag agc ctg
gac cgg ctg atg aat cct 1296His Ser Ser Tyr Ala His Ser Gln Ser Leu
Asp Arg Leu Met Asn Pro 420 425
430ctt atc gac cag tat ctg tac tac ctg gcc cgg acc cag agc acc acg
1344Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr
435 440 445ggt tcc acc aga gag ctg cag
ttt cat cag gct ggg ccc aac act atg 1392Gly Ser Thr Arg Glu Leu Gln
Phe His Gln Ala Gly Pro Asn Thr Met 450 455
460gcc gag caa tca aag aac tgg tta cct ggt cct tgc ttc cgg caa caa
1440Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Phe Arg Gln Gln465
470 475 480cgc gtt tcc aag
gtg ctg gat cag aac gcc aac agc aac ttt gcc tgg 1488Arg Val Ser Lys
Val Leu Asp Gln Asn Ala Asn Ser Asn Phe Ala Trp 485
490 495act gct gcc act aaa tat cac ttg aat ggg
cgt aac tct ctg acc aat 1536Thr Ala Ala Thr Lys Tyr His Leu Asn Gly
Arg Asn Ser Leu Thr Asn 500 505
510ccg gga gtt ccc atg gca aca cac aag gac gac gag gac agg ttc ttt
1584Pro Gly Val Pro Met Ala Thr His Lys Asp Asp Glu Asp Arg Phe Phe
515 520 525ccc att aac ggg gtg ctg gtt
ttt ggc aag acc gga gcc gcc aac aaa 1632Pro Ile Asn Gly Val Leu Val
Phe Gly Lys Thr Gly Ala Ala Asn Lys 530 535
540aca acg ctg gaa aat gtt ctg atg aca aac gaa gaa gaa atc aaa act
1680Thr Thr Leu Glu Asn Val Leu Met Thr Asn Glu Glu Glu Ile Lys Thr545
550 555 560acc aac ccg gtg
gct aca gaa gaa tat ggc gtg gtt tcc agc aat ttg 1728Thr Asn Pro Val
Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu 565
570 575cag gct ggg act aca aac cca cag aca ctg
act gtt aac aac cag ggg 1776Gln Ala Gly Thr Thr Asn Pro Gln Thr Leu
Thr Val Asn Asn Gln Gly 580 585
590gcc tta cct ggc atg gtg tgg cag aac agg gac gtg tac ctg caa ggt
1824Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly
595 600 605ccc atc tgg gcc aaa att cct
cac acg gac ggc aac ttt cac ccg tct 1872Pro Ile Trp Ala Lys Ile Pro
His Thr Asp Gly Asn Phe His Pro Ser 610 615
620cct ttg atg ggt gga ttt gga ctt aaa cac ccg cct cct cag atc cta
1920Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu625
630 635 640att aaa aac acg
cct gtt cct gcc aat cct ccg gag gtg ttt act cct 1968Ile Lys Asn Thr
Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro 645
650 655gcc aag ttt gct tcg ttc atc acg cag tac
agc acc ggt cag gtc agc 2016Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr
Ser Thr Gly Gln Val Ser 660 665
670gtg gaa atc gag tgg gag ctg cag aaa gaa aac agc aag cgc tgg aac
2064Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn
675 680 685cca gag att cag tac act tcc
aat ttt gat aaa tct aat aat gtg gac 2112Pro Glu Ile Gln Tyr Thr Ser
Asn Phe Asp Lys Ser Asn Asn Val Asp 690 695
700ttt gct gtt aac aat gaa ggt gtt tac tct gag cct cgc ccc att ggc
2160Phe Ala Val Asn Asn Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly705
710 715 720act cgc tac ctc
acc cgt aac ctg taa 2187Thr Arg Tyr Leu
Thr Arg Asn Leu 7254728PRTadeno-associated virus rh.93
4Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1
5 10 15Glu Gly Ile Arg Glu Trp
Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25
30Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu
Val Leu Pro 35 40 45Gly Tyr Lys
Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp
Lys Ala Tyr Asp65 70 75
80Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala
85 90 95Asp Ala Glu Phe Gln Glu
Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100
105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg
Val Leu Glu Pro 115 120 125Leu Gly
Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130
135 140Pro Val Asp Ser Pro Asp Ser Ser Thr Gly Ile
Gly Lys Lys Gly Gln145 150 155
160Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu
165 170 175Ser Val Pro Asp
Pro Gln Pro Leu Ser Glu Pro Pro Ala Ala Pro Thr 180
185 190Ser Val Gly Ser Gly Thr Val Ala Ala Gly Ser
Gly Ala Pro Met Ala 195 200 205Asp
Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp 210
215 220His Cys Asp Ser Thr Trp Leu Gly Asp Arg
Val Ile Thr Thr Ser Thr225 230 235
240Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln
Ile 245 250 255Ser Ser Gln
Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser 260
265 270Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
Phe His Cys His Phe Ser 275 280
285Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro 290
295 300Lys Lys Leu Arg Phe Lys Leu Phe
Asn Ile Gln Val Lys Glu Val Thr305 310
315 320Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu
Thr Ser Thr Ile 325 330
335Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser
340 345 350Ala His Gln Gly Cys Leu
Pro Pro Phe Pro Ala Asp Val Phe Met Ile 355 360
365Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser
Val Gly 370 375 380Arg Ser Ser Phe Tyr
Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg385 390
395 400Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr
Phe Glu Asp Val Pro Phe 405 410
415His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro
420 425 430Leu Ile Asp Gln Tyr
Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr 435
440 445Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly
Pro Asn Thr Met 450 455 460Ala Glu Gln
Ser Lys Asn Trp Leu Pro Gly Pro Cys Phe Arg Gln Gln465
470 475 480Arg Val Ser Lys Val Leu Asp
Gln Asn Ala Asn Ser Asn Phe Ala Trp 485
490 495Thr Ala Ala Thr Lys Tyr His Leu Asn Gly Arg Asn
Ser Leu Thr Asn 500 505 510Pro
Gly Val Pro Met Ala Thr His Lys Asp Asp Glu Asp Arg Phe Phe 515
520 525Pro Ile Asn Gly Val Leu Val Phe Gly
Lys Thr Gly Ala Ala Asn Lys 530 535
540Thr Thr Leu Glu Asn Val Leu Met Thr Asn Glu Glu Glu Ile Lys Thr545
550 555 560Thr Asn Pro Val
Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu 565
570 575Gln Ala Gly Thr Thr Asn Pro Gln Thr Leu
Thr Val Asn Asn Gln Gly 580 585
590Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly
595 600 605Pro Ile Trp Ala Lys Ile Pro
His Thr Asp Gly Asn Phe His Pro Ser 610 615
620Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile
Leu625 630 635 640Ile Lys
Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro
645 650 655Ala Lys Phe Ala Ser Phe Ile
Thr Gln Tyr Ser Thr Gly Gln Val Ser 660 665
670Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg
Trp Asn 675 680 685Pro Glu Ile Gln
Tyr Thr Ser Asn Phe Asp Lys Ser Asn Asn Val Asp 690
695 700Phe Ala Val Asn Asn Glu Gly Val Tyr Ser Glu Pro
Arg Pro Ile Gly705 710 715
720Thr Arg Tyr Leu Thr Arg Asn Leu 72552202DNAArtificial
Sequencesynthetic hybrid of AAVrh.91 and AAVrh.93CDS(1)..(2202) 5atg gct
gcc gat ggt tat ctt cca gat tgg ctc gag gac aac ctc tct 48Met Ala
Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1 5
10 15gag ggc att cgc gag tgg tgg gcg
ctg aaa cct gga gcc ccg aaa ccc 96Glu Gly Ile Arg Glu Trp Trp Ala
Leu Lys Pro Gly Ala Pro Lys Pro 20 25
30aaa gcc aac cag caa aag cag gac gac ggc cgg ggt ctg gtg ctt
cct 144Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu
Pro 35 40 45ggc tac aag tac ctc
gga ccc ttc aac gga ctc gac aag ggg gag ccc 192Gly Tyr Lys Tyr Leu
Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55
60gtc aac gcg gcg gac gca gcg gcc ctc gag cac gac aag gcc
tac gac 240Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala
Tyr Asp65 70 75 80cag
cag ctc aaa gcg ggt gac aat ccg tac ctg cgg tat aac cac gcc 288Gln
Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala
85 90 95gac gcc gag ttt cag gag cgt
ctg caa gaa gat acg tct ttt ggg ggc 336Asp Ala Glu Phe Gln Glu Arg
Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105
110aac ctc ggg cga gca gtc ttc cag gcc aag aag cgg gtt ctc
gaa cct 384Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu
Glu Pro 115 120 125ttt ggt ctg gtt
gag gaa gca gct aag acg gct cct gga aag aaa cgt 432Phe Gly Leu Val
Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130
135 140ccg gta gag cag tcg ccc caa gaa cca gac tcc tcc
tcg ggc att ggc 480Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser
Ser Gly Ile Gly145 150 155
160aaa tca ggc cag cag ccc gcc aaa aag aga ctc aat ttc ggt cag act
528Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175ggc gac tca gag tca
gtc ccc gac cct caa cct ctc gga gaa cct cca 576Gly Asp Ser Glu Ser
Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190gaa acc ccc gct gct gtg gga cct act aca atg gct
tca ggc ggt ggc 624Glu Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala
Ser Gly Gly Gly 195 200 205gca cca
atg gca gac aat aac gaa ggc gcc gac gga gtg ggt aat gcc 672Ala Pro
Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210
215 220tca gga aat tgg cat tgc gat tcc aca tgg ctg
ggc gac aga gtc atc 720Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu
Gly Asp Arg Val Ile225 230 235
240acc acc agc acc cga acc tgg gcc ctt cct acc tac aac aac cac ctc
768Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255tac aag caa atc tcc
agc gct tca acg ggg gcc agt aac gac aac cac 816Tyr Lys Gln Ile Ser
Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260
265 270tac ttt ggc tac agc acc ccc tgg ggg tat ttt gac
ttc aac aga ttc 864Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp
Phe Asn Arg Phe 275 280 285cac tgc
cac ttc tca cca cgt gac tgg cag cga ctc atc aac aac aac 912His Cys
His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290
295 300tgg gga ttc cgg ccc aag aag ctg cgg ttc aag
ctc ttc aac atc caa 960Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys
Leu Phe Asn Ile Gln305 310 315
320gtc aaa gag gtt acg acg aac gac ggc gtc aca acc atc gct aat aac
1008Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn
325 330 335ctt acc agc acg att
cag gtt ttc tcg gac tcg gag tac cag ctg ccg 1056Leu Thr Ser Thr Ile
Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro 340
345 350tac gtc ctc ggc tct gcg cac cag ggc tgc ctc cct
ccg ttc ccg gcg 1104Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro
Pro Phe Pro Ala 355 360 365gac gtc
ttc atg att cct cag tac ggc tac ctg acg ctc aac aac ggt 1152Asp Val
Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly 370
375 380agt cag tct gtg ggt cgt tct tcc ttc tac tgc
ctg gaa tat ttc ccc 1200Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys
Leu Glu Tyr Phe Pro385 390 395
400tct caa atg ctg aga acg ggc aac aac ttt gaa ttc agt tac acc ttc
1248Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe
405 410 415gag gat gtg cct ttc
cac agc agc tac gcg cat agc cag agc ctg gac 1296Glu Asp Val Pro Phe
His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp 420
425 430cgg ctg atg aat cct ctt atc gac cag tat ctg tac
tac ctg gcc cgg 1344Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr
Tyr Leu Ala Arg 435 440 445acc cag
agc acc acg ggt tcc acc aga gag ctg cag ttt cat cag gct 1392Thr Gln
Ser Thr Thr Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala 450
455 460ggg ccc aac act atg gcc gag caa tca aag aac
tgg tta cct ggt cct 1440Gly Pro Asn Thr Met Ala Glu Gln Ser Lys Asn
Trp Leu Pro Gly Pro465 470 475
480tgc ttc cgg caa caa cgc gtt tcc aag gtg ctg gat cag aac gcc aac
1488Cys Phe Arg Gln Gln Arg Val Ser Lys Val Leu Asp Gln Asn Ala Asn
485 490 495agc aac ttt gcc tgg
act gct gcc act aaa tat cac ttg aat ggg cgt 1536Ser Asn Phe Ala Trp
Thr Ala Ala Thr Lys Tyr His Leu Asn Gly Arg 500
505 510aac tct ctg acc aat ccg gga gtt ccc atg gca aca
cac aag gac gac 1584Asn Ser Leu Thr Asn Pro Gly Val Pro Met Ala Thr
His Lys Asp Asp 515 520 525gag gac
agg ttc ttt ccc att aac ggg gtg ctg gtt ttt ggc aag acc 1632Glu Asp
Arg Phe Phe Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr 530
535 540gga gcc gcc aac aaa aca acg ctg gaa aat gtt
ctg atg aca aac gaa 1680Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val
Leu Met Thr Asn Glu545 550 555
560gaa gaa atc aaa act acc aac ccg gtg gct aca gaa gaa tat ggc gtg
1728Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val
565 570 575gtt tcc agc aat ttg
cag gct ggg act aca aac cca cag aca ctg act 1776Val Ser Ser Asn Leu
Gln Ala Gly Thr Thr Asn Pro Gln Thr Leu Thr 580
585 590gtt aac aac cag ggg gcc tta cct ggc atg gtg tgg
cag aac agg gac 1824Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp
Gln Asn Arg Asp 595 600 605gtg tac
ctg caa ggt ccc atc tgg gcc aaa att cct cac acg gac ggc 1872Val Tyr
Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly 610
615 620aac ttt cac ccg tct cct ttg atg ggt gga ttt
gga ctt aaa cac ccg 1920Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe
Gly Leu Lys His Pro625 630 635
640cct cct cag atc cta att aaa aac acg cct gtt cct gcc aat cct ccg
1968Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro
645 650 655gag gtg ttt act cct
gcc aag ttt gct tcg ttc atc acg cag tac agc 2016Glu Val Phe Thr Pro
Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser 660
665 670acc ggt cag gtc agc gtg gaa atc gag tgg gag ctg
cag aaa gaa aac 2064Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu
Gln Lys Glu Asn 675 680 685agc aag
cgc tgg aac cca gag att cag tac act tcc aat ttt gat aaa 2112Ser Lys
Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Phe Asp Lys 690
695 700tct aat aat gtg gac ttt gct gtt aac aat gaa
ggt gtt tac tct gag 2160Ser Asn Asn Val Asp Phe Ala Val Asn Asn Glu
Gly Val Tyr Ser Glu705 710 715
720cct cgc ccc att ggc act cgc tac ctc acc cgt aac ctg taa
2202Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu
725 7306733PRTArtificial SequenceSynthetic Construct 6Met
Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1
5 10 15Glu Gly Ile Arg Glu Trp Trp
Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25
30Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val
Leu Pro 35 40 45Gly Tyr Lys Tyr
Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55
60Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys
Ala Tyr Asp65 70 75
80Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala
85 90 95Asp Ala Glu Phe Gln Glu
Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100
105 110Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg
Val Leu Glu Pro 115 120 125Phe Gly
Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130
135 140Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser
Ser Ser Gly Ile Gly145 150 155
160Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175Gly Asp Ser Glu
Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190Glu Thr Pro Ala Ala Val Gly Pro Thr Thr Met
Ala Ser Gly Gly Gly 195 200 205Ala
Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210
215 220Ser Gly Asn Trp His Cys Asp Ser Thr Trp
Leu Gly Asp Arg Val Ile225 230 235
240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His
Leu 245 250 255Tyr Lys Gln
Ile Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260
265 270Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr
Phe Asp Phe Asn Arg Phe 275 280
285His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290
295 300Trp Gly Phe Arg Pro Lys Lys Leu
Arg Phe Lys Leu Phe Asn Ile Gln305 310
315 320Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr
Ile Ala Asn Asn 325 330
335Leu Thr Ser Thr Ile Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro
340 345 350Tyr Val Leu Gly Ser Ala
His Gln Gly Cys Leu Pro Pro Phe Pro Ala 355 360
365Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn
Asn Gly 370 375 380Ser Gln Ser Val Gly
Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro385 390
395 400Ser Gln Met Leu Arg Thr Gly Asn Asn Phe
Glu Phe Ser Tyr Thr Phe 405 410
415Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp
420 425 430Arg Leu Met Asn Pro
Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg 435
440 445Thr Gln Ser Thr Thr Gly Ser Thr Arg Glu Leu Gln
Phe His Gln Ala 450 455 460Gly Pro Asn
Thr Met Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro465
470 475 480Cys Phe Arg Gln Gln Arg Val
Ser Lys Val Leu Asp Gln Asn Ala Asn 485
490 495Ser Asn Phe Ala Trp Thr Ala Ala Thr Lys Tyr His
Leu Asn Gly Arg 500 505 510Asn
Ser Leu Thr Asn Pro Gly Val Pro Met Ala Thr His Lys Asp Asp 515
520 525Glu Asp Arg Phe Phe Pro Ile Asn Gly
Val Leu Val Phe Gly Lys Thr 530 535
540Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met Thr Asn Glu545
550 555 560Glu Glu Ile Lys
Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val 565
570 575Val Ser Ser Asn Leu Gln Ala Gly Thr Thr
Asn Pro Gln Thr Leu Thr 580 585
590Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp
595 600 605Val Tyr Leu Gln Gly Pro Ile
Trp Ala Lys Ile Pro His Thr Asp Gly 610 615
620Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His
Pro625 630 635 640Pro Pro
Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro
645 650 655Glu Val Phe Thr Pro Ala Lys
Phe Ala Ser Phe Ile Thr Gln Tyr Ser 660 665
670Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys
Glu Asn 675 680 685Ser Lys Arg Trp
Asn Pro Glu Ile Gln Tyr Thr Ser Asn Phe Asp Lys 690
695 700Ser Asn Asn Val Asp Phe Ala Val Asn Asn Glu Gly
Val Tyr Ser Glu705 710 715
720Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu
725 73072214DNAadeno-associated virus 7CDS(1)..(2214)
7atg gct gcc gat ggt tat ctt cca gat tgg ctc gag gac aac ctc tct
48Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser1
5 10 15gag ggc att cgc gag tgg
tgg gac ctg aaa cct gga gcc ccg aaa ccc 96Glu Gly Ile Arg Glu Trp
Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25
30aaa gcc aac cag caa aag cag gac aac ggc cgg ggt ctg
gtg ctt cct 144Lys Ala Asn Gln Gln Lys Gln Asp Asn Gly Arg Gly Leu
Val Leu Pro 35 40 45ggc tac aag
tac ctc gga ccc ttc aac gga ctc gac aag ggg gag ccc 192Gly Tyr Lys
Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60gtc aac gcg gcg gac gca gcg gcc ctc gag cac gac
aag gcc tac gac 240Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp
Lys Ala Tyr Asp65 70 75
80cag cag ctc aaa gcg ggt gac aat ccg tac ctg cgg tat aac cac gcc
288Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala
85 90 95gac gcc gag ttt cag gag
cgt ctg caa gaa gat acg tca ttt ggg ggc 336Asp Ala Glu Phe Gln Glu
Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100
105 110aac ctc ggg cga gca gtc ttc cag gcc aag aag cgg
gtt ctc gaa cct 384Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg
Val Leu Glu Pro 115 120 125ctc ggt
ctg gtt gag gaa ggc gct aag acg gct cct gca aag aag aga 432Leu Gly
Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Ala Lys Lys Arg 130
135 140ccg gta gag ccg tca cct cag cgt tcc ccc gac
tcc tcc acg ggc atc 480Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp
Ser Ser Thr Gly Ile145 150 155
160ggc aag aaa ggc cag cag ccc gcc aga aag aga ctc aat ttc ggt cag
528Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln
165 170 175act ggc gac tca gag
tca gtc ccc gac cct caa cct ctc gga gaa cct 576Thr Gly Asp Ser Glu
Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro 180
185 190cca gca gcg ccc tct agt gtg gga tct ggt aca gtg
gct gca ggc ggt 624Pro Ala Ala Pro Ser Ser Val Gly Ser Gly Thr Val
Ala Ala Gly Gly 195 200 205ggc gca
cca atg gca gac aat aac gaa ggt gcc gac gga gtg ggt aat 672Gly Ala
Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn 210
215 220gcc tca gga aat tgg cat tgc gat tcc aca tgg
ctg ggc gac aga gtc 720Ala Ser Gly Asn Trp His Cys Asp Ser Thr Trp
Leu Gly Asp Arg Val225 230 235
240att acc acc agc acc cga acc tgg gcc ctg ccc acc tac aac aac cac
768Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His
245 250 255ctc tac aag caa atc
tcc agt gaa act gca ggt agt acc aac gac aac 816Leu Tyr Lys Gln Ile
Ser Ser Glu Thr Ala Gly Ser Thr Asn Asp Asn 260
265 270acc tac ttc ggc tac agc acc ccc tgg ggg tat ttt
gac ttt aac aga 864Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe
Asp Phe Asn Arg 275 280 285ttc cac
tgc cac ttc tca cca cgt gac tgg cag cga ctc atc aac aac 912Phe His
Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290
295 300aac tgg gga ttc cgg ccc aag aag ctg cgg ttc
aag ctc ttc aac atc 960Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe
Lys Leu Phe Asn Ile305 310 315
320cag gtc aag gag gtc acg acg aat gac ggc gtt acg acc atc gct aat
1008Gln Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn
325 330 335aac ctt acc agc acg
att cag gta ttc tcg gac tcg gaa tac cag ctg 1056Asn Leu Thr Ser Thr
Ile Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu 340
345 350ccg tac gtc ctc ggc tct gcg cac cag ggc tgc ctg
cct ccg ttc ccg 1104Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu
Pro Pro Phe Pro 355 360 365gcg gac
gtc ttc atg att cct cag tac ggc tac ctg act ctc aac aat 1152Ala Asp
Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn 370
375 380ggc agt cag tct gtg gga cgt tcc tcc ttc tac
tgc ctg gag tac ttc 1200Gly Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr
Cys Leu Glu Tyr Phe385 390 395
400ccc tct cag atg ctg aga acg ggc aac aac ttt gag ttc agc tac agc
1248Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser
405 410 415ttc gag gac gtg cct
ttc cac agc agc tac gca cac agc cag agc ctg 1296Phe Glu Asp Val Pro
Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420
425 430gac cgg ctg atg aat ccc ctc atc gac cag tac ttg
tac tac ctg gcc 1344Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu
Tyr Tyr Leu Ala 435 440 445aga aca
cag agt aac cca gga ggc aca gct ggc aat cgg gaa ctg cag 1392Arg Thr
Gln Ser Asn Pro Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln 450
455 460ttt tac cag ggc ggg cct tca act atg gcc gaa
caa gcc aag aat tgg 1440Phe Tyr Gln Gly Gly Pro Ser Thr Met Ala Glu
Gln Ala Lys Asn Trp465 470 475
480tta cct gga cct tgc ttc cgg caa caa aga gtc tcc aaa acg ctg gat
1488Leu Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp
485 490 495caa aac aac aac agc
aac ttt gct tgg act ggt gcc acc aaa tat cac 1536Gln Asn Asn Asn Ser
Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His 500
505 510ctg aac ggc aga aac tcg ttg gtt aat ccc ggc gtc
gcc atg gca act 1584Leu Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val
Ala Met Ala Thr 515 520 525cac aag
gac gac gag gac cgc ttt ttc cca tcc agc gga gtc ctg att 1632His Lys
Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile 530
535 540ttt gga aaa act gga gca act aac aaa act aca
ttg gaa aat gtg tta 1680Phe Gly Lys Thr Gly Ala Thr Asn Lys Thr Thr
Leu Glu Asn Val Leu545 550 555
560atg aca aat gaa gaa gaa att cgt cct act aat cct gta gcc acg gaa
1728Met Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu
565 570 575gaa tac ggg ata gtc
agc agc aac tta caa gcg gct aat act gca gcc 1776Glu Tyr Gly Ile Val
Ser Ser Asn Leu Gln Ala Ala Asn Thr Ala Ala 580
585 590cag aca caa gtt gtc aac aac cag gga gcc tta cct
ggc atg gtc tgg 1824Gln Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro
Gly Met Val Trp 595 600 605cag aac
cgg gac gtg tac ctg cag ggt ccc atc tgg gcc aag att cct 1872Gln Asn
Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro 610
615 620cac acg gat ggc aac ttt cac ccg tct cct ttg
atg ggc ggc ttt gga 1920His Thr Asp Gly Asn Phe His Pro Ser Pro Leu
Met Gly Gly Phe Gly625 630 635
640ctt aaa cat ccg cct cct cag atc ctg atc aag aac act ccc gtt ccc
1968Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro
645 650 655gct aat cct ccg gag
gtg ttt act cct gcc aag ttt gct tcg ttc atc 2016Ala Asn Pro Pro Glu
Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile 660
665 670aca cag tac agc acc gga caa gtc agc gtg gaa atc
gag tgg gag ctg 2064Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile
Glu Trp Glu Leu 675 680 685cag aag
gaa aac agc aag cgc tgg aac ccg gag att cag tac acc tcc 2112Gln Lys
Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser 690
695 700aac ttt gaa aag cag act ggt gtg gac ttt gcc
gtt gac agc cag ggt 2160Asn Phe Glu Lys Gln Thr Gly Val Asp Phe Ala
Val Asp Ser Gln Gly705 710 715
720gtt tac tct gag cct cgc cct att ggc act cgt tac ctc acc cgt aat
2208Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn
725 730 735ctg taa
2214Leu8737PRTadeno-associated virus 7 8Met Ala Ala Asp Gly Tyr Leu Pro
Asp Trp Leu Glu Asp Asn Leu Ser1 5 10
15Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro
Lys Pro 20 25 30Lys Ala Asn
Gln Gln Lys Gln Asp Asn Gly Arg Gly Leu Val Leu Pro 35
40 45Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu
Asp Lys Gly Glu Pro 50 55 60Val Asn
Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp65
70 75 80Gln Gln Leu Lys Ala Gly Asp
Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90
95Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser
Phe Gly Gly 100 105 110Asn Leu
Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115
120 125Leu Gly Leu Val Glu Glu Gly Ala Lys Thr
Ala Pro Ala Lys Lys Arg 130 135 140Pro
Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile145
150 155 160Gly Lys Lys Gly Gln Gln
Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln 165
170 175Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro
Leu Gly Glu Pro 180 185 190Pro
Ala Ala Pro Ser Ser Val Gly Ser Gly Thr Val Ala Ala Gly Gly 195
200 205Gly Ala Pro Met Ala Asp Asn Asn Glu
Gly Ala Asp Gly Val Gly Asn 210 215
220Ala Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val225
230 235 240Ile Thr Thr Ser
Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245
250 255Leu Tyr Lys Gln Ile Ser Ser Glu Thr Ala
Gly Ser Thr Asn Asp Asn 260 265
270Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285Phe His Cys His Phe Ser Pro
Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295
300Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn
Ile305 310 315 320Gln Val
Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn
325 330 335Asn Leu Thr Ser Thr Ile Gln
Val Phe Ser Asp Ser Glu Tyr Gln Leu 340 345
350Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro
Phe Pro 355 360 365Ala Asp Val Phe
Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn 370
375 380Gly Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys
Leu Glu Tyr Phe385 390 395
400Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser
405 410 415Phe Glu Asp Val Pro
Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420
425 430Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu
Tyr Tyr Leu Ala 435 440 445Arg Thr
Gln Ser Asn Pro Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln 450
455 460Phe Tyr Gln Gly Gly Pro Ser Thr Met Ala Glu
Gln Ala Lys Asn Trp465 470 475
480Leu Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp
485 490 495Gln Asn Asn Asn
Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His 500
505 510Leu Asn Gly Arg Asn Ser Leu Val Asn Pro Gly
Val Ala Met Ala Thr 515 520 525His
Lys Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile 530
535 540Phe Gly Lys Thr Gly Ala Thr Asn Lys Thr
Thr Leu Glu Asn Val Leu545 550 555
560Met Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr
Glu 565 570 575Glu Tyr Gly
Ile Val Ser Ser Asn Leu Gln Ala Ala Asn Thr Ala Ala 580
585 590Gln Thr Gln Val Val Asn Asn Gln Gly Ala
Leu Pro Gly Met Val Trp 595 600
605Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro 610
615 620His Thr Asp Gly Asn Phe His Pro
Ser Pro Leu Met Gly Gly Phe Gly625 630
635 640Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn
Thr Pro Val Pro 645 650
655Ala Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile
660 665 670Thr Gln Tyr Ser Thr Gly
Gln Val Ser Val Glu Ile Glu Trp Glu Leu 675 680
685Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr
Thr Ser 690 695 700Asn Phe Glu Lys Gln
Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly705 710
715 720Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr
Arg Tyr Leu Thr Arg Asn 725 730
735Leu926DNAArtificial Sequenceprimer sequence 9gctgcgtcaa
ctggaccaat gagaac
261028DNAArtificial Sequenceprimer sequence 10cgcagagacc aaagttcaac
tgaaacga 281125DNAArtificial
Sequenceprimer sequence 11ggcgaacagc ggacaccgat atgaa
251225DNAArtificial Sequenceprimer sequence
12ggctctcgtc gcgtgagaat gagaa
251322DNAArtificial SequencemiRNA target sequence 13agtgaattct accagtgcca
ta 221424DNAArtificial
SequencemiRNA target sequence 14agtgtgagtt ctaccattgc caaa
24
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20210149323 | IMAGE FORMING APPARATUS |
20210149322 | IMAGE FORMING APPARATUS |
20210149321 | IMAGE FORMING APPARATUS HAVING SIMPLE CONFIGURATION AND CAPABLE OF MEASURING TONER CURRENT INCLUDED IN DEVELOPING CURRENT, AND ACCURATELY CALCULATING TONER CHARGE AMOUNT BASED ON MEASUREMENT RESULT |
20210149320 | IMAGE FORMING APPARATUS USING TWO-COMPONENT DEVELOPER INCLUDING TONER AND CARRIER |
20210149319 | ADJUSTING POWER LEVELS TO COMPENSATE FOR PRINT SPOT SIZE VARIATION |