Patent application title: L-LACTATE PRODUCTION IN CYANOBACTERIA
Inventors:
Martijn Bekker (Amsterdam, NL)
Maarten Joost Teixeira De Mattos (Amsterdam, NL)
Klaas Jan Hellingwerf (Amsterdam, NL)
Assignees:
PHOTANOL B.V.
IPC8 Class: AC12P756FI
USPC Class:
435139
Class name: Preparing oxygen-containing organic compound containing a carboxyl group lactic acid
Publication date: 2013-03-21
Patent application number: 20130071895
Abstract:
A process of producing L-lactate as defined herein by feeding carbon
dioxide to a culture of a cyanobacterial cell and subjecting said culture
to light, wherein said cell is capable of expressing a nucleic acid
molecule, wherein the expression of said nucleic acid molecule confer on
the cell the ability to convert a glycolytic intermediate into L-lactate
and wherein said nucleic acid molecule is under the control of a
regulatory system which responds to light or to a change in the
concentration of a nutrient in said culture.Claims:
1. A process of producing L-lactate by feeding carbon dioxide to a
culture of a cyanobacterial cells and subjecting said culture to light,
wherein said cell comprises a nucleic acid molecule coding for an enzyme
capable of converting pyruvate to L-lactate, preferably for a L-lactate
dehydrogenase, more preferably for a NAD(P)H-dependent L-lactate
dehydrogenase, and wherein the expression of said nucleic acid molecule
confers on the cell the ability to convert a glycolytic intermediate into
L-lactate.
2. A process according to claim 1, wherein said nucleic acid molecule is under the control of a regulatory system which responds to light intensity.
3. A process according to claim 1, wherein said enzyme is substantially not sensitive towards oxygen inactivation.
4. (canceled)
5. A process according to claim 1, wherein the nucleic acid molecule comprises a a nucleotide sequence encoding a L-lactate dehydrogenase, wherein said nucleotide sequence is selected from the group consisting of: i. nucleotide sequences encoding a L-lactate dehydrogenase, said L-lactate dehydrogenase comprising an amino acid sequence that has at least 40% sequence identity with the amino acid sequence of SEQ ID NO:2; ii. nucleotide sequences comprising a nucleotide sequence that has at least 40% sequence identity with the nucleotide sequence of SEQ ID NO:1; iii. nucleotide sequences the reverse complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); and iv. nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code.
6. A process according to claim 1, wherein the nucleic acid molecule comprised in the cell is integrated into its genome, preferably via homologous recombination.
7. A process according to claim 1, wherein the nucleic acid molecule is under the control of a light-regulated promoter, preferably a psbA2 promoter, more preferably a light-regulated promoter that has at least 80% nucleic acid sequence identity with SEQ ID NO: 5.
8. A process according to claim 1, wherein the nucleic acid molecule is under the control of a nutrient-regulated promoter, preferably a SigE promoter, more preferably a nutrient-regulated promoter that has at least 80% nucleic acid sequence identity with SEQ ID NO:3.
9. A process according to claim 1, wherein L-lactate is separated from the culture.
10. A process according to claim 1, wherein the glycolytic intermediate is pyruvate.
11. A nucleic acid molecule comprising a nucleotide sequence encoding a L-lactate dehydrogenase, wherein said nucleotide sequence is selected from the group consisting of: i. nucleotide sequences encoding a L-lactate dehydrogenase, said L-lactate dehydrogenase comprising an amino acid sequence that has at least 40% sequence identity with the amino acid sequence of SEQ ID NO:2; ii. nucleotide sequences comprising a nucleotide sequence that has at least 40% sequence identity with the nucleotide sequence of SEQ ID NO:1; iii. nucleotide sequences the reverse complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); and iv. nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code; and wherein the nucleotide sequence is under the control of a regulatory system which responds to light by linking said nucleotide sequence to a psbA2 promoter, preferably a light-regulated promoter that has at least 80% nucleic acid sequence identity with SEQ ID NO: 5.
12. (canceled)
13. (canceled)
14. A Cyanobacterium comprising an expression vector comprising a nucleic acid molecule as defined in claim 12, wherein the expression of said nucleic acid molecule confers on the Cyanobacterium the ability to convert a glycolytic intermediate into L-lactate and wherein the nucleic acid molecule is under the control of a regulatory system which responds to light intensity when culturing said Cyanobacteria.
15. A Cyanobacterium according to claim 14, wherein the glycolytic intermediate, is pyruvate.
16. A Cyanobacterium according to claim 14, wherein the nucleic acid molecule comprised in the Cyanobacteria is integrated into its genome, preferably via homologous recombination.
17. A process according to claim 1, wherein said nucleic acid molecule is under the control of a regulatory system which responds a change in the concentration of a nutrient of said culture.
18. A process according to claim 1, wherein the cyanobacterial cell is derived from a Synechocystis cell, preferably a Synechocystis PCC 6803 cell.
19. A Cyanobacterium according to claim 14, wherein the Cyanobacterium is derived from a Synechocystis, preferably a Synechocystis PCC 6803.
Description:
FIELD OF THE INVENTION
[0001] The invention relates to a process of producing an L-lactate produced in the pathway leading to L-lactate by feeding carbon dioxide to a culture of a cyanobacterial cell and subjecting said culture to light, wherein said cell is capable of expressing a nucleic acid molecule wherein the expression of said nucleic acid molecule confers on said cell the ability to convert a glycolytic intermediate such as pyruvate or glyceraldehyde 3-phosphate into L-lactate and wherein expression of said nucleic acid molecule is under the control of a regulatory system which responds to a change in the concentration of a nutrient in said culture. The invention further relates to a cyanobacterial cell for use in this process.
BACKGROUND OF THE INVENTION
[0002] Numerous biotechnological processes make use of genetically engineered organisms in order to produce bulk or fine chemicals, proteins or antibiotics. In many cases, increased production has been obtained by improved gene expression and by optimization of growth conditions. In all processes we are aware of, the initial carbon-precursor has been and still is sugar (notably glucose, but many other mono- and polysaccharides are in use) or related organic substrates: solventogenesis (including butanol and ethanol) and organic acid production (e.g. lactic-, citric- or succinic acid) always starts from glucose, which makes it inefficient as the production process uses a high energy initial compound as substrate.
[0003] Lactic acid is a naturally occurring organic acid, which has many applications, e.g. it can be used as an acidulant, preservative in the food industry, pharmaceutical, leather and textile industries, as well as a chemical feedstock (Vijayakumar et al. (2008) Chem. Biochem. Eng. Q 22(2):245-264).
[0004] Lactic acid can be produced either via chemical synthesis or via microbial fermentation. Currently, most of the lactic acid is producted via microbial fermentation using lactic acid bacteria, although production using filamentous fungi is also known (Vijayakumar et al. vide supra).
[0005] However, there is still a need for an alternative and even improved production process of L-lactate, preferably without the need of expensive or complicated starting materials, which process does not have the drawbacks of existing processes.
DESCRIPTION OF THE INVENTION
[0006] Energy ultimately comes from the sun and this energy drives photosynthetic process in plants and photoautotrophic bacteria. This knowledge has led to new methods for the synthesis of biochemicals. In essence, these processes employ plants and algal species to reduce CO2 to the level of sugars and cell material. After harvesting, these end products are converted to ethanol by yeast fermentation (in the case of crops) or converted chemically to biofuels (in the case of algae). The overall energy conservation of these methods is highly inefficient and therefore demands large surface areas. In addition, the processes are rather labor-intensive, are demanding with respect to water consumption and affect foodstock prices with adverse consequences for food supplies. A more remotely similar process is based on the conversion of solar energy into hydrogen. Also this process suffers from a severely decreased efficiency.
[0007] U.S. Pat. No. 6,699,696 describes a process of producing ethanol by feeding carbon dioxide to a cyanobacterial cell, especially a Synechococcus comprising a nucleic acid molecule encoding an enzyme enabling the cell to convert pyruvate into ethanol, subjecting said cyanobacterial cell to sun energy and collecting ethanol. This system has several drawbacks among others the expression system used is temperature sensitive which demands to adapt the production system for such regulation.
[0008] WO 2009/078712 describes a process of producing ethanol, propanol, butanol, acetone, 1,3-propanediol, ethylene or D-lactate and where appropriate intermediary compounds in the pathway leading to any of these organic compounds. The process is carried out by feeding carbon dioxide to a culture of cyanobacterial cells and subjecting the culture to light, wherein the cells are capable of expressing a nucleic acid molecule under the control of a regulatory system which responds to a change in the concentration of a nutrient in the culture which confers on the cell the ability to convert a glycolytic intermediate into the above-mentioned organic compounds and/or into intermediary compounds.
The present invention relates to a scalable process for the production of an organic compound suitable as biochemical for large scale plastic production. The invention combines metabolic properties of photoautotrophic and chemoorganotrophic prokaryotes and is based on the employment of recombinant oxyphototrophs with high rates of conversion of Calvin cycle intermediates to a fermentative end product. Its novelty resides in the fact that its core chemical reactions use CO2 as the sole carbon-containing precursor and light (preferably sunlight) as the sole energy source to drive CO2 reduction. Preferably, production is controlled by a nutrient- or light-mediated promoter. Using a nutrient-mediated promoter, production is controlled by a medium component and starts at the most appropriate time, namely at the highest possible cell density. Alternatively, a light-mediated promoter is controlled by light intensity. Whereas in current production processes for biochemicals, organisms are substrate (e.g., crops in ethanol production) or product (e.g., microalgae as biodiesel), here microorganisms are used as highly specialized catalysts for the conversion of CO2 as substrate to a useful end product. These catalysts can be subjected to optimization strategies through physical- and chemical systems-biology approaches. The biochemical background of the invention is more extensively described in example 1 of WO 2009/078712 (herein incorporated by reference). Each aspect of the invention is more extensively described below.
Cyanobacteria
[0009] In a first aspect, the invention provides a Cyanobacterium capable of expressing a nucleic acid molecule, wherein the expression of said nucleic acid molecule confers on the Cyanobacterium the ability to convert a glycolytic intermediate into an L-lactate produced in the pathway leading to L-lactate. Preferably, the nucleic acid molecule is under the control of a regulatory system which responds to a change in the concentration of a nutrient or to light intensity when culturing said Cyanobacterium. In the context of the invention a Cyanobacterium or a cyanobacterial cell (also known as a blue-green algae) is a photosynthetic unicellular prokaryote. Examples of Cyanobacteria include the genera Aphanocapsa, Anabaena, Nostoc, Oscillatoria, Synechococcus, Gloeocapsa, Agmenellum, Scytonema, Mastigocladus, Arthrosprira, Haplosiphon. A preferred genus is Synechococcus. A more preferred species of this genus is a Synechocystis species. Even more preferably, the Synechocystis is a Pasteur Culture Collection (PCC) 6083 Synechocystis, which is a publicly available strain via ATCC for example. A preferred organism used is the phototrophic Synechocystis PCC 6083: this is a fast growing cyanobacterium with no specific nutritional demands. Its physiological traits are well-documented: it is able to survive and grow in a wide range of conditions. For example, Synechocystis sp. PCC 6803 can grow in the absence of photosynthesis if a suitable fixed-carbon source such as glucose is provided. Perhaps most significantly, Synechocystis sp. PCC 6803 was the first photosynthetic organism for which the entire genome sequence was determined (available on http://www.kazusa.or.jp/cyano/cyano.html). In addition, an efficient gene deletion strategy (Shestakov S V et al, (2002), Photosynthesis Research, 73: 279-284 and Nakamura Y et al, (1999), Nucleic Acids Res. 27:66-68) is available for Synechocystis sp. PCC 6803, and this organism is furthermore easily transformable via homologous recombination (Grigirieva G A et al, (1982), FEMS Microbiol. Lett. 13: 367-370). A Cyanobacterium as defined herein is capable of converting a glycolytic intermediate into L-lactate as defined herein. A biochemical background of the Cyanobacteria of the invention is given in WO 2009/078712 (see e.g. Example 1 of WO 2009/078712). A Cyanobacterium as defined herein preferably comprises a nucleic acid molecule encoding an enzyme capable of converting a glycolytic intermediate into L-lactate as defined herein. A Cyanobacterium is therefore capable of expressing a nucleic acid molecule as defined herein, whereby the expression of a nucleic acid molecule as defined herein confers on the Cyanobacterium the ability to convert a glycolytic intermediate into L-lactate as defined herein. "Converting a glycolytic intermediate into L-lactate" preferably means that detectable amounts of an organic compound are detected in the culture of a Cyanobacterium as defined herein cultured in the presence of light and dissolved carbon dioxide and/or bicarbonate ions during at least 1 day using a suitable assay for the organic compound. A preferred concentration of said dissolved carbon dioxide and/or bicarbonate ions is at least the natural occurring concentration at neutral to alkaline conditions (pH 7 to 8) being approximately 1 mM. A more preferred concentration of carbon dioxide and/or bicarbonate ions is higher than this natural occurring concentration. A preferred method to increase the carbon dioxide and/or bicarbonate ions in solution is by enrichment with waste carbon dioxide from industrial plants. The concentration of carbon dioxide in the gas that is sparged into the culture broth may be increased from the equivalent of 0.03% (air) up to 0.2%. L-lactate is produced within the cell and may spontaneously diffuse into the culture broth. A preferred assay for L-lactate is High Performance Liquid Chromatography (HPLC). A detectable amount for L-lactate is preferably at least 0.1 mM under said culture conditions and using said assay. Preferably, a detectable amount is at least 0.2 mM, 0.3 mM, 0.4 mM, or at least 0.5 mM.
L-lactate as Organic Product
[0010] When an organic product to be produced is L-lactate, preferred nucleic acid molecules code for enzymes capable of converting pyruvate into L-lactate, said enzyme comprise a lactate dehydrogenase. Preferred assays for L-lactate are HPLC and enzymatic assays. A detectable amount by HPLC of L-lactate is preferably at least 0.1 mM under said culture conditions as defined earlier herein and using said assay. A detectable amount by enzymatic assays of L-lactate is preferably at least 0.2 mg/l under said culture conditions as defined earlier herein and using said assay. Therefore, in this preferred embodiment, a Cyanobacterium comprises a nucleic acid molecule encoding a L-lactate dehydrogenase, preferably a NAD(P)H-dependent L-lactate dehydrogenase (EC 1.1.1.27; also known as ldh, ldhB; preferably from Lactococcus lactis, more preferably from Lactococcus lactis subsp. lactis MG1363) Accordingy, this preferred embodiment relates to a Cyanobacterium capable of expressing at least one nucleic acid molecule, said nucleic acid molecule being represented by a nucleotide sequence, wherein the expression of this nucleotide sequence confers on the cell the ability to convert the glycolytic intermediate pyruvate into L-lactate:
[0011] (a) a nucleotide sequence encoding a L-lactate dehydrogenase, wherein said nucleotide sequence is selected from the group consisting of:
[0012] i. nucleotide sequences encoding a L-lactate dehydrogenase, said L-lactate dehydrogenase comprising an amino acid sequence that has at least 40% sequence identity with the amino acid sequence of SEQ ID NO:2.
[0013] ii. nucleotide sequences comprising a nucleotide sequence that has at least 40% sequence identity with the nucleotide sequence of SEQ ID NO:1.
[0014] iii. nucleotide sequences the reverse complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii);
[0015] iv. nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code.
[0016] Each nucleotide sequence or amino acid sequence described herein by virtue of its identity percentage (at least 40%) with a given nucleotide sequence or amino acid sequence respectively has in a further preferred embodiment an identity of at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, and most preferably 100% identity with the given nucleotide or amino acid sequence respectively. In a preferred embodiment, sequence identity is determined by comparing the whole length of the sequences as identified herein.
Each nucleotide sequence encoding an enzyme as described herein may encode either a prokaryotic or an eukaryotic enzyme, i.e. an enzyme with an amino acid sequence that is identical to that of an enzyme that naturally occurs in a prokaryotic or eukaryotic organism. The present inventors have found that the ability of a particular enzyme or to a combination of particular enzymes as defined herein to confer to a Cyanobacterial cell the ability to convert a glycolytic intermediate into L-lactate does not depend so much on whether the enzyme is of prokaryotic or eukaryotic origin. Rather this depends on the relatedness (identity percentage) of the enzyme amino acid sequence or corresponding nucleotide sequence to that of the corresponding identified SEQ ID NO. Alternatively or in combination with previous preferred embodiments, the invention relates to a further preferred embodiment, wherein at least one enzyme as defined herein is substantially not sensitive towards oxygen inactivation. "Being substantially not sensitive towards oxygen inactivation" preferably means that when such enzyme is expressed in a Cyanobacterium as described herein and when this Cyanobacterium is cultured in a process of the invention, significant activity of said enzyme is detectable using a specific assay known to the skilled person. More preferably, a significant activity of said enzyme is at least 20% of the activity of the same enzyme expressed in the same Cyanobacterium but cultured in the absence of oxygen. Even more preferably, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of the activity is detectable. Most preferably, the activity of said enzyme as expressed in a Cyanobacterium as described herein and when this Cyanobacterium is cultured in the process of the invention is identical with the activity of the same enzyme as expressed in a same Cyanobacterium as described herein and when this Cyanobacterium is cultured in the absence of oxygen. This is an advantage of the present invention that the Cyanobacterium hence obtained is preferably used in a process of the invention wherein oxygen is produced, since it will substantially not affect the activity of the enzymes used herein. Alternatively or in combination with previous preferred embodiments, the invention relates to a further preferred embodiment wherein, a Cyanobacterium as defined herein is a Cyanobacterium that has been transformed with a nucleic acid construct comprising a nucleotide sequence encoding an enzyme as defined above depending on the organic product to be produced. A nucleic acid construct comprising a nucleic acid molecule coding for a given enzyme as defined herein will ensure expression of the given nucleic acid molecule, and of the corresponding enzyme in a Cyanobacterium. In a more preferred embodiment, a nucleic acid construct comprises more than one nucleic acid molecule, each nucleic acid molecule coding for a given enzyme. In an even more preferred embodiment, a nucleic acid construct comprises two, three, four nucleic acid molecules, each nucleic acid molecule coding for a given enzyme. In a most preferred embodiment, a nucleic acid construct comprises all nucleic acid molecules needed for the conversion of a glycolytic intermediate into L-lactate, each nucleic acid molecule coding for a given enzyme. This most preferred embodiment is illustrated in example 2. In this most preferred embodiment, a nucleic acid construct comprises an expression cassette, said expression cassette comprising each needed nucleic acid molecule. Each nucleic acid molecule is operably linked with other nucleic acid molecule present. Most preferably, a suitable promoter is operably linked with the expression cassette to ensure expression of the nucleic acid molecule in a Cyanobacterium as later defined herein. To this end, a nucleic acid construct may be constructed as described in e.g. U.S. Pat. No. 6,699,696 or U.S. Pat. No. 4,778,759. A Cyanobacterium may comprise a single but preferably comprises multiple copies of each nucleic acid construct. A nucleic acid construct may be maintained on a plasmid which is subject to autonomous replication or it may be maintained on a nucleic acid designed for integration into the host chromosome. Suitable plasmid nucleic acid constructs may e.g. be based on the pBluescript from the company Strategene or on any other plasmid. Preferably, however, each nucleic acid construct is integrated in one or more copies into the genome of a cyanobacterial cell. Integration into a cyanobacterial cell's genome may occur at random by illegitimate recombination but preferably a nucleic acid construct is integrated into the Cyanobacterium cell's genome by homologous recombination as is well known in the art (U.S. Pat. No. 4,778,759). Homologous recombination occurs preferably at a neutral integration site. A neutral integration site is an integration which is not expected to be necessary for the production process of the invention, i.e for the growth and/or the production of L-lactate as defined herein. A preferred integration site is the nrt operon as illustrated in the examples (Osanai, T., Imamura, S., Asayama, M., Shirai, M., Suzuki, I., Murata, N., Tanaka, K, (2006) Nitrogen induction of sugar catabolic gene expression in Synechocystis sp. PCC 6803. DNA Research 13, 185-19). Accordingly, in a more preferred embodiment, a cyanobacterial cell of the invention comprises a nucleic acid construct comprising a nucleic acid molecule, said nucleic acid molecule being represented by a nucleotide sequence, said nucleotide sequence being a coding sequence of an enzyme as identified herein. Said cyanobacterial cell is capable of expression of these enzymes. In an even more preferred embodiment, a nucleic acid molecule encoding an enzyme is operably linked to a promoter that causes sufficient expression of a corresponding nucleic acid molecule in a Cyanobacterium to confer to a Cyanobacterium the ability to convert a glycolytic intermediate into L-lactate. In case of an expression cassette as earlier defined herein, a promoter is upstream of the expression cassette. Accordingly, in a further aspect, the invention also encompasses a nucleic acid construct as earlier outlined herein. Preferably, a nucleic acid construct comprises a nucleic acid molecule encoding an enzyme as earlier defined herein. Nucleic acid molecules encoding an enzyme have been all earlier defined herein.
[0017] A promoter that could be used to achieve the expression of a nucleic acid molecule coding for an enzyme as defined herein may be not native to a nucleic acid molecule coding for an enzyme to be expressed, i.e. a promoter that is heterologous to the nucleic acid molecule (coding sequence) to which it is operably linked. Although a promoter preferably is heterologous to a coding sequence to which it is operably linked, it is also preferred that a promoter is homologous, i.e. endogenous to a Cyanobacterium. Preferably, a heterologous promoter (to the nucleotide sequence) is capable of producing a higher steady state level of a transcript comprising a coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is a promoter that is native to a coding sequence, preferably under conditions where sun light and carbon dioxide are present. A suitable promoter in this context includes both constitutive and inducible natural promoters as well as engineered promoters. A promoter used in a Cyanobacterium cell of the invention may be modified, if desired, to affect its control characteristics. A preferred promoter is a PsbA2, as is further outlined below in the next paragraph.
[0018] Alternatively or in combination with previous preferred embodiments, the invention relates to a further preferred embodiment, wherein a nucleic acid molecule as defined herein is expressed constitutively and is additionally regulated so as to respond to a change in light intensity (Mohamed, A., Eriksson, J., Osiewacz, H. D., Jansson, C. (1993) Differential expression of the psbA genes in the cyanobacterium Synechocystis 6803. Molecular and General Genetics 238, 161-168) and (Eriksson J., Salih, G. F., Ghebramedhin, H., Jansson, C. (2000) Deletion Mutagenesis of the psbA2 Region in Synechocystis 6803: Identification of a Putative cis Element Involved in Photoregulation. Molecular Cell Biology Research Communications 3, 292-298). In a more preferred embodiment, the expression of a nucleic acid molecule is induced when a culture is exposed to higher light intensities such as for example the light intensity of day as compared to the light intensity at night. As exemplified in example 4, this is preferably achieved by using a PsbA2 promoter in a nucleic acid construct comprising a nucleic acid molecule as defined herein. Such promoter is always active at a basal level, hence also under standard low intensity growth light as well as in darkness. During the day (at least irradiance of 250, 260, 270, 280, 290 or 300 μE/m2/sec), a Cyanobacterium of the invention will grow and produce L-lactate. During the night (less irradiance than 100, 90, 80, 70, 60 or 50 μE/m2/sec), a Cyanobacterium will not grow and expression of the L-lactate producing enzyme L-lactate dehydrogenase is lowered. When light is present at considerable higher intensities, e.g. at least 250, 260, 270, 280, 290 or 300 μE/m2/sec, as commonly used standard growth light intensities, the PsbA2 promoter is induced. As a consequence, in this process there is more production of L-lactate as defined herein if the cells are exposed to high light intensity, i.e. at least 250, 260, 270, 280, 290 or 300 μE/m2/sec. There is a basal production if cells are kept in darkness or at light intensities below 100, 90, 80, 70, 60 or 50 μE/m2/sec. This production process has several advantages compared to production processes under a constitutive promoter only: a) As with a constitutive promoter the expression of a nucleic acid construct comprising a nucleic acid molecule as defined herein is always active and therefore L-lactate will always be formed; and b) The yield of L-lactate will be improved. Although not wishing to be bound by any theory, this might be due to the fact that high light treatment as defined above results in higher expression of the nucleic acid molecule as defined herein, whereas at the same time the availability of high light provides also a higher carbon flux to the central carbon metabolite pool. The skilled person knows how to assess the intensity of light in such a way that the cultures production is optimized regarding light influx and its carbon balance.
[0019] The full promoter of psbA2 (including its light responsive elements) is identified as a region up to -167 by upstream the start codon ofpsbA2. (Eriksson J., Salih, G. F., Ghebramedhin, H., Janson, C. (2000) Deletion Mutagenesis of the psbA2 Region in Synechocystis 6803: Identification of a Putative cis Element Involved in Photoregulation. Molecular Cell Biology Research Communications 3, 292-298). The gene product of psbA2 is the D1 protein of photosystem II (PSII). Its degradation is affected by the rate of PSII photo damage which also stimulates new transcription of psbA2. (Komenda, J., Hassan, H. A. G., Diner, B. A., Debus, R. J., Barber, J., Nixon, P. J. (2000) Degradation of the Photosystem II D1 and D2 proteins in different strains of the cyanobacterium Synechocystis PCC 6803 varying with respect to the type and level of psbA transcript. Plant Molecular Biology 42 635-645). Over-expression of psbA2 can be achieved by exposure to light intensities above 250 μE/m2/sec for a defined period of time to stimulate synthesis of new transcript of psbA2. (Kommalapati, M., Hwang, H. J., Wang, H. L., Burnap, R. L. (2007) Engineered ectopic expression of the psbA gene encoding the photosystem II D1 protein in Synechocystis sp. PCC6803. Photosynthetic Research 92 315-325). Preferably, the cells are exposed to light intensities above 250 μE/m2/sec for at least 15 minutes, however they may be exposed longer, such as for hours, for days or for weeks. Preferably, the psbA2 promoter as identified in SEQ ID NO:5 is used or a promoter which has at least 80% identity with the sequence as provided in SEQ ID NO:5.
Alternatively or in combination with previous embodiments, a nucleic acid molecule as defined herein is expressed constitutively and is regulated so as to respond to a change in the concentration of a nutrient when culturing said Cyanobacteria of the invention. Preferably, this is achieved by a promoter, more preferrably, the promoter is a SigE controlled promotor of the glyceraldehyde dehydrogenase gene from Synechocystis PCC 6083 as identified in SEQ ID NO:3 (Takashi Osanai, et al, Positive Regulation of Sugar Catabolic Pathways in the Cyanobacterium Synechocystis sp. PCC 6803 by the Group 2 sigma Factor SigE. J. Biol. Chem. (2005) 35: 30653-30659) or a promoter which as at least 80% identity with the sequence as provided in SEQ ID NO:3. This promoter is quite advantageous to be used as outlined below in the next paragraph. Alternatively or in combination with previous preferred embodiments, the invention relates to a further preferred embodiment, wherein the expression of a nucleic acid molecule as defined herein is regulated so as to respond to a change in the concentration of a nutrient such as ammonium (Osanai, T., Imamura, S., Asayama, M., Shirai, M., Suzuki, I., Murata, N., Tanaka, K, (2006) Nitrogen induction of sugar catabolic gene expression in Synechocystis sp. PCC 6803. DNA Research 13, 185-195). In a more preferred embodiment, the expression of a nucleic acid molecule is induced when ammonium concentration is below a given value. This is preferably achieved by using a SigE promoter in a nucleic acid construct comprising a nucleic acid molecule as defined herein. Such promoter is inactive in a first phase of the process when ammonium is present in a concentration which is approximately above 1 mM. In this first phase, a Cyanobacterium will grow and not produce any L-lactate as defined herein. When the ammonium source, has been used for growth and its concentration is approximately below 1 mM, the SigE promoter is induced. As a consequence, the process is divided in 2 phases, a first phase where cell numbers increase and a second phase of the production process of the invention, which is characterized by the production of L-lactate as defined herein. This two phased production process has several advantages compared to one phase production processes: a) the growth phase is separated from the production phase and therefore high cell densities can be obtained in a short time b) the yield of L-lactate as defined herein will be improved due to the fact that no carbon flux to growth will occur in the second phase. The skilled person knows how to assess the concentration of a nutrient such as ammonium in the culture.
Method
[0020] In a second aspect, the invention relates to a process of producing L-lactate as defined herein by feeding carbon dioxide to a culture of a cyanobacterial cell and subjecting said culture to light, wherein said cell is capable of expressing a nucleic acid molecule, wherein the expression of said nucleic acid molecule confer on the cell the ability to convert a glycolytic intermediate into L-lactate and wherein said nucleic acid molecule is under the control of a regulatory system which responds to a change in the concentration of a nutrient in said culture. A Cyanobacterium, a glycolytic intermediate, L-lactate, a nucleic acid molecule, and a regulatory system have all earlier been defined herein. In a process of the invention, carbon dioxide is fed to a culture broth of Cyanobacteria. The skilled person knows that the carbon dioxide concentration is dependent from the temperature, the pH and the concentration of carbon dioxide present in the air used. Therefore, this is quite difficult to give an estimation of the concentration of carbon dioxide which is being used. Below, we give estimations of preferred concentrations used. A preferred feeding concentration of carbon dioxide is air enriched to 5% carbon dioxide. A preferred source of carbon dioxide may be the waste gas from an industrial plant. Usually a process is started with a culture (also named culture broth) of Cyanobacteria having an optical density measured at 660 nm of approximately 0.2 to 2.0 (OD660=0.2 to 2) as measured in any conventional spectrophotometer with a measuring path length of 1 cm. Usually the cell number in the culture doubles every 20 hours. A preferred process takes place in a tank with a depth of 30-50 cm exposed to sun light. In a preferred process, the number of cells increases until the source of ammonium is exhausted or below a given value as earlier explained herein, subsequently the production of L-lactate will start. In a preferred embodiment, the light used is natural. A preferred natural light is sunlight. Daylight (or sunlight) may have an intensity ranged between approximately 500 and approximately 1500 μEinstein/m2/s. In another preferred embodiment, the light used is artificial. Such artificial light may have an intensity ranged between approximately 70 and approximately 800 μEinstein/m2/s. Preferably, the cells are continuously under the light conditions as specified herein. However, the cells may also be exposed to high light intensities (such as e.g. daylight/sunlight) as defined elsewhere herein for a certain amount of time, after which the cells are exposed to a lower light intensity as defined elsewhere herein for a certain amount of time, and optionally this cycle is repeated. In a preferred embodiment, the cycle is the day/night cycle. In a preferred process, L-lactate is separated from the culture broth. This may be realized continuously with the production process or subsequently to it. Separation may be based on bipolar fractionating electrodialysis, membrane separation and/or precipitation methods. The skilled person will know which separating method is the most appropriate, such as for example as described in U.S. Pat. No. 6,280,985, U.S. Pat. No. 2,350,370, Vijayakumar et al. (2008) Chem. biochem. Eng. Q 22(2):245-264 or as described in http://www.jurag.dk/Lactic-acid-process-description.pdf.
Nucleic Acid Molecule and Expression Vector
[0021] In a further aspect, the invention relates to a nucleic acid molecule comprising a nucleotide sequence encoding a L-lactate dehydrogenases defined above and wherein the nucleotide sequence is under the control of a regulatory system which responds to light as is earlier defined herein. Preferably, a nucleotide sequence according to the invention is operably linked to a light-regulated promoter, preferably a psbA2 promoter, more preferably a light-regulated promoter that has at least 80% nucleic acid sequence identity with SEQ ID NO: 5, as further defined above. The invention also relates to an expression vector comprising a nucleic acid molecule of the invention. Preferably, an expression vector comprises a nucleotide sequence encoding a L-lactate dehydrogenase of the invention, which is operably linked to one or more control sequences, which direct the production of the encoded polypeptide in a cyanobacterium and wherein the nucleotide sequence is under the control of a regulatory system which responds to light as is earlier defined herein. An expression vector may be seen as a recombinant expression vector. An expression vector may be any vector which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of a nucleotide sequence encoding a polypeptide of the invention in a cyanobacterium.
General Definitions
Sequence Identity and Similarity
[0022] Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Usually, sequence identities or similarities are compared over the whole length of the sequences compared. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by various methods, known to those skilled in the art. In a preferred embodiment, sequence identity is determined by comparing the whole length of the sequences as identified herein.
[0023] Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990), publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894). A most preferred algorithm used is EMBOSS (http://www.ebi.ac.uk/emboss/align). Preferred parameters for amino acid sequences comparison using EMBOSS are gap open 10.0, gap extend 0.5, Blosum 62 matrix. Preferred parameters for nucleic acid sequences comparison using EMBOSS are gap open 10.0, gap extend 0.5, DNA full matrix (DNA identity matrix).
[0024] Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gln or his; Asp to glu; Cys to ser or ala; Gln to asn; Glu to asp; Gly to pro; His to asn or gln; Ile to leu or val; Leu to ile or val; Lys to arg; gln or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.
Hybridising Nucleic Acid Sequences
[0025] Nucleotide sequences encoding the enzymes expressed in the cell of the invention or promoters used in the cell of the invention may also be defined by their capability to hybridise with the nucleotide sequences of SEQ ID NO. 1, 3, or 5, respectively, under moderate, or preferably under stringent hybridisation conditions. Stringent hybridisation conditions are herein defined as conditions that allow a nucleic acid sequence of at least about 25, preferably about 50 nucleotides, 75 or 100 and most preferably of about 200 or more nucleotides, to hybridise at a temperature of about 65° C. in a solution comprising about 1 M salt, preferably 6×SSC or any other solution having a comparable ionic strength, and washing at 65° C. in a solution comprising about 0.1 M salt, or less, preferably 0.2×SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having about 90% or more sequence identity.
[0026] Moderate conditions are herein defined as conditions that allow a nucleic acid sequences of at least 50 nucleotides, preferably of about 200 or more nucleotides, to hybridise at a temperature of about 45° C. in a solution comprising about 1 M salt, preferably 6×SSC or any other solution having a comparable ionic strength, and washing at room temperature in a solution comprising about 1 M salt, preferably 6×SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours, and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having up to 50% sequence identity. The person skilled in the art will be able to modify these hybridisation conditions in order to specifically identify sequences varying in identity between 50% and 90%.
Homologous
[0027] The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically be operably linked to another promoter sequence than in its natural environment. When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as earlier presented. Preferably the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp. Preferably, two nucleic acid or polypeptides sequences are said to be homologous when they have more than 80% identity.
Heterologous
[0028] The term "heterologous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein (also named polypeptide or enzyme) that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but has been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognize as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous nucleic acid or protein. The term heterologous also applies to non-natural combinations of nucleic acid or amino acid sequences, i.e. combinations where at least two of the combined sequences are foreign with respect to each other.
Operably Linked
[0029] As used herein, the term "operably linked" refers to a linkage of polynucleotide elements (or coding sequences or nucleic acid sequence or nucleic acid molecule) in a functional relationship. A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the nucleic acid sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
Promoter
[0030] As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acid molecules, located upstream with respect to the direction of transcription of the transcription initiation site of the nucleic acid molecule, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation.
Genetic Modifications
[0031] For overexpression of an enzyme in a host cells=of the inventions as described above, as well as for additional genetic modification of a host cell=, preferably Cyanobacteria, host cells are transformed with the various nucleic acid constructs of the invention by methods well known in the art. Such methods are e.g. known from standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). Methods for transformation and genetic modification of cyanobacterial cells are known from e.g. U.S. Pat. No. 6,699,696 or U.S. Pat. No. 4,778,759.
[0032] A promoter for use in a nucleic acid construct for overexpression of an enzyme in a cyanobacterial cell of the invention has been described above. Optionally, a selectable marker may be present in a nucleic acid construct. As used herein, the term "marker" refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a Cyanobacterial cell containing the marker. A marker gene may be an antibiotic resistance gene whereby the appropriate antibiotic can be used to select for transformed cells from among cells that are not transformed. Preferably however, a non-antibiotic resistance marker is used, such as an auxotrophic marker (URA3, TRP1, LEU2). In a preferred embodiment, a Cyanobacterial cell transformed with a nucleic acid construct is marker gene free. Methods for constructing recombinant marker gene free microbial host cells are disclosed in EP-A-0 635 574 and are based on the use of bidirectional markers. Alternatively, a screenable marker such as Green Fluorescent Protein, lacZ, luciferase, chloramphenicol acetyltransferase, beta-glucuronidase may be incorporated into a nucleic acid construct of the invention allowing to screen for transformed cells.
[0033] Optional further elements that may be present in a nucleic acid construct of the invention include, but are not limited to, one or more leader sequences, enhancers, integration factors, and/or reporter genes, intron sequences, centromers, telomers and/or matrix attachment (MAR) sequences. A nucleic acid construct of the invention can be provided in a manner known per se, which generally involves techniques such as restricting and linking nucleic acids/nucleic acid sequences, for which reference is made to the standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press.
[0034] Methods for inactivation and gene disruption in Cyanobacterial cells are well known in the art (see e.g. Shestakov S V et al, (2002), Photosynthesis Research, 73: 279-284 and Nakamura Y et al, (1999), Nucleic Acids Res. 27:66-68).
In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb "to consist" may be replaced by "to consist essentially of" meaning that a peptide or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way
DESCRIPTION OF THE FIGURES
[0035] FIG. 1: pBPS1dh. The construct represents the transcriptional coupled approach. HOM1 and HOM2 are the integration platforms to facilitate (double) homologous recombination with the respective sequence in the cyanobacterial genome. KanR resulting in kanamycine resistant is used as positive (antibiotic) marker. The plasmid is based on pBluescript (SK+II, Strategene). In SEQ ID NO: 4 the nucleic acid sequence of pBPS1dh is given.
[0036] FIG. 2: L-lactate detection in Synechocystis P.sub.psbA2::psbA2::ldh::kan cultures growing in BG-11 depicted on the left Y-axis. OD730 times 100 on the right (log scale) Y-axis.
[0037] FIG. 3: Growth curve of Synechocystis glucose non-tolerant cultures growing in BG-11 supplemented with 10 mM TES and 5 mM glucose at 37° C.
[0038] FIG. 4. Growth of Synechocystis ldh-8 in a 1.8 liter continuous growth system. X-axis indicates time in hours, y-axis the cell concentration in gram/litre.1 and 2 indicate two biological replicates.
EXAMPLES
Example 1
Strategy 1. Cloning of the PsbA2 Promoter in Front of a Gene of Interest
[0039] Promoter sequence of psbA2 of Synechocystis sp. PCC 6803: (SEQ ID NO: 5)
TABLE-US-00001 TAATTGTATGCCCGACTATTGCTTAAACTGACTGACCACTGACCTTAAG AGTAATGGCGTGCAAGGCCCAGTGATCAATTTCATTATTTTTCATTATT TCATCTCCATTGTCCCTGAAAATCAGTTGTGTCGCCCCTCTACACAGCC CAGAACTATGGTAAAGGCGCACGAAAAACCGCCAGGTAAACTCTTCTCA ACCCCCAAAACGCCCTCTGTTTACCCATGGAAAAAACGACAATTACAAG AAAGTAAAACTTATGTCATCTATAAGCTTCGTGTATATTAACTTCCTGT TACAAAGCTTTACAAAACTCTCATTAATCCTTTAGACTAAGTTTAGTCA GTTCCAATCTGAACATCGACAAATACAT
Sequence derived from cyanobase. The promoter sequence is 371 bp in length and stops right upstream of the Ribosomal Binding Site (RBS). Primer binding sites are underlined. Primers used contain sequences for restriction enzymes for cloning purposes:
TABLE-US-00002 SEQ ID Name Sequence NO PpsbA2_F GCGgaattcgcggccgcttctagag 8 TAATTGTATGCCCGACTATT PpsbA2_R GTActgcagcggccgctactagta 9 ATGTATTTGTCGATGTTCAGATTGG
Strategy 2. Cloning a Gene of Interest Transcriptional Coupled to the psbA2 Gene Promoter and ORF sequence of psbA2 of Synechocystis sp. PCC 6803 (SEQ ID NO:6; amino acid sequence in SEQ ID NO:7):
TABLE-US-00003 TAATTGTATGCCCGACTATTGCTTAAACTGACTGACCACTGACCTTAAG AGTAATGGCGTGCAAGGCCCAGTGATCAATTTCATTATTTTTCATTATT TCATCTCCATTGTCCCTGAAAATCAGTTGTGTCGCCCCTCTACACAGCC CAGAACTATGGTAAAGGCGCACGAAAAACCGCCAGGTAAACTCTTCTCA ACCCCCAAAACGCCCTCTGTTTACCCATGGAAAAAACGACAATTACAAG AAAGTAAAACTTATGTCATCTATAAGCTTCGTGTATATTAACTTCCTGT TACAAAGCTTTACAAAACTCTCATTAATCCTTTAGACTAAGTTTAGTCA GTTCCAATCTGAACATCGACAAATACATAAGGAATTATAACCAAATGAC AACGACTCTCCAACAGCGCGAAAGCGCTTCCTTGTGGGAACAGTTTTGT CAGTGGGTGACCTCTACCAACAACCGGATTTATGTCGGTTGGTTCGGTA CCTTGATGATCCCCACCCTCTTAACTGCCACCACTTGCTTCATCATTGC CTTCATCGCCGCTCCCCCCGTTGACATCGACGGTATCCGTGAGCCCGTT GCTGGTTCTTTGCTTTACGGTAACAACATCATCTCTGGTGCTGTTGTAC CTTCTTCCAACGCTATCGGTTTGCACTTCTACCCCATCTGGGAAGCCGC TTCCTTAGATGAGTGGTTGTACAACGGTGGTCCTTACCAGTTGGTAGTA TTCCACTTCCTCATCGGCATTTTCTGCTACATGGGTCGTCAGTGGGAAC TTTCCTACCGCTTAGGTATGCGTCCTTGGATTTGTGTGGCTTACTCTGC CCCCGTATCCGCTGCCACCGCCGTATTCTTGATCTACCCCATTGGTCAA GGCTCCTTCTCTGATGGTATGCCCTTGGGTATTTCTGGTACCTTCAACT TCATGATCGTGTTCCAAGCTGAGCACAACATCCTGATGCACCCCTTCCA CATGTTAGGTGTGGCTGGTGTATTCGGTGGTAGCTTGTTCTCCGCCATG CACGGTTCCTTGGTAACCTCCTCCTTGGTGCGTGAAACCACCGAAGTTG AATCCCAGAACTACGGTTACAAATTCGGTCAAGAAGAAGAAACCTACAA CATCGTTGCCGCCCACGGCTACTTTGGTCGGTTGATCTTCCAATATGCT TCTTTCAACAACAGCCGTTCCTTGCACTTCTTCTTGGGTGCTTGGCCTG TAATCGGCATCTGGTTCACTGCTATGGGTGTAAGCACCATGGCGTTCAA CCTGAACGGTTTCAACTTCAACCAGTCCATCTTGGATAGCCAAGGCCGG GTAATCGGCACCTGGGCTGATGTATTGAACCGAGCCAACATCGGTTTTG AAGTAATGCACGAACGCAATGCCCACAACTTCCCCCTCGACTTAGCGTC TGGGGAGCAAGCTCCTGTGGCTTTGACCGCTCCTGCTGTCAACGGTTAA
Sequence derived from cyanobase. The promoter and gene sequence is 1470 bp in length and stops at the stop codon of psbA2. Primer binding sites are underlined. RBS and start codon (ATG) and stop codon (TAA) are bold and underlined. Primers used contain sequences for restriction enzymes for cloning purposes:
TABLE-US-00004 SEQ ID Name Sequence NO: Hom1Xho_F TTTACTCGAGTGTTGTACCTTCTTCC 10 AACGCTATCGG Hom1Hind_R TTTAAAGCTTTTAACCGTTGACAGCA 11 GGAGCGG
L-ldh is derived from Lactococcus lactis MG1363 (SEQ ID NO:1 and 2):
TABLE-US-00005 Atggctgataaacaacgtaagaaagttatccttgttggtgacggtgctgtaggttcatcatacgcttttgccc- ttgttaaccaagg aattgcacaagaattaggtattgttgacctttttaaagaaaaaactcaaggggatgcagaagacctttctcatg- ccttggcattta catcacctaaaaagatttactctgcagactactctgatgcaagcgacgctgacctcgttgtcttgacttctggt- gctccacaaaaa ccaggtgaaactcgtcttgaccttgttgaaaaaaatcttcgtattactaaagatgttgtaactaaaattgttgc- ttcaggattcaaag gaatcttcctcgttgctgctaacccagttgacatcttgacatacgcaacttggaaattctctggtttccctaaa- aaccgtgttgtag gttcaggtacttcacttgatactgcacgtttccgtcaagcattggctgaaaaagttgacgttgatgctcgttca- atccacgcatac atcatgggtgaacacggtgactcagaatttgctgtttggtcacacgctaacgttgctggtgttaaattggaaca- atggttccaag aaaatgactaccttaacgaagcagaaatcgttgaattgtttgagtctgtacgtgatgcagcttactcaatcatc- gctaaaaaaggt gcaacattctacggtgtggctgtagcccttgctcgtattactaaagcaattcttgatgatgaacatgcagtact- tcctgtatcagta ttccaagatggacaatatggggtaagcgactgctaccttggtcaaccagctgtagttggtgctgaaggtgttgt- taacccaattc acattccattgaacgatgctgaaatgcaaaaaatggaagcttctggagctcaattgaaagctatcatcgatgaa- gcttttgctaa agaagaatttgcttctgcagttaaaaactaa
TABLE-US-00006 SEQ ID Name Primer NO: LldhRBS_F AAATGAATTCAGGAGG 12 GAAAATCATGGCTGATAAACAAC Lldh_R aaatgaattcttagtttttaact 13 gcagaagcaaattct
Example 2
Biochemical Background of the Cyanobacterium of the Invention
[0040] L-ldh of the organism L. lactis (SEQ ID NO:1) is fused downstream to the transcript of psbA2 as described in example 1 above. The plasmid was transformed into Synechocystis PCC 6803 (freely obtainable, e.g. from Research Group of Aquatic Microbiology (AMB); Prof. dr. Jef Huisman, Institute for Biodiversity and Ecosystem Dynamics; University of Amsterdam, Amsterdam, The Netherlands; or see publications e.g. Hackenberg et al. (2009) Planta 230(4): 625-637). Mutant cultures were selected for by growth on agar plates containing 20 μg/ml of kanamycine until the genome was fully segregated. This mutant was named Synechocystis ldh-8. A scratch of mutant culture was inoculated in BG-11 medium supplemented with 10 mM TES-buffer-NaOH (pH=8.0) and 10 ug/ml kanamycine and grown to stationary phase within several days (OD of 1.5). An aliquot of the initial culture was used to inoculate 100 ml BG-11 supplemented with 10 mM TES-buffer-NaOH (pH=8.0) and with 10 μg/mlkanamycine to an OD of 0.1. The culture was incubated at low light intensity (˜40 μE), 30° C. and shaking at 100 rpm. On average every second day 1 ml of culture was collected, processed and L-lactate was determined in 100 μl the cultures supernatant with an enzymatic assay provided by Megazyme (Megazyme International Ireland Ltd. Ireland). With the help of standard concentrations of L-lactate the concentration of L-lactate in the culture was determined (FIG. 2). In conclusion, L-lactate production increases in time (at least up to 30 days) at a rate of more than 20 μmol(gr [dw])-1h-1.
Example (3)
[0041] Resistance to lactic acid of Synechocystis PCC 6803 The culture was grown in 100 ml BG-11 supplemented with 10 mM TES-buffer-NaOH (pH=8.0) and with 10 μg/mlkanamycine to an OD of 0.1. The culture was incubated at low light intensity (˜40 μE), 30° C. and shaking at 100 rpm. It was clearly shown (FIG. 3) that up to a concentration of 50mM L-lactic acid cultures are not affected with respect to growth-rate.
Example (4)
[0042] Lactate Production Under Control of a psbA Promoter in Synechocystis PCC 6803 in a Continuous Growth Fermentor The lactate producing Synechocystis PCC 6803 mutant ldh-8 was grown in a continuous culture with a dilution rate of 0.018 in BG-11 medium with 10 mM NaNO3, 50 mM NaCO3 and 20 mM TES buffer. The culture was mixed by air bubbling with 1% added CO2, and illuminated with continuous white light from a LED-light source at an intensity of ˜450 μE. Lactate concentrations were determined with the enzymatic 1-lactate assay kit from Megazyme (see FIG. 4). Duplicate samples were taken after 300 hours and washed in BG-11 medium to remove lactate. Lactate production was monitored in batch cultures of 100 ml with a cell density of 0.33 g/L for 5 hours at a light intensity of 150 μE. Duplicate samples were also taken after 600 hours and the lactate concentration was determined directly from chemostat. On average the lactate concentration in chemostat was 647 μM, this gives a lactate flux of 647*0.018/0.36=32.3 μmol(gr [dw])-1h-1. This shows a constant production of L-lactate at a rate of 1 mg/l/hour during at least 3 weeks.
Sequence CWU
1
1
131978DNALactococcus lactisCDS(1)..(978) 1atg gct gat aaa caa cgt aag aaa
gtt atc ctt gtt ggt gac ggt gct 48Met Ala Asp Lys Gln Arg Lys Lys
Val Ile Leu Val Gly Asp Gly Ala 1 5
10 15 gta ggt tca tca tac gct ttt gcc ctt
gtt aac caa gga att gca caa 96Val Gly Ser Ser Tyr Ala Phe Ala Leu
Val Asn Gln Gly Ile Ala Gln 20 25
30 gaa tta ggt att gtt gac ctt ttt aaa gaa
aaa act caa ggg gat gca 144Glu Leu Gly Ile Val Asp Leu Phe Lys Glu
Lys Thr Gln Gly Asp Ala 35 40
45 gaa gac ctt tct cat gcc ttg gca ttt aca tca
cct aaa aag att tac 192Glu Asp Leu Ser His Ala Leu Ala Phe Thr Ser
Pro Lys Lys Ile Tyr 50 55
60 tct gca gac tac tct gat gca agc gac gct gac
ctc gtt gtc ttg act 240Ser Ala Asp Tyr Ser Asp Ala Ser Asp Ala Asp
Leu Val Val Leu Thr 65 70 75
80 tct ggt gct cca caa aaa cca ggt gaa act cgt ctt
gac ctt gtt gaa 288Ser Gly Ala Pro Gln Lys Pro Gly Glu Thr Arg Leu
Asp Leu Val Glu 85 90
95 aaa aat ctt cgt att act aaa gat gtt gta act aaa att
gtt gct tca 336Lys Asn Leu Arg Ile Thr Lys Asp Val Val Thr Lys Ile
Val Ala Ser 100 105
110 gga ttc aaa gga atc ttc ctc gtt gct gct aac cca gtt
gac atc ttg 384Gly Phe Lys Gly Ile Phe Leu Val Ala Ala Asn Pro Val
Asp Ile Leu 115 120 125
aca tac gca act tgg aaa ttc tct ggt ttc cct aaa aac cgt
gtt gta 432Thr Tyr Ala Thr Trp Lys Phe Ser Gly Phe Pro Lys Asn Arg
Val Val 130 135 140
ggt tca ggt act tca ctt gat act gca cgt ttc cgt caa gca ttg
gct 480Gly Ser Gly Thr Ser Leu Asp Thr Ala Arg Phe Arg Gln Ala Leu
Ala 145 150 155
160 gaa aaa gtt gac gtt gat gct cgt tca atc cac gca tac atc atg
ggt 528Glu Lys Val Asp Val Asp Ala Arg Ser Ile His Ala Tyr Ile Met
Gly 165 170 175
gaa cac ggt gac tca gaa ttt gct gtt tgg tca cac gct aac gtt gct
576Glu His Gly Asp Ser Glu Phe Ala Val Trp Ser His Ala Asn Val Ala
180 185 190
ggt gtt aaa ttg gaa caa tgg ttc caa gaa aat gac tac ctt aac gaa
624Gly Val Lys Leu Glu Gln Trp Phe Gln Glu Asn Asp Tyr Leu Asn Glu
195 200 205
gca gaa atc gtt gaa ttg ttt gag tct gta cgt gat gca gct tac tca
672Ala Glu Ile Val Glu Leu Phe Glu Ser Val Arg Asp Ala Ala Tyr Ser
210 215 220
atc atc gct aaa aaa ggt gca aca ttc tac ggt gtg gct gta gcc ctt
720Ile Ile Ala Lys Lys Gly Ala Thr Phe Tyr Gly Val Ala Val Ala Leu
225 230 235 240
gct cgt att act aaa gca att ctt gat gat gaa cat gca gta ctt cct
768Ala Arg Ile Thr Lys Ala Ile Leu Asp Asp Glu His Ala Val Leu Pro
245 250 255
gta tca gta ttc caa gat gga caa tat ggg gta agc gac tgc tac ctt
816Val Ser Val Phe Gln Asp Gly Gln Tyr Gly Val Ser Asp Cys Tyr Leu
260 265 270
ggt caa cca gct gta gtt ggt gct gaa ggt gtt gtt aac cca att cac
864Gly Gln Pro Ala Val Val Gly Ala Glu Gly Val Val Asn Pro Ile His
275 280 285
att cca ttg aac gat gct gaa atg caa aaa atg gaa gct tct gga gct
912Ile Pro Leu Asn Asp Ala Glu Met Gln Lys Met Glu Ala Ser Gly Ala
290 295 300
caa ttg aaa gct atc atc gat gaa gct ttt gct aaa gaa gaa ttt gct
960Gln Leu Lys Ala Ile Ile Asp Glu Ala Phe Ala Lys Glu Glu Phe Ala
305 310 315 320
tct gca gtt aaa aac taa
978Ser Ala Val Lys Asn
325
2325PRTLactococcus lactis 2Met Ala Asp Lys Gln Arg Lys Lys Val Ile Leu
Val Gly Asp Gly Ala 1 5 10
15 Val Gly Ser Ser Tyr Ala Phe Ala Leu Val Asn Gln Gly Ile Ala Gln
20 25 30 Glu Leu
Gly Ile Val Asp Leu Phe Lys Glu Lys Thr Gln Gly Asp Ala 35
40 45 Glu Asp Leu Ser His Ala Leu
Ala Phe Thr Ser Pro Lys Lys Ile Tyr 50 55
60 Ser Ala Asp Tyr Ser Asp Ala Ser Asp Ala Asp Leu
Val Val Leu Thr 65 70 75
80 Ser Gly Ala Pro Gln Lys Pro Gly Glu Thr Arg Leu Asp Leu Val Glu
85 90 95 Lys Asn Leu
Arg Ile Thr Lys Asp Val Val Thr Lys Ile Val Ala Ser 100
105 110 Gly Phe Lys Gly Ile Phe Leu Val
Ala Ala Asn Pro Val Asp Ile Leu 115 120
125 Thr Tyr Ala Thr Trp Lys Phe Ser Gly Phe Pro Lys Asn
Arg Val Val 130 135 140
Gly Ser Gly Thr Ser Leu Asp Thr Ala Arg Phe Arg Gln Ala Leu Ala 145
150 155 160 Glu Lys Val Asp
Val Asp Ala Arg Ser Ile His Ala Tyr Ile Met Gly 165
170 175 Glu His Gly Asp Ser Glu Phe Ala Val
Trp Ser His Ala Asn Val Ala 180 185
190 Gly Val Lys Leu Glu Gln Trp Phe Gln Glu Asn Asp Tyr Leu
Asn Glu 195 200 205
Ala Glu Ile Val Glu Leu Phe Glu Ser Val Arg Asp Ala Ala Tyr Ser 210
215 220 Ile Ile Ala Lys Lys
Gly Ala Thr Phe Tyr Gly Val Ala Val Ala Leu 225 230
235 240 Ala Arg Ile Thr Lys Ala Ile Leu Asp Asp
Glu His Ala Val Leu Pro 245 250
255 Val Ser Val Phe Gln Asp Gly Gln Tyr Gly Val Ser Asp Cys Tyr
Leu 260 265 270 Gly
Gln Pro Ala Val Val Gly Ala Glu Gly Val Val Asn Pro Ile His 275
280 285 Ile Pro Leu Asn Asp Ala
Glu Met Gln Lys Met Glu Ala Ser Gly Ala 290 295
300 Gln Leu Lys Ala Ile Ile Asp Glu Ala Phe Ala
Lys Glu Glu Phe Ala 305 310 315
320 Ser Ala Val Lys Asn 325
3305DNAArtificialpromoter 3agcagtttac agaggcgatt tatcggcggg taagactata
cagtatcggg aaaaaattaa 60gaacggtcaa agaatctgga catatcacaa cccacaatct
agtattcaaa atccttctgc 120ctggccttat ttggtcgtat ttacccattg tgcccaaatc
cgaccattgt tgccaattat 180tccccaggta accacggcga tcgccaagga aagatttaag
tattttttcc cattctccct 240aatcctgcgg ccaaggagct gggttaacgt tagggcaagt
cggatgtcct ggtgtgaccg 300ggtca
30546901DNAArtificialplasmid construct 4ctaaattgta
agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60attttttaac
caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120gatagggttg
agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180caacgtcaaa
gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240ctaatcaagt
tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300cccccgattt
agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360agcgaaagga
gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420cacacccgcc
gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480caactgttgg
gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540gggatgtgct
gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600taaaacgacg
gccagtgagc gcgcgtaata cgactcacta tagggcgaat tgggtaccgg 660gccccccctc
gagcccatct gggaagccgc ttccttagat gagtggttgt acaacggtgg 720tccttaccag
ttggtagtat tccacttcct catcggcatt ttctgctaca tgggtcgtca 780gtgggaactt
tcctaccgct taggtatgcg tccttggatt tgtgtggctt actctgcccc 840cgtatccgct
gccaccgccg tattcttgat ctaccccatt ggtcaaggct ccttctctga 900tggtatgccc
ttgggtattt ctggtacctt caacttcatg atcgtgttcc aagctgagca 960caacatcctg
atgcacccct tccacatgtt aggtgtggct ggtgtattcg gtggtagctt 1020gttctccgcc
atgcacggtt ccttggtaac ctcctccttg gtgcgtgaaa ccaccgaagt 1080tgaatcccag
aactacggtt acaaattcgg tcaagaagaa gaaacctaca acatcgttgc 1140cgcccacggc
tactttggtc ggttgatctt ccaatatgct tctttcaaca acagccgttc 1200cttgcacttc
ttcttgggtg cttggcctgt aatcggcatc tggttcactg ctatgggtgt 1260aagcaccatg
gcgttcaacc tgaacggttt caacttcaac cagtccatct tggatagcca 1320aggccgggta
atcggcacct gggctgatgt attgaaccga gccaacatcg gttttgaagt 1380aatgcacgaa
cgcaatgccc acaacttccc cctcgactta gcgtctgggg agcaagctcc 1440tgtggctttg
accgctcctg ctgtcaacgg ttaaaagctt gatatcgaat tcaggaggga 1500aaatcatggc
tgataaacaa cgtaagaaag ttatccttgt tggtgacggt gctgtaggtt 1560catcatacgc
ttttgccctt gttaaccaag gaattgcaca agaattaggt attgttgacc 1620tttttaaaga
aaaaactcaa ggggatgcag aagacctttc tcatgccttg gcatttacat 1680cacctaaaaa
gatttactct gcagactact ctgatgcaag cgacgctgac ctcgttgtct 1740tgacttctgg
tgctccacaa aaaccaggtg aaactcgtct tgaccttgtt gaaaaaaatc 1800ttcgtattac
taaagatgtt gtaactaaaa ttgttgcttc aggattcaaa ggaatcttcc 1860tcgttgctgc
taacccagtt gacatcttga catacgcaac ttggaaattc tctggtttcc 1920ctaaaaaccg
tgttgtaggt tcaggtactt cacttgatac tgcacgtttc cgtcaagcat 1980tggctgaaaa
agttgacgtt gatgctcgtt caatccacgc atacatcatg ggtgaacacg 2040gtgactcaga
atttgctgtt tggtcacacg ctaacgttgc tggtgttaaa ttggaacaat 2100ggttccaaga
aaatgactac cttaacgaag cagaaatcgt tgaattgttt gagtctgtac 2160gtgatgcagc
ttactcaatc atcgctaaaa aaggtgcaac attctacggt gtggctgtag 2220cccttgctcg
tattactaaa gcaattcttg atgatgaaca tgcagtactt cctgtatcag 2280tattccaaga
tggacaatat ggggtaagcg actgctacct tggtcaacca gctgtagttg 2340gtgctgaagg
tgttgttaac ccaattcaca ttccattgaa cgatgctgaa atgcaaaaaa 2400tggaagcttc
tggagctcaa ttgaaagcta tcatcgatga agcttttgct aaagaagaat 2460ttgcttctgc
agttaaaaac taagaattcc tgcagcccgg gaagcttctc gagattctca 2520tgtttgacag
cttatcatcg ataagcttca cgctgccgca agcactcagg gcgcaagggc 2580tgctaaagga
agcggaacac gtagaaagcc agtccgcaga aacggtgctg accccggatg 2640aatgtcagct
actgggctat ctggacaagg gaaaacgcaa gcgcaaagag aaagcaggta 2700gcttgcagtg
ggcttacatg gcgatagcta gactgggcgg ttttatggac agcaagcgaa 2760ccggaattgc
cagctggggc gccctctggt aaggttggga agccctgcaa agtaaactgg 2820atggctttct
tgccgccaag gatctgatgg cgcaggggat caagatctga tcaagagaca 2880ggatgaggat
cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct 2940tgggtggaga
ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc 3000gccgtgttcc
ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc 3060ggtgccctga
atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc 3120gttccttgcg
cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg 3180ggcgaagtgc
cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc 3240atcatggctg
atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac 3300caccaagcga
aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat 3360caggatgatc
tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc 3420aaggcgcgca
tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg 3480aatatcatgg
tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg 3540gcggaccgct
atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc 3600gaatgggctg
accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc 3660gccttctatc
gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg 3720accaagcgac
gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa 3780ggttgggctt
cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc 3840tcatgctgga
gttcttcgcc caccccgggg gatccttcct tggtgtaatg ccaactgaat 3900aatctgcaaa
ttgcactctc cttcaatggg gggtgctttt tgcttgactg agtaatcttc 3960tgattgctga
tcttgattgc catcgatcgc cggggagtcc ggggcagtta ccattagaga 4020gtctagagaa
ttaatccatc ttcgatagag gaattatggg ggaagaacct gtgccggcgg 4080ataaagcatt
aggcaagaaa ttcaagaaaa aaaatgcctc ctggagcatt gaagaaagcg 4140aagctctgta
ccgggttgag gcctgggggg caccttattt tgccattaat gccgctggta 4200acataaccgt
ctctcccaac ggcgatcggg gcggttcgtt agatttgttg gaactggtgg 4260aagccctgcg
gcaaagaaag ctcggcttac ccctattaat tcgtttttcc gatattttgg 4320ccgatcgcct
agagcgattg aatagttgtt ttgccaaggc gatcgcccgt tacaattacc 4380ccaacaccta
tcaggcggtt tatccggtca aatgtaacca gcaacgacat ctggtggaag 4440ccctggttcg
ctttgggcaa acttcccagt gtggattgga ggcaggttcc aaaccggaat 4500tgatgattgc
cctcgcaact ctaccacctc ccttagaccg tcaggacaag cataccaagc 4560ccctaatcat
ttgtaatggc tacaaagacc aggattatct agaaacagct ctgttagcca 4620aacgcttagg
ccatcgtccc atcatcatca ttgaacaact acgggaactg gaatgggcgg 4680ccgccaccgc
ggtggagctc cagcttttgt tccctttagt gagggttaat tgcgcgcttg 4740gcgtaatcat
ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4800aacatacgag
ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 4860acattaattg
cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4920cattaatgaa
tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 4980tcctcgctca
ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 5040tcaaaggcgg
taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 5100gcaaaaggcc
agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 5160aggctccgcc
cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 5220ccgacaggac
tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 5280gttccgaccc
tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 5340ctttctcata
gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 5400ggctgtgtgc
acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 5460cttgagtcca
acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 5520attagcagag
cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 5580ggctacacta
gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 5640aaaagagttg
gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 5700gtttgcaagc
agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 5760tctacggggt
ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 5820ttatcaaaaa
ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 5880taaagtatat
atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 5940atctcagcga
tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 6000actacgatac
gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 6060cgctcaccgg
ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 6120agtggtcctg
caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 6180gtaagtagtt
cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 6240gtgtcacgct
cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 6300gttacatgat
cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 6360gtcagaagta
agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 6420cttactgtca
tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 6480ttctgagaat
agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 6540accgcgccac
atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 6600aaactctcaa
ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 6660aactgatctt
cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 6720caaaatgccg
caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 6780ctttttcaat
attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 6840gaatgtattt
agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 6900c
69015371DNASynechocystis PCC6803 5taattgtatg cccgactatt gcttaaactg
actgaccact gaccttaaga gtaatggcgt 60gcaaggccca gtgatcaatt tcattatttt
tcattatttc atctccattg tccctgaaaa 120tcagttgtgt cgcccctcta cacagcccag
aactatggta aaggcgcacg aaaaaccgcc 180aggtaaactc ttctcaaccc ccaaaacgcc
ctctgtttac ccatggaaaa aacgacaatt 240acaagaaagt aaaacttatg tcatctataa
gcttcgtgta tattaacttc ctgttacaaa 300gctttacaaa actctcatta atcctttaga
ctaagtttag tcagttccaa tctgaacatc 360gacaaataca t
37161470DNASynechocystis
PCC6803CDS(388)..(1470) 6taattgtatg cccgactatt gcttaaactg actgaccact
gaccttaaga gtaatggcgt 60gcaaggccca gtgatcaatt tcattatttt tcattatttc
atctccattg tccctgaaaa 120tcagttgtgt cgcccctcta cacagcccag aactatggta
aaggcgcacg aaaaaccgcc 180aggtaaactc ttctcaaccc ccaaaacgcc ctctgtttac
ccatggaaaa aacgacaatt 240acaagaaagt aaaacttatg tcatctataa gcttcgtgta
tattaacttc ctgttacaaa 300gctttacaaa actctcatta atcctttaga ctaagtttag
tcagttccaa tctgaacatc 360gacaaataca taaggaatta taaccaa atg aca acg act
ctc caa cag cgc gaa 414 Met Thr Thr Thr
Leu Gln Gln Arg Glu 1 5
agc gct tcc ttg tgg gaa cag ttt tgt cag tgg gtg
acc tct acc aac 462Ser Ala Ser Leu Trp Glu Gln Phe Cys Gln Trp Val
Thr Ser Thr Asn 10 15 20
25 aac cgg att tat gtc ggt tgg ttc ggt acc ttg atg atc
ccc acc ctc 510Asn Arg Ile Tyr Val Gly Trp Phe Gly Thr Leu Met Ile
Pro Thr Leu 30 35
40 tta act gcc acc act tgc ttc atc att gcc ttc atc gcc gct
ccc ccc 558Leu Thr Ala Thr Thr Cys Phe Ile Ile Ala Phe Ile Ala Ala
Pro Pro 45 50 55
gtt gac atc gac ggt atc cgt gag ccc gtt gct ggt tct ttg ctt
tac 606Val Asp Ile Asp Gly Ile Arg Glu Pro Val Ala Gly Ser Leu Leu
Tyr 60 65 70
ggt aac aac atc atc tct ggt gct gtt gta cct tct tcc aac gct atc
654Gly Asn Asn Ile Ile Ser Gly Ala Val Val Pro Ser Ser Asn Ala Ile
75 80 85
ggt ttg cac ttc tac ccc atc tgg gaa gcc gct tcc tta gat gag tgg
702Gly Leu His Phe Tyr Pro Ile Trp Glu Ala Ala Ser Leu Asp Glu Trp
90 95 100 105
ttg tac aac ggt ggt cct tac cag ttg gta gta ttc cac ttc ctc atc
750Leu Tyr Asn Gly Gly Pro Tyr Gln Leu Val Val Phe His Phe Leu Ile
110 115 120
ggc att ttc tgc tac atg ggt cgt cag tgg gaa ctt tcc tac cgc tta
798Gly Ile Phe Cys Tyr Met Gly Arg Gln Trp Glu Leu Ser Tyr Arg Leu
125 130 135
ggt atg cgt cct tgg att tgt gtg gct tac tct gcc ccc gta tcc gct
846Gly Met Arg Pro Trp Ile Cys Val Ala Tyr Ser Ala Pro Val Ser Ala
140 145 150
gcc acc gcc gta ttc ttg atc tac ccc att ggt caa ggc tcc ttc tct
894Ala Thr Ala Val Phe Leu Ile Tyr Pro Ile Gly Gln Gly Ser Phe Ser
155 160 165
gat ggt atg ccc ttg ggt att tct ggt acc ttc aac ttc atg atc gtg
942Asp Gly Met Pro Leu Gly Ile Ser Gly Thr Phe Asn Phe Met Ile Val
170 175 180 185
ttc caa gct gag cac aac atc ctg atg cac ccc ttc cac atg tta ggt
990Phe Gln Ala Glu His Asn Ile Leu Met His Pro Phe His Met Leu Gly
190 195 200
gtg gct ggt gta ttc ggt ggt agc ttg ttc tcc gcc atg cac ggt tcc
1038Val Ala Gly Val Phe Gly Gly Ser Leu Phe Ser Ala Met His Gly Ser
205 210 215
ttg gta acc tcc tcc ttg gtg cgt gaa acc acc gaa gtt gaa tcc cag
1086Leu Val Thr Ser Ser Leu Val Arg Glu Thr Thr Glu Val Glu Ser Gln
220 225 230
aac tac ggt tac aaa ttc ggt caa gaa gaa gaa acc tac aac atc gtt
1134Asn Tyr Gly Tyr Lys Phe Gly Gln Glu Glu Glu Thr Tyr Asn Ile Val
235 240 245
gcc gcc cac ggc tac ttt ggt cgg ttg atc ttc caa tat gct tct ttc
1182Ala Ala His Gly Tyr Phe Gly Arg Leu Ile Phe Gln Tyr Ala Ser Phe
250 255 260 265
aac aac agc cgt tcc ttg cac ttc ttc ttg ggt gct tgg cct gta atc
1230Asn Asn Ser Arg Ser Leu His Phe Phe Leu Gly Ala Trp Pro Val Ile
270 275 280
ggc atc tgg ttc act gct atg ggt gta agc acc atg gcg ttc aac ctg
1278Gly Ile Trp Phe Thr Ala Met Gly Val Ser Thr Met Ala Phe Asn Leu
285 290 295
aac ggt ttc aac ttc aac cag tcc atc ttg gat agc caa ggc cgg gta
1326Asn Gly Phe Asn Phe Asn Gln Ser Ile Leu Asp Ser Gln Gly Arg Val
300 305 310
atc ggc acc tgg gct gat gta ttg aac cga gcc aac atc ggt ttt gaa
1374Ile Gly Thr Trp Ala Asp Val Leu Asn Arg Ala Asn Ile Gly Phe Glu
315 320 325
gta atg cac gaa cgc aat gcc cac aac ttc ccc ctc gac tta gcg tct
1422Val Met His Glu Arg Asn Ala His Asn Phe Pro Leu Asp Leu Ala Ser
330 335 340 345
ggg gag caa gct cct gtg gct ttg acc gct cct gct gtc aac ggt taa
1470Gly Glu Gln Ala Pro Val Ala Leu Thr Ala Pro Ala Val Asn Gly
350 355 360
7360PRTSynechocystis PCC6803 7Met Thr Thr Thr Leu Gln Gln Arg Glu Ser Ala
Ser Leu Trp Glu Gln 1 5 10
15 Phe Cys Gln Trp Val Thr Ser Thr Asn Asn Arg Ile Tyr Val Gly Trp
20 25 30 Phe Gly
Thr Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Thr Cys Phe 35
40 45 Ile Ile Ala Phe Ile Ala Ala
Pro Pro Val Asp Ile Asp Gly Ile Arg 50 55
60 Glu Pro Val Ala Gly Ser Leu Leu Tyr Gly Asn Asn
Ile Ile Ser Gly 65 70 75
80 Ala Val Val Pro Ser Ser Asn Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95 Trp Glu Ala
Ala Ser Leu Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr 100
105 110 Gln Leu Val Val Phe His Phe Leu
Ile Gly Ile Phe Cys Tyr Met Gly 115 120
125 Arg Gln Trp Glu Leu Ser Tyr Arg Leu Gly Met Arg Pro
Trp Ile Cys 130 135 140
Val Ala Tyr Ser Ala Pro Val Ser Ala Ala Thr Ala Val Phe Leu Ile 145
150 155 160 Tyr Pro Ile Gly
Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile 165
170 175 Ser Gly Thr Phe Asn Phe Met Ile Val
Phe Gln Ala Glu His Asn Ile 180 185
190 Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe
Gly Gly 195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Val 210
215 220 Arg Glu Thr Thr Glu
Val Glu Ser Gln Asn Tyr Gly Tyr Lys Phe Gly 225 230
235 240 Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala
Ala His Gly Tyr Phe Gly 245 250
255 Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu
His 260 265 270 Phe
Phe Leu Gly Ala Trp Pro Val Ile Gly Ile Trp Phe Thr Ala Met 275
280 285 Gly Val Ser Thr Met Ala
Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln 290 295
300 Ser Ile Leu Asp Ser Gln Gly Arg Val Ile Gly
Thr Trp Ala Asp Val 305 310 315
320 Leu Asn Arg Ala Asn Ile Gly Phe Glu Val Met His Glu Arg Asn Ala
325 330 335 His Asn
Phe Pro Leu Asp Leu Ala Ser Gly Glu Gln Ala Pro Val Ala 340
345 350 Leu Thr Ala Pro Ala Val Asn
Gly 355 360 845DNAArtificialprimer 8gcggaattcg
cggccgcttc tagagtaatt gtatgcccga ctatt
45949DNAArtificialprimer 9gtactgcagc ggccgctact agtaatgtat ttgtcgatgt
tcagattgg 491037DNAArtificialprimer 10tttactcgag
tgttgtacct tcttccaacg ctatcgg
371133DNAArtificialprimer 11tttaaagctt ttaaccgttg acagcaggag cgg
331239DNAArtificialprimer 12aaatgaattc aggagggaaa
atcatggctg ataaacaac 391338DNAArtificialprimer
13aaatgaattc ttagttttta actgcagaag caaattct
38
User Contributions:
Comment about this patent or add new information about this topic: