Kaye
Allan Kaye, Bristol GB
Patent application number | Description | Published |
---|---|---|
20080223986 | Trussed Structure - The invention provides a trussed structure comprising a frame and at least one strut, wherein the frame is of composite material and includes sockets which are integral with the frame. The invention also provides a process of making the trussed structures. The struts are typically of composite material and the trussed structures of the invention are particularly suitable for use in aircraft, for example, as wing ribs or floor beams. | 09-18-2008 |
20110220006 | COMPOSITE LAMINATE STRUCTURE - A structure comprising a composite laminate having an edge; and an impact indicator which is carried by the edge and comprises a resin which fractures upon impact. The fracture provides permanent visible evidence of impact damage, for instance by cracking or by one or more pieces breaking off from the impact indicator. As well as providing such visible evidence of impact damage, the impact indicator may also provide an element of impact protection. Typically the impact indicator is formed from a resin which is more brittle and less strong than the material forming the composite laminate. For instance the material forming the composite laminate may be reinforced, and the resin forming the impact indicator may be un-reinforced. | 09-15-2011 |
Brett James Kaye, Tauranga NZ
Patent application number | Description | Published |
---|---|---|
20140012538 | METHOD AND APPARATUS FOR PROCESSING A LENGTH OF MATERIAL - An apparatus for processing a length of material, comprises at least one processor configured to: receive a signal indicating manual designation of a point along the length of material as a first end point; receive at least one signal from at least one distance measuring device associated with a timber-working head, the signal indicating the distance between the first end point and a second end point on the length of material; and determine the actual length of material to be processed. An associated method is disclosed. | 01-09-2014 |
20140096870 | METHOD, APPARATUS, AND SYSTEM FOR CONTROLLING A TIMBER-WORKING DEVICE - Method, apparatus, and system for operation of a timber-working device configured to perform at least one operation having an associated hazard zone. At least one signal from at least one orientation sensor associated with the timber-working head may indicate whether a predetermined location is within the hazard zone based on the orientation of the timber-working head. Operation of the timber-working head can be controlled based on the signal. | 04-10-2014 |
20140096871 | METHOD, APPARATUS, AND SYSTEM FOR CONTROLLING A TIMBER-WORKING DEVICE - A method, apparatus, and system for operation of a timber-working device capable of performing an operation having an associated hazard zone. The device can receive a wireless signal indicating a location of an object tracking device, determine the location of the object tracking device relative to the hazard zone of the timber-working device and determine a recommended operation of the timber-working device based at least in part on the location of the object tracking device relative to the hazard zone. | 04-10-2014 |
20140238544 | TIMBER-WORKING HEAD AND METHOD OF OPERATION - A timber-working head and method of operation are provided. The head has a frame to which first and second arms are pivotally connected. Respective linear drive actuators pivot the respective arms relative to the frame to open and close them. At least one processor controls application of pressure by the linear drive actuators such that the arms grasp timber to be processed by the head. The position of the linear actuators is used to determine whether the timber is offset from a feed axis of the frame beyond a predetermined distance, and the application of pressure by one of the linear actuators to reduce the offset to be within the predetermined distance. | 08-28-2014 |
20140238545 | SYSTEM, DEVICE, AND METHOD FOR PROCESSING A LENGTH OF MATERIAL - A system, device, and method for processing a length of material are provided. A material-working device has first and second cutting devices, each having different cutting capacities. Data relating to the length and diameter at a plurality of points of the material is received, and used to determine at least one cutting position along its length. The diameter of the length of material at the cutting position is determined, and used to select either the first cutting device or second cutting device for use in performing a cut at the cutting position based on the cutting capacity of each cutting device. | 08-28-2014 |
David M. Kaye, Beaumaris AU
Patent application number | Description | Published |
---|---|---|
20140066891 | Devices and Methods for Modulating Medium Delivery - Devices, systems and methods for controlling, regulating, altering, transforming or otherwise modulating the delivery of a substance to a delivery site. The devices, systems and methods optimize the delivery of the substance to an intended site, such as a vessel, vascular bed, organ and/or other corporeal structures, while reducing inadvertent introduction or reflux substance to other vessels, vascular beds, organs, and/or other structures, including systemic introduction. | 03-06-2014 |
David Martin Kaye, Victoria AU
Patent application number | Description | Published |
---|---|---|
20080288060 | Treating Valvular Insufficiency - In a method of treating valvular insufficiency in a patient, a plurality of filaments ( | 11-20-2008 |
20090018526 | Devices and Methods for Perfusing an Organ - The present invention provides devices and methods for use in the perfusion of organs and anatomical regions. In one aspect the present method provides a percutaneously deliverable device for supporting a vessel in a human or animal subject including means for supporting the vessel during delivery of a fluid thereto or collection of a fluid therefrom. In another aspect the invention provides a method for delivery or collection of a fluid to or from an organ or anatomical region in a human or animal subject, the method including the step of supporting a vessel associated with the organ or anatomical region. The devices and methods may be used to deliver, remove or recirculate a therapeutic agent to an organ or anatomical region. | 01-15-2009 |
David Martin Kaye, Beaumaris AU
Patent application number | Description | Published |
---|---|---|
20100274173 | Regional cardiac tissue treatment - A method for treating an occlusion in a coronary artery of a patient includes percutaneously advancing an occlusion treatment tool (such as an angioplasty balloon or stent delivery device) through the vasculature of the patient and into a coronary artery to a site of the occlusion. Following the treatment of the occlusion, a therapeutic agent is admitted into the first coronary artery. The therapeutic agent is selected to treat microvasculature obstructions at a target cardiac tissue site distal to the site of the occlusion. | 10-28-2010 |
20110015558 | Isolating cardiac circulation - In a method for substantially isolating cardiac circulation from systemic circulation, flow between the coronary sinus and the right atrium is occluded. A venous collection device having a collection lumen and a support structure is located in the coronary sinus. The support structure is used to maintain patency of the coronary sinus during collection of fluid through the collection lumen. An artificial flow path is provided between the collection lumen and the one or more coronary arteries, thus isolating the cardiac circulation. According to the method, cardiac pumping for systemic circulation can be maintained during isolation of the cardiac circulation. | 01-20-2011 |
20130079697 | SYSTEMS AND METHODS FOR LIMB TREATMENT - A method of delivering a medicament to a limb of a patient body includes isolating a circulatory system of the limb from a circulatory system of the patient body, wherein the limb circulatory system is substantially all limb arteries and substantially all limb veins located between an isolation region and an end of the limb. A perfusion catheter is inserted into a limb artery in an antegrade position, while a collection catheter is inserted into a limb vein in a retrograde position. The blood flow of the limb circulatory system is then circulated by collecting the blood flow with the collection catheter and delivering the blood flow with the perfusion catheter. A medicament is perfused into the limb circulatory system with the perfusion catheter. | 03-28-2013 |
20130253629 | DEVICES AND METHODS FOR PERFUSING AN ORGAN - The present invention provides devices and methods for use in the perfusion of organs and anatomical regions. In one aspect the present method provides a percutaneously deliverable device for supporting a vessel in a human or animal subject including means for supporting the vessel during delivery of a fluid thereto or collection of a fluid therefrom. In another aspect the invention provides a method for delivery or collection of a fluid to or from an organ or anatomical region in a human or animal subject, the method including the step of supporting a vessel associated with the organ or anatomical region. The devices and methods may be used to deliver, remove or recirculate a therapeutic agent to an organ or anatomical region. | 09-26-2013 |
20140328908 | CONTROLLED-RELEASE FORMULATION - The present invention relates to oral controlled-release formulations of 5-(pyridinyl)-2(1H)-pyridinone compounds and their use in the treatment of a subject with heart failure, a stage, class or manifestation of heart failure, or at risk of developing or exhibiting symptoms of heart failure. The formulations of the invention release the compounds in the range of between 0.1 μg/kg body weight/minute and 20 μg/kg body weight/minute. | 11-06-2014 |
Hagen Kaye, Kitchener CA
Patent application number | Description | Published |
---|---|---|
20120250762 | SYSTEM AND METHOD FOR IMPLEMENTATION OF DYNAMIC ENCODING RATES FOR MOBILE DEVICES - There is disclosed a system and method for transmission of data signals from a mobile device to a network. In an embodiment, the method comprises encoding video data at a first encoding rate into a plurality of video frames using a first encoding module; encoding video data at a second encoding rate into a plurality of video frames using a second encoding module; detecting a change in the availability of wireless bandwidth in the network; and switching a selector to retrieve frames from either the first encoding module or the second encoding module for transmission in dependence upon the available wireless bandwidth. The encoding rate of whichever one of the first encoding module and the second encoding module is currently not selected is successively increased or decreased, and a selector is switched to retrieve frames from either the first encoding module or the second encoding module. | 10-04-2012 |
20120260296 | SYSTEM AND METHOD FOR TRANSMISSION OF DATA FROM A WIRELESS MOBILE DEVICE OVER A MULTIPATH WIRELESS ROUTER - There is disclosed a system and method for transmission of multiple data streams from a mobile device to a network. In an embodiment, the system includes a multipath wireless router configured to provide a plurality of network connections including cellular, satellite, or wired Ethernet. An encoding module provided on the mobile device is configured to encode high volume data (e.g. high definition video) recorded by the mobile device into multiple data streams in dependence on the number of network connections available for transmission via the multipath wireless router. The encoding module provided on the mobile device transmits the multiple data streams to the wireless router using Wi-Fi to provide a local, short-hop, high capacity network connection. The plurality of network connections available via the multipath wireless router provides the necessary capacity and reliability to transmit a high volume of data, such as high definition video, virtually live. | 10-11-2012 |
Hagen Kaye, Waterloo CA
Patent application number | Description | Published |
---|---|---|
20140250486 | SYSTEM AND METHOD FOR TRANSMISSION OF DATA FROM A WIRELESS MOBILE DEVICE OVER A MULTIPATH WIRELESS ROUTER - There is disclosed a system and method for transmission of multiple data streams from a mobile device to a network. In an embodiment, the system includes a multipath wireless router configured to provide a plurality of network connections including cellular, satellite, or wired Ethernet. An encoding module provided on the mobile device is configured to encode high volume data (e.g. high definition video) recorded by the mobile device into multiple data streams in dependence on the number of network connections available for transmission via the multipath wireless router. The encoding module provided on the mobile device transmits the multiple data streams to the wireless router using Wi-Fi to provide a local, short-hop, high capacity network connection. The plurality of network connections available via the multipath wireless router provides the necessary capacity and reliability to transmit a high volume of data, such as high definition video, virtually live. | 09-04-2014 |
Joel Kaye, Netanya IL
Patent application number | Description | Published |
---|---|---|
20110027219 | Treatment of Crohn's disease with laquinimod - This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease. | 02-03-2011 |
20110218203 | TREATMENT OF RHEUMATOID ARTHRITIS WITH A COMBINATION OF LAQUINIMOD AND METHOTREXATE - This invention provides a method of treating a subject afflicted with rheumatoid arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate, wherein the amounts when taken together are effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in combination with methotrexate in treating a subject afflicted with rheumatoid arthritis. This invention also provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate for use in treating a subject afflicted with rheumatoid arthritis. | 09-08-2011 |
20130203807 | USE OF LAQUINIMOD FOR TREATING CROHN'S DISEASE PATIENTS WHO FAILED FIRST-LINE ANTI-TNF THERAPY - This application provides for a method of treating a human patient afflicted with anti-TNFα refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day. | 08-08-2013 |
20130324574 | TREATMENT OF OCULAR INFLAMMATORY DISEASES USING LAQUINIMOD - Disclosed is a method for treating an ocular inflammatory disease (OID), e.g., uveitis or conjunctivitis, comprising periodic administration of a therapeutically effective amount of laquinimod or a pharmaceutically acceptable salt thereof. Also provided is a pharmaceutical composition comprising laquinimod or a pharmaceutically acceptable salt thereof for use in treating a subject suffering from an OID, uveitis, bacterial conjunctivitis, viral conjunctivitis, an inflammation of the orbital tissue, the lacrimal apparatus, the eyelid, the cornea, the retina or the optic pathway. This application also provides a method for treating a subject suffering from an autoimmune disease-associated ocular inflammation comprising periodic ocular administration to the subject a therapeutically effective amount of laquinimod or a pharmaceutically acceptable salt, and an ocular pharmaceutical composition comprising laquinimod or a pharmaceutically acceptable salt thereof for use in treating an autoimmune disease-associated ocular inflammation. | 12-05-2013 |
20140017226 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND FAMPRIDINE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject fampridine as an add-on therapy to or in combination with laquinimod. This invention also provides a package comprising laquinimod and fampridine for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides fampridine for use as an add-on therapy or in combination with laquinimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and fampridine for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fampridine in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 01-16-2014 |
20140057883 | TREATMENT OF CROHN'S DISEASE WITH LAQUINIMOD - This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease. | 02-27-2014 |
20140200243 | TREATMENT OF CROHN'S DISEASE WITH LAQUINIMOD - This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease. | 07-17-2014 |
20140275215 | ANTI-CLUSTERIN MONOTHERAPY FOR CANCER TREATMENT - The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. | 09-18-2014 |
Joel Flaxman Kaye, Netanya IL
Patent application number | Description | Published |
---|---|---|
20130096158 | Treatment Of Multiple Sclerosis With Combination Of Laquinimod And Fingolimod - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with fingolimod. This invention also provides a package and a pharmaceutical composition comprising laquinimod and fingolimod for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with fingolimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fingolimod in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 04-18-2013 |
20130259856 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND DIMETHYL FUMARATE - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with DMF. This invention also provides a package comprising laquinimod and DMF for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with DMF in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and DMF for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and DMF in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 10-03-2013 |
20150037263 | TREATMENT OF MULTIPLE SCLEROSIS WITH COMBINATION OF LAQUINIMOD AND FINGOLIMOD - This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject laquinimod as an add-on therapy to or in combination with fingolimod. This invention also provides a package and a pharmaceutical composition comprising laquinimod and fingolimod for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides laquinimod for use as an add-on therapy or in combination with fingolimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention further provides use of laquinimod and fingolimod in the preparation of a combination for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. | 02-05-2015 |
John E. Kaye, Dugald CA
Patent application number | Description | Published |
---|---|---|
20120308305 | Shore Line Erosion Control - A novel design for eliminating bank and cliff erosion on sandy beaches and having a very small width footprint on the beach is provided by an adjustable metal frame main structure with curved corrugated steel sheets coated with a special sandy colored polyurethane attached to the frame so as to curve upwardly to a generally vertical upper edge. A base sheet of the frame is held down against the sand by heavy rock so that the toe of the curved sheet is buried three feet below the sand surface. The design does not require any armor rock in front of the curved sheet. | 12-06-2012 |
Laura Kaye, Cambridge GB
Patent application number | Description | Published |
---|---|---|
20130206142 | INHALER - An inhaler, the inhaler including a body ( | 08-15-2013 |
Mathew V. Kaye, West Midlands GB
Patent application number | Description | Published |
---|---|---|
20140026467 | INSECT TRAP - The invention relates to an insect trap ( | 01-30-2014 |
Matthew Varghese Kaye, West Midlands GB
Patent application number | Description | Published |
---|---|---|
20110041384 | INSECT TRAP - The invention relates to an insect trap which has been designed to facilitate simple and efficient servicing, maintenance and cleaning. The trap includes a back housing; a frame swing mounted to said housing; and a cover comprising openings allowing insects to enter the trap and the frame supports at least one light such that said frame and lights can be moved from a first position where they overlie the back housing, to a second position where they lie clear of the back housing such that an insect catching means which may be fitted over the back housing is readily accessible for replacement during servicing. Additionally, the trap is adapted for ease of servicing and jet cleaning by the provision of shields each of which sealably protect, from water ingress, the plurality of lights at the positions where they connect to electrical fittings. | 02-24-2011 |
Neil Kaye, Balmain AU
Patent application number | Description | Published |
---|---|---|
20140053939 | FLEXIBLE PLASTIC HOSE AND METHOD FOR MANUFACTURING SAME - Disclosed is a flexible plastic hose ( | 02-27-2014 |
Neil Anthony Kaye, New South Wales AU
Patent application number | Description | Published |
---|---|---|
20120125333 | RESPIRATORY SYSTEM - The present invention relates a modular respiratory system to which different parts can be added in a convenient way enabling such upgraded respiratory system to deliver the most comfortable respiratory conditions at an acceptable cost of ownership. | 05-24-2012 |
20120255550 | BREATHING CIRCUIT SYSTEM - A breathing circuit system for supplying a breathable gas from a breathable gas supply system to a patient interface. The system comprises a heated conduit, comprising a hose and a hose heating system associated with the hose, and a plurality of adapter elements. The hose heating system is provided for operating within a first predetermined voltage range. A controller is associated with the breathing circuit and provides voltage within a second predetermined voltage range. Each adapter element comprises at least one electric component provided for adjusting the voltage supplied by the controller from a second range to the first range. | 10-11-2012 |
Nicholas A. Kaye, Berkshire GB
Patent application number | Description | Published |
---|---|---|
20090049006 | METHOD AND SYSTEM FOR PROCESSING KNOWLEDGE - The invention provides a knowledge sharing method for supporting mobile workers before, during and after visiting a location, organisation or individual as part of their day to day activities. It achieves this through a knowledge management system which has a database for storing knowledge specific to a plurality of entities such as customers, maintenance locations, client organisation or individuals, for example. The database provides stored knowledge to a user in response to said user providing an identity of one of said plurality of entities. The retrieved knowledge being provided to the user in audio form on a voice enabled interface between the user and the system. The retrieved knowledge is provided to said user from the knowledge stored in the database specific to that entity. This knowledge may be based on information provided by other users of the knowledge management system. | 02-19-2009 |
Paul Kaye, Hainault GB
Patent application number | Description | Published |
---|---|---|
20140137475 | MINIATURE DAMPER, VIEWING PANEL UNIT, AND INSTALLATION METHOD - There is disclosed a miniature damper ( | 05-22-2014 |
Paul Kaye, York GB
Patent application number | Description | Published |
---|---|---|
20090297499 | USE OF CHARCOAL FOR TREATING INFLAMMATORY CONDITIONS - The invention relates to the use of charcoal in the manufacture of an oral composition for the treatment of an inflammatory condition other than an inflammatory bowel disease and other than interstitial or other inflammation within the kidney. | 12-03-2009 |
Paul Henry Kaye, Hertfordshire GB
Patent application number | Description | Published |
---|---|---|
20130229655 | Second Generation Low-Cost Particle Counter - An apparatus for the detection of a fluid-borne particle ( | 09-05-2013 |
Paul Henry Kaye, Hattfield GB
Patent application number | Description | Published |
---|---|---|
20140028998 | Fluid-Borne Particle Detector - There is disclosed improved apparatus and methods for detection of shape, size and intrinsic fluorescence properties of a fluid borne particle wherein the apparatus comprises a laser, two light sources, two detectors, and optionally a third detector. The apparatus is particularly suitable for detection of airborne biological particles. | 01-30-2014 |
Paul Henry Kaye, Herts GB
Patent application number | Description | Published |
---|---|---|
20100328665 | FLUID-BORNE PARTICLE DETECTOR - There is disclosed improved apparatus and methods for detection of shape, size and intrinsic fluorescence properties of a fluid borne particle wherein the apparatus comprises a laser, two light sources, two detectors, and optionally a third detector. The apparatus is particularly suitable for detection of airbone biological particles. | 12-30-2010 |
Rob Kaye, Macclesfield GB
Patent application number | Description | Published |
---|---|---|
20120165450 | MALLEABLE MATERIAL - The invention relates to a malleable material which can be manipulated by a person such as a child, directly or via forming apparatus with the material substantially retaining the shape to which the same has been formed, following manipulation. The material is formed from a base formed from one or more silicone materials. In one embodiment the material includes a glow pigment which causes the material to fluoresce when exposed to light, such as UV or near UV light. In one embodiment the material includes a colour pigment which determines the condition of the material in a normal condition and, when a glow component is also provided, in addition to the material being caused to fluoresce, the colour of the material may also be caused to change colour. | 06-28-2012 |
Sarah Jane Kaye, Greater Manchester GB
Patent application number | Description | Published |
---|---|---|
20110081348 | FUNGAL SIGNALLING AND METABOLIC ENZYMES - Method of identifying an anti-fungal agent which targets as an essential protein or gene of a fungus comprising contacting a candidate substance with (i) a protein which comprises the sequence shown by SEQ ID NOS: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 50, 53, 56, 59, 61 or 63, or (ii) a protein which has 60% identity with (i), or (iii) a protein comprising a fragment of (i) or (ii) which fragment has a length of at least 50 amino acids, or (iv) a polynucleotide that comprises a sequence which encodes (i), (ii) or (iii), or (v) a polynucleotide comprising a sequence which has at least 70% identity with the coding sequence of (iv), and determining whether the candidate substance binds or modulates (i), (ii), (iii), (iv), or (v), wherein binding or modulation of (i), (ii), (iii), (iv), or (v) indicates that the candidate substance is an anti-fungal agent. | 04-07-2011 |
Sarah Jane Kaye, London GB
Patent application number | Description | Published |
---|---|---|
20120196763 | ANTIFUNGAL TARGET - A method of identifying an antifungal agent which targets a PPTB protein of a fungus comprising determining whether a candidate compound binds to or inhibits a PPTB protein, wherein binding or inhibition indicates that the candidate sub-stance is an antifungal agent. | 08-02-2012 |
Viktor Kaye, Moscow RU
Patent application number | Description | Published |
---|---|---|
20130225036 | INERTIAL DYNAMIC TOY - An inertial dynamic toy is disclosed comprising: an annular housing having a circumferential groove: a flywheel mounted to a flywheel support axle, the flywheel support axle configured to be retained inside the annular housing; and an outrigger support frame releasably attached to the annular housing. | 08-29-2013 |
Viktor Avgustovich Kaye, Moscow RU
Patent application number | Description | Published |
---|---|---|
20150044937 | Inertial Dynamic Toy - An inertial dynamic toy is disclosed comprising: an annular housing having a circumferential groove; a flywheel mounted to a flywheel support axle, the flywheel support axle configured to be retained inside the annular housing; and an outrigger support frame releasably attached to the annular housing. | 02-12-2015 |
Yuval Kaye, Moshave Nitzanei Sinai IL
Patent application number | Description | Published |
---|---|---|
20140101789 | Plants Tolerant To Abiotic Stress - The present invention provides genetically modified plants having increased tolerance to environmental abiotic stress, particularly to salt stress and water stress (drought). The tolerant genetically modified plants of the invention include transgenic plants overexpressing at least one inositol polyphosphate 5-phosphatase selected from 5TPase7 5TPase9 and plants having altered expression of the Endonuclease/Exonuclease/Phosphatase (EEP) protein ZEEP1. | 04-10-2014 |