PFIZER INC. Patent applications |
Patent application number | Title | Published |
20160136170 | USE OF A TETRASUBSTITUTED PYRAZOLO[4, 3-D]PYRIMIDINE COMPOUND FOR TREATING DIABETIC NEPHROPATHY - The present invention relates to methods of delaying progression to end stage renal disease (ESRD) in patients comprising administration of 1-(2-ethoxyethyl)-5-(ethyl(methyl)amino)-7-((4-methylpyridin-2-yl)amino)-N-(methylsulfonyl)-1H-pyrazolo[4,3-d]pyrimidine-3-carboxamide. The present invention also includes administration of pharmaceutical compositions for delaying progression to ESRD. | 05-19-2016 |
20160122799 | Fecal Recovery Assay - The fecal recovery assay of this invention accurately quantifies the number of viable BB12 colonies in the gastrointestinal tract of humans and animals. This BB12 culture method is highly selective for isolating BB12 colonies from human stool. Furthermore, this method has the utility of assessing the survivability of BB12 delivered by food products and supplements through the GI tract, and thus providing potential information on the human health effects of viable BB12. | 05-05-2016 |
20160115178 | SOLID FORMS OF A MACROCYCLIC KINASE INHIBITOR - This invention relates to crystalline solvates of (10R)-7-amino-12-fluoro-2,10,16-trimethyl-15-oxo-10,15,16,17-tetrahydro-2H-8,4-(metheno)pyrazolo[4,3-h][2,5,11]benzoxadiazacyclotetradecine-3-carbonitrile, useful in the treatment of abnormal cell growth, such as cancer, in mammals. This invention also relates to pharmaceutical compositions comprising such crystalline solvates, and to methods of using such solvates and compositions in the treatment of abnormal cell growth in mammals, especially humans. | 04-28-2016 |
20160102074 | SUBSTITUTED AMIDE COMPOUNDS - The present invention is directed at substituted amide compounds, pharmaceutical compositions containing such compounds and the use of such compounds to reduce plasma lipid levels, such as LDL-cholesterol and triglycerides and accordingly to treat diseases which are exacerbated by high levels of LDL-cholesterol and triglycerides, such as atherosclerosis and cardiovascular diseases, in mammals, including humans. | 04-14-2016 |
20160052930 | AMINOPYRIMIDINYL COMPOUNDS - A compound having the structure: | 02-25-2016 |
20160045508 | PYRROLO[2,3-D]PYRIMIDINE DERIVATIVES - Described herein are pyrrolo{2,3-d}pyrimidine derivatives, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing them, and therapeutic uses thereof. | 02-18-2016 |
20160039828 | Imidazopyridazine Compounds - The present invention is directed to compounds of Formula I: | 02-11-2016 |
20160016940 | Indole and Indazole Compounds that Activate AMPK - The present invention relates to indole and indazole compounds of Formula (I) that activate 5′ adenosine monophosphate-activated protein kinase (AMPK). The invention also encompasses pharmaceutical compositions containing these compounds and methods for treating or preventing diseases, conditions, or disorders ameliorated by activation of AMPK. | 01-21-2016 |
20160016907 | PYRIDINE DERIVATIVES AS MUSCARINIC M1 RECEPTOR POSITIVE ALLOSTERIC MODULATORS - The present invention provides, in part, compounds of Formula I: | 01-21-2016 |
20160002357 | BISPECIFIC HETERODIMERIC DIABODIES AND USES THEREOF - Bispecific heterodimeric diabody molecules and uses thereof in the treatment of cancer. The bispecific heterodimeric diabody molecules comprise two polypeptide chains that associate to form two epitope binding sites recognizing the P-cadherin tumor cell associated antigen and the CD3 T cell antigen. | 01-07-2016 |
20160002264 | Carbocyclic- And Heterocyclic-Substituted Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - The present invention provides compounds of formula I, | 01-07-2016 |
20160002223 | SOLID FORMS OF A SELECTIVE CDK4/6 INHIBITOR - This invention relates to the crystalline free base of acetyl-8-cyclopentyl-5-methyl-2-(5-piperazin-1-yl-pyridin-2-ylamino)-8H-pyrido[2,3-d]pyrimidin-7-one, formula (1) having improved properties, to pharmaceutical compositions and dosage forms comprising the free base, and to methods for making and using such compounds, compositions and dosage forms in the treatment of cell proliferative diseases, such as cancer. | 01-07-2016 |
20150376207 | Substituted Phenyl Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - The present invention is directed to compounds, tautomers and pharmaceutically acceptable salts of the compounds which are disclosed, wherein the compounds have the structure of Formula I, | 12-31-2015 |
20150376185 | N1-PYRAZOLOSPIROKETONE ACETYL-CoA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 12-31-2015 |
20150366874 | Novel 4-(Substituted Amino)-7H-Pyrrolo[2,3-d]Pyrimidines As LRRK2 Inhibitors - The present invention provides novel 4,5-disubstituted-7H-pyrrolo[2,3-d]pyrimidine derivatives of Formula I, and the pharmaceutically acceptable salts thereof | 12-24-2015 |
20150361067 | SUBSTITUTED DIHYDROISOQUINOLINONE COMPOUNDS - This invention relates to compounds of general formula (I) | 12-17-2015 |
20150353508 | QUINOLINYL GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula I | 12-10-2015 |
20150344490 | Heteroaromatic Compounds and their Use as Dopamine D1 Ligands - The present invention provides, in part, compounds of Formula I: | 12-03-2015 |
20150344474 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 12-03-2015 |
20150336958 | SUBSTITUTED ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 11-26-2015 |
20150329555 | SUBSTITUTED-6,8-DIOXABICYCLO[3.2.1]OCTANE-2,3-DIOL COMPOUNDS AS TARGETING AGENTS OF ASGPR - Compounds of Formula (A) are described herein and the uses thereof for the treatment of diseases, conditions and/or disorders mediated by pharmaceutical compositions and the uses thereof as asialoglycoprotein receptor (ASGPR) targeting agents. | 11-19-2015 |
20150307522 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 10-29-2015 |
20150307494 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 10-29-2015 |
20150291621 | 2-Amino-6-Methyl-4,4a,5,6-Tetrahydropyrano[3,4-d][1,3]Thiazin-8a(8H)-yl-1,- 3-Thiazol-4-yl Amides - The present invention is directed to compounds, tautomers and pharmaceutically acceptable salts of the compounds which are disclosed, wherein the compounds have the structure of Formula I, | 10-15-2015 |
20150290318 | Combination of Local and Systemic Immunomodulative Therapies for Enhanced Treatment of Cancer - A method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic immunomodulatory anticancer agent. A further method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic targeted anticancer agent. The present invention is further directed to pharmaceutical compositions for treatment of cancer. The intralesional chemoablative pharmaceutical composition can comprise an IL chemoablative agent comprising primarily a halogenated xanthene. | 10-15-2015 |
20150290165 | Combination of Local and Systemic Immunomodulative Therapies for Enhanced Treatment of Cancer - A method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic immunomodulatory anticancer agent. A further method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic targeted anticancer agent. The present invention is further directed to pharmaceutical compositions for treatment of cancer. The intralesional chemoablative pharmaceutical composition can comprise an IL chemoablative agent comprising primarily a halogenated xanthene. | 10-15-2015 |
20150284405 | Bicyclic-Fused Heteroaryl or Aryl Compounds - Compounds, tautomers and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula Ia, | 10-08-2015 |
20150274735 | USE OF A TETRASUBSTITUTED PYRAZOLO[4, 3-D]PYRIMIDINE COMPOUND FOR TREATING DIABETIC NEPHROPATHY - The present invention relates to methods of delaying progression to end stage renal disease (ESRD) in patients comprising administration of 1-(2-ethoxyethyl)-5-(ethyl(methyl)amino)-7-((4-methyl-pyridin-2-yl)amino)-N-(methylsulfonyl)-1H-pyrazolo[4,3-d]pyrimidine-3-carboxamide. The present invention also includes administration of pharmaceutical compositions for delaying progression to ESRD. 1-(2-ethoxyethyl)-5-(ethyl(methyl)amino)-7-((4-methyl-pyridin-2-yl)amino)-N-(methylsulfonyl)-1H-pyrazolo[4,3-d]pyrimidine-3-carboxamide. | 10-01-2015 |
20150266962 | ANTI-IL-13 RECEPTOR ALPHA 2 ANTIBODIES AND ANTIBODY-DRUG CONJUGATES - Disclosed herein are anti-IL-13-Rα2 antibodies and antibody drug conjugates and methods for preparing and using the same. | 09-24-2015 |
20150266861 | Glucagon Receptor Modulators - The present invention provides a compound of Formula (I) | 09-24-2015 |
20150266859 | GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula (I) | 09-24-2015 |
20150259323 | DIACYLGLYCEROL ACYLTRANSFERASE 2 INHIBITORS - Compounds of Formula I that inhibit the activity of the diacylglycerol acyltransferase 2 (DGAT2) and their uses in the treatment of diseases linked thereto in animals are described herein. | 09-17-2015 |
20150239908 | Alkyl-Substituted Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - Compounds, tautomers and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I, as defined in the specification. Corresponding pharmaceutical compositions, methods of treatment, methods of synthesis, and intermediates are also disclosed. | 08-27-2015 |
20150239842 | BENZAMIDE AND HETEROBENZAMIDE COMPOUNDS - This invention relates to compounds of general formula (I), in which R | 08-27-2015 |
20150231144 | Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - The present invention provides compounds of Formula I, and the tautomers thereof, and the pharmaceutically acceptable salts of the compounds and tautomers, wherein the compounds have the structure | 08-20-2015 |
20150224110 | Heteroaryl-Substituted Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - The present invention is directed to compounds, tautomers and pharmaceutically acceptable salts of the compounds which are disclosed, wherein the compounds have the structure of Formula I, | 08-13-2015 |
20150203574 | ANTIBODIES TO IL-6 AND THEIR USES - Antibodies and antigen-binding portions thereof that bind to human IL-6 are provided. Also provided are nucleic acids encoding such antibodies and antigen binding portions, methods of making such antibodies and antigen binding portions, compositions comprising such antibodies or antigen binding portions, and uses of such antibodies or antigen binding portions. | 07-23-2015 |
20150196561 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 07-16-2015 |
20150190346 | COMPOSITIONS AND METHODS FOR TREATMENT OF ABNORMAL CELL GROWTH - This invention relates to oral dosage forms and methods that are useful in the treatment of abnormal cell growth, such as cancer, in mammals, especially humans. | 07-09-2015 |
20150182513 | N-Link Hydroxamic Acid Derivatives Useful As Antibacterial Agents - The present invention is directed to a new class of hydroxamic acid derivatives, their use as LpxC inhibitors, and more specifically their use to treat bacterial infections. | 07-02-2015 |
20150175573 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 06-25-2015 |
20150175572 | ARYL AND HETEROARYL FUSED LACTAMS - This invention relates to compounds of general formula (I) | 06-25-2015 |
20150152109 | N1/N2-LACTAM ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 06-04-2015 |
20150141402 | PURINE DERIVATIVES - The present invention relates to compounds of formula (I) | 05-21-2015 |
20150125472 | ANTI-EFNA4 ANTIBODY-DRUG CONJUGATES - The present invention provides for anti-EFNA4 antibody-drug conjugates and methods for preparing and using the same. | 05-07-2015 |
20150119381 | USE OF GHRELIN RECEPTOR INVERSE AGONISTS OR ANTAGONISTS FOR TREATING SLEEP DISORDERS - The present invention relates to methods of treating sleep disorders in patients comprising administration of a ghrelin receptor inverse agonist or antagonist. The invention also includes methods of treating sleep disorders comprising the administration of a pharmaceutical composition comprising a ghrelin receptor inverse agonist or antagonist and at least one pharmaceutically acceptable carrier, diluent, or excipient. | 04-30-2015 |
20150112068 | SUBSTITUTED ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 04-23-2015 |
20150099882 | QUINOLINYL GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula I | 04-09-2015 |
20150099782 | ANTAGONISTS OF PROSTAGLANDIN EP3 RECEPTOR - Provided herein are antagonists of prostaglandin EP3 receptor, processes to make said antagonists, and methods comprising administering said antagonists to a mammal in need thereof. | 04-09-2015 |
20150094338 | Glucagon Receptor Modulators - The present invention provides a compound of Formula (I) | 04-02-2015 |
20150087637 | Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - Compounds and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I, | 03-26-2015 |
20150087585 | DIACYLGLYCEROL ACYLTRANSFERASE 2 INHIBITORS - Derivatives of purine, 3H-imidazo[4,5-b]pyrimidine and 1H-imidazo[4,5-d]pyrazine of Formula I that inhibit the activity of the diacylglycerol acyltransferase 2 (DGAT2) and their uses in the treatment of diseases linked thereto in animals are described herein. | 03-26-2015 |
20150065565 | DIOXA-BICYCLO[3.2.1]OCTANE-2,3,4-TRIOL DERIVATIVES - Compounds of Formula (A) and (B) are described herein and the uses thereof for the treatment of diseases, conditions and/or disorders mediated by sodium-glucose transporter inhibitors (in particular, SGLT2 inhibitors). | 03-05-2015 |
20150065513 | DIOXA-BICYCLO[3.2.1]OCTANE-2,3,4-TRIOL DERIVATIVES - Compounds of Formula (A) and (B) are described herein and the uses thereof for the treatment of diseases, conditions and/or disorders mediated by sodium-glucose transporter inhibitors (in particular, SGLT2 inhibitors). | 03-05-2015 |
20150065512 | DIOXA-BICYCLO[3.2.1]OCTANE-2,3,4-TRIOL DERIVATIVES - Compounds of Formula (A) and (B) are described herein and the uses thereof for the treatment of diseases, conditions and/or disorders mediated by sodium-glucose transporter inhibitors (in particular, SGLT2 inhibitors). | 03-05-2015 |
20150038484 | INDOLE AND INDAZOLE COMPOUNDS THAT ACTIVATE AMPK - The present invention relates to indole and indazole compounds of Formula (I) | 02-05-2015 |
20150025098 | N1/N2-LACTAM ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 01-22-2015 |
20150011470 | N1-PYRAZOLOSPIROKETONE ACETYL-CoA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 01-08-2015 |
20140377255 | 4-1BB BINDING MOLECULES - The present disclosure provides isolated binding molecules that bind to human 4-1BB, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions. | 12-25-2014 |
20140371467 | GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula (I) | 12-18-2014 |
20140364398 | C-Linked Hydroxamic Acid Derivatives Useful As Antibacterial Agents - The present invention is directed to a new class of hydroxamic acid derivatives, their use as LpxC inhibitors, and more specifically their use to treat bacterial infections. | 12-11-2014 |
20140343031 | N-Link Hydroxamic Acid Derivatives Useful As Antibacterial Agents - The present invention is directed to a new class of hydroxamic acid derivatives, their use as LpxC inhibitors, and more specifically their use to treat bacterial infections. | 11-20-2014 |
20140342450 | ANTIBODIES TO CCR2 - Provided are antibodies including human antibodies and antigen-binding portions thereof that specifically bind to CCR2, preferably human CCR2, and that may inhibit CCR2. The present antibodies may bind to the first and/or second extracellular loops of CCR2. Isolated heavy and light chains derived from the antibodies and nucleic acid molecules encoding the antibodies and chains are provided. Methods of making and using the anti-CCR2 antibodies or antigen-binding portions, and compositions comprising these antibodies or antigen-binding portions, including compositions for diagnosis and treatment, are provided. Also provided are gene therapy methods using nucleic acid molecules encoding the heavy and/or light chains that comprise the human anti-CCR2 antibodies or antigen-binding portions thereof. | 11-20-2014 |
20140336176 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 11-13-2014 |
20140335178 | DOSAGE FORMS OF APIXABAN - The present invention relates to a Factor Xa inhibitor dosage form comprising apixaban in a solubility-improved form wherein the dosage form provides controlled release of apixaban and methods for preventing or treating venous thromboembolisms, deep vein thrombosis and acute coronary syndrome with said dosage form. | 11-13-2014 |
20140329862 | Glucagon Receptor Modulators - The present invention provides a compound of Formula (I) | 11-06-2014 |
20140329820 | Triazine Derivatives - The present invention is directed to a new class of triazine derivatives as described by formula I below in which A, X, R | 11-06-2014 |
20140315928 | SUBSTITUTED AMIDE COMPOUNDS - The present invention is directed at substituted amide compounds, pharmaceutical compositions containing such compounds and the use of such compounds to reduce plasma lipid levels, such as LDL-cholesterol and triglycerides and accordingly to treat diseases which are exacerbated by high levels of LDL-cholesterol and triglycerides, such as atherosclerosis and cardiovascular diseases, in mammals, including humans. | 10-23-2014 |
20140288125 | N-METHYL-2-[3-((E)-2-PYRIDIN-2-YL-VINYL)-1H-INDAZOL-6-YLSULFANYL]-BENZAMID- E FOR THE TREATMENT OF CHRONIC MYELOGENOUS LEUKEMIA - The present invention relates to a method of treating chronic myelogenous leukemia in a subject comprising administering to the subject a compound, such as N-methyl-2-[3-((E)-2-pyridin-2-yl-vinyl)-1H-indazol-6-ylsulfanyl]-benzamide, that inhibits the T315I mutation in BCR-ABL tyrosine kinase, or a pharmaceutically acceptable salt thereof. The present invention also relates to a pharmaceutical composition comprising a compound such as N-methyl-2-[3-((E)-2-pyridin-2-yl-vinyl)-1H-indazol-6-ylsulfanyl]-benzamide, that inhibits the T315I mutation in BCR-ABL tyrosine kinase, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or diluent. | 09-25-2014 |
20140288111 | N1-PYRAZOLOSPIROKETONE ACETYL-CoA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 09-25-2014 |
20140288086 | ENANTIOMERICALLY PURE AMINOHETEROARYL COMPOUNDS AS PROTEIN KINASE INHIBITORS - Enantiomerically pure compound of formula 1 | 09-25-2014 |
20140286959 | Methods of Treating Inflammatory Disorders Using Anti-M-CSF Antibodies - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to a M-CSF, preferably human M-CSF, and that function to inhibit a M-CSF. The invention also relates to human anti-M-CSF antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-M-CSF antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-M-CSF antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-M-CSF antibodies. The invention also relates to transgenic animals and transgenic plants comprising nucleic acid molecules of the present invention. | 09-25-2014 |
20140271842 | TOFACITINIB ORAL SUSTAINED RELEASE DOSAGE FORMS - The present invention relates to oral sustained release formulations of tofacitinib and pharmaceutical acceptable salts thereof. The formulations described herein have desirable pharmacokinetic characteristics. | 09-18-2014 |
20140243364 | ENHANCED STABILITY OF NOVEL LIQUID COMPOSITIONS - The present invention relates to compositions of pharmaceutical agents in combination with additional pharmaceutical agents in a mixture of polyethylene glycol, polyvinylpyrrolidone, and propylene glycol and a process of making the compositions. | 08-28-2014 |
20140243318 | SALTS AND POLYMORPHS OF 8-FLUORO-2--1,3,4,5-TETRAHYDRO-6H-AZEPINO[5,4,3-CD]INDOL-6-ONE - The present invention relates to novel polymorphic forms of 8-fluoro-2-{4-[(methylamino)methyl]phenyl}-1,3,4,5-tetrahydro-6H-azepino[5,4,3-cd]indol-6-one, and to processes for their preparation. Such polymorphic forms may be a component of a pharmaceutical composition and may be used to treat a mammalian disease condition mediated by poly(ADP-ribose) polymerase activity including the disease condition such as cancer. | 08-28-2014 |
20140243312 | PYRROLO[2,3-D]PYRIMIDINE DERIVATIVES - Described herein are pyrrolo{2,3-d}pyrimidine derivatives, their use as Janus Kinase (JAK) inhibitors, and pharmaceutical compositions containing them. | 08-28-2014 |
20140206670 | COMBINATIONS COMPRISING ALPHA-2-DELTA LIGANDS - The instant invention relates to a combination, particularly a synergistic combination, of an alpha-2-delta ligand and a dual serotonin-noradrenaline re-uptake inhibitor (DSNRI) or one or both of a selective serotonin re-uptake inhibitor (SSRI) and a selective noradrenaline re-uptake inhibitor (SNRI), and pharmaceutically acceptable salts thereof, pharmaceutical compositions thereof and their use in the treatment of pain, particularly neuropathic pain. | 07-24-2014 |
20140206651 | Hydroxamic Acid Derivatives Useful As Antibacterial Agents - The invention relates to a compound of formula (I): | 07-24-2014 |
20140187794 | Process for Preparing Chiral Compounds - The present invention is directed to a 2-deoxyribose-5-phosphate aldolase (DERA) chemoenzymatic process for making chiral compounds. | 07-03-2014 |
20140179667 | ARYL AND HETEROARYL FUSED LACTAMS - This invention relates to compounds of general formula (I) | 06-26-2014 |
20140163015 | HEXAHYDROPYRANO[3,4-d][1,3]THIAZIN-2-AMINE COMPOUNDS - The present invention provides compounds of Formula I, and the tautomers thereof, and the pharmaceutically acceptable salts of the compounds and tautomers, wherein the compounds have the structure | 06-12-2014 |
20140161821 | TREATMENT WITH ANTI-PCSK9 ANTIBODIES - The present invention concerns dosages for the treatment of human patients susceptible to or diagnosed with a disorder characterized by marked elevations of low density lipoprotein particles in the plasma with a PCSK9 antagonist antibody alone or in combination with a statin. | 06-12-2014 |
20140155627 | Process for Forming Amorphous Atorvastatin - A process for forming amorphous atorvastatin comprising the steps of dissolving atorvastatin in a non-hydroxylic solvent and removing the solvent by freeze-drying, as well as processes of dissolving atorvastatin in a hydroxylic solvent with a solubilizing agent or an alkalizing agent or an antioxidant and removing the solvent by freeze-drying to afford amorphous atorvastatin. | 06-05-2014 |
20140155390 | NOVEL SELECTIVE ANDROGEN RECEPTOR MODULATORS - The present invention relates to a compound of Formula 1, 2 or 3: | 06-05-2014 |
20140154268 | ALPHA5-BETA1 ANTIBODIES AND THEIR USES - The present disclosure provides isolated monoclonal antibodies, particularly human monoclonal antibodies, or antigen binding portions thereof, that specifically bind to integrin α5β1 with high affinity. Nucleic acid molecules encoding the antibodies of the disclosure, expression vectors, host cells and methods for expressing the antibodies of the disclosure are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies or antigen binding portions thereof are also provided. The disclosure also provides methods for treating various cancers using the anti-α5β1 antibodies or antigen binding portions thereof described herein. | 06-05-2014 |
20140142316 | Tricyclic Compounds, Compositions, And Methods - The present invention is directed to compounds of Formula I: | 05-22-2014 |
20140135339 | MACROCYCLIC DERIVATIVES FOR THE TREATMENT OF DISEASES - The invention relates to compounds of formula (Φ) | 05-15-2014 |
20140135338 | QUINOLINYL GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula I or a pharmaceutically acceptable salt thereof, wherein R | 05-15-2014 |
20140134193 | SPLICEOSTATIN ANALOGS AND METHODS FOR THEIR PREPARATION - The present invention is directed to novel cytotoxic spliceostatin analogs and derivatives, to antibody drug conjugates thereof, and to methods for using the same to treat medical conditions including cancer. | 05-15-2014 |
20140134176 | PLATELET-DERIVED GROWTH FACTOR B SPECIFIC ANTIBODIES AND COMPOSITIONS AND USES THEREOF - The present invention provides antibodies, or antigen-binding fragment thereof, which specifically bind to PDGF-B. The invention further provides a method of obtaining such antibodies and nucleic acids encoding the same. The invention further relates to compositions and therapeutic methods for use of these antibodies for the treatment and/or prevention of PDGF-B mediated diseases, disorders or conditions. | 05-15-2014 |
20140128374 | HETEROAROMATIC COMPOUNDS AND THEIR USE AS DOPAMINE D1 LIGANDS - The present invention provides, in part, compounds of Formula I: | 05-08-2014 |
20140127211 | ANTI-NOTCH3 ANTIBODIES AND ANTIBODY-DRUG CONJUGATES - The present invention provides for anti-Notch3 antibodies, anti-Notch3 antibody-drug conjugates and methods for preparing and using the same. | 05-08-2014 |
20140120089 | ANTIBODIES TO INSULIN-LIKE GROWTH FACTOR I RECEPTOR - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to insulin-like growth factor I receptor (IGF-IR), which is preferably human IGF-IR. The invention also relates to human anti-IGF-IR antibodies, including chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulin molecules derived from anti-IGF-IR antibodies and nucleic acid molecules encoding such molecules. The present invention also relates to methods of making anti-IGF-IR antibodies, pharmaceutical compositions comprising these antibodies and methods of using the antibodies and compositions thereof for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-IGF-IR antibodies. The invention also relates to gene therapy methods and transgenic animals comprising nucleic acid molecules of the present invention. | 05-01-2014 |
20140088111 | Novel Bicyclic Pyridinones - Compounds and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I | 03-27-2014 |
20140088081 | Amino-Heterocyclic Compounds - The invention provides PDE9-inhibiting compounds of Formula (I), | 03-27-2014 |
20140086914 | TREATMENT METHODS USING c-MET ANTIBODIES - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to c-Met, preferably human c-Met, and that function to inhibit c-Met. The invention also relates to human anti-c-Met antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-c-Met antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-c-Met antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-c-Met antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 03-27-2014 |
20140080756 | 2,3-DIHYDRO-1H-INDEN-1-YL-2,7-DIAZASPIRO[3.5]NONANE DERIVATIVES - The present invention provides a compound of Formula (I) | 03-20-2014 |
20140066622 | Imidazo[5,1-f][1,2,4]Triazines For The Treatment of Neurological Disorders - The present invention relates to compounds of the Formula | 03-06-2014 |
20140057938 | KAT ll INHIBITORS - Compounds of Formula I: | 02-27-2014 |
20140057919 | FLUORO-PYRIDINONE DERIVATIVES USEFUL AS ANTIBACTERIAL AGENTS - The present invention is directed to a new class of hydroxamic acid derivatives, their use as LpxC inhibitors and, more specifically, their use to treat bacterial infections. | 02-27-2014 |
20140045790 | Novel Bicyclic Pyridinones - Compounds and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I | 02-13-2014 |
20140024690 | Isoxazole Derivatives Useful As Antibacterial Agents - The present invention is directed to a new class of hydroxamic acid derivatives, their use as LpxC inhibitors and, more specifically, their use to treat bacterial infections. | 01-23-2014 |
20140023638 | ANTIBODY TO GDF8 AND USES THEREOF - The disclosure provides novel molecules related to growth and differentiation factor 8 (GDF8), in particular epitopes specific to GDF8 and other specific antagonists of GDF8 in particular anti GDF8 antibodies or antigen binding protein or fragment thereof which may inhibit GDF8 activity and signal in vitro and/or in vivo. The disclosure also provides for an immunoassay used to detect and quantitate GDF8. The disclosure also provides methods for diagnosing, preventing, ameliorating, and treating GDF8 associated disorders, e.g., degenerative orders of muscle, bone, and insulin metabolism. Finally, the disclosure provides pharmaceuticals for the treatment of such disorders by using the antibodies, polypeptides, polynucleotides, and vectors of the invention. | 01-23-2014 |
20140005384 | Salt forms of [R-(R*,R*)]-2-(4-fluorophenyl)-beta, delta-dihydroxy-5-(1-methylethyl)-3-phenyl-4-[phenylamino)carbonyl]-1H-py- rrole-1-heptanoic acid | 01-02-2014 |
20140004142 | PCSK9 VACCINE | 01-02-2014 |
20130345392 | EDN3-LIKE PEPTIDES AND USES THEREOF - This application discloses novel EDN3-like polypeptides. One such short polypeptide is EDN3 97-140, which is a 44 amino acid peptide that stimulates GLP-1 secretion in enteric cells and inhibits gluconeogenesis in hepatic cells. EDN3 97-140, as well as other EDN3-like polypeptides provided herein may be used in the study and treatment of a number of indications, including the treatment of metabolic disorders such as obesity and diabetes. | 12-26-2013 |
20130317198 | Tandem Purification of Proteins - The present disclosure provides methods for purifying products from a fluid. In some embodiments, provided purification methods use a combination of purification modes (e.g., protein A and ion exchange) operated in tandem, wherein at least one of the modes utilizes weak partitioning. In some embodiments, provided purification methods operate under robust conditions in which a degree of binding between a product and resin is maintained despite variations in operating parameters. | 11-28-2013 |
20130315865 | TRIAZINE COMPOUNDS AS PI3 KINASE AND MTOR INHIBITORS - Compounds of formula I | 11-28-2013 |
20130296308 | Heterocyclic Substituted Hexahydropyrano[3,4-d][1,3]Thiazin-2-Amine Compounds - Compounds, tautomers and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I, | 11-07-2013 |
20130295110 | PROSTATE-ASSOCIATED ANTIGENS AND VACCINE-BASED IMMUNOTHERAPY REGIMENS - The present disclosure provides (a) isolated immunogenic PAA polypeptides; (b) isolated nucleic acid molecules encoding immunogenic PAA polypeptides; (c) vaccine compositions comprising an immunogenic PAA polypeptide or an isolated nucleic acid molecule encoding an immunogenic PAA polypeptide; (d) methods relating to uses of the polypeptides, nucleic acid molecules, and compositions; and (e) vaccine-based immunotherapy regimens which involve co-administration of a vaccine in combination with an immune-suppressive-cell inhibitor and an immune-effector-cell enhancer. | 11-07-2013 |
20130280266 | ANTIBODIES TO IL-6 AND THEIR USES - Antibodies and antigen-binding portions thereof that bind to human IL-6 are provided. Also provided are nucleic acids encoding such antibodies and antigen binding portions, methods of making such antibodies and antigen binding portions, compositions comprising such antibodies or antigen binding portions, and uses of such antibodies or antigen binding portions. | 10-24-2013 |
20130267493 | INDOLE AND INDAZOLE COMPOUNDS THAT ACTIVATE AMPK - The present invention relates to indole and indazole compounds of Formula (I) | 10-10-2013 |
20130261712 | COLD THERAPY DEVICE - The present invention is directed to a device for absorbing heat from a body. More particularly, the invention pertains to an improved device which utilizes a gel material comprising liquids and solids to absorb, over an extended period of time, heat from a body. The present invention also includes methods of providing cold therapy treatment to a user | 10-03-2013 |
20130252973 | Benzofuranyl Derivatives - The present invention provides compounds of Formula (I) | 09-26-2013 |
20130252961 | MACROCYCLIC DERIVATIVES FOR THE TREATMENT OF DISEASES - The invention relates to compounds of formula (Φ) | 09-26-2013 |
20130252935 | Monobactams - The present invention is directed to a new class of monobactam derivatives and their use for treating bacterial infections. | 09-26-2013 |
20130243807 | NEISSERIA MENINGITIDIS COMPOSITIONS AND METHODS THEREOF - In one aspect, the invention relates to an isolated polypeptide comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 71. In another aspect, the invention relates to an immunogenic composition including an isolated non-lipidated, non-pyruvylated ORF2086 polypeptide from | 09-19-2013 |
20130225487 | DIOXA-BICYCLO[3.2.1]OCTANE-2,3,4-TRIOL DERIVATIVES - Compounds of Formula (A) and (B) are described herein and the uses thereof for the treatment of diseases, conditions and/or disorders mediated by sodium-glucose transporter inhibitors (in particular, SGLT2 inhibitors). | 08-29-2013 |
20130210800 | PYRIDINE-2-DERIVATIVES AS SMOOTHENED RECEPTOR MODULATORS - The present application relates to compounds of Formula (I), and Formula (II), or pharmaceutically acceptable salt thereof, wherein A, X, Y, Z, e, f, R | 08-15-2013 |
20130209479 | CANCER TREATMENT - The present invention relates to methods of treating cancer, such as melanoma, by administering a CTLA4 antagonist to a subject with a serum C-Reactive Protein (CRP) concentration that is less than or equal to some amount. The invention further relates to methods of treating cancer by determining the level of serum CRP concentration in a subject, and then administering a CTLA4 antagonist if the CRP concentration is less than or equal to a certain amount. The invention further relates to, among other things, the use of serum CRP concentration as a predictive factor for a subject's response to a cancer treatment. | 08-15-2013 |
20130203767 | Treatment of Pulmonary Hypertension - This invention relates to the use of certain cyclic guanosine 3′,5′-monophosphate phosphodiesterase type five (cGMP PDE5) inhibitors, including in particular the compound sildenafil, for the treatment of pulmonary hypertension. | 08-08-2013 |
20130197008 | 3-AMINOCYCLOPENTANECARBOXAMIDES AS CHEMOKINE RECEPTOR AGONISTS - There is provided a compound of Formula I(a) or I(b): | 08-01-2013 |
20130196952 | HETEROCYCLIC DERIVATIVES FOR THE TREATMENT OF DISEASES - The invention relates to compounds of Formula (1) and to processes for the preparation of intermediates used in the preparation of compositions containing and the uses of such derivatives. The compounds according to the present invention are useful in numerous diseases in which ALK protein is involved or in which inhibition of ALK activity may induce benefit, especially for the treatment of cancer mediated by a mutated EML4-ALK fusion protein. | 08-01-2013 |
20130190334 | N1-PYRAZOLOSPIROKETONE ACETYL-CoA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) Z N N O N O A1R2 R1 R3R 3 L A2 (I) or a pharmaceutically acceptable salt of the compound, wherein R1, R2, R3,Z, A1, L and A 5 2 are as described herein; pharmaceutical compositions thereof; and the use thereof in treating diseases, conditions or disorders modulated by the inhibition of an acetyl-CoA carboxylase enzyme(s) in an animal. | 07-25-2013 |
20130184294 | Pyrimidones for Treatment of Potassium Channel Related Diseases - The present invention relates to compounds of Formula I as described herein or a pharmaceutically acceptable salt thereof, pharmaceutical composition comprising a compound of Formula I or a pharmaceutically acceptable salt thereof and methods of treating a disease, disorder, or condition of the central nervous system, including bipolar disorder, depressive disorders, anxiety disorders, cognitive disorders, pain disorders, urogenital disorders, and epilepsy, among the other diseases, disorders or conditions discussed herein as mono-therapy or in combination with another active pharmaceutical ingredient. | 07-18-2013 |
20130165452 | Substituted Heteroaryls - The present invention provides Formula (1A) compounds | 06-27-2013 |
20130164310 | ANTI-DIABETIC COMPOUNDS - The present invention provides a composition of the formula: [FGF21-1 | 06-27-2013 |
20130150391 | Piperidinyl Pyrimidine Amides As KV7 Potassium Channel Openers - The present invention relates to compounds of Formula (I) as described herein or a pharmaceutically acceptable salt thereof, pharmaceutical composition comprising a compound of Formula (I) or a pharmaceutically acceptable salt thereof and methods of treating, or manufacture of a medicament to treat, a disease, disorder, or condition of the central nervous system, including bipolar disorder, depressive disorders, anxiety disorders, cognitive disorders, pain disorders, urogentital disorder, and epilepsy, among the other diseases, disorders or conditions discussed herein as mono-therapy or in combination with another active pharmaceutical ingredient. | 06-13-2013 |
20130150376 | Novel Sultam Compounds - Compounds and pharmaceutically acceptable salts of the compounds are disclosed, wherein the compounds have the structure of Formula I (I) as defined in the specification. Corresponding pharmaceutical compositions, methods of treatment, methods of synthesis, and intermediates are also disclosed. | 06-13-2013 |
20130137671 | Substituted Triazole Derivatives As Oxytocin Antagonists - The present invention relates to substituted triazoles of formula (I), uses thereof, processes for the preparation thereof and compositions containing said compounds. These inhibitors have utility in a variety of therapeutic areas including sexual dysfunction. | 05-30-2013 |
20130129753 | CYTOTOXIC PEPTIDES AND ANTIBODY DRUG CONJUGATES THEREOF - The present invention is directed to cytotoxic pentapeptides, to antibody drug conjugates thereof, and to methods for using the same to treat cancer. | 05-23-2013 |
20130109670 | TRIAZINE COMPOUNDS AS PI3 KINASE AND MTOR INHIBITORS | 05-02-2013 |
20130079324 | PYRROLOPYRIMIDINE AND PURINE DERIVATIVES - The present invention relates to compounds of formula (I) | 03-28-2013 |
20130078270 | HER-2 PEPTIDES AND VACCINES - The present invention provides (a) isolated immunogenic HER-2 peptides capable of inducing immune responses against human HER-2 receptor; (b) isolated nucleic acid molecules encoding an isolated immunogenic HER-2 peptide; (c) plasmid constructs comprising a nucleic acid molecule encoding an isolated immunogenic HER-2 peptide; (d) vaccine compositions comprising an isolated immunogenic HER-2 peptide (e) vaccine compositions comprising an isolated nucleic acid molecule encoding an isolated immunogenic HER-2 peptide; and (f) methods of treating or preventing cancer, inhibiting abnormal cell proliferation, or eliciting an immune response against HER-2 protein in a mammal using (1) an isolated immunogenic HER-2 peptide, (2) nucleic acid molecule encoding an isolated immunogenic HER-2 peptide, or (3) a composition comprising an isolated immunogenic HER-2 peptide, or composition comprising a nucleic acid molecule encoding an isolated immunogenic HER-2 peptide. | 03-28-2013 |
20130078240 | 4-1BB BINDING MOLECULES - The present disclosure provides isolated binding molecules that bind to human 4-1BB, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions. | 03-28-2013 |
20130072427 | GPR 119 MODULATORS - Compounds of formula (I) that modulate the activity of the G-protein-coupled receptor GPR119 and their uses in the treatment of diseases linked to the modulation of the G-protein-coupled receptor GPR119 in animals are described herein. | 03-21-2013 |
20130071921 | ANTIBODIES SPECIFIC FOR DKK-1 AND THEIR USES - The present invention provides antibodies and fragments thereof that bind to Dkk-1 and, in particular, to humanized antibodies and fragments thereof that bind to Dkk-1 and, even more particularly to fully humanized antibodies and immunologically functional fragments that bind to Dkk-1. Also provided are antibodies and fragments thereof which compete with the binding of an anti-mouse Dkk-1 monoclonal antibody for binding to Dkk-1 | 03-21-2013 |
20130045245 | APIXABAN FORMULATIONS - Compositions comprising crystalline apixaban particles having a D | 02-21-2013 |
20130030181 | N1-Pyrazolospiroketone Acetyl-CoA Carboxylase Inhibitors - The invention provides a compound of Formula (I) | 01-31-2013 |
20130029377 | RECOMBINANT APOA-1M FROM ENGINEERED BACTERIA - Apolipoprotein A-1 Milano (ApoA-1M), the protein component of a high-density lipoprotein (HDL) mimic with promising potential for reduction of atherosclerotic plaque, is produced on a large scale by expression in | 01-31-2013 |
20130024956 | ANTIBODIES TO CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 01-24-2013 |
20130022616 | Interleukin-31 Monoclonal Antibody - An isolated antibody that specifically binds to at least one of canine Interleukin-31 (IL-31) or feline IL-31 is provided. Such antibodies can be in the form of diagnostic and/or veterinary compositions useful for treating a pruritic and/or allergic condition in dogs or cats. | 01-24-2013 |
20120329781 | COMBINATIONS COMPRISING ALPHA-2-DELTA LIGANDS - The instant invention relates to a combination, particularly a synergistic combination, of an alpha-2-delta ligand and a dual serotonin-noradrenaline re-uptake inhibitor (DSNRI) or one or both of a selective serotonin re-uptake inhibitor (SSRI) and a selective noradrenaline re-uptake inhibitor (SNRI), and pharmaceutically acceptable salts thereof, pharmaceutical compositions thereof and their use in the treatment of pain, particularly neuropathic pain. | 12-27-2012 |
20120329777 | Amino-Heterocyclic Compounds - The invention provides PDE9-inhibiting compounds of Formula (I), | 12-27-2012 |
20120328639 | IMMUNOGENIC LHRH COMPOSITIONS AND METHODS RELATING THERETO - The present invention relates generally to an immunogenic LHRH composition and more particularly to an immunogenic LHRH composition comprising a LHRH C-terminal fragment of at least five amino acids. The present invention is useful, inter alia, as a prophylactic and/or therapeutic agent for the modification of fertility and behaviour patterns of animals, the achievement of livestock production gains such as increasing growth, decreasing feed conversion ratios or the control of unwanted organoleptic characteristics or the treatment of disorders of the reproductive organs. | 12-27-2012 |
20120322823 | HETEROCYCLIC SULFONAMIDES, USES AND PHARMACEUTICAL COMPOSITIONS THEREOF - The invention is directed to a class of compounds, including the pharmaceutically acceptable salts of the compounds, having the structure of formula I: | 12-20-2012 |
20120322782 | VETERINARY COMPOSITIONS - The present invention relates to veterinary compositions in a form of an orally deliverable tablet, and more particularly to a controlled-release composition that provides sufficiently long duration to permit once daily administration. | 12-20-2012 |
20120321654 | INFECTIOUS CLONES OF TORQUE TENO VIRUS - The present invention is directed to novel nucleotide and amino acid sequences of Torque teno virus (“TTV”), including novel genotypes thereof, all of which are useful in the preparation of vaccines for treating and preventing diseases in swine and other animals. Vaccines provided according to the practice of the invention are effective against multiple swine TTV genotypes and isolates. Diagnostic and therapeutic polyclonal and monoclonal antibodies are also a feature of the present invention, as are infectious clones useful in the propagation of the virus and in the preparation of vaccines. Particularly important aspects of the invention include vaccines that provide TTV ORF1 protein, or peptide fragments thereof, as antigen. | 12-20-2012 |
20120321651 | Anti-IGE Vaccines - The present invention provides compositions and methods for the use of antigenic peptides derived from the Fc portion of the epsilon heavy chain of an IgE molecule as vaccines for the treatment and prevention of IgE-mediated allergic disorders. In particular, the invention provides compositions, methods for the treatment and prevention of IgE-mediated allergic disorders comprising an immunogenic amount of one or more antigenic peptides derived from the CH3 domain or junction of Ch-3/CH4 domain of an IgE molecule and methods for the evaluation of IgE mediated allergies in dogs. | 12-20-2012 |
20120321614 | ANTIBODIES TO C-MET - The present invention relates to antibodies including human antibodies and antigen-binding portions thereof that specifically bind to c-Met, preferably human c-Met, and that function to inhibit c-Met. The invention also relates to human anti-c-Met antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-c-Met antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-c-Met antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-c-Met antibodies. The invention also relates to transgenic animals or plants comprising nucleic acid molecules of the present invention. | 12-20-2012 |
20120316210 | TOPICAL ANTIPARASITIC FORMULATIONS - This invention recites topical formulations comprising demiditraz, fipronil, an acid modifier, at least one veterinarily acceptable carrier, and optionally, at least one antioxidant for treating a parasitic infection or infestation in animals. | 12-13-2012 |
20120316150 | AMIDE COMPOUNDS USEFUL IN THERAPY - A compound of Formula (I), or a pharmaceutically acceptable salt or solvate thereof, | 12-13-2012 |
20120316105 | Polymyxin Derivates Useful As Antibacterial Agents - The present invention provides a new class of polymyxin derivates useful for treating bacterial infections, especially Gram-negative infections, that have reduced renal cytotoxicity. | 12-13-2012 |
20120315271 | METHODS FOR TREATING BONE CANCER BY ADMINISTERING A NERVE GROWTH FACTOR ANTAGONIST ANTIBODY - The invention features methods and compositions for preventing or treating bone cancer pain including cancer pain associated with bone metastasis by administering an antagonist of nerve growth factor (NGF). The NGF antagonist may be an anti-NGF (such as anti-hNGF) antibody that is capable of binding hNGF. | 12-13-2012 |
20120309775 | 4-METHYLPYRIDOPYRIMIDINONE COMPOUNDS - The present invention is directed to novel 4-methylpyridopyrimidinone compounds of Formula (I), | 12-06-2012 |
20120302599 | KAT ll INHIBITORS - Compounds of Formula I: | 11-29-2012 |
20120302550 | SALTS AND POLYMORPHS OF 8-FLUORO-2--1,3,4,5-TETRAHYDRO-6H-AZEPINO[5,4,3-CD]INDOL-6-ONE - The present invention relates to novel polymorphic forms of 8-fluoro-2-{4-[(methylamino)methyl]phenyl}-1,3,4,5-tetrahydro- | 11-29-2012 |
20120302542 | MONOBACTAMS - The present invention is directed to a new class of monobactam derivatives and their use for treating bacterial infections. | 11-29-2012 |
20120283237 | NOVEL CEPHALOSPORINS USEFUL AS ANTIBACTERIAL AGENTS - The present invention provides novel cephalosporin derivatives of formula I, | 11-08-2012 |
20120282279 | Anti-Diabetic Compounds - The present invention provides a FGF21 molecule covalently attached to the combining site of an antibody via a linker, wherein the linker is covalently attached to the side chain of a linking residue within FGF21. Various uses of the compounds are provided, including methods to prevent or treat diabetes or diabetes-related conditions. | 11-08-2012 |
20120279908 | A METHOD FOR DETECTING A MALFUNCTIONING EGG PICKER - Methods and apparatus are provided that automatically determine whether or not eggs designated for removal from an egg carrier have been removed by an egg removal apparatus. Light is emitted along a path above and across an egg carrier as an egg picker moves to pick up an egg. The length of time that the light path is blocked when the egg picker is moved is measured and used to determine whether or not the egg has been removed from the carrier. Another apparatus and method is provided for detecting a malfunctioning egg picker. A detection device detects a number of eggs in the egg carrier. A control device monitors the egg picker and the detection device. The control device calculates the number of eggs in the egg carrier for determining when the number of eggs varies a predetermined amount from an egg count number for the egg carrier. | 11-08-2012 |
20120276599 | KETOREDUCTASE POLYPEPTIDES FOR THE PRODUCTION OF (R)-3-HYDROXYTHIOLANE - The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to synthesize chiral compounds. | 11-01-2012 |
20120270893 | SUBSTITUTED ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) | 10-25-2012 |
20120263677 | Combination of Local and Systemic Immunomodulative Therapies for Enhanced Treatment of Cancer - A method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic immunomodulatory anticancer agent. A further method for the treatment of cancer comprising administration of a therapeutically effective amount of an intralesional chemoablative pharmaceutical composition, or variant of said composition, in combination with a therapeutically effective amount of a systemic targeted anticancer agent. The present invention is further directed to pharmaceutical compositions for treatment of cancer. The intralesional chemoablative pharmaceutical composition can comprise an IL chemoablative agent comprising primarily a halogenated xanthene. | 10-18-2012 |
20120259115 | PYRROLO[2,3-D]PYRIMIDINE DERIVATIVES: THEIR INTERMEDIATES AND SYNTHESIS - This invention relates to methods and intermediates useful for the synthesis of pyrrolo [2,3-d] pyrimidine compounds. Specifically novel synthetic methods and intermediates for the synthesis of 3-{(3R,4R)-4-methyl-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-amino}-piperidin-1-yl)-3-oxo-propionitrile and its corresponding citrate salt are disclosed. | 10-11-2012 |
20120258976 | CRYSTALLINE PYRROLO[2,3-D]PYRIMIDINE COMPOUNDS - The present invention discloses novel crystalline and non-crystalline forms of 3-((3R,4R)-4-methyl-3-[methyl-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-amino]-pip-eridin-1-yl)-3-oxopropionitrile, pharmaceutical composition containing the same, preparations thereof and the uses thereof. | 10-11-2012 |
20120252825 | BENEFICIAL EFFECTS OF COMBINATION THERAPY ON CHOLESTEROL - The present invention discloses pharmaceutical combination therapies for the treatment or prevention of diseases in a mammal comprising a Janus Kinase inhibitor or a pharmaceutically acceptable salt thereof and a HMG-CoA reductase inhibitor or a pharmaceutically acceptable salt thereof. Pharmaceutical compositions containing the same and kits for achieving a therapeutic effect in a mammal comprising pharmaceutical combination therapies are further described. | 10-04-2012 |
20120251566 | SAPONIN ADJUVANT COMPOSITIONS AND METHODS RELATING THERETO - An adjuvant composition which comprises an anionic macromolecule component particularly an ionic polysaccharide such as DEAE-dextran, and a saponin component, particularly an immunostimulating complex component. Immunogenic compositions comprising an immunogen and this adjuvant composition are also disclosed together with methods of use thereof. | 10-04-2012 |
20120237498 | 4-1BB BINDING MOLECULES - The present disclosure provides isolated binding molecules that bind to human 4-1BB, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions. | 09-20-2012 |
20120232026 | SPIROCYCLIC ISOXAZOLINE DERIVATIVES AS ANTIPARASITIC AGENTS - The invention recites spirocyclic isoxazoline derivatives of Formula (V.1), Formula (V.2), Formula (V.1.1), and Formula (1) | 09-13-2012 |
20120225910 | Substituted Heteroaryls - The present invention provides Formula (1A) compounds | 09-06-2012 |
20120225900 | N2-PYRAZOLOSPIROKETONE ACETYL-COA CARBOXYLASE INHIBITORS - The invention provides a compound of Formula (I) or a pharmaceutically acceptable salt of said compound, wherein R | 09-06-2012 |
20120225014 | ANTIBODIES TO CD40 - The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies. The invention also relates to transgenic animals comprising nucleic acid molecules of the present invention. | 09-06-2012 |
20120219571 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 08-30-2012 |
20120214827 | Anhydrous Crystalline Forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-am- ino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide - The invention comprises (1) anhydrous crystalline forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide, (2) pharmaceutical compositions comprising at least one such form, (3) methods for the treatment of a phosphodiesterase-5-mediated condition using at least one such form, and (4) methods for preparing such forms. The compound N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide has the following structure (I). | 08-23-2012 |
20120213793 | CANCER TREATMENT - The present invention relates to methods of treating cancer, such as melanoma, by administering a CTLA4 antagonist to a subject with a serum C-Reactive Protein (CRP) concentration that is less than or equal to some amount. The invention further relates to methods of treating cancer by determining the level of serum CRP concentration in a subject, and then administering a CTLA4 antagonist if the CRP concentration is less than or equal to a certain amount. The invention further relates to, among other things, the use of serum CRP concentration as a predictive factor for a subjects response to a cancer treatment. | 08-23-2012 |
20120208830 | Anhydrous Crystalline Forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-am- ino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide - The invention comprises (1) anhydrous crystalline forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide, (2) pharmaceutical compositions comprising at least one such form, (3) methods for the treatment of a phosphodiesterase-5-mediated condition using at least one such form, and (4) methods for preparing such forms. The compound N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide has the following structure (I). | 08-16-2012 |
20120202834 | GLUCAGON RECEPTOR MODULATORS - The present invention provides a compound of Formula (I) | 08-09-2012 |
20120202285 | ANTIBODIES TO IL-6 AND THEIR USES - Antibodies and antigen-binding portions thereof that bind to human IL-6 are provided. Also provided are nucleic acids encoding such antibodies and antigen binding portions, methods of making such antibodies and antigen binding portions, compositions comprising such antibodies or antigen binding portions, and uses of such antibodies or antigen binding portions. | 08-09-2012 |
20120165343 | Glucagon Receptor Modulators - The present invention provides a compound of Formula (I) | 06-28-2012 |
20120157502 | PHENANTHRENONE COMPOUNDS, COMPOSITIONS AND METHODS - The present invention is directed to compounds of Formula I: | 06-21-2012 |
20120157471 | BENZIMIDAZOLE DERIVATIVES - The present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R | 06-21-2012 |
20120148597 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 06-14-2012 |
20120142749 | SOLID SALT FORMS OF A PYRROLE SUBSTITUTED 2-INDOLINONE - The present invention relates to solid salt forms of the 3-pyrrole substituted 2-indolinone compound 5-[5-fluoro-2-oxo-1, 2-dihydro-indol-(3Z)-ylidenemethyl]-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (2-pirrolidin-1-yl-ethyl)-amide. It also relates to polymorphs of the phosphate salt of the amide. The invention further relates to the use of the salts and polymorphs in the treatment of protein kinase related disorders. | 06-07-2012 |
20120122901 | PYRROLO[2,3-D]PYRIMIDINE COMPOUNDS - Described herein is pyrrolo{2,3-d}pyrimidine compounds, their use as Janus Kinase (JAK) inhibitors, pharmaceutical compositions containing this compounds, and methods for the preparation of these compounds. | 05-17-2012 |
20120108588 | NOVEL 3-AMIDO-PYRROLO[3,4-C]PYRAZOLE-5(1H, 4H,6H) CARBALDEHYDE DERIVATIVES - The present invention relates to compounds and pharmaceutically acceptable salts of Formula (I): | 05-03-2012 |
20120107351 | In Ovo Vaccination of Campylobacter in Avian Species - The present invention provides a method of inducing an immune response against | 05-03-2012 |
20120095062 | TRICYCLIC COMPOUNDS, COMPOSITIONS, AND METHODS - The present invention is directed to compounds of Formula I: | 04-19-2012 |
20120093813 | ANTI NOTCH-1 ANTIBODIES - This invention is directed toward monoclonal antibodies that bind specifically to Notch1. In one embodiment, the antibodies binds to at least a first epitope and a second epitope, wherein the first epitope resides with the LinA domain of the Notch1 negative regulatory region (NRR), and the second epitope resides within the HD-C domain of the Notch1 NRR. | 04-19-2012 |
20120088802 | TRICYCLIC COMPOUNDS, COMPOSITIONS AND METHODS - The present invention is directed to compounds of Formula I: | 04-12-2012 |
20120088746 | AMIDE DERIVATIVES AS ION-CHANNEL LIGANDS AND PHARMACEUTICAL COMPOSITIONS AND METHODS OF USING THE SAME - Compounds are disclosed that have a formula represented by the following: Formula (I). The compounds may be prepared as pharmaceutical compositions, and may be used for the prevention and treatment of a variety of conditions in mammals including humans, including by way of non-limiting example, pain, inflammation, traumatic injury, and others. | 04-12-2012 |
20120087978 | DOSAGE FORMS OF APIXABAN - The present invention relates to a Factor Xa inhibitor dosage form comprising apixaban in a solubility-improved form wherein the dosage form provides controlled release of apixaban and methods for preventing or treating venous thromboembolisms, deep vein thrombosis and acute coronary syndrome with said dosage form. | 04-12-2012 |
20120077765 | ISOXAZOLINE OXIMES AS ANTIPARASITIC AGENTS - This invention recites naphthyl isoxazoline oxime derivatives of Formula (1) | 03-29-2012 |
20120045442 | HUMAN MONOCLONAL ANTIBODIES TO CTLA-4 - In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. | 02-23-2012 |
20120039908 | Control of Protein Glycosylation and Compositions and Methods Relating Thereto - The invention relates to novel methods for controlling the glycosylation of a protein and the protein produced thereby. An exemplary method of the invention comprises producing a protein comprising a decreased level of glycosylation, e.g., the protein comprises fewer glycans or fewer saccharides at the glycosylation site, by culturing a host cell expressing the protein in the presence of a glycosylation inhibitor. In an exemplary method of the invention, the biological characteristics of the protein are altered by the decreased level of glycosylation, e.g., the binding of the protein with its target ligand is modified. | 02-16-2012 |
20120035209 | Hydroxy Substituted 1H-Imidazopyridines and Methods - Hydroxy substituted 1H-imidazo[4,5-c]pyridin-4-amines, with a hydroxy substituent at the 2-position, pharmaceutical compositions containing these compounds, methods of making the compounds, intermediates, and methods of use of these compounds as immunomodulators for inducing cytokine biosynthesis in animals and in the treatment of diseases including viral and neoplastic diseases are disclosed. | 02-09-2012 |
20120035194 | SUBSTITUTED 2-AMINO-FUSED HETEROCYCLIC COMPOUNDS - The present invention relates to compounds of formula (I), | 02-09-2012 |
20120021001 | MARKED BOVINE VIRAL DIARRHEA VIRUS VACCINES - The present invention is directed to a bovine viral diarrhea virus comprising at least one helicase domain amino acid mutation wherein the mutation in the NS3 domain results in a loss of recognition by a monoclonal antibody raised against wild-type NS3 but wherein viral RNA replication and the generation of infectious virus is retained. The present invention is useful, for example, to produce a marked bovine viral diarrhea virus vaccine or to differentiate between vaccinated and infected or unvaccinated animals. | 01-26-2012 |
20120020995 | PARAPOXVIRUS VECTORS - The present invention relates to recombinant parapoxviruses comprising heterologous DNA derived from a canine distemper virus, to the preparation of such constructs, and to their use in immunogenic compositions and vaccines. It further relates to the use of recombinant parapoxviruses for diagnostics. | 01-26-2012 |
20120015435 | PCSK9 ANTAGONISTS - The present invention provides antagonizing antibodies, antigen-binding portions thereof, and aptamers that bind to proprotein convertase subtilisin kexin type 9 (PCSK9). Also provided are antibodies directed to peptides, in which the antibodies bind to PCSK9. The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acid. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof to reduce LDL-cholesterol levels and/or for the treatment and/or prevention of cardiovascular disease, including treatment of hypercholesterolemia. | 01-19-2012 |