Patent application title: RNA HYDROGELS
Inventors:
Li Niu (Loudonville, NY, US)
Zhen Huang (Latham, NY, US)
IPC8 Class: AC12N15115FI
USPC Class:
1 1
Class name:
Publication date: 2020-09-17
Patent application number: 20200291404
Abstract:
Disclosed herein are RNA molecules with particular nucleotide sequences
that, through Watson-Crick base pairing, enable the RNAs to form a
hydrogel.Claims:
1. A synthetic RNA comprising: a 5' region, a first loop region, an
inter-loop region, a second loop region, and a 3' region, wherein through
Watson-Crick pairing, the synthetic RNA has the secondary structure of A,
##STR00013##
2. The synthetic RNA of claim 1, wherein the 5' region consists of the sequence of SEQ ID NO: 14.
3. The synthetic RNA of claim 2, wherein the first loop region consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20.
4. The synthetic RNA of claim 2, wherein the inter-loop region consists of a nucleotide sequence selected from SEQ ID NO: 21 or SEQ ID NO: 22.
5. The synthetic RNA of claim 2, wherein the second loop region consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 23.
6. The synthetic RNA of claim 2, wherein the 3' region consists of a nucleotide sequence selected from SEQ ID NO: 24 or SEQ ID NO: 25.
7. The synthetic RNA of claim 2, wherein the 5' region consists of the sequence of SEQ ID NO: 14; the first loop region consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20; the inter-loop region consists of a nucleotide sequence selected from SEQ ID NO: 21 or SEQ ID NO: 22; the second loop region consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 23; and the 3' region consists of a nucleotide sequence selected from SEQ ID NO: 24 or SEQ ID NO: 25.
8. The synthetic RNA of claim 1, wherein a oligonucleotide consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 8, 10, 11, 12 and 13.
9. A synthetic RNA of claim 1 comprising tandem repeats of a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 8, 10, 11, 12 and 13.
10. The synthetic RNA of claim 9, where the tandem repeats are separated by a linking/intervening nucleotide sequence.
11. The synthetic RNA of claim 8, wherein the oligonucleotide forms a hydrogel.
12. A pharmaceutical composition comprising a synthetic oligonucleotide consisting of the nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 8, 10, 11, 12 and 13.
13. A pharmaceutical composition comprising a hydrogel comprising an oligonucleotide with the nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 8, 10, 11, 12 and 13.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of and claims priority to both U.S. patent application Ser. No. 15/727,043 filed on Oct. 6, 2017 and U.S. provisional application No. 62/404,837 filed on Oct. 6, 2016, the contents of which are hereby incorporated by reference into the present application.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing, created on Aug. 24, 2016; the file, in ASCII format, is designated 0794159P_SeqListing_ST25.txt and is 6.36 kilobytes in size. The file is hereby incorporated by reference in its entirety into the instant application.
TECHNICAL FIELD
[0004] The disclosure relates to hydrogels, particularly RNA hydrogels.
BACKGROUND OF THE DISCLOSURE
[0005] Hydrogels are three-dimensional polymer networks, and these networks can be formed by chemical cross-linking of monomers or self-assembly of monomers through non-covalent interactions (1). An naturally occurring biomolecules except RNA are known capable of forming hydrogels (2, 3). The other type of nucleic acids, DNA, can readily form hydrogels since double-stranded DNA with compatible sticky ends can be designed to form hydrogel networks by self-assembly. In contrast, RNAs are generally single stranded, form intra-strand double helixes, and adopt complex tertiary structures, through Watson-Crick base paring (guanine-cytosine or G-C and adenine-uracil or A-U), noncanonical base pairing (e.g., G-U or A-A) and complex tertiary interactions, such as base stacking, kissing loops and pseudoknots (4, 5). As such, RNAs have been shown to act in additional roles as catalysts (6), aptamers (7) and riboswitches (8). However, RNA has not been reported to form a molecular network, resulting in a hydrogel, presumably because no RNA has been shown to possess "sticky ends" and/or modular sequence segments as designer building blocks for network assembly through intermolecular interactions.
SUMMARY OF THE DISCLOSURE
[0006] In one aspect, the disclosure relates to an RNA capable of forming a hydrogel. The RNA of the disclosure comprises a 5' region, a first loop region, an inter-loop region, a second loop region and a 3' region. In one embodiment, the 5' region, which is approximately 31 nucleotides in length, comprises the nucleotide sequence of SEQ ID NO: 14 or SEQ ID NO: 26. The first loop region (also referred to herein as Motif 1 or M1), having between 3 and 12 nucleotides, comprises a nucleotide sequence made up of all As, only 3 As, or a variety of substitutions. Exemplary embodiments of the first loop region include nucleotide sequences such as SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20. A second loop region comprises approximately 10 nucleotides and, for example, has the nucleotide sequence of SEQ ID NO: 23. The RNA further comprises an inter-loop region extending from Loop 1 to Loop 2, comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22. The RNA's 3' region comprises the nucleotide sequence of SEQ ID NO: 24 or SEQ ID NO: 25.
[0007] The RNA of the disclosure, through Watson-Crick base pairing, roughly comprises the secondary structure of A, as shown below:
##STR00001##
[0008] In one aspect, the RNA of the disclosure comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.
[0009] In one embodiment, the RNA forms a hydrogel at room temperature.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIGS. 1A-1D shows the nucleotide sequence and biological function of two previously identified RNA aptamers, designated CZ and 2CZ, (see WO 2016/057920). (A) Sequence of CZ, SEQ ID NO: 1 (upper, shown in gray) and 2CZ, SEQ ID NO: 9 (lower; black is the linker sequence--see B). (B) Secondary structure of CZ and 2CZ, as predicted by MFold. (C) On the left is PAGE separated, in vitro transcription mixture of CZ and 2CZ. Lane L was the RNA Century Markers (Ambion). Shown on the right is the 2CZ sample before (lane B) and after PAGE purification (lane A). Lane M was a 100-nt RNA marker. (D) Monomeric 2CZ RNA potentiated GluA2Q-mediated whole-cell current response to 0.1 mM glutamate (right trace), as compared to the control (left trace). The HEK-293 cells that expressed GluA2Q were voltage clamped at -60 mV, pH 7.4 and ambient temperature. The bar on top of a trace shows the time course of glutamate exposure, and 2 .mu.M 2CZ was used.
[0011] FIGS. 2A-2B contains photographs showing an RNA hydrogel formed by self-assembled 2CZ. (A) The hydrogel formed by PAGE purified 2CZ (left panel) with 2 mM MgCl.sub.2 in 25 mM HEPES (pH 7.5). The lyophilized 2CZ hydrogel from an original 400 .mu.l of 2.5% hydrogel (right panel). (B) The thermotropic nature of the 2CZ hydrogel, formed by self-assembly, is shown in a temperature ramp experiment where the gel was melted when heated to 65.degree. C. and reformed when cooled down to room temperature.
[0012] FIGS. 3A-3E shows the results of RNA hydrogel characterizations. (A) Temperature sweeps obtained from a 2.5% 2CZ sample containing 2 mM MgCl.sub.2 at 1% strain, 1 rad/s, and heating/cooling rate of 0.1.degree. C./min. The region in gray represents G' and G'' lower than instrument resolution limit. (B) Frequency sweeps (1% strain) obtained from a 2.5% 2CZ solution with 2 mM MgCl.sub.2. (C) Cryo-TEM micrograph of 0.5% 2CZ in HEPES buffer with 2 mM MgCl.sub.2. (D) Cryo-SEM micrograph of 3.2% 2CZ with 5 mM MgCl.sub.2. (E) Small angle X-ray scattering (SAXS) patterns collected from 1% and 2% 2CZ hydrogel containing 0, 2, or 5 mM MgCl.sub.2.
[0013] FIGS. 4A-4F shows TEM Micrographs of 0.5% 2CZ in 25 mM HEPES (pH 7.5) with 2 mM MgCl.sub.2. Panels A to F show how the radii of the strands were determined. The areas in the white dotted rectangles were magnified and analyzed using a micrograph scripting software.
[0014] FIG. 5 shows frequency sweep G' and G'' (1% strain) on 3.2% 2CZ containing 25 mM MgCl.sub.2.
[0015] FIG. 6 shows the results of whole-cell recording assay with D17 mutant with GluA2Q.sub.flip receptor. Shown here is a pair of whole-cell current traces from the GluA2 channel invoked by 0.1 mM of glutamate with and without D17 (at 2 .mu.M). The average potentiation ratio (A'/A) from three cells was 1.03. This result showed that the D17 mutant RNA, which no longer contained the CGU sequence in Motif 1 (see, Table 1), lost the potentiating property (as compared with the result shown in FIG. 1D). Therefore, the CGU tri-nucleotide sequence in Motif 1 is essential for the biological activity of both the wild-type CZ and 2CZ aptamers.
DETAILED DESCRIPTION OF DISCLOSURE
[0016] All patents, published applications and other references cited herein are hereby incorporated by reference into the present application. Methodologies used in developing the present invention are well known to those of skill in the art and are described, for example, in Oligonucleotide Synthesis, 1984 (M. L. Gait ed.), the contents of which are hereby incorporated by reference. In the description that follows, certain conventions will be followed as regards the usage of terminology. In general, terms used herein are intended to be interpreted consistently with the meaning of those terms as they are known to those of skill in the art.
RNA Hydrogels
[0017] Described herein are RNAs that form hydrogels. The hydrogel structure formed is a polymeric network, not a precipitate or aggregate, both of which can be pelleted by centrifugation. The formation of this polymer network is sequence-dependent but not concentration dependent.
[0018] In one embodiment, an RNA capable of forming a hydrogel as disclosed herein is an oligonucleotide comprising, from 5' to 3', a 5' terminal region extending to a first loop region (Loop 1 shown below) followed by an inter-loop region leading to a second loop (Loop 2 shown below) followed by a 3' terminal region.
[0019] In one embodiment, the RNA comprises a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 16, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 21, a second loop region comprising the nucleotide sequence of SEQ ID NO: 23 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 24. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 3.
[0020] In one embodiment, the RNA comprises a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 16, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 22, a second loop region comprising the nucleotide sequence of SEQ ID NO: 16 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 25. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 8.
[0021] In one embodiment, the RNA comprises a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 18, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 22, a second loop region comprising the nucleotide sequence of SEQ ID NO: 18 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 25. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 10.
[0022] In one embodiment, the RNA comprises a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 19, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 21, a second loop region comprising the nucleotide sequence of SEQ ID NO: 23 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 24. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 11.
[0023] In one embodiment, the RNA contains a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 20, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 21, a second loop region comprising the nucleotide sequence of SEQ ID NO: 23 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 24. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 12.
[0024] In one embodiment, the RNA contains a 5' region comprising the nucleotide sequence of SEQ ID NO: 14, a first loop region comprising the nucleotide sequence of SEQ ID NO: 17, an inter-loop region comprising the nucleotide sequence of SEQ ID NO: 21, a second loop region comprising the nucleotide sequence of SEQ ID NO: 23 and a 3' region comprising the nucleotide sequence of SEQ ID NO: 24. An exemplary embodiment of this RNA is one comprising the nucleotide sequence of SEQ ID NO: 13.
[0025] In some embodiments, the RNA hydrogel comprises a nucleotide sequence that, through Watson-Crick base pairing, roughly forms a molecule with the secondary structure shown below:
##STR00002##
[0026] In one embodiment, an RNA hydrogel is an RNA whose sequence is essentially a double repeat of an aptamer with the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO:10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13. This double motif aptamer comprises two units of a single aptamer, and a linker (as shown in below).
##STR00003##
Aptamers that Give Rise to a Hydrogel
[0027] Disclosed are RNA molecules that can form hydrogels on their own. Previously, a unique RNA aptamer, designated CZ, was selected from a library of .about.10.sup.14 sequences using SELEX, an in vitro evolution experiment (9, 10). The goal was to find an RNA aptamer capable of positively enhancing AMPA receptor response to glutamate, the endogenous neurotransmitter in the central nervous system. Positive modulation of AMPA receptors improves cognition (11). For instance, depolarization at dendritic spines via AMPA channels is linked to the induction of long-term potentiation (LTP), a presumed substrate of memory (12). Studies of the interaction between glutamatergic and monoaminergic systems suggest a reduced glutamatergic transmission is linked to certain cognitive disorders, such as schizophrenia and Parkinson's disease (13). Potentiators of AMPA receptors are therefore drug candidates for a treatment of cognitive disorders (11, 14).
[0028] After a 13-round SELEX run, an RNA, designated "CZ aptamer" was isolated against GluA2, a key AMPA receptor subunit (15, 16). A second aptamer, 2CZ, which comprises two repeating units of CZ was designed and made based on the CZ sequence (FIG. 1C). The nucleotide sequences and presumed secondary structures of CZ and 2CZ are shown in FIGS. 1A and 1B. Using whole-cell current recording with the GluA2 receptor expressed in HEK-293 cells, purified 2CZ RNA potentiated GluA2 response to glutamate (FIG. 1D). Specifically, the 2CZ aptamer potentiated the GluA2 channel by increasing current amplitude without slowing or blocking channel desensitization, seen as the falling phase of the whole-cell current (FIG. 1D).
[0029] Surprisingly, the 2CZ aptamer formed an elastic solution in a standard enzymatic transcription reaction mixture (FIG. 2A). A 237-nt 2CZ RNA whose sequence was essentially a double repeat of the CZ aptamer (FIGS. 1A and 1B) was prepared. As expected, the purified RNA (FIG. 1C) also formed a hydrogel (left panel in FIG. 2A and Table 4; here 2CZ RNA was used as an example). When heated to .about.65.degree. C., for example, the hydrogel melted to a clear viscous liquid; upon cooling to room temperature, the solution returned to its elastic state, indicating that sol-gel and gel-sol transitions are thermotropic (FIG. 2B). This was expected because the gelation of RNA was by self-assembly. Lyophilization of the 2CZ RNA solution left sponge-textured material in a tube with nearly identical volume to the one before dehydration, suggesting the RNA formed a supramolecular structure strong enough to span nearly the full solution volume and maintain its solid state (right panel, FIG. 2A). The gelation also depended on the concentration of both the RNA and salt. The critical concentration of gelation for 2CZ aptamer, identified by visual inspection of non-flowing behavior of solutions under gravity, was .about.0.8% (weight) RNA/25 mM MgCl.sub.2 or .about.2.5% RNA/2 mM MgCl.sub.2 or .about.4% RNA without any Mg.sup.2+ added to 25 mM HEPES buffer (pH 7.5 and 22.degree. C.) (note that for transcription reaction to make 2CZ RNA, a minimal concentration of 10 mM Mg.sup.2+Cl.sub.2 was required) (Table 4). Therefore, the gelation originated from inherent interactions between RNA chains through Mg.sup.2+, and Mg.sup.2+ appeared to facilitate gelation. Furthermore, the gelation of a 2CZ sample was unaffected whether the sample was in a 50 mM Tris or HEPES buffer at pH 7.5 or 8.
[0030] The viscoelastic properties of 2CZ hydrogels were quantified using a dynamic mechanical spectrometer. Temperature sweep of an RNA solution (2.5% w/v 2CZ in 2 mM MgCl.sub.2 buffer) at a heating rate of 0.1.degree. C./min decreased shear storage modulus G'.apprxeq.300 Pa and loss modulus G'' 50 Pa at 5.degree. C. to both lower than 1 Pa at 25.degree. C., indicating gel-sol transition (FIG. 3A). Cooling recovered the gel behavior with slightly reduced moduli, perhaps due to a slow gelation process. Frequency sweep experiments identified G' plateau domains (FIG. 3B). As temperature dropped from 20 to 5.degree. C., the plateau became wider and G' became larger. In the terminal regime, G' and G'' showed temperature-independent scalings of G'.about..omega..sup.1.0 and G''.about..omega..sup.0.78, nearly identical to those of living worm-like micelles [c.f. FIG. 9 in (17)]. This suggests the mechanical elasticity was likely from dynamic RNA chain associations forming temporal junctions for elastic networks (17, 18).
[0031] To understand structural origins of the viscoelastic properties of the 2CZ RNA solutions, real and reciprocal space characterizations were conducted. Cryogenic-transmission electron microscopy (Cryo-TEM) of a 2CZ RNA solution revealed faint but unmistakable features of randomly walking linear motifs with an average diameter of 4.0.+-.0.4 nm on micrographs (FIG. 3C; See FIG. 4A-4F for the procedure of diameter measurements). Some motifs appear darker on the micrograph, possibly due to varying degrees of projection of structures in relatively thick vitrified water films (50-100 nm), i.e., struts travelling normal to the TEM micrograph produce darker traces than those travelling in lateral directions (19). Those structures were also confirmed by cryogenic-scanning electron micrograph (Cryo-SEM). The Cryo-SEM image clearly showed a supramolecular network (bright domains) composed of linear struts and junction structures (FIG. 3D), although morphological details of junction and linear motifs could not be further identified due to limitations in micrograph resolution and characterization technique.
[0032] Using small angle X-ray scattering (SAXS), we investigated spatial correlation of RNA chains in solutions. Two-dimensional scattering patterns of 2CZ RNA solutions (1 and 2% of 2CZ RNA in HEPES buffer with 0, 2, and 5 mM of MgCl.sub.2) were collected at 25.degree. C., and converted into 1D scattering intensity vs. scattering vector q=4.pi..lamda..sup.-1 sin(.theta.) where .theta. is the scattering angle and A is X-ray wavelength. All the 1D patterns (FIG. 3E) showed a broad peak, which shifted to lower q domain as RNA concentration increased, indicating a concentration-dependent interdomain spacing d=2.pi./q (see below). Those domain spacings suggested an interparticle distance of most of the RNA chains homogenously dispersed in a solution, I=(C.sub.2CZN.sub.av/M.sub.2CZ).sup.-1/3 where C.sub.2CZ is 2CZ RNA concentration, N.sub.av is Avogadro's number, and M.sub.2CZ=73 kDa. For the 1% concentration, I.sub.1%.apprxeq.d.sub.1%.apprxeq.23 nm and for 2%, I.sub.2%.apprxeq.18 nm and d.sub.2%.apprxeq.17 nm (corresponding q=2.pi./d as marked by arrows in FIG. 3E). Again, this consistency also suggested RNA likely formed the hydrogel network structures by dynamic associations with neighboring RNA chains with the non-Maxwell terminal behavior of G'' and G'' (20, 21). That the principal peak of 1% and 2% 2CZ solutions shifted to the lower q as MgCl.sub.2 concentration increased along with amplified intensity in the q<0.012 .ANG..sup.-1 indicated associations between RNA chains became stronger at higher MgCl.sub.2 concentrations (22). Indeed, a 3.2% 2CZ solution at 25 mM MgCl.sub.2 showed wider G' plateau and slower terminal relaxation (FIG. 5) compared to those of RNA chains at 2 mM MgCl.sub.2 (FIG. 3B), consistent with the notion that Mg.sup.2+ ions bonded to RNA and stabilized their structures for enhanced mechanical strength (23).
[0033] Because the CZ RNA aptamer we discovered is uniquely capable of self-assembling to form a hydrogel network, a single RNA molecule must minimally contain two unique sequence segments. These two sequence segments would enable a single RNA molecule as a monomer to bind non-covalently with the same sequence segments of at least two other RNA molecules so that RNA molecules could "grow" longer to form dynamic suprastructures or a hydrogel network. These sequence segments, possibly in motif forms, for intermolecular interactions should still be available after an RNA first folds intramolecularly. To reveal the role of these unique sequences, we first used MFold (24) to predict secondary structures in the CZ RNA "monomer". By MFold, a CZ aptamer shows two terminal motifs or Motif 1 on one end and Motif 2 on the other (see, Table 1).
[0034] Next, we created a series of site-specific mutants, based on these MFold-predicted motifs, and analyzed their gel-forming abilities by measuring G' and G'' on two different temperature scales (see, Table 1). (a) Replacing Motif 1 with a classic tetraloop (25) abolished the gel-forming ability, suggesting this loop and its size (or a 12-nt loop) was essential (D1 in Table 1 as compared with the wild-type sequence). (b) To further investigate Motif 1, we kept the loop size but replaced three non-A nucleotides, i.e., CGU in the middle, with A's (D17, Table 1). It is well known that two GC base pairs (or GC from one RNA pair with CG from another RNA molecule) can form strong Watson-Crick interaction, known as "kissing interaction" (23). Such an interaction is strong enough to stabilize an RNA dimer, as is found in some retroviruses (26). Surprisingly, however, the mutant with the all A loop (D17, Table 1), which eliminated any possibility of forming "kissing loop" interaction with any two CZ aptamers, formed a hydrogel, if not a better gel (Table 1). This result indicated that the CGU tri-nucleotides were nonessential in gelation but suggested that the Motif 1 loop, dominated by As or adenines, might be special. (c) Indeed, the all U loop mutant with the same size (D23) was virtually defective in gelation (Table 1). (d) On Motif 2, replacing the loop that is capable of forming 8 Watson-Crick base pairs between two molecules, i.e., the AGUACUACA segment, eliminated the ability of RNA gelation (D2, Table 1).
[0035] The mutation experiment further allowed us to evaluate the individual role of the two motifs in forming RNA network structures. In Motif 2, there is a contiguous eight nucleotide segment that can form two G:C and six A:U Watson-Crick base pairs between two CZ aptamers through Motif 2. Furthermore, there are five nucleotides on each side of this segment that could form additional four A:U, four G:C and two G:U base pairs. However, the mutant with two M2 motifs (D12, Table 1) did not form a hydrogel, suggesting Watson-Crick base pairing was not strong enough on its own to form stable intermolecular network interaction. Second, the RNA with two M1 motifs did not form a hydrogel either (D11, Table 1). But, the mutant RNA with two all A-loops did form a hydrogel (D17i2 with the mutated Motif 1, Table 1). These results showed that both Motifs 1 and 2 in the same RNA molecule or CZ aptamer are required to act together in forming RNA network structures. However, the all A-loop Motif 1 is strong enough on its own or as a single design module to form a hydrogel network (D17i2). In other words, based on the ability to form strong RNA network structures, an all A-loop motif (12 As) is superior to the wild-type Motif 1 which contains 9 As but three non-A nucleotides or CGU. The CGU tri-nucleotides, however, are essential for the biological activity of the wild-type CZ aptamer (FIG. 1D), given that the all A-loop M1 mutant (D17) is no longer capable of potentiating the GluA2 AMPA receptor response (FIG. 6) (note that only monomeric RNA could potentiate the receptor). It should be noted that CZ aptamer was originally selected to potentiate the AMPA receptor activity; that aptamer, however, just happens to be capable of forming a hydrogel by self-assembly.
[0036] It is interesting to note that adenine dominates the wild-type M1 loop sequence (and in D17 mutant, adenine is the only nucleotide in the M1 loop sequence). It is plausible that adenine bases form a unique tertiary structure. Such a structure allows As to be packed by base stacking, because they lack the exocyclic atoms of other bases (27). This is perhaps similar to a three-A sequence known as A-minor motif. A-minor motifs, as found in large ribosomal subunits, can stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns as well as RNA-protein contacts (27). That a mutant RNA (D17) with the all-A M1 loop was just as capable as the wild-type CZ RNA in gelation (see the G'' and G'' data in Table 1) suggested that the interaction emanating from As from M1 is critical in the formation of network interaction for the hydrogel. We note, however, other types of RNA tertiary interactions may be also important in the intermolecular interaction among RNA monomers, such as sacrificial bonding (28), leading to the formation of RNA supramolecular network structure that is also heterogeneous in both sizes and shapes.
[0037] Our study illustrates that an RNA molecule with specific sequence motifs that can interact with other RNA molecules in sufficient concentration can form a hydrogel by self-assembling into a polymeric network structure without the help and/or presence of any other regent including a cross linker. In this case, each of the two motifs serves as an "arm" in its own direction to extend its non-covalent contact with the same or complementary motif but from another RNA molecule. Together, the CZ RNA aptamer with the two motifs is like an "elbow joint" as a design module to build a complex RNA network matrix. Moreover, the hydrogel formed by a structurally-engineered 2CZ RNA aptamer or by a mutant with dual all A-loops (D17i2) suggests that RNA hydrogels (using CZ aptamer to build a different but gel-forming competent RNA) should allow us to retain the original biological function. RNA hydrogels can be further explored for diverse applications such as drug delivery with further structure modifications by chemical cross-linking to change, for example, mesh size (2, 3, 29).
EXAMPLES
Example 1
Materials and Methods
GluA2Qflip AMPA Receptor Expression in HEK-293 Cells.
[0038] For the identification of CZ potentiating aptamers, we ran SELEX against the GluA2Q.sub.flip variant transiently expressed in HEK-293 cells. HEK-2933 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin in a 37.degree. C., 5% COP, humidified incubator. The DNA plasmids encoding green fluorescent protein and large T-antigen were cotransfected in HEK 293S cells (1). For SELEX, the transfected cells were harvested 48 hours after transfection, and the membrane fragment that contained the GluA2Q.sub.flip receptor was prepared as described (1). The fragmented HEK-293 cell membrane containing the GluA2Q.sub.flip receptor was prepared by homogenizing the cells using a 50 mM Tris acetate buffer (pH=7.4) containing 10 mM EDTA and 1 mM phenylmethanesulphonyl fluoride, followed by centrifugation to collect the membrane fragments.
Selex
[0039] The preparation of the RNA library and the protocol of running SELEX were described previously (1). For binding in the initial round of selection, the RNA library with .about.10.sup.14 random sequences was dissolved in the extracellular buffer, which contained (in mM) 150 NaCl, 3 KCl, 1 CaCl.sub.2), 1 MgCl.sub.2, 10 HEPES (pH 7.4). The membrane-bound receptor was adjusted to a final concentration of 8 nM as determined by [.sup.3H]AMPA binding. A total of 13-round SELEX were carried out against GluA2Q.sub.flip. In each round before mixing with the RNA pool, the receptor containing membrane was first preincubated in 1.times. extracellular buffer containing 400 .mu.M cyclothiazide (CTZ) for 5 min at 37.degree. C., and then for additional 5 min after supplementing 10 mM glutamate in the mixture. The membrane bound RNAs were separated from the solution through a 25 mm nitrocellular filter with 0.45 .mu.m pore size. Any useful RNAs were eluted from the filter, which contained membrane-bound RNAs, using 8 M urea. The eluted RNA through extraction of the aqueous phase (1) was then precipitated in ethanol, air-dried, and dissolved in H.sub.2O. The sample was then subject to reverse transcription and PCR, as described (1). In all but the first four rounds, the RNA pool was pretreated, prior to a new round of SELEX, by a negative selection procedure in which cell membrane fragments that contained no GluA2Q.sub.flip was used to "filter off" any unwanted RNAs.
Sequencing of DNA pools for identification of CZ aptamer.
[0040] For identification of CZ aptamer, we carried out two methods of sequencing. At the end of the 13th selection round, the DNA pools from rounds 10, 12, and 13 were separately cloned into the pGEM-T easy vector (Invitrogen) for sequencing. Sequencing alignment and comparison allowed us to identify the CZ sequence by this method (the CZ sequence appearance rate was 1.2%). We also attempted next generation deep sequencing (the deep sequencing was done at the Mass Medical School Deep Sequencing Core facility). From two separate SELEX runs, the highest appearance of the CZ sequence we found was 0.1% in round 6, the fourth most populous sequences in that pool (we did not do deep sequencing analysis beyond round 6).
Whole-Cell Current Recording Assay of the CZ Potentiating Function.
[0041] The procedure for whole-cell current recording to assay putative aptamers was previously described (1,2). All recordings were at -60 mV and 22.degree. C. The recording electrode was filled with the buffer (in mM): 110 CsF, 30 CsCl, 4 NaCl, 0.5 CaCl.sub.2, 5 EGTA, and 10 HEPES (pH 7.4 adjusted by CsOH). The extracellular buffer composition was a 50 mM Tris acetate buffer (pH=7.4) containing 10 mM EDTA and 1 mM phenylmethanesulphonyl fluoride. The whole-cell current was recorded using an Axopatch 200B amplifier at a cutoff frequency of 2-20 kHz by a built-in, four-pole Bessel filter and digitized at 5-50 kHz sampling frequency using a Digidata 1322A (Molecular Devices). pClamp 8 (Molecular Devices) was used for data acquisition. A flow device (1,2) was used to apply glutamate in the absence and presence of aptamers, including CZ aptamer, to a cell expressing GluA2Q.sub.flip receptors.
[0042] It should be noted that once assembled into a hydrogel, CZ and 2 CZ RNA no longer showed biological activity or AMPA receptor potentiation. Monomeric CZ and 2 CZ aptamer were active. To make sure we had RNA aptamer prior to polymerization, we first used Amicon centrifuge filters to get RNA aptamer. For example, Amicon filters with 50 k Dalton molecular weight cut off was used to prepare CZ RNA sample for electrophysiology assay. The flow-through was collected, which contained monomeric RNA because the CZ RNA has MW of 32.5 k Dalton. Polymerized RNA was retained on the top of the filter. When too concentrated, gel formation was observed. PAGE gel was also used, similar to the one shown in FIG. 1. Second, for the monomeric RNA sample, right before the electrophysiology measurement, the sample was subject to 10 min incubation at 90.degree. C. The sample was allowed to quickly cool down to room temperature for whole-cell recording assay.
RNA Transcription and Purification
[0043] An RNA in vitro transcription reaction contained 0.3 .mu.M DNA template, 25 mM of each NTPs (i.e., ATP, CTP, GTP and UTP), 50 ng/.mu.l of T7 RNA polymerase, 0.005 unit/pi of pyrophosphatase, 25 mM of MgCl.sub.2, 10 mM DTT, 2 mM spermidine, and 50 mM HEPES (pH 7.5). The transcription mixture was incubated at 37.degree. C. overnight and then kept at 4.degree. C. AH the RNA aptamers and mutants were purified for experiments reported in this study. Specifically, a tubular PAGE column (Bio-Rad Prepcell 491) was used to purify RNA from a transcription mixture. The detailed method has been described previously (3). Briefly, the polyacrylamide gel column was formed by 80 ml of 12% acrylamide/bis-acrylamide (37.5:1) solution in 1.times. Tris-Borate-EDTA (TBE) buffer containing 8 M urea. For each run, about 1 ml of the transcription mixture was mixed with 1 ml of gel loading buffer H (Bio-Rad), which contained 95% of formamide. The RNA transcription sample with loading buffer was incubated at 95.degree. C. for 5 min before being loaded onto the column. The elution of the RNA sample was monitored by a UV detector and collected in a fraction collector (BioFrac, Bio-Rad) at 1.5 nil/fraction. The fractions were then pooled based on the chromatography trace and concentrated in an Amicon filtration centrifuge tube (Millipore). The TBE buffer in the eluted samples was exchanged with 25 mM HEPES buffer by spinning in an Amicon filtration tube; the same procedure was repeated two more times. The concentration of the collected sample was determined by UV absorption at 260 nm, using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific).
Rheology Study.
[0044] A Physica MCR101 rheometer (Anton Paar) was used in the rheology study. Peltier plate was employed for temperature control, Sample was tested in a chamber with water reservoir to minimize dehydration. All RNAs were PAGE purified, and the samples were tested at 3% (30 mg/ml) in 25 mM HEPES (pH7.5) with 25 mM of MgCl.sub.2. G' and G'' lower than 1 Pa indicates the measured moduli were under the instrument resolution limit. The results are shown in Table 1 (including Table 1 cont'd), FIGS. 3a and 3b, and FIG. 5, respectively.
Small Angle X-Ray Scattering Study.
[0045] Small angle X-ray scattering study was performed at the DuPont-Northwestern-Dow Collaborative Access Team (DND-CAT) located at Sector 5 of the Advanced Photon Source (APS) in the Argonne National Laboratory, IL. RNA hydrogel samples were contained in borosilicate capillary tubes (Charles Supper) and characterized at 25.degree. C. on a MAR CCD located at 8.5 m to the samples by illumination of monochromatic X-ray with wavelength .lamda.=0.756 .ANG.. The 2D patterns were integrated azimuthally for 1 dimensional scattering intensity versus scattering vector q=4.pi..lamda..sup.-1 sin(.theta.) where .theta. is the scattering. The collected 1D patterns were subtracted with blank capillary signal.
Cryogenic-Transmission Electron Microscopy.
[0046] Standard cryogenic-TEM sample preparation and characterization procedures were employed. Thin film of 2CZ RNA solution was vitrified on a Lacey Formvar/Carbon grid (TedPella) in liquefied ethane using a Vitrobot (FEI). Prepared sample was imaged using a FEI Tecnai G2 F30 field-emission TEM.
Cryogenic-Scanning Electron Microscopy.
[0047] 2CZ RNA solution with 5 mM MgCl.sub.2 was vitrified under high pressure (.about.2,100 bar) using Balzers HPM 010 high pressure freezer. The vitrified solution was etched at -100.degree. C. for 2 minutes in a Leica ACE 600 high vacuum coater (lowest pressure achievable was 2.5.times.10.sup.-6 mbar) and coated with platinum (2.5 nm) at -108.degree. C. Micrographs were recorded using a Hitachi SU 8230 scanning electron microscope at 10.sup.-4 Pa and -112.degree. C.
REFERENCES
[0048] 1. B. Amsden, Solute diffusion within hydrogels. Mechanisms and models. Macromolecules 31, 8382-8395 (1998).
[0049] 2. K. Y. Lee, D. J. Mooney, Hydrogels for tissue engineering. Chem Rev 101, 1869-1879 (2001).
[0050] 3. G. Fichman, E. Gazit, Self-assembly of short peptides to form hydrogels: design of building blocks, physical properties and technological applications. Acta Biomater 10, 1671-1682 (2014).
[0051] 4. N. B. Leontis, J. Stombaugh, E. Westhof, The non-Watson-Crick base pairs and their associated isostericity matrices. Nucleic Acids Res 30, 3497-3531 (2002).
[0052] 5. S. E. Butcher, A. M. Pyle, The molecular interactions that stabilize RNA tertiary structure: RNA motifs, patterns, and networks. Acc Chem Res 44, 1302-1311 (2011).
[0053] 6. G. F. Joyce, RNA evolution and the origins of life. Nature 338, 217-224 (1989).
[0054] 7. J. Zhou, M. L. Bobbin, J. C. Burnett, J. J. Rossi, Current progress of RNA aptamer-based therapeutics. Front Genet 3, 234 (2012).
[0055] 8. W. Winkler, A. Nahvi, R. R. Breaker, Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature 419, 952-956 (2002).
[0056] 9. A. D. Ellington, J. W. Szostak, In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990).
[0057] 10. C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510 (1990).
[0058] 11. G. Lynch, Glutamate-based therapeutic approaches: ampakines. Curr Opin Pharmacol 6, 82-88 (2006).
[0059] 12. S. J. Martin, P. D. Grimwood, R. G. Morris, Synaptic plasticity and memory: an evaluation of the hypothesis. Annu Rev Neurosci 23, 649-711 (2000).
[0060] 13. M. Carlsson, A. Carlsson, Interactions between glutamatergic and monoaminergic systems within the basal ganglia--implications for schizophrenia and Parkinson's disease. Trends Neurosci 13, 272-276 (1990).
[0061] 14. E. B. Bloss et al., Behavioral and biological effects of chronic S18986, a positive AMPA receptor modulator, during aging. Exp Neurol 210, 109-117 (2008).
[0062] 15. R. Dingledine, K. Borges, D. Bowie, S. F. Traynelis, The glutamate receptor ion channels. Pharmacol Rev 51, 7-61 (1999).
[0063] 16. Z. Huang, Y. Han, C. Wang, L. Niu, Potent and selective inhibition of the open-channel conformation of AMPA receptors by an RNA aptamer. Biochemistry 49, 5790-5798 (2010).
[0064] 17. H. Rehage, H. Hoffmann, Rheological properties of viscoelastic surfactant systems. Journal of Physical Chemistry 92, 4712-4719 (1988).
[0065] 18. M. E. Cates, S. J. Candau, Statics and dynamics of worm-like surfactant micelles. Journal of Physics: Condensed Matter 2, 6869-6892 (1990).
[0066] 19. Y. Y. Won, A. K. Brannan, H. T. Davis, F. S. Bates, Cryogenic Transmission Electron Microscopy (Cryo-TEM) of Micelles and Vesicles Formed in Water by Poly(ethylene oxide)-Based Block Copolymers. The Journal of Physical Chemistry 106, 3354-3364 (2002).
[0067] 20. R. P. Sijbesma et al., Reversible polymers formed from self-complementary monomers using quadruple hydrogen bonding. Science 278, 1601-1604 (1997).
[0068] 21. P. C. Hiemenz, T. P. Lodge, Polymer Chemistry. 2nd ed. CRC Press: Boca Raton, (2007).
[0069] 22. H. D. Mertens, D. I. Svergun, Structural characterization of proteins and complexes using small-angle X-ray solution scattering. J Struct Biol 172, 128-141 (2010).
[0070] 23. P. T. Li, C. Bustamante, I. Tinoco, Jr., Unusual mechanical stability of a minimal RNA kissing complex. Proc Natl Acad Sci USA 103, 15847-15852 (2006).
[0071] 24. M. Zuker, Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 3406-3415. (2003).
[0072] 25. M. Costa, F. Michel, Rules for RNA recognition of GNRA tetraloops deduced by in vitro selection: comparison with in vivo evolution. Embo J 16, 3289-3302 (1997).
[0073] 26. H. Fan, Leukemogenesis by Moloney murine leukemia virus: a multistep process. Trends Microbiol 5, 74-82 (1997).
[0074] 27. P. Nissen, J. A. Ippolito, N. Ban, P. B. Moore, T. A. Steitz, RNA tertiary interactions in the large ribosomal subunit: the A-minor motif. Proc Natl Acad Sci USA 98, 4899-4903 (2001).
[0075] 28. G. E. Fantner et al., Sacrificial bonds and hidden length: unraveling molecular mesostructures in tough materials. Biophys J 90, 1411-1418 (2006).
[0076] 29. B. V. Slaughter, S. S. Khurshid, O. Z. Fisher, A. Khademhosseini, N. A. Peppas, Hydrogels in regenerative medicine. Adv Mater 21, 3307-3329 (2009).
[0077] 30. Huang, Z., Pei, W., Jayaseelan, S., Shi, H., and Niu, L. (2007) RNA aptamers selected against the GluR2 glutamate receptor channel. Biochemistry 46, 12648-12655
[0078] 31. Huang, Z., Han, Y., Wang, C., and Niu, L. (2010) Potent and selective inhibition of the open-channel conformation of AMPA receptors by an RNA aptamer. Biochemistry 49, 5790-5798
[0079] 32. Lin, C. Y., Huang, Z., Jaremko, W., and Niu, L. (2014) High-performance liquid chromatography purification of chemically modified RNA aptamers. Anal Biochem 449, 106-108
TABLE-US-00001
[0079] TABLE 1 Rheology experiments on CZ hydrogels and its mutations.sup.a T = 10.degree. C., .omega. = 1/s T = 20.degree. C., .omega. = 1/s RNA.sup.b G' (Pa).sup.c G'' (Pa).sup.c G' (Pa).sup.c G'' (Pa).sup.c ##STR00004## 207 30.3 56.2 20.8 ##STR00005## <1 <1 <1 <1 ##STR00006## 628 22.9 723 19 ##STR00007## 23.4 2.9 29.1 4.9 ##STR00008## <1 <1 <1 <1 ##STR00009## 2.3 1.9 1.5 1.1 ##STR00010## <1 <1 <1 <1 ##STR00011## 145 70.5 67.3 25.6 ##STR00012## 505 70.5 233 57.2 Additional sequences shown below. SEQ ID T = 10.degree. C., f = 1/s T = 20.degree. C., f = 1/s NO: RNA G' (Pa) G'' (Pa) G' (Pa) G'' (Pa) 10 D15 132 10.7 168 12.4 11 D25 288 19.2 631 34.7 12 D26 217 22.7 430 32.1 13 D27 1180 149 1830 122 .sup.aMotif 1 is defined by a 12-nt loop, located on the upper left side of the aptamer, as shown in aptamer CZ. Motif 2 is defined by a 9-nt loop, located in the lower right hand side of the aptamer, as shown in CZ. CZ is the wild-type aptamer, and thus a motif in CZ is comprised of the wild-type RNA sequence. Any other RNA sequence in either motif represents mutations. .sup.bAll RNAs were PAGE purified, and the samples were tested at 3% (30 mg/ml) in 25 mM HEPES (pH 7.5) with 25 mM of MgCl.sub.2. .sup.cG' and G'' lower than 1 Pa indicates the measured moduli were under the instrument resolution limit.
TABLE-US-00002 TABLE 2 SEQ ID NO. .dwnarw. 1 CZ GGGAGAAUUCAACUGCCAUCUAGGCGGCGC Original AAAAAACGUAAAAUGGGUCAUGGGAAAGGG sequence CAGGUGAGAGGACUAGUACUACAAGCUUCU from SELEX GGACUCGGU 3 D17 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC The "CGU" AAAAAAAAAAAAAUGGGUCAUGGGAAAGGG in the CAGGUGAGAGGACUAGUACUACAAGCUUCU loop of GGACUCGGU motif 1 was replaced with pure As 8 D1712 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC Two pure AAAAAAAAAAAAAUGGGUCAUGGGAAAGGG A-loop CAGACGGCGCAAAAAAAAAAAAAUGGGUCA without UGCUCCC Motif 2 9 2CZ GGGAGGCGGAUUCGAGAAUUCAACUGCCAU CZ CUAGGCGGCGCAAAAAACGUAAAAUGGGUC sequence AUGGGAAAGGGCAGGUGAGAGGACUAGUAC repeats UACAAGCUUCUGGACUCGGAUCCGUGACCC in 1 AAAGGUCAUACUCCCGGAGAAUUCAACUGC molecule CAUCUAGGCGGCGCAAAAAACGUAAAAUGG GUCAUGGGAAAGGGCAGGUGAGAGGACUAG UACUACAAGCUUCUGGACUCCAAUAUU 10 D15 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC Single AAAAAACUUAAAAUGGGUCAUGGGAAAGGG "G" to CAGACGGCGCAAAAAACUUAAAAUGGGUCA "U" mu- UGCUCCC tation in motif 1, two motif 1 without motif 2, compare to D1712 11 D25 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC The 12-nt AAAAUGGGUCAUGGGAAAGGGCAGGUGAGA loop in GGACUAGUACUACAAGCUUCUGGACUCGG motif 1 U-3' was reduced to "AAA" 12 D26 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC The 12-nt AGUGUUAGAGCCUUGGGUCAUGGGAAAGGG loop in CAGGUGAGAGGACUAGUACUACAAGCUUCU motif 1 GGACUCGGU was replaced with an arbituary 12-nt sequence 13 D27 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC Four "A" AAUAGACGUAUAUUGGGUCAUGGGAAAGGG positions CAGGUGAGAGGACUAGUACUACAAGCUUCU in the GGACUCGGU 12-nt loop of motif 1 were mutated to "U" or "G" 14 GGGAGAAUUCAACUGCCAUCUAGGCGGCGC A 15 AAAAACGUAAAA 16 AAAAAAAAAAAA 17 AUAGACGUAUAU 18 AAAAACGUAAAA 19 AAA 20 GUGUUAGAGCCU 21 UGGGUCAUGGGAAAGGGCAGGUGAGAGGAC 22 UGGGUCAUGGGAAAGGGCAGACGGCGCA 23 UAGUACUACA 24 AGCUUCUGGACUCGGU 25 UGGGUCAUGCUCCC
TABLE-US-00003 TABLE 3 SEQ ID NOS. 5' Loop 1 Inter-Loop Loop2 3' Full Molecule CZ 14 15 21 23 24 1 D17 14 16 21 23 24 3 D17I2 14 16 22 16 25 8 D15 14 18 22 18 25 10 D25 14 19 21 23 24 11 D26 14 20 21 23 24 12 D27 14 17 21 23 24 13 2CZ 26 15 21 23 24-U 9
TABLE-US-00004 TABLE 4 Composition of 2CZ samples employed for material characterizations 2CZ RNA.sup.a MgCl.sub.2.sup.b Characterization Method (% w/v) (mM) Visual inspection.sup.c 4 0 2.5 2 0.8 25 Cryo-TEM.sup.d 0.5 0, 2 Cryo-SEM 3.2 5 SAXS.sup.e 1, 2 0, 2, 5 Rheology 2.5 2 .sup.a2CZ RNA was PAGE purified and dissolved in 25 mM HEPES buffer (pH 7.5); 1% (w/v) of RNA concentration was 10 .mu.g/.mu.l or 137 .mu.M .sup.bMgCl.sub.2 concentration in HEPES buffer .sup.cBy visual inspection, hydrogel was formed, as judged by a non-flow behavior under gravity, when the tube with the gel was inverted .sup.d0.5% 2CZ samples with/without 2 mM of MgCl.sub.2 were tested separately .sup.eEach concentration of the 2CZ sample was prepared in 3 tubes with 0, 2, or 5 mM of MgCl.sub.2, respectively.
Sequence CWU
1
1
26199RNAArtificial Sequencesynthetic polynucleotide 1gggagaauuc aacugccauc
uaggcggcgc aaaaaacgua aaauggguca ugggaaaggg 60caggugagag gacuaguacu
acaagcuucu ggacucggu 99286RNAArtificial
Sequencesynthetic polynucleotide 2ggagaauuca acugccaucu aggcggccga
aaggucaugg gaaagggcag gugagaggac 60uaguacuaca agcuucugga cucggu
86399RNAArtificial Sequencesynthetic
polynucleotide 3gggagaauuc aacugccauc uaggcggcgc aaaaaaaaaa aaauggguca
ugggaaaggg 60caggugagag gacuaguacu acaagcuucu ggacucggu
99499RNAArtificial Sequencesynthetic polynucleotide
4gggagaauuc aacugccauc uaggcggcgc auuuuuuuuu uuuuggguca ugggaaaggg
60caggugagag gacuaguacu acaagcuucu ggacucggu
99593RNAArtificial Sequencesynthetic polynucleotide 5gggagaauuc
aacugccauc uaggcggcgc aaaaaacgua aaauggguca ugggaaaggg 60caggugagag
gacugaaaag cuucuggacu ccc
93697RNAArtificial Sequencesynthetic polynucleotide 6gggagaauuc
aacugccauc uaggcggcgc aaaaaacgua aaauggguca ugggaaaggg 60cagacggcgc
aaaaaacgua aaauggguca ugcuccc
97785RNAArtificial Sequencesynthetic polynucleotide 7gggagaauuc
aacugccaag aggacuagua cuacaagcuu cuaagggcag gugagaggac 60uaguacuaca
agcuucugga cuccc
85897RNAArtificial Sequencesynthetic polynucleotide 8gggagaauuc
aacugccauc uaggcggcgc aaaaaaaaaa aaauggguca ugggaaaggg 60cagacggcgc
aaaaaaaaaa aaauggguca ugcuccc
979237RNAArtificial Sequencesynthetic polynucleotide 9gggaggcgga
uucgagaauu caacugccau cuaggcggcg caaaaaacgu aaaauggguc 60augggaaagg
gcaggugaga ggacuaguac uacaagcuuc uggacucgga uccgugaccc 120aaaggucaua
cucccggaga auucaacugc caucuaggcg gcgcaaaaaa cguaaaaugg 180gucaugggaa
agggcaggug agaggacuag uacuacaagc uucuggacuc caauauu
2371097RNAArtificial Sequencesynthetic polynucleotdie 10gggagaauuc
aacugccauc uaggcggcgc aaaaaacuua aaauggguca ugggaaaggg 60cagacggcgc
aaaaaacuua aaauggguca ugcuccc
971190RNAArtificial Sequencesynthetic polynucleotide 11gggagaauuc
aacugccauc uaggcggcgc aaaauggguc augggaaagg gcaggugaga 60ggacuaguac
uacaagcuuc uggacucggu
901299RNAArtificial Sequencesynthetic polynucleotide 12gggagaauuc
aacugccauc uaggcggcgc aguguuagag ccuuggguca ugggaaaggg 60caggugagag
gacuaguacu acaagcuucu ggacucggu
991399RNAArtificial Sequencesynthetic polynucleotide 13gggagaauuc
aacugccauc uaggcggcgc aauagacgua uauuggguca ugggaaaggg 60caggugagag
gacuaguacu acaagcuucu ggacucggu
991431RNAArtificial Sequencesynthetic polynucleotide 14gggagaauuc
aacugccauc uaggcggcgc a
311512RNAArtificial Sequencesynthetic polynucleotide 15aaaaacguaa aa
121612RNAArtificial
Sequencesynthetic polynucleotide 16aaaaaaaaaa aa
121712RNAArtificial Sequencesynthetic
polynucleotide 17auagacguau au
121812RNAArtificial Sequencesynthetic polynucleotide
18aaaaacuuaa aa
12193RNAArtificial Sequencesynthetic polynucleotide 19aaa
32012RNAArtificial
Sequencesynthetic polynucleotide 20guguuagagc cu
122130RNAArtificial Sequencesynthetic
polynucleotide 21ugggucaugg gaaagggcag gugagaggac
302228RNAArtificial Sequencesynthetic polynucleotide
22ugggucaugg gaaagggcag acggcgca
282310RNAArtificial Sequencesynthetic polynucleotide 23uaguacuaca
102416RNAArtificial
Sequencesynthetic polynucleotide 24agcuucugga cucggu
162514RNAArtificial Sequencesynthetic
polynucleotide 25ugggucaugc uccc
142642RNAArtificial Sequencesynthetic polynucleotide
26gggaggcgga uucgagaauu caacugccau cuaggcggcg ca
42
User Contributions:
Comment about this patent or add new information about this topic: