Patent application title: CELL-PERMEABLE (ICP)-SOCS3 RECOMBINANT PROTEIN AND USES THEREOF
Inventors:
Daewoong Jo
Daewoong Jo (Brentwood, TN, US)
Daewoong Jo (Brentwood, TN, US)
Youngsil Choi (Seoul, KR)
Kuysook Lee (Namyangju-Si, KR)
Seulmee Shin (Seoul, KR)
Jihye Kim (Incheon, KR)
Jeongmin Kim (Seoul, KR)
Chohyun Kim (Incheon, KR)
Assignees:
CELLIVERY THERAPEUTICS, INC.
IPC8 Class: AC07K1447FI
USPC Class:
1 1
Class name:
Publication date: 2017-05-18
Patent application number: 20170137482
Abstract:
The present invention relates to providing improved cell-permeable
(iCP)-SOCS3 recombinant protein and uses thereof. Preferably, the
iCP-SOCS3 recombinant protein may be used as protein-based anti-solid
tumor agent by utilizing the platform technology for macromolecule
intracellular transduction.Claims:
1. An improved Cell-Permeable (iCP)-SOCS3 recombinant protein, which
comprises a SOCS3 protein and an advanced macromolecule transduction
domain (aMTD) being composed of 9-13 amino acid sequences and having
improved cell and/or tissue permeability, wherein the aMTD is fused to
one end or both ends of the SOCS3 protein and has the following features
of: (a) being composed of 3 or more amino acids sequences selected from
the group consisting of Ala, Val, Ile, Leu, and Pro; (b) having proline
as amino acid sequences corresponding to any one or more of positions 5
to 8, and 12 of its amino acid sequence; and (c) having an instability
index of 40-60; an aliphatic index of 180-220; and a grand average of
hydropathy (GRAVY) of 2.1-2.6, as measured by Protparam.
2. The iCP-SOCS3 recombinant protein according to claim 1, wherein one or more solubilization domain (SD)(s) are further fused to the end(s) of one or more of the SOCS3 protein and the aMTD.
3. The iCP-SOCS3 recombinant protein according to claim 1, wherein the aMTD is composed of 12 amino acid sequences and represented by the following general formula: Here, X(s) independently refer to Alanine (A), Valine (V), Leucine (L) or Isoleucine (I); and Proline (P) can be positioned in one of U(s) (either 5', 6', 7' or 8'); and the remaining U(s) are independently composed of A, V, L or I, P at the 12' is Proline.
4. The iCP-SOCS3 recombinant protein according to claim 1, wherein the SOCS3 protein has an amino acid sequence of SEQ ID NO: 814.
5. The iCP-SOCS3 recombinant protein according to claim 4, wherein the SOCS3 protein is encoded by a polynucleotide sequence of SEQ ID NO: 815.
6. The iCP-SOCS3 recombinant protein according to claim 1, wherein the SOCS3 protein further comprises a ligand selectively binding to a receptor of a cell, a tissue, or an organ.
7. The iCP-SOCS3 recombinant protein according to claim 1, wherein the aMTD has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-240 and 822.
8. The iCP-SOCS3 recombinant protein according to claim 7, wherein the aMTD is encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 241-480 and 823.
9. The iCP-SOCS3 recombinant protein according to claim 2, wherein the SD(s) have an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 798, 799, 800, 801, 802, 803, and 804.
10. The iCP-SOCS3 recombinant protein of claim 9, wherein the SD(s) are encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 805, 806, 807, 808, 809, 810, and 811.
11. The iCP-SOCS3 recombinant protein according to claim 1, wherein the iCP-SOCS3 recombinant protein has a histidine-tag affinity domain additionally fused to one end thereof.
12. The iCP-SOCS3 recombinant protein according to claim 11, wherein the histidine-tag affinity domain has an amino acid sequence of SEQ ID NO: 812.
13. The iCP-SOCS3 recombinant protein of claim 12, wherein the histidine-tag affinity domain is encoded by a polynucleotide sequence of SEQ ID NO: 813.
14. The iCP-SOCS3 recombinant protein according to claim 1, wherein the fusion is formed via a peptide bond or a chemical bond.
15. The iCP-SOCS3 recombinant protein according to claim 1, wherein the iCP-SOCS3 recombinant protein is used for the treating, preventing, or delaying the onset of, solid tumor.
16. A polynucleotide sequence encoding the iCP-SOCS3 recombinant protein of claim 1.
17. A recombinant expression vector comprising the polynucleotide sequence of claim 16.
18. A transformant transformed with the recombinant expression vector of claim 17.
19. A preparing method of the iCP-SOCS3 recombinant protein of claim 1 comprising: preparing the recombinant expression vector of claim 17; preparing a transformant using the recombinant expression vector; culturing the transformant; and recovering the recombinant protein expressed by the culturing.
20. A method of treating, preventing, or delaying the onset of, solid tumor in a subject comprising: identifying a subject in need of treating, preventing, or delaying the onset of, solid tumor; and administering to the subject a therapeutically effective amount of the iCP-SOCS3 recombinant protein of claim 1.
Description:
TECHNICAL FIELD
[0001] The present invention relates to providing improved cell-permeable (iCP)-SOCS3 recombinant protein and uses thereof. Preferably, the iCP-SOCS3 recombinant protein may be used as protein-based anti-solid tumor agent by utilizing the platform technology for macromolecule intracellular transduction.
BACKGROUND ART
[0002] The Janus kinase signal transducers and activators of transcription signaling (JAK/STAT) plays important roles in immune responses, including oncogenesis. So many investigations demonstrated that STAT-3, an important member of STAT proteins, was considered as a proto-oncogene in various types of disorder. STAT-3 is phosphorylated and dimerizes by the Janus kinase (JAK), and its overexpression and constitutive activation can significantly induce cell proliferation, tumor angiogenesis, invasion. Meanwhile, inhibition of JAK-STAT signaling led to suppress the cancer cell growth and induce apoptosis. Suppressor of cytokine signaling-3 (SOCS3), a kind of endogenous protein inhibitor of JAK/STAT pathway, was identified to be inversely associated with the STATS expression and phosphorylation in vivo and in vitro and aberrant expression of SOCS3 protein was observed in human solid tumors including gastric, colorectal and breast cancer, and glioblastoma.
[0003] Gastric cancer remains the second leading cause of cancer-related death in the world. Advances in early detection and decreased chronic Helicobacter pylori infection rates have led to a substantial reduction in gastric cancer rates worldwide. However, effective treatment regimens for gastric cancers, especially advanced gastric cancer, are still lacking; therefore, the prognosis of patients with this disease remains poor. SOCS3 mRNA levels are higher in adjacent normal mucosal tissues, however, gastric cancer patients with high simultaneous expression of SOCS3 have a better overall survival than those with low simultaneous expression. Based on this, SOCS3 may represent new therapeutic target to treat gastric cancer.
[0004] Colorectal cancer is one of the most fatal neoplastic diseases worldwide and a serious global health problem, with over one million new cases and half million mortalities worldwide each year. It has been reported as being relevant to some inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis. The pathogenesis of colorectal carcinoma is complex, with the involvement of multiple cellular transduction pathways including IL-6/STAT3 signaling. Reduced or silenced SOCS3 has been found in many human types of cancer including colorectal cancer, and restoring SOCS3 expression in the cancer cells inhibits IL-6-mediated STAT3 activation, induces tumor cell apoptosis and decreases cell proliferation. Therefore, suppression of the IL-6/STAT3 pathway via modulation of SOCS3 has been a promising strategy for anti-colon/colorectal cancer therapy.
[0005] Glioblastoma, the most common neoplasm among diffuse infiltrating astrocytomas, is notorious for its ability to evade immune-surveillance as well as for its invasive and angiogenic properties. Gliomas are the most common type of primary brain tumors are highly malignant and are associated with a very poor prognosis. Glioblastoma is a very aggressive subtype of glioma with very short life expectancy and limited treatment options. A hallmark of this lethal disorder is the presence of activated STAT3. Because SOCS3 is a negative regulator of STAT-3 activation, it hypothesized that SOCS3 may function as a tumor suppressor in glioblastoma tissues.
[0006] Breast cancer is a disease that arises from the accumulation of alterations in the genome of cells that make up the mammary gland. Breast cancer is the most common type of cancer among women, with an estimated 1.38 million new cases of cancer diagnosed in 2008 (23% of all cancers), and the second most common type of cancer overall (10.9% of all cancers). Expression of SOCS3 protein is significantly down-regulated in breast cancer specimens and replacing of SOCS3 protein may directly influence the treatment of breast cancer.
[0007] Cytokine signaling is strictly regulated by the SOCS family proteins induced by different classes of agonists, including cytokines, hormones and infectious agents. Among them, SOCS1 and SOCS3 are relatively specific to STAT1 and STAT3, respectively. SOCS1 inhibits JAK activation through its N-terminal kinase inhibitory region (KIR) by the direct binding to the activation loop of JAKs, while SOCS3 binds to janus kinases (JAKs)-proximal sites on the receptor through its SH2 domain and inhibits JAK activity that blocks recruitment of STAT3. Both promote anti-inflammatory effects due to the suppression of inflammation-inducing cytokine signaling. Furthermore, the SOCS box, another domain in SOCS proteins, interacts with E3 ubiquitin ligases and/or couples the SH2 domain-binding proteins to the ubiquitin-proteasome pathway. Therefore, SOCSs inhibit cytokine signaling by suppressing JAK kinase activity and degrading the activated cytokine receptor complex.
[0008] In connection with SOCSs and various solid tumors including gastric, colorectal and breast cancer, and glioblastoma, the SOCS1 gene has been implicated as an anti-oncogene in the tumor development. Previous studies have reported that aberrant methylation in the CpG island of SOCS1 induces its transcriptional silencing in cancer cell lines, and SOCS1 heterozygous mice are hypersensitive to various cancers. In addition, abnormalities of SOCS3 are also associated with the solid tumors. Hypermethylation of CpG islands in the SOCS3 promoter is correlated with its transcriptional silencing in tumors cell lines. SOCS3 overexpression down-regulates active STAT3, induces apoptosis, and suppresses growth in cancer cells. The importance of STAT3 to inflammation-associated carcinogenesis is underlined by the previous study that cancer-specific deletion of SOCS3 in a mouse carcinoma model results in larger and more numerous tumors. This means that SOCS3 plays a major role in the negative regulation of the JAK/STAT pathway in carcinogenesis and contributes to the suppression of tumor development by protecting the tissue cells.
REFERENCES
[0009] 1. Fischer P M., Cellular uptake mechanisms and potential therapeutic utility of peptidic cell delivery vectors: progress 2001-2006, Med Res Rev. 2007; 27:755-95.
[0010] 2. Heitz F, Morris M C, Divita G., Twenty years of cell-penetrating peptides: from molecular mechanisms to therapeutics, Br J Pharmacol. 2009; 157:195-206.
[0011] 3. Lapenna S, Giordano A., Cell cycle kinases as therapeutic targets for cancer, Nat Rev Drug Discov. 2009; 8:547-66.
[0012] 4. Lim J, Kim J, Duong T, Lee G, Kim J, Yoon J. et al., Antitumor activity of cell-permeable p18(INK4c) with enhanced membrane and tissue penetration, Mol Ther. 2012; 20:1540-9.
[0013] 5. Jo D, Liu D, Yao S, Collins R D, Hawiger J., Intracellular protein therapy with SOCS3 inhibits inflammation and apoptosis, Nat Med. 2005; 11:892-8.
[0014] 6. Jo D, Nashabi A, Doxsee C, Lin Q, Unutmaz D, Chen J. et al., Epigenetic regulation of gene structure and function with a cell-permeable Cre recombinase, Nat Biotechnol. 2001; 19:929-33.
[0015] 7. Liu D, Li C, Chen Y, Burnett C, Liu X Y, Downs S. et al., Nuclear import of proinflammatory transcription factors is required for massive liver apoptosis induced by bacterial lipopolysaccharide, J Biol Chem. 2004; 279:48434-42.
[0016] 8. Liu D, Liu X Y, Robinson D, Burnett C, Jackson C, Seele L. et al., Suppression of Staphylococcal Enterotoxin B-induced Toxicity by a Nuclear Import Inhibitor, J Biol Chem. 2004; 279:19239-46.
[0017] 9. Liu D, Zienkiewicz J, DiGiandomenico A, Hawiger J., Suppression of acute lung inflammation by intracellular peptide delivery of a nuclear import inhibitor, Mol Ther. 2009; 17:796-802.
[0018] 10. Moore D J, Zienkiewicz J, Kendall P L, Liu D, Liu X, Veach R A. et al., In vivo islet protection by a nuclear import inhibitor in a mouse model of type 1 diabetes, PLoS One. 2010; 5:e13235.
[0019] 11. Lim J, Jang G, Kang S, Lee G, Nga do T T, Phuong do T L. et al., Cell-permeable NM23 blocks the maintenance and progression of established pulmonary metastasis, Cancer Res. 2011; 71:7216-25.
[0020] 12. Duong T, Kim J, Ruley H E, Jo D., Cell-permeable parkin proteins suppress Parkinson disease-associated phenotypes in cultured cells and animals, PLoS One. 2014; 9:e102517.
[0021] 13. Lim J, Duong T, Do N, Do P, Kim J, Kim H. et al., Antitumor activity of cell-permeable RUNX3 protein in gastric cancer cells. Clin Cancer Res. 2013; 19:680-90.
[0022] 14. Lim J, Duong T, Lee G, Seong B L, El-Rifai W, Ruley H E et al. The effect of intracellular protein delivery on the anti-tumor activity of recombinant human endostatin, Biomaterials. 2013; 34:6261-71.
[0023] 15. Lim J, Kim J, Kang J, Jo D., Partial somatic to stem cell transformations induced by cell-permeable reprogramming factors, Scientific Reports. 2014; 4:4361.
DISCLOSURE
Technical Problem
[0024] To negatively control JAK/STAT signaling, recombinant SOCS3 proteins that contain a cell-penetrating peptide (CPP)--membrane-translocating motif (MTM) from fibroblast growth factor (FGF)-4 has been reported. These recombinant SOCS3 proteins inhibited STAT phosphorylation, inflammatory cytokines production and MHC-II expression in cultured and primary macrophages. In addition, SOCS3 fused to MTM protected mice challenged with a lethal dose of the SEB super-antigen, by suppressing apoptosis and hemorrhagic necrosis in multiple organs. However, the SOCS3 proteins fused to FGF4-derived MTM displayed extremely low solubility, poor yields and relatively low cell- and tissue-permeability. Therefore, the MTM-fused SOCS3 proteins were not suitable for further clinical development as therapeutic agents.
Technical Solution
[0025] For MITT, six critical factors (length, bending potential, instability index, aliphatic index, GRAVY, amino acid composition) have been determined through analysis of baseline hydrophobic CPPs. Advanced macromolecule transduction domain (aMTD), newly designed based on these six critical factors, could optimize cell-/tissue-permeability of SOCS3 proteins that have a therapeutic effects and develop them as protein-based drugs. Further, in order to increase solubility and yield of recombinant protein, solubilization domains (SDs) additionally fused to the aMTD-SOCS3 recombinant protein, thereby notably increased the solubility and manufacturing yield of the recombinant protein.
[0026] In this application, aMTD/SD-fused iCP-SOCS3 recombinant proteins (iCP-SOCS3), much improved physicochemical characteristics (solubility and yield) and functional activity (cell-/tissue-permeability) compared with the protein fused only to FGF-4-derived MTM. In addition, the newly developed iCP-SOCS3 proteins have now been demonstrated to have therapeutic application in treating solid tumor, exploiting the ability of SOCS3 to suppress JAK/STAT signaling. The present application represents that macromolecule intracellular transduction technology (MITT) enabled by the new hydrophobic CPPs that are aMTD may provide novel protein therapy through SOCS3-intracellular protein replacement against the solid tumor. These findings suggest that restoration of SOCS3 by replenishing the intracellular SOCS3 with iCP-SOCS3 protein creates a new paradigm for anti-cancer therapy, and the intracellular protein replacement therapy with the SOCS3 recombinant protein fused to the combination of aMTD and SD pair may be useful to treat the solid tumor.
[0027] One aspect disclosed in the present application provides an improved Cell-Permeable (iCP)-SOCS3 recombinant protein, which comprises a SOCS3 protein; and an advanced macromolecule transduction domain (aMTD) being composed of 9-13 amino acid sequences and having improved cell and/or tissue permeability, wherein the aMTD is fused to one end or both ends of the SOCS3 protein and has the following features of:
[0028] (a) being composed of 3 or more amino acid sequences selected from the group consisting of Ala, Val, Ile, Leu, and Pro;
[0029] (b) having proline as amino acid sequences corresponding to any one or more of positions 5 to 8, and 12 of its amino acid sequence; and
[0030] (c) having an instability index of 40-60; an aliphatic index of 180-220; and a grand average of hydropathy (GRAVY) of 2.1-2.6, as measured by Protparam.
[0031] According to one embodiment, one or more solubilization domain (SD)(s) are further fused to the end(s) of one or more of the SOCS3 protein and the aMTD.
[0032] According to another embodiment, the aMTD may form .alpha.-Helix structure. According to still another embodiment, the aMTD may be composed of 12 amino acid sequences and represented by the following general formula:
[0033] wherein X(s) independently refer to Alanine (A), Valine (V), Leucine (L) or Isoleucine (I); and Proline (P) can be positioned in one of U(s) (either 5', 6', 7' or 8'). The remaining U(s) are independently composed of A, V, L or I, P at the 12' is Proline.
[0034] Another aspect disclosed in the present application provides an iCP-SOCS3 recombinant protein which is represented by any one of the following structural formulae:
A-B-C, A-C-B, B-A-C, B-C-A, C-A-B, C-B-A and A-C-B-C
[0035] wherein A is an advanced macromolecule transduction domain (aMTD) having improved cell and/or tissue permeability, B is a SOCS3 protein, and C is a solubilization domain (SD); and
[0036] the aMTD is composed of 9-13 amino acid sequences and has the following features of:
[0037] (a) being composed of 3 or more amino acids selected from the group consisting of Ala, Val, Ile, Leu, and Pro;
[0038] (b) having proline as amino acid sequences corresponding to any one or more of positions 5 to 8, and 12 of its amino acid sequence;
[0039] (c) having an instability index of 40-60; an aliphatic index of 180-220; and a grand average of hydropathy (GRAVY) of 2.1-2.6, as measured by Protparam; and
[0040] (d) forming .alpha.-Helix structure.
[0041] According to one embodiment disclosed in the present application, the SOCS3 protein may have an amino acid sequence of SEQ ID NO: 814.
[0042] According to another embodiment disclosed in the present application, the SOCS3 protein may be encoded by a polynucleotide sequence of SEQ ID NO: 815.
[0043] According to still another embodiment disclosed in the present application, the SOCS3 protein may further include a ligand selectively binding to a receptor of a cell, a tissue, or an organ. According to still another embodiment disclosed in the present application, the aMTD may have an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-240 and 822.
[0044] According to still another embodiment disclosed in the present application, the aMTD may be encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 241-480 and 823.
[0045] According to still another embodiment disclosed in the present application, the SD(s) may have an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 798, 799, 800, 801, 802, 803, and 804.
[0046] According to still another embodiment disclosed in the present application, the SD(s) may be encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 805, 806, 807, 808, 809, 810, and 811.
[0047] According to still another embodiment disclosed in the present application, the iCP-SOCS3 recombinant protein may have a histidine-tag affinity domain additionally fused to one end thereof.
[0048] According to still another embodiment disclosed in the present application, the histidine-tag affinity domain may have an amino acid sequence of SEQ ID NO: 812.
[0049] According to still another embodiment disclosed in the present application, the histidine-tag affinity domain may be encoded by a polynucleotide sequence of SEQ ID NO: 813.
[0050] According to still another embodiment disclosed in the present application, the fusion may be formed via a peptide bond or a chemical bond.
[0051] According to still another embodiment disclosed in the present application, the iCP-SOCS3 recombinant protein may be used for the treating, preventing, or delaying the onset of, solid tumor.
[0052] Still another aspect disclosed in the present application provides a polynucleotide sequence encoding the iCP-SOCS3 recombinant protein.
[0053] According to one embodiment disclosed in the present application, the polynucleotide sequence may be a polynucleotide sequence represented by SEQ ID NO: 825.
[0054] Still another aspect disclosed in the present application provides a recombinant expression vector including the polynucleotide sequence.
[0055] Still another aspect disclosed in the present application provides a transformant transformed with the recombinant expression vector.
[0056] Still another aspect disclosed in the present application provides a preparing method of the iCP-SOCS3 recombinant protein including preparing the recombinant expression vector; preparing the transformant using the recombinant expression vector; culturing the transformant; and recovering the recombinant protein expressed by the culturing.
[0057] Still another aspect disclosed in the present application provides a composition including the iCP-SOCS3 recombinant protein as an active ingredient.
[0058] Still another aspect disclosed in the present application provides a pharmaceutical composition for the treating, preventing, or delaying the onset of, solid tumor including the iCP-SOCS3 recombinant protein as an active ingredient; and a pharmaceutically acceptable carrier.
[0059] Still another aspect disclosed in the present application provides use of the iCP-SOCS3 recombinant protein as a medicament for the treating, preventing, or delaying the onset of, solid tumor.
[0060] Still another aspect disclosed in the present application provides a medicament including the iCP-SOCS3 recombinant protein.
[0061] Still another aspect disclosed in the present application provides use of the iCP-SOCS3 recombinant protein in the preparation of a medicament for the treating, preventing, or delaying the onset of, solid tumor.
[0062] Still another aspect disclosed in the present application provides a method of treating, preventing, or delaying the onset of, solid tumor in a subject, the method including identifying a subject in need of the treating, preventing, or delaying the onset of, solid tumor; and administering to the subject a therapeutically effective amount of the iCP-SOCS3 recombinant protein.
[0063] According to one embodiment disclosed in the present application, the subject may be a mammal.
[0064] Unless defined otherwise, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Although a certain method and a material is described herein, it should not be construed as being limited thereto, any similar or equivalent method and material to those may also be used in the practice or testing of the present invention. All publications mentioned herein are incorporated herein by reference in their entirety to disclose and describe the methods and/or materials in connection with which the publications are cited. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0065] A "peptide," as used herein, refers to a chain-type polymer formed by amino acid residues which are linked to each other via peptide bonds, and used interchangeably with "polypeptide." Further, a "polypeptide" includes a peptide and a protein.
[0066] Further, the term "peptide" includes amino acid sequences that are conservative variations of those peptides specifically exemplified herein. The term "conservative variation," as used herein, denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative variations include substitution of one hydrophobic residue, such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine, or methionine for another, or substitution of one polar residue for another, for example, substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids which may be substituted for one another include asparagine, glutamine, serine, and threonine.
[0067] The term "conservative variation" also includes use of a substituted amino acid in place of an unsubstituted parent amino acid, provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide. Such conservative substitutions are within the definition of the classes of the peptides disclosed in the present application.
[0068] A person having ordinary skill in the art may make similar substitutions to obtain peptides having higher cell permeability and a broader host range. For example, one aspect disclosed in the present application provides peptides corresponding to amino acid sequences (e.g. SEQ ID NOs: 1 to 240 and 822) provided herein, as well as analogues, homologs, isomers, derivatives, amidated variations, and conservative variations thereof, as long as the cell permeability of the peptide remains.
[0069] Minor modifications to primary amino acid sequence disclosed in the present application may result in peptides which have substantially equivalent or enhanced cell permeability, as compared to the specific peptides described herein. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous.
[0070] All peptides may be synthesized using L-amino acids, but D forms of all of the peptides may be synthetically produced. In addition, C-terminal derivatives, such as C-terminal methyl esters and C-terminal amidates, may be produced in order to increase the cell permeability of the peptide according to one embodiment disclosed in the present application.
[0071] All of the peptides produced by these modifications are included herein, as long as in the case of amidated versions of the peptide, the cell permeability of the original peptide is altered or enhanced such that the amidated peptide is therapeutically useful. It is envisioned that such modifications are useful for altering or enhancing cell permeability of a particular peptide.
[0072] Furthermore, deletion of one or more amino acids may also result in a modification to the structure of the resultant molecule without any significant change in its cell permeability. This may lead to the development of a smaller active molecule which may also have utility. For example, amino- or carboxyl-terminal amino acids which may not be required for the cell permeability of a particular peptide may be removed.
[0073] The term "gene" refers to an arbitrary nucleic acid sequence or a part thereof having a functional role in protein coding or transcription, or regulation of other gene expression. The gene may be composed of all nucleic acids encoding a functional protein or a part of the nucleic acid encoding or expressing the protein. The nucleic acid sequence may include a gene mutation in exon, intron, initiation or termination region, promoter sequence, other regulatory sequence, or a unique sequence adjacent to the gene.
[0074] The term "primer" refers to an oligonucleotide sequence that hybridizes to a complementary RNA or DNA target polynucleotide and serves as the starting points for the stepwise synthesis of a polynucleotide from mononucleotides by the action of a nucleotidyltransferase as occurs, for example, in a polymerase chain reaction.
[0075] The term "coding region" or "coding sequence" refers to a nucleic acid sequence, a complement thereof, or a part thereof which encodes a particular gene product or a fragment thereof for which expression is desired, according to the normal base pairing and codon usage relationships. Coding sequences include exons in genomic DNA or immature primary RNA transcripts, which are joined together by the cellular biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of the nucleic acid, and the coding sequence may be deduced therefrom.
[0076] One aspect disclosed in the present application provides an iCP-SOCS3 recombinant protein, which comprises a SOCS3 protein and an advanced macromolecule transduction domain (aMTD) being composed of 9-13 amino acid sequences, preferably 10-12 amino acid sequences, and having improved cell and/or tissue permeability, wherein the aMTD is fused to one end or both ends of the SOCS3 protein and has the following features of:
[0077] (a) being preferably composed of 3 or more amino acid sequences selected from the group consisting of Ala, Val, Ile, Leu, and Pro;
[0078] (b) having proline as amino acid sequences corresponding to any one or more of positions 5 to 8, and 12 of its amino acid sequence, and preferably one or more of positions 5 to 8 and position 12 of its amino acid sequence; and
[0079] (c) having an instability index of preferably 40-60 and more preferably 41-58; an aliphatic index of preferably 180-220 and more preferably 185-225; and a grand average of hydropathy (GRAVY) of preferably 2.1-2.6 and more preferably 2.2-2.6 as measured by Protparam (see http://web.expasy.org/protparam/).
[0080] These critical factors that facilitate the cell permeable ability of aMTD sequences were analyzed, identified, and determined according to one embodiment disclosed in the present application. These aMTD sequences are artificially assembled based on the critical factors (CFs) determined from in-depth analysis of previously published hydrophobic CPPs.
[0081] The aMTD sequences according to one aspect disclosed in the present application are the first artificially developed cell permeable polypeptides capable of mediating the transduction of biologically active macromolecules--including peptides, polypeptides, protein domains, or full-length proteins--through the plasma membrane of cells.
[0082] According to one embodiment, one or more solubilization domain (SD)(s) are further fused to one or more of the SOCS3 protein and the aMTD, preferably one end or both ends of the SOCS3 protein, and more preferably the C-terminus of the SOCS3 protein.
[0083] According to another embodiment, the aMTD may form a-Helix structure.
[0084] According to still another embodiment, the aMTD may be preferably composed of 12 amino acid sequences and represented by the following general formula:
[0085] Here, X(s) independently refer to Alanine (A), Valine (V), Leucine (L) or Isoleucine (I); and Proline (P) can be positioned in one of U(s) (either 5', 6', 7' or 8'). The remaining U(s) are independently composed of A, V, L or I, P at the 12' is Proline.
[0086] Still another aspect disclosed in the present application provides an iCP-SOCS3 recombinant protein which is represented by any one of structural formulae A-B-C, A-C-B, B-A-C, B-C-A, C-A-B, C-B-A and A-C-B-C, and preferably by A-B-C or C-B-A:
[0087] wherein A is an advanced macromolecule transduction domain (aMTD) having improved cell and/or tissue permeability, B is a SOCS3 protein, and C is a solubilization domain (SD); and
[0088] the aMTD is composed of 9-13, preferably 10-12 amino acid sequences and has the following features of:
[0089] (a) being composed of 3 or more amino acid sequences selected from the group consisting of Ala, Val, Ile, Leu, and Pro;
[0090] (b) having proline as amino acid sequences corresponding to any one or more of positions 5 to 8, and 12 of its amino acid sequence, and preferably, one or more of positions 5 to 8 and position 12 of its amino acid sequence;
[0091] (c) having an instability index of 40-60, preferably 41-58 and more preferably 50-58; an aliphatic index of 180-220. preferably 185-225 and more preferably 195-205; and a grand average of hydropathy (GRAVY) of 2.1-2.6 and preferably 2.2-2.6, as measured by Protparam (see http://web.expasy.org/protparam/); and
[0092] (d) preferably forming .alpha.-Helix structure.
[0093] In one embodiment disclosed in the present application, the SOCS3 protein may have an amino acid sequence of SEQ ID NO: 814.
[0094] In another embodiment disclosed in the present application, the SOCS3 protein may be encoded by a polynucleotide sequence of SEQ ID NO: 815.
[0095] When the iCP-SOCS3 recombinant protein is intended to be delivered to a particular cell, tissue, or organ, the SOCS3 protein may form a fusion product, together with an extracellular domain of a ligand capable of selectively binding to a receptor which is specifically expressed on the particular cell, tissue, or organ, or monoclonal antibody (mAb) capable of specifically binding to the receptor or the ligand and a modified form thereof.
[0096] The binding of the peptide and a biologically active substance may be formed either by indirect linkage by a cloning technique using an expression vector at a nucleotide level or by direct linkage via chemical or physical covalent or non-covalent bond of the peptide and the biologically active substance.
[0097] In still another embodiment disclosed in the present application, the SOCS3 protein may preferably further include a ligand selectively binding to a receptor of a cell, a tissue, or an organ.
[0098] In one embodiment disclosed in the present application, the aMTD may have an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-240 and 822, preferably SEQ ID NOs: 2, 16, 22, 32, 40, 43, 63, 65, 77, 84, 85, 86, 110, 131, 142, 143, 177, 228, 229, 233, 237, 239 and 822, more preferably SEQ ID NO: 43.
[0099] In still another embodiment disclosed in the present application, the aMTD may be encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 241-480 and 823, preferably SEQ ID NOs: 242, 256, 262, 272, 280, 283, 303, 305, 317, 324, 325, 326, 350, 371, 382, 383, 417, 468, 469 473, 477, 479 and 823, more preferably SEQ ID NO: 283. In still another embodiment disclosed in the present application, the SD(s) may have an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 798, 799, 800, 801, 802, 803, and 804. The SD may be preferably SDA of SEQ ID NO: 798, SDB of SEQ ID NO: 799, or SDB' of SEQ ID NO: 804, and more preferably, SDB of SEQ ID NO: 799 which has superior structural stability, or SDB' of SEQ ID NO: 804 which has a modified amino acid sequence of SDB to avoid immune responses upon in vivo application. The modification of the amino acid sequence in SDB may be replacement of an amino acid residue, Valine, corresponding to position 28 of the amino acid sequence of SDB (SEQ ID NO: 799) by Leucine.
[0100] In still another embodiment disclosed in the present application, the SDs may be encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 805, 806, 807, 808, 809, 810, and 811. The SD may be preferably SDA encoded by a polynucleotide sequence of SEQ ID NO: 805, SDB encoded by a polynucleotide sequence of SEQ ID NO: 806, or SDB' for deimmunization (or humanization) encoded by a polynucleotide sequence of SEQ ID NO: 811, and more preferably, SDB having superior structural stability, which is encoded by a polynucleotide sequence of SEQ ID NO: 806, or SDB' having a modified polynucleotide sequence of SDB to avoid immune responses upon in vivo application, which is encoded by a polynucleotide sequence of SEQ ID NO: 811.
[0101] In still another embodiment disclosed in the present application, the iCP-SOCS3 recombinant protein may be preferably selected from the group consisting of:
[0102] 1) a recombinant protein, in which SOCS3 having an amino acid sequence of SEQ ID NO: 814 is fused to the N-terminus or the C-terminus of aMTD having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 240 and 822, 2, 16, 22, 32, 40, 43, 63, 65, 77, 84, 85, 86, 110, 131, 142, 143, 177, 228, 229, 233, 237, 239 and 822, more preferably SEQ ID NO: 43;
[0103] 2) a recombinant protein, in which SD having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 798 to 804 is further fused to one or more of the N-terminus or the C-terminus of the SOCS3 and aMTD in the recombinant protein of 1); and
[0104] 3) a recombinant protein, in which a Histidine tag having an amino acid sequence of 812 is further fused to the N-terminus of the recombinant protein of 1) or 2).
[0105] According to one embodiment, the iCP-SOCS3 recombinant protein may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO: 825.
[0106] The SOCS3 protein may exhibit a physiological phenomenon-related activity or a therapeutic purpose-related activity by intracellular or in-vivo delivery. The recombinant expression vector may include a tag sequence which makes it easy to purify the recombinant protein, for example, consecutive histidine codon, maltose binding protein codon, Myc codon, etc., and further include a fusion partner to enhance solubility of the recombinant protein, etc. Further, for the overall structural and functional stability of the recombinant protein or flexibility of the proteins encoded by respective genes, the recombinant expression vector may further include one or more glycine, proline, and spacer amino acid or polynucleotide sequences including AAY amino acids. Furthermore, the recombinant expression vector may include a sequence specifically digested by an enzyme in order to remove an unnecessary region of the recombinant protein, an expression regulatory sequence, and a marker or reporter gene sequence to verify intracellular delivery, but is not limited thereto.
[0107] In still another embodiment disclosed in the present application, the iCP-SOCS3 recombinant protein may preferably have a histidine-tag affinity domain additionally fused to one end thereof.
[0108] In still another embodiment disclosed in the present application, the histidine-tag affinity domain may have an amino acid sequence of SEQ ID NO: 812.
[0109] In still another embodiment disclosed in the present application, the histidine-tag affinity domain may be encoded by a polynucleotide sequence of SEQ ID NO: 813.
[0110] In still another embodiment disclosed in the present application, the fusion may be formed via a peptide bond or a chemical bond.
[0111] The chemical bond may be preferably selected from the group consisting of disulfide bonds, diamine bonds, sulfide-amine bonds, carboxyl-amine bonds, ester bonds, and covalent bonds.
[0112] In still another embodiment disclosed in the present application, the iCP-SOCS3 recombinant protein may be used for the treating, preventing, or delaying the onset of, solid tumor.
[0113] Still another aspect disclosed in the present application provides a polynucleotide sequence encoding the iCP-SOCS3.
[0114] According to still another embodiment disclosed in the present application, the polynucleotide sequence may be fused with a histidine-tag affinity domain.
[0115] Still another aspect disclosed in the present application provides a recombinant expression vector including the polynucleotide sequence.
[0116] Preferably, the vector may be inserted in a host cell and recombined with the host cell genome, or refers to any nucleic acid including a nucleotide sequence competent to replicate spontaneously as an episome. Such a vector may include a linear nucleic acid, a plasmid, a phagemid, a cosmid, an RNA vector, a viral vector, etc.
[0117] Preferably, the vector may be genetically engineered to incorporate the nucleic acid sequence encoding the recombinant protein in an orientation either N-terminal and/or C-terminal to a nucleic acid sequence encoding a peptide, a polypeptide, a protein domain, or a full-length protein of interest, and in the correct reading frame so that the recombinant protein consisting of aMTD, SOCS3 protein, and preferably SD may be expressed. Expression vectors may be selected from those readily available for use in prokaryotic or eukaryotic expression systems.
[0118] Standard recombinant nucleic acid methods may be used to express a genetically engineered recombinant protein. The nucleic acid sequence encoding the recombinant protein according to one embodiment disclosed in the present application may be cloned into a nucleic acid expression vector, e.g., with appropriate signal and processing sequences and regulatory sequences for transcription and translation, and the protein may be synthesized using automated organic synthetic methods. Synthetic methods of producing proteins are described in, for example, the literature [Methods in Enzymology, Volume 289: Solid-Phase Peptide Synthesis by Gregg B. Fields (Editor), Sidney P. Colowick, Melvin I. Simon (Editor), Academic Press (1997)].
[0119] In order to obtain high level expression of a cloned gene or nucleic acid, for example, a cDNA encoding the recombinant protein according to one embodiment disclosed in the present application, the recombinant protein sequence may be typically subcloned into an expression vector that includes a strong promoter for directing transcription, a transcription/translation terminator, and in the case of a nucleic acid encoding a protein, a ribosome binding site for translational initiation. Suitable bacterial promoters are well known in the art and are described, e.g., in the literatures [Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3d Edition, Cold Spring Harbor Laboratory, N.Y. (2001); and Ausubel, et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N. Y. (1989)]. Bacterial expression systems for expression of the recombinant protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Palva et al., Gene 22: 229-235 (1983); Mosbach et al., Nature 302: 543-545 (1983)). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. The eukaryotic expression vector may be preferably an adenoviral vector, an adeno-associated vector, or a retroviral vector.
[0120] Generally, the expression vector for expressing the cell permeable recombinant protein according to one embodiment disclosed in the present application in which the cargo protein, i.e. .DELTA.SOCS3 protein, is attached to the N-terminus, C-terminus, or both termini of aMTD may include regulatory sequences including, for example, a promoter, operably attached to a sequence encoding the advanced macromolecule transduction domain. Non-limiting examples of inducible promoters that may be used include steroid-hormone responsive promoters (e.g., ecdysone-responsive, estrogen-responsive, and glutacorticoid-responsive promoters), tetracycline "Tet-On" and "Tet-Off" systems, and metal-responsive promoters.
[0121] The polynucleotide sequence according to one embodiment disclosed in the present application may be present in a vector in which the polynucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the polynucleotide sequence by a suitable host cell.
[0122] According to one embodiment disclosed in the present application, the polynucleotide sequence may be selected from the following groups:
[0123] 1) a polynucleotide sequence, in which any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 241-480 and 823, preferably SEQ ID NOs: 242, 252, 274, 279, 322, 331, 338, 345, 347, 361, 365, 370, 371, 383, 387, 417, 462, 468, 469, 473, 477, 479 and 823, more preferably SEQ ID NO: 283, is operably linked with a polynucleotide sequence of SEQ ID NO: 815; and
[0124] 2) a polynucleotide sequence, in which any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 805 to 811 is further operably linked to the polynucleotide sequence of 1), or further operably linked to between: any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 241-480 and 823, preferably SEQ ID NOs: 242, 256, 262, 272, 280, 283, 303, 305, 317, 324, 325, 326, 350, 371, 382, 383, 417, 468, 469, 473, 477, 479 and 823, more preferably SEQ ID NO: 283; and a polynucleotide sequence of SEQ ID NO: 815.
[0125] Within an expression vector, the term "operably linked" is intended to mean that the polynucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the polynucleotide sequence. The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements. Such operable linkage with the expression vector can be achieved by conventional gene recombination techniques known in the art, while site-directed DNA cleavage and linkage are carried out by using conventional enzymes known in the art.
[0126] The expression vectors may contain a signal sequence or a leader sequence for membrane targeting or secretion, as well as regulatory sequences such as a promoter, an operator, an initiation codon, a termination codon, a polyadenylation signal, an enhancer and the like. The promoter may be a constitutive or an inducible promoter. Further, the expression vector may include one or more selectable marker genes for selecting the host cell containing the expression vector, and may further include a polynucleotide sequence that enables the vector to replicate in the host cell in question.
[0127] The expression vector constructed according to one embodiment disclosed in the present application may be the vector where the polynucleotide encoding the iCP-SOCS3 recombinant protein (where an aMTD is fused to the N-terminus or C-terminus of a SOCS3 protein) is inserted within the multiple cloning sites (MCS), preferably within the Nde1/Sal1 site or BamH1/Sal1 site of a pET-28a(+)(Novagen, Darmstadt, Germany) or pET-26b(+) vector(Novagen, Darmstadt, Germany).
[0128] In still another embodiment disclosed in the present application, the polynucleotide encoding the SD being additionally fused to the N-terminus or C-terminus of a SOCS3 protein or an aMTD may be inserted into a cleavage site of restriction enzyme (Ndel, BamH1 and Sal1, etc.) within the multiple cloning sites (MCS) of a pET-28a(+)(Novagen, Darmstadt, Germany) or pET-26b(+) vector(Novagen, Darmstadt, Germany).
[0129] In still another embodiment disclosed in the present application, the polynucleotide encoding the iCP-SOCS3 recombinant protein may be cloned into a pET-28a(+) vector bearing a His-tag sequence so as to fuse six histidine residues to the N-terminus of the iCP-SOCS3 recombinant protein to allow easy purification.
[0130] According to one embodiment disclosed in the present application, the polynucleotide sequence may be a polynucleotide sequence selected from the group consisting of SEQ ID NOS: 824, 826, 828 and 830.
[0131] The recombinant protein may be introduced into an appropriate host cell, e.g., a bacterial cell, a yeast cell, an insect cell, or a tissue culture cell. The recombinant protein may also be introduced into embryonic stem cells in order to generate a transgenic organism. Large numbers of suitable vectors and promoters are known to those skilled in the art and are commercially available for generating the recombinant protein.
[0132] Known methods may be used to construct vectors including the polynucleotide sequence according to one embodiment disclosed in the present application and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo recombination/genetic recombination. For example, these techniques are described in the literatures [Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3d Edition, Cold Spring Harbor Laboratory, N. Y. (2001); and Ausubel et al., Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience, N.Y. (1989)].
[0133] Still another aspect disclosed in the present application provides a transformant transformed with the recombinant expression vector.
[0134] The transformation includes transfection, and refers to a process whereby a foreign (extracellular) DNA, with or without an accompanying material, enters into a host cell. The "transfected cell" refers to a cell into which the foreign DNA is introduced into the cell, and thus the cell harbors the foreign DNA. The DNA may be introduced into the cell so that a nucleic acid thereof may be integrated into the chromosome or replicable as an extrachromosomal element. The cell introduced with the foreign DNA, etc. is called a transformant.
[0135] As used herein, `introducing` of a protein, a peptide, an organic compound into a cell may be used interchangeably with the expression of `carrying,` `penetrating,``transporting,``delivering,` `permeating` or `passing.`
[0136] It is understood that the host cell refers to a eukaryotic or prokaryotic cell into which one or more DNAs or vectors are introduced, and refers not only to the particular subject cell but also to the progeny or potential progeny thereof. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0137] The host cells may be preferably bacterial cells, and as the bacterial cells, there are, in principle, no limitations. They may be eubacteria (gram-positive or gram-negative) or archaebacteria, as long as they allow genetic manipulation for insertion of a gene of interest, preferably for site-specific integration, and they may be cultured on a manufacturing scale. Preferably, the host cells may have the property to allow cultivation to high cell densities.
[0138] Examples of bacterial host cells that may be used in the preparation of the recombinant protein are E. coli (Lee, 1996; Hannig and Makrides, 1998), Bacillus subtilis, Pseudomonas fluorescens (Squires et al., 2004; Retallack et al., 2006) as well as various Corynebacterium (US 2006/0003404 A1) and Lactococcus lactis (Mierau et al., 2005) strains. Preferably, the host cells are Escherichia coli cells.
[0139] More preferably, the host cell may include an RNA polymerase capable of binding to a promoter regulating the gene of interest. The RNA polymerase may be endogenous or exogenous to the host cell.
[0140] Preferably, host cells with a foreign strong RNA polymerase may be used. For example, Escherichia coli strains engineered to carry a foreign RNA polymerase (e.g. like in the case of using a T7 promoter a T7-like RNA polymerase in the so-called "T7 strains") integrated in their genome may be used. Examples of T7 strains, e.g. BL21(DE3), HMS174(DE3), and their derivatives or relatives (see Novagen, pET System manual, 11.sup.th edition), may be widely used and commercially available. Preferably, BL21-CodonPlus (DE3)-RIL or BL21-CodonPlus (DE3)-RIPL (Agilent Technologies) may be used. These strains are DE3 lysogens containing the T7 RNA polymerase gene under control of the lacUV5 promoter. Induction with IPTG allows production of T7 RNA polymerase which then directs the expression of the gene of interest under the control of the T7 promoter.
[0141] The host cell strains, E. coli BL21(DE3) or HMS174(DE3), which have received their genome-based T7 RNA polymerase via the phage DE3, are lysogenic. It is preferred that the T7 RNA polymerase contained in the host cell has been integrated by a method which avoids, or preferably excludes, the insertion of residual phage sequences in the host cell genome since lysogenic strains have the disadvantage to potentially exhibit lytic properties, leading to undesirable phage release and cell lysis.
[0142] Still another aspect disclosed in the present application provides a preparing method of the iCP-SOCS3 recombinant protein including preparing the recombinant expression vector; preparing the transformant using the recombinant expression vector; culturing the transformant; and recovering the recombinant protein expressed by culturing.
[0143] Culturing may be preferably in a mode that employs the addition of a feed medium, this mode being selected from the fed-batch mode, semi-continuous mode, or continuous mode, and the bacterial expression host cells may include a DNA construct, integrated in their genome, carrying the DNA sequence encoding the protein of interest under the control of a promoter that enables expression of said protein.
[0144] There are no limitations in the type of the culture medium. The culture medium may be semi-defined, i.e. containing complex media compounds (e.g. yeast extract, soy peptone, casamino acids), or it may be chemically defined, without any complex compounds. Preferably, a defined medium may be used. The defined media (also called minimal or synthetic media) are exclusively composed of chemically defined substances, i.e. carbon sources such as glucose or glycerol, salts, vitamins, and, in view of a possible strain auxotrophy, specific amino acids or other substances such as thiamine. Most preferably, glucose may be used as a carbon source. Usually, the carbon source of the feed medium serves as the growth-limiting component which controls the specific growth rate.
[0145] Host cells may be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or the use of cell lysing agents. The literature [Scopes, Protein Purification: Principles and Practice, New York: Springer-Verlag (1994)] describes a number of general methods for purifying recombinant (and non-recombinant) proteins. The methods may include, e.g., ion-exchange chromatography, size-exclusion chromatography, affinity chromatography, selective precipitation, dialysis, and hydrophobic interaction chromatography. These methods may be adapted to devise a purification strategy for the cell permeable recombinant protein. If the cell permeable recombinant protein includes a purification handle, such as an epitope tag or a metal chelating sequence, affinity chromatography may be used to easily purify the protein.
[0146] The amount of the protein produced may be evaluated by detecting the advanced macromolecule transduction domain directly (e.g., using Western analysis) or indirectly (e.g., by assaying materials derived from the cells for specific DNA binding activity, such as by electrophoretic mobility shift assay). Proteins may be detected prior to purification, during any stage of purification, or after purification. In some implementations, purification or complete purification may not be necessary.
[0147] The iCP-SOCS3 recombinant proteins according to one embodiment disclosed in the present application are cell permeable proteins, and may be used as protein-based vaccines, particularly in the case where killed or attenuated whole organism vaccines are impractical.
[0148] The iCP-SOCS3 recombinant proteins according to one embodiment disclosed in the present application may be preferably used for the treating, preventing, or delaying the onset of, solid tumor. The cell permeable recombinant proteins may be delivered to the interior of the cell, eliminating the need to transfect or transform the cell with a recombinant vector. The cell permeable recombinant proteins may be used in vitro to investigate protein function or may be used to maintain cells in a desired state.
[0149] Still another aspect disclosed in the present application provides a composition including the iCP-SOCS3 Recombinant Protein as an active ingredient.
[0150] Still another aspect disclosed in the present application provides a pharmaceutical composition for treating, preventing, or delaying the onset of, solid tumor including the iCP-SOCS3 Recombinant Protein as an active ingredient; and a pharmaceutically acceptable carrier.
[0151] According to one embodiment disclosed in the present application, the iCP-SOCS3 Recombinant Protein may be used in a single agent, or in combination with one or more other anti-cancer agents.
[0152] Solid tumor described herein include, but are not limited to, described herein include, but are not limited to, prostate cancer, renal cancer, hepatic cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, renal cancer, colorectal cancer, pancreatic cancer, gastric cancer, breast cancer, lung cancer, cancers of the head and neck, thyroid cancer, glioblastoma, Kaposi's sarcoma, melanoma, oesophageal cancer, gastro-oesophageal cancer, cervical cancer, hepatocellular carcinoma, endometrial cancer, urothelial cancer, or ovarian cancer.
[0153] According to one embodiment disclosed in the present invention, the tumor may be early stage tumor, metastatic tumor, non-metastatic tumor, primary tumor, resected tumor, advanced tumor, locally advanced tumor, unresectable tumor, tumor in remission, or recurrent tumor.
[0154] Preferably, the composition may be for injectable (e.g. intraperitoneal, intravenous, and intra-arterial, etc.) and may include the active ingredient in an amount of 0.001 mg/kg to 1000 mg/kg, preferably 0.01 mg/kg to 100 mg/kg, more preferably 0.1 mg/kg to 50 mg/kg for human.
[0155] For examples, dosages per day normally fall within the range of about 0.001 to about 1000 mg/kg of body weight. In the treatment of adult humans, the range of about 0.1 to about 50 mg/kg/day, in single or divided dose, is especially preferred. However, it will be understood that the concentration of the iCP-SOCS3 recombinant protein actually administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the age, weight, and response of the individual patient, and the severity of the patient's symptoms, and therefore the above dosage ranges are not intended to limit the scope of the invention in any way. In some instances dosage levels below the lower limit of the aforesaid range may be more than adequate, while in other cases still larger doses may be employed without causing any harmful side effect, provided that such larger doses are first divided into several smaller doses for administration throughout the day.
[0156] Still another aspect disclosed in the present application provides use of the iCP-SOCS3 recombinant protein as a medicament for treating, preventing, or delaying the onset of, solid tumor.
[0157] Still another aspect disclosed in the present application provides a medicament including the iCP-SOCS3 recombinant protein.
[0158] Still another aspect disclosed in the present application provides use of the iCP-SOCS3 recombinant protein for the preparation of a medicament for treating, preventing, or delaying the onset of, solid tumor.
[0159] Still another aspect disclosed in the present application provides a method of treating, preventing, or delaying the onset of, solid tumor in a subject including identifying a subject in need of treating, preventing, or delaying the onset of, solid tumor; and administering to the subject a therapeutically effective amount of the iCP-SOCS3 recombinant protein.
[0160] In one embodiment disclosed in the present application, the subject may be preferably a mammal.
[0161] Preferably, the subject in need of treating, preventing, or delaying the onset of, solid tumor may be identified by any conventional diagnostic methods known in the art including ultrasound, CT scan, MRI, alpha-fetoprotein testing, and biopsy, etc.
[0162] The pharmaceutical composition according to one embodiment disloced in the present application may be prepared by using pharmaceutically suitable and physiologically acceptable additives, in addition to the active ingredient, and the additives may include excipients, disintegrants, sweeteners, binders, coating agents, blowing agents, lubricants, glidants, flavoring agents, etc.
[0163] For administration, the pharmaceutical composition may be preferably formulated by further including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredient.
[0164] Dosage forms of the pharmaceutical composition may include granules, powders, tablets, coated tablets, capsules, suppositories, liquid formulations, syrups, juice, suspensions, emulsions, drops, injectable liquid formulations, etc. For formulation of the composition into a tablet or capsule, for example, the active ingredient may be combined with any oral, non-toxic pharmaceutically acceptable inert carrier, such as ethanol, glycerol, water, etc. If desired or necessary, suitable binders, lubricants, disintegrants, and colorants may be additionally included as a mixture.
[0165] Examples of the suitable binder may include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth, or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, etc. Examples of the disintegrant may include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, etc. For formulation of the composition into a liquid preparation, a pharmaceutically acceptable carrier which is sterile and biocompatible may be used, such as saline, sterile water, a Ringer's solution, buffered saline, an albumin infusion solution, a dextrose solution, a maltodextrin solution, glycerol, and ethanol, and these materials may be used alone or in any combination thereof. If necessary, other common additives, such as antioxidants, buffers, bacteriostatic agents, etc., may be added. Further, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, and emulsions, or pills, capsules, granules, or tablets. Furthermore, the composition may be preferably formulated, depending upon diseases and ingredients, using any appropriate method known in the art, as disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton Pa.
[0166] Preferably, the treatment or treating mean improving or stabilizing the subject's condition or disease; or preventing or relieving the development or worsening of symptoms associated with the subject's condition or disease. The prevention, prophylaxis and preventive treatment are used herein as synonyms.
[0167] Preferably, the treating, preventing, or delaying the onset of, solid tumor may be any one or more of the following: alleviating one or more symptoms of tumor, delaying progressing of tumor, shrinking tumor size in patient, inhibiting tumor growth, prolonging overall survival, prolonging disease-free survival, prolonging time to disease progression, preventing or delaying tumor metastasis, reducing or eradiating preexisting tumor metastasis, reducing incidence or burden of preexisting tumor metastasis, preventing recurrence of tumor.
[0168] The subject and patient are used herein interchangeably. They refer to a human or another mammal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate) that can be afflicted with or is susceptible to a disease or disorder but may or may not have the disease or disorder. In certain embodiments, the subject is a human being.
[0169] Preferably, the amount effective or effective amount is the amount of an active ingredient or a pharmaceutical composition disclosed herein that when administered to a subject for treating a disease, is sufficient to effect such treatment of the disease. Any improvement in the patient is considered sufficient to achieve treatment. An effective amount of an active ingredient or a pharmaceutical composition disclosed herein, used for the preventing, or delaying the onset of, solid tumor may vary depending upon the manner of administration, the age, body weight, and general health of the patient. Ultimately, the prescribers or researchers will decide the appropriate amount and dosage regimen.
[0170] In the treatment or prevention method according to one embodiment disclosed in the present application, the composition including the iCP-SOCS3 recombinant protein as an active ingredient may be administered in a common manner via oral, buccal, rectal, intravenous, intra-arterial, intraperitoneal, intramuscular, intrasternal, percutaneous, topical, intraocular or subcutaneous route, more preferably via intraperitoneal, intravenous, or intra-arterial injection route.
Advantageous Effects
[0171] According to one aspect disclosed in the present application, development and establishment of improved cell-permeable SOCS3 recombinant protein, as therapeutics of solid tumor are provided. Because iCP-SOCS3 was designed based on endogenous proteins, it would be a safety anti-solid tumor drug without side-effect.
[0172] However, the effects of the disclosures in the present application are not limited to the above-mentioned effects, and another effects not mentioned will be clearly understood by those skilled in the art from the following description.
DESCRIPTION OF DRAWINGS
[0173] FIG. 1 shows Structure of aMTD- or rPeptide-Fused Recombinant Proteins. A schematic diagram of the His-tagged CRA recombinant proteins is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), aMTD or rPeptide (gray) and cargo A (CRA, black) are shown.
[0174] FIG. 2a shows Construction of Expression Vectors for aMTDs- or rPeptide-Fused Recombinant Proteins. FIGS. 2b and 2c show the agarose gel electrophoresis analysis showing plasmid DNA fragments at 645 bp insert encoding aMTDs or rPeptide-fused CRA cloned into the pET28a(+) vector according to the present invention.
[0175] FIGS. 3a to 3d show Inducible Expression of aMTD- or rPeptide-Fused Recombinant Proteins. Expressed recombinant aMTD- or random peptide-fused CRA recombinant proteins were transformed in E. coli BL21 (DE3) strain. Expression of recombinant proteins in E. coli before (-) and after (+) induction with IPTG was monitored by SDS-PAGE, and stained with Coomassie blue.
[0176] FIGS. 4a and 4b show Purification of aMTD- or rPeptide-Fused Recombinant Proteins. Expressed recombinant proteins were purified by Ni.sup.2+ affinity chromatography under the natural condition. Purification of recombinant proteins displayed through SDS-PAGE analysis.
[0177] FIGS. 5a to 5u show Determination of aMTD-Mediated Cell-Permeability. Cell-permeability of a negative control (A: rP38) and reference hydrophobic CPPs (MTM12 and MTD85) are shown. The cell-permeability of each aMTD and/or rPeptide is visually compared to that of the cargo protein lacking peptide sequence (HCA). Gray shaded area represents untreated RAW 264.7 cells (vehicle); thin light gray line represents the cells treated with equal molar concentration of FITC (FITC only); dark thick line indicates the cells treated with FITC-his-tagged CRA protein (HCA); and the cells treated with the FITC-proteins (HMCA) fused to negative control (rP38), reference CPP (MTM12 or MTD85) or new hydrophobic CPP (aMTD) are shown with light thick line and indicated by arrows.
[0178] FIGS. 6a to 6c show Determination of rPeptide-Mediated Cell-Permeability. The cell-permeability of each aMTD and/or rPeptide was visually compared to that of the cargo protein lacking peptide sequence (HCA). Gray shaded area represents untreated RAW 264.7 cells (vehicle); thin light gray line represents the cells treated with equal molar concentration of FITC (FITC only); dark thick line indicates the cells treated with FITC-his-tagged CRA protein (HCA); and the cells treated with the FITC-proteins fused to rPeptides are shown with light thick line and indicated by arrows.
[0179] FIGS. 7a to 7k shows Visualized Cell-Permeability of aMTD-Fused Recombinant Proteins. NIH3T3 clls were treated with FITC-labeled protein (10 .mu.M) fused to aMTD for 1 hour at 37. Cell-permeability of the proteins was visualized by laser scanning confocal microscopy (LSM700 version).
[0180] FIG. 8 shows Visualized Cell-Permeability of rPeptide-Fused Recombinant Proteins. Cell-permeability of rPeptide-fused recombinant proteins was visualized by laser scanning confocal microscopy (LSM700 version).
[0181] FIGS. 9a to 9c show Relative Cell-Permeability of aMTD-Fused Recombinant Proteins Compared to Negative Control (rP38). The FIG. shows graphs comparing the cell-permeability of the recombinant proteins fused to aMTDs and a negative control (A: rP38).
[0182] FIGS. 10a to 10c show Relative Cell-Permeability of aMTD-Fused Recombinant Proteins Compared to Reference CPP (MTM12). The FIG. shows graphs comparing the cell-permeability of the recombinant proteins fused to aMTDs and a reference CPP (MTM12).
[0183] FIGS. 11a to 11c show Relative Cell-Permeability of aMTD-Fused Recombinant Proteins Compared to Reference CPP (MTD85). The FIG. shows graphs comparing the cell-permeability of the recombinant proteins fused to aMTDs and a reference CPP (MTD85).
[0184] FIG. 12 shows Relative Cell-Permeability of rPeptide-Mediated Recombinant Proteins Compared to Average that of aMTDs. The FIG. shows graphs comparing the cell-permeability of the recombinant proteins fused to rPeptides and that (average value: aMTD AVE) of aMTDs.
[0185] FIGS. 13a and 13b show Association of Cell-Permeability with Amino Acid Composition in aMTD Sequences. These graphs display delivery potential (Geometric Mean) of aMTDs influenced with amino acid composition (A, I, V and L).
[0186] FIGS. 14a and 14b show Association of Cell-Permeability with Critical Factors in aMTDs. These graphs show the association of cell-permeability with critical factors [bending potential: proline position (PP), rigidity/flexibility: instability index (II), structural feature: aliphatic index (AI) and hydropathy: grand average of hydropathy (GRAVY)].
[0187] FIGS. 15a and 15b show Relative Relevance of aMTD-Mediated Cell-Permeability with Critical Factors. Cell-permeability of 10 high and 10 low ranked aMTDs in their delivery potential were examined for their association with the critical factors [bending potential: proline position (PP), rigidity/flexibility: instability index (II), structural feature: aliphatic index (AI) and hydropathy: grand average of hydropathy (GRAVY)].
[0188] FIG. 16 shows Relative Relevance of rPeptide-Mediated Cell-Permeability with Hydropathy Range (GRAVY). This graph and a chart illustrate relative relevance of rPeptide-mediated cell-permeability with its hydropathy range (GRAVY).
[0189] FIG. 17 shows a structure of iCP-SOCS3 recombinant protein designed according to example 6-1.
[0190] FIG. 18 shows the agarose gel electrophoresis analysis showing plasmid DNA fragments insert encoding His-SOCS3-SDB (HS3B), His-aMTD.sub.165-SOC53-SDB (HM.sub.165S3B), His-aMTD.sub.165-SOCS3-SDC (HM.sub.165S3C), His-aMTD.sub.165-SOC53-SDD (HM.sub.165S3D), His-aMTD.sub.165-SOC53-SDE (HM.sub.165S3E) cloned into the pET28a (+) vector according to example 6-1.
[0191] FIG. 19 shows inducible expression and purification of iCP-SOCS3 recombinant protein in E. coli according to example 6-2 and improvement of solubility/yield of iCP-SOCS3 recombinant protein by fusing aMTD/SD according to example 6-3.
[0192] FIG. 20 shows aMTD-Mediated cell-permeability of SOCS3 recombinant proteins in RAW 264.7 cells according to example 7-1.
[0193] FIG. 21 shows aMTD-Mediated intracellular delivery and localization of SOCS3 Recombinant Proteins in NIH3T3 cells cells according to example 7-1.
[0194] FIG. 22 shows systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins in vivo according to example 7-2.
[0195] FIG. 23 shows inhibition of IFN-.gamma.-induced STAT phosphorylation by iCP-SOCS3 recombinant protein according to example 8-1.
[0196] FIG. 24 shows inhibition of LPS-induced cytokines secretion by iCP-SOCS3 recombinant protein according to example 8-2.
[0197] FIG. 25 shows the structures of SOCS3 recombinant protein lacking aMTD prepared as a negative control according to example 9.
[0198] FIG. 26 shows expression, purification, and solubility/yield of HS3 (lacking aMTD and SD) and HS3B (lacking aMTD) determined according to example 6-3.
[0199] FIG. 27 shows the agarose gel electrophoresis analysis showing plasmid DNA fragments insert encoding His-aMTD#-SOCS3-SDB (HM.sub.#S3B) and His-rP#-SOCS3-SDB cloned into the pET28a (+) vector according to example 10.
[0200] FIGS. 28a and 28b show expression, purification, and solubility/yield of His-aMTD#-SOCS3-SDB (HM.sub.#S3B) determined according to example 10.
[0201] FIG. 29 shows expression, purification, and solubility/yield of His-rP#-SOCS3-SDB (HrP.sub.#S3B) determined according to example 10.
[0202] FIG. 30 shows solubility/yield of His-aMTD#-SOCS3-SDB (HM.sub.#S3B) determined according to example 10.
[0203] FIG. 31 show aMTD-mediated cell-permeability. The cell-permeability of each SOCS3 recombinant protein fused with SD and various aMTD is visually compared to that of the cargo protein lacking CPP (HS3B) or lacking CPP and SD (HS3). Gray shaded area represents untreated E. coli cells (diluent); green line represents the cells treated with equal molar concentration of FITC (FITC only); black line indicates the cells treated with FITC-his-SOCS protein (FITC-HS3); blue line indicates the cells treated with FITC-his-SOCS-SDB protein (FITC-HS3B) purple line indicates the cells treated with FITC-his-aMTD.sub.#-SOCS-SDB protein (FITC-HM.sub.#S3B).
[0204] FIG. 32 shows relative cell-permeability of His-aMTD.sub.#-SOCS3-SDB-Fused recombinant proteins Compared to control (Vehicle, FITC only, HS3 and HS3B).
[0205] FIG. 33 shows random Peptide-Mediated cell-permeability. The cell-permeability of each SOCS3 recombinant protein fused with SDB and aMTD.sub.165 or various rP is visually compared to that of the cargo protein lacking CPP (HS3B) or lacking CPP and SD (HS3). Gray shaded area represents untreated E. coli cells (diluent); green line represents the cells treated with equal molar concentration of FITC (FITC only); black line indicates the cells treated with FITC-his-SOCS protein (FITC-HS3); blue line indicates the cells treated with FITC-his-SOCS-SDB protein (FITC-HS3B) and purple line indicates the cells treated with FITC-his-rPeptide.sub.#-SOCS-SDB protein (FITC-HrP.sub.#S3B).
[0206] FIG. 34 shows relative cell-permeability of His-rP.sub.#-SOCS3-SDB-Fused recombinant proteins Compared to control (Vehicle, FITC only, HS3 and HS3B).
[0207] FIG. 35 shows apoptotic cells analysis according to example 11-1.
[0208] FIG. 36 shows induction of apoptosis by iCP-SOCS3 recombinant proteins according to example 11-2.
[0209] FIG. 37 shows cell migration inhibition by iCP-SOCS3 recombinant protein according to example 11-3.
[0210] FIG. 38 shows solubility/yield, permeability and biological activity of His-aMTD#-SOCS3-SDB (HM.sub.#S3B) determined according to example 10 to 11-3.
[0211] FIG. 39 shows expression, purification, and solubility/yield of M.sub.165S3SB (lacking his-tag) determined according to example 12-1.
[0212] FIG. 40 shows cell-permeability of SOCS3 recombinant proteins (lacking his-tag) in RAW 264.7 cells according to example 12-2.
[0213] FIG. 41 shows Annexin V analysis according to example 12-3.
[0214] FIG. 42 shows cell migration inhibition (bottom) by iCP-SOCS3 recombinant protein according to example 12-3.
[0215] FIG. 43 shows a structure of iCP-SOCS3 recombinant protein (His-aMTD.sub.165-50C53-SDB') constructed according to example 12-4.
[0216] FIG. 44 shows expression, purification, and solubility/yield of HM.sub.165S3SB and HM.sub.165S3SB' determined according to example 12-4.
[0217] FIG. 45 shows aMTD-Mediated cell-permeability of iCP-SOCS3 recombinant proteins (HM.sub.165S3B and HM.sub.165S3B'(V28L)) in RAW 264.7 cells according to example 12-5.
[0218] FIG. 46 shows antiproliferative activity of iCP-SOCS3 recombinant proteins (HM.sub.165S3B and HM.sub.165S3B'(V28L)) according to example 12-6.
[0219] FIG. 47 shows induction of apoptosis by iCP-SOCS3 recombinant proteins (HM.sub.165S3B and HM.sub.165S3B'(V28L)) according to example 12-6.
[0220] FIG. 48 shows cell migration inhibition by SOCS3 recombinant proteins (HM.sub.165S3B and HM.sub.165S3B'(V28L)) according to example 12-6.
[0221] FIG. 49a shows a structure of iCP-SOCS3 recombinant proteins (top) and agarose gel electrophoresis analysis (bottom) according to example 12-7 and FIG. 49b shows inducible expressions and purifications of iCP-SOCS3 recombinant protein in E. coli (bottom) according to example 12-7.
[0222] FIG. 50 shows inhibition of IFN-.gamma.-induced STAT phosphorylation by iCP-SOCS3 recombinant protein according to example 13.
[0223] FIG. 51 shows effect of treating EDTA (FIG. 51A) and proteinase K (FIG. 51B) on aMTD-mediated SOCS3 protein uptake into cells according to example 14.
[0224] FIG. 52 shows effect of treating taxol (FIG. 52 A) and antimycin (FIG. 52 B) on aMTD-mediated SOCS3 protein uptake into cells according to example 14.
[0225] FIG. 53 shows effect of temperature on aMTD-mediated SOCS3 protein uptake into cells according to example 14.
[0226] FIG. 54 shows aMTD-mediated cell-to-cell delivery assessed according to example 14.
[0227] FIG. 55 shows bioavailability of iCP-SOCS3 recombinant protein in PBMC, splenocytes and hepatocytes analyzed by fluorescence microscopy according to example 15.
[0228] FIG. 56 shows biodistribution of iCP-SOCS3 recombinant protein in pancreas tissues analyzed by confocal microscope according to example 15.
[0229] FIG. 57 shows aMTD-Mediated cell-permeability of SOCS3 recombinant proteins in various cancer cells according to example 16.
[0230] FIG. 58 shows systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins into Various Tissues according to example 16.
[0231] FIG. 59 shows expression level of endogenous SOCS3 mRNA in gastric cell line analyzed by the agarose gel electrophoresis according to example 17-1-2.
[0232] FIG. 60 shows expression level of SOCS3 gene, and phosphorylation of JAK1 and JAK2 in gastric cancer cell line analyzed by western blot analysis according to example 17-1-3.
[0233] FIG. 61 shows expression level of endogenous SOCS3 mRNA in colon cancer cell line analyzed by the agarose gel electrophoresis according to example 17-2-2.
[0234] FIG. 62 shows expression level of SOCS3 gene, and phosphorylation of JAK1 and JAK2 in colon cancer cell line analyzed by western blot analysis according to example 17-2-3.
[0235] FIG. 63 shows methylation and unmethylation level of endogenous SOCS3 in glioblastoma cell line analyzed by the agarose gel electrophoresis according to example 17-3-1.
[0236] FIG. 64 shows expression level of SOCS3 gene, and phosphorylation of JAK1 and JAK2 in glioblastoma cancer cell line analyzed by western blot analysis according to example 17-3-2.
[0237] FIG. 65 shows expression level of endogenous SOCS3 mRNA in breast cancer cell line analyzed by the agarose gel electrophoresis according to example 17-4-1.
[0238] FIG. 66 shows methylation and unmethylation level of endogenous SOCS3 in breast cancer cell line analyzed by the agarose gel electrophoresis according to example 17-4-2.
[0239] FIG. 67 shows expression level of SOCS3 gene, and phosphorylation of JAK1 and JAK2 in breast cancer cell line analyzed by western blot analysis according to example 17-4-3.
[0240] FIG. 68 shows antiproliferative activity of iCP-SOCS3 recombinant protein in gastric cancer cell line according to example 18-1.
[0241] FIG. 69 shows antiproliferative activity of iCP-SOCS3 recombinant protein in colorectal cancer cell line according to example 18-1.
[0242] FIG. 70 shows antiproliferative activity of iCP-SOCS3 recombinant protein in glioblastoma cell line according to example 18-1.
[0243] FIG. 71 shows antiproliferative activity of iCP-SOCS3 recombinant protein in breast cancer cell line according to example 18-1.
[0244] FIG. 72 shows cell migration inhibition activity by iCP-SOCS3 recombinant protein in gastric cancer cell line (AGS) according to example 18-2.
[0245] FIG. 73 shows cell migration inhibition activity by iCP-SOCS3 recombinant protein in colorectal cancer cell line (HCT116) according to example 18-2.
[0246] FIG. 74 shows cell migration inhibition activity by iCP-SOCS3 recombinant protein in glioblastoma cell line (U-87 MG) according to example 18-2.
[0247] FIG. 75 shows cell migration inhibition activity by iCP-SOCS3 recombinant protein in breast cancer cell line (MDA-MB-231) according to example 18-2.
[0248] FIG. 76 show transwell migration inhibition activity by iCP-SOCS3 recombinant protein in gastric cancer cell line (AGS) (FIG. 76, left), and decrease in invasion by iCP-SOCS3 recombinant protein in gastric cancer cell line (AGS) (FIG. 76, right) analyzed according to example 18-2.
[0249] FIG. 77 show transwell migration inhibition activity by iCP-SOCS3 recombinant protein in glioblstoma cell line (U-87 MG) analyzed according to example 18-2.
[0250] FIGS. 78 to 82 show induction of apoptosis in normal cells (FIG. 78), in gastric cancer cells (FIG. 79), in colorectal cancer cells (HCT116, FIG. 80), in glioblastoma cells (U-87 MG, FIG. 81), and in breast cancer cells (MDA-MB-231, FIG. 82) by iCP-SOCS3 recombinant proteins assessed by Annexin V staining according to example 18-3.
[0251] FIG. 83 show induction of apoptosis in colon cancer cells (HCT116) by iCP-SOCS3 recombinant proteins analyzed by TUNEL assay according to example 18-4.
[0252] FIGS. 84 to 88 show inhibition of cell cycle progression in normal cells (FIG. 84), in gastric cancer cells (AGS, FIG. 85), in colon cancer cells (HCT116, FIG. 86), in glioblastoma cells (U-87 MG, FIG. 87), and in breast cancer cells (MDA-MB-231, FIG. 88) by iCP-SOCS3 recombinant proteins assessed by flow cytometric analysis according to example 18-5.
[0253] FIG. 89 shows down regulation of expression of apoptosis by iCP-SOCS3 recombinant proteins in breast cancer cells (MDA-MB-231) determined by immunoblotting according to example 18-6.
[0254] FIG. 90 shows suppression of the tumor growth by iCP-SOCS3 recombinant proteins in gastric cancer cells (NCI-N87) assessed according to example 19-1.
[0255] FIG. 91 shows suppression of the tumor growth by iCP-SOCS3 recombinant proteins in colorectal cancer cells (HCT116) assessed according to example 19-2.
[0256] FIG. 92 shows suppression of the tumor growth by iCP-SOCS3 recombinant proteins in glioblastoma cells (U-87 MG) assessed according to example 19-3.
[0257] FIG. 93 shows suppression of the tumor growth by iCP-SOCS3 recombinant proteins in breast cancer cells (MDA-MB-231) assessed according to example 19-4.
[0258] FIG. 94 shows humanized SDB domain according to example 12-4.
[0259] FIG. 95 shows methylation and unmethylation level of endogenous SOCS3 in gastric cancer cell line analyzed by the agarose gel electrophoresis according to example 17-1-1.
[0260] FIG. 96 shows methylation and unmethylation level of endogenous SOCS3 in colon cancer cell line analyzed by the agarose gel electrophoresis according to example 17-2-1.
[0261] FIG. 97 shows sequences of amino acid and nucleotide of basic CPP, and primers used in example 6-4.
[0262] FIG. 98 shows structure, expression, purification and solubility/yield of aMTD/SD-fused SOCS3 recombinant protein and basic CPP/SD-fused SOCS3 recombinant protein according to example 6-4.
[0263] FIG. 99 shows comparison of cell-permeability between aMTD/SD fused SOCS3 recombinant proteins and basic/SD-fused in RAW 264.7 cells according to example 7-1-2.
[0264] FIG. 100 shows comparison of tissue-permeability between aMTD/SD fused SOCS3 recombinant proteins and basic/SD-fused in various tissues of ICR mice according to example 7-2-2.
[0265] FIG. 101 shows effect of treating protein K (FIG. 101 A) and Taxol (FIG. 101 B) on aMTD (or basic CPP)-mediated SOCS3 protein uptake into cells according to example 14-2.
[0266] FIGS. 102 and 103 show aMTD (or basic CPP)-mediated cell-to-cell delivery (FIG. 102) and cell-to-cell function assessed according to example 14-2.
MODE FOR INVENTION
1. Analysis of Reference Hydrophobic CPPs to Identify `Critical Factors` for Development of Advanced MTDs
[0267] Previously reported MTDs were selected from a screen of more than 1,500 signal peptide sequences. Although the MTDs that have been developed did not have a common sequence or sequence motif, they were all derived from the hydrophobic (H) regions of signal sequences (HRSSs) that also lack common sequences or motifs except their hydrophobicity and the tendency to adopt alpha-helical conformations. The wide variation in H-region sequences may reflect prior evolution for proteins with membrane translocating activity and subsequent adaptation to the SRP/Sec61 machinery, which utilizes a methionine-rich signal peptide binding pocket in SRP to accommodate a wide-variety of signal peptide sequences.
[0268] Previously described hydrophobic CPPs (e.g. MTS/MTM and MTD) were derived from the hydrophobic regions present in the signal peptides of secreted and cell surface proteins. The prior art consists first, of ad hoc use of H-region sequences (MTS/MTM), and second, of H-region sequences (with and without modification) with highest CPP activity selected from a screen of 1,500 signal sequences (MTM). Second prior art, the modified H-region derived hydrophobic CPP sequences had advanced in diversity with multiple number of available sequences apart from MTS/MTM derived from fibroblast growth factor (FGF) 4. However, the number of MTDs that could be modified from naturally occurring secreted proteins are somewhat limited. Because there is no set of rules in determining their cell-permeability, no prediction for the cell-permeability of modified MTD sequences can be made before testing them.
[0269] The hydrophobic CPPs, like the signal peptides from which they originated, did not conform to a consensus sequence, and they had adverse effects on protein solubility when incorporated into protein cargo. We therefore set out to identify optimal sequence and structural determinants, namely critical factors (CFs), to design new hydrophobic CPPs with enhanced ability to deliver macromolecule cargoes including proteins into the cells and tissues while maintaining protein solubility. These newly developed CPPs, advanced macromolecule transduction domains (aMTDs) allowed almost infinite number of possible designs that could be designed and developed based on the critical factors. Also, their cell-permeability could be predicted by their character analysis before conducting any in vitro and/or in vivo experiments. These critical factors below have been developed by analyzing all published reference hydrophobic CPPs.
[0270] 1-1. Analysis of Hydrophobic CPPs
[0271] Seventeen different hydrophobic CPPs (Table 1) published from 1995 to 2014 (Table 2) were selected. After physiological and chemical properties of selected hydrophobic CPPs were analyzed, 11 different characteristics that may be associated with cell-permeability have been chosen for further analysis. These 11 characteristics are as follows: sequence, amino acid length, molecular weight, pI value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition and secondary structure of the sequences (Table 3).
[0272] Table 1 shows the summary of published hydrophobic Cell-Penetrating Peptides which were chosen.
TABLE-US-00001 TABLE 1 # Pepides Origin Protein Ref. 1 MTM Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 1 2 MTS Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 2 3 MTD10 Streptomyces coelicolor NP_625021 Glycosyl hydrolase 8 4 MTD13 Streptomyces coelicolor NP_639877 Putative secreted protein 3 5 MTD47 Streptomyces coelicolor NP_627512 Secreted protein 4 6 MTD56 Homo sapiens P23274 Peptidyl-prolyl cis-trans isomerase B precursor 5 7 MTD73 Drosophila melanogaster AAA17887 Spatzle (spz) protein 5 8 MTD77 Homo sapiens NP_003231 Kaposi fibroblast growth factor (K-FGF) 6 9 MTD84 Phytophthora cactorum AAK63068 Phytotoxic protein PcF precusor 4 10 MTD85 Streptomyces coelicolor NP_629842 Peptide transport system peptide binding 7 protein 11 MTD86 Streptomyces coelicolor NP_629842 Peptide transport system secreted peptide 7 binding protein 12 MTD103 Homo sapiens TMBV19 domain Family member B 8 13 MTD132 Streptomyces coelicolor NP_628377 P60-family secreted protein 4 14 MTD151 Streptomyces coelicolor NP_630126 Secreted chitinase 8 15 MTD173 Streptomyces coelicolor NP_624384 Secreted protein 4 16 MTD174 Streptomyces coelicolor NP_733505 Large, multifunctional secreted protein 8 17 MTD181 Neisseria meningitidis Z2491 CAB84257.1 Putative secreted protein 4
[0273] Table 2 summarizes reference information
TABLE-US-00002 TABLE 2 References # Title Journal Year Vol Issue Page 1 Inhibition of Nuclear Translocation of Transcription Factor JOURNAL OF 1995 270 24 14255 NF-kB by a Synthetic peptide Containing a Cell Membrane- BIOLOGICAL permeable Motif and Nuclear Localization Sequence CHEMISTRY 2 Epigenetic Regulation of Gene Structure and Function with NATURE 2001 19 10 929 a Cell-Permeable Cre Recombinase BIOTECHNOLOGY 3 Cell-Permeable NM23 Blocks the Maintenance and CANCER 2011 71 23 7216 Progression of Established Pulmonary Metastasis RESEARCH 4 Antitumor Activity of Cell-Permeable p18INK4c With MOLECULAR 2012 20 8 1540 Enhanced Membrane and Tissue Penetration THERAPY 5 Antitumor Activity of Cell-Permeable RUNX3 Protein in CLINICAL 2012 19 3 680 Gastric Cancer Cells CANCER RESEARCH 6 The Effect of Intracellular Protein Delivery on the Anti- BIOMATERIALS 2013 34 26 6261 Tumor Activity of Recombinant Human Endostatin 7 Partial Somatic to Stem Cell Transformations Induced By SCIENTIFIC 2014 4 10 4361 Cell-Permeable Reprogramming Factors REPORTS 8 Cell-Permeable Parkin Proteins Suppress Parkinson PLOS ONE 2014 9 7 17 Disease-Associated Phenotypes in Cultured Cells and Animals
[0274] Table 3 shows characteristics of published hydrophobic Cell-Penetrating Peptides (A) which were analyzed.
TABLE-US-00003 TABLE 3 Rigidity/ Structural Flexibility Feature Molecular Bending (Instability (Aliphatic # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) 1 MTM AAVALLPAVLLALLAP 16 1,515.9 5.6 Bending 45.5 220.0 2 MTS AAVLLPVLLAAP 12 1,147.4 5.6 Bending 57.3 211.7 3 MTD10 LGGAVVAAPVAAAVAP 16 1,333.5 5.5 Bending 47.9 140.6 4 MTD13 LAAAALAVLPL 11 1,022.3 5.5 Bending 26.6 213.6 5 MTD47 AAAVPVLVAA 10 881.0 5.6 Bending 47.5 176.0 6 MTD56 VLLAAALIA 9 854.1 5.5 No- 8.9 250.0 Bending 7 MTD73 PVLLLLA 7 737.9 6.0 No- 36.1 278.6 Bending 8 MTD77 AVALLILAV 9 882.1 5.6 No- 30.3 271.1 Bending 9 MTD84 AVALVAVVAVA 11 982.2 5.6 No- 9.1 212.7 Bending 10 MTD85 LLAAAAALLLA 11 1,0102 5.5 No- 9.1 231.8 Bending 11 MTD86 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1 231.8 Bending 12 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 13 MTD132 AVVVPAIVLAAP 12 1,119.4 5.6 Bending 50.3 195.0 14 MTD151 AAAPVAAVP 9 1,031.4 5.5 Bending 73.1 120.0 15 MTD173 AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 16 MTD174 LILLLPAVALP 12 1,011.8 5.5 Bending 79.1 257.3 17 MTD181 AVLLLPAAA 9 838.0 5.6 Bending 51.7 206.7 AVE 10.8 .+-. 2.4 1,011 .+-. 189.6 5.6 .+-. 0.1 Proline 40.1 .+-. 21.9 217.9 .+-. 43.6 Presence Hydro- A/a pathy Residue Composition Secondary # Peptides Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 1 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 2 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 3 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 4 MTD13 LAAAALAVLPL 2.4 Aliphatic 5 1 4 0 1 0 No-Helix RUNX3 3 Ring 5 MTD47 AAAVPVLVAA 2.4 Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 Ring 6 MTD56 VLLAAALIA 3.0 Aliphatic 4 1 3 1 0 0 Helix ES 5 Ring 7 MTD73 PVLLLLA 2.8 Aliphatic 1 1 4 0 1 0 Helix ES 5 Ring 8 MTD77 AVALLILAV 3.3 Aliphatic 3 2 3 1 0 0 Helix NM23 6 Ring 9 MTD84 AVALVAVVAVA 3.1 Aliphatic 5 5 1 0 0 0 Helix OCT4 4 Ring 10 MTD85 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 7 Ring 11 MTD86 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix SOX2 7 Ring 12 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 8 Ring 13 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 Ring 14 MTD151 AAAPVAAVP 1.6 Aliphatic No-Helix Parkin 8 Ring 15 MTD173 AVIPILAVP 2.4 Aliphatic 2 2 1 2 2 0 Helix KLF4 4 Ring 16 MTD174 LILLLPAVALP 2.6 Aliphatic Helix Parkin 8 Ring 17 MTD181 AVLLLPAAA 2.4 Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 Ring AVE 2.5 .+-. 0.4
[0275] Two peptide/protein analysis programs were used (ExPasy: SoSui: http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes and structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.
[0276] 1-2. Characteristics of Analyzed Peptides: Length, Molecular Weight and Pl Value
[0277] Average length, molecular weight and pl value of the peptides analyzed were 10.8.+-.2.4, 1,011.+-.189.6 and 5.6.+-.0.1, respectively (Table 4)
[0278] Table 4 summarizes Critical Factors (CFs) of published hydrophobic Cell-Penetrating Peptides (A) which were analyzed.
TABLE-US-00004 TABLE 4 Length: 10.8 .+-. 2.4 Molecular Weight: 1,011 .+-. 189.6 pI: 5.6 .+-. 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 40.1 .+-. 21.9 Residue Structure & Aliphatic Index (AI): 217.9 .+-. 43.6 Hydropathy (GRAVY): 2.5 .+-. 0.4 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: .alpha.-Helix is favored but not required.
[0279] 1-3. Characteristics of Analyzed Peptides: Bending Potential--Proline Position (PP)
[0280] Bending potential (bending or no-bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain.
[0281] Eleven out of 17 were determined as `Bending` peptide which means that proline is present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a "bent" configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.
[0282] 1-4. Characteristics of Analyzed Peptides: Rigidity/Flexibility
[0283] Instability Index (II) Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.1.+-.21.9 which suggested that the peptide should be somehow flexible, but not too much rigid or flexible (Table 3).
[0284] 1-5. Characteristics of Analyzed Peptides: Structural Features
[0285] structural feature (Aliphatic Index: AI) and hydropathy (Grand Average of Hydropathy: GRAVY)
[0286] Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic--that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 (MTD10--Table 3) and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.5.+-.0.4 and 217.9.+-.43.6, respectively. Their amino acid composition is also indicated in the Table 3.
[0287] 1-6. Characteristics of analyzed peptides: secondary structure (Helicity)
[0288] As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a "bent" configuration with hydrophobic sequences having .alpha.-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial for membrane penetration. Therefore, structural analysis of the peptides was conducted to determine whether the sequences were to form helix or not. Nine peptides were helix and eight were not (Table 3). It seems to suggest that helix structure may not be required.
[0289] 1-7. Determination of Critical Factors (CFs)
[0290] In the 11 characteristics analyzed, the following 6 are selected namely "Critical Factors" for the development of new hydrophobic CPPs--advanced MTDs: amino acid length, bending potential (proline presence and location), rigidity/flexibility (instability index: II), structural feature (aliphatic index: AI), hydropathy (GRAVY) and amino acid composition/residue structure (hydrophobic and aliphatic A/a) (Table 3 and Table 4).
2. Analysis of Selected Hydrophobic CPPs to Optimize `Critical Factors`
[0291] Since the analyzed data of the 17 different hydrophobic CPPs (analysis A, Table 3 and 4) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, analysis B (Table 5 and 6) and C (Table 7 and 8) were also conducted to optimize the critical factors for better design of improved CPPs--aMTDs. Therefore, 17 hydrophobic CPPs have been grouped into two groups and analyzed the groups for their characteristics in relation to the cell permeable property. The critical factors have been optimized by comparing and contrasting the analytical data of the groups and determining the common homologous features that may be critical for the cell permeable property.
[0292] 2-1. Selective analysis (B) of peptides used to biologically active cargo protein for in vivo
[0293] In analysis B, eight CPPs were used with each biologically active cargo in vivo. Length was 11.+-.3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility (instability index: II) was 41.+-.15, but removing one [MTD85: rigid, with minimal II (9.1)] of the peptides increased the overall instability index to 45.6.+-.9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy (Table 5 and 6)
[0294] Table 5 shows characteristics of published hydrophobic Cell-Penetrating Peptides (B): selected CPPs that were used to each cargo in vivo.
TABLE-US-00005 TABLE 5 Structural Rigidity/Flexibility Feature Molecular Bending (Instability (Aliphatic # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) 1 MTM AAVALLPAVLLALLAP 16 1,515.9 5.6 Bending 45.5 220.0 2 MTS AAVLLPVLLAAP 12 1,147.4 5.6 Bending 57.3 211.7 3 MTD10 LGGAVVAAPVAAAVAP 16 1,333.5 5.5 Bending 47.9 140.6 4 MTD73 PVLLLLA 7 737.9 6.0 No- 36.1 278.6 Bending 5 MTD77 AVALLILAV 9 882.1 5.6 No- 30.3 271.1 Bending 6 MTD85 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1* 231.8 Bending 7 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 8 MTD132 AVVVPAIVLAAP 12 1,119.4 5.6 Bending 50.3 195.0 AVE 11 .+-. 3.2 1,083 .+-. 252 5.6 .+-. 0.1 Proline 41 .+-. 15 227 .+-. 47 Presence A/a Hydropathy Residue Composition Secondary # Peptides Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 1 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 2 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 3 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 4 MTD73 PVLLLLA 2.8 Aliphatic 1 1 4 0 1 0 Helix ES 6 Ring 5 MTD77 AVALLILAV 3.3 Aliphatic 3 2 3 1 0 0 Helix NM23 3 Ring 6 MTD85 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 5 Ring 7 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 4 Ring 8 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 7 Ring AVE 2.5 .+-. 0.4 *Removing the MTD85 increases II to 45.6 .+-. 9.3.
[0295] Table 6 shows summarized Critical Factors of published hydrophobic Cell-Penetrating Peptides (B).
TABLE-US-00006 TABLE 6 Length: 11 .+-. 3.2 Molecular Weight: 1,083 .+-. 252 pI: 5.6 .+-. 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 41.0 .+-. 15 ('Removing the MTD85 increases II to 45.6 .+-. 9.3) Residue Structure & Aliphatic Index (AI): 227 .+-. 47 Hydropathy (GRAVY): 2.5 .+-. 0.4 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: .alpha.-Helix is favored but not required.
[0296] 2-2. Selective Analysis (C) of Peptides that Provided Bending Potential and Higher Flexibility
[0297] To optimize the `Common Range and/or Consensus Feature of Critical Factor` for the practical design of aMTDs and the random peptides (rPs or rPeptides), which were to prove that the `Critical Factors` determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs--protein aggregation, low solubility/yield, and poor cell-/tis sue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.
[0298] Hydrophobic CPPs which did not have a bending potential, rigid or too much flexible sequences (too much low or too much high Instability Index), or too low or too high hydrophobic CPPs were unselected, but secondary structure was not considered because helix structure of sequence was not required.
[0299] In analysis C, eight selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed (Table 7 and 8). Common amino acid length is 12 (11.6.+-.3.0). Proline is presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1.+-.3.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7.+-.37.5 and 2.4.+-.0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs--aMTDs.
[0300] Table 7 shows characteristics of published hydrophobic Cell-Penetrating Peptides (C): selected CPPs that provided bending potential and higher flexibility.
TABLE-US-00007 TABLE 7 Structural Rigidity/Flexibility Feature Molecular Bending (Instability (Aliphatic # Peptides Sequence Length Weight pI Potential Index: II) Index: AI) 1 MTM AAVALLPAVLLALLAP 16 1515.9 5.6 Bending 45.5 220.0 2 MTS AAVLLPVLLAAP 12 1147.4 5.6 Bending 57.3 211.7 3 MTD10 LGGAVVAAPVAAAVAP 16 1333.5 5.5 Bending 47.9 140.6 4 MTD47 AAAVPVLVAA 10 881.0 5.6 Bending 47.5 176.0 5 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 6 MTD132 AVVVPAIVLAAP 12 1119.4 5.6 Bending 50.3 195.0 7 MTD173 AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 8 MTD181 AVLLLPAAA 9 838.0 5.6 Bending 51.7 206.7 AVE 11.6 .+-. 3.0 1081.2 .+-. 244.6 5.6 .+-. 0.1 Proline 50.1 .+-. 3.6 204.7 .+-. 37.5 Presence A/a Hydropathy Residue Composition Secondary # Peptides Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 1 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 2 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 3 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 4 MTD47 AAAVPVLVAA 2.4 Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 Ring 5 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 8 Ring 6 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 Ring 7 MTD173 AVIPILAVP 2.4 Aliphatic 2 2 1 2 2 0 Helix KLF4 4 Ring 8 MTD181 AVLLLPAAA 2.4 Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 Ring AVE 2.4 .+-. 0.3
[0301] Table 8 shows summarized Critical Factors of published hydrophobic Cell-Penetrating Peptides (C)
TABLE-US-00008 TABLE 8 Length: 11.6 .+-. 3.0 Molecular Weight: 1,081.2 .+-. 224.6 pI: 5.6 .+-. 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides. Instability Index (II): 50.1 .+-. 3.6 Residue Structure & Aliphatic Index (AI): 204.7 .+-. 37.5 Hydropathy (GRAVY): 2.4 .+-. 0.3 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: .alpha.-Helix is favored but not required.
3. New design of improved hydrophobic CPPs--aMTDs based on the optimized Critical Factors
[0302] 3-1. Determination of common sequence and/or common homologous structure
[0303] As mentioned above, H-regions of signal sequence (HRSS)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, sequence motif, and/or common-structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence- and structural-motif which satisfy newly determined `Critical Factors` to have `Common Function,` namely, to facilitate protein translocation across the membrane with similar mechanism to the analyzed reference CPPs. Based on the analysis A, B and C, the common homologous features have been analyzed to determine the critical factors that influence the cell-permeability. The range value of each critical factor has been determined to include the analyzed index of each critical factor from analysis A, B and C to design novel aMTDs (Table 9). These features have been confirmed experimentally with newly designed aMTDs in their cell-permeability.
[0304] Table 9 shows comparison the range/feature of each Critical Factor between the value of analyzed CPPs and the value determined for new design of novel aMTDs sequences
TABLE-US-00009 TABLE 9 Summarized Critical Factors of aMTD Selected CPPs Newly Designed CPPs Critical Factor Range Range Bending Potential Proline presences in Proline presences in (Proline Position: PP) the middle and/or at the middle (5', 6', 7' the end of peptides or 8') and at the end of peptides Rigidity/Flexibility 45.5-57.3 40-60 (Instability Index: II) (50.1 .+-. 3.6) Structural Feature 140.6-220.0 180-220 (Aliphatic Index: AI) (204.7 .+-. 37.5) Hydropathy 1.8-2.8 2.1-2.6 (Grand Average of (2.4 .+-. 0.3) Hydropathy GRAVY) Length 11.6 .+-. 3.0 9-13 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
[0305] In Table 9, universal common features and sequence/structural motif are provided. Length is 9-13 amino acids, and bending potential is provided with the presence of proline in the middle of sequence (at 5', 6', 7' or 8' amino acid) for peptide bending and at the end of peptide for recombinant protein bending and Rigidity/Flexibility of aMTDs is II>40 are described in Table 9.
[0306] 3-2. Critical Factors for development of advanced MTDs
[0307] Recombinant cell-permeable proteins fused to the hydrophobic CPPs to deliver therapeutically active cargo molecules including proteins into live cells had previously been reported, but the fusion proteins expressed in bacteria system were hard to be purified as a soluble form due to their low solubility and yield. To address the crucial weakness for further clinical development of the cell-permeable proteins as protein-based biotherapeutics, greatly improved form of the hydrophobic CPP, named as advanced MTD (aMTD) has newly been developed through critical factors-based peptide analysis. The critical factors used for the current invention of the aMTDs are herein (Table 9).
[0308] 1. Amino Acid Length: 9-13
[0309] 2. Bending Potential (Proline Position: PP)
[0310] : Proline presences in the middle (from 5' to 8' amino acid) and at the end of sequence
[0311] 3. Rigidity/Flexibility (Instability Index: II): 40-60
[0312] 4. Structural Feature (Aliphatic Index: AI): 180-220
[0313] 5. Hydropathy (GRAVY): 2.1-2.6
[0314] 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids--A, V, L, I and P
[0315] 3-3. Design of potentially best aMTDs that all Critical Factors are considered and satisfied
[0316] After careful consideration of six critical factors derived from analysis of unique features of hydrophobic CPPs, advanced macromolecule transduction domains (aMTDs) have been designed and developed based on the common 12 amino acid platform which satisfies the critical factors including amino acid length (9-13) determined from the analysis.
[0317] Unlike previously published hydrophobic CPPs that require numerous experiments to determine their cell-permeability, newly developed aMTD sequences could be designed by performing just few steps as follows using above mentioned platform to follow the determined range value/feature of each critical factor.
[0318] First, prepare the 12 amino acid sequence platform for aMTD. Second, place proline (P) in the end (12') of sequence and determine where to place proline in one of four U(s) in 5', 6', 7', and 8. Third, alanine (A), valine (V), leucine (L) or isoleucine (I) is placed in either X(s) and/or U(s), where proline is not placed. Lastly, determine whether the amino acid sequences designed based on the platform, satisfy the value or feature of six critical factors to assure the cell permeable property of aMTD sequences. Through these processes, numerous novel aMTD sequences have been constructed. The expression vectors for preparing non-functional cargo recombinant proteins fused to each aMTD, expression vectors have been constructed and forcedly expressed in bacterial cells. These aMTD-fused recombinant proteins have been purified in soluble form and determined their cell-permeability quantitatively. aMTD sequences have been newly designed, numbered from 1 to 240, as shown in Table 10-15. In Table 10-15, sequence ID Number is a sequence listings for reference, and aMTD numbers refer to amino acid listing numbers that actually have been used at the experiments. For further experiments, aMTD numbers have been used. In addition, polynucleotide sequences shown in the sequence lists have been numbered from SEQ ID NO: 241 to SEQ ID NO: 480.
[0319] Tables 10 to 15 shows 240 new hydrophobic aMTD sequences that were developed to satisfy all critical factors.
TABLE-US-00010 TABLE 10 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 1 1 AAALAPVVLALP 12 57.3 187.5 2.1 Aliphatic 2 2 AAAVPLLAVVVP 12 41.3 195.0 2.4 Aliphatic 3 3 AALLVPAAVLAP 12 57.3 187.5 2.1 Aliphatic 4 4 ALALLPVAALAP 12 57.3 195.8 2.1 Aliphatic 5 5 AAALLPVALVAP 12 57.3 187.5 2.1 Aliphatic 6 11 VVALAPALAALP 12 57.3 187.5 2.1 Aliphatic 7 12 LLAAVPAVLLAP 12 57.3 211.7 2.3 Aliphatic 8 13 AAALVPVVALLP 12 57.3 203.3 2.3 Aliphatic 9 21 AVALLPALLAVP 12 57.3 211.7 2.3 Aliphatic 10 22 AVVLVPVLAAAP 12 57.3 195.0 2.4 Aliphatic 11 23 VVLVLPAAAAVP 12 57.3 195.0 2.4 Aliphatic 12 24 IALAAPALIVAP 12 50.2 195.8 2.2 Aliphatic 13 25 IVAVAPALVALP 12 50.2 203.3 2.4 Aliphatic 14 42 VAALPVVAVVAP 12 57.3 186.7 2.4 Aliphatic 15 43 LLAAPLVVAAVP 12 41.3 187.5 2.1 Aliphatic 16 44 ALAVPVALLVAP 12 57.3 203.3 2.3 Aliphatic 17 61 VAALPVLLAALP 12 57.3 211.7 2.3 Aliphatic 18 62 VALLAPVALAVP 12 57.3 203.3 2.3 Aliphatic 19 63 AALLVPALVAVP 12 57.3 203.3 2.3 Aliphatic
TABLE-US-00011 TABLE 11 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 20 64 AIVALPVAVLAP 12 50.2 203.3 2.4 Aliphatic 21 65 IAIVAPVVALAP 12 50.2 203.3 2.4 Aliphatic 22 81 AALLPALAALLP 12 57.3 204.2 2.1 Aliphatic 23 82 AVVLAPVAAVLP 12 57.3 195.0 2.4 Aliphatic 24 83 LAVAAPLALALP 12 41.3 195.8 2.1 Aliphatic 25 84 AAVAAPLLLALP 12 41.3 195.8 2.1 Aliphatic 26 85 LLVLPAAALAAP 12 57.3 195.8 2.1 Aliphatic 27 101 LVALAPVAAVLP 12 57.3 203.3 2.3 Aliphatic 28 102 LALAPAALALLP 12 57.3 204.2 2.1 Aliphatic 29 103 ALIAAPILALAP 12 57.3 204.2 2.2 Aliphatic 30 104 AVVAAPLVLALP 12 41.3 203.3 2.3 Aliphatic 31 105 LLALAPAALLAP 12 57.3 204.1 2.1 Aliphatic 32 121 AIVALPALALAP 12 50.2 195.8 2.2 Aliphatic 33 123 AAIIVPAALLAP 12 50.2 195.8 2.2 Aliphatic 34 124 IAVALPALIAAP 12 50.3 195.8 2.2 Aliphatic 35 141 AVIVLPALAVAP 12 50.2 203.3 2.4 Aliphatic 36 143 AVLAVPAVLVAP 12 57.3 195.0 2.4 Aliphatic 37 144 VLAIVPAVALAP 12 50.2 203.3 2.4 Aliphatic 38 145 LLAVVPAVALAP 12 57.3 203.3 2.3 Aliphatic 39 161 AVIALPALIAAP 12 57.3 195.8 2.2 Aliphatic 40 162 AVVALPAALIVP 12 50.2 203.3 2.4 Aliphatic 41 163 LALVLPAALAAP 12 57.3 195.8 2.1 Aliphatic 42 164 LAAVLPALLAAP 12 57.3 195.8 2.1 Aliphatic 43 165 ALAVPVALAIVP 12 50.2 203.3 2.4 Aliphatic 44 182 ALIAPVVALVAP 12 57.3 203.3 2.4 Aliphatic 45 183 LLAAPVVIALAP 12 57.3 211.6 2.4 Aliphatic 46 184 LAAIVPAIIAVP 12 50.2 211.6 2.4 Aliphatic 47 185 AALVLPLIIAAP 12 41.3 220.0 2.4 Aliphatic 48 201 LALAVPALAALP 12 57.3 195.8 2.1 Aliphatic 49 204 LIAALPAVAALP 12 57.3 195.8 2.2 Aliphatic 50 205 ALALVPAIAALP 12 57.3 195.8 2.2 Aliphatic 51 221 AAILAPIVALAP 12 50.2 195.8 2.2 Aliphatic 52 222 ALLIAPAAVIAP 12 57.3 195.8 2.2 Aliphatic 53 223 AILAVPIAVVAP 12 57.3 203.3 2.4 Aliphatic 54 224 ILAAVPIALAAP 12 57.3 195.8 2.2 Aliphatic 55 225 VAALLPAAAVLP 12 57.3 187.5 2.1 Aliphatic 56 241 AAAVVPVLLVAP 12 57.3 195.0 2.4 Aliphatic 57 242 AALLVPALVAAP 12 57.3 187.5 2.1 Aliphatic 58 243 AAVLLPVALAAP 12 57.3 187.5 2.1 Aliphatic 59 245 AAALAPVLALVP 12 57.3 187.5 2.1 Aliphatic 60 261 LVLVPLLAAAAP 12 41.3 211.6 2.3 Aliphatic 61 262 ALIAVPAIIVAP 12 50.2 211.6 2.4 Aliphatic 62 263 ALAVIPAAAILP 12 54.9 195.8 2.2 Aliphatic 63 264 LAAAPVVIVIAP 12 50.2 203.3 2.4 Aliphatic 64 265 VLAIAPLLAAVP 12 41.3 211.6 2.3 Aliphatic 65 281 ALIVLPAAVAVP 12 50.2 203.3 2.4 Aliphatic 66 282 VLAVAPALIVAP 12 50.2 203.3 2.4 Aliphatic 67 283 AALLAPALIVAP 12 50.2 195.8 2.2 Aliphatic 68 284 ALIAPAVALIVP 12 50.2 211.7 2.4 Aliphatic 69 285 AIVLLPAAVVAP 12 50.2 203.3 2.4 Aliphatic
TABLE-US-00012 TABLE 12 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 70 301 VIAAPVLAVLAP 12 57.3 203.3 2.4 Aliphatic 71 302 LALAPALALLAP 12 57.3 204.2 2.1 Aliphatic 72 304 AIILAPIAAIAP 12 57.3 204.2 2.3 Aliphatic 73 305 IALAAPILLAAP 12 57.3 204.2 2.2 Aliphatic 74 321 IVAVALPALAVP 12 50.2 203.3 2.3 Aliphatic 75 322 VVAIVLPALAAP 12 50.2 203.3 2.3 Aliphatic 76 323 IVAVALPVALAP 12 50.2 203.3 2.3 Aliphatic 77 324 IVAVALPAALVP 12 50.2 203.3 2.3 Aliphatic 78 325 IVAVALPAVALP 12 50.2 203.3 2.3 Aliphatic 79 341 IVAVALPAVLAP 12 50.2 203.3 2.3 Aliphatic 80 342 VIVALAPAVLAP 12 50.2 203.3 2.3 Aliphatic 81 343 IVAVALPALVAP 12 50.2 203.3 2.3 Aliphatic 82 345 ALLIVAPVAVAP 12 50.2 203.3 2.3 Aliphatic 83 361 AVVIVAPAVIAP 12 50.2 195.0 24 Aliphatic 84 363 AVLAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 85 364 LVAAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 86 365 AVIVVAPALLAP 12 50.2 203.3 2.3 Aliphatic 87 381 VVAIVLPAVAAP 12 50.2 195.0 24 Aliphatic 88 382 AAALVIPAILAP 12 54.9 195.8 2.2 Aliphatic 89 383 VIVALAPALLAP 12 50.2 211.6 2.3 Aliphatic 90 384 VIVAIAPALLAP 12 50.2 211.6 2.4 Aliphatic 91 385 IVAIAVPALVAP 12 50.2 203.3 2.4 Aliphatic 92 401 AALAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 93 402 ALAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 94 403 AAALVIPAAILP 12 54.9 195.8 2.2 Aliphatic 95 404 LAAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 96 405 LAAAVIPVAILP 12 54.9 211.7 2.4 Aliphatic 97 421 AAILAAPLIAVP 12 57.3 195.8 2.2 Aliphatic 98 422 VVAILAPLLAAP 12 57.3 211.7 2.4 Aliphatic 99 424 AVVVAAPVLALP 12 57.3 195.0 2.4 Aliphatic 100 425 AVVAIAPVLALP 12 57.3 203.3 2.4 Aliphatic 101 442 ALAALVPAVLVP 12 57.3 203.3 2.3 Aliphatic 102 443 ALAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 103 444 LAAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 104 445 ALAALVPALVVP 12 57.3 203.3 2.3 Aliphatic 105 461 IAAVIVPAVALP 12 50.2 203.3 2.4 Aliphatic 106 462 IAAVLVPAVALP 12 57.3 203.3 2.4 Aliphatic 107 463 AVAILVPLLAAP 12 57.3 211.7 2.4 Aliphatic 108 464 AVVILVPLAAAP 12 57.3 203.3 2.4 Aliphatic 109 465 IAAVIVPVAALP 12 50.2 203.3 2.4 Aliphatic 110 481 AIAIAIVPVALP 12 50.2 211.6 2.4 Aliphatic 111 482 ILAVAAIPVAVP 12 54.9 203.3 2.4 Aliphatic 112 483 ILAAAIIPAALP 12 54.9 204.1 2.2 Aliphatic 113 484 LAVVLAAPAIVP 12 50.2 203.3 2.4 Aliphatic 114 485 AILAAIVPLAVP 12 50.2 211.6 2.4 Aliphatic 115 501 VIVALAVPALAP 12 50.2 203.3 2.4 Aliphatic 116 502 AIVALAVPVLAP 12 50.2 203.3 2.4 Aliphatic 117 503 AAIIIVLPAALP 12 50.2 220.0 2.4 Aliphatic 118 504 LIVALAVPALAP 12 50.2 211.7 2.4 Aliphatic 119 505 AIIIVIAPAAAP 12 50.2 195.8 2.3 Aliphatic
TABLE-US-00013 TABLE 13 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 120 521 LAALIVVPAVAP 12 50.2 203.3 2.4 Aliphatic 121 522 ALLVIAVPAVAP 12 57.3 203.3 2.4 Aliphatic 122 524 AVALIVVPALAP 12 50.2 203.3 2.4 Aliphatic 123 525 ALAIVVAPVAVP 12 50.2 195.0 2.4 Aliphatic 124 541 LLALIIAPAAAP 12 57.3 204.1 2.1 Aliphatic 125 542 ALALIIVPAVAP 12 50.2 211.6 2.4 Aliphatic 126 543 LLAALIA.sup.PAAL.sup.P 12 57.3 204.1 2.1 Aliphatic 127 544 IVALIVAPAAVP 12 43.1 203.3 2.4 Aliphatic 128 545 VVLVLAAPAAVP 12 57.3 195.0 2.3 Aliphatic 129 561 AAVAIVLPAVVP 12 50.2 195.0 2.4 Aliphatic 130 562 ALIAAIVPALVP 12 50.2 211.7 2.4 Aliphatic 131 563 ALAVIVVPALAP 12 50.2 203.3 2.4 Aliphatic 132 564 VAIALIVPALAP 12 50.2 211.7 2.4 Aliphatic 133 565 VAIVLVAPAVAP 12 50.2 195.0 2.4 Aliphatic 134 582 VAVALIVPALAP 12 50.2 203.3 2.4 Aliphatic 135 583 AVILALAPIVAP 12 50.2 211.6 2.4 Aliphatic 136 585 ALIVAIAPALVP 12 50.2 211.6 2.4 Aliphatic 137 601 AAILIAVPIAAP 12 57.3 195.8 2.3 Aliphatic 138 602 VIVALAAPVLAP 12 50.2 203.3 2.4 Aliphatic 139 603 VLVALAAPVIAP 12 57.3 203.3 2.4 Aliphatic 140 604 VALIAVAPAVVP 12 57.3 195.0 2.4 Aliphatic 141 605 VIAAVLAPVAVP 12 57.3 195.0 2.4 Aliphatic 142 622 ALIVLAAPVAVP 12 50.2 203.3 2.4 Aliphatic 143 623 VAAAIALPAIVP 12 50.2 187.5 2.3 Aliphatic 144 625 ILAAAAAPLIVP 12 50.2 195.8 2.2 Aliphatic 145 643 LALVLAAPAIVP 12 50.2 211.6 2.4 Aliphatic 146 645 ALAVVALPAIVP 12 50.2 203.3 2.4 Aliphatic 147 661 AAILAPIVAALP 12 50.2 195.8 2.2 Aliphatic 148 664 ILIAIAIPAAAP 12 54.9 204.1 2.3 Aliphatic 149 665 LAIVLAAPVAVP 12 50.2 203.3 2.3 Aliphatic 150 666 AAIAIIAPAIVP 12 50.2 195.8 2.3 Aliphatic 151 667 LAVAIVAPALVP 12 50.2 203.3 2.3 Aliphatic 152 683 LAIVLAAPAVLP 12 50.2 211.7 2.4 Aliphatic 153 684 AAIVLALPAVLP 12 50.2 211.7 2.4 Aliphatic 154 685 ALLVAVLPAALP 12 57.3 211.7 2.3 Aliphatic 155 686 AALVAVLPVALP 12 57.3 203.3 2.3 Aliphatic 156 687 AILAVALPLLAP 12 57.3 220.0 2.3 Aliphatic 157 703 IVAVALVPALAP 12 50.2 203.3 2.4 Aliphatic 158 705 IVAVALLPALAP 12 50.2 211.7 2.4 Aliphatic 159 706 IVAVALLPAVAP 12 50.2 203.3 2.4 Aliphatic 160 707 IVALAVLPAVAP 12 50.2 203.3 2.4 Aliphatic 161 724 VAVLAVLPALAP 12 57.3 203.3 2.3 Aliphatic 162 725 IAVLAVAPAVLP 12 57.3 203.3 2.3 Aliphatic 163 726 LAVAIIAPAVAP 12 57.3 187.5 2.2 Aliphatic 164 727 VALAIALPAVLP 12 57.3 211.6 2.3 Aliphatic 165 743 AIAIALVPVALP 12 57.3 211.6 2.4 Aliphatic 166 744 AAVVIVAPVALP 12 50.2 195.0 2.4 Aliphatic 167 746 VAIIVVAPALAP 12 50.2 203.3 2.4 Aliphatic 168 747 VALLAIAPALAP 12 57.3 195.8 2.2 Aliphatic 169 763 VAVLIAVPALAP 12 57.3 203.3 2.3 Aliphatic
TABLE-US-00014 TABLE 14 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 170 764 AVALAVLPAVVP 12 57.3 195.0 2.3 Aliphatic 171 765 AVALAVVPAVLP 12 57.3 195.0 2.3 Aliphatic 172 766 IVVIAVAPAVAP 12 50.2 195.0 2.4 Aliphatic 173 767 IVVAAVVPALAP 12 50.2 195.0 2.4 Aliphatic 174 783 IVALVPAVAIAP 12 50.2 203.3 2.5 Aliphatic 175 784 VAALPAVALVVP 12 57.3 195.0 2.4 Aliphatic 176 786 LVAIAPLAVLAP 12 41.3 211.7 2.4 Aliphatic 177 787 AVALVPVIVAAP 12 50.2 195.0 2.4 Aliphatic 178 788 AIAVAIAPVALP 12 57.3 187.5 2.3 Aliphatic 179 803 AIALAVPVLALP 12 57.3 211.7 2.4 Aliphatic 180 805 LVLIAAAPIALP 12 41.3 220.0 2.4 Aliphatic 181 806 LVALAVPAAVLP 12 57.3 203.3 2.3 Aliphatic 182 807 AVALAVPALVLP 12 57.3 203.3 2.3 Aliphatic 183 808 LVVLAAAPLAVP 12 41.3 203.3 2.3 Aliphatic 184 809 LIVLAAPALAAP 12 50.2 195.8 2.2 Aliphatic 185 810 VIVLAAPALAAP 12 50.2 187.5 2.2 Aliphatic 186 811 AVVLAVPALAVP 12 57.3 195.0 2.3 Aliphatic 187 824 LIIVAAAPAVAP 12 50.2 187.5 2.3 Aliphatic 188 825 IVAVIVAPAVAP 12 43.2 195.0 2.5 Aliphatic 189 826 LVALAAPIIAVP 12 41.3 211.7 2.4 Aliphatic 190 827 IAAVLAAPALVP 12 57.3 187.5 2.2 Aliphatic 191 828 IALLAAPIIAVP 12 41.3 220.0 2.4 Aliphatic 192 829 AALALVAPVIVP 12 50.2 203.3 2.4 Aliphatic 193 830 IALVAAPVALVP 12 57.3 203.3 2.4 Aliphatic 194 831 IIVAVAPAAIVP 12 43.2 203.3 2.5 Aliphatic 195 832 AVAAIVPVIVAP 12 43.2 195.0 2.5 Aliphatic 196 843 AVLVLVAPAAAP 12 41.3 219.2 2.5 Aliphatic 197 844 VVALLAPLIAAP 12 41.3 211.8 2.4 Aliphatic 198 845 AAVVIAPLLAVP 12 41.3 203.3 2.4 Aliphatic 199 846 IAVAVAAPLLVP 12 41.3 203.3 2.4 Aliphatic 200 847 LVAIVVLPAVAP 12 50.2 219.2 2.6 Aliphatic 201 848 AVAIVVLPAVAP 12 50.2 195.0 2.4 Aliphatic 202 849 AVILLAPLIAAP 12 57.3 220.0 2.4 Aliphatic 203 850 LVIALAAPVALP 12 57.3 211.7 2.4 Aliphatic 204 851 VLAVVLPAVALP 12 57.3 219.2 2.5 Aliphatic 205 852 VLAVAAPAVLLP 12 57.3 203.3 2.3 Aliphatic 206 863 AAVVLLPIIAAP 12 41.3 211.7 2.4 Aliphatic 207 864 ALLVIAPAIAVP 12 57.3 211.7 2.4 Aliphatic 208 865 AVLVIAVPAIAP 12 57.3 203.3 2.5 Aliphatic 209 867 ALLVVIAPLAAP 12 41.3 211.7 2.4 Aliphatic 210 868 VLVAAILPAAIP 12 54.9 211.7 2.4 Aliphatic 211 870 VLVAAVLPIAAP 12 41.3 203.3 2.4 Aliphatic 212 872 VLAAAVLPLVVP 12 41.3 219.2 2.5 Aliphatic 213 875 AIAIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 214 877 VAIIAVPAVVAP 12 57.3 195.0 2.4 Aliphatic 215 878 IVALVAPAAVVP 12 50.2 195.0 2.4 Aliphatic 216 879 AAIVLLPAVVVP 12 50.2 219.1 2.5 Aliphatic 217 881 AALIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 218 882 AIALVVPAVAVP 12 57.3 195.0 2.4 Aliphatic 219 883 LAIVPAAIAALP 12 50.2 195.8 2.2 Aliphatic
TABLE-US-00015 TABLE 15 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue ID Number aMTD Sequences Length (II) (AI) (GRAVY) Structure 220 885 LVAIAPAVAVLP 12 57.3 203.3 2.4 Aliphatic 221 887 VLAVAPAVAVLP 12 57.3 195.0 2.4 Aliphatic 222 888 ILAVVAIPAAAP 12 54.9 187.5 2.3 Aliphatic 223 889 ILVAAAPIAALP 12 57.3 195.8 2.2 Aliphatic 224 891 ILAVAAIPAALP 12 54.9 195.8 2.2 Aliphatic 225 893 VIAIPAILAAAP 12 54.9 195.8 2.3 Aliphatic 226 895 AIIIVVPAIAAP 12 50.2 211.7 2.5 Aliphatic 227 896 AILIVVAPIAAP 12 50.2 211.7 2.5 Aliphatic 228 897 AVIVPVAIIAAP 12 50.2 203.3 2.5 Aliphatic 229 899 AVVIALPAVVAP 12 57.3 195.0 2.4 Aliphatic 230 900 ALVAVIAPVVAP 12 57.3 195.0 2.4 Aliphatic 231 901 ALVAVLPAVAVP 12 57.3 195.0 2.4 Aliphatic 232 902 ALVAPLLAVAVP 12 41.3 203.3 2.3 Aliphatic 233 904 AVLAVVAPVVAP 12 57.3 186.7 2.4 Aliphatic 234 905 AVIAVAPLVVAP 12 41.3 195.0 2.4 Aliphatic 235 906 AVIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 236 907 VAIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 237 908 VALALAPVVVAP 12 57.3 195.0 2.3 Aliphatic 238 910 VAALLPAVVVAP 12 57.3 195.0 2.3 Aliphatic 239 911 VALALPAVVVAP 12 57.3 195.0 2.3 Aliphatic 240 912 VALLAPAVVVAP 12 57.3 195.0 2.3 Aliphatic 52.6 .+-. 5.1 201.7 .+-. 7.8 2.3 .+-. 0.1
[0320] 3-4. Design of the peptides that did not satisfy at least one Critical Factor
[0321] To demonstrate that this invention of new hydrophobic CPPs--aMTDs, which satisfy all critical factors described above, are correct and rationally designed, the peptides which do not satisfy at least one critical factor have also been designed. Total of 31 rPeptides (rPs) are designed, developed and categorized as follows: no bending peptides, either no proline in the middle as well at the end and/or no central proline; rigid peptides (II<40); too much flexible peptides; aromatic peptides (aromatic ring presences); hydrophobic, with non-aromatic peptides but have amino acids other than A, V, L, I, P or additional proline residues; hydrophilic, but non-aliphatic peptides.
[0322] 3-4-1. Peptides that do not Satisfy the Bending Potential
[0323] Table 16 shows the peptides that do not have any proline in the middle (at 5', 6', 7' or 8') and at the end of the sequences. In addition, Table 16 describes the peptides that do not have proline in the middle of the sequences. All these peptides are supposed to have no-bending potential.
TABLE-US-00016 TABLE 16 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GRAVY) No-Bending Peptides 931 AVLIAPAILAAA 12 6 57.3 204.2 2.5 (No Proline at 5, 6, 7 936 ALLILAAAVAAP 12 12 41.3 204.2 2.4 or 8 and/or 12) 152 LAAAVAAVAALL 12 None 9.2 204.2 2.7 27 LAIVAAAAALVA 12 None 2.1 204.2 2.8 935 ALLILPAAAVAA 12 6 57.3 204.2 2.4 670 ALLILAAAVAAL 12 None 25.2 236.6 2.8 934 LILAPAAVVAAA 12 5 57.3 195.8 2.5 37 TTCSQQQYCTNG 12 None 53.1 0.0 -1.1 16 NNSCTTVTNGSQ 12 None 47.4 0.0 -1.4 113 PVAVALLIAVPP 12 1, 11, 12 57.3 195.0 2.1
[0324] 3-4-2. Peptides that do not Satisfy the Rigidity/Flexibility
[0325] To prove that rigidity/flexibility of the sequence is a crucial critical factor, rigid (Avg. II: 21.8.+-.6.6) and too high flexible sequences (Avg. II: 82.3.+-.21.0) were also designed. Rigid peptides that instability index is much lower than that of new aMTDs (II: 41.3-57.3, Avg. II: 53.3.+-.5.7) are shown in Table 17. Bending, but too high flexible peptides that II is much higher than that of new aMTDs are also provided in Table 18.
TABLE-US-00017 TABLE 17 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptide ID Sequences Length (PP) (II) (AI) (GRAVY) Rigid Peptides 226 ALVAAIPALAIP 12 6 20.4 195.8 2.2 (II < 50) 6 VIAMIPAAFWVA 12 6 15.7 146.7 2.2 750 LAIAAIAPLAIP 12 8, 12 22.8 204.2 2.2 26 AAIALAAPLAIV 12 8 18.1 204.2 2.5 527 LVLAAVAPIAIP 12 8, 12 22.8 211.7 2.4 466 IIAAAAPLAIIP 12 7, 12 22.8 204.2 2.3 167 VAIAIPAALAIP 12 6, 12 20.4 195.8 2.3 246 VVAVPLLVAFAA 12 5 25.2 195.0 2.7 426 AAALAIPLAIIP 12 7, 12 4.37 204.2 2.2 606 AAAIAAIPIIIP 12 8, 12 4.4 204.2 2.4 66 AGVLGGPIMGVP 12 7, 12 35.5 121.7 1.3 248 VAAIVPIAALVP 12 6, 12 34.2 203.3 2.5 227 LAAIVPIAAAVP 12 6, 12 34.2 187.5 2.2 17 GGCSAPQTTCSN 12 6 51.6 8.3 -0.5 67 LDAEVPLADDVP 12 6, 12 34.2 130.0 0.3
TABLE-US-00018 TABLE 18 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GARVY) Bending Peptides 692 PAPLPPVVILAV 12 1, 3, 5, 6 105.5 186.7 1.8 but Too High 69 PVAVLPPAALVP 12 1, 6, 7, 12 89.4 162.5 1.6 Flexibility 390 VPLLVPVVPVVP 12 2, 6, 9, 12 105.4 210.0 2.2 350 VPILVPVVPVVP 12 2, 6, 9, 12 121.5 210.0 2.2 331 VPVLVPLVPVVP 12 2, 6, 9, 12 105.4 210.0 2.2 9 VALVPAALILPP 12 5, 11, 12 89.4 203.3 2.1 68 VAPVLPAAPLVP 12 3, 6, 9, 12 105.5 162.5 1.6 349 VPVLVPVVPVVP 12 2, 6, 9, 12 121.5 201.6 2.2 937 VPVLVPLPVPVV 12 2, 6, 8, 10 121.5 210.0 2.2 938 VPVLLPVVVPVP 12 2, 6, 10, 12 121.5 210.0 2.2 329 LPVLVPVVPVVP 12 2, 6, 9, 12 121.5 210.0 2.2 49 VVPAAPAVPVVP 12 3, 6, 9, 12 121.5 145.8 1.7 772 LPVAPVIPIIVP 12 2, 5, 8, 12 79.9 210.8 2.1 210 ALIALPALPALP 12 6, 9, 12 89.4 195.8 1.8 28 AVPLLPLVPAVP 12 3, 6, 9, 12 89.4 186.8 1.8 693 AAPVLPVAVPIV 12 3, 6, 10 82.3 186.7 2.1 169 VALVAPALILAP 12 6, 12 73.4 211.7 2.4 29 VLPPLPVLPVLP 12 3, 4, 6, 9, 12 121.5 202.5 1.7 190 AAILAPAVIAPP 12 6, 11, 12 89.4 163.3 1.8
[0326] 3-4-3. Peptides that do not Satisfy the Structural Features
[0327] New hydrophobic CPPs--aMTDs are consisted with only hydrophobic and aliphatic amino acids (A, V, L, I and P) with average ranges of the indexes--AI: 180-220 and GRAVY: 2.1-2.6 (Table 9). Based on the structural indexes, the peptides which contain an aromatic residue (W, F or Y) are shown in Table 19 and the peptides which are hydrophobic with non-aromatic sequences but have amino acids residue other than A, V, L, I, P or additional proline residues are designed (Table 20). Finally, hydrophilic and/or bending peptides which are consisted with non-aliphatic amino acids are shown in Table 21.
TABLE-US-00019 TABLE 19 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GRAVY) Aromatic Peptides 30 WFFAGPIMLIWP 12 6, 12 9.2 105.8 1.4 (Aromatic Ring 33 AAAILAPAFLAV 12 7 57.3 171.7 2.4 Presences) 131 WIIAPVWLAWIA 12 5 51.6 179.2 1.9 922 WYVIPVLPLVVP 12 8, 12 41.3 194.2 2.2 71 FMWMWFPFMWYP 12 7, 12 71.3 0.0 0.6 921 IWWFVVLPLVVP 12 8, 12 41.3 194.2 2.2
TABLE-US-00020 TABLE 20 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GARVY) Hydrophobic 436 VVMLVVPAVMLP 12 7.12 57.3 194.2 2.6 but Non Aromatic 138 PPAALLAILAVA 12 1.2 57.3 195.8 2.2 Peptides 77 PVALVLVALVAP 12 1.12 41.3 219.2 2.5 577 MLMIALVPMIAV 12 8 18.9 195.0 2.7 97 ALLAAPPALLAL 12 6.7 57.3 204.2 2.1 214 ALIVAPALMALP 12 6.12 60.5 187.5 2.2 59 AVLAAPVVAALA 12 6 41.3 187.5 2.5 54 LAVAAPPVVALL 12 6.7 57.3 203.3 2.3
TABLE-US-00021 TABLE 21 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptide ID Sequences Length (PP) (II) (AI) (GRAVY) Hydrophilic Peptides 949 SGNSCQQCGNSS 12 None 41.7 0.0 -1.1 but Non Aliphatic 39 CYNTSPCTGCCY 12 6 52.5 0.0 0.0 19 YVSCCTYTNGSQ 12 None 47.7 0.0 -1.0 947 CYYNQQSNNNNQ 12 None 59.6 0.0 -2.4 139 TGSTNSPTCTST 12 7 53.4 0.0 -0.7 18 NYCCTPTTNGQS 12 6 47.9 0.0 -0.9 20 NYCNTCPTYGQS 12 7 47.4 0.0 -0.9 635 GSTGGSQQNNQY 12 None 31.9 0.0 -1.9 40 TYNTSCTPGTCY 12 8 49.4 0.0 -0.6 57 QNNCNTSSQGGG 12 None 52.4 0.0 -1.6 159 CYSGSTSQNQPP 12 11.12 51.0 0.0 -1.3 700 GTSNTCQSNQNS 12 None 19.1 0.0 -1.6 38 YYNQSTCGGQCY 12 None 53.8 0.0 -1.0
[0328] 3-5. Summary of Newly Designed Peptides
[0329] Total of 457 sequences have been designed based on the critical factors. Designed potentially best aMTDs (hydrophobic, flexible, bending, aliphatic and 12-A/a length peptides) that do satisfy all range/feature of critical factors are 316. Designed rPeptides that do not satisfy at least one of the critical factors are 141 that no bending peptide sequences are 26; rigid peptide (II<40) sequences are 23; too much flexible peptides are 24; aromatic peptides (aromatic ring presences) are 27; hydrophobic, but non-aromatic peptides are 23; and hydrophilic, but non-aliphatic peptides are 18.
4. Preparation of Recombinant Report Proteins Fused to aMTDs and rPeptides
[0330] Recombinant proteins fused to aMTDs and others [rPeptides, reference hydrophobic CPP sequences (MTM and MTD)] were expressed in a bacterial system, purified with single-step affinity chromatography and prepared as soluble proteins in physiological condition. These recombinant proteins have been tested for the ability of their cell-permeability by utilizing flow cytometry and laser scanning confocal microscopy.
[0331] 4-1. Selection of Cargo Protein for Recombinant Proteins Fused to Peptide Sequences
[0332] For clinical/non-clinical application, aMTD-fused cargo materials would be biologically active molecules that could be one of the following: enzymes, transcription factors, toxic, antigenic peptides, antibodies and antibody fragments. Furthermore, biologically active molecules could be one of these following macromolecules: enzymes, hormones, carriers, immunoglobulin, membrane-bound proteins, transmembrane proteins, internal proteins, external proteins, secreted proteins, virus proteins, native proteins, glycoproteins, fragmented proteins, disulfide bonded proteins, recombinant proteins, chemically modified proteins and prions. In addition, these biologically active molecules could be one of the following: nucleic acid, coding nucleic acid sequence, mRNAs, antisense RNA molecule, carbohydrate, lipid and glycolipid.
[0333] According to these pre-required conditions, a non-functional cargo to evaluate aMTD-mediated protein uptake has been selected and called as Cargo A (CRA) that should be soluble and non-functional. The domain (A/a 289-840; 184 A/a length) is derived from protein S (Genbank ID: CP000113.1).
[0334] 4-2. Construction of Expression Vector and Preparation of Recombinant Proteins
[0335] Coding sequences for recombinant proteins fused to each aMTD are cloned Ndel (5') and SalI (3') in pET-28a(+) (Novagen, Darmstadt, Germany) from PCR-amplified DNA segments. PCR primers for the recombinant proteins fused to aMTD and rPeptides are SEQ ID NOs: 481.about.797. Structure of the recombinant proteins is displayed in FIG. 1.
[0336] The recombinant proteins were forcedly expressed in E. coli BL21 (DE3) cells grown to an OD.sub.600 of 0.6 and induced for 2 hours with 0.7 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni.sup.2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany) in natural condition. After the purification, purified proteins were dissolved in a physiological buffer such as DMEM medium.
TABLE-US-00022 TABLE 22 Potentially Best aMTDs (Hydrophobic, 240 Flexible, Bending, Aliphatic & Helical) Random Peptides 31 No Bending Peptides (No Proline at 5 or 6 and/or 12) 02 No Bending Peptides (No Central Proline) 01 Rigid Peptides (II < 50) 09 Too Much Flexible Peptides 09 Aromatic Peptides (Aromatic Ring Presences) 01 Hydrophobic, But Non-Aromatic Peptides 02 Hydrophilic, But Non-Aliphatic Peptides 07
[0337] 4-3. Expression of aMTD- or Random Peptide (rP)-Fused Recombinant Proteins
[0338] Using the standardized six critical factors, 316 aMTD sequences have been designed. In addition, 141 rPeptides are also developed that lack one of these critical factors: no bending peptides: i) absence of proline both in the middle and at the end of sequence or ii) absence of proline either in the middle or at the end of sequence, rigid peptides, too much flexible peptides, aromatic peptides (aromatic ring presence), hydrophobic but non-aromatic peptides, and hydrophilic but non-aliphatic peptides (Table 22).
[0339] These rPeptides are devised to be compared and contrasted with aMTDs in order to analyze structure/sequence activity relationship (SAR) of each critical factor with regard to the peptides' intracellular delivery potential. All peptide (aMTD or rPeptide)-containing recombinant proteins have been fused to the CRA to enhance the solubility of the recombinant proteins to be expressed, purified, prepared and analyzed.
[0340] These designed 316 aMTDs and 141 rPeptides fused to CRA were all cloned (FIG. 2) and tested for inducible expression in E. coli (FIG. 3). Out of these peptides, 240 aMTDs were inducibly expressed, purified and prepared in soluble form (FIG. 4). In addition, 31 rPeptides were also prepared as soluble form (FIG. 4).
[0341] To prepare the proteins fused to rPeptides, 60 proteins were expressed that were 10 out of 26 rPeptides in the category of no bending peptides (Table 16); 15 out of 23 in the category of rigid peptides [instability index (II)<40] (Table 17); 19 out of 24 in the category of too much flexible peptides (Table 18); 6 out of 27 in the category of aromatic peptides (Table 19); 8 out of 23 in the category of hydrophobic but non-aromatic peptides (Table 20); and 12 out of 18 in the category of hydrophilic but non-aliphatic peptides (Table 21).
[0342] 4-4. Quantitative Cell-Permeability of aMTD-Fused Recombinant Proteins
[0343] The aMTDs and rPeptides were fluorescently labeled and compared based on the critical factors for cell-permeability by using flow cytometry and confocal laser scanning microscopy (FIGS. 5 to 8). The cellular uptake of the peptide-fused non-functional cargo recombinant proteins could quantitatively be evaluated in flow cytometry, while confocal laser scanning microscopy allows intracellular uptake to be assessed visually. The analysis included recombinant proteins fused to a negative control [rP38] that has opposite characteristics (hydrophilic and aromatic sequence: YYNQSTCGGQCY) to the aMTDs (hydrophobic and aliphatic sequences). Relative cell-permeability (relative fold) of aMTDs to the negative control was also analyzed (Table 23 and FIG. 9).
[0344] Table 23 shows Comparison Analysis of Cell-Permeability of aMTDs with a Negative Control (A: rP38).
TABLE-US-00023 TABLE 23 Negative Control rP38 aMTD 19.6 .+-. 1.6* The Average of 240 aMTDs (Best: 164.2) *Relative Fold (aMTD in Geo Mean in its comparison to rP38)
[0345] Relative cell-permeability (relative fold) of aMTDs to the reference CPPs [B: MTM12 (AAVLLPVLLAAP), C: MTD85 (AVALLILAV)] was also analyzed (Tables 40 and 41)
[0346] Table 24 shows Comparison Analysis of Cell-Permeability of aMTDs with a Reference CPP (B: MTM12).
TABLE-US-00024 TABLE 24 MTM12 aMTD 13.1 .+-. 1.1* The Average of 240 aMTDs (Best: 109.9) *Relative Fold (aMTD in Geo Mean in its comparison to MTM12)
[0347] Table 25 shows Comparison Analysis of Cell-Permeability of aMTDs with a Reference CPP (C: MTD85).
TABLE-US-00025 TABLE 25 MTD85 aMTD 6.6 .+-. 0.5* The Average of 240 aMTDs (Best: 55.5) *Relative Fold (aMTD in Geo Mean in its comparison to MTD85)
[0348] Geometric means of negative control (histidine-tagged rP38-fused CRA recombinant protein) subtracted by that of naked protein (histidine-tagged CRA protein) lacking any peptide (rP38 or aMTD) was standardized as relative fold of 1. Relative cell-permeability of 240 aMTDs to the negative control (A type) was significantly increased by up to 164 fold, with average increase of 19.6.+-.1.6 (Table 26-31).
TABLE-US-00026 TABLE 26 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio (Fold) ID Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 1 899 AVVIALPAVVAP 12 7 57.3 195.0 2.4 164.2 109.9 55.5 2 908 VALALAPVVVAP 12 7 57.3 195.0 2.3 150.6 100.8 50.9 3 910 VAALLPAVVVAP 12 6 57.3 195.0 2.3 148.5 99.4 50.2 4 810 VIVLAAPALAAP 12 7 50.2 187.5 2.2 120.0 80.3 40.6 5 904 AVLAVVAPVVAP 12 8 57.3 186.7 2.4 105.7 70.8 35.8 6 321 IVAVALPALAVP 12 7 50.2 203.3 2.3 97.8 65.2 32.9 7 851 VLAVVLPAVALP 12 7 57.3 219.2 2.5 96.6 64.7 32.7 8 911 VALALPAVVVAP 12 6 57.3 195.0 2.3 84.8 56.8 28.7 9 852 VLAVAAPAVLLP 12 7 57.3 203.3 2.3 84.6 56.6 28.6 10 803 AIALAVPVLALP 12 7 57.3 211.7 2.4 74.7 50.0 25.3 11 888 ILAVVAIPAAAP 12 8 54.9 187.5 2.3 71.0 47.5 24.0 12 825 IVAVIVAPAVAP 12 8 43.2 195.0 2.5 69.7 46.6 23.6 13 895 AIIIVVPAIAAP 12 7 50.2 211.7 2.5 60.8 40.7 20.6 14 896 AILIVVAPIAAP 12 8 50.2 211.7 2.5 57.5 38.5 19.4 15 727 VALAIALPAVLP 12 8 57.3 211.6 2.3 54.7 36.7 18.5 16 603 VLVALAAPVIAP 12 8 57.3 203.3 2.4 54.1 36.1 18.2 17 847 LVAIVVLPAVAP 12 8 50.2 219.2 2.6 50.2 33.4 16.9 18 826 LVALAAPIIAVP 12 7 41.3 211.7 2.4 49.2 32.9 16.6 19 724 VAVLAVLPALAP 12 8 57.3 203.3 2.3 47.5 31.8 16.1 20 563 ALAVIVVPALAP 12 8 50.2 203.3 2.4 47.1 31.4 15.9 21 811 AVVLAVPALAVP 12 7 57.3 195.0 2.3 46.5 31.1 15.7 22 831 IIVAVAPAAIVP 12 7 43.2 203.3 2.5 46.3 31.0 15.7 23 829 AALALVAPVIVP 12 8 50.2 203.3 2.4 44.8 30.0 15.2 24 891 ILAVAAIPAALP 12 8 54.3 195.8 2.2 44.7 29.9 15.1 25 905 AVIAVAPLVVAP 12 7 41.3 195.0 2.4 44.0 29.5 14.9 26 564 VAIALIVPALAP 12 8 50.2 211.7 2.4 43.6 29.1 14.7 27 124 IAVALPALIAAP 12 6 50.3 195.8 2.2 43.6 29.0 14.7 28 827 IAAVLAAPALVP 12 8 57.3 187.5 2.2 43.0 28.8 14.6 29 2 AAAVPLLAVVVP 12 5 41.3 195.0 2.4 40.9 27.2 13.8 30 385 IVAIAVPALVAP 12 7 50.2 203.3 2.4 38.8 25.9 13.1 31 828 IALLAAPIIAVP 12 7 41.3 220.0 2.4 36.8 24.6 12.4 32 806 LVALAVPAAVLP 12 7 57.3 203.3 2.3 36.7 24.6 12.4 33 845 AAVVIAPLLAVP 12 7 41.3 203.3 2.4 35.8 24.0 12.1 34 882 AIALVVPAVAVP 12 7 57.3 195.0 2.4 35.0 23.4 11.8 35 545 VVLVLAAPAAVP 12 8 57.3 195.0 2.3 34.6 23.1 11.7 36 161 AVIALPALIAAP 12 6 57.3 195.8 2.2 34.5 23.0 11.6 37 481 AIAIAIVPVALP 12 8 50.2 211.6 2.4 34.3 23.0 11.6 38 900 ALVAVIAPVVAP 12 8 57.3 195.0 2.4 34.3 22.9 11.6 39 223 AILAVPIAVVAP 12 6 57.3 203.3 2.4 33.0 22.1 11.2 40 824 LIIVAAAPAVAP 12 8 50.2 187.5 2.3 32.8 21.9 11.1 41 562 ALIAAIVPALVP 12 8 50.2 211.7 2.4 32.7 21.8 11.0 42 222 ALLIAPAAVIAP 12 6 57.3 195.8 2.2 32.6 21.7 11.0 43 61 VAALPVLLAALP 12 5 57.3 211.7 2.3 31.2 20.8 10.5 44 582 VAVALIVPALAP 12 8 50.2 203.3 2.4 30.6 20.4 10.3 45 889 ILVAAAPIAALP 12 7 57.3 195.8 2.2 30.3 20.3 10.3 46 787 AVALVPVIVAAP 12 6 50.2 195.0 2.4 29.3 19.6 9.9 47 703 IVAVALVPALAP 12 8 50.2 203.3 2.4 29.2 19.5 9.9 48 705 IVAVALLPALAP 12 8 50.2 211.7 2.4 28.6 19.1 9.7 49 885 LVAIAPAVAVLP 12 6 57.3 203.3 2.4 28.3 19.0 9.6 50 3 AALLVPAAVLAP 12 6 57.3 187.5 2.1 27.0 18.0 9.1 51 601 AAILIAVPIAAP 12 8 57.3 195.8 2.3 26.8 17.9 9.0 52 843 AVLVLVAPAAAP 12 8 41.3 219.2 2.5 26.4 17.7 8.9 53 403 AAALVIPAAILP 12 7 54.2 195.8 2.2 25.2 16.8 8.5 54 544 IVALIVAPAAVP 12 8 43.1 203.3 2.4 23.4 15.6 7.9 55 522 ALLVIAVPAVAP 12 8 57.3 203.3 2.4 22.7 15.2 7.7
TABLE-US-00027 TABLE 27 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio (Fold) ID Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 56 805 LVLIAAAPIALP 12 8 41.3 220.0 2.4 22.3 14.9 7.6 57 464 AVVILVPLAAAP 12 7 57.3 203.3 2.4 22.3 14.9 7.5 58 405 LAAAVIPVAILP 12 7 54.9 211.7 2.4 22.2 14.8 7.5 59 747 VALLAIAPALAP 12 8 57.3 195.8 2.2 22.0 14.8 7.5 60 501 VIVALAVPALAP 12 8 50.2 203.3 2.4 21.5 14.4 7.3 61 661 AAILAPIVAALP 12 6 50.2 195.8 2.2 21.4 14.3 7.2 62 786 LVAIAPLAVLAP 12 6 41.3 211.7 2.4 21.2 14.2 7.2 63 625 ILAAAAAPLIVP 12 8 50.2 195.8 2.2 20.9 13.9 7.0 64 442 ALAALVPAVLVP 12 7 57.3 203.3 2.3 20.4 13.6 6.9 65 912 VALLAPAVVVAP 12 6 57.3 195.0 2.3 19.9 13.3 6.7 66 165 ALAVPVALAIVP 12 5 50.2 203.3 2.4 19.8 13.2 6.7 67 422 VVAILAPLLAAP 12 7 57.3 211.7 2.4 19.6 13.1 6.6 68 686 AALVAVLPVALP 12 8 57.3 203.3 2.3 19.5 13.1 6.6 69 343 IVAVALPALVAP 12 7 50.2 203.3 2.3 19.4 12.9 6.5 70 323 IVAVALPVALAP 12 7 50.2 203.3 2.3 19.1 12.8 6.4 71 461 IAAVIVPAVALP 12 7 50.2 203.3 2.4 19.0 12.7 6.4 72 21 AVALLPALLAVP 12 6 57.3 211.7 2.3 18.9 12.6 6.4 73 404 LAAAVIPAAILP 12 7 54.9 195.8 2.2 18.9 12.6 6.4 74 261 LVLVPLLAAAAP 12 5 41.3 211.6 2.3 18.5 12.3 6.2 75 524 AVALIVVPALAP 12 8 50.2 203.3 2.4 18.3 12.2 6.2 76 225 VAALLPAAAVLP 12 6 57.3 187.5 2.1 18.3 12.2 6.2 77 264 LAAAPVVIVIAP 12 5 50.2 203.3 2.4 18.2 12.1 6.1 78 1 AAALAPVVLALP 12 6 57.3 187.5 2.1 17.7 11.8 6.0 79 382 AAALVIPAILAP 12 7 54.3 195.8 2.2 17.7 11.8 6.0 80 463 AVAILVPLLAAP 12 7 57.3 211.7 2.4 17.6 11.7 5.9 81 322 VVAIVLPALAAP 12 7 50.2 203.3 2.3 17.6 11.7 5.9 82 503 AAIIIVLPAALP 12 8 50.2 223.0 2.4 17.6 11.8 5.9 83 870 VLVAAVLPIAAP 12 8 41.3 203.3 2.4 16.6 11.1 5.6 84 241 AAAVVPVLLVAP 12 6 57.3 195.0 2.4 16.6 11.0 5.6 85 726 LAVAIIAPAVAP 12 8 57.3 187.5 2.2 16.5 11.0 5.6 86 341 IVAVALPAVLAP 12 7 50.2 203.3 2.3 16.4 10.9 5.5 87 542 ALALIIVPAVAP 12 8 50.2 211.6 2.4 16.2 10.8 5.5 88 361 AVVIVAPAVIAP 12 7 50.2 195.0 2.4 16.0 10.7 5.4 89 224 ILAAVPIALAAP 12 6 57.3 195.8 2.2 15.8 10.6 5.3 90 482 ILAVAAIPVAVP 12 8 54.9 203.3 2.4 15.8 10.6 5.3 91 64 AIVALPVAVLAP 12 6 50.2 203.3 2.4 15.8 10.6 5.3 92 484 LAVVLAAPAIVP 12 8 50.2 203.3 2.4 15.6 10.4 5.3 93 868 VLVAAILPAAIP 12 8 54.9 211.7 2.4 14.9 10.0 5.0 94 541 LLALIIAPAAAP 12 8 57.3 204.1 2.1 14.8 9.9 5.0 95 666 AAIAIIAPAIVP 12 8 50.2 195.8 2.3 14.7 9.9 5.0 96 665 LAIVLAAPVAVP 12 8 50.2 203.3 2.3 14.7 9.9 5.0 97 363 AVLAVAPALIVP 12 7 50.2 203.3 2.3 14.7 9.8 4.9 98 242 AALLVPALVAAP 12 6 57.3 187.5 2.1 14.6 9.7 4.9 99 384 VIVAIAPALLAP 12 7 50.2 211.6 2.4 14.0 9.4 4.7 100 877 VAIIAVPAVVAP 12 7 57.3 195.0 2.4 14.0 9.4 4.7 101 863 AAVVLLPIIAAP 12 7 41.3 211.7 2.4 13.8 9.3 4.7 102 525 ALAIVVAPVAVP 12 8 50.2 195.0 2.4 13.8 9.2 4.7 103 875 AIAIVVPAVAVP 12 7 50.2 195.0 2.4 13.8 9.2 4.7 104 285 AIVLLPAAVVAP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 105 281 ALIVLPAAVAVP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 106 867 ALLVVIAPLAAP 12 8 41.3 211.7 2.4 13.2 8.8 4.4 107 766 IVVIAVAPAVAP 12 8 50.2 195.0 2.4 12.9 8.6 4.4 108 342 VIVALAPAVLAP 12 7 50.2 203.3 2.3 12.7 8.5 4.3 109 881 AALIVVPAVAVP 12 7 50.2 195.0 2.4 12.7 8.5 4.3 110 505 AIIIVIAPAAAP 12 8 50.2 195.8 2.3 12.4 8.3 4.2
TABLE-US-00028 TABLE 28 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio (Fold) ID Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 111 763 VAVLIAVPALAP 12 8 57.3 203.3 2.3 12.3 7.2 4.2 112 706 IVAVALLPAVAP 12 8 50.2 203.3 2.4 12.0 7.0 4.1 113 687 AILAVALPLLAP 12 8 57.3 220.0 2.3 12.0 7.0 4.1 114 643 LALVLAAPAIVP 12 8 50.2 211.6 2.4 11.8 7.9 4.0 115 282 VLAVAPALIVAP 12 6 50.2 203.3 2.4 11.8 7.9 4.0 116 543 LLAALIAPAALP 12 8 57.3 204.1 2.1 11.7 7.8 4.0 117 325 IVAVALPAVALP 12 7 50.2 203.3 2.3 11.7 7.8 4.0 118 846 IAVAVAAPLLVP 12 8 41.3 203.3 2.4 11.7 6.8 4.0 119 383 VIVALAPALLAP 12 7 50.2 211.6 2.3 11.6 7.7 3.9 120 381 VVAIVLPAVAAP 12 7 50.2 195.0 2.4 11.5 7.7 3.9 121 808 LVVLAAAPLAVP 12 8 41.3 203.3 2.3 11.5 7.6 3.9 122 865 AVLVIAVPAIAP 12 8 57.3 203.3 2.5 11.3 7.5 3.8 123 725 IAVLAVAPAVLP 12 8 57.3 203.3 2.3 11.2 7.5 3.8 124 844 VVALLAPLIAAP 12 7 41.3 211.8 2.4 11.2 7.5 3.8 125 897 AVIVPVAIIAAP 12 5 50.2 203.3 2.5 11.2 7.5 3.8 126 605 VIAAVLAPVAVP 12 8 57.3 195.0 2.4 11.0 7.4 3.7 127 744 AAVVIVAPVALP 12 8 50.2 195.0 2.4 11.0 7.3 3.7 128 221 AAILAPIVALAP 12 6 50.2 195.8 2.2 10.9 7.3 3.7 129 622 ALIVLAAPVAVP 12 8 50.2 203.3 2.4 10.6 7.1 3.6 130 401 AALAVIPAAILP 12 7 54.9 195.8 2.2 10.6 7.1 3.6 131 324 IVAVALPAALVP 12 7 50.2 203.3 2.3 10.3 6.9 3.5 132 878 IVALVAPAAVVP 12 7 50.2 195.0 2.4 10.3 6.9 3.5 133 302 LALAPALALLAP 12 5 57.3 204.2 2.1 10.2 6.8 3.4 134 635 ALLVAVLPAALP 12 8 57.3 211.7 2.3 10.2 5.9 3.4 135 848 AVAIVVLPAVAP 12 8 50.2 195.0 2.4 10.0 6.7 3.4 136 602 VIVALAAPVLAP 12 8 50.2 203.3 2.4 9.9 5.8 3.4 137 788 AIAVAIAPVALP 12 8 57.3 187.5 2.3 9.8 6.6 3.3 138 145 LLAVVPAVALAP 12 6 57.3 203.3 2.3 9.5 6.3 3.2 139 11 VVALAPALAALP 12 6 57.3 187.5 2.1 9.5 6.3 3.2 140 141 AVIVLPALAVAP 12 6 50.2 203.3 2.4 9.4 6.3 3.2 141 521 LAALIVVPAVAP 12 8 50.2 203.3 2.4 9.4 6.3 3.2 142 425 AVVAIAPVLALP 12 7 57.3 203.3 2.4 9.4 6.3 3.2 143 365 AVIVVAPALLAP 12 7 50.2 203.3 2.3 9.3 6.2 3.1 144 263 ALAVIPAAAILP 12 6 54.9 195.8 2.2 9.0 6.0 3.0 145 345 ALLIVAPVAVAP 12 7 50.2 203.3 2.3 8.9 5.9 3.0 146 850 LVIALAAPVALP 12 8 57.3 211.7 2.4 8.8 5.9 3.0 147 144 VLAIVPAVALAP 12 6 50.2 203.3 2.4 8.8 5.9 3.0 148 767 IVVAAVVPALAP 12 8 50.2 195.0 2.4 8.5 5.0 2.9 149 185 AALVLPLIIAAP 12 6 41.3 220.0 2.4 8.5 5.7 2.9 150 849 AVILLAPLIAAP 12 7 57.3 220.0 2.4 8.3 4.8 2.8 151 864 ALLVIAPAIAVP 12 7 57.3 211.7 2.4 8.2 4.8 2.8 152 162 AVVALPAALIVP 12 6 50.2 203.3 2.4 8.2 5.5 2.8 153 164 LAAVLPALLAAP 12 6 57.3 195.8 2.1 8.2 5.5 2.8 154 907 VAIALAPVVVAP 12 7 57.3 195.0 2.4 8.1 5.4 2.8 155 444 LAAALVPVALVP 12 7 57.3 203.3 2.3 8.1 5.4 2.7 156 443 ALAALVPVALVP 12 7 57.3 203.3 2.3 8.0 5.3 2.7 157 901 ALVAVLPAVAVP 12 7 57.3 195.0 2.4 7.7 5.1 2.6 158 887 VLAVAPAVAVLP 12 6 57.3 195.0 2.4 7.7 5.1 2.6 159 746 VAIIVVAPALAP 12 8 50.2 203.3 2.4 7.6 4.4 2.6 160 902 ALVAPLLAVAVP 12 5 41.3 203.3 2.3 7.6 5.1 2.6 161 565 VAIVLVAPAVAP 12 8 50.2 195.0 2.4 7.5 5.0 2.5 162 245 AAALAPVLALVP 12 6 57.3 187.5 2.1 7.5 5.0 2.5 163 743 AIAIALVPVALP 12 8 57.3 211.6 2.4 7.4 4.9 2.5 164 465 AVVILVPLAAAP 12 7 57.3 203.3 2.4 7.4 4.9 2.5 165 104 AVVAAPLVLALP 12 6 41.3 203.3 2.3 7.3 4.9 2.5
TABLE-US-00029 TABLE 29 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio (Fold) ID Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 166 707 IVALAVLPAVAP 12 8 50.2 203.3 2.4 7.3 4.9 2.5 167 872 VLAAAVLPLVVP 12 8 41.3 219.2 2.5 7.3 4.9 2.5 168 583 AVILALAPIVAP 12 8 50.2 211.6 2.4 7.3 4.8 2.4 169 879 AAIVLLPAVVVP 12 7 50.2 219.1 2.5 7.2 4.8 2.4 170 784 VAALPAVALVVP 12 5 57.3 195.0 2.4 7.1 4.7 2.4 171 893 VIAIPAILAAAP 12 5 54.9 195.8 2.3 7.0 4.7 2.4 172 13 AAALVPVVALLP 12 6 57.3 203.3 2.3 7.0 4.7 2.4 173 809 LIVLAAPALAAP 12 7 50.2 195.8 2.2 7.0 4.7 2.4 174 445 ALAALVPALVVP 12 7 57.3 203.3 2.3 6.9 4.6 2.3 175 81 AALLPALAALLP 12 5 57.3 204.2 2.1 6.9 4.6 2.3 176 667 LAVAIVAPALVP 12 8 50.2 203.3 2.3 6.9 4.5 2.3 177 906 AVIALAPVVVAP 12 7 57.3 195.0 2.4 6.8 4.6 2.3 178 483 ILAAAIIPAALP 12 8 54.9 204.1 2.2 6.8 4.5 2.3 179 485 AILAAIVPLAVP 12 8 50.2 211.6 2.4 6.8 4.5 2.3 180 421 AAILAAPLIAVP 12 7 57.3 195.8 2.2 6.7 4.5 2.3 181 585 ALIVAIAPALVP 12 8 50.2 211.6 2.4 6.6 4.4 2.2 182 424 AVVVAAPVLALP 12 7 57.3 195.0 2.4 6.6 4.4 2.2 183 364 LVAAVAPALIVP 12 7 50.2 203.3 2.3 6.5 4.3 2.2 184 402 ALAAVIPAAILP 12 7 54.9 195.8 2.2 6.4 4.3 2.2 185 462 IAAVLVPAVALP 12 7 57.3 203.3 2.4 6.3 4.2 2.1 186 265 VLAIAPLLAAVP 12 6 41.3 211.6 2.3 6.0 4.0 2.0 187 301 VIAAPVLAVLAP 12 6 57.3 203.3 2.4 6.0 4.0 2.0 188 183 LLAAPVVIALAP 12 6 57.3 211.6 2.4 6.0 4.0 2.0 189 243 AAVLLPVALAAP 12 6 57.3 187.5 2.1 5.9 3.9 2.0 190 664 ILIAIAIPAAAP 12 8 54.9 204.1 2.3 5.7 3.8 1.9 191 783 IVALVPAVAIAP 12 6 50.2 203.3 2.5 5.7 3.8 1.9 192 502 AIVALAVPVLAP 12 8 50.2 203.3 2.4 5.6 3.7 1.9 193 262 ALIAVPAIIVAP 12 6 50.2 211.6 2.4 5.5 3.7 1.5 194 683 LAIVLAAPAVLP 12 8 50.2 211.7 2.4 5.5 3.2 1.9 195 830 IALVAAPVALVP 12 7 57.3 203.3 2.4 5.3 3.5 1.8 196 764 AVALAVLPAVVP 12 8 57.3 195.0 2.3 5.0 3.4 1.7 197 807 AVALAVPALVLP 12 7 57.3 203.3 2.3 5.0 3.3 1.7 198 184 LAAIVPAIIAVP 12 6 50.2 211.6 2.4 4.8 3.2 1.6 199 305 IALAAPILLAAP 12 6 57.3 204.2 2.2 4.8 3.2 1.6 200 101 LVALAPVAAVLP 12 6 57.3 203.3 2.3 4.5 3.0 1.5 201 304 AIILAPIAAIAP 12 6 57.3 204.2 2.3 4.4 3.0 1.5 202 604 VALIAVAPAVVP 12 3 57.3 195.0 2.4 4.3 2.5 1.5 203 645 ALAVVALPAIVP 12 8 50.2 203.3 2.4 4.3 2.9 1.5 204 201 LALAVPALAALP 12 6 57.3 195.8 2.1 4.2 2.8 1.4 205 163 LALVLPAALAAP 12 6 57.3 195.8 2.1 4.1 2.4 1.4 206 832 AVAAIVPVIVAP 12 7 43.2 195.0 2.5 4.1 2.7 1.4 207 182 ALIAPVVALVAP 12 6 57.3 203.3 2.4 4.0 2.7 1.4 208 23 VVLVLPAAAAVP 12 6 57.3 195.0 2.4 4.0 2.6 1.3 209 105 LLALAPAALLAP 12 6 57.3 204.1 2.1 4.0 2.6 1.3 210 561 AAVAIVLPAVVP 12 8 50.2 195.0 2.4 3.9 2.6 1.3 211 765 AVALAVVPAVLP 12 8 57.3 195.0 2.3 3.8 2.2 1.3 212 684 AAIVLALPAVLP 12 8 50.2 211.7 2.4 3.5 2.1 1.2 213 143 AVLAVPAVLVAP 12 6 57.3 195.0 2.4 3.3 2.2 1.1 214 504 LIVALAVPALAP 12 8 50.2 211.7 2.4 3.3 2.2 1.1 215 22 AVVLVPVLAAAP 12 6 57.3 195.0 2.4 3.1 2.1 1.1 216 5 AAALLPVALVAP 12 6 57.3 187.5 21 3.1 2.1 1.0 217 283 AALLAPALIVAP 12 6 50.2 195.8 2.2 3.1 2.0 1.0 218 65 IAIVAPVVALAP 12 6 50.2 203.3 2.4 3.0 2.0 1.0 219 883 LAIVPAAIAALP 12 6 50.2 195.8 2.2 3.0 2.0 1.0 220 123 AAIIVPAALLAP 12 6 50.2 195.8 2.2 2.9 2.0 1.0
TABLE-US-00030 TABLE 30 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio (Fold) ID Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 221 284 ALIAPAVALIVP 12 5 50.2 211.7 2.4 2.8 1.8 0.9 222 205 ALALVPAIAALP 12 6 57.3 195.8 2.2 2.6 1.7 0.9 223 42 VAALPVVAVVAP 12 5 57.3 186.7 2.4 2.5 1.7 0.8 224 121 AIVALPALALAP 12 6 50.2 195.8 2.2 2.5 1.7 0.8 225 25 IVAVAPALVALP 12 6 50.2 203.3 2.4 2.4 1.6 0.8 226 24 IALAAPALIVAP 12 6 50.2 195.8 2.2 2.3 1.6 0.8 227 204 LIAALPAVAALP 12 6 57.3 195.8 2.2 2.2 1.5 0.8 228 12 LLAAVPAVLLAP 12 6 57.3 211.7 2.3 2.2 1.5 0.7 229 43 LLAAPLVVAAVP 12 5 41.3 187.5 2.1 2.1 1.4 0.7 230 103 ALIAAPILALAP 12 6 57.3 204.2 2.2 2.1 1.4 0.7 231 82 AVVLAPVAAVLP 12 6 57.3 195.0 2.4 2.1 1.4 0.7 232 4 ALALLPVAALAP 12 6 57.3 195.8 2.1 2.0 1.3 0.7 233 85 LLVLPAAALAAP 12 5 57.3 195.8 2.1 1.9 1.3 0.7 234 63 AALLVPALVAVP 12 6 57.3 203.3 2.3 1.9 1.3 0.7 235 44 ALAVPVALLVAP 12 5 57.3 203.3 2.3 1.6 1.1 0.5 236 84 AAVAAPLLLALP 12 6 41.3 195.8 2.1 1.5 1.0 0.5 237 62 VALLAPVALAVP 12 6 57.3 203.3 2.3 1.4 0.9 0.5 238 83 LAVAAPLALALP 12 6 41.3 195.8 2.1 1.4 0.9 0.5 239 102 LALAPAALALLP 12 5 57.3 204.2 2.1 1.4 0.9 0.5 240 623 VAAAIALPAIVP 12 8 50.2 187.5 2.3 0.8 0.6 0.3 19.6 .+-. 13.1 .+-. 1.1 6.6 .+-. 1.6 0.5
[0349] Moreover, compared to reference CPPs (B type: MTM12 and C type: MTD85), novel 240 aMTDs averaged of 13.+-.1.1 (maximum 109.9) and 6.6.+-.0.5 (maximum 55.5) fold higher cell-permeability, respectively (Tables 26-31).
TABLE-US-00031 TABLE 31 Negative Control rP38 MTM12 MTD85 aMTD 19.6 .+-. 1.6* 13.1 .+-. 1.1* 6.6 .+-. 0.5* The Average (Best: 164.2) (Best: 109.9) (Best: 55.5) of 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to rP38, MTM12 or MTD85)
[0350] In addition, cell-permeability of 31 rPeptides has been compared with that of 240 aMTDs (0.3.+-.0.04; Tables 32 and 33).
TABLE-US-00032 TABLE 32 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Relative Ratio Number ID Sequence Length (PP) (II) (AI) (GRAVY) to aMTD AVE 1 692 PAPLPPVVILAV 12 1, 3, 5, 6 105.5 186.7 1.8 0.74 2 26 AAIALAAPLAIV 12 8 18.1 204.2 2.5 0.65 3 113 PVAVALLIAVPP 12 1, 11, 12 57.3 195.0 2.1 0.61 4 466 IIAAAAPLAIIP 12 7, 12 22.8 204.2 2.3 0.52 5 167 VAIAIPAALAIP 12 6, 12 20.4 195.8 2.3 0.50 6 97 ALLAAPPALLAL 12 6, 7 57.3 204.2 2.1 0.41 7 390 VPLLVPVVPVVP 12 2, 6, 9, 12 105.4 210.0 2.2 0.41 8 426 AAALAIPLAIIP 12 7, 12 4.37 204.2 2.2 0.40 9 214 ALIVAPALMALP 12 6, 12 60.5 187.5 2.2 0.33 10 68 VAPVLPAAPLVP 12 3, 6, 9, 12 105.5 162.5 1.6 0.32 11 39 CYNTSPCTGCCY 12 6 52.5 0.0 0.0 0.29 12 934 LILAPAAVVAAA 12 5 57.3 195.8 2.5 0.28 13 938 VPVLLPVVVPVP 12 2, 6, 10, 12 121.5 210.0 2.2 0.28 14 329 LPVLVPVVPVVP 12 2, 6, 9, 12 121.5 210.0 2.2 0.23 15 606 AAAIAAIPIIIP 12 8, 12 4.4 204.2 2.4 0.20 16 49 VVPAAPAVPVVP 12 3, 6, 9, 12 121.5 145.8 1.7 0.18 17 139 TGSTNSPTCTST 12 7 53.4 0.0 -0.7 0.17 18 772 LPVAPVIPIIVP 12 2, 5, 8, 12 79.9 210.8 2 1 0.16 19 921 IWWFVVLPLVVP 12 8, 12 41.3 194.2 2.2 0.14 20 66 AGVLGGPIMGVP 12 7, 12 35.5 121.7 1.3 0.13 21 693 AAPVLPVAVPIV 12 3, 6, 10 82.3 186.7 2.1 0.13 22 18 NYCCTPTTNGQS 12 6 47.9 0.0 -0.9 0.10 23 16 NNSCTTYTNGSQ 12 None 47.4 0.0 -1.4 0.08 24 227 LAAIVPIAAAVP 12 6, 12 34.2 187.5 2.2 0.08 25 17 GGCSAPQTTCSN 12 6 51.6 8.3 -0.5 0.08 26 67 LDAEVPLADDVP 12 6, 12 34.2 130.0 0.3 0.08 27 635 GSTGGSQQNNQY 12 None 31.9 0.0 -1.9 0.07 28 29 VLPPLPVLPVLP 12 3, 4, 6, 9, 12 121.5 202.5 1.7 0.07 29 57 QNNCNTSSQGGG 12 None 52.4 0.0 -1.6 0.06 30 700 GTSNTCQSNQNS 12 None 19.1 0.0 -1.6 0.05 31 38 YYNQSTCGGQCY 12 ND 53.8 0.0 -1.0 0.05 AVE 0.3 .+-. 0.04
TABLE-US-00033 TABLE 33 Relative Ratio to aMTD AVE* rPeptide 0.3 .+-. 0.04 The Average of 31 aMTDs *Out of 240 aMTDs, average relative fold of aMTD had been 19.6 fold compared to type A (rP38).
[0351] In summary, relative cell-permeability of aMTDs has shown maximum of 164.0, 109.9 and 55.5 fold higher to rP38, MTM12 and MTD85, respectively. In average of total 240 aMTD sequences, 19.6.+-.1.6, 13.1.+-.1.1 and 6.6.+-.0.5 fold higher cell-permeability are shown to the rP38, MTM12 and MTD85, respectively (Tables 26-31). Relative cell-permeability of negative control (rP38) to the 240 aMTDs is only 0.3.+-.0.04 fold.
[0352] 4-5. Intracellular Delivery and Localization of aMTD-Fused Recombinant Proteins
[0353] Recombinant proteins fused to the aMTDs were tested to determine their intracellular delivery and localization by laser scanning confocal microscopy with a negative control (rP38) and previous published CPPs (MTM12 and MTD85) as the positive control references. NIH3T3 cells were exposed to 10 .mu.M of FITC-labeled protein for 1 hour at 37, and nuclei were counterstained with DAPI. Then, cells were examined by confocal laser scanning microscopy (FIG. 7). Recombinant proteins fused to aMTDs clearly display intracellular delivery and cytoplasmic localization (FIG. 7) that are typically higher than the reference CPPs (MTM12 and MTD85). The rP38-fused recombinant protein did not show internalized fluorescence signal (FIG. 7a). In addition, as seen in FIG. 8, rPeptides (his-tagged CRA recombinant proteins fused to each rPeptide) display lower- or non-cell-permeability.
[0354] 4-6. Summary of Quantitative and Visual Cell-Permeability of Newly Developed aMTDs
[0355] Histidine-tagged aMTD-fused cargo recombinant proteins have been greatly enhanced in their solubility and yield. Thus, FITC-conjugated recombinant proteins have also been tested to quantitate and visualize intracellular localization of the proteins and demonstrated higher cell-permeability compared to the reference CPPs.
[0356] In the previous studies using the hydrophobic signal-sequence-derived CPPs--MTS/MTM or MTDs, 17 published sequences have been identified and analyzed in various characteristics such as length, molecular weight, pI value, bending potential, rigidity, flexibility, structural feature, hydropathy, amino acid residue and composition, and secondary structure of the peptides. Based on these analytical data of the sequences, novel artificial and non-natural peptide sequences designated as advanced MTDs (aMTDs) have been invented and determined their functional activity in intracellular delivery potential with aMTD-fused recombinant proteins.
[0357] aMTD-fused recombinant proteins have promoted the ability of protein transduction into the cells compared to the recombinant proteins containing rPeptides and/or reference hydrophobic CPPs (MTM12 and MTD85). According to the results, it has been demonstrated that critical factors of cell-penetrating peptide sequences play a major role to determine peptide-mediated intracellular delivery by penetrating plasma membrane. In addition, cell-permeability can considerably be improved by following the rational that all satisfy the critical factors.
5. Structure/Sequence Activity Relationship (SAR) of aMTDs on Delivery Potential
[0358] After determining the cell-permeability of novel aMTDs, structure/sequence activity relationship (SAR) has been analyzed for each critical factor in selected some of and all of novel aMTDs (FIGS. 13 to 16 and Table 34).
TABLE-US-00034 TABLE 34 Rank of Rigidity/ Sturctural Relative Ratio Amino Acid Delivery Flexibility Feature Hydropathy (Fold) Composition Potential (II) (AI) (GRAVY) A B C A V I L 1~10 55.9 199.2 2.3 112.7 75.5 38.1 4.0 3.5 0.4 2.1 11~20 51.2 205.8 2.4 56.2 37.6 19.0 4.0 2.7 1.7 1.6 21~30 49.1 199.2 2.3 43.6 28.9 14.6 4.3 2.7 1.4 1.6 31~40 52.7 201.0 2.4 34.8 23.3 11.8 4.2 2.7 1.5 1.6 41~50 53.8 201.9 2.3 30.0 20.0 10.1 4.3 2.3 1.1 2.3 51~60 51.5 205.2 2.4 23.5 15.7 7.9 4.4 2.1 1.5 2.0 222~231 52.2 197.2 2.3 2.2 1.5 0.8 4.5 2.1 1.0 2.4 232~241 54.1 199.7 2.2 1.7 1.2 0.6 4.6 1.7 0.2 3.5
[0359] 5-1. Proline Position:
[0360] In regards to the bending potential (proline position: PP), aMTDs with its proline at 7' or 8' amino acid in their sequences have much higher cell-permeability compared to the sequences in which their proline position is at 5' or 6' (FIGS. 14a and 15a).
[0361] 5-2. Hydropathy:
[0362] In addition, when the aMTDs have GRAVY (Grand Average of Hydropathy) ranging in 2.1-2.2, these sequences display relatively lower cell-permeability, while the aMTDs with 2.3-2.6 GRAVY are shown significantly higher one (FIGS. 14b and 15b).
[0363] 5-3. rPeptide SAR:
[0364] To the SAR of aMTDs, rPeptides have shown similar SAR correlations in the cell-permeability, pertaining to their proline position (PP) and hydropathy (GRAVY). These results confirms that rPeptides with high GRAVY (2.4.about.2.6) have better cell-permeability (FIG. 16).
[0365] 5-4. Analysis of Amino Acid Composition:
[0366] In addition to proline position and hydropathy, the difference of amino acid composition is also analyzed. Since aMTDs are designed based on critical factors, each aMTD-fused recombinant protein has equally two proline sequences in the composition. Other hydrophobic and aliphatic amino acids--alanine, isoleucine, leucine and valine --are combined to form the rest of aMTD peptide sequences.
[0367] Alanine: In the composition of amino acids, the result does not show a significant difference by the number of alanine in terms of the aMTD's delivery potential because all of the aMTDs have three to five alanines. In the sequences, however, four alanine compositions show the most effective delivery potential (geometric mean) (FIG. 13a).
[0368] Leucine and Isoleucine: Also, the compositions of isoleucine and leucine in the aMTD sequences show inverse relationship between the number of amino acid (I and L) and delivery potential of aMTDs. Lower number of isoleucine and leucine in the sequences tends to have higher delivery potential (geometric mean) (FIGS. 13a and 13b).
[0369] Valine: Conversely, the composition of valine of aMTD sequences shows positive correlation with their cell-permeability. When the number of valine in the sequence is low, the delivery potential of aMTD is also relatively low (FIG. 13b).
[0370] Ten aMTDs having the highest cell-permeability are selected (average geometric mean: 2584.+-.126). Their average number of valine in the sequences is 3.5; 10 aMTDs having relatively low cell-permeability (average geometric mean: 80.+-.4) had average of 1.9 valine amino acids. The average number of valine in the sequences is lowered as their cell-permeability is also lowered as shown in FIG. 13b. Compared to higher cell-permeable aMTDs group, lower sequences had average of 1.9 in their valine composition. Therefore, to obtain high cell-permeable sequence, an average of 2-4 valines should be composed in the sequence.
[0371] 5-5. Conclusion of SAR Analysis:
[0372] As seen in FIG. 15, all 240 aMTDs have been examined for these association of the cell-permeability and the critical factors: bending potential (PP), rigidity/flexibility (II), structure feature (AI), and hydropathy (GRAVY), amino acid length and composition. Through this analysis, cell-permeability of aMTDs tends to be lower when their central proline position is at 5' or 6' and GRAVY is 2.1 or lower (FIG. 15). Moreover, after investigating 10 higher and 10 lower cell-permeable aMTDs, these trends are clearly shown to confirm the association of cell-permeability with the central proline position and hydropathy.
6. Experimental Confirmation of Index Range/Feature of Critical Factors
[0373] The range and feature of five out of six critical factors have been empirically and experimentally determined that are also included in the index range and feature of the critical factors initially proposed before conducting the experiments and SAR analysis. In terms of index range and feature of critical factors of newly developed 240 aMTDs, the bending potential (proline position: PP), rigidity/flexibility (Instability Index: II), structural feature (Aliphatic Index: AI), hydropathy (GRAVY), amino acid length and composition are all within the characteristics of the critical factors derived from analysis of reference hydrophobic CPPs.
[0374] Therefore, our hypothesis to design and develop new hydrophobic CPP sequences as advanced MTDs is empirically and experimentally proved and demonstrated that critical factor-based new aMTD rational design is correct.
TABLE-US-00035 TABLE 35 Summarized Critical Factors of aMTD Analysis of Newly Designed CPPs Experimental Results Critical Factor Range Range Bending Potential Proline presences in Proline presences in (Proline Position: PP) the middle (5', 6', 7' the middle (5', 6', 7' or 8') and at the or 8') and at the end of peptides end of peptides Rigidity/Flexibility 40-60 41.3-57.3 (Instability Index: II) Structural Feature 180-220 187.5-220.0 (Aliphatic Index: AI) Hydropathy 2.1-2.6 2.2-2.6 (Grand Average of Hydropathy GRAVY) Length 9-13 12 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
7. Discovery and Development of Protein-Based New Biotherapeutics with MITT Enabled by aMTDs for Protein Therapy
[0375] Total of 240 aMTD sequences have been designed and developed based on the critical factors. Quantitative and visual cell-permeability of 240 aMTDs (hydrophobic, flexible, bending, aliphatic and 12 a/a-length peptides) are all practically determined.
[0376] To measure the cell-permeability of aMTDs, rPeptides have also been designed and tested. As seen in FIGS. 13 to 15, there are vivid association of cell-permeability and the critical factors of the peptides. Out of these critical factors, we are able to configure that the most effective cell-permeable aMTDs have the amino acid length of 12; composition of A, V, L, I and P; multiple proline located at either 7' or 8' and at the end (12'); instability index ranged of 41.3-57.3; aliphatic index ranged of 187.5-220.0; and hydropathy (GRAVY) ranged of 2.2-2.6.
[0377] These examined critical factors are within the range that we have set for our critical factors; therefore, we are able to confirm that the aMTDs that satisfy these critical factors have relatively high cell-permeability and much higher intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.
[0378] It has been widely evident that many human diseases are caused by proteins with deficiency or over-expression that causes mutations such as gain-of-function or loss-of-function. If biologically active proteins could be delivered for replacing abnormal proteins within a short time frame, possibly within an hour or two, in a quantitative manner, the dosage may be regulated depending on when and how proteins may be needed. By significantly improving the solubility and yield of novel aMTD in this invention (Table 31), one could expect its practical potential as an agent to effectively deliver therapeutic macromolecules such as proteins, peptides, nucleic acids, and other chemical compounds into live cells as well as live mammals including human. Therefore, newly developed MITT utilizing the pool (240) of novel aMTDs can be used as a platform technology for discovery and development of protein-based biotherapeutics to apprehend intracellular protein therapy after determining the optimal cargo-aMTD relationship.
[0379] The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.
Example 1. Development of Novel Advanced Macromolecule Transduction Domain (aMTD)
[0380] H-regions of signal sequences (HRSP)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined `critical factors` to have a `common function,` to facilitate protein translocation across the plasma membrane with similar mechanism to the analyzed CPPs.
[0381] The structural motif as follows:
[0382] In Table 9, universal common sequence/structural motif is provided as follows. The amino acid length of the peptides in this invention ranges from 9 to 13 amino acids, mostly 12 amino acids, and their bending potentials are dependent with the presence and location of proline in the middle of sequence (at 5', 6', 7' or 8' amino acid) and at the end of peptide (at 12') for recombinant protein bending. Instability index (II) for rigidity/flexibility of aMTDs is II<40, grand average of hydropathy (GRAVY) for hydropathy is around 2.2, and aliphatic index (AI) for structural features is around 200 (Table 9). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and summarized in Tables 10 to 15.
Example 2. Construction of Expression Vectors for Recombinant Proteins Fused to aMTDs
[0383] Our newly developed technology has enabled us to expand the method for making cell-permeable recombinant proteins. The expression vectors were designed for histidine-tagged CRA proteins fused with aMTDs or rPeptides. To construct expression vectors for recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify each designed aMTD or rPeptide fused to CRA.
[0384] The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1.times. reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea) was digested on the restriction enzyme site between Nde I (5') and Sal I (3') involving 35 cycles of denaturation (95.degree. C.), annealing (62.degree. C.), and extension (72.degree. C.) for 30 seconds each. For the last extension cycle, the PCR reactions remained for 5 minutes at 72.degree. C. Then, they were cloned into the site of pET-28a(+) vectors (Novagen, Darmstadt, Germany). DNA ligation was performed using T4 DNA ligase at 4.degree. C. overnight. These plasmids were mixed with competent cells of E. coli DH5-alpha strain on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat shocked in the water bath at 42.degree. C. for 90 seconds. Then, the mixture added with LB broth media was recovered in 37.degree. C. shaking incubator for 1 hour. Transformant was plated on LB broth agar plate with kanamycin (50 .mu.g/mL) (Biopure, Johnson City, Tenn., USA) before incubating at 37.degree. C. overnight. From a single colony, plasmid DNA was extracted, and after the digestion of Nde I and Sal I restriction enzymes, digested DNA was confirmed at 645 bp by using 1.2% agarose gels electrophoresis (FIG. 2). PCR primers for the CRA recombinant proteins fused to aMTD and random peptides (rPeptide) are summarized in Tables 23 to 30. Amino acid sequences of aMTD and rPeptide primers are shown in Tables 31 to 38.
Example 3. Inducible Expression, Purification and Preparation of Recombinant Proteins Fused to aMTDs and rPeptides
[0385] To express recombinant proteins, pET-28a(+) vectors for the expression of CRA proteins fused to a negative control [rPeptide 38 (rP38)], reference hydrophobic CPPs (MTM.sub.12 and MTD.sub.85) and aMTDs were transformed in E. coli BL21 (DE3) strains. Cells were grown at 37.degree. C. in LB medium containing kanamycin (50 .mu.g/ml) with a vigorous shaking and induced at OD.sub.600=0.6 by adding 0.7 mM IPTG (Biopure) for 2 hours at 37.degree. C. Induced recombinant proteins were loaded on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (InstantBlue, Expedeon, Novexin, UK) (FIG. 3).
[0386] The E. coli cultures were harvested by centrifugation at 5,000.times. rpm for 10 minutes, and the supernatant was discarded. The pellet was re-suspended in the lysis buffer (50 mM NaH.sub.2PO.sub.4, 10 mM Imidazol, 300 mM NaCl, pH 8.0). The cell lysates were sonicated on ice using a sonicator (Sonics and Materials, Inc., Newtown, Conn., USA) equipped with a probe. After centrifuging the cell lysates at 5,000.times. rpm for 10 minutes to pellet the cellular debris, the supernatant was incubated with lysis buffer-equilibrated Ni-NTA resin (Qiagen, Hilden, Germany) gently by open-column system (Bio-rad, Hercules, Calif., USA). After washing protein-bound resin with 200 ml wash buffer (50 mM NaH.sub.2PO.sub.4, 20 mM Imidazol, 300 mM NaCl, pH 8.0), the bounded proteins were eluted with elution buffer (50 mM NaH.sub.2PO.sub.4, 250 mM Imidazol, 300 mM NaCl, pH 8.0).
[0387] Recombinant proteins purified under natural condition were analyzed on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (FIG. 4). All of the recombinant proteins were dialyzed for 8 hours and overnight against physiological buffer, a 1:1 mixture of cell culture medium (Dulbecco's Modified Eagle's Medium: DMEM, Hyclone, Logan, Utah, USA) and Dulbecco's phosphate buffered saline (DPBS, Gibco, Grand Island, N.Y., USA). From 316 aMTDs and 141 rPeptides cloned, 240 aMTD- and 31 rPeptide-fused recombinant proteins were induced, purified, prepared and analyzed for their cell-permeability.
Example 4. Determination of Quantitative Cell-Permeability of Recombinant Proteins
[0388] For quantitative cell-permeability, the aMTD- or rPeptide-fused recombinant proteins were conjugated to fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo., USA). RAW 264.7 cells were treated with 10 .mu.M FITC-labeled recombinant proteins for 1 hour at 37.degree. C., washed three times with cold PBS, treated with 0.25% tripsin/EDTA (Sigma-Aldrich, St. Louis, Mo.) for 20 minutes at 37.degree. C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins were analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software (FIGS. 5 to 6). The relative cell-permeability of aMTDs were measured and compared with the negative control (rP38) and reference hydrophobic CPPs (MTM12 and MTD85) (Table 31).
Example 5. Determination of Cell-Permeability and Intracellular Localization of Recombinant Proteins
[0389] For a visual reference of cell-permeability, NIH3T3 cells were cultured for 24 hours on coverslip in 24-wells chamber slides, treated with 10 .mu.M FITC-conjugated recombinant proteins for 1 hour at 37.degree. C., and washed three times with cold PBS. Treated cells were fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 10 minutes at room temperature, washed three times with PBS, and mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif., USA), and counter stained with DAPI (4',6-diamidino-2-phenylindole). The intracellular localization of the fluorescent signal was determined by confocal laser scanning microscopy (LSM700, Zeiss, Germany; FIGS. 7 and 8).
Example 6-1. Cloning of aMTD/SD-Fused SOCS3 Recombinant Protein
[0390] Full-length cDNA for human SOCS3 (SEQ ID NO: 815) was purchased from Origene (USA). Histidine-tagged human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) using primers for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1.times. reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5') and Sal I (3') involving 35 cycles of denaturing (95.degree. C.), annealing (62.degree. C.), and extending (72.degree. C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72.degree. C. The PCR products were subcloned into 6.times. His expression vector, pET-28a(+) (Novagen, Darmstadt, Germany). Coding sequence for SDA or SDB fused to C terminus of his-tagged aMTD-SOCS3 was cloned at BamHI (5') and SalI (3') in pET-28a(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.
TABLE-US-00036 TABLE 36 Cargo SD Recombinant Protein 5' Primers 3' Primers SOCS3 -- HS3 5'- 5'- GGAATTCCATATGGTCACCCAC CCCGGATCCTAAA AGCAAGTTTCCCGCCGCC-3' GCGGGGCATCGTAC TGGTCCAGGAA-3' -- HM.sub.165S3 5'- 5'- GGAATTCCATATGGCGCTGGCG CCCGGATCCTAAA GTGCCGGTGGCGCTGGCGATT GCGGGGCATCGTAC GTGCCGGTCACCCACAGCAAG TGGTCCAGGAA-3' TTTC-3' A HM.sub.165S3A 5'- 5'- GGAATTCCATATGGGGCTGGCG CGCGTCGACTTACC GTGCCGGTGGCGCTGGCGATT TCGGCTGCACCGG GTGCCGGTCACCCACAGCAAG ACGGCGATAC-3' TTTC-3' B HM.sub.165S3B 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTAAA GTGCCGGTGGCGCTGGCGATT GGGTTTCCGAAGGC GTGCCGGTCACCCACAGCAAG TTGGCTATCTT-3' TTTC-3' C HM.sub.165S3C 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTAGGC GTGCCGGTGGCGCTGGCGATT CAGGTTAGCGTCGA GTGCCGGTCACCCACAGCAAG G-3' TTTC-3' D HM.sub.165S3D 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTATTTT GTGCCGGTGGCGCTGGCGATT TTCTCGGACAGATA- GTGCCGGTCACCCACAGCAAG 3' TTTC-3' E HM.sub.165S3E 5'- 5'- GGAATTCCATATGGCGCTGGCG ACGCGTCGACTTAA GTGCCGGTGGCGCTGGCGATT CCTCCAATCTGTTC GTGCCGGTCACCCACAGCAAG GCGGTGAGCCTC-3' TTTC-3'
Example 6-2. Preparation of aMTD/SD-Fused SOCS3 Recombinant Protein
[0391] To determine a stable structure of the cell-permeable aMTD/SD-fused SOCS3 recombinant protein, a pET-28a(+) vector and an E. coli BL21-CodonPlus (DE3)-RIL were subjected to the following experiment.
[0392] Each of the recombinant expression vectors, HS3, HMS3, HMS3A, HMS3B, HMS3C, HMS3D, and HMS3E prepared in example 6-1 was transformed into E. coli BL21 CodonPlus(DE3)-RIL by a heat shock method, and then 600 ul of each was incubated in an LB medium (Biopure, Johnson City, Tenn., USA) containing 50 .mu.g/ml of kanamycin at 37.degree. C. for 1 hour. Thereafter, the recombinant protein gene-introduced E. coli was inoculated in 7 ml of LB medium, and then incubated at 37.degree. C. overnight. The E. coli was inoculated in 700 ml of LB medium and incubated at 37.degree. C. until OD.sub.600 reached 0.6. To this culture medium, 0.6 mM of isopropyl-.beta.-D-thiogalactoside (IPTG, Gen Depot, USA) was added as a protein expression inducer, followed by further incubation at 37.degree. C. for 3 hours. This culture medium was centrifuged at 4.degree. C. and 8,000 rpm for 10 minutes and a supernatant was discarded to recover a cell pellet. The cell pellet thus recovered was suspended in a lysis buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl, 8 M Urea, pH 8.0), and cells were disrupted by sonication (on/off time: 30 sec/30 sec, on time 2 hours, amplify 40%), and centrifuged at 15,000 rpm for 30 min to obtain a soluble fraction and an insoluble fraction.
[0393] This insoluble fraction was suspended in a denature lysis buffer (8 M Urea, 10 mM Tris, 100 mM Sodium phosphate) and purified by Ni.sup.2+ affinity chromatography as directed by the supplier(Qiagen, Hilden, Germany) and refolded by dialyzing with a refolding buffer (0.55 M guanidine HCl, 0.44 M L-arginine, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 100 mM NDSB, 2 mM reduced glutathione, and 0.2 mM oxidized glutathione). After purification, the proteins were put in a SnakeSkin Dialysis Tubing bag (pore size: 10000 mw, Thermo scientific, USA) and then they were dialyzed by physiological buffer (DMEM). The strain lysate where protein expression was not induced, the strain lysate where protein expression was induced by addition of IPTG, and purified proteins were loaded on SDS-PAGE to analyze protein expression characteristics and expression levels (FIGS. 19 and 20).
[0394] As shown in FIG. 19, it was confirmed that SOCS3 recombinant proteins showed high expression levels in the BL21CodonPlus(DE3)-RIL strain. SOCS3 recombinant proteins containing aMTD.sub.165 and solubilization domain (HM.sub.165S3A and HM.sub.165S3B) had little tendency to precipitate whereas recombinant SOCS3 proteins lacking a solubilization domain (HM.sub.165S3) or lacking an aMTD and a SD (HS3) were largely insoluble. Solubility of aMTD/SD-fused SOCS3 proteins was scored on a 5 point scale compared with that of SOCS3 proteins lacking the solubilization domain.
Example 6-3. Determination of Solubility/Yield of aMTD/SD-Fused SOCS3 Recombinant Proteins According to SD Type
[0395] To determine aMTD/SD-fused SOCS3 recombinant proteins having optimal cell-permeability, solubilization domains were replaced in the same manner as in Example 6-2 to prepare 5 kinds of aMTD/SD-fused SOCS3 recombinant proteins, and their solubility/yield were measured (FIG. 19).
[0396] As shown in FIG. 19, it was confirmed that the aMTD/SD-fused SOCS3 recombinant protein prepared by fusing with SDB among the different SDs showed the highest solubility/yield. Therefore, the SDB-fused iCP-SOCS3 recombinant protein was used in the subsequent experiment.
Example 6-4. Comparison Between aMTD/SD-Fused SOCS3 Recombinant Protein and Basic CPP/SD-Fused SOCS3 Recombinant Protein
[0397] To compare the solubility/yield, cell/tissue-permeability, mechanism of cytopermeability of aMTD/SD-fused SOCS3 recombinant proteins to those of conventional basic CPP/SD-fused SOCS3 recombinant proteins, cloning, preparation, and measurement of solubility/yield of the basic CPP/SD-fused SOCS3 recombinant proteins were performed in the same manner as in Examples 6-1 to 6-3 except for a known basic CPP (TAT or PolyR) being used instead of aMTD. Sequences of amino acids and nucleotides of basic CPP, and the primers used in this example are shown in FIG. 97.
[0398] The solubility/yield of aMTD165/SD-fused SOCS3 recombinant proteins was much higher than that of TAT/SD-fused SOCS3 or PolyR/SD-fused SOCS3 recombinant proteins (FIG. 98).
Example 7-1. Cell-Permeability Test
[0399] To examine cell-permeability of SOCS3 recombinant protein, SOCS3 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (KCLB, Seoul, South Korea) (FIG. 20) or NIH3T3 cells (KCLB, Seoul, South Korea) (FIG. 21) were treated with 10 .mu.M FITC-labeled SOCS3 recombinant proteins and cultivated for 1 hr at 37.degree. C.
[0400] In this regard, RAW 264.7 cells were cultured in a DMEM medium containing 10% fetal bovine serum (FBS, Hyclone, USA) and 500 mg/ml of 1% penicillin/streptomycin (Hyclone, USA).
[0401] After cultivation, the cells were washed three times with ice-cold PBS (Phosphate-buffered saline, Hyclone, USA) and treated with proteinase K (10 .mu.g/mL, SIGMA, USA) to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FlowJo cytometric analysis software, Guava, Millipore, Darmstadt, Germany). Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control (FIG. 20). Each of NIH3T3 cells was incubated for 1 hour at 37.degree. C. with 10 .mu.M FITC-labeled SOCS3 protein. For nuclear staining, a mixture of VECTASHIELD Mounting Medium (Vector Laboratories, Burlingame, Calif.) and DAPI (4',6-diamidino-2-phenylindole) was added to NIH3T3 cells, and visualized using a confocal laser microscope (LSM700, Zeiss, Germany) (FIG. 21).
[0402] As shown in FIGS. 20 and 21, SOCS3 recombinant proteins containing aMTD.sub.165 (HM.sub.165S3, HM.sub.165S3A and HM.sub.165S3B) efficiently entered the cells (FIGS. 20 and 21) and were localized to various extents in cytoplasm (FIG. 21). In contrast, SOCS3 protein containing non-aMTD (HS3) did not appear to enter cells. While all SOCS3 proteins containing aMTD.sub.165 transduced into the cells, HM.sub.165S3B displayed more uniform cellular distribution, and protein uptake of HM.sub.165S3B was also very efficient.
Example 7-1-2. Comparison Between aMTD/SD-Fused SOCS3 Recombinant Protein and Basic CPP/SD-Fused SOCS3 Recombinant Protein
[0403] The cell-permeability of basic CPP/SD-fused SOCS3 recombinant proteins was assessed by the same method as used in Example 7-1 except for a known basic CPP (TAT or PolyR) being used instead of aMTD. The results of the assessment were shown in FIG. 99.
[0404] According to the results, all recombinant proteins exhibited cell-permeability. Among the proteins, aMTD/SD-fused SOCS3 recombinant protein (HM.sub.165S3B) showed the highest cell-permeability.
Example 7-2. Tissue-Permeability Test
[0405] To further investigate in vivo delivery of SOCS3 recombinant proteins, ICR mice (Doo-Yeol Biotech Co. Ltd., Seoul, Korea) were intraperitoneal (IP) injected with 600 .mu.g/head of 10 .mu.M FITC (Fluorescein isothiocyanate, SIGMA, USA)-labeled SOCS3 proteins and sacrificed after 2 hrs. From the mice, the liver, kidney, spleen, lung, heart, and brain were removed and washed with PBS, and then placed on a dry ice, and embedded with an O.C.T. compound (Sakura). After cryosectioning at 20 .mu.m, tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany)(FIG. 22).
[0406] As shown in FIG. 22, SOCS3 recombinant proteins fused to aMTD.sub.165 (HM.sub.165S3, HM.sub.165S3A and HM.sub.165S3B) were distributed to a variety of tissues (liver, kidney, spleen, lung, heart and, to a lesser extent, brain). Liver showed highest levels of fluorescent cell-permeable SOCS3 since intraperitoneal administration favors the delivery of proteins to this organ via the portal circulation. SOCS3 containing aMTD.sub.165 was detectable to a lesser degree in lung, spleen and heart. aMTD/SDB-fused SOCS3 recombinant protein (HM.sub.165S3B) showed the highest systemic delivery of SOCS3 protein to the tissues compared to the SOCS3 containing only aMTD (HM.sub.165S3) or aMTD/SDA (HM.sub.165S3A) proteins. These data suggest that SOCS3 protein containing both of aMTD.sub.165 and SDB leads to higher cell-/tissue-permeability due to the increase in solubility and stability of the protein, and it displayed a dramatic synergic effect on cell-/tissue-permeability.
Example 7-2-2. Comparison Between aMTD/SD-Fused SOCS3 Recombinant Protein and Basic CPP/SD-Fused SOCS3 Recombinant Protein
[0407] The tissue-permeability of basic CPP/SD-fused SOCS3 recombinant proteins was assessed by the same method as used in Example 7-2 except for a known basic CPP (TAT or PolyR) being used instead of aMTD. The results of the assessment were shown in FIG. 100.
[0408] According to the results, only aMTD/SD-fused SOCS3 recombinant protein (HM.sub.165S3B) exhibited superior cell-permeability.
Example 8-1 Biological Activity Test of iCP-SOCS3--Inhibition Activity of IFN-.gamma.-Induced STAT Phosphorylation
[0409] It was examined whether the iCP-SOCS3 recombinant proteins prepared by fusion with combinations of aMTD and SD inhibits activation of the JAK/STAT-signaling pathway.
[0410] PANC-1 Cells (KCLB, Seoul, South Korea) were treated with 10 ng/ml IFN-.gamma. (R&D systems, Abingdon, UK) for 15 min and treated with either DMEM (vehicle) or 10 .mu.M aMTD/SD-fused SOCS3 recombinant proteins for 2 hrs. The cells were lysed in RIPA lysis buffer (Biosesang, Seongnam, Korea) containing proteinase inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. Equal amounts of lysates were separated on 10% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked using 5% skim milk in TBST and for western blot analysis incubated with the following antibodies: anti-phospho-STAT1 (Cell Signaling Technology, USA) and anti-phospho-STAT3 (Cell Signaling Technology, USA), then HRP conjugated anti-rabbit secondary antibody (Santacruz).
[0411] The well-known cytokine signaling inhibitory actions of SOCS3 are inflammation inhibition through i) inhibition of IFN-.gamma.-mediated JAK/STAT and ii) inhibition of LPS-mediated cytokine secretion. The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT1 and STAT3 by IFN-.gamma.-mediated Janus kinases (JAK) 1 and 2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. As shown in FIG. 23, All SOCS3 recombinant proteins containing aMTD (HM.sub.165S3, HM.sub.165S3A and HM.sub.165S3B), suppressed IFN-.gamma.-induced phosphorylation of STAT1 and STAT3. In contrast, STAT phosphorylation was readily detected in cells exposed to HS3, which lacks the aMTD motif required for membrane penetration, indicating that HS3, which lacks an MTD sequence did not enter the cells, has no biological activity.
Example 8-2. Biological Activity Test of iCP-SOCS3
[0412] Peritoneal macrophages were obtained from C3H/HeJ mice (Doo-Yeol Biotech Co. Ltd. Korea) Peritoneal macrophages were incubated with 10 .mu.M SOCS3 recombinant proteins (1:HS3, 2:HM.sub.165S3, 3:HM.sub.165S3A and 4:HM.sub.165S3B, respectively) for 1 hr at 37.degree. C. and then stimulated them with LPS (Lipopolysaccharide)(500 ng/ml) and/or IFN-.gamma. (100 U/ml) without removing iCP-SOCS3 proteins for 3, 6, or 9 hrs. The culture media were collected, and the extracellular levels of cytokine (TNF-.alpha., IL-6) were measured by a cytometric bead array (BD Pharmingen, San Diego, Calif., USA) according to the manufacturer's instructions.
[0413] The effect of cell-permeable SOCS3 proteins on cytokines secretion was investigated. Treatment of C3H/HeJ primary peritoneal macrophages with SOCS3 proteins containing aMTD.sub.165 suppressed TNF-.alpha. and IL-6 secretion induced by the combination of IFN-.gamma. and LPS by 50-90% during subsequent 9 hrs of incubation (FIG. 24). In particular, aMTD.sub.165/SDB-fused SOCS3 recombinant protein showed the greatest inhibitory effect on cytokine secretion. In contrast, cytokine secretion in macrophages treated with non-permeable SOCS3 protein (HS3) was unchanged, indicating that recombinant SOCS3 lacking the aMTD doesn't affect intracellular signaling. Therefore, we conclude that differences in the biological activities of HM.sub.165S3B as compared to HS3B are due to the differences in protein uptake mediated by the aMTD sequence. In light of solubility/yield, cell-/tissue-permeability, and biological effect, SOCS3 recombinant protein containing aMTD and SDB (HM.sub.165S3B) is a prototype of a new generation of improved cell-permeable SOCS3 (iCP-SOCS3), and will be selected for further evaluation as a potential anti-tumor agent.
Example 9. Preparation of Control Protein (Non-CP-SOCS3: HS3B Recombinant Protein)
[0414] As an experimental negative control, a SOCS3 recombinant protein having no cell permeability was prepared.
[0415] According to Example 6-2, SOCS3 recombinant proteins lacking SD (HM.sub.165S3) or both aMTD and SD (HS3) were found to be less soluble, produced lower yields, and showed tendency to precipitate when they were expressed and purified in E. coli. Therefore, we additionally designed and constructed SOCS3 recombinant protein containing only SDB (without aMTD.sub.165: HS3B) as a negative control (FIG. 25). Preparation, expression and purification, and measurement of solubility/yield of the recombinant proteins were performed in the same manner as in Examples 6-2 and 6-3.
TABLE-US-00037 TABLE 37 Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 B HS3B 5'- 5'- GGAATTCCATATGG CGCGTCGACTTAAA TCACCCAC GGGTTTCCGAAGGC AGCAAGTTTCCC TTGGCTATCTT-3' GCCGCC-3'
[0416] As expected, its solubility and yield increased compared to that of SOCS3 proteins lacking SDB (HS3; FIG. 26). Therefore, HS3B proteins were used as a control protein.
Example 10. Selection of aMTD for Cell-Permeability
[0417] After a basic structure of the stable recombinant proteins fused with combinations of aMTD and SD was determined, 22 aMTDs were selected for development of iCP-SOCS3 recombinant protein (Tables 38 and 39), based on the critical Factors, in order to examine which aMTD provides the highest cell-/tissue-permeability.
[0418] For comparison, 5 kinds of random peptides that do not satisfying one or more critical factors were selected (Table 40).
[0419] Solubility/yield and cell-permeability of 22 kinds of aMTD/SDB-fused SOCS3 recombinant proteins, prepared by using primers of Table 41 in the same manner as in Example 6-2, were analyzed according to Examples 6-3 and 7-1, respectively.
TABLE-US-00038 TABLE 41 Amino Acid Cargo Sequence 5' Primers 3' Primers aMTD ID SOCS3 MTM AAVLLPVLLAAP GGAATTCCATATGGCGGCGGTGCTGC CGCGTCGACTTAAAGGGTTTCCGA TGCCGGTGCTGCTGGCGGCGCCGGT AGGCTTGGCTATCTT CACCCACAGCAAGTTTCCCGCCGCC 44 ALAVPVALLVAP GGAATTCCATATGGCGCTGGCGGTGCC GGTGGCGCTGCTGGTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 81 AALLPALAALLP GGAATTCCATATGGCGGCGCTGCTGCC GGCGCTGGCGGCGCTGCTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 123 AAIIVPAALLAP GGAATTCCATATGGCGGCGATTATTGTG CCGGCGGCGCTGCTGGCGCCGGTCAC CCACAGCAAGTTTCCCGCCGCC 162 AVVALPAALIVP GGAATTCCATATGGCGGTGGTGGCGCT GCCGGCGGCGCTGATTGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 281 ALIVLPAAVAVP GGAATTCCATATGGCGCTGATTGTGCT GCCGGCGGCGGTGGCGGTGCCGGTC ACCCACAGCAAGTTTCCCGCCGCC 324 IVAVALPAALVP GGAATTCCATATGATTGTGGCGGTGGC GCTGCCGGCGGCGCTGGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 364 LVAAVAPALIVP GGAATTCCATATGCTGGTGGCGGCGGT GGCGCCGGCGCTGATTGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 365 AVIVVAPALLAP GGAATTCCATATGGCGGTGATTGTGGT GGCGCCGGCGCTGCTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 622 ALIVLAAPVAVP GGAATTCCATATGGCGCTGATTGTGCT GGCGGCGCCGGTGGCGGTGCCGGTC ACCCACAGCAAGTTTCCCGCCGCC 662 ALAVILAPVAVP GGAATTCCATATGGCGCTGGCGGTGAT TCTGGCGCCGGTGGCGGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 563 ALAVIVVPALAP GGAATTCCATATGGCGCTGGCGGTGAT TGTGGTGCCGGCGCTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 899 AVVIALPAVVAP GGAATTCCATATGGCGGTGGTGATTGC GCTGCCGGCGGTGGTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 897 AVIVPVAIIAAP GGAATTCCATATGGCGGTGATTGTGCC GGTGGCGATTATTGCGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 623 VAAAIALPAIVP GGAATTCCATATGGTGGCGGCGGCGAT TGCGCTGCCGGCGATTGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 908 VALALAPVVVAP GGAATTCCATATGGTGGCGCTGGCGCT GGCGCCGGTGGTGGTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 911 VALALPAVVVAP GGAATTGCATATGGTGGCGCTGGCGCT GCCGGCGGTGGTGGTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 2 AAAVPLLAVVVP GGAATTCCATATGGCGGCGGCGGTGC CGCTGCTGGCGGTGGTGGTGCCGGTC ACCCACAGCAAGTTTCCCGCCGCC 904 AVLAVVAPVVAP GGAATTCCATATGGCGGTGCTGGCGGT GGTGGCGCCGGTGGTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 481 AIAIAIVPVALP GGAATTCCATATGGCGATTGCGATTGC GATTGTGCCGGTGGCGCTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 787 AVALVPVIVAAP GGAATTGCATATGGCGGTGGCGCTGGT GCCGGTGATTGTGGCGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 264 LAAAPVVIVIAP GGAATTCCATATGCTGGCGGCGGCGC CGGTGGTGATTGTGATTGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 363 AVLAVAPALIVP GGAATTCCATATGGCGGTGCTGGCGGT GGCGCCGGCGCTGATTGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 121 AIVALPALALAP GGAATTGGATATGGGGATTGTGGCGCT GCCGGCGCTGGCGCTGGCGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC rPeptide ID SOCS3 921 IWWFVVLPLVVP GGAATTCCATATGATTTGGTCGTTTGTG CGCGTCGACTTAAAGGGTTTCCGAA GTGCTGCCGCTGGTGGTGCCGGTCAC GGCTTGGCTATCTT CCACAGCAAGTTTCCCGCCGCC 16 NNSCTTYTNGSQ GGAATTCCATATGAACAACAGCTGCAC CACCTATACCAACGGCAGCCAGGTCA CCCACAGCAAGTTTCCCGCCGCC 67 LDAEVPLADDVP GGAATTCCATATGCTGGATGCGGAAGT GCCGCTGGCGGATGATGTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 29 VLPPLPVLPVLP GGAATTCCATATGGTGCTGCCGCCGCT GCCGGTGCTGCCGGTGCTGCCGGTCA CCCACAGCAAGTTTCCCGCCGCC 700 GTSNTCQSNQNS GGAATTCCATATGGGCACCAGCAACAC CTGCCAGAGCAACCAGAACAGCGTCA CCCACAGCAAGTTTCCCGCCGCC
[0420] As shown in FIGS. 27 to 34, it was confirmed that most of the aMTD/SDB-fused SOCS3 recombinant proteins showed high solubility and yield and high cell permeability by aMTD. However, Random peptide-SOCS3-SDB recombinant protein showed remarkably low cell permeability.
Example 11-1. Investigation of Biological Activity for Determination of Optimal aMTD-Fused SOCS3 Recombinant Protein--1
[0421] Four kinds of aMTD/SD-fused SOCS3 recombinant proteins having high cell permeability and one kind of aMTD/SD-fused SOCS3 recombinant protein having the lowest cell permeability were selected, and their biological activity was analyzed.
[0422] PANC-1 cells (pancreatic carcinoma cell line) were seeded in a 16-well chamber slide at a density of 5.times.10.sup.3 cells/well, and then treated with 10 uM of aMTD/SD-fused SOCS3 for 24 hours. Apoptotic cells were analyzed using terminal dUTP nick-end labeling (TUNEL) assay with In Situ Cell Death Detection kit TMR red (Roche, 4056 Basel, Switzerland). Cells were treated with either 10 .mu.M SOCS3 recombinant protein or buffer alone for 16 hrs with 2% fetal bovine serum (Hyclone, Logan, Utah, USA). Treated cells were washed with cold PBS two times, fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 1 hr at room temperature, and incubated in 0.1% Triton X-100 for 2 min on the ice. Cells were washed with cold PBS twice, and treated TUNEL reaction mixture for 1 hr at 37.degree. C. in dark, washed cold PBS three times and observed by fluorescence microscopy (Nikon, Tokyo, Japan).
[0423] As shown in FIG. 35, most of the aMTD/SDB-fused SOCS3 recombinant proteins induced cell death of pancreatic carcinoma cells, and of them, aMTD.sub.165 or aMTD.sub.324-fused SOCS3 recombinant protein induced death of the largest number of cancer cells.
Example 11-2. Investigation of Biological Activity for Determination of Optimal aMTD-Fused SOCS3 Recombinant Protein--2
[0424] AGS cells (gastric carcinoma cell line) (American Type Culture Collection; ATCC) were seeded in a 12-well plate at a density of 1.times.10.sup.5 cells/well, and then treated with 10 uM of aMTD/SD-fused SOCS3 for 14 hours. Cancer cell death was analyzed by Annexin V analysis. Annexin V/7-Aminoactinomycin D (7-AAD) staining was performed using flow cytometry according to the manufacturer's guidelines (BD Pharmingen, San Diego, Calif., USA). Briefly, cells were washed three times with ice-cold PBS. The cells were then resuspended in 100 .mu.l of binding buffer and incubated with 1 .mu.l of 7-AAD and 1 .mu.l of annexin V-PE for 30 min in the dark at 37.degree. C. Flow cytometric analysis was immediately performed using a guava easyCyte.TM. 8 Instrument (Merck Millipore, Darmstadt, Germany).
[0425] As shown in FIG. 36, most of the aMTD/SDB-fused SOCS3 recombinant proteins induced cell death of gastric carcinoma cells, and of them, aMTD.sub.165 or aMTD.sub.281-fused SOCS3 recombinant protein induced death of the largest number of cancer cells.
Example 11-3. Investigation of Biological Activity for Determination of Optimal aMTD-Fused SOCS3 Recombinant Protein--3
[0426] AGS cells (gastric cancer cell line) were seeded in a 12 well plate at a density of 2.5.times.10.sup.5 per well, grown to 90% confluence. Confluent AGS cells were incubated with 10 .mu.M HM#S3B in serum-free medium for 2 hrs prior to changing the growth medium (DMEM/F12, Hyclone, Logan, Utah, USA) and washed twice with PBS, and the monolayer at the center of the well was "wounded" by scraping with a sterilized white pipette tip. Cells were cultured for an additional 24 hrs and cell migration was observed by phase contrast microscopy (Nikon, ECLIPSE Ts2). The migration was quantified by counting the number of cells that migrated from the wound edge into the clear area.
[0427] As shown in FIG. 37, most of the aMTD/SDB-fused SOCS3 recombinant proteins inhibited cell migration of gastric carcinoma cells, and of them, aMTD.sub.165 or aMTD.sub.904-fused SOCS3 recombinant protein showed the most effective inhibition of cancer cell migration.
[0428] Solubility/yield, permeability, and biological activity of 22 kinds of the aMTD-fused recombinant proteins were examined in Examples 10 to 11-3, and as a result, the aMTD.sub.165/SDB-fused SOCS3 recombinant protein was found to show the most excellent effect (FIG. 38). Therefore, the aMTD.sub.165-fused recombinant protein was used in the subsequent experiment.
Example 12-1. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-1
[0429] To develop a new drug as an anticancer agent, His-tag-removed iCP-SOCS3 recombinant protein was prepared and equivalence of His-Tag+, -iCP-SOCS3 was investigated.
[0430] Histidine-tag free human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1.times. reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5') and Sal I (3') involving 35 cycles of denaturing (95.degree. C.), annealing (62.degree. C.), and extending (72.degree. C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72.degree. C. The PCR products were subcloned into pET-26b(+) (Novagen, Darmstadt, Germany). Coding sequence for SDB fused to C terminus of aMTD-SOCS3 was cloned at BamHI (5') and SalI (3') in pET-26b(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.
TABLE-US-00039 TABLE 42 Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 -- HS3 5'- 5'- GGAATTCCATATGGTCACCCAC CCCGGATCCTTAAA AGCAAGTTTCCCGCCGCC-3' GCGGGGCATCGTAC TGGTCCAGGAA-3' -- HM.sub.165S3 5'- 5'- GGAATTCCATATGGCGCTGGCG CCCGGATCCTTAAA GTGCCGGTGGCGCTGGCGATT GCGGGGCATCGTAC GTGCCGGTCACCCACAGCAAG TGGTCCAGGAA-3' TTTC-3' A HM.sub.165S3A 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTACC GTGCCGGTGGCGCTGGCGATT TCGGCTGCACCGGC GTGCCGGTCACCCACAGCAAG ACGGCGATAC-3' TTTC-3' B HM.sub.165S3B 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTAAA GTGCCGGTGGCGCTGGCGATT GGGTTTCCGAAGGC GTGCCGGTCACCCACAGCAAG TTGGCTATCTT-3' TTTC-3' C HM.sub.165S3C 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTAGGC GTGCCGGTGGCGCTGGCGATT CAGGTTAGCGTCGA GTGCCGGTCACCCACAGCAAG G-3' TTTC-3' D HM.sub.165S3D 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTATTTT GTGCCGGTGGCGCTGGCGATT TTCTCGGACAGATA- GTGCCGGTCACCCACAGCAAG 3' TTTC-3' E HM.sub.165S3E 5'- 5'- GGAATTCCATATGGCGCTGGCG ACGCGTCGACTTAA GTGCCGGTGGCGCTGGCGATT CCTCCAATCTGTTC GTGCCGGTCACCCACAGCAAG GCGGTGAGCCTC-3' TTTC-3' B M.sub.165S3B 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTAAA GTGCCGGTGGCGCTGGCGATT GGGTTTCCGAAGGC GTGCCGGTCACCCACAGCAAG TTGGCTATCTT-3' TTTC-3'
[0431] Expression, purification and solubility/yield were measured in the same manner as in Example 6-2 to 6-3, and as a result, his-tag-removed M.sub.165S3B was found to have high solubility/yield (FIG. 39).
Example 12-2. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-2
[0432] In the same manner as in Example 7-1, RAW264.7 cells were treated with FITC-labeled HS3B, HM.sub.165S3B, and M.sub.165S3B proteins, and cell permeability was evaluated.
[0433] As shown in FIG. 40, both HM.sub.165S3B and M.sub.165S3B were found to have high cell permeability.
Example 12-3. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-3
[0434] To investigate biological activity equivalence of the HM.sub.165S3B and M.sub.165S3B recombinant proteins, induction of apoptosis of gastric carcinoma cell line (AGS) was analyzed by Annexin V staining in the same manner as in Example 11-2, and inhibition of migration was analyzed in the same manner as in Example 11-3.
[0435] As shown in FIG. 41, it was confirmed that both HM.sub.165S3B and M.sub.165S3B showed high anticancer efficacy and M.sub.165S3B exhibited efficacy equivalent to or higher than HM.sub.165S3B.
Example 12-4. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-4
[0436] In silico MHC class II binding analysis using iTope.TM. (ANTITOPE.LTD) revealed changing the V28 pl anchor residue in SDB sequence to L makes this region human germline and as such both MHC class II binding peptides within this region would be expected to be low risk due to T cell tolerance.
[0437] To prepare humanized SDB domain, iCP-SOCS3 was prepared in the same manner as in Example 6-1, except that SDB' having a substitution of valine with leucine at an amino acid position 28 was used (FIG. 94). Further, protein purification was performed in the same manner as in Example 6-2 using the primer as below (Table 43).
TABLE-US-00040 TABLE 43 Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 -- HS3 5'- 5'- GGAATTCCATATGGTCACCCAC CCCGGATCCTTAAA AGCAAGTTTCCCGCCGCC-3' GCGGGGCATCGTAC TGGTCCAGGAA-3' -- HM.sub.165S3 5'- 5'- GGAATTCCATATGGCGCTGGCG CCCGGATCCTTAAA GTGCCGGTGGCGCTGGCGATT GCGGGGCATCGTAC GTGCCGGTCACCCACAGCAAG TGGTCCAGGAA-3' TTTC-3' A HM.sub.165S3A 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTACC GTGCCGGTGGCGCTGGCGATT TCGGCTGCACCGGC GTGCCGGTCACCCACAGCAAG ACGGCGATAC-3' TTTC-3' B HM.sub.165S3B 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTAAA GTGCCGGTGGCGCTGGCGATT GGGTTTCCGAAGGC GTGCCGGTCACCCACAGCAAG TTGGCTATCTT-3' TTTC-3' C HM.sub.165S3C 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTAGGC GTGCCGGTGGCGCTGGCGATT CAGGTTAGCGTCGA GTGCCGGTCACCCACAGCAAG G-3' TTTC-3' D HM.sub.165S3D 5'- 5'- GGAATTCCATATGGCGCTGGCG GCGTCGACTTATTTT GTGCCGGTGGCGCTGGCGATT TTCTCGGACAGATA- GTGCCGGTCACCCACAGCAAG 3' TTTC-3' E HM.sub.165S3E 5'- 5'- GGAATTCCATATGGCGCTGGCG ACGCGTCGACTTAA GTGCCGGTGGCGCTGGCGATT CCTCCAATCTGTTC GTGCCGGTCACCCACAGCAAG GCGGTGAGCCTC-3' TTTC-3' B* HM.sub.165S3B* 5'- 5'- GGAATTCCATATGGCGCTGGCG CGCGTCGACTTAAA GTGCCGGTGGCGCTGGCGATT GGGTTTCCGAAGGC GTGCCGGTCACCCACAGCAAG TTGGCTATCTT-3' TTTC-3'
[0438] As shown in FIG. 44, both HM.sub.165S3B and HM.sub.165S3B'(V28L) were found to have high solubility/yield.
Example 12-5. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-5
[0439] In the same manner as in Example 7-1, RAW264.7 cells were treated with FITC-labeled HM.sub.165S3B and HM.sub.165S3B'(V28L) proteins, and cell permeability was evaluated.
[0440] As shown in FIG. 45, both HM.sub.165S3B and HM.sub.165S3B'(V28L) were found to have high cell permeability.
Example 12-6. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-6
[0441] To investigate biological activity equivalence of the HM.sub.165S3B and HM.sub.165S3B'(V28L) recombinant proteins, anti-proliferative activity was examined and induction of apoptosis of gastric carcinoma cell line (AGS) was analyzed by Annexin V staining in the same manner as in Example 11-2, and inhibition of migration was analyzed in the same manner as in Example 11-3.
[0442] Antiproliferative activity were evaluated with the CellTiter-Glo Cell Viability Assay. AGS cells (3.times.10.sup.3/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or 10 .mu.M HM.sub.165S3B, HM.sub.165S3B'(V28L) for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.
[0443] It was confirmed that both HM.sub.165S3B and HM.sub.165S3B'(V28L) showed high anti-proliferative effects on gastric carcinoma cells (FIG. 46), and also effects of inducing apoptosis (FIG. 47) and of inhibiting migration of gastric carcinoma cells (FIG. 48), and in particular, HM.sub.165S3B'(V28L) exhibited efficacy equivalent to or higher than HM.sub.165S3B.
Example 12-7. Preparation of iCP-SOCS3 Recombinant Protein and Investigation of Equivalence Thereof-7
[0444] iCP-SOCS3 of BS3M.sub.165 structure was prepared in the same manner as in Example 6-1, and B'S3M.sub.165 iCP-SOCS3 was also prepared by humanized SDB domain (FIG. 49a).
TABLE-US-00041 TABLE 44 Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 B BS3M.sub.165 5'-GGAATTCCATA 5'- TGATGGCAGAACAA ACGCGTCGACTTAC AGCGAC-3' GCCAGCGCCACCG GCACCGCCAGCGC AATCACCGGAAGCG GGGCATCGTACTGG TCCAG-3' B* B*S3M.sub.165 5'-GGAATTCCATA 5'- TGATGGCAGAACAA ACGCGTCGACTTAC AGCGAC-3' GCCAGCGCCACCG GCACCGCCAGCGC AATCACCGGAAGCG GGGCATCGTACTGG TCCAG-3'
[0445] Expressions and purifications of iCP-SOCS3 recombinant protein (BS3M.sub.165, B'S3M.sub.165) in E. coli (bottom) were analyzed in the same manner as in Examples 6-2 and 6-3, respectively, and shown in FIG. 49b. Further, E. coli codon-optimized iCP-SOCS3 was prepared.
Example 13. Test of Biological Activity of iCP-SOCS3--Inhibition Activity of IFN-.gamma.-Induced STAT Phosphorylation
[0446] Whether iCP-SOCS3 (HM.sub.165S3B) recombinant protein inhibits activation of the JAK/STAT-signaling pathway was examined by the method of Example 8-1.
[0447] PANC-1 Cells (KCLB, Seoul, South Korea) were treated with 10 ng/ml IFN-.gamma. (R&D systems, Abingdon, UK) for 15 min and treated with either DMEM (vehicle) or 1, 5, 10 .mu.M aMTD/SD-fused SOCS3 recombinant proteins for 2 hrs. The cells were lysed in RIPA lysis buffer (Biosesang, Seongnam, Korea) containing proteinase inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. Equal amounts of lysates were separated on 10% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked using 5% skim milk in TBST and for western blot analysis incubated with the following antibodies: anti-phospho-STAT3 (Cell Signaling Technology, USA), then HRP conjugated anti-rabbit secondary antibody (Santacruz).
[0448] The well-known cytokine signaling inhibitory actions of SOCS3 are inflammation inhibition through i) inhibition of IFN-.gamma.-mediated JAK/STAT and ii) inhibition of LPS-mediated cytokine secretion. The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT3 by IFN-.gamma.-mediated Janus kinases (JAK) 1 and 2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. As shown in FIG. 50, iCP-SOCS3 (HM.sub.165S3B) suppressed IFN-.gamma.-induced phosphorylation of STAT3 in dose dependent manner. In contrast, STAT phosphorylation was readily detected in cells exposed to HS3B, which lacks the aMTD motif required for membrane penetration, indicating that HS3B, which lacks an MTD sequence did not enter the cells, has no biological activity.
Example 14. Investigation of aMTD-Mediated Intracellular Delivery Mechanism
[0449] The mechanism of aMTD.sub.165-mediated intracellular delivery was investigated.
[0450] (1) RAW 264.7 cells were pretreated with 100 mM EDTA for 3 hours, and then treated with 10 .mu.M of iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour, followed by flow cytometry in the same manner as in Example 7-1 (FIG. 51A).
[0451] (2) RAW 264.7 cells were pretreated with 5 .mu.g/ml of proteinase K for 10 minutes, and then treated with 10 .mu.M of iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour, followed by flow cytometry (FIG. 51B).
[0452] (3) RAW 264.7 cells were pretreated with 20 .mu.M taxol for 30 minutes, and then treated with 10 .mu.M of iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour, followed by flow cytometry (FIG. 52A).
[0453] (4) RAW 264.7 cells were pretreated with 1 mM ATP and 10 .mu.M antimycin singly or in combination for 2 hours, and then treated with 10 .mu.M of iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour, followed by flow cytometry (FIG. 52B).
[0454] (5) RAW 264.7 cells were left at 4.degree. C. and 37.degree. C. for 1 hour, respectively, and then treated with 10 .mu.M of iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour, followed by flow cytometry (FIG. 53).
[0455] The aMTD-mediated intracellular delivery of SOCS3 protein did not require protease-sensitive protein domains displayed on the cell surface (FIG. 51B), microtubule function (FIG. 52A), or ATP utilization (FIG. 52B), since aMTD.sub.165-dependent uptake, compare to HS3 and HS3B, was essentially unaffected by treating cells with proteinase K, taxol, or the ATP depleting agent, antimycin. Conversely, iCP-SOCS3 (HM.sub.165S3B) proteins uptake was blocked by treatment with EDTA and low temperature (FIGS. 51A and 53), indicating the importance of membrane integrity and fluidity for aMTD-mediated protein transduction.
[0456] Moreover, whether cells treated with iCP-SOCS3 (HM.sub.165S3B) protein could transfer the protein to neighboring cells were also tested.
[0457] For this, RAW 264.7 cells were treated with 10 .mu.M of FITC-labeled iCP-SOCS3 (HM.sub.165S3B) recombinant protein for 1 hour. Thereafter, these cells were co-cultured with PerCP-Cy5.5-CD14-stained RAW 264.7 cells for 2 hours. Cell-to-cell protein transfer was assessed by flow cytometry, scoring for CD14/FITC double-positive cells. Efficient cell-to-cell transfer of HM.sub.165S3B, but not HS3 or HS3B (FIG. 54), suggests that SOCS3 recombinant proteins containing aMTD.sub.165 are capable of bidirectional passage across the plasma membrane.
Example 14-2. Investigation of Basic CPP-Mediated Intracellular Delivery Mechanism
[0458] The mechanism of basic CPP (TAT and PolyR)-mediated intracellular delivery was also investigated in the same manner as in Example 7-1 and Example 14.
[0459] As shown in FIG. 101, it was confirmed that aMTD165/SD-fused SOCS3 recombinant proteins are independent to cell surface receptor (FIG. 101A) and the cell-permeability of aMTD165/SD-fused SOCS3 recombinant proteins is not due to endocytosis (FIG. 101B).
[0460] Whether cells treated with aMTD165/SD-fused SOCS3, TAT/SD-fused SOCS3, and PolyR/SD-fused SOCS3 could transfer the protein to neighboring cells were also tested on a molecular level in the same manner as in Example 13.
[0461] For this, RAW 264.7 cells were treated with 5 .mu.M of FITC-labeled HM.sub.165S3B, HTS3B for 2 hour and washed with PBS two times. Thereafter, they were seeded on PANC-1 cell, incubated for 2 hours and treated with 20 ng/ml of IFN-.gamma. for 15 minutes, followed by Western blotting in the same manner as in Example 8-1. And Cell-to-cell protein transfer was assessed by flow cytometry.
[0462] As shown in FIG. 102, efficient cell-to-cell transfer of HM.sub.165S3B, but not HTS3B or HRS3B, suggests that only SOCS3 recombinant proteins containing aMTD165 are capable of bidirectional passage across the plasma membrane.
[0463] Moreover, as shown in FIG. 103, phospho-STAT3 was only reduced in cells treated with HM.sub.165S3B.
Example 15. Investigation of Bioavailability of iCP-SOCS3
[0464] To investigate BA of the iCP-SOCS3 (HM.sub.165S3B) recombinant proteins, ICR mice (Doo-Yeol Biotech Co. Ltd., Seoul, Korea) were intravenous (IV) injected with 600 .mu.g/head of 10 .mu.M FITC (Fluorescein isothiocyanate, SIGMA, USA)-labeled SOCS3 recombinant proteins (HS3B, HM.sub.165S3B) and after 15 min, 30 min, 1H, 2H, 4H, 8H, 12H, 16H, 24H, 36H, 48H, mice of each group were sacrificed. From the mice, peripheral blood mononuclear cells (PBMCs), splenocytes, and hepatocytes were separated.
[0465] Further, the spleen was removed and washed with PBS, and then placed on a dry ice and embedded in an O.C.T. compound (Sakura). After cryosectioning at 20 .mu.m, tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany).
[0466] Isolation of PBMC
[0467] After anesthesia with ether, ophthalmectomy was performed and the blood was collected therefrom using a 1 ml syringe. The collected blood was immediately put in an EDTA tube and mixed well. The blood was centrifuged at 4,000 rpm and 4.degree. C. for 5 minutes, and plasma was discarded and only buffy coat was collected in a new microtube. 0.5 ml of RBC lysis buffer (Sigma) was added thereto, followed by vortexing. The microtube was left at room temperature for 5 minutes, and then centrifuged at 4,000 rpm and 4.degree. C. for 5 minutes. 0.3 ml of PBS was added to a pellet, followed by pipetting and flow cytometry (FlowJo cytometric analysis software, Guava, Millipore, Darmstadt, Germany).
[0468] Isolation of Splenocytes and Hepatocytes
[0469] Mice were laparotomized and the spleen or liver were removed. The spleen or liver thus removed was separated into single cells using a Cell Strainer (SPL, Korea). These cells were collected in a microtube, followed by centrifugation at 4,000 rpm and 4.degree. C. for 5 minutes. 0.5 ml of RBC lysis buffer was added thereto, followed by vortexing. The microtube was left at room temperature for 5 minutes, and then centrifuged at 4,000 rpm and 4.degree. C. for 5 minutes. 0.5 ml of PBS was added to a pellet, followed by pipetting and flow cytometry (FlowJo cytometric analysis software, Guava, Millipore, Darmstadt, Germany).
[0470] As shown in FIG. 55, in PBMCs, the maximum permeability of iCP-SOCS3 was observed at 30 minutes, and in splenocytes, the maximum permeability of iCP-SOCS3 was observed at 2 hours and maintained up to 16 hours. In hepatocytes, the maximum permeability of iCP-SOCS3 was observed at 15 minutes and maintained up to 16 hours. As shown in FIG. 56, in the pancreas tissue, very high distribution of iCP-SOCS3 was observed at 2 hours, and maintained up to 8 hours. Therefore, it can be seen that iCP-SOCS3 is rapidly delivered from blood to various tissues within 2 hours, and maintained up to 8-16 hours depending on the tissues.
Example 16. Investigation of Anticancer Efficacy of iCP-SOCS3 Recombinant Protein
[0471] To develop the iCP-SOCS3 recombinant protein as a therapeutic agent for solid tumors, its permeability to solid tumors (gastric cancer, colorectal cancer, breast cancer, glioblastoma cell line) and various tissues was investigated.
[0472] AGS (gastric cancer cell line), HCT116 (colorectal cancer cell line), MDA-MB-231 (breast cancer cell line), and U-87 MG (glioblastoma cell line) cells (Korean cell line bank, Korea) were seeded in a 12 well plate, grown to 90% confluence. Cells were treated with 10 .mu.M FITC-labeled iCP-SOCS3 recombinant proteins and cultivated for 1 hr at 37.degree. C.
[0473] After cultivation, the cells were treated with proteinase K (10 .mu.g/mL, SIGMA, USA) and washed three times with ice-cold PBS (Phosphate-buffered saline, Hyclone, USA) to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FlowJo cytometric analysis software, Guava, Millipore, Darmstadt, Germany). Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control (FIG. 57).
[0474] The permeability to various tissues was analyzed at 2 hours after protein injection by the method described in Example 7-3.
[0475] As shown in FIG. 57, iCP-SOCS3 recombinant proteins (FITC-HM.sub.165S3SB) promoted the transduction into cultured various cancer cells. In contrast, SOCS3 proteins containing non-aMTD (FITC-HS3 and FITC-HS3B) did not appear to enter cells.
[0476] In addition, iCP-SOCS3 recombinant proteins (FITC-HM.sub.165S3SB) enhanced the systemic delivery to various tissues after intraperitoneal injection (FIG. 58). Therefore, these data indicate that iCP-SOCS3 protein could be intracellularly delivered and distributed to the various cancer cells and various tissues, contributing for beneficial biotherapeutic effects.
Example 17. Investigation of Anticancer Efficacy of iCP-SOCS3 Recombinant Protein
Example 17-1. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 Recombinant Protein in Gastric Cancer Cells
[0477] To develop the iCP-SOCS3 recombinant protein as a mechanism-specific therapeutic agent for solid tumors, SOCS3 levels endogenously expressed and activation of JAK/STAT-signaling pathway were investigated in different gastric cancer cell lines and normal cells, and normal hepatic cells.
Example 17-1-1. Analysis of Hypermethylation Level in Gastric Cancer Cells
[0478] SOCS3 expression is suppressed due to methylation in cancer cells, and therefore, inflammation or cancer development is increased. Further, to investigate the effect of cell permeable SOCS3, a cancer cell line where endogenous SOCS3 expression is suppressed should be selected or applied to a model, and therefore, the present experiments were performed.
[0479] Genomic DNA was extracted from cancer cell line using an Exgene.TM. Tissue SV mini kit (Geneall.RTM., Korea). DNA was quantified, and experiments were performed using 500 ng of gDNA and an EZ DNA Methylation-Gold.TM. kit (ZYMO Research, Orange, Calif., USA) according to the manufacturer's instructions. DNA was used to perform PCR, and methylation and unmethylation of endogenous SOCS3 were qualitatively analyzed by electrophoresis. In this regard, the primers used are as follows.
[0480] Unmethyl-F was 5'-tag tgt gta agt tgt agg aga gtg g-3'(SEQ ID NO: 816), Unmethyl-R was 5'-cta aac ata aaa aaa taa cac taa tcc aaa-3' (SEQ ID NO: 817), Methyl-F was 5'-gta gtg cgt aag ttg tag gag agc-3' (SEQ ID NO: 818), Methyl-R was 5'-gta aaa aaa taa cgc taa tcc gaa-3' (SEQ ID NO: 819), PCR was performed for 30 cycles consisting of pre-denaturation at 95.degree. C. for 5 minutes, denaturation at 95.degree. C. for 30 seconds, annealing at 60.degree. C. for 45 seconds, extension at 72.degree. C. for 1 minute, and final extension at 72.degree. C. for 8 minutes.
[0481] As shown in FIG. 95, unmethylation of SOCS3 was observed in HEK293 and HaCaT cells which are normal cells, whereas hypermethylation of the promoter region of SOCS3 gene was observed in MNK75, MKN74, MKN45, MKN28, AGS, STKM2, NCI-N87 which are gastric cancer cell lines (U: unmethylated SOCS3, M: methylated SOCS3). These results indicate that SOCS3 is silenced by hypermethylation in gastric cancer cell lines.
Example 17-1-2. Analysis of Expression Level of Endogenous SOCS3 mRNA in Gastric Cell Line
[0482] SOCS3 mRNA expression levels in cancer cells were analyzed by RT-PCR. mRNAs were isolated from normal cell lines and cancer cell lines according to a method provided in a manufacturer's sheet of Hybrid-R (Geneall, Korea), and PCR was performed using SOCS3 primer F 5'-cct act gaa ccc tcc tcc ga-3' (SEQ ID NO: 820) and SOCS3 primer R 5'-gca get ggg tga ctt tct ca-3' (SEQ ID NO: 821) for 30 cycles consisting of denaturing (95.degree. C.), annealing (60.degree. C.), and extending (72.degree. C.) for 45 seconds each.
[0483] It was confirmed that high expression levels of SOCS3 were observed in the normal HEK293 whereas low expression levels of SOCS3 were observed in the gastric cancer cell lines, except MKN74 (FIG. 59).
Example 17-1-3. Analysis of Endogenous SOCS3 and JAK/STAT Signaling Activation Status in Gastric Cell Line
[0484] JAK/STAT3 activation in cancer cells was analyzed by Western blot analysis. The normal HEK293 cells, and gastric cancer cell lines, MKN75, MKN74, MKN45, MKN28, AGS, STKM2, and NCI-N87 were washed with PBS, and then the cells were lysed in RIPA lysis buffer (Biosesang, Seongnam, Korea) containing protease inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. to isolate proteins, followed by Western blotting in the same manner as in Example 8-1.
[0485] As shown in FIG. 60, high expression levels of SOCS3 and low levels of phosphorylations of p-JAK1, p-JAK2, p-STAT1, and p-STAT3 were observed in normal HEK293 cells. Low expression levels of SOCS3 gene were observed in the gastric cancer cell lines, compared to the normal cell line, and high levels of p-JAK1 and p-JAK2 in MKN75, high levels of p-STAT1 in MKN75, MKN74, MKN28, and NCI-N87, and high levels of p-STAT3 in MKN75, MKN45, AGS, STKN2, and NCI-N87. These results suggest a possibility of developing a mechanism-specific anticancer agent, because SOCS3-deficient cancer cells can be replenished with cell permeable proteins, and activated JAK/STAT-signaling can be negatively regulated.
Example 17-2. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 Recombinant Protein
[0486] To develop the iCP-SOCS3 recombinant protein as a mechanism-specific therapeutic agent for solid tumors, SOCS3 levels endogenously expressed and activation of JAK/STAT-signaling pathway were investigated in different colorectal cell lines, normal cells, and normal hepatic cells.
Example 17-2-1. Analysis of Hypermethylation Level in Colorectal Cancer Cells
[0487] SOCS3 expression is suppressed due to methylation in cancer cells, and therefore, inflammation or cancer development is increased. Further, to investigate the effect of cell permeable SOCS3, a cancer cell line where endogenous SOCS3 expression is suppressed should be selected or applied to a model, and therefore, the present experiments were performed.
[0488] Genomic DNA was extracted from cancer cell line using an Exgene.TM. Tissue SV mini kit (Geneall.RTM., Korea). DNA was quantified, and experiments were performed using 500 ng of gDNA and an EZ DNA Methylation-Gold.TM. kit (ZYMO Research, Orange, Calif., USA) according to the manufacturer's instructions. DNA was used to perform PCR, and methylation and unmethylation of endogenous SOCS3 were qualitatively analyzed by electrophoresis. In this regard, the primers used are as follows.
[0489] Unmethyl-F was 5'-tag tgt gta agt tgt agg aga gtg g-3'(SEQ ID NO: 816), Unmethyl-R was 5'-cta aac ata aaa aaa taa cac taa tcc aaa-3' (SEQ ID NO: 817), Methyl-F was 5'-gta gtg cgt aag ttg tag gag agc-3' (SEQ ID NO: 818), Methyl-R was 5'-gta aaa aaa taa cgc taa tcc gaa-3' (SEQ ID NO: 819), PCR was performed for 30 cycles consisting of pre-denaturation at 95.degree. C. for 5 minutes, denaturation at 95.degree. C. for 30 seconds, annealing at 60.degree. C. for 45 seconds, extension at 72.degree. C. for 1 minute, and final extension at 72.degree. C. for 8 minutes.
[0490] As shown in FIG. 96, unmethylation of SOCS3 was observed in HEK293 and HaCaT cells which are normal cells, whereas hypermethylation of the promoter region of SOCS3 gene was observed in HCT116, SW480, RKO, HT29 which are colorectal cell lines (U: unmethylated SOCS3, M: methylated SOCS3). These results indicate that SOCS3 is silenced by hypermethylation in colorectal cancer cell lines.
Example 17-2-2. Analysis of Expression Level of Endogenous SOCS3 mRNA in Colorectal Cancer Cell Line
[0491] SOCS3 mRNA expression levels in cancer cells were analyzed by RT-PCR. mRNAs were isolated from normal cell lines and cancer cell lines according to a method provided in a manufacturer's sheet of Hybrid-R (Geneall, Korea), and PCR was performed using SOCS3 primer F 5'-cct act gaa ccc tcc tcc ga-3' (SEQ ID NO: 820) and SOCS3 primer R 5'-gca get ggg tga ctt tct ca-3' (SEQ ID NO: 821) for 30 cycles consisting of denaturing (95.degree. C.), annealing (60.degree. C.), and extending (72.degree. C.) for 45 seconds each.
[0492] The results of electrophoresis showed that high expression levels of SOCS3 were observed in the normal HEK293 cells whereas low expression levels of SOCS3 gene were observed in the colorectal cancer cell lines, SW480 and HT29 (FIG. 61).
Example 17-2-3. Analysis of Expression of Endogenous SOCS3 and JAK/STAT Signaling Activation Status in Colorectal Cancer Cell Line
[0493] JAK/STAT3 activation in cancer cells was analyzed by Western blot analysis. The normal HEK293 cells, and colorectal cancer cell lines, HCT116, SW480, RKO, and HT29 were washed with PBS, and then the cells were lysed in RIPA lysis buffer (Biosesang, Seongnam, Korea) containing proteinase inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. to isolate proteins, followed by western blotting in the same manner as in Example 8-1.
[0494] As shown in FIG. 62, high expression level of SOCS3 and low phosphorylation levels of p-JAK1, p-JAK2, p-STAT1, and p-STAT3 were observed in normal HEK293 cells. Low expression level of SOCS3 gene was observed in the colorectal cancer cell lines, compared to the normal cell line, and similar levels of p-JAK1, p-JAK2, and p-STAT3 were observed in HCT116 and HT29. These results suggest a possibility of developing a mechanism-specific anticancer agent, because SOCS3-deficient cancer cells can be replenished with cell permeable proteins, and activated JAK/STAT-signaling can be negatively regulated.
Example 17-3. Investigation of Anticancer Efficacy of iCP-SOCS3 Recombinant Protein (Glioblastoma Cells)
[0495] To develop the iCP-SOCS3 recombinant protein as a mechanism-specific therapeutic agent for solid tumors, SOCS3 levels endogenously expressed and activation of JAK/STAT-signaling pathway were investigated in different glioblastoma cells, normal cells, and normal hepatic cells.
Example 17-3-1. Analysis of Hypermethylation Level in Glioblastoma Cell Line
[0496] SOCS3 expression is suppressed due to methylation in cancer cells, and therefore, inflammation or cancer development is increased. Further, to investigate the effect of cell permeable SOCS3, a cancer cell line where endogenous SOCS3 expression is suppressed should be selected or applied to a model, and therefore, the present experiments were performed.
[0497] Genomic DNA was extracted from cancer cell line using an Exgene.TM. Tissue SV mini kit (Geneall.RTM., Korea). DNA was quantified, and experiments were performed using 500 ng of gDNA and an EZ DNA Methylation-Gold.TM. kit (ZYMO Research, Orange, Calif., USA) according to the manufacturer's instructions. DNA was used to perform PCR, and methylation and unmethylation of endogenous SOCS3 were qualitatively analyzed by electrophoresis. In this regard, the primers used are as follows.
[0498] Unmethyl-F was 5'-tag tgt gta agt tgt agg aga gtg g-3'(SEQ ID NO: 816), Unmethyl-R was 5'-cta aac ata aaa aaa taa cac taa tcc aaa-3' (SEQ ID NO: 817), Methyl-F was 5'-gta gtg cgt aag ttg tag gag agc-3' (SEQ ID NO: 818), and Methyl-R was 5'-gta aaa aaa taa cgc taa tcc gaa-3' (SEQ ID NO: 819). PCR was performed for 30 cycles consisting of pre-denaturation at 95.degree. C. for 5 minutes, denaturation at 95.degree. C. for 30 seconds, annealing at 60.degree. C. for 45 seconds, and extension at 72.degree. C. for 1 minute, and then final extension at 72.degree. C. for 8 minutes.
[0499] As shown in FIG. 63, unmethylation of SOCS3 was observed in HEK293 and HaCaT cells which are normal cells, whereas hypermethylation of the promoter region of SOCS3 gene was observed in U-87 MG, U-118 MG, T98G, LN229 which are glioblastoma cell lines (U: unmethylated SOCS3, M: methylated SOCS3). These results indicate that SOCS3 is silenced by hypermethylation in glioblastoma cell lines.
Example 17-3-2. Analysis of Expression of Endogenous SOCS3 and JAK/STAT Signaling Activation Status in Glioblastoma Cells
[0500] JAK/STAT3 activation in cancer cells was analyzed by Western blot analysis. The normal HaCaT and HEK293 cells, and glioblastoma cells, U-87 MG, U-118 MG, T98G, and LN229 were washed with PBS, and then the cells were lysed in RIM lysis buffer (Biosesang, Seongnam, Korea) containing protease inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. to isolate proteins, followed by western blotting in the same manner as in Example 8-1.
[0501] As shown in FIG. 64, high expression levels of SOCS3 and low phosphorylation levels of p-STAT1, p-STAT3, and p-p65 were observed in normal HaCaT and HEK293 cells. Low expression level of SOCS3 gene was observed in the glioblastoma cell lines, compared to the normal cell line, and high levels of p-STAT1 and p-STAT3 were observed in LN229 and T98G. High levels of P-p65 were observed in all 4 types of glioblastoma cell lines. These results suggest a possibility of developing a mechanism-specific anticancer agent, because SOCS3-deficient cancer cells can be replenished with cell permeable proteins, and activated JAK/STAT-signaling can be negatively regulated.
Example 17-4. Investigation of Anticancer Efficacy of iCP-SOCS3 Recombinant Protein
[0502] To develop the iCP-SOCS3 recombinant protein as a mechanism-specific therapeutic agent for solid tumors, SOCS3 levels endogenously expressed and activation of JAK/STAT-signaling pathway were investigated in different breast cancer cell lines, normal cells, and normal hepatic cells.
Example 17-4-1. Analysis of Expression Level of Endogenous SOCS3 mRNA in Breast Cancer Cell Line
[0503] SOCS3 mRNA expression levels in cancer cells were analyzed by RT-PCR. mRNAs were isolated from normal cell lines and cancer cell lines according to a method provided in a manufacturer's sheet of Hybrid-R (Geneall, Korea), and PCR was performed using SOCS3 primer F 5'-cct act gaa ccc tcc tcc ga-3' (SEQ ID NO: 820) and SOCS3 primer R 5'-gca get ggg tga ctt tct ca-3' (SEQ ID NO: 821) for 30 cycles consisting of denaturing (95.degree. C.), annealing (60.degree. C.), and extending (72.degree. C.) for 45 seconds each.
[0504] The results of electrophoresis showed that high expression levels of SOCS3 were observed in the normal HEK293 cells whereas low expression levels of SOCS3 were observed in the breast cancer cell lines, except MDA-MB-231 (FIG. 65).
Example 17-4-2. Analysis of Hypermethylation Level in Breast Cancer Cell Line
[0505] SOCS3 expression is suppressed due to methylation in cancer cells, and therefore, inflammation or cancer development is increased. Further, to investigate the effect of cell permeable SOCS3, a cancer cell line where endogenous SOCS3 expression is suppressed should be selected or applied to a model, and therefore, the present experiments were performed.
[0506] Genomic DNA was extracted from cancer cell line using an Exgene.TM. Tissue SV mini kit (Geneall.RTM., Korea). DNA was quantified, and experiments were performed using 500 ng of gDNA and an EZ DNA Methylation-Gold.TM. kit (ZYMO Research, Orange, Calif., USA) according to the manufacturer's instructions. DNA was used to perform PCR, and methylation and unmethylation of endogenous SOCS3 were qualitatively analyzed by electrophoresis. In this regard, the primers used are as follows.
[0507] Unmethyl-F was 5'-tag tgt gta agt tgt agg aga gtg g-3'(SEQ ID NO: 816), Unmethyl-R was 5'-cta aac ata aaa aaa taa cac taa tcc aaa-3' (SEQ ID NO: 817), Methyl-F was 5'-gta gtg cgt aag ttg tag gag agc-3' (SEQ ID NO: 818), and Methyl-R was 5'-gta aaa aaa taa cgc taa tcc gaa-3' (SEQ ID NO: 819). PCR was performed for 30 cycles consisting of pre-denaturation at 95.degree. C. for 5 minutes, denaturation at 95.degree. C. for 30 seconds, annealing at 60.degree. C. for 45 seconds, and extension at 72.degree. C. for 1 minute, and then final extension at 72.degree. C. for 8 minutes.
[0508] As shown in FIG. 66, unmethylation of SOCS3 was observed in HEK293 cells which are normal cells, whereas hypermethylation of the promoter region of SOCS3 gene was observed in breast cancer cell lines, MDA-MB-231, MCF7, SK-BR3, and T47D (U: unmethylated SOCS3, M: methylated SOCS3). These results indicate that SOCS3 is silenced by hypermethylation in breast cancer cell lines.
Example 17-4-3. Analysis of Expression of Endogenous SOCS3 and JAK/STAT Signaling Activation Status in Breast Cancer Cell Line
[0509] JAK/STAT3 activation in cancer cells was analyzed by Western blot analysis. The normal HEK293 cells, and breast cancer cell lines, MDA-MB-231, MCF7, SK-BR3, and T47D were washed with PBS, and then the cells were lysed in RIPA lysis buffer (Biosesang, Seongnam, Korea) containing protease inhibitor cocktail (Roche, Indianapolis, Ind., USA), incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. to isolate proteins, followed by western blotting in the same manner as in Example 8-1.
[0510] As shown in FIG. 67, high expression levels of SOCS3 and low phosphorylation levels of p-STAT1 and p-STAT3 were observed in normal HEK293 cells. Low expression level of SOCS3 gene was observed in the breast cancer cell lines, compared to the normal cell line. Further, high levels of p-STAT1 were observed in SK-BR3 and T47D, and high levels of p-STAT3 were observed in MDA-MB-231 and T47D. These results suggest a possibility of developing a mechanism-specific anticancer agent, because SOCS3-deficient cancer cells can be replenished with cell permeable proteins, and activated JAK/STAT-signaling can be negatively regulated.
Example 18. Investigation of Anti-Cancer Efficacy of iCP-SOCS3
Example 18-1. Investigation of Anti-Cancer Efficacy (Anti-Proliferative Activity) of iCP-SOCS3
[0511] In order to develop the iCP-SOCS3 recombinant protein as a therapeutic agent for solid tumors, efficacy of iCP-SOCS3 on proliferation of solid tumors (gastric cancer, colorectal cancer, breast cancer, and glioblastoma cell lines) was investigated.
[0512] Cells originated from human gastric cancer cells (AGS, MKN45, MKN75, NCI-N87), colorectal cancer cells (HCT116), glioblastoma (U-87 MG), breast cancer cells (MDA-MB-231), and mouse fibroblast (NIH3T3) were purchased from ATCC (Manassas, Va., USA) and KCLB (Seoul, Korea). All the cells were maintained as recommended by the supplier. These cells (3.times.10.sup.3/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or 10 .mu.M recombinant SOCS3 proteins for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.
[0513] Since the endogenous level of SOCS3 protein is reduced in solid tumor patient, and SOCS3 negatively regulates cell growth and motility in cultured solid tumor cells, we investigated whether iCP-SOCS3 inhibits cell viability through SOCS3 intracellular replacement in solid tumor cells. As shown in FIG. 68, SOCS3 recombinant proteins containing aMTD.sub.165 significantly suppressed cancer cell proliferation. HM.sub.165S3B (iCP-SOCS3) protein was the most cytotoxic to gastric cancer cells--over 40% in 10 .mu.M treatment (p<0.01)--especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; left).
[0514] As shown in FIG. 69, SOCS3 recombinant proteins containing aMTD.sub.165 significantly suppressed cancer cell proliferation. HM.sub.165S3B (iCP-SOCS3) protein was the most cytotoxic to colorectal cancer cells--over 60% in 10 .mu.M treatment (p<0.01)--especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; left).
[0515] As shown in FIG. 70, SOCS3 recombinant proteins containing aMTD.sub.165 significantly suppressed cancer cell proliferation. HM.sub.165S3B (iCP-SOCS3) protein was the most cytotoxic to glioblastoma cells--over 80% in 10 .mu.M treatment (p<0.01)--especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; left).
[0516] As shown in FIG. 71, SOCS3 recombinant proteins containing aMTD.sub.165 significantly suppressed cancer cell proliferation. HM.sub.165S3B (iCP-SOCS3) protein was the most cytotoxic to breast cancer cells--over 40% in 10 .mu.M treatment (p<0.01)--especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; left).
[0517] However, neither cell-permeable SOCS3 protein adversely affected the cell viability of non-cancer cells (NIH3T3) even after exposing these cells to equal concentrations (10 .mu.M) of protein over 4 days. These results suggest that the iCP-SOCS3 protein is not overly toxic to normal cells and selectively kills tumor cells, and would have a great ability to inhibit cell survival-associated phenotypes in various cancer without any severe aberrant effects as a protein-based biotherapeutics.
Example 18-2. Investigation of Anti-Cancer Efficacy (Cell Migration Inhibition) of iCP-SOCS3
[0518] In order to develop the iCP-SOCS3 recombinant protein as a therapeutic agent for solid tumors, efficacy of iCP-SOCS3 on migration and metastasis of solid tumors (gastric cancer, colorectal cancer, breast cancer, and glioblastoma cell lines) was investigated.
[0519] Cells were seeded into 12-well plates, grown to 90% confluence, and incubated with 10 .mu.M Non-CP-SOCS3 (HS3B), iCP-SOCS3 (HM.sub.165S3B) in serum-free medium for 2 hrs prior to changing the growth medium (recommended medium by the supplier). The cells were washed twice with PBS, and the monolayer at the center of the well was "wounded" by scraping with a pipette tip. Cells were cultured for an additional 24-48 hrs and cell migration was observed by phase contrast microscopy (Nikon, ECLIPSE Ts2). The migration was quantified by counting the number of cells that migrated from the wound edge into the clear area.
[0520] As shown in FIGS. 72-75, iCP-SOCS3 (HM.sub.165S3B) suppressed the repopulation of wounded monolayer although SOCS3 protein lacking aMTD.sub.165 (HS3B) had no effect on the cell migration, in AGS (FIG. 72), HCT116 (FIG. 73), U-87 MG (FIG. 74), and MDA-MB-231 (FIG. 75), respectly. In normal cells (NIH3T3), iCP-SOCS3 (HM.sub.165S3B) had no effect on the cell migration.
[0521] Transwell Migration Assay
[0522] The lower surface of Transwell inserts (Costar) was coated with 0.1% gelatin, and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (40 ng/ml). Cells were added to each upper chamber at a density of 5.times.10.sup.5, and the plate was incubated at 37.degree. C. in a 5% CO.sub.2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.
[0523] As shown in FIGS. 76 (left) and 77, AGS (FIG. 76) and U-87 MG (FIG. 77) cells treated with iCP-SOCS3 (HM.sub.165S3B) protein also showed significant inhibitory effect on their Transwell migration compared with untreated cells (Vehicle) and non-permeable SOCS3 protein-treated cells.
[0524] Invasion Assay
[0525] The lower surface of Transwell inserts (Costar) was coated with 0.1% gelatin, the upper surface of Transwell inserts was coated with matrigel (40 .mu.g per well; BD Pharmingen, San Diego, Calif., USA), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (40 ng/ml). Cells (5.times.10.sup.5) were added to each upper chamber, and the plate was incubated at 37.degree. C. in a 5% CO.sub.2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.
[0526] As shown in FIG. 76 (right), AGS treated with iCP-SOCS3 (HM.sub.165S3B) protein caused remarkable decrease in invasion compared with the control proteins. Taken together, these data indicate that iCP-SOCS3 contributes to inhibit tumorigenic activities of solid tumors.
Example 18-3. Investigation of Anti-Cancer Efficacy (Induction of Apoptosis) of iCP-SOCS3
[0527] To further determine the effect of iCP-SOCS3 on the tumorigenicity of solid tumors, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in various cancer cells, such as gastric cancer cells (AGS and MKN45), colorectal cancer cells (HCT116), glioblastoma cells (U-87 MG), and breast cancer cells (MDA-MB-231).
[0528] Annexin V/7-Aminoactinomycin D (7-AAD) staining was performed using flow cytometry according to the manufacturer's guidelines (BD Pharmingen, San Diego, Calif., USA). Briefly, 1.times.10.sup.6 cells were washed three times with ice-cold PBS. The cells were then resuspended in 100 .mu.l of binding buffer and incubated with 1 .mu.l of 7-AAD and 1 .mu.l of Annexin V-7-AAD for 30 min in the dark at 4.degree. C. Flow cytometric analysis was immediately performed using a guava easyCyte.TM. 8 Instrument (Merck Millipore, Darmstadt, Germany). In this regard, gemcitabine (0.1.about.10 .mu.M) was used as a reference drug.
[0529] As shown in FIG. 78, 10 uM of iCP-SOCS3 (HM.sub.165S3B) protein did not induce apoptosis in normal cell lines (NIH3T3 and HEK293). Whereas, as shown in FIGS. 79-82, 10 uM iCP-SOCS3 (HM.sub.165S3B) was efficient inducer of apoptosis in cancer cells, as assessed by Annexin V staining. Consistently, no changes in Annexin V staining were observed in cancer cells treated with HS3B compared to untreated cell (Vehicle).
Example 18-4. Investigation of Anti-Cancer Efficacy (Induction of Apoptosis) of iCP-SOCS3
[0530] To further determine the effect of iCP-SOCS3 on the tumorigenicity of solid tumors, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in colorectal cancer cells.
[0531] Apoptotic cells were analyzed using terminal dUTP nick-end labeling (TUNEL) assay with In Situ Cell Death Detection kit TMR red (Roche, 4056 Basel, Switzerland). Cells were treated for 24 hr with 10 .mu.M HS3B or HM.sub.165S3B proteins with 2% fetal bovine serum and apoptotic cells were visualized by TUNEL staining. Treated cells were washed with cold PBS two times, fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 1 hr at room temperature, and incubated in 0.1% Triton X-100 for 2 min on the ice. Cells were washed with cold PBS twice, and treated TUNEL reaction mixture for 1 hr at 37.degree. C. in dark, washed cold PBS three times and observed by fluorescence microscopy (Nikon, Tokyo, Japan).
[0532] iCP-SOCS3 (HM.sub.165S3B) protein was considerably efficient inducer of apoptosis in HCT116 cells (FIG. 83), as assessed by a fluorescent terminal dUTP nick-end labeling (TUNEL) assay. Consistently, no changes in TUNEL was observed in HCT116 cells treated with HS3B compared to untreated cell (Vehicle).
Example 18-5. Investigation of Anti-Cancer Efficacy (Inhibition of Cell Cycle Progression) of iCP-SOCS3
[0533] To further determine the effect of iCP-SOCS3 on the tumorigenicity of solid tumors, we subsequently investigated whether iCP-SOCS3 regulates cell cycle progression in various cancer cells, such as gastric cancer cells (AGS), colorectal cancer cells (HCT116), glioblastoma cells (U-87 MG, and breast cancer cells (MDA-MB-231).
[0534] Cancer cells and normal cells (NIH3T3, HaCaT, and HEK293) were treated with 10 uM protein (Non-CP-SOCS3 (HS3B) and iCP-SOSC3 (HM.sub.165S3B)) for 8 hrs. After the treatment, cells were washed twice with cold PBS and re-suspended in 1 ml cold PBS, fixed in cold 70% ethanol, washed with cold PBS twice and re-suspended in PI master mix (PI 10 ug/ml (sigma), 50 ug/ml RNase A (invitrogen) in staining buffer) at a final cell density of 2.times.10.sup.5 cell/ml. The cell mixtures were incubated 30 min in the dark at 4.degree. C. Flow cytometric analysis was immediately performed using a guava easyCyte.TM. 8 Instrument (Merck Millipore, Darmstadt, Germany).
[0535] iCP-SOCS3 (HM.sub.165S3B) protein efficiently inhibited cell cycle progression in various cancer cells, such as AGS, HCT116, U-87 MG, and MDA-MB-231 (FIGS. 85 to 88), while iCP-SOCS3 (HM.sub.165S3B) protein did not inhibit cell cycle progression in normal cells (FIG. 84).
Example 18-6. Investigation of Anti-Cancer Efficacy (Effect on Molecular Mechanism-Mode of Action) of iCP-SOCS3
[0536] To further determine the effect of iCP-SOCS3 on the tumorigenicity of solid tumors, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in breast cancer cells (MDA-MB-231).
[0537] Cells were treated for 24 hr with 10 .mu.M HS3B or HM.sub.165S3B proteins, lysed in RIPA lysis buffer containing proteinase inhibitor cocktail, incubated for 15 min at 4.degree. C., and centrifuged at 13,000 rpm for 10 min at 4.degree. C. Equal amounts of lysates were separated on 15% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked using 5% skim milk or 5% Albumin in TBST and incubated with the following antibodies: anti-Bcl-2 (Santa Cruz biotechnology), anti-Cleaved Caspase 3 (Cell Signaling Technology), then HRP conjugated anti-mouse or anti-rabbit secondary antibody. The expression of each protein was determined by immunoblotting with indicated antibodies. An antibody against .beta.-actin was used as a loading control.
[0538] MDA-MB-231 cells treated with iCP-SOCS3 (HM.sub.165S3B) protein dramatically reduced the expression of anti-apoptotic protein such as B-cell lymphoma 2 (Bcl-2) and increased the level of cleaved cysteine-aspartic acid protease (caspase-3) at 24 hr (FIG. 89). These results indicate that iCP-SOCS3 induces apoptosis of breast cancer cells and may suppress the cancer progression by this pathway.
Example 19. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 in Xenograft Model (Cell-Derived Xenograft (CDX)-Model)
Example 19-1. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 in Gastric Cancer Cell (NCI-N87)-Derived Xenograft (CDX) Model
[0539] In the following experiments, Western blotting was performed in the same manner as in Example 8-1, and RT-PCR and IHC were performed by the following method.
[0540] RT-PCR
[0541] Tumor tissues were finely minced using a homogenizer according to the manufacturer's protocol of Hybrid-R (geneall, Korea), and then mRNA was isolated therefrom. 1 ug of mRNA thus separated was used to synthesize cDNA using an Accupower RT Premix (Bioneer, Korea). PCR was performed using 2 ul of cDNA and the primers of Table 45. PCR was performed using an Accupower PCR Premix (Bioneer, Korea) for 30 cycles consisting of denaturing (95.degree. C.), annealing (60.degree. C.), and extending (72.degree. C.) for 45 seconds each.
TABLE-US-00042 TABLE 45 Genes Forward Sequence Reverse Sequence Cyclin E CCGTTTACAAGCTAAGCAGC GTGGTTCCAAGTCAGAATGC Cyclin TCAGTACTTGAGGCGACAAGG CTCCCTAATTGCTTGCTGAGG A1 Bax CCCTTTTGCTTCAGGGTTTC GCCACTCGGAAAAAGACCTC FAK TGGTGAAAGCTGTCATCGAG CTGGGCCAGTTTCATCTTGT p21 CAGCGGAACAAGGAGTCAGA AGAAACGGGAACCAGGACAC p27 GATAATCCCGCTCTGAATGC GCTTCTCTTAGTGCTGTAGC VEGF CTTCAAGCCATCCTGTGTGC ACGCGAGTCTGTGTTTTTGC HIF-1.alpha. ATCAGACACCTAGTCCTTCCG TTGAGGACTTGCGCTTTCAGG GAPDH AAGGGTCATCATCTCTGCCC GTGATGGCATGGACTGTGGT
[0542] Immunohistochemistry (IHC)
[0543] Tissue samples were fixed in 4% Paraformaldehyde (Duksan, South Korea) for 3 days, dehydrated, cleared with xylene and embedded in Paraplast. Sections (6 .mu.m thick) of tumor were placed onto poly-L-lysine coated slides. To block endogenous peroxidase activity, sections were incubated for 15 min with 3% H.sub.2O.sub.2 in methanol. After washing three times with PBS, slides were incubated for 30 min with blocking solution (5% fetal bovine serum in PBS). Mouse anti-Bax antibody (sc-7480, Santa Cruz Biotechnology, SantaCruz, Calif., USA) and rabbit anti-VEGF (ab46154, Abcam, Cambridge, UK) were diluted 1:1000 (to protein concentration 0.1 .mu.g/ml) in blocking solution, applied to sections, and incubated at 4.degree. C. for 24 hrs. After washing three times with PBS, sections were incubated with biotinylated mouse and rabbit IgG (Vector Laboratories, Burlingame, Calif., USA) at a 1:1000 dilution for 1 hr at room temperature, then incubated with avidin-biotinylated peroxidase complex using a Vectorstain ABC Kit (Vector Laboratories, Burlingame, Calif., USA) for 30 min at room temperature. After the slides are reacted with oxidized 3, 3-diaminobenzidine as a chromogen, they were counterstained with Harris hematoxylin (Sigma-Aldrich, USA). Permanently mounted slides were observed and photographed using a microscope equipped with a digital imaging system (ECLIPSE Ti, Nikon, Japan).
[0544] Anti-tumor activity of iCP-SOCS3 against human cancer xenografts was assessed. Female Balb/c.sup.nu/nu mice (5-week-old, Doo-Yeol Biotech Co. Ltd. Korea) were subcutaneously implanted with Hep3B2.1-7 tumor block (1 mm.sup.3) into the left back side of the mouse. Tumor-bearing mice were intravenously administered with 600 .mu.g/head of iCP-SOCS3 (HM.sub.165S3B) or the control proteins (HS3B) for 21 days and observed for 2 weeks following the termination of the treatment. After protein treatment, mice were killed, and six organs (brain, heart, lung, liver, kidney, and spleen) from each were collected and kept in a suitable fixation solution until the next step. Tumor size was monitored by measuring the longest (length) and shortest dimensions (width) once a day with a dial caliper, and tumor volume was calculated as width2.times.length.times.0.5.
[0545] As shown in FIG. 90, HM.sub.165S3B protein significantly suppressed the tumor growth (p<0.05) during the treatment and the effect persisted for at least 2 weeks after the treatment was terminated (65% inhibition at day 35, respectively). Whereas, the growth of HS3B-treated tumors increased, matching the rates observed in control mice (Vehicle). These results suggest that iCP-SOCS3 inhibits the growth of established tumors as well as the tumor growth of gastric cancer cells.
[0546] mRNA levels were analyzed using the tumor tissues removed at 2 weeks (Day 35) after termination of drug administration to analyze changes in expressions of major biomarker genes by iCP-SOCS3.
[0547] Expressions of cell cycle (cyclinA1) and angiogenesis (VEGF)-related genes were significantly regulated by treatment of iCP-SOCS3.
[0548] Accordingly, it was confirmed that iCP-SOCS3 is able to inhibit development of gastric cancer through expressions of various factors regulating cancer activity such as cell cycle, angiogenesis, etc.
[0549] Further, tumor tissues removed at 2 weeks (Day 35) after termination of drug administration were used to perform Western blotting and IHC, and increase or decrease in the expressions of cancer activity regulating factors by iCP-SOCS3 was observed.
[0550] In iCP-SOCS3-treated tumor tissues, expressions of a cell cycle regulator, p21 and apoptosis inducers, Bax and cleaved caspase-3 were increased. Further, expression of an angiogenesis inducer VEGF was also remarkably decreased (FIG. 90). Accordingly, it was demonstrated that cell cycle, apoptosis, and angiogenesis are also regulated by iCP-SOCS3 in-vivo.
Example 19-2. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 in Colorectal Cancer Cell (HCT116)-Derived Xenograft (CDX) Model
[0551] The following experiments were performed in the same manner as in Example 19-1.
[0552] As shown in FIG. 91, HM.sub.165S3B protein significantly suppressed the tumor growth (p<0.05) during the treatment and the effect persisted for at least 2 weeks after the treatment was terminated (79% at day 35, respectively). Whereas, the growth of HS3B-treated tumors increased, matching the rates observed in control mice (Vehicle). These results suggest that iCP-SOCS3 inhibits the growth of established tumors as well as the tumor growth of colorectal cancer cells.
[0553] mRNA levels were analyzed using the tumor tissues removed at 2 weeks (Day 35) after termination of drug administration to analyze changes in expressions of major biomarker genes by iCP-SOCS3.
[0554] Expressions of apoptosis (Bax) and angiogenesis (VEGF)-related genes were significantly regulated by treatment of iCP-SOCS3.
[0555] Accordingly, it was confirmed that iCP-SOCS3 is able to inhibit development of colorectal cancer through expressions of various factors regulating cancer activity such as apoptosis, angiogenesis, etc.
[0556] Further, tumor tissues removed at 2 weeks (Day 35) after termination of drug administration were used to perform Western blotting and IHC, and increase or decrease in the expressions of cancer activity regulating factors by iCP-SOCS3 was observed.
[0557] In iCP-SOCS3-treated tumor tissues, expressions of a cell cycle regulator, p21 and an apoptosis inducer, Bax were increased. Further, expression of an angiogenesis inducer VEGF was also remarkably decreased (FIG. 91). Accordingly, it was demonstrated that cell cycle, apoptosis, and angiogenesis are also regulated by iCP-SOCS3 in-vivo.
Example 19-3. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 in Glioblastoma Cell (U-87 MG)-Derived Xenograft (CDX) Model
[0558] The following experiments were performed in the same manner as in Example 19-1.
[0559] As shown in FIG. 92, HM.sub.165S3B protein significantly suppressed the tumor growth (p<0.05) during the treatment and the effect persisted for at least 2 weeks after the treatment was terminated (76% at day 42, respectively). Whereas, the growth of HS3B-treated tumors increased, matching the rates observed in control mice (Vehicle). These results suggest that iCP-SOCS3 inhibits the growth of established tumors as well as the tumor growth of glioblastoma cells.
[0560] mRNA levels were analyzed using the tumor tissues removed at 3 weeks (Day 42) after termination of drug administration to analyze changes in expressions of major biomarker genes by iCP-SOCS3.
[0561] Expressions of apoptosis (Bax), cell cycle (CDK4, CDK2, cyclinE, cyclinAl), angiogenesis (HIF1a, VEGF), and migration (FAK)-related genes were significantly regulated by treatment of iCP-SOCS3.
[0562] Expressions of NSE, FSTL-1, and GFAT which are biomarker genes of glioblastoma were remarkably decreased by iCP-SOCS3.
[0563] Expressions of VEGF and angiopoietin I which are biomarker genes of angiogenesis were significantly decreased by treatment of iCP-SOCS3.
[0564] Accordingly, it was confirmed that iCP-SOCS3 is able to inhibit development of glioblastoma through expressions of various factors regulating cancer activity such as apoptosis, cell cycle, migration, angiogenesis, etc.
Example 19-4. Investigation of Anti-Cancer Efficacy of iCP-SOCS3 in Breast Cancer Cell (MDA-MB-231)-Derived Xenograft (CDX) Model
[0565] The following experiments were performed in the same manner as in Example 19-1.
[0566] As shown in FIG. 93, HM.sub.165S3B protein significantly suppressed the tumor growth (p<0.05) during the treatment and the effect persisted for at least 2 weeks after the treatment was terminated (63% at day 35, respectively). Whereas, the growth of HS3B-treated tumors increased, matching the rates observed in control mice (Vehicle). These results suggest that iCP-SOCS3 inhibits the growth of established tumors as well as the tumor growth of breast cancer cells. mRNA levels were analyzed using the tumor tissues removed at 2 weeks (Day 35) after termination of drug administration to analyze changes in expressions of major biomarker genes by iCP-SOCS3.
[0567] Expressions of cell cycle (p21, p2'7, cyclinE), proliferation (PCNA), and angiogenesis (HIF1a, VEGF)-related genes were significantly regulated by treatment of iCP-SOCS3.
[0568] Accordingly, it was confirmed that iCP-SOCS3 is able to inhibit development of breast cancer through expressions of various factors regulating cancer activity such as cell cycle, angiogenesis, etc., indicating characteristics of iCP-SOCS3 as a mechanism-specific therapeutic agent targeting solid tumors.
[0569] Further, tumor tissues removed at 2 weeks (Day 35) after termination of drug administration were used to perform Western blotting and IHC, and increase or decrease in the expressions of cancer activity regulating factors by iCP-SOCS3 was observed.
[0570] In iCP-SOCS3-treated tumor tissues, expression of a cell cycle regulator, p21 was increased and expressions of angiogenesis inducers, VEGF and CD31 were remarkably decreased (FIG. 93). Accordingly, it was demonstrated that cell cycle and angiogenesis are also regulated by iCP-SOCS3 in-vivo.
[0571] Statistical Analysis
[0572] Statistical analysis and graphic presentation have been performed using GraphPad Prism 5.01 software (GraphPad, La Jolla, Calif., USA). All experimental data are presented as means.+-.SEM. Statistical significance was analyzed by the Student's t-test or ANOVA method. Experimental differences between groups were assessed using paired Student's t-tests. For animal experiments, ANOVA was used for comparing between and within groups to determine the significance. Differences with p<0.05 are considered to be statistically significant.
[0573] Those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in different forms without departing from the essential characteristics thereof. Therefore, it should be understood that the disclosed embodiments are not limitative, but illustrative in all aspects. The scope of the present invention is made to the appended claims rather than to the foregoing description, and all variations which come within the range of equivalency of the claims are therefore intended to be embraced therein.
Sequence CWU
1
1
838112PRTArtificial SequenceAmino acid Sequence of aMTD1 1Ala Ala Ala Leu
Ala Pro Val Val Leu Ala Leu Pro1 5 10
212PRTArtificial SequenceAmino acid Sequence of aMTD2 2Ala Ala Ala Val
Pro Leu Leu Ala Val Val Val Pro1 5 10
312PRTArtificial SequenceAmino acid Sequence of aMTD3 3Ala Ala Leu Leu
Val Pro Ala Ala Val Leu Ala Pro1 5 10
412PRTArtificial SequenceAmino acid Sequence of aMTD4 4Ala Leu Ala Leu
Leu Pro Val Ala Ala Leu Ala Pro1 5 10
512PRTArtificial SequenceAmino acid Sequence of aMTD5 5Ala Ala Ala Leu
Leu Pro Val Ala Leu Val Ala Pro1 5 10
612PRTArtificial SequenceAmino acid Sequence of aMTD11 6Val Val Ala
Leu Ala Pro Ala Leu Ala Ala Leu Pro1 5 10
712PRTArtificial SequenceAmino acid Sequence of aMTD12 7Leu Leu
Ala Ala Val Pro Ala Val Leu Leu Ala Pro1 5
10 812PRTArtificial SequenceAmino acid Sequence of aMTD13 8Ala
Ala Ala Leu Val Pro Val Val Ala Leu Leu Pro1 5
10 912PRTArtificial SequenceAmino acid Sequence of aMTD21
9Ala Val Ala Leu Leu Pro Ala Leu Leu Ala Val Pro1 5
10 1012PRTArtificial SequenceAmino acid Sequence of
aMTD22 10Ala Val Val Leu Val Pro Val Leu Ala Ala Ala Pro1 5
10 1112PRTArtificial SequenceAmino acid Sequence
of aMTD23 11Val Val Leu Val Leu Pro Ala Ala Ala Ala Val Pro1
5 10 1212PRTArtificial SequenceAmino acid
Sequence of aMTD24 12Ile Ala Leu Ala Ala Pro Ala Leu Ile Val Ala Pro1
5 10 1312PRTArtificial SequenceAmino
acid Sequence of aMTD25 13Ile Val Ala Val Ala Pro Ala Leu Val Ala Leu
Pro1 5 10 1412PRTArtificial
SequenceAmino acid Sequence of aMTD42 14Val Ala Ala Leu Pro Val Val Ala
Val Val Ala Pro1 5 10
1512PRTArtificial SequenceAmino acid Sequence of aMTD43 15Leu Leu Ala Ala
Pro Leu Val Val Ala Ala Val Pro1 5 10
1612PRTArtificial SequenceAmino acid Sequence of aMTD44 16Ala Leu Ala
Val Pro Val Ala Leu Leu Val Ala Pro1 5 10
1712PRTArtificial SequenceAmino acid Sequence of aMTD61 17Val Ala
Ala Leu Pro Val Leu Leu Ala Ala Leu Pro1 5
10 1812PRTArtificial SequenceAmino acid Sequence of aMTD62 18Val
Ala Leu Leu Ala Pro Val Ala Leu Ala Val Pro1 5
10 1912PRTArtificial SequenceAmino acid Sequence of aMTD63
19Ala Ala Leu Leu Val Pro Ala Leu Val Ala Val Pro1 5
10 2012PRTArtificial SequenceAmino acid Sequence of
aMTD64 20Ala Ile Val Ala Leu Pro Val Ala Val Leu Ala Pro1 5
10 2112PRTArtificial SequenceAmino acid Sequence
of aMTD65 21Ile Ala Ile Val Ala Pro Val Val Ala Leu Ala Pro1
5 10 2212PRTArtificial SequenceAmino acid
Sequence of aMTD81 22Ala Ala Leu Leu Pro Ala Leu Ala Ala Leu Leu Pro1
5 10 2312PRTArtificial SequenceAmino
acid Sequence of aMTD82 23Ala Val Val Leu Ala Pro Val Ala Ala Val Leu
Pro1 5 10 2412PRTArtificial
SequenceAmino acid Sequence of aMTD83 24Leu Ala Val Ala Ala Pro Leu Ala
Leu Ala Leu Pro1 5 10
2512PRTArtificial SequenceAmino acid Sequence of aMTD84 25Ala Ala Val Ala
Ala Pro Leu Leu Leu Ala Leu Pro1 5 10
2612PRTArtificial SequenceAmino acid Sequence of aMTD85 26Leu Leu Val
Leu Pro Ala Ala Ala Leu Ala Ala Pro1 5 10
2712PRTArtificial SequenceAmino acid Sequence of aMTD101 27Leu Val
Ala Leu Ala Pro Val Ala Ala Val Leu Pro1 5
10 2812PRTArtificial SequenceAmino acid Sequence of aMTD102 28Leu
Ala Leu Ala Pro Ala Ala Leu Ala Leu Leu Pro1 5
10 2912PRTArtificial SequenceAmino acid Sequence of aMTD103
29Ala Leu Ile Ala Ala Pro Ile Leu Ala Leu Ala Pro1 5
10 3012PRTArtificial SequenceAmino acid Sequence of
aMTD104 30Ala Val Val Ala Ala Pro Leu Val Leu Ala Leu Pro1
5 10 3112PRTArtificial SequenceAmino acid
Sequence of aMTD105 31Leu Leu Ala Leu Ala Pro Ala Ala Leu Leu Ala Pro1
5 10 3212PRTArtificial SequenceAmino
acid Sequence of aMTD121 32Ala Ile Val Ala Leu Pro Ala Leu Ala Leu Ala
Pro1 5 10 3312PRTArtificial
SequenceAmino acid Sequence of aMTD123 33Ala Ala Ile Ile Val Pro Ala Ala
Leu Leu Ala Pro1 5 10
3412PRTArtificial SequenceAmino acid Sequence of aMTD124 34Ile Ala Val
Ala Leu Pro Ala Leu Ile Ala Ala Pro1 5 10
3512PRTArtificial SequenceAmino acid Sequence of aMTD141 35Ala Val
Ile Val Leu Pro Ala Leu Ala Val Ala Pro1 5
10 3612PRTArtificial SequenceAmino acid Sequence of aMTD143 36Ala
Val Leu Ala Val Pro Ala Val Leu Val Ala Pro1 5
10 3712PRTArtificial SequenceAmino acid Sequence of aMTD144
37Val Leu Ala Ile Val Pro Ala Val Ala Leu Ala Pro1 5
10 3812PRTArtificial SequenceAmino acid Sequence of
aMTD145 38Leu Leu Ala Val Val Pro Ala Val Ala Leu Ala Pro1
5 10 3912PRTArtificial SequenceAmino acid
Sequence of aMTD161 39Ala Val Ile Ala Leu Pro Ala Leu Ile Ala Ala Pro1
5 10 4012PRTArtificial SequenceAmino
acid Sequence of aMTD162 40Ala Val Val Ala Leu Pro Ala Ala Leu Ile Val
Pro1 5 10 4112PRTArtificial
SequenceAmino acid Sequence of aMTD163 41Leu Ala Leu Val Leu Pro Ala Ala
Leu Ala Ala Pro1 5 10
4212PRTArtificial SequenceAmino acid Sequence of aMTD164 42Leu Ala Ala
Val Leu Pro Ala Leu Leu Ala Ala Pro1 5 10
4312PRTArtificial SequenceAmino acid Sequence of aMTD165 43Ala Leu
Ala Val Pro Val Ala Leu Ala Ile Val Pro1 5
10 4412PRTArtificial SequenceAmino acid Sequence of aMTD182 44Ala
Leu Ile Ala Pro Val Val Ala Leu Val Ala Pro1 5
10 4512PRTArtificial SequenceAmino acid Sequence of aMTD183
45Leu Leu Ala Ala Pro Val Val Ile Ala Leu Ala Pro1 5
10 4612PRTArtificial SequenceAmino acid Sequence of
aMTD184 46Leu Ala Ala Ile Val Pro Ala Ile Ile Ala Val Pro1
5 10 4712PRTArtificial SequenceAmino acid
Sequence of aMTD185 47Ala Ala Leu Val Leu Pro Leu Ile Ile Ala Ala Pro1
5 10 4812PRTArtificial SequenceAmino
acid Sequence of aMTD201 48Leu Ala Leu Ala Val Pro Ala Leu Ala Ala Leu
Pro1 5 10 4912PRTArtificial
SequenceAmino acid Sequence of aMTD204 49Leu Ile Ala Ala Leu Pro Ala Val
Ala Ala Leu Pro1 5 10
5012PRTArtificial SequenceAmino acid Sequence of aMTD205 50Ala Leu Ala
Leu Val Pro Ala Ile Ala Ala Leu Pro1 5 10
5112PRTArtificial SequenceAmino acid Sequence of aMTD221 51Ala Ala
Ile Leu Ala Pro Ile Val Ala Leu Ala Pro1 5
10 5212PRTArtificial SequenceAmino acid Sequence of aMTD222 52Ala
Leu Leu Ile Ala Pro Ala Ala Val Ile Ala Pro1 5
10 5312PRTArtificial SequenceAmino acid Sequence of aMTD223
53Ala Ile Leu Ala Val Pro Ile Ala Val Val Ala Pro1 5
10 5412PRTArtificial SequenceAmino acid Sequence of
aMTD224 54Ile Leu Ala Ala Val Pro Ile Ala Leu Ala Ala Pro1
5 10 5512PRTArtificial SequenceAmino acid
Sequence of aMTD225 55Val Ala Ala Leu Leu Pro Ala Ala Ala Val Leu Pro1
5 10 5612PRTArtificial SequenceAmino
acid Sequence of aMTD241 56Ala Ala Ala Val Val Pro Val Leu Leu Val Ala
Pro1 5 10 5712PRTArtificial
SequenceAmino acid Sequence of aMTD242 57Ala Ala Leu Leu Val Pro Ala Leu
Val Ala Ala Pro1 5 10
5812PRTArtificial SequenceAmino acid Sequence of aMTD243 58Ala Ala Val
Leu Leu Pro Val Ala Leu Ala Ala Pro1 5 10
5912PRTArtificial SequenceAmino acid Sequence of aMTD245 59Ala Ala
Ala Leu Ala Pro Val Leu Ala Leu Val Pro1 5
10 6012PRTArtificial SequenceAmino acid Sequence of aMTD261 60Leu
Val Leu Val Pro Leu Leu Ala Ala Ala Ala Pro1 5
10 6112PRTArtificial SequenceAmino acid Sequence of aMTD262
61Ala Leu Ile Ala Val Pro Ala Ile Ile Val Ala Pro1 5
10 6212PRTArtificial SequenceAmino acid Sequence of
aMTD263 62Ala Leu Ala Val Ile Pro Ala Ala Ala Ile Leu Pro1
5 10 6312PRTArtificial SequenceAmino acid
Sequence of aMTD264 63Leu Ala Ala Ala Pro Val Val Ile Val Ile Ala Pro1
5 10 6412PRTArtificial SequenceAmino
acid Sequence of aMTD265 64Val Leu Ala Ile Ala Pro Leu Leu Ala Ala Val
Pro1 5 10 6512PRTArtificial
SequenceAmino acid Sequence of aMTD281 65Ala Leu Ile Val Leu Pro Ala Ala
Val Ala Val Pro1 5 10
6612PRTArtificial SequenceAmino acid Sequence of aMTD282 66Val Leu Ala
Val Ala Pro Ala Leu Ile Val Ala Pro1 5 10
6712PRTArtificial SequenceAmino acid Sequence of aMTD283 67Ala Ala
Leu Leu Ala Pro Ala Leu Ile Val Ala Pro1 5
10 6812PRTArtificial SequenceAmino acid Sequence of aMTD284 68Ala
Leu Ile Ala Pro Ala Val Ala Leu Ile Val Pro1 5
10 6912PRTArtificial SequenceAmino acid Sequence of aMTD285
69Ala Ile Val Leu Leu Pro Ala Ala Val Val Ala Pro1 5
10 7012PRTArtificial SequenceAmino acid Sequence of
aMTD301 70Val Ile Ala Ala Pro Val Leu Ala Val Leu Ala Pro1
5 10 7112PRTArtificial SequenceAmino acid
Sequence of aMTD302 71Leu Ala Leu Ala Pro Ala Leu Ala Leu Leu Ala Pro1
5 10 7212PRTArtificial SequenceAmino
acid Sequence of aMTD304 72Ala Ile Ile Leu Ala Pro Ile Ala Ala Ile Ala
Pro1 5 10 7312PRTArtificial
SequenceAmino acid Sequence of aMTD305 73Ile Ala Leu Ala Ala Pro Ile Leu
Leu Ala Ala Pro1 5 10
7412PRTArtificial SequenceAmino acid Sequence of aMTD321 74Ile Val Ala
Val Ala Leu Pro Ala Leu Ala Val Pro1 5 10
7512PRTArtificial SequenceAmino acid Sequence of aMTD322 75Val Val
Ala Ile Val Leu Pro Ala Leu Ala Ala Pro1 5
10 7612PRTArtificial SequenceAmino acid Sequence of aMTD323 76Ile
Val Ala Val Ala Leu Pro Val Ala Leu Ala Pro1 5
10 7712PRTArtificial SequenceAmino acid Sequence of aMTD324
77Ile Val Ala Val Ala Leu Pro Ala Ala Leu Val Pro1 5
10 7812PRTArtificial SequenceAmino acid Sequence of
aMTD325 78Ile Val Ala Val Ala Leu Pro Ala Val Ala Leu Pro1
5 10 7912PRTArtificial SequenceAmino acid
Sequence of aMTD341 79Ile Val Ala Val Ala Leu Pro Ala Val Leu Ala Pro1
5 10 8012PRTArtificial SequenceAmino
acid Sequence of aMTD342 80Val Ile Val Ala Leu Ala Pro Ala Val Leu Ala
Pro1 5 10 8112PRTArtificial
SequenceAmino acid Sequence of aMTD343 81Ile Val Ala Val Ala Leu Pro Ala
Leu Val Ala Pro1 5 10
8212PRTArtificial SequenceAmino acid Sequence of aMTD345 82Ala Leu Leu
Ile Val Ala Pro Val Ala Val Ala Pro1 5 10
8312PRTArtificial SequenceAmino acid Sequence of aMTD361 83Ala Val
Val Ile Val Ala Pro Ala Val Ile Ala Pro1 5
10 8412PRTArtificial SequenceAmino acid Sequence of aMTD363 84Ala
Val Leu Ala Val Ala Pro Ala Leu Ile Val Pro1 5
10 8512PRTArtificial SequenceAmino acid Sequence of aMTD364
85Leu Val Ala Ala Val Ala Pro Ala Leu Ile Val Pro1 5
10 8612PRTArtificial SequenceAmino acid Sequence of
aMTD365 86Ala Val Ile Val Val Ala Pro Ala Leu Leu Ala Pro1
5 10 8712PRTArtificial SequenceAmino acid
Sequence of aMTD381 87Val Val Ala Ile Val Leu Pro Ala Val Ala Ala Pro1
5 10 8812PRTArtificial SequenceAmino
acid Sequence of aMTD382 88Ala Ala Ala Leu Val Ile Pro Ala Ile Leu Ala
Pro1 5 10 8912PRTArtificial
SequenceAmino acid Sequence of aMTD383 89Val Ile Val Ala Leu Ala Pro Ala
Leu Leu Ala Pro1 5 10
9012PRTArtificial SequenceAmino acid Sequence of aMTD384 90Val Ile Val
Ala Ile Ala Pro Ala Leu Leu Ala Pro1 5 10
9112PRTArtificial SequenceAmino acid Sequence of aMTD385 91Ile Val
Ala Ile Ala Val Pro Ala Leu Val Ala Pro1 5
10 9212PRTArtificial SequenceAmino acid Sequence of aMTD401 92Ala
Ala Leu Ala Val Ile Pro Ala Ala Ile Leu Pro1 5
10 9312PRTArtificial SequenceAmino acid Sequence of aMTD402
93Ala Leu Ala Ala Val Ile Pro Ala Ala Ile Leu Pro1 5
10 9412PRTArtificial SequenceAmino acid Sequence of
aMTD403 94Ala Ala Ala Leu Val Ile Pro Ala Ala Ile Leu Pro1
5 10 9512PRTArtificial SequenceAmino acid
Sequence of aMTD404 95Leu Ala Ala Ala Val Ile Pro Ala Ala Ile Leu Pro1
5 10 9612PRTArtificial SequenceAmino
acid Sequence of aMTD405 96Leu Ala Ala Ala Val Ile Pro Val Ala Ile Leu
Pro1 5 10 9712PRTArtificial
SequenceAmino acid Sequence of aMTD421 97Ala Ala Ile Leu Ala Ala Pro Leu
Ile Ala Val Pro1 5 10
9812PRTArtificial SequenceAmino acid Sequence of aMTD422 98Val Val Ala
Ile Leu Ala Pro Leu Leu Ala Ala Pro1 5 10
9912PRTArtificial SequenceAmino acid Sequence of aMTD424 99Ala Val
Val Val Ala Ala Pro Val Leu Ala Leu Pro1 5
10 10012PRTArtificial SequenceAmino acid Sequence of aMTD425
100Ala Val Val Ala Ile Ala Pro Val Leu Ala Leu Pro1 5
10 10112PRTArtificial SequenceAmino acid Sequence of
aMTD442 101Ala Leu Ala Ala Leu Val Pro Ala Val Leu Val Pro1
5 10 10212PRTArtificial SequenceAmino acid
Sequence of aMTD443 102Ala Leu Ala Ala Leu Val Pro Val Ala Leu Val Pro1
5 10 10312PRTArtificial
SequenceAmino acid Sequence of aMTD444 103Leu Ala Ala Ala Leu Val Pro Val
Ala Leu Val Pro1 5 10
10412PRTArtificial SequenceAmino acid Sequence of aMTD445 104Ala Leu Ala
Ala Leu Val Pro Ala Leu Val Val Pro1 5 10
10512PRTArtificial SequenceAmino acid Sequence of aMTD461 105Ile
Ala Ala Val Ile Val Pro Ala Val Ala Leu Pro1 5
10 10612PRTArtificial SequenceAmino acid Sequence of aMTD462
106Ile Ala Ala Val Leu Val Pro Ala Val Ala Leu Pro1 5
10 10712PRTArtificial SequenceAmino acid Sequence of
aMTD463 107Ala Val Ala Ile Leu Val Pro Leu Leu Ala Ala Pro1
5 10 10812PRTArtificial SequenceAmino acid
Sequence of aMTD464 108Ala Val Val Ile Leu Val Pro Leu Ala Ala Ala Pro1
5 10 10912PRTArtificial
SequenceAmino acid Sequence of aMTD465 109Ile Ala Ala Val Ile Val Pro Val
Ala Ala Leu Pro1 5 10
11012PRTArtificial SequenceAmino acid Sequence of aMTD481 110Ala Ile Ala
Ile Ala Ile Val Pro Val Ala Leu Pro1 5 10
11112PRTArtificial SequenceAmino acid Sequence of aMTD482 111Ile
Leu Ala Val Ala Ala Ile Pro Val Ala Val Pro1 5
10 11212PRTArtificial SequenceAmino acid Sequence of aMTD483
112Ile Leu Ala Ala Ala Ile Ile Pro Ala Ala Leu Pro1 5
10 11312PRTArtificial SequenceAmino acid Sequence of
aMTD484 113Leu Ala Val Val Leu Ala Ala Pro Ala Ile Val Pro1
5 10 11412PRTArtificial SequenceAmino acid
Sequence of aMTD485 114Ala Ile Leu Ala Ala Ile Val Pro Leu Ala Val Pro1
5 10 11512PRTArtificial
SequenceAmino acid Sequence of aMTD501 115Val Ile Val Ala Leu Ala Val Pro
Ala Leu Ala Pro1 5 10
11612PRTArtificial SequenceAmino acid Sequence of aMTD502 116Ala Ile Val
Ala Leu Ala Val Pro Val Leu Ala Pro1 5 10
11712PRTArtificial SequenceAmino acid Sequence of aMTD503 117Ala
Ala Ile Ile Ile Val Leu Pro Ala Ala Leu Pro1 5
10 11812PRTArtificial SequenceAmino acid Sequence of aMTD504
118Leu Ile Val Ala Leu Ala Val Pro Ala Leu Ala Pro1 5
10 11912PRTArtificial SequenceAmino acid Sequence of
aMTD505 119Ala Ile Ile Ile Val Ile Ala Pro Ala Ala Ala Pro1
5 10 12012PRTArtificial SequenceAmino acid
Sequence of aMTD521 120Leu Ala Ala Leu Ile Val Val Pro Ala Val Ala Pro1
5 10 12112PRTArtificial
SequenceAmino acid Sequence of aMTD522 121Ala Leu Leu Val Ile Ala Val Pro
Ala Val Ala Pro1 5 10
12212PRTArtificial SequenceAmino acid Sequence of aMTD524 122Ala Val Ala
Leu Ile Val Val Pro Ala Leu Ala Pro1 5 10
12312PRTArtificial SequenceAmino acid Sequence of aMTD525 123Ala
Leu Ala Ile Val Val Ala Pro Val Ala Val Pro1 5
10 12412PRTArtificial SequenceAmino acid Sequence of aMTD541
124Leu Leu Ala Leu Ile Ile Ala Pro Ala Ala Ala Pro1 5
10 12512PRTArtificial SequenceAmino acid Sequence of
aMTD542 125Ala Leu Ala Leu Ile Ile Val Pro Ala Val Ala Pro1
5 10 12612PRTArtificial SequenceAmino acid
Sequence of aMTD543 126Leu Leu Ala Ala Leu Ile Ala Pro Ala Ala Leu Pro1
5 10 12712PRTArtificial
SequenceAmino acid Sequence of aMTD544 127Ile Val Ala Leu Ile Val Ala Pro
Ala Ala Val Pro1 5 10
12812PRTArtificial SequenceAmino acid Sequence of aMTD545 128Val Val Leu
Val Leu Ala Ala Pro Ala Ala Val Pro1 5 10
12912PRTArtificial SequenceAmino acid Sequence of aMTD561 129Ala
Ala Val Ala Ile Val Leu Pro Ala Val Val Pro1 5
10 13012PRTArtificial SequenceAmino acid Sequence of aMTD562
130Ala Leu Ile Ala Ala Ile Val Pro Ala Leu Val Pro1 5
10 13112PRTArtificial SequenceAmino acid Sequence of
aMTD563 131Ala Leu Ala Val Ile Val Val Pro Ala Leu Ala Pro1
5 10 13212PRTArtificial SequenceAmino acid
Sequence of aMTD564 132Val Ala Ile Ala Leu Ile Val Pro Ala Leu Ala Pro1
5 10 13312PRTArtificial
SequenceAmino acid Sequence of aMTD565 133Val Ala Ile Val Leu Val Ala Pro
Ala Val Ala Pro1 5 10
13412PRTArtificial SequenceAmino acid Sequence of aMTD582 134Val Ala Val
Ala Leu Ile Val Pro Ala Leu Ala Pro1 5 10
13512PRTArtificial SequenceAmino acid Sequence of aMTD583 135Ala
Val Ile Leu Ala Leu Ala Pro Ile Val Ala Pro1 5
10 13612PRTArtificial SequenceAmino acid Sequence of aMTD585
136Ala Leu Ile Val Ala Ile Ala Pro Ala Leu Val Pro1 5
10 13712PRTArtificial SequenceAmino acid Sequence of
aMTD601 137Ala Ala Ile Leu Ile Ala Val Pro Ile Ala Ala Pro1
5 10 13812PRTArtificial SequenceAmino acid
Sequence of aMTD602 138Val Ile Val Ala Leu Ala Ala Pro Val Leu Ala Pro1
5 10 13912PRTArtificial
SequenceAmino acid Sequence of aMTD603 139Val Leu Val Ala Leu Ala Ala Pro
Val Ile Ala Pro1 5 10
14012PRTArtificial SequenceAmino acid Sequence of aMTD604 140Val Ala Leu
Ile Ala Val Ala Pro Ala Val Val Pro1 5 10
14112PRTArtificial SequenceAmino acid Sequence of aMTD605 141Val
Ile Ala Ala Val Leu Ala Pro Val Ala Val Pro1 5
10 14212PRTArtificial SequenceAmino acid Sequence of aMTD622
142Ala Leu Ile Val Leu Ala Ala Pro Val Ala Val Pro1 5
10 14312PRTArtificial SequenceAmino acid Sequence of
aMTD623 143Val Ala Ala Ala Ile Ala Leu Pro Ala Ile Val Pro1
5 10 14412PRTArtificial SequenceAmino acid
Sequence of aMTD625 144Ile Leu Ala Ala Ala Ala Ala Pro Leu Ile Val Pro1
5 10 14512PRTArtificial
SequenceAmino acid Sequence of aMTD643 145Leu Ala Leu Val Leu Ala Ala Pro
Ala Ile Val Pro1 5 10
14612PRTArtificial SequenceAmino acid Sequence of aMTD645 146Ala Leu Ala
Val Val Ala Leu Pro Ala Ile Val Pro1 5 10
14712PRTArtificial SequenceAmino acid Sequence of aMTD661 147Ala
Ala Ile Leu Ala Pro Ile Val Ala Ala Leu Pro1 5
10 14812PRTArtificial SequenceAmino acid Sequence of aMTD664
148Ile Leu Ile Ala Ile Ala Ile Pro Ala Ala Ala Pro1 5
10 14912PRTArtificial SequenceAmino acid Sequence of
aMTD665 149Leu Ala Ile Val Leu Ala Ala Pro Val Ala Val Pro1
5 10 15012PRTArtificial SequenceAmino acid
Sequence of aMTD666 150Ala Ala Ile Ala Ile Ile Ala Pro Ala Ile Val Pro1
5 10 15112PRTArtificial
SequenceAmino acid Sequence of aMTD667 151Leu Ala Val Ala Ile Val Ala Pro
Ala Leu Val Pro1 5 10
15212PRTArtificial SequenceAmino acid Sequence of aMTD683 152Leu Ala Ile
Val Leu Ala Ala Pro Ala Val Leu Pro1 5 10
15312PRTArtificial SequenceAmino acid Sequence of aMTD684 153Ala
Ala Ile Val Leu Ala Leu Pro Ala Val Leu Pro1 5
10 15412PRTArtificial SequenceAmino acid Sequence of aMTD685
154Ala Leu Leu Val Ala Val Leu Pro Ala Ala Leu Pro1 5
10 15512PRTArtificial SequenceAmino acid Sequence of
aMTD686 155Ala Ala Leu Val Ala Val Leu Pro Val Ala Leu Pro1
5 10 15612PRTArtificial SequenceAmino acid
Sequence of aMTD687 156Ala Ile Leu Ala Val Ala Leu Pro Leu Leu Ala Pro1
5 10 15712PRTArtificial
SequenceAmino acid Sequence of aMTD703 157Ile Val Ala Val Ala Leu Val Pro
Ala Leu Ala Pro1 5 10
15812PRTArtificial SequenceAmino acid Sequence of aMTD705 158Ile Val Ala
Val Ala Leu Leu Pro Ala Leu Ala Pro1 5 10
15912PRTArtificial SequenceAmino acid Sequence of aMTD706 159Ile
Val Ala Val Ala Leu Leu Pro Ala Val Ala Pro1 5
10 16012PRTArtificial SequenceAmino acid Sequence of aMTD707
160Ile Val Ala Leu Ala Val Leu Pro Ala Val Ala Pro1 5
10 16112PRTArtificial SequenceAmino acid Sequence of
aMTD724 161Val Ala Val Leu Ala Val Leu Pro Ala Leu Ala Pro1
5 10 16212PRTArtificial SequenceAmino acid
Sequence of aMTD725 162Ile Ala Val Leu Ala Val Ala Pro Ala Val Leu Pro1
5 10 16312PRTArtificial
SequenceAmino acid Sequence of aMTD726 163Leu Ala Val Ala Ile Ile Ala Pro
Ala Val Ala Pro1 5 10
16412PRTArtificial SequenceAmino acid Sequence of aMTD727 164Val Ala Leu
Ala Ile Ala Leu Pro Ala Val Leu Pro1 5 10
16512PRTArtificial SequenceAmino acid Sequence of aMTD743 165Ala
Ile Ala Ile Ala Leu Val Pro Val Ala Leu Pro1 5
10 16612PRTArtificial SequenceAmino acid Sequence of aMTD744
166Ala Ala Val Val Ile Val Ala Pro Val Ala Leu Pro1 5
10 16712PRTArtificial SequenceAmino acid Sequence of
aMTD746 167Val Ala Ile Ile Val Val Ala Pro Ala Leu Ala Pro1
5 10 16812PRTArtificial SequenceAmino acid
Sequence of aMTD747 168Val Ala Leu Leu Ala Ile Ala Pro Ala Leu Ala Pro1
5 10 16912PRTArtificial
SequenceAmino acid Sequence of aMTD763 169Val Ala Val Leu Ile Ala Val Pro
Ala Leu Ala Pro1 5 10
17012PRTArtificial SequenceAmino acid Sequence of aMTD764 170Ala Val Ala
Leu Ala Val Leu Pro Ala Val Val Pro1 5 10
17112PRTArtificial SequenceAmino acid Sequence of aMTD765 171Ala
Val Ala Leu Ala Val Val Pro Ala Val Leu Pro1 5
10 17212PRTArtificial SequenceAmino acid Sequence of aMTD766
172Ile Val Val Ile Ala Val Ala Pro Ala Val Ala Pro1 5
10 17312PRTArtificial SequenceAmino acid Sequence of
aMTD767 173Ile Val Val Ala Ala Val Val Pro Ala Leu Ala Pro1
5 10 17412PRTArtificial SequenceAmino acid
Sequence of aMTD783 174Ile Val Ala Leu Val Pro Ala Val Ala Ile Ala Pro1
5 10 17512PRTArtificial
SequenceAmino acid Sequence of aMTD784 175Val Ala Ala Leu Pro Ala Val Ala
Leu Val Val Pro1 5 10
17612PRTArtificial SequenceAmino acid Sequence of aMTD786 176Leu Val Ala
Ile Ala Pro Leu Ala Val Leu Ala Pro1 5 10
17712PRTArtificial SequenceAmino acid Sequence of aMTD787 177Ala
Val Ala Leu Val Pro Val Ile Val Ala Ala Pro1 5
10 17812PRTArtificial SequenceAmino acid Sequence of aMTD788
178Ala Ile Ala Val Ala Ile Ala Pro Val Ala Leu Pro1 5
10 17912PRTArtificial SequenceAmino acid Sequence of
aMTD803 179Ala Ile Ala Leu Ala Val Pro Val Leu Ala Leu Pro1
5 10 18012PRTArtificial SequenceAmino acid
Sequence of aMTD805 180Leu Val Leu Ile Ala Ala Ala Pro Ile Ala Leu Pro1
5 10 18112PRTArtificial
SequenceAmino acid Sequence of aMTD806 181Leu Val Ala Leu Ala Val Pro Ala
Ala Val Leu Pro1 5 10
18212PRTArtificial SequenceAmino acid Sequence of aMTD807 182Ala Val Ala
Leu Ala Val Pro Ala Leu Val Leu Pro1 5 10
18312PRTArtificial SequenceAmino acid Sequence of aMTD808 183Leu
Val Val Leu Ala Ala Ala Pro Leu Ala Val Pro1 5
10 18412PRTArtificial SequenceAmino acid Sequence of aMTD809
184Leu Ile Val Leu Ala Ala Pro Ala Leu Ala Ala Pro1 5
10 18512PRTArtificial SequenceAmino acid Sequence of
aMTD810 185Val Ile Val Leu Ala Ala Pro Ala Leu Ala Ala Pro1
5 10 18612PRTArtificial SequenceAmino acid
Sequence of aMTD811 186Ala Val Val Leu Ala Val Pro Ala Leu Ala Val Pro1
5 10 18712PRTArtificial
SequenceAmino acid Sequence of aMTD824 187Leu Ile Ile Val Ala Ala Ala Pro
Ala Val Ala Pro1 5 10
18812PRTArtificial SequenceAmino acid Sequence of aMTD825 188Ile Val Ala
Val Ile Val Ala Pro Ala Val Ala Pro1 5 10
18912PRTArtificial SequenceAmino acid Sequence of aMTD826 189Leu
Val Ala Leu Ala Ala Pro Ile Ile Ala Val Pro1 5
10 19012PRTArtificial SequenceAmino acid Sequence of aMTD827
190Ile Ala Ala Val Leu Ala Ala Pro Ala Leu Val Pro1 5
10 19112PRTArtificial SequenceAmino acid Sequence of
aMTD828 191Ile Ala Leu Leu Ala Ala Pro Ile Ile Ala Val Pro1
5 10 19212PRTArtificial SequenceAmino acid
Sequence of aMTD829 192Ala Ala Leu Ala Leu Val Ala Pro Val Ile Val Pro1
5 10 19312PRTArtificial
SequenceAmino acid Sequence of aMTD830 193Ile Ala Leu Val Ala Ala Pro Val
Ala Leu Val Pro1 5 10
19412PRTArtificial SequenceAmino acid Sequence of aMTD831 194Ile Ile Val
Ala Val Ala Pro Ala Ala Ile Val Pro1 5 10
19512PRTArtificial SequenceAmino acid Sequence of aMTD832 195Ala
Val Ala Ala Ile Val Pro Val Ile Val Ala Pro1 5
10 19612PRTArtificial SequenceAmino acid Sequence of aMTD843
196Ala Val Leu Val Leu Val Ala Pro Ala Ala Ala Pro1 5
10 19712PRTArtificial SequenceAmino acid Sequence of
aMTD844 197Val Val Ala Leu Leu Ala Pro Leu Ile Ala Ala Pro1
5 10 19812PRTArtificial SequenceAmino acid
Sequence of aMTD845 198Ala Ala Val Val Ile Ala Pro Leu Leu Ala Val Pro1
5 10 19912PRTArtificial
SequenceAmino acid Sequence of aMTD846 199Ile Ala Val Ala Val Ala Ala Pro
Leu Leu Val Pro1 5 10
20012PRTArtificial SequenceAmino acid Sequence of aMTD847 200Leu Val Ala
Ile Val Val Leu Pro Ala Val Ala Pro1 5 10
20112PRTArtificial SequenceAmino acid Sequence of aMTD848 201Ala
Val Ala Ile Val Val Leu Pro Ala Val Ala Pro1 5
10 20212PRTArtificial SequenceAmino acid Sequence of aMTD849
202Ala Val Ile Leu Leu Ala Pro Leu Ile Ala Ala Pro1 5
10 20312PRTArtificial SequenceAmino acid Sequence of
aMTD850 203Leu Val Ile Ala Leu Ala Ala Pro Val Ala Leu Pro1
5 10 20412PRTArtificial SequenceAmino acid
Sequence of aMTD851 204Val Leu Ala Val Val Leu Pro Ala Val Ala Leu Pro1
5 10 20512PRTArtificial
SequenceAmino acid Sequence of aMTD852 205Val Leu Ala Val Ala Ala Pro Ala
Val Leu Leu Pro1 5 10
20612PRTArtificial SequenceAmino acid Sequence of aMTD863 206Ala Ala Val
Val Leu Leu Pro Ile Ile Ala Ala Pro1 5 10
20712PRTArtificial SequenceAmino acid Sequence of aMTD864 207Ala
Leu Leu Val Ile Ala Pro Ala Ile Ala Val Pro1 5
10 20812PRTArtificial SequenceAmino acid Sequence of aMTD865
208Ala Val Leu Val Ile Ala Val Pro Ala Ile Ala Pro1 5
10 20912PRTArtificial SequenceAmino acid Sequence of
aMTD867 209Ala Leu Leu Val Val Ile Ala Pro Leu Ala Ala Pro1
5 10 21012PRTArtificial SequenceAmino acid
Sequence of aMTD868 210Val Leu Val Ala Ala Ile Leu Pro Ala Ala Ile Pro1
5 10 21112PRTArtificial
SequenceAmino acid Sequence of aMTD870 211Val Leu Val Ala Ala Val Leu Pro
Ile Ala Ala Pro1 5 10
21212PRTArtificial SequenceAmino acid Sequence of aMTD872 212Val Leu Ala
Ala Ala Val Leu Pro Leu Val Val Pro1 5 10
21312PRTArtificial SequenceAmino acid Sequence of aMTD875 213Ala
Ile Ala Ile Val Val Pro Ala Val Ala Val Pro1 5
10 21412PRTArtificial SequenceAmino acid Sequence of aMTD877
214Val Ala Ile Ile Ala Val Pro Ala Val Val Ala Pro1 5
10 21512PRTArtificial SequenceAmino acid Sequence of
aMTD878 215Ile Val Ala Leu Val Ala Pro Ala Ala Val Val Pro1
5 10 21612PRTArtificial SequenceAmino acid
Sequence of aMTD879 216Ala Ala Ile Val Leu Leu Pro Ala Val Val Val Pro1
5 10 21712PRTArtificial
SequenceAmino acid Sequence of aMTD881 217Ala Ala Leu Ile Val Val Pro Ala
Val Ala Val Pro1 5 10
21812PRTArtificial SequenceAmino acid Sequence of aMTD882 218Ala Ile Ala
Leu Val Val Pro Ala Val Ala Val Pro1 5 10
21912PRTArtificial SequenceAmino acid Sequence of aMTD883 219Leu
Ala Ile Val Pro Ala Ala Ile Ala Ala Leu Pro1 5
10 22012PRTArtificial SequenceAmino acid Sequence of aMTD885
220Leu Val Ala Ile Ala Pro Ala Val Ala Val Leu Pro1 5
10 22112PRTArtificial SequenceAmino acid Sequence of
aMTD887 221Val Leu Ala Val Ala Pro Ala Val Ala Val Leu Pro1
5 10 22212PRTArtificial SequenceAmino acid
Sequence of aMTD888 222Ile Leu Ala Val Val Ala Ile Pro Ala Ala Ala Pro1
5 10 22312PRTArtificial
SequenceAmino acid Sequence of aMTD889 223Ile Leu Val Ala Ala Ala Pro Ile
Ala Ala Leu Pro1 5 10
22412PRTArtificial SequenceAmino acid Sequence of aMTD891 224Ile Leu Ala
Val Ala Ala Ile Pro Ala Ala Leu Pro1 5 10
22512PRTArtificial SequenceAmino acid Sequence of aMTD893 225Val
Ile Ala Ile Pro Ala Ile Leu Ala Ala Ala Pro1 5
10 22612PRTArtificial SequenceAmino acid Sequence of aMTD895
226Ala Ile Ile Ile Val Val Pro Ala Ile Ala Ala Pro1 5
10 22712PRTArtificial SequenceAmino acid Sequence of
aMTD896 227Ala Ile Leu Ile Val Val Ala Pro Ile Ala Ala Pro1
5 10 22812PRTArtificial SequenceAmino acid
Sequence of aMTD897 228Ala Val Ile Val Pro Val Ala Ile Ile Ala Ala Pro1
5 10 22912PRTArtificial
SequenceAmino acid Sequence of aMTD899 229Ala Val Val Ile Ala Leu Pro Ala
Val Val Ala Pro1 5 10
23012PRTArtificial SequenceAmino acid Sequence of aMTD900 230Ala Leu Val
Ala Val Ile Ala Pro Val Val Ala Pro1 5 10
23112PRTArtificial SequenceAmino acid Sequence of aMTD901 231Ala
Leu Val Ala Val Leu Pro Ala Val Ala Val Pro1 5
10 23212PRTArtificial SequenceAmino acid Sequence of aMTD902
232Ala Leu Val Ala Pro Leu Leu Ala Val Ala Val Pro1 5
10 23312PRTArtificial SequenceAmino acid Sequence of
aMTD904 233Ala Val Leu Ala Val Val Ala Pro Val Val Ala Pro1
5 10 23412PRTArtificial SequenceAmino acid
Sequence of aMTD905 234Ala Val Ile Ala Val Ala Pro Leu Val Val Ala Pro1
5 10 23512PRTArtificial
SequenceAmino acid Sequence of aMTD906 235Ala Val Ile Ala Leu Ala Pro Val
Val Val Ala Pro1 5 10
23612PRTArtificial SequenceAmino acid Sequence of aMTD907 236Val Ala Ile
Ala Leu Ala Pro Val Val Val Ala Pro1 5 10
23712PRTArtificial SequenceAmino acid Sequence of aMTD908 237Val
Ala Leu Ala Leu Ala Pro Val Val Val Ala Pro1 5
10 23812PRTArtificial SequenceAmino acid Sequence of aMTD910
238Val Ala Ala Leu Leu Pro Ala Val Val Val Ala Pro1 5
10 23912PRTArtificial SequenceAmino acid Sequence of
aMTD911 239Val Ala Leu Ala Leu Pro Ala Val Val Val Ala Pro1
5 10 24012PRTArtificial SequenceAmino acid
Sequence of aMTD912 240Val Ala Leu Leu Ala Pro Ala Val Val Val Ala Pro1
5 10 24136DNAArtificial SequencecDNA
Sequence of aMTD1 241gcggcggcgc tggcgccggt ggtgctggcg ctgccg
3624236DNAArtificial SequencecDNA Sequence of aMTD2
242gcggcggcgg tgccgctgct ggcggtggtg gtgccg
3624336DNAArtificial SequencecDNA Sequence of aMTD3 243gcggcgctgc
tggtgccggc ggcggtgctg gcgccg
3624436DNAArtificial SequencecDNA Sequence of aMTD4 244gcgctggcgc
tgctgccggt ggcggcgctg gcgccg
3624536DNAArtificial SequencecDNA Sequence of aMTD5 245gcggcggcgc
tgctgccggt ggcgctggtg gcgccg
3624636DNAArtificial SequencecDNA Sequence of aMTD11 246gtggtggcgc
tggcgccggc gctggcggcg ctgccg
3624736DNAArtificial SequencecDNA Sequence of aMTD12 247ctgctggcgg
cggtgccggc ggtgctgctg gcgccg
3624836DNAArtificial SequencecDNA Sequence of aMTD13 248gcggcggcgc
tggtgccggt ggtggcgctg ctgccg
3624936DNAArtificial SequencecDNA Sequence of aMTD21 249gcggtggcgc
tgctgccggc gctgctggcg gtgccg
3625036DNAArtificial SequencecDNA Sequence of aMTD22 250gcggtggtgc
tggtgccggt gctggcggcg gcgccg
3625136DNAArtificial SequencecDNA Sequence of aMTD23 251gtggtgctgg
tgctgccggc ggcggcggcg gtgccg
3625236DNAArtificial SequencecDNA Sequence of aMTD24 252attgcgctgg
cggcgccggc gctgattgtg gcgccg
3625336DNAArtificial SequencecDNA Sequence of aMTD25 253attgtggcgg
tggcgccggc gctggtggcg ctgccg
3625436DNAArtificial SequencePolynucleotide Sequence of aMTD42
254gtggcggcgc tgccggtggt ggcggtggtg gcgccg
3625536DNAArtificial SequencecDNA Sequence of aMTD43 255ctgctggcgg
cgccgctggt ggtggcggcg gtgccg
3625636DNAArtificial SequencecDNA Sequence of aMTD44 256gcgctggcgg
tgccggtggc gctgctggtg gcgccg
3625736DNAArtificial SequencecDNA Sequence of aMTD61 257gtggcggcgc
tgccggtgct gctggcggcg ctgccg
3625836DNAArtificial SequencecDNA Sequence of aMTD62 258gtggcgctgc
tggcgccggt ggcgctggcg gtgccg
3625936DNAArtificial SequencecDNA Sequence of aMTD63 259gcggcgctgc
tggtgccggc gctggtggcg gtgccg
3626036DNAArtificial SequencecDNA Sequence of aMTD64 260gcgattgtgg
cgctgccggt ggcggtgctg gcgccg
3626136DNAArtificial SequencecDNA Sequence of aMTD65 261attgcgattg
tggcgccggt ggtggcgctg gcgccg
3626236DNAArtificial SequencecDNA Sequence of aMTD81 262gcggcgctgc
tgccggcgct ggcggcgctg ctgccg
3626336DNAArtificial SequencecDNA Sequence of aMTD82 263gcggtggtgc
tggcgccggt ggcggcggtg ctgccg
3626436DNAArtificial SequencecDNA Sequence of aMTD83 264ctggcggtgg
cggcgccgct ggcgctggcg ctgccg
3626536DNAArtificial SequencecDNA Sequence of aMTD84 265gcggcggtgg
cggcgccgct gctgctggcg ctgccg
3626636DNAArtificial SequencecDNA Sequence of aMTD85 266ctgctggtgc
tgccggcggc ggcgctggcg gcgccg
3626736DNAArtificial SequencecDNA Sequence of aMTD101 267ctggtggcgg
tggcgccggt ggcggcggtg ctgccg
3626836DNAArtificial SequencecDNA Sequence of aMTD102 268ctggcgctgg
cgccggcggc gctggcgctg ctgccg
3626936DNAArtificial SequencecDNA Sequence of aMTD103 269gcgctgattg
cggcgccgat tctggcgctg gcgccg
3627036DNAArtificial SequencecDNA Sequence of aMTD104 270gcggtggtgg
cggcgccgct ggtgctggcg ctgccg
3627136DNAArtificial SequencecDNA Sequence of aMTD105 271ctgctggcgc
tggcgccggc ggcgctgctg gcgccg
3627236DNAArtificial SequencecDNA Sequence of aMTD121 272gcgattgtgg
cgctgccggc gctggcgctg gcgccg
3627336DNAArtificial SequencecDNA Sequence of aMTD123 273gcggcgatta
ttgtgccggc ggcgctgctg gcgccg
3627436DNAArtificial SequencecDNA Sequence of aMTD124 274attgcggtgg
cgctgccggc gctgattgcg gcgccg
3627536DNAArtificial SequencePolynucleotide Sequence of aMTD141
275gcggtgattg tgctgccggc gctggcggtg gcgccg
3627636DNAArtificial SequencePolynucleotide Sequence of aMTD143
276gcggtgctgg cggtgccggc ggtgctggtg gcgccg
3627736DNAArtificial SequencePolynucleotide Sequence of aMTD144
277gtgctggcga ttgtgccggc ggtggcgctg gcgccg
3627836DNAArtificial SequencePolynucleotide Sequence of aMTD145
278ctgctggcgg tggtgccggc ggtggcgctg gcgccg
3627936DNAArtificial SequencecDNA Sequence of aMTD161 279gcggtgattg
cgctgccggc gctgattgcg gcgccg
3628036DNAArtificial SequencecDNA Sequence of aMTD162 280gcggtggtgg
cgctgccggc ggcgctgatt gtgccg
3628136DNAArtificial SequencecDNA Sequence of aMTD163 281ctggcgctgg
tgctgccggc ggcgctggcg gcgccg
3628236DNAArtificial SequencecDNA Sequence of aMTD164 282ctggcggcgg
tgctgccggc gctgctggcg gcgccg
3628336DNAArtificial SequencecDNA Sequence of aMTD165 283gcgctggcgg
tgccggtggc gctggcgatt gtgccg
3628436DNAArtificial SequencecDNA Sequence of aMTD182 284gcgctgattg
cgccggtggt ggcgctggtg gcgccg
3628536DNAArtificial SequencecDNA Sequence of aMTD183 285ctgctggcgg
cgccggtggt gattgcgctg gcgccg
3628636DNAArtificial SequencecDNA Sequence of aMTD184 286ctggcggcga
ttgtgccggc gattattgcg gtgccg
3628736DNAArtificial SequencecDNA Sequence of aMTD185 287gcggcgctgg
tgctgccgct gattattgcg gcgccg
3628836DNAArtificial SequencecDNA Sequence of aMTD201 288ctggcgctgg
cggtgccggc gctggcggcg ctgccg
3628936DNAArtificial SequencecDNA Sequence of aMTD204 289ctgattgcgg
cgctgccggc ggtggcggcg ctgccg
3629036DNAArtificial SequencecDNA Sequence of aMTD205 290gcgctggcgc
tggtgccggc gattgcggcg ctgccg
3629136DNAArtificial SequencecDNA Sequence of aMTD221 291gcggcgattc
tggcgccgat tgtggcgctg gcgccg
3629236DNAArtificial SequencecDNA Sequence of aMTD222 292gcgctgctga
ttgcgccggc ggcggtgatt gcgccg
3629336DNAArtificial SequencecDNA Sequence of aMTD223 293gcgattctgg
cggtgccgat tgcggtggtg gcgccg
3629436DNAArtificial SequencecDNA Sequence of aMTD224 294attctggcgg
cggtgccgat tgcgctggcg gcgccg
3629536DNAArtificial SequencecDNA Sequence of aMTD225 295gtggcggcgc
tgctgccggc ggcggcggtg ctgccg
3629636DNAArtificial SequencecDNA Sequence of aMTD241 296gcggcggcgg
tggtgccggt gctgctggtg gcgccg
3629736DNAArtificial SequencecDNA Sequence of aMTD242 297gcggcgctgc
tggtgccggc gctggtggcg gcgccg
3629836DNAArtificial SequencecDNA Sequence of aMTD243 298gcggcggtgc
tgctgccggt ggcgctggcg gcgccg
3629936DNAArtificial SequencecDNA Sequence of aMTD245 299gcggcggcgc
tggcgccggt gctggcgctg gtgccg
3630036DNAArtificial SequencecDNA Sequence of aMTD261 300ctggtgctgg
tgccgctgct ggcggcggcg gcgccg
3630136DNAArtificial SequencecDNA Sequence of aMTD262 301gcgctgattg
cggtgccggc gattattgtg gcgccg
3630236DNAArtificial SequencecDNA Sequence of aMTD263 302gcgctggcgg
tgattccggc ggcggcgatt ctgccg
3630336DNAArtificial SequencecDNA Sequence of aMTD264 303ctggcggcgg
cgccggtggt gattgtgatt gcgccg
3630436DNAArtificial SequencecDNA Sequence of aMTD265 304gtgctggcga
ttgcgccgct gctggcggcg gtgccg
3630536DNAArtificial SequencecDNA Sequence of aMTD281 305gcgctgattg
tgctgccggc ggcggtggcg gtgccg
3630636DNAArtificial SequencecDNA Sequence of aMTD282 306gtgctggcgg
tggcgccggc gctgattgtg gcgccg
3630736DNAArtificial SequencecDNA Sequence of aMTD283 307gcggcgctgc
tggcgccggc gctgattgtg gcgccg
3630836DNAArtificial SequencecDNA Sequence of aMTD284 308gcgctgattg
cgccggcggt ggcgctgatt gtgccg
3630936DNAArtificial SequencecDNA Sequence of aMTD285 309gcgattgtgc
tgctgccggc ggcggtggtg gcgccg
3631036DNAArtificial SequencecDNA Sequence of aMTD301 310gtgattgcgg
cgccggtgct ggcggtgctg gcgccg
3631136DNAArtificial SequencecDNA Sequence of aMTD302 311ctggcgctgg
cgccggcgct ggcgctgctg gcgccg
3631236DNAArtificial SequencecDNA Sequence of aMTD304 312gcgattattc
tggcgccgat tgcggcgatt gcgccg
3631336DNAArtificial SequencecDNA Sequence of aMTD305 313attgcgctgg
cggcgccgat tctgctggcg gcgccg
3631436DNAArtificial SequencecDNA Sequence of aMTD321 314attgtggcgg
tggcgctgcc ggcgctggcg gtgccg
3631536DNAArtificial SequencecDNA Sequence of aMTD322 315gtggtggcga
ttgtgctgcc ggcgctggcg gcgccg
3631636DNAArtificial SequencecDNA Sequence of aMTD323 316attgtggcgg
tggcgctgcc ggtggcgctg gcgccg
3631736DNAArtificial SequencecDNA Sequence of aMTD324 317attgtggcgg
tggcgctgcc ggcggcgctg gtgccg
3631836DNAArtificial SequencecDNA Sequence of aMTD325 318attgtggcgg
tggcgctgcc ggcggtggcg ctgccg
3631936DNAArtificial SequencecDNA Sequence of aMTD341 319attgtggcgg
tggcgctgcc ggcggtgctg gcgccg
3632036DNAArtificial SequencecDNA Sequence of aMTD342 320gtgattgtgg
cgctggcgcc ggcggtgctg gcgccg
3632136DNAArtificial SequencecDNA Sequence of aMTD343 321attgtggcgg
tggcgctgcc ggcgctggtg gcgccg
3632236DNAArtificial SequencecDNA Sequence of aMTD345 322gcgctgctga
ttgtggcgcc ggtggcggtg gcgccg
3632336DNAArtificial SequencecDNA Sequence of aMTD361 323gcggtggtga
ttgtggcgcc ggcggtgatt gcgccg
3632436DNAArtificial SequencecDNA Sequence of aMTD363 324gcggtgctgg
cggtggcgcc ggcgctgatt gtgccg
3632536DNAArtificial SequencecDNA Sequence of aMTD364 325ctggtggcgg
cggtggcgcc ggcgctgatt gtgccg
3632636DNAArtificial SequencecDNA Sequence of aMTD365 326gcggtgattg
tggtggcgcc ggcgctgctg gcgccg
3632736DNAArtificial SequencecDNA Sequence of aMTD381 327gtggtggcga
ttgtgctgcc ggcggtggcg gcgccg
3632836DNAArtificial SequencecDNA Sequence of aMTD382 328gcggcggcgc
tggtgattcc ggcgattctg gcgccg
3632936DNAArtificial SequencecDNA Sequence of aMTD383 329gtgattgtgg
cgctggcgcc ggcgctgctg gcgccg
3633036DNAArtificial SequencecDNA Sequence of aMTD384 330gtgattgtgg
cgattgcgcc ggcgctgctg gcgccg
3633136DNAArtificial SequencecDNA Sequence of aMTD385 331attgtggcga
ttgcggtgcc ggcgctggtg gcgccg
3633236DNAArtificial SequencecDNA Sequence of aMTD401 332gcggcgctgg
cggtgattcc ggcggcgatt ctgccg
3633336DNAArtificial SequencePolynucleotide of aMTD402 333gcgctggcgg
cggtgattcc ggcggcgatt ctgccg
3633436DNAArtificial SequencecDNA Sequence of aMTD403 334gcggcggcgc
tggtgattcc ggcggcgatt ctgccg
3633536DNAArtificial SequencecDNA Sequence of aMTD404 335ctggcggcgg
cggtgattcc ggcggcgatt ctgccg
3633636DNAArtificial SequencecDNA Sequence of aMTD405 336ctggcggcgg
cggtgattcc ggtggcgatt ctgccg
3633736DNAArtificial SequencecDNA Sequence of aMTD421 337gcggcgattc
tggcggcgcc gctgattgcg gtgccg
3633836DNAArtificial SequencecDNA Sequence of aMTD422 338gtggtggcga
ttctggcgcc gctgctggcg gcgccg
3633936DNAArtificial SequencecDNA Sequence of aMTD424 339gcggtggtgg
tggcggcgcc ggtgctggcg ctgccg
3634036DNAArtificial SequencecDNA Sequence of aMTD425 340gcggtggtgg
cgattgcgcc ggtgctggcg ctgccg
3634136DNAArtificial SequencecDNA Sequence of aMTD442 341gcgctggcgg
cgctggtgcc ggcggtgctg gtgccg
3634236DNAArtificial SequencecDNA Sequence of aMTD443 342gcgctggcgg
cgctggtgcc ggtggcgctg gtgccg
3634336DNAArtificial SequencecDNA Sequence of aMTD444 343ctggcggcgg
cgctggtgcc ggtggcgctg gtgccg
3634436DNAArtificial SequencecDNA Sequence of aMTD445 344gcgctggcgg
cgctggtgcc ggcgctggtg gtgccg
3634536DNAArtificial SequencecDNA Sequence of aMTD461 345attgcggcgg
tgattgtgcc ggcggtggcg ctgccg
3634636DNAArtificial SequencecDNA Sequence of aMTD462 346attgcggcgg
tgctggtgcc ggcggtggcg ctgccg
3634736DNAArtificial SequencecDNA Sequence of aMTD463 347gcggtggcga
ttctggtgcc gctgctggcg gcgccg
3634836DNAArtificial SequencecDNA Sequence of aMTD464 348gcggtggtga
ttctggtgcc gctggcggcg gcgccg
3634936DNAArtificial SequencecDNA Sequence of aMTD465 349attgcggcgg
tgattgtgcc ggtggcggcg ctgccg
3635036DNAArtificial SequencecDNA Sequence of aMTD481 350gcgattgcga
ttgcgattgt gccggtggcg ctgccg
3635136DNAArtificial SequencecDNA Sequence of aMTD482 351attctggcgg
tggcggcgat tccggtggcg gtgccg
3635236DNAArtificial SequencecDNA Sequence of aMTD483 352attctggcgg
cggcgattat tccggcggcg ctgccg
3635336DNAArtificial SequencecDNA Sequence of aMTD484 353ctggcggtgg
tgctggcggc gccggcgatt gtgccg
3635436DNAArtificial SequencecDNA Sequence of aMTD485 354gcgattctgg
cggcgattgt gccgctggcg gtgccg
3635536DNAArtificial SequencecDNA Sequence of aMTD501 355gtgattgtgg
cgctggcggt gccggcgctg gcgccg
3635636DNAArtificial SequencecDNA Sequence of aMTD502 356gcgattgtgg
cgctggcggt gccggtgctg gcgccg
3635736DNAArtificial SequencecDNA Sequence of aMTD503 357gcggcgatta
ttattgtgct gccggcggcg ctgccg
3635836DNAArtificial SequencecDNA Sequence of aMTD504 358ctgattgtgg
cgctggcggt gccggcgctg gcgccg
3635936DNAArtificial SequencecDNA Sequence of aMTD505 359gcgattatta
ttgtgattgc gccggcggcg gcgccg
3636036DNAArtificial SequencecDNA Sequence of aMTD521 360ctggcggcgc
tgattgtggt gccggcggtg gcgccg
3636136DNAArtificial SequencecDNA Sequence of aMTD522 361gcgctgctgg
tgattgcggt gccggcggtg gcgccg
3636236DNAArtificial SequencecDNA Sequence of aMTD524 362gcggtggcgc
tgattgtggt gccggcgctg gcgccg
3636336DNAArtificial SequencecDNA Sequence of aMTD525 363gcgctggcga
ttgtggtggc gccggtggcg gtgccg
3636436DNAArtificial SequencecDNA Sequence of aMTD541 364ctgctggcgc
tgattattgc gccggcggcg gcgccg
3636536DNAArtificial SequencecDNA Sequence of aMTD542 365gcgctggcgc
tgattattgt gccggcggtg gcgccg
3636636DNAArtificial SequencecDNA Sequence of aMTD543 366ctgctggcgg
cgctgattgc gccggcggcg ctgccg
3636736DNAArtificial SequencecDNA Sequence of aMTD544 367attgtggcgc
tgattgtggc gccggcggcg gtgccg
3636836DNAArtificial SequencecDNA Sequence of aMTD545 368gtggtgctgg
tgctggcggc gccggcggcg gtgccg
3636936DNAArtificial SequencecDNA Sequence of aMTD561 369gcggcggtgg
cgattgtgct gccggcggtg gtgccg
3637036DNAArtificial SequencecDNA Sequence of aMTD562 370gcgctgattg
cggcgattgt gccggcgctg gtgccg
3637136DNAArtificial SequencecDNA Sequence of aMTD563 371gcgctggcgg
tgattgtggt gccggcgctg gcgccg
3637236DNAArtificial SequencecDNA Sequence of aMTD564 372gtggcgattg
cgctgattgt gccggcgctg gcgccg
3637336DNAArtificial SequencecDNA Sequence of aMTD565 373gtggcgattg
tgctggtggc gccggcggtg gcgccg
3637436DNAArtificial SequencecDNA Sequence of aMTD582 374gtggcggtgg
cgctgattgt gccggcgctg gcgccg
3637536DNAArtificial SequencecDNA Sequence of aMTD583 375gcggtgattc
tggcgctggc gccgattgtg gcgccg
3637636DNAArtificial SequencecDNA Sequence of aMTD585 376gcgctgattg
tggcgattgc gccggcgctg gtgccg
3637736DNAArtificial SequencecDNA Sequence of aMTD601 377gcggcgattc
tgattgcggt gccgattgcg gcgccg
3637836DNAArtificial SequencecDNA Sequence of aMTD602 378gtgattgtgg
cgctggcggc gccggtgctg gcgccg
3637936DNAArtificial SequencecDNA Sequence of aMTD603 379gtgctggtgg
cgctggcggc gccggtgatt gcgccg
3638036DNAArtificial SequencecDNA Sequence of aMTD604 380gtggcgctga
ttgcggtggc gccggcggtg gtgccg
3638136DNAArtificial SequencecDNA Sequence of aMTD605 381gtgattgcgg
cggtgctggc gccggtggcg gtgccg
3638236DNAArtificial SequencecDNA Sequence of aMTD622 382gcgctgattg
tgctggcggc gccggtggcg gtgccg
3638336DNAArtificial SequencecDNA Sequence of aMTD623 383gtggcggcgg
cgattgcgct gccggcgatt gtgccg
3638436DNAArtificial SequencecDNA Sequence of aMTD625 384attctggcgg
cggcggcggc gccgctgatt gtgccg
3638536DNAArtificial SequencecDNA Sequence of aMTD643 385ctggcgctgg
tgctggcggc gccggcgatt gtgccg
3638636DNAArtificial SequencecDNA Sequence of aMTD645 386gcgctggcgg
tggtggcgct gccggcgatt gtgccg
3638736DNAArtificial SequencecDNA Sequence of aMTD661 387gcggcgattc
tggcgccgat tgtggcggcg ctgccg
3638836DNAArtificial SequencecDNA Sequence of aMTD664 388attctgattg
cgattgcgat tccggcggcg gcgccg
3638936DNAArtificial SequencecDNA Sequence of aMTD665 389ctggcgattg
tgctggcggc gccggtggcg gtgccg
3639036DNAArtificial SequencecDNA Sequence of aMTD666 390gcggcgattg
cgattattgc gccggcgatt gtgccg
3639136DNAArtificial SequencecDNA Sequence of aMTD667 391ctggcggtgg
cgattgtggc gccggcgctg gtgccg
3639236DNAArtificial SequencecDNA Sequence of aMTD683 392ctggcgattg
tgctggcggc gccggcggtg ctgccg
3639336DNAArtificial SequencecDNA Sequence of aMTD684 393gcggcgattg
tgctggcgct gccggcggtg ctgccg
3639436DNAArtificial SequencecDNA Sequence of aMTD685 394gcgctgctgg
tggcggtgct gccggcggcg ctgccg
3639536DNAArtificial SequencecDNA Sequence of aMTD686 395gcggcgctgg
tggcggtgct gccggtggcg ctgccg
3639636DNAArtificial SequencecDNA Sequence of aMTD687 396attgtggcgg
tggcgctggt gccggcgctg gcgccg
3639736DNAArtificial SequencecDNA Sequence of aMTD703 397attgtggcgg
tggcgctggt gccggcgctg gcgccg
3639836DNAArtificial SequencecDNA Sequence of aMTD705 398attgtggcgg
tggcgctgct gccggcgctg gcgccg
3639936DNAArtificial SequencecDNA Sequence of aMTD706 399attgtggcgg
tggcgctgct gccggcggtg gcgccg
3640036DNAArtificial SequencecDNA Sequence of aMTD707 400attgtggcgc
tggcggtgct gccggcggtg gcgccg
3640136DNAArtificial SequencecDNA Sequence of aMTD724 401gtggcggtgc
tggcggtgct gccggcgctg gcgccg
3640236DNAArtificial SequencecDNA Sequence of aMTD725 402attgcggtgc
tggcggtggc gccggcggtg ctgccg
3640336DNAArtificial SequencecDNA Sequence of aMTD726 403ctggcggtgg
cgattattgc gccggcggtg gcgccg
3640436DNAArtificial SequencecDNA Sequence of aMTD727 404gtggcgctgg
cgattgcgct gccggcggtg ctgccg
3640536DNAArtificial SequencecDNA Sequence of aMTD743 405gcgattgcga
ttgcgctggt gccggtggcg ctgccg
3640636DNAArtificial SequencecDNA Sequence of aMTD744 406gcggcggtgg
tgattgtggc gccggtggcg ctgccg
3640736DNAArtificial SequencecDNA Sequence of aMTD746 407gcggcgattc
tggcgattgt ggcgccgctg gcgccg
3640836DNAArtificial SequencecDNA Sequence of aMTD747 408gtggcgctgc
tggcgattgc gccggcgctg gcgccg
3640936DNAArtificial SequencecDNA Sequence of aMTD763 409gtggcggtgc
tgattgcggt gccggcgctg gcgccg
3641036DNAArtificial SequencecDNA Sequence of aMTD764 410gcggtggcgc
tggcggtgct gccggcggtg gtgccg
3641136DNAArtificial SequencecDNA Sequence of aMTD765 411gcggtggcgc
tggcggtggt gccggcggtg ctgccg
3641236DNAArtificial SequencecDNA Sequence of aMTD766 412attgtggtga
ttgcggtggc gccggcggtg gcgccg
3641336DNAArtificial SequencecDNA Sequence of aMTD767 413attgtggtgg
cggcggtggt gccggcgctg gcgccg
3641436DNAArtificial SequencecDNA Sequence of aMTD783 414attgtggcgc
tggtgccggc ggtggcgatt gcgccg
3641536DNAArtificial SequencecDNA Sequence of aMTD784 415gtggcggcgc
tgccggcggt ggcgctggtg gtgccg
3641636DNAArtificial SequencecDNA Sequence of aMTD786 416ctggtggcga
ttgcgccgct ggcggtgctg gcgccg
3641736DNAArtificial SequencecDNA Sequence of aMTD787 417gcggtggcgc
tggtgccggt gattgtggcg gcgccg
3641836DNAArtificial SequencecDNA Sequence of aMTD788 418gcgattgcgg
tggcgattgc gccggtggcg ctgccg
3641936DNAArtificial SequencecDNA Sequence of aMTD803 419gcgattgcgc
tggcggtgcc ggtgctggcg ctgccg
3642036DNAArtificial SequencecDNA Sequence of aMTD805 420ctggtgctga
ttgcggcggc gccgattgcg ctgccg
3642136DNAArtificial SequencecDNA Sequence of aMTD806 421ctggtggcgc
tggcggtgcc ggcggcggtg ctgccg
3642236DNAArtificial SequencecDNA Sequence of aMTD807 422gcggtggcgc
tggcggtgcc ggcgctggtg ctgccg
3642336DNAArtificial SequencecDNA Sequence of aMTD808 423ctggtggtgc
tggcggcggc gccgctggcg gtgccg
3642436DNAArtificial SequencecDNA Sequence of aMTD809 424ctgattgtgc
tggcggcgcc ggcgctggcg gcgccg
3642536DNAArtificial SequencecDNA Sequence of aMTD810 425gtgattgtgc
tggcggcgcc ggcgctggcg gcgccg
3642636DNAArtificial SequencecDNA Sequence of aMTD811 426gcggtggtgc
tggcggtgcc ggcgctggcg gtgccg
3642736DNAArtificial SequencecDNA Sequence of aMTD824 427ctgattattg
tggcggcggc gccggcggtg gcgccg
3642836DNAArtificial SequencecDNA Sequence of aMTD825 428attgtggcgg
tgattgtggc gccggcggtg gcgccg
3642936DNAArtificial SequencecDNA Sequence of aMTD826 429ctggtggcgc
tggcggcgcc gattattgcg gtgccg
3643036DNAArtificial SequencecDNA Sequence of aMTD827 430attgcggcgg
tgctggcggc gccggcgctg gtgccg
3643136DNAArtificial SequencecDNA Sequence of aMTD828 431attgcgctgc
tggcggcgcc gattattgcg gtgccg
3643236DNAArtificial SequencecDNA Sequence of aMTD829 432gcggcgctgg
cgctggtggc gccggtgatt gtgccg
3643336DNAArtificial SequencecDNA Sequence of aMTD830 433attgcgctgg
tggcggcgcc ggtggcgctg gtgccg
3643436DNAArtificial SequencecDNA Sequence of aMTD831 434attattgtgg
cggtggcgcc ggcggcgatt gtgccg
3643536DNAArtificial SequencecDNA Sequence of aMTD832 435gcggtggcgg
cgattgtgcc ggtgattgtg gcgccg
3643636DNAArtificial SequencecDNA Sequence of aMTD843 436gcggtgctgg
tgctggtggc gccggcggcg gcgccg
3643736DNAArtificial SequencecDNA Sequence of aMTD844 437gtggtggcgc
tgctggcgcc gctgattgcg gcgccg
3643836DNAArtificial SequencecDNA Sequence of aMTD845 438gcggcggtgg
tgattgcgcc gctgctggcg gtgccg
3643936DNAArtificial SequencecDNA Sequence of aMTD846 439attgcggtgg
cggtggcggc gccgctgctg gtgccg
3644036DNAArtificial SequencecDNA Sequence of aMTD847 440ctggtggcga
ttgtggtgct gccggcggtg gcgccg
3644136DNAArtificial SequencecDNA Sequence of aMTD848 441gcggtggcga
ttgtggtgct gccggcggtg gcgccg
3644236DNAArtificial SequencecDNA Sequence of aMTD849 442gcggtgattc
tgctggcgcc gctgattgcg gcgccg
3644336DNAArtificial SequencecDNA Sequence of aMTD850 443ctggtgattg
cgctggcggc gccggtggcg ctgccg
3644436DNAArtificial SequencecDNA Sequence of aMTD851 444gtgctggcgg
tggtgctgcc ggcggtggcg ctgccg
3644536DNAArtificial SequencecDNA Sequence of aMTD852 445gtgctggcgg
tggcggcgcc ggcggtgctg ctgccg
3644636DNAArtificial SequencecDNA Sequence of aMTD863 446gcggcggtgg
tgctgctgcc gattattgcg gcgccg
3644736DNAArtificial SequencecDNA Sequence of aMTD864 447gcgctgctgg
tgattgcgcc ggcgattgcg gtgccg
3644836DNAArtificial SequencecDNA Sequence of aMTD865 448gcggtgctgg
tgattgcggt gccggcgatt gcgccg
3644936DNAArtificial SequencecDNA Sequence of aMTD867 449gcgctgctgg
tggtgattgc gccgctggcg gcgccg
3645036DNAArtificial SequencecDNA Sequence of aMTD868 450gtgctggtgg
cggcgattct gccggcggcg attccg
3645136DNAArtificial SequencecDNA Sequence of aMTD870 451gtgctggtgg
cggcggtgct gccgattgcg gcgccg
3645236DNAArtificial SequencecDNA Sequence of aMTD872 452gtgctggcgg
cggcggtgct gccgctggtg gtgccg
3645336DNAArtificial SequencecDNA Sequence of aMTD875 453gcgattgcga
ttgtggtgcc ggcggtggcg gtgccg
3645436DNAArtificial SequencecDNA Sequence of aMTD877 454gtggcgatta
ttgcggtgcc ggcggtggtg gcgccg
3645536DNAArtificial SequencecDNA Sequence of aMTD878 455attgtggcgc
tggtggcgcc ggcggcggtg gtgccg
3645636DNAArtificial SequencecDNA Sequence of aMTD879 456gcggcgattg
tgctgctgcc ggcggtggtg gtgccg
3645736DNAArtificial SequencecDNA Sequence of aMTD881 457gcggcgctga
ttgtggtgcc ggcggtggcg gtgccg
3645836DNAArtificial SequencecDNA Sequence of aMTD882 458gcgattgcgc
tggtggtgcc ggcggtggcg gtgccg
3645936DNAArtificial SequencecDNA Sequence of aMTD883 459ctggcgattg
tgccggcggc gattgcggcg ctgccg
3646036DNAArtificial SequencecDNA Sequence of aMTD885 460ctggtggcga
ttgcgccggc ggtggcggtg ctgccg
3646136DNAArtificial SequencecDNA Sequence of aMTD887 461gtgctggcgg
tggcgccggc ggtggcggtg ctgccg
3646236DNAArtificial SequencecDNA Sequence of aMTD888 462attctggcgg
tggtggcgat tccggcggcg gcgccg
3646336DNAArtificial SequencecDNA Sequence of aMTD889 463attctggtgg
cggcggcgcc gattgcggcg ctgccg
3646436DNAArtificial SequencecDNA Sequence of aMTD891 464attctggcgg
tggcggcgat tccggcggcg ctgccg
3646536DNAArtificial SequencecDNA Sequence of aMTD893 465gtgattgcga
ttccggcgat tctggcggcg gcgccg
3646636DNAArtificial SequencecDNA Sequence of aMTD895 466gcgattatta
ttgtggtgcc ggcgattgcg gcgccg
3646736DNAArtificial SequencecDNA Sequence of aMTD896 467gcgattctga
ttgtggtggc gccgattgcg gcgccg
3646836DNAArtificial SequencecDNA Sequence of aMTD897 468gcggtgattg
tgccggtggc gattattgcg gcgccg
3646936DNAArtificial SequencecDNA Sequence of aMTD899 469gcggtggtga
ttgcgctgcc ggcggtggtg gcgccg
3647036DNAArtificial SequencecDNA Sequence of aMTD900 470gcgctggtgg
cggtgattgc gccggtggtg gcgccg
3647136DNAArtificial SequencecDNA Sequence of aMTD901 471gcgctggtgg
cggtgctgcc ggcggtggcg gtgccg
3647236DNAArtificial SequencecDNA Sequence of aMTD902 472gcgctggtgg
cgccgctgct ggcggtggcg gtgccg
3647336DNAArtificial SequencecDNA Sequence of aMTD904 473gcggtgctgg
cggtggtggc gccggtggtg gcgccg
3647436DNAArtificial SequencecDNA Sequence of aMTD905 474gcggtgattg
cggtggcgcc gctggtggtg gcgccg
3647536DNAArtificial SequencecDNA Sequence of aMTD906 475gcggtgattg
cgctggcgcc ggtggtggtg gcgccg
3647636DNAArtificial SequencecDNA Sequence of aMTD907 476gtggcgattg
cgctggcgcc ggtggtggtg gcgccg
3647736DNAArtificial SequencecDNA Sequence of aMTD908 477gtggcgctgg
cgctggcgcc ggtggtggtg gcgccg
3647836DNAArtificial SequencecDNA Sequence of aMTD910 478gtggcggcgc
tgctgccggc ggtggtggtg gcgccg
3647936DNAArtificial SequencecDNA Sequence of aMTD911 479gtggcgctgg
cgctgccggc ggtggtggtg gcgccg
3648036DNAArtificial SequencecDNA Sequence of aMTD912 480gtggcgctgc
tggcgccggc ggtggtggtg gcgccg
3648169DNAArtificial SequencecDNA Sequence of aMTD1 5'-primer
481gggtttcata tggcggcggc gctggcgccg gtggtgctgg cgctgccggc aaatattacc
60gttttctat
6948269DNAArtificial SequencecDNA Sequence of aMTD2 5'-primer
482gggtttcata tggcggcggc ggtgccgctg ctggcggtgg tggtgccggc aaatattacc
60gttttctat
6948369DNAArtificial SequencecDNA Sequence of aMTD3 5'-primer
483gggtttcata tggcggcgct gctggtgccg gcggcggtgc tggcgccggc aaatattacc
60gttttctat
6948469DNAArtificial SequencecDNA Sequence of aMTD4 5'-primer
484gggtttcata tggcgctggc gctgctgccg gtggcggcgc tggcgccggc aaatattacc
60gttttctat
6948569DNAArtificial SequencecDNA Sequence of aMTD5 5'-primer
485gggtttcata tggcggcggc gctgctgccg gtggcgctgg tggcgccggc aaatattacc
60gttttctat
6948669DNAArtificial SequencecDNA Sequence of aMTD6 5'-primer
486gggtttcata tggtgattgc gatgattccg gcggcgtttt gggtggcggc aaatattacc
60gttttctat
6948769DNAArtificial SequencecDNA Sequence of aMTD9 5'-primer
487gggtttcata tggtggcgct ggtgccggcg gcgctgattc tgccgccggc aaatattacc
60gttttctat
6948869DNAArtificial SequencecDNA Sequence of aMTD11 5'-primer
488gggtttcata tggtggtggc gctggcgccg gcgctggcgg cgctgccggc aaatattacc
60gttttctat
6948969DNAArtificial SequencecDNA Sequence of aMTD12 5'-primer
489gggtttcata tgctgctggc ggcggtgccg gcggtgctgc tggcgccggc aaatattacc
60gttttctat
6949069DNAArtificial SequencecDNA Sequence of aMTD13 5'-primer
490gggtttcata tggcggcggc gctggtgccg gtggtggcgc tgctgccggc aaatattacc
60gttttctat
6949169DNAArtificial SequencecDNA Sequence of aMTD16 5'-primer
491gggtttcata tgaacaacag ctgcaccacc tataccaacg gcagccaggc aaatattacc
60gttttctat
6949269DNAArtificial SequencecDNA Sequence of aMTD17 5'-primer
492gggtttcata tgggcggctg cagcgcgccg cagaccacct gcagcaacgc aaatattacc
60gttttctat
6949369DNAArtificial SequencecDNA Sequence of aMTD18 5'-primer
493gggtttcata tgaactattg ctgcaccccg accaccaacg gccagagcgc aaatattacc
60gttttctat
6949469DNAArtificial SequencecDNA Sequence of aMTD19 5'-primer
494gggtttcata tgtatgtgag ctgctgcacc tataccaacg gcagccaggc aaatattacc
60gttttctat
6949569DNAArtificial SequencecDNA Sequence of aMTD20 5'-primer
495gggtttcata tgaactattg caacacctgc ccgacctatg gccagagcgc aaatattacc
60gttttctat
6949669DNAArtificial SequencecDNA Sequence of aMTD21 5'-primer
496gggtttcata tggcggtggc gctgctgccg gcgctgctgg cggtgccggc aaatattacc
60gttttctat
6949769DNAArtificial SequencecDNA Sequence of aMTD22 5'-primer
497gggtttcata tggcggtggt gctggtgccg gtgctggcgg cggcgccggc aaatattacc
60gttttctat
6949869DNAArtificial SequencecDNA Sequence of aMTD23 5'-primer
498gggtttcata tggtggtgct ggtgctgccg gcggcggcgg cggtgccggc aaatattacc
60gttttctat
6949969DNAArtificial SequencecDNA Sequence of aMTD24 5'-primer
499gggtttcata tgattgcgct ggcggcgccg gcgctgattg tggcgccggc aaatattacc
60gttttctat
6950069DNAArtificial SequencecDNA Sequence of aMTD25 5'-primer
500gggtttcata tgattgtggc ggtggcgccg gcgctggtgg cgctgccggc aaatattacc
60gttttctat
6950169DNAArtificial SequencecDNA Sequence of aMTD26 5'-primer
501gggtttcata tggcggcgat tgcgctggcg gcgccgctgg cgattgtggc aaatattacc
60gttttctat
6950269DNAArtificial SequencecDNA Sequence of aMTD27 5'-primer
502gggtttcata tgctggcgat tgtggcggcg gcggcggcgc tggtggcggc aaatattacc
60gttttctat
6950369DNAArtificial SequencecDNA Sequence of aMTD28 5'-primer
503gggtttcata tggcggtgcc gctgctgccg ctggtgccgg cggtgccggc aaatattacc
60gttttctat
6950469DNAArtificial SequencecDNA Sequence of aMTD29 5'-primer
504gggtttcata tggtgctgcc gccgctgccg gtgctgccgg tgctgccggc aaatattacc
60gttttctat
6950569DNAArtificial SequencecDNA Sequence of aMTD30 5'-primer
505gggtttcata tggcgatggc gctgctgccg gcggcggtgg cggtggcggc aaatattacc
60gttttctat
6950669DNAArtificial SequencecDNA Sequence of aMTD33 5'-primer
506gggtttcata tggcggcggc gattctggcg ccggcgtttc tggcggtggc aaatattacc
60gttttctat
6950769DNAArtificial SequencecDNA Sequence of aMTD37 5'-primer
507gggtttcata tgtattataa ccagagcacc tgcggcggcc agtgctatgc aaatattacc
60gttttctat
6950869DNAArtificial SequencecDNA Sequence of aMTD38 5'-primer
508gggtttcata tgaccacctg cagccagcag cagtattgca ccaacggcgc aaatattacc
60gttttctat
6950969DNAArtificial SequencecDNA Sequence of aMTD39 5'-primer
509gggtttcata tgtgctataa caccagcccg tgcaccggct gctgctatgc aaatattacc
60gttttctat
6951069DNAArtificial SequencecDNA Sequence of aMTD40 5'-primer
510gggtttcata tgacctataa caccagctgc accccgggca cctgctatgc aaatattacc
60gttttctat
6951169DNAArtificial SequencecDNA Sequence of aMTD42 5'-primer
511gggtttcata tggtggcggc gctgccggtg gtggcggtgg tggcgccggc aaatattacc
60gttttctat
6951269DNAArtificial SequencecDNA Sequence of aMTD43 5'-primer
512gggtttcata tgctgctggc ggcgccgctg gtggtggcgg cggtgccggc aaatattacc
60gttttctat
6951369DNAArtificial SequencecDNA Sequence of aMTD44 5'-primer
513gggtttcata tggcgctggc ggtgccggtg gcgctgctgg tggcgccggc aaatattacc
60gttttctat
6951469DNAArtificial SequencecDNA Sequence of aMTD49 5'-primer
514gggtttcata tggtggtgcc ggcggcgccg gcggtgccgg tggtgccggc aaatattacc
60gttttctat
6951569DNAArtificial SequencecDNA Sequence of aMTD54 5'-primer
515gggtttcata tgctggcggt ggcggcgccg ccggtggtgg cgctgctggc aaatattacc
60gttttctat
6951669DNAArtificial SequencecDNA Sequence of aMTD57 5'-primer
516gggtttcata tgcagaacaa ctgcaacacc agcagccagg gcggcggcgc aaatattacc
60gttttctat
6951769DNAArtificial SequencecDNA Sequence of aMTD59 5'-primer
517gggtttcata tggcggtgct ggcggcgccg gtggtggcgg cgctggcggc aaatattacc
60gttttctat
6951869DNAArtificial SequencecDNA Sequence of aMTD61 5'-primer
518gggtttcata tggtggcggc gctgccggtg ctgctggcgg cgctgccggc aaatattacc
60gttttctat
6951969DNAArtificial SequencecDNA Sequence of aMTD62 5'-primer
519gggtttcata tggtggcgct gctggcgccg gtggcgctgg cggtgccggc aaatattacc
60gttttctat
6952069DNAArtificial SequencecDNA Sequence of aMTD63 5'-primer
520gggtttcata tggcggcgct gctggtgccg gcgctggtgg cggtgccggc aaatattacc
60gttttctat
6952169DNAArtificial SequencecDNA Sequence of aMTD64 5'-primer
521gggtttcata tggcgattgt ggcgctgccg gtggcggtgc tggcgccggc aaatattacc
60gttttctat
6952269DNAArtificial SequencecDNA Sequence of aMTD65 5'-primer
522gggtttcata tgattgcgat tgtggcgccg gtggtggcgc tggcgccggc aaatattacc
60gttttctat
6952369DNAArtificial SequencecDNA Sequence of aMTD66 5'-primer
523gggtttcata tggcgggcgt gctgggcggc ccgattatgg gcgtgccggc aaatattacc
60gttttctat
6952469DNAArtificial SequencecDNA Sequence of aMTD67 5'-primer
524gggtttcata tgctggatgc ggaagtgccg ctggcggatg atgtgccggc aaatattacc
60gttttctat
6952569DNAArtificial SequencecDNA Sequence of aMTD68 5'-primer
525gggtttcata tggtggcgcc ggtgctgccg gcggcgccgc tggtgccggc aaatattacc
60gttttctat
6952669DNAArtificial SequencecDNA Sequence of aMTD69 5'-primer
526gggtttcata tgccggtggc ggtgctgccg ccggcggcgc tggtgccggc aaatattacc
60gttttctat
6952769DNAArtificial SequencecDNA Sequence of aMTD71 5'-primer
527gggtttcata tgtttatgtg gatgtggttt ccgtttatgt ggtatccggc aaatattacc
60gttttctat
6952869DNAArtificial SequencecDNA Sequence of aMTD77 5'-primer
528gggtttcata tggcgatgct gctgatgccg attgtgctga ttgcgccggc aaatattacc
60gttttctat
6952969DNAArtificial SequencecDNA Sequence of aMTD81 5'-primer
529gggtttcata tggcggcgct gctgccggcg ctggcggcgc tgctgccggc aaatattacc
60gttttctat
6953069DNAArtificial SequencecDNA Sequence of aMTD82 5'-primer
530gggtttcata tggcggtggt gctggcgccg gtggcggcgg tgctgccggc aaatattacc
60gttttctat
6953169DNAArtificial SequencecDNA Sequence of aMTD83 5'-primer
531gggtttcata tgctggcggt ggcggcgccg ctggcgctgg cgctgccggc aaatattacc
60gttttctat
6953269DNAArtificial SequencecDNA Sequence of aMTD84 5'-primer
532gggtttcata tggcggcggt ggcggcgccg ctgctgctgg cgctgccggc aaatattacc
60gttttctat
6953369DNAArtificial SequencecDNA Sequence of aMTD85 5'-primer
533gggtttcata tgctgctggt gctgccggcg gcggcgctgg cggcgccggc aaatattacc
60gttttctat
6953469DNAArtificial SequencecDNA Sequence of aMTD97 5'-primer
534gggtttcata tggcgctgct ggcggcgccg ccggcgctgc tggcgctggc aaatattacc
60gttttctat
6953569DNAArtificial SequencecDNA Sequence of aMTD101 5'-primer
535gggtttcata tgctggtggc ggtggcgccg gtggcggcgg tgctgccggc aaatattacc
60gttttctat
6953669DNAArtificial SequencecDNA Sequence of aMTD102 5'-primer
536gggtttcata tgctggcgct ggcgccggcg gcgctggcgc tgctgccggc aaatattacc
60gttttctat
6953769DNAArtificial SequencecDNA Sequence of aMTD103 5'-primer
537gggtttcata tggcgctgat tgcggcgccg attctggcgc tggcgccggc aaatattacc
60gttttctat
6953869DNAArtificial SequencecDNA Sequence of aMTD104 5'-primer
538gggtttcata tggcggtggt ggcggcgccg ctggtgctgg cgctgccggc aaatattacc
60gttttctat
6953969DNAArtificial SequencecDNA Sequence of aMTD105 5'-primer
539gggtttcata tgctgctggc gctggcgccg gcggcgctgc tggcgccggc aaatattacc
60gttttctat
6954069DNAArtificial SequencecDNA Sequence of aMTD113 5'-primer
540gggtttcata tgccggtggc ggtggcgctg ctgattgcgg tgccgccggc aaatattacc
60gttttctat
6954169DNAArtificial SequencecDNA Sequence of aMTD121 5'-primer
541gggtttcata tggcgattgt ggcgctgccg gcgctggcgc tggcgccggc aaatattacc
60gttttctat
6954269DNAArtificial SequencecDNA Sequence of aMTD123 5'-primer
542gggtttcata tggcggcgat tattgtgccg gcggcgctgc tggcgccggc aaatattacc
60gttttctat
6954369DNAArtificial SequencecDNA Sequence of aMTD124 5'-primer
543gggtttcata tgattgcggt ggcgctgccg gcgctgattg cggcgccggc aaatattacc
60gttttctat
6954469DNAArtificial SequencecDNA Sequence of aMTD131 5'-primer
544gggtttcata tgtggattat tgcgccggtg tggctggcgt ggattgcggc aaatattacc
60gttttctat
6954569DNAArtificial SequencecDNA Sequence of aMTD138 5'-primer
545gggtttcata tgccgccggc ggcgctgctg gcgattctgg cggtggcggc aaatattacc
60gttttctat
6954669DNAArtificial SequencecDNA Sequence of aMTD139 5'-primer
546gggtttcata tgaccggcag caccaacagc ccgacctgca ccagcaccgc aaatattacc
60gttttctat
6954769DNAArtificial SequencecDNA Sequence of aMTD141 5'-primer
547gggtttcata tggcggtgat tgtgctgccg gcgctggcgg tggcgccggc aaatattacc
60gttttctat
6954869DNAArtificial SequencecDNA Sequence of aMTD142 5'-primer
548gggtttcata tgctgctggc ggcggtgccg gtggcgctgg tggcgccggc aaatattacc
60gttttctat
6954969DNAArtificial SequencecDNA Sequence of aMTD143 5'-primer
549gggtttcata tggcggtgct ggcggtgccg gcggtgctgg tggcgccggc aaatattacc
60gttttctat
6955069DNAArtificial SequencecDNA Sequence of aMTD144 5'-primer
550gggtttcata tggcggtgct ggcggtgccg gcggtgctgg tggcgccggc aaatattacc
60gttttctat
6955169DNAArtificial SequencecDNA Sequence of aMTD145 5'-primer
551gggtttcata tgctgctggc ggtggtgccg gcggtggcgc tggcgccggc aaatattacc
60gttttctat
6955269DNAArtificial SequencecDNA Sequence of aMTD152 5'-primer
552gggtttcata tgctggcggc ggcggtggcg gcggtggcgg cgctgctggc aaatattacc
60gttttctat
6955369DNAArtificial SequencecDNA Sequence of aMTD159 5'-primer
553gggtttcata tgtgctatag cggcagcacc agccagaacc agccgccggc aaatattacc
60gttttctat
6955469DNAArtificial SequencecDNA Sequence of aMTD161 5'-primer
554gggtttcata tggcggtgat tgcgctgccg gcgctgattg cggcgccggc aaatattacc
60gttttctat
6955569DNAArtificial SequencecDNA Sequence of aMTD162 5'-primer
555gggtttcata tggcggtggt ggcgctgccg gcggcgctga ttgtgccggc aaatattacc
60gttttctat
6955669DNAArtificial SequencecDNA Sequence of aMTD163 5'-primer
556gggtttcata tgctggcgct ggtgctgccg gcggcgctgg cggcgccggc aaatattacc
60gttttctat
6955769DNAArtificial SequencecDNA Sequence of aMTD164 5'-primer
557gggtttcata tgctggcggc ggtgctgccg gcgctgctgg cggcgccggc aaatattacc
60gttttctat
6955869DNAArtificial SequencecDNA Sequence of aMTD165 5'-primer
558gggtttcata tggcgctggc ggtgccggtg gcgctggcga ttgtgccggc aaatattacc
60gttttctat
6955969DNAArtificial SequencecDNA Sequence of aMTD167 5'-primer
559gggtttcata tggtggcgat tgcgattccg gcggcgctgg cgattccggc aaatattacc
60gttttctat
6956069DNAArtificial SequencecDNA Sequence of aMTD169 5'-primer
560gggtttcata tggtggcgct ggtggcgccg gcgctgattc tggcgccggc aaatattacc
60gttttctat
6956169DNAArtificial SequencecDNA Sequence of aMTD182 5'-primer
561gggtttcata tggcgctgat tgcgccggtg gtggcgctgg tggcgccggc aaatattacc
60gttttctat
6956269DNAArtificial SequencecDNA Sequence of aMTD183 5'-primer
562gggtttcata tgctgctggc ggcgccggtg gtgattgcgc tggcgccggc aaatattacc
60gttttctat
6956369DNAArtificial SequencecDNA Sequence of aMTD184 5'-primer
563gggtttcata tgctggcggc gattgtgccg gcgattattg cggtgccggc aaatattacc
60gttttctat
6956469DNAArtificial SequencecDNA Sequence of aMTD185 5'-primer
564gggtttcata tggcggcgct ggtgctgccg ctgattattg cggcgccggc aaatattacc
60gttttctat
6956569DNAArtificial SequencecDNA Sequence of aMTD189 5'-primer
565gggtttcata tggtgattct ggtggcgccg gcggtgattg cgccgccggc aaatattacc
60gttttctat
6956669DNAArtificial SequencecDNA Sequence of aMTD190 5'-primer
566gggtttcata tggcggcgat tctggcgccg gcggtgattg cgccgccggc aaatattacc
60gttttctat
6956769DNAArtificial SequencecDNA Sequence of aMTD201 5'-primer
567gggtttcata tgctggcgct ggcggtgccg gcgctggcgg cgctgccggc aaatattacc
60gttttctat
6956869DNAArtificial SequencecDNA Sequence of aMTD204 5'-primer
568gggtttcata tgctgattgc ggcgctgccg gcggtggcgg cgctgccggc aaatattacc
60gttttctat
6956969DNAArtificial SequencecDNA Sequence of aMTD205 5'-primer
569gggtttcata tggcgctggc gctggtgccg gcgattgcgg cgctgccggc aaatattacc
60gttttctat
6957069DNAArtificial SequencecDNA Sequence of aMTD210 5'-primer
570gggtttcata tggcgctgat tgcgctgccg gcgctgccgg cgctgccggc aaatattacc
60gttttctat
6957169DNAArtificial SequencecDNA Sequence of aMTD214 5'-primer
571gggtttcata tggcgctgat tgtggcgccg gcgctgatgg cgctgccggc aaatattacc
60gttttctat
6957269DNAArtificial SequencecDNA Sequence of aMTD221 5'-primer
572gggtttcata tggcggcgat tctggcgccg attgtggcgc tggcgccggc aaatattacc
60gttttctat
6957369DNAArtificial SequencecDNA Sequence of aMTD222 5'-primer
573gggtttcata tggcgctgct gattgcgccg gcggcggtga ttgcgccggc aaatattacc
60gttttctat
6957469DNAArtificial SequencecDNA Sequence of aMTD223 5'-primer
574gggtttcata tggcgattct ggcggtgccg attgcggtgg tggcgccggc aaatattacc
60gttttctat
6957569DNAArtificial SequencecDNA Sequence of aMTD224 5'-primer
575gggtttcata tgattctggc ggcggtgccg attgcgctgg cggcgccggc aaatattacc
60gttttctat
6957669DNAArtificial SequencecDNA Sequence of aMTD225 5'-primer
576gggtttcata tggtggcggc gctgctgccg gcggcggcgg tgctgccggc aaatattacc
60gttttctat
6957769DNAArtificial SequencecDNA Sequence of aMTD226 5'-primer
577gggtttcata tggcgctggt ggcggcgatt ccggcgctgg cgattccggc aaatattacc
60gttttctat
6957869DNAArtificial SequencecDNA Sequence of aMTD227 5'-primer
578gggtttcata tgctggcggc gattgtgccg attgcggcgg cggtgccggc aaatattacc
60gttttctat
6957969DNAArtificial SequencecDNA Sequence of aMTD241 5'-primer
579gggtttcata tggcggcggc ggtggtgccg gtgctgctgg tggcgccggc aaatattacc
60gttttctat
6958069DNAArtificial SequencecDNA Sequence of aMTD242 5'-primer
580gggtttcata tggcggcgct gctggtgccg gcgctggtgg cggcgccggc aaatattacc
60gttttctat
6958169DNAArtificial SequencecDNA Sequence of aMTD243 5'-primer
581gggtttcata tggcggcggt gctgctgccg gtggcgctgg cggcgccggc aaatattacc
60gttttctat
6958269DNAArtificial SequencecDNA Sequence of aMTD245 5'-primer
582gggtttcata tggcggcggc gctggcgccg gtgctggcgc tggtgccggc aaatattacc
60gttttctat
6958369DNAArtificial SequencecDNA Sequence of aMTD246 5'-primer
583gggtttcata tggtggtggc ggtgccgctg ctggtggcgt ttgcggcggc aaatattacc
60gttttctat
6958469DNAArtificial SequencecDNA Sequence of aMTD248 5'-primer
584gggtttcata tggtggcggc gattgtgccg attgcggcgc tggtgccggc aaatattacc
60gttttctat
6958569DNAArtificial SequencecDNA Sequence of aMTD261 5'-primer
585gggtttcata tgctggtgct ggtgccgctg ctggcggcgg cggcgccggc aaatattacc
60gttttctat
6958669DNAArtificial SequencecDNA Sequence of aMTD262 5'-primer
586gggtttcata tggcgctgat tgcggtgccg gcgattattg tggcgccggc aaatattacc
60gttttctat
6958769DNAArtificial SequencecDNA Sequence of aMTD263 5'-primer
587gggtttcata tggcgctggc ggtgattccg gcggcggcga ttctgccggc aaatattacc
60gttttctat
6958869DNAArtificial SequencecDNA Sequence of aMTD264 5'-primer
588gggtttcata tgctggcggc ggcgccggtg gtgattgtga ttgcgccggc aaatattacc
60gttttctat
6958969DNAArtificial SequencecDNA Sequence of aMTD265 5'-primer
589gggtttcata tggtgctggc gattgcgccg ctgctggcgg cggtgccggc aaatattacc
60gttttctat
6959069DNAArtificial SequencecDNA Sequence of aMTD281 5'-primer
590gggtttcata tggcgctgat tgtgctgccg gcggcggtgg cggtgccggc aaatattacc
60gttttctat
6959169DNAArtificial SequencecDNA Sequence of aMTD282 5'-primer
591gggtttcata tggtgctggc ggtggcgccg gcgctgattg tggcgccggc aaatattacc
60gttttctat
6959269DNAArtificial SequencecDNA Sequence of aMTD283 5'-primer
592gggtttcata tggcggcgct gctggcgccg gcgctgattg tggcgccggc aaatattacc
60gttttctat
6959369DNAArtificial SequencecDNA Sequence of aMTD284 5'-primer
593gggtttcata tggcgctgat tgcgccggcg gtggcgctga ttgtgccggc aaatattacc
60gttttctat
6959469DNAArtificial SequencecDNA Sequence of aMTD285 5'-primer
594gggtttcata tggcgattgt gctgctgccg gcggcggtgg tggcgccggc aaatattacc
60gttttctat
6959569DNAArtificial SequencecDNA Sequence of aMTD301 5'-primer
595gggtttcata tggtgattgc ggcgccggtg ctggcggtgc tggcgccggc aaatattacc
60gttttctat
6959669DNAArtificial SequencecDNA Sequence of aMTD302 5'-primer
596gggtttcata tgctggcgct ggcgccggcg ctggcgctgc tggcgccggc aaatattacc
60gttttctat
6959769DNAArtificial SequencecDNA Sequence of aMTD304 5'-primer
597gggtttcata tggcgattat tctggcgccg attgcggcga ttgcgccggc aaatattacc
60gttttctat
6959869DNAArtificial SequencecDNA Sequence of aMTD305 5'-primer
598gggtttcata tgattgcgct ggcggcgccg attctgctgg cggcgccggc aaatattacc
60gttttctat
6959969DNAArtificial SequencecDNA Sequence of aMTD321 5'-primer
599gggtttcata tgattgtggc ggtggcgctg ccggcgctgg cggtgccggc aaatattacc
60gttttctat
6960069DNAArtificial SequencecDNA Sequence of aMTD322 5'-primer
600gggtttcata tggtggtggc gattgtgctg ccggcgctgg cggcgccggc aaatattacc
60gttttctat
6960169DNAArtificial SequencecDNA Sequence of aMTD323 5'-primer
601gggtttcata tgattgtggc ggtggcgctg ccggtggcgc tggcgccggc aaatattacc
60gttttctat
6960269DNAArtificial SequencecDNA Sequence of aMTD324 5'-primer
602gggtttcata tgattgtggc ggtggcgctg ccggcggcgc tggtgccggc aaatattacc
60gttttctat
6960369DNAArtificial SequencecDNA Sequence of aMTD325 5'-primer
603gggtttcata tgattgtggc ggtggcgctg ccggcggtgg cgctgccggc aaatattacc
60gttttctat
6960469DNAArtificial SequencecDNA Sequence of aMTD329 5'-primer
604gggtttcata tgctgccggt gctggtgccg gtggtgccgg tggtgccggc aaatattacc
60gttttctat
6960569DNAArtificial SequencecDNA Sequence of aMTD331 5'-primer
605gggtttcata tggtgccggt gctggtgccg ctggtgccgg tggtgccggc aaatattacc
60gttttctat
6960669DNAArtificial SequencecDNA Sequence of aMTD341 5'-primer
606gggtttcata tgattgtggc ggtggcgctg ccggcggtgc tggcgccggc aaatattacc
60gttttctat
6960769DNAArtificial SequencecDNA Sequence of aMTD342 5'-primer
607gggtttcata tggtgattgt ggcgctggcg ccggcggtgc tggcgccggc aaatattacc
60gttttctat
6960869DNAArtificial SequencecDNA Sequence of aMTD343 5'-primer
608gggtttcata tgattgtggc ggtggcgctg ccggcgctgg tggcgccggc aaatattacc
60gttttctat
6960969DNAArtificial SequencecDNA Sequence of aMTD345 5'-primer
609gggtttcata tggcgctgct gattgtggcg ccggtggcgg tggcgccggc aaatattacc
60gttttctat
6961069DNAArtificial SequencecDNA Sequence of aMTD349 5'-primer
610gggtttcata tggtgccggt gctggtgccg gtggtgccgg tggtgccggc aaatattacc
60gttttctat
6961169DNAArtificial SequencecDNA Sequence of aMTD350 5'-primer
611gggtttcata tggtgccgat tctggtgccg gtggtgccgg tggtgccggc aaatattacc
60gttttctat
6961269DNAArtificial SequencecDNA Sequence of aMTD361 5'-primer
612gggtttcata tggcggtggt gattgtggcg ccggcggtga ttgcgccggc aaatattacc
60gttttctat
6961369DNAArtificial SequencecDNA Sequence of aMTD363 5'-primer
613gggtttcata tggcggtgct ggcggtggcg ccggcgctga ttgtgccggc aaatattacc
60gttttctat
6961469DNAArtificial SequencecDNA Sequence of aMTD364 5'-primer
614gggtttcata tgctggtggc ggcggtggcg ccggcgctga ttgtgccggc aaatattacc
60gttttctat
6961569DNAArtificial SequencecDNA Sequence of aMTD365 5'-primer
615gggtttcata tggcggtgat tgtggtggcg ccggcgctgc tggcgccggc aaatattacc
60gttttctat
6961669DNAArtificial SequencecDNA Sequence of aMTD381 5'-primer
616gggtttcata tggtggtggc gattgtgctg ccggcggtgg cggcgccggc aaatattacc
60gttttctat
6961769DNAArtificial SequencecDNA Sequence of aMTD382 5'-primer
617gggtttcata tggcggcggc gctggtgatt ccggcgattc tggcgccggc aaatattacc
60gttttctat
6961869DNAArtificial SequencecDNA Sequence of aMTD383 5'-primer
618gggtttcata tggtgattgt ggcgctggcg ccggcgctgc tggcgccggc aaatattacc
60gttttctat
6961969DNAArtificial SequencecDNA Sequence of aMTD384 5'-primer
619gggtttcata tggtgattgt ggcgattgcg ccggcgctgc tggcgccggc aaatattacc
60gttttctat
6962069DNAArtificial SequencecDNA Sequence of aMTD385 5'-primer
620gggtttcata tgattgtggc gattgcggtg ccggcgctgg tggcgccggc aaatattacc
60gttttctat
6962169DNAArtificial SequencecDNA Sequence of aMTD390 5'-primer
621gggtttcata tggtgccgct gctggtgccg gtggtgccgg tggtgccggc aaatattacc
60gttttctat
6962269DNAArtificial SequencecDNA Sequence of aMTD401 5'-primer
622gggtttcata tggcggcgct ggcggtgatt ccggcggcga ttctgccggc aaatattacc
60gttttctat
6962369DNAArtificial SequencecDNA Sequence of aMTD402 5'-primer
623gggtttcata tggcgctggc ggcggtgatt ccggcggcga ttctgccggc aaatattacc
60gttttctat
6962469DNAArtificial SequencecDNA Sequence of aMTD403 5'-primer
624gggtttcata tggcggcggc gctggtgatt ccggcggcga ttctgccggc aaatattacc
60gttttctat
6962569DNAArtificial SequencecDNA Sequence of aMTD404 5'-primer
625gggtttcata tgctggcggc ggcggtgatt ccggcggcga ttctgccggc aaatattacc
60gttttctat
6962669DNAArtificial SequencecDNA Sequence of aMTD405 5'-primer
626gggtttcata tgctggcggc ggcggtgatt ccggtggcga ttctgccggc aaatattacc
60gttttctat
6962769DNAArtificial SequencecDNA Sequence of aMTD421 5'-primer
627gggtttcata tggcggcgat tctggcggcg ccgctgattg cggtgccggc aaatattacc
60gttttctat
6962869DNAArtificial SequencecDNA Sequence of aMTD422 5'-primer
628gggtttcata tggtggtggc gattctggcg ccgctgctgg cggcgccggc aaatattacc
60gttttctat
6962969DNAArtificial SequencecDNA Sequence of aMTD424 5'-primer
629gggtttcata tggcggtggt ggtggcggcg ccggtgctgg cgctgccggc aaatattacc
60gttttctat
6963069DNAArtificial SequencecDNA Sequence of aMTD425 5'-primer
630gggtttcata tggcggtggt ggcgattgcg ccggtgctgg cgctgccggc aaatattacc
60gttttctat
6963169DNAArtificial SequencecDNA Sequence of aMTD426 5'-primer
631gggtttcata tggcggcggc gctggcgatt ccgctggcga ttattccggc aaatattacc
60gttttctat
6963269DNAArtificial SequencecDNA Sequence of aMTD436 5'-primer
632gggtttcata tggcggtggt gctggtgatt atgccggcgg cgattccggc aaatattacc
60gttttctat
6963369DNAArtificial SequencecDNA Sequence of aMTD442 5'-primer
633gggtttcata tggcgctggc ggcgctggtg ccggcggtgc tggtgccggc aaatattacc
60gttttctat
6963469DNAArtificial SequencecDNA Sequence of aMTD443 5'-primer
634gggtttcata tggcgctggc ggcgctggtg ccggtggcgc tggtgccggc aaatattacc
60gttttctat
6963569DNAArtificial SequencecDNA Sequence of aMTD444 5'-primer
635gggtttcata tgctggcggc ggcgctggtg ccggtggcgc tggtgccggc aaatattacc
60gttttctat
6963669DNAArtificial SequencecDNA Sequence of aMTD445 5'-primer
636gggtttcata tggcgctggc ggcgctggtg ccggcgctgg tggtgccggc aaatattacc
60gttttctat
6963769DNAArtificial SequencecDNA Sequence of aMTD461 5'-primer
637gggtttcata tgattgcggc ggtgattgtg ccggcggtgg cgctgccggc aaatattacc
60gttttctat
6963869DNAArtificial SequencecDNA Sequence of aMTD462 5'-primer
638gggtttcata tgattgcggc ggtgctggtg ccggcggtgg cgctgccggc aaatattacc
60gttttctat
6963969DNAArtificial SequencecDNA Sequence of aMTD463 5'-primer
639gggtttcata tggcggtggc gattctggtg ccgctgctgg cggcgccggc aaatattacc
60gttttctat
6964069DNAArtificial SequencecDNA Sequence of aMTD464 5'-primer
640gggtttcata tggcggtggt gattctggtg ccgctggcgg cggcgccggc aaatattacc
60gttttctat
6964169DNAArtificial SequencecDNA Sequence of aMTD465 5'-primer
641gggtttcata tgattgcggc ggtgattgtg ccggtggcgg cgctgccggc aaatattacc
60gttttctat
6964269DNAArtificial SequencecDNA Sequence of aMTD466 5'-primer
642gggtttcata tgattattgc ggcggcggcg ccgctggcga ttattccggc aaatattacc
60gttttctat
6964369DNAArtificial SequencecDNA Sequence of aMTD481 5'-primer
643gggtttcata tggcgattgc gattgcgatt gtgccggtgg cgctgccggc aaatattacc
60gttttctat
6964469DNAArtificial SequencecDNA Sequence of aMTD482 5'-primer
644gggtttcata tgattctggc ggtggcggcg attccggtgg cggtgccggc aaatattacc
60gttttctat
6964569DNAArtificial SequencecDNA Sequence of aMTD483 5'-primer
645gggtttcata tgattctggc ggcggcgatt attccggcgg cgctgccggc aaatattacc
60gttttctat
6964669DNAArtificial SequencecDNA Sequence of aMTD484 5'-primer
646gggtttcata tgctggcggt ggtgctggcg gcgccggcga ttgtgccggc aaatattacc
60gttttctat
6964769DNAArtificial SequencecDNA Sequence of aMTD485 5'-primer
647gggtttcata tggcgattct ggcggcgatt gtgccgctgg cggtgccggc aaatattacc
60gttttctat
6964869DNAArtificial SequencecDNA Sequence of aMTD501 5'-primer
648gggtttcata tggtgattgt ggcgctggcg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6964969DNAArtificial SequencecDNA Sequence of aMTD502 5'-primer
649gggtttcata tggcgattgt ggcgctggcg gtgccggtgc tggcgccggc aaatattacc
60gttttctat
6965069DNAArtificial SequencecDNA Sequence of aMTD503 5'-primer
650gggtttcata tggcggcgat tattattgtg ctgccggcgg cgctgccggc aaatattacc
60gttttctat
6965169DNAArtificial SequencecDNA Sequence of aMTD504 5'-primer
651gggtttcata tgctgattgt ggcgctggcg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6965269DNAArtificial SequencecDNA Sequence of aMTD505 5'-primer
652gggtttcata tggcgattat tattgtgatt gcgccggcgg cggcgccggc aaatattacc
60gttttctat
6965369DNAArtificial SequencecDNA Sequence of aMTD521 5'-primer
653gggtttcata tgctggcggc gctgattgtg gtgccggcgg tggcgccggc aaatattacc
60gttttctat
6965469DNAArtificial SequencecDNA Sequence of aMTD522 5'-primer
654gggtttcata tggcgctgct ggtgattgcg gtgccggcgg tggcgccggc aaatattacc
60gttttctat
6965569DNAArtificial SequencecDNA Sequence of aMTD524 5'-primer
655gggtttcata tggcggtggc gctgattgtg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6965669DNAArtificial SequencecDNA Sequence of aMTD525 5'-primer
656gggtttcata tggcgctggc gattgtggtg gcgccggtgg cggtgccggc aaatattacc
60gttttctat
6965769DNAArtificial SequencecDNA Sequence of aMTD527 5'-primer
657gggtttcata tgctggtgct ggcggcggtg gcgccgattg cgattccggc aaatattacc
60gttttctat
6965869DNAArtificial SequencecDNA Sequence of aMTD541 5'-primer
658gggtttcata tgctgctggc gctgattatt gcgccggcgg cggcgccggc aaatattacc
60gttttctat
6965969DNAArtificial SequencecDNA Sequence of aMTD542 5'-primer
659gggtttcata tggcgctggc gctgattatt gtgccggcgg tggcgccggc aaatattacc
60gttttctat
6966069DNAArtificial SequencecDNA Sequence of aMTD543 5'-primer
660gggtttcata tgctgctggc ggcgctgatt gcgccggcgg cgctgccggc aaatattacc
60gttttctat
6966169DNAArtificial SequencecDNA Sequence of aMTD544 5'-primer
661gggtttcata tgattgtggc gctgattgtg gcgccggcgg cggtgccggc aaatattacc
60gttttctat
6966269DNAArtificial SequencecDNA Sequence of aMTD545 5'-primer
662gggtttcata tggtggtgct ggtgctggcg gcgccggcgg cggtgccggc aaatattacc
60gttttctat
6966369DNAArtificial SequencecDNA Sequence of aMTD561 5'-primer
663gggtttcata tggcggcggt ggcgattgtg ctgccggcgg tggtgccggc aaatattacc
60gttttctat
6966469DNAArtificial SequencecDNA Sequence of aMTD562 5'-primer
664gggtttcata tggcgctgat tgcggcgatt gtgccggcgc tggtgccggc aaatattacc
60gttttctat
6966569DNAArtificial SequencecDNA Sequence of aMTD563 5'-primer
665gggtttcata tggcgctggc ggtgattgtg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6966669DNAArtificial SequencecDNA Sequence of aMTD564 5'-primer
666gggtttcata tggtggcgat tgcgctgatt gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6966769DNAArtificial SequencecDNA Sequence of aMTD565 5'-primer
667gggtttcata tggtggcgat tgtgctggtg gcgccggcgg tggcgccggc aaatattacc
60gttttctat
6966869DNAArtificial SequencecDNA Sequence of aMTD577 5'-primer
668gggtttcata tggcggcggt gctgattgtg ccgattatgg tgatgccggc aaatattacc
60gttttctat
6966969DNAArtificial SequencecDNA Sequence of aMTD582 5'-primer
669gggtttcata tggtggcggt ggcgctgatt gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6967069DNAArtificial SequencecDNA Sequence of aMTD583 5'-primer
670gggtttcata tggcggtgat tctggcgctg gcgccgattg tggcgccggc aaatattacc
60gttttctat
6967169DNAArtificial SequencecDNA Sequence of aMTD585 5'-primer
671gggtttcata tggcgctgat tgtggcgatt gcgccggcgc tggtgccggc aaatattacc
60gttttctat
6967269DNAArtificial SequencecDNA Sequence of aMTD601 5'-primer
672gggtttcata tggcggcgat tctgattgcg gtgccgattg cggcgccggc aaatattacc
60gttttctat
6967369DNAArtificial SequencecDNA Sequence of aMTD602 5'-primer
673gggtttcata tggtgattgt ggcgctggcg gcgccggtgc tggcgccggc aaatattacc
60gttttctat
6967469DNAArtificial SequencecDNA Sequence of aMTD603 5'-primer
674gggtttcata tggtgctggt ggcgctggcg gcgccggtga ttgcgccggc aaatattacc
60gttttctat
6967569DNAArtificial SequencecDNA Sequence of aMTD604 5'-primer
675gggtttcata tggtggcgct gattgcggtg gcgccggcgg tggtgccggc aaatattacc
60gttttctat
6967669DNAArtificial SequencecDNA Sequence of aMTD605 5'-primer
676gggtttcata tggtgattgc ggcggtgctg gcgccggtgg cggtgccggc aaatattacc
60gttttctat
6967769DNAArtificial SequencecDNA Sequence of aMTD606 5'-primer
677gggtttcata tggcggcggc gattgcggcg attccgatta ttattccggc aaatattacc
60gttttctat
6967869DNAArtificial SequencecDNA Sequence of aMTD622 5'-primer
678gggtttcata tggcggcggc gattgcggcg attccgatta ttattccggc aaatattacc
60gttttctat
6967969DNAArtificial SequencecDNA Sequence of aMTD623 5'-primer
679gggtttcata tggtggcggc ggcgattgcg ctgccggcga ttgtgccggc aaatattacc
60gttttctat
6968069DNAArtificial SequencecDNA Sequence of aMTD625 5'-primer
680gggtttcata tgattctggc ggcggcggcg gcgccgctga ttgtgccggc aaatattacc
60gttttctat
6968169DNAArtificial SequencecDNA Sequence of aMTD635 5'-primer
681gggtttcata tgggcagcac cggcggcagc cagcagaaca accagtatgc aaatattacc
60gttttctat
6968269DNAArtificial SequencecDNA Sequence of aMTD643 5'-primer
682gggtttcata tgctggcgct ggtgctggcg gcgccggcga ttgtgccggc aaatattacc
60gttttctat
6968369DNAArtificial SequencecDNA Sequence of aMTD645 5'-primer
683gggtttcata tggcgctggc ggtggtggcg ctgccggcga ttgtgccggc aaatattacc
60gttttctat
6968469DNAArtificial SequencecDNA Sequence of aMTD661 5'-primer
684gggtttcata tggcggcgat tctggcgccg attgtggcgg cgctgccggc aaatattacc
60gttttctat
6968569DNAArtificial SequencecDNA Sequence of aMTD664 5'-primer
685gggtttcata tgattctgat tgcgattgcg attccggcgg cggcgccggc aaatattacc
60gttttctat
6968669DNAArtificial SequencecDNA Sequence of aMTD665 5'-primer
686gggtttcata tgctggcgat tgtgctggcg gcgccggtgg cggtgccggc aaatattacc
60gttttctat
6968769DNAArtificial SequencecDNA Sequence of aMTD666 5'-primer
687gggtttcata tggcggcgat tgcgattatt gcgccggcga ttgtgccggc aaatattacc
60gttttctat
6968869DNAArtificial SequencecDNA Sequence of aMTD667 5'-primer
688gggtttcata tgctggcggt ggcgattgtg gcgccggcgc tggtgccggc aaatattacc
60gttttctat
6968969DNAArtificial SequencecDNA Sequence of aMTD676 5'-primer
689gggtttcata tggtgccgct gctggtgccg gtgccggtgg tggtgccggc aaatattacc
60gttttctat
6969069DNAArtificial SequencecDNA Sequence of aMTD683 5'-primer
690gggtttcata tgctggcgat tgtgctggcg gcgccggcgg tgctgccggc aaatattacc
60gttttctat
6969169DNAArtificial SequencecDNA Sequence of aMTD684 5'-primer
691gggtttcata tggcggcgat tgtgctggcg ctgccggcgg tgctgccggc aaatattacc
60gttttctat
6969269DNAArtificial SequencecDNA Sequence of aMTD685 5'-primer
692gggtttcata tggcgctgct ggtggcggtg ctgccggcgg cgctgccggc aaatattacc
60gttttctat
6969369DNAArtificial SequencecDNA Sequence of aMTD686 5'-primer
693gggtttcata tggcggcgct ggtggcggtg ctgccggtgg cgctgccggc aaatattacc
60gttttctat
6969469DNAArtificial SequencecDNA Sequence of aMTD687 5'-primer
694gggtttcata tggcgattct ggcggtggcg ctgccgctgc tggcgccggc aaatattacc
60gttttctat
6969569DNAArtificial SequencecDNA Sequence of aMTD692 5'-primer
695gggtttcata tgccggcgcc gctgccgccg gtggtgattc tggcggtggc aaatattacc
60gttttctat
6969669DNAArtificial SequencecDNA Sequence of aMTD693 5'-primer
696gggtttcata tggcggcgcc ggtgctgccg gtggcggtgc cgattgtggc aaatattacc
60gttttctat
6969769DNAArtificial SequencecDNA Sequence of aMTD700 5'-primer
697gggtttcata tgggcaccag caacacctgc cagagcaacc agaacagcgc aaatattacc
60gttttctat
6969869DNAArtificial SequencecDNA Sequence of aMTD703 5'-primer
698gggtttcata tgattgtggc ggtggcgctg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6969968DNAArtificial SequencecDNA Sequence of aMTD705 5'-primer
699gggtttcata tattgtggcg gtggcgctgc tgccggcgct ggcgccggca aatattaccg
60ttttctat
6870069DNAArtificial SequencecDNA Sequence of aMTD706 5'-primer
700gggtttcata tgattgtggc ggtggcgctg ctgccggcgg tggcgccggc aaatattacc
60gttttctat
6970169DNAArtificial SequencecDNA Sequence of aMTD707 5'-primer
701gggtttcata tgattgtggc gctggcggtg ctgccggcgg tggcgccggc aaatattacc
60gttttctat
6970269DNAArtificial SequencecDNA Sequence of aMTD724 5'-primer
702gggtttcata tggtggcggt gctggcggtg ctgccggcgc tggcgccggc aaatattacc
60gttttctat
6970369DNAArtificial SequencecDNA Sequence of aMTD725 5'-primer
703gggtttcata tgattgcggt gctggcggtg gcgccggcgg tgctgccggc aaatattacc
60gttttctat
6970469DNAArtificial SequencecDNA Sequence of aMTD726 5'-primer
704gggtttcata tgctggcggt ggcgattatt gcgccggcgg tggcgccggc aaatattacc
60gttttctat
6970569DNAArtificial SequencecDNA Sequence of aMTD727 5'-primer
705gggtttcata tggtggcgct ggcgattgcg ctgccggcgg tgctgccggc aaatattacc
60gttttctat
6970669DNAArtificial SequencecDNA Sequence of aMTD743 5'-primer
706gggtttcata tggcgattgc gattgcgctg gtgccggtgg cgctgccggc aaatattacc
60gttttctat
6970769DNAArtificial SequencecDNA Sequence of aMTD744 5'-primer
707gggtttcata tggcggcggt ggtgattgtg gcgccggtgg cgctgccggc aaatattacc
60gttttctat
6970869DNAArtificial SequencecDNA Sequence of aMTD745 5'-primer
708gggtttcata tggcggcgat tctggcgatt gtggcgccgc tggcgccggc aaatattacc
60gttttctat
6970969DNAArtificial SequencecDNA Sequence of aMTD746 5'-primer
709gggtttcata tggtggcgat tattgtggtg gcgccggcgc tggcgccggc aaatattacc
60gttttctat
6971069DNAArtificial SequencecDNA Sequence of aMTD747 5'-primer
710gggtttcata tggtggcgct gctggcgatt gcgccggcgc tggcgccggc aaatattacc
60gttttctat
6971169DNAArtificial SequencecDNA Sequence of aMTD750 5'-primer
711gggtttcata tgctggcgat tgcggcgatt gcgccgctgg cgattccggc aaatattacc
60gttttctat
6971269DNAArtificial SequencecDNA Sequence of aMTD763 5'-primer
712gggtttcata tggtggcggt gctgattgcg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6971369DNAArtificial SequencecDNA Sequence of aMTD764 5'-primer
713gggtttcata tggcggtggc gctggcggtg ctgccggcgg tggtgccggc aaatattacc
60gttttctat
6971469DNAArtificial SequencecDNA Sequence of aMTD765 5'-primer
714gggtttcata tggcggtggc gctggcggtg gtgccggcgg tgctgccggc aaatattacc
60gttttctat
6971569DNAArtificial SequencecDNA Sequence of aMTD766 5'-primer
715gggtttcata tgattgtggt gattgcggtg gcgccggcgg tggcgccggc aaatattacc
60gttttctat
6971669DNAArtificial SequencecDNA Sequence of aMTD767 5'-primer
716gggtttcata tgattgtggt ggcggcggtg gtgccggcgc tggcgccggc aaatattacc
60gttttctat
6971769DNAArtificial SequencecDNA Sequence of aMTD772 5'-primer
717gggtttcata tgctgccggt ggcgccggtg attccgatta ttgtgccggc aaatattacc
60gttttctat
6971869DNAArtificial SequencecDNA Sequence of aMTD783 5'-primer
718gggtttcata tgattgtggc gctggtgccg gcggtggcga ttgcgccggc aaatattacc
60gttttctat
6971969DNAArtificial SequencecDNA Sequence of aMTD784 5'-primer
719gggtttcata tggtggcggc gctgccggcg gtggcgctgg tggtgccggc aaatattacc
60gttttctat
6972069DNAArtificial SequencecDNA Sequence of aMTD786 5'-primer
720gggtttcata tgctggtggc gattgcgccg ctggcggtgc tggcgccggc aaatattacc
60gttttctat
6972169DNAArtificial SequencecDNA Sequence of aMTD787 5'-primer
721gggtttcata tggcggtggc gctggtgccg gtgattgtgg cggcgccggc aaatattacc
60gttttctat
6972269DNAArtificial SequencecDNA Sequence of aMTD788 5'-primer
722gggtttcata tggcgattgc ggtggcgatt gcgccggtgg cgctgccggc aaatattacc
60gttttctat
6972369DNAArtificial SequencecDNA Sequence of aMTD803 5'-primer
723gggtttcata tggcgattgc gctggcggtg ccggtgctgg cgctgccggc aaatattacc
60gttttctat
6972469DNAArtificial SequencecDNA Sequence of aMTD805 5'-primer
724gggtttcata tgctggtgct gattgcggcg gcgccgattg cgctgccggc aaatattacc
60gttttctat
6972569DNAArtificial SequencecDNA Sequence of aMTD806 5'-primer
725gggtttcata tgctggtggc gctggcggtg ccggcggcgg tgctgccggc aaatattacc
60gttttctat
6972669DNAArtificial SequencecDNA Sequence of aMTD807 5'-primer
726gggtttcata tggcggtggc gctggcggtg ccggcgctgg tgctgccggc aaatattacc
60gttttctat
6972769DNAArtificial SequencecDNA Sequence of aMTD808 5'-primer
727gggtttcata tgctggtggt gctggcggcg gcgccgctgg cggtgccggc aaatattacc
60gttttctat
6972869DNAArtificial SequencecDNA Sequence of aMTD809 5'-primer
728gggtttcata tgctgattgt gctggcggcg ccggcgctgg cggcgccggc aaatattacc
60gttttctat
6972969DNAArtificial SequencecDNA Sequence of aMTD810 5'-primer
729gggtttcata tggtgattgt gctggcggcg ccggcgctgg cggcgccggc aaatattacc
60gttttctat
6973069DNAArtificial SequencecDNA Sequence of aMTD811 5'-primer
730gggtttcata tggcggtggt gctggcggtg ccggcgctgg cggtgccggc aaatattacc
60gttttctat
6973169DNAArtificial SequencecDNA Sequence of aMTD824 5'-primer
731gggtttcata tgctgattat tgtggcggcg gcgccggcgg tggcgccggc aaatattacc
60gttttctat
6973269DNAArtificial SequencecDNA Sequence of aMTD825 5'-primer
732gggtttcata tgattgtggc ggtgattgtg gcgccggcgg tggcgccggc aaatattacc
60gttttctat
6973369DNAArtificial SequencecDNA Sequence of aMTD826 5'-primer
733gggtttcata tgctggtggc gctggcggcg ccgattattg cggtgccggc aaatattacc
60gttttctat
6973469DNAArtificial SequencecDNA Sequence of aMTD827 5'-primer
734gggtttcata tgattgcggc ggtgctggcg gcgccggcgc tggtgccggc aaatattacc
60gttttctat
6973569DNAArtificial SequencecDNA Sequence of aMTD828 5'-primer
735gggtttcata tgattgcgct gctggcggcg ccgattattg cggtgccggc aaatattacc
60gttttctat
6973669DNAArtificial SequencecDNA Sequence of aMTD829 5'-primer
736gggtttcata tggcggcgct ggcgctggtg gcgccggtga ttgtgccggc aaatattacc
60gttttctat
6973769DNAArtificial SequencecDNA Sequence of aMTD830 5'-primer
737gggtttcata tgattgcgct ggtggcggcg ccggtggcgc tggtgccggc aaatattacc
60gttttctat
6973869DNAArtificial SequencecDNA Sequence of aMTD831 5'-primer
738gggtttcata tgattattgt ggcggtggcg ccggcggcga ttgtgccggc aaatattacc
60gttttctat
6973969DNAArtificial SequencecDNA Sequence of aMTD832 5'-primer
739gggtttcata tggcggtggc ggcgattgtg ccggtgattg tggcgccggc aaatattacc
60gttttctat
6974069DNAArtificial SequencecDNA Sequence of aMTD843 5'-primer
740gggtttcata tggcggtgct ggtgctggtg gcgccggcgg cggcgccggc aaatattacc
60gttttctat
6974169DNAArtificial SequencecDNA Sequence of aMTD844 5'-primer
741gggtttcata tggtggtggc gctgctggcg ccgctgattg cggcgccggc aaatattacc
60gttttctat
6974269DNAArtificial SequencecDNA Sequence of aMTD845 5'-primer
742gggtttcata tggcggcggt ggtgattgcg ccgctgctgg cggtgccggc aaatattacc
60gttttctat
6974369DNAArtificial SequencecDNA Sequence of aMTD846 5'-primer
743gggtttcata tgattgcggt ggcggtggcg gcgccgctgc tggtgccggc aaatattacc
60gttttctat
6974469DNAArtificial SequencecDNA Sequence of aMTD847 5'-primer
744gggtttcata tgctggtggc gattgtggtg ctgccggcgg tggcgccggc aaatattacc
60gttttctat
6974569DNAArtificial SequencecDNA Sequence of aMTD848 5'-primer
745gggtttcata tggcggtggc gattgtggtg ctgccggcgg tggcgccggc aaatattacc
60gttttctat
6974669DNAArtificial SequencecDNA Sequence of aMTD849 5'-primer
746gggtttcata tggcggtgat tctgctggcg ccgctgattg cggcgccggc aaatattacc
60gttttctat
6974769DNAArtificial SequencecDNA Sequence of aMTD850 5'-primer
747gggtttcata tgctggtgat tgcgctggcg gcgccggtgg cgctgccggc aaatattacc
60gttttctat
6974869DNAArtificial SequencecDNA Sequence of aMTD851 5'-primer
748gggtttcata tggtgctggc ggtggtgctg ccggcggtgg cgctgccggc aaatattacc
60gttttctat
6974969DNAArtificial SequencecDNA Sequence of aMTD852 5'-primer
749gggtttcata tggtgctggc ggtggcggcg ccggcggtgc tgctgccggc aaatattacc
60gttttctat
6975069DNAArtificial SequencecDNA Sequence of aMTD863 5'-primer
750gggtttcata tggcggcggt ggtgctgctg ccgattattg cggcgccggc aaatattacc
60gttttctat
6975169DNAArtificial SequencecDNA Sequence of aMTD864 5'-primer
751gggtttcata tggcgctgct ggtgattgcg ccggcgattg cggtgccggc aaatattacc
60gttttctat
6975269DNAArtificial SequencecDNA Sequence of aMTD865 5'-primer
752gggtttcata tggcggtgct ggtgattgcg gtgccggcga ttgcgccggc aaatattacc
60gttttctat
6975369DNAArtificial SequencecDNA Sequence of aMTD867 5'-primer
753gggtttcata tggcgctgct ggtggtgatt gcgccgctgg cggcgccggc aaatattacc
60gttttctat
6975469DNAArtificial SequencecDNA Sequence of aMTD868 5'-primer
754gggtttcata tggtgctggt ggcggcgatt ctgccggcgg cgattccggc aaatattacc
60gttttctat
6975569DNAArtificial SequencecDNA Sequence of aMTD870 5'-primer
755gggtttcata tggtgctggt ggcggcggtg ctgccgattg cggcgccggc aaatattacc
60gttttctat
6975669DNAArtificial SequencecDNA Sequence of aMTD872 5'-primer
756gggtttcata tggtgctggc ggcggcggtg ctgccgctgg tggtgccggc aaatattacc
60gttttctat
6975769DNAArtificial SequencecDNA Sequence of aMTD875 5'-primer
757gggtttcata tggcgattgc gattgtggtg ccggcggtgg cggtgccggc aaatattacc
60gttttctat
6975869DNAArtificial SequencecDNA Sequence of aMTD877 5'-primer
758gggtttcata tggtggcgat tattgcggtg ccggcggtgg tggcgccggc aaatattacc
60gttttctat
6975969DNAArtificial SequencecDNA Sequence of aMTD878 5'-primer
759gggtttcata tgattgtggc gctggtggcg ccggcggcgg tggtgccggc aaatattacc
60gttttctat
6976069DNAArtificial SequencecDNA Sequence of aMTD879 5'-primer
760gggtttcata tggcggcgat tgtgctgctg ccggcggtgg tggtgccggc aaatattacc
60gttttctat
6976169DNAArtificial SequencecDNA Sequence of aMTD881 5'-primer
761gggtttcata tggcggcgct gattgtggtg ccggcggtgg cggtgccggc aaatattacc
60gttttctat
6976269DNAArtificial SequencecDNA Sequence of aMTD882 5'-primer
762gggtttcata tggcgattgc gctggtggtg ccggcggtgg cggtgccggc aaatattacc
60gttttctat
6976369DNAArtificial SequencecDNA Sequence of aMTD883 5'-primer
763gggtttcata tgctggcgat tgtgccggcg gcgattgcgg cgctgccggc aaatattacc
60gttttctat
6976469DNAArtificial SequencecDNA Sequence of aMTD884 5'-primer
764gggtttcata tggtgctgat tgtgccggcg gcgattgcgg cgctgccggc aaatattacc
60gttttctat
6976569DNAArtificial SequencecDNA Sequence of aMTD885 5'-primer
765gggtttcata tgctggtggc gattgcgccg gcggtggcgg tgctgccggc aaatattacc
60gttttctat
6976669DNAArtificial SequencecDNA Sequence of aMTD886 5'-primer
766gggtttcata tggtgctggc ggtgccggcg gcgattgcgg cgctgccggc aaatattacc
60gttttctat
6976769DNAArtificial SequencecDNA Sequence of aMTD887 5'-primer
767gggtttcata tggtgctggc ggtggcgccg gcggtggcgg tgctgccggc aaatattacc
60gttttctat
6976869DNAArtificial SequencecDNA Sequence of aMTD888 5'-primer
768gggtttcata tgattctggc ggtggtggcg attccggcgg cggcgccggc aaatattacc
60gttttctat
6976969DNAArtificial SequencecDNA Sequence of aMTD889 5'-primer
769gggtttcata tgattctggt ggcggcggcg ccgattgcgg cgctgccggc aaatattacc
60gttttctat
6977069DNAArtificial SequencecDNA Sequence of aMTD891 5'-primer
770gggtttcata tgattctggc ggtggcggcg attccggcgg cgctgccggc aaatattacc
60gttttctat
6977169DNAArtificial SequencecDNA Sequence of aMTD893 5'-primer
771gggtttcata tggtgattgc gattccggcg attctggcgg cggcgccggc aaatattacc
60gttttctat
6977269DNAArtificial SequencecDNA Sequence of aMTD895 5'-primer
772gggtttcata tggcgattat tattgtggtg ccggcgattg cggcgccggc aaatattacc
60gttttctat
6977369DNAArtificial SequencecDNA Sequence of aMTD896 5'-primer
773gggtttcata tggcgattct gattgtggtg gcgccgattg cggcgccggc aaatattacc
60gttttctat
6977469DNAArtificial SequencecDNA Sequence of aMTD897 5'-primer
774gggtttcata tggcggtgat tgtgccggtg gcgattattg cggcgccggc aaatattacc
60gttttctat
6977569DNAArtificial SequencecDNA Sequence of aMTD899 5'-primer
775gggtttcata tggcggtggt gattgcgctg ccggcggtgg tggcgccggc aaatattacc
60gttttctat
6977669DNAArtificial SequencecDNA Sequence of aMTD900 5'-primer
776gggtttcata tggcgctggt ggcggtgatt gcgccggtgg tggcgccggc aaatattacc
60gttttctat
6977769DNAArtificial SequencecDNA Sequence of aMTD901 5'-primer
777gggtttcata tggcgctggt ggcggtgctg ccggcggtgg cggtgccggc aaatattacc
60gttttctat
6977869DNAArtificial SequencecDNA Sequence of aMTD902 5'-primer
778gggtttcata tggcgctggt ggcgccgctg ctggcggtgg cggtgccggc aaatattacc
60gttttctat
6977969DNAArtificial SequencecDNA Sequence of aMTD904 5'-primer
779gggtttcata tggcggtgct ggcggtggtg gcgccggtgg tggcgccggc aaatattacc
60gttttctat
6978069DNAArtificial SequencecDNA Sequence of aMTD905 5'-primer
780gggtttcata tggcggtgat tgcggtggcg ccgctggtgg tggcgccggc aaatattacc
60gttttctat
6978169DNAArtificial SequencecDNA Sequence of aMTD906 5'-primer
781gggtttcata tggcggtgat tgcgctggcg ccggtggtgg tggcgccggc aaatattacc
60gttttctat
6978269DNAArtificial SequencecDNA Sequence of aMTD907 5'-primer
782gggtttcata tggtggcgat tgcgctggcg ccggtggtgg tggcgccggc aaatattacc
60gttttctat
6978369DNAArtificial SequencecDNA Sequence of aMTD908 5'-primer
783gggtttcata tggtggcgct ggcgctggcg ccggtggtgg tggcgccggc aaatattacc
60gttttctat
6978469DNAArtificial SequencecDNA Sequence of aMTD910 5'-primer
784gggtttcata tggtggcggc gctgctgccg gcggtggtgg tggcgccggc aaatattacc
60gttttctat
6978569DNAArtificial SequencecDNA Sequence of aMTD911 5'-primer
785gggtttcata tggtggcgct ggcgctgccg gcggtggtgg tggcgccggc aaatattacc
60gttttctat
6978669DNAArtificial SequencecDNA Sequence of aMTD912 5'-primer
786gggtttcata tggtggcgct gctggcgccg gcggtggtgg tggcgccggc aaatattacc
60gttttctat
6978769DNAArtificial SequencecDNA Sequence of aMTD921 5'-primer
787gggtttcata tgatttggtg gtttgtggtg ctgccgctgg tggtgccggc aaatattacc
60gttttctat
6978869DNAArtificial SequencecDNA Sequence of aMTD922 5'-primer
788gggtttcata tgtggtatgt gatttttgtg ctgccgctgg tggtgccggc aaatattacc
60gttttctat
6978969DNAArtificial SequencecDNA Sequence of aMTD931 5'-primer
789gggtttcata tggcggtgct gattgcgccg gcgattctgg cggcggcggc aaatattacc
60gttttctat
6979069DNAArtificial SequencecDNA Sequence of aMTD934 5'-primer
790gggtttcata tgctgattct ggcgccggcg gcggtggtgg cggcggcggc aaatattacc
60gttttctat
6979169DNAArtificial SequencecDNA Sequence of aMTD935 5'-primer
791gggtttcata tggcgctgct gattctgccg gcggcggcgg tggcggcggc aaatattacc
60gttttctat
6979269DNAArtificial SequencecDNA Sequence of aMTD936 5'-primer
792gggtttcata tggcgctgct gattctggcg gcggcggtgg cggcgccggc aaatattacc
60gttttctat
6979369DNAArtificial SequencecDNA Sequence of aMTD937 5'-primer
793gggtttcata tggtgccggt gctggtgccg ctgccggtgc cggtggtggc aaatattacc
60gttttctat
6979469DNAArtificial SequencecDNA Sequence of aMTD938 5'-primer
794gggtttcata tggtgccggt gctgctgccg gtggtggtgc cggtgccggc aaatattacc
60gttttctat
6979569DNAArtificial SequencecDNA Sequence of aMTD947 5'-primer
795gggtttcata tgtgctatta taatcagcag tccaataata ataatcaggc aaatattacc
60gttttctat
6979669DNAArtificial SequencecDNA Sequence of aMTD949 5'-primer
796gggtttcata tgtccggcaa ttcctgccag cagtgcggca attcctccgc aaatattacc
60gttttctat
6979739DNAArtificial SequencecDNA Sequence of aMTD 3'-primer
797cgcgtcgact tacctcggct gcaccggcac ggagatgac
39798184PRTArtificial SequenceAmino acid Sequence of SDA 798Met Ala Asn
Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln1 5
10 15 Val Asp Leu Pro Pro Gly Asn Tyr Thr
Arg Ala Gln Leu Ala Ala Leu 20 25
30 Gly Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val
35 40 45 Lys Ala Ile Leu Tyr Gln
Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu 50 55
60 Val Val Ala Asn Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val
Ser65 70 75 80 Ser Ile
Arg Val Ile Ser Val Pro Val Gln Pro Arg Met Ala Asn Ile 85
90 95 Thr Val Phe Tyr Asn Glu Asp Phe
Gln Gly Lys Gln Val Asp Leu Pro 100 105
110 Pro Gly Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly Ile Glu
Asn 115 120 125 Asn Thr Ile Ser
Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile Leu 130
135 140 Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu
Val Val Ala Asn145 150 155
160 Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val
165 170 175 Ile Ser Val Pro Val
Gln Pro Arg 180 79999PRTArtificial
SequenceAmino acid Sequence of SDB 799Met Ala Glu Gln Ser Asp Lys Asp Val
Lys Tyr Tyr Thr Leu Glu Glu1 5 10
15 Ile Gln Lys His Lys Asp Ser Lys Ser Thr Trp Val Ile Leu His
His 20 25 30 Lys Val Tyr Asp
Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu 35
40 45 Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr
Glu Asn Phe Glu 50 55 60 Asp Val Gly
His Ser Thr Asp Ala Arg Glu Leu Ser Lys Thr Tyr Ile65 70
75 80 Ile Gly Glu Leu His Pro Asp Asp
Arg Ser Lys Ile Ala Lys Pro Ser 85 90
95 Glu Thr Leu800109PRTArtificial SequenceAmino acid
Sequence of SDC 800Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe
Asp Thr Asp1 5 10 15 Val
Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp 20
25 30 Cys Gly Pro Cys Lys Met Ile Ala
Pro Ile Leu Asp Glu Ile Ala Asp 35 40
45 Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn
50 55 60 Pro Gly Thr Ala Pro Lys Tyr
Gly Ile Arg Gly Ile Pro Thr Leu Leu65 70
75 80 Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val
Gly Ala Leu Ser 85 90 95
Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala 100
105 801208PRTArtificial SequenceAmino acid
Sequence of SDD 801Met Lys Lys Ile Trp Leu Ala Leu Ala Gly Leu Val Leu
Ala Phe Ser1 5 10 15 Ala
Ser Ala Ala Gln Tyr Glu Asp Gly Lys Gln Tyr Thr Thr Leu Glu 20
25 30 Lys Pro Val Ala Gly Ala Pro Gln
Val Leu Glu Phe Phe Ser Phe Phe 35 40
45 Cys Pro His Cys Tyr Gln Phe Glu Glu Val Leu His Ile Ser Asp Asn
50 55 60 Val Lys Lys Lys Leu Pro Glu
Gly Val Lys Met Thr Lys Tyr His Val65 70
75 80 Asn Phe Met Gly Gly Asp Leu Gly Lys Asp Leu Thr
Gln Ala Trp Ala 85 90 95
Val Ala Met Ala Leu Gly Val Glu Asp Lys Val Thr Val Pro Leu Phe
100 105 110 Glu Gly Val Gln Lys Thr Gln
Thr Ile Arg Ser Ala Ser Asp Ile Arg 115 120
125 Asp Val Phe Ile Asn Ala Gly Ile Lys Gly Glu Glu Tyr Asp Ala
Ala 130 135 140 Trp Asn Ser Phe Val
Val Lys Ser Leu Val Ala Gln Gln Glu Lys Ala145 150
155 160 Ala Ala Asp Val Gln Leu Arg Gly Val Pro
Ala Met Phe Val Asn Gly 165 170
175 Lys Tyr Gln Leu Asn Pro Gln Gly Met Asp Thr Ser Asn Met Asp Val
180 185 190 Phe Val Gln Gln Tyr
Ala Asp Thr Val Lys Tyr Leu Ser Glu Lys Lys 195
200 205 802100PRTArtificial SequenceAmino acid Sequence
of SDE 802Gly Ser Leu Gln Asp Ser Glu Val Asn Gln Glu Ala Lys Pro Glu
Val1 5 10 15 Lys Pro
Glu Val Lys Pro Glu Thr His Ile Asn Leu Lys Val Ser Asp 20
25 30 Gly Ser Ser Glu Ile Phe Phe Lys Ile
Lys Lys Thr Thr Pro Leu Arg 35 40
45 Arg Leu Met Glu Ala Phe Ala Lys Arg Gln Gly Lys Glu Met Asp Ser 50
55 60 Leu Thr Phe Leu Tyr Asp Gly Ile
Glu Ile Gln Ala Asp Gln Thr Pro65 70 75
80 Glu Asp Leu Asp Met Glu Asp Asn Asp Ile Ile Glu Ala
His Arg Glu 85 90 95 Gln
Ile Gly Gly 100803297PRTArtificial SequenceAmino acid Sequence
of SDF 803Gly Ser Glu Ile Gly Thr Gly Phe Pro Phe Asp Pro His Tyr Val
Glu1 5 10 15 Val Leu Gly
Glu Arg Met His Tyr Val Asp Val Gly Pro Arg Asp Gly 20
25 30 Thr Pro Val Leu Phe Leu His Gly Asn Pro
Thr Ser Ser Tyr Val Trp 35 40 45
Arg Asn Ile Ile Pro His Val Ala Pro Thr His Arg Cys Ile Ala Pro 50
55 60 Asp Leu Ile Gly Met Gly Lys Ser Asp
Lys Pro Asp Leu Gly Tyr Phe65 70 75
80 Phe Asp Asp His Val Arg Phe Met Asp Ala Phe Ile Glu Ala
Leu Gly 85 90 95 Leu Glu
Glu Val Val Leu Val Ile His Asp Trp Gly Ser Ala Leu Gly 100
105 110 Phe His Trp Ala Lys Arg Asn Pro Glu
Arg Val Lys Gly Ile Ala Phe 115 120
125 Met Glu Phe Ile Arg Pro Ile Pro Thr Trp Asp Glu Trp Pro Glu Phe
130 135 140 Ala Arg Glu Thr Phe Gln Ala
Phe Arg Thr Thr Asp Val Gly Arg Lys145 150
155 160 Leu Ile Ile Asp Gln Asn Val Phe Ile Glu Gly Thr
Leu Pro Met Gly 165 170
175 Val Val Arg Pro Leu Thr Glu Val Glu Met Asp His Tyr Arg Glu Pro
180 185 190 Phe Leu Asn Pro Val Asp
Arg Glu Pro Leu Trp Arg Phe Pro Asn Glu 195 200
205 Leu Pro Ile Ala Gly Glu Pro Ala Asn Ile Val Ala Leu Val
Glu Glu 210 215 220 Tyr Met Asp Trp
Leu His Gln Ser Pro Val Pro Lys Leu Leu Phe Trp225 230
235 240 Gly Thr Pro Gly Val Leu Ile Pro Pro
Ala Glu Ala Ala Arg Leu Ala 245 250
255 Lys Ser Leu Pro Asn Cys Lys Ala Val Asp Ile Gly Pro Gly Leu
Asn 260 265 270 Leu Leu Gln
Glu Asp Asn Pro Asp Leu Ile Gly Ser Glu Ile Ala Arg 275
280 285 Trp Leu Ser Thr Leu Glu Ile Ser Gly 290
295 80499PRTArtificial SequenceAmino acid Sequence
of SDB' for deimunization 804Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr
Tyr Thr Leu Glu Glu1 5 10
15 Ile Gln Lys His Lys Asp Ser Lys Ser Thr Trp Leu Ile Leu His His
20 25 30 Lys Val Tyr Asp Leu Thr
Lys Phe Leu Glu Glu His Pro Gly Gly Glu 35 40
45 Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn
Phe Glu 50 55 60 Asp Val Gly His Ser
Thr Asp Ala Arg Glu Leu Ser Lys Thr Tyr Ile65 70
75 80 Ile Gly Glu Leu His Pro Asp Asp Arg Ser
Lys Ile Ala Lys Pro Ser 85 90
95 Glu Thr Leu805552DNAArtificial SequencecDNA Sequence of SDA
805atggcaaata ttaccgtttt ctataacgaa gacttccagg gtaagcaggt cgatctgccg
60cctggcaact atacccgcgc ccagttggcg gcgctgggca tcgagaataa taccatcagc
120tcggtgaagg tgccgcctgg cgtgaaggct atcctgtacc agaacgatgg tttcgccggc
180gaccagatcg aagtggtggc caatgccgag gagttgggcc cgctgaataa taacgtctcc
240agcatccgcg tcatctccgt gcccgtgcag ccgcgcatgg caaatattac cgttttctat
300aacgaagact tccagggtaa gcaggtcgat ctgccgcctg gcaactatac ccgcgcccag
360ttggcggcgc tgggcatcga gaataatacc atcagctcgg tgaaggtgcc gcctggcgtg
420aaggctatcc tctaccagaa cgatggtttc gccggcgacc agatcgaagt ggtggccaat
480gccgaggagc tgggtccgct gaataataac gtctccagca tccgcgtcat ctccgtgccg
540gtgcagccga gg
552806297DNAArtificial SequencecDNA Sequence of SDB 806atggcagaac
aaagcgacaa ggatgtgaag tactacactc tggaggagat tcagaagcac 60aaagacagca
agagcacctg ggtgatccta catcataagg tgtacgatct gaccaagttt 120ctcgaagagc
atcctggtgg ggaagaagtc ctgggcgagc aagctggggg tgatgctact 180gagaactttg
aggacgtcgg gcactctacg gatgcacgag aactgtccaa aacatacatc 240atcggggagc
tccatccaga tgacagatca aagatagcca agccttcgga aaccctt
297807327DNAArtificial SequencecDNA Sequence of SDC 807atgagcgata
aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60gacggggcga
tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120ccgattctgg
atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180atcgatcaaa
accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240ctgttcaaaa
acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300aaagagttcc
tcgacgctaa cctggcc
327808624DNAArtificial SequencecDNA Sequence of SDD 808atgaaaaaga
tttggctggc gctggctggt ttagttttag cgtttagcgc atcggcggcg 60cagtatgaag
atggtaaaca gtacactacc ctggaaaaac cggtagctgg cgcgccgcaa 120gtgctggagt
ttttctcttt cttctgcccg cactgctatc agtttgaaga agttctgcat 180atttctgata
atgtgaagaa aaaactgccg gaaggcgtga agatgactaa ataccacgtc 240aacttcatgg
gtggtgacct gggcaaagat ctgactcagg catgggctgt ggcgatggcg 300ctgggcgtgg
aagacaaagt gactgttccg ctgtttgaag gcgtacagaa aacccagacc 360attcgttctg
cttctgatat ccgcgatgta tttatcaacg caggtattaa aggtgaagag 420tacgacgcgg
cgtggaacag cttcgtggtg aaatctctgg tcgctcagca ggaaaaagct 480gcagctgacg
tgcaattgcg tggcgttccg gcgatgtttg ttaacggtaa atatcagctg 540aatccgcagg
gtatggatac cagcaatatg gatgtttttg ttcagcagta tgctgataca 600gtgaaatatc
tgtccgagaa aaaa
624809300DNAArtificial SequencecDNA Sequence of SDE 809gggtccctgc
aggactcaga agtcaatcaa gaagctaagc cagaggtcaa gccagaagtc 60aagcctgaga
ctcacatcaa tttaaaggtg tccgatggat cttcagagat cttcttcaag 120atcaaaaaga
ccactccttt aagaaggctg atggaagcgt tcgctaaaag acagggtaag 180gaaatggact
ccttaacgtt cttgtacgac ggtattgaaa ttcaagctga tcagacccct 240gaagatttgg
acatggagga taacgatatt attgaggctc accgcgaaca gattggaggt
300810891DNAArtificial SequencecDNA Sequence of SDF 810ggatccgaaa
tcggtactgg ctttccattc gacccccatt atgtggaagt cctgggcgag 60cgcatgcact
acgtcgatgt tggtccgcgc gatggcaccc ctgtgctgtt cctgcacggt 120aacccgacct
cctcctacgt gtggcgcaac atcatcccgc atgttgcacc gacccatcgc 180tgcattgctc
cagacctgat cggtatgggc aaatccgaca aaccagacct gggttatttc 240ttcgacgacc
acgtccgctt catggatgcc ttcatcgaag ccctgggtct ggaagaggtc 300gtcctggtca
ttcacgactg gggctccgct ctgggtttcc actgggccaa gcgcaatcca 360gagcgcgtca
aaggtattgc atttatggag ttcatccgcc ctatcccgac ctgggacgaa 420tggccagaat
ttgcccgcga gaccttccag gccttccgca ccaccgacgt cggccgcaag 480ctgatcatcg
atcagaacgt ttttatcgag ggtacgctgc cgatgggtgt cgtccgcccg 540ctgactgaag
tcgagatgga ccattaccgc gagccgttcc tgaatcctgt tgaccgcgag 600ccactgtggc
gcttcccaaa cgagctgcca atcgccggtg agccagcgaa catcgtcgcg 660ctggtcgaag
aatacatgga ctggctgcac cagtcccctg tcccgaagct gctgttctgg 720ggcaccccag
gcgttctgat cccaccggcc gaagccgctc gcctggccaa aagcctgcct 780aactgcaagg
ctgtggacat cggcccgggt ctgaatctgc tgcaagaaga caacccggac 840ctgatcggca
gcgagatcgc gcgctggctg tctactctgg agatttccgg t
891811297DNAArtificial SequencecDNA Sequence of SDB' for deimunization
811atggcagaac aaagcgacaa ggatgtgaag tactacactc tggaggagat tcagaagcac
60aaagacagca agagcacctg gctgatccta catcataagg tgtacgatct gaccaagttt
120ctcgaagagc atcctggtgg ggaagaagtc ctgggcgagc aagctggggg tgatgctact
180gagaactttg aggacgtcgg gcactctacg gatgcacgag aactgtccaa aacatacatc
240atcggggagc tccatccaga tgacagatca aagatagcca agccttcgga aaccctt
29781219PRTArtificial SequenceAmino acid Sequence of Histidine Tag 812Met
Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro1
5 10 15 Arg Gly Ser81357DNAArtificial
SequencecDNA Sequence of Histidine Tag 813atgggcagca gccatcatca
tcatcatcac agcagcggcc tggtgccgcg cggcagc 57814225PRTArtificial
SequenceAmino Acid Sequence of Human SOCS3 814Met Val Thr His Ser Lys Phe
Pro Ala Ala Gly Met Ser Arg Pro Leu1 5 10
15 Asp Thr Ser Leu Arg Leu Lys Thr Phe Ser Ser Lys Ser
Glu Tyr Gln 20 25 30 Leu Val
Val Asn Ala Val Arg Lys Leu Gln Glu Ser Gly Phe Tyr Trp 35
40 45 Ser Ala Val Thr Gly Gly Glu Ala Asn Leu
Leu Leu Ser Ala Glu Pro 50 55 60 Ala
Gly Thr Phe Leu Ile Arg Asp Ser Ser Asp Gln Arg His Phe Phe65
70 75 80 Thr Leu Ser Val Lys Thr
Gln Ser Gly Thr Lys Asn Leu Arg Ile Gln 85
90 95 Cys Glu Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro
Arg Ser Thr Gln 100 105 110
Pro Val Pro Arg Phe Asp Cys Val Leu Lys Leu Val His His Tyr Met
115 120 125 Pro Pro Pro Gly Ala Pro Ser
Phe Pro Ser Pro Pro Thr Glu Pro Ser 130 135
140 Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu Pro Gly Ser
Pro145 150 155 160 Pro
Arg Arg Ala Tyr Tyr Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu
165 170 175 Val Leu Ser Arg Pro Leu Ser
Ser Asn Val Ala Thr Leu Gln His Leu 180 185
190 Cys Arg Lys Thr Val Asn Gly His Leu Asp Ser Tyr Glu Lys
Val Thr 195 200 205 Gln Leu Pro
Gly Pro Ile Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro 210
215 220 Leu225815675DNAArtificial SequencecDNA Sequences
of Human SOCS3 815atggtcaccc acagcaagtt tcccgccgcc gggatgagcc gccccctgga
caccagcctg 60cgcctcaaga ccttcagctc caagagcgag taccagctgg tggtgaacgc
agtgcgcaag 120ctgcaggaga gcggcttcta ctggagcgca gtgaccggcg gcgaggcgaa
cctgctgctc 180agtgccgagc ccgccggcac ctttctgatc cgcgacagct cggaccagcg
ccacttcttc 240acgctcagcg tcaagaccca gtctgggacc aagaacctgc gcatccagtg
tgaggggggc 300agcttctctc tgcagagcga tccccggagc acgcagcccg tgccccgctt
cgactgcgtg 360ctcaagctgg tgcaccacta catgccgccc cctggagccc cctccttccc
ctcgccacct 420actgaaccct cctccgaggt gcccgagcag ccgtctgccc agccactccc
tgggagtccc 480cccagaagag cctattacat ctactccggg ggcgagaaga tccccctggt
gttgagccgg 540cccctctcct ccaacgtggc cactcttcag catctctgtc ggaagaccgt
caacggccac 600ctggactcct atgagaaagt cacccagctg ccggggccca ttcgggagtt
cctggaccag 660tacgatgccc cgctt
67581625DNAArtificial SequenceUnmethyl-F primer 816tagtgtgtaa
gttgtaggag agtgg
2581730DNAArtificial SequenceUnmethyl-R primer 817ctaaacataa aaaaataaca
ctaatccaaa 3081824DNAArtificial
SequenceMethyl-F primer 818gtagtgcgta agttgtagga gagc
2481924DNAArtificial SequenceMethyl-R primer
819gtaaaaaaat aacgctaatc cgaa
2482020DNAArtificial SequenceSOCS3 primer F 820cctactgaac cctcctccga
2082120DNAArtificial
SequenceSOCS3 primer R 821gcagctgggt gactttctca
2082212PRTArtificial SequenceAmino acid Sequence of
aMTD662 822Ala Leu Ala Val Ile Leu Ala Pro Val Ala Val Pro1
5 10 82336DNAArtificial SequencecDNA Sequence of
aMTD662 823gcgctggcgg tgattctggc gccggtggcg gtgccg
368241005DNAArtificial SequencecDNA sequence of E.coli codon usage
optimized M165S3B' 824gcgctggcgg tgccggttgc gctggcgatc gtgccggtta
cccacagcaa gtttccggcg 60gcgggtatga gccgtccgct ggacaccagc ctgcgtctga
agacctttag cagcaaaagc 120gagtaccagc tggttgtgaa cgcggtgcgt aaactgcaag
aaagcggctt ctattggagc 180gcggttaccg gtggcgaggc gaacctgctg ctgagcgcgg
agccggcggg caccttcctg 240atccgtgaca gcagcgatca gcgtcacttc tttaccctga
gcgttaagac ccagagcggc 300accaaaaacc tgcgtattca atgcgagggt ggcagcttca
gcctgcaaag cgacccgcgt 360agcacccaac cggtgccgcg ttttgattgc gtgctgaagc
tggttcacca ctacatgccg 420ccgccgggtg cgccgagctt cccgagcccg ccgaccgagc
cgagcagcga ggttccggaa 480cagccgagcg cgcaaccgct gccgggtagc ccgccgcgtc
gtgcgtacta tatctatagc 540ggtggcgaaa aaattccgct ggtgctgagc cgtccgctga
gcagcaacgt tgcgaccctg 600caacacctgt gccgtaagac cgtgaacggt cacctggaca
gctacgagaa agttacccaa 660ctgccgggcc cgatccgtga atttctggac cagtatgatg
cgccgctgat ggcggaacaa 720agcgacaagg atgtgaaata ctataccctg gaggaaatcc
agaagcacaa agacagcaag 780agcacctggc tgattctgca ccacaaggtg tacgatctga
ccaaattcct ggaggaacat 840ccgggtggtg aggaagtgct gggcgagcaa gcgggtggcg
atgcgaccga gaactttgaa 900gacgtgggcc acagcaccga tgcgcgtgag ctgagcaaaa
cctatatcat tggtgaactg 960cacccggacg atcgtagcaa gattgcgaaa ccgagcgaaa
ccctg 1005825335PRTArtificial SequenceAmino acid
sequence of E.coli codon usage optimized M165S3B' 825Ala Leu Ala Val
Pro Val Ala Leu Ala Ile Val Pro Val Thr His Ser1 5
10 15 Lys Phe Pro Ala Ala Gly Met Ser Arg Pro
Leu Asp Thr Ser Leu Arg 20 25
30 Leu Lys Thr Phe Ser Ser Lys Ser Glu Tyr Gln Leu Val Val Asn Ala
35 40 45 Val Arg Lys Leu Gln Glu Ser
Gly Phe Tyr Trp Ser Ala Val Thr Gly 50 55
60 Gly Glu Ala Asn Leu Leu Leu Ser Ala Glu Pro Ala Gly Thr Phe Leu65
70 75 80 Ile Arg Asp
Ser Ser Asp Gln Arg His Phe Phe Thr Leu Ser Val Lys 85
90 95 Thr Gln Ser Gly Thr Lys Asn Leu Arg
Ile Gln Cys Glu Gly Gly Ser 100 105
110 Phe Ser Leu Gln Ser Asp Pro Arg Ser Thr Gln Pro Val Pro Arg Phe
115 120 125 Asp Cys Val Leu Lys Leu
Val His His Tyr Met Pro Pro Pro Gly Ala 130 135
140 Pro Ser Phe Pro Ser Pro Pro Thr Glu Pro Ser Ser Glu Val Pro
Glu145 150 155 160 Gln
Pro Ser Ala Gln Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr
165 170 175 Tyr Ile Tyr Ser Gly Gly Glu
Lys Ile Pro Leu Val Leu Ser Arg Pro 180 185
190 Leu Ser Ser Asn Val Ala Thr Leu Gln His Leu Cys Arg Lys
Thr Val 195 200 205 Asn Gly His
Leu Asp Ser Tyr Glu Lys Val Thr Gln Leu Pro Gly Pro 210
215 220 Ile Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu
Met Ala Glu Gln225 230 235
240 Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu Glu Ile Gln Lys His
245 250 255 Lys Asp Ser Lys Ser
Thr Trp Leu Ile Leu His His Lys Val Tyr Asp 260
265 270 Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu
Glu Val Leu Gly 275 280 285 Glu
Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe Glu Asp Val Gly His 290
295 300 Ser Thr Asp Ala Arg Glu Leu Ser Lys Thr
Tyr Ile Ile Gly Glu Leu305 310 315
320 His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro Ser Glu Thr Leu
325 330
3358261074DNAArtificial SequencecDNA sequence of HM165S3B 826atgggcagca
gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60atggcgctgg
cggtgccggt ggcgctggcg attgtgccgg tcacccacag caagtttccc 120gccgccggga
tgagccgccc cctggacacc agcctgcgcc tcaagacctt cagctccaag 180agcgagtacc
agctggtggt gaacgcagtg cgcaagctgc aggagagcgg cttctactgg 240agcgcagtga
ccggcggcga ggcgaacctg ctgctcagtg ccgagcccgc cggcaccttt 300ctgatccgcg
acagctcgga ccagcgccac ttcttcacgc tcagcgtcaa gacccagtct 360gggaccaaga
acctgcgcat ccagtgtgag gggggcagct tctctctgca gagcgatccc 420cggagcacgc
agcccgtgcc ccgcttcgac tgcgtgctca agctggtgca ccactacatg 480ccgccccctg
gagccccctc cttcccctcg ccacctactg aaccctcctc cgaggtgccc 540gagcagccgt
ctgcccagcc actccctggg agtcccccca gaagagccta ttacatctac 600tccgggggcg
agaagatccc cctggtgttg agccggcccc tctcctccaa cgtggccact 660cttcagcatc
tctgtcggaa gaccgtcaac ggccacctgg actcctatga gaaagtcacc 720cagctgccgg
ggcccattcg ggagttcctg gaccagtacg atgccccgct tggatccatg 780gcagaacaaa
gcgacaagga tgtgaagtac tacactctgg aggagattca gaagcacaaa 840gacagcaaga
gcacctgggt gatcctacat cataaggtgt acgatctgac caagtttctc 900gaagagcatc
ctggtgggga agaagtcctg ggcgagcaag ctgggggtga tgctactgag 960aactttgagg
acgtcgggca ctctacggat gcacgagaac tgtccaaaac atacatcatc 1020ggggagctcc
atccagatga cagatcaaag atagccaagc cttcggaaac cctt
1074827362PRTArtificial SequenceAmino acid sequence of HM165S3B 827Met
Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro1
5 10 15 Arg Gly Ser His Met Ala Leu
Ala Val Pro Val Ala Leu Ala Ile Val 20 25
30 Pro Val Thr His Ser Lys Phe Pro Ala Ala Gly Met Glu Thr
Ser Arg 35 40 45 Pro Leu Asp Thr
Ser Leu Arg Leu Lys Thr Phe Ser Ser Lys Ser Glu 50 55
60 Tyr Gln Leu Val Val Asn Ala Val Arg Lys Leu Gln Glu
Ser Gly Phe65 70 75 80
Tyr Trp Ser Ala Val Thr Gly Gly Glu Ala Asn Leu Leu Leu Ser Ala
85 90 95 Glu Pro Ala Gly Thr Phe
Leu Ile Arg Asp Ser Ser Asp Gln Arg His 100
105 110 Phe Phe Thr Leu Ser Val Lys Thr Gln Ser Gly Thr
Lys Asn Leu Arg 115 120 125 Ile
Gln Cys Glu Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser 130
135 140 Thr Gln Pro Val Pro Arg Phe Asp Cys Val
Leu Lys Leu Val His His145 150 155
160 Tyr Met Glu Thr Pro Pro Pro Gly Ala Pro Ser Phe Pro Ser Pro
Pro 165 170 175 Thr Glu
Pro Ser Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu 180
185 190 Pro Gly Ser Pro Pro Arg Arg Ala Tyr
Tyr Ile Tyr Ser Gly Gly Glu 195 200
205 Lys Ile Pro Leu Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala Thr
210 215 220 Leu Gln His Leu Cys Arg Lys
Thr Val Asn Gly His Leu Asp Ser Tyr225 230
235 240 Glu Lys Val Thr Gln Leu Pro Gly Pro Ile Arg Glu
Phe Leu Asp Gln 245 250
255 Tyr Asp Ala Pro Leu Gly Ser Met Ala Glu Gln Ser Asp Lys Asp Val
260 265 270 Lys Tyr Tyr Thr Leu Glu
Glu Ile Gln Lys His Lys Asp Ser Lys Ser 275 280
285 Thr Trp Val Ile Leu His His Lys Val Tyr Asp Leu Thr Lys
Phe Leu 290 295 300 Glu Glu His Pro
Gly Gly Glu Glu Val Leu Gly Glu Gln Ala Gly Gly305 310
315 320 Asp Ala Thr Glu Asn Phe Glu Asp Val
Gly His Ser Thr Asp Ala Arg 325 330
335 Glu Leu Ser Lys Thr Tyr Ile Ile Gly Glu Leu His Pro Asp Asp
Arg 340 345 350 Ser Lys Ile
Ala Lys Pro Ser Glu Thr Leu 355 360
8281014DNAArtificial SequencecDNA sequence of BS3M165 828atgatggcag
aacaaagcga caaggatgtg aagtactaca ctctggagga gattcagaag 60cacaaagaca
gcaagagcac ctgggtgatc ctacatcata aggtgtacga tctgaccaag 120tttctcgaag
agcatcctgg tggggaagaa gtcctgggcg agcaagctgg gggtgatgct 180actgagaact
ttgaggacgt cgggcactct acggatgcac gagaactgtc caaaacatac 240atcatcgggg
agctccatcc agatgacaga tcaaagatag ccaagccttc ggaaaccctt 300ggatccgtca
cccacagcaa gtttcccgcc gccgggatga gccgccccct ggacaccagc 360ctgcgcctca
agaccttcag ctccaagagc gagtaccagc tggtggtgaa cgcagtgcgc 420aagctgcagg
agagcggctt ctactggagc gcagtgaccg gcggcgaggc gaacctgctg 480ctcagtgccg
agcccgccgg cacctttctg atccgcgaca gctcggacca gcgccacttc 540ttcacgctca
gcgtcaagac ccagtctggg accaagaacc tgcgcatcca gtgtgagggg 600ggcagcttct
ctctgcagag cgatccccgg agcacgcagc ccgtgccccg cttcgactgc 660gtgctcaagc
tggtgcacca ctacatgccg ccccctggag ccccctcctt cccctcgcca 720cctactgaac
cctcctccga ggtgcccgag cagccgtctg cccagccact ccctgggagt 780ccccccagaa
gagcctatta catctactcc gggggcgaga agatccccct ggtgttgagc 840cggcccctct
cctccaacgt ggccactctt cagcatctct gtcggaagac cgtcaacggc 900cacctggact
cctatgagaa agtcacccag ctgccggggc ccattcggga gttcctggac 960cagtacgatg
ccccgcttcc ggtgattgcg ctggcggtgc cggtggcgct ggcg
1014829342PRTArtificial SequenceAmino acid sequence of BS3M165 829Met Met
Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu1 5
10 15 Glu Ile Gln Lys His Lys Asp Ser
Lys Ser Thr Trp Val Ile Leu His 20 25
30 His Lys Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His Pro Gly
Gly 35 40 45 Glu Glu Val Leu Gly
Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe 50 55
60 Glu Asp Val Gly His Ser Thr Asp Ala Arg Glu Leu Ser Lys
Thr Tyr65 70 75 80 Ile
Ile Gly Glu Leu His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro
85 90 95 Ser Glu Thr Leu Gly Ser Val
Thr His Ser Lys Phe Pro Ala Ala Gly 100 105
110 Met Glu Thr Ser Arg Pro Leu Asp Thr Ser Leu Arg Leu Lys
Thr Phe 115 120 125 Ser Ser Lys
Ser Glu Tyr Gln Leu Val Val Asn Ala Val Arg Lys Leu 130
135 140 Gln Glu Ser Gly Phe Tyr Trp Ser Ala Val Thr Gly
Gly Glu Ala Asn145 150 155
160 Leu Leu Leu Ser Ala Glu Pro Ala Gly Thr Phe Leu Ile Arg Asp Ser
165 170 175 Ser Asp Gln Arg His
Phe Phe Thr Leu Ser Val Lys Thr Gln Ser Gly 180
185 190 Thr Lys Asn Leu Arg Ile Gln Cys Glu Gly Gly Ser
Phe Ser Leu Gln 195 200 205 Ser
Asp Pro Arg Ser Thr Gln Pro Val Pro Arg Phe Asp Cys Val Leu 210
215 220 Lys Leu Val His His Tyr Met Glu Thr Pro
Pro Pro Gly Ala Pro Ser225 230 235
240 Phe Pro Ser Pro Pro Thr Glu Pro Ser Ser Glu Val Pro Glu Gln
Pro 245 250 255 Ser Ala
Gln Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr Tyr Ile 260
265 270 Tyr Ser Gly Gly Glu Lys Ile Pro Leu
Val Leu Ser Arg Pro Leu Ser 275 280
285 Ser Asn Val Ala Thr Leu Gln His Leu Cys Arg Lys Thr Val Asn Gly
290 295 300 His Leu Asp Ser Tyr Glu Lys
Val Thr Gln Leu Pro Gly Pro Ile Arg305 310
315 320 Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu Pro Val
Ile Ala Leu Ala 325 330
335 Val Pro Val Ala Leu Ala 340 8301014DNAArtificial
SequencecDNA sequence of B'S3M165 830atgatggcag aacaaagcga caaggatgtg
aagtactaca ctctggagga gattcagaag 60cacaaagaca gcaagagcac ctggctgatc
ctacatcata aggtgtacga tctgaccaag 120tttctcgaag agcatcctgg tggggaagaa
gtcctgggcg agcaagctgg gggtgatgct 180actgagaact ttgaggacgt cgggcactct
acggatgcac gagaactgtc caaaacatac 240atcatcgggg agctccatcc agatgacaga
tcaaagatag ccaagccttc ggaaaccctt 300ggatccgtca cccacagcaa gtttcccgcc
gccgggatga gccgccccct ggacaccagc 360ctgcgcctca agaccttcag ctccaagagc
gagtaccagc tggtggtgaa cgcagtgcgc 420aagctgcagg agagcggctt ctactggagc
gcagtgaccg gcggcgaggc gaacctgctg 480ctcagtgccg agcccgccgg cacctttctg
atccgcgaca gctcggacca gcgccacttc 540ttcacgctca gcgtcaagac ccagtctggg
accaagaacc tgcgcatcca gtgtgagggg 600ggcagcttct ctctgcagag cgatccccgg
agcacgcagc ccgtgccccg cttcgactgc 660gtgctcaagc tggtgcacca ctacatgccg
ccccctggag ccccctcctt cccctcgcca 720cctactgaac cctcctccga ggtgcccgag
cagccgtctg cccagccact ccctgggagt 780ccccccagaa gagcctatta catctactcc
gggggcgaga agatccccct ggtgttgagc 840cggcccctct cctccaacgt ggccactctt
cagcatctct gtcggaagac cgtcaacggc 900cacctggact cctatgagaa agtcacccag
ctgccggggc ccattcggga gttcctggac 960cagtacgatg ccccgcttcc ggtgattgcg
ctggcggtgc cggtggcgct ggcg 1014831342PRTArtificial SequenceAmino
acid sequence of B'S3M165 831Met Met Ala Glu Gln Ser Asp Lys Asp Val Lys
Tyr Tyr Thr Leu Glu1 5 10
15 Glu Ile Gln Lys His Lys Asp Ser Lys Ser Thr Trp Leu Ile Leu His
20 25 30 His Lys Val Tyr Asp Leu
Thr Lys Phe Leu Glu Glu His Pro Gly Gly 35 40
45 Glu Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu
Asn Phe 50 55 60 Glu Asp Val Gly His
Ser Thr Asp Ala Arg Glu Leu Ser Lys Thr Tyr65 70
75 80 Ile Ile Gly Glu Leu His Pro Asp Asp Arg
Ser Lys Ile Ala Lys Pro 85 90
95 Ser Glu Thr Leu Gly Ser Val Thr His Ser Lys Phe Pro Ala Ala Gly
100 105 110 Met Glu Thr Ser Arg
Pro Leu Asp Thr Ser Leu Arg Leu Lys Thr Phe 115
120 125 Ser Ser Lys Ser Glu Tyr Gln Leu Val Val Asn Ala
Val Arg Lys Leu 130 135 140 Gln Glu
Ser Gly Phe Tyr Trp Ser Ala Val Thr Gly Gly Glu Ala Asn145
150 155 160 Leu Leu Leu Ser Ala Glu Pro
Ala Gly Thr Phe Leu Ile Arg Asp Ser 165
170 175 Ser Asp Gln Arg His Phe Phe Thr Leu Ser Val Lys
Thr Gln Ser Gly 180 185 190
Thr Lys Asn Leu Arg Ile Gln Cys Glu Gly Gly Ser Phe Ser Leu Gln
195 200 205 Ser Asp Pro Arg Ser Thr Gln
Pro Val Pro Arg Phe Asp Cys Val Leu 210 215
220 Lys Leu Val His His Tyr Met Glu Thr Pro Pro Pro Gly Ala Pro
Ser225 230 235 240 Phe
Pro Ser Pro Pro Thr Glu Pro Ser Ser Glu Val Pro Glu Gln Pro
245 250 255 Ser Ala Gln Pro Leu Pro Gly
Ser Pro Pro Arg Arg Ala Tyr Tyr Ile 260 265
270 Tyr Ser Gly Gly Glu Lys Ile Pro Leu Val Leu Ser Arg Pro
Leu Ser 275 280 285 Ser Asn Val
Ala Thr Leu Gln His Leu Cys Arg Lys Thr Val Asn Gly 290
295 300 His Leu Asp Ser Tyr Glu Lys Val Thr Gln Leu Pro
Gly Pro Ile Arg305 310 315
320 Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu Pro Val Ile Ala Leu Ala
325 330 335 Val Pro Val Ala Leu
Ala 340 83211PRTArtificial SequenceAmino acid sequence
of TAT 832Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg1 5
10 83333DNAArtificial SequenceNucleotide sequence of
TAT 833tatggccgca aaaaacgccg ccagcgccgc cgc
338349PRTArtificial SequenceAmino acid sequence of PolyR 834Arg Arg
Arg Arg Arg Arg Arg Arg Arg1 5
83527PRTArtificial SequenceNucleotide sequence of PolyR 835Cys Gly Thr
Cys Gly Thr Cys Gly Thr Cys Gly Thr Cys Gly Thr Cys1 5
10 15 Gly Thr Cys Gly Thr Cys Gly Thr Cys
Gly Thr 20 25 83673DNAArtificial
Sequence5' primer for TAT 836ggaattccat atgtatggcc gcaaaaaacg ccgccagcgc
cgccgcgtca cccacagcaa 60gtttcccgcc gcc
7383767DNAArtificial Sequence5' primer for PolyR
837ggaattccat atgcgtcgtc gtcgtcgtcg tcgtcgtcgt gtcacccaca gcaagtttcc
60cgccgcc
6783839DNAArtificial Sequence3' primer for TAT and PolyR 838cgcgtcgact
taaagggttt ccgaaggctt ggctatctt 39
User Contributions:
Comment about this patent or add new information about this topic: