Patent application title: Compositions Comprising Boosting Polypeptide And Starch Degrading Enzyme And Uses Thereof
Inventors:
Martin Borchert (Alleroed, DK)
Martin Borchert (Alleroed, DK)
Peter Fischer Hallin (Holte, DK)
Ming Li (Beijing, CN)
Ming Li (Beijing, CN)
Assignees:
Novozymes A/S
IPC8 Class: AC12N924FI
USPC Class:
435162
Class name: Acyclic ethanol multiple stages of fermentation; multiple types of micro-organisms or reuse of micro-organisms
Publication date: 2012-10-04
Patent application number: 20120252086
Abstract:
The present invention provides a composition comprising a polypeptide
comprising or consisting of an X46 domain and further a starch degrading
enzyme and uses of such composition. The polypeptide comprising or
consisting of an X46 domain can boost the activity of a starch-degrading
enzyme.Claims:
1-14. (canceled)
15. A composition comprising a polypeptide comprising or consisting of an X46 domain and a starch-degrading enzyme.
16. The composition of claim 15, wherein the polypeptide has at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
17. The composition of claim 15, wherein the polypeptide has at least 70% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
18. The composition of claim 15, wherein the polypeptide has at least 80% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
19. The composition of claim 15, wherein the polypeptide has at least 90% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
20. The composition of claim 15, wherein the polypeptide has at least 95% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
20. The composition of claim 15, wherein the polypeptide comprises any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
21. The composition of claim 15, wherein the starch-degrading enzyme(s) is(are) selected from the group consisting of alpha-amylases, beta-amylases, CGTases, glucoamylases, isoamylases, amylopullulanases, and pullulanases.
22. The composition of claim 15, wherein the X46 domain containing polypeptide does not have any starch-degrading activity.
23. A polypeptide consisting of an X46 domain having at least 60% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
24. The polypeptide of claim 23, wherein the X46 domain has at least 70% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
25. The polypeptide of claim 23, wherein the X46 domain has at least 80% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
26. The polypeptide of claim 23, wherein the X46 domain has at least 90% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
27. The polypeptide of claim 23, wherein the X46 domain has at least 95% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
28. A process for producing a fermentation product comprising the steps of: (a) liquefying a starch-containing material in the presence of a composition of claim 15; (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme; and (c) fermenting using a fermenting organism.
29. The process of claim 28, wherein the starch-degrading enzyme is an alpha-amylase.
30. An isolated polynucleotide encoding an X46 domain of claim 19 selected from the consisting of: (a) a polynucleotide having at least 60% identity with the X46 domain coding part shown in SEQ ID NO: 84, 86 or 88 or a complementary strand thereof; and ii) a polynucleotide which hybridizes under low stringency with the X46 domain coding part of SEQ ID NO: 84, 86 or 88 or a complementary strand thereof.
31. A nucleic acid construct comprising the polynucleotide of claim 30 operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host.
32. A recombinant expression vector comprising the nucleic acid construct of claim 31.
33. A recombinant host cell comprising the nucleic acid construct of claim 31.
34. A method for producing an X46 domain comprising (a) cultivating the recombinant host cell of claim 33 under conditions conducive for production of an X46 domain; and (b) recovering the X46 domain.
Description:
REFERENCE TO SEQUENCE LISTING
[0001] This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions comprising a starch degrading enzyme activity boosting polypeptide and further a starch-degrading enzyme. The invention also relates to boosting polypeptides, polynucleotides encoding boosting polypeptides, nucleic acid constructs comprising the polynucleotides, recombinant expression vectors comprising the nucleic acid construct, recombinant host cell comprising the nucleic acid construct or the vector, methods for producing the boosting polypeptides and the use of compositions of the invention for starch convention processes include processes for producing a fermentation product, such as especially ethanol.
BACKGROUND OF THE INVENTION
[0003] Starch can be hydrolyzed into simpler carbohydrates by acids, various enzymes, or a combination thereof. The primary enzymes used to hydrolyze starch into simpler carbohydrates are endoamylases, exoamylases, and debranching enzymes, which hydrolyze amylose and amylopectin. Amylose is hydrolyzed mainly by amylases, while amylopectin also requires debranching enzymes such as pullulanases (E.C. 3.2.1.41) for complete hydrolysis. The endoamylases, the most common being alpha-amylases (E.C. 3.2.1.1), are specific for alpha-1,4-linkages of amylose and amylopectin. Exoamylases have the ability to hydrolyze both alpha-1,4-linkages and alpha-1,6-linkages of amylose and amylopectin. A common example is amyloglucosidase (often referred to as glucoamylase) (E.C. 3.2.1.20). Beta-amylase is an enzyme that has the ability to hydrolyze the alpha-1,4-linkages of amylose. Debranching enzymes, e.g., pullulanases, hydrolyze alpha-1,6-linkages in amylopectin. Hydrolysis products of debranching enzymes are mainly maltotriose and maltose.
[0004] It would be advantageous to boost the enzymatic activity of starch-degrading enzymes and to improve conversion of starch-containing materials into sugars, especially fermentable sugars that can be converted to fermentation products, such as ethanol.
SUMMARY OF THE INVENTION
[0005] The present invention provides compositions comprising a starch-degrading enzyme activity boosting polypeptide and a starch-degrading activity. A composition of the invention results in increased starch degrading activity compared to the same composition without a starch-degrading activity boosting polypeptide. A composition of the invention comprises at least two components, a boosting polypeptide and a starch-degrading enzyme. However, it should be understood that the composition may comprise more than one of each components.
[0006] In the first aspect the invention relates to compositions comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme.
[0007] The polypeptide comprising or consisting of an X46 domain may in an embodiment not have starch-degrading activity by itself. In another embodiment the polypeptide comprising an X46 domain also has starch-degrading activity, as will be described further below. In a preferred embodiment the X46 domain comprising polypeptide has pullulanase, amylopullulanase and/or amylase, such as alpha-amylase activity.
[0008] In an embodiment the polypeptide comprising or consisting of an X46 domain is selected from the group of:
[0009] i) a polypeptide comprising or consisting of the amino acid sequence shown in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or
[0010] ii) an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or
[0011] iii) a polypeptide determined by Hidden Markov Model (HMM) using SEQ ID NOS: 7-81, 85, 87 and 89 having a HMM score of at least 150;
[0012] iv) a variant thereof (i.e., of i), ii) or iii)) comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
[0013] In another embodiment the invention relates to a process for producing a fermentation product, especially ethanol, from starch-containing material comprising the steps of:
[0014] (a) liquefying starch-containing material in the presence of a composition of the invention and optionally an alpha-amylase;
[0015] (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme;
[0016] (c) fermenting using a fermenting organism.
[0017] The invention also relates to polypeptides consisting of an X46 domain. In an embodiment the polypeptide consisting of an X46 domain does not have starch-degrading activity.
[0018] The invention also relates to an isolated polynucleotide encoding an X46 domain of the invention as well as a nucleic acid construct comprising the polynucleotide of the invention operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host. The invention also relates to a recombinant expression vector comprising the nucleic acid construct of the invention and a recombinant host cell comprising the nucleic acid construct of the invention or the vector of the invention. The invention furthermore relates to a method for producing a polypeptide consisting of an X46 domain comprising (a) cultivating the recombinant host cell of the invention under conditions conducive for production of an X46 domain; and (b) recovering the X46 domain.
[0019] Finally the invention relates to the use of a composition of the invention in a process of producing sweeteners from starch or in a process of producing a fermentation product, such as ethanol, from gelatinized.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 shows Appendix A listing X46 domains identified by Hidden Markov Models (HMM)
[0021] FIG. 2 shows Appendix C which displays a multiple alignment of X46 domains.
[0022] For instance SWISSPROT:CIQSR8:898..1122/1-225 indicates that the sequences is from Swissprot, database, has identification number "C1QSR8", the X46 domain is located from amino acid 898 to 1122 and is 225 amino acids long.
[0023] FIG. 3 shows Appendix D showing that the DUF2223 domain consists of 16 seed sequences in the current release of Pfam (version 24.0, October 2009). Appendix D displays a multiple alignment of DUF2223 domain (or X46 domain) sequences.
DETAILED DESCRIPTION OF THE INVENTION
[0024] The present invention relates to compositions comprising a polypeptide that boosts the enzymatic activity of starch-degrading enzymes. The invention also relates to processes of converting starch-containing materials into sugars and/or fermentation product, such as especially ethanol.
[0025] The inventors have identified an uncharacterized polypeptide located upstream of the amylopullulanase gene Apu from Dictyoglomus thermophilum DSM 3960 (Uniprot: quadrature9Y818). The translated product of SEQ ID:1 is SEQ ID:2 (Uniprot: B5YCY6) and was identified to have a domain DUF2223 according to the Pfam nomenclature. The inventors found that a composition comprising a polypeptide including an X46 domain boosts the starch hydrolyzing activity of starch-degrading enzymes. For instance, the inventors found that when incubating a polypeptide comprising an X46 domain (SEQ ID NO: 89) from Dictyoglomus thermophilum pullulanase shown in SEQ ID NO: 6 the pullulanase activity was boosted even though the X46 domain did not have pullulanase activity on its own. The Thermococcus litoralis/Thermococcus hydrothermalis X4 chimer pullulanase (SEQ ID NO: 83) has been shown to produce an increase in ethanol yield of +0.6 g/L (versus control) at pH 5.0 using LIQUEZYME® SC DS (i.e., commercial Bacillus stearothermophilus alpha-amylase variant from Novozymes). Mash treated with an X46 domain containing polypeptide alone produced +0.9 g/L more ethanol than the control. When tested in combination with the X46 domain containing polypeptide (SEQ ID NO: 89), it boosted ethanol yield by +1.2 g/L relative to the control. The inventors also found an activity boosting effect to an alpha-amylase. Specifically the inventors found that the Subulispora sp (AM3162-P8GR) alpha-amylase disclosed in WO 2009/140504 boosted the ethanol yield as can also be seen in the Examples.
Composition of the Invention
[0026] In the first aspect the invention relates to compositions comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme. A composition of the invention results in increased (i.e., boosted) starch-degrading activity compared to a corresponding composition without said polypeptide comprising or consisting of an X46 domain. In an embodiment the polypeptide comprising or consisting of an X46 domain increases (i.e., boosts) the activity of pullulanases, preferably pullulanases of type I of Family GH13 and/or amylopullulanases of type II of Family GH57. In a preferred embodiment said pullulanase (EC.3.2.1.41) of type I of Family GH13, is a pullulanase derived from a strain of Bacillus, such as a strain of the species Bacillus deramificans, in particular the pullulanase shown in SEQ ID NO: 2 in WO 00/01796 or a strain of the pullulanase of the species Bacillus acidopullulyticus, in particular the pullulanase shown in SEQ ID NO: 1 in WO 00/01796 (which are hereby incorporated by reference). The X46 domain may also be derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum; a strain of Pyrococcus, especially a strain of Pyrococcus woesie, or a strain of the genus Thermococcus, including Thermococcus litoralis, Thermococcus hydrothermalis. Is should be understood that the X46 domain may also be from other microorganism, such as from genera, especially species of the X46 domain found by HMM (as will be described further). These include: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
[0027] In another embodiment the polypeptide comprising or consisting of an X46 domain increases (i.e., boosts) the activity of alpha-amylases. In an embodiment the X46 domain comprising polypeptide has pullulanase, amylopullulanase and/or amylase activity.
[0028] In an embodiment the ratio between the polypeptide comprising or consisting of an X46 domain and the starch-degrading enzyme(s) in the composition of the invention is between 10:1 to 1:10, in particular between 5:1 to 1:5, especially between 2:1 to 1:2, such as around 1:1.
Polypeptides Comprising of Consisting of an X46 Domain
[0029] A composition of the invention comprises a polypeptide comprising or consisting of an
[0030] X46 domain and further a starch-degrading enzyme. The polypeptide comprising or consisting of an X46 domain may be selected from the group of: [0031] i) a polypeptide comprising or consisting of the amino acid sequence shown in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; [0032] ii) an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or [0033] iii) a polypeptide determined by Hidden Markov Model (HMM) using SEQ ID NOS: 7-81, 85, 87 and 89 and/or the sequences identified in FIG. 1 (Appendix a), having a HMM score of at least 150; [0034] iv) a variant thereof (i.e., of i), ii) or iii)) comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
[0035] Polypeptides comprising or consisting of an X46 domain can be found by the method described in the "Identification of X46 domains by Hidden Markov Models"-section below. According to the invention such polypeptide(s) increase(s) the starch hydrolyzing activity of starch-degrading enzymes. When using HMM for identifying an X46 domain containing polypeptide the HMM score may preferably be at least 200, such as in the range between 150-400 or 200-400, such as between 220-350 or 170-350.
[0036] In a preferred embodiment the X46 domain containing polypeptide may comprise or consist of: [0037] a. the amino acid sequence shown in any of SEQ ID NOS: 2, 4, and 6; or [0038] b. an amino acid sequence having at least 60% identity to any of SEQ ID NOS 2, 4, and 6; or [0039] c. a variant thereof (i.e., of a or b) comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, and 6;
[0040] In an embodiment the polypeptide comprising an X46 domain has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to the polypeptide shown in SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
[0041] In an embodiment the variant of the polypeptide comprising an X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 2, 4, and 6.
[0042] In an embodiment the polypeptide consisting of an X46 domain has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 7-81, 85, 87, and 89.
[0043] In an embodiment the polypeptide consisting of an X46 domain may consists of: [0044] a. the amino acid sequence shown in any of SEQ ID NOS: 7-81, 85, 87 or 89; or [0045] b. an amino acid sequence having at least 60% identity to any of SEQ ID NO: 7-81, 85, 87 or 89; [0046] c. a variant of any of SEQ ID NOS 7-81, 85, 87 or 89; which optionally further has an N- and/or C-terminal amino acid sequence, wherein said Nand/or C-terminal amino acid sequence(s) consist(s) of 1 to 50 amino acids, preferably 1-25 amino acids, especially 1 to 10 amino acids.
Starch Degrading Enzymes
[0047] As mentioned above a composition of the invention comprises a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme. The starch-degrading enzymes may preferably be of family GH13 or family GH57. The starch-degrading enzymes may be selected from the group of: pullulanases, amylopullulanases, and alpha-amylases, isoamylases, beta-amylases, glucoamylases, and CGTases. According to the invention the starch-degrading enzymes may in preferred embodiments be selected from the group consisting of pullulanases, amylopullulanases, and alpha-amylases. In a preferred embodiment the starch-degrading enzyme has increased hydrolyzing activity (i.e., boosted enzyme activity) when combined with a polypeptide comprising or consisting of an X46 domain in accordance with the present invention.
Family GH13 Enzymes
[0048] Family GH13 is defined by the CAZy-team and an updated list can be found on the CAZy-server (see "www.cazy.org"). Family GH13 enzymes include alpha-amylase (EC 3.2.1.1); pullulanase (EC 3.2.1.41); cyclomaltodextrin glucanotransferase (EC 2.4.1.19); cyclomaltodextrinase (EC 3.2.1.54); trehalose-6-phosphate hydrolase (EC 3.2.1.93); oligoalpha-glucosidase (EC 3.2.1.10); maltogenic amylase (EC 3.2.1.133); neopullulanase (EC 3.2.1.135); alpha-glucosidase (EC 3.2.1.20); maltotetraose-forming alpha-amylase (EC 3.2.1.60); isoamylase (EC 3.2.1.68); glucodextranase (EC 3.2.1.70); maltohexaose-forming alpha-amylase (EC 3.2.1.98); maltotriose-forming alpha-amylase (EC 3.2.1.116); branching enzyme (EC 2.4.1.18); trehalose synthase (EC 5.4.99.16); 4-alpha-glucanotransferase (EC 2.4.1.25); maltopentaose-forming alpha-amylase (EC 3.2.1.-); amylosucrase (EC 2.4.1.4); sucrose phosphorylase (EC 2.4.1.7); malto-oligosyltrehalose trehalohydrolase (EC 3.2.1.141); isomaltulose synthase (EC 5.4.99.11); amino acid transporter. In a preferred embodiment the Family 13 enzymes contemplated according to the present invention are starch-degrading enzymes, in particular of classified under EC 3.2.1.41 (pullulanase) and EC 3.2.1.1 (alpha-amylase).
Family GH57 Enzymes
[0049] Family GH57 is defined by the CAZy-team and an updates list can be found on the CAZy-server (see "www.cazy.org"). Family GH57 enzymes include alpha-amylase (EC 3.2.1.1); 4-alpha-glucanotransferase (EC 2.4.1.25); alpha-galactosidase (EC 3.2.1.22); amylopullulanase (EC 3.2.1.41); branching enzyme (EC 2.4.1.18).
[0050] Preferred are pullulanase of Family GH57 which include pullulanases classified under EC 3.2.1.41 and are often referred to as pullulanase of type II or sometimes "amylopullulanases". Type II pullulanases are in contrast to type I pullulanases (which specifically attack alpha-1,6 linkages), also hydrolyze alpha-1,4 linkages. A collection of family GH57 pullulanases are described in Zone et al. (2004) Eur. J. Biochem. 271, 2863-2872 (incorporated by reference). In context of the invention family GH57 pullulanases are not limited to those described in there.
[0051] Preferred family GH57 pullulanases of type II include UNIPROT: Q9Y818 and UNIPROT: Q8NKS8 which are derived from strains of the hyperthermophile bacteria Thermococcus hydrothermalis (SEQ ID NO: 2) and Thermococcus litoralis, respectively. Hybrids thereof, preferably truncated GH57 pullulanases are also contemplated according to the invention. A preferred example is the Thermococcus litoralis/Thermococcus hydrothermalis X4 chimer pullulanase shown in SEQ ID NO: 83.
[0052] Family GH57 pullulanases may be obtained from any source, such as a microorganism, preferably a bacterium or fungal organism, such as yeast and a filamentous fungus. In an embodiment the family GH57 pullulanase is a wild-type enzyme. In a preferred embodiment the pullulanase is derived from a bacterium, preferably of the genus Thermococcus or Pyrococcus, including the ones in the table below.
TABLE-US-00001 Thermococcus hydrothermalis. SWISSPROT: Q9Y8I8 Thermococcus sp. HJ21. SWISSPROT: B6SED6 Thermococcus onnurineus (strain NA1). SWISSPROT: B6YV54 Thermococcus kodakaraensis). SWISSPROT: Q5JJ55 Thermococcus sp. AM4. SWISSPROT: B7QZQ4 Pyrococcus furiosus. SWISSPROT: Q8TZQ1 Pyrococcus furiosus DSM 3638. SWISSPROT: Q3HUR3 Pyrococcus furiosus. SWISSPROT: O30772 Thermococcus gammatolerans SWISSPROT: C5A4E3 (strain DSM 15229/JCM 11827/EJ3). Thermococcus barophilus MP. SWISSPROT: B5IRL5 Thermococcus litoralis. SWISSPROT: Q8NKS8 Pyrococcus abyssi. SWISSPROT: Q9V294
X46 Domains and Identification Thereof.
[0053] X46 domains are also referred to a "DUF2223 domains" ("Domain of Unknown Function") which until now have no known function. The DUF2223 members, as of Pfam release 24, 13. October 2009, are found in various prokaryotic membrane-anchored proteins predicted to be involved in the regulation of pullulanases (see http://pfam.sanger.ac.uk/family/DUF2223).
[0054] According to the invention HMM (Hidden Markov Models) may advantageously be used for identifying polypeptides comprising or consisting of an X46 domain. The HMM score may be at least 150, but preferably the HMM score is at least 200 or in the range between 150-400 or 200-400, such as between 170-350 or 220-350. Polypeptides comprising or consisting of X46 domains were identified by HMM as will be explained further below. All the polypeptide shown in FIG. 2 (Appendix C) has been found by HMM as described below.
Identification of X46 Domains by Hidden Markov Models (HMM)
[0055] Software: The two programs hmmbuild and hmmsearch from the software package hmmer version 3.0b3 (ftp://selab.janelia.org/pub/software/hmmer3) were used to construct Hidden Markov Models (HMMs) describing the X46 domain.
Claim: eFAM X46 Annotation
[0056] A total of 59 polypeptide/protein sequences have been identified to contain one or more X46 domains (FIG. 1 or appendix A) and from these, a total of 67×46 domains have been identified. A multiple alignment of the 67 domain sequences has been constructed using Muscle version 3.7, with default parameters (FIG. 2 or appendix C). An HMM is constructed as follows, where appendix_c.selex denotes the alignment file in SELEX format:
[0057] hmmbuild -informat selex appendix_c.hmm appendix_c.selex
[0058] A given query sequence provided in file query.fsa in fasta format, can be queried against the HMM by using hmmsearch program:
[0059] hmmsearch appendix_c.hmm query.fsa
[0060] The claim covers sequences that give a domain alignment score of 150 or better when search against the appendix_c.hmm model using hmmsearch.
Claim: Pfam DUF2223
[0061] The DUF2223 domain consists of 16 seed sequences in the current release of Pfam (version 24.0, October 2009, see appendix D or FIG. 3).
[0062] The Hidden Markov Model is constructed from this alignment as follows, where appendix_c.stockholm represents the input alignment file in Stockolm format:
[0063] hmmbuild -informat stockholm appendix_d.hmm appendix_d.stockholm
[0064] A given query sequence provided in file query.fsa in fasta format, can be queried against the HMM by using hmmsearch program:
[0065] hmmsearch appendix_d.hmm query.fsa
[0066] The claim covers sequences that give a domain alignment score of 150 or better when search against the appendix_d.hmm model using hmmsearch.
[0067] FIG. 1 (appendix a) lists sequences comprising an X46 domain. All sequences are hereby incorporated by reference. The location of the X46 domain is mentioned after the species name. For instance, the Pyrococcus furiosus X46 domain is located from amino acids 798 and 982.
DEFINITIONS
[0068] Variant: The term "variant" is defined herein as a polypeptide, e.g., polypeptide comprising or consisting of an X46 domain, having an alteration, such as a substitution, insertion, deletion, truncation, of one or more (several) amino acid residues at one or more (several) specific positions of the mature parent polypeptide or enzyme. The variant has the activity of the parent polypeptide or enzyme, e.g., "enzyme activity boosting effect" or "starch-degrading activity". The altered polynucleotide is obtained through human intervention by modification of the polynucleotide sequence encoding the polypeptide or enzyme or a homologous sequence thereof.
[0069] A variant may have at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, least 80%, at least 90%, at least 95%, or at least 100% of the enzyme activity of the mature parent enzyme.
[0070] A variant may have, e.g., at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, least 80%, at least 90%, at least 95%, or at least 100% of the enzyme activity boosting activity of the mature parent polypeptide.
[0071] Wild-Type polypeptide or enzyme: The term "wild-type" polypeptide or enzyme denotes a polypeptide, e.g., X46 domain, expressed by a naturally occurring microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.
[0072] Parent Enzyme: The term "parent" polypeptide or enzyme as used herein means a polypeptide, e.g., polypeptide comprising or consisting of an X46 domain, e.g., starch-degrading enzyme, to which a modification, e.g., substitution(s), insertion(s), deletion(s), and/or truncation(s), is made to produce polypeptide or enzyme variants. This term also refers to the polypeptides or enzymes with which a variant is compared and aligned. The parent may be a naturally occurring (wild-type) polypeptide or enzyme or a variant. For instance, the parent polypeptide may be a variant of a naturally occurring polypeptide which has been modified or altered in the amino acid sequence. A parent may also be an allelic variant, which is a polypeptide or enzyme encoded by any of two or more alternative forms of a gene occupying the same chromosomal locus.
[0073] Isolated variant or polypeptide: The term "isolated variant" or "isolated polypeptide" as used herein refers to a variant or a polypeptide that is isolated from a source. In one aspect, the variant or polypeptide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, and most preferably at least 90% pure, as determined by SDS-PAGE.
[0074] Substantially pure variant or polypeptide: The term "substantially pure variant" or "substantially pure polypeptide" denotes herein a variant or polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated. It is, therefore, preferred that the substantially pure variant or polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total variant or polypeptide material present in the preparation. The variant and polypeptide is preferably in a substantially pure form. This can be accomplished, for example, by preparing the variant or polypeptide by well-known recombinant methods or by classical purification methods.
[0075] Mature polypeptide: The term "mature polypeptide" is defined herein as a polypeptide that is in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one preferred embodiment, the mature polypeptide is any of the amino acid sequences shown in SEQ ID NOS: 2, 4, 6-81, 85, 87 or 89.
[0076] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" is defined herein as a nucleotide sequence that encodes a mature polypeptide. In one embodiment, the mature polypeptide coding sequence is the nucleotides identified as "mat_peptide" in any of SEQ ID NOS: 1, 3, 5, 84, 86 or 88. For instance, the mature polypeptide in SEQ ID NO: 1 is located from nucleotide 82 to 3804.
[0077] Alignment: Alignment of two amino acid sequence in order to identify corresponding position may be done by using the MUSCLE (MUltiple Sequence Comparison by Log-Expectation) alignment program (Edgar, Robert C. (2004), MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5), 1792-97.) with 16 iterations of the protein sequence alignments. Alternatively, another alignment program is identified.
[0078] Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity". For purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277; http://emboss.org), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues×100)/(Length of Alignment-Total Number of Gaps in Alignment)
[0079] For purposes of the present invention, the degree of identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra; http://emboss.org), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides×100)/(Length of Alignment-Total Number of Gaps in Alignment)
[0080] Alternatively, another identity program is identified.
[0081] Isolated polynucleotide: The term "isolated polynucleotide" as used herein refers to a polynucleotide that is isolated from a source. In one aspect, the isolated polynucleotide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, and most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by agarose electrophoresis.
[0082] Substantially pure polynucleotide: The term "substantially pure polynucleotide" as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered polypeptide production systems. Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively or recombinantly associated. A substantially pure polynucleotide may, however, include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form, i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively or recombinantly associated. The polynucleotides may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
[0083] Coding sequence: When used herein the term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of its polypeptide product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence may be a DNA, cDNA, synthetic, or recombinant polynucleotide.
[0084] Nucleic acid construct: The term "nucleic acid construct" as used herein refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
[0085] Control sequences: The term "control sequences" is defined herein to include all components necessary for the expression of a polynucleotide encoding a polypeptide. Each control sequence may be native or foreign to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
[0086] Operably linked: The term "operably linked" denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.
[0087] Expression: The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0088] Expression vector: The term "expression vector" is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to additional nucleotides that provide for its expression.
[0089] Host cell: The term "host cell", as used herein, includes any cell type that is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
[0090] Hybridization: The polynucleotide may be able to hybridize with the mature polypeptide coding sequence. The hybridization may be done by prehybridization and hybridization at 42° C. in 5×SSPE, 0.3% SDS, 200 μg/ml sheared and denatured salmon sperm DNA, and either 25% formamide (for very low and low stringencies), 35% formamide (for medium and medium-high stringencies), or 50% formamide (for high and very high stringencies), following standard Southern blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2×SSC, 0.2% SDS preferably at 45° C. (very low stringency), 50° C. (low stringency), 55° C. (medium stringency), 60° C. (medium-high stringency), 65° C. (high stringency), or 70° C. (very high stringency).
X46 Domain Polypeptides of the Invention
[0091] In one aspect the invention relates to polypeptides consisting of an X46 domain. In a preferred embodiment the polypeptide consists of an X46 domain selected from the group of: [0092] i) the amino acid sequence shown in any of SEQ ID NOS: 7-81, 85, 87 and 89; or [0093] ii) an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89; or [0094] iii) a variant thereof comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0095] In an embodiment the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0096] In an embodiment the variant of the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0097] In a preferred embodiment the X46 domain has a total number of amino acid substitutions, deletions and/or insertions compared to any of the parent X46 domain shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
[0098] In a preferred embodiment the variant of the X46 domain has a total number of amino acid substitutions, deletions and/or insertions compared to any of the X46 domain polypeptides shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
[0099] In an embodiment the X46 domain of the invention is derived from a microorganism, in particular a bacterium, fungal organism, preferably a yeast or a filamentous fungus.
[0100] More specifically the X46 domain may be derived from a bacteria, especially one selected from a strain of the species: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix orenii, Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
Isolated Polynucleotide Encoding an X46 Domain Polypeptide
[0101] The invention also relates to an isolated polynucleotide comprising a nucleotide sequence which encodes an X46 domain. In a preferred embodiment the polynucleotide encodes the X46 shown in any of SEQ NOS: 7-81, 85, 87 and 89.
[0102] In a preferred embodiment the invention relates to an isolated polynucleotide encoding an X46 domain selected from the consisting of: [0103] i) a polynucleotide having at least 60%, preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% identity with the X46 coding part of SEQ ID NOS: 1, 3, 5, 84, 86 and 88 or a complementary strand thereof; [0104] ii) a polynucleotide which hybridizes under low stringency, preferably medium, especially high stringency conditions with the X46 domain coding part of SEQ ID NO: 1, 3, 5, 84, 86 or 88 or a complementary strand thereof.
Nucleic Acid Constructs
[0105] The present invention also relates to nucleic acid constructs comprising the polynucleotide described above, operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. The control sequence may include an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of a polynucleotide encoding an X46 domain of the present invention. The promoter sequence contains transcriptional control sequences that mediate the expression of the X46 domain. The promoter may be any nucleotide sequence that shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also include a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the X46 domain. Any terminator that is functional in the host cell of choice may be used in the present invention. The control sequence may also include a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the X46 domain of the invention. Any leader sequence that is functional in the host cell of choice may be used in the present invention. The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell of choice may be used in the present invention. The control sequence may also include a signal peptide coding sequence that codes for an amino acid sequence linked to the amino terminus of a X46 domain and directs the encoded X46 domain into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the secreted polypeptide in question. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. The foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, the foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide in question. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., secreted into a culture medium, may be used in the present invention. The control sequence may also include a propeptide coding sequence that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide in question. It may also be desirable to add regulatory sequences that allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those that cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Examples of useful control sequences are described in WO2007090402.
Expression Vectors
[0106] The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described herein may be joined together to produce a recombinant expression vector that may include one or more (several) convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, a polynucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression. Examples of vector systems are described in WO2007090402.
Host Cells
[0107] The present invention also relates to recombinant host cells, comprising an isolated polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source. Examples of host cells are described in WO2007090402.
Methods of Production
[0108] The present invention relates to methods of producing an X46 domain of the present invention, comprising: (a) cultivating a recombinant host cell, as described herein, under conditions conducive for production of the polypeptide in question; and (b) recovering the polypeptide in question. The production may be carried out as described in WO2007090402.
Processes for Producing Fermentation Products from Gelatinized Starch-Containing Material
[0109] In this aspect the invention relates to processes for producing fermentation products, especially ethanol, from starch-containing material, which process includes a liquefaction step and sequentially or simultaneously performed saccharification and fermentation steps. Consequently, the invention relates to processes for producing fermentation products from starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of a composition of the invention and optionally an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme; (c) fermenting using a fermenting organism.
[0110] In a preferred embodiment the composition comprises a polypeptide comprising or consisting of an X46 domain and a pullulanase. In another preferred embodiment the composition comprises a polypeptide comprising or consisting of an X46 domain and an alpha-amylase. Examples of suitable and preferred pullulanases are described above.
[0111] In an embodiment a protease, such as an acid fungal protease or a metallo protease is added before, during and/or after liquefaction. The protease may be any of the ones mentioned in the "Protease"-section below. In a preferred embodiment the metallo protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670. The alpha-amylase may be any of the ones mentioned in the "Alpha-Amylase"-section below. In a preferred embodiment the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A. niger, A. oryzae, A. awamoti, or A. kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus or the alpha-amylase disclosed in Richardson et al. (2002), The Journal of Biological Chemistry, Vol. 277, No 29, Issue 19 July, pp. 267501-26507, referred to as BD5088. The carbohydrate-source generating enzymes may be any of the ones mentioned below in the Carbohydrate-Source Generating Enzyme"-section. In a preferred embodiment the carbohydrate-source generating enzyme is a glucoamylase derived from a strain of Aspergillus, preferably Aspergillus niger or Aspergillus awamori, a strain of Talaromyces, especially Talaromyces emersonii; or a strain of Athelia, especially Athelia rolfsii; a strain of Trametes, preferably Trametes cingulata; a strain of the genus Pachykytospora, preferably a strain of Pachykytospora papyracea; or a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus; or a strain of the genus Peniophora, preferably a strain of the species Peniophora rufomarginata; or a mixture thereof.
[0112] Saccharification step (b) and fermentation step (c) may be carried out either sequentially or simultaneously. The pullulanase and/or metallo protease may be added during liquefaction, saccharification and/or fermentation. The pullulanase and/or metallo protease may also advantageously be added before liquefaction (pre-liquefaction treatment), i.e., before or during step (a), and/or after liquefaction (post liquefaction treatment), i.e., after step (a). The pullulanase is most advantageously added during liquefaction, i.e., during step (a). The fermentation product, such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation. Suitable starch-containing starting materials are listed in the section "Starch-Containing Materials"-section below. Contemplated enzymes are listed in the "Enzymes"-section below. The liquefaction is preferably carried out in the presence of at least an alpha-amylase, preferably a bacterial alpha-amylase or acid fungal alpha-amylase. The fermenting organism is preferably yeast, preferably a strain of Saccharomyces cerevisiae. Suitable fermenting organisms are listed in the "Fermenting Organisms"-section below. In a particular embodiment, the process of the invention further comprises, prior to step (a), the steps of:
[0113] x) reducing the particle size of the starch-containing material, preferably by milling (e.g., using a hammer mill);
[0114] y) forming a slurry comprising the starch-containing material and water.
[0115] In a preferred embodiment the particle size is smaller than a #7 screen, preferably a smaller than a #6 screen. A #7 screen is usually used in conventional prior art processes. The aqueous slurry may contain from 10-55 w/w-% dry solids (DS), preferably 25-45 w/w-% dry solids (DS), more preferably 30-40 w/w-% dry solids (DS) of starch-containing material. The slurry is heated to above the gelatinization temperature and alpha-amylase, preferably bacterial and/or acid fungal alpha-amylase may be added to initiate liquefaction (thinning). The slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to alpha-amylase in step (a). Liquefaction may in an embodiment be carried out as a three-step hot slurry process. The slurry is heated to between 60-95° C., preferably between 70-90° C., such as preferably between 80-90° C., preferably around 85° C., at pH 4-6, preferably 4.5-5.0, and alpha-amylase, together with pullulanase and/or protease, preferably metallo protease, are added to initiate liquefaction (thinning). In an embodiment the slurry may then be jet-cooked at a temperature between 95-140° C., preferably 100-135° C., such as 105-125° C., for about 1-15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes. The slurry is cooled to 60-95° C. and alpha-amylase and pullulanase and/or protease, preferably metallo protease, may be added to finalize hydrolysis (secondary liquefaction). The liquefaction process is usually carried out at pH 4-6, in particular at a pH from 4.5 to 5. Saccharification step (b) may be carried out using conditions well-known in the art. For instance, a full saccharification process may last up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65° C., typically about 60° C., followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically carried out at temperatures from 20-75° C., preferably from 40-70° C., typically around 60° C., and at a pH between 4 and 5, normally at about pH 4.5. The most widely used process in fermentation product, especially ethanol, production is the simultaneous saccharification and fermentation (SSF) process, in which there is no holding stage for the saccharification, meaning that fermenting organism, such as yeast, and enzyme(s), may be added together. SSF may typically be carried out at a temperature from 25° C. to 40° C., such as from 28° C. to 35° C., such as from 30° C. to 34° C., preferably around about 32° C. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
Fermentation Medium
[0116] "Fermentation media" or "fermentation medium" refers to the environment in which fermentation is carried out and which includes the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism. The fermentation medium may comprise nutrients and growth stimulator(s) for the fermenting organism(s). Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; urea, vitamins and minerals, or combinations thereof.
Fermenting Organisms
[0117] The term "fermenting organism" refers to any organism, including bacterial and fungal organisms, suitable for use in a fermentation process and capable of producing the desired fermentation product. Especially suitable fermenting organisms are able to ferment, i.e., convert, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product. Examples of fermenting organisms include fungal organisms, such as yeast. Preferred yeast includes strains of Saccharomyces spp., in particular, Saccharomyces cerevisiae. In one embodiment the fermenting organism is added to the fermentation medium so that the viable fermenting organism, such as yeast, count per mL of fermentation medium is in the range from 105 to 1012, preferably from 107 to 1010, especially about 5×107. Commercially available yeast includes, e.g., RED STAR® and ETHANOL RED® yeast (available from Fermentis/Lesaffre, USA), FALI (available from Fleischmann's Yeast, USA), SUPERSTART and THERMOSACC® fresh yeast (available from Ethanol Technology, WI, USA), BIOFERM AFT and XR (available from NABC--North American Bioproducts Corporation, GA, USA), GERT STRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from DSM Specialties).
Starch-Containing Materials
[0118] Any suitable starch-containing material may be used according to the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing materials, suitable for use in a process of the invention, include whole grains, corn, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, rice, peas, beans, or sweet potatoes, or mixtures thereof or starches derived there from, or cereals. Contemplated are also waxy and non-waxy types of corn and barley. The term "granular starch" means raw uncooked starch, i.e., starch in its natural form found in cereal, tubers or grains. Starch is formed within plant cells as tiny granules insoluble in water. When put in cold water, the starch granules may absorb a small amount of the liquid and swell. At temperatures up to 50° C. to 75° C. the swelling may be reversible. However, with higher temperatures an irreversible swelling called "gelatinization" begins. Granular starch to be processed may be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a more crude starch-containing materials comprising (e.g., milled) whole grains including non-starch fractions such as germ residues and fibers. The raw material, such as whole grains, may be reduced in particle size, e.g., by milling, in order to open up the structure and allowing for further processing. Two processes are preferred according to the invention: wet and dry milling. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in production of, e.g., syrups. Both dry and wet milling is well known in the art of starch processing and is equally contemplated for a process of the invention. In an embodiment the particle size is reduced to between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen.
Fermentation Products
[0119] The term "fermentation product" means a product produced by a process including a fermentation step using a fermenting organism. Fermentation products contemplated according to the invention include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low-alcohol beer, low-calorie beer or light beer. Preferred fermentation processes used include alcohol fermentation processes. The fermentation product, such as ethanol, obtained according to the invention, may preferably be used as fuel. However, in the case of ethanol it may also be used as potable ethanol.
Recovery
[0120] Subsequent to fermentation the fermentation product may be separated from the fermentation medium. The slurry may be distilled to extract the desired fermentation product or the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques. Alternatively the fermentation product may be recovered by stripping. Methods for recovery are well known in the art.
Use of a Composition of the Invention
[0121] A composition of the invention comprising a polypeptide comprising or consisting of an X46 and further a starch-degrading enzyme may be used in the conversion of starch, e.g., for the production of dextrose, sweeteners, syrup (such as high-fructose syrup), edible products (such as snack pellets), ethanol or beer, e.g. as described in WO 2000/001796, WO 2001/051620, 2006-213132, or WO2003024242. Thus, it may be used in the liquefaction of starch (WO 2006/028897), in beer brewing (WO 2007/144393), or for saccharification in combination with a glucoamylase (EP 63909).
[0122] In a preferred embodiment the invention relates to the use of a composition of the invention in a process of producing a fermentation product, such as ethanol, from gelatinized, especially fuel ethanol.
Enzymes
Proteases
[0123] According to the present invention the protease used may be of any origin. In a preferred embodiment the protease may be an acid fungal protease or a metallo protease. In a preferred embodiment the protease is a metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670 disclosed in WO 2003/048353 (Novozymes). According to the invention a peptidase and other protein degrading enzymes are referred to as proteases. In a preferred embodiment the protease is an endo-protease and/or an exo-protease. Suitable proteases may be of fungal, bacterial, including filamentous fungi and yeast, and plant origin. In an embodiment the protease is an acidic protease, i.e., a protease characterized by the ability to hydrolyze proteins under acidic conditions below pH 7, e.g., at a pH between 2-7. In an embodiment the acidic protease has an optimum pH in the range from 2.5 and 3.5 (determined on high nitrogen casein substrate at 0.7% w/v at 37° C.) and a temperature optimum between 5 to 50° C. at an enzyme concentration of 10 mg/mL at 30° C. for one hour in 0.1 M piperazine/acetate/glycine buffer). In another embodiment the protease is an alkaline protease, i.e., a protease characterized by the ability to hydrolyze proteins under alkaline conditions above pH 7, e.g., at a pH between 7 and 11. In an embodiment the alkaline protease is derived from a strain of Bacillus, preferably Bacillus licheniformis. In an embodiment the alkaline protease has an optimum temperature in the range from 7 and 11 and a temperature optimum around 70° C. determined at pH 9. In another embodiment the protease is a neutral protease, i.e., a protease characterized by the ability to hydrolyze proteins under conditions between pH 5 and 8. In an embodiment the alkaline protease is derived from a strain of Bacillus, preferably Bacillus amyloliquefaciens. In an embodiment the alkaline protease has an optimum pH in the range between 7 and 11 (determined at 25° C., 10 minutes reaction time with an enzyme concentration of 0.01-0.2 AU/L) and a temperature optimum between 50° C. and 70° C. (determined at pH 8.5, minutes reaction time and 0.03-0.3 AU/L enzyme concentration. In an embodiment the protease is a metallo protease. In a preferred embodiment the protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoaccus aurantiacus CGMCC No. 0670 having the sequence shown in the mature part of SEQ ID NO: 2 in WO 2003/048353 hereby incorporated by reference. The Thermoaccus aurantiacus protease is active from 20-90° C., with an optimum temperature around 70° C. Further, the enzyme is activity between pH 5-10 with an optimum around pH 6. Suitable plant proteases may be derived from barley. Suitable bacterial proteases include Bacillus proteases derived from Bacillus amyloliquefaciens and Bacillus licheniformis. Suitable filamentous bacterial proteases may be derived from a strain of Nocardiopsis, preferably Nocardiopsis prasina NRRL 18262 protease (or Nocardiopsis sp. 10R) and Nocardiopsis dassonavilla NRRL 18133 (Nocardiopsis dassonavilla M58-1) both described in WO 1988/003947 (Novozymes). Suitable acid fungal proteases include fungal proteases derived from Aspergillus, Mucor, Rhizomucor, Rhizopus, Candida, Coriolus, Endothia, Enthomophtra, lrpex, Penicillium, Sclerotium, Thermoaccus, and Torulopsis. Especially contemplated are proteases derived from Aspergillus niger (see, e.g., Koaze et al., (1964), Agr. Biol. Chem. Japan, 28, 216), Aspergillus saitoi (see, e.g., Yoshida, (1954) J. Agr. Chem. Soc. Japan, 28, 66), Aspergillus awamori (Hayashida et al., (1977) Agric. Biol. Chem., 42(5), 927-933, Aspergillus aculeatus (WO 95/02044), or Aspergillus oryzae; proteases from Mucor pusillus or Mucor miehei disclosed in U.S. Pat. No. 4,357,357 and U.S. Pat. No. 3,988,207; and Rhizomucor mehei or Rhizomucor pusillus disclosed in, e.g., WO 94/24880 (hereby incorporated by reference). Aspartic acid proteases are described in, for example, Hand-book of Proteolytic Enzymes, Edited by A. J. Barrett, N. D. Rawlings and J. F. Woessner, Aca-demic Press, San Diego, 1998, Chapter 270). Suitable examples of aspartic acid protease include, e.g., those disclosed in R. M. Berka et al. Gene, 96, 313 (1990)); (R. M. Berka et al. Gene, 125, 195-198 (1993)); and Gomi et al. Biosci. Biotech. Biochem. 57, 1095-1100 (1993), which are hereby incorporated by reference. Commercially available products include ALCALASE®, ESPERASE®, NEUTRASE®, RENILASE®, NOVOZYM® FM 2.0L, and NOVOZYM® 50006 (available from Novozymes A/S, Denmark) and GC106® and SPEZYME® FAN from Genencor Int., Inc., USA. The protease may be present in concentrations in the range from 0.0001 to 1.0 wt.-% of TS, preferably 0.001 to 0.1 wt.-% of TS.
Alpha-Amylase
[0124] According to the invention any alpha-amylase may be used, such as of fungal, bacterial or plant origin. In a preferred embodiment the alpha-amylase is an acid alpha-amylase, e.g., acid fungal alpha-amylase or acid bacterial alpha-amylase. The term "acid alpha-amylase" means an alpha-amylase (E.C. 3.2.1.1) which added in an effective amount has activity optimum at a pH in the range of 3 to 7, preferably from 3.5 to 6, or more preferably from 4-5.
Bacterial Alpha-Amylase
[0125] According to the invention a bacterial alpha-amylase is preferably derived from the genus Bacillus. In a preferred embodiment the Bacillus alpha-amylase is derived from a strain of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis or Bacillus stearothermophilus, but may also be derived from other Bacillus sp. Specific examples of contemplated alpha-amylases include the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase SEQ ID NO: 5 in WO 99/19467 and the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 (all sequences hereby incorporated by reference). In an embodiment the alpha-amylase may be an enzyme having a degree of identity of at least 60%, preferably at least 70%, more preferred at least 80%, even more preferred at least 90%, such as at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to any of the sequences shown in SEQ ID NOS: 1, 2 or 3, respectively, in WO 99/19467. The Bacillus alpha-amylase may also be a variant and/or hybrid, especially one described in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, and WO 02/10355 (all documents hereby incorporated by reference). Specifically contemplated alpha-amylase variants are disclosed in U.S. Pat. No. 6,093,562, 6,297,038 or U.S. Pat. No. 6,187,576 (hereby incorporated by reference) and include Bacillus stearothermophilus alpha-amylase (BSG alpha-amylase) variants having a deletion of one or two amino acid in positions R179 to G182, preferably a double deletion disclosed in WO 1996/023873--see e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to delta(181-182) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO:3 disclosed in WO 99/19467 or deletion of amino acids R179 and G180 using SEQ ID NO:3 in WO 99/19467 for numbering (which reference is hereby incorporated by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylase, which have a double deletion corresponding to delta(181-182) and further comprise a N193F substitution (also denoted I181*+G182*+N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO:3 disclosed in WO 99/19467.
Bacterial Hybrid Alpha-Amylase
[0126] A hybrid alpha-amylase specifically contemplated comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467), with one or more, especially all, of the following substitution: G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the Bacillus licheniformis numbering in SEQ ID NO: 4 of WO 99/19467). Also preferred are variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha-amylase backbones): H154Y, A181T, N190F, A209V and Q264S and/or deletion of two residues between positions 176 and 179, preferably deletion of E178 and G179 (using the SEQ ID NO: 5 numbering of WO 99/19467). In an embodiment the bacterial alpha-amylase is dosed in an amount of 0.0005-5 KNU per g DS, preferably 0.001-1 KNU per g DS, such as around 0.050 KNU per g DS.
Fungal Alpha-Amylase
[0127] Fungal alpha-amylases include alpha-amylases derived from a strain of the genus Aspergillus, such as Aspergillus oryzae, Aspergillus niger and Aspergillis kawachii alpha-amylases.
[0128] A preferred acidic fungal alpha-amylase is a Fungamyl-like alpha-amylase which is derived from a strain of Aspergillus otyzae. According to the present invention, the term "Fungamyl-like alpha-amylase" indicates an alpha-amylase which exhibits a high identity, i.e. at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature part of the amino acid sequence shown in SEQ ID NO: 10 in WO 96/23874. Another preferred acid alpha-amylase is derived from a strain Aspergillus niger. In a preferred embodiment the acid fungal alpha-amylase is the one from Aspergillus niger disclosed as "AMYA_ASPNG" in the Swiss-prot/TeEMBL database under the primary accession no. P56271 and described in WO 89/01969 (Example 3--incorporated by reference). A commercially available acid fungal alpha-amylase derived from Aspergillus niger is SP288 (available from Novozymes A/S, Denmark). Other contemplated wild-type alpha-amylases include those derived from a strain of the genera Rhizomucor and Meripilus, preferably a strain of Rhizomucor pusillus (WO 2004/055178 incorporated by reference) or Meripilus giganteus. In a preferred embodiment the alpha-amylase is derived from Aspergillus kawachii and disclosed by Kaneko et al. J. Ferment. Bioeng 81:292-298 (1996) "Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acidstable alpha-amylase from Aspergillus kawachii, and further as EMBL: #AB008370. The fungal alpha-amylase may also be a wild-type enzyme comprising a starch-binding domain (SBD) and an alpha-amylase catalytic domain (i.e., none-hybrid), or a variant thereof. In an embodiment the wild-type alpha-amylase is derived from a strain of Aspergillus kawachii. The alpha-amylase may also be derived from a strain of Subulispora, preferably the one disclosed as SEQ ID NO: 2 in WO 2009/140504.
Fungal Hybrid Alpha-Amylase
[0129] In a preferred embodiment the fungal acid alpha-amylase is a hybrid alpha-amylase. Preferred examples of fungal hybrid alpha-amylases include the ones disclosed in WO 2005/003311 or U.S. Patent Publication no. 2005/0054071 (Novozymes) or U.S. patent application No. 60/638,614 (Novozymes) which is hereby incorporated by reference. A hybrid alpha-amylase may comprise an alpha-amylase catalytic domain (CD) and a carbohydrate-binding domain/module (CBM), such as a starch binding domain, and optional a linker. Specific examples of contemplated hybrid alpha-amylases include those disclosed in Table 1 to 5 of the examples in U.S. patent application No. 60/638,614, including Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO:100 in U.S. 60/638,614), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO:101 in U.S. 60/638,614), Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD (which is disclosed in Table 5 as a combination of amino acid sequences SEQ ID NO:20, SEQ ID NO:72 and SEQ ID NO:96 in U.S. application Ser. No. 11/316,535) or as V039 in Table 5 in WO 2006/069290, and Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO:102 in U.S. 60/638,614). Other specifically contemplated hybrid alpha-amylases are any of the ones listed in Tables 3, 4, 5, and 6 in Example 4 in U.S. application Ser. No. 11/316,535 and WO 2006/069290 (hereby incorporated by reference). Other specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. Patent Publication no. 2005/0054071, including those disclosed in Table 3 on page 15, such as Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain. Contemplated are also alpha-amylases which exhibit a high identity to any of above mention alpha-amylases, i.e., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature enzyme sequences. An acid alpha-amylases may according to the invention be added in an amount of 0.001 to 10 AFAU/g DS, preferably from 0.01 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS or 0.001 to 1 FAU-F/g DS, preferably 0.01 to 1 FAU-F/g DS.
Commercial Alpha-Amylase Products
[0130] Preferred commercial compositions comprising alpha-amylase include MYCOLASE® from DSM (Gist Brocades), BAN®, TERMAMYL® SC, FUNGAMYL®, LIQUOZYME® X, LIQUOZYME® SC and SAN® SUPER, SAN® EXTRA L (Novozymes A/S) and CLARASE® L-40,000, DEX-LO®, SPEZYME® FRED, SPEZYME® AA, and SPEZYME® DELTA AA, SPEZYME® XTRA, SPEZYME ALPHA®, GC358 (Genencor Int.), FUELZYME®-LF (Verenium Inc), and the acid fungal alpha-amylase sold under the trade name SP288 (available from Novozymes A/S, Denmark).
Carbohydrate-Source Generating Enzyme
[0131] The term "carbohydrate-source generating enzyme" includes glucoamylase (being glucose generators), beta-amylase and maltogenic amylase (being maltose generators) and also alpha-glucosidase. A carbohydrate-source generating enzyme is capable of producing a carbohydrate that can be used as an energy-source by the fermenting organism(s) in question, for instance, when used in a process of the invention for producing a fermentation product, such as ethanol. The generated carbohydrate may be converted directly or indirectly to the desired fermentation product, preferably ethanol. According to the invention a mixture of carbohydrate-source generating enzymes may be used. Especially contemplated blends are mixtures comprising at least a glucoamylase and an alpha-amylase, especially an acid amylase, even more preferred an acid fungal alpha-amylase. The ratio between glucoamylase activity (AGU) and fungal alpha-amylase activity (FAU-F) (i.e., AGU per FAU-F) may in a preferred embodiment of the invention be between 0.1 and 100 AGU/FAU-F, in particular between 2 and 50 AGU/FAU-F, such as in the range from 10-40 AGU/FAU-F, especially when doing one-step fermentation (Raw Starch Hydrolysis--RSH), i.e., when saccharification and fermentation are carried out simultaneously (i.e. without a liquefaction step). In a conventional starch-to-ethanol process (i.e., including a liquefaction step (a)) the ratio may preferably be as defined in EP 140,410-B1, especially when saccharification in step (b) and fermentation in step (c) are carried out simultaneously.
Glucoamylase
[0132] A glucoamylase used according to the invention may be derived from any suitable source, e.g., derived from a microorganism or a plant. Preferred glucoamylases are of fungal or bacterial origin, selected from the group consisting of Aspergillus glucoamylases, in particular Aspergillus niger G1 or G2 glucoamylase (Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102), or variants thereof, such as those disclosed in WO 92/00381, WO 00/04136 and WO 01/04273 (from Novozymes, Denmark); the A. awamori glucoamylase disclosed in WO 84/02921, Aspergillus oryzae glucoamylase (Agric. Biol. Chem. (1991), 55 (4), p. 941-949), or variants or fragments thereof. Other Aspergillus glucoamylase variants include variants with enhanced thermal stability: G137A and G139A (Chen et al. (1996), Prot. Eng. 9, 499-505); D257E and D293E/Q (Chen et al. (1995), Prot. Eng. 8, 575-582); N182 (Chen et al. (1994), Biochem. J. 301, 275-281); disulphide bonds, A246C (Fierobe et al. (1996), Biochemistry, 35, 8698-8704; and introduction of Pro residues in position A435 and S436 (Li et al. (1997), Protein Eng. 10, 1199-1204. Other glucoamylases include Athelia rolfsii (previously denoted Corticium rolfsii) glucoamylase (see U.S. Pat. No. 4,727,026 and (Nagasaka et al. (1998) "Purification and properties of the raw-starch-degrading glucoamylases from Corticium rolfsii, Appl Microbiol Biotechnol 50:323-330), Talaromyces glucoamylases, in particular derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (U.S. Pat. No. Re. 32,153), Talaromyces duponti, Talaromyces thermophilus (U.S. Pat. No. 4,587,215). Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831) and Trametes cingulata, Pachykytospora papyracea; and Leucopaxillus giganteus all disclosed in WO 2006/069289; or Peniophora rufomarginata disclosed in WO2007/124285; or a mixture thereof. Also hybrid glucoamylase are contemplated according to the invention. Examples the hybrid glucoamylases disclosed in WO 2005/045018. Specific examples include the hybrid glucoamylase disclosed in Table 1 and 4 of Example 1 (which hybrids are hereby incorporated by reference). Contemplated are also glucoamylases which exhibit a high identity to any of above mention glucoamylases, i.e., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature enzymes sequences mentioned above. Commercially available compositions comprising glucoamylase include AMG 200L; AMG 300 L; SAN® SUPER, SAN® EXTRA L, SPIRIZYME® PLUS, SPIRIZYME® FUEL, SPIRIZYME® B4U, SPIRIZYME® ULTRA and AMG® E (from Novozymes A/S); OPTIDEX® 300, GC480, GC417 (from Genencor Int.); AMIGASE® and AMIGASE® PLUS (from DSM); G-ZYME® G900, G-ZYME® and G990 ZR (from Genencor Int.). Glucoamylases may in an embodiment be added in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS, especially between 0.01-5 AGU/g DS, such as 0.1-2 AGU/g DS.
Beta-Amylase
[0133] A beta-amylase (E.C 3.2.1.2) is the name traditionally given to exo-acting maltogenic amylases, which catalyze the hydrolysis of 1,4-alpha-glucosidic linkages in amylose, amylopectin and related glucose polymers. Maltose units are successively removed from the non-reducing chain ends in a step-wise manner until the molecule is degraded or, in the case of amylopectin, until a branch point is reached. The maltose released has the beta anomeric configuration, hence the name beta-amylase. Beta-amylases have been isolated from various plants and microorganisms (W. M. Fogarty and C. T. Kelly, Progress in Industrial Microbiology, vol. 15, pp. 112-115, 1979). These beta-amylases are characterized by having optimum temperatures in the range from 40° C. to 65° C. and optimum pH in the range from 4.5 to 7. A commercially available beta-amylase from barley is NOVOZYM® WBA from Novozymes A/S, Denmark and SPEZYME® BBA 1500 from Genencor Int., USA.
Maltogenic Amylase
[0134] The amylase may also be a maltogenic alpha-amylase. A "maltogenic alpha-amylase" (glucan 1,4-alpha-maltohydrolase, E.C. 3.2.1.133) is able to hydrolyze amylose and amylopectin to maltose in the alpha-configuration. A maltogenic amylase from Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A/S. Maltogenic alpha-amylases are described in U.S. Pat. Nos. 4,598,048, 4,604,355 and 6,162,628, which are hereby incorporated by reference. The maltogenic amylase may in a preferred embodiment be added in an amount of 0.05-5 mg total protein/gram DS or 0.05-5 MANU/g DS.
Materials & Methods
Materials:
[0135] Bacillus deramificans pullulanase is disclosed in SEQ ID NO: 96
[0136] Thermococcus litoralis and Thermococcus hydrothermalis amylopullulanase X4 chimer is disclosed in SEQ ID NO: 83
[0137] BMSY Medium:
[0138] (1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer, pH 6.0, 1.34% YNB, 4×10-5% biotin, 2% sorbitol)
Methods:
Hidden Markov Model (HMM):
[0139] The strategy for creating the Hidden Markov Model is described above in the section "Identification of X46 domains by Hidden Markov Models.
Alpha-Amylase Activity (KNU)
[0140] The amylolytic activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.
[0141] One Kilo Novo alpha amylase Unit (KNU) is defined as the amount of enzyme which, under standard conditions (i.e., at 37° C.+/-0.05; 0.0003 M Ca2+; and pH 5.6) dextrinizes 5260 mg starch dry substance Merck Amylum solubile. A folder EB-SM-0009.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
Determination of FAU activity
[0142] One Fungal Alpha-Amylase Unit (FAU) is defined as the amount of enzyme, which breaks down 5.26 g starch (Merck Amylum solubile Erg. B.6, Batch 9947275) per hour based upon the following standard conditions:
TABLE-US-00002 Substrate Soluble starch Temperature 37° C. pH 4.7 Reaction time 7-20 minutes
Determination of Acid Alpha-Amylase Activity (AFAU)
[0143] Acid alpha-amylase activity is measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard. The standard used is AMG 300 L (from Novozymes A/S, Denmark, glucoamylase wild-type Aspergillus niger G1, also disclosed in Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102) and WO 92/00381). The neutral alpha-amylase in this AMG falls after storage at room temperature for 3 weeks from approx. 1 FAU/mL to below 0.05 FAU/mL.
[0144] The acid alpha-amylase activity in this AMG standard is determined in accordance with the following description. In this method, 1 AFAU is defined as the amount of enzyme, which degrades 5.260 mg starch dry matter per hour under standard conditions. Iodine forms a blue complex with starch but not with its degradation products. The intensity of color is therefore directly proportional to the concentration of starch. Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under specified analytic conditions.
##STR00001##
[0145] Standard conditions/reaction conditions: (per minute)
[0146] Substrate: Starch, approx. 0.17 g/L
[0147] Buffer: Citate, approx. 0.03 M
[0148] Iodine (I2): 0.03 g/L
[0149] CaCl2: 1.85 mM
[0150] pH: 2.50±0.05
[0151] Incubation temperature: 40° C.
[0152] Reaction time: 23 seconds
[0153] Wavelength: lambda=590 nm
[0154] Enzyme concentration: 0.025 AFAU/mL
[0155] Enzyme working range: 0.01-0.04 AFAU/mL
[0156] If further details are preferred these can be found in EB-SM-0259.02/01 available on request from Novozymes A/S, Denmark, and incorporated by reference.
Glucoamylase Activity (AGU)
[0157] The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37° C., pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes. An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.
TABLE-US-00003 AMG incubation: Substrate: maltose 23.2 mM Buffer: acetate 0.1M pH: 4.30 ± 0.05 Incubation temperature: 37° C. ± 1 Reaction time: 5 minutes Enzyme working range: 0.5-4.0 AGU/mL
TABLE-US-00004 Color reaction: GlucDH: 430 U/L Mutarotase: 9 U/L NAD: 0.21 mM Buffer: phosphate 0.12M; 0.15M NaCl pH: 7.60 ± 0.05 Incubation temperature: 37° C. ± 1 Reaction time: 5 minutes Wavelength: 340 nm
[0158] A folder (EB-SM-0131.02/01) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.
Determination of Maltogenic Amylase Activity (MANU)
[0159] One MANU (Maltogenic Amylase Novo Unit) may be defined as the amount of enzyme required to release one micro mole of maltose per minute at a concentration of 10 mg of maltotriose (Sigma M 8378) substrate per ml of 0.1 M citrate buffer, pH 5.0 at 37° C. for 30 minutes.
Protease Assays
[0160] The following assays for protease activity were used:
AZCL-Casein Assay
[0161] A solution of 0.2% of the blue substrate AZCL-casein is suspended in Borax/NaH2PO4 buffer pH9 while stirring. (For pH profile the buffer system pH 3 to pH 11 is used instead). The solution is distributed while stirring to microtiter plate (100 microL to each well), 30 microL enzyme sample is added and the plates are incubated in an Eppendorf Thermomixer for 30 minutes at 45° C. and 600 rpm. Denatured enzyme sample (100° C. boiling for 20 min) is used as a blank. After incubation the reaction is stopped by transferring the microtiter plate onto ice and the coloured solution is separated from the solid by centrifugation at 3000 rpm for 5 minutes at 4° C. 60 microL of supernatant is transferred to a microtiter plate and the absorbance at 595 nm is measured using a BioRad Microplate Reader.
pNA-Assay
[0162] 50 microL protease sample is added to a microtiter plate and the assay is started by adding 100 microL 1 mM pNA substrate (5 mg dissolved in 100 microL DMSO and further diluted to 10 mL with Borax/NaH2PO4 buffer pH9.0). The increase in OD405 at room temperature is monitored as a measure of the protease activity.
Determination of Maltogenic Amylase Activity (MANU)
[0163] One MANU (Maltogenic Amylase Novo Unit) may be defined as the amount of enzyme required to release one micro mole of maltose per minute at a concentration of 10 mg of maltotriose (Sigma M 8378) substrate per ml of 0.1 M citrate buffer, pH 5.0 at 37° C. for 30 minutes.
Determination of Pullulanase Activity
[0164] Pullulanase activity is determined as described in Example 2 below.
EXAMPLES
Example 1
Cloning and Expression of X46 Domain from Dictyoglomus thermophilum DSM 3960
[0165] A synthetic gene based on the X46 domain (DUF2223 domain) containing polypeptide sequence of Dictyoglomus thermophilum DSM 3960 gene locus DICTH--0512 (Uniprot: B5YCY6) was designed and the gene was codon optimized for Bacillus subtilis as described in EP patent application no. 10173848.2. The amino terminus of the respective polypeptide Uniprot: B5YCY6 was corrected and the sequence MISKKLKGGENSPPLKRFKEGYK (amino acids 1-23 in SEQ ID NO: 92) was predicted to be part of the signal peptide. Therefore, the amino acids 1-41 of SEQ ID NO: 92 were not part of the designed synthetic gene (SEQ ID NO: 93) and the respective translated protein (SEQ ID NO: 94). The synthetic gene comprises the signal peptide of the amyL gene from B. licheniformis (amino acids 1-28 SEQ ID NO: 94) and an affinity tag (amino acids 29-35 in SEQ ID NO: 94) which enabled purification of the mature peptide by affinity chromatography.
[0166] The synthetic gene was extracted by double-digestion according to the manufacturer's manual (FastDigest®, Fermentas, Germany) from a plasmid carrying the synthetic gene. The synthetic gene (SEQ ID NO: 93) was cloned in an E. coli/Bacillus subtilis shuttle plasmid described in shuttle vector described in Example 1 in EP patent application no. 10173848.2 which is hereby incorporated by reference). The derived construct (denoted C624V) was transformed into a suitable B. subtilis host and the gene SEQ ID NO: 93 integrated into the Bacillus subtilis chromosome by homologous recombination into the pectate lyase (pel) locus. The gene was expressed under the control of the a triple promoter system consisting of the promoters from Bacillus licheniformis alpha-amylase gene (amyL), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), and the Bacillus thuringiensis cryIIIA promoter including a stabilizing sequence (as described in WO 99/43835). The gene coding for chloramphenicol acetyltransferase was used as maker (as described in (Diderichsen et al., 1993, Plasmid 30: 312-315). Chloramphenicol resistant clones were analyzed by DNA sequencing to verify the correct DNA sequence of the construct. One expression clone denoted O5BG5 was selected and was cultivated on a rotary shaking table in 500 mL baffled Erlenmeyer flasks each containing 100 mL casein based media supplemented with 6 mg/L chloramphenicol. B. subtilis O5BG5 was cultivated for 5-7 days at 37° C. and successful expression of the mature protein (SEQ ID NO: 94, amino acids 29-284) was observed by SDS-PAGE gel electrophoresis. To partially purify the recombinantly expressed protein from the culture supernatant of a B. subtilis O5BG5 culture, the cell free culture supernatant was subjected to incubation for 30 minutes at 80° C., following a centrifugation at 10.000 rpm for 30 minutes at 4° C. This procedure partially separates the precipitated B. subtilis endogenous polypeptides from the recombinant X46 polypeptide which remains in the water phase of the solution. The treatment did not lead to loss of intact X46 polypeptide as judged by SDS-PAGE analysis, indicating that X46 domain containing polypeptide of Dictyoglomus thermophilum DSM 3960 is a heat stable protein.
Example 2
Determination of Pullulanase Activity
[0167] Petri dishes with AZCL-pullulan (Megazyme) were used for detection of pullulanase activity in culture supernatants or in preparations containing purified pullulanase and were prepared as follows. 115.2 mL Britton-Robinson buffer and 284.8 mL deionized water were mixed and pH was adjusted to 4.5 adding 2 N NaOH. Subsequently 4 g agarose type II (Sigma A6877) was added and the solution was heated with stirring until the agarose was dissolved. After cooling down (to around 55° C.) with stirring, approx. 0.025% AZCL-pullulan (Megazyme) was added and 70 mL was poured in a 14 cm diameter Petri dish. Wells of 4 mm diameter were punched out after solidification of the agarose.
[0168] Alternatively, Petri dishes containing amylopectin were used and prepared as follows. 400 ml BT-agar (6.25 g/L tryptone, 6.25 g/L amylopectin hydrate, 25 g/L granulated agar in deionized water) was mixed at 55° C. with 100 ml Ba2-solution (1 g/L (NH4)2SO4, 2.5 g/L MgSO4.7H2O, 1.25 g/L CaCl2.2H2O, 15 g/L KH2PO4 in deionized water) and 70 mL was poured in a 14 cm diameter Petri plate.
[0169] 500 microL samples were taken from the cultures described in the previous example and centrifuged at 10.000 rpm for 10 minutes at 12° C. 10-20 micro l of the supernatant (or purified pullulanase preparations or assay mixtures) was spotted on the different activity plates and incubated at 40° C. for 16 hours. The formation of halos, i.e. clearing of the amylopectin precipitate or blue color formation around the punched holes indicated pullulanase activity. The activity was scored by measuring the cross diameter of the halos (number 0 in the tables always indicated no pullulanase activity was observed).
Example 3
Purification of Recombinantly Expressed X46 Domain Containing Polypeptide from Dictyoglomus thermophilum DSM 3960
[0170] Two chromatographic steps were used to purify the recombinantly expressed HQ-tagged X46 domain. Briefly, for the first affinity step, the pH of the culture liquid was set to 8.0 and the liquid filtered through a 0.22 micro m bottle top filter. The pH adjusted culture liquid was then applied to a Ni-NTA column pre equilibrated with Buffer A (25 mM Tris/HCl, 5 mM Imidazole, pH 8.0). The X46 domain was eluted from the column by a linear gradient from 0 to 100% Buffer B (25 mM Tris/HCl buffer, 500 mM Imidazole, pH 8.0). After elution, fractions containing X46 domain, as measured by SDS-PAGE, were pooled and concentrated using a VivaCell 250 (Sartorius Stedim) ultrafiltration unit. The concentrate was then diluted with water to the desired volume and pH adjusted to 8.0. After pH adjustment the sample was applied to a Source15Q (GE Healthcare) anion exchange column pre equilibrated with Buffer C (25 mM Tris/Acetate, pH 8.0). Elution was by a linear gradient from 0 to 100% Buffer D (25 mM Tris/Acetate, 1M NaCl, pH 8.0). Fractions containing X46 domain as measured by SDS-PAGE were then collected and pooled.
Example 4
Increased Pullulanase and Amylopullualanse Activity in Combination with X46 Domain Containing Polypeptide from Dictyoglomus thermophilum DSM 3960
[0171] A combination of pullulanase and amylopullulanase and the X46 domain-containing polypeptide from Dictyoglomus thermophilum DSM 3960 from Example 1 was incubated at different temperatures in order to assess the boosting effect on the debranching activity of (i) amylopullulanase that already contains two native X46 domains, (ii) amylopullulanase that were missing X46 domains and (iii) pullulanases of type I that do not have X46 domains by nature.
[0172] Different combinations of 1 micro g of the Thermococcus litoralis and Thermococcus hydrothermalis amylopullulanase X4 chimer (SEQ ID NO: 83) (construct C629Z), also described in U.S. patent application No. 61/289,040 (Novozymes), or 1 micro g of the Thermococcus hydrothermalis amylopullulanase as described in Example 5 of U.S. patent application No. 61/289,040 (Novozymes), or 1 micro g of the purified Bacillus deramificans pullulanase (SEQ ID NO: 97) were spotted together with 5 micro g of purified X46 domain polypeptide from Example 3 in a total volume of 20 microL on screening plates as described in Example 2. Water was used as a negative control to compensate for a possible protein-protein interaction effect, 5 micro g of bovine serum albumin (BSE) (from Sigma) was used instead of X46 domain polypeptide. The following table summarized the observed halo diameters. The Bacillus deramificans pullulanase was not incubated at temperatures 70° C. and 80° C., because the pullulanase is not stable at those temperatures under the assay conditions chosen.
TABLE-US-00005 O/N incl. Temp. 60° C. 70° C. 80° C. X46 domain 0 0 0 X4 Chimer 5 mm 5.5 mm 6.25 mm X4 Chimer + BSA 4 mm 5.5 mm 6 mm X4 Chimer + X46 Domain 6 mm 8 mm 8.75 mm T. hydrothermalis 4 mm 5 mm 4 mm amylopullulanase T. hydrothermalis 4 mm 5.25 mm 4 mm amylopullulanase + BSA T. hydrothermalis 5 mm 6 mm 5 mm amylopullulanase + X46 Domain Bacillus deramificans 7 mm Nd nd pullulanase Bacillus deramificans 7 mm Nd nd pullulanase + BSA Bacillus deramificans 9 mm Nd nd pullulanase + X46 Domain
[0173] In all cases, the addition of X46 domain polypeptide enhanced the activity of the debranching enzymes, especially pronounced for Bacillus deramificans pullulanase at 60° C. and the X4 chimer at 80° C., where both pullulanase enzymes are close to their optimal temperature. The X46 domain alone does not display any debranching activity (0) and must therefore work in synergy with starch-degrading enzymes. Notably, the increased enzyme activity was detected for both types of pullulanases, type I pullulanase (Bacillus deramificans pullulanase) and type II pullulanase (X4 chimer and Thermococcus hydrothermalis amylopullulanase). X46 domain polypeptide in combination with Thermococcus hydrothermalis amylopullulanase, which itself has two X46 domains resulted in a slight enhancement (i.e., up to 1 mm difference).
Example 5
Cloning and Expression of Isolated X46 Domain from Thermococcus hydrothermalis DSM14834 Amylopullulanase
TABLE-US-00006 [0174] Oligo Gene name Oligo seq X46 C1QBX46F AGGGGTATCTCTCGAGAAAAGAACAGACC domain (SEQ ID CAGAGGGTGACG NO: 95) C1QBR GGTGCTGATGGAATTCTGGCTCCTCTCCA (SEQ ID CCAGTTC NO: 96)
[0175] The synthetic gene described as SEQ ID NO: 14 in U.S. patent application No. 61/289,040 (Novozymes) and SEQ ID NO: 98 herein, was used as template to amplify the isolated domain of the amylopullulanase from Thermococcus hydrothermalis. The X46 (DUF2223b) domain was amplified with Phusion polymerase using oligo pairs mentioned in above table and cloned in Pichia pastoris as described in U.S. patent application No. 61/289,040 (Novozymes).
[0176] The sequence of the resulting expression construct (the coding region of the expressed X46 domain and alpha signal peptide is shown in SEQ ID NO: 100 (DNA) and SEQ ID NO: 101 (Peptide) was confirmed and named pX46. The plasmid was transformed into Pichia pastoris using standard electroporation protocol (see WO 2004/069872-A1 hereby incorporated by reference). The resulting transformants (named X46) were grown in BMSY media for 2 days at 28° C. with vigorous shaking. Then cells were induced for 3 days with a daily supplement of 0.5% methanol. The culture supernatant was applied to Invitrogen SDS-polyacrylamide gel electrophoresis. The transformant with strongest band was chosen for further fermentation and subsequent purification.
Purification
[0177] The pH of the Pichia pastoris culture expressing the isolated X46 domain was adjusted to 7.0 with NaOH then filtered through a 0.45 micro m filter. The solution was applied to a 30 mL Ni-sepharose High Performance column (GE Healthcare) which was equilibrated with 20 mM Tris-HCl containing 0.3 M NaCl at pH 7.0. The protein was eluted with a linear imidazole gradient (0-500 mM). Fractions from the column were analyzed by SDS-PAGE.
Amylopullulanase and Isolated X46 Domain
Ratio Profile
[0178] 10 micro g amylopullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), different amounts of X46 domain, 100 microL 0.4% AZCL-HE-pullulan (Megazyme International Ireland Ltd.) and 150 microL buffer at pH 4.5, and different amounts of milliQ water (to give the same final volume for the different ratios) were mixed and incubated at corresponding temperature for 50 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure of pullulanase activity. For each sample the reaction was performed triplicate.
[0179] Results for different ratio (the amount of amylopullulanase was kept at 10 micro g for each reaction). The activity of the 10 micro g amylopullulanase alone was set to 100%.
Ratio Profile for 50° C.
TABLE-US-00007 [0180] Sam- X46 Domain 1 1 1 1 2 5 10 ple Thermococcus 10 5 2 1 1 1 1 ratio hydrothermalis amylo- pullulanase Relative activity (%) 111 88 109 119 117 111 135
Ratio Profile for 75° C.
TABLE-US-00008 [0181] Sam- X46 Domain 1 1 1 1 2 5 10 ple Thermococcus 10 5 2 1 1 1 1 ratio hydrothermalis amylo- pullulanase Relative activity (%) 103 124 139 136 118 133 104
Temperature Profile
[0182] 10 micro g pullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), 20 micro g X46 domain, 100 micro L 0.4% AZCL-HE-pullulan and 150 micro L buffer at pH 4.5 were mixed and incubated at corresponding temperature for 50 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure of pullulanase. For each sample the reaction was performed triplicate.
TABLE-US-00009 Temperature 50° C. 60° C. 70° C. 80° C. Relative activity (%) 100 114 126 178
pH Profile
[0183] pH buffers: 100 mM Succinic acid, HEPES, CHES, CAPSO, 1 mM CaCl2, 150 mM KCl, 0.01% Triton X-100, pH adjusted to 3.5, 4.0, 4.5, 5.0, 6.0 7.0, and 8.0 with HCl and NaOH.
[0184] 10 micro g pullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), 20 micro g X46 domain, 100 microL 0.4% AZCL-HE-pullulan (in MilliQ) and 150 microL 50 mM pH buffer (3.5-8) were mixed and incubated at 50° C. for 30 minutes with shaking at 900 rpm. 100 microL supernatant was transferred to a new microtiter plate. OD595 was read as a measure of pullulanase activity. For each enzyme the reaction was performed triplicate.
TABLE-US-00010 pH 3.5 4 4.5 5 6 7 8 Relative activity (%) 100 146 183 162 157 164 162
Boosting Effect Test of Alpha-Amylase
[0185] 1 micro g alpha-amylase from Subulispora disclosed as SEQ ID NO: 2 in WO 2009/140504 (Novozymes); different amounts of X46 domain; 100 microL 0.4% AZCL-HE-amylose (Megazyme International Ireland Ltd.) at pH 4.5, and different amount of milliQ water (to give the same final volume for different ratio) were mixed and incubated at 37° C. for 30 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure for pullulanase activity. For each sample the reaction was performed triplicate.
[0186] Results for different ratio (the amount of alpha-amylase was kept at 1 micro g for each reaction)
[0187] The activity of the 1 micro g amylase alone was set to 100%.
TABLE-US-00011 Sample ratio Amylase 1 1 1 1 2 5 10 X46 Domain 10 5 2 1 1 1 1 Relative activity (%) 81 133 113 89 133 137 81
[0188] The present invention is further described in the following numbered paragraphs:
[0189] [1] A composition comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme.
[0190] [2] A composition of paragraph 1, wherein the polypeptide comprising or consisting of an X46 domain is selected from the group of: [0191] i) a polypeptide comprising or consisting of the amino acid sequence shown in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; [0192] ii) an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; [0193] iii) a polypeptide determined by Hidden Markov Model (HMM) using SEQ ID NOS: 7-81, 85, 87 and 89 and/or the sequences identified in FIG. 1 (Appendix a), having a HMM score of at least 150; [0194] iv) a variant thereof (i.e., of i), ii) or iii)) comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
[0195] [3] The composition of paragraphs 1 or 2, wherein the polypeptide(s) increase(s) the starch hydrolyzing activity of the starch-degrading enzyme(s).
[0196] [4] The composition of paragraphs 1-3, wherein the starch-degrading enzyme(s) is(are) selected from the group consisting of pullulanases, amylopullulanases, alpha-amylases, isoamylases, beta-amylases, glucoamylases, and CGTases.
[0197] [5] The composition of any of paragraphs 1-4, wherein the HMM score is at least 200.
[0198] [6] The composition of any of paragraphs 1-5, wherein the polypeptide comprising or consisting of an X46 domain is found by HMM selected from the group consisting of any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0199] [7] The composition of any of paragraphs 1-6, wherein the polypeptide comprising or consisting of an X46 domain is selected from the group consisting of: [0200] a. the amino acid sequence shown in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or [0201] b. an amino acid sequence having at least 60% identity to any of SEQ ID NOS 2, 4, 6-81, 85, 87 and 89; or [0202] c. a variant thereof comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
[0203] [8] The composition of any of paragraphs 1-7, wherein the polypeptide comprising or consisting of an X46 domain increases the activity of pullulanases, especially pullulanases of type I of Family GH13 and/or amylopullulanases, especially amylopullulanases of type II of Family GH57.
[0204] [9] The composition of paragraph 8, wherein the pullulanase (EC.3.2.1.41) is of type I of Family GH13, in particular a pullulanase derived from a strain of Bacillus, such as a strain of the species Bacillus deramificans, in particular the pullulanase shown in SEQ ID NO: 97 or a strain of the pullulanase of the species Bacillus acidopullulyticus, in particular the pullulanase shown in SEQ ID NO: 1 in WO 00/01796.
[0205] [10] The composition of any of paragraphs 1-9, wherein the X46 domain containing polypeptide has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to the polypeptide shown in SEQ ID NOS: 2, 4, and 6, wherein the variant has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 2, 4, and 6.
[0206] [11] The composition of any of paragraphs 1 to 10, wherein the polypeptide consisting of an X46 domain or variant thereof has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0207] [12] The composition of any of paragraphs 1-10, wherein the X46 domain comprising polypeptide is derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum; a strain of Pyrococcus, especially a strain of Pyrococcus woesie, or a strain of the genus Thermococcus, including Thermococcus litoralis, Thermococcus hydrothermalis.
[0208] [13] The composition of any of paragraphs 1-12, wherein the X46 domain containing polypeptide does not have any starch-degrading activity, in particular does not have pullulanase activity, alpha-amylase activity, isoamylase activity, beta-amylase activity, glucoamylase activity or CGTase activity.
[0209] [14] The composition of any of paragraphs 1-13, wherein the X46 domain polypeptide consists of: [0210] a. the amino acid sequence shown in any of SEQ ID NOS: 7-81, 85, 87 or 89; or [0211] b. an amino acid sequence having at least 60% identity to any of SEQ ID NO: 7-81, 85, 87 or 89; [0212] c. a variant of any of SEQ ID NOS 7-81, 85, 87 or 89; which optionally further has an N- and/or C-terminal amino acid sequence, wherein said Nand/or C-terminal amino acid sequence(s) consist(s) of 1 to 50 amino acids, preferably 1-25 amino acids, especially 1 to 10 amino acids.
[0213] [15] The composition of any of paragraphs 1-14, wherein the ratio between the polypeptide comprising or consisting of an X46 domain and the starch-degrading enzyme(s) is between 10:1 to 1:10, in particular between 5:1 to 1:5, especially between 2:1 to 1:2, such as around 1:1.
[0214] [16] A polypeptide consisting of an X46 domain selected from the group of: [0215] i). the amino acid sequence shown in any of SEQ ID NOS: 7-81, 85, 87 and 89; or [0216] ii). an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89; or [0217] iii). a variant thereof comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0218] [17] The polypeptide of paragraph 16, wherein the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[0219] [18] The polypeptide of paragraphs 16 or 17, wherein the polypeptide consisting of an X46 domain or a variant thereof has a total number of amino acid substitutions, deletions and/or insertions compared to any of the X46 domain shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
[0220] [19] The polypeptide of any of paragraphs 16-18, wherein the X46 domain is derived from a strain selected from the group consisting of: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix orenii, Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
[0221] [20] An isolated polynucleotide encoding an X46 domain of any of paragraphs 16-19 selected from the consisting of: [0222] i) a polynucleotide having at least 60%, preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% identity with the X46 domain coding part shown in SEQ ID NO: 84, 86 or 88 or a complementary strand thereof; and [0223] ii) a polynucleotide which hybridizes under low stringency, preferably medium, especially high stringency conditions with the X46 domain coding part of SEQ ID NO: 84, 86 or 88 or a complementary strand thereof
[0224] [21] A nucleic acid construct comprising the polynucleotide of paragraphs 20 operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host.
[0225] [22] A recombinant expression vector comprising the nucleic acid construct of paragraph 21.
[0226] [23] A recombinant host cell comprising the nucleic acid construct of paragraph 21 or the vector of paragraph 22.
[0227] [24] A method for producing an X46 domain of any of paragraphs 16-19 comprising (a) cultivating the recombinant host cell of paragraph 23 under conditions conducive for production of an X46 domain; and (b) recovering the X46 domain.
[0228] [25] A process for producing a fermentation product from starch-containing material comprising the steps of: [0229] (a) liquefying starch-containing material in the presence of a composition as defined in any of paragraphs 1-15 and optionally an alpha-amylase, and [0230] (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme; [0231] (c) fermenting using a fermenting organism.
[0232] [26] The process of paragraph 25, wherein the alpha-amylase is of bacterial origin, in particular a Bacillus alpha-amylase.
[0233] [27] The process of paragraphs 25 or 26, wherein the alpha-amylase is a bacterial alpha-amylase derived from a strain of Bacillus, such as Bacillus stearothermophilus, in particular the Bacillus stearothermophilus as disclosed in WO99/019467 as SEQ ID NO: 3 with the double deletion I181+G182 and substitution N193F and/or a hybrid alpha-amylase comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467), with the following substitution: G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the Bacillus licheniformis numbering in SEQ ID NO: 4 of WO 99/19467).
[0234] [28] The process of any of paragraphs 25-27, wherein the alpha-amylase is dosed in an amount of 0.0005-5 KNU per g DS, preferably 0.001-1 KNU per g DS, such as around 0.050 KNU per g DS.
[0235] [29] The process of any of paragraphs 25-28, wherein the alpha-amylase is a fungal alpha-amylase, preferably an acid fungal alpha-amylase or a bacterial alpha-amylase.
[0236] [30] The process of any of paragraphs 25-29, wherein the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A. niger, A. otyzae, A. awamori, or Aspergillus kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
[0237] [31] The process of any of paragraphs 25-30, wherein the alpha-amylase is present in an amount of 0.001 to 10 AFAU/g DS, preferably 0.01 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS or 0.001 to 1 FAU-F/g DS, preferably 0.01 to 1 FAU-F/g DS.
[0238] [32] The process of any of paragraphs 25-31, further wherein a polypeptide comprising or consisting of an X46 domain, preferably of SEQ ID NO: 2, 4, 6-81, 85, 87 and 89 is present during step (a), step (b) or step (c).
[0239] [33] The process of any of paragraphs 25-32, wherein polypeptide comprising an X46 is a pullulanase, preferably a pullulanase of type I of Family GH13 or an amylopullulanase of type II of family GH57.
[0240] [34] The process of paragraph 25-33, wherein pullulanase is the X4 chimer pullulanase shown in SEQ ID NO: 83.
[0241] [35] The process of any of paragraphs 25-34, wherein the polypeptide comprising or consisting of an X46 domain is derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum.
[0242] [36] The process of any of paragraphs 25-35, wherein the polypeptide comprising or consisting of an X46 domain is derived from a strain from the genus Thermococcus, including Thermococcus litoralis and Thermococcus hydrothermalis; or is obtained from a strain of the genus Pyrococcus, such as Pyrococcus woesei.
[0243] [37] The process of any one of paragraphs 25-36, further wherein a protease, in particular an acid fungal protease or a metallo protease is added before, during and/or after liquefaction.
[0244] [38] The process paragraph 37, wherein the metallo protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670.
[0245] [39] The process of any of paragraphs 25-38, wherein the carbohydrate-source generating enzyme is selected from the group consisting of glucoamylase, alpha-glucosidase, maltogenic amylase, and beta-amylase.
[0246] [40] The process of any of paragraphs 25-39, wherein the carbohydrase-source generating enzyme is glucoamylase and is present in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, especially 0.1 to 0.5 AGU/g DS.
[0247] [41] The process of any of paragraphs 25-40, wherein the glucoamylase is derived from a strain of Aspergillus, preferably Aspergillus niger or Aspergillus awamori, a strain of Talaromyces, especially Talaromyces emersonii; or a strain of Athelia, especially Athelia rolfsii; a strain of Trametes, preferably Trametes cingulata; a strain of the genus Pachykytospora, preferably a strain of Pachykytospora papyracea; or a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus; or a strain of the genus Peniophora, preferably a strain of the species Peniophora rufomarginata; or a mixture thereof.
[0248] [42] The process of any of paragraphs 25-41, wherein step (a) is carried out at pH 4-6, preferably at a pH from 4.5 to 5.0, such as around pH 4.5.
[0249] [43] The process of any of paragraphs 25-41, wherein the fermentation product is recovered after fermentation, preferably by distillation.
[0250] [44] The process of any of paragraphs 25-43, wherein the step (b) and (c) are carried out sequentially or simultaneously (i.e., SSF process).
[0251] [45] The process of any of paragraphs 25-44, wherein the fermentation product is a beverage, in particular beer, or alcohol, preferably ethanol, especially fuel ethanol, potable ethanol and/or industrial ethanol.
[0252] [46] The process of any of paragraphs 25-45, wherein the starch-containing starting material is whole grain.
[0253] [47] The process of any of paragraphs 25-46, wherein the starch-containing material is derived from corn, wheat, barley, rye, milo, sago, cassava, manioc, tapioca, sorghum, rice or potatoes.
[0254] [48] The process of any of paragraphs 25-47, wherein the fermenting organism is a strain of Saccharomyces, preferably a strain of Saccharomyces cerevisae.
[0255] [49]. The process of any of paragraphs 25-47, further comprising, prior to the step (a), the steps of: [0256] x) reducing the particle size of starch-containing material, preferably to a particle size to between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, so at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen; y) [0257] y) forming a slurry comprising the starch-containing material and water.
[0258] [50] The process of any of paragraphs 25-49, wherein the slurry in step (a) is heated to above the gelatinization temperature, preferably to a temperature between 70-95° C., preferably 80-90° C., such as around 85° C.
[0259] [51] The process of any of paragraphs 25 or 50, wherein the slurry is jet-cooked at a temperature between 95-140° C., such as 110-135° C., or 105-125° C., for 1-15 minutes, preferably for 3-10 minutes, especially around 5 minutes.
[0260] [52] The use of a composition as defined in any one of paragraphs 1-15 in a process of producing sweeteners from starch.
[0261] [53] The use of a composition of any of paragraphs 1-15, in a process of producing a fermentation product, such as ethanol, from gelatinized.
Sequence CWU
1
10113804DNAThermococcus
hydrothermalismisc_signal(1)..(48)CDS(1)..(3801)Pullulanase 1atg aac ttg
tac cta att aca tta cta ttc gcc agt cta tgc agc gca 48Met Asn Leu
Tyr Leu Ile Thr Leu Leu Phe Ala Ser Leu Cys Ser Ala -25
-20 -15gct gag cca aag cct ttg aac gtc atc atc gtt
tgg cat cag cac caa 96Ala Glu Pro Lys Pro Leu Asn Val Ile Ile Val
Trp His Gln His Gln -10 -5 -1 1
5cct tac tac tac gac cca gtt caa gac gtt tac act aga cct tgg gtc
144Pro Tyr Tyr Tyr Asp Pro Val Gln Asp Val Tyr Thr Arg Pro Trp Val
10 15 20aga ttg cat gct gcc
aac aac tac tgg aag atg gct cac tac ttg tct 192Arg Leu His Ala Ala
Asn Asn Tyr Trp Lys Met Ala His Tyr Leu Ser 25
30 35caa tac cct gag gtt cat gct acc atc gac ttg tct
ggt tct ttg atc 240Gln Tyr Pro Glu Val His Ala Thr Ile Asp Leu Ser
Gly Ser Leu Ile 40 45 50gct caa
ttg gcc gac tac atg aac ggt aag aag gac act tac caa atc 288Ala Gln
Leu Ala Asp Tyr Met Asn Gly Lys Lys Asp Thr Tyr Gln Ile 55
60 65atc act gag aag atc gcc aac ggt gag cct ttg
act gtt gac gag aag 336Ile Thr Glu Lys Ile Ala Asn Gly Glu Pro Leu
Thr Val Asp Glu Lys70 75 80
85tgg ttc atg ttg caa gcc cct gga ggt ttc ttc gac aac act atc cca
384Trp Phe Met Leu Gln Ala Pro Gly Gly Phe Phe Asp Asn Thr Ile Pro
90 95 100tgg aac ggt gag cct
atc acc gac cca aac gga aac cct atc aga gac 432Trp Asn Gly Glu Pro
Ile Thr Asp Pro Asn Gly Asn Pro Ile Arg Asp 105
110 115ttc tgg gac aga tac act gag ttg aag aac aag atg
ttg tct gcc aag 480Phe Trp Asp Arg Tyr Thr Glu Leu Lys Asn Lys Met
Leu Ser Ala Lys 120 125 130gcc aag
tac gcc aac ttc gtc acc gag tct caa aag gtt gcc gtt acc 528Ala Lys
Tyr Ala Asn Phe Val Thr Glu Ser Gln Lys Val Ala Val Thr 135
140 145aac gag ttc acc gag cag gac tac atc gac ttg
gcc gtc ttg ttc aac 576Asn Glu Phe Thr Glu Gln Asp Tyr Ile Asp Leu
Ala Val Leu Phe Asn150 155 160
165ttg gcc tgg atc gac tac aac tac atc acc tct act cca gag ttc aag
624Leu Ala Trp Ile Asp Tyr Asn Tyr Ile Thr Ser Thr Pro Glu Phe Lys
170 175 180gca ttg tac gac aag
gtt gac gag ggt gga tac aca aga gcc gac gtt 672Ala Leu Tyr Asp Lys
Val Asp Glu Gly Gly Tyr Thr Arg Ala Asp Val 185
190 195aag acc gtc ttg gac gcc caa atc tgg ttg ttg aac
cac acc ttc gag 720Lys Thr Val Leu Asp Ala Gln Ile Trp Leu Leu Asn
His Thr Phe Glu 200 205 210gag cat
gag aag atc aac ttg ttg ttg ggt aac ggt aac gtt gag gtc 768Glu His
Glu Lys Ile Asn Leu Leu Leu Gly Asn Gly Asn Val Glu Val 215
220 225aca gtt gtt cct tac gct cac cca atc gga cct
atc ttg aac gac ttc 816Thr Val Val Pro Tyr Ala His Pro Ile Gly Pro
Ile Leu Asn Asp Phe230 235 240
245ggt tgg gac tcc gac ttc aac gac cag gtc aag aag gcc gac gag ttg
864Gly Trp Asp Ser Asp Phe Asn Asp Gln Val Lys Lys Ala Asp Glu Leu
250 255 260tac aag cct tac ttg
gga gga ggt aca gcc gtt cca aag gga gga tgg 912Tyr Lys Pro Tyr Leu
Gly Gly Gly Thr Ala Val Pro Lys Gly Gly Trp 265
270 275gct gcc gag tct gct ttg aac gac aag act ttg gag
atc ttg gct gag 960Ala Ala Glu Ser Ala Leu Asn Asp Lys Thr Leu Glu
Ile Leu Ala Glu 280 285 290aac gga
tgg gag tgg gtt atg acc gac cag atg gtt ttg ggt aag ttg 1008Asn Gly
Trp Glu Trp Val Met Thr Asp Gln Met Val Leu Gly Lys Leu 295
300 305ggt atc gag gga acc gtt gag aac tac cat aag
cct tgg gtt gca gag 1056Gly Ile Glu Gly Thr Val Glu Asn Tyr His Lys
Pro Trp Val Ala Glu310 315 320
325ttc aac ggt aag aag atc tac ttg ttc cca aga aac cac gac ttg tca
1104Phe Asn Gly Lys Lys Ile Tyr Leu Phe Pro Arg Asn His Asp Leu Ser
330 335 340gac aga gtt gga ttc
act tac tct gga atg aac caa cag caa gct gtt 1152Asp Arg Val Gly Phe
Thr Tyr Ser Gly Met Asn Gln Gln Gln Ala Val 345
350 355gag gac ttc gtc aac gag ttg ttg aag ttg caa aag
caa aac tac gac 1200Glu Asp Phe Val Asn Glu Leu Leu Lys Leu Gln Lys
Gln Asn Tyr Asp 360 365 370ggt tcc
ttg gtt tac gtt gtt act ttg gac gga gag aac cca gtc gag 1248Gly Ser
Leu Val Tyr Val Val Thr Leu Asp Gly Glu Asn Pro Val Glu 375
380 385aac tac cct tac gac ggt gag ttg ttc ttg act
gag ttg tac aag aag 1296Asn Tyr Pro Tyr Asp Gly Glu Leu Phe Leu Thr
Glu Leu Tyr Lys Lys390 395 400
405ttg aca gag ttg caa gag caa gga ttg atc aga act ttg acc cct tca
1344Leu Thr Glu Leu Gln Glu Gln Gly Leu Ile Arg Thr Leu Thr Pro Ser
410 415 420gag tac atc cag ttg
tac ggt gac aag gcc aac aag ttg act cct aga 1392Glu Tyr Ile Gln Leu
Tyr Gly Asp Lys Ala Asn Lys Leu Thr Pro Arg 425
430 435atg atg gag aga ttg gac ttg aca ggt gac aac gtc
aac gct ttg ttg 1440Met Met Glu Arg Leu Asp Leu Thr Gly Asp Asn Val
Asn Ala Leu Leu 440 445 450aag gcc
cag tcc ttg ggt gag ttg tac gac atg acc gga gtc aag gag 1488Lys Ala
Gln Ser Leu Gly Glu Leu Tyr Asp Met Thr Gly Val Lys Glu 455
460 465gag atg caa tgg cca gag agt agt tgg atc gac
ggt act ttg agt act 1536Glu Met Gln Trp Pro Glu Ser Ser Trp Ile Asp
Gly Thr Leu Ser Thr470 475 480
485tgg atc ggt gag cct cag gag aac tac ggt tgg tac tgg ttg tac atg
1584Trp Ile Gly Glu Pro Gln Glu Asn Tyr Gly Trp Tyr Trp Leu Tyr Met
490 495 500gcc aga aag gcc ttg
atg gag aac aag gac aag atg tca caa gcc gac 1632Ala Arg Lys Ala Leu
Met Glu Asn Lys Asp Lys Met Ser Gln Ala Asp 505
510 515tgg gag aag gcc tac gag tac ttg ttg aga gcc gag
gct tcc gac tgg 1680Trp Glu Lys Ala Tyr Glu Tyr Leu Leu Arg Ala Glu
Ala Ser Asp Trp 520 525 530ttc tgg
tgg tac ggt tcc gac caa gac tct ggt cag gac tac act ttc 1728Phe Trp
Trp Tyr Gly Ser Asp Gln Asp Ser Gly Gln Asp Tyr Thr Phe 535
540 545gac aga tac ttg aag aca tac ttg tac gag atg
tac aag ttg gct gga 1776Asp Arg Tyr Leu Lys Thr Tyr Leu Tyr Glu Met
Tyr Lys Leu Ala Gly550 555 560
565gtt gag cct cca tcc tac ttg ttc gga aac tac ttc cca gac gga gag
1824Val Glu Pro Pro Ser Tyr Leu Phe Gly Asn Tyr Phe Pro Asp Gly Glu
570 575 580cct tac aca act aga
ggt ttg gtt ggt ttg aag gac gga gag atg aag 1872Pro Tyr Thr Thr Arg
Gly Leu Val Gly Leu Lys Asp Gly Glu Met Lys 585
590 595aac ttc tcc agt atg tca cca ttg gcc aag ggt gtc
tct gtc tac ttc 1920Asn Phe Ser Ser Met Ser Pro Leu Ala Lys Gly Val
Ser Val Tyr Phe 600 605 610gac ggt
gag ggt atc cat ttc atc gtt aag gga aac ttg gac aga ttc 1968Asp Gly
Glu Gly Ile His Phe Ile Val Lys Gly Asn Leu Asp Arg Phe 615
620 625gag gtc tca atc tgg gag aag gac gag aga gtt
ggt aac act ttc act 2016Glu Val Ser Ile Trp Glu Lys Asp Glu Arg Val
Gly Asn Thr Phe Thr630 635 640
645aga ttg cag gag aag cca gac gag ttg tct tac ttc atg ttc cct ttc
2064Arg Leu Gln Glu Lys Pro Asp Glu Leu Ser Tyr Phe Met Phe Pro Phe
650 655 660tcc aga gac tct gtt
ggt ttg ttg atc aca aag cat gtt gtt tac gag 2112Ser Arg Asp Ser Val
Gly Leu Leu Ile Thr Lys His Val Val Tyr Glu 665
670 675aac ggt aag gcc gag atc tac ggt gct acc gac tac
gag aag tcc gag 2160Asn Gly Lys Ala Glu Ile Tyr Gly Ala Thr Asp Tyr
Glu Lys Ser Glu 680 685 690aag ttg
gga gag gcc act gtc aag aac act agt gag gga atc gag gtc 2208Lys Leu
Gly Glu Ala Thr Val Lys Asn Thr Ser Glu Gly Ile Glu Val 695
700 705gtc ttg cct ttc gac tac atc gag aac cca tcc
gac ttc tac ttc gcc 2256Val Leu Pro Phe Asp Tyr Ile Glu Asn Pro Ser
Asp Phe Tyr Phe Ala710 715 720
725gtt tcc acc gtc aag gac ggt gac ttg gag gtt atc tcc aca cct gtt
2304Val Ser Thr Val Lys Asp Gly Asp Leu Glu Val Ile Ser Thr Pro Val
730 735 740gag ttg aag ttg cct
acc gag gtc aag ggt gtt gtt atc gcc gac atc 2352Glu Leu Lys Leu Pro
Thr Glu Val Lys Gly Val Val Ile Ala Asp Ile 745
750 755aca gac cca gag ggt gac gac cat ggt cca ggt aac
tac aca tac cca 2400Thr Asp Pro Glu Gly Asp Asp His Gly Pro Gly Asn
Tyr Thr Tyr Pro 760 765 770acc gac
aag gtt ttc aag cca gga gtt ttc gac ttg ttg aga ttc aga 2448Thr Asp
Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg Phe Arg 775
780 785atg ttg gag caa act gag agt tac gtt atg gag
ttc tac ttc aag gac 2496Met Leu Glu Gln Thr Glu Ser Tyr Val Met Glu
Phe Tyr Phe Lys Asp790 795 800
805ttg gga ggt aac cct tgg aac ggt cca aac gga ttc tcc ttg cag atc
2544Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile
810 815 820atc gag gtt tac ttg
gac ttc aag gac gga gga aac tcc tca gcc atc 2592Ile Glu Val Tyr Leu
Asp Phe Lys Asp Gly Gly Asn Ser Ser Ala Ile 825
830 835aag atg ttc cca gac gga cct gga gcc aac gtt aac
ttg gac cca gag 2640Lys Met Phe Pro Asp Gly Pro Gly Ala Asn Val Asn
Leu Asp Pro Glu 840 845 850cac cca
tgg gac gtt gcc ttc aga att gcc ggt tgg gac tac gga aac 2688His Pro
Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly Asn 855
860 865ttg atc atc ttg cca aac gga act gcc atc caa
ggt gag atg caa atc 2736Leu Ile Ile Leu Pro Asn Gly Thr Ala Ile Gln
Gly Glu Met Gln Ile870 875 880
885tct gcc gac cct gtc aag aac gct atc atc gtt aag gtt cct aag aag
2784Ser Ala Asp Pro Val Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys
890 895 900tac atc gcc atc aac
gag gac tac ggt ttg tgg ggt gac gtc ttg gtt 2832Tyr Ile Ala Ile Asn
Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Val 905
910 915gga tca cag gac ggt tac gga cca gac aag tgg aga
aca gct gcc gtc 2880Gly Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg
Thr Ala Ala Val 920 925 930gac gcc
gag caa tgg aag ttg gga gga gcc gac cca caa gct gtt atc 2928Asp Ala
Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile 935
940 945aac gga gtt gct cct aga gtt atc gac gag ttg
gtt cca cag gga ttc 2976Asn Gly Val Ala Pro Arg Val Ile Asp Glu Leu
Val Pro Gln Gly Phe950 955 960
965gag cca aca cag gag gag caa ttg tcc tcc tac gac gcc aac gac atg
3024Glu Pro Thr Gln Glu Glu Gln Leu Ser Ser Tyr Asp Ala Asn Asp Met
970 975 980aag ttg gct acc gtc
aag gca ttg ttg ttg ttg aag caa ggt atc gtt 3072Lys Leu Ala Thr Val
Lys Ala Leu Leu Leu Leu Lys Gln Gly Ile Val 985
990 995gtt aca gac cct gag ggt gac gac cat gga cca gga
aca tac aca 3117Val Thr Asp Pro Glu Gly Asp Asp His Gly Pro Gly
Thr Tyr Thr 1000 1005 1010tac cct
acc gac aag gtt ttc aag cca ggt gtt ttc gac ttg ttg 3162Tyr Pro
Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu 1015
1020 1025aag ttc aag gtt aca gag gga agt gac
gac tgg act ttg gag ttc 3207Lys Phe Lys Val Thr Glu Gly Ser Asp
Asp Trp Thr Leu Glu Phe 1030 1035
1040cat ttc aag gac ttg gga ggt aac cct tgg aac ggt cca aac ggt
3252His Phe Lys Asp Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly
1045 1050 1055ttc tct ttg cag atc atc
gag gtt tac ttc gac ttc aag gag gga 3297Phe Ser Leu Gln Ile Ile
Glu Val Tyr Phe Asp Phe Lys Glu Gly 1060 1065
1070ggt aac gtc tcc gcc atc aag atg ttc cca gac ggt cct
gga tca 3342Gly Asn Val Ser Ala Ile Lys Met Phe Pro Asp Gly Pro
Gly Ser 1075 1080 1085aac gtt aga
ttg gac cca aat cac cca tgg gac ttg gcc ttg aga 3387Asn Val Arg
Leu Asp Pro Asn His Pro Trp Asp Leu Ala Leu Arg 1090
1095 1100att gcc ggt tgg gac tac ggt aac ttg atc
atc ttg cca gac ggt 3432Ile Ala Gly Trp Asp Tyr Gly Asn Leu Ile
Ile Leu Pro Asp Gly 1105 1110
1115acc gcc tac cag ggt gag atg caa atc tct gcc gac cca gtt aag
3477Thr Ala Tyr Gln Gly Glu Met Gln Ile Ser Ala Asp Pro Val Lys
1120 1125 1130aac gcc atc atc gtc aag
gtt cct aag aag tac ttg aac atc tca 3522Asn Ala Ile Ile Val Lys
Val Pro Lys Lys Tyr Leu Asn Ile Ser 1135 1140
1145gac tac gga ttg tac aca gcc gtc atc gtt gga tct cag
gac ggt 3567Asp Tyr Gly Leu Tyr Thr Ala Val Ile Val Gly Ser Gln
Asp Gly 1150 1155 1160tac ggt cca
gac aag tgg aga cct gtt gct gcc gag gct gag caa 3612Tyr Gly Pro
Asp Lys Trp Arg Pro Val Ala Ala Glu Ala Glu Gln 1165
1170 1175tgg aag ttg ggt ggt gcc gac cca caa gct
gtt atc gac aac ttg 3657Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala
Val Ile Asp Asn Leu 1180 1185
1190gtt cca aga gtt gtt gac gag ttg gtt cca gag gga ttc aag cca
3702Val Pro Arg Val Val Asp Glu Leu Val Pro Glu Gly Phe Lys Pro
1195 1200 1205aca cag gag gag caa ttg
tct tca tac gac ttg gag aag aag act 3747Thr Gln Glu Glu Gln Leu
Ser Ser Tyr Asp Leu Glu Lys Lys Thr 1210 1215
1220ttg gcc act gtt ttg atg gtt cca ttg gtt aac gga act
ggt gga 3792Leu Ala Thr Val Leu Met Val Pro Leu Val Asn Gly Thr
Gly Gly 1225 1230 1235gag gag cca
taa 3804Glu Glu Pro
124021267PRTThermococcus hydrothermalis 2Met Asn Leu Tyr Leu Ile Thr
Leu Leu Phe Ala Ser Leu Cys Ser Ala -25 -20
-15Ala Glu Pro Lys Pro Leu Asn Val Ile Ile Val Trp His Gln His
Gln -10 -5 -1 1 5Pro Tyr
Tyr Tyr Asp Pro Val Gln Asp Val Tyr Thr Arg Pro Trp Val 10
15 20Arg Leu His Ala Ala Asn Asn Tyr
Trp Lys Met Ala His Tyr Leu Ser 25 30
35Gln Tyr Pro Glu Val His Ala Thr Ile Asp Leu Ser Gly Ser Leu
Ile 40 45 50Ala Gln Leu Ala Asp
Tyr Met Asn Gly Lys Lys Asp Thr Tyr Gln Ile 55 60
65Ile Thr Glu Lys Ile Ala Asn Gly Glu Pro Leu Thr Val Asp
Glu Lys70 75 80 85Trp
Phe Met Leu Gln Ala Pro Gly Gly Phe Phe Asp Asn Thr Ile Pro
90 95 100Trp Asn Gly Glu Pro Ile Thr
Asp Pro Asn Gly Asn Pro Ile Arg Asp 105 110
115Phe Trp Asp Arg Tyr Thr Glu Leu Lys Asn Lys Met Leu Ser
Ala Lys 120 125 130Ala Lys Tyr Ala
Asn Phe Val Thr Glu Ser Gln Lys Val Ala Val Thr 135
140 145Asn Glu Phe Thr Glu Gln Asp Tyr Ile Asp Leu Ala
Val Leu Phe Asn150 155 160
165Leu Ala Trp Ile Asp Tyr Asn Tyr Ile Thr Ser Thr Pro Glu Phe Lys
170 175 180Ala Leu Tyr Asp Lys
Val Asp Glu Gly Gly Tyr Thr Arg Ala Asp Val 185
190 195Lys Thr Val Leu Asp Ala Gln Ile Trp Leu Leu Asn
His Thr Phe Glu 200 205 210Glu His
Glu Lys Ile Asn Leu Leu Leu Gly Asn Gly Asn Val Glu Val 215
220 225Thr Val Val Pro Tyr Ala His Pro Ile Gly Pro
Ile Leu Asn Asp Phe230 235 240
245Gly Trp Asp Ser Asp Phe Asn Asp Gln Val Lys Lys Ala Asp Glu Leu
250 255 260Tyr Lys Pro Tyr
Leu Gly Gly Gly Thr Ala Val Pro Lys Gly Gly Trp 265
270 275Ala Ala Glu Ser Ala Leu Asn Asp Lys Thr Leu
Glu Ile Leu Ala Glu 280 285 290Asn
Gly Trp Glu Trp Val Met Thr Asp Gln Met Val Leu Gly Lys Leu 295
300 305Gly Ile Glu Gly Thr Val Glu Asn Tyr His
Lys Pro Trp Val Ala Glu310 315 320
325Phe Asn Gly Lys Lys Ile Tyr Leu Phe Pro Arg Asn His Asp Leu
Ser 330 335 340Asp Arg Val
Gly Phe Thr Tyr Ser Gly Met Asn Gln Gln Gln Ala Val 345
350 355Glu Asp Phe Val Asn Glu Leu Leu Lys Leu
Gln Lys Gln Asn Tyr Asp 360 365
370Gly Ser Leu Val Tyr Val Val Thr Leu Asp Gly Glu Asn Pro Val Glu 375
380 385Asn Tyr Pro Tyr Asp Gly Glu Leu
Phe Leu Thr Glu Leu Tyr Lys Lys390 395
400 405Leu Thr Glu Leu Gln Glu Gln Gly Leu Ile Arg Thr
Leu Thr Pro Ser 410 415
420Glu Tyr Ile Gln Leu Tyr Gly Asp Lys Ala Asn Lys Leu Thr Pro Arg
425 430 435Met Met Glu Arg Leu Asp
Leu Thr Gly Asp Asn Val Asn Ala Leu Leu 440 445
450Lys Ala Gln Ser Leu Gly Glu Leu Tyr Asp Met Thr Gly Val
Lys Glu 455 460 465Glu Met Gln Trp Pro
Glu Ser Ser Trp Ile Asp Gly Thr Leu Ser Thr470 475
480 485Trp Ile Gly Glu Pro Gln Glu Asn Tyr Gly
Trp Tyr Trp Leu Tyr Met 490 495
500Ala Arg Lys Ala Leu Met Glu Asn Lys Asp Lys Met Ser Gln Ala Asp
505 510 515Trp Glu Lys Ala Tyr
Glu Tyr Leu Leu Arg Ala Glu Ala Ser Asp Trp 520
525 530Phe Trp Trp Tyr Gly Ser Asp Gln Asp Ser Gly Gln
Asp Tyr Thr Phe 535 540 545Asp Arg Tyr
Leu Lys Thr Tyr Leu Tyr Glu Met Tyr Lys Leu Ala Gly550
555 560 565Val Glu Pro Pro Ser Tyr Leu
Phe Gly Asn Tyr Phe Pro Asp Gly Glu 570
575 580Pro Tyr Thr Thr Arg Gly Leu Val Gly Leu Lys Asp
Gly Glu Met Lys 585 590 595Asn
Phe Ser Ser Met Ser Pro Leu Ala Lys Gly Val Ser Val Tyr Phe 600
605 610Asp Gly Glu Gly Ile His Phe Ile Val
Lys Gly Asn Leu Asp Arg Phe 615 620
625Glu Val Ser Ile Trp Glu Lys Asp Glu Arg Val Gly Asn Thr Phe Thr630
635 640 645Arg Leu Gln Glu
Lys Pro Asp Glu Leu Ser Tyr Phe Met Phe Pro Phe 650
655 660Ser Arg Asp Ser Val Gly Leu Leu Ile Thr
Lys His Val Val Tyr Glu 665 670
675Asn Gly Lys Ala Glu Ile Tyr Gly Ala Thr Asp Tyr Glu Lys Ser Glu
680 685 690Lys Leu Gly Glu Ala Thr Val
Lys Asn Thr Ser Glu Gly Ile Glu Val 695 700
705Val Leu Pro Phe Asp Tyr Ile Glu Asn Pro Ser Asp Phe Tyr Phe
Ala710 715 720 725Val Ser
Thr Val Lys Asp Gly Asp Leu Glu Val Ile Ser Thr Pro Val
730 735 740Glu Leu Lys Leu Pro Thr Glu
Val Lys Gly Val Val Ile Ala Asp Ile 745 750
755Thr Asp Pro Glu Gly Asp Asp His Gly Pro Gly Asn Tyr Thr
Tyr Pro 760 765 770Thr Asp Lys Val
Phe Lys Pro Gly Val Phe Asp Leu Leu Arg Phe Arg 775
780 785Met Leu Glu Gln Thr Glu Ser Tyr Val Met Glu Phe
Tyr Phe Lys Asp790 795 800
805Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile
810 815 820Ile Glu Val Tyr Leu
Asp Phe Lys Asp Gly Gly Asn Ser Ser Ala Ile 825
830 835Lys Met Phe Pro Asp Gly Pro Gly Ala Asn Val Asn
Leu Asp Pro Glu 840 845 850His Pro
Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly Asn 855
860 865Leu Ile Ile Leu Pro Asn Gly Thr Ala Ile Gln
Gly Glu Met Gln Ile870 875 880
885Ser Ala Asp Pro Val Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys
890 895 900Tyr Ile Ala Ile
Asn Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Val 905
910 915Gly Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp
Arg Thr Ala Ala Val 920 925 930Asp
Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile 935
940 945Asn Gly Val Ala Pro Arg Val Ile Asp Glu
Leu Val Pro Gln Gly Phe950 955 960
965Glu Pro Thr Gln Glu Glu Gln Leu Ser Ser Tyr Asp Ala Asn Asp
Met 970 975 980Lys Leu Ala
Thr Val Lys Ala Leu Leu Leu Leu Lys Gln Gly Ile Val 985
990 995Val Thr Asp Pro Glu Gly Asp Asp His Gly
Pro Gly Thr Tyr Thr 1000 1005
1010Tyr Pro Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu
1015 1020 1025Lys Phe Lys Val Thr Glu
Gly Ser Asp Asp Trp Thr Leu Glu Phe 1030 1035
1040His Phe Lys Asp Leu Gly Gly Asn Pro Trp Asn Gly Pro
Asn Gly 1045 1050 1055Phe Ser Leu
Gln Ile Ile Glu Val Tyr Phe Asp Phe Lys Glu Gly 1060
1065 1070Gly Asn Val Ser Ala Ile Lys Met Phe Pro
Asp Gly Pro Gly Ser 1075 1080
1085Asn Val Arg Leu Asp Pro Asn His Pro Trp Asp Leu Ala Leu Arg
1090 1095 1100Ile Ala Gly Trp Asp Tyr
Gly Asn Leu Ile Ile Leu Pro Asp Gly 1105 1110
1115Thr Ala Tyr Gln Gly Glu Met Gln Ile Ser Ala Asp Pro
Val Lys 1120 1125 1130Asn Ala Ile
Ile Val Lys Val Pro Lys Lys Tyr Leu Asn Ile Ser 1135
1140 1145Asp Tyr Gly Leu Tyr Thr Ala Val Ile Val
Gly Ser Gln Asp Gly 1150 1155
1160Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu Ala Glu Gln
1165 1170 1175Trp Lys Leu Gly Gly Ala
Asp Pro Gln Ala Val Ile Asp Asn Leu 1180 1185
1190Val Pro Arg Val Val Asp Glu Leu Val Pro Glu Gly Phe
Lys Pro 1195 1200 1205Thr Gln Glu
Glu Gln Leu Ser Ser Tyr Asp Leu Glu Lys Lys Thr 1210
1215 1220Leu Ala Thr Val Leu Met Val Pro Leu Val
Asn Gly Thr Gly Gly 1225 1230
1235Glu Glu Pro 124032541DNAFervidobacterium
nodosumsig_peptide(1)..(81)CDS(1)..(2538)Pullulanase 3atg aag aaa ccg ttg
ggg aaa att gtc gca agc acc gca cta ctc att 48Met Lys Lys Pro Leu
Gly Lys Ile Val Ala Ser Thr Ala Leu Leu Ile -25
-20 -15tct gtt gct ttt agt tca tcg atc gca tcg gct gct
act gag ctt gta 96Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala Ala
Thr Glu Leu Val -10 -5 -1 1
5atc cac tat cac cgc tgg gac ggc aac tac gac ggc tgg aac ctt tgg
144Ile His Tyr His Arg Trp Asp Gly Asn Tyr Asp Gly Trp Asn Leu Trp
10 15 20atc tgg tgg gtt gag ccg
atc agc aag gat ggc gca gca tac cag ttt 192Ile Trp Trp Val Glu Pro
Ile Ser Lys Asp Gly Ala Ala Tyr Gln Phe 25 30
35act gag aaa gac gac ttc ggc gta gtt gct cgc gta aag
ttt gac gag 240Thr Glu Lys Asp Asp Phe Gly Val Val Ala Arg Val Lys
Phe Asp Glu 40 45 50acg ctt aca
aag gtt ggc atc atc gtt cgc ctt aac gag tgg aag gag 288Thr Leu Thr
Lys Val Gly Ile Ile Val Arg Leu Asn Glu Trp Lys Glu 55
60 65aag gac gta gca atg gac cgc ttc atc agc atc aaa
gac ggc aag gca 336Lys Asp Val Ala Met Asp Arg Phe Ile Ser Ile Lys
Asp Gly Lys Ala70 75 80
85gag gta tgg ctt ctt cag ggc atc gag caa atc tat act act aag cca
384Glu Val Trp Leu Leu Gln Gly Ile Glu Gln Ile Tyr Thr Thr Lys Pro
90 95 100gac act tca cct cgc
gta ctt ttt gct caa gct cgc gct caa gac gtt 432Asp Thr Ser Pro Arg
Val Leu Phe Ala Gln Ala Arg Ala Gln Asp Val 105
110 115atc gag gcg tat ctt aca ggc caa gtt gac aca act
aag gta tct gct 480Ile Glu Ala Tyr Leu Thr Gly Gln Val Asp Thr Thr
Lys Val Ser Ala 120 125 130aag gtt
aca gta gac ggc gta gag cgc aag gtt gct aag gta gag aag 528Lys Val
Thr Val Asp Gly Val Glu Arg Lys Val Ala Lys Val Glu Lys 135
140 145gct aac cct act gac atc tct aag aca aac cac
gta aag atc act ctt 576Ala Asn Pro Thr Asp Ile Ser Lys Thr Asn His
Val Lys Ile Thr Leu150 155 160
165gct gag cct atc aag ctt gac gag gta aac aag gac gta caa gtt gag
624Ala Glu Pro Ile Lys Leu Asp Glu Val Asn Lys Asp Val Gln Val Glu
170 175 180atc gag ggc tac aag
cca gct cgc gta atc atg atg gag atc ctt gac 672Ile Glu Gly Tyr Lys
Pro Ala Arg Val Ile Met Met Glu Ile Leu Asp 185
190 195aaa atc tat tac gat ggc cca ctt ggc ttc gag tac
tca cct aca aag 720Lys Ile Tyr Tyr Asp Gly Pro Leu Gly Phe Glu Tyr
Ser Pro Thr Lys 200 205 210act act
atc cgc gta tgg tca cct gtt tca aaa aca gta gac ctt ctt 768Thr Thr
Ile Arg Val Trp Ser Pro Val Ser Lys Thr Val Asp Leu Leu 215
220 225ctt tac aag aac tgg gac gac aaa gag cct aca
aaa gta gtt ccg atg 816Leu Tyr Lys Asn Trp Asp Asp Lys Glu Pro Thr
Lys Val Val Pro Met230 235 240
245aag tac atc ggc aat ggt gcg tgg gag gct gtt ctt gac ggc gac tgg
864Lys Tyr Ile Gly Asn Gly Ala Trp Glu Ala Val Leu Asp Gly Asp Trp
250 255 260gag ggc tgg ttc tat
cgc atc cgc tac ttc tct tac ggc gag tac cgc 912Glu Gly Trp Phe Tyr
Arg Ile Arg Tyr Phe Ser Tyr Gly Glu Tyr Arg 265
270 275gag ggc gta gac tac ttt agc aag gct gta aca aag
aac tca gct aag 960Glu Gly Val Asp Tyr Phe Ser Lys Ala Val Thr Lys
Asn Ser Ala Lys 280 285 290tct gca
atc atc gac ctt aag aag aca aac cct tct gac tgg gac aag 1008Ser Ala
Ile Ile Asp Leu Lys Lys Thr Asn Pro Ser Asp Trp Asp Lys 295
300 305gac gta cgt ccg act atg aag gcg ctt gag gac
gct atc atc tac gag 1056Asp Val Arg Pro Thr Met Lys Ala Leu Glu Asp
Ala Ile Ile Tyr Glu310 315 320
325atc cat atc gct gac atg act ggc ctt gac aac agc aac gta aag aac
1104Ile His Ile Ala Asp Met Thr Gly Leu Asp Asn Ser Asn Val Lys Asn
330 335 340aag gct aca tat ctt
ggc ctt act gag aag ggc aca cgt ggc cct aac 1152Lys Ala Thr Tyr Leu
Gly Leu Thr Glu Lys Gly Thr Arg Gly Pro Asn 345
350 355ggc gta acg act ggc ctt gac cat ctt gtt gag ctt
ggc gtt aca cat 1200Gly Val Thr Thr Gly Leu Asp His Leu Val Glu Leu
Gly Val Thr His 360 365 370gtt cac
atc ctt cca atg ttc gac ttc tat act ggc gac gag tct gag 1248Val His
Ile Leu Pro Met Phe Asp Phe Tyr Thr Gly Asp Glu Ser Glu 375
380 385cgc gac ttc gag aag tct tac aac tgg ggc tat
gac cct tac ctt ttc 1296Arg Asp Phe Glu Lys Ser Tyr Asn Trp Gly Tyr
Asp Pro Tyr Leu Phe390 395 400
405act gta cca gaa ggt cgc tac tct aca aac cca atc gac cct cac gta
1344Thr Val Pro Glu Gly Arg Tyr Ser Thr Asn Pro Ile Asp Pro His Val
410 415 420cgc atc aac gag gta
aag cag atg gta aag gct ctt cat gag aac ggc 1392Arg Ile Asn Glu Val
Lys Gln Met Val Lys Ala Leu His Glu Asn Gly 425
430 435atc cgc gta atc ctt gac atg gta ttc cct cac aca
ttt ggc atc ggc 1440Ile Arg Val Ile Leu Asp Met Val Phe Pro His Thr
Phe Gly Ile Gly 440 445 450gta ctt
tca cca ttt gac act gca gta cca tac tat ttc tat cgc atc 1488Val Leu
Ser Pro Phe Asp Thr Ala Val Pro Tyr Tyr Phe Tyr Arg Ile 455
460 465gac aag act ggc gca tac ctt aac gag tca ggc
gta ggt aac gta atg 1536Asp Lys Thr Gly Ala Tyr Leu Asn Glu Ser Gly
Val Gly Asn Val Met470 475 480
485gca act gaa cgc cca atg ctt cgc aag tac gta atc gac act ctt aag
1584Ala Thr Glu Arg Pro Met Leu Arg Lys Tyr Val Ile Asp Thr Leu Lys
490 495 500tgg tgg gta ctt gag
tac cat gta gac ggc ttc cgc ttt gac caa atg 1632Trp Trp Val Leu Glu
Tyr His Val Asp Gly Phe Arg Phe Asp Gln Met 505
510 515ggc ctt atg gac aag aag aca atg ctt gac ctt gag
aag gag ctt cat 1680Gly Leu Met Asp Lys Lys Thr Met Leu Asp Leu Glu
Lys Glu Leu His 520 525 530gcg atc
gac cct act atc ctt ctt tac ggc gag ccg tgg ggt ggc tgg 1728Ala Ile
Asp Pro Thr Ile Leu Leu Tyr Gly Glu Pro Trp Gly Gly Trp 535
540 545ggt gct cct atc cgc ttc ggc aag agc gac gta
ggt ggc act cat atc 1776Gly Ala Pro Ile Arg Phe Gly Lys Ser Asp Val
Gly Gly Thr His Ile550 555 560
565gct gcg ttc aac gac gag ttt cgc gac gct atg cgt ggc tct gta ttc
1824Ala Ala Phe Asn Asp Glu Phe Arg Asp Ala Met Arg Gly Ser Val Phe
570 575 580aac gca aca gtt aaa
ggc ttc ctt atg ggt gca ctt gct aaa gag act 1872Asn Ala Thr Val Lys
Gly Phe Leu Met Gly Ala Leu Ala Lys Glu Thr 585
590 595gca atc aaa cgt ggc gta gta ggc tct atc gag tac
gac gac gtt atc 1920Ala Ile Lys Arg Gly Val Val Gly Ser Ile Glu Tyr
Asp Asp Val Ile 600 605 610cgc tca
ttc gct aaa gac cct gag gag act atc aac tat gta gct tgt 1968Arg Ser
Phe Ala Lys Asp Pro Glu Glu Thr Ile Asn Tyr Val Ala Cys 615
620 625cat gac aac cat act ctt tgg gac aag aac tac
ctt gcg gct cag gca 2016His Asp Asn His Thr Leu Trp Asp Lys Asn Tyr
Leu Ala Ala Gln Ala630 635 640
645gac acg aac atc aag tgg acg gag gag atg ctt aag aac gcg caa aag
2064Asp Thr Asn Ile Lys Trp Thr Glu Glu Met Leu Lys Asn Ala Gln Lys
650 655 660ctt gct ggc gct atc
ctt ctt act tct caa ggc atc cct ttc ctt cac 2112Leu Ala Gly Ala Ile
Leu Leu Thr Ser Gln Gly Ile Pro Phe Leu His 665
670 675gct ggc caa gac ttt gct cgc aca aag aaa ggc gac
gag aac tca tac 2160Ala Gly Gln Asp Phe Ala Arg Thr Lys Lys Gly Asp
Glu Asn Ser Tyr 680 685 690aac tct
cca atc tca atc aac ggc ctt gac tat gct cgc aaa gct gag 2208Asn Ser
Pro Ile Ser Ile Asn Gly Leu Asp Tyr Ala Arg Lys Ala Glu 695
700 705ttt atc gac gta ttc aac tac tac aaa ggc ctt
att gag atc cgc aag 2256Phe Ile Asp Val Phe Asn Tyr Tyr Lys Gly Leu
Ile Glu Ile Arg Lys710 715 720
725gca cac cct gcg ttt cgc caa cgc aca gct gac gac atc aaa aag aag
2304Ala His Pro Ala Phe Arg Gln Arg Thr Ala Asp Asp Ile Lys Lys Lys
730 735 740atc act ttc ctt cct
aca aca cgc aag atg gta gcg ttt aca atc aaa 2352Ile Thr Phe Leu Pro
Thr Thr Arg Lys Met Val Ala Phe Thr Ile Lys 745
750 755gac gag aac gac tca tgg aaa gag atc ctt gta atc
tat aac ggc gac 2400Asp Glu Asn Asp Ser Trp Lys Glu Ile Leu Val Ile
Tyr Asn Gly Asp 760 765 770aca aag
gac cag gac ttc aca ctt ccg gag ggc act tgg aac gta gtt 2448Thr Lys
Asp Gln Asp Phe Thr Leu Pro Glu Gly Thr Trp Asn Val Val 775
780 785gtt gac caa caa aat gct ggc aca aaa gtt ctt
tac caa gtt tca ggc 2496Val Asp Gln Gln Asn Ala Gly Thr Lys Val Leu
Tyr Gln Val Ser Gly790 795 800
805aag atc aca gtt aag tct atc tca gct atg gtt atg tac aag taa
2541Lys Ile Thr Val Lys Ser Ile Ser Ala Met Val Met Tyr Lys
810 8154846PRTFervidobacterium nodosum 4Met Lys Lys
Pro Leu Gly Lys Ile Val Ala Ser Thr Ala Leu Leu Ile -25
-20 -15Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala
Ala Thr Glu Leu Val -10 -5 -1 1
5Ile His Tyr His Arg Trp Asp Gly Asn Tyr Asp Gly Trp Asn Leu Trp
10 15 20Ile Trp Trp Val Glu
Pro Ile Ser Lys Asp Gly Ala Ala Tyr Gln Phe 25
30 35Thr Glu Lys Asp Asp Phe Gly Val Val Ala Arg Val
Lys Phe Asp Glu 40 45 50Thr Leu
Thr Lys Val Gly Ile Ile Val Arg Leu Asn Glu Trp Lys Glu 55
60 65Lys Asp Val Ala Met Asp Arg Phe Ile Ser Ile
Lys Asp Gly Lys Ala70 75 80
85Glu Val Trp Leu Leu Gln Gly Ile Glu Gln Ile Tyr Thr Thr Lys Pro
90 95 100Asp Thr Ser Pro
Arg Val Leu Phe Ala Gln Ala Arg Ala Gln Asp Val 105
110 115Ile Glu Ala Tyr Leu Thr Gly Gln Val Asp Thr
Thr Lys Val Ser Ala 120 125 130Lys
Val Thr Val Asp Gly Val Glu Arg Lys Val Ala Lys Val Glu Lys 135
140 145Ala Asn Pro Thr Asp Ile Ser Lys Thr Asn
His Val Lys Ile Thr Leu150 155 160
165Ala Glu Pro Ile Lys Leu Asp Glu Val Asn Lys Asp Val Gln Val
Glu 170 175 180Ile Glu Gly
Tyr Lys Pro Ala Arg Val Ile Met Met Glu Ile Leu Asp 185
190 195Lys Ile Tyr Tyr Asp Gly Pro Leu Gly Phe
Glu Tyr Ser Pro Thr Lys 200 205
210Thr Thr Ile Arg Val Trp Ser Pro Val Ser Lys Thr Val Asp Leu Leu 215
220 225Leu Tyr Lys Asn Trp Asp Asp Lys
Glu Pro Thr Lys Val Val Pro Met230 235
240 245Lys Tyr Ile Gly Asn Gly Ala Trp Glu Ala Val Leu
Asp Gly Asp Trp 250 255
260Glu Gly Trp Phe Tyr Arg Ile Arg Tyr Phe Ser Tyr Gly Glu Tyr Arg
265 270 275Glu Gly Val Asp Tyr Phe
Ser Lys Ala Val Thr Lys Asn Ser Ala Lys 280 285
290Ser Ala Ile Ile Asp Leu Lys Lys Thr Asn Pro Ser Asp Trp
Asp Lys 295 300 305Asp Val Arg Pro Thr
Met Lys Ala Leu Glu Asp Ala Ile Ile Tyr Glu310 315
320 325Ile His Ile Ala Asp Met Thr Gly Leu Asp
Asn Ser Asn Val Lys Asn 330 335
340Lys Ala Thr Tyr Leu Gly Leu Thr Glu Lys Gly Thr Arg Gly Pro Asn
345 350 355Gly Val Thr Thr Gly
Leu Asp His Leu Val Glu Leu Gly Val Thr His 360
365 370Val His Ile Leu Pro Met Phe Asp Phe Tyr Thr Gly
Asp Glu Ser Glu 375 380 385Arg Asp Phe
Glu Lys Ser Tyr Asn Trp Gly Tyr Asp Pro Tyr Leu Phe390
395 400 405Thr Val Pro Glu Gly Arg Tyr
Ser Thr Asn Pro Ile Asp Pro His Val 410
415 420Arg Ile Asn Glu Val Lys Gln Met Val Lys Ala Leu
His Glu Asn Gly 425 430 435Ile
Arg Val Ile Leu Asp Met Val Phe Pro His Thr Phe Gly Ile Gly 440
445 450Val Leu Ser Pro Phe Asp Thr Ala Val
Pro Tyr Tyr Phe Tyr Arg Ile 455 460
465Asp Lys Thr Gly Ala Tyr Leu Asn Glu Ser Gly Val Gly Asn Val Met470
475 480 485Ala Thr Glu Arg
Pro Met Leu Arg Lys Tyr Val Ile Asp Thr Leu Lys 490
495 500Trp Trp Val Leu Glu Tyr His Val Asp Gly
Phe Arg Phe Asp Gln Met 505 510
515Gly Leu Met Asp Lys Lys Thr Met Leu Asp Leu Glu Lys Glu Leu His
520 525 530Ala Ile Asp Pro Thr Ile Leu
Leu Tyr Gly Glu Pro Trp Gly Gly Trp 535 540
545Gly Ala Pro Ile Arg Phe Gly Lys Ser Asp Val Gly Gly Thr His
Ile550 555 560 565Ala Ala
Phe Asn Asp Glu Phe Arg Asp Ala Met Arg Gly Ser Val Phe
570 575 580Asn Ala Thr Val Lys Gly Phe
Leu Met Gly Ala Leu Ala Lys Glu Thr 585 590
595Ala Ile Lys Arg Gly Val Val Gly Ser Ile Glu Tyr Asp Asp
Val Ile 600 605 610Arg Ser Phe Ala
Lys Asp Pro Glu Glu Thr Ile Asn Tyr Val Ala Cys 615
620 625His Asp Asn His Thr Leu Trp Asp Lys Asn Tyr Leu
Ala Ala Gln Ala630 635 640
645Asp Thr Asn Ile Lys Trp Thr Glu Glu Met Leu Lys Asn Ala Gln Lys
650 655 660Leu Ala Gly Ala Ile
Leu Leu Thr Ser Gln Gly Ile Pro Phe Leu His 665
670 675Ala Gly Gln Asp Phe Ala Arg Thr Lys Lys Gly Asp
Glu Asn Ser Tyr 680 685 690Asn Ser
Pro Ile Ser Ile Asn Gly Leu Asp Tyr Ala Arg Lys Ala Glu 695
700 705Phe Ile Asp Val Phe Asn Tyr Tyr Lys Gly Leu
Ile Glu Ile Arg Lys710 715 720
725Ala His Pro Ala Phe Arg Gln Arg Thr Ala Asp Asp Ile Lys Lys Lys
730 735 740Ile Thr Phe Leu
Pro Thr Thr Arg Lys Met Val Ala Phe Thr Ile Lys 745
750 755Asp Glu Asn Asp Ser Trp Lys Glu Ile Leu Val
Ile Tyr Asn Gly Asp 760 765 770Thr
Lys Asp Gln Asp Phe Thr Leu Pro Glu Gly Thr Trp Asn Val Val 775
780 785Val Asp Gln Gln Asn Ala Gly Thr Lys Val
Leu Tyr Gln Val Ser Gly790 795 800
805Lys Ile Thr Val Lys Ser Ile Ser Ala Met Val Met Tyr Lys
810 81556022DNADictyoglomus
thermophilumCDS(1886)..(5020)pullulanase 5ggatcttcat ggatatgggg
aaatggaatt gaagtttctg gaaaagtatt tgatacaaac 60ttcttagcag gtattaattc
gtcagatcaa atctcttact taagattaaa aagagcattt 120caaaacctaa ctcttggatt
tacagcaatg ggtgctaatt ggggtgttgc taaccaagga 180aagagtttat tcggagtaga
tgtaactgga aaattagcca atgtagacgt aaaagcagaa 240ggaatatacg gcaagggctc
ctttgatact ggctctgaag gtggaatggt cctatatggt 300gacttttcaa ctcagctaac
acctgttgta aaaatttacg gcacagccaa aaaagttgat 360ggaggttata tcaatcaatt
taactggttc aaaactgatc aaactcaact tattcctgga 420gaaagtggat cttatggtac
atactttaag cttggttccg taattacccc actttccaat 480ttatcctttg aaccaattgt
agaactaata aatagagaaa atataaacca aaaaactact 540aatctaaaag gtatagtaac
atatgtagta aataagaacc taactgttaa gggaacagtg 600gccaattcaa cagtagatag
taatagttcc actaacatta ctcttgaaac aacctttgta 660cctttacaaa atctctcaat
ttatggaaag ttatatcaac caatcggagg aaatacagaa 720atttatggaa atctttcaac
caccttcgat aaattaaatg tctacttagc tgggaattat 780tcagcaagca aatcatacct
gtacttaaac gctctctata acttagctaa gaatgtaaat 840cttagagcaa tatctcaact
tcttaaagat agtagcacaa ctcataatac ctactatcta 900gctcttgaac ttaacaatgc
ttctctctac tttggtaatg ctccatcaga agaaggttct 960gtaaccgact ttgtaaaaca
aataggagca aaaatttctt ttgatttcta aaaaattaaa 1020agggggggag aattctcccc
ccttaaaaag attcaaggag ggctataaaa tgaaaaagtt 1080attaatttta atttccttaa
tacttctttc cactattgtt tttgctgaac ctgtaaaata 1140tcctcttata ttcaacgatc
ctgtaaacga cgacaagggg cctggaacat acacctatcc 1200tacagaccca gtttttaaat
ctggtacttt tgatatgaca aaagtagtaa tagatgccga 1260taatgataat gtatatttca
agatctcctt cagagtacct atagagaatc cttggggaag 1320tccattagga atttccttac
aaacgatcca tatatatatt gataaggatc ataagaaaga 1380ttcaggattc agggatttta
tcccaggtgt aagagcccaa accacaccgg aaagtgcatg 1440ggatttagcc atactcgtag
aaggttggcc tacagagcta aaaagttctg taaaaaatgc 1500agctcctgaa atgtataagt
attgtgtctt cccctctaaa ggagtaactg tcgatggcaa 1560taccataacc atacctgtac
ctaagaagac ccttggtgac aacttccaaa aaggttgggg 1620atttcaagtt ttcatcatgg
gacaagaggg attcccaacc caggaccctg tgtcttgtag 1680gatcagagag gtcttatcta
cagctcaaca atggagattt agcggtggtg atgactttta 1740tggagatcct aatattatag
acctattaga ttacgaggat ataaaccaat ttgagatttt 1800aagtaaatat aagagtgatg
ctaaatttga gaagaatgtg tatgctcaag taccctttat 1860ctatgtaaag tagaggtggg
ttctc atg aag agt acg aag aag atc tta ata 1912
Met Lys Ser Thr Lys Lys Ile Leu Ile -25
-20ttt tct ctt ctt ttc cta ata att tct cta atc tcc tta agt
ttt tct 1960Phe Ser Leu Leu Phe Leu Ile Ile Ser Leu Ile Ser Leu Ser
Phe Ser -15 -10 -5 -1caa
gat ata cct ata aat gtt tac aat cct aag gta caa aag gtc gca 2008Gln
Asp Ile Pro Ile Asn Val Tyr Asn Pro Lys Val Gln Lys Val Ala1
5 10 15aaa cca cta tat tta gcc atc
ata tgg cac aac cac caa ccc cta tat 2056Lys Pro Leu Tyr Leu Ala Ile
Ile Trp His Asn His Gln Pro Leu Tyr 20 25
30tat gat ccc gaa caa aat cta aat att ctt cct tgg gta aga
atg cat 2104Tyr Asp Pro Glu Gln Asn Leu Asn Ile Leu Pro Trp Val Arg
Met His 35 40 45gcc ata aaa gac
tac tac gac atg gcc tac atc tta aaa aat tac cca 2152Ala Ile Lys Asp
Tyr Tyr Asp Met Ala Tyr Ile Leu Lys Asn Tyr Pro 50 55
60caa gta aag gct aat ttc aat atg gta cct tcc cta cta
tat caa tta 2200Gln Val Lys Ala Asn Phe Asn Met Val Pro Ser Leu Leu
Tyr Gln Leu65 70 75
80gaa cta tat aca aaa aag ggt ata aaa gat aag tat cta ctt ctt aca
2248Glu Leu Tyr Thr Lys Lys Gly Ile Lys Asp Lys Tyr Leu Leu Leu Thr
85 90 95gag aaa cca gct gat
caa ctt act tta gaa gat aag gaa ttt ata ctg 2296Glu Lys Pro Ala Asp
Gln Leu Thr Leu Glu Asp Lys Glu Phe Ile Leu 100
105 110aga aga ttc ttt gac gtt aac tgg gat aga ata att
aag aga ttc ccc 2344Arg Arg Phe Phe Asp Val Asn Trp Asp Arg Ile Ile
Lys Arg Phe Pro 115 120 125aga tat
tgg gaa ctt ttg aat aag aga ggt cag tct ata gat gat aca 2392Arg Tyr
Trp Glu Leu Leu Asn Lys Arg Gly Gln Ser Ile Asp Asp Thr 130
135 140ata ata gca aaa gca att caa acc ttt act act
cag gac ttt aga gat 2440Ile Ile Ala Lys Ala Ile Gln Thr Phe Thr Thr
Gln Asp Phe Arg Asp145 150 155
160tta caa gta tgg ttc aat tta gca tgg ttt gat cct gat ttc caa aag
2488Leu Gln Val Trp Phe Asn Leu Ala Trp Phe Asp Pro Asp Phe Gln Lys
165 170 175tat gat aag gat ctt
tca aga ctt ata gaa aaa ggc aga gat ttt aca 2536Tyr Asp Lys Asp Leu
Ser Arg Leu Ile Glu Lys Gly Arg Asp Phe Thr 180
185 190gaa gag gat aaa aaa ata gtt ata aat aaa caa tat
gaa ata atg tca 2584Glu Glu Asp Lys Lys Ile Val Ile Asn Lys Gln Tyr
Glu Ile Met Ser 195 200 205aag att
att cca cta tac gca gaa tta cag aaa aac aaa caa ata gaa 2632Lys Ile
Ile Pro Leu Tyr Ala Glu Leu Gln Lys Asn Lys Gln Ile Glu 210
215 220gta act act aca cct ttc ttc cat ccc ata tta
cct ctc tta gta gat 2680Val Thr Thr Thr Pro Phe Phe His Pro Ile Leu
Pro Leu Leu Val Asp225 230 235
240ata aaa tct gct aag att gca gta caa gac ata gcc tta cct aac gct
2728Ile Lys Ser Ala Lys Ile Ala Val Gln Asp Ile Ala Leu Pro Asn Ala
245 250 255aca ata aat tat gcc
gat gat gca tct tct cag ctt tct atg gct gta 2776Thr Ile Asn Tyr Ala
Asp Asp Ala Ser Ser Gln Leu Ser Met Ala Val 260
265 270aat tac tac aaa aag ttc ttc aag agt aat ccc aag
ggt ctc tgg cct 2824Asn Tyr Tyr Lys Lys Phe Phe Lys Ser Asn Pro Lys
Gly Leu Trp Pro 275 280 285tca gaa
gga tca gta agc caa gat atc ata ccc ata gta agt agt gct 2872Ser Glu
Gly Ser Val Ser Gln Asp Ile Ile Pro Ile Val Ser Ser Ala 290
295 300gga ttt atg tgg atg gca agc gat gaa gat gta
ctt gca aaa tct ctt 2920Gly Phe Met Trp Met Ala Ser Asp Glu Asp Val
Leu Ala Lys Ser Leu305 310 315
320aat act cct att atc aga gac tcg aga ggt aat gtg gta aat act gat
2968Asn Thr Pro Ile Ile Arg Asp Ser Arg Gly Asn Val Val Asn Thr Asp
325 330 335atc ctt tac caa cca
tat gta gta gag gaa caa gga aaa aaa gta tac 3016Ile Leu Tyr Gln Pro
Tyr Val Val Glu Glu Gln Gly Lys Lys Val Tyr 340
345 350atg gta ttt aga gac aaa aat ctc tcg gat aaa atc
ggt ttt gtt tat 3064Met Val Phe Arg Asp Lys Asn Leu Ser Asp Lys Ile
Gly Phe Val Tyr 355 360 365agc gga
atg aaa gga gaa aac gca gct aaa gat ttt gtt aat cga tta 3112Ser Gly
Met Lys Gly Glu Asn Ala Ala Lys Asp Phe Val Asn Arg Leu 370
375 380gag agt atc tat gaa aaa gta aaa gac gat aat
aaa cca tat ctt gtg 3160Glu Ser Ile Tyr Glu Lys Val Lys Asp Asp Asn
Lys Pro Tyr Leu Val385 390 395
400acg gta att ctc gat ggt gag aac tgt tgg gaa tat tac gaa aat gat
3208Thr Val Ile Leu Asp Gly Glu Asn Cys Trp Glu Tyr Tyr Glu Asn Asp
405 410 415gga aaa gaa ttt ctc
cac acc cta tat aaa tta ctt act gat agc cca 3256Gly Lys Glu Phe Leu
His Thr Leu Tyr Lys Leu Leu Thr Asp Ser Pro 420
425 430tac att gaa act gta aga tta aca gat tat tta aac
aag ttc cct cca 3304Tyr Ile Glu Thr Val Arg Leu Thr Asp Tyr Leu Asn
Lys Phe Pro Pro 435 440 445att aaa
aag ata gaa aaa ctc cat gca gga tca tgg ctt gat gga acc 3352Ile Lys
Lys Ile Glu Lys Leu His Ala Gly Ser Trp Leu Asp Gly Thr 450
455 460ttc ctc act tgg gta gga gaa caa gaa gaa aac
aaa gca tgg gaa ctt 3400Phe Leu Thr Trp Val Gly Glu Gln Glu Glu Asn
Lys Ala Trp Glu Leu465 470 475
480tta gac aag gca aga aca gaa tta ata tat gaa acc tta aaa cag aga
3448Leu Asp Lys Ala Arg Thr Glu Leu Ile Tyr Glu Thr Leu Lys Gln Arg
485 490 495aaa acc atc tct cct
gta tta aat cca gat tct tta aga aac aat att 3496Lys Thr Ile Ser Pro
Val Leu Asn Pro Asp Ser Leu Arg Asn Asn Ile 500
505 510gaa aaa gca tgg ttt gag cta tat gca gca gaa ggt
agc gac tgg ttc 3544Glu Lys Ala Trp Phe Glu Leu Tyr Ala Ala Glu Gly
Ser Asp Trp Phe 515 520 525tgg tgg
tat gga gat gat caa gat tct aca aat gat ctt gcc ttt gac 3592Trp Trp
Tyr Gly Asp Asp Gln Asp Ser Thr Asn Asp Leu Ala Phe Asp 530
535 540gaa ctc ttt aga aaa cat ctt ata aat gtt tac
aaa tta atc ggc aaa 3640Glu Leu Phe Arg Lys His Leu Ile Asn Val Tyr
Lys Leu Ile Gly Lys545 550 555
560gat atc ccc caa gaa ctt ttc ctc cca ata gta aaa ata ggt gaa gaa
3688Asp Ile Pro Gln Glu Leu Phe Leu Pro Ile Val Lys Ile Gly Glu Glu
565 570 575aaa cca tta caa aat
ata caa gca aaa ttc aca cct aat att gat ggc 3736Lys Pro Leu Gln Asn
Ile Gln Ala Lys Phe Thr Pro Asn Ile Asp Gly 580
585 590tta att aat cca gaa gat gag tgg aaa aat gct gct
att tat ctt gct 3784Leu Ile Asn Pro Glu Asp Glu Trp Lys Asn Ala Ala
Ile Tyr Leu Ala 595 600 605aaa aaa
ggg aca gga ctt tcc gta aaa cct gca gac ttt ata gag aaa 3832Lys Lys
Gly Thr Gly Leu Ser Val Lys Pro Ala Asp Phe Ile Glu Lys 610
615 620ttg tat tta gga tta gat aat gac aat gta tac
ttc tta gta gaa tca 3880Leu Tyr Leu Gly Leu Asp Asn Asp Asn Val Tyr
Phe Leu Val Glu Ser625 630 635
640aag act aat ttc aaa gat tat ttt gga aaa ccc tac tac ctt gcc ata
3928Lys Thr Asn Phe Lys Asp Tyr Phe Gly Lys Pro Tyr Tyr Leu Ala Ile
645 650 655tac ttc tcc aat cct
aat caa aag gaa tat aac cta tat cct aga aat 3976Tyr Phe Ser Asn Pro
Asn Gln Lys Glu Tyr Asn Leu Tyr Pro Arg Asn 660
665 670gga aac aaa act tta gga tac gga ata gca tac gaa
gtc cta att gac 4024Gly Asn Lys Thr Leu Gly Tyr Gly Ile Ala Tyr Glu
Val Leu Ile Asp 675 680 685ttc tct
aaa att aat tct aca gga gaa tta gag gcc att cta aat caa 4072Phe Ser
Lys Ile Asn Ser Thr Gly Glu Leu Glu Ala Ile Leu Asn Gln 690
695 700gcc tta ggc aac aac tcc tgg aaa caa caa tct
aca tta aaa gca ggg 4120Ala Leu Gly Asn Asn Ser Trp Lys Gln Gln Ser
Thr Leu Lys Ala Gly705 710 715
720att tct gag aaa tat gtg gaa ata ggt gta cct ttt aaa gaa ctc aaa
4168Ile Ser Glu Lys Tyr Val Glu Ile Gly Val Pro Phe Lys Glu Leu Lys
725 730 735gtt caa ggg aga gat
cga ata gca atc aat gtg gta ttt gga aaa gaa 4216Val Gln Gly Arg Asp
Arg Ile Ala Ile Asn Val Val Phe Gly Lys Glu 740
745 750gaa cca gaa gat gta gtt cca tat tat gcg cct ata
tat cta act gtg 4264Glu Pro Glu Asp Val Val Pro Tyr Tyr Ala Pro Ile
Tyr Leu Thr Val 755 760 765cct gag
aaa aaa tta gat att aca tat ttc tcc att gat gat cca aca 4312Pro Glu
Lys Lys Leu Asp Ile Thr Tyr Phe Ser Ile Asp Asp Pro Thr 770
775 780gga gat gat tat gga tgg ggc aag gtt gtt tat
cca aca gct cct gtg 4360Gly Asp Asp Tyr Gly Trp Gly Lys Val Val Tyr
Pro Thr Ala Pro Val785 790 795
800ttt aaa cct gga gtc ttt gac ata att cat gta gaa atg ggt aaa agc
4408Phe Lys Pro Gly Val Phe Asp Ile Ile His Val Glu Met Gly Lys Ser
805 810 815aag gac gat att gta
ttc aaa gtt aaa att aga gga gat tta gaa aat 4456Lys Asp Asp Ile Val
Phe Lys Val Lys Ile Arg Gly Asp Leu Glu Asn 820
825 830cca tgg gga tct cct aca gga gtg tca gtt caa acc
ata gat ata tac 4504Pro Trp Gly Ser Pro Thr Gly Val Ser Val Gln Thr
Ile Asp Ile Tyr 835 840 845ata aac
gat ggt aaa gaa ggg cca tat tat tat caa gca tta cca gga 4552Ile Asn
Asp Gly Lys Glu Gly Pro Tyr Tyr Tyr Gln Ala Leu Pro Gly 850
855 860agg cag gcc aat atc cca gaa gga tgg aat aaa
gca ata tgg gct gag 4600Arg Gln Ala Asn Ile Pro Glu Gly Trp Asn Lys
Ala Ile Trp Ala Glu865 870 875
880gga tgg att caa gaa tta gta gtt cca gcg tta gat gaa aag gga gaa
4648Gly Trp Ile Gln Glu Leu Val Val Pro Ala Leu Asp Glu Lys Gly Glu
885 890 895gta caa tta aaa gaa
ata aaa gga gtt gtt caa tta act gca gac ccc 4696Val Gln Leu Lys Glu
Ile Lys Gly Val Val Gln Leu Thr Ala Asp Pro 900
905 910ata gaa aga acc ata aca ata tca gtg cct gaa aaa
tat tta ggt cct 4744Ile Glu Arg Thr Ile Thr Ile Ser Val Pro Glu Lys
Tyr Leu Gly Pro 915 920 925gta acc
cca gat tgg aaa atc ctt gta ata tta tgt ggg caa gaa gga 4792Val Thr
Pro Asp Trp Lys Ile Leu Val Ile Leu Cys Gly Gln Glu Gly 930
935 940tac ccc aga cct gga agt tgg aga gta aga gag
gta gaa gaa gaa gca 4840Tyr Pro Arg Pro Gly Ser Trp Arg Val Arg Glu
Val Glu Glu Glu Ala945 950 955
960aaa caa tgg aga ttt ggt ggt gga gac gac ttc tat gga gat cct aac
4888Lys Gln Trp Arg Phe Gly Gly Gly Asp Asp Phe Tyr Gly Asp Pro Asn
965 970 975att ata gat atg ata
gtt ccc cct gga aca aaa caa gaa gat ata ttg 4936Ile Ile Asp Met Ile
Val Pro Pro Gly Thr Lys Gln Glu Asp Ile Leu 980
985 990tct aaa tgg gta agt agt gaa gat gaa gaa gaa aat
gtt tat gta gaa 4984Ser Lys Trp Val Ser Ser Glu Asp Glu Glu Glu Asn
Val Tyr Val Glu 995 1000 1005ctc
ccc ttg atc ccc ctt agg atc ctt atg aac caa taaaagcccc 5030Leu
Pro Leu Ile Pro Leu Arg Ile Leu Met Asn Gln 1010
1015 1020cgaatgaagg agagggaaag aaaacccctc tccttcattt
tttaaatttt tagacaaaac 5090tttttataat ccttgtttac aaaaaaaaca attagctata
aaattattta ttgttatgaa 5150taaaccattg ttcagacata ttaaaaagct attatggcag
tataaatgga aatatatcac 5210aggagcattt ttcctactcc ttaccgatat cttccaactt
atatccccaa aattaatcgg 5270ttggggtgta gattatctta acaaaggaac cttaaccttt
aagagtttac tgttagtatt 5330tattgcatta ttacttttag caatactaac tgccatattt
cgttttttct ggagaatgca 5390aattcttgcc acagcaagaa gattagaagc gcaaattcga
gaaaagtatt ttactcattt 5450acaaactctt tctctaaact tttttaatta caaaaaaaca
ggagaactaa tggctcttgc 5510tacaaatgac ttaggagctg taagagaaat gtttgctttt
ggaatagtta tgctattaga 5570tacaatcttt cttggaactc tttctatctt ctttctacta
agtataagtc ccaagctcac 5630cctttatatt gctattcccc ttcctctaat tacgttaaca
ataactttct ttgggaaaat 5690aacccataga aggtttagac ttgtacaaga tagttttgca
aaattaactg acaaagcaga 5750agagaccata gctggaataa gagtagtcaa agcttacgta
caagaagaag cagaacttaa 5810aaaatttgta gaaagagccc aagatttatt aaataaaaat
attaacttag ttaaggcatg 5870gggatttatg tttccaacca ttgaactatt agcaggattc
tctgttttat ttgtcttttt 5930atttggaggc ttagaagtaa taagaggaaa tataagcctt
ggtgacttca ttgcttttaa 5990ctcatattta ggtctcctta tctggcctat ga
602261045PRTDictyoglomus thermophilum 6Met Lys Ser
Thr Lys Lys Ile Leu Ile Phe Ser Leu Leu Phe Leu Ile-25
-20 -15 -10Ile Ser Leu Ile Ser Leu Ser
Phe Ser Gln Asp Ile Pro Ile Asn Val -5 -1 1
5Tyr Asn Pro Lys Val Gln Lys Val Ala Lys Pro Leu Tyr Leu Ala
Ile 10 15 20Ile Trp His Asn His
Gln Pro Leu Tyr Tyr Asp Pro Glu Gln Asn Leu 25 30
35Asn Ile Leu Pro Trp Val Arg Met His Ala Ile Lys Asp Tyr
Tyr Asp40 45 50 55Met
Ala Tyr Ile Leu Lys Asn Tyr Pro Gln Val Lys Ala Asn Phe Asn
60 65 70Met Val Pro Ser Leu Leu Tyr
Gln Leu Glu Leu Tyr Thr Lys Lys Gly 75 80
85Ile Lys Asp Lys Tyr Leu Leu Leu Thr Glu Lys Pro Ala Asp
Gln Leu 90 95 100Thr Leu Glu Asp
Lys Glu Phe Ile Leu Arg Arg Phe Phe Asp Val Asn 105
110 115Trp Asp Arg Ile Ile Lys Arg Phe Pro Arg Tyr Trp
Glu Leu Leu Asn120 125 130
135Lys Arg Gly Gln Ser Ile Asp Asp Thr Ile Ile Ala Lys Ala Ile Gln
140 145 150Thr Phe Thr Thr Gln
Asp Phe Arg Asp Leu Gln Val Trp Phe Asn Leu 155
160 165Ala Trp Phe Asp Pro Asp Phe Gln Lys Tyr Asp Lys
Asp Leu Ser Arg 170 175 180Leu Ile
Glu Lys Gly Arg Asp Phe Thr Glu Glu Asp Lys Lys Ile Val 185
190 195Ile Asn Lys Gln Tyr Glu Ile Met Ser Lys Ile
Ile Pro Leu Tyr Ala200 205 210
215Glu Leu Gln Lys Asn Lys Gln Ile Glu Val Thr Thr Thr Pro Phe Phe
220 225 230His Pro Ile Leu
Pro Leu Leu Val Asp Ile Lys Ser Ala Lys Ile Ala 235
240 245Val Gln Asp Ile Ala Leu Pro Asn Ala Thr Ile
Asn Tyr Ala Asp Asp 250 255 260Ala
Ser Ser Gln Leu Ser Met Ala Val Asn Tyr Tyr Lys Lys Phe Phe 265
270 275Lys Ser Asn Pro Lys Gly Leu Trp Pro Ser
Glu Gly Ser Val Ser Gln280 285 290
295Asp Ile Ile Pro Ile Val Ser Ser Ala Gly Phe Met Trp Met Ala
Ser 300 305 310Asp Glu Asp
Val Leu Ala Lys Ser Leu Asn Thr Pro Ile Ile Arg Asp 315
320 325Ser Arg Gly Asn Val Val Asn Thr Asp Ile
Leu Tyr Gln Pro Tyr Val 330 335
340Val Glu Glu Gln Gly Lys Lys Val Tyr Met Val Phe Arg Asp Lys Asn 345
350 355Leu Ser Asp Lys Ile Gly Phe Val
Tyr Ser Gly Met Lys Gly Glu Asn360 365
370 375Ala Ala Lys Asp Phe Val Asn Arg Leu Glu Ser Ile
Tyr Glu Lys Val 380 385
390Lys Asp Asp Asn Lys Pro Tyr Leu Val Thr Val Ile Leu Asp Gly Glu
395 400 405Asn Cys Trp Glu Tyr Tyr
Glu Asn Asp Gly Lys Glu Phe Leu His Thr 410 415
420Leu Tyr Lys Leu Leu Thr Asp Ser Pro Tyr Ile Glu Thr Val
Arg Leu 425 430 435Thr Asp Tyr Leu Asn
Lys Phe Pro Pro Ile Lys Lys Ile Glu Lys Leu440 445
450 455His Ala Gly Ser Trp Leu Asp Gly Thr Phe
Leu Thr Trp Val Gly Glu 460 465
470Gln Glu Glu Asn Lys Ala Trp Glu Leu Leu Asp Lys Ala Arg Thr Glu
475 480 485Leu Ile Tyr Glu Thr
Leu Lys Gln Arg Lys Thr Ile Ser Pro Val Leu 490
495 500Asn Pro Asp Ser Leu Arg Asn Asn Ile Glu Lys Ala
Trp Phe Glu Leu 505 510 515Tyr Ala Ala
Glu Gly Ser Asp Trp Phe Trp Trp Tyr Gly Asp Asp Gln520
525 530 535Asp Ser Thr Asn Asp Leu Ala
Phe Asp Glu Leu Phe Arg Lys His Leu 540
545 550Ile Asn Val Tyr Lys Leu Ile Gly Lys Asp Ile Pro
Gln Glu Leu Phe 555 560 565Leu
Pro Ile Val Lys Ile Gly Glu Glu Lys Pro Leu Gln Asn Ile Gln 570
575 580Ala Lys Phe Thr Pro Asn Ile Asp Gly
Leu Ile Asn Pro Glu Asp Glu 585 590
595Trp Lys Asn Ala Ala Ile Tyr Leu Ala Lys Lys Gly Thr Gly Leu Ser600
605 610 615Val Lys Pro Ala
Asp Phe Ile Glu Lys Leu Tyr Leu Gly Leu Asp Asn 620
625 630Asp Asn Val Tyr Phe Leu Val Glu Ser Lys
Thr Asn Phe Lys Asp Tyr 635 640
645Phe Gly Lys Pro Tyr Tyr Leu Ala Ile Tyr Phe Ser Asn Pro Asn Gln
650 655 660Lys Glu Tyr Asn Leu Tyr Pro
Arg Asn Gly Asn Lys Thr Leu Gly Tyr 665 670
675Gly Ile Ala Tyr Glu Val Leu Ile Asp Phe Ser Lys Ile Asn Ser
Thr680 685 690 695Gly Glu
Leu Glu Ala Ile Leu Asn Gln Ala Leu Gly Asn Asn Ser Trp
700 705 710Lys Gln Gln Ser Thr Leu Lys
Ala Gly Ile Ser Glu Lys Tyr Val Glu 715 720
725Ile Gly Val Pro Phe Lys Glu Leu Lys Val Gln Gly Arg Asp
Arg Ile 730 735 740Ala Ile Asn Val
Val Phe Gly Lys Glu Glu Pro Glu Asp Val Val Pro 745
750 755Tyr Tyr Ala Pro Ile Tyr Leu Thr Val Pro Glu Lys
Lys Leu Asp Ile760 765 770
775Thr Tyr Phe Ser Ile Asp Asp Pro Thr Gly Asp Asp Tyr Gly Trp Gly
780 785 790Lys Val Val Tyr Pro
Thr Ala Pro Val Phe Lys Pro Gly Val Phe Asp 795
800 805Ile Ile His Val Glu Met Gly Lys Ser Lys Asp Asp
Ile Val Phe Lys 810 815 820Val Lys
Ile Arg Gly Asp Leu Glu Asn Pro Trp Gly Ser Pro Thr Gly 825
830 835Val Ser Val Gln Thr Ile Asp Ile Tyr Ile Asn
Asp Gly Lys Glu Gly840 845 850
855Pro Tyr Tyr Tyr Gln Ala Leu Pro Gly Arg Gln Ala Asn Ile Pro Glu
860 865 870Gly Trp Asn Lys
Ala Ile Trp Ala Glu Gly Trp Ile Gln Glu Leu Val 875
880 885Val Pro Ala Leu Asp Glu Lys Gly Glu Val Gln
Leu Lys Glu Ile Lys 890 895 900Gly
Val Val Gln Leu Thr Ala Asp Pro Ile Glu Arg Thr Ile Thr Ile 905
910 915Ser Val Pro Glu Lys Tyr Leu Gly Pro Val
Thr Pro Asp Trp Lys Ile920 925 930
935Leu Val Ile Leu Cys Gly Gln Glu Gly Tyr Pro Arg Pro Gly Ser
Trp 940 945 950Arg Val Arg
Glu Val Glu Glu Glu Ala Lys Gln Trp Arg Phe Gly Gly 955
960 965Gly Asp Asp Phe Tyr Gly Asp Pro Asn Ile
Ile Asp Met Ile Val Pro 970 975
980Pro Gly Thr Lys Gln Glu Asp Ile Leu Ser Lys Trp Val Ser Ser Glu 985
990 995Asp Glu Glu Glu Asn Val Tyr Val
Glu Leu Pro Leu Ile Pro Leu1000 1005
1010Arg Ile Leu Met Asn Gln1015 10207237PRTPyrococcus
woeseiDOMAIN(1)..(237)X46 domain 7Asp Pro Glu Gly Asp Asp His Gly Pro Gly
Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Lys Val Phe Val Glu Gly Ala Phe Asp Leu Leu Arg Phe Arg Met
20 25 30Leu Glu Gln Thr Asp Ala
Tyr Val Met Glu Phe Tyr Phe Lys Glu Leu 35 40
45Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln
Ile Ile 50 55 60Glu Val Tyr Leu Asp
Phe Lys Glu Gly Gly Asn Thr Ser Ala Ile Lys65 70
75 80Met Phe Pro Asp Gly Pro Gly Ala Asn Val
Gln Leu Asp Pro Glu His 85 90
95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly Asn Leu
100 105 110Ile Val Leu Ala Asn
Gly Thr Val Tyr Gln Gly Glu Met Gln Ile Ser 115
120 125Ala Asp Pro Thr Lys Asn Ala Val Ile Val Lys Leu
Pro Lys Lys Tyr 130 135 140Leu Ser Ile
Gly Asp Tyr Gly Leu Tyr Ala Ala Val Leu Val Gly Ser145
150 155 160Gln Asp Gly Tyr Gly Pro Asp
Lys Trp Arg Pro Val Ala Val Glu Ala 165
170 175Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala
Val Val Asp Asn 180 185 190Leu
Ala Pro Arg Val Val Asp Met Leu Val Pro Glu Gly Phe Lys Pro 195
200 205Thr Gln Glu Glu Gln Leu Ser Ser Tyr
Asp Val Glu Lys Lys Glu Leu 210 215
220Ala Thr Val Tyr Met Ile Thr Leu Val Ser Gly Ser Gly225
230 2358241PRTThermococcus
hydrothermalisDOMAIN(1)..(241)X46 domain 8Thr Asp Pro Glu Gly Asp Asp His
Gly Pro Gly Asn Tyr Thr Tyr Pro1 5 10
15Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg
Phe Arg 20 25 30Met Leu Glu
Gln Thr Glu Ser Tyr Val Met Glu Phe Tyr Phe Lys Asp 35
40 45Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly
Phe Ser Leu Gln Ile 50 55 60Ile Glu
Val Tyr Leu Asp Phe Lys Asp Gly Gly Asn Ser Ser Ala Ile65
70 75 80Lys Met Phe Pro Asp Gly Pro
Gly Ala Asn Val Asn Leu Asp Pro Glu 85 90
95His Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp
Tyr Gly Asn 100 105 110Leu Ile
Ile Leu Pro Asn Gly Thr Ala Ile Gln Gly Glu Met Gln Ile 115
120 125Ser Ala Asp Pro Val Lys Asn Ala Ile Ile
Val Lys Val Pro Lys Lys 130 135 140Tyr
Ile Ala Ile Asn Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Val145
150 155 160Gly Ser Gln Asp Gly Tyr
Gly Pro Asp Lys Trp Arg Thr Ala Ala Val 165
170 175Asp Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro
Gln Ala Val Ile 180 185 190Asn
Gly Val Ala Pro Arg Val Ile Asp Glu Leu Val Pro Gln Gly Phe 195
200 205Glu Pro Thr Gln Glu Glu Gln Leu Ser
Ser Tyr Asp Ala Asn Asp Met 210 215
220Lys Leu Ala Thr Val Lys Ala Leu Leu Leu Leu Lys Gln Gly Ile Val225
230 235
240Val9240PRTThermococcus litoralisDOMAIN(1)..(240)X46 domain 9Asp Ile
Glu Trp Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Ala Thr1 5
10 15Asn Lys Val Phe Val Pro Gly His
Leu Asp Leu Leu Lys Val Arg Ile 20 25
30Leu Glu Lys Pro Ser Ser Tyr Val Phe Glu Tyr Tyr Phe Lys Asp
Leu 35 40 45Gly Asp Asn Ser Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Ala Tyr Phe Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala
Ile Lys65 70 75 80Met
Phe Pro Asp Gly Pro Gly Ser Asn Val Asp Leu Asp Pro Glu His
85 90 95Pro Trp Asp Val Ala Leu Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Ile 100 105
110Ile Val Leu Pro Asp Gly Thr Ser Tyr Gln Gly Glu Met Lys
Ile Ser 115 120 125Ala Asp Pro Val
Lys Asn Ala Ile Val Val Glu Val Pro Lys Lys Tyr 130
135 140Leu Glu Ile Ser Lys Asp Tyr Gly Leu Tyr Gly Ala
Ile Leu Val Gly145 150 155
160Ser Gln Asp Gly Tyr Glu Pro Asp Lys Trp Arg Pro Val Ala Val Asp
165 170 175Ala Glu Glu Trp Lys
Gly Gly Gly Ala Asp Val Asn Ala Val Ile Ala 180
185 190Gly Val Ala Pro Arg Val Tyr Asp Leu Leu Val Pro
Glu Asp Phe Lys 195 200 205Pro Thr
Gln Glu Glu Gln Leu Ser Ser Tyr Asp Ala Glu Asn Gly Lys 210
215 220Arg Ala Ile Val Lys Met Ile Pro Leu Phe Gly
Val Glu Glu Lys Pro225 230 235
24010240PRTDictyoglomus thermophilumDOMAIN(1)..(240)X46 Domain 10Asp
Asp Pro Thr Gly Asp Asp Tyr Gly Trp Gly Lys Val Val Tyr Pro1
5 10 15Thr Ala Pro Val Phe Lys Pro
Gly Val Phe Asp Ile Ile His Val Glu 20 25
30Met Gly Lys Ser Lys Asp Asp Ile Val Phe Lys Val Lys Ile
Arg Gly 35 40 45Asp Leu Glu Asn
Pro Trp Gly Ser Pro Thr Gly Val Ser Val Gln Thr 50 55
60Ile Asp Ile Tyr Ile Asn Asp Gly Lys Glu Gly Pro Tyr
Tyr Tyr Gln65 70 75
80Ala Leu Pro Gly Arg Gln Ala Asn Ile Pro Glu Gly Trp Asn Lys Ala
85 90 95Ile Trp Ala Glu Gly Trp
Ile Gln Glu Leu Val Val Pro Ala Leu Asp 100
105 110Glu Lys Gly Glu Val Gln Leu Lys Glu Ile Lys Gly
Val Val Gln Leu 115 120 125Thr Ala
Asp Pro Ile Glu Arg Thr Ile Thr Ile Ser Val Pro Glu Lys 130
135 140Tyr Leu Gly Pro Val Thr Pro Asp Trp Lys Ile
Leu Val Ile Leu Cys145 150 155
160Gly Gln Glu Gly Tyr Pro Arg Pro Gly Ser Trp Arg Val Arg Glu Val
165 170 175Glu Glu Glu Ala
Lys Gln Trp Arg Phe Gly Gly Gly Asp Asp Phe Tyr 180
185 190Gly Asp Pro Asn Ile Ile Asp Met Ile Val Pro
Pro Gly Thr Lys Gln 195 200 205Glu
Asp Ile Leu Ser Lys Trp Val Ser Ser Glu Asp Glu Glu Glu Asn 210
215 220Val Tyr Val Glu Leu Pro Leu Ile Pro Leu
Arg Ile Leu Met Asn Gln225 230 235
24011223PRTFervidobacterium nodosumDOMAIN(1)..(223)X46 domain
11Ala Asp Lys Ile Gly Asp Asp Tyr Gly Phe Gly Thr Tyr Val Tyr Pro1
5 10 15Lys Asp Pro Ala Phe Ala
Pro Tyr Lys Gly Leu Trp Asp Ile Thr Glu 20 25
30Val Thr Val Leu Glu Asn Asp Glu Ala Tyr Val Phe Ser
Ile Lys Phe 35 40 45Ala Glu Met
Thr Asn Pro Trp Ala Ser Pro Lys Gly Phe Ser His Gln 50
55 60Leu Val Asn Ile Tyr Leu Asp Thr Lys Ala Gly Gly
Lys Thr Ser Thr65 70 75
80Tyr Lys Glu Gly Ala Arg Val Gln Phe Lys Glu Pro Trp Asp Tyr Phe
85 90 95Ile Lys Val Ala Gly Trp
Pro Asp Asp Arg Ile Val Phe Ala Thr Ala 100
105 110Asp Gly Lys Glu Ile Pro Glu Ala Ile Ile Tyr Glu
Ala Asp Pro Ala 115 120 125Asp Lys
Val Ile His Ile Ile Val Phe Lys Lys Tyr Leu Glu Val Lys 130
135 140Thr Gly Ile Lys Ala Tyr Ile Leu Ser Leu Ser
Gln Asp Gly Tyr Gly145 150 155
160Thr Asp His Ile Arg Pro Val Ser Lys Asp Pro Thr Gln Trp Thr Leu
165 170 175Gly Gly Tyr Pro
Val Asp Ser Lys Asp Phe Ala Pro Tyr Val Leu Asp 180
185 190Thr Ile Val Pro Glu Gly Gln Lys Gln Glu Asp
Ile Leu Lys Ser Tyr 195 200 205Val
Pro Gly Gln Ser Tyr Ala Thr Leu Ile Pro Ile Val Val Lys 210
215 22012185PRTPyrococcus
furiosusDOMAIN(1)..(185)X46 Domain 12Asp Pro Glu Gly Asp Asp His Gly Pro
Gly Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Lys Val Phe Val Glu Gly Ala Phe Asp Leu Leu Arg Phe Arg
Met 20 25 30Leu Glu Gln Thr
Asp Ala Tyr Val Met Glu Phe Tyr Phe Lys Glu Leu 35
40 45Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser
Leu Gln Ile Ile 50 55 60Glu Val Tyr
Leu Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala Ile Lys65 70
75 80Met Phe Pro Asp Gly Pro Gly Ala
Asn Val Gln Leu Asp Pro Glu His 85 90
95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly
Asn Leu 100 105 110Ile Val Leu
Ala Asn Gly Thr Val Tyr Gln Gly Glu Met Gln Ile Ser 115
120 125Ala Asp Pro Thr Lys Asn Ala Val Ile Val Lys
Leu Pro Lys Lys Tyr 130 135 140Leu Ser
Ile Gly Asp Tyr Gly Leu Tyr Ala Ala Val Leu Val Gly Ser145
150 155 160Gln Asp Gly Tyr Gly Pro Asp
Lys Trp Arg Pro Val Ala Val Glu Ala 165
170 175Glu Gln Trp Lys Leu Gly Gly Ala Asp 180
18513238PRTStaphylothermus marinusDOMAIN(1)..(238)X46
Domain 13Asp Pro Glu Gly Asp Asp Asn Gly Tyr Gly Asn Leu Thr Tyr Pro Thr1
5 10 15Asn Glu Val Phe
Gln Pro Gly Val Phe Asp Met Leu Lys Phe Gly Val 20
25 30Tyr Glu Asp Ser Asp Asn Val Tyr Phe Lys Val
Thr Val Lys Asn Leu 35 40 45Gly
Asp Asn Pro Trp Ser Gly Pro Asn Gly Phe Cys Leu Gln His Val 50
55 60Gln Ile Tyr Met Leu Thr Thr Asp Asp Thr
Leu Pro Lys Asn Thr Ser65 70 75
80Thr Ile Gly Leu Asn Val Glu Ile Trp His Gly Trp Asn Tyr Val
Leu 85 90 95Leu Met Val
Pro Gly Trp Asp Ser Ala Pro Ala Pro Gln Gly Gln Leu 100
105 110Ser Ala Leu Tyr Asp Ala Thr Gly Lys Leu
Leu Ala Val Glu Thr Leu 115 120
125Asn Asn Thr Ile Asp Val Tyr Val Asp Pro Ser Asn Asn Asn Thr Ile 130
135 140Val Ala Lys Val Ser Lys Ser Leu
Leu Thr Asp Val Ala Asn Ile Lys145 150
155 160Asp Trp Val Phe Val Val Ala Leu Ala Gly Tyr Asp
Gly Tyr Ala Pro 165 170
175Tyr Lys Val Arg Ser Ile Val Ala Gly Asn Ala Thr Glu Trp Asn Phe
180 185 190Gly Gly Gly Asp Pro Gln
Ala Ile Asn Ala Gly Val Gln Pro Met Ile 195 200
205Ile Asp Leu Leu Ala Pro Thr Ala Gln Asp Gln Tyr Asn Met
Leu Ser 210 215 220Ser Tyr Asn Ala Ala
Ala Lys Ser Met Ala Val Ile Gly Gly225 230
23514231PRTPyrobaculum aerophilumDOMAIN(1)..(231)X46 Domain 14Ala Asp
Pro Val Gly Asp Asp Phe Gly Pro Gly Arg Tyr Gln Tyr Pro1 5
10 15Lys Asn Pro Val Phe Lys Pro Gly
Val Phe Asp Leu Thr Glu Phe Ser 20 25
30Leu Tyr Asp Val Gly Asp Lys Leu Arg Phe Val Phe Lys Val Arg
Glu 35 40 45Leu Gly Asp Asn Pro
Trp Gly Gly Pro Ala Gly Phe Ser Leu Gln Phe 50 55
60Phe His Val Tyr Ile Asn Arg Gly Ser Gly Ser Arg Asn Asp
Thr Leu65 70 75 80Gly
Leu Arg Val Ala Leu Cys Arg Asp Ala Ala Trp Asp Val Ala Leu
85 90 95Leu Ile Gly Pro Gly Trp Ser
Gly Gly Asn Arg Ile Val Tyr Ser Asp 100 105
110Asn Thr Tyr Val Asp Asp Ala Met Ser Ile Lys Val Ala Pro
Asn Asn 115 120 125Thr Val Val Ala
Asp Val Pro Lys Arg Tyr Ile Gly Glu Phe Asn Ser 130
135 140Ser Trp Lys Ile Thr Val Phe Leu Thr Ser Trp Asp
Gly Tyr Gly Pro145 150 155
160Asp Asn Ile Arg Asn Phe Gly Val Val Ser Asp Glu Trp Thr Ala Gly
165 170 175Gly Ala Asp Pro Val
Ala Val Leu Ala Asn Val Ala Pro Arg Val Phe 180
185 190Asp Leu Leu Ala Glu Thr Ala Glu Gln Gln Ile Lys
Ala Leu Thr Ser 195 200 205Tyr Gln
Val Thr Arg Leu Pro Asn Gly Thr Tyr Leu Gly Arg Pro Thr 210
215 220Arg Val Cys Ala Tyr Ile Ser225
23015251PRTPyrobaculum aerophilumDOMAIN(1)..(251)X46 Domain 15Asp Glu
Ser Gly Asp Phe Gln Gly Pro Gly Trp Tyr Ser Leu Pro Gln1 5
10 15Tyr Pro Val Phe Lys Asn Gly Ser
Val Phe Asp Val Thr Lys Phe Glu 20 25
30Val Leu Tyr Asn Ala Ser Ala Asp Ala Leu Val Phe Arg Ile Thr
Phe 35 40 45Ala Asp Leu Gly Gly
Asn Pro Trp Gly Ser Glu Thr Gly Phe Ser Leu 50 55
60Gln Tyr Val Leu Ile Tyr Ile Ser Arg Gly Phe Pro Gly Asn
Pro Trp65 70 75 80Gly
Thr Val Ser Cys Thr Ile Leu Arg Pro Asp Asp Gly Asn Val Ala
85 90 95Ser Gly Asn Ala Phe Phe Asp
Glu Ala Thr Arg Phe Phe Cys Pro Asp 100 105
110Pro Ala Asn Leu Thr Gln Tyr Lys Tyr Thr Pro Gly Val Arg
Phe Ser 115 120 125Ser Leu Ala Pro
Trp Asp Val Ala Ile Phe Ile Gly Pro Lys Trp Gly 130
135 140Asn Glu Thr Val Asn Phe Val Ala Val Ala Asp Val
Thr Gly Gly Thr145 150 155
160Ile Ser Val Ser Pro Leu Pro Gln Val Tyr Ala Ser Asp Asn Ser Ile
165 170 175Ile Ala Val Val Pro
Arg Lys Leu Ile Pro Pro Thr Thr Arg Leu Met 180
185 190Ser Asp Phe Pro Gln Pro Ser Trp Arg Tyr Tyr Val
Leu Val Thr Ser 195 200 205Tyr Asp
Asp Tyr Gly Pro Gly Arg Ile Arg Pro Phe Gly Pro Met Ala 210
215 220Gln Glu Trp Thr Val Gly Val Gly Thr Ala Asn
Ala Ser Ala Val Leu225 230 235
240Ser Gly Thr Val Pro Arg Val Leu Asp Ile Leu 245
25016234PRTPyrococcus abyssiDOMAIN(1)..(234)X46 Domain 16Ile
Glu Gly Asp Asp His Gly Pro Gly Asn Tyr Thr Tyr Ala Thr Asp1
5 10 15Lys Val Phe Val Glu His His
Leu Asp Leu Leu Lys Val Arg Leu Leu 20 25
30Glu Arg Pro Asn Ser Tyr Val Phe Glu Phe Tyr Phe Lys Glu
Leu Gly 35 40 45Asp Asn Pro Trp
Asn Ala Pro Tyr Gly Phe Ser Leu Gln Ile Met Glu 50 55
60Val Tyr Leu Asp Tyr Lys Glu Gly Gly Asn Thr Ser Ala
Ile Lys Met65 70 75
80Phe Pro Asp Gly Pro Gly Ser Asn Val Asp Leu Asp Pro Glu His Pro
85 90 95Trp Asp Val Ala Leu Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Ile Ile 100
105 110Val Leu Ala Asn Gly Thr Thr Tyr Gln Gly Glu Met
Lys Ile Ser Ala 115 120 125Asp Pro
Val Lys Asn Arg Ile Ile Val Glu Val Pro Lys Lys Tyr Leu 130
135 140Pro Lys Val Pro Glu Phe Met Ala Val Leu Val
Gly Ser Gln Asp Gly145 150 155
160Phe Gly Pro Asp Lys Trp Arg Pro Val Ser Val Lys Ala Glu Gln Trp
165 170 175Val Gly Gly Gly
Ala Pro Ala Asp Ala Val Ile Ala Gly Val Ala Pro 180
185 190Arg Val Tyr Asp Leu Leu Val Pro Glu Gly Phe
Glu Pro Thr Gln Glu 195 200 205Glu
Gln Leu Ser Ser Phe Asp Pro Lys Ala Gly Lys Arg Ala Val Val 210
215 220Lys Met Ile Pro Val Lys Ala Lys Thr
Asn225 23017238PRTPyrococcus abyssiDOMAIN(1)..(238)X46
Domain 17Ile Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Ala Thr Asp1
5 10 15Lys Val Phe Val
Glu His His Leu Asp Leu Leu Arg Phe Arg Met Leu 20
25 30Asp Thr Gly Asp Thr Tyr Thr Leu Glu Phe Tyr
Phe Lys Glu Leu Gly 35 40 45Asp
Asn Pro Trp Asn Ala Pro Tyr Gly Phe Ser Leu Gln Ile Ile Glu 50
55 60Val Tyr Leu Asp Phe Lys Glu Gly Gly Asn
Thr Ser Ala Ile Lys Met65 70 75
80Phe Pro Asp Gly Pro Gly Ser Asn Val Asp Leu Asp Pro Glu His
Pro 85 90 95Trp Asp Val
Ala Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn Ile Ile 100
105 110Val Pro Ala Asn Gly Thr Val Tyr Thr Gly
Glu Met Lys Ile Ser Ala 115 120
125Asp Pro Ile Lys Asn Ala Ile Ile Val Glu Val Pro Lys Lys Phe Ile 130
135 140Ser Leu Asp Lys Asn Tyr Gly Leu
Tyr Gly Ala Val Leu Val Gly Ser145 150
155 160Gln Asp Gly Phe Gly Pro Asp Lys Trp Arg Pro Val
Ser Val Lys Ala 165 170
175Glu Gln Trp Val Gly Gly Gly Ala Ser Ala Glu Ala Val Ile Ala Gly
180 185 190Val Ala Pro Arg Val Tyr
Asp Leu Leu Val Pro Gln Gly Phe Arg Pro 195 200
205Thr Gln Glu Glu Gln Leu Ser Ser Phe Asp Pro Lys Ala Gly
Lys Arg 210 215 220Ala Ile Val Lys Met
Ile Pro Leu Trp Ser Val Pro Lys Glu225 230
23518238PRTStaphylothermus helenicusDOMAIN(1)..(238)X46 Domain 18Asp Pro
Glu Gly Asp Asp Asn Gly Tyr Gly Asn Ile Thr Tyr Pro Thr1 5
10 15Asn Glu Val Phe Gln Pro Gly Val
Phe Asp Met Leu Lys Phe Gly Val 20 25
30Tyr Glu Asp Ser Asp Asn Val Tyr Phe Lys Val Thr Val Lys Asn
Ser 35 40 45Gly Asp Asn Pro Trp
Ser Gly Pro Asn Gly Phe Cys Leu Gln His Ile 50 55
60Gln Ile Tyr Met Leu Thr Thr Asp Asp Ala Leu Pro Lys Asn
Thr Ser65 70 75 80Thr
Ile Gly Leu Asn Val Glu Ile Trp His Gly Trp Asn Tyr Val Leu
85 90 95Leu Met Val Pro Gly Trp Asp
Thr Ala Pro Val Pro Lys Gly Gln Leu 100 105
110Ser Ala Leu Tyr Asp Ala Thr Gly Lys Leu Leu Ala Val Glu
Thr Leu 115 120 125Asn Asn Thr Ile
Asp Val Tyr Leu Asp Pro Ser Asp Asn Asn Thr Ile 130
135 140Val Ala Lys Ile Ser Lys Ser Leu Leu Ala Asp Val
Gly Asn Ile Lys145 150 155
160Asp Trp Val Phe Val Val Ala Leu Ala Gly Tyr Asp Gly Tyr Ala Pro
165 170 175Tyr Lys Val Arg Ser
Ile Val Ala Gly Asn Ser Thr Glu Trp Asn Phe 180
185 190Gly Gly Gly Asp Pro Glu Ala Ile Asn Ala Gly Val
Gln Pro Met Ile 195 200 205Ile Asp
Leu Leu Ala Pro Thr Ala Gln Asp Gln Tyr Asn Met Leu Ser 210
215 220Ser Tyr Asp Ala Ala Ala Asn Ser Thr Ala Ile
Ile Gly Gly225 230
23519245PRTStaphylothermus marinusDOMAIN(1)..(245)X46 Domain 19Asp Pro
Leu Gly Asp Asp Asn Gly Tyr Gly Asn Ile Thr Tyr Pro Thr1 5
10 15Asp Ser Val Phe Gln Pro Gly Val
Phe Asp Leu Val Lys Phe Gln Ile 20 25
30Glu Asp Thr Ala Ser Thr Leu Tyr Phe Lys Val Thr Leu Asp Asn
Leu 35 40 45Gly Asp Asn Pro Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Tyr Ile 50 55
60Gln Ile Tyr Ile Leu Thr Ser Asn Gln Thr Leu Pro Val Asn
Tyr Thr65 70 75 80Thr
Ser Gly Leu Asn Val Met Val Ser His Gly Trp Asn Tyr Ala Val
85 90 95Leu Met Val Pro Gly Trp Asp
Thr Ala Pro Val Pro Asn Gly Gln Leu 100 105
110Ser Ala Ile Tyr Asp Ala Asn Gly Asn Val Val Ala Val Glu
Gly Ser 115 120 125Thr Pro Gly Phe
Asp Val Tyr Val Asp Pro Asn Ile Asn Asn Thr Ile 130
135 140Val Ala Ser Ile Asp Lys Thr Leu Leu Tyr Asp Thr
Gln Asn Leu Pro145 150 155
160Leu Trp Lys Ile Ala Val Val Val Ala Gly Tyr Asp Gly Tyr Ala Pro
165 170 175Tyr Lys Val Arg Gln
Val Val Ala Gly Asn Ser Thr Gln Trp Glu Phe 180
185 190Gly Gly Gly Asp Pro Ala Ala Ile Asn Ala Gly Val
Gln Pro Glu Val 195 200 205Ile Asp
Leu Leu Ala Pro Thr Ala Asn Asp Gln Tyr Gln Met Leu Ser 210
215 220Ser Tyr Asn Ala Ser Thr Gly Thr Pro Ala Asn
Ile Thr Gly Ile Ser225 230 235
240Val Ser Ser Met Thr 24520240PRTStaphylothermus
marinusDOMAIN(1)..(240)X46 Domain 20Asp Pro Leu Gly Asp Asp Asn Gly Tyr
Gly Asn Ile Thr Tyr Pro Thr1 5 10
15Asp Ser Val Phe Gln Pro Gly Val Phe Asp Leu Ala Gly Phe Lys
Val 20 25 30Val Asp Ala Gly
Ser Thr Ile Gln Phe Tyr Val Tyr Leu Asp Asn Leu 35
40 45Gly Asp Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser
Leu Gln Tyr Ile 50 55 60His Ile Tyr
Ile Tyr Thr Gly Asp Ser Ser Leu Pro Val Asn Thr Thr65 70
75 80Ser Phe Gly Glu Asn Val Asp Tyr
Ser Pro Gly Trp His Met Ala Ile 85 90
95Leu Leu Thr Pro Gly Trp Asp Thr Ala Pro Val Pro Asn Gly
Gln Leu 100 105 110Ser Ala Ile
Tyr Tyr Tyr Asn Gly Thr Ala Tyr Ala Gln Asp Asn Asn 115
120 125Leu Phe Lys Val Tyr Val Asp Thr Ser Asn Asn
Thr Ile Ile Ala Glu 130 135 140Val Asp
Lys Ser Leu Leu Leu Asp Thr Asn Ile Ile Asn Asn Trp Lys145
150 155 160Tyr Ala Val Ile Met Thr Gly
Tyr Asp Gly Tyr Gln Pro Asp Lys Val 165
170 175Arg Lys Val Val Ala Gly Asn Ser Thr Gln Trp Glu
Phe Gly Gly Gly 180 185 190Asp
Pro Ala Ala Ile Asn Ala Gly Val Gln Pro Tyr Val Ile Asp Leu 195
200 205Leu Ala Pro Thr Ser Ser Glu Gln Tyr
Gln Met Leu Ser Ser Tyr Asp 210 215
220Pro Ala Ala Gly Thr Arg Ala Val Val Tyr Val Gln Tyr Pro Val Thr225
230 235
24021239PRTArthrobacter globiformisDOMAIN(1)..(239)X46 Domain 21Asp Pro
Ala Gly Asp Asp Asn Gly Pro Gly Thr Tyr Arg Tyr Pro Thr1 5
10 15Asn Ser Ala Tyr Val Pro Gly Ala
Phe Asp Leu Thr Gly Val Asp Val 20 25
30Tyr Asp Ala Gly Asp Asp Tyr Ala Phe Val Ala Thr Ile Ala Gly
Glu 35 40 45Val Thr Asn Pro Trp
Gly Gly Gln Ala Ile Ser His Gln Arg Val Asn 50 55
60Ile Tyr Leu Gly Lys Gly Glu Gly Gly Ala Thr Pro Gly Leu
Pro Gly65 70 75 80Thr
Asn Ile Asn Leu Glu His Ala Trp Asp Ser Val Ile Val Thr Asp
85 90 95Gly Arg Phe Asp Gly Ala Gly
Val Tyr Ala Pro Asp Gly Thr Arg Thr 100 105
110Ser Ala Val Ser Leu Leu Ala Val Pro Glu Ala Arg Gln Ile
Val Thr 115 120 125Arg Val Pro Lys
Ala Ala Leu Gly Gly Leu Asp Pro Ala Thr Ala Arg 130
135 140Met Ser Val Ala Met Phe Gly Asn Ala Glu Ser Gly
Glu Gly Ile Gly145 150 155
160Asn Val Arg Pro Val Tyr Asp Gly Ala Tyr Trp Glu Ala Gly Asp Pro
165 170 175Ala Trp Ile Lys Glu
Trp Arg Phe Gly Gly Gly Ala Gly Val Phe Asp 180
185 190Gly Thr Ile Pro Ser Arg Asp Thr Asp Thr Asp Asp
Pro Asn Ala Leu 195 200 205Asp Val
Leu Val Gly Glu Gly Gln Thr Gln Ala Ala Val Leu Asp Trp 210
215 220Arg Ala Gly Ser Pro Val Val Val Pro Met Leu
Gly Leu Gln Pro225 230
23522243PRTScardovia inopinataDOMAIN(1)..(243)X46 Domain 22Asp Pro Gln
Gly Asp Asp Asp Gly Asp Gly Asn Tyr Leu Tyr Pro Thr1 5
10 15Asp Gly Ala Phe Asn Lys Gly Ser Phe
Asp Met Thr Gly Val Arg Val 20 25
30Tyr Ser Asp Gly Asp Thr Ile Arg Leu Val Ala Thr Met Ala Gly Asp
35 40 45Val Arg Asn Pro Trp Ser Ala
Asn His Met Ser Thr Gln Arg Leu Asn 50 55
60Tyr Tyr Leu Ser Asp Pro Gly Asn Ala Ser Gly Ile Ser Ala Gly Val65
70 75 80Gly Ala Ser Ala
Val Pro Leu Leu Pro Gly Thr Asn Thr Asn Ser Arg 85
90 95Gly Pro Trp Arg Tyr Ala Ile Val Val Asp
Gly Arg Asn Ala Ala Ser 100 105
110Lys Tyr Gly Pro Gly Val Tyr Asp Lys Asn Gly Thr Arg Leu Gly Pro
115 120 125Ile Asp Leu Thr Val Val Gly
Gly Arg Gln Ile Val Ala Ser Phe Asp 130 135
140Ala Ser Leu Leu Ala Gly Phe Asp Tyr Ala Lys Ala Gly Tyr Gln
Val145 150 155 160Ser Met
Phe Ser Ser Ser Glu Asp Gly Glu Gly Val Gly Asn Val Arg
165 170 175Pro Val Tyr Ser Ala Asp Cys
Tyr His Gly Ile Gly Cys Asp Ala Gly 180 185
190Thr Gly Gln Tyr Lys Phe Gly Gly Gly Arg Gly Gln Thr Met
Ser Ser 195 200 205Ser Pro Phe Asp
Thr Asp Leu Thr Asp Ser Asn Ala Ile Asp Val Ile 210
215 220Thr Gly Pro Ala Asp Gln His Ala Leu Met Lys Pro
Val Ala Gly Gly225 230 235
240Pro Ile Leu23242PRTParascardovia denticolensDOMAIN(1)..(242)X46
Domain 23Asp Pro Gln Gly Asp Asp Asp Gly Asp Gly Asp Tyr Ile Tyr Pro Thr1
5 10 15Asp Gly Ala Phe
Asn Lys Gly Ser Phe Asp Leu Thr Gly Val Lys Val 20
25 30Tyr Arg Asp Gly Asp Lys Ile Cys Leu Val Ala
Ser Met Ala Gly Asp 35 40 45Val
Arg Asn Pro Trp Ser Ala Asn Gln Met Ser Thr Gln Arg Leu Asn 50
55 60Tyr Tyr Leu Ser Asp Thr Ala Val Ala Ala
Ala Pro Gly Asp Gln Ala65 70 75
80Ala Thr Thr Thr Pro Leu Leu Pro Gly Thr Asn Thr Asn Ala Ala
Gly 85 90 95Ala Trp Arg
Tyr Ala Val Val Val Asp Gly Arg Asn Ala Asp Ser Gln 100
105 110Tyr Gly Pro Gly Val Tyr Asp Lys Asp Gly
Arg Lys Leu Gly Gly Ile 115 120
125Asp Leu Asp Val Val Gly Gly Arg Gln Val Val Ala Ser Phe Asp Ala 130
135 140Ser Leu Leu Gly Ala Phe Asp Leu
Ala Lys Ala Gly Tyr Gln Val Ser145 150
155 160Met Tyr Ser Ser Ser Glu Asp Gly Glu Gly Val Gly
Asn Val Arg Pro 165 170
175Val Tyr Ser Leu Asp Cys His Lys Gly Val Thr Cys Pro Ala Gly Thr
180 185 190Gly Asp Tyr Arg Phe Gly
Gly Gly Arg Gly Glu Val Ser Asp Lys Ser 195 200
205Pro Phe Asp Thr Asp Leu Thr Asp Ser Asn Ala Ile Asp Ala
Val Thr 210 215 220Gly Ser Thr Asp Gln
His Ala Val Met Lys Pro Val Glu Gly Gly Pro225 230
235 240Val Leu24239PRTThermosphaera
aggregansDOMAIN(1)..(239)X46 Domain 24Asp Pro Glu Gly Asp Asp Lys Gly Thr
Gly Thr Leu Leu Tyr Pro Thr1 5 10
15Asn Pro Val Phe Gln Pro Ser Ile Tyr Asp Leu Val Lys Phe Gly
Val 20 25 30Tyr Ile Asp Asp
Asn Phe Val Tyr Phe Arg Thr Thr Val Lys Asn Leu 35
40 45Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe Cys
Leu Gln Asn Val 50 55 60Gln Ile Tyr
Ile Thr Thr Thr Ser Glu Ala Leu Pro Ile Asn Thr Ser65 70
75 80Ser Ile Gly Leu Gly Val Gln Ile
Trp His Gly Trp His Tyr Ala Val 85 90
95Ile Ala Ile Pro Gly Trp Gly Ser Thr Pro Tyr Pro Asp Gly
Glu Val 100 105 110Ser Val Leu
Phe Asn Ala Lys Met Asp Arg Leu Ala Asp Glu Tyr Asn 115
120 125Asn Asn Asp Leu Phe Asp Val Tyr Leu Ser Asp
Ile Glu Pro Asn Thr 130 135 140Ile Glu
Val Lys Ile Ser Lys Thr Leu Leu Glu Asp Val Glu Asn Ile145
150 155 160Arg Asn Trp Val Val Phe Val
Ala Val Ser Ser Tyr Asp Gly Tyr Gly 165
170 175Glu Gly Lys Ile Arg Ala Val Gln Ala Gly Asp Pro
Gly Glu Trp Val 180 185 190Leu
Gly Gly Gly Asp Pro Leu Ala Ile Leu Ala Gly Val Gln Pro Lys 195
200 205Val Val Asp Ile Leu Ala Pro Thr Pro
Glu Gln Gln Tyr Ala Met Leu 210 215
220Thr Ser Tyr Asp Thr Ala Asn Lys Ile Pro Ala Lys Val Ser Gly225
230 23525239PRTThermosphaera
aggregansDOMAIN(1)..(239)X46 Domain 25Asp Pro Ile Gly Asp Asp Asp Gly Ala
Gly Gly Tyr Thr Tyr Pro Thr1 5 10
15Asn Pro Val Phe Ala Pro Gly Val Phe Asp Leu Val Lys Phe Gln
Val 20 25 30Val Asp Ala Gly
Asp Lys Val Val Phe Thr Ile Thr Phe Arg Asn Leu 35
40 45Gly Gly Asn Pro Trp Gly Gly Pro Asn Gly Trp Ser
Met Gln Gln Val 50 55 60His Ile Tyr
Val His Thr Thr Met Ser Gly Gly Lys Thr Asp Thr Phe65 70
75 80Gly Leu Asn Val Lys Ile Ala Glu
Glu His Ala Trp His Met Ala Leu 85 90
95Ile Val Ala Pro Gly Trp Gly Thr Asp Pro Val Pro Ile Gly
Glu Lys 100 105 110Thr Gly Ile
Tyr Tyr Tyr Asp Lys Glu Ser Pro Thr Ala Gln Glu Gly 115
120 125Asp Phe Lys Ala Tyr Ala Asp Thr Gly Asn Asn
Arg Ile Ile Val Glu 130 135 140Val Pro
Lys Ser Met Leu Tyr Asp Thr Gly Asn Ile Asp Lys Trp Ile145
150 155 160Tyr Val Val Ala Val Thr Ser
His Asp Gly Tyr Ser Pro Thr Arg Ile 165
170 175Arg Ala Phe Gln Val Gly Gly Gly Glu Trp Val Val
Gly Val Pro Ser 180 185 190Asp
Tyr Ala Val Ala Val Leu Asn Gly Val Leu Pro Tyr Val Leu Asp 195
200 205Leu Leu Ala Glu Thr Lys Glu Asp Gln
Tyr Ser Met Leu Lys Ser Tyr 210 215
220Ser Ile Glu Ala Lys Ala Leu Ala Thr Leu Arg Gly Val Gly Ala225
230 23526227PRTThermincola
potensDOMAIN(1)..(227)X46 Domain 26Asp Pro Ala Arg Asp Asp Tyr Gly Pro
Gly Ser Tyr Lys Tyr Pro Thr1 5 10
15Asp Ser Ile Phe Asp Pro Lys Ser Gly His Phe Asp Leu Leu Lys
Phe 20 25 30Thr Val Ser Ala
Lys Glu Asp Lys Tyr Phe Phe Asp Ile Lys Leu Gly 35
40 45Arg Ile Thr Asn Pro Trp Gly Ala Ala Glu Gly Phe
Ser His Gln Ile 50 55 60Ile Gln Ile
Tyr Ile Ala Asp Gly Ser Glu Asn Gly Arg Ile Glu Thr65 70
75 80Phe Lys Gln Gly Ala Asn Val Gln
Phe Ser Pro Gln Tyr Pro Trp Thr 85 90
95Ser Leu Ile Lys Val Val Ser Phe Gly Lys Thr Ala Val Tyr
Ser Ser 100 105 110Thr Asp Tyr
Glu Thr Ser Asp Gly Lys Ser Val Gly Val Thr Ala Lys 115
120 125Leu Gln Pro Asp Lys Gln Thr Ile Arg Val Thr
Val Pro Lys Lys Tyr 130 135 140Ile Ala
Gly Gln Pro Glu Lys Trp Ala Tyr Tyr Val Leu Val Gly Ser145
150 155 160Gln Asp Gly Ser Gly Pro Asp
Asn Tyr Arg Gln Val Met Ala Gln Val 165
170 175Thr Gln Trp Asn Phe Gly Gly Gly Gln Asn Ser Pro
Leu Asn Pro Asn 180 185 190Val
Ile Asp Ile Leu Ala Pro Lys Lys Gly Leu His Thr Gln Glu Lys 195
200 205Met Leu Lys Ser Phe Asp Pro Gly Arg
Gly Arg Leu Ala Met Leu Tyr 210 215
220Pro Val Gly22527238PRTStaphylothermus hellenicusDOMAIN(1)..(238)X46
Domain 27Asp Pro Glu Gly Asp Asp Asn Gly Tyr Gly Asn Ile Thr Tyr Pro Thr1
5 10 15Asn Glu Val Phe
Gln Pro Gly Val Phe Asp Met Leu Lys Phe Gly Val 20
25 30Tyr Glu Asp Ser Asp Asn Val Tyr Phe Lys Val
Thr Val Lys Asn Ser 35 40 45Gly
Asp Asn Pro Trp Ser Gly Pro Asn Gly Phe Cys Leu Gln His Ile 50
55 60Gln Ile Tyr Met Leu Thr Thr Asp Asp Ala
Leu Pro Lys Asn Thr Ser65 70 75
80Thr Ile Gly Leu Asn Val Glu Ile Trp His Gly Trp Asn Tyr Val
Leu 85 90 95Leu Met Val
Pro Gly Trp Asp Thr Ala Pro Val Pro Lys Gly Gln Leu 100
105 110Ser Ala Leu Tyr Asp Ala Thr Gly Lys Leu
Leu Ala Val Glu Thr Leu 115 120
125Asn Asn Thr Ile Asp Val Tyr Leu Asp Pro Ser Asp Asn Asn Thr Ile 130
135 140Val Ala Lys Ile Ser Lys Ser Leu
Leu Ala Asp Val Gly Asn Ile Lys145 150
155 160Asp Trp Val Phe Val Val Ala Leu Ala Gly Tyr Asp
Gly Tyr Ala Pro 165 170
175Tyr Lys Val Arg Ser Ile Val Ala Gly Asn Ser Thr Glu Trp Asn Phe
180 185 190Gly Gly Gly Asp Pro Glu
Ala Ile Asn Ala Gly Val Gln Pro Met Ile 195 200
205Ile Asp Leu Leu Ala Pro Thr Ala Gln Asp Gln Tyr Asn Met
Leu Ser 210 215 220Ser Tyr Asp Ala Ala
Ala Asn Ser Thr Ala Ile Ile Gly Gly225 230
23528223PRTKtedonobacter racemiferDOMAIN(1)..(223)X46 Domain 28Pro Ser
Asn Asp Asp Asn Gly Pro Gly Asn Tyr Ala Tyr Pro Thr Ala1 5
10 15Ser Asp Phe His Pro Gly Ala Tyr
Asp Met Gln Asp Phe Arg Val Tyr 20 25
30Asp Asp Gly Thr Asn Ile Ile Phe Lys Val Gln Val Thr Asp Leu
Thr 35 40 45Pro Thr Phe Gly Ser
Pro Leu Gly Ala Gln Leu Ile Asp Val Tyr Val 50 55
60His Glu Pro Gly Ala Ser Gln Thr Ser Ile Ala Ala Ala Tyr
Pro Gln65 70 75 80Arg
Asn Tyr Ser Ile Asp Pro Gly Ala Ser Trp Ser Gln Leu Leu Glu
85 90 95Val Gln Gly Phe Gly Gln Arg
Tyr Val Asp Ala Arg Gly Thr Thr Leu 100 105
110Gly Thr Ile Asn Ile Ser Ala Asn Ala Ile Ser Arg Tyr Ile
Thr Phe 115 120 125Ser Val Pro Lys
Ala Thr Leu Gly Gln Pro Gly Ser Gly Trp Gly Phe 130
135 140Thr Val Thr Leu Thr Gly Gln Asp Gly Tyr Ser Pro
Asp Gln Ala Arg145 150 155
160Ser Phe Ala Ser Thr Pro Gln Pro Tyr Asn Phe Gly Val Cys Ala Thr
165 170 175Ala Ser Ser Asp Pro
His Cys Thr Val Asp Pro Ala Thr Val Pro Lys 180
185 190Val Met Asp Val Leu Thr Pro Ser Asn Val Gln Gln
Ser Ser Glu Leu 195 200 205Asp Tyr
Thr Lys Gly Pro Val Val Leu Gln Asp Val Val Ile Pro 210
215 22029253PRTPyrobaculum
calidifontisDOMAIN(1)..(253)X46 Domain 29Asp Pro Thr Gly Asp Tyr Lys Gly
Pro Gly Trp Phe Leu Pro Pro Gln1 5 10
15Asn Pro Val Phe Lys Asn Gly Thr Val Phe Asp Leu Thr Arg
Phe Glu 20 25 30Val Leu Tyr
Asn Ala Thr Ala Asp Ala Leu Val Phe Arg Leu Thr Phe 35
40 45Ala Asp Leu Gly Asp Asn Pro Trp Gly Thr Glu
Thr Gly Phe Ser Val 50 55 60Gln Tyr
Ile Gln Ile Tyr Ile His Arg Gly Phe Pro Gly Asn Pro Trp65
70 75 80Gly Thr Val Ser Cys Thr Ile
Leu Arg Pro Asp Asp Gly Asp Val Ala 85 90
95Ala Gly Asn Ala Phe Phe Asp Glu Ala Thr Arg Phe Phe
Cys Pro Asp 100 105 110Pro Ala
Asn Leu Thr Gln Phe Lys Tyr Thr Pro Gly Val Lys Phe Ser 115
120 125Asn Asp Ala Pro Trp Asp Val Ala Ile Phe
Ile Gly Pro Lys Trp Gly 130 135 140Asn
Glu Thr Val Asn Tyr Val Ala Val Ala Asp Val Thr Gly Gly Thr145
150 155 160Ile Ser Val Ala Pro Leu
Gln Arg Val Tyr Ala Ser Gly Asn Thr Ile 165
170 175Val Ala Val Val Pro Arg Ser Ala Ile Pro Pro Thr
Thr Arg Leu Met 180 185 190Ser
Asp Phe Pro Gln Pro Ser Trp Arg Tyr Tyr Val Leu Val Thr Ser 195
200 205Tyr Asp Gly Tyr Gly Pro Gly Arg Ile
Arg Pro Phe Gly Pro Met Ala 210 215
220Gln Glu Trp Ala Val Gly Val Gly Ala Ala Asn Ala Ser Ser Val Leu225
230 235 240Ala Gly Thr Val
Pro Arg Val Leu Asp Val Leu Gly Pro 245
25030222PRTAcetohalobium arabaticumDOMAIN(1)..(222)X46 Domain 30Asp Pro
Glu Gly Asp Asp Tyr Gly Pro Gly Thr Tyr Val Tyr Pro Thr1 5
10 15Ser Glu Gln Phe Ala Pro Phe Glu
Gly Leu Phe Asp Leu Arg Arg Val 20 25
30Arg Val Glu Glu Arg Glu Ser Asp Tyr Ser Phe Arg Phe Lys Phe
Gly 35 40 45Thr Val Thr Asn Pro
Trp His Ala Pro Tyr Gly Phe Ser His Gln Leu 50 55
60Ile Gln Val Tyr Ile Asp Asn Gln Asp Ser Gly Ala Thr Thr
Val Phe65 70 75 80Lys
Lys Gly Ala Asn Val Lys Phe Ser Lys Glu Ser Ser Trp Asn Lys
85 90 95Leu Ile Lys Ile Thr Gly Trp
Asn Ile Lys Val Phe Asp Tyr Gln Asp 100 105
110Asp Leu Ser Gln Glu Thr Glu Pro Val Val Asp Ala Glu Ala
Lys Val 115 120 125Leu Glu Asp Lys
Gln Thr Ile Gln Ala Arg Ile Pro Lys Glu Leu Ile 130
135 140Gly Ser Leu Asp Ser Ala Arg Tyr Tyr Val Leu Ile
Gly Ser Leu Asp145 150 155
160Gly Phe Ser Tyr Asp Asn Tyr Arg Pro Val Ile Glu Glu Val Asp Asp
165 170 175Trp Lys Phe Gly Gly
Gly Thr Asp Thr Gln Tyr Asn Pro Asn Val Leu 180
185 190Asp Ile Leu Val Pro Glu Asp Lys Ser Gln Lys Glu
Ile Leu Ser Gly 195 200 205Tyr Asp
Val Glu Glu Glu Glu Leu Ala Thr Leu Tyr Pro Val 210
215 22031231PRTPyrobaculum
calidifontisDOMAIN(1)..(231)X46 Domain 31Glu Asp Pro Pro Gly Asp Asp Phe
Gly Pro Gly Ser Tyr Asn Tyr Pro1 5 10
15Lys Asn Pro Ala Phe Arg Pro Gly Val Phe Asp Leu Leu Gly
Met Glu 20 25 30Val Tyr Asp
Leu Gly Asp Lys Leu Arg Phe Val Phe Arg Val Arg Glu 35
40 45Leu Gly Gly Asn Pro Trp Gly Gly Pro Ala Gly
Phe Ser Leu Gln Phe 50 55 60Phe His
Val Tyr Ile Asn Arg Gly Arg Gly Thr Arg Asn Asp Thr Leu65
70 75 80Gly Leu Arg Val Ala Leu Cys
Arg Asp Ala Ala Trp Asp Ala Ala Leu 85 90
95Leu Ile Gly Pro Gly Trp Ser Gly Gly Asn Arg Ile Val
Phe Ala Asp 100 105 110Gly Ser
Phe Ile Asp Asp Ala Ile Ser Ile Arg Ala Gly Pro Asn Asn 115
120 125Thr Val Val Ala Asp Val Pro Lys Lys Tyr
Ile Gly Asp Phe Asp Pro 130 135 140Lys
Trp Arg Leu Thr Val Phe Leu Thr Ser Trp Asp Gly Tyr Gly Pro145
150 155 160Asp Asn Ile Arg Asn Phe
Gly Val Met Ala Asp Glu Trp Thr Val Gly 165
170 175Gly Ala Asp Pro Ala Ala Val Leu Ala Gly Val Ala
Pro Arg Val Phe 180 185 190Asp
Leu Leu Ala Pro Ala Ala Glu Glu Gln Lys Lys Ala Leu Ser Thr 195
200 205Tyr Lys Val Ser Arg Leu Pro Asn Gly
Thr Tyr Val Gly Thr Pro Ala 210 215
220Thr Val Cys Thr Tyr Val Ser225 23032231PRTPyrobaculum
arsenaticumDOMAIN(1)..(231)X46 Domain 32Val Asp Pro Leu Gly Asp Asp Phe
Gly Pro Gly Lys Tyr Gln Tyr Pro1 5 10
15Lys Asn Pro Ala Phe Lys Pro Gly Val Phe Asp Leu Thr Leu
Phe Glu 20 25 30Leu Tyr Asp
Leu Gly Asp Lys Phe Arg Phe Gln Phe Arg Val Lys Glu 35
40 45Leu Gly Gly Asn Pro Trp Gly Gly Pro Ala Gly
Phe Ser Leu Gln Phe 50 55 60Phe His
Val Tyr Ile Asn Arg Gly Gly Gly Val Arg Asn Asp Thr Leu65
70 75 80Gly Leu Arg Val Ser Leu Cys
Lys Glu Ala Ser Trp Asp Val Ala Leu 85 90
95Leu Ile Gly Pro Gly Trp Thr Gly Gly Asn Arg Ile Val
Tyr Ala Asp 100 105 110Gly Val
Tyr Val Asp Asp Ala Met Ser Ile Lys Leu Gly Thr Asn Asn 115
120 125Thr Ile Ile Ala Asp Val Pro Lys Lys Tyr
Leu Gly Asn Tyr Asp Asn 130 135 140Lys
Trp Lys Ile Thr Val Phe Leu Thr Ser Trp Asp Gly Tyr Gly Pro145
150 155 160Asp Asn Ile Arg Asn Phe
Gly Val Met Ala Asp Glu Trp Thr Val Gly 165
170 175Gly Ala Asp Pro Val Ala Val Leu Ala Gly Val Ala
Pro Arg Val Phe 180 185 190Asp
Val Leu Ala Glu Thr Ala Glu Met Gln Val Lys Ala Leu Thr Ser 195
200 205Tyr Lys Val Val Arg Leu Pro Asn Gly
Thr Tyr Ile Gly Ala Pro Ala 210 215
220Val Val Cys Ala Tyr Leu Thr225 23033253PRTPyrobaculum
arsenaticumDOMAIN(1)..(253)X46 Domain 33Asp Pro Thr Gly Asp Phe Lys Gly
Pro Gly Trp Phe Val Pro Pro Gln1 5 10
15Asn Pro Val Phe Lys Asn Gly Thr Val Phe Asp Leu Thr Lys
Phe Glu 20 25 30Val Leu Tyr
Asn Ala Thr Ala Asp Ala Leu Val Phe Arg Leu Thr Phe 35
40 45Ala Asp Leu Gly Gly Asn Pro Trp Gly Ser Glu
Thr Gly Phe Ser Leu 50 55 60Gln Tyr
Val Gln Ile Tyr Ile Ser Arg Gly Phe Pro Gly Asn Pro Trp65
70 75 80Gly Thr Val Ser Cys Thr Ile
Leu Arg Pro Asp Asp Gly Asp Val Ala 85 90
95Ser Gly Asn Ala Phe Phe Asp Glu Ala Thr Arg Phe Phe
Cys Pro Asp 100 105 110Pro Ala
Asn Leu Thr Gln Phe Lys Tyr Thr Pro Gly Val Lys Phe Ser 115
120 125Ser Gln Ala Pro Trp Asp Val Ala Ile Phe
Ile Gly Pro Lys Trp Gly 130 135 140Asn
Glu Thr Val Asn Phe Val Ala Val Ala Asp Val Thr Gly Gly Thr145
150 155 160Ile Ser Val Ser Pro Leu
Pro Arg Val Tyr Ala Gln Gly Asn Ala Ile 165
170 175Val Ala Val Val Pro Arg Lys Leu Ile Pro Pro Thr
Thr Arg Leu Met 180 185 190Ser
Asp Phe Pro Gln Pro Ser Trp Arg Tyr Tyr Val Leu Val Thr Ser 195
200 205Tyr Asp Gly Asn Gly Pro Gly Arg Ile
Arg Pro Phe Gly Pro Met Ala 210 215
220Gln Glu Trp Thr Val Gly Val Gly Thr Ala Asn Ala Ser Ser Val Leu225
230 235 240Ser Gly Thr Ile
Pro Arg Val Leu Asp Val Leu Gly Pro 245
25034202PRTAnaeromyxobacter dehalogenansDOMAIN(1)..(202)X46 Domain 34Asp
Pro Val Gly Asp Asp Asn Gly Pro Gly Lys Tyr Val Tyr Pro Thr1
5 10 15Asp Pro Val Tyr Lys Ala Gly
Ser Phe Asp Leu Thr Gln Leu Lys Val 20 25
30Thr Glu Lys Gly Asp Lys Val Thr Phe Glu Ile Thr Val Asn
Ser Asp 35 40 45Leu Glu Asp Pro
Trp Gly Met Pro Ala Pro Ala Asn Phe Ser Val Gln 50 55
60Met Ala Ile Ile His Ile Gln Thr Gly Lys Gly Pro Ser
Phe Thr Lys65 70 75
80Gly Ile Pro Gly Thr Asn Val Val Phe Ala Lys Asp Ser Ala Trp Asn
85 90 95Lys Val Val Ile Leu Ser
Pro Gln Pro Ala Gly Arg Val Arg Ser Glu 100
105 110Ala Lys Gln Lys Ala Ala Asp Leu Leu Ala Ala Ile
Val Val Pro Asp 115 120 125Glu Thr
Ile Gly Lys Gly Arg Thr Ile Thr Gly Thr Val Ser Lys Lys 130
135 140Asp Leu Gly Glu Gly Ser Ile Ala Lys Trp Gly
Tyr Gln Val Leu Met145 150 155
160Gln Ser Asn Glu Gly Phe Pro Asp Lys Thr Asp Leu Leu Thr Arg Lys
165 170 175Val Asn Glu Tyr
Glu Gly Gln His Arg Phe Gly Gly Gly Thr Asp Thr 180
185 190Asp Cys Asp Pro His Val Met Asp Val Leu
195 20035261PRTPyrobaculum islandicumDOMAIN(1)..(261)X46
Domain 35Asp Leu Ala Gly Asp Phe Lys Gly Pro Gly Trp Tyr Val Leu Pro Gln1
5 10 15Asn Pro Val Phe
Lys Asn Gly Thr Val Phe Asp Leu Thr Lys Phe Glu 20
25 30Val Leu Tyr Asn Ala Thr Ala Asp Ala Leu Ile
Phe Arg Val Thr Phe 35 40 45Ala
Asp Leu Gly Gly Asn Pro Trp Asn Ser Glu Thr Gly Phe Ser Leu 50
55 60Gln Tyr Val Gln Ile Tyr Ile Ser Arg Gly
Phe Pro Gly Asn Pro Trp65 70 75
80Gly Thr Val Ser Cys Ser Ile Leu Arg Pro Asp Asp Gly Asn Pro
Ala 85 90 95Val Gly Asn
Ala Phe Phe Asp Thr Ala Thr Arg Phe Phe Cys Pro Asp 100
105 110Pro Ala Asn Leu Thr Gln Phe Lys Tyr Thr
Pro Gly Val Lys Phe Ser 115 120
125Ser Ser Ala Pro Trp Asp Val Ala Ile Phe Ile Gly Pro Lys Trp Gly 130
135 140Asn Glu Thr Val Asn Phe Val Ala
Val Ala Asp Val Thr Gly Gly Thr145 150
155 160Ile Ser Val Ser Pro Leu Pro Arg Val Tyr Ala Gln
Gly Asn Ser Ile 165 170
175Ile Ala Val Val Pro Arg Lys Leu Ile Pro Pro Thr Thr Arg Leu Met
180 185 190Ser Asp Phe Pro Gln Pro
Thr Trp Arg Tyr Tyr Val Leu Val Thr Ser 195 200
205Tyr Asp Gly Phe Gly Pro Gly Arg Ile Arg Pro Phe Gly Pro
Leu Ala 210 215 220Gln Glu Trp Thr Val
Gly Val Gly Ala Ala Asn Ala Ser Ala Ile Leu225 230
235 240Ala Gly Thr Leu Pro Arg Val Leu Asp Val
Leu Gly Ser Asn Ala Gln 245 250
255Leu Arg Ala Phe Ser 26036231PRTPyrobaculum
islandicumDOMAIN(1)..(231)X46 Domain 36Ala Asp Pro Pro Gly Asp Asp Phe
Gly Thr Gly Lys Tyr Arg Tyr Pro1 5 10
15Lys Asn Pro Val Phe Lys Pro Gly Val Phe Asp Leu Leu Gly
Phe Thr 20 25 30Leu Tyr Asp
Leu Gly Asp Arg Leu Arg Phe Met Phe Arg Val Arg Glu 35
40 45Phe Gly Gly Asn Pro Trp Ser Gly Pro Ala Gly
Phe Ser Leu Gln Phe 50 55 60Phe His
Val Tyr Ile Asn Arg Gly Arg Gly Glu Arg Asn Asp Thr Leu65
70 75 80Gly Leu Gly Val Thr Leu Cys
Lys Glu Ala Met Trp Asp Val Ala Leu 85 90
95Leu Ile Gly Pro Gly Trp Ser Gly Gly Asn Arg Ile Val
Tyr Ser Asp 100 105 110Gly Ser
Phe Ile Asp Asp Ala Met Ala Ile Arg Pro Gly Pro Asn Asn 115
120 125Thr Ile Val Ala Asp Val Pro Lys Lys Tyr
Ile Gly Glu Phe Glu Lys 130 135 140Ser
Trp Lys Leu Thr Val Phe Leu Thr Ser Trp Asp Gly Tyr Gly Pro145
150 155 160Asp Asn Ile Arg Arg Phe
Gly Val Val Glu Asp Glu Trp Thr Val Gly 165
170 175Gly Ala Asp Ala Ala Ala Val Leu Ala Gly Val Ala
Pro Arg Val Phe 180 185 190Asp
Val Leu Ala Pro Thr Val Asp Ala Gln Val Arg Ala Leu Thr Ser 195
200 205Tyr Lys Val Ser Arg Leu Pro Asn Gly
Thr Tyr Val Gly Ala Pro Ala 210 215
220Ser Val Cys Ile Phe Tyr Thr225
23037217PRTPsychroflexus torquisDOMAIN(1)..(217)X46 Domain 37Asp Ala Ile
Gly Asp Glu Thr Gly Asp Gly Asp Tyr Ile Tyr Pro Leu1 5
10 15Ser Ser Asp Phe Ala Thr Pro Asn Asn
Gly Gly Leu Trp Asp Ala Lys 20 25
30Lys Leu Thr Ile Arg Gln Ser Ala Trp Asn Ala Gln Phe Ile Leu Glu
35 40 45Met Asp Glu Met Thr Asp Ile
Trp Ser Leu Ser Asn Gly Phe Ser His 50 55
60Gln Ile Val Gln Ile Tyr Val Asp Gln Gly Glu Thr Ser Tyr Gly Ser65
70 75 80Thr Glu Met Leu
Ser Gly Ala Asn Ala Leu Ile Asp Asp Ala Trp Ala 85
90 95Trp Glu Val Ala Ile Ser Gly Thr Gly Glu
Pro Gly Ala Val Leu Ala 100 105
110Val Gln Ser Gln Thr Gly Ser Thr Ser Ser Arg Gly Val Asp Val Ser
115 120 125Gly Asp Val Asp Ala Lys Thr
Ile Thr Phe Thr Val Ser Lys Asp Val 130 135
140Ile Gly Asp Asp Ile Pro Asn Tyr Arg Tyr Ile Val Val Ile Gly
Ser145 150 155 160Gln Asp
Gly Phe Gly Thr Gly Lys Trp Arg Asp Val Asp Ala Ser Pro
165 170 175Ser Thr Trp Thr Leu Gly Gly
Gly Ser Asp Pro Ala Ser Asp Asp Gly 180 185
190Ile Asp Tyr Asp Pro Asn Ile Ile Asp Met Ile Leu Asn Gly
Ser Gly 195 200 205Gln Glu Ala Met
Leu Ser Ser Tyr Asp 210 21538227PRTHalothermothrix
oreniiDOMAIN(1)..(227)X46 Domain 38Asp Pro Ala Gly Asp Asp Tyr Gly Pro
Gly Asn Tyr Arg Tyr Pro Thr1 5 10
15Asn Gly Asp Phe His Pro Phe Glu Gly Leu Phe Asp Ile Thr Arg
Phe 20 25 30Arg Ile Thr Glu
Lys Gly Asp Tyr Tyr Phe Phe Asp Phe Lys Phe Ser 35
40 45Lys Ile Thr Asn Pro Trp Gln Ser Glu Asn Gly Phe
Ser Leu Pro Leu 50 55 60Ile Glu Leu
Tyr Ile Asp Asn Gln Gln Gly Gly Asp Val Lys Leu Phe65 70
75 80Glu Pro Gly Ala Asn Val Glu Leu
Cys Pro Asp Tyr Pro Trp Asp Val 85 90
95Phe Leu Lys Ile Ser Gly Phe Trp Val Arg Ala Phe Asn Pro
Ser Asp 100 105 110Arg Asp Lys
Arg Lys Glu Leu Gln Ala Glu Ile Leu Ser Leu Gln Gln 115
120 125Leu Glu Lys Asn Pro Trp Asp Val Asn Asp Ser
Ser Leu Thr Val Thr 130 135 140Gly Asn
Thr Ile Thr Leu Lys Ile Lys Arg Asp Ile Val Gly Pro Leu145
150 155 160Asp Lys Ala Tyr Leu Tyr Ile
Leu Ile Gly Gly Phe Asp Pro Phe Gly 165
170 175Pro Gly His Phe Arg Glu Val Val Ser Asn Thr Ala
Ser Trp Arg Phe 180 185 190Ser
Leu Asn Ser Ser Gly Lys Leu Asp Tyr Ala Pro Arg Val Ile Asp 195
200 205Val Ile Leu Pro Glu Gly Met Lys Gln
Glu Glu Val Leu Gly Asn Phe 210 215
220Asn Asn Asp22539202PRTAnaeromyxobacter sp.DOMAIN(1)..(202)X46 Domain
39Asp Pro Val Gly Asp Asp Asn Gly Pro Gly Lys Tyr Val Tyr Pro Thr1
5 10 15Asp Pro Val Tyr Lys Ala
Gly Ser Phe Asp Leu Thr Gln Leu Lys Val 20 25
30Thr Glu Lys Gly Asp Lys Val Thr Phe Glu Ile Thr Val
Asn Ser Asp 35 40 45Leu Glu Asp
Pro Trp Gly Met Pro Ala Pro Ala Asn Phe Ser Val Gln 50
55 60Met Ala Phe Ile His Val Gln Thr Gly Lys Gly Pro
Ser Phe Thr Lys65 70 75
80Gly Leu Pro Gly Thr Asn Val Glu Phe Ala Lys Asp Ser Ala Trp Asn
85 90 95Lys Val Val Ile Leu Ser
Pro Gln Pro Ala Gly Arg Val Arg Ser Glu 100
105 110Ala Lys Gln Lys Ala Ala Asp Leu Leu Ala Ala Ile
Val Val Pro Asp 115 120 125Glu Thr
Val Gly Lys Gly Arg Thr Ile Thr Gly Thr Val Ser Lys Lys 130
135 140Asp Leu Gly Glu Gly Ser Ile Ala Lys Trp Gly
Tyr Gln Val Leu Met145 150 155
160Gln Ser Asn Glu Gly Phe Pro Asp Lys Thr Asp Leu Leu Thr Arg Lys
165 170 175Val Asn Glu Tyr
Glu Gly Gln His Arg Phe Gly Gly Gly Thr Asp Thr 180
185 190Asp Cys Asp Pro His Val Ile Asp Val Leu
195 20040239PRTArthrobacter
globiformisDOMAIN(1)..(239)X46 Domain 40Asp Pro Ser Gly Asp Asp Asn Gly
Pro Gly Thr Tyr Thr Tyr Pro Thr1 5 10
15Asn Pro Val Tyr Val Pro Gly Ala Phe Asp Leu Thr Gly Val
Asp Leu 20 25 30Tyr Asp Ala
Gly Asp Asn Tyr Ala Phe Val Thr Thr Ile Ala Gly Asp 35
40 45Val Thr Asn Pro Trp Gly Gly Gln Gly Ile Ser
His Gln Arg Ile Asn 50 55 60Val Tyr
Leu Ser Asn Gly Lys Ala Ala Pro Thr Pro Ala Leu Pro Gly65
70 75 80Thr Asn Val Asn Val Glu Asn
Ala Trp Asp Ser Val Ile Val Thr Asp 85 90
95Gly Arg Phe Asp Gly Ala Gly Val Tyr Ser Pro Asp Gly
Thr Arg Thr 100 105 110Ser Pro
Val Thr Leu Leu Thr Val Pro Glu Ala His Gln Ile Val Thr 115
120 125Met Val Pro Lys Thr Ala Leu Gly Asn Leu
Asp Pro Ala Ser Ala Lys 130 135 140Leu
Ala Val Ala Met Phe Gly Asn Ala Glu Ser Gly Glu Gly Val Gly145
150 155 160Asn Val Arg Pro Val Tyr
Asp Gly Ala Tyr Trp Ala Ala Gly Asp Pro 165
170 175Ser Trp Ile Lys Glu Trp Arg Phe Gly Gly Gly Ala
Ala Cys Phe Asp 180 185 190Gly
Gly Ile Ala Ser Arg Asp Thr Asp Thr Ser Asp Pro Asn Ala Leu 195
200 205Asp Val Ile Val Arg Asp Gly Gln Ser
Gln Ala Thr Val Leu Asp Trp 210 215
220His Thr Ala Ser Pro Ala Val Ile Pro Met Val Gly Leu Lys Pro225
230 23541225PRTThermus
thermophilusDOMAIN(1)..(225)X46 Domain 41Pro Asp Pro Glu Gly Asp Glu His
Gly Pro Gly Thr Tyr Thr Tyr Pro1 5 10
15Lys Asp Asn Ala Phe Ala Pro Phe Gln Gly Leu Phe Asp Leu
Leu Glu 20 25 30Met Arg Ile
Leu Asp Ser Gly Ala Thr Trp Thr Phe Val Phe Ser Phe 35
40 45Lys Glu Met Thr Asn Pro Trp Gly Ala Pro Ala
Gly Phe Ser His Gln 50 55 60Leu Leu
Asn Val Tyr Leu Asp Phe Lys Asp Gly Gly Arg Thr Asp Pro65
70 75 80Phe Ala Lys Gly Ala Lys Val
Ala Phe Asp Pro Glu His Pro Trp Asp 85 90
95Leu Phe Leu Lys Ala Ala Gly Trp Pro Gln Tyr Gly Gln
Arg Val Gly 100 105 110Phe Pro
Asp Gly Thr Asp Thr Ala Asp Gly Ile Thr Val Gly Ser Asn 115
120 125Pro Ala Asp Lys Gln Val Ile Val Gln Leu
Asp Lys Lys His Phe Asn 130 135 140Pro
Ala Pro Gly Gln Arg Val Cys Phe Tyr Val Leu Val Gly Ser Gln145
150 155 160Asp Gly Tyr Gly Pro Asp
His Phe Arg Pro Val Ala Lys Glu Ala Gly 165
170 175Pro Trp Asn Leu Gly Gly Ala Glu Asn Glu Asp Ala
Pro Leu Val Val 180 185 190Asp
Tyr Leu Trp Pro Glu Glu Gly Val Gln Glu Ala Met Leu Ser Arg 195
200 205Tyr Gly Gly Gly Arg His Ala Val Leu
Lys Pro Tyr Cys Val Ala Trp 210 215
220Pro22542239PRTArthrobacter globiformisDOMAIN(1)..(239)X46 Domain 42Asp
Pro Ser Gly Asp Asp Asn Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1
5 10 15Asn Pro Val Tyr Val Pro Gly
Ala Phe Asp Leu Thr Gly Val Asp Leu 20 25
30Tyr Asp Ala Gly Asp Asn Tyr Ala Phe Val Thr Thr Ile Ala
Gly Asp 35 40 45Val Thr Asn Pro
Trp Gly Gly Gln Gly Ile Ser His Gln Arg Ile Asn 50 55
60Val Tyr Leu Ser Asn Gly Lys Ala Ala Pro Thr Pro Ala
Leu Pro Gly65 70 75
80Thr Asn Val Asn Val Glu Asn Ala Trp Asp Ser Val Ile Val Thr Asp
85 90 95Gly Arg Phe Asp Gly Ala
Gly Val Tyr Ser Pro Asp Gly Thr Arg Thr 100
105 110Ser Pro Val Thr Leu Leu Thr Val Pro Glu Ala His
Gln Ile Val Thr 115 120 125Met Val
Pro Lys Thr Ala Leu Gly Asn Leu Asp Pro Ala Ser Ala Lys 130
135 140Leu Ala Val Ala Met Phe Gly Asn Ala Glu Ser
Gly Glu Gly Val Gly145 150 155
160Asn Val Arg Pro Val Tyr Asp Gly Ala Tyr Trp Ala Ala Gly Asp Pro
165 170 175Ser Trp Ile Lys
Glu Trp Arg Phe Gly Gly Gly Ala Ala Cys Phe Asp 180
185 190Gly Gly Ile Ala Ser Arg Asp Thr Asp Thr Ser
Asp Pro Asn Ala Leu 195 200 205Asp
Val Ile Val Arg Asp Gly Gln Ser Gln Ala Thr Val Leu Asp Trp 210
215 220His Thr Ala Ser Pro Ala Val Ile Pro Met
Val Gly Leu Lys Pro225 230
23543202PRTStigmatella aurantiacaDOMAIN(1)..(202)X46 Domain 43Asp Pro Thr
Gly Asp Asp Asn Gly Pro Gly Lys Tyr Val Tyr Pro Thr1 5
10 15Asp Thr Val Tyr Lys Lys Gly Thr Phe
Asp Leu Thr Glu Val Thr Val 20 25
30Glu Lys Lys Gly Asp Lys Val Glu Phe Thr Ala Ser Leu Gly Ala Asp
35 40 45Leu Glu Asp Pro Trp Lys Leu
Gly Ser Gly Phe Ser Leu Gln Met Val 50 55
60Phe Ile Phe Ile Asp Lys Asp Gly Lys Ala Gly Ser Gly His Thr Glu65
70 75 80Gly Leu Pro Gly
Leu Asn Ile Gln Phe Ala Pro Glu Ala Ala Trp Glu 85
90 95Lys Val Val Leu Leu Ser Pro Gln Ala Ala
Pro Arg Leu Lys Thr Glu 100 105
110Ala Ala Asn Lys Ala Ser Ala Leu Lys Asp Asp Ile Val Val Pro Ser
115 120 125Arg Thr Lys Gly Ser Gly Arg
Lys Leu Thr Ala Thr Val Lys Ala Ser 130 135
140Glu Leu Gly Glu Gly Asp Pro Ser Gln Trp Gly Tyr Gln Val Val
Val145 150 155 160Gln Ser
Asn Glu Gly Phe Pro Ala Gly Asn Asp Leu Met Thr Arg Lys
165 170 175Val Asn Glu Tyr Glu Gly Gln
His Arg Phe Gly Gly Gly His Asp Gly 180 185
190Glu Cys Asp Pro His Val Ile Asp Ile Leu 195
20044239PRTArthrobacter globiformisDOMAIN(1)..(239)X46 Domain
44Asp Pro Ala Gly Asp Asp Asn Gly Pro Gly Thr Tyr Arg Tyr Pro Thr1
5 10 15Asn Ser Ala Tyr Val Pro
Gly Ala Phe Asp Leu Thr Gly Val Asp Val 20 25
30Tyr Asp Ala Gly Asp Asp Tyr Ala Phe Val Ala Thr Ile
Ala Gly Glu 35 40 45Val Thr Asn
Pro Trp Gly Gly Gln Ala Ile Ser His Gln Arg Val Asn 50
55 60Ile Tyr Leu Gly Lys Gly Glu Gly Gly Ala Thr Pro
Gly Leu Pro Gly65 70 75
80Thr Asn Ile Asn Leu Glu His Ala Trp Asp Ser Val Ile Val Thr Asp
85 90 95Gly Arg Phe Asp Gly Ala
Gly Val Tyr Ala Pro Asp Gly Thr Arg Thr 100
105 110Ser Ala Val Ser Leu Leu Ala Val Pro Glu Ala Arg
Gln Ile Val Thr 115 120 125Arg Val
Pro Lys Ala Ala Leu Gly Gly Leu Asp Pro Ala Thr Ala Arg 130
135 140Met Ser Val Ala Met Phe Gly Asn Ala Thr Ser
Gly Glu Gly Ile Gly145 150 155
160Asn Val Arg Pro Val Tyr Asp Gly Ala Tyr Trp Glu Ala Gly Asp Pro
165 170 175Ala Trp Ile Lys
Glu Trp Arg Phe Gly Gly Gly Arg Gly Val Phe Asp 180
185 190Gly Thr Ile Pro Ser Arg Asp Thr Asp Thr Asp
Asp Pro Asn Ala Leu 195 200 205Asp
Val Leu Val Gly Glu Gly Gln Thr Gln Ala Ala Val Leu Asp Trp 210
215 220Arg Ala Gly Ser Pro Val Val Val Pro Met
Leu Gly Leu Gln Pro225 230
23545239PRTArthrobacter globiformisDOMAIN(1)..(239)X46 Domain 45Asp Pro
Ala Gly Asp Asp Asn Gly Pro Gly Thr Tyr Arg Tyr Pro Thr1 5
10 15Asn Ser Ala Tyr Val Pro Gly Ala
Phe Asp Leu Thr Gly Val Asp Val 20 25
30Tyr Asp Ala Gly Asp Asp Tyr Ala Phe Val Ala Thr Ile Ala Gly
Glu 35 40 45Val Thr Asn Pro Trp
Gly Gly Gln Ala Ile Ser His Gln Arg Val Asn 50 55
60Ile Tyr Leu Gly Lys Gly Glu Gly Gly Ala Thr Pro Gly Leu
Pro Gly65 70 75 80Thr
Asn Ile Asn Leu Glu His Ala Trp Asp Ser Val Ile Val Thr Asp
85 90 95Gly Arg Phe Asp Gly Ala Gly
Val Tyr Ala Pro Asp Gly Thr Arg Thr 100 105
110Ser Ala Val Ser Leu Leu Ala Val Pro Glu Ala Arg Gln Ile
Val Thr 115 120 125Arg Val Pro Lys
Ala Ala Leu Gly Gly Leu Asp Pro Ala Thr Ala Arg 130
135 140Met Ser Val Ala Met Phe Gly Asn Ala Glu Ser Gly
Glu Gly Ile Gly145 150 155
160Asn Val Arg Pro Val Tyr Asp Gly Ala Tyr Trp Glu Ala Gly Asp Pro
165 170 175Ala Trp Ile Lys Glu
Trp Arg Phe Gly Gly Gly Ala Gly Val Phe Asp 180
185 190Gly Thr Ile Pro Ser Arg Asp Thr Asp Thr Asp Asp
Pro Asn Ala Leu 195 200 205Asp Val
Leu Val Gly Glu Gly Gln Thr Gln Ala Ala Val Leu Asp Trp 210
215 220Arg Ala Gly Ser Pro Val Val Val Pro Met Leu
Gly Leu Gln Pro225 230
23546202PRTAnaeromyxobacter dehalogenans 46Asp Pro Val Gly Asp Asp Asn
Gly Pro Gly Lys Tyr Val Tyr Pro Thr1 5 10
15Asp Pro Val Tyr Lys Ala Gly Ser Phe Asp Leu Thr Gln
Leu Glu Val 20 25 30Thr Glu
Lys Gly Asp Lys Val Thr Phe Glu Ile Thr Val Asn Ser Asp 35
40 45Leu Glu Asp Pro Trp Gly Met Pro Ala Pro
Ala Asn Phe Ser Val Gln 50 55 60Met
Ala Phe Ile His Val Gln Thr Gly Lys Gly Pro Ser Phe Thr Lys65
70 75 80Gly Leu Pro Gly Thr Asn
Val Val Phe Ala Lys Asp Ser Ala Trp Asn 85
90 95Lys Val Val Ile Leu Ser Pro Gln Pro Ala Gly Arg
Val Arg Ser Glu 100 105 110Ala
Lys Gln Lys Ala Ala Asp Leu Leu Ala Ala Ile Val Val Pro Asp 115
120 125Glu Thr Ile Gly Lys Gly Arg Thr Ile
Thr Gly Thr Val Ser Lys Lys 130 135
140Asp Leu Gly Glu Gly Ser Ile Ala Arg Trp Gly Tyr Gln Val Leu Met145
150 155 160Gln Ser Asn Glu
Gly Phe Pro Asp Lys Thr Asp Leu Leu Thr Arg Lys 165
170 175Val Asn Glu Tyr Glu Gly Gln His Arg Phe
Gly Gly Gly Thr Asp Thr 180 185
190Asp Cys Asp Pro His Val Ile Asp Val Leu 195
20047255PRTThermoproteus neutrophilus 47Asp Pro Lys Gly Asp Phe Asn Gly
Pro Gly Trp Tyr Thr Pro Pro Leu1 5 10
15Asn Pro Val Phe Lys Asn Gly Thr Val Phe Asp Ile Thr Lys
Phe Glu 20 25 30Val Leu Tyr
Asn Ala Ser Ser Asp Ala Leu Ile Leu Arg Ile Thr Phe 35
40 45Ser Asp Leu Gly Gly Asn Pro Leu Asn Ser Glu
Thr Gly Phe Ser Leu 50 55 60Gln Tyr
Ile Gln Val Tyr Ile His Arg Gly Phe Pro Gly Asn Pro Trp65
70 75 80Gly Thr Val Ser Cys Ser Val
Leu Arg Pro Glu Asp Gly Asn Pro Ala 85 90
95Ala Gly Asn Ala Phe Tyr Asp Glu Ala Thr Arg Phe Phe
Cys Pro Asp 100 105 110Pro Ala
Asn Leu Thr Gln Phe Lys Tyr Thr Pro Gly Val Lys Phe Ser 115
120 125Ser Ser Ala Pro Trp Asp Val Ala Ile Phe
Ile Gly Pro Lys Trp Gly 130 135 140Asn
Asp Thr Val Asn Leu Val Ala Val Ala Asp Val Thr Gly Gly Thr145
150 155 160Ile Ser Val Ser Pro Leu
Pro Arg Val Tyr Thr Gln Gly Ser Ser Val 165
170 175Val Ala Val Val Pro Arg Lys Leu Ile Pro Pro Thr
Thr Arg Phe Met 180 185 190Ser
Asp Phe Pro Gln Pro Thr Trp Arg Tyr Tyr Val Leu Val Thr Ala 195
200 205Tyr Asp Arg Asn Gly Pro Gly Arg Ile
Ile Gln Phe Ala Thr Gln Ala 210 215
220Asp Ala Ser Lys Ala Gly Ala Gly Ser Ala Asn Ala Ser Ala Ile Ala225
230 235 240Ser Gly Thr Leu
Pro Arg Val Phe Asp Val Leu Gly Pro Asn Ala 245
250 25548237PRTPyrococcus furiosus 48Asp Pro Glu Gly
Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5
10 15Asp Lys Val Phe Val Glu Gly Ala Phe Asp
Leu Leu Arg Phe Arg Met 20 25
30Leu Glu Gln Thr Asp Ala Tyr Val Met Glu Phe Tyr Phe Lys Glu Leu
35 40 45Gly Gly Asn Pro Trp Asn Gly Pro
Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Leu Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala Ile Lys65
70 75 80Met Phe Pro Asp Gly
Pro Gly Ala Asn Val Gln Leu Asp Pro Glu His 85
90 95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp
Asp Tyr Gly Asn Leu 100 105
110Ile Val Leu Ala Asn Gly Thr Val Tyr Gln Gly Glu Met Gln Ile Ser
115 120 125Ala Asp Pro Thr Lys Asn Ala
Val Ile Val Lys Leu Pro Lys Lys Tyr 130 135
140Leu Ser Ile Gly Asp Tyr Gly Leu Tyr Ala Ala Val Leu Val Gly
Ser145 150 155 160Gln Asp
Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Glu Ala
165 170 175Glu Gln Trp Lys Leu Gly Gly
Ala Asp Pro Gln Ala Val Val Asp Asn 180 185
190Leu Ala Pro Arg Val Val Asp Met Leu Val Pro Glu Gly Phe
Lys Pro 195 200 205Thr Gln Glu Glu
Gln Leu Ser Ser Tyr Asp Val Glu Lys Lys Glu Leu 210
215 220Ala Thr Val Tyr Met Ile Thr Leu Val Ser Gly Ser
Gly225 230 23549224PRTThermus
aquaticusDOMAIN(1)..(224)X46 Domain 49Asp Pro Glu Gly Asp Glu His Gly Pro
Gly Thr Tyr Thr Tyr Pro Lys1 5 10
15Asp Gln Ala Phe Ala Pro Phe Lys Gly Leu Phe Asp Leu Leu Glu
Met 20 25 30Arg Ile Leu Asp
Gly Gly Ala Thr Trp Thr Phe Val Phe Thr Phe Lys 35
40 45Glu Met Thr Asn Pro Trp Gly Ala Pro Ala Gly Phe
Ser His Gln Leu 50 55 60Ile Asn Val
Tyr Ile Asp Tyr Lys Glu Gly Gly Lys Thr Glu Thr Phe65 70
75 80Ala Lys Gly Ala Lys Val Ala Phe
Asp Pro Glu His Pro Trp Asp Leu 85 90
95Phe Leu Lys Ala Ala Gly Trp Pro Gln Tyr Gly Gln Arg Val
Gly Phe 100 105 110Pro Asp Gly
Thr Asp Thr Ala Asp Gly Val Val Val Ala Ser Asn Pro 115
120 125Ala Asp Lys Gln Val Ile Leu Gln Val Asp Lys
Lys Tyr Phe Asn Pro 130 135 140Ala Pro
Gly Gln Lys Val Cys Phe Tyr Val Leu Val Gly Ser Gln Asp145
150 155 160Gly Tyr Gly Pro Asp His Phe
Arg Pro Val Gly Lys Glu Ala Gly Pro 165
170 175Trp Asn Leu Gly Gly Ala Gly Asn Glu Asp Ala Pro
Leu Val Val Asp 180 185 190Tyr
Leu Trp Pro Glu Lys Gly Val Gln Glu Ala Met Leu Ser Gln Tyr 195
200 205Gly Gly Gly Lys Tyr Ala Val Leu Lys
Pro Tyr Cys Val Thr Trp Pro 210 215
22050238PRTThermococcus barophilusDOMAIN(1)..(238)X46 Domain 50Asp Pro
Glu Gly Asp Asp Tyr Gly Pro Gly Thr Tyr Thr Tyr Ala Thr1 5
10 15Asp Lys Val Phe Val Lys Gly Ala
Phe Asp Leu Leu Arg Phe Arg Met 20 25
30Leu Glu Gln Thr Asp Ala Tyr Val Met Glu Phe Tyr Phe Lys Glu
Leu 35 40 45Gly Asp Asn Pro Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala
Ile Lys65 70 75 80Met
Phe Pro Asp Gly Pro Gly Ser Asn Val Gln Leu Asp Pro Asp His
85 90 95Pro Trp Asp Val Ala Phe Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Ile 100 105
110Ile Val Leu Ser Asn Gly Thr Ala Ile Gln Gly Glu Leu Gln
Ile Ser 115 120 125Ala Asp Pro Val
Lys Asn Ala Ile Ile Val Arg Val Pro Lys Lys Tyr 130
135 140Leu Gln Ile Asn Glu Asp Tyr Gly Leu Tyr Gly Ala
Val Leu Val Gly145 150 155
160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Glu
165 170 175Ala Glu Gln Trp Lys
Ile Gly Gly Ala Glu Pro Asp Ala Val Ile Asn 180
185 190Asn Val Ala Pro Arg Val Met Asp Leu Leu Ala Pro
Lys Gly Phe Lys 195 200 205Pro Thr
Gln Glu Glu Gln Leu Lys Ser Tyr Asp Ala Lys Asn Ile Lys 210
215 220Leu Ala Thr Val Lys Met Leu Pro Leu Leu Lys
Thr Gly Ile225 230
23551237PRTThermococcus barophilusDOMAIN(1)..(237)X46 Domain 51Asp Pro
Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Ala Thr1 5
10 15Asn Lys Val Phe Val Pro His His
Leu Asp Leu Leu Lys Phe Lys Met 20 25
30Thr Glu Glu Asn Glu Tyr Trp Lys Leu Glu Phe Tyr Phe Lys Glu
Leu 35 40 45Gly Asp Asn Pro Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala
Ile Lys65 70 75 80Met
Phe Pro Asp Gly Pro Gly Ser Asn Val Asp Leu Asp Pro Asn His
85 90 95Pro Trp Asp Val Ala Leu Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Ile 100 105
110Ile Val Val Pro Gly Lys Lys Pro Ile Gln Gly Glu Leu Lys
Ile Ser 115 120 125Ala Asp Pro Thr
Arg Asn Ala Ile Ile Val Glu Leu Pro Lys Lys Tyr 130
135 140Leu Gln Ile Asp Glu Asp Tyr Gly Leu Tyr Ala Ala
Val Leu Val Gly145 150 155
160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Gln
165 170 175Ala Glu Glu Trp Lys
Gly Gly Gly Ala Glu Pro Asp Ala Val Ile Asn 180
185 190Asn Val Ala Pro Arg Val Tyr Asp Leu Leu Val Pro
Glu Gly Tyr Lys 195 200 205Pro Thr
Gln Glu Glu Met Leu Ser Ser Tyr Asp Ala Lys Ala Gly Lys 210
215 220Arg Ala Val Val Leu Met Ile Pro Ile Ile Lys
Gly Thr225 230
23552223PRTCoprothermobacter proteolyticusDOMAIN(1)..(223)X46 Domain
52Thr Asp Pro Val Phe Lys Asp Gly Asp Phe Asp Leu Leu Lys Phe Glu1
5 10 15Leu Gly Leu Tyr Glu Gly
Ser Tyr Thr Ala Thr Tyr Thr Val Gly Asn 20 25
30Leu Asp Asp Ala Trp Gly Ser Thr Ile Gly Leu Ser Lys
Ala Thr Tyr 35 40 45Phe Leu Phe
Ile Asp Asn Lys Ala Asp Glu Gly Thr Thr Gln Gly Ile 50
55 60Glu Gly Leu Asn Ile Ser Phe Ala Glu Asn Phe Lys
Trp Asp Val Ala65 70 75
80Leu Gln Ile Glu Gly Trp Glu Ser Lys Val Tyr Lys Val Ser Ser Gly
85 90 95Glu Ile Asn Ala Ala Asn
Ala Ala Asp Leu Gly Val Glu Ile Lys Gly 100
105 110Thr Glu Gly Ala Pro Gly Gln Val Val Val Tyr Ile
Pro Lys Asp Val 115 120 125Val Gly
Glu Leu Thr Ala Glu Ser Lys Ile Met Val Met Val Ala Gly 130
135 140Gln Asp Gly Tyr Gly Val Asn Arg Ile Arg Gln
Val Thr Pro Glu Ala145 150 155
160Gln Gln Trp Arg Phe Gly Gly Gly Asn Glu Glu Gly Thr Ala Pro Ala
165 170 175Val Ile Asp Met
Ile Val Pro Glu Gly Met Lys Gln Glu Glu Ile Leu 180
185 190Asp Tyr Lys Thr Lys Ala Val Ala Ile Pro Gly
Val Ser Leu Lys Pro 195 200 205Trp
Ile Gln Val Pro Ser Val Ala Val Leu Thr Pro Val Val Ile 210
215 22053228PRTB5Y6P8 Coprothermobacter
proteolyticusDOMAIN(1)..(228)X46 Domain 53Glu Asp Pro Glu Gly Asp Asp Tyr
Gly Pro Gly Tyr Tyr Thr Tyr Pro1 5 10
15Thr Asp Pro Val Phe Lys Glu Gly Asp Phe Asp Leu Leu Lys
Phe Glu 20 25 30Phe Gly Leu
Tyr Glu Gly Ser Tyr Thr Ala Thr Tyr Thr Val Gly Asn 35
40 45Leu Asp Asn Val Trp Ala Ser Gly Asn Gly Leu
Ser Lys Ala Thr Tyr 50 55 60Phe Leu
Phe Ile Asp Asn Lys Ala Asp Glu Gly Thr Thr Gln Gly Ile65
70 75 80Glu Gly Leu Asn Ile Ser Phe
Ala Glu Asn Phe Lys Trp Asp Ile Ala 85 90
95Phe Gln Ile Glu Gly Trp Glu Ser Lys Val Tyr Gln Val
Ser Ser Gly 100 105 110Glu Ile
Ser Ala Ala Asn Ala Ala Asp Leu Ser Val Glu Ile Lys Gly 115
120 125Ile Glu Gly Ala Pro Gly Gln Val Val Val
Asp Ile Pro Lys Glu Val 130 135 140Val
Gly Glu Leu Thr Ala Asp Ser Lys Ile Met Val Met Val Ala Gly145
150 155 160Gln Asp Gly Tyr Gly Val
Asn Arg Ile Arg Gln Val Ala Pro Glu Ala 165
170 175Gln Gln Trp Arg Phe Gly Gly Gly Asn Glu Ala Gly
Thr Ala Pro Ala 180 185 190Val
Ile Asp Met Ile Val Pro Glu Gly Met Lys Gln Glu Glu Ile Leu 195
200 205Asp Tyr Lys Thr Lys Ala Val Thr Ile
Pro Gly Val Ser Leu Lys Pro 210 215
220Phe Phe Val Ser22554236PRTDictyoglomus
thermophilumDOMAIN(1)..(236)DOMAIN(1)..(236)X46 Domain 54Asn Asp Pro Val
Asn Asp Asp Lys Gly Pro Gly Thr Tyr Thr Tyr Pro1 5
10 15Thr Asp Pro Val Phe Lys Ser Gly Thr Phe
Asp Met Thr Lys Val Val 20 25
30Ile Asp Ala Asp Asn Asp Asn Val Tyr Phe Lys Ile Ser Phe Arg Val
35 40 45Pro Ile Glu Asn Pro Trp Gly Ser
Pro Leu Gly Ile Ser Leu Gln Thr 50 55
60Ile His Ile Tyr Ile Asp Lys Asp His Lys Lys Asp Ser Gly Phe Arg65
70 75 80Asp Phe Ile Pro Gly
Val Arg Ala Gln Thr Thr Pro Glu Ser Ala Trp 85
90 95Asp Leu Ala Ile Leu Val Glu Gly Trp Pro Thr
Glu Leu Lys Ser Ser 100 105
110Val Lys Asn Ala Ala Pro Glu Met Tyr Lys Tyr Cys Val Phe Pro Ser
115 120 125Lys Gly Val Thr Val Asp Gly
Asn Thr Ile Thr Ile Pro Val Pro Lys 130 135
140Lys Thr Leu Gly Asp Asn Phe Gln Lys Gly Trp Gly Phe Gln Val
Phe145 150 155 160Ile Met
Gly Gln Glu Gly Phe Pro Thr Gln Asp Pro Val Ser Cys Arg
165 170 175Ile Arg Glu Val Leu Ser Thr
Ala Gln Gln Trp Arg Phe Ser Gly Gly 180 185
190Asp Asp Phe Tyr Gly Asp Pro Asn Ile Ile Asp Leu Leu Asp
Tyr Glu 195 200 205Asp Ile Asn Gln
Phe Glu Ile Leu Ser Lys Tyr Lys Ser Asp Ala Lys 210
215 220Phe Glu Lys Asn Val Tyr Ala Gln Val Pro Phe Ile225
230 23555238PRTThermococcus
hydrothermalisDOMAIN(1)..(238)X46 Domain 55Thr Asp Pro Glu Gly Asp Asp
His Gly Pro Gly Thr Tyr Thr Tyr Pro1 5 10
15Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu
Lys Phe Lys 20 25 30Val Thr
Glu Gly Ser Asp Asp Trp Thr Leu Glu Phe His Phe Lys Asp 35
40 45Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn
Gly Phe Ser Leu Gln Ile 50 55 60Ile
Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Val Ser Ala Ile65
70 75 80Lys Met Phe Pro Asp Gly
Pro Gly Ser Asn Val Arg Leu Asp Pro Asn 85
90 95His Pro Trp Asp Leu Ala Leu Arg Ile Ala Gly Trp
Asp Tyr Gly Asn 100 105 110Leu
Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln Gly Glu Met Gln Ile 115
120 125Ser Ala Asp Pro Val Lys Asn Ala Ile
Ile Val Lys Val Pro Lys Lys 130 135
140Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr Ala Val Ile Val Gly145
150 155 160Ser Gln Asp Gly
Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu 165
170 175Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp
Pro Gln Ala Val Ile Asp 180 185
190Asn Leu Val Pro Arg Val Val Asp Glu Leu Val Pro Glu Gly Phe Lys
195 200 205Pro Thr Gln Glu Glu Gln Leu
Ser Ser Tyr Asp Leu Glu Lys Lys Thr 210 215
220Leu Ala Thr Val Leu Met Val Pro Leu Val Asn Gly Thr Gly225
230 23556236PRTDictyoglomus
turgidumDOMAIN(1)..(236)X46 Domain 56Asn Asp Pro Thr Asn Asp Asp Lys Gly
Pro Gly Thr Tyr Thr Tyr Pro1 5 10
15Thr Asp Gly Val Phe Lys Pro Gly Thr Phe Asp Met Thr Lys Val
Val 20 25 30Ile Asp Ala Asp
Asn Asp Asn Val Tyr Phe Lys Ile Ser Phe Arg Val 35
40 45Pro Ile Glu Asn Pro Trp Gly Ser Pro Ile Gly Leu
Ser Leu Gln Thr 50 55 60Ile His Ile
Tyr Ile Asp Lys Asp His Lys Lys Asp Ser Gly Phe Arg65 70
75 80Asp Phe Ile Pro Gly Val Arg Ala
Gln Thr Thr Pro Glu Ser Ala Trp 85 90
95Asp Leu Ala Ile Leu Val Glu Gly Trp Pro Thr Glu Leu Lys
Ser Ser 100 105 110Val Lys Asn
Ala Ala Pro Glu Met Tyr Lys Tyr Cys Val Phe Pro Ser 115
120 125Lys Gly Val Thr Val Asp Gly Asn Thr Ile Ile
Ile Pro Val Ser Lys 130 135 140Lys Thr
Leu Gly Asp Asp Phe Gln Lys Gly Trp Gly Phe Gln Val Phe145
150 155 160Ile Met Gly Gln Glu Gly Phe
Pro Thr Gln Asp Pro Val Ser Cys Arg 165
170 175Ile Arg Glu Val Leu Ser Thr Ala Gln Gln Trp Arg
Phe Gly Gly Gly 180 185 190Asp
Asp Phe Tyr Gly Asp Pro Asn Ile Ile Asp Met Leu Asp Tyr Glu 195
200 205Gly Ile Asn Gln Phe Glu Val Leu Gly
Lys Tyr Lys Ser Asp Ala Lys 210 215
220Phe Glu Lys Asn Val Tyr Ala Gln Val Pro Phe Ile225 230
23557240PRTDictyoglomus turgidum 57Asp Asp Pro Thr Gly
Asp Asp Tyr Gly Trp Gly Lys Val Val Tyr Pro1 5
10 15Thr Ala Pro Val Phe Lys Pro Gly Val Phe Asp
Ile Ile His Val Glu 20 25
30Met Gly Lys Ser Lys Asp Asp Ile Val Phe Lys Ile Lys Ile Arg Gly
35 40 45Asp Leu Glu Asn Pro Trp Gly Ser
Pro Thr Gly Val Ser Val Gln Thr 50 55
60Ile Asp Ile Tyr Ile Asn Asp Gly Lys Glu Ser Thr Tyr Tyr Tyr Gln65
70 75 80Ala Leu Pro Gly Arg
Gln Ala Asn Ile Pro Glu Gly Trp Asn Lys Ala 85
90 95Ile Trp Ala Glu Gly Trp Ile Gln Glu Leu Ile
Ile Pro Thr Leu Asp 100 105
110Glu Lys Gly Lys Val Gln Leu Lys Glu Ile Lys Gly Val Val Gln Leu
115 120 125Ser Thr Asp Pro Thr Glu Arg
Thr Ile Ile Ile Ser Val Pro Glu Lys 130 135
140Tyr Leu Gly Pro Val Thr Pro Asp Trp Lys Ile Leu Val Ile Leu
Cys145 150 155 160Gly Gln
Glu Gly Tyr Pro Arg Pro Gly Ser Trp Arg Val Arg Glu Val
165 170 175Glu Glu Glu Ala Lys Gln Trp
Arg Phe Gly Gly Gly Asp Asp Phe Tyr 180 185
190Gly Asp Pro Asn Ile Ile Asp Met Ile Val Pro Pro Gly Met
Lys Gln 195 200 205Glu Asp Ile Leu
Ser Lys Trp Val Ser Ser Glu Asp Glu Glu Glu Asn 210
215 220Val Tyr Val Glu Leu Pro Leu Ile Pro Leu Arg Val
Leu Met Ser Gln225 230 235
24058238PRTThermococcus sp.DOMAIN(1)..(238)X46 Domain 58Asp Pro Glu Gly
Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5
10 15Asn Asp Val Phe Lys Pro Gly Val Phe Asp
Leu Leu Arg Phe Arg Met 20 25
30Leu Glu Gln Thr Asp Ser Tyr Val Met Glu Phe Tyr Phe Lys Asp Leu
35 40 45Gly Gly Asn Pro Trp Asn Ala Pro
Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Leu Asp Phe Lys Asp Gly Gly Asn Ser Thr Ala Ile Lys65
70 75 80Met Phe Pro Asp Gly
Pro Gly Ala Asn Val Asn Leu Asp Pro Asp His 85
90 95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp
Asp Tyr Gly Asn Leu 100 105
110Ile Val Leu Pro Asn Gly Thr Ala Tyr Gln Gly Glu Met Gln Ile Ser
115 120 125Ala Asp Pro Val Lys Asn Ala
Val Ile Val Lys Val Pro Lys Lys Tyr 130 135
140Ile Ala Ile Asn Glu Asp Tyr Gly Leu Trp Gly Ala Val Leu Thr
Gly145 150 155 160Ser Gln
Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Glu
165 170 175Ala Glu Glu Trp Lys Val Gly
Gly Ala Asp Pro Asn Ala Val Ile Asn 180 185
190Gly Val Ala Pro Arg Val Ile Asp Leu Leu Ala Pro Ala Asn
Phe Arg 195 200 205Pro Thr Gln Glu
Glu Gln Leu Ser Ser Tyr Asp Ala Asn Asp Met Lys 210
215 220Leu Ala Thr Val Lys Ala Leu Pro Leu Leu Lys Gln
Gly Ile225 230 23559238PRTThermococcus
sp.DOMAIN(1)..(238)X46 Domain 59Asp Pro Glu Gly Asp Asp His Gly Pro Gly
Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Lys Val Phe Val Pro Gly His Leu Asp Leu Leu Lys Phe Lys Met
20 25 30Ile Glu Gly Ser Asp Asp
Trp Thr Leu Glu Phe Tyr Phe Lys Asp Leu 35 40
45Gly Gly Asn Pro Trp Asn Ala Pro Asn Gly Phe Ser Leu Gln
Ile Ile 50 55 60Glu Val Tyr Leu Asp
Tyr Thr Asp Gly Gly Asn Ser Ser Ala Ile Lys65 70
75 80Met Phe Pro Asp Gly Pro Gly Ser Asn Val
Gln Leu Asp Pro Gly His 85 90
95Pro Trp Asp Val Ala Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn Leu
100 105 110Ile Val Leu Pro Asn
Gly Thr Val Tyr Gln Gly Glu Met Gln Ile Ser 115
120 125Ala Asp Pro Val Lys Asn Ala Ile Val Val Arg Leu
Pro Lys Lys Tyr 130 135 140Leu Pro Ala
Ile Gly Asp Tyr Gly Leu Tyr Ala Ser Val Leu Val Gly145
150 155 160Ser Gln Asp Gly Tyr Gly Pro
Asp Lys Trp Arg Pro Val Ala Val Asp 165
170 175Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro Asn
Ala Val Ile Asn 180 185 190Gly
Val Ala Pro Arg Val Val Asp Glu Leu Val Pro Pro Gly Phe Glu 195
200 205Pro Thr Gln Glu Glu Gln Leu Ser Ser
Tyr Asp Ala Asn Asp Met Lys 210 215
220Leu Ala Thr Val Leu Met Ile Pro Leu Val Glu Gly Thr Gly225
230 23560226PRTKosmotoga oleariaDOMAIN(1)..(226)X46
Domain 60Asp Pro Lys Gly Asp Asp Tyr Gly Phe Gly Ser Tyr Val Tyr Pro Leu1
5 10 15Asn Ala Ala Phe
Asp Pro Phe Lys Gly Leu Trp Asp Ile Glu Ser Val 20
25 30Lys Val Leu Glu Asn Asp Gln Ser Val Val Phe
Gln Phe Lys Phe Gly 35 40 45Glu
Met Thr Asn Pro Trp Asn Ala Pro Lys Gly Phe Ser His Gln Leu 50
55 60Ile Asn Ile Tyr Ile Asp Ala Val Glu Gly
Gly Arg Thr Asp Thr Tyr65 70 75
80Lys Ala Gly Ala Arg Val Ala Phe Ser Pro Glu Tyr Pro Trp Asp
Tyr 85 90 95Phe Ile Lys
Val Ala Gly Trp Pro Ser Tyr Gly Gln Leu Phe Ala Thr 100
105 110Ala Glu Gly Asp Glu Ile Pro Asp Ala Val
Gln Val Glu Ala Asp Pro 115 120
125Gly Glu Lys Leu Ile Asn Val Ile Ile Ser Lys Asp Val Leu Gly Asn 130
135 140Pro Glu Thr Met Ala Val Tyr Ile
Leu Ser Gly Ser Gln Asp Gly Tyr145 150
155 160Gly Pro Asp His Phe Arg Ala Val Thr Pro Glu Pro
Ser Asp Trp Thr 165 170
175Leu Gly Gly Tyr Pro Leu Asp Ala Gly Glu Phe Ala Pro Phe Val Leu
180 185 190Asp Ile Val Val Pro Glu
Gly Tyr Ser Gln Glu Glu Ile Leu Ser Ser 195 200
205Tyr Asp Lys Glu Gln Gln Lys Tyr Ala Thr Leu Val Pro Val
Ile Ile 210 215 220Glu
Phe22561238PRTThermococcus onnurineusDOMAIN(1)..(238)X46 Domain 61Asp Pro
Glu Gly Asp Asp Tyr Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5
10 15Asp Lys Val Phe Val Glu Gly Ala
Phe Asp Leu Leu Arg Phe Arg Met 20 25
30Leu Glu Gln Thr Asp Ala Tyr Val Met Glu Phe Tyr Phe Lys Asp
Leu 35 40 45Gly Gly Asn Pro Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Leu Asp Phe Lys Glu Gly Gly Asn Ser Ser Ala
Ile Lys65 70 75 80Met
Phe Pro Asp Gly Pro Gly Ala Asn Val Asn Leu Asp Pro Glu His
85 90 95Pro Trp Asp Val Ala Leu Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Leu 100 105
110Ile Val Leu Pro Asn Gly Thr Val Tyr Gln Gly Glu Met Gln
Ile Ser 115 120 125Ala Asp Pro Val
Lys Ser Ala Ile Ile Val Lys Ile Pro Lys Lys Tyr 130
135 140Ile Gln Ile Asn Glu Asp Tyr Gly Phe Trp Gly Asp
Val Leu Val Gly145 150 155
160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Glu
165 170 175Ala Glu Gln Trp Lys
Leu Gly Gly Ala Asp Pro Gln Ala Val Ile Asn 180
185 190Asn Val Ala Pro Arg Val Val Asp Glu Leu Val Pro
Glu Gly Phe Lys 195 200 205Pro Thr
Gln Glu Glu Gln Leu Ser Ser Tyr Asp Ala Asn Glu Ile Lys 210
215 220Leu Ala Thr Val Lys Ala Ile Pro Leu Leu Lys
Gln Gly Ile225 230
23562237PRTThermococcus onnurineusDOMAIN(1)..(237)X46 Domain 62Asp Pro
Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5
10 15Asp Lys Val Phe Val Pro Gly His
Leu Asp Leu Leu Lys Phe Lys Met 20 25
30Ile Glu Gly Asp Asp Ala Trp Thr Leu Glu Phe Tyr Phe Lys Asp
Leu 35 40 45Gly Gly Asn Pro Trp
Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Val Tyr Phe Asp Phe Thr Asp Gly Gly Asn Thr Ser Ala
Ile Lys65 70 75 80Met
Phe Pro Asp Gly Pro Gly Ser Asn Val Gln Leu Asp Pro Gly His
85 90 95Pro Trp Asp Leu Ala Leu Arg
Ile Ala Gly Trp Asp Tyr Gly Asn Leu 100 105
110Ile Val Leu Pro Asp Gly Thr Val Tyr Gln Gly Glu Met Gln
Ile Ser 115 120 125Ala Asp Pro Val
Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys Tyr 130
135 140Leu Ser Val Thr Asp Tyr Gly Leu Tyr Thr Ala Val
Leu Val Gly Ser145 150 155
160Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Glu Ala
165 170 175Glu Gln Trp Lys Leu
Gly Gly Ala Asp Pro Asn Ala Val Ile Asp Asn 180
185 190Leu Ala Pro Arg Val Val Asp Met Leu Val Pro Glu
Gly Leu Lys Pro 195 200 205Thr Gln
Glu Glu Gln Leu Ser Ser Tyr Asp Leu Glu Lys Lys Thr Leu 210
215 220Ala Thr Val Leu Met Ile Pro Leu Val Glu Gly
Thr Gly225 230 23563238PRTThermococcus
sp.DOMAIN(1)..(238)X46 Domain 63Asp Pro Glu Gly Asp Asp His Gly Pro Gly
Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg Phe Arg Leu
20 25 30Leu Glu Gly Thr Asp Asp
Tyr Ile Met Glu Phe Tyr Phe Lys Asn Leu 35 40
45Gly Asp Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln
Ile Ile 50 55 60Glu Val Tyr Leu Asp
Tyr Lys Pro Gly Gly Asn Thr Ser Ala Ile Lys65 70
75 80Met Phe Pro Asp Gly Pro Gly Ala Asn Val
Asp Leu Asp Pro Asp His 85 90
95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly Asn Leu
100 105 110Ile Val Leu Pro Asn
Gly Thr Val Tyr Gln Gly Glu Met Gln Ile Ser 115
120 125Ala Asp Pro Thr Lys Asn Ala Ile Ile Val Lys Val
Pro Lys Lys Tyr 130 135 140Ile Lys Ile
Asp Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Thr Gly145
150 155 160Ser Gln Asp Gly Tyr Gly Pro
Asp Lys Trp Arg Pro Val Ala Val Lys 165
170 175Ala Glu Gln Trp Lys Val Gly Gly Gly Asp Pro Asp
Ala Ile Ile Ala 180 185 190Gly
Val Glu Pro Arg Val Met Asp Glu Leu Val Pro Pro Gly Phe Lys 195
200 205Pro Thr Gln Glu Glu Gln Leu Ser Ser
Tyr Asp Ala Glu Lys Gly Lys 210 215
220Arg Ala Thr Val Lys Ala Ile Pro Leu Leu Lys Thr Gly Ile225
230 23564238PRTThermococcus sp.DOMAIN(1)..(238)X46
Domain 64Asp Pro Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1
5 10 15Asp Pro Val Phe
Val Pro Gly Ala Phe Asp Leu Leu Lys Phe Arg Met 20
25 30Val Asn Glu Ser Asp Cys Trp Arg Leu Glu Phe
Tyr Phe Lys Asn Leu 35 40 45Gly
Asp Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile Ile 50
55 60Glu Ala Tyr Phe Asp Phe Lys Asp Gly Gly
Asn Thr Ser Ala Ile Lys65 70 75
80Met Tyr Pro Asp Gly Pro Gly Ala Asn Val Asp Leu Asp Pro Lys
His 85 90 95Pro Trp Asp
Leu Ala Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn Leu 100
105 110Ile Val Leu Pro Asn Gly Thr Val Tyr Gln
Gly Glu Met Lys Ile Ser 115 120
125Ala Asp Pro Thr Lys Asn Ala Ile Ile Val Glu Leu Pro Lys Arg Tyr 130
135 140Leu Arg Val Ser Pro Glu Tyr Gly
Leu Tyr Ala Ser Ile Leu Thr Gly145 150
155 160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro
Val Ala Val Lys 165 170
175Ala Glu Gln Trp Lys Val Gly Gly Gly Asp Pro Asp Ala Ile Ile Ala
180 185 190Gly Val Glu Pro Arg Val
Met Asp Glu Leu Val Pro Pro Gly Phe Lys 195 200
205Pro Thr Gln Glu Gln Gln Leu Ser Ser Tyr Asp Ala Glu Lys
Gly Lys 210 215 220Arg Ala Thr Val Leu
Met Ile Thr Leu Ile Lys Gly Thr Ser225 230
23565232PRTThermococcus sp.DOMAIN(1)..(232)X46 Domain 65Ser Asp Pro Val
Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1 5
10 15Thr Asp Pro Val Phe Asn Lys Thr Gly Leu
Phe Asp Ile Thr Gly Met 20 25
30Asp Val Tyr Glu Thr Pro Asn Asp Tyr Val Phe Tyr Phe His Phe Lys
35 40 45Asn Leu Gly Gly Asn Pro Trp Asn
Gly Pro Asn Gly Phe Ser Leu Gln 50 55
60Ile Ile Glu Ala Tyr Phe Asp Phe Lys Asp Gly Gly Asn Thr Ser Ala65
70 75 80Ile Lys Leu Ala Asp
Asn Gly Pro Gly Ala Asn Val Gln Phe Asn Arg 85
90 95Pro Trp Asp Val Ala Phe Arg Val Thr Gly Trp
Thr Ser Lys Leu Val 100 105
110Leu Pro Asn Met Ser Thr Val Asp Ile Glu Ala Ser Ala Asp Leu Ser
115 120 125Thr Asn Thr Val Ile Val Lys
Val Pro Arg Glu Tyr Leu Asn Ile Thr 130 135
140Pro Asp Thr Phe Tyr Ala Val Leu Val Gly Ser Gln Asp Gly Tyr
Gly145 150 155 160Val Asp
Glu Trp Arg Asp Val Gln Val Asn Ala Ser Gln Trp Arg Ile
165 170 175Gly Gly Gly Asp Ala Asp Ala
Ile Ile Ala Gly Val Ala Pro Arg Val 180 185
190Met Asp Leu Leu Val Pro Ser Trp Phe His Pro Thr Gln Glu
Glu Gln 195 200 205Leu Ser Ser Tyr
Asp Ala Lys Asp Lys Lys Leu Ala Thr Val Asp Met 210
215 220Ile Pro Val Ser Glu Asn Tyr Gly225
23066237PRTThermococcus sp.DOMAIN(1)..(237)X46 Domain 66Ser Asp Pro Val
Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1 5
10 15Thr Asp Pro Val Phe Asn Lys Thr Gly Leu
Phe Asp Leu Thr Gly Val 20 25
30Asp Ile Leu Lys Ala Gly Asp Lys Tyr Ile Phe Ser Phe His Phe Lys
35 40 45Asn Leu Gly Gly Asn Pro Trp Asn
Gly Pro Asn Gly Phe Ser Leu Gln 50 55
60Ile Ile Glu Ala Tyr Phe Asp Phe Lys Asp Gly Gly Asn Thr Ser Ala65
70 75 80Ile Lys Met Ala Asp
Asn Gly Pro Gly Ser Asn Val Asn Leu Asp Pro 85
90 95Asn His Pro Trp Asp Leu Ala Phe Arg Val Tyr
Gly Trp Gly Lys Ala 100 105
110Leu Val Leu Pro Asn Gly Thr Val Leu Asp Asp Ile Asp Val Phe Ala
115 120 125Asp Gln Gly Gln Asn Thr Ile
Asn Val Val Val Pro Ala Lys Tyr Phe 130 135
140Gly Asp Gly Leu Lys Val Glu Gly Ile Lys Phe Pro Arg Leu Ala
Val145 150 155 160Leu Val
Gly Ser Gln Asp Gly Tyr Gly Val Asp Gln Trp Arg Asp Val
165 170 175Gln Val Asn Ala Ser Gln Trp
Arg Ile Gly Gly Gly Asp Ala Asp Ala 180 185
190Ile Ile Ala Gly Val Ala Pro Arg Val Met Asp Leu Leu Val
Pro Asp 195 200 205Trp Phe Ser Pro
Ser Gln Glu Glu Gln Leu Ser Ser Tyr Asn Ala Ser 210
215 220Ala Gly Lys Arg Ala Thr Val Asp Met Ile Pro Val
Val225 230 23567245PRTDesulfurococcus
kamchatkensisDOMAIN(1)..(245)X46 Domain 67Asp Pro Thr Gly Asp Asp Asp Gly
Pro Gly Gly Tyr Gly Tyr Pro Gly1 5 10
15Asn Ser Val Phe Lys Pro Gly Val Phe Asp Met Thr Arg Phe
Thr Val 20 25 30Ile Asp Gln
Gly Asp Lys Ile Val Phe Lys Val Ile Phe Arg Asp Leu 35
40 45Gly Gly Asn Pro Trp Ser Gly Pro Asn Gly Trp
Ser Leu Gln Gln Val 50 55 60His Ile
Tyr Ile His Thr Pro Leu Gly Ala Lys Gly Asn Ser Thr Thr65
70 75 80Ile Gly Leu Asn Ala Asp Ile
Ala Glu Gly Tyr Glu Trp His Met Ala 85 90
95Ile Ile Leu Ala Pro Gly Trp Gly Ser Asp Pro Ile Pro
Val Gly Glu 100 105 110Lys Ser
Ala Ile Tyr Tyr Tyr Asp Lys Asp Lys Pro Val Val Gln Asp 115
120 125Ser Gly Phe Lys Val Tyr Ala Asp Gln Ala
Gly Asn Ser Ile Ile Ala 130 135 140Glu
Val Ser Lys Ser Leu Leu Tyr Asp Val Glu Asp Ile Lys Lys Trp145
150 155 160Val Tyr Ile Val Ala Val
Thr Ser His Asp Gly Tyr Gly Thr Asn Lys 165
170 175Ile Arg Ser Phe Ser Pro Ser Gly Gly Glu Trp Ser
Val Ser Val Pro 180 185 190Ser
Asn Tyr Ser Val Ala Ile Leu Ala Gly Val Ile Pro Tyr Ile Leu 195
200 205Asp Val Leu Ala Pro Thr Pro Glu Glu
Gln His Ser Met Leu Leu Ser 210 215
220Phe Asp Leu Ala Gly Lys Lys Leu Ala Gln Leu Lys Gly Tyr Gly Ala225
230 235 240Thr Pro Val Thr
Ile 24568251PRTDesulfurococcus
kamchatkensisDOMAIN(1)..(251)X46 Domain 68Asp Pro Glu Gly Asp Asp Lys Gly
Pro Gly Thr Tyr Gly Tyr Pro Thr1 5 10
15Ala Ser Val Tyr Ala Pro Gly Val Phe Asp Ile Val Arg Ala
Ser Leu 20 25 30Glu Val Glu
Ser Glu Asp Leu Val Val Arg Val Tyr Phe Lys Asn Leu 35
40 45Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly Phe
Ser Leu Gln Tyr Ile 50 55 60Gln Val
Tyr Ile Arg Thr Thr Asn Pro Leu Ala Thr Asn Lys Val Tyr65
70 75 80Arg Arg Asp Thr Phe Gly Leu
Asn Ile Glu Leu Arg Asp Asp Tyr Ala 85 90
95Trp Gln Tyr Ala Leu Leu Ile Ser Pro Gly Trp Gly Ser
Gly Pro Leu 100 105 110Pro Asp
Gly Glu Leu Ser Ser Leu His Tyr Ala Asn Gly Thr Val Leu 115
120 125Val Glu Gly Lys Asp Phe Lys Val Ser Ser
Asn Thr Ser Asp Asn Tyr 130 135 140Val
Glu Val Arg Thr Pro Leu Asn Leu Leu Ser Asp Trp Glu Asn Leu145
150 155 160Lys Ser Trp Lys Ile Ile
Val Ala Val Ala Ser Trp Ala Gly Glu Asn 165
170 175Pro Asp Arg Ile Arg Ser Phe Ala Pro Gly Gly Gly
Glu Trp Leu Ser 180 185 190Asp
Pro Val Ala Tyr Ala Asn Glu Ser Ser Lys Pro Leu Ile Gln Ser 195
200 205Ala Leu Leu Val Asn Val Leu Pro Lys
Met Tyr Asp Leu Leu Ile Tyr 210 215
220Ser Gln Glu Tyr Pro His Gly Leu Thr Ala Asp Gln Gln Tyr Thr Trp225
230 235 240Leu Met Gly Phe
Asn Pro Ser Lys Ser Thr Leu 245
25069238PRTDesulfurococcus kamchatkensisDOMAIN(1)..(238)X46 Domain 69Asp
Pro Thr Gly Asp Asp Lys Gly Gln Gly Thr Ile Leu Tyr Pro Thr1
5 10 15Asn Thr Val Phe Lys Pro Gly
Val Phe Asp Leu Val Asn Phe Lys Val 20 25
30Leu Gln Asp Glu Asp Phe Ile Tyr Leu Gln Val Lys Val Arg
Asp Leu 35 40 45Gly Gly Asn Pro
Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln His Val 50 55
60Gln Ile Tyr Ile Gly Thr Thr Asn Lys Ser Leu Pro Val
Asn Thr Ser65 70 75
80Thr Phe Gly Leu His Val Asp Leu Ala Pro Gly Trp Asn Tyr Ala Ile
85 90 95Ile Ala Val Pro Gly Trp
Gly Asn Thr Pro Tyr Pro Asp Gly Glu Val 100
105 110Ser Ala Leu Tyr Gly Ala Asp Asn Lys Leu Ile Val
Asp Glu Tyr Asn 115 120 125Asn Thr
Thr Leu Phe Asp Val Tyr Ala Tyr Thr Asp Ile Asn Ile Ile 130
135 140Glu Val Lys Ile Ala Lys Ser Leu Leu Ser Asp
Val Asp Asn Ile Gly145 150 155
160Ser Trp Ile Trp Tyr Val Phe Leu Thr Ser Tyr Asp Gly Tyr Gly Glu
165 170 175Leu Lys Ile Arg
Ser Ile Gln Ala Gly Asp Pro Gly Glu Trp Ala Leu 180
185 190Gly Gly Gly Asp Ala Thr Ala Ile Leu Ala Gly
Val Gln Pro Lys Val 195 200 205Val
Asp Leu Leu Ala Pro Thr Asp Gln Asp Gln Tyr Asn Met Leu Lys 210
215 220Ser Tyr Asp Ala Ser Ala Gly Lys Leu Ala
Val Val Tyr Gly225 230
23570240PRTThermococcus litoralisDOMAIN(1)..(240)X46 Domain 70Asp Ile Glu
Trp Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Ala Thr1 5
10 15Asn Lys Val Phe Val Pro Gly His Leu
Asp Leu Leu Lys Val Arg Ile 20 25
30Leu Glu Lys Pro Ser Ser Tyr Val Phe Glu Tyr Tyr Phe Lys Asp Leu
35 40 45Gly Asp Asn Ser Trp Asn Gly
Pro Asn Gly Phe Ser Leu Gln Ile Ile 50 55
60Glu Ala Tyr Phe Asp Phe Lys Glu Gly Gly Asn Thr Ser Ala Ile Lys65
70 75 80Met Phe Pro Asp
Gly Pro Gly Ser Asn Val Asp Leu Asp Pro Glu His 85
90 95Pro Trp Asp Val Ala Leu Arg Ile Ala Gly
Trp Asp Tyr Gly Asn Ile 100 105
110Ile Val Leu Pro Asp Gly Thr Ser Tyr Gln Gly Glu Met Lys Ile Ser
115 120 125Ala Asp Pro Val Lys Asn Ala
Ile Val Val Glu Val Pro Lys Lys Tyr 130 135
140Leu Glu Ile Ser Lys Asp Tyr Gly Leu Tyr Gly Ala Ile Leu Val
Gly145 150 155 160Ser Gln
Asp Gly Tyr Glu Pro Asp Lys Trp Arg Pro Val Ala Val Asp
165 170 175Ala Glu Glu Trp Lys Gly Gly
Gly Ala Asp Val Asn Ala Val Ile Ala 180 185
190Gly Val Ala Pro Arg Val Tyr Asp Leu Leu Val Pro Glu Asp
Phe Lys 195 200 205Pro Thr Gln Glu
Glu Gln Leu Ser Ser Tyr Asp Ala Glu Asn Gly Lys 210
215 220Arg Ala Ile Val Lys Met Ile Pro Leu Phe Gly Val
Glu Glu Lys Pro225 230 235
24071224PRTThermosipho melanesiensisDOMAIN(1)..(224)X46 Domain 71Glu Asp
Pro Leu Gly Asp Glu Tyr Gly Pro Gly Ser Tyr Val Tyr Pro1 5
10 15Lys Asp Gln Ala Phe Lys Pro Phe
Lys Gly Leu Phe Asp Met Ile Lys 20 25
30Val Val Val Leu Glu Asn Glu Lys Ser Phe Ile Phe Gln Ile Lys
Phe 35 40 45Ala Glu Met Thr Asn
Pro Trp Gly Ala Pro Lys Gly Phe Ser His Gln 50 55
60Leu Ile Asn Ile Tyr Leu Asp Thr Lys Glu Gly Gly Arg Thr
Asp Thr65 70 75 80Tyr
Lys Glu Gly Ala Arg Val Ala Phe Asp Pro Gln His Ser Trp Asp
85 90 95Tyr Phe Ile Lys Val Ala Gly
Trp Pro Ser Tyr Gly Gln Phe Phe Ala 100 105
110Thr Ser Asp Gly Asn Glu Ile Ser Asp Ala Val Arg Val Glu
Ala Asn 115 120 125Pro Gly Lys Lys
Val Ile Asn Val Ile Leu Leu Lys Lys Tyr Ile Asn 130
135 140Ile Glu Thr Gly Ile Tyr Ala Tyr Ile Leu Val Gly
Ser Gln Asp Gly145 150 155
160Tyr Gly Pro Asp Asn Phe Arg Pro Val Thr Pro Glu Pro Ser Gln Trp
165 170 175Thr Leu Gly Gly Tyr
Pro Lys Asp Ser Asn Asp Met Ala Pro Tyr Val 180
185 190Leu Asp Ile Leu Val Glu Ser Gly Lys Asp Gln Arg
Glu Ile Leu Ser 195 200 205Ser Phe
Thr Lys Thr Asn Tyr Ala Val Leu Lys Pro Val Lys Ile Lys 210
215 22072225PRTCatenulispora
acidiphilaDOMAIN(1)..(225)X46 Domain 72Pro Ala Gly Asn Asp Asn Gly Pro
Gly Thr Tyr Gln Tyr Pro Thr Ser1 5 10
15Ser Ser Tyr Ala Ser Gly Ser Phe Asp Leu Thr Gly Phe Gln
Val Ile 20 25 30Thr Ala Gly
Ser Glu Val Tyr Leu Arg Ala Ser Leu Ala Asn Leu Val 35
40 45Pro Thr Phe Gly Ser Val Asp Gly Ala Gln Leu
Leu Asp Ile Tyr Val 50 55 60His Asn
Pro Ala Ala Thr Ser Thr Ser Thr Ala Ala Ala Phe Pro Ser65
70 75 80Arg Asn Tyr Thr Ile Ala Pro
Ser Asp Ala Trp Asn Gln Arg Leu Glu 85 90
95Ile Gln Gly Phe Ala Ser Pro Val Trp Val Ala Pro Ser
Gly Gln Gln 100 105 110Val Gly
Thr Pro Thr Ala Val Val Ala Ser Thr Val Ala Asp Thr Ile 115
120 125Thr Ile Ala Leu Pro Ala Ala Gln Phe Gly
Thr Pro Gly Pro Gly Trp 130 135 140Thr
Phe Thr Leu Gly Leu Thr Gly Gln Asn Gly Phe Gln Ala Asp Gln145
150 155 160Ala Ile Pro Phe Thr Ala
Thr Pro Gly Asp Tyr Thr Phe Gly Val Cys 165
170 175Pro Val Gly Gly Thr Ala Pro Ile Cys Ser Val Ser
Pro Gly Ser Val 180 185 190Pro
Glu Val Met Ser Thr Ile Thr Pro Pro Gly Val Ser Gln Ser Ala 195
200 205Glu Leu Asp Pro Thr Leu Gly Pro Val
Val Leu His Gly Val Thr Ala 210 215
220Pro22573238PRTThermococcus gammatolerans 73Asp Pro Glu Gly Asp Asp His
Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Gly Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg
Phe Arg Leu 20 25 30Leu Glu
Gly Ala Asp Gly Tyr Ile Met Glu Phe Tyr Phe Lys Asn Leu 35
40 45Gly Asp Asn Pro Trp Asn Gly Pro Asn Gly
Phe Ser Leu Gln Ile Ile 50 55 60Glu
Val Tyr Leu Asp Tyr Lys Pro Gly Gly Asn Thr Ser Ala Ile Lys65
70 75 80Met Phe Pro Asp Gly Pro
Gly Ala Asn Val Asn Leu Asp Pro Glu His 85
90 95Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp
Tyr Gly Asn Leu 100 105 110Ile
Val Leu Pro Asn Gly Thr Val Tyr Gln Gly Glu Met Lys Ile Ser 115
120 125Thr Asp Pro Thr Lys Asn Ala Ile Ile
Val Lys Ile Pro Lys Lys Tyr 130 135
140Ile Lys Ile Asp Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Thr Gly145
150 155 160Ser Gln Asp Gly
Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val Thr 165
170 175Ala Glu Gln Trp Lys Val Gly Gly Gly Asp
Pro Asp Ala Ile Ile Ala 180 185
190Gly Val Glu Pro Arg Val Met Asp Glu Leu Val Pro Pro Gly Phe Lys
195 200 205Pro Thr Gln Glu Gln Gln Leu
Ser Ser Tyr Asp Ala Glu Asn Gly Lys 210 215
220Arg Ala Thr Val Lys Ala Ile Ser Leu Leu Lys Thr Gly Ile225
230 23574238PRTThermococcus
gammatoleransDOMAIN(1)..(238)X46 Domain 74Asp Pro Glu Gly Asp Asp His Gly
Pro Gly Thr Tyr Thr Tyr Pro Thr1 5 10
15Asp Pro Val Phe Val Pro Gly Ala Phe Asp Leu Leu Lys Phe
Lys Met 20 25 30Val Asn Glu
Ser Asp Tyr Trp His Leu Glu Phe Tyr Phe Lys Asp Leu 35
40 45Gly Asp Asn Pro Trp Asn Gly Pro Asn Gly Phe
Ser Leu Gln Ile Ile 50 55 60Glu Ala
Tyr Phe Asp Phe Lys Asp Gly Gly Asn Thr Ser Ala Ile Lys65
70 75 80Met Phe Pro Asp Gly Pro Gly
Ala Asn Val Asp Leu Asp Pro Ser His 85 90
95Pro Trp Asp Leu Ala Leu Arg Ile Ala Gly Trp Asp Tyr
Gly Asn Leu 100 105 110Ile Val
Leu Pro Asn Gly Thr Val Tyr Gln Gly Glu Met Lys Ile Ser 115
120 125Ala Asp Pro Thr Lys Asn Ala Ile Ile Val
Glu Leu Pro Lys Arg Tyr 130 135 140Leu
Arg Val Asn Arg Glu Tyr Gly Leu Tyr Ala Ser Ile Leu Thr Gly145
150 155 160Ser Gln Asp Gly Tyr Gly
Pro Asp Lys Trp Arg Pro Val Ala Val Thr 165
170 175Ala Glu Gln Trp Lys Val Gly Gly Gly Asp Pro Asp
Ala Ile Ile Ala 180 185 190Gly
Val Glu Pro Arg Val Met Asp Glu Leu Val Pro Pro Gly Phe Lys 195
200 205Pro Thr Gln Glu Gln Gln Leu Ser Ser
Tyr Asp Ala Glu Asn Gly Lys 210 215
220Arg Ala Thr Val Leu Met Ile Thr Leu Ile Lys Gly Thr Ser225
230 23575232PRTThermococcus
gammatoleransDOMAIN(1)..(232)X46 Domain 75Ser Asp Pro Glu Gly Asp Asp His
Gly Pro Gly Thr Tyr Thr Tyr Pro1 5 10
15Thr Asp Pro Val Phe Asn Arg Thr Gly Leu Phe Asp Ile Thr
Gly Met 20 25 30Asp Val Tyr
Glu Thr Pro Asn Asp Tyr Val Phe Tyr Phe His Phe Lys 35
40 45Asn Leu Gly Asp Asn Gln Trp Asn Gly Pro Asn
Gly Phe Ser Tyr Gln 50 55 60Ile Ile
Glu Ala Tyr Phe Asp Phe Lys Asp Gly Gly Asn Thr Ser Ala65
70 75 80Ile Lys Leu Ala Asp Asn Gly
Pro Gly Ala Asn Val Gln Phe Asn Arg 85 90
95Pro Trp Asp Leu Ala Phe Arg Val Thr Gly Trp Thr Ser
Lys Leu Val 100 105 110Leu Pro
Asn Met Ser Thr Val Asp Ile Glu Ala Asn Ala Asp Leu Ser 115
120 125Thr Asn Thr Ile Ile Val Lys Val Pro Arg
Glu Tyr Leu Asn Phe Thr 130 135 140Glu
Asp Thr Phe Tyr Ala Val Leu Val Gly Ser Gln Asp Gly Tyr Gly145
150 155 160Val Asp Glu Trp Arg Asp
Val Gln Val Glu Ala Ala Gln Trp Arg Val 165
170 175Gly Gly Gly Asp Ser Asp Ala Ile Ile Ala Gly Val
Ala Pro Arg Val 180 185 190Met
Asp Leu Leu Val Pro Glu Trp Phe His Pro Thr Gln Glu Glu Gln 195
200 205Leu Ser Gly Tyr Asp Ala Lys Asp Lys
Lys Leu Ala Thr Val Asp Met 210 215
220Ile Pro Val Ser Glu Asn Tyr Gly225
23076236PRTThermococcus gammatoleransDOMAIN(1)..(236)X46 Domain 76Asp Pro
Ala Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro Thr1 5
10 15Asp Pro Val Phe Asn Lys Thr Gly
Leu Phe Asp Ile Thr Gly Met Asp 20 25
30Ile Leu Lys Ala Gly Asp Lys Tyr Ile Phe Ser Phe His Phe Lys
Asn 35 40 45Leu Gly Gly Asn Val
Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile 50 55
60Ile Glu Ala Tyr Phe Asp Phe Lys Asp Gly Gly Asn Thr Ser
Ala Ile65 70 75 80Lys
Met Ala Asp Asn Gly Pro Gly Ala Asn Val Asp Leu Asp Pro Asn
85 90 95His Pro Trp Asp Leu Ala Phe
Arg Val His Gly Trp Gly Lys Ala Leu 100 105
110Val Leu Pro Asn Gly Thr Val Leu Asp Asp Ile Asp Val Phe
Thr Asp 115 120 125Gln Gly Gln Asn
Thr Ile Asn Val Val Val Pro Ala Lys Tyr Phe Gly 130
135 140Asp Gly Leu Lys Val Glu Gly Ile Lys Phe Pro Arg
Leu Ala Val Leu145 150 155
160Val Gly Ser Gln Asp Gly Tyr Gly Val Asp Gln Trp Arg Asp Val Gln
165 170 175Val Asn Ala Ser Gln
Trp Arg Val Gly Gly Gly Asp Ser Asp Ala Ile 180
185 190Ile Ala Gly Val Ala Pro Arg Val Met Asp Leu Leu
Val Pro Asn Trp 195 200 205Phe Ser
Pro Ser Gln Glu Glu Gln Leu Ser Ser Tyr Asn Ala Ser Ala 210
215 220Gly Lys Arg Ala Thr Val Asp Met Ile Pro Val
Val225 230 23577225PRTThermus
thermophilusDOMAIN(1)..(225)X46 Domain 77Pro Asp Pro Glu Gly Asp Glu His
Gly Pro Gly Thr Tyr Thr Tyr Pro1 5 10
15Lys Asp Asn Ala Phe Ala Pro Phe Gln Gly Leu Phe Asp Leu
Leu Glu 20 25 30Met Arg Ile
Leu Asp Ser Gly Ala Thr Trp Thr Phe Val Phe Pro Phe 35
40 45Lys Glu Met Thr Asn Pro Trp Gly Ala Pro Ala
Gly Phe Ser His Gln 50 55 60Leu Leu
Asn Val Tyr Leu Asp Phe Lys Asp Gly Gly Arg Thr Asp Pro65
70 75 80Phe Ala Lys Gly Ala Lys Val
Ala Phe Asp Pro Glu His Pro Trp Asp 85 90
95Leu Phe Leu Lys Ala Ala Gly Trp Pro Gln Tyr Gly Gln
Arg Val Gly 100 105 110Phe Pro
Asp Gly Thr Asp Thr Ala Asp Gly Ile Thr Val Gly Ser Asn 115
120 125Pro Ala Asp Lys Gln Val Ile Val Gln Leu
Asp Lys Lys His Phe Asn 130 135 140Pro
Ala Ser Gly Gln Arg Val Cys Phe Tyr Val Leu Val Gly Ser Gln145
150 155 160Asp Gly Tyr Gly Pro Asp
His Phe Arg Pro Val Ala Lys Glu Ala Gly 165
170 175Pro Trp Asn Leu Gly Gly Ala Glu Asn Glu Asp Ala
Pro Leu Val Val 180 185 190Asp
Tyr Leu Trp Pro Glu Lys Gly Val Gln Glu Ala Met Leu Ser Arg 195
200 205Tyr Gly Gly Gly Arg His Ala Val Leu
Lys Pro Tyr Cys Val Ala Trp 210 215
220Pro22578241PRTThermococcus kodakaraensisDOMAIN(1)..(241)X46 Domain
78Ala Asp Pro Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1
5 10 15Thr Asp Ser Val Phe Lys
Pro Gly Val Phe Asp Leu Leu Arg Phe Arg 20 25
30Met Leu Glu Gln Ala Asp Ser Tyr Val Met Glu Phe Tyr
Phe Lys Asp 35 40 45Leu Gly Gly
Asn Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile 50
55 60Ile Glu Val Tyr Leu Asp Phe Lys Glu Gly Gly Asn
Ser Ser Ala Ile65 70 75
80Lys Met Phe Pro Asp Gly Pro Gly Ser Asn Val Asn Leu Asp Pro Phe
85 90 95His Pro Trp Asp Val Ala
Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn 100
105 110Leu Ile Val Leu Pro Asn Gly Thr Ala Ile Gln Gly
Glu Met Gln Ile 115 120 125Ser Ala
Asp Pro Thr Lys Asn Ser Ile Val Val Lys Leu Pro Lys Lys 130
135 140Tyr Phe Pro Gly Val Ser Asp Tyr Gly Leu Tyr
Ala Ser Val Leu Val145 150 155
160Gly Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Val
165 170 175Glu Ala Glu Gln
Trp Lys Gly Gly Gly Ala Asp Pro Gln Ala Val Ile 180
185 190Ala Gly Val Ala Pro Arg Val Tyr Asp Met Leu
Val Pro Glu Gly Phe 195 200 205Lys
Pro Thr Gln Glu Glu Gln Leu Lys Ser Tyr Asp Thr Glu Asn Gly 210
215 220Lys Leu Ala Thr Val Val Met Ile Pro Leu
Val Glu Gly Thr Gly Gly225 230 235
240Glu79225PRTCatenulispora acidiphilaDOMAIN(1)..(225)X46 Domain
79Pro Ala Gly Asn Asp Asn Gly Pro Gly Thr Tyr Gln Tyr Pro Thr Ser1
5 10 15Ser Ser Tyr Ala Ser Gly
Ser Phe Asp Leu Thr Gly Phe Gln Val Ile 20 25
30Thr Ala Gly Ser Glu Val Tyr Leu Arg Ala Ser Leu Ala
Asn Leu Val 35 40 45Pro Thr Phe
Gly Ser Val Asp Gly Ala Gln Leu Leu Asp Ile Tyr Val 50
55 60His Asn Pro Ala Ala Thr Ser Thr Ser Thr Ala Ala
Ala Phe Pro Ser65 70 75
80Arg Asn Tyr Thr Ile Ala Pro Ser Asp Ala Trp Asn Gln Arg Leu Glu
85 90 95Ile Gln Gly Phe Ala Ser
Pro Val Trp Val Ala Pro Ser Gly Gln Gln 100
105 110Val Gly Thr Pro Thr Ala Val Val Ala Ser Thr Val
Ala Asp Thr Ile 115 120 125Thr Ile
Ala Leu Pro Ala Ala Gln Phe Gly Thr Pro Gly Pro Gly Trp 130
135 140Thr Phe Thr Leu Gly Leu Thr Gly Gln Asn Gly
Phe Gln Ala Asp Gln145 150 155
160Ala Ile Pro Phe Thr Ala Thr Pro Gly Asp Tyr Thr Phe Gly Val Cys
165 170 175Pro Val Gly Gly
Thr Ala Pro Ile Cys Ser Val Ser Pro Gly Ser Val 180
185 190Pro Glu Val Met Ser Thr Ile Thr Pro Pro Gly
Val Ser Gln Ser Ala 195 200 205Glu
Leu Asp Pro Thr Leu Gly Pro Val Val Leu His Gly Val Thr Ala 210
215 220Pro22580232PRTThermoplasma
acidophilumDOMAIN(1)..(232)X46 domain 80Leu Val Ser Ser Ile His Asn Thr
Val Pro Pro Val Gly Asp Gly Tyr1 5 10
15Tyr Thr Tyr Pro Asp Gln Pro Thr Gln Ile Pro Pro Gly Ser
Leu Asn 20 25 30Leu Glu Tyr
Val Asn Val Ser Glu Asn Gln Phe Asn Val Leu Trp Ala 35
40 45Phe Lys Tyr Ala Gln Leu Trp Asn Ile Trp Asn
Gly Pro Leu Gly Phe 50 55 60Ser Asn
Gln Ile Ile Asn Ile Phe Leu Ser Asn Gly Ser Thr Ser Gly65
70 75 80Asn Thr Tyr Leu Gly Ser Gly
Pro Asn Ala Glu Ser Ser Ile Pro Trp 85 90
95Gln Lys Met Ile Tyr Ile Ser Gly Trp Ala Thr Tyr Val
Gln Thr Leu 100 105 110Thr Gly
Thr Tyr Ser Asn Gly Ile Leu Val Ser Val Asn Leu Ser Leu 115
120 125Gly Glu Ile Tyr Val Thr Ile Pro Ile Glu
Tyr Leu Gly Gln Asn Phe 130 135 140Leu
Ser Tyr Arg Tyr Leu Ile Val Ala Gly Ser Tyr Asp Gly Tyr Gly145
150 155 160Val Asp Gly Trp Arg Val
Val Asp Gln Tyr Asn Thr Thr Asn Gly Gly 165
170 175Trp Gln Gly Gly Gly Gly Ser Pro Pro Trp Ser Ser
Asn Ile Tyr Thr 180 185 190Tyr
Ile Ala Pro Ala Thr Val Gly Glu Gly Thr Leu Thr Gln Gln Glu 195
200 205Ala Leu Ser Asn Phe Ser Val Gly His
Tyr Ala Thr Leu Val Pro Ile 210 215
220Thr Leu Pro Pro Leu Asn Glu Thr225
23081238PRTThermococcus hydrothermalisDOMAIN(1)..(238)X46 Domain 81Thr
Asp Pro Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1
5 10 15Thr Asp Lys Val Phe Lys Pro
Gly Val Phe Asp Leu Leu Lys Phe Lys 20 25
30Val Thr Glu Gly Ser Asp Asp Trp Thr Leu Glu Phe His Phe
Lys Asp 35 40 45Leu Gly Gly Asn
Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile 50 55
60Ile Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Val
Ser Ala Ile65 70 75
80Lys Met Phe Pro Asp Gly Pro Gly Ser Asn Val Arg Leu Asp Pro Asn
85 90 95His Pro Trp Asp Leu Ala
Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn 100
105 110Leu Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln Gly
Glu Met Gln Ile 115 120 125Ser Ala
Asp Pro Val Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys 130
135 140Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr
Ala Val Ile Val Gly145 150 155
160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu
165 170 175Ala Glu Gln Trp
Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile Asp 180
185 190Asn Leu Val Pro Arg Val Val Asp Glu Leu Val
Pro Glu Gly Phe Lys 195 200 205Pro
Thr Gln Glu Glu Gln Leu Ser Ser Tyr Asp Leu Glu Lys Lys Thr 210
215 220Leu Ala Thr Val Leu Met Val Pro Leu Val
Asn Gly Thr Gly225 230
235822430DNAArtificial SequenceThermococcus litoralis/Thermococcus
hydrothermalis X4 chimer pullulanase 82atg aag aaa ccg ttg ggg aaa att
gtc gca agc acc gca cta ctc att 48Met Lys Lys Pro Leu Gly Lys Ile
Val Ala Ser Thr Ala Leu Leu Ile -25 -20
-15tct gtt gct ttt agt tca tcg atc gca tcg gct gag gag ccg aag cct
96Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala Glu Glu Pro Lys Pro
-10 -5 -1 1 5ctt aac gtt atc
atc gtt tgg cac cag cac caa cct tac tac tac gac 144Leu Asn Val Ile
Ile Val Trp His Gln His Gln Pro Tyr Tyr Tyr Asp 10
15 20ccg atc caa gac atc tac aca cgc cct tgg
gtt cgc ctt cac gca gca 192Pro Ile Gln Asp Ile Tyr Thr Arg Pro Trp
Val Arg Leu His Ala Ala 25 30
35aac aac tac tgg aag atg gcg aac tac ctt tct aag tac cca gac gta
240Asn Asn Tyr Trp Lys Met Ala Asn Tyr Leu Ser Lys Tyr Pro Asp Val
40 45 50cac gta gca atc gac ctt tct ggc
tct ctt atc gct caa ctt gcg gac 288His Val Ala Ile Asp Leu Ser Gly
Ser Leu Ile Ala Gln Leu Ala Asp 55 60
65tac atg aac ggc aag aag gac aca tac cag atc gtt act gag aag atc
336Tyr Met Asn Gly Lys Lys Asp Thr Tyr Gln Ile Val Thr Glu Lys Ile70
75 80 85gcg aac ggc gag ccg
ctt act ctt gag gac aag tgg ttc atg ctt caa 384Ala Asn Gly Glu Pro
Leu Thr Leu Glu Asp Lys Trp Phe Met Leu Gln 90
95 100gct cca ggt ggc ttc ttc gac cat act atc cct
tgg aac ggc gag cct 432Ala Pro Gly Gly Phe Phe Asp His Thr Ile Pro
Trp Asn Gly Glu Pro 105 110
115gtt gct gac gag aac ggc aac cct tac cgc gag caa tgg gac cgc tac
480Val Ala Asp Glu Asn Gly Asn Pro Tyr Arg Glu Gln Trp Asp Arg Tyr
120 125 130gca gag ctt aag gac aag cgc
aac aac gct ttc aag aag tac gct aac 528Ala Glu Leu Lys Asp Lys Arg
Asn Asn Ala Phe Lys Lys Tyr Ala Asn 135 140
145ctt cca ctt aac gag caa aag gtt aag atc aca gct gag ttc acg gag
576Leu Pro Leu Asn Glu Gln Lys Val Lys Ile Thr Ala Glu Phe Thr Glu150
155 160 165caa gac tac atc
gac ctt gct gta ctt ttc aac ctt gca tgg atc gac 624Gln Asp Tyr Ile
Asp Leu Ala Val Leu Phe Asn Leu Ala Trp Ile Asp 170
175 180tac aac tac atc atc aac aca ccg gag ctt
aag gcg ctt tac gac aag 672Tyr Asn Tyr Ile Ile Asn Thr Pro Glu Leu
Lys Ala Leu Tyr Asp Lys 185 190
195gtt gac gta ggt ggc tac act aaa gag gac gtt gca aca gtt ctt aag
720Val Asp Val Gly Gly Tyr Thr Lys Glu Asp Val Ala Thr Val Leu Lys
200 205 210cac caa atg tgg ctt ctt aac
cat aca ttc gag gag cat gag aag atc 768His Gln Met Trp Leu Leu Asn
His Thr Phe Glu Glu His Glu Lys Ile 215 220
225aac tac ctt ctt ggc aac ggc aac gtt gag gtt acg gtt gtt ccg tac
816Asn Tyr Leu Leu Gly Asn Gly Asn Val Glu Val Thr Val Val Pro Tyr230
235 240 245gct cat cct att
ggc cct ctt ctt aac gac ttc ggc tgg tac gag gac 864Ala His Pro Ile
Gly Pro Leu Leu Asn Asp Phe Gly Trp Tyr Glu Asp 250
255 260ttc gac gct cat gtt aag aag gct cat gag
ctt tac aag aag tac ctt 912Phe Asp Ala His Val Lys Lys Ala His Glu
Leu Tyr Lys Lys Tyr Leu 265 270
275ggc gac aac cgc gta gag cct caa ggt ggc tgg gct gct gag tca gct
960Gly Asp Asn Arg Val Glu Pro Gln Gly Gly Trp Ala Ala Glu Ser Ala
280 285 290ctt aac gac aag aca ctt gag
atc ctt aca aac aac ggc tgg aag tgg 1008Leu Asn Asp Lys Thr Leu Glu
Ile Leu Thr Asn Asn Gly Trp Lys Trp 295 300
305gtt atg act gac caa atg gta ctt gac atc ctt ggc atc cca aac act
1056Val Met Thr Asp Gln Met Val Leu Asp Ile Leu Gly Ile Pro Asn Thr310
315 320 325gta gag aac tac
tac aag cct tgg gtt gct gag ttc aac ggc aag aag 1104Val Glu Asn Tyr
Tyr Lys Pro Trp Val Ala Glu Phe Asn Gly Lys Lys 330
335 340atc tac ctt ttt cct cgc aac cat gac ctt
agc gac cgc gtt ggc ttc 1152Ile Tyr Leu Phe Pro Arg Asn His Asp Leu
Ser Asp Arg Val Gly Phe 345 350
355cgc tac tct ggc atg aac caa tac caa gcg gtt gag gac ttc gta aac
1200Arg Tyr Ser Gly Met Asn Gln Tyr Gln Ala Val Glu Asp Phe Val Asn
360 365 370gag ctt ctt aag gtt caa aag
gag aac tat gac ggc tct ctt gta tac 1248Glu Leu Leu Lys Val Gln Lys
Glu Asn Tyr Asp Gly Ser Leu Val Tyr 375 380
385gtt gtt act ctt gac ggc gag aac cct tgg gag cat tac ccg ttc gac
1296Val Val Thr Leu Asp Gly Glu Asn Pro Trp Glu His Tyr Pro Phe Asp390
395 400 405ggc aag atc ttc
ctt gag gag ctt tac aag aag ctt act gag ctt cag 1344Gly Lys Ile Phe
Leu Glu Glu Leu Tyr Lys Lys Leu Thr Glu Leu Gln 410
415 420aag caa ggc ctt atc cgc aca gtt aca cct
tct gag tac atc cag atg 1392Lys Gln Gly Leu Ile Arg Thr Val Thr Pro
Ser Glu Tyr Ile Gln Met 425 430
435tac ggc gac aag gca aac aag ctt acg ccg cgc atg atg gag cgc ctt
1440Tyr Gly Asp Lys Ala Asn Lys Leu Thr Pro Arg Met Met Glu Arg Leu
440 445 450gac ctt aca ggc gac aac gta
aac gcg ctt ctt aag gct cag tca ctt 1488Asp Leu Thr Gly Asp Asn Val
Asn Ala Leu Leu Lys Ala Gln Ser Leu 455 460
465ggc gag ctt tac gac atg act ggc gtt aaa gag gag atg caa tgg cct
1536Gly Glu Leu Tyr Asp Met Thr Gly Val Lys Glu Glu Met Gln Trp Pro470
475 480 485gag tca tca tgg
atc gac ggc act ctt tct aca tgg atc ggc gag cct 1584Glu Ser Ser Trp
Ile Asp Gly Thr Leu Ser Thr Trp Ile Gly Glu Pro 490
495 500cag gag aac tat ggc tgg tat tgg ctt tac
atg gca cgc aaa gca ctt 1632Gln Glu Asn Tyr Gly Trp Tyr Trp Leu Tyr
Met Ala Arg Lys Ala Leu 505 510
515atg gag aac aag gac aag atg tct caa gct gac tgg gag aag gca tac
1680Met Glu Asn Lys Asp Lys Met Ser Gln Ala Asp Trp Glu Lys Ala Tyr
520 525 530gag tac ctt ctt cgc gca gag
gcg tca gac tgg ttc tgg tgg tac ggc 1728Glu Tyr Leu Leu Arg Ala Glu
Ala Ser Asp Trp Phe Trp Trp Tyr Gly 535 540
545tca gac caa gac tct ggc caa gac tac aca ttt gac cgc tac ctt aag
1776Ser Asp Gln Asp Ser Gly Gln Asp Tyr Thr Phe Asp Arg Tyr Leu Lys550
555 560 565acg tac ctt tac
gag atg tac aaa ctt gct ggc gtt gag cct cct tca 1824Thr Tyr Leu Tyr
Glu Met Tyr Lys Leu Ala Gly Val Glu Pro Pro Ser 570
575 580tat ctt ttc ggc aac tac ttt cct gac ggc
gag ccg tac aca act cgt 1872Tyr Leu Phe Gly Asn Tyr Phe Pro Asp Gly
Glu Pro Tyr Thr Thr Arg 585 590
595ggc ctt gtt ggc ctt aaa gac ggc gag atg aaa aac ttt agc tct atg
1920Gly Leu Val Gly Leu Lys Asp Gly Glu Met Lys Asn Phe Ser Ser Met
600 605 610tct cct ctt gct aag ggc gtt
tct gtt tac ttt gac ggc gag ggc atc 1968Ser Pro Leu Ala Lys Gly Val
Ser Val Tyr Phe Asp Gly Glu Gly Ile 615 620
625cat ttc atc gtt aag ggc aac ctt gac cgc ttc gag gtt agc atc tgg
2016His Phe Ile Val Lys Gly Asn Leu Asp Arg Phe Glu Val Ser Ile Trp630
635 640 645gag aag gac gag
cgc gta ggc aac act ttc act cgc ctt caa gag aag 2064Glu Lys Asp Glu
Arg Val Gly Asn Thr Phe Thr Arg Leu Gln Glu Lys 650
655 660cct gac gag ctt tct tac ttt atg ttc cct
ttc tct cgc gac agc gtt 2112Pro Asp Glu Leu Ser Tyr Phe Met Phe Pro
Phe Ser Arg Asp Ser Val 665 670
675ggc ctt ctt atc act aag cac gta gtt tat gag aac ggc aag gct gag
2160Gly Leu Leu Ile Thr Lys His Val Val Tyr Glu Asn Gly Lys Ala Glu
680 685 690atc tat ggc gct aca gac tat
gag aag tca gag aaa ctt ggc gag gct 2208Ile Tyr Gly Ala Thr Asp Tyr
Glu Lys Ser Glu Lys Leu Gly Glu Ala 695 700
705act gtt aag aac act tca gag ggc atc gag gta gta ctt cct ttt gac
2256Thr Val Lys Asn Thr Ser Glu Gly Ile Glu Val Val Leu Pro Phe Asp710
715 720 725tac atc gag aac
cca tca gac ttc tac ttc gct gtt tct act gtt aag 2304Tyr Ile Glu Asn
Pro Ser Asp Phe Tyr Phe Ala Val Ser Thr Val Lys 730
735 740gac ggc gac ctt gag gtt atc tct act cct
gta gag ctt aaa ctt cct 2352Asp Gly Asp Leu Glu Val Ile Ser Thr Pro
Val Glu Leu Lys Leu Pro 745 750
755aca gag gtt aaa ggc gtt gtt atc gct gac atc acg gac cct gag ggc
2400Thr Glu Val Lys Gly Val Val Ile Ala Asp Ile Thr Asp Pro Glu Gly
760 765 770gac gac cat ggc cct ggc aac
tat act taa 2430Asp Asp His Gly Pro Gly Asn
Tyr Thr 775 78083809PRTArtificial SequenceSynthetic
Construct 83Met Lys Lys Pro Leu Gly Lys Ile Val Ala Ser Thr Ala Leu Leu
Ile -25 -20 -15Ser Val Ala Phe Ser
Ser Ser Ile Ala Ser Ala Glu Glu Pro Lys Pro -10 -5
-1 1 5Leu Asn Val Ile Ile Val Trp His Gln His Gln
Pro Tyr Tyr Tyr Asp 10 15
20Pro Ile Gln Asp Ile Tyr Thr Arg Pro Trp Val Arg Leu His Ala Ala
25 30 35Asn Asn Tyr Trp Lys Met Ala
Asn Tyr Leu Ser Lys Tyr Pro Asp Val 40 45
50His Val Ala Ile Asp Leu Ser Gly Ser Leu Ile Ala Gln Leu Ala
Asp 55 60 65Tyr Met Asn Gly Lys Lys
Asp Thr Tyr Gln Ile Val Thr Glu Lys Ile70 75
80 85Ala Asn Gly Glu Pro Leu Thr Leu Glu Asp Lys
Trp Phe Met Leu Gln 90 95
100Ala Pro Gly Gly Phe Phe Asp His Thr Ile Pro Trp Asn Gly Glu Pro
105 110 115Val Ala Asp Glu Asn Gly
Asn Pro Tyr Arg Glu Gln Trp Asp Arg Tyr 120 125
130Ala Glu Leu Lys Asp Lys Arg Asn Asn Ala Phe Lys Lys Tyr
Ala Asn 135 140 145Leu Pro Leu Asn Glu
Gln Lys Val Lys Ile Thr Ala Glu Phe Thr Glu150 155
160 165Gln Asp Tyr Ile Asp Leu Ala Val Leu Phe
Asn Leu Ala Trp Ile Asp 170 175
180Tyr Asn Tyr Ile Ile Asn Thr Pro Glu Leu Lys Ala Leu Tyr Asp Lys
185 190 195Val Asp Val Gly Gly
Tyr Thr Lys Glu Asp Val Ala Thr Val Leu Lys 200
205 210His Gln Met Trp Leu Leu Asn His Thr Phe Glu Glu
His Glu Lys Ile 215 220 225Asn Tyr Leu
Leu Gly Asn Gly Asn Val Glu Val Thr Val Val Pro Tyr230
235 240 245Ala His Pro Ile Gly Pro Leu
Leu Asn Asp Phe Gly Trp Tyr Glu Asp 250
255 260Phe Asp Ala His Val Lys Lys Ala His Glu Leu Tyr
Lys Lys Tyr Leu 265 270 275Gly
Asp Asn Arg Val Glu Pro Gln Gly Gly Trp Ala Ala Glu Ser Ala 280
285 290Leu Asn Asp Lys Thr Leu Glu Ile Leu
Thr Asn Asn Gly Trp Lys Trp 295 300
305Val Met Thr Asp Gln Met Val Leu Asp Ile Leu Gly Ile Pro Asn Thr310
315 320 325Val Glu Asn Tyr
Tyr Lys Pro Trp Val Ala Glu Phe Asn Gly Lys Lys 330
335 340Ile Tyr Leu Phe Pro Arg Asn His Asp Leu
Ser Asp Arg Val Gly Phe 345 350
355Arg Tyr Ser Gly Met Asn Gln Tyr Gln Ala Val Glu Asp Phe Val Asn
360 365 370Glu Leu Leu Lys Val Gln Lys
Glu Asn Tyr Asp Gly Ser Leu Val Tyr 375 380
385Val Val Thr Leu Asp Gly Glu Asn Pro Trp Glu His Tyr Pro Phe
Asp390 395 400 405Gly Lys
Ile Phe Leu Glu Glu Leu Tyr Lys Lys Leu Thr Glu Leu Gln
410 415 420Lys Gln Gly Leu Ile Arg Thr
Val Thr Pro Ser Glu Tyr Ile Gln Met 425 430
435Tyr Gly Asp Lys Ala Asn Lys Leu Thr Pro Arg Met Met Glu
Arg Leu 440 445 450Asp Leu Thr Gly
Asp Asn Val Asn Ala Leu Leu Lys Ala Gln Ser Leu 455
460 465Gly Glu Leu Tyr Asp Met Thr Gly Val Lys Glu Glu
Met Gln Trp Pro470 475 480
485Glu Ser Ser Trp Ile Asp Gly Thr Leu Ser Thr Trp Ile Gly Glu Pro
490 495 500Gln Glu Asn Tyr Gly
Trp Tyr Trp Leu Tyr Met Ala Arg Lys Ala Leu 505
510 515Met Glu Asn Lys Asp Lys Met Ser Gln Ala Asp Trp
Glu Lys Ala Tyr 520 525 530Glu Tyr
Leu Leu Arg Ala Glu Ala Ser Asp Trp Phe Trp Trp Tyr Gly 535
540 545Ser Asp Gln Asp Ser Gly Gln Asp Tyr Thr Phe
Asp Arg Tyr Leu Lys550 555 560
565Thr Tyr Leu Tyr Glu Met Tyr Lys Leu Ala Gly Val Glu Pro Pro Ser
570 575 580Tyr Leu Phe Gly
Asn Tyr Phe Pro Asp Gly Glu Pro Tyr Thr Thr Arg 585
590 595Gly Leu Val Gly Leu Lys Asp Gly Glu Met Lys
Asn Phe Ser Ser Met 600 605 610Ser
Pro Leu Ala Lys Gly Val Ser Val Tyr Phe Asp Gly Glu Gly Ile 615
620 625His Phe Ile Val Lys Gly Asn Leu Asp Arg
Phe Glu Val Ser Ile Trp630 635 640
645Glu Lys Asp Glu Arg Val Gly Asn Thr Phe Thr Arg Leu Gln Glu
Lys 650 655 660Pro Asp Glu
Leu Ser Tyr Phe Met Phe Pro Phe Ser Arg Asp Ser Val 665
670 675Gly Leu Leu Ile Thr Lys His Val Val Tyr
Glu Asn Gly Lys Ala Glu 680 685
690Ile Tyr Gly Ala Thr Asp Tyr Glu Lys Ser Glu Lys Leu Gly Glu Ala 695
700 705Thr Val Lys Asn Thr Ser Glu Gly
Ile Glu Val Val Leu Pro Phe Asp710 715
720 725Tyr Ile Glu Asn Pro Ser Asp Phe Tyr Phe Ala Val
Ser Thr Val Lys 730 735
740Asp Gly Asp Leu Glu Val Ile Ser Thr Pro Val Glu Leu Lys Leu Pro
745 750 755Thr Glu Val Lys Gly Val
Val Ile Ala Asp Ile Thr Asp Pro Glu Gly 760 765
770Asp Asp His Gly Pro Gly Asn Tyr Thr 775
78084715DNAThermococcus hydrothermalisCDS(1)..(714) 84acc gac ccc gag
ggc gac gat cat ggt cct ggc act tac acg tat ccg 48Thr Asp Pro Glu
Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1 5
10 15acg gac aag gtc ttc aaa cct ggc gtg ttc
gat ttg ctc aag ttc aaa 96Thr Asp Lys Val Phe Lys Pro Gly Val Phe
Asp Leu Leu Lys Phe Lys 20 25
30gtc acc gag ggc tcc gat gat tgg acc ttg gag ttc cat ttc aag gac
144Val Thr Glu Gly Ser Asp Asp Trp Thr Leu Glu Phe His Phe Lys Asp
35 40 45ttg gga ggc aac cct tgg aac gga
ccc aac ggc ttc tcg ctc cag atc 192Leu Gly Gly Asn Pro Trp Asn Gly
Pro Asn Gly Phe Ser Leu Gln Ile 50 55
60atc gaa gtg tac ttc gac ttc aaa gaa ggc gga aac gtg tcc gcc att
240Ile Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Val Ser Ala Ile65
70 75 80aag atg ttc ccg gac
gga ccc gga tcg aac gtg agg ctc gat ccc aac 288Lys Met Phe Pro Asp
Gly Pro Gly Ser Asn Val Arg Leu Asp Pro Asn 85
90 95cat cct tgg gat ttg gca ctc cgg att gcc ggt
tgg gac tac gga aac 336His Pro Trp Asp Leu Ala Leu Arg Ile Ala Gly
Trp Asp Tyr Gly Asn 100 105
110ctc atc att ctc ccg gat ggc acc gcc tac cag ggc gag atg cag atc
384Leu Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln Gly Glu Met Gln Ile
115 120 125tcg gca gac ccg gtc aag aac
gcc atc atc gtc aag gtc cct aag aaa 432Ser Ala Asp Pro Val Lys Asn
Ala Ile Ile Val Lys Val Pro Lys Lys 130 135
140tac ttg aac atc tcg gat tat ggc ctc tat acc gca gtg atc gtg ggc
480Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr Ala Val Ile Val Gly145
150 155 160tcc cag gat gga
tac gga ccc gac aaa tgg cga ccc gtc gca gcc gag 528Ser Gln Asp Gly
Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu 165
170 175gcc gag cag tgg aaa ctc ggt ggt gcc gac
ccc cag gca gtc atc gat 576Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp
Pro Gln Ala Val Ile Asp 180 185
190aac ttg gtg cct cgg gtg gtg gac gag ttg gtg cct gag ggt ttc aaa
624Asn Leu Val Pro Arg Val Val Asp Glu Leu Val Pro Glu Gly Phe Lys
195 200 205ccc acc cag gag gag cag ctc
tcc tcg tat gac ttg gag aag aag aca 672Pro Thr Gln Glu Glu Gln Leu
Ser Ser Tyr Asp Leu Glu Lys Lys Thr 210 215
220ttg gcg act gtc ctc atg gtc cct ttg gtc aac ggc act gga g
715Leu Ala Thr Val Leu Met Val Pro Leu Val Asn Gly Thr Gly225
230 23585238PRTThermococcus hydrothermalis 85Thr
Asp Pro Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr Tyr Pro1
5 10 15Thr Asp Lys Val Phe Lys Pro
Gly Val Phe Asp Leu Leu Lys Phe Lys 20 25
30Val Thr Glu Gly Ser Asp Asp Trp Thr Leu Glu Phe His Phe
Lys Asp 35 40 45Leu Gly Gly Asn
Pro Trp Asn Gly Pro Asn Gly Phe Ser Leu Gln Ile 50 55
60Ile Glu Val Tyr Phe Asp Phe Lys Glu Gly Gly Asn Val
Ser Ala Ile65 70 75
80Lys Met Phe Pro Asp Gly Pro Gly Ser Asn Val Arg Leu Asp Pro Asn
85 90 95His Pro Trp Asp Leu Ala
Leu Arg Ile Ala Gly Trp Asp Tyr Gly Asn 100
105 110Leu Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln Gly
Glu Met Gln Ile 115 120 125Ser Ala
Asp Pro Val Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys 130
135 140Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr
Ala Val Ile Val Gly145 150 155
160Ser Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu
165 170 175Ala Glu Gln Trp
Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile Asp 180
185 190Asn Leu Val Pro Arg Val Val Asp Glu Leu Val
Pro Glu Gly Phe Lys 195 200 205Pro
Thr Gln Glu Glu Gln Leu Ser Ser Tyr Asp Leu Glu Lys Lys Thr 210
215 220Leu Ala Thr Val Leu Met Val Pro Leu Val
Asn Gly Thr Gly225 230
23586670DNAFervidobacter nodosumCDS(2)..(670) 86c gct gac aag atc ggc gac
gac tat ggc ttc ggc aca tac gtt tac cca 49 Ala Asp Lys Ile Gly Asp
Asp Tyr Gly Phe Gly Thr Tyr Val Tyr Pro 1 5
10 15aaa gac cct gca ttc gca ccg tat aag ggc ctt tgg
gac atc aca gag 97Lys Asp Pro Ala Phe Ala Pro Tyr Lys Gly Leu Trp
Asp Ile Thr Glu 20 25 30gta
act gtt ctt gag aac gac gag gca tat gtt ttc tca atc aag ttt 145Val
Thr Val Leu Glu Asn Asp Glu Ala Tyr Val Phe Ser Ile Lys Phe 35
40 45gct gag atg act aac cct tgg gca agc
cca aag ggc ttc tct cac caa 193Ala Glu Met Thr Asn Pro Trp Ala Ser
Pro Lys Gly Phe Ser His Gln 50 55
60ctt gta aac atc tat ctt gac aca aag gca ggt ggc aag act tct acg
241Leu Val Asn Ile Tyr Leu Asp Thr Lys Ala Gly Gly Lys Thr Ser Thr65
70 75 80tac aaa gaa ggt gct
cgc gta caa ttc aag gag ccg tgg gac tat ttc 289Tyr Lys Glu Gly Ala
Arg Val Gln Phe Lys Glu Pro Trp Asp Tyr Phe 85
90 95atc aag gtt gca ggc tgg cca gac gac cgc atc
gtt ttt gct act gcg 337Ile Lys Val Ala Gly Trp Pro Asp Asp Arg Ile
Val Phe Ala Thr Ala 100 105
110gac ggc aaa gag atc ccg gag gct atc atc tac gag gca gac cct gct
385Asp Gly Lys Glu Ile Pro Glu Ala Ile Ile Tyr Glu Ala Asp Pro Ala
115 120 125gac aag gta atc cac atc atc
gta ttc aaa aag tat ctt gag gta aag 433Asp Lys Val Ile His Ile Ile
Val Phe Lys Lys Tyr Leu Glu Val Lys 130 135
140act ggc atc aag gct tac atc ctt agc ctt tct caa gac ggc tat ggc
481Thr Gly Ile Lys Ala Tyr Ile Leu Ser Leu Ser Gln Asp Gly Tyr Gly145
150 155 160acg gac cat att
cgc cca gtt agc aaa gac cct act caa tgg aca ctt 529Thr Asp His Ile
Arg Pro Val Ser Lys Asp Pro Thr Gln Trp Thr Leu 165
170 175ggt ggc tat cct gtt gac agc aaa gac ttc
gct cca tat gta ctt gac 577Gly Gly Tyr Pro Val Asp Ser Lys Asp Phe
Ala Pro Tyr Val Leu Asp 180 185
190aca atc gtt cca gag ggc caa aaa caa gag gac atc ctt aag tct tac
625Thr Ile Val Pro Glu Gly Gln Lys Gln Glu Asp Ile Leu Lys Ser Tyr
195 200 205gtt cct ggc cag tca tac gca
act ctt atc cct atc gtt gtt aaa 670Val Pro Gly Gln Ser Tyr Ala
Thr Leu Ile Pro Ile Val Val Lys 210 215
22087223PRTFervidobacter nodosum 87Ala Asp Lys Ile Gly Asp Asp Tyr Gly
Phe Gly Thr Tyr Val Tyr Pro1 5 10
15Lys Asp Pro Ala Phe Ala Pro Tyr Lys Gly Leu Trp Asp Ile Thr
Glu 20 25 30Val Thr Val Leu
Glu Asn Asp Glu Ala Tyr Val Phe Ser Ile Lys Phe 35
40 45Ala Glu Met Thr Asn Pro Trp Ala Ser Pro Lys Gly
Phe Ser His Gln 50 55 60Leu Val Asn
Ile Tyr Leu Asp Thr Lys Ala Gly Gly Lys Thr Ser Thr65 70
75 80Tyr Lys Glu Gly Ala Arg Val Gln
Phe Lys Glu Pro Trp Asp Tyr Phe 85 90
95Ile Lys Val Ala Gly Trp Pro Asp Asp Arg Ile Val Phe Ala
Thr Ala 100 105 110Asp Gly Lys
Glu Ile Pro Glu Ala Ile Ile Tyr Glu Ala Asp Pro Ala 115
120 125Asp Lys Val Ile His Ile Ile Val Phe Lys Lys
Tyr Leu Glu Val Lys 130 135 140Thr Gly
Ile Lys Ala Tyr Ile Leu Ser Leu Ser Gln Asp Gly Tyr Gly145
150 155 160Thr Asp His Ile Arg Pro Val
Ser Lys Asp Pro Thr Gln Trp Thr Leu 165
170 175Gly Gly Tyr Pro Val Asp Ser Lys Asp Phe Ala Pro
Tyr Val Leu Asp 180 185 190Thr
Ile Val Pro Glu Gly Gln Lys Gln Glu Asp Ile Leu Lys Ser Tyr 195
200 205Val Pro Gly Gln Ser Tyr Ala Thr Leu
Ile Pro Ile Val Val Lys 210 215
22088720DNADictyoglomus thermophilumCDS(1)..(720)X46 Domain 88gat gat cca
aca gga gat gat tat gga tgg ggc aag gtt gtt tat cca 48Asp Asp Pro
Thr Gly Asp Asp Tyr Gly Trp Gly Lys Val Val Tyr Pro1 5
10 15aca gct cct gtg ttt aaa cct gga gtc
ttt gac ata att cat gta gaa 96Thr Ala Pro Val Phe Lys Pro Gly Val
Phe Asp Ile Ile His Val Glu 20 25
30atg ggt aaa agc aag gac gat att gta ttc aaa gtt aaa att aga gga
144Met Gly Lys Ser Lys Asp Asp Ile Val Phe Lys Val Lys Ile Arg Gly
35 40 45gat tta gaa aat cca tgg gga
tct cct aca gga gtg tca gtt caa acc 192Asp Leu Glu Asn Pro Trp Gly
Ser Pro Thr Gly Val Ser Val Gln Thr 50 55
60ata gat ata tac ata aac gat ggt aaa gaa ggg cca tat tat tat caa
240Ile Asp Ile Tyr Ile Asn Asp Gly Lys Glu Gly Pro Tyr Tyr Tyr Gln65
70 75 80gca tta cca gga
agg cag gcc aat atc cca gaa gga tgg aat aaa gca 288Ala Leu Pro Gly
Arg Gln Ala Asn Ile Pro Glu Gly Trp Asn Lys Ala 85
90 95ata tgg gct gag gga tgg att caa gaa tta
gta gtt cca gcg tta gat 336Ile Trp Ala Glu Gly Trp Ile Gln Glu Leu
Val Val Pro Ala Leu Asp 100 105
110gaa aag gga gaa gta caa tta aaa gaa ata aaa gga gtt gtt caa tta
384Glu Lys Gly Glu Val Gln Leu Lys Glu Ile Lys Gly Val Val Gln Leu
115 120 125act gca gac ccc ata gaa aga
acc ata aca ata tca gtg cct gaa aaa 432Thr Ala Asp Pro Ile Glu Arg
Thr Ile Thr Ile Ser Val Pro Glu Lys 130 135
140tat tta ggt cct gta acc cca gat tgg aaa atc ctt gta ata tta tgt
480Tyr Leu Gly Pro Val Thr Pro Asp Trp Lys Ile Leu Val Ile Leu Cys145
150 155 160ggg caa gaa gga
tac ccc aga cct gga agt tgg aga gta aga gag gta 528Gly Gln Glu Gly
Tyr Pro Arg Pro Gly Ser Trp Arg Val Arg Glu Val 165
170 175gaa gaa gaa gca aaa caa tgg aga ttt ggt
ggt gga gac gac ttc tat 576Glu Glu Glu Ala Lys Gln Trp Arg Phe Gly
Gly Gly Asp Asp Phe Tyr 180 185
190gga gat cct aac att ata gat atg ata gtt ccc cct gga aca aaa caa
624Gly Asp Pro Asn Ile Ile Asp Met Ile Val Pro Pro Gly Thr Lys Gln
195 200 205gaa gat ata ttg tct aaa tgg
gta agt agt gaa gat gaa gaa gaa aat 672Glu Asp Ile Leu Ser Lys Trp
Val Ser Ser Glu Asp Glu Glu Glu Asn 210 215
220gtt tat gta gaa ctc ccc ttg atc ccc ctt agg atc ctt atg aac caa
720Val Tyr Val Glu Leu Pro Leu Ile Pro Leu Arg Ile Leu Met Asn Gln225
230 235
24089240PRTDictyoglomus thermophilum 89Asp Asp Pro Thr Gly Asp Asp Tyr
Gly Trp Gly Lys Val Val Tyr Pro1 5 10
15Thr Ala Pro Val Phe Lys Pro Gly Val Phe Asp Ile Ile His
Val Glu 20 25 30Met Gly Lys
Ser Lys Asp Asp Ile Val Phe Lys Val Lys Ile Arg Gly 35
40 45Asp Leu Glu Asn Pro Trp Gly Ser Pro Thr Gly
Val Ser Val Gln Thr 50 55 60Ile Asp
Ile Tyr Ile Asn Asp Gly Lys Glu Gly Pro Tyr Tyr Tyr Gln65
70 75 80Ala Leu Pro Gly Arg Gln Ala
Asn Ile Pro Glu Gly Trp Asn Lys Ala 85 90
95Ile Trp Ala Glu Gly Trp Ile Gln Glu Leu Val Val Pro
Ala Leu Asp 100 105 110Glu Lys
Gly Glu Val Gln Leu Lys Glu Ile Lys Gly Val Val Gln Leu 115
120 125Thr Ala Asp Pro Ile Glu Arg Thr Ile Thr
Ile Ser Val Pro Glu Lys 130 135 140Tyr
Leu Gly Pro Val Thr Pro Asp Trp Lys Ile Leu Val Ile Leu Cys145
150 155 160Gly Gln Glu Gly Tyr Pro
Arg Pro Gly Ser Trp Arg Val Arg Glu Val 165
170 175Glu Glu Glu Ala Lys Gln Trp Arg Phe Gly Gly Gly
Asp Asp Phe Tyr 180 185 190Gly
Asp Pro Asn Ile Ile Asp Met Ile Val Pro Pro Gly Thr Lys Gln 195
200 205Glu Asp Ile Leu Ser Lys Trp Val Ser
Ser Glu Asp Glu Glu Glu Asn 210 215
220Val Tyr Val Glu Leu Pro Leu Ile Pro Leu Arg Ile Leu Met Asn Gln225
230 235
24090873DNADictyoglomus thermophilumCDS(1)..(873)Uniprot B5YCY6 90ttg att
tct aaa aaa tta aaa ggg ggg gag aat tct ccc ccc tta aaa 48Leu Ile
Ser Lys Lys Leu Lys Gly Gly Glu Asn Ser Pro Pro Leu Lys1 5
10 15aga ttc aag gag ggc tat aaa atg
aaa aag tta tta att tta att tcc 96Arg Phe Lys Glu Gly Tyr Lys Met
Lys Lys Leu Leu Ile Leu Ile Ser 20 25
30tta ata ctt ctt tcc act att gtt ttt gct gaa cct gta aaa tat
cct 144Leu Ile Leu Leu Ser Thr Ile Val Phe Ala Glu Pro Val Lys Tyr
Pro 35 40 45ctt ata ttc aac gat
cct gta aac gac gac aag ggg cct gga aca tac 192Leu Ile Phe Asn Asp
Pro Val Asn Asp Asp Lys Gly Pro Gly Thr Tyr 50 55
60acc tat cct aca gac cca gtt ttt aaa tct ggt act ttt gat
atg aca 240Thr Tyr Pro Thr Asp Pro Val Phe Lys Ser Gly Thr Phe Asp
Met Thr65 70 75 80aaa
gta gta ata gat gcc gat aat gat aat gta tat ttc aag atc tcc 288Lys
Val Val Ile Asp Ala Asp Asn Asp Asn Val Tyr Phe Lys Ile Ser
85 90 95ttc aga gta cct ata gag aat
cct tgg gga agt cca tta gga att tcc 336Phe Arg Val Pro Ile Glu Asn
Pro Trp Gly Ser Pro Leu Gly Ile Ser 100 105
110tta caa acg atc cat ata tat att gat aag gat cat aag aaa
gat tca 384Leu Gln Thr Ile His Ile Tyr Ile Asp Lys Asp His Lys Lys
Asp Ser 115 120 125gga ttc agg gat
ttt atc cca ggt gta aga gcc caa acc aca ccg gaa 432Gly Phe Arg Asp
Phe Ile Pro Gly Val Arg Ala Gln Thr Thr Pro Glu 130
135 140agt gca tgg gat tta gcc ata ctc gta gaa ggt tgg
cct aca gag cta 480Ser Ala Trp Asp Leu Ala Ile Leu Val Glu Gly Trp
Pro Thr Glu Leu145 150 155
160aaa agt tct gta aaa aat gca gct cct gaa atg tat aag tat tgt gtc
528Lys Ser Ser Val Lys Asn Ala Ala Pro Glu Met Tyr Lys Tyr Cys Val
165 170 175ttc ccc tct aaa gga
gta act gtc gat ggc aat acc ata acc ata cct 576Phe Pro Ser Lys Gly
Val Thr Val Asp Gly Asn Thr Ile Thr Ile Pro 180
185 190gta cct aag aag acc ctt ggt gac aac ttc caa aaa
ggt tgg gga ttt 624Val Pro Lys Lys Thr Leu Gly Asp Asn Phe Gln Lys
Gly Trp Gly Phe 195 200 205caa gtt
ttc atc atg gga caa gag gga ttc cca acc cag gac cct gtg 672Gln Val
Phe Ile Met Gly Gln Glu Gly Phe Pro Thr Gln Asp Pro Val 210
215 220tct tgt agg atc aga gag gtc tta tct aca gct
caa caa tgg aga ttt 720Ser Cys Arg Ile Arg Glu Val Leu Ser Thr Ala
Gln Gln Trp Arg Phe225 230 235
240agc ggt ggt gat gac ttt tat gga gat cct aat att ata gac cta tta
768Ser Gly Gly Asp Asp Phe Tyr Gly Asp Pro Asn Ile Ile Asp Leu Leu
245 250 255gat tac gag gat ata
aac caa ttt gag att tta agt aaa tat aag agt 816Asp Tyr Glu Asp Ile
Asn Gln Phe Glu Ile Leu Ser Lys Tyr Lys Ser 260
265 270gat gct aaa ttt gag aag aat gtg tat gct caa gta
ccc ttt atc tat 864Asp Ala Lys Phe Glu Lys Asn Val Tyr Ala Gln Val
Pro Phe Ile Tyr 275 280 285gta aag
tag 873Val Lys
29091290PRTDictyoglomus thermophilum 91Leu Ile Ser Lys Lys Leu Lys Gly
Gly Glu Asn Ser Pro Pro Leu Lys1 5 10
15Arg Phe Lys Glu Gly Tyr Lys Met Lys Lys Leu Leu Ile Leu
Ile Ser 20 25 30Leu Ile Leu
Leu Ser Thr Ile Val Phe Ala Glu Pro Val Lys Tyr Pro 35
40 45Leu Ile Phe Asn Asp Pro Val Asn Asp Asp Lys
Gly Pro Gly Thr Tyr 50 55 60Thr Tyr
Pro Thr Asp Pro Val Phe Lys Ser Gly Thr Phe Asp Met Thr65
70 75 80Lys Val Val Ile Asp Ala Asp
Asn Asp Asn Val Tyr Phe Lys Ile Ser 85 90
95Phe Arg Val Pro Ile Glu Asn Pro Trp Gly Ser Pro Leu
Gly Ile Ser 100 105 110Leu Gln
Thr Ile His Ile Tyr Ile Asp Lys Asp His Lys Lys Asp Ser 115
120 125Gly Phe Arg Asp Phe Ile Pro Gly Val Arg
Ala Gln Thr Thr Pro Glu 130 135 140Ser
Ala Trp Asp Leu Ala Ile Leu Val Glu Gly Trp Pro Thr Glu Leu145
150 155 160Lys Ser Ser Val Lys Asn
Ala Ala Pro Glu Met Tyr Lys Tyr Cys Val 165
170 175Phe Pro Ser Lys Gly Val Thr Val Asp Gly Asn Thr
Ile Thr Ile Pro 180 185 190Val
Pro Lys Lys Thr Leu Gly Asp Asn Phe Gln Lys Gly Trp Gly Phe 195
200 205Gln Val Phe Ile Met Gly Gln Glu Gly
Phe Pro Thr Gln Asp Pro Val 210 215
220Ser Cys Arg Ile Arg Glu Val Leu Ser Thr Ala Gln Gln Trp Arg Phe225
230 235 240Ser Gly Gly Asp
Asp Phe Tyr Gly Asp Pro Asn Ile Ile Asp Leu Leu 245
250 255Asp Tyr Glu Asp Ile Asn Gln Phe Glu Ile
Leu Ser Lys Tyr Lys Ser 260 265
270Asp Ala Lys Phe Glu Lys Asn Val Tyr Ala Gln Val Pro Phe Ile Tyr
275 280 285Val Lys
29092290PRTDictyoglomus thermophilumSIGNAL(1)..(23)signal peptide
predicted by signal P 92Met Ile Ser Lys Lys Leu Lys Gly Gly Glu Asn Ser
Pro Pro Leu Lys1 5 10
15Arg Phe Lys Glu Gly Tyr Lys Met Lys Lys Leu Leu Ile Leu Ile Ser
20 25 30Leu Ile Leu Leu Ser Thr Ile
Val Phe Ala Glu Pro Val Lys Tyr Pro 35 40
45Leu Ile Phe Asn Asp Pro Val Asn Asp Asp Lys Gly Pro Gly Thr
Tyr 50 55 60Thr Tyr Pro Thr Asp Pro
Val Phe Lys Ser Gly Thr Phe Asp Met Thr65 70
75 80Lys Val Val Ile Asp Ala Asp Asn Asp Asn Val
Tyr Phe Lys Ile Ser 85 90
95Phe Arg Val Pro Ile Glu Asn Pro Trp Gly Ser Pro Leu Gly Ile Ser
100 105 110Leu Gln Thr Ile His Ile
Tyr Ile Asp Lys Asp His Lys Lys Asp Ser 115 120
125Gly Phe Arg Asp Phe Ile Pro Gly Val Arg Ala Gln Thr Thr
Pro Glu 130 135 140Ser Ala Trp Asp Leu
Ala Ile Leu Val Glu Gly Trp Pro Thr Glu Leu145 150
155 160Lys Ser Ser Val Lys Asn Ala Ala Pro Glu
Met Tyr Lys Tyr Cys Val 165 170
175Phe Pro Ser Lys Gly Val Thr Val Asp Gly Asn Thr Ile Thr Ile Pro
180 185 190Val Pro Lys Lys Thr
Leu Gly Asp Asn Phe Gln Lys Gly Trp Gly Phe 195
200 205Gln Val Phe Ile Met Gly Gln Glu Gly Phe Pro Thr
Gln Asp Pro Val 210 215 220Ser Cys Arg
Ile Arg Glu Val Leu Ser Thr Ala Gln Gln Trp Arg Phe225
230 235 240Ser Gly Gly Asp Asp Phe Tyr
Gly Asp Pro Asn Ile Ile Asp Leu Leu 245
250 255Asp Tyr Glu Asp Ile Asn Gln Phe Glu Ile Leu Ser
Lys Tyr Lys Ser 260 265 270Asp
Ala Lys Phe Glu Lys Asn Val Tyr Ala Gln Val Pro Phe Ile Tyr 275
280 285Val Lys 29093861DNADictyoglomus
thermophilum 93atgaaacaac aaaaacggct ttacgcccga ttgctgacgc tgttatttgc
gctcatcttc 60ttgctgcctc attctgcagc cgcgcatcag caccaacacc agcatgctga
gcctgttaag 120taccctctta tcttcaacga ccctgttaac gacgacaaag gccctggcac
ttatacttac 180cctacagacc cagtattcaa gtctggcact ttcgacatga ctaaggttgt
tatcgacgct 240gacaacgaca acgtttactt caagatctct ttccgcgtac caatcgagaa
cccttggggc 300tctcctcttg gcatcagcct tcaaacaatc cacatctata tcgacaagga
ccacaagaag 360gacagcggct tccgcgactt catcccaggc gtacgtgcgc aaacaacacc
agagtcagct 420tgggaccttg ctatccttgt agagggctgg cctacagagc ttaagtcatc
agttaagaac 480gctgctccgg agatgtataa gtattgtgtt ttcccgtcta agggcgtaac
tgttgacggc 540aacactatca ctatcccagt acctaagaag actcttggcg acaacttcca
aaagggctgg 600ggctttcagg tattcatcat gggccaagag ggcttcccta ctcaagaccc
agtttcttgc 660cgcatccgcg aggttctttc tactgctcaa caatggcgct tttctggtgg
cgacgacttc 720tacggcgacc ctaacatcat cgaccttctt gactacgagg acatcaacca
gttcgagatc 780cttagcaagt ataagagcga cgctaagttc gagaagaacg tttatgctca
ggtaccattc 840atctacgtaa agtaaacgcg t
86194284PRTDictyoglomus
thermophilumSIGNAL(1)..(28)MISC_FEATURE(29)..(35)Affinity tag 94Met Lys
Gln Gln Lys Arg Leu Tyr Ala Arg Leu Leu Thr Leu Leu Phe1 5
10 15Ala Leu Ile Phe Leu Leu Pro His
Ser Ala Ala Ala His Gln His Gln 20 25
30His Gln His Ala Glu Pro Val Lys Tyr Pro Leu Ile Phe Asn Asp
Pro 35 40 45Val Asn Asp Asp Lys
Gly Pro Gly Thr Tyr Thr Tyr Pro Thr Asp Pro 50 55
60Val Phe Lys Ser Gly Thr Phe Asp Met Thr Lys Val Val Ile
Asp Ala65 70 75 80Asp
Asn Asp Asn Val Tyr Phe Lys Ile Ser Phe Arg Val Pro Ile Glu
85 90 95Asn Pro Trp Gly Ser Pro Leu
Gly Ile Ser Leu Gln Thr Ile His Ile 100 105
110Tyr Ile Asp Lys Asp His Lys Lys Asp Ser Gly Phe Arg Asp
Phe Ile 115 120 125Pro Gly Val Arg
Ala Gln Thr Thr Pro Glu Ser Ala Trp Asp Leu Ala 130
135 140Ile Leu Val Glu Gly Trp Pro Thr Glu Leu Lys Ser
Ser Val Lys Asn145 150 155
160Ala Ala Pro Glu Met Tyr Lys Tyr Cys Val Phe Pro Ser Lys Gly Val
165 170 175Thr Val Asp Gly Asn
Thr Ile Thr Ile Pro Val Pro Lys Lys Thr Leu 180
185 190Gly Asp Asn Phe Gln Lys Gly Trp Gly Phe Gln Val
Phe Ile Met Gly 195 200 205Gln Glu
Gly Phe Pro Thr Gln Asp Pro Val Ser Cys Arg Ile Arg Glu 210
215 220Val Leu Ser Thr Ala Gln Gln Trp Arg Phe Ser
Gly Gly Asp Asp Phe225 230 235
240Tyr Gly Asp Pro Asn Ile Ile Asp Leu Leu Asp Tyr Glu Asp Ile Asn
245 250 255Gln Phe Glu Ile
Leu Ser Lys Tyr Lys Ser Asp Ala Lys Phe Glu Lys 260
265 270Asn Val Tyr Ala Gln Val Pro Phe Ile Tyr Val
Lys 275 2809541DNAArtificial SequenceSynthetic
Construct 95aggggtatct ctcgagaaaa gaacagaccc agagggtgac g
419636DNAArtificial SequenceSynthertic Construct 96ggtgctgatg
gaattctggc tcctctccac cagttc
3697957PRTBacillus denitrificansSIGNAL(1)..(29)Signal 97Met Ala Lys Lys
Leu Ile Tyr Val Cys Leu Ser Val Cys Leu Val -125
-120 -115Leu Thr Trp Ala Phe Asn Val Lys Gly Gln
Ser Ala His Ala Asp -110 -105
-100Gly Asn Thr Thr Thr Ile Ile Val His Tyr Phe Arg Pro Ala Gly Asp
-95 -90 -85Tyr Gln Pro Trp Ser
Leu Trp Met Trp Pro Lys Asp Gly Gly Gly Ala -80
-75 -70Glu Tyr Asp Phe Asn Gln Pro Ala Asp Ser Phe Gly
Ala Val Ala Ser -65 -60 -55Ala Asp
Ile Pro Gly Asn Pro Ser Gln Val Gly Ile Ile Val Arg Thr -50
-45 -40Gln Asp Trp Thr Lys Asp Val Ser Ala Asp Arg
Tyr Ile Asp Leu Ser-35 -30 -25
-20Lys Gly Asn Glu Val Trp Leu Val Glu Gly Asn Ser Gln Ile Phe Tyr
-15 -10 -5Asn Glu Lys Asp
Ala Glu Asp Ala Ala Lys Pro Ala Val Ser Asn Ala -1 1
5 10Tyr Leu Asp Ala Ser Asn Gln Val Leu Val Lys Leu
Ser Gln Pro Leu 15 20 25Thr Leu Gly
Glu Gly Ala Ser Gly Phe Thr Val His Asp Asp Thr Ala30 35
40 45Asn Lys Asp Ile Pro Val Thr Ser
Val Lys Asp Ala Ser Leu Gly Gln 50 55
60Asp Val Thr Ala Val Leu Ala Gly Thr Phe Gln His Ile Phe
Gly Gly 65 70 75Ser Asp Trp
Ala Pro Asp Asn His Ser Thr Leu Leu Lys Lys Val Thr 80
85 90Asn Asn Leu Tyr Gln Phe Ser Gly Asp Leu Pro
Glu Gly Asn Tyr Gln 95 100 105Tyr Lys
Val Ala Leu Asn Asp Ser Trp Asn Asn Pro Ser Tyr Pro Ser110
115 120 125Asp Asn Ile Asn Leu Thr Val
Pro Ala Gly Gly Ala His Val Thr Phe 130
135 140Ser Tyr Ile Pro Ser Thr His Ala Val Tyr Asp Thr
Ile Asn Asn Pro 145 150 155Asn
Ala Asp Leu Gln Val Glu Ser Gly Val Lys Thr Asp Leu Val Thr 160
165 170Val Thr Leu Gly Glu Asp Pro Asp Val
Ser His Thr Leu Ser Ile Gln 175 180
185Thr Asp Gly Tyr Gln Ala Lys Gln Val Ile Pro Arg Asn Val Leu Asn190
195 200 205Ser Ser Gln Tyr
Tyr Tyr Ser Gly Asp Asp Leu Gly Asn Thr Tyr Thr 210
215 220Gln Lys Ala Thr Thr Phe Lys Val Trp Ala
Pro Thr Ser Thr Gln Val 225 230
235Asn Val Leu Leu Tyr Asp Ser Ala Thr Gly Ser Val Thr Lys Ile Val
240 245 250Pro Met Thr Ala Ser Gly His
Gly Val Trp Glu Ala Thr Val Asn Gln 255 260
265Asn Leu Glu Asn Trp Tyr Tyr Met Tyr Glu Val Thr Gly Gln Gly
Ser270 275 280 285Thr Arg
Thr Ala Val Asp Pro Tyr Ala Thr Ala Ile Ala Pro Asn Gly
290 295 300Thr Arg Gly Met Ile Val Asp
Leu Ala Lys Thr Asp Pro Ala Gly Trp 305 310
315Asn Ser Asp Lys His Ile Thr Pro Lys Asn Ile Glu Asp Glu
Val Ile 320 325 330Tyr Glu Met Asp
Val Arg Asp Phe Ser Ile Asp Pro Asn Ser Gly Met 335
340 345Lys Asn Lys Gly Lys Tyr Leu Ala Leu Thr Glu Lys
Gly Thr Lys Gly350 355 360
365Pro Asp Asn Val Lys Thr Gly Ile Asp Ser Leu Lys Gln Leu Gly Ile
370 375 380Thr His Val Gln Leu
Met Pro Val Phe Ala Ser Asn Ser Val Asp Glu 385
390 395Thr Asp Pro Thr Gln Asp Asn Trp Gly Tyr Asp Pro
Arg Asn Tyr Asp 400 405 410Val Pro
Glu Gly Gln Tyr Ala Thr Asn Ala Asn Gly Asn Ala Arg Ile 415
420 425Lys Glu Phe Lys Glu Met Val Leu Ser Leu His
Arg Glu His Ile Gly430 435 440
445Val Asn Met Asp Val Val Tyr Asn His Thr Phe Ala Thr Gln Ile Ser
450 455 460Asp Phe Asp Lys
Ile Val Pro Glu Tyr Tyr Tyr Arg Thr Asp Asp Ala 465
470 475Gly Asn Tyr Thr Asn Gly Ser Gly Thr Gly Asn
Glu Ile Ala Ala Glu 480 485 490Arg
Pro Met Val Gln Lys Phe Ile Ile Asp Ser Leu Lys Tyr Trp Val 495
500 505Asn Glu Tyr His Ile Asp Gly Phe Arg Phe
Asp Leu Met Ala Leu Leu510 515 520
525Gly Lys Asp Thr Met Ser Lys Ala Ala Ser Glu Leu His Ala Ile
Asn 530 535 540Pro Gly Ile
Ala Leu Tyr Gly Glu Pro Trp Thr Gly Gly Thr Ser Ala 545
550 555Leu Pro Asp Asp Gln Leu Leu Thr Lys Gly
Ala Gln Lys Gly Met Gly 560 565
570Val Ala Val Phe Asn Asp Asn Leu Arg Asn Ala Leu Asp Gly Asn Val 575
580 585Phe Asp Ser Ser Ala Gln Gly Phe
Ala Thr Gly Ala Thr Gly Leu Thr590 595
600 605Asp Ala Ile Lys Asn Gly Val Glu Gly Ser Ile Asn
Asp Phe Thr Ser 610 615
620Ser Pro Gly Glu Thr Ile Asn Tyr Val Thr Ser His Asp Asn Tyr Thr
625 630 635Leu Trp Asp Lys Ile Ala
Leu Ser Asn Pro Asn Asp Ser Glu Ala Asp 640 645
650Arg Ile Lys Met Asp Glu Leu Ala Gln Ala Val Val Met Thr
Ser Gln 655 660 665Gly Val Pro Phe Met
Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly670 675
680 685Gly Asn Asp Asn Ser Tyr Asn Ala Gly Asp
Ala Val Asn Glu Phe Asp 690 695
700Trp Ser Arg Lys Ala Gln Tyr Pro Asp Val Phe Asn Tyr Tyr Ser Gly
705 710 715Leu Ile His Leu Arg
Leu Asp His Pro Ala Phe Arg Met Thr Thr Ala 720
725 730Asn Glu Ile Asn Ser His Leu Gln Phe Leu Asn Ser
Pro Glu Asn Thr 735 740 745Val Ala Tyr
Glu Leu Thr Asp His Val Asn Lys Asp Lys Trp Gly Asn750
755 760 765Ile Ile Val Val Tyr Asn Pro
Asn Lys Thr Val Ala Thr Ile Asn Leu 770
775 780Pro Ser Gly Lys Trp Ala Ile Asn Ala Thr Ser Gly
Lys Val Gly Glu 785 790 795Ser
Thr Leu Gly Gln Ala Glu Gly Ser Val Gln Val Pro Gly Ile Ser 800
805 810Met Met Ile Leu His Gln Glu Val Ser
Pro Asp His Gly Lys Lys 815 820
825983798DNAArtificial SequenceSynthetic DNA from Thermococcus
hydrothermalis for Pichia pastoris expression 98gct gag cca aag cct
ttg aac gtc atc atc gtt tgg cat cag cac caa 48Ala Glu Pro Lys Pro
Leu Asn Val Ile Ile Val Trp His Gln His Gln1 5
10 15cct tac tac tac gac cca gtt caa gac gtt tac
act aga cct tgg gtc 96Pro Tyr Tyr Tyr Asp Pro Val Gln Asp Val Tyr
Thr Arg Pro Trp Val 20 25
30aga ttg cat gct gcc aac aac tac tgg aag atg gct cac tac ttg tct
144Arg Leu His Ala Ala Asn Asn Tyr Trp Lys Met Ala His Tyr Leu Ser
35 40 45caa tac cct gag gtt cat gct acc
atc gac ttg tct ggt tct ttg atc 192Gln Tyr Pro Glu Val His Ala Thr
Ile Asp Leu Ser Gly Ser Leu Ile 50 55
60gct caa ttg gcc gac tac atg aac ggt aag aag gac act tac caa atc
240Ala Gln Leu Ala Asp Tyr Met Asn Gly Lys Lys Asp Thr Tyr Gln Ile65
70 75 80atc act gag aag atc
gcc aac ggt gag cct ttg act gtt gac gag aag 288Ile Thr Glu Lys Ile
Ala Asn Gly Glu Pro Leu Thr Val Asp Glu Lys 85
90 95tgg ttc atg ttg caa gcc cct gga ggt ttc ttc
gac aac act atc cca 336Trp Phe Met Leu Gln Ala Pro Gly Gly Phe Phe
Asp Asn Thr Ile Pro 100 105
110tgg aac ggt gag cct atc acc gac cca aac gga aac cct atc aga gac
384Trp Asn Gly Glu Pro Ile Thr Asp Pro Asn Gly Asn Pro Ile Arg Asp
115 120 125ttc tgg gac aga tac act gag
ttg aag aac aag atg ttg tct gcc aag 432Phe Trp Asp Arg Tyr Thr Glu
Leu Lys Asn Lys Met Leu Ser Ala Lys 130 135
140gcc aag tac gcc aac ttc gtc acc gag tct caa aag gtt gcc gtt acc
480Ala Lys Tyr Ala Asn Phe Val Thr Glu Ser Gln Lys Val Ala Val Thr145
150 155 160aac gag ttc acc
gag cag gac tac atc gac ttg gcc gtc ttg ttc aac 528Asn Glu Phe Thr
Glu Gln Asp Tyr Ile Asp Leu Ala Val Leu Phe Asn 165
170 175ttg gcc tgg atc gac tac aac tac atc acc
tct act cca gag ttc aag 576Leu Ala Trp Ile Asp Tyr Asn Tyr Ile Thr
Ser Thr Pro Glu Phe Lys 180 185
190gca ttg tac gac aag gtt gac gag ggt gga tac aca aga gcc gac gtt
624Ala Leu Tyr Asp Lys Val Asp Glu Gly Gly Tyr Thr Arg Ala Asp Val
195 200 205aag acc gtc ttg gac gcc caa
atc tgg ttg ttg aac cac acc ttc gag 672Lys Thr Val Leu Asp Ala Gln
Ile Trp Leu Leu Asn His Thr Phe Glu 210 215
220gag cat gag aag atc aac ttg ttg ttg ggt aac ggt aac gtt gag gtc
720Glu His Glu Lys Ile Asn Leu Leu Leu Gly Asn Gly Asn Val Glu Val225
230 235 240aca gtt gtt cct
tac gct cac cca atc gga cct atc ttg aac gac ttc 768Thr Val Val Pro
Tyr Ala His Pro Ile Gly Pro Ile Leu Asn Asp Phe 245
250 255ggt tgg gac tcc gac ttc aac gac cag gtc
aag aag gcc gac gag ttg 816Gly Trp Asp Ser Asp Phe Asn Asp Gln Val
Lys Lys Ala Asp Glu Leu 260 265
270tac aag cct tac ttg gga gga ggt aca gcc gtt cca aag gga gga tgg
864Tyr Lys Pro Tyr Leu Gly Gly Gly Thr Ala Val Pro Lys Gly Gly Trp
275 280 285gct gcc gag tct gct ttg aac
gac aag act ttg gag atc ttg gct gag 912Ala Ala Glu Ser Ala Leu Asn
Asp Lys Thr Leu Glu Ile Leu Ala Glu 290 295
300aac gga tgg gag tgg gtt atg acc gac cag atg gtt ttg ggt aag ttg
960Asn Gly Trp Glu Trp Val Met Thr Asp Gln Met Val Leu Gly Lys Leu305
310 315 320ggt atc gag gga
acc gtt gag aac tac cat aag cct tgg gtt gca gag 1008Gly Ile Glu Gly
Thr Val Glu Asn Tyr His Lys Pro Trp Val Ala Glu 325
330 335ttc aac ggt aag aag atc tac ttg ttc cca
aga aac cac gac ttg tca 1056Phe Asn Gly Lys Lys Ile Tyr Leu Phe Pro
Arg Asn His Asp Leu Ser 340 345
350gac aga gtt gga ttc act tac tct gga atg aac caa cag caa gct gtt
1104Asp Arg Val Gly Phe Thr Tyr Ser Gly Met Asn Gln Gln Gln Ala Val
355 360 365gag gac ttc gtc aac gag ttg
ttg aag ttg caa aag caa aac tac gac 1152Glu Asp Phe Val Asn Glu Leu
Leu Lys Leu Gln Lys Gln Asn Tyr Asp 370 375
380ggt tcc ttg gtt tac gtt gtt act ttg gac gga gag aac cca gtc gag
1200Gly Ser Leu Val Tyr Val Val Thr Leu Asp Gly Glu Asn Pro Val Glu385
390 395 400aac tac cct tac
gac ggt gag ttg ttc ttg act gag ttg tac aag aag 1248Asn Tyr Pro Tyr
Asp Gly Glu Leu Phe Leu Thr Glu Leu Tyr Lys Lys 405
410 415ttg aca gag ttg caa gag caa gga ttg atc
aga act ttg acc cct tca 1296Leu Thr Glu Leu Gln Glu Gln Gly Leu Ile
Arg Thr Leu Thr Pro Ser 420 425
430gag tac atc cag ttg tac ggt gac aag gcc aac aag ttg act cct aga
1344Glu Tyr Ile Gln Leu Tyr Gly Asp Lys Ala Asn Lys Leu Thr Pro Arg
435 440 445atg atg gag aga ttg gac ttg
aca ggt gac aac gtc aac gct ttg ttg 1392Met Met Glu Arg Leu Asp Leu
Thr Gly Asp Asn Val Asn Ala Leu Leu 450 455
460aag gcc cag tcc ttg ggt gag ttg tac gac atg acc gga gtc aag gag
1440Lys Ala Gln Ser Leu Gly Glu Leu Tyr Asp Met Thr Gly Val Lys Glu465
470 475 480gag atg caa tgg
cca gag agt agt tgg atc gac ggt act ttg agt act 1488Glu Met Gln Trp
Pro Glu Ser Ser Trp Ile Asp Gly Thr Leu Ser Thr 485
490 495tgg atc ggt gag cct cag gag aac tac ggt
tgg tac tgg ttg tac atg 1536Trp Ile Gly Glu Pro Gln Glu Asn Tyr Gly
Trp Tyr Trp Leu Tyr Met 500 505
510gcc aga aag gcc ttg atg gag aac aag gac aag atg tca caa gcc gac
1584Ala Arg Lys Ala Leu Met Glu Asn Lys Asp Lys Met Ser Gln Ala Asp
515 520 525tgg gag aag gcc tac gag tac
ttg ttg aga gcc gag gct tcc gac tgg 1632Trp Glu Lys Ala Tyr Glu Tyr
Leu Leu Arg Ala Glu Ala Ser Asp Trp 530 535
540ttc tgg tgg tac ggt tcc gac caa gac tct ggt cag gac tac act ttc
1680Phe Trp Trp Tyr Gly Ser Asp Gln Asp Ser Gly Gln Asp Tyr Thr Phe545
550 555 560gac aga tac ttg
aag aca tac ttg tac gag atg tac aag ttg gct gga 1728Asp Arg Tyr Leu
Lys Thr Tyr Leu Tyr Glu Met Tyr Lys Leu Ala Gly 565
570 575gtt gag cct cca tcc tac ttg ttc gga aac
tac ttc cca gac gga gag 1776Val Glu Pro Pro Ser Tyr Leu Phe Gly Asn
Tyr Phe Pro Asp Gly Glu 580 585
590cct tac aca act aga ggt ttg gtt ggt ttg aag gac gga gag atg aag
1824Pro Tyr Thr Thr Arg Gly Leu Val Gly Leu Lys Asp Gly Glu Met Lys
595 600 605aac ttc tcc agt atg tca cca
ttg gcc aag ggt gtc tct gtc tac ttc 1872Asn Phe Ser Ser Met Ser Pro
Leu Ala Lys Gly Val Ser Val Tyr Phe 610 615
620gac ggt gag ggt atc cat ttc atc gtt aag gga aac ttg gac aga ttc
1920Asp Gly Glu Gly Ile His Phe Ile Val Lys Gly Asn Leu Asp Arg Phe625
630 635 640gag gtc tca atc
tgg gag aag gac gag aga gtt ggt aac act ttc act 1968Glu Val Ser Ile
Trp Glu Lys Asp Glu Arg Val Gly Asn Thr Phe Thr 645
650 655aga ttg cag gag aag cca gac gag ttg tct
tac ttc atg ttc cct ttc 2016Arg Leu Gln Glu Lys Pro Asp Glu Leu Ser
Tyr Phe Met Phe Pro Phe 660 665
670tcc aga gac tct gtt ggt ttg ttg atc aca aag cat gtt gtt tac gag
2064Ser Arg Asp Ser Val Gly Leu Leu Ile Thr Lys His Val Val Tyr Glu
675 680 685aac ggt aag gcc gag atc tac
ggt gct acc gac tac gag aag tcc gag 2112Asn Gly Lys Ala Glu Ile Tyr
Gly Ala Thr Asp Tyr Glu Lys Ser Glu 690 695
700aag ttg gga gag gcc act gtc aag aac act agt gag gga atc gag gtc
2160Lys Leu Gly Glu Ala Thr Val Lys Asn Thr Ser Glu Gly Ile Glu Val705
710 715 720gtc ttg cct ttc
gac tac atc gag aac cca tcc gac ttc tac ttc gcc 2208Val Leu Pro Phe
Asp Tyr Ile Glu Asn Pro Ser Asp Phe Tyr Phe Ala 725
730 735gtt tcc acc gtc aag gac ggt gac ttg gag
gtt atc tcc aca cct gtt 2256Val Ser Thr Val Lys Asp Gly Asp Leu Glu
Val Ile Ser Thr Pro Val 740 745
750gag ttg aag ttg cct acc gag gtc aag ggt gtt gtt atc gcc gac atc
2304Glu Leu Lys Leu Pro Thr Glu Val Lys Gly Val Val Ile Ala Asp Ile
755 760 765aca gac cca gag ggt gac gac
cat ggt cca ggt aac tac aca tac cca 2352Thr Asp Pro Glu Gly Asp Asp
His Gly Pro Gly Asn Tyr Thr Tyr Pro 770 775
780acc gac aag gtt ttc aag cca gga gtt ttc gac ttg ttg aga ttc aga
2400Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg Phe Arg785
790 795 800atg ttg gag caa
act gag agt tac gtt atg gag ttc tac ttc aag gac 2448Met Leu Glu Gln
Thr Glu Ser Tyr Val Met Glu Phe Tyr Phe Lys Asp 805
810 815ttg gga ggt aac cct tgg aac ggt cca aac
gga ttc tcc ttg cag atc 2496Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn
Gly Phe Ser Leu Gln Ile 820 825
830atc gag gtt tac ttg gac ttc aag gac gga gga aac tcc tca gcc atc
2544Ile Glu Val Tyr Leu Asp Phe Lys Asp Gly Gly Asn Ser Ser Ala Ile
835 840 845aag atg ttc cca gac gga cct
gga gcc aac gtt aac ttg gac cca gag 2592Lys Met Phe Pro Asp Gly Pro
Gly Ala Asn Val Asn Leu Asp Pro Glu 850 855
860cac cca tgg gac gtt gcc ttc aga att gcc ggt tgg gac tac gga aac
2640His Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp Asp Tyr Gly Asn865
870 875 880ttg atc atc ttg
cca aac gga act gcc atc caa ggt gag atg caa atc 2688Leu Ile Ile Leu
Pro Asn Gly Thr Ala Ile Gln Gly Glu Met Gln Ile 885
890 895tct gcc gac cct gtc aag aac gct atc atc
gtt aag gtt cct aag aag 2736Ser Ala Asp Pro Val Lys Asn Ala Ile Ile
Val Lys Val Pro Lys Lys 900 905
910tac atc gcc atc aac gag gac tac ggt ttg tgg ggt gac gtc ttg gtt
2784Tyr Ile Ala Ile Asn Glu Asp Tyr Gly Leu Trp Gly Asp Val Leu Val
915 920 925gga tca cag gac ggt tac gga
cca gac aag tgg aga aca gct gcc gtc 2832Gly Ser Gln Asp Gly Tyr Gly
Pro Asp Lys Trp Arg Thr Ala Ala Val 930 935
940gac gcc gag caa tgg aag ttg gga gga gcc gac cca caa gct gtt atc
2880Asp Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile945
950 955 960aac gga gtt gct
cct aga gtt atc gac gag ttg gtt cca cag gga ttc 2928Asn Gly Val Ala
Pro Arg Val Ile Asp Glu Leu Val Pro Gln Gly Phe 965
970 975gag cca aca cag gag gag caa ttg tcc tcc
tac gac gcc aac gac atg 2976Glu Pro Thr Gln Glu Glu Gln Leu Ser Ser
Tyr Asp Ala Asn Asp Met 980 985
990aag ttg gct acc gtc aag gca ttg ttg ttg ttg aag caa ggt atc gtt
3024Lys Leu Ala Thr Val Lys Ala Leu Leu Leu Leu Lys Gln Gly Ile Val
995 1000 1005gtt aca gac cct gag ggt
gac gac cat gga cca gga aca tac aca 3069Val Thr Asp Pro Glu Gly
Asp Asp His Gly Pro Gly Thr Tyr Thr 1010 1015
1020tac cct acc gac aag gtt ttc aag cca ggt gtt ttc gac ttg
ttg 3114Tyr Pro Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu
Leu 1025 1030 1035aag ttc aag gtt aca
gag gga agt gac gac tgg act ttg gag ttc 3159Lys Phe Lys Val Thr
Glu Gly Ser Asp Asp Trp Thr Leu Glu Phe 1040 1045
1050cat ttc aag gac ttg gga ggt aac cct tgg aac ggt cca
aac ggt 3204His Phe Lys Asp Leu Gly Gly Asn Pro Trp Asn Gly Pro
Asn Gly 1055 1060 1065ttc tct ttg cag
atc atc gag gtt tac ttc gac ttc aag gag gga 3249Phe Ser Leu Gln
Ile Ile Glu Val Tyr Phe Asp Phe Lys Glu Gly 1070
1075 1080ggt aac gtc tcc gcc atc aag atg ttc cca gac
ggt cct gga tca 3294Gly Asn Val Ser Ala Ile Lys Met Phe Pro Asp
Gly Pro Gly Ser 1085 1090 1095aac gtt
aga ttg gac cca aat cac cca tgg gac ttg gcc ttg aga 3339Asn Val
Arg Leu Asp Pro Asn His Pro Trp Asp Leu Ala Leu Arg 1100
1105 1110att gcc ggt tgg gac tac ggt aac ttg atc
atc ttg cca gac ggt 3384Ile Ala Gly Trp Asp Tyr Gly Asn Leu Ile
Ile Leu Pro Asp Gly 1115 1120 1125acc
gcc tac cag ggt gag atg caa atc tct gcc gac cca gtt aag 3429Thr
Ala Tyr Gln Gly Glu Met Gln Ile Ser Ala Asp Pro Val Lys 1130
1135 1140aac gcc atc atc gtc aag gtt cct aag
aag tac ttg aac atc tca 3474Asn Ala Ile Ile Val Lys Val Pro Lys
Lys Tyr Leu Asn Ile Ser 1145 1150
1155gac tac gga ttg tac aca gcc gtc atc gtt gga tct cag gac ggt
3519Asp Tyr Gly Leu Tyr Thr Ala Val Ile Val Gly Ser Gln Asp Gly
1160 1165 1170tac ggt cca gac aag tgg
aga cct gtt gct gcc gag gct gag caa 3564Tyr Gly Pro Asp Lys Trp
Arg Pro Val Ala Ala Glu Ala Glu Gln 1175 1180
1185tgg aag ttg ggt ggt gcc gac cca caa gct gtt atc gac aac
ttg 3609Trp Lys Leu Gly Gly Ala Asp Pro Gln Ala Val Ile Asp Asn
Leu 1190 1195 1200gtt cca aga gtt gtt
gac gag ttg gtt cca gag gga ttc aag cca 3654Val Pro Arg Val Val
Asp Glu Leu Val Pro Glu Gly Phe Lys Pro 1205 1210
1215aca cag gag gag caa ttg tct tca tac gac ttg gag aag
aag act 3699Thr Gln Glu Glu Gln Leu Ser Ser Tyr Asp Leu Glu Lys
Lys Thr 1220 1225 1230ttg gcc act gtt
ttg atg gtt cca ttg gtt aac gga act ggt gga 3744Leu Ala Thr Val
Leu Met Val Pro Leu Val Asn Gly Thr Gly Gly 1235
1240 1245gag gag cca gaa ttc cat cag cac caa cat caa
cac caa cat cag 3789Glu Glu Pro Glu Phe His Gln His Gln His Gln
His Gln His Gln 1250 1255 1260cac cca
taa 3798His Pro
1265991265PRTArtificial SequenceSynthetic Construct 99Ala Glu Pro Lys
Pro Leu Asn Val Ile Ile Val Trp His Gln His Gln1 5
10 15Pro Tyr Tyr Tyr Asp Pro Val Gln Asp Val
Tyr Thr Arg Pro Trp Val 20 25
30Arg Leu His Ala Ala Asn Asn Tyr Trp Lys Met Ala His Tyr Leu Ser
35 40 45Gln Tyr Pro Glu Val His Ala Thr
Ile Asp Leu Ser Gly Ser Leu Ile 50 55
60Ala Gln Leu Ala Asp Tyr Met Asn Gly Lys Lys Asp Thr Tyr Gln Ile65
70 75 80Ile Thr Glu Lys Ile
Ala Asn Gly Glu Pro Leu Thr Val Asp Glu Lys 85
90 95Trp Phe Met Leu Gln Ala Pro Gly Gly Phe Phe
Asp Asn Thr Ile Pro 100 105
110Trp Asn Gly Glu Pro Ile Thr Asp Pro Asn Gly Asn Pro Ile Arg Asp
115 120 125Phe Trp Asp Arg Tyr Thr Glu
Leu Lys Asn Lys Met Leu Ser Ala Lys 130 135
140Ala Lys Tyr Ala Asn Phe Val Thr Glu Ser Gln Lys Val Ala Val
Thr145 150 155 160Asn Glu
Phe Thr Glu Gln Asp Tyr Ile Asp Leu Ala Val Leu Phe Asn
165 170 175Leu Ala Trp Ile Asp Tyr Asn
Tyr Ile Thr Ser Thr Pro Glu Phe Lys 180 185
190Ala Leu Tyr Asp Lys Val Asp Glu Gly Gly Tyr Thr Arg Ala
Asp Val 195 200 205Lys Thr Val Leu
Asp Ala Gln Ile Trp Leu Leu Asn His Thr Phe Glu 210
215 220Glu His Glu Lys Ile Asn Leu Leu Leu Gly Asn Gly
Asn Val Glu Val225 230 235
240Thr Val Val Pro Tyr Ala His Pro Ile Gly Pro Ile Leu Asn Asp Phe
245 250 255Gly Trp Asp Ser Asp
Phe Asn Asp Gln Val Lys Lys Ala Asp Glu Leu 260
265 270Tyr Lys Pro Tyr Leu Gly Gly Gly Thr Ala Val Pro
Lys Gly Gly Trp 275 280 285Ala Ala
Glu Ser Ala Leu Asn Asp Lys Thr Leu Glu Ile Leu Ala Glu 290
295 300Asn Gly Trp Glu Trp Val Met Thr Asp Gln Met
Val Leu Gly Lys Leu305 310 315
320Gly Ile Glu Gly Thr Val Glu Asn Tyr His Lys Pro Trp Val Ala Glu
325 330 335Phe Asn Gly Lys
Lys Ile Tyr Leu Phe Pro Arg Asn His Asp Leu Ser 340
345 350Asp Arg Val Gly Phe Thr Tyr Ser Gly Met Asn
Gln Gln Gln Ala Val 355 360 365Glu
Asp Phe Val Asn Glu Leu Leu Lys Leu Gln Lys Gln Asn Tyr Asp 370
375 380Gly Ser Leu Val Tyr Val Val Thr Leu Asp
Gly Glu Asn Pro Val Glu385 390 395
400Asn Tyr Pro Tyr Asp Gly Glu Leu Phe Leu Thr Glu Leu Tyr Lys
Lys 405 410 415Leu Thr Glu
Leu Gln Glu Gln Gly Leu Ile Arg Thr Leu Thr Pro Ser 420
425 430Glu Tyr Ile Gln Leu Tyr Gly Asp Lys Ala
Asn Lys Leu Thr Pro Arg 435 440
445Met Met Glu Arg Leu Asp Leu Thr Gly Asp Asn Val Asn Ala Leu Leu 450
455 460Lys Ala Gln Ser Leu Gly Glu Leu
Tyr Asp Met Thr Gly Val Lys Glu465 470
475 480Glu Met Gln Trp Pro Glu Ser Ser Trp Ile Asp Gly
Thr Leu Ser Thr 485 490
495Trp Ile Gly Glu Pro Gln Glu Asn Tyr Gly Trp Tyr Trp Leu Tyr Met
500 505 510Ala Arg Lys Ala Leu Met
Glu Asn Lys Asp Lys Met Ser Gln Ala Asp 515 520
525Trp Glu Lys Ala Tyr Glu Tyr Leu Leu Arg Ala Glu Ala Ser
Asp Trp 530 535 540Phe Trp Trp Tyr Gly
Ser Asp Gln Asp Ser Gly Gln Asp Tyr Thr Phe545 550
555 560Asp Arg Tyr Leu Lys Thr Tyr Leu Tyr Glu
Met Tyr Lys Leu Ala Gly 565 570
575Val Glu Pro Pro Ser Tyr Leu Phe Gly Asn Tyr Phe Pro Asp Gly Glu
580 585 590Pro Tyr Thr Thr Arg
Gly Leu Val Gly Leu Lys Asp Gly Glu Met Lys 595
600 605Asn Phe Ser Ser Met Ser Pro Leu Ala Lys Gly Val
Ser Val Tyr Phe 610 615 620Asp Gly Glu
Gly Ile His Phe Ile Val Lys Gly Asn Leu Asp Arg Phe625
630 635 640Glu Val Ser Ile Trp Glu Lys
Asp Glu Arg Val Gly Asn Thr Phe Thr 645
650 655Arg Leu Gln Glu Lys Pro Asp Glu Leu Ser Tyr Phe
Met Phe Pro Phe 660 665 670Ser
Arg Asp Ser Val Gly Leu Leu Ile Thr Lys His Val Val Tyr Glu 675
680 685Asn Gly Lys Ala Glu Ile Tyr Gly Ala
Thr Asp Tyr Glu Lys Ser Glu 690 695
700Lys Leu Gly Glu Ala Thr Val Lys Asn Thr Ser Glu Gly Ile Glu Val705
710 715 720Val Leu Pro Phe
Asp Tyr Ile Glu Asn Pro Ser Asp Phe Tyr Phe Ala 725
730 735Val Ser Thr Val Lys Asp Gly Asp Leu Glu
Val Ile Ser Thr Pro Val 740 745
750Glu Leu Lys Leu Pro Thr Glu Val Lys Gly Val Val Ile Ala Asp Ile
755 760 765Thr Asp Pro Glu Gly Asp Asp
His Gly Pro Gly Asn Tyr Thr Tyr Pro 770 775
780Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp Leu Leu Arg Phe
Arg785 790 795 800Met Leu
Glu Gln Thr Glu Ser Tyr Val Met Glu Phe Tyr Phe Lys Asp
805 810 815Leu Gly Gly Asn Pro Trp Asn
Gly Pro Asn Gly Phe Ser Leu Gln Ile 820 825
830Ile Glu Val Tyr Leu Asp Phe Lys Asp Gly Gly Asn Ser Ser
Ala Ile 835 840 845Lys Met Phe Pro
Asp Gly Pro Gly Ala Asn Val Asn Leu Asp Pro Glu 850
855 860His Pro Trp Asp Val Ala Phe Arg Ile Ala Gly Trp
Asp Tyr Gly Asn865 870 875
880Leu Ile Ile Leu Pro Asn Gly Thr Ala Ile Gln Gly Glu Met Gln Ile
885 890 895Ser Ala Asp Pro Val
Lys Asn Ala Ile Ile Val Lys Val Pro Lys Lys 900
905 910Tyr Ile Ala Ile Asn Glu Asp Tyr Gly Leu Trp Gly
Asp Val Leu Val 915 920 925Gly Ser
Gln Asp Gly Tyr Gly Pro Asp Lys Trp Arg Thr Ala Ala Val 930
935 940Asp Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp
Pro Gln Ala Val Ile945 950 955
960Asn Gly Val Ala Pro Arg Val Ile Asp Glu Leu Val Pro Gln Gly Phe
965 970 975Glu Pro Thr Gln
Glu Glu Gln Leu Ser Ser Tyr Asp Ala Asn Asp Met 980
985 990Lys Leu Ala Thr Val Lys Ala Leu Leu Leu Leu
Lys Gln Gly Ile Val 995 1000
1005Val Thr Asp Pro Glu Gly Asp Asp His Gly Pro Gly Thr Tyr Thr
1010 1015 1020Tyr Pro Thr Asp Lys Val
Phe Lys Pro Gly Val Phe Asp Leu Leu 1025 1030
1035Lys Phe Lys Val Thr Glu Gly Ser Asp Asp Trp Thr Leu Glu
Phe 1040 1045 1050His Phe Lys Asp Leu
Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly 1055 1060
1065Phe Ser Leu Gln Ile Ile Glu Val Tyr Phe Asp Phe Lys
Glu Gly 1070 1075 1080Gly Asn Val Ser
Ala Ile Lys Met Phe Pro Asp Gly Pro Gly Ser 1085
1090 1095Asn Val Arg Leu Asp Pro Asn His Pro Trp Asp
Leu Ala Leu Arg 1100 1105 1110Ile Ala
Gly Trp Asp Tyr Gly Asn Leu Ile Ile Leu Pro Asp Gly 1115
1120 1125Thr Ala Tyr Gln Gly Glu Met Gln Ile Ser
Ala Asp Pro Val Lys 1130 1135 1140Asn
Ala Ile Ile Val Lys Val Pro Lys Lys Tyr Leu Asn Ile Ser 1145
1150 1155Asp Tyr Gly Leu Tyr Thr Ala Val Ile
Val Gly Ser Gln Asp Gly 1160 1165
1170Tyr Gly Pro Asp Lys Trp Arg Pro Val Ala Ala Glu Ala Glu Gln
1175 1180 1185Trp Lys Leu Gly Gly Ala
Asp Pro Gln Ala Val Ile Asp Asn Leu 1190 1195
1200Val Pro Arg Val Val Asp Glu Leu Val Pro Glu Gly Phe Lys
Pro 1205 1210 1215Thr Gln Glu Glu Gln
Leu Ser Ser Tyr Asp Leu Glu Lys Lys Thr 1220 1225
1230Leu Ala Thr Val Leu Met Val Pro Leu Val Asn Gly Thr
Gly Gly 1235 1240 1245Glu Glu Pro Glu
Phe His Gln His Gln His Gln His Gln His Gln 1250
1255 1260His Pro 12651001026DNAThermococcus
hydrothermalisCDS(1)..(1026)misc_signal(1)..(243)misc_feature(256)..(981)-
X46 Domain 100atg aga ttt cct tca att ttt act gca gtt tta ttc gca gca tcc
tcc 48Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser
Ser1 5 10 15gca tta gct
gct cca gtc aac act aca aca gaa gat gaa acg gca caa 96Ala Leu Ala
Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20
25 30att ccg gct gaa gct gtc atc ggt tac tca
gat tta gaa ggg gat ttc 144Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser
Asp Leu Glu Gly Asp Phe 35 40
45gat gtt gct gtt ttg cca ttt tcc aac agc aca aat aac ggg tta ttg
192Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50
55 60ttt ata aat act act att gcc agc att
gct gct aaa gaa gaa ggg gta 240Phe Ile Asn Thr Thr Ile Ala Ser Ile
Ala Ala Lys Glu Glu Gly Val65 70 75
80tct ctc gag aaa aga aca gac cct gag ggt gac gac cat gga
cca gga 288Ser Leu Glu Lys Arg Thr Asp Pro Glu Gly Asp Asp His Gly
Pro Gly 85 90 95aca tac
aca tac cct acc gac aag gtt ttc aag cca ggt gtt ttc gac 336Thr Tyr
Thr Tyr Pro Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp 100
105 110ttg ttg aag ttc aag gtt aca gag gga
agt gac gac tgg act ttg gag 384Leu Leu Lys Phe Lys Val Thr Glu Gly
Ser Asp Asp Trp Thr Leu Glu 115 120
125ttc cat ttc aag gac ttg gga ggt aac cct tgg aac ggt cca aac ggt
432Phe His Phe Lys Asp Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly 130
135 140ttc tct ttg cag atc atc gag gtt
tac ttc gac ttc aag gag gga ggt 480Phe Ser Leu Gln Ile Ile Glu Val
Tyr Phe Asp Phe Lys Glu Gly Gly145 150
155 160aac gtc tcc gcc atc aag atg ttc cca gac ggt cct
gga tca aac gtt 528Asn Val Ser Ala Ile Lys Met Phe Pro Asp Gly Pro
Gly Ser Asn Val 165 170
175aga ttg gac cca aat cac cca tgg gac ttg gcc ttg aga att gcc ggt
576Arg Leu Asp Pro Asn His Pro Trp Asp Leu Ala Leu Arg Ile Ala Gly
180 185 190tgg gac tac ggt aac ttg
atc atc ttg cca gac ggt acc gcc tac cag 624Trp Asp Tyr Gly Asn Leu
Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln 195 200
205ggt gag atg caa atc tct gcc gac cca gtt aag aac gcc atc
atc gtc 672Gly Glu Met Gln Ile Ser Ala Asp Pro Val Lys Asn Ala Ile
Ile Val 210 215 220aag gtt cct aag aag
tac ttg aac atc tca gac tac gga ttg tac aca 720Lys Val Pro Lys Lys
Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr225 230
235 240gcc gtc atc gtt gga tct cag gac ggt tac
ggt cca gac aag tgg aga 768Ala Val Ile Val Gly Ser Gln Asp Gly Tyr
Gly Pro Asp Lys Trp Arg 245 250
255cct gtt gct gcc gag gct gag caa tgg aag ttg ggt ggt gcc gac cca
816Pro Val Ala Ala Glu Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro
260 265 270caa gct gtt atc gac aac
ttg gtt cca aga gtt gtt gac gag ttg gtt 864Gln Ala Val Ile Asp Asn
Leu Val Pro Arg Val Val Asp Glu Leu Val 275 280
285cca gag gga ttc aag cca aca cag gag gag caa ttg tct tca
tac gac 912Pro Glu Gly Phe Lys Pro Thr Gln Glu Glu Gln Leu Ser Ser
Tyr Asp 290 295 300ttg gag aag aag act
ttg gcc act gtt ttg atg gtt cca ttg gtt aac 960Leu Glu Lys Lys Thr
Leu Ala Thr Val Leu Met Val Pro Leu Val Asn305 310
315 320gga act ggt gga gag gag cca gaa ttc cat
cag cac caa cat caa cac 1008Gly Thr Gly Gly Glu Glu Pro Glu Phe His
Gln His Gln His Gln His 325 330
335caa cat cag cac cca taa
1026Gln His Gln His Pro 340101341PRTThermococcus
hydrothermalis 101Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala
Ser Ser1 5 10 15Ala Leu
Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20
25 30Ile Pro Ala Glu Ala Val Ile Gly Tyr
Ser Asp Leu Glu Gly Asp Phe 35 40
45Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50
55 60Phe Ile Asn Thr Thr Ile Ala Ser Ile
Ala Ala Lys Glu Glu Gly Val65 70 75
80Ser Leu Glu Lys Arg Thr Asp Pro Glu Gly Asp Asp His Gly
Pro Gly 85 90 95Thr Tyr
Thr Tyr Pro Thr Asp Lys Val Phe Lys Pro Gly Val Phe Asp 100
105 110Leu Leu Lys Phe Lys Val Thr Glu Gly
Ser Asp Asp Trp Thr Leu Glu 115 120
125Phe His Phe Lys Asp Leu Gly Gly Asn Pro Trp Asn Gly Pro Asn Gly
130 135 140Phe Ser Leu Gln Ile Ile Glu
Val Tyr Phe Asp Phe Lys Glu Gly Gly145 150
155 160Asn Val Ser Ala Ile Lys Met Phe Pro Asp Gly Pro
Gly Ser Asn Val 165 170
175Arg Leu Asp Pro Asn His Pro Trp Asp Leu Ala Leu Arg Ile Ala Gly
180 185 190Trp Asp Tyr Gly Asn Leu
Ile Ile Leu Pro Asp Gly Thr Ala Tyr Gln 195 200
205Gly Glu Met Gln Ile Ser Ala Asp Pro Val Lys Asn Ala Ile
Ile Val 210 215 220Lys Val Pro Lys Lys
Tyr Leu Asn Ile Ser Asp Tyr Gly Leu Tyr Thr225 230
235 240Ala Val Ile Val Gly Ser Gln Asp Gly Tyr
Gly Pro Asp Lys Trp Arg 245 250
255Pro Val Ala Ala Glu Ala Glu Gln Trp Lys Leu Gly Gly Ala Asp Pro
260 265 270Gln Ala Val Ile Asp
Asn Leu Val Pro Arg Val Val Asp Glu Leu Val 275
280 285Pro Glu Gly Phe Lys Pro Thr Gln Glu Glu Gln Leu
Ser Ser Tyr Asp 290 295 300Leu Glu Lys
Lys Thr Leu Ala Thr Val Leu Met Val Pro Leu Val Asn305
310 315 320Gly Thr Gly Gly Glu Glu Pro
Glu Phe His Gln His Gln His Gln His 325
330 335Gln His Gln His Pro 340
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20140135104 | METHOD FOR IMPLEMENTING A COMPUTER GAME |
20140135103 | SKILL CALIBRATED HYBRID GAME |
20140135102 | METHOD FOR IMPLEMENTING A COMPUTER GAME |
20140135101 | THREE-DICE GAMING METHOD AND SYSTEM FOR TWO PERSON COMPETITION |
20140135100 | ELECTRONIC GAMING DEVICE WITH SCRAPE AWAY FEATURE |