Patent application title: METHODS AND COMPOSITIONS FOR TREATING CONDITIONS USING RECOMBINANT SELF-COMPLEMENTARY ADENO-ASSOCIATED VIRUS
Inventors:
IPC8 Class: AA61K3820FI
USPC Class:
Class name:
Publication date: 2022-06-09
Patent application number: 20220175887
Abstract:
Methods and compositions for treating symptoms of conditions such as but
not limited to osteoarthritis and rheumatoid arthritis. The methods may
feature direct intraarticular injection of a recombinant
self-complementary adeno-associated virus (sc-rAAV) with a vector adapted
to express a modified IL-1Ra peptide. The methods of the present
invention may express a therapeutically effective amount of the modified
IL-1Ra peptide so as to ameliorating symptoms associated with the
condition being treated.Claims:
1-67. (canceled)
68. A method comprising administering to a human subject into a location of interest a composition comprising a recombinant adeno-associated virus (rAAV) comprising a capsid and a nucleic acid vector comprising a modified IL-1Ra gene comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2.
69. The method of claim 68, wherein the nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2 is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.
70. The method of claim 68, wherein the rAAV is self-complementary rAAV.
71. The method of claim 68, wherein the nucleic acid vector further comprises an SV40 and bovine growth hormone (bGH) polyadenylation sequence; and/or SV40 splice donor (SD) and splice acceptor (SA) sites.
72. The method of claim 68, wherein the nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2 is operably linked to a promoter.
73. The method of claim 68, wherein the capsid comprises at least a portion of AAV1, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or combinations thereof.
74. The method of claim 68, wherein the location of interest is a joint, synovium, subsynovium, joint capsule, tendon, ligament, cartilage, or peri-articular muscle of the human subject.
75. The method of claim 68, wherein the composition is administered via direct intraarticular injection.
76. The method of claim 68, wherein the human subject is diagnosed with or is at risk for developing osteoarthritis or rheumatoid arthritis.
77. (canceled)
78. A method of delivering an IL-1Ra peptide to a chondrocyte or synoviocyte, comprising contacting the chondrocyte or synoviocyte with a composition comprising a recombinant adeno-associated virus (rAAV) comprising a capsid and a nucleic acid vector comprising a modified IL-1Ra gene comprising a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2.
79. The method of claim 78, wherein the nucleic acid sequence encodes a biologically active interleukin-1 receptor agonist (IL-1Ra) protein.
80. The method of claim 78, wherein the sequence that is at least 90% identical to SEQ ID NO: 2 is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.
81. The method of claim 78, wherein the rAAV is self-complementary rAAV.
82-85. (canceled)
86. The method of claim 68, wherein the method is a method of repairing cartilage or reducing inflammation, comprising administering the composition comprising the rAAV into a location of cartilage.
87. The method of claim 86, wherein the human subject has been diagnosed with or is at risk for developing osteoarthritis or rheumatoid arthritis.
88. The method of claim 86, wherein the capsid comprises at least a portion of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or combinations thereof.
89. The method of claim 68, further comprising co-administering a secondary therapy to the location of interest.
90. The method of claim 68, wherein the method is a method of ameliorating symptoms of osteoarthritis or rheumatoid arthritis in a human; wherein the rAAV transduces the vector into cells in the location of interest, and wherein the modified IL-1Ra gene is expressed so as to provide the human with an amount of IL-1 Ra peptide effective for ameliorating symptoms associated with osteoarthritis or rheumatoid arthritis.
91. The method of claim 86, wherein the rAAV is a recombinant self-complementary adeno-associated virus (sc-rAAV), wherein said sc-rAAV comprises: a. an engineered AAV capsid; and b. a vector packaged within the capsid, said vector comprising a modified IL-1 Ra gene operably linked to a promoter, and wherein the modified IL-1Ra gene is at least 95% identical SEQ ID NO 2.
92. A method of providing interleukin-1 receptor agonist (IL-1Ra) peptide to an area of inflammation in a subject, said method comprising: introducing into a location of inflammation a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV), wherein said sc-rAAV comprises: a. an engineered AAV capsid; and b. a vector packaged within the capsid, said vector comprising a modified IL-1 Ra gene operably linked to a promoter, the modified IL-1 Ra gene is at least 95% identical to SEQ ID NO: 2 or the IL-1Ra gene encodes an IL-1Ra protein as set forth in SEQ ID NO: 6; wherein the sc-rAAV transduces the vector into cells in the location of inflammation, wherein the modified IL-1 Ra gene is expressed so as to provide the cells in the location of inflammation a therapeutically effective amount of IL-1 Ra peptide effective for reducing inflammation.
93-96. (canceled)
Description:
CROSS REFERENCE
[0001] This application claims priority to U.S. Provisional Patent Application No. 62/377,297 filed Aug. 19, 2016, the specification(s) of which is/are incorporated herein in their entirety by reference.
REFERENCE TO SEQUENCE LISTING
[0002] Applicant asserts that the information recorded in the form of an Annex C/ST.25 text file submitted under Rule 13ter.1(a), entitled CALIM_16_02_PCT_Sequence_Listing_ST25.txt, is identical to that forming part of the international application as filed. The content of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to gene therapy and compositions for gene therapy, more particularly to recombinant self-complementary adeno-associated virus (sc-rAAV) and methods of treating conditions or symptoms of conditions using sc-rAAV.
BACKGROUND OF THE INVENTION
[0004] Osteoarthritis (OA) affects over 27 million Americans and is the leading cause of disability among the elderly. Patients with OA are also at higher risk of death. The cost of OA to our health care system is estimated to be over $100 billion per annum. Such statistics reflect the fact that OA is both incurable and remarkably resistant to treatment.
[0005] The earliest and predominant symptom of OA is pain. This normally arises late in the disease process, by which time there is often considerable structural alteration in the affected joint, including loss of articular cartilage, sclerosis of the sub-chondral bone, the formation of osteophytes, and synovial inflammation. In knee joints, there is also meniscal damage. In the absence of disease-modifying osteoarthritis drugs (DMOADs) that halt or reverse disease progression, present treatments are palliative. Because there currently is no effective way to intervene in the disease process, many patients progress to the point of needing total joint replacement surgery. While a successful procedure, this involves major, expensive surgery with extensive rehabilitation. In many cases, there is a need for revision surgery to replace a prosthetic joint that has become dysfunctional.
[0006] In the absence of DMOADs, the present standard of care is palliative. As reflected in the most recent guidelines for treating OA of the knee (the target joint of this IND) issued by the American College of Rheumatology (ACR) in 2012 and the American Academy of Orthopaedic Surgeons (AAOS) in 2013, present approaches to treatment fall into three progressive categories. Non-pharmacological therapy includes a range of strategies such as patient education and self-help, exercise programs and weight loss. Pharmacological therapy includes the use of acetaminophen, non-steroidal anti-inflammatory drugs (NSAIDs), opiates and the intra-articular injection of glucocorticoids or hyaluronic acid. NSAIDs bring partial relief to many patients, but are associated with upper GI bleeding and kidney failure, of especial concern in the present context as many individuals with OA are elderly. The intraarticular injection of glucocorticoids brings rapid relief in many cases, but the effects usually persist for only a few weeks. Repeated injection of glucocorticoids is impractical and counter-indicated because of concerns about infection and evidence that sustained, high doses of glucocorticoids damage articular cartilage. The benefits of the intraarticular injection of hyaluronic acid (viscosupplementation) are disputed; the ACR makes no recommendation on this score, while the AAOS no longer recommends it. The intra-articular injection of mesenchymal stem cells (MSCs) and autologous blood products, such as platelet-rich plasma, is increasingly popular but not approved by the FDA for OA. The latest recommendations from the Osteoarthritis Research Society International and European League Against Rheumatism for treatment of OA of the knee do not differ greatly from those of the ACR and AAOS. The recommendations of the various bodies highlight the paucity of treatment options for OA and the complete lack of reliably effective pharmacologic interventions. Even when there is some response to therapy, it addresses only the signs and symptoms, not disease progression. When treatment fails to control the symptoms and progression of OA, surgical intervention may be indicated.
[0007] Arthroscopic lavage and debridement has been widely used to provide symptomatic relief, but its use has declined following evidence that its effects are no greater than placebo. An osteotomy is sometimes performed to realign the forces in the knee joint, so that load is now born by areas of intact cartilage. This measure can provide relief for several years until the newly weight-bearing articular cartilage erodes and symptoms reappear. In general, osteotomy is viewed as a delaying tactic that buys time until the surgical implantation of a prosthetic knee joint. Many patients progress to the point of needing total joint replacement, and over 700,000 artificial knees were surgically implanted last in year in the US.
[0008] IL-1 is a powerful mediator of both chondrocytic chondrolysis and suppression of matrix synthesis by chondrocytes. Together, these two processes are highly destructive to cartilage. IL-1 has also been shown to inhibit chondrogenesis but at the same time promote certain aspects of the osteogenic differentiation that could help account for the formation of osteophytes and sclerosis of sub-chondral bone. Paradoxically, IL-1 also promotes osteoclastic activity. By stimulating both osteogenesis and osteolysis, IL-1 would enhance bone turnover, as seen in the sub- chondral bone during OA. Finally, IL-1 is well positioned to provoke the inflammatory changes seen in OA. Its pyrogenic activities are known and the expression of vanishingly small amounts of IL-1 in the knee joints of rabbits is sufficient to elicit a pronounced synovitis.
[0009] In studying cartilage recovered from human joints with OA, the production of IL-1 by chondrocytes was found to be highly elevated and sustained in an autocrine fashion. Moreover, the cells did not produce IL-1Ra. This suggests enhanced autocrine and paracrine activation of chondrocytes by IL-1 in the absence of its major physiological inhibitor during OA. Enhanced responsiveness of chondrocytes to IL-1 in OA was also indicated by increased expression of the type I IL-1 receptor, the signaling receptor, on OA chondrocytes. The local production and consumption of IL-1 by chondrocytes may help explain why concentrations of IL-1 in synovial fluid tend to be low, even in OA. Also, genetic analyses have identified single nucleotide polymorphisms (SNPs) in the human gene encoding IL-1Ra (IL1 RN) and regulatory elements that correlate with the incidence and severity of certain types of OA.
[0010] Targeted drug delivery is a major problem for the intra-articular treatment of joint diseases. Molecules of all sizes, as well as particles, are rapidly removed from joints via the lymphatics, subsynovial capillaries, or both. This makes it difficult to achieve sustained, therapeutic doses of anti-OA drugs in joints. To address this, small molecules can be delivered systemically, but proteins are difficult to deliver in this fashion because of size-dependent constraints in crossing the fenestrated endothelium of the synovial capillaries. Moreover, systemic delivery exposes non- target sites to high doses of the therapeutic, leading to unwanted side-effects. The rapid egress of proteins from joints, with half-lives typically of a few hours, makes intra-articular delivery potentially ineffective. As an example, recombinant IL-1Ra (Kineret, Amgen Biologicals) is delivered by daily subcutaneous injection in effort to treat symptoms of RA. However, daily delivery fails to maintain therapeutic serum levels of IL-1Ra between injections (Evans et al., 1996, Human Gene Therapy, 7:1261-1290; Evans et al., 2005, PNAS 102 (24): 8698-8703). Some studies have used ex vivo gene transfer for introducing IL-1Ra to treat OA. However, these approaches are laborious and have not seemed to provide long-term gene expression (Frisbie et al., 2002, Gene Therapy 9(1): 12-20). Also, several studies describe the use of a dual variable domain-immunoglobulin (DVD-Ig) targeting IL-1alpha and IL-1beta (e.g., ABT-981) for treating osteoarthritis (Kamath et al., 2011, Osteoarthritis and Cartilage 19S1:S64; Wang et al., 2015, Osteoarthritis and Cartilage 23:A398-399; Wang et al., 2014, Osteoarthritis and cartilage 22:S462-S463; Lacy et al., 2015, mAbs 7(3):605-619; Wu et al., 2009, mAbs 1(4):339-347; Wang et al., 2014, Scientific Abstracts SAT0448 pg. 756; Goss et al., 2014, Scientific Abstracts SAT0447 pg. 755-756; US 2015/0050238; Wang et al., 2014 ACR/ARHP Annual Meeting Abstract Number 2237; Wang et al., 2015 ACR/ARHP Annual Meeting Abstract Number 318). However, these peptides require repeated systemic introduction (e.g., 4 doses every 2 weeks or 3 doses every 4 weeks, e.g., by subcutaneous injection or intravenous infusion) because of the relatively short half-life (Wang et al., 2015, Osteoarthritis and Cartilage 23:A398-399; Wang et al., 2014, Osteoarthritis and cartilage 22:S462-S463; Evans et al., 2005, PNAS 102 (24): 8698-8703).
[0011] The present invention features methods and compositions for delivering a therapeutic gene product (e.g., IL-1Ra) in a sustained manner to a location of interest, e.g., joints. The present invention also features methods and compositions for treating symptoms of conditions such as but not limited to osteoarthritis and rheumatoid arthritis. The present invention also features methods and compositions for providing an individual (e.g., a human) a therapeutically effective amount of a therapeutic gene product (e.g., IL-1Ra). The methods and compositions may feature a recombinant self-complementary adeno-associated virus (sc-rAAV), wherein the sc-rAAV comprises an engineered capsid and a vector (e.g., a sc-rAAV vector) packaged within the capsid. The vector may comprise a transgene (e.g., a nucleotide sequence encoding a protein of interest, e.g., a therapeutic gene product, e.g., IL-1Ra or a codon modified version thereof) operably linked to a promoter (e.g., a constitutive promoter). The therapeutic gene product may be delivered to a location of interest, e.g., a joint. For example, for treating osteoarthritis, the sc-rAAV may be introduced into cells (e.g., chondrocytes, synoviocytes, etc.) in a joint via direct intraarticular injection. The present invention is not limited to the aforementioned conditions, nor the location of interest (e.g., joint).
[0012] It is noted that Goodrich et al. (Molecular Therapy-Nucleic Acids, 2013, 2:e70) generally discloses a method of treating osteoarthritis using scAAV-delivered IL-1Ra. However, Goodrich et al. does not specifically identify or enable any particular IL-1Ra sequence, e.g., an IL-1Ra sequence according to the present invention. In particular, the field of gene therapy is an unpredictable area wherein one cannot assume that any particular gene sequence for a protein of interest will be efficiently expressed. Moreover, gene therapy is also unpredictable with respect to effectiveness in animal model compared to humans, e.g., one cannot assume that if a particular method is effective in an animal model that it will be effective in humans.
SUMMARY OF THE INVENTION
[0013] The present invention features a recombinant self-complementary adeno-associated virus (sc-rAAV). In some embodiments, the sc-rAAV comprises an engineered AAV capsid and a vector packaged within the capsid, wherein the vector comprises a modified IL-1Ra gene operably linked to a promoter and the modified IL-1Ra gene is at least 95% identical to SEQ ID NO: 2. In some embodiments, the promoter comprises a CMV promoter. In some embodiments, the engineered capsid comprises at least a portion of serotype AAV2 and at least a portion of serotype AAV6. In some embodiments, the engineered capsid comprises at least a portion of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or a combination thereof. In some embodiments, the vector further comprises SV40 and bovine growth hormone (bGH) polyadenylation sequences. In some embodiments, the vector further comprises SV40 splice donor (SD) and splice acceptor (SA) sites. In some embodiments, the vector comprises sc-rAAV2.5Hu-IL-1Ra. In some embodiments, the sc-rAAV is part of a composition.
[0014] In some embodiments, the sc-rAAV comprises an engineered AAV capsid and a vector packaged within the capsid, wherein the vector comprises a modified IL-1Ra gene operably linked to a promoter and the modified IL-1Ra gene encodes IL-1Ra protein according to SEQ ID NO: 6.
[0015] The present invention features a method of providing a human in need thereof (e.g., a human diagnosed with or at risk for osteoarthritis or rheumatoid arthritis) a therapeutically effective amount of interleukin-1 receptor agonist (IL-1Ra) peptide. In some embodiments, the method comprises introducing into a location of interest (e.g., via intraarticular injection) a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV) according to the present invention. The sc-rAAV transduces the vector into cells in the location of interest, wherein the modified IL-1Ra gene is expressed so as to provide the human with the therapeutically effective amount of said IL-1Ra peptide.
[0016] The present invention also features a method of ameliorating symptoms of osteoarthritis or rheumatoid arthritis in a human. In some embodiments, the method comprises introducing into a location of interest (e.g., via direct intraarticular injection) a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV) according to the present invention. The sc-rAAV transduces the vector into cells in the location of interest, wherein the modified IL-1Ra gene is expressed so as to provide the human with an amount of IL-1Ra peptide effective for ameliorating symptoms associated with osteoarthritis or rheumatoid arthritis.
[0017] The present invention also features a method of repairing cartilage in a human in need thereof (e.g., a human diagnosed with or at risk for developing osteoarthritis or rheumatoid arthritis). In some embodiments, the method comprises introducing into a location of cartilage (e.g., via direct intraarticular injection) a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV) according to the present invention. The sc-rAAV transduces the vector into cells in the location of cartilage, wherein the modified IL-1Ra gene is expressed so as to provide the human with IL-1Ra peptide effective for repairing cartilage.
[0018] The present invention also features a method of providing interleukin-1 receptor agonist (IL-1Ra) peptide to an area of inflammation. In some embodiments, the method comprises introducing into a location of inflammation (e.g., via intraarticular injection) a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV) according to the present invention. The sc-rAAV transduces the vector into cells in the location of inflammation, wherein the modified IL-1Ra gene is expressed so as to provide the cells in the location of inflammation a therapeutically effective amount of IL-1Ra peptide effective for reducing inflammation.
[0019] In some embodiments, the location of interest is a joint, synovium, subsynovium, joint capsule, tendon, ligament, cartilage, or peri-articular muscle of the human. In some embodiments, the cells are chondrocytes, synoviocytes, or a combination thereof.
[0020] In some embodiments, the method is performed a second time at a time point after a time when the method is performed first. In some embodiments, the time point is at least 3 months. In some embodiments, the method further comprises co-introducing a secondary therapy (e.g., a glucocorticoid, hyaluronan, platelet-rich plasma, recombinant, human IL-1Ra, or a combination thereof) to the location of interest in combination with the composition.
[0021] The present invention also features a method of delivering IL-1Ra peptide to a chondrocyte or synoviocyte. In some embodiments, the method comprises contacting the chondrocyte or synoviocyte with a recombinant self-complementary adeno-associated virus (sc-rAAV) according to the present invention, e.g., an engineered adeno-associated virus (AAV) capsid comprising at least a portion of serotype 2 and at least a portion of serotype 6 and a vector packaged within the capsid, wherein the vector comprises a modified IL-1Ra gene operably linked to a CMV promoter and the modified IL-1Ra gene is at least 95% identical to SEQ ID NO: 2. The sc-rAAV transduces the vector into the chondrocyte or synoviocyte and the modified IL-1Ra gene is expressed to as to provide IL-1Ra peptide to the chondrocyte or synoviocyte.
[0022] For the aforementioned methods and compositions (e.g., a method of providing a human in need thereof a therapeutically effective amount of interleukin-1 receptor agonist (IL-1Ra) peptide, a method of ameliorating symptoms of osteoarthritis or rheumatoid arthritis in a human, a method of delivering IL-1Ra peptide to a chondrocyte or synoviocyte, a composition comprising a recombinant self-complementary adeno-associated virus (sc-rAAV), a recombinant self-complementary adeno-associated virus (sc-rAAV) vector comprising a modified IL-1Ra gene operably linked to a CMV promoter, a method of repairing cartilage in a canine in need thereof, a method of providing interleukin-1 receptor agonist (IL-1Ra) peptide to an area of inflammation, etc.), the modified IL-1Ra gene may be at least 95% identical SEQ ID NO: 2 and encode IL-1Ra according to SEQ ID NO: 6.
[0023] Any feature or combination of features described herein are included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context, this specification, and the knowledge of one of ordinary skill in the art. Additional advantages and aspects of the present invention are apparent in the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 shows Plasmid sc-rAAV2.5Hu-IL-1Ra, which contains a modified cDNA encoding the human IL-1Ra protein under control of the CMV promoter. The gene insert also contains SV40 and bovine growth hormone (bGH) polyadenylation sequences, as well as SV40 splice donor (SD) and splice acceptor (SA) sites. The region between inverted terminal repeats (TR) has been verified by sequencing.
[0025] TERMS
[0026] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. "Comprising" means "including." Hence "comprising A or B" means "including A" or "including B" or "including A and B."
[0027] Suitable methods and materials for the practice and/or testing of embodiments of the disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which the disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, the disclosures of which are incorporated in their entirety herein by reference.
[0028] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
[0029] Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
[0030] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
[0031] Adeno-associated virus (AAV), Recombinant AAV (rAAV), and Recombinant Self-Complementary AAV (sc-rAAV): AAV is a small virus (20 nm) in the family Parvoviridae. AAV is not known to cause disease. AAV has recently been used to gene therapy for a variety of reasons including that it has been shown to have low immunogenicity, the ability to effectively transduce non-dividing cells, and the ability to infect a variety of cell and tissue types. Recombinant AAV (rAAV) does not contain native viral coding sequences. Recombinant AAV DNA is packaged into the viral capsid as a single stranded molecule about 4600 nucleotides in length. Following infection of the cell by the virus, the molecular machinery of the cell converts the single DNA strand into a double-stranded form. Only the double stranded DNA form is useful to the proteins of the cell that transcribe the contained gene or genes into RNA. Self-complementary AAV (sc-rAAV) is an engineered form of rAAV that can form an intra-molecular double stranded DNA template. Thus, upon infection, the two complementary halves of sc-rAAV will associate to form one double stranded DNA unit that is ready for immediate replication and synthesis.
[0032] Expression: The translation of a nucleic acid sequence into a protein. Proteins may be expressed and remain intracellular, become a component of the cell surface membrane, or be secreted into the extracellular matrix or medium.
[0033] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
[0034] Pharmaceutically acceptable vehicles: Pharmaceutically acceptable carriers (vehicles), e.g., solutions, may be conventional but are not limited to conventional vehicles. For example, E. W. Martin, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 15th Edition (1975) and D. B. Troy, ed. Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore MD and Philadelphia, PA, 21.sup.st Edition (2006) describe compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules. In general, the nature of the carrier will depend on the particular mode of administration being employed. In addition to biologically-neutral carriers, pharmaceutical compositions administered may contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
[0035] Preventing, treating, managing, or ameliorating a condition: "Preventing" a disease may refer to inhibiting the full development of a condition. "Treating" may refer to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. "Managing" may refer to a therapeutic intervention that does not allow the signs or symptoms of a disease or condition to worsen. "Ameliorating" may refer to the reduction in the number or severity of signs or symptoms of a disease or condition.
[0036] Sequence identity: The identity (or similarity) between two or more nucleic acid sequences is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biotechnology (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site. BLASTN may be used to compare nucleic acid sequences, while BLASTP may be used to compare amino acid sequences. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences. The BLAST-like alignment tool (BLAT) may also be used to compare nucleic acid sequences (Kent, Genome Res. 12:656-664, 2002). BLAT is available from several sources, including Kent Informatics (Santa Cruz, Calif.) and on the Internet (genome.ucsc.edu). Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (1166/1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth.
[0037] Therapeutically effective amount: A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. Such agents may include IL-1Ra. For example, a therapeutically effective amount of IL-1Ra may be an amount sufficient to prevent, treat, or ameliorate symptoms of osteoarthritis or rheumatoid arthritis. The therapeutically effective amount of an agent useful for preventing, ameliorating, and/or treating a subject will be dependent on the subject being treated, the type and severity of the affliction, and the manner of administration of the therapeutic composition.
[0038] Transduced: A transduced cell is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. As used herein, the term transduction encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viruses or viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. Such cells are sometimes called transformed cells.
[0039] Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may lack the nucleic acid sequences that permit it to replicate in a host cell. A vector may also include a gene of interest, one or more selectable marker genes, other genetic elements known in the art, or any other appropriate insert.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention features methods and compositions for delivering a therapeutic gene product (e.g., IL-1Ra) in a sustained manner to a location of interest, e.g., a joint. The present invention also features methods and compositions for treating symptoms of conditions such as but not limited to osteoarthritis or rheumatoid arthritis. The present invention also features methods and compositions for providing an individual (e.g., a human) a therapeutically effective amount of a therapeutic gene product (e.g., IL-1Ra). The methods and compositions may feature a recombinant self-complementary adeno-associated virus (sc-rAAV), wherein the sc-rAAV comprises an engineered capsid and a vector (an sc-rAAV vector) packaged within the capsid. The vector may comprise a transgene (e.g., a nucleotide sequence encoding a protein of interest, e.g., a therapeutic gene product, e.g., IL-1Ra or a modified version thereof) operably linked to a promoter (e.g., a constitutive promoter).
[0041] As previously discussed, the present invention features compositions comprising a recombinant self-complementary adeno-associated virus (sc-rAAVs) vector. A non-limiting example of a sc-rAAV vector is shown in SEQ ID NO: 1 of Table 1 below. The sc-rAAV vector of SEQ ID NO: 1 comprises a modified IL-1Ra gene. In some embodiments, the vector comprises SV40 polyadenylation sequences. In some embodiments, the vector comprises bovine growth hormone (bGH) polyadenylation sequences. In some embodiments, the vector comprises SV40 splice donor (SD) and splice acceptor (SA) sites. The sc-rAAV vector is not limited to SEQ ID NO: 1.
[0042] The sc-rAAV vectors comprise a nucleic acid that encodes a peptide of interest. In some embodiments, the nucleic acid is at least 90% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 92% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 94% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 95% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 96% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 97% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 98% identical to SEQ ID NO: 2. In some embodiments, the nucleic acid is at least 99% identical to SEQ ID NO: 2. Non-limiting examples of such nucleic acid sequences can be found in Table 1 below. For example, SEQ ID NO: 3 is a sequence for a modified human IL-1Ra that is about 98% identical to SEQ ID NO: 2; SEQ ID NO: 4 is a sequence for a modified human IL-1Ra that is about 99% identical to SEQ ID NO: 2; and (note that the bold letters in Table 1 are nucleotide substitutions as compared to SEQ ID NO: 2, and the codon underlined).
TABLE-US-00001 TABLE 1 SEQ ID NO: DESCRIPTION SEQUENCE 1 Sequence of Hu-IL-1Ra CATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGG plasmid containing entire CGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGG viral sequence with CTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCC modified human IL1Ra ACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG insert (underlined) and CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCAT the SacII/NotI restriction AGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG sites in bold italics. AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCT GGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGA TACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGC TCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG GGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCC GGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCA CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGC GGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGA AGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGC GGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGA TCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGG AACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGG ATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATC TAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATC AGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCA TCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCT CCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGC CGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATG GCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTG ACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGA CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACAT AGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCC ACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTT TCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATA AGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATAT TATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCC CGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTA ACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTC GGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCLGGAGACGGTC ACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGC GCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCA TCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCG CACAGATGCGTAAGGAGAAAATACCGCATCAGGAATTCCAACATCCAA TAAATCATACAGGCAAGGCAAAGAATTAGCAAAATTAAGCAATAAAGC CTCAGAGCATAAAGCTAAATCGGTTGTACCAAAAACATTATGACCCTG TAATACTTTTGCGGGAGAAGCCTTTATTTCAACGCAAGGATAAAAATT TTTAGAACCCTCATATATTTTAAATGCAATGCCTGAGTAATGTGTAGG TAAAGATTCAAACGGGTGAGAAAGGCCGGAGACAGTCAAATCACCATC AATATGATATTCAACCGTTCTAGCTGATAAATTCATGCCGGAGAGGGT AGCTATTTTTGAGAGGTCTCTACAAAGGCTATCAGGTCATTGCCTGAG AGTCTGGAGCAAACAAGAGAATCGATGAACGGTAATCGTAAAACTAGC ATGTCAATCATATGTACCCCGGTTGATAATCAGAAAAGCCCCAAAAAC AGGAAGATTGTATAAGCAAATATTTAAATTGTAAACGTTAATATTTTG TTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAA TAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAG ATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAG AACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGAT GGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGG TGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGA GCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAA GCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTG CGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCG TACTATGGTTGCTTTGACGAGCACGTATAACGTGCTTTCCTCGTTAGA ATCAGAGCGGGAGCTAAACAGGAGGCCGATTAAAGGGATTTTAGACAG GAACGGTACGCCAGAATCCTGAGAAGTGTTTTTATAATCAGTGAGGCC ACCGAGTAAAAGAGTCTGTCCATCACGCAAATTAACCGTTGTCGCAAT ACTTCTTTGATTAGTAATAACATCACTTGCCTGAGTAGAAGAACTCAA ACTATCGGCCTTGCTGGTAATATCCAGAACAATATTACCGCCAGCCAT TGCAACAGGAAAAACGCTCATGGAAATACCTACATTTTGACGCTCAAT CGTCTGGAATTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGG CGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGCGCTCGCTC GCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA CTCCATCACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTA CTTATCTACGTAGCCATGCTCGATCTGAATTCGGTACCCGTTACATAA CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACT TTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTG GCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTC AATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATT ACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGG TTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGG AGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAAC AACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGA CGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCC AGCCTCCGGACTCTAGAGGATCCGGTACTCGAGGAACTGAAAAACCAG AAAGTTAACTGGTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCG GATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCTCAGTGGATGTTGC CTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTG CGGAATTGTAC CCACCATGGAAATCTGCAGAGGCCTGCGGA GCCACCTGATTACCCTGCTGCTGTTCCTGTTCCACAGCGAGACAATCT GCCGGCCCAGCGGCCGGAAGTCCAGCAAGATGCAGGCCTTCCGGATCT GGGACGTGAACCAGAAAACCTTCTACCTGCGGAACAACCAGCTGGTGG CCGGATACCTGCAGGGCCCCAACGTGAACCTGGAAGAGAAGATCGACG TGGTGCCCATCGAGCCCCACGCCCTGTTTCTGGGCATCCACGGCGGCA AGATGTGCCTGAGCTGCGTGAAGTCCGGCGACGAGACAAGACTGCAGC TGGAAGCCGTGAACATCACCGACCTGAGCGAGAACCGGAAGCAGGACA AGAGATTCGCCTTCATCAGAAGCGACAGCGGCCCCACCACCAGCTTTG AGAGCGCCGCCTGCCCCGGCTGGTTCCTGTGTACAGCCATGGAAGCCG ACCAGCCCGTGTCCCTGACAAACATGCCCGACGAGGGCGTGATGGTCA CCAAGTTCTATTTTCAAGAAGATGAGTAATAA CGGGATCC AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAAT GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT ATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTG CATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTA GTCGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCA GCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGG TGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCA TTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGA CAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGAACCCCACTCCCTC TCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCG ACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGA GCGAGCGAGCGCGCAGCTGCTG 2 Modified human IL-1Ra ATGGAAATCTGCAGAGGCCTGCGGAGCCACCTGATTACCCTGCTGCTG insert TTCCTGTTCCACAGCGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCC AGCAAGATGCAGGCCTTCCGGATCTGGGACGTGAACCAGAAAACCTTC TACCTGCGGAACAACCAGCTGGTGGCCGGATACCTGCAGGGCCCCAAC GTGAACCTGGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCC CTGTTTCTGGGCATCCACGGCGGCAAGATGTGCCTGAGCTGCGTGAAG TCCGGCGACGAGACAAGACTGCAGCTGGAAGCCGTGAACATCACCGAC CTGAGCGAGAACCGGAAGCAGGACAAGAGATTCGCCTTCATCAGAAGC GACAGCGGCCCCACCACCAGCTTTGAGAGCGCCGCCTGCCCCGGCTGG TTCCTGTGTACAGCCATGGAAGCCGACCAGCCCGTGTCCCTGACAAAC ATGCCCGACGAGGGCGTGATGGTCACCAAGTTCTATTTTCAAGAAGAT GAGTAATAA 3 Modified human IL-1Ra ATGGAAATCTGCAGAGGACTGCGGAGCCACCTAATTACCCTACTCCTT insert (98% identical to TTCCTGTTCCACAGCGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCC SEQ ID NO: 2; bold AGCAAGATGCAGGCTTTCCGGATCTGGGACGTGAACCAGAAAACCTTC letters are nucleotide TACCTCCGGAACAACCAGCTGGTGGCGGGATACCTCCAGGGCCCCAAC substitutions within a GTGAACCTAGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCC codon (codon is CTGTTTCTGGGCATCCACGGCGGCAAGATGTGCCTGAGCTGCGTGAAG underlined)) TCCGGCGACGAGACAAGACTGCAGCTGGAAGCCGTGAACATCACCGAC CTGAGCGAGAACCGGAAGCAGGACAAGAGATTCGCCTTCATCAGAAGC GACAGCGGCCCCACCACCAGCTTTGAGAGCGCCGCCTGCCCCGGCTGG TTCCTGTGTACAGCCATGGAAGCCGACCAGCCCGTGTCCCTGACAAAC ATGCCCGACGAGGGCGTGATGGTCACCAAGTTCTATTTTCAAGAAGAT GAGTAATAA 4 Modified human IL-1Ra ATGGAGATCTGCAGAGGCCTGCGGAGCCATCTGATTACCCTACTGCTT insert (99% identical to TTCCTGTTCCATAGCGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCC SEQ ID NO: 2; bold AGCAAAATGCAGGCCTTCCGGATCTGGGACGTGAACCAGAAAACCTTC letters are nucleotide TACCTGCGGAACAACCAGCTGGTGGCCGGATACCTGCAGGGCCCCAAG substitutions within a GTGAACCTGGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCC codon (codon is CTGTTTCTGGGCATCCACGGCGGCAAGATGTGCCTGAGCTGCGTGAAG underlined)) TCCGGCGACGAGACAAGACTGCAGCTGGAAGCCGTGAACATCACCGAC CTGAGCGAGAACCGGAAGCAGGACAAGAGATTCGCCTTCATCAGAAGC GACAGCGGCCCCACCACCAGCTTTGAGAGCGCCGCCTGCCCCGGCTGG TTCCTGTGTACAGCCATGGAAGCCGACCAGCCCGTGTCCCTGACAAAC ATGCCCGACGAGGGCGTGATGGTCACCAAGTTCTATTTTCAAGAAGAT GAGTAATAA 5 Modified human IL-1Ra ATGGAGATCTGCAGAGGACTGCGGAGCCACCTAATTACCCTACTCCTT insert (95% identical to TTCCTGTTCCATAGCGAGACAATCTGCCGGCCCAGCGGCCGGAAGTCC SEQ ID NO: 2; bold AGCAAAATGCAGGCTTTCCGGATCTGGGATGTGAACCAGAAGACCTTC letters are nucleotide TACCTCCGGAACAACCAGCTGGTGGCGGGATACCTCCAGGGCCCCAAC substitutions within a GTGAACCTAGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCC codon (codon is CTGTTTCTGGGCATCCATGGCGGCAAGATGTGTCTGAGTTGCGTGAAG underlined)) TCAGGCGACGAGACAAGACTGCAGCTGGAAGCCGTGAACATCACCGAC CTGAGCGAAAACCGGAAGCAGGACAAGAGATTCGCCTTCATCAGAAGC GACAGCGGCCCCACCACTAGCTTTGAGAGCGCAGCCTGCCCCGGCTGG TTCCTGTGTACAGCCATGGAGGCCGACCAGCCCGTGTCCCTGACAAAC ATGCCTGACGAAGGCGTGATGGTCACCAAGTTCTACTTTCAAGAAGAT GAATAATAA
[0043] In some embodiments, the IL-1Ra peptide encoded by the IL-1Ra insert comprises IL-1Ra (see SEQ ID NO: 6 in Table 2 below).
TABLE-US-00002 TABLE 2 SEQ ID NO: DESCRIPTION SEQUENCE 6 IL-1Ra MEICRGLRSH LITLLLFLFH SETICRPSGR KSSKMQAFRI (UNIPROT WDVNQKTFYL RNNQLVAGYL QGPNVNLEEK P18510) IDVVPIEPHA LFLGIHGGKM CLSCVKSGDE TRLQLEAVNI TDLSENRKQD KRFAFIRSDS GPTTSFESAA CPGWFLCTAM EADQPVSLTN MPDEGVMVTK FYFQEDE
[0044] The transgene (e.g., nucleotide sequence encoding protein of interest) is operably linked to a promoter. In some embodiments, the promoter comprises the cytomegalovirus (CMV) promoter. The present invention is not limited to the CMV promoter and may feature any appropriate promoter or portions of various promoters. Examples of promoters include CMV promoter, hybrid CMV promoter, CAG promoter, human beta-actin promoter, hybrid beta-actin promoter, EF1 promoter, U1a promoter, U1b promoter, a Tet-inducible promoter, a VP16-LexA promoter, chicken beta-actin (CBA) promoter, human elongation factor-1alpha promoter, simian virus 40 (SV40) promoter, and herpes simplex virus thymidine kinase promoter.
[0045] In some embodiments, the promoter comprises a hybrid promoter. As an example, Table 3 shows an IL-1 beta/IL-6 hybrid promoter (see also van de Loo et al., 2004, Gene Therapy 11:581-590). The present invention is also not limited to the hybrid promoter shown in Table 3.
TABLE-US-00003 TABLE 3 SEQ ID NO: DESCRIPTION SEQUENCE 7 IL-1 beta/ atccaagag ggagaagaag cccattggag atgatgccat aaaggaagtg IL-6 hybrid gaagcgatat gataaaaatc atagtgccca ttcccaaata atcccagaag promoter cagaagggaa aggagagaaa tatccacaaa gacaggtgtg ggtacacaca acatttttca tactttaaga tcccagagga ctcatggaaa tgatacaaga aaatgactca taagaacaaa tattaggaag ccagtgccaa gaatgagatg ggaaattggg gaaaatgttg ggggcagatt gcttagttct gttctaagca agagggtgaa caaggaagga acagctcact acaaagaaca gacatcactg catgtacaca caataatata agaactaacc catgattatt ttgcttgtct tcttgttcaa aatgattgaa gaccaatgag atgagatcaa ccttgataac tggctggctt cggcatgatt agacacaaga tggtatcagg gcacttgctg ctttgaataa tgtcagtctc ctgtcttgga agaatgacct gacagggtaa agaggaactt gcagctgaga aaggctttag tgactcaaga gctgaataat tccccaaaag ctggagcatc ctggcatttc cagctcccca tctctgcttg ttccacttcc ttggggctac atcaccatct acatcatcat cactcttcca ctccctccct tagtgccaac tatgtttata gcgagatatt ttctgctcat tggggatcgg aaggaagtgc tgtggcctga gcggtctcct tgggaagaca ggatctgata catacgttgc acaacctatt tgacataaga ggtttcactt cctgagatgg atgggatggt agcagatttg ggtccaggtt acagggccag gatgagacat ggcagaactg tggagactgt tacgtcaggg ggcattgccc catggctcca aaatttccct cgagc ctctggccc caccctcacc ctccaacaaa gatttatcaa atgtgggatt ttcccatgag tctcaatatt agagtctcaa cccccaataa atataggact ggagatgtct gaggctcatt ctgccctcga gcccaccggg aacgaaagag aagctctatc tcccctccag gagcccagct atgaactcct tc
[0046] In some embodiments, the sc-rAAV vector is packaged within a capsid. In some embodiments, the capsid comprises at least a portion of AAV serotype 1 (AAV1), AAV serotype 2, (AAV2), AAV serotype 3, (AAV3), AAV serotype 4, (AAV4), AAV serotype 5, (AAV5), AAV serotype 6, (AAV6), derivatives thereof, or combination thereof. For example, in some embodiments, the capsid comprises at least a portion of AAV serotype 2 and at least a portion of AAV serotype 6, e.g., AAV2.5.
[0047] The composition, e.g., the composition comprising the sc-rAAV, may be introduced into cells in a location of interest (e.g., in a human). For example, in some embodiments when treating symptoms of osteoarthritis, the composition may be introduced into cells (e.g., chondrocytes, synoviocytes, e.g., type A, type B, etc.) in a joint via direct intraarticular injection. In some embodiments, the composition is administered to a joint, synovium, subsynovium, joint capsule, tendon, ligament, cartilage, or peri-articular muscle of the human. The present invention is not limited to the aforementioned conditions (e.g., osteoarthritis), the means of administration (e.g., intraarticular injection), the location of interest (e.g., joint), or cell type (e.g., chondrocytes, synoviocytes). For example, in some embodiments, other cell types that may be transduced may include mesenchymal stem cells.
[0048] The sc-rAAV transduces the vector into cells and the modified IL-1Ra peptide is expressed. In some embodiments, the IL-1Ra peptide is expressed so as to provide the human with a therapeutically effective amount of said modified IL-1Ra peptide effective for ameliorating symptoms associated with various conditions such as osteoarthritis or rheumatoid arthritis.
[0049] In some embodiments, introduction of the composition (e.g., the sc-rAAV) is performed once. In some embodiments, introduction of the composition (e.g., the sc-rAAV) is performed twice, e.g., a first time and a second time subsequent to the first time. In some embodiments, introduction of the composition is performed more than two times, e.g., three times, four times, five times, etc. The introduction of the composition a second time may be performed at a time point after the time when the method is first performed, e.g., after 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, more than one year, etc.
[0050] The composition may comprise any appropriate pharmaceutical composition. In some embodiments, the composition comprises a buffered solution. In some embodiments, the buffered solution comprises phosphate buffered saline (PBS). In some embodiments, the composition further comprises sorbitol, e.g., 5% sorbitol. In some embodiments, the composition further comprises a salt, e.g., NaCI. The concentration of salt may be any appropriate concentration, e.g., 350 mM NaCI, more than 350 mM NaCI, less then 350 mM, etc.
[0051] In some embodiments, the composition (e.g., the sc-rAAV) is co-administered with a secondary therapy. In some embodiments, the secondary therapy comprises a therapeutic for OA or RA or any other appropriate therapy for treating the symptoms of the condition. Non-limiting examples of secondary therapies for OA include glucocorticoids, hyaluronan (viscosupplementation), platelet-rich plasma, and recombinant, human IL-1Ra (Anakinra; Kineret.RTM.). For example, in some embodiments, the sc-rAAV is co-administered with glucocorticoids or platelet-rich plasma.
[0052] The disclosures of the following U.S. Patents are incorporated in their entirety by reference herein: US2008/0187576, US2009/0104155, KR2012041139, JP2015518816, WO2013151672, WO2008088895, U.S. Pat. Nos. 8,529,885, 7,037,492, US20070128177, U.S. Pat. Nos. 6,491,907, 8,999,948, US20150218586, U.S. Pat. No. 7,892,824, US20130295614, JP2002538770, JP2010516252, KR2002027450, KR2003028080, U.S. Pat. No. 6,482,634, US20090105148, US20120232130, US20140234255, U.S. Pat. Nos. 5,756,283, 6,083,716, WO2002038782, WO2007039699, WO2012047093, WO2014170470, WO2015018860, WO2015044292, WO2015158749, U.S. Pat. Nos. 7,452,696, 6,943,153, 6,429,001, WO2015031392, WO2004092211.
EXAMPLE 1
[0053] Example 1 describes administration of a sc-rAAV of the present invention (encoding IL-1Ra). The present invention is not limited to the disclosure of Example 1. Five patients enroll in a clinical trial investigating administration of a sc-rAAV of the present invention. The patients are as follows: (1) a 65 year old male with osteoarthritis in his right knee; (2) a 59 year old male with osteoarthritis in his left knee; (3) a 58 year old female with osteoarthritis in her left knee; (4) a 51 year old male with osteoarthritis in his right knee; and (5) a 48 year old male with osteoarthritis in his right knee. Each patient is administered the sc-rAAV via intraarticular injection at 1.times.10.sup.12 viral genes per knee. IL-1Ra is expressed in the chondrocytes and synoviocytes. Patient 1 describes amelioration of OA-related symptoms within 2 weeks. Patient 2 describes amelioration of OA-related symptoms within 1 week. Patient 3 describes amelioration of OA-related symptoms within 5 weeks. Patient 4 describes amelioration of OA-related symptoms within 1 week. As of 6 weeks, Patient 5 describes no amelioration of OA-related symptoms.
EXAMPLE 2
[0054] Example 2 describes a first administration of a sc-rAAV of the present invention (encoding IL-1Ra) and a second administration of the same sc-rAAV of the present invention after a period of time. The present invention is not limited to the disclosure of Example 2. A 55-year-old male presents with osteoarthritis in his right knee. His physician performs a single intra-articular injection of the sc-rAAV vector of the present invention (encoding IL-1Ra). The patient's symptoms are eliminated within 2 months. After 6 months, the physician administers a second (single) intra-articular injection of the same sc-rAAV vector (encoding IL-1Ra) of the present invention. The patient's symptoms are still absent 6 months following the second injection.
EXAMPLE 3
[0055] Example 3 describes a first administration of a sc-rAAV of the present invention (encoding IL-1Ra) and a second administration of a sc-rAAV of the present invention (encoding IL-1Ra) different from the first sc-rAAV after a period of time. The present invention is not limited to the disclosure of Example 3. A 49-year-old female presents with osteoarthritis in her right ankle. Her physician performs a single intra-articular injection of the sc-rAAV vector of the present invention (encoding IL-1Ra). The patient's symptoms have improved within 5 months but are not eliminated. After 6 months, the physician administers a second (single) intra-articular injection of a different sc-rAAV vector (encoding IL-1Ra) of the present invention. Six months following the second injection, the patient's symptoms are eliminated.
EXAMPLE 4
[0056] Example 4 describes co-administration of a sc-rAAV of the present invention (encoding IL-1Ra) and a secondary therapy. The present invention is not limited to the disclosure of Example 4. A 68-year-old male presents with osteoarthritis in his left knee. His physician performs a single intra-articular injection of both a sc-rAAV vector of the present invention (encoding IL-1Ra) and platelet-rich plasma. The patient's symptoms are eliminated within 2 months.
[0057] Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.
[0058] Although there has been shown and described embodiments of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Reference numbers recited in the claims are exemplary and for ease of review by the patent office only, and are not limiting in any way. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase "comprising" includes embodiments that could be described as "consisting of", and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase "consisting of" is met.
[0059] Any reference numbers recited in the below claims are solely for ease of examination of this patent application, and are exemplary, and are not intended in any way to limit the scope of the claims to the particular features having the corresponding reference numbers in the drawings.
Sequence CWU
1
1
715718DNAArtificial SequenceSequence of Hu-IL-1Ra plasmid containing
entire viral sequence with modified human IL1Ra insert and the SacII
/ NotI restriction sites. 1cattaatgaa tcggccaacg cgcggggaga
ggcggtttgc gtattgggcg ctcttccgct 60tcctcgctca ctgactcgct gcgctcggtc
gttcggctgc ggcgagcggt atcagctcac 120tcaaaggcgg taatacggtt atccacagaa
tcaggggata acgcaggaaa gaacatgtga 180gcaaaaggcc agcaaaaggc caggaaccgt
aaaaaggccg cgttgctggc gtttttccat 240aggctccgcc cccctgacga gcatcacaaa
aatcgacgct caagtcagag gtggcgaaac 300ccgacaggac tataaagata ccaggcgttt
ccccctggaa gctccctcgt gcgctctcct 360gttccgaccc tgccgcttac cggatacctg
tccgcctttc tcccttcggg aagcgtggcg 420ctttctcata gctcacgctg taggtatctc
agttcggtgt aggtcgttcg ctccaagctg 480ggctgtgtgc acgaaccccc cgttcagccc
gaccgctgcg ccttatccgg taactatcgt 540cttgagtcca acccggtaag acacgactta
tcgccactgg cagcagccac tggtaacagg 600attagcagag cgaggtatgt aggcggtgct
acagagttct tgaagtggtg gcctaactac 660ggctacacta gaaggacagt atttggtatc
tgcgctctgc tgaagccagt taccttcgga 720aaaagagttg gtagctcttg atccggcaaa
caaaccaccg ctggtagcgg tggttttttt 780gtttgcaagc agcagattac gcgcagaaaa
aaaggatctc aagaagatcc tttgatcttt 840tctacggggt ctgacgctca gtggaacgaa
aactcacgtt aagggatttt ggtcatgaga 900ttatcaaaaa ggatcttcac ctagatcctt
ttaaattaaa aatgaagttt taaatcaatc 960taaagtatat atgagtaaac ttggtctgac
agttaccaat gcttaatcag tgaggcacct 1020atctcagcga tctgtctatt tcgttcatcc
atagttgcct gactccccgt cgtgtagata 1080actacgatac gggagggctt accatctggc
cccagtgctg caatgatacc gcgagaccca 1140cgctcaccgg ctccagattt atcagcaata
aaccagccag ccggaagggc cgagcgcaga 1200agtggtcctg caactttatc cgcctccatc
cagtctatta attgttgccg ggaagctaga 1260gtaagtagtt cgccagttaa tagtttgcgc
aacgttgttg ccattgctac aggcatcgtg 1320gtgtcacgct cgtcgtttgg tatggcttca
ttcagctccg gttcccaacg atcaaggcga 1380gttacatgat cccccatgtt gtgcaaaaaa
gcggttagct ccttcggtcc tccgatcgtt 1440gtcagaagta agttggccgc agtgttatca
ctcatggtta tggcagcact gcataattct 1500cttactgtca tgccatccgt aagatgcttt
tctgtgactg gtgagtactc aaccaagtca 1560ttctgagaat agtgtatgcg gcgaccgagt
tgctcttgcc cggcgtcaat acgggataat 1620accgcgccac atagcagaac tttaaaagtg
ctcatcattg gaaaacgttc ttcggggcga 1680aaactctcaa ggatcttacc gctgttgaga
tccagttcga tgtaacccac tcgtgcaccc 1740aactgatctt cagcatcttt tactttcacc
agcgtttctg ggtgagcaaa aacaggaagg 1800caaaatgccg caaaaaaggg aataagggcg
acacggaaat gttgaatact catactcttc 1860ctttttcaat attattgaag catttatcag
ggttattgtc tcatgagcgg atacatattt 1920gaatgtattt agaaaaataa acaaataggg
gttccgcgca catttccccg aaaagtgcca 1980cctgacgtct aagaaaccat tattatcatg
acattaacct ataaaaatag gcgtatcacg 2040aggccctttc gtctcgcgcg tttcggtgat
gacggtgaaa acctctgaca catgcagctc 2100ccggagacgg tcacagcttg tctgtaagcg
gatgccggga gcagacaagc ccgtcagggc 2160gcgtcagcgg gtgttggcgg gtgtcggggc
tggcttaact atgcggcatc agagcagatt 2220gtactgagag tgcaccatat gcggtgtgaa
ataccgcaca gatgcgtaag gagaaaatac 2280cgcatcagga attccaacat ccaataaatc
atacaggcaa ggcaaagaat tagcaaaatt 2340aagcaataaa gcctcagagc ataaagctaa
atcggttgta ccaaaaacat tatgaccctg 2400taatactttt gcgggagaag cctttatttc
aacgcaagga taaaaatttt tagaaccctc 2460atatatttta aatgcaatgc ctgagtaatg
tgtaggtaaa gattcaaacg ggtgagaaag 2520gccggagaca gtcaaatcac catcaatatg
atattcaacc gttctagctg ataaattcat 2580gccggagagg gtagctattt ttgagaggtc
tctacaaagg ctatcaggtc attgcctgag 2640agtctggagc aaacaagaga atcgatgaac
ggtaatcgta aaactagcat gtcaatcata 2700tgtaccccgg ttgataatca gaaaagcccc
aaaaacagga agattgtata agcaaatatt 2760taaattgtaa acgttaatat tttgttaaaa
ttcgcgttaa atttttgtta aatcagctca 2820ttttttaacc aataggccga aatcggcaaa
atcccttata aatcaaaaga atagaccgag 2880atagggttga gtgttgttcc agtttggaac
aagagtccac tattaaagaa cgtggactcc 2940aacgtcaaag ggcgaaaaac cgtctatcag
ggcgatggcc cactacgtga accatcaccc 3000taatcaagtt ttttggggtc gaggtgccgt
aaagcactaa atcggaaccc taaagggagc 3060ccccgattta gagcttgacg gggaaagccg
gcgaacgtgg cgagaaagga agggaagaaa 3120gcgaaaggag cgggcgctag ggcgctggca
agtgtagcgg tcacgctgcg cgtaaccacc 3180acacccgccg cgcttaatgc gccgctacag
ggcgcgtact atggttgctt tgacgagcac 3240gtataacgtg ctttcctcgt tagaatcaga
gcgggagcta aacaggaggc cgattaaagg 3300gattttagac aggaacggta cgccagaatc
ctgagaagtg tttttataat cagtgaggcc 3360accgagtaaa agagtctgtc catcacgcaa
attaaccgtt gtcgcaatac ttctttgatt 3420agtaataaca tcacttgcct gagtagaaga
actcaaacta tcggccttgc tggtaatatc 3480cagaacaata ttaccgccag ccattgcaac
aggaaaaacg ctcatggaaa tacctacatt 3540ttgacgctca atcgtctgga attccattcg
ccattcaggc tgcgcaactg ttgggaaggg 3600cgatcggtgc gggcctcttc gctattacgc
cagctggcgc gctcgctcgc tcactgaggc 3660cgcccgggca aagcccgggc gtcgggcgac
ctttggtcgc ccggcctcag tgagcgagcg 3720agcgcgcaga gagggagtgg ccaactccat
cactaggggt tccttgtagt taatgattaa 3780cccgccatgc tacttatcta cgtagccatg
ctcgatctga attcggtacc cgttacataa 3840cttacggtaa atggcccgcc tggctgaccg
cccaacgacc cccgcccatt gacgtcaata 3900atgacgtatg ttcccatagt aacgccaata
gggactttcc attgacgtca atgggtggag 3960tatttacggt aaactgccca cttggcagta
catcaagtgt atcatatgcc aagtacgccc 4020cctattgacg tcaatgacgg taaatggccc
gcctggcatt atgcccagta catgacctta 4080tgggactttc ctacttggca gtacatctac
gtattagtca tcgctattac catggtgatg 4140cggttttggc agtacatcaa tgggcgtgga
tagcggtttg actcacgggg atttccaagt 4200ctccacccca ttgacgtcaa tgggagtttg
ttttggcacc aaaatcaacg ggactttcca 4260aaatgtcgta acaactccgc cccattgacg
caaatgggcg gtaggcgtgt acggtgggag 4320gtctatataa gcagagctcg tttagtgaac
cgtcagatcg cctggagacg ccatccacgc 4380tgttttgacc tccatagaag acaccgggac
cgatccagcc tccggactct agaggatccg 4440gtactcgagg aactgaaaaa ccagaaagtt
aactggtaag tttagtcttt ttgtctttta 4500tttcaggtcc cggatccggt ggtggtgcaa
atcaaagaac tgctcctcag tggatgttgc 4560ctttacttct aggcctgtac ggaagtgtta
cttctgctct aaaagctgcg gaattgtacc 4620cgcgggccac catggaaatc tgcagaggcc
tgcggagcca cctgattacc ctgctgctgt 4680tcctgttcca cagcgagaca atctgccggc
ccagcggccg gaagtccagc aagatgcagg 4740ccttccggat ctgggacgtg aaccagaaaa
ccttctacct gcggaacaac cagctggtgg 4800ccggatacct gcagggcccc aacgtgaacc
tggaagagaa gatcgacgtg gtgcccatcg 4860agccccacgc cctgtttctg ggcatccacg
gcggcaagat gtgcctgagc tgcgtgaagt 4920ccggcgacga gacaagactg cagctggaag
ccgtgaacat caccgacctg agcgagaacc 4980ggaagcagga caagagattc gccttcatca
gaagcgacag cggccccacc accagctttg 5040agagcgccgc ctgccccggc tggttcctgt
gtacagccat ggaagccgac cagcccgtgt 5100ccctgacaaa catgcccgac gagggcgtga
tggtcaccaa gttctatttt caagaagatg 5160agtaataagc ggccgccggg atccagacat
gataagatac attgatgagt ttggacaaac 5220cacaactaga atgcagtgaa aaaaatgctt
tatttgtgaa atttgtgatg ctattgcttt 5280atttgtaacc attataagct gcaataaaca
agttaacaac aacaattgca ttcattttat 5340gtttcaggtt cagggggagg tgtgggaggt
tttttagtcg actagagctc gctgatcagc 5400ctcgactgtg ccttctagtt gccagccatc
tgttgtttgc ccctcccccg tgccttcctt 5460gaccctggaa ggtgccactc ccactgtcct
ttcctaataa aatgaggaaa ttgcatcgca 5520ttgtctgagt aggtgtcatt ctattctggg
gggtggggtg gggcaggaca gcaaggggga 5580ggattgggaa gacaatagca ggaaccccac
tccctctctg cgcgctcgct cgctcactga 5640ggccgggcga ccaaaggtcg cccgacgccc
gggctttgcc cgggcggcct cagtgagcga 5700gcgagcgcgc agctgctg
57182537DNAArtificial SequenceModified
human IL-1Ra insert 2atggaaatct gcagaggcct gcggagccac ctgattaccc
tgctgctgtt cctgttccac 60agcgagacaa tctgccggcc cagcggccgg aagtccagca
agatgcaggc cttccggatc 120tgggacgtga accagaaaac cttctacctg cggaacaacc
agctggtggc cggatacctg 180cagggcccca acgtgaacct ggaagagaag atcgacgtgg
tgcccatcga gccccacgcc 240ctgtttctgg gcatccacgg cggcaagatg tgcctgagct
gcgtgaagtc cggcgacgag 300acaagactgc agctggaagc cgtgaacatc accgacctga
gcgagaaccg gaagcaggac 360aagagattcg ccttcatcag aagcgacagc ggccccacca
ccagctttga gagcgccgcc 420tgccccggct ggttcctgtg tacagccatg gaagccgacc
agcccgtgtc cctgacaaac 480atgcccgacg agggcgtgat ggtcaccaag ttctattttc
aagaagatga gtaataa 5373537DNAArtificial SequenceModified human
IL-1Ra insert (98% identical to SEQ ID NO 2; 3atggaaatct gcagaggact
gcggagccac ctaattaccc tactcctttt cctgttccac 60agcgagacaa tctgccggcc
cagcggccgg aagtccagca agatgcaggc tttccggatc 120tgggacgtga accagaaaac
cttctacctc cggaacaacc agctggtggc gggatacctc 180cagggcccca acgtgaacct
agaagagaag atcgacgtgg tgcccatcga gccccacgcc 240ctgtttctgg gcatccacgg
cggcaagatg tgcctgagct gcgtgaagtc cggcgacgag 300acaagactgc agctggaagc
cgtgaacatc accgacctga gcgagaaccg gaagcaggac 360aagagattcg ccttcatcag
aagcgacagc ggccccacca ccagctttga gagcgccgcc 420tgccccggct ggttcctgtg
tacagccatg gaagccgacc agcccgtgtc cctgacaaac 480atgcccgacg agggcgtgat
ggtcaccaag ttctattttc aagaagatga gtaataa 5374537DNAArtificial
SequenceModified human IL-1Ra insert (99% identical to SEQ ID NO 2;
4atggagatct gcagaggcct gcggagccat ctgattaccc tactgctttt cctgttccat
60agcgagacaa tctgccggcc cagcggccgg aagtccagca aaatgcaggc cttccggatc
120tgggacgtga accagaaaac cttctacctg cggaacaacc agctggtggc cggatacctg
180cagggcccca acgtgaacct ggaagagaag atcgacgtgg tgcccatcga gccccacgcc
240ctgtttctgg gcatccacgg cggcaagatg tgcctgagct gcgtgaagtc cggcgacgag
300acaagactgc agctggaagc cgtgaacatc accgacctga gcgagaaccg gaagcaggac
360aagagattcg ccttcatcag aagcgacagc ggccccacca ccagctttga gagcgccgcc
420tgccccggct ggttcctgtg tacagccatg gaagccgacc agcccgtgtc cctgacaaac
480atgcccgacg agggcgtgat ggtcaccaag ttctattttc aagaagatga gtaataa
5375537DNAArtificial SequenceModified human IL-1Ra insert (95% identical
to SEQ ID NO 2; 5atggagatct gcagaggact gcggagccac ctaattaccc
tactcctttt cctgttccat 60agcgagacaa tctgccggcc cagcggccgg aagtccagca
aaatgcaggc tttccggatc 120tgggatgtga accagaagac cttctacctc cggaacaacc
agctggtggc gggatacctc 180cagggcccca acgtgaacct agaagagaag atcgacgtgg
tgcccatcga gccccacgcc 240ctgtttctgg gcatccatgg cggcaagatg tgtctgagtt
gcgtgaagtc aggcgacgag 300acaagactgc agctggaagc cgtgaacatc accgacctga
gcgaaaaccg gaagcaggac 360aagagattcg ccttcatcag aagcgacagc ggccccacca
ctagctttga gagcgcagcc 420tgccccggct ggttcctgtg tacagccatg gaggccgacc
agcccgtgtc cctgacaaac 480atgcctgacg aaggcgtgat ggtcaccaag ttctactttc
aagaagatga ataataa 5376177PRTHomo sapiens 6Met Glu Ile Cys Arg Gly
Leu Arg Ser His Leu Ile Thr Leu Leu Leu1 5
10 15Phe Leu Phe His Ser Glu Thr Ile Cys Arg Pro Ser
Gly Arg Lys Ser 20 25 30Ser
Lys Met Gln Ala Phe Arg Ile Trp Asp Val Asn Gln Lys Thr Phe 35
40 45Tyr Leu Arg Asn Asn Gln Leu Val Ala
Gly Tyr Leu Gln Gly Pro Asn 50 55
60Val Asn Leu Glu Glu Lys Ile Asp Val Val Pro Ile Glu Pro His Ala65
70 75 80Leu Phe Leu Gly Ile
His Gly Gly Lys Met Cys Leu Ser Cys Val Lys 85
90 95Ser Gly Asp Glu Thr Arg Leu Gln Leu Glu Ala
Val Asn Ile Thr Asp 100 105
110Leu Ser Glu Asn Arg Lys Gln Asp Lys Arg Phe Ala Phe Ile Arg Ser
115 120 125Asp Ser Gly Pro Thr Thr Ser
Phe Glu Ser Ala Ala Cys Pro Gly Trp 130 135
140Phe Leu Cys Thr Ala Met Glu Ala Asp Gln Pro Val Ser Leu Thr
Asn145 150 155 160Met Pro
Asp Glu Gly Val Met Val Thr Lys Phe Tyr Phe Gln Glu Asp
165 170 175Glu71165DNAArtificial
SequenceIL-1 beta/IL-6 hybrid promoter 7atccaagagg gagaagaagc ccattggaga
tgatgccata aaggaagtgg aagcgatatg 60ataaaaatca tagtgcccat tcccaaataa
tcccagaagc agaagggaaa ggagagaaat 120atccacaaag acaggtgtgg gtacacacaa
catttttcat actttaagat cccagaggac 180tcatggaaat gatacaagaa aatgactcat
aagaacaaat attaggaagc cagtgccaag 240aatgagatgg gaaattgggg aaaatgttgg
gggcagattg cttagttctg ttctaagcaa 300gagggtgaac aaggaaggaa cagctcacta
caaagaacag acatcactgc atgtacacac 360aataatataa gaactaaccc atgattattt
tgcttgtctt cttgttcaaa atgattgaag 420accaatgaga tgagatcaac cttgataact
ggctggcttc ggcatgatta gacacaagat 480ggtatcaggg cacttgctgc tttgaataat
gtcagtctcc tgtcttggaa gaatgacctg 540acagggtaaa gaggaacttg cagctgagaa
aggctttagt gactcaagag ctgaataatt 600ccccaaaagc tggagcatcc tggcatttcc
agctccccat ctctgcttgt tccacttcct 660tggggctaca tcaccatcta catcatcatc
actcttccac tccctccctt agtgccaact 720atgtttatag cgagatattt tctgctcatt
ggggatcgga aggaagtgct gtggcctgag 780cggtctcctt gggaagacag gatctgatac
atacgttgca caacctattt gacataagag 840gtttcacttc ctgagatgga tgggatggta
gcagatttgg gtccaggtta cagggccagg 900atgagacatg gcagaactgt ggagactgtt
acgtcagggg gcattgcccc atggctccaa 960aatttccctc gagcctctgg ccccaccctc
accctccaac aaagatttat caaatgtggg 1020attttcccat gagtctcaat attagagtct
caacccccaa taaatatagg actggagatg 1080tctgaggctc attctgccct cgagcccacc
gggaacgaaa gagaagctct atctcccctc 1140caggagccca gctatgaact ccttc
1165
User Contributions:
Comment about this patent or add new information about this topic: