Patent application title: PROTEIN PRODUCTION IN FILAMENTOUS FUNGAL CELLS IN THE ABSENCE OF INDUCING SUBSTRATES
Inventors:
IPC8 Class: AC12N942FI
USPC Class:
Class name:
Publication date: 2022-05-12
Patent application number: 20220145278
Abstract:
Certain embodiments of the disclosure are directed to variant filamentous
fungal cells, compositions thereof and methods thereof for increased
production of one or more proteins of interest. More particularly, in
certain embodiments, the disclosure is directed to variant filamentous
fungal (host) cells derived from parental filamentous fungal cells,
wherein the variant host cells comprise a genetic modification which
enables the expression/production of a protein of interest (POI) in the
absence of inducing substrate. In certain embodiments, a variant fungal
host cell of the disclosure comprises a genetic modification which
increases the expression of a variant activator of cellulase expression 3
(ace3) gene encoding an Ace3 protein referred to herein as Ace3-L.Claims:
1-16. (canceled)
17. A method for producing a lignocellulosic degrading enzyme in a Trichoderma sp. fungal cell in the absence of an inducing substrate comprising: introducing into the fungal cell a polynucleotide construct comprising an upstream (5') promoter sequence operably linked to a downstream (3') nucleic acid encoding an Ace3 protein comprising at least 95% sequence identity to SEQ ID NO: 6 and "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids, and fermenting the cell under conditions suitable for fungal cell growth and protein production, wherein such conditions do not include an inducing substrate.
18. The method of claim 17, wherein the polynucleotide construct further comprises a downstream (3') native ace3 terminator sequence operably linked to the nucleic acid encoding the Ace3 protein.
19. The method of claim 17, wherein the polynucleotide construct is integrated into the fungal cell genome.
20. The method of claim 17, wherein the polynucleotide construct is integrated into a telomere site of the fungal cell genome.
21-22. (canceled)
23. The method of claim 17, wherein the encoded Ace3 protein comprises an amino acid sequence comprising at least 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14.
24-57. (canceled)
58. The method of claim 17, wherein the lignocellulose degrading enzyme is selected from the group consisting of cellulase enzymes, hemi-cellulase enzymes, or a combination thereof.
59. The method of claim 17, further comprising an introduced expression cassette encoding a protein of interest.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. application Ser. No. 16/336,500, filed Mar. 26, 2019, which is a 371 of International Application No. PCT/US2017/54983, filed Oct. 3, 2017, which claims benefit to U.S. Provisional Application No. 62/403,787, filed Oct. 4, 2016, all of which are hereby incorporated by reference in their entirety.
SEQUENCE LISTING
[0002] The sequence listing text file submitted herewith via EFS contains the file "NB41159WOPCT_SEQLISTING.txt" created on Oct. 2, 2017, which is 157 kilobytes in size. This sequence listing complies with 37 C.F.R. .sctn. 1.52(e) and is incorporated herein by reference in its entirety.
FIELD
[0003] The present disclosure is generally related to the fields of molecular biology, biochemistry, protein production and filamentous fungi. Certain embodiments of the disclosure are directed to variant filamentous fungal cells, compositions thereof and methods thereof for increased production of one or more proteins of interest. More particularly, in certain embodiments, the disclosure is directed to variant filamentous fungal (host) cells derived from parental filamentous fungal cells, wherein the variant host cells comprise a genetic modification which enables the expression/production of one or more proteins of interest (POI) in the absence of inducing substrate.
BACKGROUND
[0004] Cellulose, a component of lignocellulosic plant material, is the most abundant polysaccharide found in nature. Likewise, filamentous fungi are known in the art to be efficient degraders of plant biomass, and are in fact a major source of industrially relevant lignocellulosic degrading enzymes (referred to hereinafter collectively as "cellulase" enzymes). For example, filamentous fungi are known to produce extracellular cellulase enzymes (e.g., cellobiohydrolases, endoglucanases, .beta.-glucosidases) that hydrolyze the .beta.-(1,4)-linked glycosidic bonds of cellulose to produce glucose (i.e., thereby conferring the ability of these filamentous fungi to utilize cellulose for growth).
[0005] In particular, the filamentous fungus Trichoderma reesei (T. reesei; an anamorph of the fungus Hypocrea jecorina) is known to be an efficient producer of cellulase enzymes (see, e.g., PCT International Application Nos. WO1998/15619, WO2005/028636, WO2006/074005, WO1992/06221, WO1992/06209, WO1992/06183, WO2002/12465 and the like). As such, filamentous fungi such as T. reesei have been utilized for their ability to produce enzymes which are valuable in the production of such commodities as cellulosic derived ethanol, textiles and clothing, detergents, fibers, food and feed additives and other industrial uses.
[0006] The expression (and production) of these industrially relevant enzymes in Trichoderma are known to be dependent on the carbon source available for growth. More particularly, the production of cellulase enzymes by filamentous fungi is an energy-consuming process and as such, both inducing and repressing mechanisms have evolved in filamentous fungi to ensure the efficient production of these enzymes. For example, the various genes encoding enzymes needed for the degradation of plant cell wall material (i.e., cellulases/hemicellulases) are "activated" in the presence of an "inducing" substrate and "repressed" in the presence of easily metabolized carbon sources (e.g., D-glucose) that are preferred over plant biomass via a mechanism known as "carbon catabolite repression" (hereinafter, "CCR"). Thus, the cellulase genes are tightly repressed by glucose and are induced several thousand folds by cellulose and certain disaccharides (e.g., sophorose, lactose, gentiobiose). For example, the expression level of the major cellobiohydrolase 1 (cbh1) is "up-regulated" several thousand fold on media containing inducing carbon sources such as cellulose or sophorose, compared with glucose containing media (Ilmen et al., 1997). Furthermore, the addition of a "repressing" carbon source to "induced" T. reesei cultures was shown to override the (cellulose or sophorose) induction, thereby resulting in down-regulation of cellulase gene expression (el-Gogary et al., 1989; Ilmen et al., 1997). Thus, the expression of genes comprising the cellulase system (enzymes) are at least coordinated and regulated at the transcriptional level, wherein the gene members of this system act synergistically, and as noted above, are necessary for the efficient hydrolysis of cellulose to soluble oligosaccharides.
[0007] More specifically, a genome-wide analysis revealed that there are at least ten (10) cellulolytic and sixteen (16) xylanolytic enzyme encoding genes in T. reesei (Martinez et al., 2008). In particular, the most abundantly secreted enzymes are the two main cellobiohydrolases (EC. 3.2.1.91), cbh1 (cellobiohydrolase 1) and cbh2 (cellobiohydrolase 2), and the two major specific endo-.beta.-1,4-xylanases (EC 3.3.1.8), xyn1 (endo-1,4-beta-xylanase 1) and xyn2 (endo-1,4-beta-xylanase 2), referred to herein as "major industrially relevant hemicellulases and cellulases" or "MIHCs". These MIHCs work together with additional enzymes to degrade cellulose and xylan, which results in the formation of soluble oligosaccharides and monosaccharides, such as cellobiose, D-glucose, xylobiose and D-xylose. In addition, sophorose is a product of the transglycosylation activity of some of these enzymes (Vaheri et al., 1979). More particularly, these soluble oligo- and monosaccharides (i.e., cellobiose, D-glucose, xylobiose, D-xylose and sophorose) have been reported in the literature to influence the expression of the MICHs in T. reesei. For example, the presence of D-glucose causes CCR, which results in the secretion of low quantities of MIHCs. Sophorose is believed to be the most potent inducer for the expression of cbh1 and cbh2. D-xylose modulates xyn1 and xyn2 expression in a concentration dependent manner.
[0008] In general, the commercial scale production of enzymes/polypeptides by filamentous fungi such as Trichoderma is typically by either solid or submerged culture, including batch, fed batch, and continuous flow processes. For example, one of the most problematic and expensive aspects of industrial cellulase production in Trichoderma is providing the appropriate inducer (i.e., inducing substrate) to the Trichoderma host cells. For example, as is the case for laboratory scale experiments, cellulase (enzyme) production on a commercial scale is "induced" by growing the fungal cells on solid cellulose (i.e., an inducing substrate) or by culturing the cells in the presence of a disaccharide inducer such as "lactose" (i.e., an inducing substrate).
[0009] Unfortunately, on an industrial scale, both methods of "induction" have drawbacks which result in high costs being associated with cellulase production. For example, as set forth above, cellulase synthesis is subject to both cellulose induction and glucose repression. Thus, a critical factor influencing the yield of cellulase enzymes under the control of an inducible promoter is the maintenance of a proper balance between cellulose substrate and glucose concentration (i.e., it is critical for obtaining reasonable commercial yields of the regulated gene product). Although cellulose is an effective and inexpensive inducer, controlling the glucose concentration when filamentous fungal cells are grown on solid cellulose can be problematic. At low concentrations of cellulose, glucose production may be too slow to meet the metabolic needs of active cell growth and function. On the other hand, cellulase synthesis can be halted by glucose repression when glucose generation is faster than its consumption. Thus, expensive process control schemes are required to provide slow substrate addition and monitoring of glucose concentration (Ju and Afolabi, 1999). Moreover, the slow continuous delivery of substrate can be difficult to achieve as a result of the solid nature of the cellulosic materials.
[0010] Some of the problems associated with the use of cellulose as an "inducing substrate" can be overcome through the use of soluble "inducing substrates" such as "lactose", "sophorose" or "gentiobiose". For example, when using lactose as an "inducing substrate", the lactose has to be provided at high concentrations so as to function as an inducer and a carbon source (e.g., see Seiboth, et. al., 2002). Sophorose is a more potent inducer than cellulose, but sophorose is expensive and difficult to manufacture. For example, a mixture of glucose, sophorose and other disaccharides (i.e., generated via enzymatic conversion of glucose) can be used for the efficient production of cellulases, which incurs a greater (production) cost than using glucose alone. Thus, while it is easier to handle and control than solid cellulose, the use of sophorose as an inducing substrate can nonetheless make the cost of producing cellulases prohibitively expensive.
[0011] Based on the foregoing, it is evident that there remains an ongoing and unmet need in the art for cost effective commercial scale production of enzymes/polypeptides by filamentous fungi without the need or requirement of providing costly inducing substrates (e.g., sophorose, lactose and the like) for such production. More particularly, there remains a need in the art for the commercial scale production of one or more endogenous lignocellulosic degrading enzymes by filamentous fungal host cells, wherein such filamentous fungal cells are capable of expressing one or more of these genes in the absence of an inducing substrate. In addition, there are further unmet needs in the art for cost effective production of one or more heterologous protein products expressed and produced in such filamentous fungal host cells, wherein the heterologous genes encoding such proteins are introduced into a fungal host cell, which is capable of expressing such heterologous genes in the absence of an inducing substrate.
BRIEF SUMMARY
[0012] Certain embodiments of the disclosure are related to the commercial scale production of enzymes/polypeptides by filamentous fungi without the need or requirement of providing costly inducing substrates (e.g., sophorose, lactose and the like) for such production. Thus, certain other embodiments are related to variant filamentous fungal cells, compositions thereof and methods thereof for increased production of one or more proteins of interest. For example, certain embodiments of the disclosure are directed to a variant filamentous fungal cell derived from a parental filamentous fungal cell, the variant cell comprising an introduced polynucleotide construct encoding an Ace3 protein comprising about 90% sequence identity to an Ace3 protein of SEQ ID NO: 6, wherein the variant cell produces an increased amount of a protein of interest (POI) in the absence of an inducing substrate relative to the parental cell, wherein the variant and parental cells are cultivated under similar conditions. In certain other embodiments, the variant cell produces an increased amount of a POI in the presence of an inducing substrate relative to the parental cell, wherein the variant and parental cells are cultivated under similar conditions.
[0013] In another embodiment of the variant cell, an encoded Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6, comprises "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids. In another embodiment, an encoded Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6, comprises an N-terminal amino acid fragment of SEQ ID NO: 98 operably linked and preceding SEQ ID NO: 6. In certain other embodiments of the variant cell, the Ace-3 protein comprises about 90% sequence identity to SEQ ID NO: 12. In another embodiment, the introduced polynucleotide encoding an Ace3 protein comprises an open reading frame (ORF) sequence comprising about 90% identity to SEQ ID NO: 5.
[0014] In yet other embodiments of the variant cell, the POI is an endogenous POI or a heterologous POI. Thus, in certain embodiments, the variant cell comprises an introduced polynucleotide construct encoding a heterologous POI. In another embodiment, a polynucleotide construct encoding the heterologous POI is expressed under the control of a cellulose-inducible gene promoter. In certain other embodiments, an endogenous POI is a lignocellulose degrading enzyme. Thus, in other embodiments, a lignocellulose degrading enzyme is selected from the group consisting of cellulase enzymes, hemi-cellulase enzymes, or a combination thereof. In certain other embodiments, a lignocellulose degrading enzyme is selected from the group consisting of cbh1, cbh2, egl1, egl2, egl3, egl4, egl5, egl6, bgl1, bgl2, xyn1, xyn2, xyn3, bxl1, abf1, abf2, abf3, axe1, axe2, axe3, man1, agl1, agl2, agl3, gir1, swo1, cip1 and cip2. In yet other embodiments, a heterologous POI is selected from the group consisting of an .alpha.-amylase, an alkaline .alpha.-amylase, a .beta.-amylase, a cellulase, a dextranase, an .alpha.-glucosidase, an .alpha.-galactosidase, a glucoamylase, a hemicellulase, a pentosanase, a xylanase, an invertase, a lactase, a naringanase, a pectinase, a pullulanase, an acid protease, an alkali protease, a bromelain, a neutral protease, a papain, a pepsin, a peptidase, a rennet, a rennin, a chymosin, a subtilisin, a thermolysin, an aspartic proteinase, a trypsin, a lipase, an esterase, a phospholipase, a phosphatase, a phytase, an amidase, an iminoacylase, a glutaminase, a lysozyme, a penicillin acylase; an isomerase, an oxidoreductases, a catalase, a chloroperoxidase, a glucose oxidase, a hydroxysteroid dehydrogenase, a peroxidase, a lyase, an aspartic .beta.-decarboxylase, a fumarase, a histadase, a transferase, a ligase, an aminopeptidase, a carboxypeptidase, a chitinase, a cutinase, a deoxyribonuclease, an .alpha.-galactosidase, a .beta.-galactosidase, a .beta.-glucosidase, a laccase, a mannosidase, a mutanase, a polyphenol oxidase, a ribonuclease and a transglutaminase.
[0015] In another embodiment of the variant cell, the polynucleotide construct comprises a promoter sequence 5' and operably linked to the polynucleotide sequence encoding an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6. In certain embodiments, the polynucleotide construct further comprises a native ace3 terminator sequence 3' and operably linked to the polynucleotide sequence encoding an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6. In certain other embodiments, the polynucleotide construct is integrated into the fungal cell genome. In certain embodiments, the polynucleotide construct is integrated into a telomere site of the fungal cell genome. In certain other embodiments, the polynucleotide construct is integrated into a glucoamylase (gla1) gene locus of the fungal cell genome. In yet other embodiments, the polynucleotide construct comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In other embodiments, an encoded Ace3 protein comprises an amino acid sequence comprising 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. Thus, in other embodiments, an encoded Ace3 protein comprises an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14.
[0016] In other embodiments, the variant cell comprises a genetic modification which expresses a polynucleotide encoding a wild-type xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 48 or a variant xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 46. In certain other embodiments, the variant cell comprises a genetic modification which reduces or prevents the expression of a gene encoding an endogenous carbon catabolite repressor 1 (Cre1) protein or an Ace1 protein. In yet another embodiment, the variant cell comprises a genetic modification which comprises expressing an Ace2 protein. In other embodiments, the filamentous fungal cell is a Pezizomycotina cell of the Ascomycota subphylum. In certain other embodiments, the filamentous fungal cell is a Trichoderma sp. cell.
[0017] In other embodiments, the disclosure is related a polynucleotide ORF encoding an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14.
[0018] In other embodiments, the disclosure is related a lignocellulose degrading enzyme produced by the variant cell of the disclosure. In other embodiments, the disclosure is related a heterologous POI produced by the variant cell of cell of the disclosure.
[0019] In other embodiments, the disclosure is related to a method for producing an endogenous protein of interest in a Trichoderma sp. fungal cell in the absence of an inducing substrate, the method comprising (i) introducing into the fungal cell a polynucleotide construct comprising in the 5' to 3' direction (a) a first nucleic acid sequence comprising a promoter and (b) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence encodes an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6 and comprises "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids, and (ii) fermenting the cells of step (i) under conditions suitable for fungal cell growth and protein production, wherein such suitable growth conditions do not include an inducing substrate. In certain embodiments of the method, the polynucleotide construct comprises a third nucleic acid sequence 3' and operably linked to the second nucleic acid, wherein the third nucleic acid sequence comprises a native ace3 terminator sequence. In another embodiment, the polynucleotide construct is integrated into the fungal cell genome. In certain embodiments, the polynucleotide construct is integrated into a telomere site of the fungal cell genome. In certain other embodiments, the polynucleotide construct is integrated into a glucoamylase (gla1) gene locus of the fungal cell genome. In other embodiments of the method, the polynucleotide construct comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In other embodiments, the encoded Ace3 protein comprises an amino acid sequence comprising 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In another embodiment, the encoded Ace3 protein comprises an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14.
[0020] In certain embodiments of the method, the step (i) promoter is selected from the group consisting of a rev3 promoter (SEQ ID NO: 15), a bxl promoter (SEQ ID NO: 16), a tkl1 promoter (SEQ ID NO: 17), a PID104295 promoter (SEQ ID NO: 18), a dld1 promoter (SEQ ID NO: 19), a xyn4 promoter (SEQ ID NO: 20), a PID72526 promoter (SEQ ID NO: 21), an axe1 promoter (SEQ ID NO: 22), a hxk1 promoter (SEQ ID NO: 23), a dic1 promoter (SEQ ID NO: 24), an opt promoter (SEQ ID NO: 25), a gut1 promoter (SEQ ID NO: 26) and a pki1 promoter (SEQ ID NO: 27).
[0021] In related embodiments of the method, the endogenous POI is a lignocellulose degrading enzyme. In certain embodiments, the lignocellulose degrading enzyme is selected from the group consisting of cellulase enzymes, hemi-cellulase enzymes, or a combination thereof. In certain embodiments, the cellulase enzymes are selected from the group consisting of cbh1, cbh2, egl1, egl2, egl3, egl4, egl5, egl6, bgl1, bgl2, swo1, cip1 and cip2. In another embodiment, the hemi-cellulase enzymes are selected from the group consisting of xyn1, xyn2, xyn3, xyn4, bxl1, abf1, abf2, abf3, axe1, axe2, axe3, man1, agl1, agl2, agl3 and gir1.
[0022] In other embodiments of the method, step (i) further comprises an introduced polynucleotide construct encoding a heterologous POI. In certain embodiments, the polynucleotide construct encoding the heterologous POI is expressed under the control of a cellulose-inducible gene promoter. In certain embodiments, a cellulose-inducible gene promoter is selected from cbh1, cbh2, egl1, egl2, xyn2 or stp1.
[0023] In other embodiments, the method further comprising a genetic modification which expresses a polynucleotide encoding a wild-type xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 48 or a variant xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 46. In other embodiments, the method further comprising a genetic modification which reduces or prevents the expression of a gene encoding an endogenous carbon catabolite repressor 1 (Cre1) protein or an Ace1 protein. In yet another embodiment, the method further comprising a genetic modification which comprises expressing an Ace2 protein.
[0024] In other embodiments, the disclosure is related to a method for producing an endogenous protein of interest in a Trichoderma sp. fungal cell in the absence of an inducing substrate, the method comprising (i) introducing into the fungal cell a polynucleotide construct comprising in the 5' to 3' direction: (a) a first nucleic acid sequence comprising a promoter and (b) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence encodes an Ace3 protein comprises about 90% sequence identity to SEQ ID NO: 12, and (ii) fermenting the cells of step (i) under conditions suitable for fungal cell growth and protein production, wherein such suitable growth conditions do not include an inducing substrate. In other embodiments, the polynucleotide construct comprises a third nucleic acid sequence 3' and operably linked to the second nucleic acid, wherein the third nucleic acid sequence comprises a native ace3 terminator sequence. In other embodiments of the method, the polynucleotide construct is integrated into the fungal cell genome. In certain embodiments, the polynucleotide construct is integrated into a telomere site of the fungal cell genome. In certain other embodiments, the polynucleotide construct is integrated into a glucoamylase (gla1) gene locus of the fungal cell genome. The other embodiment of the method, the polynucleotide construct comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In certain embodiments, the encoded Ace3 protein comprises an amino acid sequence comprising 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In certain other embodiments, the encoded Ace3 protein comprises an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14.
[0025] Thus, in other embodiments of the method 8, the endogenous POI is a lignocellulose degrading enzyme. In particular embodiments, the lignocellulose degrading enzyme is selected from the group consisting of cellulase enzymes, hemi-cellulase enzymes, or a combination thereof. In another embodiment, the cellulase enzymes are selected from the group consisting of cbh1, cbh2, egl1, egl2, egl3, egl4, egl5, egl6, bgl1, bgl2, swo1, cip1 and cip2. In other embodiments, the hemi-cellulase enzymes are selected from the group consisting of xyn1, xyn2, xyn3, xyn4, bxl1, abf1, abf2, abf3, axe1, axe2, axe3, man1, agl1, agl2, agl3 and gir1.
[0026] In another embodiment of the method, step (i) further comprises an introduced polynucleotide construct encoding a heterologous POI. In certain embodiments, the polynucleotide construct encoding the heterologous POI is expressed under the control of a cellulose-inducible gene promoter. In certain other embodiments of the method, the step (i) promoter is selected from the group consisting of a rev3 promoter (SEQ ID NO: 15), a bxl promoter (SEQ ID NO: 16), a tkl1 promoter (SEQ ID NO: 17, a PID104295 promoter (SEQ ID NO: 18), a dld1 promoter (SEQ ID NO: 19), a xyn4 promoter (SEQ ID NO: 20), a PID72526 promoter (SEQ ID NO: 21), an axe1 promoter (SEQ ID NO: 22), a hxk1 promoter (SEQ ID NO: 23), a dic1 promoter (SEQ ID NO: 24), an opt promoter (SEQ ID NO: 25), a gut1 promoter (SEQ ID NO: 26) and a pki1 promoter (SEQ ID NO: 27). In another embodiment, the method further comprises a genetic modification which expresses a polynucleotide encoding a wild-type xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 48 or a variant xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 46. In certain other embodiments, the method further comprises a genetic modification which reduces or prevents the expression of a gene encoding an endogenous carbon catabolite repressor 1 (Cre1) protein or an Ace1 protein. In yet other embodiments, the method further comprises a genetic modification which comprises expressing an Ace2 protein.
[0027] In certain other embodiments, the disclosure is directed to a method for producing a heterologous protein of interest in a Trichoderma sp. fungal cell in the absence of an inducing substrate, the method comprising (i) introducing into the fungal cell a polynucleotide construct comprising in the 5' to 3' direction: (a) a first nucleic acid sequence comprising a constitutive promoter and (b) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence encodes an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6 and comprises "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids, and (ii) fermenting the cells of step (i) under conditions suitable for fungal cell growth and protein production, wherein such suitable growth conditions do not include an inducing substrate. Thus, in certain embodiments of the method, the fungal cell comprises an introduced polynucleotide construct encoding a heterologous POI, wherein the construct is introduced into in the fungal cell prior to step (i), during step (i) or after step (i). In another embodiment, the polynucleotide construct comprises a third nucleic acid sequence 3' and operably linked to the second nucleic acid, wherein the third nucleic acid sequence comprises a native ace3 terminator sequence. In other embodiments of the method, the polynucleotide construct is integrated into the fungal cell genome. In certain embodiments, the polynucleotide construct is integrated into a telomere site of the fungal cell genome. In other embodiments, the polynucleotide construct is integrated into a glucoamylase (gla1) gene locus of the fungal cell genome.
[0028] In certain other embodiments of the method, the polynucleotide construct comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In another embodiment, the encoded Ace3 protein comprises an amino acid sequence comprising 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In other embodiments, the encoded Ace3 protein comprises an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In other embodiments, the polynucleotide construct encoding the heterologous POI is expressed under the control of a cellulose-inducible gene promoter. In certain other embodiments, the heterologous POI is selected from the group consisting of an .alpha.-amylase, an alkaline .alpha.-amylase, a .beta.-amylase, a cellulase, a dextranase, an .alpha.-glucosidase, an .alpha.-galactosidase, a glucoamylase, a hemicellulase, a pentosanase, a xylanase, an invertase, a lactase, a naringanase, a pectinase, a pullulanase, an acid protease, an alkali protease, a bromelain, a neutral protease, a papain, a pepsin, a peptidase, a rennet, a rennin, a chymosin, a subtilisin, a thermolysin, an aspartic proteinase, a trypsin, a lipase, an esterase, a phospholipase, a phosphatase, a phytase, an amidase, an iminoacylase, a glutaminase, a lysozyme, a penicillin acylase; an isomerase, an oxidoreductases, a catalase, a chloroperoxidase, a glucose oxidase, a hydroxysteroid dehydrogenase, a peroxidase, a lyase, an aspartic .beta.-decarboxylase, a fumarase, a histadase, a transferase, a ligase, an aminopeptidase, a carboxypeptidase, a chitinase, a cutinase, a deoxyribonuclease, an .alpha.-galactosidase, a .beta.-galactosidase, a .beta.-glucosidase, a laccase, a mannosidase, a mutanase, a polyphenol oxidase, a ribonuclease and a transglutaminase.
[0029] In other embodiments of the method, the step (i) promoter is selected from the group consisting of a rev3 promoter (SEQ ID NO: 15), a bxl promoter (SEQ ID NO: 16), a tkl1 promoter (SEQ ID NO: 17, a PID104295 promoter (SEQ ID NO: 18), a dld1 promoter (SEQ ID NO: 19), a xyn4 promoter (SEQ ID NO: 20), a PID72526 promoter (SEQ ID NO: 21), an axe1 promoter (SEQ ID NO: 22), a hxk1 promoter (SEQ ID NO: 23), a dic1 promoter (SEQ ID NO: 24), an opt promoter (SEQ ID NO: 25), a gut1 promoter (SEQ ID NO: 26) and a pki1 promoter (SEQ ID NO: 27). In yet other embodiments, the method further comprises a genetic modification which expresses a polynucleotide encoding a wild-type xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 48 or a variant xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 46. In another embodiment, the method further comprises a genetic modification which reduces or prevents the expression of a gene encoding an endogenous carbon catabolite repressor 1 (Cre1) protein or an Ace1 protein. In yet other embodiments, the method further comprises a genetic modification which comprises expressing an Ace2 protein.
[0030] In another embodiment, the disclosure is directed to a method for producing a heterologous protein of interest in a Trichoderma sp. fungal cell in the absence of an inducing substrate, the method comprising (i) introducing into the fungal cell a polynucleotide construct comprising in the 5' to 3' direction: (a) a first nucleic acid sequence comprising a constitutive promoter and (b) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence encodes an Ace3 protein comprises about 90% sequence identity to SEQ ID NO: 12, and (ii) fermenting the cells of step (i) under conditions suitable for fungal cell growth and protein production, wherein such suitable growth conditions do not include an inducing substrate. In particular embodiments, the fungal cell comprises an introduced polynucleotide construct encoding a heterologous POI, wherein the construct is introduced into in the fungal cell prior to step (i), during step (i) or after step (i). In other embodiments, the polynucleotide construct comprises a third nucleic acid sequence 3' and operably linked to the second nucleic acid, wherein the third nucleic acid sequence comprises a native ace3 terminator sequence. In other embodiments of the method, the polynucleotide construct is integrated into the fungal cell genome. In certain embodiments, the polynucleotide construct is integrated into a telomere site of the fungal cell genome. In other embodiments, the polynucleotide construct is integrated into a glucoamylase (gla1) gene locus of the fungal cell genome. In yet other embodiments, the polynucleotide construct comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In certain embodiments, encoded Ace3 protein comprises an amino acid sequence comprising 95% sequence identity to SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In another embodiment, the encoded Ace3 protein comprises an amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 12 or SEQ ID NO: 14. In another embodiment of the method, the polynucleotide construct encoding the heterologous POI is expressed under the control of a cellulose-inducible gene promoter. In certain embodiments, the heterologous POI is selected from the group consisting of an .alpha.-amylase, an alkaline .alpha.-amylase, a .beta.-amylase, a cellulase, a dextranase, an .alpha.-glucosidase, an .alpha.-galactosidase, a glucoamylase, a hemicellulase, a pentosanase, a xylanase, an invertase, a lactase, a naringanase, a pectinase, a pullulanase, an acid protease, an alkali protease, a bromelain, a neutral protease, a papain, a pepsin, a peptidase, a rennet, a rennin, a chymosin, a subtilisin, a thermolysin, an aspartic proteinase, a trypsin, a lipase, an esterase, a phospholipase, a phosphatase, a phytase, an amidase, an iminoacylase, a glutaminase, a lysozyme, a penicillin acylase; an isomerase, an oxidoreductases, a catalase, a chloroperoxidase, a glucose oxidase, a hydroxysteroid dehydrogenase, a peroxidase, a lyase, an aspartic .beta.-decarboxylase, a fumarase, a histadase, a transferase, a ligase, an aminopeptidase, a carboxypeptidase, a chitinase, a cutinase, a deoxyribonuclease, an .alpha.-galactosidase, a .beta.-galactosidase, a .beta.-glucosidase, a laccase, a mannosidase, a mutanase, a polyphenol oxidase, a ribonuclease and a transglutaminase.
[0031] In other embodiments of the method, the step (i) promoter is selected from the group consisting of a rev3 promoter (SEQ ID NO: 15), a bxl promoter (SEQ ID NO: 16), a tkl1 promoter (SEQ ID NO: 17, a PID104295 promoter (SEQ ID NO: 18), a dld1 promoter (SEQ ID NO: 19), a xyn4 promoter (SEQ ID NO: 20), a PID72526 promoter (SEQ ID NO: 21), an axe1 promoter (SEQ ID NO: 22), a hxk1 promoter (SEQ ID NO: 23), a dic1 promoter (SEQ ID NO: 24), an opt promoter (SEQ ID NO: 25), a gut1 promoter (SEQ ID NO: 26) and a pki1 promoter (SEQ ID NO: 27). In yet other embodiments, the method further comprises a genetic modification which expresses a polynucleotide encoding a wild-type xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 48 or a variant xylanase regulator 1 (Xyr1) protein of SEQ ID NO: 46. In another embodiment, the method further comprises a genetic modification which reduces or prevents the expression of a gene encoding an endogenous carbon catabolite repressor 1 (Cre1) protein or an Ace1 protein. In yet other embodiments, the method further comprises a genetic modification which comprises expressing an Ace2 protein.
[0032] In certain other embodiments, the disclosure is related to a method for genetically modifying a Trichoderma reesei strain for increased production of an endogenous protein in the absence of an inducing substrate, the method comprising (i) screening and identifying a T. reesei strain comprising a genomic copy of an ace3 gene encoding an Ace3-S protein of SEQ ID NO: 3, an Ace3-SC protein of SEQ ID NO: 8 or an Ace3-LC protein of SEQ ID NO: 10, wherein the T. reesei strain identified does not comprise a genomic copy of an ace3 gene encoding an Ace3-L protein of SEQ ID NO: 6, an Ace3-LN protein of SEQ ID NO: 14 or an Ace3-EL protein of SEQ ID NO: 12, (ii) introducing into the T. reesei strain identified in step (i) a polynucleotide construct comprising in the 5' to 3' direction: (a) a first nucleic acid sequence comprising a promoter and (b) a second nucleic acid sequence operably linked to the first nucleic acid sequence, wherein the second nucleic acid sequence encodes an Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6 and comprises "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids or the second nucleic acid sequence encodes an Ace-3 protein comprising about 90% sequence identity to SEQ ID NO: 12, and (iii) fermenting the cells of step (ii) under conditions suitable for fungal cell growth and protein production, wherein such suitable growth conditions do not include an inducing substrate.
[0033] In certain other embodiments, the disclosure is directed to a variant filamentous fungal cell derived from a parental filamentous fungal cell, the variant cell comprising a native ace3 gene promoter replaced by an alternative promoter, wherein the variant cell produces an increased amount of a protein of interest (POI) in the absence of an inducing substrate relative to the parental cell, wherein the variant and parental cells are cultivated under similar conditions. In particular embodiments, the alternative promoter is a Trichoderma reesei promoter. In another embodiment, the alternative promoter is a promoter selected from the group consisting of a rev3 promoter (SEQ ID NO: 15), a bxl promoter (SEQ ID NO: 16), a tkl1 promoter (SEQ ID NO: 17, a PID104295 promoter (SEQ ID NO: 18), a dld1 promoter (SEQ ID NO: 19), a xyn4 promoter (SEQ ID NO: 20), a PID72526 promoter (SEQ ID NO: 21), an axe1 promoter (SEQ ID NO: 22), a hxk1 promoter (SEQ ID NO: 23), a dic1 promoter (SEQ ID NO: 24), an opt promoter (SEQ ID NO: 25), a gut1 promoter (SEQ ID NO: 26) and a pki1 promoter (SEQ ID NO: 27).
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 presents a schematic representation of the Ace3 protein coding regions. More particularly, FIG. 1A presents a schematic representation of the Ace3 protein coding regions based on the annotation of T. reesei strains QM6a and RUT-C30, which are aligned (FIG. 1A) to the same DNA sequence in the genome. The predicted exons and introns are shown as arrows and dash lines, respectively. The dashed-vertical line indicates a non-sense mutation in RUT-C30 genome. The cloned ace3-S (short) open reading frame of SEQ ID NO: 2 and the cloned ace3-L (long) open reading frame of SEQ ID NO: 5 were screened and tested as set forth in the instant application. Set forth in FIG. 1B-FIG. 1D is an amino acid alignment of the Ace3-L protein (SEQ ID NO: 6) from T. reesei strain RUT-C30, the Ace3-S protein from T. reesei strain QM6a (SEQ ID NO: 3), the Ace3-SC protein (SEQ ID NO: 8), the Ace3-LN protein (SEQ ID NO: 14), the Ace3-LC protein (SEQ ID NO: 10) and the Ace3-EL protein (SEQ ID NO: 12).
[0035] FIG. 2 shows a schematic representation of the Ace3-expression vectors pYL1 (FIG. 2A), pYL2 (FIG. 2B), pYL3 (FIG. 2C) and pYL4 (FIG. 2D).
[0036] FIG. 3 presents a Polyacrylamide Gel Electrophoresis (SDS-PAGE) of T. reesei parental and variant cell supernatants, wherein the parental and variant cells were grown in defined medium in srMTP containing 20% lactose (lac) or 20% glucose (glu). Equal volumes of culture supernatants were loaded in each lane. M is molecular weight marker and the parental T. reesei strain served as a control strain.
[0037] FIG. 4 presents a SDS-PAGE of T. reesei parental and variant cell supernatants, wherein the parental and variant cells were grown in defined medium supplemented with either 1.5% glucose/sophorose (sop) or 1.5% glucose (glu) in shake flasks. Equal volumes of culture supernatant were loaded in each lane. The total protein concentrations of the culture supernatants are listed at the bottom of each corresponding lane. M is molecular weight marker and KD is kilodalton.
[0038] FIG. 5 presents a SDS-PAGE of T. reesei parental and variant cells grown in defined medium with either glucose/sophorose (sop) or glucose (glu) as carbon sources in 2 L fermenters. M is molecular weight marker and zero (0) is seed culture supernatant.
[0039] FIG. 6 presents a schematic diagram of a promoter replacement construct made by fusing a DNA fragment comprising a 5' region upstream of the native promoter at the ace3 locus, a loxP-flanked hygromycin B-resistance (selectable marker) cassette and a DNA fragment comprising a promoter of interest operably fused (linked) to the 5' end of the ace3 ORF.
[0040] FIG. 7 shows a schematic representation of Ace3-expression vector pYL8 comprising the dic1 promoter.
[0041] FIG. 8 shows a SDS-PAGE of T. reesei parental and its modified (daughter) cell supernatants, wherein the parental and modified strains were grown in defined medium supplemented with either 2.5% glucose/sophorose ("Sop", inducing condition) or 2.5% glucose ("Glu", non-inducing condition) in shake flasks. Equal volumes of culture supernatant were loaded in each lane. M is molecular weight marker and KD is kilodalton.
[0042] FIG. 9 shows protein production in small scale (2 L) fermentation. The T. reesei parental strain and daughter strain "LT83" were grown in defined medium with either glucose/sophorose (Sop, inducing condition) or glucose (Glu, non-inducing condition) as carbon sources. The total protein produced by the parental strain on glucose/sophorose at the end of fermentation was arbitrarily set at 100, and the relative amounts of protein produced by each strain at each time points were plotted.
[0043] FIG. 10 shows a SDS-PAGE of T. reesei parental and its modified (daughter) cell supernatants, wherein the parental and modified strains were grown in defined medium supplemented with either 2.5% glucose/sophorose ("Sop", inducing condition) or 2.5% glucose ("Glu", non-inducing condition) in shake flasks. Equal volumes of culture supernatant were loaded in each lane. M is molecular weight marker and KD is kilodalton.
[0044] FIG. 11 presents a schematic image of the ace3 locus. The arrows at the 5'-end (N-terminus) of the ace3 locus indicate the different transcription start sites in the form suggested by cDNA sequence (arrow 1), the RutC-30 annotated form (arrow 2) and QM6a annotated form (arrow 3). The arrows at the 3'-end (C-terminus) of the ace3 locus indicate the different Stop codons in the RutC-30 annotated form (arrow 4) and QM6a annotated form (arrow 5).
[0045] FIG. 12 shows a schematic image of the different ace3 forms cloned. Thus, as presented in FIG. 12 and described in Example 6, the following ace3 forms were cloned and tested: "ace3-S" of SEQ ID NO: 1, comprising a 1,713 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4, "ace3-SC" of SEQ ID NO: 7, comprising a 1,713 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4, "ace3-L" of SEQ ID NO: 4, comprising a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4, "ace3-LC" of SEQ ID NO: 9, comprising a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4, "ace3-EL" of SEQ ID NO: 11, comprising a 61 bp Exon 1, a 142 bp Intron 1, a 332 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4, and "ace3-LN" of SEQ ID NO: 13, comprising a 258 bp Exon 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4.
[0046] FIG. 13 shows the nucleic acid sequence of the ace3-SC gene form (SEQ ID NO: 7; comprising a 1,713 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4) and the encoded Ace3-SC protein sequence (SEQ ID NO: 8). As presented in FIG. 13 for the ace3-SC gene form, nucleotides shown in bold black text represent intron sequences.
[0047] FIG. 14 shows the nucleic acid sequence of the ace3-S gene form (SEQ ID NO: 1; comprising a 1,713 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4) and the encoded Ace3-S protein sequence (SEQ ID NO: 3). As presented in FIG. 14 for the ace3-S gene form, nucleotides shown in bold black text represent intron sequences.
[0048] FIG. 15 shows the nucleic acid sequence of the ace3-L gene form (SEQ ID NO: 4, comprising a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4) and the encoded Ace3-L protein sequence (SEQ ID NO: 6). As presented in FIG. 15 for the ace3-L gene form, nucleotides shown in bold black text represent intron sequences.
[0049] FIG. 16 shows the nucleic acid sequence of the ace3-LC gene form (SEQ ID NO: 9, comprising a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4) and the encoded Ace3-LC protein sequence (SEQ ID NO: 10). As presented in FIG. 16 for the ace3-LC gene form, nucleotides shown in bold black text represent intron sequences.
[0050] FIG. 17 shows the nucleic acid sequence of the ace3-EL gene form (SEQ ID NO: 11, comprising a 61 bp Exon 1, a 142 bp Intron 1, a 332 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4) and the encoded Ace3-EL protein sequence (SEQ ID NO: 12). As presented in FIG. 17 for the ace3-EL gene form, nucleotides shown in bold black text represent intron sequences.
[0051] FIG. 18 shows the nucleic acid sequence of the ace3-LN gene form (SEQ ID NO: 13, comprising a 258 bp Exon 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4) and the encoded Ace3-LN protein sequence (SEQ ID NO: 14). As presented in FIG. 18 for the ace3-LN gene form, nucleotides shown in bold black text represent intron sequences.
[0052] FIG. 19 presents a schematic diagram of the arrangement of DNA fragments designed for integration of ace3 forms at the gla1 locus.
[0053] FIG. 20 shows a schematic representation of vector pMCM3282.
[0054] FIG. 21 shows a schematic representation of vector pCHL760.
[0055] FIG. 22 shows a schematic representation of vector pCHL761.
[0056] FIG. 23 shows a SDS-PAGE of secreted proteins produced by submerged cultures (i.e., shake flasks) of T. reesei parental cells (FIG. 23, cell ID 1275.8.1) and variant T. reesei (daughter) cells (FIG. 23, cell ID Nos. 2218, 2219, 2220, 2222 and 2223) under inducing ("Glu/Sop") and non-inducing ("Glu") culture conditions.
BRIEF DESCRIPTION OF THE BIOLOGICAL SEQUENCES
[0057] The following sequences comply with 37 C.F.R. .sctn..sctn. 1.821-1.825 ("Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures--the Sequence Rules") and are consistent with WIP Standard ST.25 (2009) and the sequence listing requirements of the European Patent Convention (EPC) and the Patent Cooperation Treaty (PCT) rules 5.2 and 49.5(a-bis), and section 208 and Annex C of the administrative instructions. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. .sctn. 1.822.
[0058] SEQ ID NO: 1 is a Trichoderma reesei wild-type strain QM6a nucleic acid sequence comprising a gene encoding an Ace3-S protein of SEQ ID NO: 3.
[0059] SEQ ID NO: 2 is a nucleic acid sequence open reading frame (ORF) encoding an Ace3-S protein of SEQ ID NO: 3.
[0060] SEQ ID NO: 3 is the amino acid sequence of a Trichoderma reesei (strain QM6a) Ace3 protein, designated hereinafter, "Ace3-S".
[0061] SEQ ID NO: 4 is a Trichoderma reesei strain Rut-C30 nucleic acid sequence comprising a gene encoding an Ace3-L protein of SEQ ID NO: 6.
[0062] SEQ ID NO: 5 is a nucleic acid sequence ORF encoding an Ace3-L protein of SEQ ID NO: 6.
[0063] SEQ ID NO: 6 is the amino acid sequence of a Trichoderma reesei (strain Rut-C30) Ace3 protein, designated hereinafter, "Ace3-L".
[0064] SEQ ID NO: 7 is a Trichoderma reesei nucleic acid sequence comprising a gene encoding an Ace3-SC protein of SEQ ID NO: 8.
[0065] SEQ ID NO: 8 is the amino acid sequence of a Trichoderma reesei Ace3 protein, designated hereinafter, "Ace3-SC".
[0066] SEQ ID NO: 9 is a Trichoderma reesei nucleic acid sequence comprising a gene encoding an Ace3-LC protein of SEQ ID NO: 10.
[0067] SEQ ID NO: 10 is the amino acid sequence of a Trichoderma reesei Ace3 protein, designated hereinafter, "Ace3-LC".
[0068] SEQ ID NO: 11 is a Trichoderma reesei nucleic acid sequence comprising a gene encoding an Ace3-EL protein of SEQ ID NO: 12.
[0069] SEQ ID NO: 12 is the amino acid sequence of a Trichoderma reesei Ace3 protein, designated hereinafter, "Ace3-EL".
[0070] SEQ ID NO: 13 is a Trichoderma reesei nucleic acid sequence comprising a gene encoding an Ace3-LN protein of SEQ ID NO: 14.
[0071] SEQ ID NO: 14 is the amino acid sequence of a Trichoderma reesei Ace3 protein, designated hereinafter, "Ace3-LN".
[0072] SEQ ID NO: 15 is a nucleic acid sequence comprising a rev3 promoter sequence.
[0073] SEQ ID NO: 16 is a nucleic acid sequence comprising a .beta.-xyl promoter sequence.
[0074] SEQ ID NO: 17 is a nucleic acid sequence comprising a tki1 promoter sequence.
[0075] SEQ ID NO: 18 is a nucleic acid sequence comprising a PID104295 promoter sequence.
[0076] SEQ ID NO: 19 is a nucleic acid sequence comprising a dld1 promoter sequence.
[0077] SEQ ID NO: 20 is a nucleic acid sequence comprising a xyn4 promoter sequence.
[0078] SEQ ID NO: 21 is a nucleic acid sequence comprising a PID72526 promoter sequence.
[0079] SEQ ID NO: 22 is a nucleic acid sequence comprising an axe3 promoter sequence.
[0080] SEQ ID NO: 23 is a nucleic acid sequence comprising a hxk1 promoter sequence.
[0081] SEQ ID NO: 24 is a nucleic acid sequence comprising a dic1 promoter sequence.
[0082] SEQ ID NO: 25 is a nucleic acid sequence comprising an opt promoter sequence.
[0083] SEQ ID NO: 26 is a nucleic acid sequence comprising a gut1 promoter sequence.
[0084] SEQ ID NO: 27 is a nucleic acid sequence comprising a pki1 promoter sequence.
[0085] SEQ ID NO: 28 is a nucleic acid sequence of primer TP13.
[0086] SEQ ID NO: 29 is a nucleic acid sequence of primer TP14.
[0087] SEQ ID NO: 30 is a nucleic acid sequence of primer TP15.
[0088] SEQ ID NO: 31 is a nucleic acid sequence of primer TP16.
[0089] SEQ ID NO: 32 is a nucleic acid sequence of primer TP17.
[0090] SEQ ID NO: 33 is a nucleic acid sequence of primer TP18.
[0091] SEQ ID NO: 34 is a nucleic acid sequence of primer TP19.
[0092] SEQ ID NO: 35 is a nucleic acid sequence of primer TP20.
[0093] SEQ ID NO: 36 is a nucleic acid sequence of primer TP21.
[0094] SEQ ID NO: 37 is a nucleic acid sequence of primer TP22.
[0095] SEQ ID NO: 38 is a nucleic acid sequence of primer TP23.
[0096] SEQ ID NO: 39 is a nucleic acid sequence of primer TP24.
[0097] SEQ ID NO: 40 is a nucleic acid sequence of primer TP25.
[0098] SEQ ID NO: 41 is a nucleic acid sequence of primer TP26.
[0099] SEQ ID NO: 42 is a nucleic acid sequence of plasmid pYL1.
[0100] SEQ ID NO: 43 is a nucleic acid sequence of plasmid pYL2.
[0101] SEQ ID NO: 44 is a nucleic acid sequence of plasmid pYL3.
[0102] SEQ ID NO: 45 is a nucleic acid sequence of plasmid pYL4.
[0103] SEQ ID NO: 46 is an amino acid sequence of a T. reesei xyr1 (A824V) variant protein.
[0104] SEQ ID NO: 47 is an amino acid sequence of a T. reesei Ace2 protein.
[0105] SEQ ID NO: 48 is an amino acid sequence of a T. reesei wild-type xyr1 protein.
[0106] SEQ ID NO: 49 is primer nucleic acid sequence.
[0107] SEQ ID NO: 50 is primer nucleic acid sequence.
[0108] SEQ ID NO: 51 is primer nucleic acid sequence.
[0109] SEQ ID NO: 52 is primer nucleic acid sequence.
[0110] SEQ ID NO: 53 is primer nucleic acid sequence.
[0111] SEQ ID NO: 54 is primer nucleic acid sequence.
[0112] SEQ ID NO: 55 is primer nucleic acid sequence.
[0113] SEQ ID NO: 56 is primer nucleic acid sequence.
[0114] SEQ ID NO: 57 is primer nucleic acid sequence.
[0115] SEQ ID NO: 58 is primer nucleic acid sequence.
[0116] SEQ ID NO: 59 is primer nucleic acid sequence.
[0117] SEQ ID NO: 60 is primer nucleic acid sequence.
[0118] SEQ ID NO: 61 is primer nucleic acid sequence.
[0119] SEQ ID NO: 62 is primer nucleic acid sequence.
[0120] SEQ ID NO: 63 is primer nucleic acid sequence.
[0121] SEQ ID NO: 64 is primer nucleic acid sequence.
[0122] SEQ ID NO: 65 is primer nucleic acid sequence.
[0123] SEQ ID NO: 66 is primer nucleic acid sequence.
[0124] SEQ ID NO: 67 is primer nucleic acid sequence.
[0125] SEQ ID NO: 68 is primer nucleic acid sequence.
[0126] SEQ ID NO: 69 is primer nucleic acid sequence.
[0127] SEQ ID NO: 70 is primer nucleic acid sequence.
[0128] SEQ ID NO: 71 is primer nucleic acid sequence.
[0129] SEQ ID NO: 72 is primer nucleic acid sequence.
[0130] SEQ ID NO: 73 is primer nucleic acid sequence.
[0131] SEQ ID NO: 74 is primer nucleic acid sequence.
[0132] SEQ ID NO: 75 is primer nucleic acid sequence.
[0133] SEQ ID NO: 76 is primer nucleic acid sequence.
[0134] SEQ ID NO: 77 is primer nucleic acid sequence.
[0135] SEQ ID NO: 78 is primer nucleic acid sequence.
[0136] SEQ ID NO: 79 is primer nucleic acid sequence.
[0137] SEQ ID NO: 80 is primer nucleic acid sequence.
[0138] SEQ ID NO: 81 is primer nucleic acid sequence.
[0139] SEQ ID NO: 82 is an artificial nucleic acid sequence.
[0140] SEQ ID NO: 83 is an artificial nucleic acid sequence.
[0141] SEQ ID NO: 84 is an artificial nucleic acid sequence.
[0142] SEQ ID NO: 85 is an artificial nucleic acid sequence.
[0143] SEQ ID NO: 86 is an artificial nucleic acid sequence.
[0144] SEQ ID NO: 87 is an artificial nucleic acid sequence.
[0145] SEQ ID NO: 88 is an artificial nucleic acid sequence.
[0146] SEQ ID NO: 89 is an artificial nucleic acid sequence.
[0147] SEQ ID NO: 90 is an artificial nucleic acid sequence.
[0148] SEQ ID NO: 91 is an artificial nucleic acid sequence.
[0149] SEQ ID NO: 92 is primer nucleic acid sequence.
[0150] SEQ ID NO: 93 is primer nucleic acid sequence.
[0151] SEQ ID NO: 94 is primer nucleic acid sequence.
[0152] SEQ ID NO: 95 is primer nucleic acid sequence.
[0153] SEQ ID NO: 96 is primer nucleic acid sequence.
[0154] SEQ ID NO: 97 is primer nucleic acid sequence.
[0155] SEQ ID NO: 98 is an amino acid sequence comprising a forty-five (45) amino acid fragment of N-terminal sequence of the Ace3-EL protein of SEQ ID NO: 12.
[0156] SEQ ID NO: 99 is a nucleic acid sequence ORF encoding an Ace3-SC protein.
[0157] SEQ ID NO: 100 is a nucleic acid sequence ORF encoding an Ace3-LC protein.
[0158] SEQ ID NO: 101 is a nucleic acid sequence ORF encoding an Ace3-EL protein.
[0159] SEQ ID NO: 102 is a nucleic acid sequence ORF encoding an Ace3-LN protein.
DETAILED DESCRIPTION
I. Overview
[0160] Certain embodiments of the disclosure are directed to variant filamentous fungal cells, compositions thereof and methods thereof for increased production of one or more proteins of interest. More particularly, certain embodiments of the disclosure are directed to variant filamentous fungal cells capable of producing one or more proteins of interest in the absence of an inducing feed (i.e., an inducing substrate such as lactose, sophorose, gentiobiose, cellulose and the like). Thus, certain embodiments of the disclosure are directed to variant filamentous fungal (host) cells derived from parental filamentous fungal cells, wherein the variant host cells comprise a genetic modification which enables the expression of a gene of interest (encoding a protein of interest) in the absence of inducing substrate. The gene of interest (encoding a protein of interest) can be an endogenous filamentous fungal cell gene (e.g., cbh1, chb2, xyn1, xyn2, xyn3, egl1, egl2, egl3, bgl1, bgl2, and the like) or a gene heterologous to the filamentous fungal cell.
[0161] Thus, in certain other embodiments, a variant fungal host cell of the disclosure comprises a genetic modification which increases the expression of an "activator of cellulase expression 3" (ace3) gene encoding an Ace3 protein selected from the group consisting of an Ace3-L protein (SEQ ID NO: 6), an Ace3-EL protein (SEQ ID NO: 12) and an Ace3-LN protein (SEQ ID NO: 14). In other embodiments, a variant fungal host cell of the disclosure comprises a genetic modification which increases the expression of a polynucleotide open reading frame (ORF) encoding an Ace3 protein selected from the group consisting of an Ace3-L protein (SEQ ID NO: 6), an Ace3-EL protein (SEQ ID NO: 12) and an Ace3-LN protein (SEQ ID NO: 14). Thus, in certain embodiments, a variant fungal host cell of the disclosure comprises a genetic modification which increases the expression/production of an Ace3 gene or ORF thereof encoding a Ace3 protein comprising about 90% to about 99% sequence identity to an Ace3 protein selected from the group consisting of an Ace3-L protein (SEQ ID NO: 6), an Ace3-EL protein (SEQ ID NO: 12) and an Ace3-LN protein (SEQ ID NO: 14).
[0162] In certain embodiments, the genetic modification which increases the expression of an Ace3 protein (i.e., an Ace3-L, Ace3-EL or Ace3-LN protein) is an ace3 expression cassette which has been integrated into the genome (chromosome) of the filamentous fungal host cell. In other embodiments, the genetic modification which increases expression of an Ace3 protein in a filamentous fungal cell is an episomally maintained plasmid construct comprising an ace3 expression cassette (i.e., encoding an Ace3-L, Ace3-EL or Ace3-LN protein). In other embodiments, the genetic modification which increases the expression of an ace3 gene encoding an Ace3-L, Ace3-EL or Ace3-LN protein in a filamentous fungal cell is a telomeric vector/plasmid integrated in a telomere site. In certain embodiments, such expression cassettes or plasmids are present in more than one copy. In certain other embodiments, the ace3 gene, or ace3 ORF, is operably linked to a heterologous promoter. In other embodiments, the genetic modification which increases the expression an ace3 gene (or ORF thereof) encoding an Ace3-L, Ace3-EL or Ace3-LN protein in a filamentous fungal cell is a modification of the native ace3 promoter (i.e., the ace3 promoter region natively associated with the ace3 gene) which modification alters the expression of an ace3 gene encoding an Ace3-L, Ace3-EL or Ace3-LN protein.
II. Definitions
[0163] Prior to describing the present compositions and methods in further detail, the following terms and phrases are defined. Terms not defined should be accorded their ordinary meaning as used and known to one skilled in the art.
[0164] All publications and patents cited in this specification are herein incorporated by reference.
[0165] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the present compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present compositions and methods, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present compositions and methods.
[0166] Certain ranges are presented herein with numerical values being preceded by the term "about". The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating un-recited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. For example, in connection with a numerical value, the term "about" refers to a range of .sup.-10% to .sup.+10% of the numerical value, unless the term is otherwise specifically defined in context. In another example, the phrase a "pH value of about 6" refers to pH values of from 5.4 to 6.6, unless the pH value is specifically defined otherwise.
[0167] The headings provided herein are not limitations of the various aspects or embodiments of the present compositions and methods which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.
[0168] In accordance with this Detailed Description, the following abbreviations and definitions apply. Note that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes, and reference to "the dosage" includes reference to one or more dosages and equivalents thereof known to those skilled in the art, and so forth.
[0169] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely", "only", "excluding", "not including" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.
[0170] It is further noted that the term "comprising", as used herein, means "including, but not limited to", the component(s) after the term "comprising". The component(s) after the term "comprising" are required or mandatory, but the composition comprising the component(s) may further include other non-mandatory or optional component(s).
[0171] It is also noted that the term "consisting of," as used herein, means "including and limited to", the component(s) after the term "consisting of". The component(s) after the term "consisting of" are therefore required or mandatory, and no other component(s) are present in the composition.
[0172] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present compositions and methods described herein. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
[0173] As used herein, the term "Ascomycete fungal cell" refers to any organism in the Division Ascomycota in the Kingdom Fungi. Examples of Ascomycetes fungal cells include, but are not limited to, filamentous fungi in the subphylum Pezizomycotina, such as Trichoderma spp., Aspergillus spp., Myceliophthora spp. and Penicillium spp.
[0174] As used herein, the term "filamentous fungus" refers to all filamentous forms of the subdivision Eumycota and Oomycota. For example, filamentous fungi include, without limitation, Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, or Trichoderma species. In some embodiments, the filamentous fungus may be an Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.
[0175] In some embodiments, the filamentous fungus is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum. In some embodiments, the filamentous fungus is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, or Thielavia terrestris.
[0176] In some embodiments, a filamentous fungus is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride. In some embodiments, the filamentous fungus is a Trichoderma reesei cell derived from T. reesei strain "Rut-C30", which is available from the American Type Culture Collection as Trichoderma reesei ATCC Deposit No. 56765. In some embodiments, the filamentous fungus is a Trichoderma reesei cell derived from T. reesei strain "RL-P37", which is available from the culture collection of the Northern Regional Research Laboratory, US Department of Agriculture as NRRL No. 15709.
[0177] As used herein, the phrases "variant filamentous fungal cell(s)", "variant fungal cell(s)", "variant cell(s)" and the like refer to filamentous fungal cells that are derived (i.e., obtained) from a parental (control) filamentous fungal cell belonging to the Pezizomycotina subphylum. Thus, a "variant" filamentous fungal cell as defined herein is derived from a "parental" filamentous fungal cell, wherein the "variant" cell comprises at least one genetic modification which is not found in the "parental" cell. For example, when comparing a "variant filamentous fungal cell" vis-a-vis a "parental filamentous fungal cell" of the instant disclosure, the "parental" cell serves as the genetically unmodified (parental) "control" cell relative to "variant" cell which comprises the at least one genetic modification.
[0178] As used herein, the term "genetic modification" refers to the alteration/change of a nucleic acid sequence. The modification can include, but is not limited to, a substitution, a deletion, an insertion or a chemical modification of at least one nucleotide in the nucleic acid sequence.
[0179] As defined herein, the phrases "variant cell(s) comprising a genetic modification" and "variant cell(s) comprising a genetic modification which increases the expression of a gene encoding an Ace3-L protein, an Ace3-EL protein and/or an Ace3-LN protein", includes, but is not limited to, the introduction of at least one copy of a gene or ORF encoding an Ace3-L protein, an Ace3-EL protein and/or an Ace3-LN protein into the filamentous fungal cell. Thus, a filamentous fungal cell comprising the exogenously introduced at least one copy of a gene or ORF encoding the Ace3-L protein, the Ace3-EL protein and/or the Ace3-LN protein is a variant fungal cell comprising a genetic modification, relative to the parental fungal cell (which is unmodified).
[0180] In other embodiments, parental fungal cells of the disclosure are screened for the presence of an endogenous ace3 gene encoding any of the Ace3 protein disclosed herein (i.e., an ace3 gene encoding an Ace3-S protein, an Ace3-SC protein, an Ace3-L protein, an Ace3-LC protein, an Ace3-EL protein and an Ace3-LN protein). For example, if a parental fungal cell is determined to comprise an endogenous copy of an ace3 gene encoding an Ace3-L protein, an Ace3-EL protein or an Ace3-LN protein, a variant fungal cell thereof may be generated by genetic modification, such as, e.g., by replacing the endogenous promoter of ace3 gene with a heterologous promoter. Likewise, if a parental fungal cell is determined to comprise an endogenous copy of an ace3 gene encoding an Ace3-S protein, an Ace3-SC protein or an Ace3-LC protein, a variant fungal cell thereof may be generated by genetic modification, e.g., by introducing into the fungal cell a polynucleotide construct encoding an Ace3-L protein, an Ace3-EL protein and/or an Ace3-LN protein of the disclosure, which may further include genetic modification of the endogenous ace3 gene encoding the Ace3-S, Ace3-SC or Ace3-LC protein thereof.
[0181] In other embodiments, variant filamentous fungal cells of the disclosure will comprise further genetic modifications. For example, in certain embodiments, such variant filamentous fungal cells (i.e., comprising an exogenously introduced copy of a gene or ORF encoding an Ace3-L protein, Ace3-EL and/or Ace3-LN protein of the disclosure) further comprise a genetic modification which reduces the expression and/or activity of a gene encoding the carbon catabolite repressor protein "Cre1" or the Ace1 repressor protein.
[0182] In other embodiments, such variant filamentous fungal cells (i.e., comprising an exogenously introduced copy of a gene or ORF encoding an Ace3-L protein, Ace3-EL and/or Ace3-LN protein of the disclosure) further comprise a genetic modification which introduces at least one copy of a xylanase regulator 1 (Xyr1) set forth in SEQ ID NO: 25 or SEQ ID NO: 27.
[0183] As used herein, an "Ace3-L" protein form (SEQ ID NO: 6) and an "Ace3-LN" protein form (SEQ ID NO: 14; see, FIG. 1B) comprise identical amino acid sequences. However, the headings "Ace3-L" and "Ace3-LN" are used in certain embodiments of the disclosure for comparison with certain genes thereof encoding such protein forms, as is in no way meant to limit the present disclosure.
[0184] As used herein, the term "host cell" refers to a filamentous fungal cell that has the capacity to act as a host and expression vehicle for an incoming sequence (i.e., a polynucleotide sequence introduced into the cell), as described herein.
[0185] A "heterologous" nucleic acid construct or sequence has a portion of the sequence which is not native or existing in a native form to the cell in which it is expressed. Heterologous, with respect to a control sequence refers to a control sequence (i.e., promoter or enhancer) that does not function in nature to regulate the same gene the expression of which it is currently regulating. Generally, heterologous nucleic acid sequences are not endogenous to the cell or part of the genome in which they are present, and have been added to the cell, by infection, transfection, transformation, microinjection, electroporation, or the like. A "heterologous" nucleic acid construct may contain a control sequence/DNA coding sequence combination that is the same as, or different from a control sequence/DNA coding sequence combination found in the native cell. Similarly, a heterologous protein will often refer to two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
[0186] As used herein, the term "DNA construct" or "expression construct" refers to a nucleic acid sequence, which comprises at least two DNA polynucleotide fragments. A DNA or expression construct can be used to introduce nucleic acid sequences into a fungal host cell. The DNA may be generated in vitro (e.g., by PCR) or any other suitable techniques. In some preferred embodiments, the DNA construct comprises a sequence of interest (e.g., encoding a Ace3-L protein). In certain embodiments, a polynucleotide sequence of interest is operably linked to a promoter. In some embodiments, the DNA construct further comprises at least one selectable marker. In further embodiments, the DNA construct comprises sequences homologous to the host cell chromosome. In other embodiments, the DNA construct comprises non-homologous sequences to the host cell chromosome.
[0187] As used herein, the terms "cellulase", "cellulolytic enzymes" or "cellulase enzymes" means bacterial or fungal enzymes such as exoglucanases, exocellobiohydrolases, endoglucanases and/or .beta.-glucosidases. These different types of cellulase enzymes act synergistically to convert cellulose and its derivatives to glucose. For example, many microbes make enzymes that hydrolyze cellulose, including the wood rotting fungus Trichoderma, the compost bacteria Thermomonospora (now Thermobifida), Bacillus, and Cellulomonas; Streptomyces; and the fungi Humicola, Aspergillus and Fusarium. The enzymes made by these microbes are mixtures of proteins with three types of actions useful in the conversion of cellulose to glucose: endoglucanases (EG), cellobiohydrolases (CBH), and .beta.-glucosidase (BG). As defined herein, the terms "endoglucanases" (EG), "cellobiohydrolases" (CBH) and ".beta.-glucosidase" (BG) are used interchangeably with their abbreviations "EG", "CBH" and "BG", respectively.
[0188] As used herein, the term "carbon limitation" is a state wherein a microorganism has just enough carbon to produce a desired protein product, but not enough carbon to completely satisfy the organism's requirement, e.g., sustain growth. Therefore, the maximal amount of carbon goes toward protein production.
[0189] As used herein, the term "promoter" refers to a nucleic acid sequence that functions to direct transcription of a downstream gene or an open reading frame (ORF) thereof. The promoter will generally be appropriate to the host cell in which the target gene is being expressed. The promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed "control sequences") is necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. In certain embodiments, the promoter is an inducible promoter. In other embodiments, the promoter is a constitutive promoter.
[0190] As used herein, a "promotor sequence" is a DNA sequence which is recognized by the particular filamentous fungus for expression purposes. A "promoter" is defined as an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation. The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence. Thus, a nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA encoding a secretory leader (i.e., a signal peptide) is operably linked to DNA encoding a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. In other embodiments, linking is accomplished by seamless cloning methods where DNA were joined in a sequence-independent and scar-less manner. The seamless cloning is typically performed with, but not limited to, commercially available systems, such as Gibson Assembly (NEB), NEBuilder HiFi DNA Assembly (NEB), Golden Gate Assembly (NEB), and GeneArt Seamless cloning and Assembly system (ThermoFisher Scientific).
[0191] As used herein, the term "coding sequence" refers to a nucleotide sequence, which directly specifies the amino acid sequence of its (encoded) protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with an ATG start codon. The coding sequence typically includes DNA, cDNA, and recombinant nucleotide sequences.
[0192] As defined herein, an "open reading frame" (hereinafter, an "ORF") means a nucleic acid or nucleic acid sequence (whether naturally occurring, non-naturally occurring, or synthetic) comprising an uninterrupted reading frame consisting of (i) an initiation codon, (ii) a series of two (2) of more codons representing amino acids, and (iii) a termination codon, the ORF being read (or translated) in the 5' to 3' direction.
[0193] As used herein, the term "gene" means the segment of DNA involved in producing a polypeptide chain, that may or may not include regions preceding and following the coding region (e.g., 5' untranslated (5' UTR) or "leader" sequences and 3' UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons). The gene may encode commercially important industrial proteins or peptides, such as enzymes (e.g., proteases, mannanases, xylanases, amylases, glucoamylases, cellulases, oxidases, lipases and the like). The gene of interest may be a naturally occurring gene, a mutated gene or a synthetic gene.
[0194] As used herein, the term "recombinant" when used with reference to a cell, a nucleic acid, a protein, or a vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein, or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
[0195] The term "vector" is defined herein as a polynucleotide designed to carry nucleic acid sequences to be introduced into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage or virus particles, DNA constructs, cassettes and the like. Expression vectors may include regulatory sequences such as promoters, signal sequences, a coding sequences and transcription terminators.
[0196] An "expression vector" as used herein means a DNA construct comprising a coding sequence that is operably linked to suitable control sequences capable of effecting expression of a protein in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation.
[0197] As used herein, the term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (i.e., a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
[0198] As used herein, the term "induction" refers to the increased transcription of a gene resulting in the synthesis of a protein of interest (hereinafter, a "POI") in a filamentous fungal cell at a markedly increased rate in response to the presence of an "inducer" (i.e., inducing substrate). To measure the "induction" of a "gene of interest" (hereinafter, a "GOI") or an "ORF of interest" encoding a POI, variant filamentous fungal (host) cells are treated with a candidate inducing substrate (inducer) and are compared vis-a-vis to parental filamentous fungal (control, unmodified) cells which are not treated with the inducing substrate (inducer). Thus, the (untreated) parental (control) cells are assigned a relative protein activity value of 100%, wherein induction of the GOI encoding the POI in the variant host cells is achieved when the activity value (i.e., relative to the control cells) is greater than 100%, greater than 110%, more preferably 150%, more preferably 200-500% (i.e., two to five fold higher relative to the control), or more preferably 1000-3000% higher.
[0199] As used herein, the terms "inducer", "inducers", "inducing substrate" or "inducing substrates" are used interchangeably and refer to any compounds that cause filamentous fungal cells to produce "increased amounts" of polypeptides (e.g., enzymes, receptors, antibodies and the like) or other compounds/substances than they would produce if the inducing substrate was absent. Examples of inducing substrates include, but are not limited to, sophorose, lactose, gentibiose and cellulose.
[0200] As used herein, the term "inducing feed" refers to a composition comprising at least an "inducing substrate" which is fed to filamentous fungal cells, wherein such inducing feed induces the production of a POI.
[0201] As used herein, the term "isolated" or "purified" refers to a nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
[0202] As defined herein, the terms "protein of interest" or "POI" refer to a polypeptide that is desired to be expressed in a filamentous fungal cell. Such a protein can be an enzyme, a substrate-binding protein, a surface-active protein, a structural protein, and the like, and can be expressed at high levels, and can be for the purpose of commercialization. The protein of interest can be encoded by an endogenous gene or a heterologous gene (i.e., relative to the variant and/or the parental cells). The protein of interest can be expressed intracellularly or as a secreted (extracellular) protein.
[0203] As used herein, the terms "polypeptide" and "protein" (and/or their respective plural forms) are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component). Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
[0204] As used herein, functionally and/or structurally similar proteins are considered to be "related proteins." Such proteins can be derived from organisms of different genera and/or species, or even different classes of organisms (e.g., bacteria and fungi). Related proteins also encompass homologs determined by primary sequence analysis, determined by secondary or tertiary structure analysis, or determined by immunological cross-reactivity.
[0205] As used herein, the phrase "substantially free of an activity," or similar phrases, means that a specified activity is either undetectable in an admixture or present in an amount that would not interfere with the intended purpose of the admixture.
[0206] As used herein, the term "derivative polypeptide" refers to a protein which is derived or derivable from a protein by addition of one or more amino acids to either or both the N- and C-terminal end(s), substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, and/or insertion of one or more amino acids at one or more sites in the amino acid sequence. The preparation of a protein derivative can be achieved by modifying a DNA sequence which encodes for the native protein, transformation of that DNA sequence into a suitable host, and expression of the modified DNA sequence to form the derivative protein.
[0207] Related (and derivative) proteins include "variant proteins." Variant proteins differ from a reference/parental protein (e.g., a wild-type protein) by substitutions, deletions, and/or insertions at a small number of amino acid residues. The number of differing amino acid residues between the variant and parental protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. Variant proteins can share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with a reference protein. A variant protein can also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.
[0208] As used herein, the term "homologous protein" refers to a protein that has similar activity and/or structure to a reference protein. It is not intended that homologs necessarily be evolutionarily related. Thus, it is intended that the term encompass the same, similar, or corresponding enzyme(s) (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homolog that has a quaternary, tertiary and/or primary structure similar to the reference protein. In some embodiments, homologous proteins induce similar immunological response(s) as a reference protein. In some embodiments, homologous proteins are engineered to produce enzymes with desired activity(ies).
[0209] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, Wis.); and Devereux et al., 1984).
[0210] As used herein, the phrases "substantially similar" and "substantially identical", in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or more, compared to the reference (i.e., wild-type) sequence. Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters.
[0211] As used herein, the term "gene" is synonymous with the term "allele" in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, therefore a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.
[0212] As used herein, the terms "wild-type" and "native" are used interchangeably and refer to genes, proteins, fungal cells or strains as found in nature.
[0213] As used herein, "deletion of a gene," refers to its removal from the genome of a host cell. Where a gene includes control elements (e.g., enhancer elements) that are not located immediately adjacent to the coding sequence of a gene, deletion of a gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements, including but not limited to, for example, promoter and/or terminator sequences.
[0214] As used herein, "disruption of a gene" refers broadly to any genetic or chemical manipulation, i.e., mutation, that substantially prevents a cell from producing a functional gene product, e.g., a protein, in a host cell. Exemplary methods of disruption include complete or partial deletion of any portion of a gene, including a polypeptide-coding sequence, a promoter, an enhancer, or another regulatory element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations, thereof, any of which mutations substantially prevent the production of a function gene product. A gene can also be disrupted using RNAi, antisense, CRISPR/Cas9 or any other method that abolishes, reduces or mitigates gene expression.
[0215] As used herein, the phrase a "variant [host] cell comprising a `genetic modification` which increases the expression of a gene encoding an Ace3-L protein, Ace3-EL and/or Ace3-LN protein of the disclosure" comprises introducing (e.g., via transformation) into the host cell a plasmid or a chromosomal integration cassette comprising an ace3 gene form (or an ORF thereof) encoding such Ace3-L protein, Ace3-EL and/or Ace3-LN proteins. In certain other embodiments, such as when a parental fungal cell natively comprises an endogenous gene form encoding an Ace3-L protein, Ace3-EL and/or Ace3-LN protein, the phrase a "variant [host] cell comprising a `genetic modification` which increases the expression of a gene encoding an Ace3-L protein, Ace3-EL and/or Ace3-LN protein" includes replacing the native/wild-type ace3 gene promoter with a heterologous promoter.
[0216] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.
[0217] As used herein, the term "cell broth" refers collectively to medium and cells in a liquid/submerged culture.
[0218] As used herein, the term "cell mass" refers to the cell component (including intact and lysed cells) present in a liquid/submerged culture. Cell mass can be expressed in dry or wet weight.
[0219] As used herein, a "functional polypeptide/protein" is a protein that possesses an activity, such as an enzymatic activity, a binding activity, a surface-active property, or the like, and which has not been mutagenized, truncated, or otherwise modified to abolish or reduce that activity. Functional polypeptides can be thermostable or thermolabile, as specified.
[0220] As used herein, "a functional gene" is a gene capable of being used by cellular components to produce an active gene product, typically a protein. Functional genes are the antithesis of disrupted genes, which are modified such that they cannot be used by cellular components to produce an active gene product, or have a reduced ability to be used by cellular components to produce an active gene product.
[0221] As used herein, a "protein of interest" is a protein that is desired to be produced in a submerged culture of filamentous fungus cells. Generally, proteins of interest are commercially important for industrial, pharmaceutical, animal health, and food and beverage use, making them desirable to produce in large quantities. Proteins of interest are to be distinguished from the myriad other proteins expressed by the filamentous fungus cells, which are generally not of interest as products and are mainly considered background protein contaminants.
[0222] As used herein, a "variant fungal host cell" produces "substantially more protein per unit amount of biomass" than a "parental fungal cell" if the amount of protein produced by the variant cell is at least 5% increased, at least 10% increased, at least 15% increased, or more, compared to the parental cells, wherein the amount of protein is normalized to the total amount of biomass of cells from which protein production is measured, wherein biomass can be expressed in terms of either wet (e.g., of cell pellet) or dry weight.
III. Activator of Cellulase Expression 3 (ace3)
[0223] Recently, transcription profiling data from Trichoderma reesei cultures (Hakkinen et al., 2014) in which cellulase/hemicellulase production was "induced" (i.e., via the addition different inducing compositions; e.g., sophorose, lactose) was examined to identify putative "regulators" of cellulase and hemicellulase gene expression and a candidate gene encoding a regulatory protein was identified. Hakkinen et al. (2014) identified this candidate gene (see, Hakkinen et al. FIG. 2 and Table 2) as Gene ID No. 77513 (wherein Gene ID Numbers are as in the T. reesei database 2.0) and named the candiate gene "Activator of Cellulase Expression 3" (hereinafter, "ace3") and the encoded protein (i.e., a candidate transcription factor) "Ace3". More particularly, the Hakkinen et al. (2014) study used the predicted ace3 ORF (SEQ ID NO: 2), based on the publicly available genome sequence of T. reesei strain QM6a (see, genome.jgi.doe.gov/Trire2/Trire2.home.html), wherein the QM6a predicted annotation (Gene ID 77513) consists of two exons and one intron (e.g., see, FIG. 1).
[0224] As described herein and further set forth below in the Examples section, Applicants of the instant disclosure discovered surprising and unexpected results when comparing and evaluating the cloned ace3 ORF described in Hakkinen et al., 2014 (i.e., based on the T. reesei "QM6a strain" annotation of Ace3) relative to an ace3 ORF based on the T. reesei "RUT-C30 strain" annotation. For example, as set forth in Example 1 below, the T. reesei "QM6a strain" ace3 gene of SEQ ID NO: 1 (and the ORF of SEQ ID NO: 2) encodes a shorter Ace3 protein of SEQ ID NO: 3 (referred to herein as "Ace3-S") relative to the T. reesei "RUT-C30 strain" ace3 gene of SEQ ID NO: 4 (or ORF of SEQ ID NO: 5), which encodes a longer Ace3 protein of SEQ ID NO: 6 (referred to herein as "Ace3-L").
[0225] In contrast, the ace3 ORF predicted from the publicly available genome sequence of T. reesei strain Rut-C30 (see, genome.jgi.doe.gov/TrireRUTC30_1/TrireRUTC30_1. home.html) (Gene ID 98455) comprises a longer protein sequence (i.e., relative to the Ace3-S from T. reesei QM6a) comprising three exons and two introns (FIG. 1A). More particularly, the start codon predicted by the "RUT-C30" model is located upstream of that in the "QM6a" model, and there is a non-sense mutation at the C-terminus (Poggi-Parodi et al., 2014), resulting in a longer N-terminal sequence and shorter C-terminal sequence (e.g., see FIG. 1B).
[0226] Likewise, as described in Example 6 below, the position of the 5' end of the ace3 gene coding region is not obvious, and as such, Applicant further evaluated the 5' end of the ace3 gene as described herein. As briefly stated above, annotation of the DNA sequence at the Joint Genome Institute (JGI) differed between mutant strain Rut-C30 and the wild-type strain QM6a, even though the DNA sequence is the same. In the QM6a case, the 5' end of the coding region was suggested to be upstream of exon 3 and within intron 2 (as shown in FIG. 11). In the Rut-C30 case, the 5' end of the coding region is within exon 2 (FIG. 11).
[0227] Further analysis of the genomic DNA sequence and additional cDNA sequence suggested the possible existence of "exon 1" and "intron 1" (as shown in FIG. 11). In addition, the 3' end of the ace3 coding region in Rut-C30 comprised a mutation creating a premature stop codon, relative to the sequence of the wild-type isolate QM6a (FIG. 11). Thus, as described in Example 6, Applicant examined the effects of over-expression of these different possible forms of the ace3 gene as shown in FIG. 12.
[0228] Furthermore, as set forth in the Examples below, Applicant constructed (Example 1) and tested (Examples 2-4) the genes encoding the Ace3-S protein (SEQ ID NO: 3) and Ace3-L protein (SEQ ID NO: 6) by transforming T. reesei cells with one of four different ace3 expression vectors named "pYL1", "pYL2", "pYL3" and "pYL4" (see, FIG. 2A-2D plasmid maps). More specifically (Example 1), these expression vectors contain a vector backbone with the bacterial ColE1 ori and AmpR gene for replication and selection in E. coli. In addition, the expression vectors (see, FIG. 2A-2D) comprise a T. reesei pyr2 selection marker and a heterologous T. reesei promoter sequence (i.e., promoters of hxk1 or pki1) operably linked to the ace3 ORF coding sequence (ace3-L or ace3-S) with its native terminator.
[0229] Subsequently, the stable T. reesei transformants generated (i.e., variant host cells A4-7, B2-1, C2-28 and D3-1) were tested/screened in slow release microtiter plates (srMTPs) (Example 2), shake flasks (Example 3) and small scale fermentation (Example 4) under both "inducing" and "non-inducing" conditions, and the culture supernatants harvested and analyzed via polyacrylamide gel electrophoresis (see, FIG. 3-FIG. 5). As presented in these Examples, all of the host cells tested (i.e., parental, variant A4-7, variant B2-1, variant C2-28 and variant D3-1) secreted a high quantity of proteins in the presence of an inducing substrate (i.e., sophorose or lactose). In contrast, it was surprisingly observed that in the absence of an inducing substrate (i.e., sophorose or lactose), wherein "glucose" was the sole carbon source, only the variant host cells expressing the ace3-L ORF (i.e., variants A4-7 and C2-28) were capable of producing secreted proteins, while the parental (control) cells and variant host cells expressing the ace3-S ORF (i.e., variants B2-1 and D3-1) did not produce any detectable secreted proteins.
[0230] In other embodiments, the disclosure further demonstrates enhanced protein production under "non-inducing" conditions using thirteen (13) different promoters to drive the expression of ace3-L (Example 5) expression constructs. For example, the thirteen promoters tested included (i) a formamidase gene (rev3; Protein ID 103041) promoter (SEQ ID NO: 15), (ii) a J3-xylosidase gene (bxl; Protein ID 121127) promoter (SEQ ID NO: 16), (iii) a transketolase gene (tkl1; Protein ID 2211) promoter (SEQ ID NO: 17), (iv) a gene of unknown function (Protein ID 104295) promoter (SEQ ID NO: 18), (v) an oxidoreductase gene (did1; Protein ID 5345) promoter (SEQ ID NO: 19), (vi) a xylanase IV gene (xyn4; Protein ID 111849) promoter (SEQ ID NO: 20), (vii) an .alpha.-glucuronidase gene (Protein ID 72526) promoter (SEQ ID NO: 21), (viii) an acetyl xylan esterase gene 1 (axel; Protein ID 73632) promoter (SEQ ID NO: 22), (ix) a hexose kinase gene (hxk1; Protein ID 73665) promoter (SEQ ID NO: 23), (x) a mitochondrial carrier protein gene (dic1; Protein ID 47930) promoter (SEQ ID NO: 24), (xi) an oligopeptide transporter gene (opt; Protein ID 44278) promoter (SEQ ID NO: 25), (xii) a glycerol kinase gene (gut1; Protein ID 58356) promoter (SEQ ID NO: 26) and (xiii) a pyruvate kinase gene (pki1; Protein ID 78439) promoter (SEQ ID NO: 27). As shown in Table 3, the parental T. reesei cells only produced secreted proteins in the presence of the sophorose inducer. In contrast, the variant (daughter) T. reesei cells, comprising and expressing Ace3-L driven from any one of thirteen different promoters, produced similar amounts of secreted protein, under both inducing and non-inducing conditions. Also describe in Example 5, the T. reesei parental strain and transformants thereof were further tested in shake flasks experiments and small scale fermentation. As show in FIG. 8, the parental (control) T. reesei cells only produced secreted proteins in the presence of the sophorose ("Sop") inducer, whereas daughter strain LT83 produced similar amounts of secreted protein, under both inducing ("Sop") and non-inducing ("Glu") conditions. Likewise, as shown in FIG. 9, the parental (control) T. reesei strain only produced secreted proteins in the presence of the sophorose inducer ("Sop"), whereas daughter strain LT83 produced similar amounts of protein, under both inducing ("Sop") and non-inducing ("Glu") conditions.
[0231] Example 6 of the disclosure describes an experimental study of the effects of over-expressing the different possible forms of the ace3 gene (e.g., see, mutant strain Rut-C30/wild-type strain QM6a genome sequence annotations discussion above, FIG. 11 and FIG. 12). Thus, the different forms of ace3 depicted in FIG. 12 were over-expressed in T. reesei, wherein the over-expression vectors for the T. reesei ace3 genes were designed to enable targeted integration of ace3 at the glucoamylase locus (gla1) in T. reesei. Thus, the constructs presented in Table 5 differ by having different forms of the ace3 gene. Likewise, the strains in Table 7 were grown in 24-well microtiter plates in liquid medium with either 2% lactose or 2% glucose as carbon source, wherein the amount of total secreted proteins was measured from the culture supernatants. In both media (i.e., 2% lactose or 2% glucose) the over-expression of the ace3-L, ace3-EL and ace3-LN forms (i.e., with the RutC-30 C-terminal mutation), improved the production of total proteins (Table 8). In the medium with lactose as the carbon source, over-expression of all the forms of ace3 gene improved the production of total proteins to some extent, but the level of improvement was highest in the strains over-expressing the ace3-L, ace3-EL and ace3-LN forms of the ace3 gene (Table 8). Thus, it is clear that high levels of secreted protein are observed under the "non-inducing condition" (i.e., when glucose was used as a carbon source) when over-expressing the ace3-L, ace3-EL and ace3-LN forms of the ace3 gene.
[0232] Example 7 of the disclosure describes a promoter replacement construct (see, FIG. 6) made by fusing a DNA fragment comprising a 5' region upstream of the native promoter at the ace3 locus, a loxP-flanked hygromycin B-resistance selectable marker cassette, and a fragment comprising a promoter of interest operably fused to the 5' end of the ace3 open reading frame. For example, in certain embodiments, a promoter replacement construct is used to replace the endogenous ace3 gene promoter in a Trichoderma reesei cell with an alternate promoter.
[0233] Example 8 of the disclosure describes replacing an endogenous non-lignocellulosic gene of interest promoter, with a lignocellulosic gene of interest promoter. For example, a T. reesei glucoamylase expression construct was assembled from DNA polynucleotide fragments, wherein an ORF sequence encoding a T. reesei glucoamylase was operably linked to a 5' (upstream) T. reesei cbh1 promoter and operably linked to a 3' (downstream) T. reesei cbh1 terminator, which construct further comprised a T. reesei pyr2 gene as selectable marker. The variant (daughter) T. reesei cell (i.e., comprising a genetic modification which increases expression of a gene encoding an Ace3-L protein) was transformed with the glucoamylase expression construct, and transformants were selected and cultured in liquid medium with glucose as carbon source (i.e., without an inducing substrate such as sophorose or lactose) in order to identify those transformants that were able to secrete the T. reesei glucoamylase enzyme during culture. As presented in FIG. 10, the parental T. reesei cells produced 1,029 .mu.g/mL of glucoamylase in defined medium with glucose/sophorose (inducing condition), and only 38 .mu.g/mL of glucoamylase in defined medium with glucose (non-inducing condition), whereas the modified (daughter) strain "LT88", comprising ace3-L driven from the dic1 promoter, produced 3-fold higher glucoamylase under "inducing" ("Sop") conditions (i.e., relative to the parental (control) strain), and produced 2.5-fold higher glucoamylase under "non-inducing" ("Glu") conditions (i.e., relative to the parental (control) strain). Thus, these results demonstrate that the modified (daughter) cells comprising the Ace3-L ORF not only produce extracellular proteins in the absence of an inducer, but these variant cells also produce more total protein than the parental (control) T. reesei cells under such inducing conditions.
[0234] Example 9 describes replacing a natively associated heterologous gene of interest promoter with a lignocellulosic gene of interest promoter. For example, an ORF encoding Buttiauxella sp. phytase (i.e., a heterologous GOI) is operably linked at the 5' end to a T. reesei cbh1 promoter and at the 3' end to a T. reesei cbh1 terminator, wherein the DNA construct further comprises a selectable marker. Variant T. reesei cells (i.e., comprising a genetic modification which increases expression of a gene encoding an Ace3-L protein) is transformed with the phytase expression construct, transformants are selected and cultured in liquid medium with glucose as carbon source (i.e., without an inducing substrate such as sophorose or lactose) in order to identify those transformants that are able to secrete Buttiauxella phytase enzyme during culture.
[0235] Example 10 of the disclosure describes the construction of native ace3 promoter replacement vectors, which vectors contained a Streptococcus pyogenes cas9 gene, expressed under the T. reesei pki1 promoter and guide RNA expressed under a U6 promoter. For example, the cas9 mediated ace3 promoter replacement vectors (pCHL760 and pCHL761) were transformed into T. reesei parental cells, and to test the functionality of ace3 promoter replaced strains, cells were grown in the presence and absence of an inducer substrate (sophorose) in 50 ml submerged culture in shake flasks. As seen on SDS-PAGE, parental cells (FIG. 23, ID 1275.8.1) produced much less secreted protein in defined medium with glucose (non-inducing) compared to glucose/sophorose (induction). In contrast, transformants 2218, 2219, 2220, 2222 and 2223 produced similar amounts of secreted protein under inducing and non-inducing conditions, demonstrating that the variant cells harboring the hxk1 or dic1 promoter (i.e., replacing the native ace3 promoter at ace3 locus) produced extracellular proteins in the absence of an inducer.
[0236] Thus, as contemplated and described herein, certain aspects of the present disclosure are directed to the production of one or more endogenous filamentous fungal lignocellulosic degrading enzymes (i.e., cellulolytic enzymes, e.g., a cellobiohydrolase, a xylanase, an endoglucanase and the like). More specifically, certain embodiments of the disclosure are directed to producing such endogenous enzymes in a variant host cell of the disclosure (i.e., a variant host cell comprising a genetic modification which increases expression of an Ace3-L protein, Ace3-EL and/or Ace3-LN protein), in the complete absence of an inducing substrate. The variant host cells, compositions and methods of the instant disclosure are of particular utility for significantly reducing the cost/expense of producing the aforementioned cellulolytic enzymes, particularly due to the fact such variant host cells of the disclosure do not require an inducing substrate to produce such cellulolytic enzymes (i.e., in contrast to the parental cells which only produce such cellulolytic enzymes in presence of inducing substrates).
[0237] For example, in certain embodiments, the disclosure is directed to variant fungal host cells capable of expressing/producing one or more endogenous proteins of interest in the absence of an inducing substrate and/or one or more heterologous proteins of interest in the absence of an inducing substrate. Therefore, in certain embodiments, a variant fungal host cell of the disclosure (i.e., comprising a genetic modification which increases the expression of Ace3-L protein, Ace3-EL and/or Ace3-LN) is further modified to express an endogenous, non-lignocellulosic protein of interest and/or a heterologous protein of interest. For example, in certain embodiments, a gene encoding an endogenous, non-lignocellulosic protein of interest is modified in the variant fungal host cell. Thus, in certain embodiments, the promoter natively associated with a gene (or ORF) encoding an endogenous, non-lignocellulosic protein of interest is replaced with a promoter from a filamentous fungi gene encoding a lignocellulosic protein (e.g., a 5'-lignocellulosic gene promoter operably linked to an endogenous gene encoding a non-lignocellulosic protein of interest). Likewise, in certain other embodiments, a variant fungal host cell of the disclosure (i.e., comprising a genetic modification which increases the expression of Ace3-L protein, Ace3-EL and/or Ace3-LN) is modified to express a heterologous protein of interest. Thus, in certain other embodiments, the promoter natively associated with a gene encoding a heterologous protein of interest is replaced with a promoter from a filamentous fungi gene encoding a lignocellulosic protein (e.g., a 5'-lignocellulosic gene promoter operably linked to a heterologous gene encoding a heterologous protein of interest).
[0238] Thus, in certain embodiments, the instant disclosure is directed to a variant filamentous fungal cell derived from a parental filamentous fungal cell, wherein the variant cell comprises a genetic modification which increases the expression of a gene encoding an Ace-L protein relative to the parental cell, wherein the encoded Ace3-L protein comprises about 90% sequence identity to the Ace3-L protein of SEQ ID NO: 6. For example, in certain embodiments, an encoded Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6, comprises "Lys-Ala-Ser-Asp" as the last four C-terminal amino acids. In other embodiments, an encoded Ace3 protein comprising about 90% sequence identity to SEQ ID NO: 6, further comprises an N-terminal amino acid fragment of SEQ ID NO: 98 operably linked and preceding SEQ ID NO: 6. In another embodiment, an Ace-3 protein comprises about 90% sequence identity to SEQ ID NO: 12.
[0239] In certain other embodiments, a polynucleotide of the disclosure comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 4, SEQ ID NO: 11 or SEQ ID NO: 13. In other embodiments, a polynucleotide of the disclosure comprises a nucleotide sequence comprising about 90% sequence identity to SEQ ID NO: 5, SEQ ID NO: 101 or SEQ ID NO: 102.
IV. Filamentous Fungal Host Cells
[0240] In certain embodiments of the disclosure, variant filamentous fungal cells (i.e., derived from parental filamentous fungal cells) are provided which comprise a genetic modification which increases the expression of a gene or ORF encoding an Ace3-L polypeptide. More particularly, in certain embodiments, variant filamentous fungal cells (i.e., relative to the parental (control) cells) comprise a genetic modification that increases the expression of a gene (or ORF) encoding an Ace3-L protein of SEQ ID NO: 6. In preferred embodiments, such variant fungal cells comprising a genetic modification which increases the expression of a gene (or ORF) encoding an Ace3-L protein of SEQ ID NO: 6 are capable of producing at least one endogenous protein of interest in the absence of an inducing substrate. In other embodiments, such variant fungal cells comprising a genetic modification which increases the expression of a gene (or ORF) encoding an Ace3-L protein of SEQ ID NO: 6 are capable of producing at least one heterologous protein of interest in the absence of an inducing substrate.
[0241] Thus, in certain embodiments, a filamentous fungal cell for manipulation and use in the present disclosure includes filamentous fungi from the phylum Ascomycota, subphylum Pezizomycotina, particularly fungi that have a vegetative hyphae state. Such organisms include filamentous fungal cells used for the production of commercially important industrial and pharmaceutical proteins, including, but not limited to Trichoderma spp., Aspergillus spp., Fusarium spp., Scedosporium spp., Penicillium spp., Chrysosporium spp., Cephalosporium spp., Talaromyces spp., Geosmithia spp., Myceliophthora spp. and Neurospora spp.
[0242] Particular filamentous fungi include, but are not limited to, Trichoderma reesei (previously classified as Trichoderma longibrachiatum and Hypocrea jecorina), Aspergillus niger, Aspergillus fumigatus, Aspergillus itaconicus, Aspergillus oryzae, Aspergillus nidulans, Aspergillus terreus, Aspergillus sojae, Aspergillus japonicus, Scedosporium prolificans, Neurospora crassa, Penicillium funiculosum, Penicillium chrysogenum, Talaromyces (Geosmithia) emersonii, Fusarium venenatum, Myceliophthora thermophila and Chrysosporium lucknowense.
V. Recombinant Nucleic Acids and Molecular Biology
[0243] In certain embodiments, the instant disclosure is directed to variant filamentous fungal host cells comprising a genetic modification which increases the expression of a gene or ORF encoding an Ace3-L, Ace3-EL or Ace3-LN protein. As set forth above, such variant host cells are capable of producing one or more proteins of interest in the absence of an inducing substrate (i.e., in contrast to the unmodified parental (control) cells).
[0244] Thus, in certain embodiments, the disclosure is directed to recombinant nucleic acids comprising a gene or ORF encoding an Ace3-L, Ace3-EL or Ace3-LN protein. In certain embodiments, a recombinant nucleic acid comprises a polynucleotide expression cassette for production of an Ace3-L, Ace3-EL or Ace3-LN protein in a filamentous fungal host cell. In other embodiments, the polynucleotide expression cassette is comprised within an expression vector. In certain embodiments, the expression vector is a plasmid. In other embodiments, the recombinant nucleic acid, polynucleotide expression cassette or expression vector thereof comprises a nucleotide sequence comprising at least 85% sequence identity to SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 101, SEQ ID NO: 13 or SEQ ID NO: 102. In another embodiment, the recombinant nucleic acid, polynucleotide expression cassette or expression vector thereof comprises a nucleotide sequence encoding an Ace3-L protein comprising about 90% sequence identity to SEQ ID NO: 6.
[0245] In certain other embodiments, the recombinant nucleic acid (or polynucleotide expression cassette thereof or expression vector thereof) further comprises one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, alsl, amdS, hygR, pyr2, pyr4, pyrG, sucA, a bleomycin resistance marker, a blasticidin resistance marker, a pyrithiamine resistance marker, a chlorimuron ethyl resistance marker, a neomycin resistance marker, an adenine pathway gene, a tryptophan pathway gene, a thymidine kinase marker and the like. In a particular embodiment, the selectable marker is pyr2, which compositions and methods of use are generally set forth in PCT Publication No. WO2011/153449. Thus, in certain embodiments, a polynucleotide construct encoding an Ace3 protein of the disclosure comprises a nucleic acid sequence encoding a selectable marker operably linked thereto.
[0246] In another embodiment, the recombinant nucleic acid, polynucleotide construct, polynucleotide expression cassette or expression vector thereof comprises a heterologous promoter driving the expression of the gene (or ORF) encoding an Ace3-L, Ace3-EL or Ace3-LN protein. More particularly, in certain embodiments, the heterologous promoter is a constitutive or an inducible promoter. In particular embodiments, a heterologous promoter is selected from the group consisting of a rev3 promoter, a bxl promoter, a tkl1 promoter, a PID104295 promoter, a dld1 promoter, a xyn4 promoter, a PID72526 promoter, an axe1 promoter, a hxk1 promoter, a dic1 promoter, an opt promoter, a gut1 promoter and apki1 promoter. Without wishing to be bound by a particular theory or mechanism of action, it is contemplated herein that promoters such as rev3, bxl, tkl, PID104295, dld1, xyn4, PID72526, axe1, hxk1, dic1, opt, gut1 and a pki1, which yield higher expression levels under glucose limiting conditions (i.e., vis-a-vis excess glucose concentrations), have particular utility in the instant disclosure. Thus, in certain embodiments, a recombinant nucleic acid (or polynucleotide construct, polynucleotide expression cassette or expression vector thereof) comprises a promoter which is 5' and operably linked to the nucleic acid sequence encoding the Ace3 protein.
[0247] In another embodiment, a recombinant nucleic acid (or polynucleotide construct, polynucleotide expression cassette or expression vector thereof) further comprises a nucleic acid sequence encoding a native ace3 terminator sequence. Thus, in certain embodiments, a recombinant nucleic acid (or polynucleotide construct, polynucleotide expression cassette, or expression vector thereof) comprises a promoter which is 5' and operably linked to a nucleic acid sequence encoding an Ace3 protein and a native ace3 terminator sequence which is 3' and operably linked to a nucleic acid sequence encoding an Ace3 protein (e.g., 5'-Pro-ORF-Term-3', where "Pro" is a constitutive promoter, "ORF" encodes Ace3 and "Term" is a native ace3 terminator sequence).
[0248] Thus, in certain embodiments, standard techniques for transformation of filamentous fungi and culturing the fungi (which are well known to one skilled in the art) are used to transform a fungal host cell of the disclosure. Thus, the introduction of a DNA construct or vector into a fungal host cell includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection mediated and DEAE-Dextrin mediated transfection), incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated microprojectiles, gene gun or biolistic transformation, protoplast fusion and the like. General transformation techniques are known in the art (see, e.g., Ausubel et al., 1987, Sambrook et al., 2001 and 2012, and Campbell et al., 1989). The expression of heterologous proteins in Trichoderma is described, for example, in U.S. Pat. Nos. 6,022,725; 6,268,328; Harkki et al., 1991 and Harkki et al., 1989. Reference is also made to Cao et al. (2000), for transformation of Aspergillus strains.
[0249] Generally, transformation of Trichoderma sp. uses protoplasts or cells that have been subjected to a permeability treatment, typically at a density of 10.sup.5 to 10.sup.7/mL, particularly 2.times.10.sup.6/mL. A volume of 100 .mu.L of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl.sub.2) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives, such as dimethyl sulfoxide, heparin, spermidine, potassium chloride and the like, may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells. See, e.g., U.S. Pat. Nos. 6,022,725 and 6,268,328, both of which are incorporated by reference.
[0250] In certain embodiments, the instant disclosure is directed to the expression and production of one or more proteins of interest which are endogenous to the filamentous fungal host cell (i.e., the endogenous proteins are produced by a variant fungal host cell of the disclosure comprising a genetic modification which increasers expression of Ace3-L). In other embodiments, the disclosure is directed to expressing and producing one or more proteins of interest which are heterologous to the to the filamentous fungal host cell. Therefore, the instant disclosure generally relies on routine techniques in the field of recombinant genetics. Basic texts disclosing the general methods of use in present disclosure include Sambrook et al., (2.sup.nd Edition, 1989); Kriegler (1990) and Ausubel et al., (1994).
[0251] Thus, in certain embodiments, a heterologous gene or ORF encoding a protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the heterologous gene or ORF is typically cloned into an intermediate vector, before being transformed into a filamentous fungal (host) cells for replication and/or expression. These intermediate vectors can be prokaryotic vectors, such as, e.g., plasmids, or shuttle vectors. In certain embodiments, the expression of the heterologous gene or ORF is under the control of its native promoter. In other embodiments, the expression of the heterologous gene or ORF is placed under the control of a heterologous promoter, which can be a heterologous constitutive promoter or a heterologous inducible promoter.
[0252] Those skilled in the art are aware that a natural (native) promoter can be modified by replacement, substitution, addition or elimination of one or more nucleotides, without changing its function. The practice of the invention encompasses but is not constrained by such alterations to the promoter.
[0253] The expression vector/construct typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the heterologous sequence. For example, a typical expression cassette contains a 5' promoter operably linked to the heterologous nucleic acid sequence encoding a protein of interest and may further comprise sequence signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.
[0254] In addition to a promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. Although any fungal terminator is likely to be functional in the present invention, preferred terminators include: the terminator from Trichoderma cbhI gene, the terminator from Aspergillus nidulans trpC gene (Yelton et al., 1984; Mullaney et al., 1985), the Aspergillus awamori or Aspergillus niger glucoamylase genes (Nunberg et al., 1984; Boel et al., 1984) and/or the Mucor miehei carboxyl protease gene (EPO Publication No. 0215594).
[0255] The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include bacteriophages 2 and M13, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc.
[0256] The elements that can be included in expression vectors may also be a replicon, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, or unique restriction sites in nonessential regions of the plasmid to allow insertion of heterologous sequences. The particular antibiotic resistance gene chosen is not dispositive either, as any of the many resistance genes known in the art may be suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in Trichoderma reesei.
[0257] The methods of transformation of the present invention may result in the stable integration of all or part of the transformation vector into the genome of the filamentous fungus. However, transformation resulting in the maintenance of a self-replicating extra-chromosomal transformation vector is also contemplated.
[0258] Many standard transfection methods can be used to produce Trichoderma reesei cell lines that express large quantities of the heterologus protein. Some of the published methods for the introduction of DNA constructs into cellulase-producing strains of Trichoderma include Lorito, Hayes, DiPietro and Harman, 1993, Curr. Genet. 24: 349-356; Goldman, VanMontagu and Herrera-Estrella, 1990, Curr. Genet. 17:169-174; Penttila, Nevalainen, Ratto, Salminen and Knowles, 1987, Gene 6: 155-164, for Aspergillus Yelton, Hamer and Timberlake, 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, for Fusarium Bajar, Podila and Kolattukudy, 1991, Proc. Natl. Acad. Sci. USA 88: 8202-8212, for Streptomyces Hopwood et al., 1985, The John Innes Foundation, Norwich, UK and for Bacillus Brigidi, DeRossi, Bertarini, Riccardi and Matteuzzi, 1990, FEMS Microbiol. Lett. 55: 135-138).
[0259] Any of the known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors and any of the other known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). Also of use is the Agrobacterium-mediated transfection method such as the one described in U.S. Pat. No. 6,255,115. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the heterologous gene.
[0260] After the expression vector is introduced into the cells, the transfected cells are cultured under conditions favoring expression of genes under control of cellulase gene promoter sequences. Large batches of transformed cells can be cultured as described herein. Finally, product is recovered from the culture using standard techniques.
[0261] Thus, the invention herein provides for the expression and enhanced secretion of desired polypeptides whose expression is under control of cellulase gene promoter sequences including naturally occurring cellulase genes, fusion DNA sequences, and various heterologous constructs. The invention also provides processes for expressing and secreting high levels of such desired
VI. Proteins of Interest
[0262] As stated above, certain embodiments of the disclosure are directed to variant filamentous fungal cells (derived from a parental filamentous fungal cells), wherein the variant cells comprise a genetic modification which increases the expression of a gene encoding an Ace3-L, Ace3-EL or Ace3-LN protein (relative to the parental cell), wherein the encoded Ace3-L, Ace3-EL or Ace3-LN protein comprises about 90% sequence identity to the Ace3-L protein of SEQ ID NO: 6 and wherein the variant cells express at least one protein of interest (POI) in the absence of an inducing substrate.
[0263] Certain embodiments of the present disclosure are particularly useful for enhancing the intracellular and/or extracellular production of proteins (i.e., proteins of interest) in the absence of an inducing substrate. The protein of interest may be an endogenous protein (i.e., endogenous in the host cell) or a heterologous protein (i.e., not native in the host cell). Proteins that can be produced according to the instant disclosure include, but are not limited to, hormones, enzymes, growth factors, cytokines, antibodies and the like.
[0264] For example, a protein of interest can include, but is not limited to, a hemicellulase, a peroxidases, a protease, a cellulase, a xylanase, a lipase, a phospholipase, an esterase, a cutinase, a pectinase, a keratinase, a reductase, an oxidase, a phenol oxidase, a lipoxygenase, a ligninase, a pullulanase, a tannase, a pentosanase, a mannanase, a .beta.-glucanase, a hyaluronidase, a chondroitinase, a laccase, a amylase, a glucoamylase, an acetyl esterase, an aminopeptidase, amylases, an arabinases, an arabinosidase, an arabinofuranosidase, a carboxypeptidase, a catalase, a deoxyribonuclease, an epimerase, an .alpha.-galactosidase, a .beta.-galactosidase, an .alpha.-glucanases, a glucan lysase, an endo-.beta.-glucanase, a glucose oxidase, a glucuronidase, an invertase, an isomerase, and the like.
[0265] In certain embodiments, a protein of interest includes, but is not limited to, enzymes disclosed in PCT Application Publication Nos. WO03/027306, WO200352118, WO200352054, WO200352057, WO200352055, WO200352056, WO200416760, WO9210581, WO200448592, WO200443980, WO200528636, WO200501065, WO2005/001036, WO2005/093050, WO200593073, WO200674005, WO2009/149202, WO2011/038019, WO2010/141779, WO2011/063308, WO2012/125951, WO2012/125925, WO2012125937, WO/2011/153276, WO2014/093275, WO2014/070837, WO2014/070841, WO2014/070844, WO2014/093281, WO2014/093282, WO2014/093287, WO2014/093294, WO2015/084596 and WO2016/069541.
[0266] Optimal conditions for the production of the proteins will vary with the choice of the host cell, and with the choice of the protein(s) to be expressed. Such conditions may be readily ascertained by one skilled in the art through routine experimentation and/or optimization.
[0267] The protein of interest can be purified or isolated after expression. The protein of interest may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, and chromatofocusing. For example, the protein of interest may be purified using a standard anti-protein of interest antibody column Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful. The degree of purification necessary will vary depending on the intended use of the protein of interest. In certain instances, no purification of the protein will be necessary.
[0268] In certain other embodiments, to confirm that a genetically modified fungal cell of the disclosure (i.e., a variant fungal host cell comprising a genetic modification which increases the expression of ace3-L) has the capability of producing an increased level of a protein of interest, various methods of screening may be performed. The expression vector may encode a polypeptide fusion to the target protein which serves as a detectable label or the target protein itself may serve as the selectable or screenable marker. The labeled protein may be detected via western blotting, dot blotting (methods available at the Cold Spring Harbor Protocols website), ELISA, or, if the label is GFP, whole cell fluorescence or FACS. For example, a 6-histidine tag would be included as a fusion to the target protein, and this tag would be detected by western blotting. If the target protein expresses at sufficiently high levels, SDS-PAGE combined with Coomassie/silver staining, may be performed to detect increases in variant host cell expression over parental (control) cell, in which case no label is necessary. In addition, other methods may be used to confirm the improved level of a protein of interest, such as, the detection of the increase of protein activity or amount per cell, protein activity or amount per milliliter of medium, allowing cultures or fermentations to continue efficiently for longer periods of time, or through a combination of these methods.
[0269] The detection of specific productivity is another method to evaluate the protein production. Specific productivity (Qp) can be determined by the following equation:
Qp=gP/gDCWhr
wherein "gP" is grams of protein produced in the tank, "gDCW" is grams of dry cell weight (DCW) in the tank, "hr" is fermentation time in hours from the time of inoculation, which include the time of production as well as growth time.
[0270] In other embodiments, the variant fungal host cell is capable of producing at least about 0.5%, for example, at least about 0.5%, at least about 0.7%, at least about 1%, at least about 1.5%, at least about 2.0%, at least about 2.5%, or even at least about 3%, or more of a protein of interest, as compared vis-a-vis to the (unmodified) parental cell.
VII. Fermentation
[0271] In certain embodiments, the present disclosure provides methods of producing a protein of interest comprising fermenting a variant fungal cell, wherein the variant fungal cell secrets the protein of interest. In general, fermentation methods well known in the art are used to ferment the variant fungal cells. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions. A classical batch fermentation is a closed system, where the composition of the medium is set at the beginning of the fermentation and is not altered during the fermentation. At the beginning of the fermentation, the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a "batch" with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures, cells progress through a static lag phase to a high growth log phase and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of product.
[0272] A suitable variation on the standard batch system is the "fed-batch fermentation" system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression likely inhibits the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors, such as pH, dissolved oxygen and the partial pressure of waste gases, such as CO.sub.2. Batch and fed-batch fermentations are common and well known in the art.
[0273] Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and/or product concentration. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate and all other parameters are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off should be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology.
[0274] Certain embodiments of the instant disclosure are related to fermentation procedures for culturing fungi. Fermentation procedures for production of cellulase enzymes are known in the art. For example, cellulase enzymes can be produced either by solid or submerged culture, including batch, fed-batch and continuous-flow processes. Culturing is generally accomplished in a growth medium comprising an aqueous mineral salts medium, organic growth factors, a carbon and energy source material, molecular oxygen, and, of course, a starting inoculum of the filamentous fungal host to be employed.
[0275] In addition to the carbon and energy source, oxygen, assimilable nitrogen, and an inoculum of the microorganism, it is necessary to supply suitable amounts in proper proportions of mineral nutrients to assure proper microorganism growth, maximize the assimilation of the carbon and energy source by the cells in the microbial conversion process, and achieve maximum cellular yields with maximum cell density in the fermentation media.
[0276] The composition of the aqueous mineral medium can vary over a wide range, depending in part on the microorganism and substrate employed, as is known in the art. The mineral media should include, in addition to nitrogen, suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium, in suitable soluble assimilable ionic and combined forms, and also present preferably should be certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, and others, again in suitable soluble assimilable form, all as known in the art.
[0277] The fermentation reaction is an aerobic process in which the molecular oxygen needed is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even substantially pure molecular oxygen, provided to maintain the contents of the fermentation vessel with a suitable oxygen partial pressure effective in assisting the microorganism species to grow in a thriving fashion.
[0278] The fermentation temperature can vary somewhat, but for filamentous fungi such as Trichoderma reesei, the temperature generally will be within the range of about 20.degree. C. to 40.degree. C., generally preferably in the range of about 25.degree. C. to 34.degree. C.
[0279] The microorganisms also require a source of assimilable nitrogen. The source of assimilable nitrogen can be any nitrogen-containing compound or compounds capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. While a variety of organic nitrogen source compounds, such as protein hydrolysates, can be employed, usually cheap nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and various ammonium salts such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonium compounds can be utilized Ammonia gas itself is convenient for large scale operations, and can be employed by bubbling through the aqueous ferment (fermentation medium) in suitable amounts. At the same time, such ammonia can also be employed to assist in pH control.
[0280] The pH range in the aqueous microbial ferment (fermentation admixture) should be in the exemplary range of about 2.0 to 8.0. With filamentous fungi, the pH normally is within the range of about 2.5 to 8.0; with Trichoderma reesei, the pH normally is within the range of about 3.0 to 7.0. Preferences for pH range of microorganisms are dependent on the media employed to some extent, as well as the particular microorganism, and thus change somewhat with change in media as can be readily determined by those skilled in the art.
[0281] Preferably, the fermentation is conducted in such a manner that the carbon-containing substrate can be controlled as a limiting factor, thereby providing good conversion of the carbon-containing substrate to cells and avoiding contamination of the cells with a substantial amount of unconverted substrate. The latter is not a problem with water-soluble substrates, since any remaining traces are readily washed off. It may be a problem, however, in the case of non-water-soluble substrates, and require added product-treatment steps such as suitable washing steps.
[0282] As described above, the time to reach this level is not critical and may vary with the particular microorganism and fermentation process being conducted. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether or not the desired level of carbon source has been achieved.
[0283] The fermentation can be conducted as a batch or continuous operation, fed batch operation is much to be preferred for ease of control, production of uniform quantities of products, and most economical uses of all equipment.
[0284] If desired, part or all of the carbon and energy source material and/or part of the assimilable nitrogen source such as ammonia can be added to the aqueous mineral medium prior to feeding the aqueous mineral medium to the fermenter.
[0285] Each of the streams introduced into the reactor preferably is controlled at a predetermined rate, or in response to a need determinable by monitoring such as concentration of the carbon and energy substrate, pH, dissolved oxygen, oxygen or carbon dioxide in the off-gases from the fermenter, cell density measurable by dry cell weights, light transmittancy, or the like. The feed rates of the various materials can be varied so as to obtain as rapid a cell growth rate as possible, consistent with efficient utilization of the carbon and energy source, to obtain as high a yield of microorganism cells relative to substrate charge as possible.
[0286] In either a batch, or the preferred fed batch operation, all equipment, reactor, or fermentation means, vessel or container, piping, attendant circulating or cooling devices, and the like, are initially sterilized, usually by employing steam such as at about 121.degree. C. for at least about 15 minutes. The sterilized reactor then is inoculated with a culture of the selected microorganism in the presence of all the required nutrients, including oxygen, and the carbon-containing substrate. The type of fermenter employed is not critical.
[0287] The collection and purification of (e.g., cellulase) enzymes from the fermentation broth can also be done by procedures known to one of skill in the art. The fermentation broth will generally contain cellular debris, including cells, various suspended solids and other biomass contaminants, as well as the desired cellulase enzyme product, which are preferably removed from the fermentation broth by means known in the art.
[0288] Suitable processes for such removal include conventional solid-liquid separation techniques such as, e.g., centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration, or other known processes, to produce a cell-free filtrate. It may be preferable to further concentrate the fermentation broth or the cell-free filtrate prior to crystallization using techniques such as ultrafiltration, evaporation or precipitation.
[0289] Precipitating the proteinaceous components of the supernatant or filtrate may be accomplished by means of a salt, e.g., ammonium sulfate, followed by purification by a variety of chromatographic procedures, e.g., ion exchange chromatography, affinity chromatography or similar art recognized procedures.
EXAMPLES
[0290] It should be understood that the following Examples, while indicating embodiments of the disclosure, are given by way of illustration only. From the above discussion and these Examples, one of skill in the art can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Such modifications are also intended to fall within the scope of the claimed invention.
Example 1
Generation of Ace3 Over Expression in Filamentous Fungal Cells
1A. Overview
[0291] In the present example, variant Trichoderma reesei cells (i.e., an exemplary filamentous fungi) expressing an ace3 gene were generated by transforming parental T. reesei cells with a nucleic acid containing the pyr2 gene, a heterologous promoter and an ace3 gene, using protoplast transformation. As generally presented in FIG. 1 and FIG. 2, four (4) different ace3-expression vectors were constructed (FIG. 2A-2D) with two (2) different promoters and two different versions of ace3 ORF (FIG. 1; ace3-SC and ace3-L) in four different combinations. Promoters of hxk1 (gene encoding hexokinase) and pki1 (gene encoding pyruvate kinase) were selected to drive constitutive expression of ace3, however, other promoters can also be used and selected by the skilled artisan.
1B. Trichoderma reesei Host Cells
[0292] The T. reesei parental host cells set forth in the following examples were derived from T. reesei strain RL-P37 (NRRL Deposit No. 15709), wherein the T. reesei pyr2 gene has been deleted, as generally described by Sheir-Neiss and Montenecourt, 1984.
1C. Construction of Ace3 Expression Vectors
[0293] As set forth in the Detailed Description of the disclosure above, Ace3 is a T. reesei transcriptional factor recently shown to be required for cellulase and hemi-cellulase production under inducing conditions (i.e., in the presence of lactose) (Hakkinen et al., 2014). More particularly, Hakkinen et al. (2014) used the predicted ace3 ORF, based on the publicly available genome sequence of T. reesei strain QM6a (see, genome.jgi.doe.gov/Trire2/Trire2.home.html), wherein the QM6a predicted annotation (Protein ID 77513) consists of two exons and one intron (e.g., see, FIG. 1).
[0294] In addition, the ace3 ORF predicted from the publicly available genome sequence of T. reesei strain Rut-C30 (see, (genome.jgi.doe.gov/TrireRUTC30_1/TrireRUTC30_1. home.html) (Protein ID 98455) comprises a longer protein sequence (i.e., relative to the (short) ace3 from T. reesei QM6a) comprising three exons and two introns (FIG. 1). More particularly, the start codon predicted by the "RUT-C30" model is located upstream of that in the "QM6a" model, and there is a non-sense mutation at the C-terminus (Poggi-Parodi et al., 2014), resulting a longer N-terminal sequence and shorter C-terminal protein sequence (FIG. 1).
[0295] In the present Example, both the short ace3 ORF (based on the QM6a annotation, but including the RUT-C30 non-sense mutation that truncates the C-terminus of the protein (Ace3-S)) and the long ace3 ORF (based on the RUT-C30 annotation (Ace3-L)) were cloned. As set forth in FIG. 1, both the short ace3 (Ace3-S) and long ace3 (Ace3-L) ORFs comprise the C-terminal non-sense mutation, as found in RUT-C30 (FIG. 1). To drive the expression of the ace3 ORFs, a heterologous hexose kinase (hxk1) promoter and a heterologous pyruvate kinase (pki1) promoter were tested.
[0296] Thus, four (4) Ace3-expression vectors pYL1, pYL2, pYL3 and pYL4 (FIG. 2A-2D) were constructed using standard molecular biological procedures. These expression vectors contain a vector backbone with the bacterial ColE1 ori and AmpR gene for replication and selection in E. coli. In addition to the T. reesei pyr2 selection marker, a T. reesei promoter sequence (i.e., promoters of hxk1 orpki1), and the ace3 ORF (ace3-L or ace3-SC) with its native terminator are also present. The T. reesei promoters and the ace3 ORFs were PCR amplified from T. reesei genomic DNA using Q5 High-fidelity DNA polymerase (New England Biolabs) and the primers set forth below in Table 1.
[0297] The specific primers used to PCR amplify fragments for each vector are listed as follows. To construct vector pYL1, the hxk1 promoter was amplified using primer pair TP13 (SEQ ID NO: 7) and TP14 (SEQ ID NO: 8), the Ace3-L ORF was amplified using primers TP15 (SEQ ID NO: 9) and TP16 (SEQ ID NO: 10), and the vector backbone was amplified using primer pair TP17 (SEQ ID NO: 11) and TP18 (SEQ ID NO: 12). The complete sequence of plasmid pYL1 is provided as SEQ ID NO: 21.
[0298] To construct vector pYL2, the hxk1 promoter was PCR amplified using primer pair of TP13 (SEQ ID NO: 7) and TP19 (SEQ ID NO: 13), the Ace3-SC ORF was amplified using primers TP20 (SEQ ID NO: 14) and TP16 (SEQ ID NO: 10), and the vector backbone was amplified using primer pair TP17 (SEQ ID NO: 11) and TP18 (SEQ ID NO: 12). The complete sequence of plasmid pYL2 is provided as SEQ ID NO: 22.
[0299] To construct vector pYL3, the pki1 promoter was PCR amplified using primer pair of TP21 (SEQ ID NO: 15) and TP22 (SEQ ID NO: 16), the Ace3-L ORF was amplified using primers TP23 (SEQ ID NO: 17) and TP16 (SEQ ID NO: 10), and the vector backbone was amplified using primer pair TP17 (SEQ ID NO: 11) and TP24 (SEQ ID NO: 18). The complete sequence of plasmid pYL3 is provided as SEQ ID NO: 23.
[0300] To construct vector pYL4, the pki1 promoter was PCR amplified using primer pair of TP21 (SEQ ID NO: 15) and TP25 (SEQ ID NO: 19), the Ace3-SC ORF was amplified using primers TP26 (SEQ ID NO: 20) and TP16 (SEQ ID NO: 10), and the vector backbone was amplified using primer pair TP17 (SEQ ID NO: 11) and TP24 (SEQ ID NO: 18). The complete sequence of plasmid pYL4 is provided as SEQ ID NO: 24.
[0301] For each vector, the three PCR fragments described above were assembled and transformed into NEB DH5a competent cells using Gibson assembly cloning kit (New England Biolabs; Catalogue No.: E5510S) according to manufacturer's protocols. The resulting vectors were sequenced using Sanger sequencing, and their maps are shown in FIG. 2A-2D.
TABLE-US-00001 TABLE 1 Construct Assembly Primers Primer Sequence SEQ NO: TP13 TCAGGGTTATTGTCTCATGGCCATTTAGGCCTGGCAGGCACTGGCTCGGACGACATGT 7 TP14 AGAGCCCTGGGCCGGAGCTGCTGAGCCCATTGTTGAATTCTGGCGGGGTAGCTGTTGA 8 TP15 TCAACAGCTACCCCGCCAGAATTCAACAATGGGCTCAGCAGCTCCGGCCCAGGGCTCT 9 TP16 TCGTAAATAAACAAGCGTAACTAGCTAGCGTAGGTTATGCGAGCAACATTGCACGAAAC 10 TP17 GTTTCGTGCAATGTTGCTCGCATAACCTACGCTAGCTAGTTACGCTTGTTTATTTACGA 11 TP18 ACATGTCGTCCGAGCCAGTGCCTGCCAGGCCTAAATGGCCATGAGACAATAACCCTGA 12 TP19 AGGTGTAAGACGGGGGAGTAGCGCAGCATTGTTGAATTCTGGCGGGGTAGCTGTTGA 13 TP20 TCAACAGCTACCCCGCCAGAATTCAACAATGCTGCGCTACTCCCCCGTCTTACACCT 14 TP21 TCAGGGTTATTGTCTCATGGCCATTTAGGCCTAGACTAGCGGCCGGTCCCCTTATCCCA 15 TP22 AGAGCCCTGGGCCGGAGCTGCTGAGCCCATGGTGAAGGGGGCGGCCGCGGAGCCT 16 TP23 AGGCTCCGCGGCCGCCCCCTTCACCATGGGCTCAGCAGCTCCGGCCCAGGGCTCT 17 TP24 TGGGATAAGGGGACCGGCCGCTAGTCTAGGCCTAAATGGCCATGAGACAATAACCCTGA 18 TP25 TGTAAGACGGGGGAGTAGCGCAGCATGGTGAAGGGGGCGGCCGCGGAGCCT 19 TP26 AGGCTCCGCGGCCGCCCCCTTCACCATGCTGCGCTACTCCCCCGTCTTACA 20
1D. Transformation of T. reesei
[0302] The expression vectors of pYL1, pYL2, pYL3 and pYL4 were linearized using Pad enzyme (New England Biolabs), and transformed into T. reesei parental host cells by polyethylene glycol (PEG)-mediated protoplast transformation (Ouedraogo et al., 2015; Penttila et al., 1987). The transformants were grown on Vogel's minimal medium agar plates to select for uridine prototrophy acquired by the pyr2 marker. Stable transformants were obtained by transfer on Vogel's agar plate for two successive rounds, after which single colonies were obtained by plating dilution of spore suspension. The variant (i.e., modified) host cells harboring pYL1, pYL2, pYL3 and pYL4 were named variant A4-7, variant B2-1, variant C2-28, and variant D3-1, respectively.
Example 2
Protein Production in Slow Release Microtiter Plate (srMTP)
[0303] The present example describes the screening method used to identify transformants (see, Example 1) that secrete enzymes under non-inducing conditions. For example, stable transformants obtained from Example 1 were tested in slow release microtiter plates (srMTP). The srMTP used were 24-well PDMS elastomer plates containing either 20% glucose (wt/wt) or 20% lactose (wt/wt), which were prepared as described in PCT International Publication No. WO2014/047520.
[0304] The parental and variant T. reesei host cells described in Example 1 were tested under both "non-inducing" and "inducing" conditions. In the "non-inducing condition", cells were grown in 1.25 ml liquid broth of defined medium, supplemented with 2.5% glucose (wt/vol) in a srMTP containing 20% glucose (wt/wt). In the "inducing condition", cells were grown in 1.25 ml liquid broth of defined medium supplemented with 2.5% glucose/sophorose (wt/vol) in a srMTP containing 20% lactose (wt/wt), where sophorose and lactose serve as potent inducers for cellulase enzyme expression.
[0305] Preparation of glucose/sophorose was performed as described in U.S. Pat. No. 7,713,725. The defined medium was prepared as generally described in PCT International Publication No. WO2013/096056, comprising 9 g/L casamino acids, 5 g/L (NH.sub.4).sub.2SO.sub.4, 4.5 g/L KH.sub.2PO.sub.4, 1 g/L MgSO.sub.4.7H.sub.2O, 1 g/L CaCl.sub.2.2H.sub.2O, 33 g/L PIPPS buffer (at pH 5.5), 0.25 ml/L T. reesei trace elements. The T. reesei trace elements contains 191.41 g/l citric acid.H.sub.2O, 200 g/L FeSO.sub.4.7H.sub.2O, 16 g/L ZnSO.sub.4.7H.sub.2O, 0.56 g/L CuSO.sub.4.5H.sub.2O, 1.2 g/L MnSO.sub.4.H.sub.2O and 0.8 g/L H.sub.3BO.sub.3. All srMTP's were incubated at 28.degree. C. for approximately 120 hours with continuous shaking at 280 rpm.
[0306] Following incubation, the supernatant from all cultures were harvested and analyzed using Polyacrylamide Gel Electrophoresis (PAGE). Equal volumes of culture supernatants were subjected to a reducing environment for fifteen (15) minutes at 90.degree. C., before addition of loading dye and resolution on a 4-12% NuPage.TM. (Invitrogen, Carlsbad, Calif.) polyacrylamide gel with MOPS-SDS buffer. The gel was stained with SimplyBlue.TM. (Invitrogen) and imaged (see, FIG. 3).
[0307] As shown in FIG. 3, all of the host cells tested secreted a large quantity of proteins in the presence of an inducer (i.e., sophorose in the media and lactose in the srMTP). However, in the absence of an inducer (i.e., sophorose or lactose), where glucose was the only carbon source, only the variant host cells expressing the Ace3-L ORF (i.e., variant A4-7 and variant C2-28) produced secreted proteins, while the parental host cells or variant cells expressing Ace3-SC ORF (i.e., variant B1-1 and variant D3-1) did not produce extracellular proteins above the detection limit of PAGE. This result clearly demonstrates that Ace3-L (i.e., in contrast to Ace3-S) enables inducer-free protein production in T. reesei.
[0308] The relative concentration of secreted proteins was determined by Zorbax C3 reversed phase (RP) analysis using purified enzymes as a reference. For example, the secreted protein profiles of the host cells described above were analyzed using this method, wherein it was observed that all of the host cells (i.e., parental and variant cells) produced similar cellulase protein profiles under the inducing condition, wherein the cellulases consisted of approximately 40% CBH1, 20% CBH2, 10% EG1 and 7% of EG2. Under the non-inducing conditions, cellulase enzymes were below detection in the parental cells and the variant Ace3-S expressing host cells. In contrast, it was surprisingly found that the variant Ace3-L expressing host cells (i.e., variants A4-7 and C2-28) produced a similar ratio of cellulase enzymes as under the inducing conditions.
[0309] Briefly, this method of analysis was performed as follows: supernatant samples were diluted in 50 mM sodium acetate buffer, pH 5.0, and de-glycosylated by addition of 20 ppm EndoH, incubated at 37.degree. C. for 3 hrs. Ten (10) .mu.L 90% acetonitrile was added to 100 .mu.L EndoH-treated sample and passed over a 0.22 .mu.m filter prior to injection. An Agilent 1290 with DAD detection (Agilent Technologies) HPLC equipped with an Agilent Zorbax300 SB C3 RRHD 1.8 um (2.1.times.100 mm) column was used. The column was operating at 60.degree. C. at a flow rate of 1.0 mL/min with 0.1% Trifluoroacetic acid (TFA) in MiliQ water as running buffer A and 0.07% TFA in Acetonitrile as running buffer B. The DAD detector was operating at 220 nm and 280 nm with a 4 nm window. The injection volume was 10 .mu.L.
[0310] Additionally, it was noted that the variant Ace3-L expressing host cells produced approximately 20-30% total extracellular proteins in the srMTP with glucose (i.e., as compared to the total extracellular proteins produced in the srMTP with lactose). This relatively low expression may be due to the high glucose feed rate in srMTP with glucose. For example, it is well established that the highest cellulase and hemi-cellulase production rate is often observed with low growth rates (Arvas et al., 2011). Nevertheless, the srMTP growth assay was a relatively high-throughput assay to screen stable colonies for protein production.
[0311] Taken together, the variant T. reesei host cells expressing the Ace3-L ORF were able to produce cellulase and hemi-cellulase in the absence of an inducer, albeit at a lower protein production rate. More particularly, this low production rate was linked to the srMTP growth method, rather than the production ability of the host cells, as is shown in Example 3 and Example 4 below.
Example 3
Protein Production in Shake Flasks
[0312] To further explore and validate the srMTP results presented above, the parental host cell and variant Ace3-L expressing host cells were grown in the presence and absence of an inducer substrate in 50-mL submerged culture in shake flasks. More particularly, the parental T. reesei host cells, the variant A4-7 cells and the variant C2-28 cells were grown under both inducing conditions (i.e., glucose/sophorose as carbon source) and non-inducing conditions (i.e., glucose as carbon source) in submerged (liquid) culture and their respective extracellular (secreted) protein production levels were compared. Briefly, mycelia of each host cell (i.e., the T. reesei parental host cell, the variant A4-7 host cell and the variant C2-28 host cell) were added separately to 50-mL of YEG broth in a 250-mL Erlenmeyer flask with bottom baffles. The YEG broth contains 5 g/L yeast extract and 22 g/L glucose. The cell cultures were grown for 48 hours, followed by sub-culturing into fresh YEG for another 24 hours. These seed cultures were then inoculated into either 50 mL of defined medium supplemented with 1.5% glucose (non-inducing condition), or 50 mL of defined medium with 1.5% glucose/sophorose (inducing condition) in 250 mL shake flasks with bottom baffles.
[0313] All shake flasks were incubated at 28.degree. C. with continuous shaking at 200 rpm. After 3 days of incubation, supernatant from all cell cultures were harvested and analyzed using PAGE as described in Example 2 above. The total protein in the supernatants were measured by the Bradford dye-binding assay at 595 nm using the Bio-Rad reagent (Thermo Scientific.RTM.; Catalogue No.: 23236) and five dilutions of bovine serum albumin (BSA) as a standard. The glucose concentrations were measured by High Performance Liquid Chromatography (HPLC) analysis, and no glucose was detected in cultures after 3 days of incubation.
[0314] As shown in FIG. 4, the parental (control) T. reesei cells produced 464 .mu.g/mL total secreted protein in defined medium with glucose/sophorose (inducing), and only 140 .mu.g/L of total secreted protein in defined medium with glucose (non-inducing). In contrast, variant A4-7 cells and C2-28 cells produced similar amounts of secreted protein under inducing and non-inducing conditions, both of which are higher than the secreted protein produced in the parental (control) cells with sophorose (induction). Thus, these results demonstrate that the variant cells harboring the Ace3-L ORF (i.e., the variant A4-7 and C2-28 cells) not only produce extracellular proteins in the absence of an inducer, but these variant cells also produce more total protein than the parental (control) T. reesei cells under such inducing conditions.
Example 4
Protein Production in Small Scale Fed-Batch Fermentation
[0315] The instant example shows that the variant Ace3-L expressing cells (i.e., variant A4-7 and C2-28 cells) produced similar amounts of cellulase and hemi-cellulase enzymes in the presence and absence of an inducer substrate in a small scale fermentation. More particularly, T. reesei fermentation was carried out generally as described in U.S. Pat. No. 7,713,725, using seed cultures in citrate minimal medium in a 2 L bioreactor. More specifically, during fermentation, the supernatant from all cultures was harvested at different time points, and equal volumes of the culture supernatants were subjected to PAGE analysis. As is shown in FIG. 5, the parental (control) T. reesei cells only produced secreted proteins in the presence of the sophorose inducer. In contrast, the variant A4-7 and C2-28 cells (FIG. 5) produced similar amounts of protein, both under inducing and non-inducing conditions.
Example 5
Heterologous Promoters for Ace3 Expression
[0316] The present example demonstrates enhanced protein production under "non-inducing" conditions using thirteen (13) different promoters driving the expression of ace3-L. More particularly, T. reesei cells expressing the ace3-L gene were generated by transforming parental T. reesei cells with a telomere vector containing the pyr2 gene, a heterologous promoter and the ace3-L gene, using protoplast transformation.
[0317] Thus, thirteen T. reesei promoters were selected to drive the expression of ace3-L ORF, wherein the thirteen promoters tested include, but are not limited to: (i) a formamidase gene (rev3; Protein ID 103041) promoter (SEQ ID NO: 15), (ii) a .beta.-xylosidase gene (bxl; Protein ID 121127) promoter (SEQ ID NO: 16), (iii) a transketolase gene (tkl1; Protein ID 2211) promoter (SEQ ID NO: 17), (iv) a gene of unknown function (Protein ID 104295) promoter (SEQ ID NO: 18), (v) an oxidoreductase gene (dld1; Protein ID 5345) promoter (SEQ ID NO: 19), (vi) a xylanase IV gene (xyn4; Protein ID 111849) promoter (SEQ ID NO: 20), (vii) an .alpha.-glucuronidase gene (Protein ID 72526) promoter (SEQ ID NO: 21), (viii) an acetyl xylan esterase gene 1 (axe1; Protein ID 73632) promoter (SEQ ID NO: 22), (ix) a hexose kinase gene (hxk1; Protein ID 73665) promoter (SEQ ID NO: 23), (x) a mitochondrial carrier protein gene (dic1; Protein ID 47930) promoter (SEQ ID NO: 24), (xi) an oligopeptide transporter gene (opt; Protein ID 44278) promoter (SEQ ID NO: 25), (xii) a glycerol kinase gene (gut1; Protein ID 58356) promoter (SEQ ID NO: 26) and (xiii) a pyruvate kinase gene (pki1; Protein ID 78439) promoter (SEQ ID NO: 27). Protein ID (PID) numbers are from genome.jgi.doe.gov/Trire2/Trire2.home.html. Thus, the thirteen promoters described above were selected to drive expression because the genes thereof are generally expressed at a low level during growth when glucose concentration is high, and are expressed at a higher level when glucose concentration is low, or under sophorose-inducing conditions.
[0318] Table 2 below summarizes the thirteen promoters and expression vectors thereof, which were constructed using standard molecular biological procedures. More particularly, the expression vectors tested in the instant example (Table 2) comprise a vector backbone with the bacterial ColE1 ori and AmpR gene for replication and selection in E. coli, and the 2.mu. ori and Ura3 gene for replication and selection in Saccharomyces cerevisiae. In addition, T. reesei telomere sequences ("TrTEL"), T. reesei pyr2 selection marker, a T. reesei promoter sequence, and the ace3-L ORF, with its native terminator sequence are present. A representative vector map is shown in FIG. 7, depicting vector pYL8 containing the dic1 promoter. Thus, the other vectors (e.g., pYL9, pYL12, etc.) have the same sequences presented in FIG. 7, except for the different promoter sequences.
TABLE-US-00002 TABLE 2 ACE3-L EXPRESSION CONSTRUCTS UTILIZING DIFFERENT FUNGAL PROMOTERS TO DRIVE ACE3-L EXPRESSION Vector # Promoter ace3 ORF pYL7 opt (SEQ ID NO: 25) ace3-L pYL8 dic1 (SEQ ID NO: 24) ace3-L pYL9 gut1 (SEQ ID NO: 26) ace3-L pYL12 hxk1 (SEQ ID NO: 23) ace3-L pYL13 pki1 (SEQ ID NO: 27) ace3-L pYL22 rev3 (SEQ ID NO: 15) ace3-L pYL23 PID 104295 (SEQ ID NO: 18) ace3-L pYL24 tkl1 (SEQ ID NO: 17) ace3-L pYL25 bxl (SEQ ID NO: 16) ace3-L pYL27 dld1 (SEQ ID NO: 19) ace3-L pYL28 xyn4 (SEQ ID NO: 20) ace3-L pYL29 PID 72526 (SEQ ID NO: 21) ace3-L pYL30 axe1 (SEQ ID NO: 22) ace3-L
[0319] The expression vectors were inserted (transformed) into a T. reesei parental host strain (comprising a non-functional pyr2 gene) by polyethylene glycol (PEG)-mediated protoplast transformation (Ouedraogo et al., 2015; Penttila et al., 1987). The transformants were grown on Vogel's minimal medium agar plates to select for uridine prototrophy acquired by the pyr2 marker. Stable transformants were obtained by transferring on Vogel's agar plate for two successive rounds, followed by two successive rounds of growth on non-selective PDA plates, and one round on Vogel's agar plate, after which single colonies were obtained by plating dilutions of a spore suspension.
[0320] The parental and transformed (daughter) T. reesei host cells described above were tested under both "non-inducing" and "inducing" conditions. For example, in the "non-inducing condition", cells were grown in 1.25 ml liquid broth of defined medium, supplemented with 2.5% glucose (wt/vol) in a regular 24 well microtiter plate (MTP). In the "inducing condition", cells were grown in 1.25 ml liquid broth of defined medium supplemented with 2.5% glucose/sophorose (wt/vol) in an MTP, wherein sophorose serves as a potent inducer for cellulase enzyme expression. Following incubation, the supernatants from all cultures were harvested and the total secreted protein was measured by the Bradford dye-binding assay at 595 nm using the Bio-Rad reagent (Thermo Scientific.RTM.; Catalogue No.: 23236), and five dilutions of bovine serum albumin (BSA) as a standard.
[0321] As shown in Table 3, the parental T. reesei cells only produced high levels of secreted proteins in the presence of the sophorose inducer. In contrast, the variant (daughter) T. reesei cells, comprising and expressing Ace3-L driven from thirteen different promoters, produced similar amounts of secreted protein, under both inducing and non-inducing conditions. As shown in Table 3, the protein levels for each modified (daughter) strain are presented as a ratio which is relative to the protein (concentration) produced by the parental strain (LT4) under glucose/sophorose (Glu/Sop) inducing conditions.
TABLE-US-00003 TABLE 3 TOTAL SECRETED PROTEIN OF T. REESEI PARENTAL STRAIN (LT4) RELATIVE TO MODIFIED T. REESEI (DAUGHTER) STRAINS UNDER INDUCING ("GLU/SOP") AND NON-INDUCING ("GLU") CONDITIONS Strain ID Promoter Glu/Sop.sup.1 Glu.sup.2 LT4 (parental) N/A 1.00 0.20 LT82 opt 1.16 1.07 LT83 dic1 1.35 1.12 LT85 gut1 0.95 1.08 LT86 hxk1 0.96 0.73 LT87 pki1 1.16 0.98 LT149 rev3 0.96 0.76 LT150 PID 104295 0.94 0.41 LT151 tkl1 1.02 1.01 LT152 bxl 1.00 1.04 LT154 dld1 1.00 0.58 LT155 xyn4 0.95 0.95 LT156 PID 72526 0.95 0.89 LT157 axe1 1.01 0.85 Glu/Sop.sup.1 is an abbreviation of "Glucose/Sophorose"; Inducing Condition. Glu.sup.2 is an abbreviation of "Glucose"; Non-Inducing Condition.
[0322] Additionally, the T. reesei parental strain and transformants thereof described above were further tested in shake flasks experiments as generally described in Example 3. For example, a representative result of T. reesei daughter strain "LT83" is shown in FIG. 8, wherein daughter strain LT83 comprises an ace3-L ORF driven from a dic1 promoter (SEQ ID NO: 28). As shown in FIG. 8, the parental (control) T. reesei cells only produced secreted proteins in the presence of the sophorose ("Sop") inducer, whereas daughter strain LT83 produced similar amounts of secreted protein, under both inducing ("Sop") and non-inducing ("Glu") conditions.
[0323] Likewise, small scale fermentations were performed as generally described in Example 4. More particularly, as shown in FIG. 9, the parental (control) T. reesei strain only produced secreted proteins in the presence of the sophorose inducer ("Sop"), whereas daughter strain LT83 produced similar amounts of protein, under both inducing ("Sop") and non-inducing ("Glu") conditions.
Example 6
Cloning of T. reesei ACES Over Expression Constructs
[0324] Although the genome sequence of T. reesei is publicly available at the Joint Genome Institute (https://genome.jgi.doe.gov/), the position of the 5' end of the ace3 coding region is not obvious. For example, annotation of the DNA sequence at the Joint Genome Institute differed between mutant strain Rut-C30 (genome.jgi.doe.gov/TrireRUTC30_1/TrireRUTC30_1. home.html) and the wild-type strain QM6a (genome.jgi.doe.gov/Trire2/Trire2.home.html), even though the DNA sequence is the same. In the QM6a case, the 5' end of the ace3 coding region was suggested to be upstream (5') of exon 3 and within intron 2, as shown in FIG. 11, arrow 3. In the Rut-C30 case, the 5' end of the ace3 coding region is within exon 2 (FIG. 11, arrow 2). Further analysis of the genomic DNA sequence and additional cDNA sequence suggested the possible existence of exon 1 and intron 1, as shown in FIG. 11. In addition, the 3' end of the ace3 coding region in Rut-C30 comprises a mutation, creating a premature stop codon (FIG. 11, arrow 4), relative to the sequence of the wild-type isolate QM6a (FIG. 11, arrow 5). Thus, in the present example, the effects of over-expressing these different possible forms of the ace3 gene were experimentally studied as described herein (e.g., see, FIG. 11, FIG. 12 and FIG. 13-18).
[0325] Thus, the different forms of ace3 depicted in FIG. 12 were over-expressed in T. reesei, wherein the over-expression vectors for the T. reesei ace3 genes were designed to enable targeted integration of ace3 at the glucoamylase locus (gla1) in T. reesei. More particularly, in all of the plasmid (vector) constructs, the T. reesei ace3 gene was expressed under control of the T. reesei dic1 promoter and with the native ace3 terminator. The vectors further comprise a pyr4 marker with its native promoter and terminator for selection of T. reesei transformants A repeat of the pyr4 promoter was included to enable excision of the pyr4 gene after integration at the gla1 locus. The vector backbone enabling replication and amplification in E. coli was EcoRI-XhoI digested pRS426 (Colot et al., 2006). The 5' and 3' flanks of the T. reesei gla1 locus needed for targeted integration, the dic1 promoter, the different forms of the ace3 coding region and terminator were produced by PCR using primers given in Table 4. Template for the flanking fragments was genomic DNA from wild type T. reesei QM6a (ATCC Deposit No. 13631).
TABLE-US-00004 TABLE 4 PRIMERS USED TO GENERATE DNA FRAGMENTS PRIMER SEQUENCE Gla.5F (SID: 49) GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTCCATACGCAGCAAA CATGGGCTTGGGC Gla.5R (SID: 50) GTACGAGTACTAGGTGTGAAGATTCCGTCAAGCTTGGGCGGAATGAAGGAGG ATGTGTGAGAGG DICprom.F (SID: 51) CACACATCCTCCTTCATTCCGCCCAAGCTTGACGGAATCTTCACACCTAGTA CTCGTAC Ace3RutC.R (SID: 52) TGACATTTTTTGTTGTTCCAACACAGCATGCTTAGTCCGACGCCTTCGAGTC CAGCC Ace3term.F (SID: 53) CTGGACTCGAAGGCGTCGGACTAAGCATGCTGTGTTGGAACAACAAAAAATG TC Ace3term.R (SID: 54) GCAGAGCAGCAGTAGTCGATGCTATTAATTAAGTAGGTTATGCGAGCAACAT TG Gla.3F (SID: 55) CTCAGCCTCTCTCAGCCTCATCAGCCGCGGCCGCTGAATCGGCAAGGGGTAG TAC TAG Gla.3R (SID: 56) GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACCACATGCCAGAGTTC GATGCGCAAG Ace3_nointron.F (SID: 57) GTACCTCAGCGCTGTCGATAGCTGCACGCACTGCCGCGATGCCCACGTGCAG TGCAC Ace3_nointron.R (SID: 58) GTGCACTGCACGTGGGCATCGCGGCAGTGCGTGCAGCTATCGACAGCGCTGAG GTACTC Ace3QM.F (SID: 59) GCGGCGCTTCCGCTGTCGTAACTATGCTGCGCTACTCCCCCGTCTTAC DICprom_QM.R (SID: 60) GTAAGACGGGGGAGTAGCGCAGCATAGTTACGACAGCGGAAGCGCCGCCTTAT AAGTG Ace3RutC.F (SID: 61) GGCGGCGCTTCCGCTGTCGTAACTATGGGCTCAGCAGCTCCGGCCCAGGGCTC DICprom_rutc.R (SID: 62) GCCCTGGGCCGGAGCTGCTGAGCCCATAGTTACGACAGCGGAAGCGCCGCCTT ATAAG Ace3cDNA.F (SID: 63) GGCGGCGCTTCCGCTGTCGTAACTATGGCCACAGCGGCCGCGGCAGCAGCTGG DICprom_cDNA.R (SID: 64) CAGCTGCTGCCGCGGCCGCTGTGGCCATAGTTACGACAGCGGAAGCGCCGCCT TATAAG "SID" in the above table is an abbreviation of "Sequence Identification Number", e.g., "SEQ ID NO"
[0326] For the dic1 promoter, ace3 gene and terminator, template was an earlier plasmid pYL8 (See, Example 5) carrying these fragments. Selection marker (pyr4) was obtained from an earlier plasmid with NotI digestion. PCR primers used to generate the desired DNA fragments are shown in Table 4. PCR products and digested fragments were separated using agarose gel electrophoresis. Correct fragments were isolated from the gel with a gel extraction kit (Qiagen) according to manufacturer's protocol. The plasmids were constructed with the fragments described above using yeast homologous recombination method as described in PCT/EP2013/050126 (published as WO2013/102674). Plasmids were rescued from yeast and transformed to E. coli. A few clones were selected, plasmid DNA isolated and sequenced. An overview of the plasmids is presented in Table 5.
TABLE-US-00005 TABLE 5 OVER-EXPRESSION PLASMIDS Gene SEQ Protein SEQ Plasmid Code Cloned gene Selection locus NOTE ID ID B7683 Sc ace3 SC form PYR4 GLA QM6a N-term; 7 8 RutC-30 C-term B7684 S ace3 S form PYR4 GLA QM6a N-term; 1 3 QM6a C-term B7709 L ace3 L form PYR4 GLA RutC-30 N-term; 4 6 RutC-30 C-term B7752 LC ace3 LC form PYR4 GLA RutC-30 N-term; 9 10 QM6a C-term B7778 EL ace3 EL form PYR4 GLA RutC-30 N-term; 11 12 RutC-30 C-term B7779 LN ace3 LN form PYR4 GLA RutC-30 N-term; 13 14 RutC-30 C-term
[0327] Thus, the constructs presented in Table 5 differ by having different forms of the ace3 gene. The SC form is a short form of the gene comprising exons 3 and 4, as well as intron 3 (see, FIG. 12 and FIG. 13, SEQ ID NO: 7). More particularly, SC form of SEQ ID NO: 7 comprises a 1,713 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4. The (3'-end) C-terminus of the SC form (i.e., Exon 4) has the same mutation as the T. reesei RutC-30 strain.
[0328] The S form is a short form of the gene comprising exons 3 and 4, as well as intron 3, but without the mutation in the (3'-end) C-terminus of Exon 4 (see, FIG. 12 and FIG. 14, SEQ ID NO: 1). More particularly, the S form comprises a 1,713 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4. In both of these forms (i.e., "SC" and "S"), the translation start codon is in the long intron 2 (see, FIG. 12), as annotated for T. reesei QM6a strain, and both "SC" and "S" forms are missing part of the coding region for the putative DNA binding domain.
[0329] The L form is a long form of the gene comprising exons 2, 3 and 4, as well as intron 2 (long intron) and intron 3 (e.g., see, FIG. 12 and FIG. 15, SEQ ID NO: 4). More particularly, the L form comprises a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4. The (3'-end) C-terminus of the "L" form has the same mutation as the T. reesei RutC-30 strain.
[0330] The LC form is a long form of the gene comprising exons 2, 3 and 4, as well as intron 2 (long intron) and intron 3 (e.g., see, FIG. 12 and FIG. 16, SEQ ID NO: 9). More particularly, the LC form comprises a 258 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 177 bp Exon 4. The LC form is without the mutation in the C-terminus. In both the "L" and "LC" forms, the translation start codon is within exon 2 as annotated at JGI for the Rut-C30 strain.
[0331] The EL form is an extra-long version of the ace3 gene comprising exons 1, 2, 3 and 4, as well as intron 1, intron 2 (long intron) and intron 3 (e.g., see, FIG. 12 and FIG. 17, SEQ ID NO: 11). More particularly, the EL form comprises a 61 bp Exon 1, a 142 bp Intron 1, a 332 bp Exon 2, a 423 bp Intron 2, a 1,635 bp Exon 3, a 148 bp Intron 3 and a 144 bp Exon 4. The (3'-end) C-terminus of the EL form has the same mutation as the T. reesei RutC-30 strain.
[0332] The LN form is a long form of the gene containing exons 2, 3 and 4, as well as intron 3, but lacking intron 2 (e.g., see, FIG. 12 and FIG. 18, SEQ ID NO: 13). The (3'-end) C-terminus of the LN form has the same mutation as the T. reesei RutC-30 strain. Thus, as described above, the L, LC, LN and EL forms of ace3 encode a full putative DNA binding domain.
Transformation into the T. reesei RL-P37 Strain
[0333] All of the plasmids presented in Table 5 were digested with MssI to release the fragments for targeted integration and separated with agarose gel electrophoresis. For example, FIG. 19 provides a diagram showing the arrangement of DNA sequences within a representative fragment used for transformation of T. reesei. Correct fragments were isolated from the gel using a gel extraction kit (Qiagen) according to the manufacturer's protocol. Approximately 10 .mu.g purified fragment was used to transform protoplasts of a pyr4.sup.- mutant of T. reesei RL-P37 strain. Preparation of protoplasts and transformation were carried out as described in PCT Publication No. WO2013/102674, using pyr4 selection.
[0334] Transformants were streaked onto selective medium plates. Growing clones were screened for correct integration by PCR using primers listed in Table 6. Clones giving expected signals were purified to single cell clones and rescreened for correct integration and clone purity by PCR using primers listed in Table 6, as well as by Southern blotting (data not shown).
TABLE-US-00006 TABLE 6 PCR PRIMERS Primer Sequence SEQ ID NO: Gla1_5creen.F GCTGGAAGCTGCTGAGCAGATC 65 DICprom.R GTGCCAGCATTCCCCAGACTCG 66 T061_pyr4_orf_screen TTAGGCGACCTCTTTTTCCA 67 Gla1_3creen.R GCCGCTCAGGCATACGAGCGAC 68 DICprom.F2 CTCTGGTCGGCCTGCCGTTG 69 ace3.R TGAGTATAGCGGCTGACTTGTCG 70
Cultivation of the Different Ace3 Transformants
[0335] The strains in Table 7 were grown in 24-well microtiter plates in liquid medium with either 2% lactose or 2% glucose as carbon source. The other components of the medium were 0.45% KH2PO4, 0.5% (NH4)2SO4, 0.1% MgSO4, 0.1% CaCl2, 0.9% Casamino acids, 0.048% Citric AcidxH2O, 0.05% FeSO4x7H2O, 0.0003% MnSO4xH2O, 0.004% ZnSO4x7H2O, 0.0002% H3BO3 and 0.00014% CuSO4x5H2O. 100 mM PIPPS (Calbiochem) was included to maintain the pH at 5.5.
TABLE-US-00007 TABLE 7 TRICHODERMA REESEI STRAINS Code Name of the strain Selection M1904 RL-P37, parental strain M2015 ace3 SC clone 2-1 Pyr4 M2016 ace3 SC clone 28-3 Pyr4 M2017 ace3 S clone 9-1 Pyr4 M2018 ace3 S clone 20-1 Pyr4 M2019 ace3 L clone 16-1 Pyr4 M2020 ace3 L clone 18-1 Pyr4 M2021 ace3 LC clone 52-1 Pyr4 M2022 ace3 LC clone 14-4 Pyr4 M2023 ace3 EL clone 3-3 Pyr4 M2024 ace3 EL clone 4-5 Pyr4 M2025 ace3 LN clone 3-3 Pyr4 M2026 ace3 LN clone 4-1 Pyr4
[0336] The cultures were carried out at 28.degree. C. and 800 RPM in Infors HT microton shaker with 80% humidity. Sampling of the cultures was performed at days 3-7. The amount of total secreted proteins was measured from the culture supernatants using Bio Rad Protein Assay according to manufacturer's protocol. In both media, the over-expression of the ace3 L, EL and LN forms with the RutC-30 C-terminal mutation, improved the production of total proteins. In the medium with lactose as the carbon source, over-expression of all the forms of ace3 gene improved the production of total proteins to some extent, but the level of improvement was highest in the strains over-expressing the L, EL and LN forms of the ace3 gene. It is clear that high levels of secreted protein (Table 8) were observed when glucose (i.e., non-inducing condition) was used as a carbon source with transformants in which the L, EL or LN forms of the ace3 gene were over-expressed.
TABLE-US-00008 TABLE 8 TOTAL PROTEINS PRODUCED BY THE DIFFERENT STRAINS IN 24-WELL PLATE CULTIVATION Strain 5d, mg/ml 7d, mg/ml LACTOSE M2015 0.77 1.21 M2016 0.54 0.91 M2017 0.47 0.81 M2018 1.23 1.12 M2019 2.50 6.37 M2020 1.97 6.53 M2021 0.67 1.17 M2022 1.19 1.09 M2023 1.84 4.10 M2024 2.05 4.09 M2025 1.76 3.60 M2026 1.93 4.04 M1904 0.40 0.65 GLUCOSE M2015 0.59 0.89 M2016 0.12 0.56 M2017 0.00 0.19 M2018 0.02 0.26 M2019 1.57 2.74 M2020 1.79 2.91 M2021 0.03 0.40 M2022 0.06 0.21 M2023 1.40 2.44 M2024 1.37 2.52 M2025 1.24 2.26 M2026 1.49 2.64 M1904 0.02 0.37
Example 7
Endogenous Ace3 Heterologous Promoter Knock-In
[0337] A promoter replacement construct (see, FIG. 6) is made by fusing a DNA fragment comprising a 5' region upstream of the native promoter at the ace3 locus, a loxP-flanked hygromycin B-resistance selectable marker cassette, and a fragment comprising a promoter of interest operably fused to the 5' end of the ace3 open reading frame (e.g., see International PCT Application Serial No. PCT/US2016/017113, which further describes gene/promoter replacement cassettes for use in filamentous fungi).
[0338] Thus, a Trichoderma reesei cell is transformed with the promoter replacement construct described above, wherein transformants are isolated and genomic DNA is extracted for diagnostic PCR to confirm homologous recombination of the promoter replacement construct at the native ace3 locus. Using this method, a transformant may be identified in which the native ace3 promoter is replaced by the hygromycin-B resistance cassette and any promoter of interest. Subsequently, the hygromycin B-resistance cassette is removed by the action of cre recombinase (Nagy, 2000).
[0339] The efficiency of homologous integration at the ace3 locus may be enhanced by the action of cas9 directed to the native ace3 promoter by a suitably designed guide RNA as exemplified in International PCT Publication Nos: WO2016/100272, WO2016/100571 and WO2016/100568.
[0340] A conditional promoter replacement (CPR) strategy is described for Aspergillus fumigatus in the publication by Hu et al. (2007), which generally describes a strategy that uses the A. fumigatus NiiA nitrogen regulatable promoter (pNiiA) to delete and replace the endogenous promoter of selected genes. Thus, in certain embodiments, an analogous method can be used to replace the endogenous promoter of the ace3 gene in Trichoderma reesei with alternate promoters.
Example 8
Replacing an Endogenous Non-Lignocellulosic Gene of Interest Promoter with a Lignocellulosic Gene of Interest Promoter
[0341] A Trichoderma reesei glucoamylase expression construct was assembled from DNA polynucleotide fragments (e.g., see U.S. Pat. No. 7,413,879), wherein an ORF sequence encoding a T. reesei glucoamylase was operably linked to a 5' (upstream) T. reesei cbh1 promoter and operably linked to a 3' (downstream) T. reesei cbh1 terminator. The DNA construct further comprised a T. reesei pyr2 gene as selectable marker.
[0342] Thus, a variant (daughter) T. reesei cell of the disclosure (i.e., comprising a genetic modification which increases expression of a gene encoding an Ace3-L protein) was transformed with the glucoamylase expression construct. Transformants were selected and cultured in liquid medium with glucose as carbon source (i.e., without an inducing substrate such as sophorose or lactose) in order to identify those transformants that were able to secrete the T. reesei glucoamylase enzyme during culture.
[0343] Thus, a T. reesei glucoamylase expressing (parental) strain (control) and a modified T. reesei (daughter) glucoamylase expressing strain (i.e., comprising and expressing an Ace3-L ORF) were grown in shake flask, and supernatant from all cell cultures were harvested and analyzed using PAGE as generally described in Example 2 and Example 3 above.
[0344] More particularly, as shown in FIG. 10, the parental T. reesei cells produced 1,029 .mu.g/mL of glucoamylase in defined medium with glucose/sophorose (inducing condition), and only 38 .mu.g/mL of glucoamylase in defined medium with glucose (non-inducing condition). In contrast, the modified (daughter) strain "LT88", comprising ace3-L driven from the dic1 promoter, produced 3-fold higher glucoamylase under "inducing" ("Sop") conditions (i.e., relative to the parental (control) strain under inducing conditions), and produced 2.5-fold higher glucoamylase under "non-inducing" ("Glu") conditions (i.e., relative to the parental (control) strain under inducing conditions) or 67-fold higher glucoamylase under "non-inducing" ("Glu") conditions relative to the parental (control) strain under non-inducing conditions. Thus, these results demonstrate that the modified (daughter) cells comprising the Ace3-L ORF not only produce extracellular proteins in the absence of an inducer, but these variant cells also produce more total protein than the parental (control) T. reesei cells under such inducing conditions.
Example 9
Replacing a Natively Associated Heterologous Gene of Interest Promoter with a Lignocellulosic Gene of Interest Promoter
[0345] A phytase expression construct is assembled from DNA polynucleotide fragments as follows (e.g., see U.S. Pat. No. 8,143,046). The ORF encoding Buttiauxella sp. phytase is operably linked at the 5' end to the T. reesei cbh1 promoter and at the 3' end to the T. reesei cbh1 terminator. The DNA construct further comprises a selectable marker, the Aspergillus nidulans amdS gene. A variant T. reesei cell (i.e., comprising a genetic modification which increases expression of a gene encoding an Ace3-L protein) is transformed with the phytase expression construct. Transformants are selected and cultured in liquid medium with glucose as carbon source (i.e., without an inducing substrate such as sophorose or lactose) in order to identify those transformants that are able to secrete Buttiauxella phytase enzyme during culture.
Example 10
Construction of Native Ace3 Promoter Replacement Vectors
[0346] In the present example, two ace3 promoter replacement vectors pCHL760 and pCHL761 were constructed using standard molecular biological procedures. Vector backbone pMCM3282 (FIG. 20) contained pMB1 ori and AmpR gene for replication and selection in E. coli. In addition, the hph hygromycin selection marker for Trichoderma reesei, expressed under N. crassa cpc1 promoter and A. nidulans trpC terminator, was included. For promoter replacement, the vectors contained a Streptococcus pyogenes cas9 codon optimized for maize, expressed under T. reesei pki1 promoter and guide RNA expressed under U6 promoter (e.g., see, PCT Publication No: WO2016/100568 and WO2016/100272).
[0347] Thus, pMCM3282 was digested with EcoRV and 3 fragments having 5' and 3' homology sequences of .about.1 kb from the T. reesei ace3 locus flanking either the T. reesei hxk1 or dic1 promoter regions replacing the ace3 native promoter, were cloned into pMCM3282/EcoRV by Gibson assembly, resulted in pCHL760 (FIG. 21) and pCHL761 (FIG. 22).
[0348] The 5' and 3' ace3 homology sequences, along with either the hxk1 or dic1 promoter were PCR amplified from T. reesei genomic DNA using Q5 High-fidelity DNA polymerase (New England Biolabs) and the primers set forth below in Table 9.
TABLE-US-00009 TABLE 9 PCR PRIMERS CL1791 (SID: 71) TCTAGTATGTACGAGTACTAGGTGTGAAGATTCCGTCATTTCCTCGACAT GCGAATGCG CL1792 (SID: 72) TGCCATGCAAACCCCGCATTCGCATGTCGAGGAAATGACGGAATCTTCA CACCTAGTAC CL1793 (SID: 73) TGCAGCTACAGAGCCCTGGGCCGGAGCTGCTGAGCCCATAGTTACGACA GCGGAAGCGC CL1794 (SID: 74) ATAGCACTTATAAGGCGGCGCTTCCGCTGTCGTAACTATGGGCTCAGCA GCTCCGGC CL1840 (SID: 75) TAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGGA TAGACTAGCA TCTGAGCCATTGCAGC CL1786 (SID: 76) AGTGGCACCGAGTCGGTGGTGCTTTTTTTTCTATCGAGAGCATTGGTCAG TGGTGGCAAG CL1800 (SID: 77) ACCAATATACAAAACATGTCGTCCGAGCCAGTGCCTGCCATTTCCTCGAC ATGCGAATGC CL1801 (SID: 78) GTTGCCATGCAAACCCCGCATTCGCATGTCGAGGAAATGGCAGGCACTG GCTCGGACGAC CL1802 (SID: 79) AGCTACAGAGCCCTGGGCCGGAGCTGCTGAGCCCATTGTTGAATTCTGG CGGGGTAGCTG CL1803 (SID: 80) CTTTTACACTTTTCAACAGCTACCCCGCCAGAATTCAACAATGGGCTCA GCAGCTCCGGC CL1831 (SID: 81) TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTT TTTCTATCGAGATGTTCTGGATGGTGGAGAGG "SID" in the above table is an abbreviation of "Sequence Identification Number", e.g., "SEQ ID NO"
[0349] More particularly, the specific primers used to PCR amplify fragments for each vector are listed as follows. To construct pCHL760, 5' upstream homology region was amplified using primer pair CL1840 and CL1791, 3' downstream homology region was amplified using primers CL1794 and CL1831, dic1 promoter was amplified using primer pair CL1792 and CL1793.
[0350] To construct pCHL761, 5' upstream homology region was amplified using primer pair CL1840 and CL1800, 3' downstream homology region was amplified using primers CL1803 and CL1831, hxk1 promoter was amplified using primer pair CL1801 and CL1802.
[0351] Vector pMCM3282 (FIG. 20) includes, from 5' to 3' direction, the T. reesei U6 promoter, an E. coli ccdB cassette, and the structural region of a single-guide RNA (sgRNA) involved in Cas9 binding, including an intron from the U6 gene. The ccdB cassette was replaced with sequences specific for five different target sites within the Trichoderma ace3 gene. Insertion of guide RNA sequences into pCHL760 (FIG. 21) and pCHL761 (FIG. 22) to construct final ace3 promoter replacement vectors.
[0352] Thus, the following oligonucleotides presented in Table 10 with Aar1 restriction site were designed for production of different sgRNA sequences.
TABLE-US-00010 TABLE 10 Oligonucleotide sgRNA Sequences Oligo Oligonucleotide SEQ ID Description Oligonucleotide Sequence ID NO: CL1821 top oligo for TS1 AGTCTATCGCAGCCTTGCCTTAGCTAATGTTT 82 CL1822 bottom oligo for TS1 TCTAAAACATTAGCTAAGGCAAGGCTGCGATA 83 CL1823 top oligo for TS4 AGTCTATCGGCAGAGTCGCGTCTTCCGGGTTT 84 CL1824 bottom oligo for TS4 TCTAAAACCCGGAAGACGCGACTCTGCCGATA 85 CL1825 top oligo for TS5 AGTCTATCGAATGAGTGTAGGTACGAGTAGTTT 86 CL1826 bottom oligo for TS5 TCTAAAACTACTCGTACCTACACTCATTCGATA 87 CL1827 top oligo for TS8 AGTCTATCGGCCGCAATAGCTTCCTAATGTTT 88 CL1828 bottom oligo for TS8 TCTAAAACATTAGGAAGCTATTGCGGCCGATA 89 CL1829 top oligo for TS10 AGTCTATCGCAGCGCAATCAGTGCAGTGGTTT 90 CL1830 bottom oligo for TS10 TCTAAAACCACTGCACTGATTGCGCTGCGATA 91
[0353] More particularly, CL1821 and CL1822, CL1823 and CL1824, CL1825 and CL1826, CL1827 and CL1828, CL1829 and CL1830 were annealed to create double stranded DNAs, which were cloned individually into pCHL760 and pCHL761 at AarI site using typeIIS seamless cloning method. The final plasmids with correctly inserted guide RNA sequences lost the toxic ccdB gene.
Transformation of T. reesei
[0354] The cas9 mediated ace3 promoter replacement vectors of pCHL760 and pCHL761 were transformed into T. reesei parental cells by polyethylene glycol (PEG)-mediated protoplast transformation. The transformants were grown on Vogel's minimal medium agar with hygromycin to select for hygromycin resistant transformants. Some of these transformants were unstable, having taken up the plasmid, but without stable integration into the genomic DNA. Transformants were transferred onto Vogel's non-selective agar medium to allow loss of the plasmid and hygromycin-resistance marker.
[0355] To screen for dic1 promoter replaced transformants, genomic DNA was extracted and PCR using primer pairs CL1858 and CL1848 (expected size product for desired integration was 2,412 bp), and CL1853 and CL1818 (expected size product for desired integration was 2,431 bp), e.g. see Table 11. PCR products were subsequently analyzed by DNA sequencing to confirm the desired promoter integration.
[0356] To screen for hxk1 promoter replaced transformants, PCR using primer pairs CL1858 and CL1898 (expected size product for desired integration was 1,784 bp), and CL1853 and CL1850 (expected size product for desired integration was 2,178 bp) was performed and correct integration subsequently confirmed by DNA sequencing the PCR products, e.g. see Table 11.
TABLE-US-00011 TABLE 11 PCR Primers Primer SEQ ID ID Primer Sequence NO: CL1858 TGGAGAGACTCGGAGAGGATAGG 92 CL1853 AGCGTGGAGGCAGTTGGAGTGG 93 CL1848 TGGACAAAGCCTGGGTCCTGCTCC 94 CL1818 ATCCTGACTCGTCCTGTGTCGG 95 CL1898 AGTGCTTCGTTTAGTGGACTTG 96 CL1850 CTCGGTAGCTGCTTGAATATAG 97
Protein Production in Shake Flasks
[0357] To test the functionality of ace3 promoter replaced strains, cells were grown in the presence and absence of an inducer substrate (sophorose) in 50 ml submerged culture in shake flasks. The parental T. reesei host cells (ID No. 1275.8.1) and the variant cells ID Nos. 2218, 2219, 2220, 2221, 2222 and 2223, were grown under both inducing conditions (glucose/sophorose as carbon source) and non-inducing conditions (glucose as carbon source) in liquid culture, and their respective extracellular secreted protein production levels were compared. Briefly, mycelia of each host cell (i.e., the T. reesei parental host cell and the variant cells thereof) were added separately to 50 mL of YEG broth in a 250 mL Erlenmeyer flask with bottom baffles. The YEG broth contained 5 g/L yeast extract and 22 g/L glucose. The cell cultures were grown for 48 hours, followed by sub-culturing into fresh YEG for another 24 hours. These seed cultures were then inoculated into either 50 mL of defined medium supplemented with 2.5% glucose (non-inducing condition), or 50 mL of defined medium with 2.5% glucose/sophorose (inducing condition) in 250 mL shake flasks with bottom baffles. All shake flasks were incubated at 28.degree. C. with continuous shaking at 200 rpm. After 4 days of incubation, supernatant from all cell cultures were harvested and analyzed using SDS-PAGE, as presented in FIG. 23.
[0358] As seen on above SDS-PAGE, parental cells (FIG. 23, ID 1275.8.1) produced much less secreted protein in defined medium with glucose (non-inducing) compared to glucose/sophorose (induction). In contrast, transformants 2218, 2219, 2220, 2222 and 2223 produced similar amounts of secreted protein under inducing and non-inducing conditions. Thus, these results demonstrate that the variant cells harboring the hxk1 or dic1 promoter replacing the native ace3 promoter at ace3 locus produced extracellular proteins in the absence of an inducer.
REFERENCES
[0359] European Patent Application No. EP 215,594
[0360] European Patent Application No. EP 244,234
[0361] European Publication No. EP 0215594
[0362] PCT International Application Serial No. PCT/EP2013/050126
[0363] PCT International Application Serial No. PCT/US2016/017113
[0364] PCT International Publication No. WO03/027306
[0365] PCT International Publication No. WO1992/06183
[0366] PCT International Publication No. WO1992/06209
[0367] PCT International Publication No. WO1992/06221
[0368] PCT International Publication No. WO1992/10581
[0369] PCT International Publication No. WO1998/15619
[0370] PCT International Publication No. WO2002/12465
[0371] PCT International Publication No. WO2003/52054
[0372] PCT International Publication No. WO2003/52055
[0373] PCT International Publication No. WO2003/52056
[0374] PCT International Publication No. WO2003/52057
[0375] PCT International Publication No. WO2003/52118
[0376] PCT International Publication No. WO2004/16760
[0377] PCT International Publication No. WO2004/43980
[0378] PCT International Publication No. WO2004/48592
[0379] PCT International Publication No. WO2005/001036
[0380] PCT International Publication No. WO2005/01065
[0381] PCT International Publication No. WO2005/028636
[0382] PCT International Publication No. WO2005/093050
[0383] PCT International Publication No. WO2005/28636
[0384] PCT International Publication No. WO2005/93073
[0385] PCT International Publication No. WO2006/074005
[0386] PCT International Publication No. WO2006/74005
[0387] PCT International Publication No. WO2009/149202
[0388] PCT International Publication No. WO2010/141779
[0389] PCT International Publication No. WO2011/038019
[0390] PCT International Publication No. WO2011/063308
[0391] PCT International Publication No. WO2011/153276
[0392] PCT International Publication No. WO2012/125925
[0393] PCT International Publication No. WO2012/125951
[0394] PCT International Publication No. WO2012125937
[0395] PCT International Publication No. WO2013/102674
[0396] PCT International Publication No. WO2014/047520
[0397] PCT International Publication No. WO2014/070837
[0398] PCT International Publication No. WO2014/070841
[0399] PCT International Publication No. WO2014/070844
[0400] PCT International Publication No. WO2014/093275
[0401] PCT International Publication No. WO2014/093281
[0402] PCT International Publication No. WO2014/093282
[0403] PCT International Publication No. WO2014/093287
[0404] PCT International Publication No. WO2014/093294
[0405] PCT International Publication No. WO2015/084596
[0406] PCT International Publication No. WO2016/069541
[0407] PCT International Publication No. WO2016/100272
[0408] PCT International Publication No. WO2016/100568
[0409] PCT International Publication No. WO2016/100571
[0410] U.S. Pat. No. 6,022,725
[0411] U.S. Pat. No. 6,268,328
[0412] U.S. Pat. No. 7,413,879
[0413] U.S. Pat. No. 7,713,725
[0414] U.S. Pat. No. 8,143,046
[0415] Alexopoulos, C. J., Introductory Mycology, New York: Wiley, 1962.
[0416] Allen and Mortensen, Biotechnol. Bioeng., 2641-45, 1981.
[0417] Arvas, M., Pakula, T., Smit, B., Rautio, J., Koivistoinen, H., Jouhten, P., Lindfors, E., Wiebe, M., Penttila, M., and Saloheimo, M., "Correlation of gene expression and protein production rate-a system wide study", BMC Genomics 12, 616, 2011.
[0418] Ausbel et al., "Current Protocols in Molecular Biology", Green Publishing Associates/Wiley Interscience, New York, 1987.
[0419] Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates/Wiley Interscience, New York, 1994.
[0420] Boel et al., EMBO J. 3:1581-1585, 1984.
[0421] Campbell et al., Curr. Genet., 16: 53-56, 1989.
[0422] Cao et al., Science, 9: 991-1001, 2000.
[0423] Colot et al., PNAS 103(27):10352-10357, 2006.
[0424] Devereux et al., Nucleic Acids Res. 12:387-395, 1984.
[0425] el-Gogary et al., "Mechanism by which cellulose triggers cellobiohydrolase I gene expression in Trichoderma reesei", PNAS, 86(16)-6138-6141, 1989.
[0426] Hakkinen, M., Valkonen, M. J., Westerholm-Parvinen, A., Aro, N., Arvas, M., Vitikainen, M., Penttila, M., Saloheimo, M., and Pakula, T. M., "Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production", Biotechnol Biofuels 7, 14, 2014.
[0427] Harkki et al., BioTechnol., 7: 596-603, 1989.
[0428] Harkki et al., Enzyme Microb. Technol., 13: 227-233, 1991.
[0429] Hu et al., "Essential gene identification and drug target prioritization in Aspergillus fumigatus" PLoS Pathog., 3(3), 2007.
[0430] Ilmen et al., "Regulation of cellulase gene expression in the filamentous fungus Trichoderma reesei", Applied and Environmental Microbiology, 63(4)-1298-1306, 1997.
[0431] Ju and Afolabi, Biotechnol. Prog., 91-97, 1999.
[0432] Kriegler, Gene Transfer and Expression: A Laboratory Manual, 1990.
[0433] Martinez et al., "Genome sequencing and analysis of the bio-mass-degrading fungi Trichoderma reesei (syn. Hypocrea jecorina)", Nature Biotechnology, 26:533-560, 2008.
[0434] Mullaney et al., MGG 199:37-45, 1985.
[0435] Nagy, "Cre recombinase: the universal reagent for genome tailoring", Genesis 26(2), 99-109, 2000.
[0436] Needleman and Wunsch, J. Mol. Biol., 48:443, 1970.
[0437] Nunberg et al., Mol. Cell Biol. 4:2306, 1984.
[0438] Ouedraogo, J. P., Arentshorst, M., Nikolaev, I., Barends, S., and Ram, A. F., "I-SceI-mediated double-strand DNA breaks stimulate efficient gene targeting in the industrial fungus Trichoderma reesei" Applied microbiology and biotechnology 99, 10083-10095, 2015.
[0439] Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988.
[0440] Penttila, M., Nevalainen, H., Ratto, M., Salminen, E., and Knowles, J., "A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei", Gene 61, 155-164, 1987.
[0441] Poggi-Parodi, D., Bidard, F., Pirayre, A., Portnoy, T., Blugeon, C., Seiboth, B., Kubicek, C. P., Le Crom, S., and Margeot, A., "Kinetic transcriptome analysis reveals an essentially intact induction system in a cellulase hyper-producer Trichoderma reesei strain", Biotechnol Biofuels 7, 173, 2014.
[0442] Sambrook et al., Molecular Cloning, A Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring, New York, 1989.
[0443] Sambrook et al., Molecular Cloning, A Laboratory Manual, 4.sup.th Edition, Cold Spring Harbor Laboratory Press, Cold Spring, New York, 2012.
[0444] Seiboth, et. al., Mol. Genet. Genomics, 124-32, 2002.
[0445] Sheir-Neiss and Montenecourt, "Characterization of the secreted cellulases of Trichoderma reesei wild type and mutants during controlled fermentations", Applied Microbiology and Biotechnology, 20(1):46-53, 1984.
[0446] Smith and Waterman, Adv. Appl. Math. 2:482, 1981.
[0447] Vaheri et al., "Transglycosylation products of the cellulase system of Trichoderma reesei", Biotechnol. Lett., 1:41-46, 1979.
[0448] Yelton et al., PNAS USA 81:1470-1474, 1984.
Sequence CWU
1
1
10212038DNATrichoderma reesei 1atgctgcgct actcccccgt cttacacctg gatactctct
ccttgccacc actgaccaat 60gctcttcccc gcccaaagtg cgagtacctc agcgctgtcg
atagctgcac gcactgccgc 120gatgcccacg tgcagtgcac tttcgacctg cccctggcgc
gacgcggccc caaagcgagg 180aagaagagcg accagcccgg ccagccgcct cctgatccga
gctcgctctc caccgcggct 240cgacccggcc agatgccgcc gccgctgacc ttctccggcc
ccgcagtagc cgcgctgcag 300cccttcgcct cgtcgtcgct gtcgcccgac gcggcctggg
agcccgtcga gccgctcagc 360attgacaacg gcctgccccg gcagccgctg ggcgacctgc
ccggcctctc caccatccag 420aacatctcga cgcgccagcg atggatacac ctggccaacg
ccatgacgct gcgcaacacg 480acgctagagc gcgtctcgaa gcgatgtatc gacctcttct
tcgactacct ctaccccctc 540acccccctgg tgtacgagcc ggccctccgg gacgtgctcg
catacatctt ctcccagccc 600ttgcctggcg tcaaccaacc atcgccgctg tcacagctca
cgccagaccc gaccaccggc 660accacccccc tcaacgctgc cgagtcgtgg gccggctttg
gccagcccag cggctcgcga 720accgtcggca gcaggctggc tccctgggcc gactcgacct
tcaccctggt cacggccgtc 780tgcgcagagg cagcattcat gctacccaag gacattttcc
ccgaaggaga atccgtctct 840gagatcttgc tcgaagcctc tcgggactgc ctgcaccagc
acctcgaggc cgacctggag 900aatccgacgg ccaactcgat tgccattcgc tacttccact
ccaactgcct ccacgctgcg 960gggaagccca agtactcgtg gcacatattt ggcgaggcca
tccgcctggc gcaggtcatg 1020cagctgcacg aggaggctgc cctcgagggg ctcgtcccca
tcgaggcaga gttccgccgt 1080cgctgctttt ggatcctgta cttgggcgac aagtcagccg
ctatactcaa caatcggccc 1140atcaccatcc acaagtactg cttcgacgcc ggcatcacca
cgctataccc gtcgggtatc 1200gaggacgagt tcctgagcac ggcgtccgag ccgccccgga
agagcttcat atccggcttc 1260aacgcaaatg tgcggctctg gcagtccgcg gctgatttgc
tgctggaaat ccgcgtgctg 1320caagatcaga tgatgcagca ctttcgaggg accatgcccc
cgaaccatgt gctgccctcc 1380gccgacaggc agcatctcga ttctctctat gtccgcttca
tcacctgctt ggacgatctc 1440ccgccgtacc tccagtcgtg cactctggcg atggcagcga
tggcagaagg caacgggtct 1500gccgagtcca agcagtacgt gatacagtgc atcaacctgc
aggtgacgtt tcactgtctg 1560cgcatggtaa ttacgcagaa attcgaagac ctctcttatt
ttgctcctgg cgttgagcag 1620gctgatctca gaaagtcgga gattgtgcga gacatgctga
gggtgatgaa cgaggcgccc 1680ttttggggcc tgcaggccaa tggcgagcca aacgtgagtc
gtttccttgt ctcttctctt 1740ttctgcacac ccttttcttc gacgaccccc cctctctctt
tatatccctg cggatatgta 1800tatcatcaag cctcggcact tgttgctaat ctgtcctgat
tatgttgtct ggatgctgca 1860ggttgaaaag attcgcctta tcggagctag tttgctggcc
atcatccatc gcaaccagga 1920ttcacccttg gctacgcgag ccaggagcga cttttccgtg
cttttggata ttctcacgcg 1980gctggactcg aaggcgtcgg accaactgag gaatacgtcc
actaccgttg ttggctaa 203821890DNATrichoderma reesei 2atgctgcgct
actcccccgt cttacacctg gatactctct ccttgccacc actgaccaat 60gctcttcccc
gcccaaagtg cgagtacctc agcgctgtcg atagctgcac gcactgccgc 120gatgcccacg
tgcagtgcac tttcgacctg cccctggcgc gacgcggccc caaagcgagg 180aagaagagcg
accagcccgg ccagccgcct cctgatccga gctcgctctc caccgcggct 240cgacccggcc
agatgccgcc gccgctgacc ttctccggcc ccgcagtagc cgcgctgcag 300cccttcgcct
cgtcgtcgct gtcgcccgac gcggcctggg agcccgtcga gccgctcagc 360attgacaacg
gcctgccccg gcagccgctg ggcgacctgc ccggcctctc caccatccag 420aacatctcga
cgcgccagcg atggatacac ctggccaacg ccatgacgct gcgcaacacg 480acgctagagc
gcgtctcgaa gcgatgtatc gacctcttct tcgactacct ctaccccctc 540acccccctgg
tgtacgagcc ggccctccgg gacgtgctcg catacatctt ctcccagccc 600ttgcctggcg
tcaaccaacc atcgccgctg tcacagctca cgccagaccc gaccaccggc 660accacccccc
tcaacgctgc cgagtcgtgg gccggctttg gccagcccag cggctcgcga 720accgtcggca
gcaggctggc tccctgggcc gactcgacct tcaccctggt cacggccgtc 780tgcgcagagg
cagcattcat gctacccaag gacattttcc ccgaaggaga atccgtctct 840gagatcttgc
tcgaagcctc tcgggactgc ctgcaccagc acctcgaggc cgacctggag 900aatccgacgg
ccaactcgat tgccattcgc tacttccact ccaactgcct ccacgctgcg 960gggaagccca
agtactcgtg gcacatattt ggcgaggcca tccgcctggc gcaggtcatg 1020cagctgcacg
aggaggctgc cctcgagggg ctcgtcccca tcgaggcaga gttccgccgt 1080cgctgctttt
ggatcctgta cttgggcgac aagtcagccg ctatactcaa caatcggccc 1140atcaccatcc
acaagtactg cttcgacgcc ggcatcacca cgctataccc gtcgggtatc 1200gaggacgagt
tcctgagcac ggcgtccgag ccgccccgga agagcttcat atccggcttc 1260aacgcaaatg
tgcggctctg gcagtccgcg gctgatttgc tgctggaaat ccgcgtgctg 1320caagatcaga
tgatgcagca ctttcgaggg accatgcccc cgaaccatgt gctgccctcc 1380gccgacaggc
agcatctcga ttctctctat gtccgcttca tcacctgctt ggacgatctc 1440ccgccgtacc
tccagtcgtg cactctggcg atggcagcga tggcagaagg caacgggtct 1500gccgagtcca
agcagtacgt gatacagtgc atcaacctgc aggtgacgtt tcactgtctg 1560cgcatggtaa
ttacgcagaa attcgaagac ctctcttatt ttgctcctgg cgttgagcag 1620gctgatctca
gaaagtcgga gattgtgcga gacatgctga gggtgatgaa cgaggcgccc 1680ttttggggcc
tgcaggccaa tggcgagcca aacgttgaaa agattcgcct tatcggagct 1740agtttgctgg
ccatcatcca tcgcaaccag gattcaccct tggctacgcg agccaggagc 1800gacttttccg
tgcttttgga tattctcacg cggctggact cgaaggcgtc ggaccaactg 1860aggaatacgt
ccactaccgt tgttggctaa
18903629PRTTrichoderma reesei 3Met Leu Arg Tyr Ser Pro Val Leu His Leu
Asp Thr Leu Ser Leu Pro1 5 10
15Pro Leu Thr Asn Ala Leu Pro Arg Pro Lys Cys Glu Tyr Leu Ser Ala
20 25 30Val Asp Ser Cys Thr His
Cys Arg Asp Ala His Val Gln Cys Thr Phe 35 40
45Asp Leu Pro Leu Ala Arg Arg Gly Pro Lys Ala Arg Lys Lys
Ser Asp 50 55 60Gln Pro Gly Gln Pro
Pro Pro Asp Pro Ser Ser Leu Ser Thr Ala Ala65 70
75 80Arg Pro Gly Gln Met Pro Pro Pro Leu Thr
Phe Ser Gly Pro Ala Val 85 90
95Ala Ala Leu Gln Pro Phe Ala Ser Ser Ser Leu Ser Pro Asp Ala Ala
100 105 110Trp Glu Pro Val Glu
Pro Leu Ser Ile Asp Asn Gly Leu Pro Arg Gln 115
120 125Pro Leu Gly Asp Leu Pro Gly Leu Ser Thr Ile Gln
Asn Ile Ser Thr 130 135 140Arg Gln Arg
Trp Ile His Leu Ala Asn Ala Met Thr Leu Arg Asn Thr145
150 155 160Thr Leu Glu Arg Val Ser Lys
Arg Cys Ile Asp Leu Phe Phe Asp Tyr 165
170 175Leu Tyr Pro Leu Thr Pro Leu Val Tyr Glu Pro Ala
Leu Arg Asp Val 180 185 190Leu
Ala Tyr Ile Phe Ser Gln Pro Leu Pro Gly Val Asn Gln Pro Ser 195
200 205Pro Leu Ser Gln Leu Thr Pro Asp Pro
Thr Thr Gly Thr Thr Pro Leu 210 215
220Asn Ala Ala Glu Ser Trp Ala Gly Phe Gly Gln Pro Ser Gly Ser Arg225
230 235 240Thr Val Gly Ser
Arg Leu Ala Pro Trp Ala Asp Ser Thr Phe Thr Leu 245
250 255Val Thr Ala Val Cys Ala Glu Ala Ala Phe
Met Leu Pro Lys Asp Ile 260 265
270Phe Pro Glu Gly Glu Ser Val Ser Glu Ile Leu Leu Glu Ala Ser Arg
275 280 285Asp Cys Leu His Gln His Leu
Glu Ala Asp Leu Glu Asn Pro Thr Ala 290 295
300Asn Ser Ile Ala Ile Arg Tyr Phe His Ser Asn Cys Leu His Ala
Ala305 310 315 320Gly Lys
Pro Lys Tyr Ser Trp His Ile Phe Gly Glu Ala Ile Arg Leu
325 330 335Ala Gln Val Met Gln Leu His
Glu Glu Ala Ala Leu Glu Gly Leu Val 340 345
350Pro Ile Glu Ala Glu Phe Arg Arg Arg Cys Phe Trp Ile Leu
Tyr Leu 355 360 365Gly Asp Lys Ser
Ala Ala Ile Leu Asn Asn Arg Pro Ile Thr Ile His 370
375 380Lys Tyr Cys Phe Asp Ala Gly Ile Thr Thr Leu Tyr
Pro Ser Gly Ile385 390 395
400Glu Asp Glu Phe Leu Ser Thr Ala Ser Glu Pro Pro Arg Lys Ser Phe
405 410 415Ile Ser Gly Phe Asn
Ala Asn Val Arg Leu Trp Gln Ser Ala Ala Asp 420
425 430Leu Leu Leu Glu Ile Arg Val Leu Gln Asp Gln Met
Met Gln His Phe 435 440 445Arg Gly
Thr Met Pro Pro Asn His Val Leu Pro Ser Ala Asp Arg Gln 450
455 460His Leu Asp Ser Leu Tyr Val Arg Phe Ile Thr
Cys Leu Asp Asp Leu465 470 475
480Pro Pro Tyr Leu Gln Ser Cys Thr Leu Ala Met Ala Ala Met Ala Glu
485 490 495Gly Asn Gly Ser
Ala Glu Ser Lys Gln Tyr Val Ile Gln Cys Ile Asn 500
505 510Leu Gln Val Thr Phe His Cys Leu Arg Met Val
Ile Thr Gln Lys Phe 515 520 525Glu
Asp Leu Ser Tyr Phe Ala Pro Gly Val Glu Gln Ala Asp Leu Arg 530
535 540Lys Ser Glu Ile Val Arg Asp Met Leu Arg
Val Met Asn Glu Ala Pro545 550 555
560Phe Trp Gly Leu Gln Ala Asn Gly Glu Pro Asn Val Glu Lys Ile
Arg 565 570 575Leu Ile Gly
Ala Ser Leu Leu Ala Ile Ile His Arg Asn Gln Asp Ser 580
585 590Pro Leu Ala Thr Arg Ala Arg Ser Asp Phe
Ser Val Leu Leu Asp Ile 595 600
605Leu Thr Arg Leu Asp Ser Lys Ala Ser Asp Gln Leu Arg Asn Thr Ser 610
615 620Thr Thr Val Val
Gly62542608DNATrichoderma reesei 4atgggctcag cagctccggc ccagggctct
gtagctgcag ctgcaggcgg ccctccagct 60gctggcgctg gcgctggcgc tgtccacgcc
ctcaccacct cgcccgagtc tgcctcggcc 120tcgcagcccg gctcgccaac cgcctcaacc
acgccgccgc agaactcact cgtgtcggct 180gcaacctcgt tccaccacca tcccagaggc
cgtctggtga gcagagcctg cgaccgctgc 240cgccggcgca aggccaaggt cagtctagcc
cctttgctgt tgcttgcatc tctgttgtca 300ttgctcctcc tcctgctgct gctgatgctg
ctgctcctcc tcctcctcct cctccccgtc 360tcctggtccc tggtccctgc tcttcatatg
tccttactgc ccgtgtctcc tctccccgtt 420cccgttcccc ctcctcccgt cctcttctcc
tgcgtgtctg tcatgcgtac aaagcataca 480tacaatacat cagcatacat ggcaagcgtt
gtgttgtgtt gagagttgtg tgtattgtat 540tgcactgcct tcacaactcg ttcatactgc
tgcagcctca ccccaacacc gacctcgtct 600tccatgctgc gctactcccc cgtcttacac
ctggatactc tctccttgcc accactgacc 660aatgctcttc cccgcccaaa gtgcgagtac
ctcagcgctg tcgatagctg cacgcactgc 720cgcgatgccc acgtgcagtg cactttcgac
ctgcccctgg cgcgacgcgg ccccaaagcg 780aggaagaaga gcgaccagcc cggccagccg
cctcctgatc cgagctcgct ctccaccgcg 840gctcgacccg gccagatgcc gccgccgctg
accttctccg gccccgcagt agccgcgctg 900cagcccttcg cctcgtcgtc gctgtcgccc
gacgcggcct gggagcccgt cgagccgctc 960agcattgaca acggcctgcc ccggcagccg
ctgggcgacc tgcccggcct ctccaccatc 1020cagaacatct cgacgcgcca gcgatggata
cacctggcca acgccatgac gctgcgcaac 1080acgacgctag agcgcgtctc gaagcgatgt
atcgacctct tcttcgacta cctctacccc 1140ctcacccccc tggtgtacga gccggccctc
cgggacgtgc tcgcatacat cttctcccag 1200cccttgcctg gcgtcaacca accatcgccg
ctgtcacagc tcacgccaga cccgaccacc 1260ggcaccaccc ccctcaacgc tgccgagtcg
tgggccggct ttggccagcc cagcggctcg 1320cgaaccgtcg gcagcaggct ggctccctgg
gccgactcga ccttcaccct ggtcacggcc 1380gtctgcgcag aggcagcatt catgctaccc
aaggacattt tccccgaagg agaatccgtc 1440tctgagatct tgctcgaagc ctctcgggac
tgcctgcacc agcacctcga ggccgacctg 1500gagaatccga cggccaactc gattgccatt
cgctacttcc actccaactg cctccacgct 1560gcggggaagc ccaagtactc gtggcacata
tttggcgagg ccatccgcct ggcgcaggtc 1620atgcagctgc acgaggaggc tgccctcgag
gggctcgtcc ccatcgaggc agagttccgc 1680cgtcgctgct tttggatcct gtacttgggc
gacaagtcag ccgctatact caacaatcgg 1740cccatcacca tccacaagta ctgcttcgac
gccggcatca ccacgctata cccgtcgggt 1800atcgaggacg agttcctgag cacggcgtcc
gagccgcccc ggaagagctt catatccggc 1860ttcaacgcaa atgtgcggct ctggcagtcc
gcggctgatt tgctgctgga aatccgcgtg 1920ctgcaagatc agatgatgca gcactttcga
gggaccatgc ccccgaacca tgtgctgccc 1980tccgccgaca ggcagcatct cgattctctc
tatgtccgct tcatcacctg cttggacgat 2040ctcccgccgt acctccagtc gtgcactctg
gcgatggcag cgatggcaga aggcaacggg 2100tctgccgagt ccaagcagta cgtgatacag
tgcatcaacc tgcaggtgac gtttcactgt 2160ctgcgcatgg taattacgca gaaattcgaa
gacctctctt attttgctcc tggcgttgag 2220caggctgatc tcagaaagtc ggagattgtg
cgagacatgc tgagggtgat gaacgaggcg 2280cccttttggg gcctgcaggc caatggcgag
ccaaacgtga gtcgtttcct tgtctcttct 2340cttttctgca cacccttttc ttcgacgacc
ccccctctct ctttatatcc ctgcggatat 2400gtatatcatc aagcctcggc acttgttgct
aatctgtcct gattatgttg tctggatgct 2460gcaggttgaa aagattcgcc ttatcggagc
tagtttgctg gccatcatcc atcgcaacca 2520ggattcaccc ttggctacgc gagccaggag
cgacttttcc gtgcttttgg atattctcac 2580gcggctggac tcgaaggcgt cggactaa
260852037DNATrichoderma reesei
5atgggctcag cagctccggc ccagggctct gtagctgcag ctgcaggcgg ccctccagct
60gctggcgctg gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc tgcctcggcc
120tcgcagcccg gctcgccaac cgcctcaacc acgccgccgc agaactcact cgtgtcggct
180gcaacctcgt tccaccacca tcccagaggc cgtctggtga gcagagcctg cgaccgctgc
240cgccggcgca aggccaagtg cgagtacctc agcgctgtcg atagctgcac gcactgccgc
300gatgcccacg tgcagtgcac tttcgacctg cccctggcgc gacgcggccc caaagcgagg
360aagaagagcg accagcccgg ccagccgcct cctgatccga gctcgctctc caccgcggct
420cgacccggcc agatgccgcc gccgctgacc ttctccggcc ccgcagtagc cgcgctgcag
480cccttcgcct cgtcgtcgct gtcgcccgac gcggcctggg agcccgtcga gccgctcagc
540attgacaacg gcctgccccg gcagccgctg ggcgacctgc ccggcctctc caccatccag
600aacatctcga cgcgccagcg atggatacac ctggccaacg ccatgacgct gcgcaacacg
660acgctagagc gcgtctcgaa gcgatgtatc gacctcttct tcgactacct ctaccccctc
720acccccctgg tgtacgagcc ggccctccgg gacgtgctcg catacatctt ctcccagccc
780ttgcctggcg tcaaccaacc atcgccgctg tcacagctca cgccagaccc gaccaccggc
840accacccccc tcaacgctgc cgagtcgtgg gccggctttg gccagcccag cggctcgcga
900accgtcggca gcaggctggc tccctgggcc gactcgacct tcaccctggt cacggccgtc
960tgcgcagagg cagcattcat gctacccaag gacattttcc ccgaaggaga atccgtctct
1020gagatcttgc tcgaagcctc tcgggactgc ctgcaccagc acctcgaggc cgacctggag
1080aatccgacgg ccaactcgat tgccattcgc tacttccact ccaactgcct ccacgctgcg
1140gggaagccca agtactcgtg gcacatattt ggcgaggcca tccgcctggc gcaggtcatg
1200cagctgcacg aggaggctgc cctcgagggg ctcgtcccca tcgaggcaga gttccgccgt
1260cgctgctttt ggatcctgta cttgggcgac aagtcagccg ctatactcaa caatcggccc
1320atcaccatcc acaagtactg cttcgacgcc ggcatcacca cgctataccc gtcgggtatc
1380gaggacgagt tcctgagcac ggcgtccgag ccgccccgga agagcttcat atccggcttc
1440aacgcaaatg tgcggctctg gcagtccgcg gctgatttgc tgctggaaat ccgcgtgctg
1500caagatcaga tgatgcagca ctttcgaggg accatgcccc cgaaccatgt gctgccctcc
1560gccgacaggc agcatctcga ttctctctat gtccgcttca tcacctgctt ggacgatctc
1620ccgccgtacc tccagtcgtg cactctggcg atggcagcga tggcagaagg caacgggtct
1680gccgagtcca agcagtacgt gatacagtgc atcaacctgc aggtgacgtt tcactgtctg
1740cgcatggtaa ttacgcagaa attcgaagac ctctcttatt ttgctcctgg cgttgagcag
1800gctgatctca gaaagtcgga gattgtgcga gacatgctga gggtgatgaa cgaggcgccc
1860ttttggggcc tgcaggccaa tggcgagcca aacgttgaaa agattcgcct tatcggagct
1920agtttgctgg ccatcatcca tcgcaaccag gattcaccct tggctacgcg agccaggagc
1980gacttttccg tgcttttgga tattctcacg cggctggact cgaaggcgtc ggactaa
20376678PRTTrichoderma reesei 6Met Gly Ser Ala Ala Pro Ala Gln Gly Ser
Val Ala Ala Ala Ala Gly1 5 10
15Gly Pro Pro Ala Ala Gly Ala Gly Ala Gly Ala Val His Ala Leu Thr
20 25 30Thr Ser Pro Glu Ser Ala
Ser Ala Ser Gln Pro Gly Ser Pro Thr Ala 35 40
45Ser Thr Thr Pro Pro Gln Asn Ser Leu Val Ser Ala Ala Thr
Ser Phe 50 55 60His His His Pro Arg
Gly Arg Leu Val Ser Arg Ala Cys Asp Arg Cys65 70
75 80Arg Arg Arg Lys Ala Lys Cys Glu Tyr Leu
Ser Ala Val Asp Ser Cys 85 90
95Thr His Cys Arg Asp Ala His Val Gln Cys Thr Phe Asp Leu Pro Leu
100 105 110Ala Arg Arg Gly Pro
Lys Ala Arg Lys Lys Ser Asp Gln Pro Gly Gln 115
120 125Pro Pro Pro Asp Pro Ser Ser Leu Ser Thr Ala Ala
Arg Pro Gly Gln 130 135 140Met Pro Pro
Pro Leu Thr Phe Ser Gly Pro Ala Val Ala Ala Leu Gln145
150 155 160Pro Phe Ala Ser Ser Ser Leu
Ser Pro Asp Ala Ala Trp Glu Pro Val 165
170 175Glu Pro Leu Ser Ile Asp Asn Gly Leu Pro Arg Gln
Pro Leu Gly Asp 180 185 190Leu
Pro Gly Leu Ser Thr Ile Gln Asn Ile Ser Thr Arg Gln Arg Trp 195
200 205Ile His Leu Ala Asn Ala Met Thr Leu
Arg Asn Thr Thr Leu Glu Arg 210 215
220Val Ser Lys Arg Cys Ile Asp Leu Phe Phe Asp Tyr Leu Tyr Pro Leu225
230 235 240Thr Pro Leu Val
Tyr Glu Pro Ala Leu Arg Asp Val Leu Ala Tyr Ile 245
250 255Phe Ser Gln Pro Leu Pro Gly Val Asn Gln
Pro Ser Pro Leu Ser Gln 260 265
270Leu Thr Pro Asp Pro Thr Thr Gly Thr Thr Pro Leu Asn Ala Ala Glu
275 280 285Ser Trp Ala Gly Phe Gly Gln
Pro Ser Gly Ser Arg Thr Val Gly Ser 290 295
300Arg Leu Ala Pro Trp Ala Asp Ser Thr Phe Thr Leu Val Thr Ala
Val305 310 315 320Cys Ala
Glu Ala Ala Phe Met Leu Pro Lys Asp Ile Phe Pro Glu Gly
325 330 335Glu Ser Val Ser Glu Ile Leu
Leu Glu Ala Ser Arg Asp Cys Leu His 340 345
350Gln His Leu Glu Ala Asp Leu Glu Asn Pro Thr Ala Asn Ser
Ile Ala 355 360 365Ile Arg Tyr Phe
His Ser Asn Cys Leu His Ala Ala Gly Lys Pro Lys 370
375 380Tyr Ser Trp His Ile Phe Gly Glu Ala Ile Arg Leu
Ala Gln Val Met385 390 395
400Gln Leu His Glu Glu Ala Ala Leu Glu Gly Leu Val Pro Ile Glu Ala
405 410 415Glu Phe Arg Arg Arg
Cys Phe Trp Ile Leu Tyr Leu Gly Asp Lys Ser 420
425 430Ala Ala Ile Leu Asn Asn Arg Pro Ile Thr Ile His
Lys Tyr Cys Phe 435 440 445Asp Ala
Gly Ile Thr Thr Leu Tyr Pro Ser Gly Ile Glu Asp Glu Phe 450
455 460Leu Ser Thr Ala Ser Glu Pro Pro Arg Lys Ser
Phe Ile Ser Gly Phe465 470 475
480Asn Ala Asn Val Arg Leu Trp Gln Ser Ala Ala Asp Leu Leu Leu Glu
485 490 495Ile Arg Val Leu
Gln Asp Gln Met Met Gln His Phe Arg Gly Thr Met 500
505 510Pro Pro Asn His Val Leu Pro Ser Ala Asp Arg
Gln His Leu Asp Ser 515 520 525Leu
Tyr Val Arg Phe Ile Thr Cys Leu Asp Asp Leu Pro Pro Tyr Leu 530
535 540Gln Ser Cys Thr Leu Ala Met Ala Ala Met
Ala Glu Gly Asn Gly Ser545 550 555
560Ala Glu Ser Lys Gln Tyr Val Ile Gln Cys Ile Asn Leu Gln Val
Thr 565 570 575Phe His Cys
Leu Arg Met Val Ile Thr Gln Lys Phe Glu Asp Leu Ser 580
585 590Tyr Phe Ala Pro Gly Val Glu Gln Ala Asp
Leu Arg Lys Ser Glu Ile 595 600
605Val Arg Asp Met Leu Arg Val Met Asn Glu Ala Pro Phe Trp Gly Leu 610
615 620Gln Ala Asn Gly Glu Pro Asn Val
Glu Lys Ile Arg Leu Ile Gly Ala625 630
635 640Ser Leu Leu Ala Ile Ile His Arg Asn Gln Asp Ser
Pro Leu Ala Thr 645 650
655Arg Ala Arg Ser Asp Phe Ser Val Leu Leu Asp Ile Leu Thr Arg Leu
660 665 670Asp Ser Lys Ala Ser Asp
67572005DNATrichoderma reesei 7atgctgcgct actcccccgt cttacacctg
gatactctct ccttgccacc actgaccaat 60gctcttcccc gcccaaagtg cgagtacctc
agcgctgtcg atagctgcac gcactgccgc 120gatgcccacg tgcagtgcac tttcgacctg
cccctggcgc gacgcggccc caaagcgagg 180aagaagagcg accagcccgg ccagccgcct
cctgatccga gctcgctctc caccgcggct 240cgacccggcc agatgccgcc gccgctgacc
ttctccggcc ccgcagtagc cgcgctgcag 300cccttcgcct cgtcgtcgct gtcgcccgac
gcggcctggg agcccgtcga gccgctcagc 360attgacaacg gcctgccccg gcagccgctg
ggcgacctgc ccggcctctc caccatccag 420aacatctcga cgcgccagcg atggatacac
ctggccaacg ccatgacgct gcgcaacacg 480acgctagagc gcgtctcgaa gcgatgtatc
gacctcttct tcgactacct ctaccccctc 540acccccctgg tgtacgagcc ggccctccgg
gacgtgctcg catacatctt ctcccagccc 600ttgcctggcg tcaaccaacc atcgccgctg
tcacagctca cgccagaccc gaccaccggc 660accacccccc tcaacgctgc cgagtcgtgg
gccggctttg gccagcccag cggctcgcga 720accgtcggca gcaggctggc tccctgggcc
gactcgacct tcaccctggt cacggccgtc 780tgcgcagagg cagcattcat gctacccaag
gacattttcc ccgaaggaga atccgtctct 840gagatcttgc tcgaagcctc tcgggactgc
ctgcaccagc acctcgaggc cgacctggag 900aatccgacgg ccaactcgat tgccattcgc
tacttccact ccaactgcct ccacgctgcg 960gggaagccca agtactcgtg gcacatattt
ggcgaggcca tccgcctggc gcaggtcatg 1020cagctgcacg aggaggctgc cctcgagggg
ctcgtcccca tcgaggcaga gttccgccgt 1080cgctgctttt ggatcctgta cttgggcgac
aagtcagccg ctatactcaa caatcggccc 1140atcaccatcc acaagtactg cttcgacgcc
ggcatcacca cgctataccc gtcgggtatc 1200gaggacgagt tcctgagcac ggcgtccgag
ccgccccgga agagcttcat atccggcttc 1260aacgcaaatg tgcggctctg gcagtccgcg
gctgatttgc tgctggaaat ccgcgtgctg 1320caagatcaga tgatgcagca ctttcgaggg
accatgcccc cgaaccatgt gctgccctcc 1380gccgacaggc agcatctcga ttctctctat
gtccgcttca tcacctgctt ggacgatctc 1440ccgccgtacc tccagtcgtg cactctggcg
atggcagcga tggcagaagg caacgggtct 1500gccgagtcca agcagtacgt gatacagtgc
atcaacctgc aggtgacgtt tcactgtctg 1560cgcatggtaa ttacgcagaa attcgaagac
ctctcttatt ttgctcctgg cgttgagcag 1620gctgatctca gaaagtcgga gattgtgcga
gacatgctga gggtgatgaa cgaggcgccc 1680ttttggggcc tgcaggccaa tggcgagcca
aacgtgagtc gtttccttgt ctcttctctt 1740ttctgcacac ccttttcttc gacgaccccc
cctctctctt tatatccctg cggatatgta 1800tatcatcaag cctcggcact tgttgctaat
ctgtcctgat tatgttgtct ggatgctgca 1860ggttgaaaag attcgcctta tcggagctag
tttgctggcc atcatccatc gcaaccagga 1920ttcacccttg gctacgcgag ccaggagcga
cttttccgtg cttttggata ttctcacgcg 1980gctggactcg aaggcgtcgg actaa
20058618PRTTrichoderma reesei 8Met Leu
Arg Tyr Ser Pro Val Leu His Leu Asp Thr Leu Ser Leu Pro1 5
10 15Pro Leu Thr Asn Ala Leu Pro Arg
Pro Lys Cys Glu Tyr Leu Ser Ala 20 25
30Val Asp Ser Cys Thr His Cys Arg Asp Ala His Val Gln Cys Thr
Phe 35 40 45Asp Leu Pro Leu Ala
Arg Arg Gly Pro Lys Ala Arg Lys Lys Ser Asp 50 55
60Gln Pro Gly Gln Pro Pro Pro Asp Pro Ser Ser Leu Ser Thr
Ala Ala65 70 75 80Arg
Pro Gly Gln Met Pro Pro Pro Leu Thr Phe Ser Gly Pro Ala Val
85 90 95Ala Ala Leu Gln Pro Phe Ala
Ser Ser Ser Leu Ser Pro Asp Ala Ala 100 105
110Trp Glu Pro Val Glu Pro Leu Ser Ile Asp Asn Gly Leu Pro
Arg Gln 115 120 125Pro Leu Gly Asp
Leu Pro Gly Leu Ser Thr Ile Gln Asn Ile Ser Thr 130
135 140Arg Gln Arg Trp Ile His Leu Ala Asn Ala Met Thr
Leu Arg Asn Thr145 150 155
160Thr Leu Glu Arg Val Ser Lys Arg Cys Ile Asp Leu Phe Phe Asp Tyr
165 170 175Leu Tyr Pro Leu Thr
Pro Leu Val Tyr Glu Pro Ala Leu Arg Asp Val 180
185 190Leu Ala Tyr Ile Phe Ser Gln Pro Leu Pro Gly Val
Asn Gln Pro Ser 195 200 205Pro Leu
Ser Gln Leu Thr Pro Asp Pro Thr Thr Gly Thr Thr Pro Leu 210
215 220Asn Ala Ala Glu Ser Trp Ala Gly Phe Gly Gln
Pro Ser Gly Ser Arg225 230 235
240Thr Val Gly Ser Arg Leu Ala Pro Trp Ala Asp Ser Thr Phe Thr Leu
245 250 255Val Thr Ala Val
Cys Ala Glu Ala Ala Phe Met Leu Pro Lys Asp Ile 260
265 270Phe Pro Glu Gly Glu Ser Val Ser Glu Ile Leu
Leu Glu Ala Ser Arg 275 280 285Asp
Cys Leu His Gln His Leu Glu Ala Asp Leu Glu Asn Pro Thr Ala 290
295 300Asn Ser Ile Ala Ile Arg Tyr Phe His Ser
Asn Cys Leu His Ala Ala305 310 315
320Gly Lys Pro Lys Tyr Ser Trp His Ile Phe Gly Glu Ala Ile Arg
Leu 325 330 335Ala Gln Val
Met Gln Leu His Glu Glu Ala Ala Leu Glu Gly Leu Val 340
345 350Pro Ile Glu Ala Glu Phe Arg Arg Arg Cys
Phe Trp Ile Leu Tyr Leu 355 360
365Gly Asp Lys Ser Ala Ala Ile Leu Asn Asn Arg Pro Ile Thr Ile His 370
375 380Lys Tyr Cys Phe Asp Ala Gly Ile
Thr Thr Leu Tyr Pro Ser Gly Ile385 390
395 400Glu Asp Glu Phe Leu Ser Thr Ala Ser Glu Pro Pro
Arg Lys Ser Phe 405 410
415Ile Ser Gly Phe Asn Ala Asn Val Arg Leu Trp Gln Ser Ala Ala Asp
420 425 430Leu Leu Leu Glu Ile Arg
Val Leu Gln Asp Gln Met Met Gln His Phe 435 440
445Arg Gly Thr Met Pro Pro Asn His Val Leu Pro Ser Ala Asp
Arg Gln 450 455 460His Leu Asp Ser Leu
Tyr Val Arg Phe Ile Thr Cys Leu Asp Asp Leu465 470
475 480Pro Pro Tyr Leu Gln Ser Cys Thr Leu Ala
Met Ala Ala Met Ala Glu 485 490
495Gly Asn Gly Ser Ala Glu Ser Lys Gln Tyr Val Ile Gln Cys Ile Asn
500 505 510Leu Gln Val Thr Phe
His Cys Leu Arg Met Val Ile Thr Gln Lys Phe 515
520 525Glu Asp Leu Ser Tyr Phe Ala Pro Gly Val Glu Gln
Ala Asp Leu Arg 530 535 540Lys Ser Glu
Ile Val Arg Asp Met Leu Arg Val Met Asn Glu Ala Pro545
550 555 560Phe Trp Gly Leu Gln Ala Asn
Gly Glu Pro Asn Val Glu Lys Ile Arg 565
570 575Leu Ile Gly Ala Ser Leu Leu Ala Ile Ile His Arg
Asn Gln Asp Ser 580 585 590Pro
Leu Ala Thr Arg Ala Arg Ser Asp Phe Ser Val Leu Leu Asp Ile 595
600 605Leu Thr Arg Leu Asp Ser Lys Ala Ser
Asp 610 61592641DNATrichoderma reesei 9atgggctcag
cagctccggc ccagggctct gtagctgcag ctgcaggcgg ccctccagct 60gctggcgctg
gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc tgcctcggcc 120tcgcagcccg
gctcgccaac cgcctcaacc acgccgccgc agaactcact cgtgtcggct 180gcaacctcgt
tccaccacca tcccagaggc cgtctggtga gcagagcctg cgaccgctgc 240cgccggcgca
aggccaaggt cagtctagcc cctttgctgt tgcttgcatc tctgttgtca 300ttgctcctcc
tcctgctgct gctgatgctg ctgctcctcc tcctcctcct cctccccgtc 360tcctggtccc
tggtccctgc tcttcatatg tccttactgc ccgtgtctcc tctccccgtt 420cccgttcccc
ctcctcccgt cctcttctcc tgcgtgtctg tcatgcgtac aaagcataca 480tacaatacat
cagcatacat ggcaagcgtt gtgttgtgtt gagagttgtg tgtattgtat 540tgcactgcct
tcacaactcg ttcatactgc tgcagcctca ccccaacacc gacctcgtct 600tccatgctgc
gctactcccc cgtcttacac ctggatactc tctccttgcc accactgacc 660aatgctcttc
cccgcccaaa gtgcgagtac ctcagcgctg tcgatagctg cacgcactgc 720cgcgatgccc
acgtgcagtg cactttcgac ctgcccctgg cgcgacgcgg ccccaaagcg 780aggaagaaga
gcgaccagcc cggccagccg cctcctgatc cgagctcgct ctccaccgcg 840gctcgacccg
gccagatgcc gccgccgctg accttctccg gccccgcagt agccgcgctg 900cagcccttcg
cctcgtcgtc gctgtcgccc gacgcggcct gggagcccgt cgagccgctc 960agcattgaca
acggcctgcc ccggcagccg ctgggcgacc tgcccggcct ctccaccatc 1020cagaacatct
cgacgcgcca gcgatggata cacctggcca acgccatgac gctgcgcaac 1080acgacgctag
agcgcgtctc gaagcgatgt atcgacctct tcttcgacta cctctacccc 1140ctcacccccc
tggtgtacga gccggccctc cgggacgtgc tcgcatacat cttctcccag 1200cccttgcctg
gcgtcaacca accatcgccg ctgtcacagc tcacgccaga cccgaccacc 1260ggcaccaccc
ccctcaacgc tgccgagtcg tgggccggct ttggccagcc cagcggctcg 1320cgaaccgtcg
gcagcaggct ggctccctgg gccgactcga ccttcaccct ggtcacggcc 1380gtctgcgcag
aggcagcatt catgctaccc aaggacattt tccccgaagg agaatccgtc 1440tctgagatct
tgctcgaagc ctctcgggac tgcctgcacc agcacctcga ggccgacctg 1500gagaatccga
cggccaactc gattgccatt cgctacttcc actccaactg cctccacgct 1560gcggggaagc
ccaagtactc gtggcacata tttggcgagg ccatccgcct ggcgcaggtc 1620atgcagctgc
acgaggaggc tgccctcgag gggctcgtcc ccatcgaggc agagttccgc 1680cgtcgctgct
tttggatcct gtacttgggc gacaagtcag ccgctatact caacaatcgg 1740cccatcacca
tccacaagta ctgcttcgac gccggcatca ccacgctata cccgtcgggt 1800atcgaggacg
agttcctgag cacggcgtcc gagccgcccc ggaagagctt catatccggc 1860ttcaacgcaa
atgtgcggct ctggcagtcc gcggctgatt tgctgctgga aatccgcgtg 1920ctgcaagatc
agatgatgca gcactttcga gggaccatgc ccccgaacca tgtgctgccc 1980tccgccgaca
ggcagcatct cgattctctc tatgtccgct tcatcacctg cttggacgat 2040ctcccgccgt
acctccagtc gtgcactctg gcgatggcag cgatggcaga aggcaacggg 2100tctgccgagt
ccaagcagta cgtgatacag tgcatcaacc tgcaggtgac gtttcactgt 2160ctgcgcatgg
taattacgca gaaattcgaa gacctctctt attttgctcc tggcgttgag 2220caggctgatc
tcagaaagtc ggagattgtg cgagacatgc tgagggtgat gaacgaggcg 2280cccttttggg
gcctgcaggc caatggcgag ccaaacgtga gtcgtttcct tgtctcttct 2340cttttctgca
cacccttttc ttcgacgacc ccccctctct ctttatatcc ctgcggatat 2400gtatatcatc
aagcctcggc acttgttgct aatctgtcct gattatgttg tctggatgct 2460gcaggttgaa
aagattcgcc ttatcggagc tagtttgctg gccatcatcc atcgcaacca 2520ggattcaccc
ttggctacgc gagccaggag cgacttttcc gtgcttttgg atattctcac 2580gcggctggac
tcgaaggcgt cggaccaact gaggaatacg tccactaccg ttgttggcta 2640a
264110689PRTTrichoderma reesei 10Met Gly Ser Ala Ala Pro Ala Gln Gly Ser
Val Ala Ala Ala Ala Gly1 5 10
15Gly Pro Pro Ala Ala Gly Ala Gly Ala Gly Ala Val His Ala Leu Thr
20 25 30Thr Ser Pro Glu Ser Ala
Ser Ala Ser Gln Pro Gly Ser Pro Thr Ala 35 40
45Ser Thr Thr Pro Pro Gln Asn Ser Leu Val Ser Ala Ala Thr
Ser Phe 50 55 60His His His Pro Arg
Gly Arg Leu Val Ser Arg Ala Cys Asp Arg Cys65 70
75 80Arg Arg Arg Lys Ala Lys Cys Glu Tyr Leu
Ser Ala Val Asp Ser Cys 85 90
95Thr His Cys Arg Asp Ala His Val Gln Cys Thr Phe Asp Leu Pro Leu
100 105 110Ala Arg Arg Gly Pro
Lys Ala Arg Lys Lys Ser Asp Gln Pro Gly Gln 115
120 125Pro Pro Pro Asp Pro Ser Ser Leu Ser Thr Ala Ala
Arg Pro Gly Gln 130 135 140Met Pro Pro
Pro Leu Thr Phe Ser Gly Pro Ala Val Ala Ala Leu Gln145
150 155 160Pro Phe Ala Ser Ser Ser Leu
Ser Pro Asp Ala Ala Trp Glu Pro Val 165
170 175Glu Pro Leu Ser Ile Asp Asn Gly Leu Pro Arg Gln
Pro Leu Gly Asp 180 185 190Leu
Pro Gly Leu Ser Thr Ile Gln Asn Ile Ser Thr Arg Gln Arg Trp 195
200 205Ile His Leu Ala Asn Ala Met Thr Leu
Arg Asn Thr Thr Leu Glu Arg 210 215
220Val Ser Lys Arg Cys Ile Asp Leu Phe Phe Asp Tyr Leu Tyr Pro Leu225
230 235 240Thr Pro Leu Val
Tyr Glu Pro Ala Leu Arg Asp Val Leu Ala Tyr Ile 245
250 255Phe Ser Gln Pro Leu Pro Gly Val Asn Gln
Pro Ser Pro Leu Ser Gln 260 265
270Leu Thr Pro Asp Pro Thr Thr Gly Thr Thr Pro Leu Asn Ala Ala Glu
275 280 285Ser Trp Ala Gly Phe Gly Gln
Pro Ser Gly Ser Arg Thr Val Gly Ser 290 295
300Arg Leu Ala Pro Trp Ala Asp Ser Thr Phe Thr Leu Val Thr Ala
Val305 310 315 320Cys Ala
Glu Ala Ala Phe Met Leu Pro Lys Asp Ile Phe Pro Glu Gly
325 330 335Glu Ser Val Ser Glu Ile Leu
Leu Glu Ala Ser Arg Asp Cys Leu His 340 345
350Gln His Leu Glu Ala Asp Leu Glu Asn Pro Thr Ala Asn Ser
Ile Ala 355 360 365Ile Arg Tyr Phe
His Ser Asn Cys Leu His Ala Ala Gly Lys Pro Lys 370
375 380Tyr Ser Trp His Ile Phe Gly Glu Ala Ile Arg Leu
Ala Gln Val Met385 390 395
400Gln Leu His Glu Glu Ala Ala Leu Glu Gly Leu Val Pro Ile Glu Ala
405 410 415Glu Phe Arg Arg Arg
Cys Phe Trp Ile Leu Tyr Leu Gly Asp Lys Ser 420
425 430Ala Ala Ile Leu Asn Asn Arg Pro Ile Thr Ile His
Lys Tyr Cys Phe 435 440 445Asp Ala
Gly Ile Thr Thr Leu Tyr Pro Ser Gly Ile Glu Asp Glu Phe 450
455 460Leu Ser Thr Ala Ser Glu Pro Pro Arg Lys Ser
Phe Ile Ser Gly Phe465 470 475
480Asn Ala Asn Val Arg Leu Trp Gln Ser Ala Ala Asp Leu Leu Leu Glu
485 490 495Ile Arg Val Leu
Gln Asp Gln Met Met Gln His Phe Arg Gly Thr Met 500
505 510Pro Pro Asn His Val Leu Pro Ser Ala Asp Arg
Gln His Leu Asp Ser 515 520 525Leu
Tyr Val Arg Phe Ile Thr Cys Leu Asp Asp Leu Pro Pro Tyr Leu 530
535 540Gln Ser Cys Thr Leu Ala Met Ala Ala Met
Ala Glu Gly Asn Gly Ser545 550 555
560Ala Glu Ser Lys Gln Tyr Val Ile Gln Cys Ile Asn Leu Gln Val
Thr 565 570 575Phe His Cys
Leu Arg Met Val Ile Thr Gln Lys Phe Glu Asp Leu Ser 580
585 590Tyr Phe Ala Pro Gly Val Glu Gln Ala Asp
Leu Arg Lys Ser Glu Ile 595 600
605Val Arg Asp Met Leu Arg Val Met Asn Glu Ala Pro Phe Trp Gly Leu 610
615 620Gln Ala Asn Gly Glu Pro Asn Val
Glu Lys Ile Arg Leu Ile Gly Ala625 630
635 640Ser Leu Leu Ala Ile Ile His Arg Asn Gln Asp Ser
Pro Leu Ala Thr 645 650
655Arg Ala Arg Ser Asp Phe Ser Val Leu Leu Asp Ile Leu Thr Arg Leu
660 665 670Asp Ser Lys Ala Ser Asp
Gln Leu Arg Asn Thr Ser Thr Thr Val Val 675 680
685Gly112885DNATrichoderma reesei 11atggccacag cggccgcggc
agcagctggc ggcgcggcgg ttgctgcggg tgcagacaca 60ggtgcgttga gtcccgtccc
gtccgctcgc gttccctccc agctgccagc ccgcgtgggt 120ggcactggaa cgcagtgcag
cgcaatcagt gcagtgcggc ccccccaact aacgctgccc 180cccgtggctc ctcggccaca
caggcgctgc aggctccagc tctacaggcc ctccaggcct 240tccagggctt ccaggcaccc
ggacaggctc cgtggcgatg ggctcagcag ctccggccca 300gggctctgta gctgcagctg
caggcggccc tccagctgct ggcgctggcg ctggcgctgt 360ccacgccctc accacctcgc
ccgagtctgc ctcggcctcg cagcccggct cgccaaccgc 420ctcaaccacg ccgccgcaga
actcactcgt gtcggctgca acctcgttcc accaccatcc 480cagaggccgt ctggtgagca
gagcctgcga ccgctgccgc cggcgcaagg ccaaggtcag 540tctagcccct ttgctgttgc
ttgcatctct gttgtcattg ctcctcctcc tgctgctgct 600gatgctgctg ctcctcctcc
tcctcctcct ccccgtctcc tggtccctgg tccctgctct 660tcatatgtcc ttactgcccg
tgtctcctct ccccgttccc gttccccctc ctcccgtcct 720cttctcctgc gtgtctgtca
tgcgtacaaa gcatacatac aatacatcag catacatggc 780aagcgttgtg ttgtgttgag
agttgtgtgt attgtattgc actgccttca caactcgttc 840atactgctgc agcctcaccc
caacaccgac ctcgtcttcc atgctgcgct actcccccgt 900cttacacctg gatactctct
ccttgccacc actgaccaat gctcttcccc gcccaaagtg 960cgagtacctc agcgctgtcg
atagctgcac gcactgccgc gatgcccacg tgcagtgcac 1020tttcgacctg cccctggcgc
gacgcggccc caaagcgagg aagaagagcg accagcccgg 1080ccagccgcct cctgatccga
gctcgctctc caccgcggct cgacccggcc agatgccgcc 1140gccgctgacc ttctccggcc
ccgcagtagc cgcgctgcag cccttcgcct cgtcgtcgct 1200gtcgcccgac gcggcctggg
agcccgtcga gccgctcagc attgacaacg gcctgccccg 1260gcagccgctg ggcgacctgc
ccggcctctc caccatccag aacatctcga cgcgccagcg 1320atggatacac ctggccaacg
ccatgacgct gcgcaacacg acgctagagc gcgtctcgaa 1380gcgatgtatc gacctcttct
tcgactacct ctaccccctc acccccctgg tgtacgagcc 1440ggccctccgg gacgtgctcg
catacatctt ctcccagccc ttgcctggcg tcaaccaacc 1500atcgccgctg tcacagctca
cgccagaccc gaccaccggc accacccccc tcaacgctgc 1560cgagtcgtgg gccggctttg
gccagcccag cggctcgcga accgtcggca gcaggctggc 1620tccctgggcc gactcgacct
tcaccctggt cacggccgtc tgcgcagagg cagcattcat 1680gctacccaag gacattttcc
ccgaaggaga atccgtctct gagatcttgc tcgaagcctc 1740tcgggactgc ctgcaccagc
acctcgaggc cgacctggag aatccgacgg ccaactcgat 1800tgccattcgc tacttccact
ccaactgcct ccacgctgcg gggaagccca agtactcgtg 1860gcacatattt ggcgaggcca
tccgcctggc gcaggtcatg cagctgcacg aggaggctgc 1920cctcgagggg ctcgtcccca
tcgaggcaga gttccgccgt cgctgctttt ggatcctgta 1980cttgggcgac aagtcagccg
ctatactcaa caatcggccc atcaccatcc acaagtactg 2040cttcgacgcc ggcatcacca
cgctataccc gtcgggtatc gaggacgagt tcctgagcac 2100ggcgtccgag ccgccccgga
agagcttcat atccggcttc aacgcaaatg tgcggctctg 2160gcagtccgcg gctgatttgc
tgctggaaat ccgcgtgctg caagatcaga tgatgcagca 2220ctttcgaggg accatgcccc
cgaaccatgt gctgccctcc gccgacaggc agcatctcga 2280ttctctctat gtccgcttca
tcacctgctt ggacgatctc ccgccgtacc tccagtcgtg 2340cactctggcg atggcagcga
tggcagaagg caacgggtct gccgagtcca agcagtacgt 2400gatacagtgc atcaacctgc
aggtgacgtt tcactgtctg cgcatggtaa ttacgcagaa 2460attcgaagac ctctcttatt
ttgctcctgg cgttgagcag gctgatctca gaaagtcgga 2520gattgtgcga gacatgctga
gggtgatgaa cgaggcgccc ttttggggcc tgcaggccaa 2580tggcgagcca aacgtgagtc
gtttccttgt ctcttctctt ttctgcacac ccttttcttc 2640gacgaccccc cctctctctt
tatatccctg cggatatgta tatcatcaag cctcggcact 2700tgttgctaat ctgtcctgat
tatgttgtct ggatgctgca ggttgaaaag attcgcctta 2760tcggagctag tttgctggcc
atcatccatc gcaaccagga ttcacccttg gctacgcgag 2820ccaggagcga cttttccgtg
cttttggata ttctcacgcg gctggactcg aaggcgtcgg 2880actaa
288512723PRTTrichoderma
reesei 12Met Ala Thr Ala Ala Ala Ala Ala Ala Gly Gly Ala Ala Val Ala Ala1
5 10 15Gly Ala Asp Thr
Gly Ala Ala Gly Ser Ser Ser Thr Gly Pro Pro Gly 20
25 30Leu Pro Gly Leu Pro Gly Thr Arg Thr Gly Ser
Val Ala Met Gly Ser 35 40 45Ala
Ala Pro Ala Gln Gly Ser Val Ala Ala Ala Ala Gly Gly Pro Pro 50
55 60Ala Ala Gly Ala Gly Ala Gly Ala Val His
Ala Leu Thr Thr Ser Pro65 70 75
80Glu Ser Ala Ser Ala Ser Gln Pro Gly Ser Pro Thr Ala Ser Thr
Thr 85 90 95Pro Pro Gln
Asn Ser Leu Val Ser Ala Ala Thr Ser Phe His His His 100
105 110Pro Arg Gly Arg Leu Val Ser Arg Ala Cys
Asp Arg Cys Arg Arg Arg 115 120
125Lys Ala Lys Cys Glu Tyr Leu Ser Ala Val Asp Ser Cys Thr His Cys 130
135 140Arg Asp Ala His Val Gln Cys Thr
Phe Asp Leu Pro Leu Ala Arg Arg145 150
155 160Gly Pro Lys Ala Arg Lys Lys Ser Asp Gln Pro Gly
Gln Pro Pro Pro 165 170
175Asp Pro Ser Ser Leu Ser Thr Ala Ala Arg Pro Gly Gln Met Pro Pro
180 185 190Pro Leu Thr Phe Ser Gly
Pro Ala Val Ala Ala Leu Gln Pro Phe Ala 195 200
205Ser Ser Ser Leu Ser Pro Asp Ala Ala Trp Glu Pro Val Glu
Pro Leu 210 215 220Ser Ile Asp Asn Gly
Leu Pro Arg Gln Pro Leu Gly Asp Leu Pro Gly225 230
235 240Leu Ser Thr Ile Gln Asn Ile Ser Thr Arg
Gln Arg Trp Ile His Leu 245 250
255Ala Asn Ala Met Thr Leu Arg Asn Thr Thr Leu Glu Arg Val Ser Lys
260 265 270Arg Cys Ile Asp Leu
Phe Phe Asp Tyr Leu Tyr Pro Leu Thr Pro Leu 275
280 285Val Tyr Glu Pro Ala Leu Arg Asp Val Leu Ala Tyr
Ile Phe Ser Gln 290 295 300Pro Leu Pro
Gly Val Asn Gln Pro Ser Pro Leu Ser Gln Leu Thr Pro305
310 315 320Asp Pro Thr Thr Gly Thr Thr
Pro Leu Asn Ala Ala Glu Ser Trp Ala 325
330 335Gly Phe Gly Gln Pro Ser Gly Ser Arg Thr Val Gly
Ser Arg Leu Ala 340 345 350Pro
Trp Ala Asp Ser Thr Phe Thr Leu Val Thr Ala Val Cys Ala Glu 355
360 365Ala Ala Phe Met Leu Pro Lys Asp Ile
Phe Pro Glu Gly Glu Ser Val 370 375
380Ser Glu Ile Leu Leu Glu Ala Ser Arg Asp Cys Leu His Gln His Leu385
390 395 400Glu Ala Asp Leu
Glu Asn Pro Thr Ala Asn Ser Ile Ala Ile Arg Tyr 405
410 415Phe His Ser Asn Cys Leu His Ala Ala Gly
Lys Pro Lys Tyr Ser Trp 420 425
430His Ile Phe Gly Glu Ala Ile Arg Leu Ala Gln Val Met Gln Leu His
435 440 445Glu Glu Ala Ala Leu Glu Gly
Leu Val Pro Ile Glu Ala Glu Phe Arg 450 455
460Arg Arg Cys Phe Trp Ile Leu Tyr Leu Gly Asp Lys Ser Ala Ala
Ile465 470 475 480Leu Asn
Asn Arg Pro Ile Thr Ile His Lys Tyr Cys Phe Asp Ala Gly
485 490 495Ile Thr Thr Leu Tyr Pro Ser
Gly Ile Glu Asp Glu Phe Leu Ser Thr 500 505
510Ala Ser Glu Pro Pro Arg Lys Ser Phe Ile Ser Gly Phe Asn
Ala Asn 515 520 525Val Arg Leu Trp
Gln Ser Ala Ala Asp Leu Leu Leu Glu Ile Arg Val 530
535 540Leu Gln Asp Gln Met Met Gln His Phe Arg Gly Thr
Met Pro Pro Asn545 550 555
560His Val Leu Pro Ser Ala Asp Arg Gln His Leu Asp Ser Leu Tyr Val
565 570 575Arg Phe Ile Thr Cys
Leu Asp Asp Leu Pro Pro Tyr Leu Gln Ser Cys 580
585 590Thr Leu Ala Met Ala Ala Met Ala Glu Gly Asn Gly
Ser Ala Glu Ser 595 600 605Lys Gln
Tyr Val Ile Gln Cys Ile Asn Leu Gln Val Thr Phe His Cys 610
615 620Leu Arg Met Val Ile Thr Gln Lys Phe Glu Asp
Leu Ser Tyr Phe Ala625 630 635
640Pro Gly Val Glu Gln Ala Asp Leu Arg Lys Ser Glu Ile Val Arg Asp
645 650 655Met Leu Arg Val
Met Asn Glu Ala Pro Phe Trp Gly Leu Gln Ala Asn 660
665 670Gly Glu Pro Asn Val Glu Lys Ile Arg Leu Ile
Gly Ala Ser Leu Leu 675 680 685Ala
Ile Ile His Arg Asn Gln Asp Ser Pro Leu Ala Thr Arg Ala Arg 690
695 700Ser Asp Phe Ser Val Leu Leu Asp Ile Leu
Thr Arg Leu Asp Ser Lys705 710 715
720Ala Ser Asp132185DNATrichoderma reesei 13atgggctcag
cagctccggc ccagggctct gtagctgcag ctgcaggcgg ccctccagct 60gctggcgctg
gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc tgcctcggcc 120tcgcagcccg
gctcgccaac cgcctcaacc acgccgccgc agaactcact cgtgtcggct 180gcaacctcgt
tccaccacca tcccagaggc cgtctggtga gcagagcctg cgaccgctgc 240cgccggcgca
aggccaagtg cgagtacctc agcgctgtcg atagctgcac gcactgccgc 300gatgcccacg
tgcagtgcac tttcgacctg cccctggcgc gacgcggccc caaagcgagg 360aagaagagcg
accagcccgg ccagccgcct cctgatccga gctcgctctc caccgcggct 420cgacccggcc
agatgccgcc gccgctgacc ttctccggcc ccgcagtagc cgcgctgcag 480cccttcgcct
cgtcgtcgct gtcgcccgac gcggcctggg agcccgtcga gccgctcagc 540attgacaacg
gcctgccccg gcagccgctg ggcgacctgc ccggcctctc caccatccag 600aacatctcga
cgcgccagcg atggatacac ctggccaacg ccatgacgct gcgcaacacg 660acgctagagc
gcgtctcgaa gcgatgtatc gacctcttct tcgactacct ctaccccctc 720acccccctgg
tgtacgagcc ggccctccgg gacgtgctcg catacatctt ctcccagccc 780ttgcctggcg
tcaaccaacc atcgccgctg tcacagctca cgccagaccc gaccaccggc 840accacccccc
tcaacgctgc cgagtcgtgg gccggctttg gccagcccag cggctcgcga 900accgtcggca
gcaggctggc tccctgggcc gactcgacct tcaccctggt cacggccgtc 960tgcgcagagg
cagcattcat gctacccaag gacattttcc ccgaaggaga atccgtctct 1020gagatcttgc
tcgaagcctc tcgggactgc ctgcaccagc acctcgaggc cgacctggag 1080aatccgacgg
ccaactcgat tgccattcgc tacttccact ccaactgcct ccacgctgcg 1140gggaagccca
agtactcgtg gcacatattt ggcgaggcca tccgcctggc gcaggtcatg 1200cagctgcacg
aggaggctgc cctcgagggg ctcgtcccca tcgaggcaga gttccgccgt 1260cgctgctttt
ggatcctgta cttgggcgac aagtcagccg ctatactcaa caatcggccc 1320atcaccatcc
acaagtactg cttcgacgcc ggcatcacca cgctataccc gtcgggtatc 1380gaggacgagt
tcctgagcac ggcgtccgag ccgccccgga agagcttcat atccggcttc 1440aacgcaaatg
tgcggctctg gcagtccgcg gctgatttgc tgctggaaat ccgcgtgctg 1500caagatcaga
tgatgcagca ctttcgaggg accatgcccc cgaaccatgt gctgccctcc 1560gccgacaggc
agcatctcga ttctctctat gtccgcttca tcacctgctt ggacgatctc 1620ccgccgtacc
tccagtcgtg cactctggcg atggcagcga tggcagaagg caacgggtct 1680gccgagtcca
agcagtacgt gatacagtgc atcaacctgc aggtgacgtt tcactgtctg 1740cgcatggtaa
ttacgcagaa attcgaagac ctctcttatt ttgctcctgg cgttgagcag 1800gctgatctca
gaaagtcgga gattgtgcga gacatgctga gggtgatgaa cgaggcgccc 1860ttttggggcc
tgcaggccaa tggcgagcca aacgtgagtc gtttccttgt ctcttctctt 1920ttctgcacac
ccttttcttc gacgaccccc cctctctctt tatatccctg cggatatgta 1980tatcatcaag
cctcggcact tgttgctaat ctgtcctgat tatgttgtct ggatgctgca 2040ggttgaaaag
attcgcctta tcggagctag tttgctggcc atcatccatc gcaaccagga 2100ttcacccttg
gctacgcgag ccaggagcga cttttccgtg cttttggata ttctcacgcg 2160gctggactcg
aaggcgtcgg actaa
218514678PRTTrichoderma reesei 14Met Gly Ser Ala Ala Pro Ala Gln Gly Ser
Val Ala Ala Ala Ala Gly1 5 10
15Gly Pro Pro Ala Ala Gly Ala Gly Ala Gly Ala Val His Ala Leu Thr
20 25 30Thr Ser Pro Glu Ser Ala
Ser Ala Ser Gln Pro Gly Ser Pro Thr Ala 35 40
45Ser Thr Thr Pro Pro Gln Asn Ser Leu Val Ser Ala Ala Thr
Ser Phe 50 55 60His His His Pro Arg
Gly Arg Leu Val Ser Arg Ala Cys Asp Arg Cys65 70
75 80Arg Arg Arg Lys Ala Lys Cys Glu Tyr Leu
Ser Ala Val Asp Ser Cys 85 90
95Thr His Cys Arg Asp Ala His Val Gln Cys Thr Phe Asp Leu Pro Leu
100 105 110Ala Arg Arg Gly Pro
Lys Ala Arg Lys Lys Ser Asp Gln Pro Gly Gln 115
120 125Pro Pro Pro Asp Pro Ser Ser Leu Ser Thr Ala Ala
Arg Pro Gly Gln 130 135 140Met Pro Pro
Pro Leu Thr Phe Ser Gly Pro Ala Val Ala Ala Leu Gln145
150 155 160Pro Phe Ala Ser Ser Ser Leu
Ser Pro Asp Ala Ala Trp Glu Pro Val 165
170 175Glu Pro Leu Ser Ile Asp Asn Gly Leu Pro Arg Gln
Pro Leu Gly Asp 180 185 190Leu
Pro Gly Leu Ser Thr Ile Gln Asn Ile Ser Thr Arg Gln Arg Trp 195
200 205Ile His Leu Ala Asn Ala Met Thr Leu
Arg Asn Thr Thr Leu Glu Arg 210 215
220Val Ser Lys Arg Cys Ile Asp Leu Phe Phe Asp Tyr Leu Tyr Pro Leu225
230 235 240Thr Pro Leu Val
Tyr Glu Pro Ala Leu Arg Asp Val Leu Ala Tyr Ile 245
250 255Phe Ser Gln Pro Leu Pro Gly Val Asn Gln
Pro Ser Pro Leu Ser Gln 260 265
270Leu Thr Pro Asp Pro Thr Thr Gly Thr Thr Pro Leu Asn Ala Ala Glu
275 280 285Ser Trp Ala Gly Phe Gly Gln
Pro Ser Gly Ser Arg Thr Val Gly Ser 290 295
300Arg Leu Ala Pro Trp Ala Asp Ser Thr Phe Thr Leu Val Thr Ala
Val305 310 315 320Cys Ala
Glu Ala Ala Phe Met Leu Pro Lys Asp Ile Phe Pro Glu Gly
325 330 335Glu Ser Val Ser Glu Ile Leu
Leu Glu Ala Ser Arg Asp Cys Leu His 340 345
350Gln His Leu Glu Ala Asp Leu Glu Asn Pro Thr Ala Asn Ser
Ile Ala 355 360 365Ile Arg Tyr Phe
His Ser Asn Cys Leu His Ala Ala Gly Lys Pro Lys 370
375 380Tyr Ser Trp His Ile Phe Gly Glu Ala Ile Arg Leu
Ala Gln Val Met385 390 395
400Gln Leu His Glu Glu Ala Ala Leu Glu Gly Leu Val Pro Ile Glu Ala
405 410 415Glu Phe Arg Arg Arg
Cys Phe Trp Ile Leu Tyr Leu Gly Asp Lys Ser 420
425 430Ala Ala Ile Leu Asn Asn Arg Pro Ile Thr Ile His
Lys Tyr Cys Phe 435 440 445Asp Ala
Gly Ile Thr Thr Leu Tyr Pro Ser Gly Ile Glu Asp Glu Phe 450
455 460Leu Ser Thr Ala Ser Glu Pro Pro Arg Lys Ser
Phe Ile Ser Gly Phe465 470 475
480Asn Ala Asn Val Arg Leu Trp Gln Ser Ala Ala Asp Leu Leu Leu Glu
485 490 495Ile Arg Val Leu
Gln Asp Gln Met Met Gln His Phe Arg Gly Thr Met 500
505 510Pro Pro Asn His Val Leu Pro Ser Ala Asp Arg
Gln His Leu Asp Ser 515 520 525Leu
Tyr Val Arg Phe Ile Thr Cys Leu Asp Asp Leu Pro Pro Tyr Leu 530
535 540Gln Ser Cys Thr Leu Ala Met Ala Ala Met
Ala Glu Gly Asn Gly Ser545 550 555
560Ala Glu Ser Lys Gln Tyr Val Ile Gln Cys Ile Asn Leu Gln Val
Thr 565 570 575Phe His Cys
Leu Arg Met Val Ile Thr Gln Lys Phe Glu Asp Leu Ser 580
585 590Tyr Phe Ala Pro Gly Val Glu Gln Ala Asp
Leu Arg Lys Ser Glu Ile 595 600
605Val Arg Asp Met Leu Arg Val Met Asn Glu Ala Pro Phe Trp Gly Leu 610
615 620Gln Ala Asn Gly Glu Pro Asn Val
Glu Lys Ile Arg Leu Ile Gly Ala625 630
635 640Ser Leu Leu Ala Ile Ile His Arg Asn Gln Asp Ser
Pro Leu Ala Thr 645 650
655Arg Ala Arg Ser Asp Phe Ser Val Leu Leu Asp Ile Leu Thr Arg Leu
660 665 670Asp Ser Lys Ala Ser Asp
67515930DNAArtificial Sequencepromoter sequence 15agcagtggct
tatagcaata tcgtgcttgt ctctgccctc gctgaagcta tccctccctc 60gtgtccccct
tcgtggagaa tgactgcagt aaaggagacg atacgctctt gggaaggtcc 120tgaagggggt
ggctgttggg attgcaacct ctggcatttg tcgaatggcg ctttatgcgt 180cgcgctcgcg
agtgatgttg agaggaaagt caacgttgtg acggcttcac aatttgccct 240ttcattaagg
cttattgccc gctaaattac tataaggaag gtcggcagct gggattacgc 300atgtgttgct
agacacaatc tcgaacgaga cgctatcaga ggacaagttt tctgacaatc 360tgtcgtggta
ttgaacgctt ttcgtgtttg taaaccagca ttcatgaggt tcgagggccc 420acgcattcat
tgggatctca tcaatgaagc ggaatagtac aagaagaccg agcatccatt 480acagacctca
tgcagctaag gaaacggatc acccttaaag acgtggatgt agtttccgtt 540gctcgcgcac
attagaaggc tggtactata ggtgagggaa gcgcatgctt gttgtttatc 600cgccatgata
agaggagtgt aagccggctg catggacttt ttccataccc tgtcttgcct 660gtccatcttg
aaattggcaa gctccacctt ccggttaaaa tcgcaggctt aaggtcttct 720aataaccact
cagcatttgc tcaaccatgt ctttgctcct ctcacctgac ctgcatctcc 780ttttagcctc
caggagttgg cgaattgatg ccgattttga cgtcaaatcg cattgagata 840actcacgata
ttcgttttac aggctaaaga attgcctcca gcgttccagt tcccgtcgta 900ggccgagacg
acactgcctc actaccagcc
93016930DNAArtificial Sequencepromoter sequence 16accccaatct gaggttcagg
tttggcttcc ttcgagttct ccaagttctc tgaatcgtat 60gtccgcattc attggtatcg
aagtttgtga ttaatctcga gaatgtgcat acttcagtca 120cctcaacata cacggaatcc
agcctcttca tgaggaatcc ttactccttc ataccccaag 180tgcccgggca gataattgta
cccattcaca aatgaactta gactgtactc cgcacttctt 240tcaggctcct ctctcctcac
gatgccccaa tgcttgccac tccacaaggt acatgtagta 300atctgcagtt actcccccgc
ttttgcctac ttagccggca agaatgagat gcaagtttgt 360tcctgtcggg agtattggct
aaatggaaac acaagtagaa gaagagaaac agaaaaggtc 420caataccggc tattcacaac
ggatctgcgt ctgtgtctga tagaactagt aaaagtcggc 480agtatccgct gtcatcaaga
tcatatacta aaacgtaagc taaacgcaat ggcttggaaa 540aggggattga gacagaagat
acaccaacga ccacccctgt tagtgacaga gatggcagtc 600attcgactag cggctggcaa
ttggtgtccg ccttgtattc aggctaaata tctcgaggtg 660ccgggaaatc atggtgagga
ggagttggca tgtgtggagc cgtgatgcag gtcggaccac 720accaagaagc tggggtagca
tttccgtccc gtatggggtt aacatggggt aacatgctgg 780aattgcaaat gatgcatggg
ggaagaatgc aacatcgtca tcgtcatacc gctcaattta 840aatattgggc ttttccgggg
atcagatgga agaaggcaac agagagagag acaaggaaga 900ccgtgagcca ttgaaggaca
gccggacgca 93017930DNAArtificial
Sequencepromoter sequence 17tctatggcca ctctgtcgcc tgttcatctg tatcagcacc
aaagccatga ccgtgatgta 60ttgatgtgcc atcttggcgt tctttcggca acacaccggg
cttgaggttt gtcactccct 120ctccgcactt gagcacaacg ccggctgcct cgtgtcccag
aatacagtct ccttcgaaga 180cgagggagcc gattctccca gacttccaga aatggacatc
cgatcttgca ctctgtcagc 240ctgcagttga atgcgagttt gttgaagacc ttcagcactc
acccgcatat gccagtagct 300ttgatttgca gcaagacttg tccgcgctct ggtttataca
ctggtgcttc gaccagcttc 360aggttgtggt cggcagttgc ttgtagtgat ggattgggtc
gtggagcttg aatgatccta 420tgctcaagat cccgagctac agaaacgttg ccgctgggca
tggttgctga ggccatggtt 480taggtcgagg caatcgacag aagctcgaaa gtagtgaagt
ttggtgtaag tagaatgctg 540acggtgactt tgcgaatgcc caaatgtcaa gtgtaaagta
ccaaactact gtcggtcagg 600tgcaagaaac gcaatattgc tgggaattat taaatcagaa
gggtagacaa taagacgtga 660tggcctctga ggagctcaaa tgatcgcgct ccaagaggtg
gctaaaactt cccgattcgg 720caatcctcac ggcttcctcg atgcggatgc aataacctct
attagcctat atctgcggaa 780gctatagacc gagcatttgc gtttgtcata tcttcgacat
catttctctg atccttttct 840ttttattata tagaagctga agttgtacgg cacaactgtc
aacacaccgt tgccgcggaa 900ttctccccta tacttgacca atccatcaag
93018930DNAArtificial Sequencepromoter sequence
18tcaacatatg gttggactag gctcgtctca cgtccagttt cttcaagtca tatgttccag
60gaccgggaag atgtctgcaa attggatagt ttttctttcg tagctgccct cgatcaacct
120gggacgcgat acgcctcagt tcaagtactt gatctgaagt accgtatgtt taggctgata
180tccgatggga tgcccccaaa tacaaggctc gtcaacctga ttatgagaca attctttcac
240ctacgtcaat ctcgggtcat tctttgcaag aaacacgatc agtccatctc tcaggagcct
300gtcgtgtttt tctgctgaga ccattgggct tcccctcgac agtatgttgc cccttggcta
360actctcctcc acgcctacct ggcctacctg acctaccagg gaggcggtct tcttacctac
420ctatcaaagg gcctccacgt ggctgcgatg ctctaatcaa caaattcctt cctcgcaagc
480ttcttctttc tgactgtctt ccaggttctg ctggccttgt tcctcggcaa ccagagcgat
540cggtgcagga agcagcgaga agcgagctct caggagaata agcgagtcga tactccatcg
600gaagtctctc gcgcgtgcag ctgccgattc cgaggccact cgctctttgc cgaatgagcg
660tcacgacggc cctacagata taccgatagc gttgccctgc cacctgatca agttgtcgcc
720tactatatgt ctcgaggcat gaccgtatcc aaagctgcag cttggattct cacctcctca
780gagccgacct tggaatagca ggggacacat ttggcctcct cagcaccgct ctttggcgcg
840tctcctctgc gtttgatttg ttcttccact tctctcttcc ctgatatctc ttcttgaact
900gccggctgcg ttgtcgaact cgtgctcacg
93019930DNAArtificial Sequencepromoter sequence 19gcgattagca cgcatcgctg
ctgggaccgt gagctcgacg ggctcaacag catggtggcg 60tactgaggga tatcgttcac
atcgttgaac gaggcggaca tgagaaacga cttgatatct 120gtattattta cttgtacatg
tacggcagtc actaatacct gtctcaatca atgaagattg 180atgtaaataa gcttaatcaa
actgtctaaa atatgtttac attttaagtc tttgctcctg 240gtttgtgcta ataaatgcgt
gaggtgacat cgtccgggaa tagtgagacg aagtggtatc 300accaagtgga gggactcatt
attgttcatg cacgtcccat gtacaaggcc taaatccgcc 360agctattccc cgtatgacct
gtcaatactc gatacgatac agtagctgta tggacaagca 420agtactactg gtatgggtgt
aaccccagct gctacaaacc ctgggaagca gactctcaca 480acctattact aggtactctc
gttcgttttc tcaaagttta gggcatctcg catgagagca 540agacgttgcc ggcatcgcct
cagctactta tgatgccatc tcatcaagcc catgagacca 600cctatgcact gtcacaagag
aacaaacttc gccttttgga acccgcaaaa acaggggaga 660tgcccgttgg tctttgcttg
tctttaatcc gcttgatctg tgtccacagg aacgggggaa 720aaaacaactc gggttcgtat
ttgcggtgtg gcagcttcca acaggggtat ggaaaatcga 780ccttcccaca cgacgggtta
atatccacaa gccggcgaaa tggtaaattt ataaatcgag 840catcattccc atctgggtgg
atttcaaaca aaagaaaagg aagcgcatcg tggaaagggt 900gcaaggctcg gataaagtcc
tcttctcgcc 93020930DNAArtificial
Sequencepromoter sequence 20tgcgaactgg caatgagttt tcaaccatca aagtcacggc
gcagttgtcg tacatggtgg 60tccgagaata aaaaggctac atggtaaatt cgttaaaggg
caaggtcaat aggagcacag 120tgatgcttcc ttggacagtg ttgcttacat ccgatcatcc
caccttgaca tacactcgct 180ttgagtattc gatcgtgcca acccgattga tacattacaa
gcagaactga gccgctgtta 240tcgacacact tgcggtcttc tcagtgagac gcttctacct
cgcttgcgtt gatatcacga 300gggcattgat acgtcaacca cttcatatca agtctgattg
ctgaatgcct tcaatcattc 360aggcccacaa atatccctac agcatgctca ctttgaaatg
agtttttctc tctctttcgg 420ccagcaggcc cgtttggcgc gtatgagcgc cgaagctgac
actccagcga cgtgctgatc 480tagattctgg acacgaatag attcctattg aagggagtga
cgtccccacg atgaactccc 540gtcgagacag ttttgcatgc atacagccgt ttaacagcca
gcggtgtact ttatacaaag 600aacaacgtcg ctgtgttagt tgcgccaact tggcgtgatt
ggacggacgc cgactcaacc 660cctgcatcac aatccgccaa gaagcgtcac cgcggataaa
aaggctaaat ggatggtctt 720caactcttcg cgacatggaa cgcgagcagg tattacagaa
tgatgaccgg ttaaatctgg 780cagtctccat ggtactgaag tcaaagcaag agggacaatt
cacaatggcc ttgatataaa 840agcgataaca tgtctccggt caaggcctgg atgagcagag
tttagagcaa actgcctgct 900tgggaatctt ctctctactt tctcctcgac
93021930DNAArtificial Sequencepromoter sequence
21ctggggtaac agagctgttt gcggggatga agatcttgat gaatatggtg aatgaggaat
60ttttcctatt ggaggaagca ttgtcgaatc caagggtatg cgggctcggg gaagggcatc
120tctccttagc tgtcaaggct ctagatactg tgatactcga tgatatataa gccaaaccca
180agcaaagatc cgctggttgt ctgaacaagc cgaatgccag gccctttttg ccggagcccc
240tcatcgaaat ccgctgtgca agcggttcat gggttcaaca ttcggaatag cttctccgca
300agtctgtggg gtagcagcag cactccggca gatgccactg tgcctgtgaa tgtggggaga
360ggccagagta tggggaacca tgtgggaggc agcacggaga cactcgaagg tcatgccttg
420gagttgtgcg tactttgttt ttgcatgcct tggttccatc atcgaaagga gagcagcggt
480agatagagcc ttaagcatgg gtaaaactcc ttccgacaac tctataacag acgttaggaa
540aacaacaagt tcccagttat tacccagagc tttctttacc catcggcaca acgtgcaacg
600gccaagaatc gctgccgatc tcctcatctc cagcccctca aagtctccaa gctgcatcca
660gcatctccag gcggaccttg cttgcccaca ctttaggcta aaggcttctg cccctggtcg
720gcagtggcag aagcaacctg ctacttgacg acatgaaccc gtttgtaccg gctcggccat
780gagatgatgc agtgttccaa tggcatagtt gagtcgaagc ggtgttttca ccccttaatg
840atgtaacatg tatataacgg atgaccatgc cctccttgac ttcacttcaa cggctctatt
900atcctgcctc gagccacaag cagcgcagtc
93022930DNAArtificial Sequencepromoter sequence 22catccacatc atcttgacga
ggaaccatcg ggtggtcgga cggactctgc agatctgggg 60tgcgtctgac cgacgaggtg
tcaattagcc tacgtgtgag tacccatgct gagaattgat 120acctatggat gcaagtgcct
ctgaactatt actttatcca taggagcatc cgctaccaat 180gtgcggttaa aattgccttt
cagccaccct gtcctcggtt aattgagtga gacgtgcata 240acatggccgg cagcatggca
tggtagatga tattgggtga acgtgtcaga agaaaaggct 300agaatattcg agacagcttg
ctgatatgtg caaaacttct caagatattt gatatgtgta 360gagttactct tggcattata
ctgtaatgtg aatgtagagt gtacgctaca gtacctcaat 420ccaagaactt ataacatacc
tacataccta ctgagctaca ttttaggcag tgcctccgct 480gagaagcttt gaattctact
tttgtcgttt taactcgtga cgcattgact ggcgggtcat 540cctgatacag aatcaggacc
attgcatatg aaaaacagtc tgagaccaaa catccaatcg 600ggagacaatg ctgccatgaa
agctgattta gcctatttcg acttctcaca actcaaagag 660atgctttatg ttcgggggaa
gggaatatga ctgtgactag aatgcatcgg ggtcctgcca 720aagaatgagt tgactatgag
gaggcaaata tctgagtcat gtgagtagac cagtaaatga 780cagctggggg taatcactta
tgtgttcacc ggatatactt catattgata taaaatgcta 840tgatctccaa gtcccaacga
tactgagatg aacagcatct cttaacagtt gctttccaca 900taaataattc ctcctgttac
aagagccaaa 930231059DNAArtificial
Sequencepromoter sequence 23ggcaggcact ggctcggacg acatgttttg tatattggtt
gggactgcgg ccgcagcggg 60ggcgggagct ggtggcggcg atatgaattt ccgggcgttg
ctacaacagg taccactttg 120accacccatg gctgccgtcg ccctgcttgg agctttcagg
tcgcttccgg gcgttggcga 180ggcaagttgg acggtgggga aatgacgaaa aatggtgcat
cgcctttgta ggtgtgtgtg 240agtagtagtt ctactatgag gtacgtatgt agcagaagga
tcgagctaga atctgccggc 300attgcaaagg ttatctggaa agaggaaaag ggcctgaacc
ggcatatgga tgcattcttc 360gtacgaacta ctatctgata acagttaggt actgttatcc
atacaaagag tcttatagaa 420acactgcatc gtaataaaat actcggtagc tgcttgaata
tagtaataag atcaacatcc 480tttcacctct agtctccgtg gattccagta aaagcgctca
attctgactt ccgactctgt 540tgatgccccg tgtctgccca tcggggtggt ctagacgctg
cctcaacgcc catgtaccgg 600cctgatgggg cccttggggg caccacaagt ccactaaacg
aagcactggg gacgggactc 660gatagccctg agcagcagcc ggtctcagca gccaaccagc
ccagctggaa gcatcggcta 720ggggaggggg gcccaactac tacgtgtact actaggtaca
taatgaattg gatgggaccc 780agccagccca acctaacttt ccagccttta tagctgcagc
ctgcttcccc gtgcctcacg 840ctttttgctc ctctgctggc cggactcgga cctcttgcga
cctctgctcg accaacaatc 900cctcttgttg caccctctcg cttttgctac ctcgacgctc
aattcctcgc tgccgcctca 960cctaaccgcg tgtgcttgac tgccctcacg ctcggctcgc
ctcctgctcc gcgagcctcc 1020ttttacactt ttcaacagct accccgccag aattcaaca
1059241963DNAArtificial Sequencepromoter sequence
24gacggaatct tcacacctag tactcgtaca tactagatca gatgctgggc gagtctgggg
60aatgctggca ctggatggta taaacacccg actgcttgac gccggatcag cggcgatgca
120ccgagctgga cgtgtcaata ctacatgtat catgacgcag agctgtttct cctctggcac
180atgaacccaa agacacaagc gtcacctcgt tcctgagcag atcaggtaca gacttccata
240tctcactggt cccatctctc gagcctaaac cggcctccca ctttgcacaa gatgccccaa
300gccgttgcgc agagacgacg tggactcgac ctcgtcagcc atcgatgccg tctcagctgc
360cgcttcggcc aaccaacttg ctgcgaggca aaagtatttg ctgcattgat gccagccaac
420ctcctcctcc ttgcctcctc cattcagccg gcagcaatcc aaccacccac ccaccggcgc
480agcgccacgc aaggcacagt caggactaac actcttaggc tgcctggata catgtagaac
540ggtcttttgg tggttggggt tgctgcacat aaggtatata ctgtacatgc atatagtatg
600catacagtag acgctgcttg gcggccctgt atgtagggga tacatcatcg tccatctgct
660gctcccccgc aatccgctat ccggcatacc gagagctcag gagccggtcg ttgcccgtcc
720ttgtacgagt tacacctcca agtctccccc ggcctcccat cacagctgcc tccgcacggt
780gaccatcccc caagcaagtc gctccttgcc acttggtgga gggtcgccag tggacgagag
840ctgctgccaa tgcccatgat cagcaccggc ctgcgctggc tgactggata cttgcaagta
900ttaaaacggt cgacctcgcc ggttgttctc gtcgtcaact cttgccctct gactctgact
960ctgactcttt ccgtatcccc gtcgcatcgt gttggaagct gctcctcttg tctttttctc
1020tgccaaaccc tctcgctact aggtatctca acctttgtat acgagatcag tatcgcgggc
1080acgcagggtc tcatcctgac tcgtcctgtg tcggaatcgt ctcacgtctc actgccaaca
1140agcagtttgc gatacgcaaa tcaatcgctt gcatcaggtg cattccagat ccggcctccg
1200gacgtcgtta tataatcgcc agcgcccttc tccccaagag cccagccttt tggagcagga
1260cccaggcttt gtccatattt tgggtcgtac gcctgccttt tgccatcgcc atctgcttcc
1320tcccacccaa cccacgcccc tcatcaatct ccatctcccc cgccaaaggc gactcgatcc
1380ccgcgtgcac acacaaacca ccccggggaa aacgagacca acgctatatc ctgtggcagc
1440gcccgctcaa tccccttccc agcgtgcgcc ttgaccgcgg agtttgttat ccggtgagtg
1500cagctcccgt cttccgacca tccctccctc tctgcttgtt agtggcttgt cccacccgcc
1560aatctgcgcc ggccagcgga gcccagcctg agcccgccct cgagctcggg gccgttctgc
1620gaccctatac tttccgaggg cccaaaggcc gacgtcaaaa ctgctcgggt atcctgccgg
1680ctctggtcgg cctgccgttg ggcttggctt tgaaagaggt tgccgatgac gggatcgcag
1740tccccaagtt caaccctctc tctgccccac caatcatgac ccccatgccc gtcgttatgc
1800cactcatgtc atcgcagtgt gaacattgac ggagcttgac taatgtgaca gagtcattca
1860ggttgttgga gagccaagca gggtcctcag ctagcgaggc ccgacccgag gcgcagagtc
1920ccgaccatag cacttataag gcggcgcttc cgctgtcgta act
1963251067DNAArtificial Sequencepromoter sequence 25gtgctgcagt tgctacgcgt
agtctcaact ggcatgcgat cgacaatact aaaatcagca 60aagcctgagg tccgttgggt
gaaaacttca ttcgtactcg tactcagacc gcaaattctg 120gtatggtttg atgggttggt
tcatagtgat catccatatc atgggaagcg ccgcctgctc 180cgagaagcaa caagtagcca
acagcatcgg cactatcgtg catcatgccc caactctctc 240ctagccgtag cggacctccc
tcaaccagac agtgcccaag atcctttgac gcactatcag 300cgagtctatg tacactgacc
aacatgcagc cccggcgact tcccagatgg gccaacttca 360gtcgagacgg cgttgttttg
cagttaattg ccgccgcttg atatgcgctt aatggaaggc 420gttccgctgg aacttccctg
gcgccacgtt gttggatctc atgattgtgg tatttttccg 480tgcctcatca gttctcgagg
aacttctgta caccgaatgc catgtgaggc ccccgctcag 540ccccagctgc agcactccgt
accccatata ccaggcaaat tatcgacccc gattgcttgc 600aatcaaaatc gcttggcggc
gtcttgatat gcccgctagc aaggaaaagg caggatgctc 660gttattggtt gctcaatatc
gtcgtcgacg ggggaatgtc ccgctttcgt ccaatatcct 720gtggcgacaa gggctatcaa
aaagttcctc atccgcgatg tgccaacaac cgtggcagta 780gacaaaggtg ccttccaaaa
gaggcgataa ctggatcgcc ccccatgcat gcttgagtct 840atcaaacggc cagctggagc
ttctgttctg ttctggagtt cgtgatggtg ggtgcttggg 900tgtaccttgc ccgttgcgtg
gccggtgctc tcttgtgtga cattgcattt aaatatcatc 960gtgcctgtcg ccagtcttta
ccgacttgga gattcttgtc agctattcct ctgcaagcgt 1020tcaactgccg ccggtgagga
acactcggtc agtgccaaca caacacc 1067261124DNAArtificial
Sequencepromoter sequence 26cgaggcagat accgagatgt tgtagcacgg aagtcatctc
gtctagctgc ccgtggggaa 60aaaaaaaaaa gtaagccgga accgcaggtc caggcctgcg
gctgtacaaa ggagcaaaca 120cgatacaaac acaataccac cctatggtag catcaataat
ccgtaatcgt aatagcatgg 180gcgaatattt gccctctcgg tacggcgctc cgtaataaaa
ataacacccc cccaaatctc 240ggtgccccca attcgggtct ttttctccac cagttcggaa
ccctccctcc tatgtactct 300ctctctctct ctcgttggtt gggggagagc gagcgagcga
gagagagagg cagtgaaagg 360ctcaggctcg gtctttgctg cgccaaccct cgcccatgtc
atctccccct gattagcgcc 420ctcacctcag tttctcgccc cctcgtgacc gtttccgcct
ccacaatctg gggagcctgg 480aattagcaac tgtggaactg aggggtagat cccacgcgtc
ccgttagtaa gtgcttaagc 540gccgtgcgaa agggtgcgag caccggagtc gatgtcgaaa
tactgatgtc ctccctggaa 600cccaattact ccggggggcg actaaagcag cccagccagc
caaactagca gcaaggcaca 660cgctcacact agtaatgccc ggccggcgga tgatgttgct
tgtctgcttg tttcttgtgt 720cagggccagg aagccaaatc ttgtctgggg gggcgacata
aagggccgct cgtcggccta 780ccttgagcca cgcaaccaca cacctgtccg gtttcctcaa
ttccttatac caccaaacga 840accataacaa caacgctctc ctcctccttc atcctccttc
atcattgtat catcgtcata 900gcattgcgtt gccagctctg ttgtgtctgt cagttcatat
aacaaagcct tccgtgtctc 960tttcttcctc tcacactata tttttttttt ttcacctctc
atcacaaaga cccacacctt 1020ttccgccaca actgctccta ccaaaggcac actcgcacct
ttgaatgatc tcctccttgt 1080ccaaaagact caagtccaga agaagttcac ggagttccaa
agcc 112427780DNAArtificial Sequencepromoter sequence
27agactagcgg ccggtcccct tatcccagct gttccacgtt ggcctgcccc tcagttagcg
60ctcaactcaa tgcccctcac tggcgaggcg agggcaagga tggaggggca gcatcgcctg
120agttggagca aagcggccgc catgggagca gcgaaccaac ggagggatgc cgtgctttgt
180cgtggctgct gtggccaatc cgggcccttg gttggctcac agagcgttgc tgtgagacca
240tgagctatta ttgctaggta cagtatagag agaggagaga gagagagaga gagagagggg
300aaaaaaggtg aggttgaagt gagaaaaaaa aaaaaaaaaa aaatccaacc actgacggct
360gccggctctg ccacccccct ccctccaccc cagacaacct gcacactcag cgcgcagcat
420cacctaatct tggctcgcct tcccgcagct caggttgttt tttttttctc tctccctcgt
480cgaagccgcc cttgttccct tatttatttc cctctccatc cttgtctgcc tttggtccat
540ctgccccttt gtctgcatct cttttgcacg catcgcctta tcgtcgtctc ttttttcact
600cacgggagct tgacgaagac ctgactcgtg agcctaacct gctgatttct ctccccccct
660cccgaccggc ttgacttttg tttctcctcc agtaccttat cgcgaagccg gaagaaccct
720ctttaacccc atcaaacaag tttgtacaaa aaagcaggct ccgcggccgc ccccttcacc
7802858DNAArtificial Sequenceprimer 28tcagggttat tgtctcatgg ccatttaggc
ctggcaggca ctggctcgga cgacatgt 582958DNAArtificial Sequenceprimer
29agagccctgg gccggagctg ctgagcccat tgttgaattc tggcggggta gctgttga
583058DNAArtificial Sequenceprimer 30tcaacagcta ccccgccaga attcaacaat
gggctcagca gctccggccc agggctct 583159DNAArtificial Sequenceprimer
31tcgtaaataa acaagcgtaa ctagctagcg taggttatgc gagcaacatt gcacgaaac
593259DNAArtificial Sequenceprimer 32gtttcgtgca atgttgctcg cataacctac
gctagctagt tacgcttgtt tatttacga 593358DNAArtificial Sequenceprimer
33acatgtcgtc cgagccagtg cctgccaggc ctaaatggcc atgagacaat aaccctga
583457DNAArtificial Sequenceprimer 34aggtgtaaga cgggggagta gcgcagcatt
gttgaattct ggcggggtag ctgttga 573557DNAArtificial Sequenceprimer
35tcaacagcta ccccgccaga attcaacaat gctgcgctac tcccccgtct tacacct
573659DNAArtificial Sequenceprimer 36tcagggttat tgtctcatgg ccatttaggc
ctagactagc ggccggtccc cttatccca 593755DNAArtificial Sequenceprimer
37agagccctgg gccggagctg ctgagcccat ggtgaagggg gcggccgcgg agcct
553855DNAArtificial Sequenceprimer 38aggctccgcg gccgccccct tcaccatggg
ctcagcagct ccggcccagg gctct 553959DNAArtificial Sequenceprimer
39tgggataagg ggaccggccg ctagtctagg cctaaatggc catgagacaa taaccctga
594051DNAArtificial Sequenceprimer 40tgtaagacgg gggagtagcg cagcatggtg
aagggggcgg ccgcggagcc t 514151DNAArtificial Sequenceprimer
41aggctccgcg gccgccccct tcaccatgct gcgctactcc cccgtcttac a
51427882DNAArtificial Sequenceplasmid pYL1 42ggcaggcact ggctcggacg
acatgttttg tatattggtt gggactgcgg ccgcagcggg 60ggcgggagct ggtggcggcg
atatgaattt ccgggcgttg ctacaacagg taccactttg 120accacccatg gctgccgtcg
ccctgcttgg agctttcagg tcgcttccgg gcgttggcga 180ggcaagttgg acggtgggga
aatgacgaaa aatggtgcat cgcctttgta ggtgtgtgtg 240agtagtagtt ctactatgag
gtacgtatgt agcagaagga tcgagctaga atctgccggc 300attgcaaagg ttatctggaa
agaggaaaag ggcctgaacc ggcatatgga tgcattcttc 360gtacgaacta ctatctgata
acagttaggt actgttatcc atacaaagag tcttatagaa 420acactgcatc gtaataaaat
actcggtagc tgcttgaata tagtaataag atcaacatcc 480tttcacctct agtctccgtg
gattccagta aaagcgctca attctgactt ccgactctgt 540tgatgccccg tgtctgccca
tcggggtggt ctagacgctg cctcaacgcc catgtaccgg 600cctgatgggg cccttggggg
caccacaagt ccactaaacg aagcactggg gacgggactc 660gatagccctg agcagcagcc
ggtctcagca gccaaccagc ccagctggaa gcatcggcta 720ggggaggggg gcccaactac
tacgtgtact actaggtaca taatgaattg gatgggaccc 780agccagccca acctaacttt
ccagccttta tagctgcagc ctgcttcccc gtgcctcacg 840ctttttgctc ctctgctggc
cggactcgga cctcttgcga cctctgctcg accaacaatc 900cctcttgttg caccctctcg
cttttgctac ctcgacgctc aattcctcgc tgccgcctca 960cctaaccgcg tgtgcttgac
tgccctcacg ctcggctcgc ctcctgctcc gcgagcctcc 1020ttttacactt ttcaacagct
accccgccag aattcaacaa tgggctcagc agctccggcc 1080cagggctctg tagctgcagc
tgcaggcggc cctccagctg ctggcgctgg cgctggcgct 1140gtccacgccc tcaccacctc
gcccgagtct gcctcggcct cgcagcccgg ctcgccaacc 1200gcctcaacca cgccgccgca
gaactcactc gtgtcggctg caacctcgtt ccaccaccat 1260cccagaggcc gtctggtgag
cagagcctgc gaccgctgcc gccggcgcaa ggccaaggtc 1320agtctagccc ctttgctgtt
gcttgcatct ctgttgtcat tgctcctcct cctgctgctg 1380ctgatgctgc tgctcctcct
cctcctcctc ctccccgtct cctggtccct ggtccctgct 1440cttcatatgt ccttactgcc
cgtgtctcct ctccccgttc ccgttccccc tcctcccgtc 1500ctcttctcct gcgtgtctgt
catgcgtaca aagcatacat acaatacatc agcatacatg 1560gcaagcgttg tgttgtgttg
agagttgtgt gtattgtatt gcactgcctt cacaactcgt 1620tcatactgct gcagcctcac
cccaacaccg acctcgtctt ccatgctgcg ctactccccc 1680gtcttacacc tggatactct
ctccttgcca ccactgacca atgctcttcc ccgcccaaag 1740tgcgagtacc tcagcgctgt
cgatagctgc acgcactgcc gcgatgccca cgtgcagtgc 1800actttcgacc tgcccctggc
gcgacgcggc cccaaagcga ggaagaagag cgaccagccc 1860ggccagccgc ctcctgatcc
gagctcgctc tccaccgcgg ctcgacccgg ccagatgccg 1920ccgccgctga ccttctccgg
ccccgcagta gccgcgctgc agcccttcgc ctcgtcgtcg 1980ctgtcgcccg acgcggcctg
ggagcccgtc gagccgctca gcattgacaa cggcctgccc 2040cggcagccgc tgggcgacct
gcccggcctc tccaccatcc agaacatctc gacgcgccag 2100cgatggatac acctggccaa
cgccatgacg ctgcgcaaca cgacgctaga gcgcgtctcg 2160aagcgatgta tcgacctctt
cttcgactac ctctaccccc tcacccccct ggtgtacgag 2220ccggccctcc gggacgtgct
cgcatacatc ttctcccagc ccttgcctgg cgtcaaccaa 2280ccatcgccgc tgtcacagct
cacgccagac ccgaccaccg gcaccacccc cctcaacgct 2340gccgagtcgt gggccggctt
tggccagccc agcggctcgc gaaccgtcgg cagcaggctg 2400gctccctggg ccgactcgac
cttcaccctg gtcacggccg tctgcgcaga ggcagcattc 2460atgctaccca aggacatttt
ccccgaagga gaatccgtct ctgagatctt gctcgaagcc 2520tctcgggact gcctgcacca
gcacctcgag gccgacctgg agaatccgac ggccaactcg 2580attgccattc gctacttcca
ctccaactgc ctccacgctg cggggaagcc caagtactcg 2640tggcacatat ttggcgaggc
catccgcctg gcgcaggtca tgcagctgca cgaggaggct 2700gccctcgagg ggctcgtccc
catcgaggca gagttccgcc gtcgctgctt ttggatcctg 2760tacttgggcg acaagtcagc
cgctatactc aacaatcggc ccatcaccat ccacaagtac 2820tgcttcgacg ccggcatcac
cacgctatac ccgtcgggta tcgaggacga gttcctgagc 2880acggcgtccg agccgccccg
gaagagcttc atatccggct tcaacgcaaa tgtgcggctc 2940tggcagtccg cggctgattt
gctgctggaa atccgcgtgc tgcaagatca gatgatgcag 3000cactttcgag ggaccatgcc
cccgaaccat gtgctgccct ccgccgacag gcagcatctc 3060gattctctct atgtccgctt
catcacctgc ttggacgatc tcccgccgta cctccagtcg 3120tgcactctgg cgatggcagc
gatggcagaa ggcaacgggt ctgccgagtc caagcagtac 3180gtgatacagt gcatcaacct
gcaggtgacg tttcactgtc tgcgcatggt aattacgcag 3240aaattcgaag acctctctta
ttttgctcct ggcgttgagc aggctgatct cagaaagtcg 3300gagattgtgc gagacatgct
gagggtgatg aacgaggcgc ccttttgggg cctgcaggcc 3360aatggcgagc caaacgtgag
tcgtttcctt gtctcttctc ttttctgcac acccttttct 3420tcgacgaccc cccctctctc
tttatatccc tgcggatatg tatatcatca agcctcggca 3480cttgttgcta atctgtcctg
attatgttgt ctggatgctg caggttgaaa agattcgcct 3540tatcggagct agtttgctgg
ccatcatcca tcgcaaccag gattcaccct tggctacgcg 3600agccaggagc gacttttccg
tgcttttgga tattctcacg cggctggact cgaaggcgtc 3660ggaccaactg aggaatacgt
ccactaccgt tgttggctaa atgtgtgttg gaacaacaaa 3720aaatgtcaaa gtcggtgtaa
atatggccag gatctttgtg ttattccccc ttcagcgttg 3780ctgggtattt cccctttgtt
tactcttttc tgttttttcc agcacttgtt tttccagcag 3840tggggggaac aaaaggcgtt
tctttcccct atgccagggg ttgtccgatt tagcatttga 3900gtgtacatct tccctacatt
actaggtact taatgagctt atggagatct cccgtcattc 3960cggatattca tcacgttggt
gtatatatcc gtggttggct ttgaaacctg gagttgggtt 4020gcaatgcagt gacgcctttt
gcgaaggacc aaaataagcg aaggatgaag tctgaatagg 4080atacgaactg gctacctatg
ggtgagcatg aaatgaagcg gtcggggaaa tggcggagaa 4140acgctcgacg taacgctgtt
ggttttctcc gtttcgtgca atgttgctcg cataacctac 4200gctagctagt tacgcttgtt
tatttacgac aagatctaga agattcgaga tagaataata 4260ataataacaa caatttgcct
cttctttcca ccttttcagt cttactctcc cttctgacat 4320tgaacgcctc aatcagtcag
tcgccttgta cttggcacgg taatcctccg tgttcttgat 4380atcctcaggg gtagcaaagc
ccttcatgcc atcgataatg tcatccagag tgaggatggc 4440aaagatgggg atgccgtact
ccttcctcag ctcgccaatg gcactcggtc caggcttgga 4500gtcgtcgcca tccgcagcgg
ggagcttctc catgcggtcc agggccacga cgatgccggc 4560gacgatgccg ccctccttgg
tgatcttctc aatggcgtcc ctcttggcgg tgccggcggt 4620gatgacgtcg tcgacaatca
ggaccctctt gcccttgagc gaagcgccga cgatgttgcc 4680gccctcgccg tggtccttgg
cctccttgcg gtcaaacgag taggagacgc ggtccaggtt 4740ctggggcgcc agctcgccga
gcttgatggt gatggcggag cacagcggga tgcccttgta 4800ggccgggccg aagacgatgt
cgaactctag gccggccttc tcctgggcct cgatgatggt 4860ctttgcaaag gcggaggcga
tggcgccggc gaggcgcgcc gtgtggaatt cgcccgcgtt 4920gaagaagtag ggggatatcc
gcttggactt gagctcgaag ctgccaaact tgaggacgcc 4980gccgtcgatg gcggatttga
ggaagtcctg cttgtaggca ggcagctggg aggtggtagc 5040cattctgttg gatttggata
gtgtccttat tctctgattt gaacagtaga tcaggacgag 5100tgagagggat gcagaggttg
gattggagtg gttgagctat aaaatttaga ggcgcgccgt 5160atcgagtttt cacatggaag
tcaaagcgta cagtgcgagc ttgtacgttg gtcttagtat 5220cccacaagct tctgtctagg
tatgatgatg gctataagtc acccaaggca gaactcatct 5280tgaagattgt ctagagtgat
tttaccgctg atgaaatgac tggactccct cctcctgctc 5340ttatacgaaa aattgcctga
ctctgcaaag gttgtttgtc ttggaagatg atgtgccccc 5400ccatcgctct tatctcatac
cccgccatct ttctagattc tcatcttcaa caagaggggc 5460aatccatgat ctgcgatcca
gatgtgcttc tggcctcata ctctgccttc aggttgatgt 5520tcacttaatt ggtgacgaat
tcagctgatt tgctgcagta tgctttgtgt tggttctttc 5580caggcttgtg ccagccatga
gcgctttgag agcatgttgt cacctataaa ctcgagtaac 5640ggccacatat tgttcactac
ttgaatcaca tacctaattt tgatagaatt gacatgttta 5700aagagctgag gtagctttaa
tgcctctgaa gtattgtgac acagcttctc acagagtgag 5760aatgaaaagt tggactcccc
ctaatgaagt aaaagtttcg tctctgaacg gtgaagagca 5820tagatccggc atcaactacc
tggctagact acgacgtcaa ttctgcggcc ttttgacctt 5880tatatatgtc cattaatgca
atagattctt tttttttttt tttttttttt tttttttttt 5940tttttttttg cccaatttcg
cagatcaaag tggacgttat agcatcataa ctaagctcag 6000ttgctgaggg aagccgtcta
ctaccttagc ccatccatcc agctccatac cttgatactt 6060tagacgtgaa gcaattcaca
ctgtacgtct cgcagctctc cttcccgctc ttgcttcccc 6120actggggtcc atggtgcgtg
tatcgtcccc tccttaatta aggccattta ggccgttgct 6180ggcgtttttc cataggctcc
gcccccctga cgagcatcac aaaaatcgac gctcaagtca 6240gaggtggcga aacccgacag
gactataaag ataccaggcg tttccccctg gaagctccct 6300cgtgcgctct cctgttccga
ccctgccgct taccggatac ctgtccgcct ttctcccttc 6360gggaagcgtg gcgctttctc
atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 6420tcgctccaag ctgggctgtg
tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 6480cggtaactat cgtcttgagt
ccaacccggt aagacacgac ttatcgccac tggcagcagc 6540cactggtaac aggattagca
gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 6600gtggcctaac tacggctaca
ctagaaggac agtatttggt atctgcgctc tgctgaagcc 6660agttaccttc ggaaaaagag
ttggtagctc ttgatccggc aaacaaacca ccgctggtag 6720cggtggtttt tttgtttgca
agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 6780tcctttgatc ttttctacgg
ggtctgacgc tcagtggaac gaaaactcac gttaaggcct 6840gcagggccga ttttggtcat
gagattatca aaaaggatct tcacctagat ccttttaaat 6900taaaaatgaa gttttaaatc
aatctaaagt atatatgagt aaacttggtc tgacagttac 6960caatgcttaa tcagtgaggc
acctatctca gcgatctgtc tatttcgttc atccatagtt 7020gcctgactcc ccgtcgtgta
gataactacg atacgggagg gcttaccatc tggccccagt 7080gctgcaatga taccgcgaga
cccacgctca ccggctccag atttatcagc aataaaccag 7140ccagccggaa gggccgagcg
cagaagtggt cctgcaactt tatccgcctc catccagtct 7200attaattgtt gccgggaagc
tagagtaagt agttcgccag ttaatagttt gcgcaacgtt 7260gttgccattg ctacaggcat
cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc 7320tccggttccc aacgatcaag
gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt 7380agctccttcg gtcctccgat
cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg 7440gttatggcag cactgcataa
ttctcttact gtcatgccat ccgtaagatg cttttctgtg 7500actggtgagt actcaaccaa
gtcattctga gaatagtgta tgcggcgacc gagttgctct 7560tgcccggcgt caatacggga
taataccgcg ccacatagca gaactttaaa agtgctcatc 7620attggaaaac gttcttcggg
gcgaaaactc tcaaggatct taccgctgtt gagatccagt 7680tcgatgtaac ccactcgtgc
acccaactga tcttcagcat cttttacttt caccagcgtt 7740tctgggtgag caaaaacagg
aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg 7800aaatgttgaa tactcatact
cttccttttt caatattatt gaagcattta tcagggttat 7860tgtctcatgg ccatttaggc
ct 7882437279DNAArtificial
Sequenceplasmid pYL2 43ggcaggcact ggctcggacg acatgttttg tatattggtt
gggactgcgg ccgcagcggg 60ggcgggagct ggtggcggcg atatgaattt ccgggcgttg
ctacaacagg taccactttg 120accacccatg gctgccgtcg ccctgcttgg agctttcagg
tcgcttccgg gcgttggcga 180ggcaagttgg acggtgggga aatgacgaaa aatggtgcat
cgcctttgta ggtgtgtgtg 240agtagtagtt ctactatgag gtacgtatgt agcagaagga
tcgagctaga atctgccggc 300attgcaaagg ttatctggaa agaggaaaag ggcctgaacc
ggcatatgga tgcattcttc 360gtacgaacta ctatctgata acagttaggt actgttatcc
atacaaagag tcttatagaa 420acactgcatc gtaataaaat actcggtagc tgcttgaata
tagtaataag atcaacatcc 480tttcacctct agtctccgtg gattccagta aaagcgctca
attctgactt ccgactctgt 540tgatgccccg tgtctgccca tcggggtggt ctagacgctg
cctcaacgcc catgtaccgg 600cctgatgggg cccttggggg caccacaagt ccactaaacg
aagcactggg gacgggactc 660gatagccctg agcagcagcc ggtctcagca gccaaccagc
ccagctggaa gcatcggcta 720ggggaggggg gcccaactac tacgtgtact actaggtaca
taatgaattg gatgggaccc 780agccagccca acctaacttt ccagccttta tagctgcagc
ctgcttcccc gtgcctcacg 840ctttttgctc ctctgctggc cggactcgga cctcttgcga
cctctgctcg accaacaatc 900cctcttgttg caccctctcg cttttgctac ctcgacgctc
aattcctcgc tgccgcctca 960cctaaccgcg tgtgcttgac tgccctcacg ctcggctcgc
ctcctgctcc gcgagcctcc 1020ttttacactt ttcaacagct accccgccag aattcaacaa
tgctgcgcta ctcccccgtc 1080ttacacctgg atactctctc cttgccacca ctgaccaatg
ctcttccccg cccaaagtgc 1140gagtacctca gcgctgtcga tagctgcacg cactgccgcg
atgcccacgt gcagtgcact 1200ttcgacctgc ccctggcgcg acgcggcccc aaagcgagga
agaagagcga ccagcccggc 1260cagccgcctc ctgatccgag ctcgctctcc accgcggctc
gacccggcca gatgccgccg 1320ccgctgacct tctccggccc cgcagtagcc gcgctgcagc
ccttcgcctc gtcgtcgctg 1380tcgcccgacg cggcctggga gcccgtcgag ccgctcagca
ttgacaacgg cctgccccgg 1440cagccgctgg gcgacctgcc cggcctctcc accatccaga
acatctcgac gcgccagcga 1500tggatacacc tggccaacgc catgacgctg cgcaacacga
cgctagagcg cgtctcgaag 1560cgatgtatcg acctcttctt cgactacctc taccccctca
cccccctggt gtacgagccg 1620gccctccggg acgtgctcgc atacatcttc tcccagccct
tgcctggcgt caaccaacca 1680tcgccgctgt cacagctcac gccagacccg accaccggca
ccacccccct caacgctgcc 1740gagtcgtggg ccggctttgg ccagcccagc ggctcgcgaa
ccgtcggcag caggctggct 1800ccctgggccg actcgacctt caccctggtc acggccgtct
gcgcagaggc agcattcatg 1860ctacccaagg acattttccc cgaaggagaa tccgtctctg
agatcttgct cgaagcctct 1920cgggactgcc tgcaccagca cctcgaggcc gacctggaga
atccgacggc caactcgatt 1980gccattcgct acttccactc caactgcctc cacgctgcgg
ggaagcccaa gtactcgtgg 2040cacatatttg gcgaggccat ccgcctggcg caggtcatgc
agctgcacga ggaggctgcc 2100ctcgaggggc tcgtccccat cgaggcagag ttccgccgtc
gctgcttttg gatcctgtac 2160ttgggcgaca agtcagccgc tatactcaac aatcggccca
tcaccatcca caagtactgc 2220ttcgacgccg gcatcaccac gctatacccg tcgggtatcg
aggacgagtt cctgagcacg 2280gcgtccgagc cgccccggaa gagcttcata tccggcttca
acgcaaatgt gcggctctgg 2340cagtccgcgg ctgatttgct gctggaaatc cgcgtgctgc
aagatcagat gatgcagcac 2400tttcgaggga ccatgccccc gaaccatgtg ctgccctccg
ccgacaggca gcatctcgat 2460tctctctatg tccgcttcat cacctgcttg gacgatctcc
cgccgtacct ccagtcgtgc 2520actctggcga tggcagcgat ggcagaaggc aacgggtctg
ccgagtccaa gcagtacgtg 2580atacagtgca tcaacctgca ggtgacgttt cactgtctgc
gcatggtaat tacgcagaaa 2640ttcgaagacc tctcttattt tgctcctggc gttgagcagg
ctgatctcag aaagtcggag 2700attgtgcgag acatgctgag ggtgatgaac gaggcgccct
tttggggcct gcaggccaat 2760ggcgagccaa acgtgagtcg tttccttgtc tcttctcttt
tctgcacacc cttttcttcg 2820acgacccccc ctctctcttt atatccctgc ggatatgtat
atcatcaagc ctcggcactt 2880gttgctaatc tgtcctgatt atgttgtctg gatgctgcag
gttgaaaaga ttcgccttat 2940cggagctagt ttgctggcca tcatccatcg caaccaggat
tcacccttgg ctacgcgagc 3000caggagcgac ttttccgtgc ttttggatat tctcacgcgg
ctggactcga aggcgtcgga 3060ccaactgagg aatacgtcca ctaccgttgt tggctaaatg
tgtgttggaa caacaaaaaa 3120tgtcaaagtc ggtgtaaata tggccaggat ctttgtgtta
ttcccccttc agcgttgctg 3180ggtatttccc ctttgtttac tcttttctgt tttttccagc
acttgttttt ccagcagtgg 3240ggggaacaaa aggcgtttct ttcccctatg ccaggggttg
tccgatttag catttgagtg 3300tacatcttcc ctacattact aggtacttaa tgagcttatg
gagatctccc gtcattccgg 3360atattcatca cgttggtgta tatatccgtg gttggctttg
aaacctggag ttgggttgca 3420atgcagtgac gccttttgcg aaggaccaaa ataagcgaag
gatgaagtct gaataggata 3480cgaactggct acctatgggt gagcatgaaa tgaagcggtc
ggggaaatgg cggagaaacg 3540ctcgacgtaa cgctgttggt tttctccgtt tcgtgcaatg
ttgctcgcat aacctacgct 3600agctagttac gcttgtttat ttacgacaag atctagaaga
ttcgagatag aataataata 3660ataacaacaa tttgcctctt ctttccacct tttcagtctt
actctccctt ctgacattga 3720acgcctcaat cagtcagtcg ccttgtactt ggcacggtaa
tcctccgtgt tcttgatatc 3780ctcaggggta gcaaagccct tcatgccatc gataatgtca
tccagagtga ggatggcaaa 3840gatggggatg ccgtactcct tcctcagctc gccaatggca
ctcggtccag gcttggagtc 3900gtcgccatcc gcagcgggga gcttctccat gcggtccagg
gccacgacga tgccggcgac 3960gatgccgccc tccttggtga tcttctcaat ggcgtccctc
ttggcggtgc cggcggtgat 4020gacgtcgtcg acaatcagga ccctcttgcc cttgagcgaa
gcgccgacga tgttgccgcc 4080ctcgccgtgg tccttggcct ccttgcggtc aaacgagtag
gagacgcggt ccaggttctg 4140gggcgccagc tcgccgagct tgatggtgat ggcggagcac
agcgggatgc ccttgtaggc 4200cgggccgaag acgatgtcga actctaggcc ggccttctcc
tgggcctcga tgatggtctt 4260tgcaaaggcg gaggcgatgg cgccggcgag gcgcgccgtg
tggaattcgc ccgcgttgaa 4320gaagtagggg gatatccgct tggacttgag ctcgaagctg
ccaaacttga ggacgccgcc 4380gtcgatggcg gatttgagga agtcctgctt gtaggcaggc
agctgggagg tggtagccat 4440tctgttggat ttggatagtg tccttattct ctgatttgaa
cagtagatca ggacgagtga 4500gagggatgca gaggttggat tggagtggtt gagctataaa
atttagaggc gcgccgtatc 4560gagttttcac atggaagtca aagcgtacag tgcgagcttg
tacgttggtc ttagtatccc 4620acaagcttct gtctaggtat gatgatggct ataagtcacc
caaggcagaa ctcatcttga 4680agattgtcta gagtgatttt accgctgatg aaatgactgg
actccctcct cctgctctta 4740tacgaaaaat tgcctgactc tgcaaaggtt gtttgtcttg
gaagatgatg tgccccccca 4800tcgctcttat ctcatacccc gccatctttc tagattctca
tcttcaacaa gaggggcaat 4860ccatgatctg cgatccagat gtgcttctgg cctcatactc
tgccttcagg ttgatgttca 4920cttaattggt gacgaattca gctgatttgc tgcagtatgc
tttgtgttgg ttctttccag 4980gcttgtgcca gccatgagcg ctttgagagc atgttgtcac
ctataaactc gagtaacggc 5040cacatattgt tcactacttg aatcacatac ctaattttga
tagaattgac atgtttaaag 5100agctgaggta gctttaatgc ctctgaagta ttgtgacaca
gcttctcaca gagtgagaat 5160gaaaagttgg actcccccta atgaagtaaa agtttcgtct
ctgaacggtg aagagcatag 5220atccggcatc aactacctgg ctagactacg acgtcaattc
tgcggccttt tgacctttat 5280atatgtccat taatgcaata gattcttttt tttttttttt
tttttttttt tttttttttt 5340ttttttgccc aatttcgcag atcaaagtgg acgttatagc
atcataacta agctcagttg 5400ctgagggaag ccgtctacta ccttagccca tccatccagc
tccatacctt gatactttag 5460acgtgaagca attcacactg tacgtctcgc agctctcctt
cccgctcttg cttccccact 5520ggggtccatg gtgcgtgtat cgtcccctcc ttaattaagg
ccatttaggc cgttgctggc 5580gtttttccat aggctccgcc cccctgacga gcatcacaaa
aatcgacgct caagtcagag 5640gtggcgaaac ccgacaggac tataaagata ccaggcgttt
ccccctggaa gctccctcgt 5700gcgctctcct gttccgaccc tgccgcttac cggatacctg
tccgcctttc tcccttcggg 5760aagcgtggcg ctttctcata gctcacgctg taggtatctc
agttcggtgt aggtcgttcg 5820ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc
gaccgctgcg ccttatccgg 5880taactatcgt cttgagtcca acccggtaag acacgactta
tcgccactgg cagcagccac 5940tggtaacagg attagcagag cgaggtatgt aggcggtgct
acagagttct tgaagtggtg 6000gcctaactac ggctacacta gaaggacagt atttggtatc
tgcgctctgc tgaagccagt 6060taccttcgga aaaagagttg gtagctcttg atccggcaaa
caaaccaccg ctggtagcgg 6120tggttttttt gtttgcaagc agcagattac gcgcagaaaa
aaaggatctc aagaagatcc 6180tttgatcttt tctacggggt ctgacgctca gtggaacgaa
aactcacgtt aaggcctgca 6240gggccgattt tggtcatgag attatcaaaa aggatcttca
cctagatcct tttaaattaa 6300aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
cttggtctga cagttaccaa 6360tgcttaatca gtgaggcacc tatctcagcg atctgtctat
ttcgttcatc catagttgcc 6420tgactccccg tcgtgtagat aactacgata cgggagggct
taccatctgg ccccagtgct 6480gcaatgatac cgcgagaccc acgctcaccg gctccagatt
tatcagcaat aaaccagcca 6540gccggaaggg ccgagcgcag aagtggtcct gcaactttat
ccgcctccat ccagtctatt 6600aattgttgcc gggaagctag agtaagtagt tcgccagtta
atagtttgcg caacgttgtt 6660gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg
gtatggcttc attcagctcc 6720ggttcccaac gatcaaggcg agttacatga tcccccatgt
tgtgcaaaaa agcggttagc 6780tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
cagtgttatc actcatggtt 6840atggcagcac tgcataattc tcttactgtc atgccatccg
taagatgctt ttctgtgact 6900ggtgagtact caaccaagtc attctgagaa tagtgtatgc
ggcgaccgag ttgctcttgc 6960ccggcgtcaa tacgggataa taccgcgcca catagcagaa
ctttaaaagt gctcatcatt 7020ggaaaacgtt cttcggggcg aaaactctca aggatcttac
cgctgttgag atccagttcg 7080atgtaaccca ctcgtgcacc caactgatct tcagcatctt
ttactttcac cagcgtttct 7140gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg
gaataagggc gacacggaaa 7200tgttgaatac tcatactctt cctttttcaa tattattgaa
gcatttatca gggttattgt 7260ctcatggcca tttaggcct
7279447603DNAArtificial Sequenceplasmid pYL3
44agactagcgg ccggtcccct tatcccagct gttccacgtt ggcctgcccc tcagttagcg
60ctcaactcaa tgcccctcac tggcgaggcg agggcaagga tggaggggca gcatcgcctg
120agttggagca aagcggccgc catgggagca gcgaaccaac ggagggatgc cgtgctttgt
180cgtggctgct gtggccaatc cgggcccttg gttggctcac agagcgttgc tgtgagacca
240tgagctatta ttgctaggta cagtatagag agaggagaga gagagagaga gagagagggg
300aaaaaaggtg aggttgaagt gagaaaaaaa aaaaaaaaaa aaatccaacc actgacggct
360gccggctctg ccacccccct ccctccaccc cagacaacct gcacactcag cgcgcagcat
420cacctaatct tggctcgcct tcccgcagct caggttgttt tttttttctc tctccctcgt
480cgaagccgcc cttgttccct tatttatttc cctctccatc cttgtctgcc tttggtccat
540ctgccccttt gtctgcatct cttttgcacg catcgcctta tcgtcgtctc ttttttcact
600cacgggagct tgacgaagac ctgactcgtg agcctaacct gctgatttct ctccccccct
660cccgaccggc ttgacttttg tttctcctcc agtaccttat cgcgaagccg gaagaaccct
720ctttaacccc atcaaacaag tttgtacaaa aaagcaggct ccgcggccgc ccccttcacc
780atgggctcag cagctccggc ccagggctct gtagctgcag ctgcaggcgg ccctccagct
840gctggcgctg gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc tgcctcggcc
900tcgcagcccg gctcgccaac cgcctcaacc acgccgccgc agaactcact cgtgtcggct
960gcaacctcgt tccaccacca tcccagaggc cgtctggtga gcagagcctg cgaccgctgc
1020cgccggcgca aggccaaggt cagtctagcc cctttgctgt tgcttgcatc tctgttgtca
1080ttgctcctcc tcctgctgct gctgatgctg ctgctcctcc tcctcctcct cctccccgtc
1140tcctggtccc tggtccctgc tcttcatatg tccttactgc ccgtgtctcc tctccccgtt
1200cccgttcccc ctcctcccgt cctcttctcc tgcgtgtctg tcatgcgtac aaagcataca
1260tacaatacat cagcatacat ggcaagcgtt gtgttgtgtt gagagttgtg tgtattgtat
1320tgcactgcct tcacaactcg ttcatactgc tgcagcctca ccccaacacc gacctcgtct
1380tccatgctgc gctactcccc cgtcttacac ctggatactc tctccttgcc accactgacc
1440aatgctcttc cccgcccaaa gtgcgagtac ctcagcgctg tcgatagctg cacgcactgc
1500cgcgatgccc acgtgcagtg cactttcgac ctgcccctgg cgcgacgcgg ccccaaagcg
1560aggaagaaga gcgaccagcc cggccagccg cctcctgatc cgagctcgct ctccaccgcg
1620gctcgacccg gccagatgcc gccgccgctg accttctccg gccccgcagt agccgcgctg
1680cagcccttcg cctcgtcgtc gctgtcgccc gacgcggcct gggagcccgt cgagccgctc
1740agcattgaca acggcctgcc ccggcagccg ctgggcgacc tgcccggcct ctccaccatc
1800cagaacatct cgacgcgcca gcgatggata cacctggcca acgccatgac gctgcgcaac
1860acgacgctag agcgcgtctc gaagcgatgt atcgacctct tcttcgacta cctctacccc
1920ctcacccccc tggtgtacga gccggccctc cgggacgtgc tcgcatacat cttctcccag
1980cccttgcctg gcgtcaacca accatcgccg ctgtcacagc tcacgccaga cccgaccacc
2040ggcaccaccc ccctcaacgc tgccgagtcg tgggccggct ttggccagcc cagcggctcg
2100cgaaccgtcg gcagcaggct ggctccctgg gccgactcga ccttcaccct ggtcacggcc
2160gtctgcgcag aggcagcatt catgctaccc aaggacattt tccccgaagg agaatccgtc
2220tctgagatct tgctcgaagc ctctcgggac tgcctgcacc agcacctcga ggccgacctg
2280gagaatccga cggccaactc gattgccatt cgctacttcc actccaactg cctccacgct
2340gcggggaagc ccaagtactc gtggcacata tttggcgagg ccatccgcct ggcgcaggtc
2400atgcagctgc acgaggaggc tgccctcgag gggctcgtcc ccatcgaggc agagttccgc
2460cgtcgctgct tttggatcct gtacttgggc gacaagtcag ccgctatact caacaatcgg
2520cccatcacca tccacaagta ctgcttcgac gccggcatca ccacgctata cccgtcgggt
2580atcgaggacg agttcctgag cacggcgtcc gagccgcccc ggaagagctt catatccggc
2640ttcaacgcaa atgtgcggct ctggcagtcc gcggctgatt tgctgctgga aatccgcgtg
2700ctgcaagatc agatgatgca gcactttcga gggaccatgc ccccgaacca tgtgctgccc
2760tccgccgaca ggcagcatct cgattctctc tatgtccgct tcatcacctg cttggacgat
2820ctcccgccgt acctccagtc gtgcactctg gcgatggcag cgatggcaga aggcaacggg
2880tctgccgagt ccaagcagta cgtgatacag tgcatcaacc tgcaggtgac gtttcactgt
2940ctgcgcatgg taattacgca gaaattcgaa gacctctctt attttgctcc tggcgttgag
3000caggctgatc tcagaaagtc ggagattgtg cgagacatgc tgagggtgat gaacgaggcg
3060cccttttggg gcctgcaggc caatggcgag ccaaacgtga gtcgtttcct tgtctcttct
3120cttttctgca cacccttttc ttcgacgacc ccccctctct ctttatatcc ctgcggatat
3180gtatatcatc aagcctcggc acttgttgct aatctgtcct gattatgttg tctggatgct
3240gcaggttgaa aagattcgcc ttatcggagc tagtttgctg gccatcatcc atcgcaacca
3300ggattcaccc ttggctacgc gagccaggag cgacttttcc gtgcttttgg atattctcac
3360gcggctggac tcgaaggcgt cggaccaact gaggaatacg tccactaccg ttgttggcta
3420aatgtgtgtt ggaacaacaa aaaatgtcaa agtcggtgta aatatggcca ggatctttgt
3480gttattcccc cttcagcgtt gctgggtatt tcccctttgt ttactctttt ctgttttttc
3540cagcacttgt ttttccagca gtggggggaa caaaaggcgt ttctttcccc tatgccaggg
3600gttgtccgat ttagcatttg agtgtacatc ttccctacat tactaggtac ttaatgagct
3660tatggagatc tcccgtcatt ccggatattc atcacgttgg tgtatatatc cgtggttggc
3720tttgaaacct ggagttgggt tgcaatgcag tgacgccttt tgcgaaggac caaaataagc
3780gaaggatgaa gtctgaatag gatacgaact ggctacctat gggtgagcat gaaatgaagc
3840ggtcggggaa atggcggaga aacgctcgac gtaacgctgt tggttttctc cgtttcgtgc
3900aatgttgctc gcataaccta cgctagctag ttacgcttgt ttatttacga caagatctag
3960aagattcgag atagaataat aataataaca acaatttgcc tcttctttcc accttttcag
4020tcttactctc ccttctgaca ttgaacgcct caatcagtca gtcgccttgt acttggcacg
4080gtaatcctcc gtgttcttga tatcctcagg ggtagcaaag cccttcatgc catcgataat
4140gtcatccaga gtgaggatgg caaagatggg gatgccgtac tccttcctca gctcgccaat
4200ggcactcggt ccaggcttgg agtcgtcgcc atccgcagcg gggagcttct ccatgcggtc
4260cagggccacg acgatgccgg cgacgatgcc gccctccttg gtgatcttct caatggcgtc
4320cctcttggcg gtgccggcgg tgatgacgtc gtcgacaatc aggaccctct tgcccttgag
4380cgaagcgccg acgatgttgc cgccctcgcc gtggtccttg gcctccttgc ggtcaaacga
4440gtaggagacg cggtccaggt tctggggcgc cagctcgccg agcttgatgg tgatggcgga
4500gcacagcggg atgcccttgt aggccgggcc gaagacgatg tcgaactcta ggccggcctt
4560ctcctgggcc tcgatgatgg tctttgcaaa ggcggaggcg atggcgccgg cgaggcgcgc
4620cgtgtggaat tcgcccgcgt tgaagaagta gggggatatc cgcttggact tgagctcgaa
4680gctgccaaac ttgaggacgc cgccgtcgat ggcggatttg aggaagtcct gcttgtaggc
4740aggcagctgg gaggtggtag ccattctgtt ggatttggat agtgtcctta ttctctgatt
4800tgaacagtag atcaggacga gtgagaggga tgcagaggtt ggattggagt ggttgagcta
4860taaaatttag aggcgcgccg tatcgagttt tcacatggaa gtcaaagcgt acagtgcgag
4920cttgtacgtt ggtcttagta tcccacaagc ttctgtctag gtatgatgat ggctataagt
4980cacccaaggc agaactcatc ttgaagattg tctagagtga ttttaccgct gatgaaatga
5040ctggactccc tcctcctgct cttatacgaa aaattgcctg actctgcaaa ggttgtttgt
5100cttggaagat gatgtgcccc cccatcgctc ttatctcata ccccgccatc tttctagatt
5160ctcatcttca acaagagggg caatccatga tctgcgatcc agatgtgctt ctggcctcat
5220actctgcctt caggttgatg ttcacttaat tggtgacgaa ttcagctgat ttgctgcagt
5280atgctttgtg ttggttcttt ccaggcttgt gccagccatg agcgctttga gagcatgttg
5340tcacctataa actcgagtaa cggccacata ttgttcacta cttgaatcac atacctaatt
5400ttgatagaat tgacatgttt aaagagctga ggtagcttta atgcctctga agtattgtga
5460cacagcttct cacagagtga gaatgaaaag ttggactccc cctaatgaag taaaagtttc
5520gtctctgaac ggtgaagagc atagatccgg catcaactac ctggctagac tacgacgtca
5580attctgcggc cttttgacct ttatatatgt ccattaatgc aatagattct tttttttttt
5640tttttttttt tttttttttt tttttttttt gcccaatttc gcagatcaaa gtggacgtta
5700tagcatcata actaagctca gttgctgagg gaagccgtct actaccttag cccatccatc
5760cagctccata ccttgatact ttagacgtga agcaattcac actgtacgtc tcgcagctct
5820ccttcccgct cttgcttccc cactggggtc catggtgcgt gtatcgtccc ctccttaatt
5880aaggccattt aggccgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
5940caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
6000gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
6060cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta
6120tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
6180gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
6240cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
6300tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
6360tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
6420caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
6480aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
6540cgaaaactca cgttaaggcc tgcagggccg attttggtca tgagattatc aaaaaggatc
6600ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
6660taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
6720ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
6780ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
6840gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
6900ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
6960gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg
7020tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc
7080atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg
7140gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca
7200tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
7260atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc
7320agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc
7380ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca
7440tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
7500aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
7560tgaagcattt atcagggtta ttgtctcatg gccatttagg cct
7603457000DNAArtificial Sequenceplasmid pYL4 45agactagcgg ccggtcccct
tatcccagct gttccacgtt ggcctgcccc tcagttagcg 60ctcaactcaa tgcccctcac
tggcgaggcg agggcaagga tggaggggca gcatcgcctg 120agttggagca aagcggccgc
catgggagca gcgaaccaac ggagggatgc cgtgctttgt 180cgtggctgct gtggccaatc
cgggcccttg gttggctcac agagcgttgc tgtgagacca 240tgagctatta ttgctaggta
cagtatagag agaggagaga gagagagaga gagagagggg 300aaaaaaggtg aggttgaagt
gagaaaaaaa aaaaaaaaaa aaatccaacc actgacggct 360gccggctctg ccacccccct
ccctccaccc cagacaacct gcacactcag cgcgcagcat 420cacctaatct tggctcgcct
tcccgcagct caggttgttt tttttttctc tctccctcgt 480cgaagccgcc cttgttccct
tatttatttc cctctccatc cttgtctgcc tttggtccat 540ctgccccttt gtctgcatct
cttttgcacg catcgcctta tcgtcgtctc ttttttcact 600cacgggagct tgacgaagac
ctgactcgtg agcctaacct gctgatttct ctccccccct 660cccgaccggc ttgacttttg
tttctcctcc agtaccttat cgcgaagccg gaagaaccct 720ctttaacccc atcaaacaag
tttgtacaaa aaagcaggct ccgcggccgc ccccttcacc 780atgctgcgct actcccccgt
cttacacctg gatactctct ccttgccacc actgaccaat 840gctcttcccc gcccaaagtg
cgagtacctc agcgctgtcg atagctgcac gcactgccgc 900gatgcccacg tgcagtgcac
tttcgacctg cccctggcgc gacgcggccc caaagcgagg 960aagaagagcg accagcccgg
ccagccgcct cctgatccga gctcgctctc caccgcggct 1020cgacccggcc agatgccgcc
gccgctgacc ttctccggcc ccgcagtagc cgcgctgcag 1080cccttcgcct cgtcgtcgct
gtcgcccgac gcggcctggg agcccgtcga gccgctcagc 1140attgacaacg gcctgccccg
gcagccgctg ggcgacctgc ccggcctctc caccatccag 1200aacatctcga cgcgccagcg
atggatacac ctggccaacg ccatgacgct gcgcaacacg 1260acgctagagc gcgtctcgaa
gcgatgtatc gacctcttct tcgactacct ctaccccctc 1320acccccctgg tgtacgagcc
ggccctccgg gacgtgctcg catacatctt ctcccagccc 1380ttgcctggcg tcaaccaacc
atcgccgctg tcacagctca cgccagaccc gaccaccggc 1440accacccccc tcaacgctgc
cgagtcgtgg gccggctttg gccagcccag cggctcgcga 1500accgtcggca gcaggctggc
tccctgggcc gactcgacct tcaccctggt cacggccgtc 1560tgcgcagagg cagcattcat
gctacccaag gacattttcc ccgaaggaga atccgtctct 1620gagatcttgc tcgaagcctc
tcgggactgc ctgcaccagc acctcgaggc cgacctggag 1680aatccgacgg ccaactcgat
tgccattcgc tacttccact ccaactgcct ccacgctgcg 1740gggaagccca agtactcgtg
gcacatattt ggcgaggcca tccgcctggc gcaggtcatg 1800cagctgcacg aggaggctgc
cctcgagggg ctcgtcccca tcgaggcaga gttccgccgt 1860cgctgctttt ggatcctgta
cttgggcgac aagtcagccg ctatactcaa caatcggccc 1920atcaccatcc acaagtactg
cttcgacgcc ggcatcacca cgctataccc gtcgggtatc 1980gaggacgagt tcctgagcac
ggcgtccgag ccgccccgga agagcttcat atccggcttc 2040aacgcaaatg tgcggctctg
gcagtccgcg gctgatttgc tgctggaaat ccgcgtgctg 2100caagatcaga tgatgcagca
ctttcgaggg accatgcccc cgaaccatgt gctgccctcc 2160gccgacaggc agcatctcga
ttctctctat gtccgcttca tcacctgctt ggacgatctc 2220ccgccgtacc tccagtcgtg
cactctggcg atggcagcga tggcagaagg caacgggtct 2280gccgagtcca agcagtacgt
gatacagtgc atcaacctgc aggtgacgtt tcactgtctg 2340cgcatggtaa ttacgcagaa
attcgaagac ctctcttatt ttgctcctgg cgttgagcag 2400gctgatctca gaaagtcgga
gattgtgcga gacatgctga gggtgatgaa cgaggcgccc 2460ttttggggcc tgcaggccaa
tggcgagcca aacgtgagtc gtttccttgt ctcttctctt 2520ttctgcacac ccttttcttc
gacgaccccc cctctctctt tatatccctg cggatatgta 2580tatcatcaag cctcggcact
tgttgctaat ctgtcctgat tatgttgtct ggatgctgca 2640ggttgaaaag attcgcctta
tcggagctag tttgctggcc atcatccatc gcaaccagga 2700ttcacccttg gctacgcgag
ccaggagcga cttttccgtg cttttggata ttctcacgcg 2760gctggactcg aaggcgtcgg
accaactgag gaatacgtcc actaccgttg ttggctaaat 2820gtgtgttgga acaacaaaaa
atgtcaaagt cggtgtaaat atggccagga tctttgtgtt 2880attccccctt cagcgttgct
gggtatttcc cctttgttta ctcttttctg ttttttccag 2940cacttgtttt tccagcagtg
gggggaacaa aaggcgtttc tttcccctat gccaggggtt 3000gtccgattta gcatttgagt
gtacatcttc cctacattac taggtactta atgagcttat 3060ggagatctcc cgtcattccg
gatattcatc acgttggtgt atatatccgt ggttggcttt 3120gaaacctgga gttgggttgc
aatgcagtga cgccttttgc gaaggaccaa aataagcgaa 3180ggatgaagtc tgaataggat
acgaactggc tacctatggg tgagcatgaa atgaagcggt 3240cggggaaatg gcggagaaac
gctcgacgta acgctgttgg ttttctccgt ttcgtgcaat 3300gttgctcgca taacctacgc
tagctagtta cgcttgttta tttacgacaa gatctagaag 3360attcgagata gaataataat
aataacaaca atttgcctct tctttccacc ttttcagtct 3420tactctccct tctgacattg
aacgcctcaa tcagtcagtc gccttgtact tggcacggta 3480atcctccgtg ttcttgatat
cctcaggggt agcaaagccc ttcatgccat cgataatgtc 3540atccagagtg aggatggcaa
agatggggat gccgtactcc ttcctcagct cgccaatggc 3600actcggtcca ggcttggagt
cgtcgccatc cgcagcgggg agcttctcca tgcggtccag 3660ggccacgacg atgccggcga
cgatgccgcc ctccttggtg atcttctcaa tggcgtccct 3720cttggcggtg ccggcggtga
tgacgtcgtc gacaatcagg accctcttgc ccttgagcga 3780agcgccgacg atgttgccgc
cctcgccgtg gtccttggcc tccttgcggt caaacgagta 3840ggagacgcgg tccaggttct
ggggcgccag ctcgccgagc ttgatggtga tggcggagca 3900cagcgggatg cccttgtagg
ccgggccgaa gacgatgtcg aactctaggc cggccttctc 3960ctgggcctcg atgatggtct
ttgcaaaggc ggaggcgatg gcgccggcga ggcgcgccgt 4020gtggaattcg cccgcgttga
agaagtaggg ggatatccgc ttggacttga gctcgaagct 4080gccaaacttg aggacgccgc
cgtcgatggc ggatttgagg aagtcctgct tgtaggcagg 4140cagctgggag gtggtagcca
ttctgttgga tttggatagt gtccttattc tctgatttga 4200acagtagatc aggacgagtg
agagggatgc agaggttgga ttggagtggt tgagctataa 4260aatttagagg cgcgccgtat
cgagttttca catggaagtc aaagcgtaca gtgcgagctt 4320gtacgttggt cttagtatcc
cacaagcttc tgtctaggta tgatgatggc tataagtcac 4380ccaaggcaga actcatcttg
aagattgtct agagtgattt taccgctgat gaaatgactg 4440gactccctcc tcctgctctt
atacgaaaaa ttgcctgact ctgcaaaggt tgtttgtctt 4500ggaagatgat gtgccccccc
atcgctctta tctcataccc cgccatcttt ctagattctc 4560atcttcaaca agaggggcaa
tccatgatct gcgatccaga tgtgcttctg gcctcatact 4620ctgccttcag gttgatgttc
acttaattgg tgacgaattc agctgatttg ctgcagtatg 4680ctttgtgttg gttctttcca
ggcttgtgcc agccatgagc gctttgagag catgttgtca 4740cctataaact cgagtaacgg
ccacatattg ttcactactt gaatcacata cctaattttg 4800atagaattga catgtttaaa
gagctgaggt agctttaatg cctctgaagt attgtgacac 4860agcttctcac agagtgagaa
tgaaaagttg gactccccct aatgaagtaa aagtttcgtc 4920tctgaacggt gaagagcata
gatccggcat caactacctg gctagactac gacgtcaatt 4980ctgcggcctt ttgaccttta
tatatgtcca ttaatgcaat agattctttt tttttttttt 5040tttttttttt tttttttttt
tttttttgcc caatttcgca gatcaaagtg gacgttatag 5100catcataact aagctcagtt
gctgagggaa gccgtctact accttagccc atccatccag 5160ctccatacct tgatacttta
gacgtgaagc aattcacact gtacgtctcg cagctctcct 5220tcccgctctt gcttccccac
tggggtccat ggtgcgtgta tcgtcccctc cttaattaag 5280gccatttagg ccgttgctgg
cgtttttcca taggctccgc ccccctgacg agcatcacaa 5340aaatcgacgc tcaagtcaga
ggtggcgaaa cccgacagga ctataaagat accaggcgtt 5400tccccctgga agctccctcg
tgcgctctcc tgttccgacc ctgccgctta ccggatacct 5460gtccgccttt ctcccttcgg
gaagcgtggc gctttctcat agctcacgct gtaggtatct 5520cagttcggtg taggtcgttc
gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 5580cgaccgctgc gccttatccg
gtaactatcg tcttgagtcc aacccggtaa gacacgactt 5640atcgccactg gcagcagcca
ctggtaacag gattagcaga gcgaggtatg taggcggtgc 5700tacagagttc ttgaagtggt
ggcctaacta cggctacact agaaggacag tatttggtat 5760ctgcgctctg ctgaagccag
ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 5820acaaaccacc gctggtagcg
gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 5880aaaaggatct caagaagatc
ctttgatctt ttctacgggg tctgacgctc agtggaacga 5940aaactcacgt taaggcctgc
agggccgatt ttggtcatga gattatcaaa aaggatcttc 6000acctagatcc ttttaaatta
aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa 6060acttggtctg acagttacca
atgcttaatc agtgaggcac ctatctcagc gatctgtcta 6120tttcgttcat ccatagttgc
ctgactcccc gtcgtgtaga taactacgat acgggagggc 6180ttaccatctg gccccagtgc
tgcaatgata ccgcgagacc cacgctcacc ggctccagat 6240ttatcagcaa taaaccagcc
agccggaagg gccgagcgca gaagtggtcc tgcaacttta 6300tccgcctcca tccagtctat
taattgttgc cgggaagcta gagtaagtag ttcgccagtt 6360aatagtttgc gcaacgttgt
tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt 6420ggtatggctt cattcagctc
cggttcccaa cgatcaaggc gagttacatg atcccccatg 6480ttgtgcaaaa aagcggttag
ctccttcggt cctccgatcg ttgtcagaag taagttggcc 6540gcagtgttat cactcatggt
tatggcagca ctgcataatt ctcttactgt catgccatcc 6600gtaagatgct tttctgtgac
tggtgagtac tcaaccaagt cattctgaga atagtgtatg 6660cggcgaccga gttgctcttg
cccggcgtca atacgggata ataccgcgcc acatagcaga 6720actttaaaag tgctcatcat
tggaaaacgt tcttcggggc gaaaactctc aaggatctta 6780ccgctgttga gatccagttc
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct 6840tttactttca ccagcgtttc
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag 6900ggaataaggg cgacacggaa
atgttgaata ctcatactct tcctttttca atattattga 6960agcatttatc agggttattg
tctcatggcc atttaggcct 700046940PRTTrichoderma
reesei 46Met Leu Ser Asn Pro Leu Arg Arg Tyr Ser Ala Tyr Pro Asp Ile Ser1
5 10 15Ser Ala Ser Phe
Asp Pro Asn Tyr His Gly Ser Gln Ser His Leu His 20
25 30Ser Ile Asn Val Asn Thr Phe Gly Asn Ser His
Pro Tyr Pro Met Gln 35 40 45His
Leu Ala Gln His Ala Glu Leu Ser Ser Ser Arg Met Ile Arg Ala 50
55 60Ser Pro Val Gln Pro Lys Gln Arg Gln Gly
Ser Leu Ile Ala Ala Arg65 70 75
80Lys Asn Ser Thr Gly Thr Ala Gly Pro Ile Arg Arg Arg Ile Ser
Arg 85 90 95Ala Cys Asp
Gln Cys Asn Gln Leu Arg Thr Lys Cys Asp Gly Leu His 100
105 110Pro Cys Ala His Cys Ile Glu Phe Gly Leu
Gly Cys Glu Tyr Val Arg 115 120
125Glu Arg Lys Lys Arg Gly Lys Ala Ser Arg Lys Asp Ile Ala Ala Gln 130
135 140Gln Ala Ala Ala Ala Ala Ala Gln
His Ser Gly Gln Val Gln Asp Gly145 150
155 160Pro Glu Asp Gln His Arg Lys Leu Ser Arg Gln Gln
Ser Glu Ser Ser 165 170
175Arg Gly Ser Ala Glu Leu Ala Gln Pro Ala His Asp Pro Pro His Gly
180 185 190His Ile Glu Gly Ser Val
Ser Ser Phe Ser Asp Asn Gly Leu Ser Gln 195 200
205His Ala Ala Met Gly Gly Met Asp Gly Leu Glu Asp His His
Gly His 210 215 220Val Gly Val Asp Pro
Ala Leu Gly Arg Thr Gln Leu Glu Ala Ser Ser225 230
235 240Ala Met Gly Leu Gly Ala Tyr Gly Glu Val
His Pro Gly Tyr Glu Ser 245 250
255Pro Gly Met Asn Gly His Val Met Val Pro Pro Ser Tyr Gly Ala Gln
260 265 270Thr Thr Met Ala Gly
Tyr Ser Gly Ile Ser Tyr Ala Ala Gln Ala Pro 275
280 285Ser Pro Ala Thr Tyr Ser Ser Asp Gly Asn Phe Arg
Leu Thr Gly His 290 295 300Ile His Asp
Tyr Pro Leu Ala Asn Gly Ser Ser Pro Ser Trp Gly Val305
310 315 320Ser Leu Ala Ser Pro Ser Asn
Gln Phe Gln Leu Gln Leu Ser Gln Pro 325
330 335Ile Phe Lys Gln Ser Asp Leu Arg Tyr Pro Val Leu
Glu Pro Leu Leu 340 345 350Pro
His Leu Gly Asn Ile Leu Pro Val Ser Leu Ala Cys Asp Leu Ile 355
360 365Asp Leu Tyr Phe Ser Ser Ser Ser Ser
Ala Gln Met His Pro Met Ser 370 375
380Pro Tyr Val Leu Gly Phe Val Phe Arg Lys Arg Ser Phe Leu His Pro385
390 395 400Thr Asn Pro Arg
Arg Cys Gln Pro Ala Leu Leu Ala Ser Met Leu Trp 405
410 415Val Ala Ala Gln Thr Ser Glu Ala Ser Phe
Leu Thr Ser Leu Pro Ser 420 425
430Ala Arg Ser Lys Val Cys Gln Lys Leu Leu Glu Leu Thr Val Gly Leu
435 440 445Leu Gln Pro Leu Ile His Thr
Gly Thr Asn Ser Pro Ser Pro Lys Thr 450 455
460Ser Pro Val Val Gly Ala Ala Ala Leu Gly Val Leu Gly Val Ala
Met465 470 475 480Pro Gly
Ser Leu Asn Met Asp Ser Leu Ala Gly Glu Thr Gly Ala Phe
485 490 495Gly Ala Ile Gly Ser Leu Asp
Asp Val Ile Thr Tyr Val His Leu Ala 500 505
510Thr Val Val Ser Ala Ser Glu Tyr Lys Gly Ala Ser Leu Arg
Trp Trp 515 520 525Gly Ala Ala Trp
Ser Leu Ala Arg Glu Leu Lys Leu Gly Arg Glu Leu 530
535 540Pro Pro Gly Asn Pro Pro Ala Asn Gln Glu Asp Gly
Glu Gly Leu Ser545 550 555
560Glu Asp Val Asp Glu His Asp Leu Asn Arg Asn Asn Thr Arg Phe Val
565 570 575Thr Glu Glu Glu Arg
Glu Glu Arg Arg Arg Ala Trp Trp Leu Val Tyr 580
585 590Ile Val Asp Arg His Leu Ala Leu Cys Tyr Asn Arg
Pro Leu Phe Leu 595 600 605Leu Asp
Ser Glu Cys Ser Asp Leu Tyr His Pro Met Asp Asp Ile Lys 610
615 620Trp Gln Ala Gly Lys Phe Arg Ser His Asp Ala
Gly Asn Ser Ser Ile625 630 635
640Asn Ile Asp Ser Ser Met Thr Asp Glu Phe Gly Asp Ser Pro Arg Ala
645 650 655Ala Arg Gly Ala
His Tyr Glu Cys Arg Gly Arg Ser Ile Phe Gly Tyr 660
665 670Phe Leu Ser Leu Met Thr Ile Leu Gly Glu Ile
Val Asp Val His His 675 680 685Ala
Lys Ser His Pro Arg Phe Gly Val Gly Phe Arg Ser Ala Arg Asp 690
695 700Trp Asp Glu Gln Val Ala Glu Ile Thr Arg
His Leu Asp Met Tyr Glu705 710 715
720Glu Ser Leu Lys Arg Phe Val Ala Lys His Leu Pro Leu Ser Ser
Lys 725 730 735Asp Lys Glu
Gln His Glu Met His Asp Ser Gly Ala Val Thr Asp Met 740
745 750Gln Ser Pro Leu Ser Val Arg Thr Asn Ala
Ser Ser Arg Met Thr Glu 755 760
765Ser Glu Ile Gln Ala Ser Ile Val Val Ala Tyr Ser Thr His Val Met 770
775 780His Val Leu His Ile Leu Leu Ala
Asp Lys Trp Asp Pro Ile Asn Leu785 790
795 800Leu Asp Asp Asp Asp Leu Trp Ile Ser Ser Glu Gly
Phe Val Thr Ala 805 810
815Thr Ser His Ala Val Ser Ala Val Glu Ala Ile Ser Gln Ile Leu Glu
820 825 830Phe Asp Pro Gly Leu Glu
Phe Met Pro Phe Phe Tyr Gly Val Tyr Leu 835 840
845Leu Gln Gly Ser Phe Leu Leu Leu Leu Ile Ala Asp Lys Leu
Gln Ala 850 855 860Glu Ala Ser Pro Ser
Val Ile Lys Ala Cys Glu Thr Ile Val Arg Ala865 870
875 880His Glu Ala Cys Val Val Thr Leu Ser Thr
Glu Tyr Gln Arg Asn Phe 885 890
895Ser Lys Val Met Arg Ser Ala Leu Ala Leu Ile Arg Gly Arg Val Pro
900 905 910Glu Asp Leu Ala Glu
Gln Gln Gln Arg Arg Arg Glu Leu Leu Ala Leu 915
920 925Tyr Arg Trp Thr Gly Asn Gly Thr Gly Leu Ala Leu
930 935 94047341PRTTrichoderma reesei
47Met Asp Leu Arg Gln Ala Cys Asp Arg Cys His Asp Lys Lys Leu Arg1
5 10 15Cys Pro Arg Ile Ser Gly
Ser Pro Cys Cys Ser Arg Cys Ala Lys Ala 20 25
30Asn Val Ala Cys Val Phe Ser Pro Pro Ser Arg Pro Phe
Arg Pro His 35 40 45Glu Pro Leu
Asn His Ser His Glu His Ser His Ser His Ser His Asn 50
55 60His Asn Gly Val Gly Val Ser Phe Asp Trp Leu Asp
Leu Met Ser Leu65 70 75
80Glu Gln Gln Gln Glu Gln Gln Gln Gly Gln Pro Gln His Pro Pro Pro
85 90 95Pro Val Gln Thr Leu Ser
Glu Arg Leu Ala Ala Leu Leu Cys Ala Leu 100
105 110Asp Arg Met Leu Gln Ala Val Pro Ser Ser Leu Asp
Met His His Val 115 120 125Ser Arg
Gln Gln Leu Arg Glu Tyr Ala Asp Thr Val Gly Thr Gly Phe 130
135 140Asp Leu Gln Ser Thr Leu Asp Ser Leu Leu His
His Ala Gln Asp Leu145 150 155
160Ala Ser Leu Tyr Ser Glu Ala Val Pro Ala Ser Phe Asn Lys Arg Thr
165 170 175Thr Ala Ala Glu
Ala Asp Ala Leu Cys Ala Val Pro Asp Cys Val His 180
185 190Gln Asp Arg Thr Ser Leu His Thr Thr Pro Leu
Pro Lys Leu Asp His 195 200 205Ala
Leu Leu Asn Leu Val Met Ala Cys His Ile Arg Leu Leu Asp Val 210
215 220Met Asp Thr Leu Ala Glu His Gly Arg Met
Cys Ala Phe Met Val Ala225 230 235
240Thr Leu Pro Pro Asp Tyr Asp Pro Lys Phe Ala Val Pro Glu Ile
Arg 245 250 255Val Gly Thr
Phe Val Ala Pro Thr Asp Thr Ala Ala Ser Met Leu Leu 260
265 270Ser Val Val Val Glu Leu Gln Thr Val Leu
Val Ala Arg Val Lys Asp 275 280
285Leu Val Ala Met Val Asp Gln Val Lys Asp Asp Ala Arg Ala Ala Arg 290
295 300Glu Ala Lys Val Val Arg Leu Gln
Cys Gly Ile Leu Leu Glu Arg Ala305 310
315 320Glu Ser Thr Leu Gly Glu Trp Ser Arg Phe Lys Asp
Gly Leu Val Ser 325 330
335Ala Arg Leu Leu Lys 34048940PRTTrichoderma reesei 48Met Leu
Ser Asn Pro Leu Arg Arg Tyr Ser Ala Tyr Pro Asp Ile Ser1 5
10 15Ser Ala Ser Phe Asp Pro Asn Tyr
His Gly Ser Gln Ser His Leu His 20 25
30Ser Ile Asn Val Asn Thr Phe Gly Asn Ser His Pro Tyr Pro Met
Gln 35 40 45His Leu Ala Gln His
Ala Glu Leu Ser Ser Ser Arg Met Ile Arg Ala 50 55
60Ser Pro Val Gln Pro Lys Gln Arg Gln Gly Ser Leu Ile Ala
Ala Arg65 70 75 80Lys
Asn Ser Thr Gly Thr Ala Gly Pro Ile Arg Arg Arg Ile Ser Arg
85 90 95Ala Cys Asp Gln Cys Asn Gln
Leu Arg Thr Lys Cys Asp Gly Leu His 100 105
110Pro Cys Ala His Cys Ile Glu Phe Gly Leu Gly Cys Glu Tyr
Val Arg 115 120 125Glu Arg Lys Lys
Arg Gly Lys Ala Ser Arg Lys Asp Ile Ala Ala Gln 130
135 140Gln Ala Ala Ala Ala Ala Ala Gln His Ser Gly Gln
Val Gln Asp Gly145 150 155
160Pro Glu Asp Gln His Arg Lys Leu Ser Arg Gln Gln Ser Glu Ser Ser
165 170 175Arg Gly Ser Ala Glu
Leu Ala Gln Pro Ala His Asp Pro Pro His Gly 180
185 190His Ile Glu Gly Ser Val Ser Ser Phe Ser Asp Asn
Gly Leu Ser Gln 195 200 205His Ala
Ala Met Gly Gly Met Asp Gly Leu Glu Asp His His Gly His 210
215 220Val Gly Val Asp Pro Ala Leu Gly Arg Thr Gln
Leu Glu Ala Ser Ser225 230 235
240Ala Met Gly Leu Gly Ala Tyr Gly Glu Val His Pro Gly Tyr Glu Ser
245 250 255Pro Gly Met Asn
Gly His Val Met Val Pro Pro Ser Tyr Gly Ala Gln 260
265 270Thr Thr Met Ala Gly Tyr Ser Gly Ile Ser Tyr
Ala Ala Gln Ala Pro 275 280 285Ser
Pro Ala Thr Tyr Ser Ser Asp Gly Asn Phe Arg Leu Thr Gly His 290
295 300Ile His Asp Tyr Pro Leu Ala Asn Gly Ser
Ser Pro Ser Trp Gly Val305 310 315
320Ser Leu Ala Ser Pro Ser Asn Gln Phe Gln Leu Gln Leu Ser Gln
Pro 325 330 335Ile Phe Lys
Gln Ser Asp Leu Arg Tyr Pro Val Leu Glu Pro Leu Leu 340
345 350Pro His Leu Gly Asn Ile Leu Pro Val Ser
Leu Ala Cys Asp Leu Ile 355 360
365Asp Leu Tyr Phe Ser Ser Ser Ser Ser Ala Gln Met His Pro Met Ser 370
375 380Pro Tyr Val Leu Gly Phe Val Phe
Arg Lys Arg Ser Phe Leu His Pro385 390
395 400Thr Asn Pro Arg Arg Cys Gln Pro Ala Leu Leu Ala
Ser Met Leu Trp 405 410
415Val Ala Ala Gln Thr Ser Glu Ala Ser Phe Leu Thr Ser Leu Pro Ser
420 425 430Ala Arg Ser Lys Val Cys
Gln Lys Leu Leu Glu Leu Thr Val Gly Leu 435 440
445Leu Gln Pro Leu Ile His Thr Gly Thr Asn Ser Pro Ser Pro
Lys Thr 450 455 460Ser Pro Val Val Gly
Ala Ala Ala Leu Gly Val Leu Gly Val Ala Met465 470
475 480Pro Gly Ser Leu Asn Met Asp Ser Leu Ala
Gly Glu Thr Gly Ala Phe 485 490
495Gly Ala Ile Gly Ser Leu Asp Asp Val Ile Thr Tyr Val His Leu Ala
500 505 510Thr Val Val Ser Ala
Ser Glu Tyr Lys Gly Ala Ser Leu Arg Trp Trp 515
520 525Gly Ala Ala Trp Ser Leu Ala Arg Glu Leu Lys Leu
Gly Arg Glu Leu 530 535 540Pro Pro Gly
Asn Pro Pro Ala Asn Gln Glu Asp Gly Glu Gly Leu Ser545
550 555 560Glu Asp Val Asp Glu His Asp
Leu Asn Arg Asn Asn Thr Arg Phe Val 565
570 575Thr Glu Glu Glu Arg Glu Glu Arg Arg Arg Ala Trp
Trp Leu Val Tyr 580 585 590Ile
Val Asp Arg His Leu Ala Leu Cys Tyr Asn Arg Pro Leu Phe Leu 595
600 605Leu Asp Ser Glu Cys Ser Asp Leu Tyr
His Pro Met Asp Asp Ile Lys 610 615
620Trp Gln Ala Gly Lys Phe Arg Ser His Asp Ala Gly Asn Ser Ser Ile625
630 635 640Asn Ile Asp Ser
Ser Met Thr Asp Glu Phe Gly Asp Ser Pro Arg Ala 645
650 655Ala Arg Gly Ala His Tyr Glu Cys Arg Gly
Arg Ser Ile Phe Gly Tyr 660 665
670Phe Leu Ser Leu Met Thr Ile Leu Gly Glu Ile Val Asp Val His His
675 680 685Ala Lys Ser His Pro Arg Phe
Gly Val Gly Phe Arg Ser Ala Arg Asp 690 695
700Trp Asp Glu Gln Val Ala Glu Ile Thr Arg His Leu Asp Met Tyr
Glu705 710 715 720Glu Ser
Leu Lys Arg Phe Val Ala Lys His Leu Pro Leu Ser Ser Lys
725 730 735Asp Lys Glu Gln His Glu Met
His Asp Ser Gly Ala Val Thr Asp Met 740 745
750Gln Ser Pro Leu Ser Val Arg Thr Asn Ala Ser Ser Arg Met
Thr Glu 755 760 765Ser Glu Ile Gln
Ala Ser Ile Val Val Ala Tyr Ser Thr His Val Met 770
775 780His Val Leu His Ile Leu Leu Ala Asp Lys Trp Asp
Pro Ile Asn Leu785 790 795
800Leu Asp Asp Asp Asp Leu Trp Ile Ser Ser Glu Gly Phe Val Thr Ala
805 810 815Thr Ser His Ala Val
Ser Ala Ala Glu Ala Ile Ser Gln Ile Leu Glu 820
825 830Phe Asp Pro Gly Leu Glu Phe Met Pro Phe Phe Tyr
Gly Val Tyr Leu 835 840 845Leu Gln
Gly Ser Phe Leu Leu Leu Leu Ile Ala Asp Lys Leu Gln Ala 850
855 860Glu Ala Ser Pro Ser Val Ile Lys Ala Cys Glu
Thr Ile Val Arg Ala865 870 875
880His Glu Ala Cys Val Val Thr Leu Ser Thr Glu Tyr Gln Arg Asn Phe
885 890 895Ser Lys Val Met
Arg Ser Ala Leu Ala Leu Ile Arg Gly Arg Val Pro 900
905 910Glu Asp Leu Ala Glu Gln Gln Gln Arg Arg Arg
Glu Leu Leu Ala Leu 915 920 925Tyr
Arg Trp Thr Gly Asn Gly Thr Gly Leu Ala Leu 930 935
9404965DNAArtificial Sequenceprimer 49gtaacgccag ggttttccca
gtcacgacgg tttaaactcc atacgcagca aacatgggct 60tgggc
655064DNAArtificial
Sequenceprimer 50gtacgagtac taggtgtgaa gattccgtca agcttgggcg gaatgaagga
ggatgtgtga 60gagg
645159DNAArtificial Sequenceprimer 51cacacatcct ccttcattcc
gcccaagctt gacggaatct tcacacctag tactcgtac 595257DNAArtificial
Sequenceprimer 52tgacattttt tgttgttcca acacagcatg cttagtccga cgccttcgag
tccagcc 575354DNAArtificial Sequenceprimer 53ctggactcga aggcgtcgga
ctaagcatgc tgtgttggaa caacaaaaaa tgtc 545454DNAArtificial
Sequenceprimer 54gcagagcagc agtagtcgat gctattaatt aagtaggtta tgcgagcaac
attg 545558DNAArtificial Sequenceprimer 55ctcagcctct ctcagcctca
tcagccgcgg ccgctgaatc ggcaaggggt agtactag 585662DNAArtificial
Sequenceprimer 56gcggataaca atttcacaca ggaaacagcg tttaaaccac atgccagagt
tcgatgcgca 60ag
625757DNAArtificial Sequenceprimer 57gtacctcagc gctgtcgata
gctgcacgca ctgccgcgat gcccacgtgc agtgcac 575859DNAArtificial
Sequenceprimer 58gtgcactgca cgtgggcatc gcggcagtgc gtgcagctat cgacagcgct
gaggtactc 595948DNAArtificial Sequenceprimer 59gcggcgcttc cgctgtcgta
actatgctgc gctactcccc cgtcttac 486058DNAArtificial
Sequenceprimer 60gtaagacggg ggagtagcgc agcatagtta cgacagcgga agcgccgcct
tataagtg 586153DNAArtificial Sequenceprimer 61ggcggcgctt ccgctgtcgt
aactatgggc tcagcagctc cggcccaggg ctc 536258DNAArtificial
Sequenceprimer 62gccctgggcc ggagctgctg agcccatagt tacgacagcg gaagcgccgc
cttataag 586353DNAArtificial Sequenceprimer 63ggcggcgctt ccgctgtcgt
aactatggcc acagcggccg cggcagcagc tgg 536459DNAArtificial
Sequenceprimer 64cagctgctgc cgcggccgct gtggccatag ttacgacagc ggaagcgccg
ccttataag 596522DNAArtificial Sequenceprimer 65gctggaagct gctgagcaga
tc 226622DNAArtificial
Sequenceprimer 66gtgccagcat tccccagact cg
226720DNAArtificial Sequenceprimer 67ttaggcgacc tctttttcca
206822DNAArtificial
Sequenceprimer 68gccgctcagg catacgagcg ac
226920DNAArtificial Sequenceprimer 69ctctggtcgg cctgccgttg
207023DNAArtificial
Sequenceprimer 70tgagtatagc ggctgacttg tcg
237159DNAArtificial Sequenceprimer 71tctagtatgt acgagtacta
ggtgtgaaga ttccgtcatt tcctcgacat gcgaatgcg 597259DNAArtificial
Sequenceprimer 72tgccatgcaa accccgcatt cgcatgtcga ggaaatgacg gaatcttcac
acctagtac 597359DNAArtificial Sequenceprimer 73tgcagctaca gagccctggg
ccggagctgc tgagcccata gttacgacag cggaagcgc 597457DNAArtificial
Sequenceprimer 74atagcactta taaggcggcg cttccgctgt cgtaactatg ggctcagcag
ctccggc 577575DNAArtificial Sequenceprimer 75taaacaaata ggggttccgc
gcacatttcc ccgaaaagtg ccacctggat agactagcat 60ctgagccatt gcagc
757660DNAArtificial
Sequenceprimer 76agtggcaccg agtcggtggt gctttttttt ctatcgagag cattggtcag
tggtggcaag 607760DNAArtificial Sequenceprimer 77accaatatac aaaacatgtc
gtccgagcca gtgcctgcca tttcctcgac atgcgaatgc 607860DNAArtificial
Sequenceprimer 78gttgccatgc aaaccccgca ttcgcatgtc gaggaaatgg caggcactgg
ctcggacgac 607960DNAArtificial Sequenceprimer 79agctacagag ccctgggccg
gagctgctga gcccattgtt gaattctggc ggggtagctg 608060DNAArtificial
Sequenceprimer 80cttttacact tttcaacagc taccccgcca gaattcaaca atgggctcag
cagctccggc 608181DNAArtificial Sequenceprimer 81tagtccgtta tcaacttgaa
aaagtggcac cgagtcggtg gtgctttttt ttctatcgag 60atgttctgga tggtggagag g
818232DNAArtificial
Sequenceprimer 82agtctatcgc agccttgcct tagctaatgt tt
328332DNAArtificial Sequenceprimer 83tctaaaacat tagctaaggc
aaggctgcga ta 328432DNAArtificial
Sequenceprimer 84agtctatcgg cagagtcgcg tcttccgggt tt
328532DNAArtificial Sequenceprimer 85tctaaaaccc ggaagacgcg
actctgccga ta 328633DNAArtificial
Sequenceprimer 86agtctatcga atgagtgtag gtacgagtag ttt
338733DNAArtificial Sequenceprimer 87tctaaaacta ctcgtaccta
cactcattcg ata 338832DNAArtificial
Sequenceprimer 88agtctatcgg ccgcaatagc ttcctaatgt tt
328932DNAArtificial Sequenceprimer 89tctaaaacat taggaagcta
ttgcggccga ta 329032DNAArtificial
Sequenceprimer 90agtctatcgc agcgcaatca gtgcagtggt tt
329132DNAArtificial Sequenceprimer 91tctaaaacca ctgcactgat
tgcgctgcga ta 329223DNAArtificial
Sequenceprimer 92tggagagact cggagaggat agg
239322DNAArtificial Sequenceprimer 93agcgtggagg cagttggagt
gg 229424DNAArtificial
Sequenceprimer 94tggacaaagc ctgggtcctg ctcc
249522DNAArtificial Sequenceprimer 95atcctgactc gtcctgtgtc
gg 229622DNAArtificial
Sequenceprimer 96agtgcttcgt ttagtggact tg
229722DNAArtificial Sequenceprimer 97ctcggtagct gcttgaatat
ag 229845PRTArtificial
SequenceEL form N-terminal extension 98Met Ala Thr Ala Ala Ala Ala Ala
Ala Gly Gly Ala Ala Val Ala Ala1 5 10
15Gly Ala Asp Thr Gly Ala Ala Gly Ser Ser Ser Thr Gly Pro
Pro Gly 20 25 30Leu Pro Gly
Leu Pro Gly Thr Arg Thr Gly Ser Val Ala 35 40
45991857DNATrichoderma reesei 99atgctgcgct actcccccgt
cttacacctg gatactctct ccttgccacc actgaccaat 60gctcttcccc gcccaaagtg
cgagtacctc agcgctgtcg atagctgcac gcactgccgc 120gatgcccacg tgcagtgcac
tttcgacctg cccctggcgc gacgcggccc caaagcgagg 180aagaagagcg accagcccgg
ccagccgcct cctgatccga gctcgctctc caccgcggct 240cgacccggcc agatgccgcc
gccgctgacc ttctccggcc ccgcagtagc cgcgctgcag 300cccttcgcct cgtcgtcgct
gtcgcccgac gcggcctggg agcccgtcga gccgctcagc 360attgacaacg gcctgccccg
gcagccgctg ggcgacctgc ccggcctctc caccatccag 420aacatctcga cgcgccagcg
atggatacac ctggccaacg ccatgacgct gcgcaacacg 480acgctagagc gcgtctcgaa
gcgatgtatc gacctcttct tcgactacct ctaccccctc 540acccccctgg tgtacgagcc
ggccctccgg gacgtgctcg catacatctt ctcccagccc 600ttgcctggcg tcaaccaacc
atcgccgctg tcacagctca cgccagaccc gaccaccggc 660accacccccc tcaacgctgc
cgagtcgtgg gccggctttg gccagcccag cggctcgcga 720accgtcggca gcaggctggc
tccctgggcc gactcgacct tcaccctggt cacggccgtc 780tgcgcagagg cagcattcat
gctacccaag gacattttcc ccgaaggaga atccgtctct 840gagatcttgc tcgaagcctc
tcgggactgc ctgcaccagc acctcgaggc cgacctggag 900aatccgacgg ccaactcgat
tgccattcgc tacttccact ccaactgcct ccacgctgcg 960gggaagccca agtactcgtg
gcacatattt ggcgaggcca tccgcctggc gcaggtcatg 1020cagctgcacg aggaggctgc
cctcgagggg ctcgtcccca tcgaggcaga gttccgccgt 1080cgctgctttt ggatcctgta
cttgggcgac aagtcagccg ctatactcaa caatcggccc 1140atcaccatcc acaagtactg
cttcgacgcc ggcatcacca cgctataccc gtcgggtatc 1200gaggacgagt tcctgagcac
ggcgtccgag ccgccccgga agagcttcat atccggcttc 1260aacgcaaatg tgcggctctg
gcagtccgcg gctgatttgc tgctggaaat ccgcgtgctg 1320caagatcaga tgatgcagca
ctttcgaggg accatgcccc cgaaccatgt gctgccctcc 1380gccgacaggc agcatctcga
ttctctctat gtccgcttca tcacctgctt ggacgatctc 1440ccgccgtacc tccagtcgtg
cactctggcg atggcagcga tggcagaagg caacgggtct 1500gccgagtcca agcagtacgt
gatacagtgc atcaacctgc aggtgacgtt tcactgtctg 1560cgcatggtaa ttacgcagaa
attcgaagac ctctcttatt ttgctcctgg cgttgagcag 1620gctgatctca gaaagtcgga
gattgtgcga gacatgctga gggtgatgaa cgaggcgccc 1680ttttggggcc tgcaggccaa
tggcgagcca aacgttgaaa agattcgcct tatcggagct 1740agtttgctgg ccatcatcca
tcgcaaccag gattcaccct tggctacgcg agccaggagc 1800gacttttccg tgcttttgga
tattctcacg cggctggact cgaaggcgtc ggactaa 18571002070DNATrichoderma
reesei 100atgggctcag cagctccggc ccagggctct gtagctgcag ctgcaggcgg
ccctccagct 60gctggcgctg gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc
tgcctcggcc 120tcgcagcccg gctcgccaac cgcctcaacc acgccgccgc agaactcact
cgtgtcggct 180gcaacctcgt tccaccacca tcccagaggc cgtctggtga gcagagcctg
cgaccgctgc 240cgccggcgca aggccaagtg cgagtacctc agcgctgtcg atagctgcac
gcactgccgc 300gatgcccacg tgcagtgcac tttcgacctg cccctggcgc gacgcggccc
caaagcgagg 360aagaagagcg accagcccgg ccagccgcct cctgatccga gctcgctctc
caccgcggct 420cgacccggcc agatgccgcc gccgctgacc ttctccggcc ccgcagtagc
cgcgctgcag 480cccttcgcct cgtcgtcgct gtcgcccgac gcggcctggg agcccgtcga
gccgctcagc 540attgacaacg gcctgccccg gcagccgctg ggcgacctgc ccggcctctc
caccatccag 600aacatctcga cgcgccagcg atggatacac ctggccaacg ccatgacgct
gcgcaacacg 660acgctagagc gcgtctcgaa gcgatgtatc gacctcttct tcgactacct
ctaccccctc 720acccccctgg tgtacgagcc ggccctccgg gacgtgctcg catacatctt
ctcccagccc 780ttgcctggcg tcaaccaacc atcgccgctg tcacagctca cgccagaccc
gaccaccggc 840accacccccc tcaacgctgc cgagtcgtgg gccggctttg gccagcccag
cggctcgcga 900accgtcggca gcaggctggc tccctgggcc gactcgacct tcaccctggt
cacggccgtc 960tgcgcagagg cagcattcat gctacccaag gacattttcc ccgaaggaga
atccgtctct 1020gagatcttgc tcgaagcctc tcgggactgc ctgcaccagc acctcgaggc
cgacctggag 1080aatccgacgg ccaactcgat tgccattcgc tacttccact ccaactgcct
ccacgctgcg 1140gggaagccca agtactcgtg gcacatattt ggcgaggcca tccgcctggc
gcaggtcatg 1200cagctgcacg aggaggctgc cctcgagggg ctcgtcccca tcgaggcaga
gttccgccgt 1260cgctgctttt ggatcctgta cttgggcgac aagtcagccg ctatactcaa
caatcggccc 1320atcaccatcc acaagtactg cttcgacgcc ggcatcacca cgctataccc
gtcgggtatc 1380gaggacgagt tcctgagcac ggcgtccgag ccgccccgga agagcttcat
atccggcttc 1440aacgcaaatg tgcggctctg gcagtccgcg gctgatttgc tgctggaaat
ccgcgtgctg 1500caagatcaga tgatgcagca ctttcgaggg accatgcccc cgaaccatgt
gctgccctcc 1560gccgacaggc agcatctcga ttctctctat gtccgcttca tcacctgctt
ggacgatctc 1620ccgccgtacc tccagtcgtg cactctggcg atggcagcga tggcagaagg
caacgggtct 1680gccgagtcca agcagtacgt gatacagtgc atcaacctgc aggtgacgtt
tcactgtctg 1740cgcatggtaa ttacgcagaa attcgaagac ctctcttatt ttgctcctgg
cgttgagcag 1800gctgatctca gaaagtcgga gattgtgcga gacatgctga gggtgatgaa
cgaggcgccc 1860ttttggggcc tgcaggccaa tggcgagcca aacgttgaaa agattcgcct
tatcggagct 1920agtttgctgg ccatcatcca tcgcaaccag gattcaccct tggctacgcg
agccaggagc 1980gacttttccg tgcttttgga tattctcacg cggctggact cgaaggcgtc
ggaccaactg 2040aggaatacgt ccactaccgt tgttggctaa
20701012172DNATrichoderma reesei 101atggccacag cggccgcggc
agcagctggc ggcgcggcgg ttgctgcggg tgcagacaca 60ggcgctgcag gctccagctc
tacaggccct ccaggccttc cagggcttcc aggcacccgg 120acaggctccg tggcgatggg
ctcagcagct ccggcccagg gctctgtagc tgcagctgca 180ggcggccctc cagctgctgg
cgctggcgct ggcgctgtcc acgccctcac cacctcgccc 240gagtctgcct cggcctcgca
gcccggctcg ccaaccgcct caaccacgcc gccgcagaac 300tcactcgtgt cggctgcaac
ctcgttccac caccatccca gaggccgtct ggtgagcaga 360gcctgcgacc gctgccgccg
gcgcaaggcc aagtgcgagt acctcagcgc tgtcgatagc 420tgcacgcact gccgcgatgc
ccacgtgcag tgcactttcg acctgcccct ggcgcgacgc 480ggccccaaag cgaggaagaa
gagcgaccag cccggccagc cgcctcctga tccgagctcg 540ctctccaccg cggctcgacc
cggccagatg ccgccgccgc tgaccttctc cggccccgca 600gtagccgcgc tgcagccctt
cgcctcgtcg tcgctgtcgc ccgacgcggc ctgggagccc 660gtcgagccgc tcagcattga
caacggcctg ccccggcagc cgctgggcga cctgcccggc 720ctctccacca tccagaacat
ctcgacgcgc cagcgatgga tacacctggc caacgccatg 780acgctgcgca acacgacgct
agagcgcgtc tcgaagcgat gtatcgacct cttcttcgac 840tacctctacc ccctcacccc
cctggtgtac gagccggccc tccgggacgt gctcgcatac 900atcttctccc agcccttgcc
tggcgtcaac caaccatcgc cgctgtcaca gctcacgcca 960gacccgacca ccggcaccac
ccccctcaac gctgccgagt cgtgggccgg ctttggccag 1020cccagcggct cgcgaaccgt
cggcagcagg ctggctccct gggccgactc gaccttcacc 1080ctggtcacgg ccgtctgcgc
agaggcagca ttcatgctac ccaaggacat tttccccgaa 1140ggagaatccg tctctgagat
cttgctcgaa gcctctcggg actgcctgca ccagcacctc 1200gaggccgacc tggagaatcc
gacggccaac tcgattgcca ttcgctactt ccactccaac 1260tgcctccacg ctgcggggaa
gcccaagtac tcgtggcaca tatttggcga ggccatccgc 1320ctggcgcagg tcatgcagct
gcacgaggag gctgccctcg aggggctcgt ccccatcgag 1380gcagagttcc gccgtcgctg
cttttggatc ctgtacttgg gcgacaagtc agccgctata 1440ctcaacaatc ggcccatcac
catccacaag tactgcttcg acgccggcat caccacgcta 1500tacccgtcgg gtatcgagga
cgagttcctg agcacggcgt ccgagccgcc ccggaagagc 1560ttcatatccg gcttcaacgc
aaatgtgcgg ctctggcagt ccgcggctga tttgctgctg 1620gaaatccgcg tgctgcaaga
tcagatgatg cagcactttc gagggaccat gcccccgaac 1680catgtgctgc cctccgccga
caggcagcat ctcgattctc tctatgtccg cttcatcacc 1740tgcttggacg atctcccgcc
gtacctccag tcgtgcactc tggcgatggc agcgatggca 1800gaaggcaacg ggtctgccga
gtccaagcag tacgtgatac agtgcatcaa cctgcaggtg 1860acgtttcact gtctgcgcat
ggtaattacg cagaaattcg aagacctctc ttattttgct 1920cctggcgttg agcaggctga
tctcagaaag tcggagattg tgcgagacat gctgagggtg 1980atgaacgagg cgcccttttg
gggcctgcag gccaatggcg agccaaacgt tgaaaagatt 2040cgccttatcg gagctagttt
gctggccatc atccatcgca accaggattc acccttggct 2100acgcgagcca ggagcgactt
ttccgtgctt ttggatattc tcacgcggct ggactcgaag 2160gcgtcggact aa
21721022037DNATrichoderma
reesei 102atgggctcag cagctccggc ccagggctct gtagctgcag ctgcaggcgg
ccctccagct 60gctggcgctg gcgctggcgc tgtccacgcc ctcaccacct cgcccgagtc
tgcctcggcc 120tcgcagcccg gctcgccaac cgcctcaacc acgccgccgc agaactcact
cgtgtcggct 180gcaacctcgt tccaccacca tcccagaggc cgtctggtga gcagagcctg
cgaccgctgc 240cgccggcgca aggccaagtg cgagtacctc agcgctgtcg atagctgcac
gcactgccgc 300gatgcccacg tgcagtgcac tttcgacctg cccctggcgc gacgcggccc
caaagcgagg 360aagaagagcg accagcccgg ccagccgcct cctgatccga gctcgctctc
caccgcggct 420cgacccggcc agatgccgcc gccgctgacc ttctccggcc ccgcagtagc
cgcgctgcag 480cccttcgcct cgtcgtcgct gtcgcccgac gcggcctggg agcccgtcga
gccgctcagc 540attgacaacg gcctgccccg gcagccgctg ggcgacctgc ccggcctctc
caccatccag 600aacatctcga cgcgccagcg atggatacac ctggccaacg ccatgacgct
gcgcaacacg 660acgctagagc gcgtctcgaa gcgatgtatc gacctcttct tcgactacct
ctaccccctc 720acccccctgg tgtacgagcc ggccctccgg gacgtgctcg catacatctt
ctcccagccc 780ttgcctggcg tcaaccaacc atcgccgctg tcacagctca cgccagaccc
gaccaccggc 840accacccccc tcaacgctgc cgagtcgtgg gccggctttg gccagcccag
cggctcgcga 900accgtcggca gcaggctggc tccctgggcc gactcgacct tcaccctggt
cacggccgtc 960tgcgcagagg cagcattcat gctacccaag gacattttcc ccgaaggaga
atccgtctct 1020gagatcttgc tcgaagcctc tcgggactgc ctgcaccagc acctcgaggc
cgacctggag 1080aatccgacgg ccaactcgat tgccattcgc tacttccact ccaactgcct
ccacgctgcg 1140gggaagccca agtactcgtg gcacatattt ggcgaggcca tccgcctggc
gcaggtcatg 1200cagctgcacg aggaggctgc cctcgagggg ctcgtcccca tcgaggcaga
gttccgccgt 1260cgctgctttt ggatcctgta cttgggcgac aagtcagccg ctatactcaa
caatcggccc 1320atcaccatcc acaagtactg cttcgacgcc ggcatcacca cgctataccc
gtcgggtatc 1380gaggacgagt tcctgagcac ggcgtccgag ccgccccgga agagcttcat
atccggcttc 1440aacgcaaatg tgcggctctg gcagtccgcg gctgatttgc tgctggaaat
ccgcgtgctg 1500caagatcaga tgatgcagca ctttcgaggg accatgcccc cgaaccatgt
gctgccctcc 1560gccgacaggc agcatctcga ttctctctat gtccgcttca tcacctgctt
ggacgatctc 1620ccgccgtacc tccagtcgtg cactctggcg atggcagcga tggcagaagg
caacgggtct 1680gccgagtcca agcagtacgt gatacagtgc atcaacctgc aggtgacgtt
tcactgtctg 1740cgcatggtaa ttacgcagaa attcgaagac ctctcttatt ttgctcctgg
cgttgagcag 1800gctgatctca gaaagtcgga gattgtgcga gacatgctga gggtgatgaa
cgaggcgccc 1860ttttggggcc tgcaggccaa tggcgagcca aacgttgaaa agattcgcct
tatcggagct 1920agtttgctgg ccatcatcca tcgcaaccag gattcaccct tggctacgcg
agccaggagc 1980gacttttccg tgcttttgga tattctcacg cggctggact cgaaggcgtc
ggactaa 2037
User Contributions:
Comment about this patent or add new information about this topic: