Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: ANTISENSE-OLIGONUCLEOTIDES AS INHIBITORS OF TGF-R SIGNALING

Inventors:
IPC8 Class: AA61K317125FI
USPC Class:
Class name:
Publication date: 2022-05-12
Patent application number: 20220143071



Abstract:

The present invention relates to antisense-oligonucleotides having a length of at least 10 nucleotides, wherein at least two of the nucleotides are LNAs, their use as inhibitors of TGF-R signaling, pharmaceutical compositions containing such antisense-oligonucleotides and the use for prophylaxis and treatment of neurological, neurodegenerative, fibrotic and hyperproliferative diseases.

Claims:

1. Antisense-oligonucleotide consisting of 10 to 18 nucleotides and at least two of the 10 to 18 nucleotides are LNAs, wherein the antisense-oligonucleotide has a gapmer structure with 1 to 5 LNA units at the 3' terminal end and 1 to 5 LNA units at the 5' terminal end, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to said sequence CCCTAAACAC (Seq. ID No. 5) or sequence ACTACCAAAT (Seq. ID No. 6) or sequence GGACGCGTAT (Seq. ID No. 7) or sequence GTCTATGACG (Seq. ID No. 8) or sequence TTATTAATGC (Seq. ID No. 9) respectively or salts or optical isomers of said antisense-oligonucleotide, wherein the antisense-oligonucleotide inhibits expression of TGF-R.sub.II.

2. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide hybridizes selectively only with the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9) of the region of the gene encoding the TGF-R.sub.II or of the region of the mRNA encoding the TGF-R.sub.II.

3. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide has phosphate, phosphorothioate and/or phosphorodithioate as internucleotide linkages.

4. Antisense-oligonucleotide according to claim 1, wherein the antisense-oligonucleotide is represented by the following sequence: TABLE-US-00184 (Seq. ID No. 12) 5'-N.sup.1-GTCATAGA-N.sup.2-3' or (Seq. ID No. 98) 5'-N.sup.3-ACGCGTCC-N.sup.4-3' or (Seq. ID No. 11) 5'-N.sup.5-TTTGGTAG-N.sup.6-3' or (Seq. ID No. 101) 5'-N.sup.9-ATTAATAA-N.sup.10-3' or (Seq. ID No. 10) 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

wherein N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or CCGAGCCCCCAGCGCAGCGG; N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or T; N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sup.10 represents: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AG CTATTTG GTAG -, G CTATTTG GTAG -, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

5. Antisense-oligonucleotide according to claim 1, wherein the last 2 to 4 nucleotides at the 5' terminal end are LNA nucleotides and the last 2 to 4 nucleotides at the 3' terminal end are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the LNA nucleotides at the 3' terminal end at least 6 consecutive nucleotides are present which are non-LNA nucleotides or which are DNA nucleotides.

6. Antisense-oligonucleotide according to claim 1, wherein the LNA nucleotides are linked to each other through a phosphorothioate group or a phosphorodithioate group or wherein all nucleotides are linked to each other through a phosphate group or a phosphorothioate group or a phosphorodithioate group.

7. Antisense-oligonucleotide according to claim 1, wherein the LNA nucleotides are selected from the group consisting of: ##STR00012## wherein IL' represents --X''--P(.dbd.X')(X'')--; X' represents .dbd.O or .dbd.S; X.sup.- represents --O.sup.-, --OH, --OR.sup.H, --NHR.sup.H, --N(R.sup.H).sub.2, --OCH.sub.2CH.sub.2OR.sup.H, --OCH.sub.2CH.sub.2SR.sup.H, --BH.sub.3.sup.-, --R.sup.H, --SH, --SR.sup.H, or --S.sup.-; X'' represents --O--, --NH--, --NR.sup.H--, --CH.sub.2--, or --S--; Y is --O--, --NH--, --NR.sup.H--, --CH.sub.2-- or --S--; R.sup.C and R.sup.H are independently of each other selected from hydrogen and C.sub.1-4-alkyl; and B represents a nucleobase selected from the group consisting of: adenine, thymine, guanine, cytosine, uracil, 5-methylcytosine, 5-hydroxymethyl cytosine, N.sup.4-methylcytosine, xanthine, hypoxanthine, 7-deazaxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 6-ethyladenine, 6-ethylguanine, 2-propyladenine, 2-propylguanine, 6-carboxyuracil, 5,6-dihydrouracil, 5-propynyl uracil, 5-propynyl cytosine, 6-aza uracil, 6-aza cytosine, 6-aza thymine, 5-uracil, 4-thiouracil, 8-fluoroadenine, 8-chloroadenine, 8-bromoadenine, 8-iodoadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-fluoroguanine, 8-chloroguanine, 8-bromoguanine, 8-iodoguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-trifluoromethyluracil, 5-fluorocytosine, 5-bromocytosine, 5-chlorocytosine, 5-iodocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 3-deazaguanine, 3-deazaadenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine.

8. Antisense-oligonucleotide according to claim 1 having one of the following gapmer structures selected from the group consisting of: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, and 4-11-3.

9. Antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide binds with 100% complementarity to the mRNA encoding TGF-R.sub.II and do not bind to any other region in the human transcriptome.

10. A method for promoting regeneration and functional reconnection of damaged nerve pathways and/or for treatment and compensation of age induced decreases in neuronal stem cell renewal comprising administering to a patient an antisense-oligonucleotide according to claim 1.

11. A method for prophylaxis and treatment of a disease selected from the group consisting of neurodegenerative diseases, neuroinflammatory disorders, traumatic or posttraumatic disorders, neurovascular disorders, hypoxic disorders, postinfectious central nervous system disorders, fibrotic diseases, hyperproliferative diseases, cancer, tumors, presbyakusis and presbyopia comprising administering to a patient an antisense-oligonucleotide according to claim 1.

12. The method according to claim 11, wherein the neurodegenerative diseases and neuroinflammatory disorders are selected from the group consisting of: Alzheimer's disease, Parkinson's disease, Creutzfeldt Jakob disease, new variant of Creutzfeldt Jakobs disease, Hallervorden Spatz disease, Huntington's disease, multisystem atrophy, dementia, frontotemporal dementia, motor neuron disorders, amyotrophic lateral sclerosis, spinal muscular atrophy, spinocerebellar atrophies, schizophrenia, affective disorders, major depression, meningoencephalitis, bacterial meningoencephalitis, viral meningoencephalitis, CNS autoimmune disorders, multiple sclerosis, acute ischemic/hypoxic lesions, stroke, CNS and spinal cord trauma, head and spinal trauma, brain traumatic injuries, arteriosclerosis, atherosclerosis, microangiopathic dementia, Binswanger' disease, retinal degeneration, cochlear degeneration, macular degeneration, cochlear deafness, AIDS-related dementia, retinitis pigmentosa, fragile X-associated tremor/ataxia syndrome, progressive supranuclear palsy, striatonigral degeneration, olivopontocerebellear degeneration, Shy Drager syndrome, age dependant memory deficits, neurodevelopmental disorders associated with dementia, Down's Syndrome, synucleinopathies, superoxide dismutase mutations, trinucleotide repeat disorders, trauma, hypoxia, vascular diseases, vascular inflammations, and CNS-ageing and wherein the fibrotic diseases are selected from the group consisting of: pulmonary fibrosis, cystic fibrosis, hepatic cirrhosis, endomyocardial fibrosis, old myocardial infarction, atrial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis, nephrogenic systemic fibrosis, Crohn's Disease, keloid, systemic sclerosis, arthrofibrosis, Peyronie's disease, Dupuytren's contracture, and residuums after Lupus erythematodes.

13. A pharmaceutical composition comprising at least one single-stranded antisense-oligonucleotide according to claim 1 together with at least one pharmaceutically acceptable carrier, excipient, adjuvant, solvent or diluent.

Description:

[0001] This application is a Continuation application of U.S. application Ser. No. 15/525,561, filed May 9, 2017, which is a U.S. National Stage Application under 35 U.S.C. .sctn. 371 of International Application No. PCT/EP2015/076730, filed Nov. 16, 2015, designating the U.S. and published in English as WO 2016/075339 A1 on May 19, 2016, which claims the benefit of European Patent Application No. EP 14193368.9, filed Nov. 16, 2014. Any and all applications for which a foreign or a domestic priority is claimed is/are identified in the Application Data Sheet filed herewith and is/are hereby incorporated by reference in their entirety under 37 C.F.R. .sctn. 1.57.

[0002] The present invention relates to antisense-oligonucleotides, their use as inhibitors of TGF-R signaling, pharmaceutical compositions containing such antisense-oligonucleotides and the use for prophylaxis and treatment of neurological, neurodegenerative and hyperproliferative including oncological diseases.

[0003] TGF-.beta. exists in three known subtypes in humans, TGF-.beta.1, TGF-.beta.2, and TGF-.beta.3. These are upregulated in neurodegenerative diseases, such as ALS, and some human cancers, and increased expression of this growth factor in pathological conditions of neurodegenerative diseases, acute trauma, and neuro-inflammation and ageing has been demonstrated. Isoforms of transforming growth factor-beta (TGF-.beta.1) are also thought to be involved in the pathogenesis of pre-eclampsia.

[0004] Activated TGF-.beta.s exert their effects on the target cell via three different receptor classes: type I (TGFRI), also termed activin-like kinases (ALK; 53 kDa), type II (TGFRII; 70-100 kDa), and type III (TGFRIII; 200-400 kDa. TGF-.beta. receptors are single pass serine/threonine kinase receptors. Whereas type II receptor kinase is constitutively active, type I receptor needs to be activated. This process is initiated through binding of a ligand to TGFRII; this triggers the transient formation of a complex that includes the ligand and receptor types I and II. Taking into account the dimeric composition of the ligand, the receptor complex most likely consists of a tetrameric structure formed by two pairs of each receptor type.

[0005] TGF-.beta. signal transduction takes place through its receptors and downstream through Smad proteins. Smad-dependent cellular signal transduction initiated by binding of the TGF-.beta. isoform to a specific TGFRI/II receptor pair, leads to the phosphorylation of intracellular Smads and subsequently the translocation of an activated Smad complex into the nucleus in order to influence specific target gene expression. Signal divergence into other pathways and convergence from neighboring signaling pathways generate a highly complex network. Depending on the environmental and cellular context, TGF-beta signaling results in a variety of different cellular responses such as cellular proliferation, differentiation, motility, and apoptosis in tumor cells. In cancer, TGF-.beta. can affect tumor growth directly (referred to as intrinsic effect of TGF-.beta. signaling) or indirectly (referred to as extrinsic effect) by promoting tumor growth, inducing epithelial-mesenchymal transition (EMT), blocking antitumor immune responses, increasing tumor-associated fibrosis, modulating extracellular matrix (ECN) and cell migration, and finally enhancing angiogenesis. The factors (e.g. concentration, timing, local exposure) determining whether TGF-.beta. signaling has a tumor promoter or suppressor function are a matter of intense research and discussion. Currently, it is postulated that the tumor suppressor function of TGF-.beta. signaling is lost in early stages of cancer similar to recessive loss-of-function mutations in other tumor suppressors. Therefore there are several pharmacological approaches for treatment of divers cancers by blocking TGF-beta signaling pathways, such as investigation of Galunisertib and TEW-7197, both are small molecule inhibitor of TGFRI and being in clinical investigation, and LY3022859, an antibody against TGFRII.

[0006] Signals provided by proteins of the transforming growth factor (TGF-.beta.) family represent a system by which neural stem cells are controlled under physiological conditions but in analogy to other cell types are released from this control after transformation to cancer stem cells. TGF-.beta. is a multifunctional cytokine involved in various physiological and patho-physiological processes of the brain. It is induced in the adult brain after injury or hypoxia and during neurodegeneration when it modulates and dampens inflammatory responses. After injury, although TGF-.beta. is in general neuroprotective, it limits the self-repair of the brain by inhibiting neural stem cell proliferation and inducing fibrosis/gliosis for scar formation. Similar to its effect on neural stem cells, TGF-.beta. reveals anti-proliferative control on most cell types; however, paradoxically, many tumors escape from TGF-.beta. control. Moreover, these tumors develop mechanisms that change the anti-proliferative influence of TGF-.beta. into oncogenic cues, mainly by orchestrating a multitude of TGF-.beta.-mediated effects upon matrix, migration and invasion, angiogenesis, and, most importantly, immune escape mechanisms. Thus, TGF-.beta. is involved in tumor progression (see FIG. 3).

[0007] Consequently, the TGF Receptor II (transforming growth factor, beta receptor II; synonymously used symbols: TGF-beta type II receptor, TGFBR2; AAT3; FAA3; LDS1B; LDS2; LDS2B; MFS2; RIIC; TAAD2; TGFR-2; TGFbeta-RII, TGF-RII, TGF-R.sub.II), and in particular its inhibition, was validated as target for the treatment of neurodegenerative diseases, such as ALS, and hyperproliferative diseases such as cancer and fibrotic diseases.

[0008] Thus objective of the present application is to provide pharmaceutically active compounds able inhibit expression of the TGF Receptor II (TGF-R.sub.II) and therefore, reduce the amount of TGF Receptor II (TGF-R.sub.II) and decrease the activity of TGF-.beta. downstream signaling.

[0009] The objective of the present invention is solved by the teaching of the independent claims. Further advantageous features, aspects and details of the invention are evident from the dependent claims, the description, the figures, and the examples of the present application.

[0010] Surprisingly under thousands of candidate substances, such as protein-nucleotide complexes, siRNA, microRNA (miRNA), ribozymes, aptamers, CpG-oligos, DNA-zymes, riboswitches, lipids, peptides, small molecules, modifyers of rafts or caveoli, modifyers of golgi apparatus, antibodies and their derivatives, especially chimeras, Fab-fragments, and Fc-fragments, antisense-oligonucleotides containing LNAs (LNA.RTM.: Locked Nucleic Acids) were found the most promising candidates for the uses disclosed herein.

[0011] Thus, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TGGTCCATTC (Seq. ID No. 4) or sequence CCCTAAACAC (Seq. ID No. 5) or sequence ACTACCAAAT (Seq. ID No. 6) or sequence GGACGCGTAT (Seq. ID No. 7) or sequence GTCTATGACG (Seq. ID No. 8) or sequence TTATTAATGC (Seq. ID No. 9) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0012] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TGGTCCATTC (Seq. ID No. 4) or sequence CCCTAAACAC (Seq. ID No. 5) or sequence ACTACCAAAT (Seq. ID No. 6) or sequence GGACGCGTAT (Seq. ID No. 7) or sequence GTCTATGACG (Seq. ID No. 8) or sequence TTATTAATGC (Seq. ID No. 9) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0013] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0014] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TGGTCCATTC (Seq. ID No. 4) or the sequence CCCTAAACAC (Seq. ID No. 5) or the sequence ACTACCAAAT (Seq. ID No. 6) or the sequence GGACGCGTAT (Seq. ID No. 7) or the sequence GTCTATGACG (Seq. ID No. 8) or the sequence TTATTAATGC (Seq. ID No. 9) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0015] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TGGTCCATTC (Seq. ID No. 4) and salts and optical isomers of said antisense-oligonucleotide.

[0016] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TGGTCCATTC (Seq. ID No. 4) and salts and optical isomers of said antisense-oligonucleotide.

[0017] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TGGTCCATTC (Seq. ID No. 4) and salts and optical isomers of said antisense-oligonucleotide.

[0018] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGTCCATTC (Seq. ID No. 4), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TGGTCCATTC (Seq. ID No. 4) and salts and optical isomers of said antisense-oligonucleotide.

[0019] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CCCTAAACAC (Seq. ID No. 5) and salts and optical isomers of said antisense-oligonucleotide.

[0020] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CCCTAAACAC (Seq. ID No. 5) and salts and optical isomers of said antisense-oligonucleotide.

[0021] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CCCTAAACAC (Seq. ID No. 5) and salts and optical isomers of said antisense-oligonucleotide.

[0022] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CCCTAAACAC (Seq. ID No. 5), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CCCTAAACAC (Seq. ID No. 5) and salts and optical isomers of said antisense-oligonucleotide.

[0023] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTACCAAAT (Seq. ID No. 6), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence ACTACCAAAT (Seq. ID No. 6) and salts and optical isomers of said antisense-oligonucleotide.

[0024] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTACCAAAT (Seq. ID No. 6), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence ACTACCAAAT (Seq. ID No. 6) and salts and optical isomers of said antisense-oligonucleotide.

[0025] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTACCAAAT (Seq. ID No. 6), and the antisense-oligonucleotide comprises a sequence complementary to the sequence ACTACCAAAT (Seq. ID No. 6) and salts and optical isomers of said antisense-oligonucleotide.

[0026] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTACCAAAT (Seq. ID No. 6), and the antisense-oligonucleotide comprises a sequence complementary to the sequence ACTACCAAAT (Seq. ID No. 6) and salts and optical isomers of said antisense-oligonucleotide.

[0027] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGACGCGTAT (Seq. ID No. 7), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GGACGCGTAT (Seq. ID No. 7) and salts and optical isomers of said antisense-oligonucleotide.

[0028] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGACGCGTAT (Seq. ID No. 7), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GGACGCGTAT (Seq. ID No. 7) and salts and optical isomers of said antisense-oligonucleotide.

[0029] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGACGCGTAT (Seq. ID No. 7), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GGACGCGTAT (Seq. ID No. 7) and salts and optical isomers of said antisense-oligonucleotide.

[0030] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGACGCGTAT (Seq. ID No. 7), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GGACGCGTAT (Seq. ID No. 7) and salts and optical isomers of said antisense-oligonucleotide.

[0031] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTCTATGACG (Seq. ID No. 8), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GTCTATGACG (Seq. ID No. 8) and salts and optical isomers of said antisense-oligonucleotide.

[0032] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTCTATGACG (Seq. ID No. 8), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GTCTATGACG (Seq. ID No. 8) and salts and optical isomers of said antisense-oligonucleotide.

[0033] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTCTATGACG (Seq. ID No. 8), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GTCTATGACG (Seq. ID No. 8) and salts and optical isomers of said antisense-oligonucleotide.

[0034] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTCTATGACG (Seq. ID No. 8), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GTCTATGACG (Seq. ID No. 8) and salts and optical isomers of said antisense-oligonucleotide.

[0035] Preferably the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TTATTAATGC (Seq. ID No. 9) and salts and optical isomers of said antisense-oligonucleotide.

[0036] Slightly reworded the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TTATTAATGC (Seq. ID No. 9) and salts and optical isomers of said antisense-oligonucleotide.

[0037] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TTATTAATGC (Seq. ID No. 9) and salts and optical isomers of said antisense-oligonucleotide.

[0038] Slightly reworded consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the open reading frame of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the open reading frame of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTATTAATGC (Seq. ID No. 9), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TTATTAATGC (Seq. ID No. 9) and salts and optical isomers of said antisense-oligonucleotide.

[0039] The antisense-oligonucleotides of the present invention preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0040] Thus, preferred are antisense-oligonucleotides of the present invention which contain 3 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units.

[0041] Moreover, the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide.

[0042] Thus, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), CTGGTCCATTCA (Seq. ID No. 298), TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), TCCCTAAACACT (Seq. ID No. 301), CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), CACTACCAAATA (Seq. ID No. 304), TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), TGGACGCGTATC (Seq. ID No. 307), GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), GGTCTATGACGA (Seq. ID No. 310), TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), CTGGTCCATTCA (Seq. ID No. 298), TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), TCCCTAAACACT (Seq. ID No. 301), CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), CACTACCAAATA (Seq. ID No. 304), TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), TGGACGCGTATC (Seq. ID No. 307), GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), GGTCTATGACGA (Seq. ID No. 310), TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0043] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), CTGGTCCATTCA (Seq. ID No. 298), TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), TCCCTAAACACT (Seq. ID No. 301), CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), CACTACCAAATA (Seq. ID No. 304), TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), TGGACGCGTATC (Seq. ID No. 307), GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), GGTCTATGACGA (Seq. ID No. 310), TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), CTGGTCCATTCA (Seq. ID No. 298), TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), TCCCTAAACACT (Seq. ID No. 301), CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), CACTACCAAATA (Seq. ID No. 304), TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), TGGACGCGTATC (Seq. ID No. 307), GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), GGTCTATGACGA (Seq. ID No. 310), TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0044] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), or CTGGTCCATTCA (Seq. ID No. 298), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), or CTGGTCCATTCA (Seq. ID No. 298) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0045] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), or CTGGTCCATTCA (Seq. ID No. 298), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CTGGTCCATTC (Seq. ID No. 296), TGGTCCATTCA (Seq. ID No. 297), or CTGGTCCATTCA (Seq. ID No. 298) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0046] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), or TCCCTAAACACT (Seq. ID No. 301), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), or TCCCTAAACACT (Seq. ID No. 301) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0047] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), or TCCCTAAACACT (Seq. ID No. 301), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TCCCTAAACAC (Seq. ID No. 299), CCCTAAACACT (Seq. ID No. 300), or TCCCTAAACACT (Seq. ID No. 301) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0048] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), or CACTACCAAATA (Seq. ID No. 304), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), or CACTACCAAATA (Seq. ID No. 304) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0049] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), or CACTACCAAATA (Seq. ID No. 304), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CACTACCAAAT (Seq. ID No. 302), ACTACCAAATA (Seq. ID No. 303), or CACTACCAAATA (Seq. ID No. 304) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0050] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), or TGGACGCGTATC (Seq. ID No. 307), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), or TGGACGCGTATC (Seq. ID No. 307) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0051] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), or TGGACGCGTATC (Seq. ID No. 307), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TGGACGCGTAT (Seq. ID No. 305), GGACGCGTATC (Seq. ID No. 306), or TGGACGCGTATC (Seq. ID No. 307) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0052] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), or GGTCTATGACGA (Seq. ID No. 310), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), or GGTCTATGACGA (Seq. ID No. 310) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0053] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), or GGTCTATGACGA (Seq. ID No. 310), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GGTCTATGACG (Seq. ID No. 308), GTCTATGACGA (Seq. ID No. 309), or GGTCTATGACGA (Seq. ID No. 310) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0054] Preferably, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0055] Slightly reworded, the present invention is also directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313), and the antisense-oligonucleotide comprises a sequence complementary to the sequence TTTATTAATGC (Seq. ID No. 311), TTATTAATGCC (Seq. ID No. 312), or TTTATTAATGCC (Seq. ID No. 313) respectively and salts and optical isomers of said antisense-oligonucleotide.

[0056] The antisense-oligonucleotides of the present invention preferably comprise 3 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0057] Thus, preferred are antisense-oligonucleotides of the present invention which contain 3 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units.

[0058] Moreover, the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide.

[0059] Thus, the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), CTCCCTAAACACTA (Seq. ID No. 323), ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), ACACTACCAAATAG (Seq. ID No. 328), GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), GTGGACGCGTATCG (Seq. ID No. 333), CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), CGGTCTATGACGAG (Seq. ID No. 338), CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), CTCCCTAAACACTA (Seq. ID No. 323), ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), ACACTACCAAATAG (Seq. ID No. 328), GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), GTGGACGCGTATCG (Seq. ID No. 333), CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), CGGTCTATGACGAG (Seq. ID No. 338), CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0060] Alternatively the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), CTCCCTAAACACTA (Seq. ID No. 323), ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), ACACTACCAAATAG (Seq. ID No. 328), GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), GTGGACGCGTATCG (Seq. ID No. 333), CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), CGGTCTATGACGAG (Seq. ID No. 338), CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), and the antisense-oligonucleotide comprises a sequence complementary to the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), CTCCCTAAACACTA (Seq. ID No. 323), ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), ACACTACCAAATAG (Seq. ID No. 328), GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), GTGGACGCGTATCG (Seq. ID No. 333), CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), CGGTCTATGACGAG (Seq. ID No. 338), CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0061] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), ACTGGTCCATTCAT (Seq. ID No. 318), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0062] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), or ACTGGTCCATTCAT (Seq. ID No. 318), and the antisense-oligonucleotide comprises a sequence complementary to the sequence ACTGGTCCATTC (Seq. ID No. 314), TGGTCCATTCAT (Seq. ID No. 315), CTGGTCCATTCAT (Seq. ID No. 316), ACTGGTCCATTCA (Seq. ID No. 317), or ACTGGTCCATTCAT (Seq. ID No. 318), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0063] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), or CTCCCTAAACACTA (Seq. ID No. 323), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), or CTCCCTAAACACTA (Seq. ID No. 323), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0064] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), or CTCCCTAAACACTA (Seq. ID No. 323), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CTCCCTAAACAC (Seq. ID No. 319), CCCTAAACACTA (Seq. ID No. 320), TCCCTAAACACTA (Seq. ID No. 321), CTCCCTAAACACT (Seq. ID No. 322), or CTCCCTAAACACTA (Seq. ID No. 323), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0065] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), or ACACTACCAAATAG (Seq. ID No. 328), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), or ACACTACCAAATAG (Seq. ID No. 328), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0066] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), or ACACTACCAAATAG (Seq. ID No. 328), and the antisense-oligonucleotide comprises a sequence complementary to the sequence ACACTACCAAAT (Seq. ID No. 324), ACTACCAAATAG (Seq. ID No. 325), CACTACCAAATAG (Seq. ID No. 326), ACACTACCAAATA (Seq. ID No. 327), or ACACTACCAAATAG (Seq. ID No. 328), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0067] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), or GTGGACGCGTATCG (Seq. ID No. 333), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), or GTGGACGCGTATCG (Seq. ID No. 333), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0068] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), or GTGGACGCGTATCG (Seq. ID No. 333), and the antisense-oligonucleotide comprises a sequence complementary to the sequence GTGGACGCGTAT (Seq. ID No. 329), GGACGCGTATCG (Seq. ID No. 330), TGGACGCGTATCG (Seq. ID No. 331), GTGGACGCGTATC (Seq. ID No. 332), or GTGGACGCGTATCG (Seq. ID No. 333), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0069] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), or CGGTCTATGACGAG (Seq. ID No. 338), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), or CGGTCTATGACGAG (Seq. ID No. 338), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0070] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), or CGGTCTATGACGAG (Seq. ID No. 338), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CGGTCTATGACG (Seq. ID No. 334), GTCTATGACGAG (Seq. ID No. 335), GGTCTATGACGAG (Seq. ID No. 336), CGGTCTATGACGA (Seq. ID No. 337), or CGGTCTATGACGAG (Seq. ID No. 338), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0071] Preferably the present invention is also directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), and the antisense-oligonucleotide comprises a sequence capable of hybridizing with said sequence CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0072] Slightly reworded, the present invention is directed to antisense-oligonucleotide(s) consisting of 14 to 20 more preferably 14 to 18 nucleotides and at least four of the 14 to 20 more preferably 14 to 18 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the region of the gene encoding the TGF-R.sub.II or the region of the mRNA encoding the TGF-R.sub.II comprises the sequence CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), and the antisense-oligonucleotide comprises a sequence complementary to the sequence CTTTATTAATGC (Seq. ID No. 339), TTATTAATGCCT (Seq. ID No. 340), TTTATTAATGCCT (Seq. ID No. 341), CTTTATTAATGCC (Seq. ID No. 342), or CTTTATTAATGCCT (Seq. ID No. 343), respectively and salts and optical isomers of said antisense-oligonucleotide.

[0073] The antisense-oligonucleotides of the present invention preferably comprise 4 to 11 LNA units, more preferably 4 to 10 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0074] Thus, preferred are antisense-oligonucleotides of the present invention which contain 3 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units.

[0075] Moreover, the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide.

[0076] Thus, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12) or 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98) or 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10) or 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11) or 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100) or 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or CCGAGCCCCCAGCGCAGCGG; N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or T; N.sup.7 represents: TGAATCTTGAATATCTCATG-, GAATCTTGAATATCTCATG-, AATCTTGAATATCTCATG-, ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; N.sup.8 represents: -AGTATTCTAGAAACTCACCA, -AGTATTCTAGAAACTCACC, -AGTATTCTAGAAACTCAC, -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sup.10 represents: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G; and salts and optical isomers of the antisense-oligonucleotide.

[0077] Thus, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12) or 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98) or 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10) or 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11) or 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100) or 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein the residues N.sup.1 to N.sup.12 have the meanings especially the further limited meanings as disclosed herein and salts and optical isomers of said antisense-oligonucleotide.

[0078] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12), wherein

N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or CCGAGCCCCCAGCGCAGCGG; and salts and optical isomers of the antisense-oligonucleotide.

[0079] The antisense-oligonucleotides of formula S1 (Seq. ID No. 12) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0080] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0081] Moreover, the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0082] Thus, preferred are antisense-oligonucleotides of the formula (S1):

TABLE-US-00001 (Seq. ID No. 12) 5'-N.sup.1-GTCATAGA-N.sup.2-3'

wherein N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and N.sup.2 is selected from: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or -CCGAGCCCCCAGCGCAGCGG.

[0083] Preferably the antisense-oligonucleotide of general formula (S1) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0084] More preferably the antisense-oligonucleotide of general formula (S1) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0085] Still more preferably the antisense-oligonucleotide of general formula (S1) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0086] Further preferred are antisense-oligonucleotides of the formula (S1):

TABLE-US-00002 5'-N.sup.1-GTCATAGA-N.sup.2-3'

wherein N.sup.1 represents: TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and N.sup.2 is selected from: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, or -CCGAGCCCCCAGCGCAGC.

[0087] Also preferred are antisense-oligonucleotides of the formula (S1):

TABLE-US-00003 5'-N.sup.1-GTCATAGA-N.sup.2-3'

wherein N.sup.1 represents: GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and N.sup.2 is selected from: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, or -CCGAGCCCCCAGC.

[0088] Also preferred are antisense-oligonucleotides of the formula (S1):

TABLE-US-00004 5'-N.sup.1-GTCATAGA-N.sup.2-3'

wherein N.sup.1 represents: CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and N.sup.2 is selected from: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, or -CCGAGCCC.

[0089] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1A-CGTCATAGAC-N.sup.2A-3' (Seq. ID No. 69), wherein

N.sup.1A represents: CATGGCAGACCCCGCTGCT-, ATGGCAGACCCCGCTGCT-, TGGCAGACCCCGCTGCT-, GGCAGACCCCGCTGCT-, GCAGACCCCGCTGCT-, CAGACCCCGCTGCT-, AGACCCCGCTGCT-, GACCCCGCTGCT-, ACCCCGCTGCT-, CCCCGCTGCT-, CCCGCTGCT-, CCGCTGCT-, CGCTGCT-, GCTGCT-, CTGCT-, TGCT-, GCT-, CT-, or T-; N.sup.2A represents: -C, -CG, -CGA, -CGAG, -CGAGC, -CGAGCC, -CGAGCCC, -CGAGCCCC, -CGAGCCCCC, -CGAGCCCCCA, -CGAGCCCCCAG, -CGAGCCCCCAGC, -CGAGCCCCCAGCG, -CGAGCCCCCAGCGC, -CGAGCCCCCAGCGCA, -CGAGCCCCCAGCGCAG, -CGAGCCCCCAGCGCAGC, -CGAGCCCCCAGCGCAGCG, or CGAGCCCCCAGCGCAGCGG; and salts and optical isomers of the antisense-oligonucleotide.

[0090] Preferably N.sup.1A represents: TGGCAGACCCCGCTGCT-, GGCAGACCCCGCTGCT-, GCAGACCCCGCTGCT-, CAGACCCCGCTGCT-, AGACCCCGCTGCT-, GACCCCGCTGCT-, ACCCCGCTGCT-, CCCCGCTGCT-, CCCGCTGCT-, CCGCTGCT-, CGCTGCT-, GCTGCT-, CTGCT-, TGCT-, GCT-, CT-, or T-;

and N.sup.2A represents: -C, -CG, -CGA, -CGAG, -CGAGC, -CGAGCC, -CGAGCCC, -CGAGCCCC, -CGAGCCCCC, -CGAGCCCCCA, -CGAGCCCCCAG, -CGAGCCCCCAGC, -CGAGCCCCCAGCG, -CGAGCCCCCAGCGC, -CGAGCCCCCAGCGCA, -CGAGCCCCCAGCGCAG, or -CGAGCCCCCAGCGCAGC.

[0091] More preferably N.sup.1A represents: GACCCCGCTGCT-, ACCCCGCTGCT-, CCCCGCTGCT-, CCCGCTGCT-, CCGCTGCT-, CGCTGCT-, GCTGCT-, CTGCT-, TGCT-, GCT-, CT-, or T-; and

N.sup.2A represents: -C, -CG, -CGA, -CGAG, -CGAGC, -CGAGCC, -CGAGCCC, -CGAGCCCC, -CGAGCCCCC, -CGAGCCCCCA, -CGAGCCCCCAG, or -CGAGCCCCCAGC.

[0092] Still more preferably N.sup.1A represents: CGCTGCT-, GCTGCT-, CTGCT-, TGCT-, GCT-, CT-, or T-; and

N.sup.2A represents: -C, -CG, -CGA, -CGAG, -CGAGC, -CGAGCC, or -CGAGCCC.

[0093] Preferably the antisense-oligonucleotide of general formula (S1A/Seq. ID No. 69) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0094] More preferably the antisense-oligonucleotide of general formula (S1A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0095] Still more preferably the antisense-oligonucleotide of general formula (S1A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0096] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98), wherein

N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; and salts and optical isomers of the antisense-oligonucleotide.

[0097] The antisense-oligonucleotides of formula S2 (Seq. ID No. 98) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0098] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0099] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0100] Thus, preferred are antisense-oligonucleotides of the formula (S2):

TABLE-US-00005 (Seq. ID No. 98) 5'-N.sup.3-ACGCGTCC-N.sup.4-3'

wherein N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A.

[0101] Preferably the antisense-oligonucleotide of general formula (S2) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0102] More preferably the antisense-oligonucleotide of general formula (S2) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0103] Still more preferably the antisense-oligonucleotide of general formula (S2) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0104] Further preferred are antisense-oligonucleotides of the formula (S2):

TABLE-US-00006 5'-N.sup.3-ACGCGTCC-N.sup.4-3'

wherein N.sup.3 represents: TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A.

[0105] Also preferred are antisense-oligonucleotides of the formula (S2):

TABLE-US-00007 5'-N.sup.3-ACGCGTCC-N.sup.4-3'

wherein N.sup.3 represents: TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A.

[0106] Also preferred are antisense-oligonucleotides of the formula (S2):

TABLE-US-00008 5'-N.sup.3-ACGCGTCC-N.sup.4-3'

wherein N.sup.3 represents: CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A.

[0107] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.3A-TACGCGTCCA-N.sup.4A-3' (Seq. ID No. 70), wherein

N.sup.3A represents: GGTGGGATCGTGCTGGCGA-, GTGGGATCGTGCTGGCGA-, TGGGATCGTGCTGGCGA-, GGGATCGTGCTGGCGA-, GGATCGTGCTGGCGA-, GATCGTGCTGGCGA-, ATCGTGCTGGCGA-, TCGTGCTGGCGA-, CGTGCTGGCGA-, GTGCTGGCGA-, TGCTGGCGA-, GCTGGCGA-, CTGGCGA-, TGGCGA-, GGCGA-, GCGA-, CGA-, GA-, or A-; N.sup.4A represents: -CAGGACGATGTGCAGCGGC, -CAGGACGATGTGCAGCGG, -CAGGACGATGTGCAGCG, -CAGGACGATGTGCAGC, -CAGGACGATGTGCAG, -CAGGACGATGTGCA, -CAGGACGATGTGC, -CAGGACGATGTG, -CAGGACGATGT, -CAGGACGATG, -CAGGACGAT, -CAGGACGA, -CAGGACG, -CAGGAC, -CAGGA, -CAGG, -CAG, -CA, or -C; and salts and optical isomers of the antisense-oligonucleotide.

[0108] Preferably N.sup.3A represents: TGGGATCGTGCTGGCGA-, GGGATCGTGCTGGCGA-, GGATCGTGCTGGCGA-, GATCGTGCTGGCGA-, ATCGTGCTGGCGA-, TCGTGCTGGCGA-, CGTGCTGGCGA-, GTGCTGGCGA-, TGCTGGCGA-, GCTGGCGA-, CTGGCGA-, TGGCGA-, GGCGA-, GCGA-, CGA-, GA-, or A-;

and N.sup.4A represents: -CAGGACGATGTGCAGCG, -CAGGACGATGTGCAGC, -CAGGACGATGTGCAG, -CAGGACGATGTGCA, -CAGGACGATGTGC, -CAGGACGATGTG, -CAGGACGATGT, -CAGGACGATG, -CAGGACGAT, -CAGGACGA, -CAGGACG, -CAGGAC, -CAGGA, -CAGG, -CAG, -CA, or -C.

[0109] More preferably N.sup.3A represents: TCGTGCTGGCGA-, CGTGCTGGCGA-, GTGCTGGCGA-, TGCTGGCGA-, GCTGGCGA-, CTGGCGA-, TGGCGA-, GGCGA-, GCGA-, CGA-, GA-, or A-; and

N.sup.4A represents: -CAGGACGATGTG, -CAGGACGATGT, -CAGGACGATG, -CAGGACGAT, -CAGGACGA, -CAGGACG, -CAGGAC, -CAGGA, -CAGG, -CAG, -CA, or -C.

[0110] Still more preferably N.sup.3A represents: CTGGCGA-, TGGCGA-, GGCGA-, GCGA-, CGA-, GA-, or A-; and

N.sup.4A represents: -CAGGACG, -CAGGAC, -CAGGA, -CAGG, -CAG, -CA, or -C.

[0111] Preferably the antisense-oligonucleotide of general formula (S2A/Seq. ID No. 70) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0112] More preferably the antisense-oligonucleotide of general formula (S2A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0113] Still more preferably the antisense-oligonucleotide of general formula (S2A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0114] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10), wherein

N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G; and salts and optical isomers of the antisense-oligonucleotide.

[0115] The antisense-oligonucleotides of formula S3 (Seq. ID No. 10) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0116] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0117] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0118] Thus, preferred are antisense-oligonucleotides of the formula (S3):

TABLE-US-00009 (Seq. ID No. 10) 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

wherein N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, and N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

[0119] Preferably the antisense-oligonucleotide of general formula (S3) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0120] More preferably the antisense-oligonucleotide of general formula (S3) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0121] Still more preferably the antisense-oligonucleotide of general formula (S3) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0122] Further preferred are antisense-oligonucleotides of the formula (S3):

TABLE-US-00010 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

wherein N.sup.11 represents: AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; and N.sup.12 represents: -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

[0123] Also preferred are antisense-oligonucleotides of the formula (S3):

TABLE-US-00011 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

wherein N.sup.11 represents: AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; and N.sup.12 represents: -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

[0124] Also preferred are antisense-oligonucleotides of the formula (S3):

TABLE-US-00012 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

wherein N.sup.11 represents: TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; and N.sup.12 represents: -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or G.

[0125] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.11A-GTGTTTAGGG-N.sup.12A-3' (Seq. ID No. 71), wherein

N.sup.11A represents: TGCCCCAGAAGAGCTATTTGGTA-, GCCCCAGAAGAGCTATTTGGTA-, CCCCAGAAGAGCTATTTGGTA-, CCCAGAAGAGCTATTTGGTA-, CCAGAAGAGCTATTTGGTA-, CAGAAGAGCTATTTGGTA-, AGAAGAGCTATTTGGTA-, GAAGAGCTATTTGGTA-, AAGAGCTATTTGGTA-, AGAGCTATTTGGTA-, GAGCTATTTGGTA-, AGCTATTTGGTA-, GCTATTTGGTA-, CTATTTGGTA-, TATTTGGTA-, ATTTGGTA-, TTTGGTA-, TTGGTA-, TGGTA-, GGTA-, GTA-, TA-, or A-, N.sup.12A represents: -AGCCGTCTTCAGGAATCTTCTCC, -AGCCGTCTTCAGGAATCTTCTC, -AGCCGTCTTCAGGAATCTTCT, -AGCCGTCTTCAGGAATCTTC, -AGCCGTCTTCAGGAATCTT, -AGCCGTCTTCAGGAATCT, -AGCCGTCTTCAGGAATC, -AGCCGTCTTCAGGAAT, -AGCCGTCTTCAGGAA, -AGCCGTCTTCAGGA, -AGCCGTCTTCAGG, -AGCCGTCTTCAG, -AGCCGTCTTCA, -AGCCGTCTTC, -AGCCGTCTT, -AGCCGTCT, -AGCCGTC, -AGCCGT, -AGCCG, -AGCC, -AGC, -AG, or -A; and salts and optical isomers of the antisense-oligonucleotide.

[0126] Preferably N.sup.11A represents: AGAAGAGCTATTTGGTA-, GAAGAGCTATTTGGTA-, AAGAGCTATTTGGTA-, AGAGCTATTTGGTA-, GAGCTATTTGGTA-, AGCTATTTGGTA-, GCTATTTGGTA-, CTATTTGGTA-, TATTTGGTA-, ATTTGGTA-, TTTGGTA-, TTGGTA-, TGGTA-, GGTA-, GTA-, TA-, or A-; and

N.sup.12A represents: -AGCCGTCTTCAGGAATC, -AGCCGTCTTCAGGAAT, -AGCCGTCTTCAGGAA, -AGCCGTCTTCAGGA, -AGCCGTCTTCAGG, -AGCCGTCTTCAG, -AGCCGTCTTCA, -AGCCGTCTTC, -AGCCGTCTT, -AGCCGTCT, -AGCCGTC, -AGCCGT, -AGCCG, -AGCC, -AGC, -AG, or -A.

[0127] More preferably N.sup.11A represents: AGCTATTTGGTA-, GCTATTTGGTA-, CTATTTGGTA-, TATTTGGTA-, ATTTGGTA-, TTTGGTA-, TTGGTA-, TGGTA-, GGTA-, GTA-, TA-, or A-; and

N.sup.12A represents: -AGCCGTCTTCAG, -AGCCGTCTTCA, -AGCCGTCTTC, -AGCCGTCTT, -AGCCGTCT, -AGCCGTC, -AGCCGT, -AGCCG, -AGCC, -AGC, -AG, or -A.

[0128] Still more preferably N.sup.11A represents: TTTGGTA-, TTGGTA-, TGGTA-, GGTA-, GTA-, TA-, or A-; and

N.sup.12A represents: -AGCCGTC, -AGCCGT, -AGCCG, -AGCC, -AGC, -AG, or -A.

[0129] Preferably the antisense-oligonucleotide of general formula (S3A/Seq. ID No. 71) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0130] More preferably the antisense-oligonucleotide of general formula (S3A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0131] Still more preferably the antisense-oligonucleotide of general formula (S3A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0132] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11), wherein

N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or T; and salts and optical isomers of the antisense-oligonucleotide.

[0133] The antisense-oligonucleotides of formula S4 (Seq. ID No. 11) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0134] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0135] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0136] Thus, preferred are antisense-oligonucleotides of the formula (S4):

TABLE-US-00013 (Seq. ID No. 11) 5'-N.sup.5-TTTGGTAG-N.sup.6-3'

wherein N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 is selected from: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T.

[0137] Preferably the antisense-oligonucleotide of general formula (S4) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0138] More preferably the antisense-oligonucleotide of general formula (S4) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0139] Still more preferably the antisense-oligonucleotide of general formula (S4) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0140] Further preferred are antisense-oligonucleotides of the formula (S4):

TABLE-US-00014 5'-N.sup.5-TTTGGTAG-N.sup.6-3'

wherein N.sup.5 represents: CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 is selected from: -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T.

[0141] Also preferred are antisense-oligonucleotides of the formula (S4):

TABLE-US-00015 5'-N.sup.5-TTTGGTAG-N.sup.6-3'

wherein N.sup.5 represents: CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 is selected from: -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T.

[0142] Also preferred are antisense-oligonucleotides of the formula (S4):

TABLE-US-00016 5'-N.sup.5-TTTGGTAG-N.sup.6-3'

wherein N.sup.5 represents: AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 is selected from: -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T.

[0143] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.5A-ATTTGGTAGT-N.sup.6A-3' (Seq. ID No. 72), wherein

N.sup.5A represents: GCCCAGCCTGCCCCAGAAGAGCT-, CCCAGCCTGCCCCAGAAGAGCT-, CCAGCCTGCCCCAGAAGAGCT-, CAGCCTGCCCCAGAAGAGCT-, AGCCTGCCCCAGAAGAGCT-, GCCTGCCCCAGAAGAGCT-, CCTGCCCCAGAAGAGCT-, CTGCCCCAGAAGAGCT-, TGCCCCAGAAGAGCT-, GCCCCAGAAGAGCT-, CCCCAGAAGAGCT-, CCCAGAAGAGCT-, CCAGAAGAGCT-, CAGAAGAGCT-, AGAAGAGCT-, GAAGAGCT-, AAGAGCT-, AGAGCT-, GAGCT-, AGCT-, GCT-, CT-, or T-; and N.sup.6A represents: -GTTTAGGGAGCCGTCTTCAGGAA, -GTTTAGGGAGCCGTCTTCAGGA, -GTTTAGGGAGCCGTCTTCAGG, -GTTTAGGGAGCCGTCTTCAG, -GTTTAGGGAGCCGTCTTCA, -GTTTAGGGAGCCGTCTTC, -GTTTAGGGAGCCGTCTT, -GTTTAGGGAGCCGTCT, -GTTTAGGGAGCCGTC, -GTTTAGGGAGCCGT, -GTTTAGGGAGCCG, -GTTTAGGGAGCC, -GTTTAGGGAGC, -GTTTAGGGAG, -GTTTAGGGA, -GTTTAGGG, -GTTTAGG, -GTTTAG, -GTTTA, -GTTT, -GTT, -GT, or -G; and salts and optical isomers of the antisense-oligonucleotide.

[0144] Preferably N.sup.5A represents: CCTGCCCCAGAAGAGCT-, CTGCCCCAGAAGAGCT-, TGCCCCAGAAGAGCT-, GCCCCAGAAGAGCT-, CCCCAGAAGAGCT-, CCCAGAAGAGCT-, CCAGAAGAGCT-, CAGAAGAGCT-, AGAAGAGCT-, GAAGAGCT-, AAGAGCT-, AGAGCT-, GAGCT-, AGCT-, GCT-, CT-, or T-; and

N.sup.6A represents: -GTTTAGGGAGCCGTCTT, -GTTTAGGGAGCCGTCT, -GTTTAGGGAGCCGTC, -GTTTAGGGAGCCGT, -GTTTAGGGAGCCG, -GTTTAGGGAGCC, -GTTTAGGGAGC, -GTTTAGGGAG, -GTTTAGGGA, -GTTTAGGG, -GTTTAGG, -GTTTAG, -GTTTA, -GTTT, -GTT, -GT, or -G.

[0145] More preferably N.sup.5A represents: CCCAGAAGAGCT-, CCAGAAGAGCT-, CAGAAGAGCT-, AGAAGAGCT-, GAAGAGCT-, AAGAGCT-, AGAGCT-, GAGCT-, AGCT-, GCT-, CT-, or T-; and

N.sup.6A represents: -GTTTAGGGAGCC, -GTTTAGGGAGC, -GTTTAGGGAG, -GTTTAGGGA, -GTTTAGGG, -GTTTAGG, -GTTTAG, -GTTTA, -GTTT, -GTT, -GT, or -G.

[0146] Still more preferably N.sup.5A represents: AAGAGCT-, AGAGCT-, GAGCT-, AGCT-, GCT-, CT-, or T-; and

N.sup.6A represents: -GTTTAGG, -GTTTAG, -GTTTA, -GUT, -GTT, -GT, or -G.

[0147] Preferably the antisense-oligonucleotide of general formula (S4A/Seq. ID No. 72) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0148] More preferably the antisense-oligonucleotide of general formula (S4A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0149] Still more preferably the antisense-oligonucleotide of general formula (S4A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0150] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100), wherein

N.sup.7 represents: TGAATCTTGAATATCTCATG-, GAATCTTGAATATCTCATG-, AATCTTGAATATCTCATG-, ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; N.sup.8 represents: -AGTATTCTAGAAACTCACCA, -AGTATTCTAGAAACTCACC, -AGTATTCTAGAAACTCAC, -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; and salts and optical isomers of the antisense-oligonucleotide.

[0151] The antisense-oligonucleotides of formula S6 (Seq. ID No. 100) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0152] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0153] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0154] Thus, preferred are antisense-oligonucleotides of the formula (S6):

TABLE-US-00017 (Seq. ID No. 100) 5'-N.sup.7-AATGGACC-N.sup.8-3'

wherein N.sup.7 represents: TGAATCTTGAATATCTCATG-, GAATCTTGAATATCTCATG-, AATCTTGAATATCTCATG-, ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 is selected from: -AGTATTCTAGAAACTCACCA, -AGTATTCTAGAAACTCACC, -AGTATTCTAGAAACTCAC, -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A.

[0155] Preferably the antisense-oligonucleotide of general formula (S6) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0156] More preferably the antisense-oligonucleotide of general formula (S6) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0157] Still more preferably the antisense-oligonucleotide of general formula (S6) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0158] Further preferred are antisense-oligonucleotides of the formula (S6):

TABLE-US-00018 5'-N.sup.7-AATGGACC-N.sup.8-3'

wherein N.sup.7 represents: AATCTTGAATATCTCATG-, ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 is selected from: -AGTATTCTAGAAACTCAC, -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A.

[0159] Also preferred are antisense-oligonucleotides of the formula (S6):

TABLE-US-00019 5'-N.sup.7-AATGGACC-N.sup.8-3'

wherein N.sup.7 represents: TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 is selected from: -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A.

[0160] Also preferred are antisense-oligonucleotides of the formula (S6):

TABLE-US-00020 5'-N.sup.7-AATGGACC-N.sup.8-3'

wherein N.sup.7 represents: ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 is selected from: -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A.

[0161] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.7A-GAATGGACCA-N.sup.8A-3' (Seq. ID No. 73), wherein

N.sup.7A represents: TGAATCTTGAATATCTCAT-, GAATCTTGAATATCTCAT-, AATCTTGAATATCTCAT-, ATCTTGAATATCTCAT-, TCTTGAATATCTCAT-, CTTGAATATCTCAT-, TTGAATATCTCAT-, TGAATATCTCAT-, GAATATCTCAT-, AATATCTCAT-, ATATCTCAT-, TATCTCAT-, ATCTCAT-, TCTCAT-, CTCAT-, TCAT-, CAT-, AT-, or T-; N.sup.8A represents: -GTATTCTAGAAACTCACCA, -GTATTCTAGAAACTCACC, -GTATTCTAGAAACTCAC, -GTATTCTAGAAACTCA, -GTATTCTAGAAACTC, -GTATTCTAGAAACT, -GTATTCTAGAAAC, -GTATTCTAGAAA, -GTATTCTAGAA, -GTATTCTAGA, -GTATTCTAG, -GTATTCTA, -GTATTCT, -GTATTC, -GTATT, -GTAT, -GTA, -GT, or -G; and salts and optical isomers of the antisense-oligonucleotide.

[0162] Preferably N.sup.7A represents: AATCTTGAATATCTCAT-, ATCTTGAATATCTCAT-, TCTTGAATATCTCAT-, CTTGAATATCTCAT-, TTGAATATCTCAT-, TGAATATCTCAT-, GAATATCTCAT-, AATATCTCAT-, ATATCTCAT-, TATCTCAT-, ATCTCAT-, TCTCAT-, CTCAT-, TCAT-, CAT-, AT-, or T-;

and N.sup.8A represents: -GTATTCTAGAAACTCAC, -GTATTCTAGAAACTCA, -GTATTCTAGAAACTC, -GTATTCTAGAAACT, -GTATTCTAGAAAC, -GTATTCTAGAAA, -GTATTCTAGAA, -GTATTCTAGA, -GTATTCTAG, -GTATTCTA, -GTATTCT, -GTATTC, -GTATT, -GTAT, -GTA, -GT, or -G.

[0163] More preferably N.sup.7A represents: TGAATATCTCAT-, GAATATCTCAT-, AATATCTCAT-, ATATCTCAT-, TATCTCAT-, ATCTCAT-, TCTCAT-, CTCAT-, TCAT-, CAT-, AT-, or T-; and

N.sup.8A represents: -GTATTCTAGAAA, -GTATTCTAGAA, -GTATTCTAGA, -GTATTCTAG, -GTATTCTA, -GTATTCT, -GTATTC, -GTATT, -GTAT, -GTA, -GT, or -G.

[0164] Still more preferably N.sup.7A represents: ATCTCAT-, TCTCAT-, CTCAT-, TCAT-, CAT-, AT-, or T-; and

N.sup.8A represents: -GTATTCT, -GTATTC, -GTATT, -GTAT, -GTA, -GT, or -G.

[0165] Preferably the antisense-oligonucleotide of general formula (S6A/Seq. ID No. 73) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0166] More preferably the antisense-oligonucleotide of general formula (S6A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0167] Still more preferably the antisense-oligonucleotide of general formula (S6A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0168] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 10 to 28 nucleotides and at least two of the 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-, N.sup.10 represents: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; and salts and optical isomers of the antisense-oligonucleotide.

[0169] The antisense-oligonucleotides of formula S7 (Seq. ID No. 101) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0170] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0171] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0172] Thus, preferred are antisense-oligonucleotides of the formula (S7):

TABLE-US-00021 (Seq. ID No. 101) 5'-N.sup.9-ATTAATAA-N.sup.10-3'

wherein N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and N.sup.10 is selected from: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A.

[0173] Preferably the antisense-oligonucleotide of general formula (S7) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0174] More preferably the antisense-oligonucleotide of general formula (S7) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0175] Still more preferably the antisense-oligonucleotide of general formula (S7) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0176] Further preferred are antisense-oligonucleotides of the formula (S7):

TABLE-US-00022 5'-N.sup.9-ATTAATAA-N.sup.10-3'

wherein N.sup.9 represents: TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and N.sup.10 is selected from: -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A.

[0177] Also preferred are antisense-oligonucleotides of the formula (S7):

TABLE-US-00023 5'-N.sup.9-ATTAATAA-N.sup.10-3'

wherein N.sup.9 represents: TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and N.sup.10 is selected from: -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A.

[0178] Also preferred are antisense-oligonucleotides of the formula (S7):

TABLE-US-00024 5'-N.sup.9-ATTAATAA-N.sup.10-3'

wherein N.sup.9 represents: ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and N.sup.10 is selected from: -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A.

[0179] Preferably, the present invention is directed to antisense-oligonucleotide(s) consisting of 12 to 24 nucleotides and at least three of the 12 to 24 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.9A-CATTAATAAA-N.sup.10A-3' (Seq. ID No. 74), wherein

N.sup.9A represents: ATTCATATTTATATACAGG-, TTCATATTTATATACAGG-, TCATATTTATATACAGG-, CATATTTATATACAGG-, ATATTTATATACAGG-, TATTTATATACAGG-, ATTTATATACAGG-, TTTATATACAGG-, TTATATACAGG-, TATATACAGG-, ATATACAGG-, TATACAGG-, ATACAGG-, TACAGG-, ACAGG-, CAGG-, AGG-, GG-, or G-; N.sup.10A represents: -GTGCAAATGTTATTGGCTA, -GTGCAAATGTTATTGGCT, -GTGCAAATGTTATTGGC, -GTGCAAATGTTATTGG, -GTGCAAATGTTATTG, -GTGCAAATGTTATT, -GTGCAAATGTTAT, -GTGCAAATGTTA, -GTGCAAATGTT, -GTGCAAATGT, -GTGCAAATG, -GTGCAAAT, -GTGCAAA, -GTGCAA, -GTGCA, -GTGC, -GTG, -GT, or -G; and salts and optical isomers of the antisense-oligonucleotide.

[0180] Preferably N.sup.9A represents: TCATATTTATATACAGG-, CATATTTATATACAGG-, ATATTTATATACAGG-, TATTTATATACAGG-, ATTTATATACAGG-, TTTATATACAGG-, TTATATACAGG-, TATATACAGG-, ATATACAGG-, TATACAGG-, ATACAGG-, TACAGG-, ACAGG-, CAGG-, AGG-, GG-, or G-;

and N.sup.10A represents: -GTGCAAATGTTATTGGC, -GTGCAAATGTTATTGG, -GTGCAAATGTTATTG, -GTGCAAATGTTATT, -GTGCAAATGTTAT, -GTGCAAATGTTA, -GTGCAAATGTT, -GTGCAAATGT, -GTGCAAATG, -GTGCAAAT, -GTGCAAA, -GTGCAA, -GTGCA, -GTGC, -GTG, -GT, or -G.

[0181] More preferably N.sup.9A represents: TTTATATACAGG-, TTATATACAGG-, TATATACAGG-, ATATACAGG-, TATACAGG-, ATACAGG-, TACAGG-, ACAGG-, CAGG-, AGG-, GG-, or G-; and

N.sup.10A represents: -GTGCAAATGTTA, -GTGCAAATGTT, -GTGCAAATGT, -GTGCAAATG, -GTGCAAAT, -GTGCAAA, -GTGCAA, -GTGCA, -GTGC, -GTG, -GT, or -G.

[0182] Still more preferably N.sup.9A represents: ATACAGG-, TACAGG-, ACAGG-, CAGG-, AGG-, GG-, or G-; and

N.sup.10A represents: -GTGCAAA, -GTGCAA, -GTGCA, -GTGC, -GTG, -GT, or -G.

[0183] Preferably the antisense-oligonucleotide of general formula (S7A/Seq. ID No. 74) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0184] More preferably the antisense-oligonucleotide of general formula (S7A) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0185] Still more preferably the antisense-oligonucleotide of general formula (S7A) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0186] Moreover, the present invention is directed to antisense-oligonucleotide(s) consisting of 8 to 18, preferably 10 to 28 nucleotides and at least two of the 8 to 28, preferably 10 to 28 nucleotides are LNAs and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3' (Seq. ID No. 99), wherein

N.sup.13 represents: CCCAGCCTGCCCCAGAAGAGCTATTTG-, CCAGCCTGCCCCAGAAGAGCTATTTG-, CAGCCTGCCCCAGAAGAGCTATTTG-, AGCCTGCCCCAGAAGAGCTATTTG-, GCCTGCCCCAGAAGAGCTATTTG-, CCTGCCCCAGAAGAGCTATTTG-, CTGCCCCAGAAGAGCTATTTG-, TGCCCCAGAAGAGCTATTTG-, GCCCCAGAAGAGCTATTTG-, CCCCAGAAGAGCTATTTG-, CCCAGAAGAGCTATTTG-, CCAGAAGAGCTATTTG-, CAGAAGAGCTATTTG-, AGAAGAGCTATTTG-, GAAGAGCTATTTG-, AAGAGCTATTTG-, AGAGCTATTTG-, GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCGTCTTCAGGAATCTTCTC, -TAGGGAGCCGTCTTCAGGAATCTTCT, -TAGGGAGCCGTCTTCAGGAATCTTC, -TAGGGAGCCGTCTTCAGGAATCTT, -TAGGGAGCCGTCTTCAGGAATCT, -TAGGGAGCCGTCTTCAGGAATC, -TAGGGAGCCGTCTTCAGGAAT, -TAGGGAGCCGTCTTCAGGAA, -TAGGGAGCCGTCTTCAGGA, -TAGGGAGCCGTCTTCAGG, -TAGGGAGCCGTCTTCAG, -TAGGGAGCCGTCTTCA, -TAGGGAGCCGTCTTC, -TAGGGAGCCGTCTT, -TAGGGAGCCGTCT, -TAGGGAGCCGTC, -TAGGGAGCCGT, -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2; and salts and optical isomers of the antisense-oligonucleotide.

[0187] The antisense-oligonucleotides of formula S5 (Seq. ID No. 99) preferably comprise 2 to 10 LNA units, more preferably 3 to 9 LNA units and still more preferably 4 to 8 LNA units and also preferably at least 6 non-LNA units, more preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units. The non-LNA units are preferably DNA units. The LNA units are preferably positioned at the 3' terminal end (also named 3' terminus) and the 5' terminal end (also named 5' terminus). Preferably at least one and more preferably at least two LNA units are present at the 3' terminal end and/or at the 5' terminal end.

[0188] Thus, preferred are antisense-oligonucleotides of the present invention designed as GAPmers which contain 2 to 10 LNA units and which especially contain 1 to 5 LNA units at the 5' terminal end and 1 to 5 LNA units at the 3' terminal end of the antisense-oligonucleotide and between the LNA units at least 7 and more preferably at least 8 DNA units. More preferably the antisense-oligonucleotides comprise 2 to 4 LNA units at the 5' terminal end and 2 to 4 LNA units at the 3' terminal end and still more preferred comprise 3 to 4 LNA units at the 5' terminal end and 3 to 4 LNA units at the 3' terminal end and contain preferably at least 7 non-LNA units and most preferably at least 8 non-LNA units such as DNA units in between both LNA segments.

[0189] Moreover the antisense-oligonucleotides may contain common nucleobases such as adenine, guanine, cytosine, thymine and uracil as well as common derivatives thereof such as 5-methylcytosine or 2-aminoadenine. The antisense-oligonucleotides of the present invention may also contain modified internucleotide bridges such as phosphorothioate or phosphorodithioate instead of phosphate bridges. Such modifications may be present only in the LNA segments or only in the non-LNA segment of the antisense-oligonucleotide. As LNA units especially the residues b.sup.1 to b.sup.9 as disclosed herein are preferred.

[0190] Thus, preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00025 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: GCCTGCCCCAGAAGAGCTATTTG-, CCTGCCCCAGAAGAGCTATTTG-, CTGCCCCAGAAGAGCTATTTG-, TGCCCCAGAAGAGCTATTTG-, GCCCCAGAAGAGCTATTTG-, CCCCAGAAGAGCTATTTG-, CCCAGAAGAGCTATTTG-, CCAGAAGAGCTATTTG-, CAGAAGAGCTATTTG-, AGAAGAGCTATTTG-, GAAGAGCTATTTG-, AAGAGCTATTTG-, AGAGCTATTTG-, GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCGTCTTC, -TAGGGAGCCGTCTT, -TAGGGAGCCGTCT, -TAGGGAGCCGTC, -TAGGGAGCCGT, -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0191] Preferably the antisense-oligonucleotide of general formula (S5) has between 10 and 28 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0192] More preferably the antisense-oligonucleotide of general formula (S5) has between 11 and 24 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0193] Still more preferably the antisense-oligonucleotide of general formula (S5) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0194] Further preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00026 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: CCCCAGAAGAGCTATTTG-, CCCAGAAGAGCTATTTG-, CCAGAAGAGCTATTTG-, CAGAAGAGCTATTTG-, AGAAGAGCTATTTG-, GAAGAGCTATTTG-, AAGAGCTATTTG-, AGAGCTATTTG-, GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0195] Also preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00027 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: GAAGAGCTATTTG-, AAGAGCTATTTG-, AGAGCTATTTG-, GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TUG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0196] Also preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00028 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: CAGAAGAGCTATTTG-, AGAAGAGCTATTTG-, GAAGAGCTATTTG-, AAGAGCTATTTG-, AGAGCTATTTG-, GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCGTCTTCAGGAATCT, -TAGGGAGCCGTCTTCAGGAATC, -TAGGGAGCCGTCTTCAGGAAT, -TAGGGAGCCGTCTTCAGGAA, -TAGGGAGCCGTCTTCAGGA, -TAGGGAGCCGTCTTCAGG, -TAGGGAGCCGTCTTCAG, -TAGGGAGCCGTCTTCA, -TAGGGAGCCGTCTTC, -TAGGGAGCCGTCTT, -TAGGGAGCCGTCT, -TAGGGAGCCGTC, -TAGGGAGCCGT, -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0197] Also preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00029 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: GAGCTATTTG-, AGCTATTTG-, GCTATTTG-, CTATTTG-, TATTTG-, ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCGTCTTCAGG, -TAGGGAGCCGTCTTCAG, -TAGGGAGCCGTCTTCA, -TAGGGAGCCGTCTTC, -TAGGGAGCCGTCTT, -TAGGGAGCCGTCT, -TAGGGAGCCGTC, -TAGGGAGCCGT, -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0198] Also preferred are antisense-oligonucleotides of the formula (S5):

TABLE-US-00030 5'-(N.sup.13).sub.m-GTAGTGTT-(N.sup.14).sub.n-3'

wherein N.sup.13 represents: ATTTG-, TTTG-, TTG-, TG-, or G-; and N.sup.14 is selected from: -TAGGGAGCCGTCT, -TAGGGAGCCGTC, -TAGGGAGCCGT, -TAGGGAGCCG, -TAGGGAGCC, -TAGGGAGC, -TAGGGAG, -TAGGGA, -TAGGG, -TAGG, -TAG, -TA, or -T; and m represents 0 or 1; n represents 0 or 1; and n+m=1 or 2.

[0199] Preferably the antisense-oligonucleotide of general formula (S5/Seq. ID No. 99) has between 12 and 24 nucleotides and at least one LNA nucleotide at the 3' terminus and at least one LNA nucleotide at the 5' terminus. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable.

[0200] More preferably the antisense-oligonucleotide of general formula (S5) has between 12 and 22 nucleotides and at least two LNA nucleotides at the 3' terminus and at least two LNA nucleotides at the 5' terminus.

[0201] Still more preferably the antisense-oligonucleotide of general formula (S5) has between 12 and 20, more preferably between 13 and 19 and still more preferable between 14 and 18 nucleotides and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end. Preferably the antisense-oligonucleotides are GAPmers of the form LNA segment A-DNA segment-LNA segment B. Preferably the antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases".

[0202] Another aspect of the present invention relates to antisense-oligonucleotide(s) having a length of 10 to 28 nucleotides, preferably 10 to 24 nucleotides, more preferably 11 to 22 nucleotides or 12 to 20 nucleotides, still more preferably 13 to 19 nucleotides, and most preferably 14 to 18 nucleotides, wherein at least two of the nucleotides, preferably at least three of the nucleotides, and more preferably at least four of the nucleotides are LNAs and the sequence of the antisense-oligonucleotide of the 10 to 28 nucleotides, preferably 10 to 24 nucleotides, more preferably 11 to 22 nucleotides or 12 to 20 nucleotides, still more preferably 13 to 19 nucleotides, and most preferably 14 to 18 nucleotides is selected from the group of sequences of 10 to 28 nucleotides, preferably 10 to 24 nucleotides, more preferably 11 to 22 nucleotides or 12 to 20 nucleotides, still more preferably 13 to 19 nucleotides, and most preferably 14 to 18 nucleotides contained in a sequence selected from the following group:

TABLE-US-00031 (Seq. ID No. 75: 383-423 of Seq. ID No. 1) GAATCTTGAATATCTCATGAATGGACCAGTATTCTAGAAAC, (Seq. ID No. 77: 2245-2285 of Seq. ID No. 1) TTCATATTTATATACAGGCATTAATAAAGTGCAAATGTTAT, (Seq. ID No. 78: 2315-2356 of Seq. ID No. 1) TGAGGAAGTGCTAACACAGCTTATCCTATGACAATGTCAAAG, (Seq. ID No. 79: 2528-2576 of Seq. ID No. 1) GCCTGCCCCAGAAGAGCTATTTGGTAGTGTTTAGGGAGCCGTCTTCAGG, (Seq. ID No. 81: 3205-3253 of Seq. ID No. 1) CGCAGGTCCTCCCAGCTGATGACATGCCGCGTCAGGTACTCCTGTAGGT, (Seq. ID No. 83: 4141-4218 of Seq. ID No. 1) ATGTCGTTATTAACCGACTTCTGAACGTGCGGTGGGATCGTGCTGGCGAT ACGCGTCCACAGGACGATGTGCAGCGGC, (Seq. ID No. 84: 4216-4289 of Seq. ID No. 1) GGCCACAGGCCCCTGAGCAGCCCCCGACCCATGGCAGACCCCGCTGCTCG TCATAGACCGAGCCCCCAGCGCAG, (Seq. ID No. 86: 4141-4289 of Seq. ID No. 1) ATGTCGTTATTAACCGACTTCTGAACGTGCGGTGGGATCGTGCTGGCGAT ACGCGTCCACAGGACGATGTGCAGCGGCCACAGGCCCCTGAGCAGCCCCC GACCCATGGCAGACCCCGCTGCTCGTCATAGACCGAGCCCCCAGCGCAG, (Seq. ID No. 87: 388-418 of Seq. ID No. 1) TTGAATATCTCATGAATGGACCAGTATTCTA, (Seq. ID No. 88: 483-515 of Seq. ID No. 1) CAAGTGGAATTTCTAGGCGCCTCTATGCTACTG, (Seq. ID No. 89: 2250-2280 of Seq. ID No. 1) ATTTATATACAGGCATTAATAAAGTGCAAAT, (Seq. ID No. 90: 2320-2351 of Seq. ID No. 1) AAGTGCTAACACAGCTTATCCTATGACAATGT, (Seq. ID No. 91: 2533-2571 of Seq. ID No. 1) CCCCAGAAGAGCTATTTGGTAGTGTTTAGGGAGCCGTCT, (Seq. ID No. 92: 2753-2830 of Seq. ID No. 1) CTGGTCGCCCTCGATCTCTCAACACGTTGTCCTTCATGCTTTCGACACAG GGGTGCTCCCGCACCTTGGAACCAAATG, (Seq. ID No. 93: 3210-3248 of Seq. ID No. 1) GTCCTCCCAGCTGATGACATGCCGCGTCAGGTACTCCTG, (Seq. ID No. 94: 3655-3694 of Seq. ID No. 1) CTCAGCTTCTGCTGCCGGTTAACGCGGTAGCAGTAGAAGA, (Seq. ID No. 95: 4146-4213 of Seq. ID No. 1) GTTATTAACCGACTTCTGAACGTGCGGTGGGATCGTGCTGGCGATACGCG TCCACAGGACGATGTGCA, (Seq. ID No. 96: 4221-4284 of Seq. ID No. 1) CAGGCCCCTGAGCAGCCCCCGACCCATGGCAGACCCCGCTGCTCGTCATA GACCGAGCCCCCAG, (Seq. ID No. 97: 4495-4546 of Seq. ID No. 1) CACGCGCGGGGGTGTCGTCGCTCCGTGCGCGCGAGTGACTCACTCAACTT CA,

wherein the antisense-oligonucleotide is capable of selectively hybridizing in regard to the whole human transcriptome only with the gene encoding TGF-R.sub.II or with the mRNA encoding TGF-R.sub.II and salts and optical isomers of said antisense-oligonucleotide.

[0203] Said antisense-oligonucleotide having a sequence contained in the sequences No. 75, 77, 78, 79, 81, 83, 84, 86-97 have between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 3' terminal end and between 2 and 5, preferably 3 and 5 and more preferably between 3 and 4 LNA units at the 5' terminal end and have preferably the structure of GAPmers of the form LNA segment A-DNA segment-LNA segment B. As LNA nucleotides (LNA units) especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably in the chapter "Preferred LNAs" are suitable and as internucleotides bridges especially these disclosed in the chapter "Internucleotide Linkages (IL)" are suitable. Preferably said antisense-oligonucleotides contain at least 6, more preferably at least 7 and most preferably at least 8 non-LNA units such as DNA units in between the two LNA segments. Suitable nucleobases for the non-LNA units and the LNA units are disclosed in the chapter "Nucleobases". Suitable examples for said antisense-oligonucleotides are represented by the formulae (S1) to (S7), (S1A) to (S4A), (S6A) and (S7A).

[0204] The Seq. ID No. 1 represents the antisense strand of the cDNA (cDNA) (5'-3' antisense-sequence) of the Homo sapiens transforming growth factor, beta receptor II (TGF-R.sub.II), transcript variant 2.

[0205] The Seq. ID No. 2 represents the sense strand of the cDNA (5'-3' sense-sequence) of the Homo sapiens transforming growth factor, beta receptor II (70/80 kDa) (TGF-R.sub.II), transcript variant 2. Alternatively, one can also regard the sequence of Seq. ID No. 2 to represent the sequence of the mRNA of the Homo sapiens transforming growth factor, beta receptor II (TGF-R.sub.II), transcript variant 2 (Seq. ID No. 3), but written in the DNA code, i.e. represented in G, C, A, T code, and not in the RNA code.

[0206] The Seq. ID No. 3 represents the mRNA (5'-3' sense-sequence) of the Homo sapiens transforming growth factor, beta receptor II (TGF-R.sub.II), transcript variant 2. It is evident that the mRNA displayed in Seq. ID No. 3 is written in the RNA code, i.e. represented in G, C, A, U code.

[0207] It shall be understood, that "coding DNA strand", as used herein, refers to the DNA strand that is identical to the mRNA (except that is written in the DNA code) and that encompasses the codons that used for protein translation. It is not used as template for the transcription into mRNA. Thus, the terms "coding DNA strand", "sense DNA strand" and "non-template DNA strand" can be used interchangeably. Furthermore, "non-coding DNA strand", as used herein, refers to the DNA strand that is complementary to the "coding DNA strand" and serves as a template for the transcription of mRNA. Thus, the terms "non-coding DNA strand", "antisense DNA strand" and "template DNA strand" can be used interchangeably

[0208] The term "antisense-oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics or variants thereof such as antisense-oligonucleotides having a modified internucleotide linkage like a phosphorothioate linkage and/or one or more modified nucleobases such as 5-methylcytosine and/or one or more modified nucleotide units such as LNAs like .beta.-D-oxy-LNA. The term "antisense-oligonucleotide" includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleotide (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms, because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. The antisense-oligonucleotides are short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and inhibit its expression.

[0209] The term "nucleoside" is well known to a skilled person and refers to a pentose sugar moiety like ribose, desoxyribose or a modified or locked ribose or a modified or locked desoxyribose like the LNAs which are below disclosed in detail. A nucleobase is linked to the glycosidic carbon atom (position 1' of the pentose) and an internucleotide linkage is formed between the 3' oxygen or sulfur atom and preferably the 3' oxygen atom of a nucleoside and the 5' oxygen or sulfur atom and preferably the 5' oxygen atom of the adjacent nucleoside, while the internucleotide linkage does not belong to the nucleoside (see FIG. 2).

[0210] The term "nucleotide" is well known to a skilled person and refers to a pentose sugar moiety like ribose, desoxyribose or a modified or locked ribose or a modified or locked desoxyribose like the LNAs which are below disclosed in detail. A nucleobase is linked to the glycosidic carbon atom (position 1' of the pentose) and an internucleotide linkage is formed between the 3' oxygen or sulfur atom and preferably the 3' oxygen atom of a nucleotide and the 5' oxygen or sulfur atom and preferably the 5' oxygen atom of the adjacent nucleotide, while the internucleotide linkage is a part of the nucleotide (see FIG. 2).

Nucleobases

[0211] The term "nucleobase" is herein abbreviated with "B" and refers to the five standard nucleotide bases adenine (A), thymine (T), guanine (G), cytosine (C), and uracil (U) as well as to modifications or analogues thereof or analogues with ability to form Watson-Crick base pair with bases in the complimentary strand. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (C*), 5-hydroxymethyl cytosine, N.sup.4-methylcytosine, xanthine, hypoxanthine, 7-deazaxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 6-ethyladenine, 6-ethylguanine, 2-propyladenine, 2-propylguanine, 6-carboxyuracil, 5-halouracil, 5,6-dihydrouracil, 5-halocytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-aza uracil, 6-aza cytosine, 6-aza thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-fluoroadenine, 8-chloroadenine, 8-bromoadenine, 8-iodoadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-fluoroguanine, 8-chloroguanine, 8-bromoguanine, 8-iodoguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-trifluoromethyluracil, 5-fluorocytosine, 5-bromocytosine, 5-chlorocytosine, 5-iodocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 3-deazaguanine, 3-deazaadenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine etc., with 5-methylcytosine and/or 2-aminoadenine substitutions being preferred since these modifications have been shown to increase nucleic acid duplex stability.

[0212] Preferred antisense-oligonucleotides of the present invention can comprise analogues of nucleobases. The nucleobase of only one nucleotide unit of the antisense-oligonucleotide could be replaced by an analogue of a nucleobase or two, three, four, five or even all nucleobases in an antisense-oligonucleotide could be replaced by analogues of nucleobases, such as 5-methylcytosine, or N.sup.6-methyl-adenine or 2-aminoadenine. Preferably the LNA units might be connected to analogues of nucleobases such as 5-methylcytosine.

[0213] It will be recognized that when referring to a sequence of nucleotides or monomers, what is referred to, is the sequence of bases, such as A, T, G, C or U. However, except the specific examples disclosed in Tables 3 to 8 the representation of the antisense-oligonucleotides by the letter code A, T, G, C and U has to be understood that said antisense-oligonucleotide may contain any the nucleobases as disclosed herein, any of the 3' end groups as disclosed herein, any of the 5' end groups as disclosed herein, and any of the internucleotide linkages (also referred to as internucleotide bridges) as disclosed herein. The nucleotides A, T, G, C and U have also to be understood as being LNA nucleotides or non-LNA nucleotides such as preferably DNA nucleotides. Only in regard to the specific examples as disclosed in Tables 4 to 9 the nucleobases, the LNA units, the non-LNA units, the internucleotide linkages and the end groups are further specified as outlined in the chapter "Legend" before Table 2.

[0214] The antisense-oligonucleotides as well as the salts of the antisense-oligonucleotides as disclosed herein have been proven to be complementary to the target which is the gene encoding for the TGF-R.sub.II or the mRNA encoding the TGF-R.sub.II, i.e., hybridize sufficiently well and with sufficient specificity and especially selectivity to give the desired inhibitory effect.

[0215] The term "salt" refers to physiologically and/or pharmaceutically acceptable salts of the antisense-oligonucleotides of the present invention. The antisense-oligonucleotides contain nucleobases like adenine, guanine, thymine, cytosine or derivatives thereof which are basic and which form a salt like a chloride or mesylate salt. The internucleotide linkage preferably contains a negatively charged oxygen or sulfur atom which form salts like the sodium, lithium or potassium salt. Thus, pharmaceutically acceptable base addition salts are formed with inorganic bases or organic bases. Examples for suitable organic and inorganic bases are bases derived from metal ions, e.g., aluminum, alkali metal ions, such as sodium or potassium, alkaline earth metal ions such as calcium or magnesium, or an amine salt ion or alkali- or alkaline-earth hydroxides, -carbonates or -bicarbonates. Examples include aqueous LiOH, NaOH, KOH, NH.sub.4OH, potassium carbonate, ammonia and sodium bicarbonate, ammonium salts, primary, secondary and tertiary amines, such as, e.g., tetraalkylammonium hydroxide, lower alkylamines such as methylamine, t-butylamine, procaine, ethanolamine, arylalkylamines such as dibenzylamine and N,N-dibenzylethylenediamine, lower alkylpiperidines such as N-ethylpiperidine, cycloalkylamines such as cyclohexylamine or dicyclohexylamine, morpholine, glucamine, N-methyl- and N,N-dimethylglucamine, 1-adamantylamine, benzathine, or salts derived from amino acids like arginine, lysine, ornithine or amides of originally neutral or acidic amino acids, chloroprocaine, choline, procaine or the like.

[0216] Since the antisense-oligonucleotides are basic, they form pharmaceutically acceptable salts with organic and inorganic acids. Examples of suitable acids for such acid addition salt formation are hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, acetic acid, citric acid, oxalic acid, malonic acid, salicylic acid, p-aminosalicylic acid, malic acid, fumaric acid, succinic acid, ascorbic acid, maleic acid, sulfonic acid, phosphonic acid, perchloric acid, nitric acid, formic acid, propionic acid, gluconic acid, lactic acid, tartaric acid, hydroxymaleic acid, pyruvic acid, phenylacetic acid, benzoic acid, p-aminobenzoic acid, p-hydroxybenzoic acid, methanesulfonic acid, ethanesulfonic acid, nitrous acid, hydroxyethanesulfonic acid, ethylenesulfonic acid, p-toluenesulfonic acid, naphthylsulfonic acid, sulfanilic acid, camphersulfonic acid, china acid, mandelic acid, o-methylmandelic acid, hydrogen-benzenesulfonic acid, picric acid, adipic acid, D-o-tolyltartaric acid, tartronic acid, -toluic acid, (o, m, p)-toluic acid, naphthylamine sulfonic acid, and other mineral or carboxylic acids well known to those skilled in the art. The salts are prepared by contacting the free base form with a sufficient amount of the desired acid to produce a salt in the conventional manner.

[0217] In the context of this invention, "hybridization" means nucleic acid hybridization, wherein a single-stranded nucleic acid (DNA or RNA) interacts with another single-stranded nucleic acid having a very similar or even complementary sequence. Thereby the interaction takes place by hydrogen bonds between specific nucleobases (base pairing).

[0218] As used herein, the term "complementarity" (DNA and RNA base pair complementarity) refers to the capacity for precise pairing between two nucleic acids. The nucleotides in a base pair are complementary when their shape allows them to bond together by hydrogen bonds. Thereby forms the pair of adenine and thymidine (or uracil) two hydrogen bonds and the cytosine-guanine pair forms three hydrogen bonds. "Complementary sequences" as used herein means DNA or RNA sequences, being such that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary, much like looking in the mirror and seeing the reverse of things.

[0219] The term "specifically hybridizable" as used herein indicates a sufficient degree of complementarity or precise base pairing of the antisense-oligonucleotide to the target sequence such that stable and specific binding occurs between the antisense-oligonucleotide and the DNA or RNA target. The sequence of an oligonucleotide according to the invention does not need to be 100% complementary to that of its target nucleic acid to be specifically hybridizable, although a 100% complementarity is preferred. Thereby "100% complementarity" means that the antisense-oligonucleotide hybridizes with the target over its complete or full length without mismatch. In other words, within the present invention it is defined that an antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule takes place under physiological or pathological conditions but non-specific binding of the antisense-oligonucleotide to non-target sequences is highly unlikely or even impossible.

[0220] Therefore, the present invention refers preferably to antisense oligonucleotides, wherein the antisense oligonucleotides bind with 100% complementarity to the mRNA encoding TGF RII and do not bind to any other region in the complete human transcriptome. Further preferred the present invention refers to antisense oligonucleotides, wherein the antisense oligonucleotides have 100% complementarity over their complete length to the mRNA encoding TGF RII and have no off-target effects. Alternatively, the present invention refers preferably to antisense oligonucleotides having 100% complementarity to the mRNA encoding TGF RII but no complementarity to another mRNA of the human transcriptome. Thereby the term "human transcriptome" refers to the total set of transcripts in the human organism, which means transcripts of all cell types and environmental conditions (at any given time).

Specificity

[0221] The antisense-oligonucleotides of the present invention have in common that they are specific in regard to the region where they bind to the gene or to the mRNA encoding TGF-R.sub.II. According to the present invention it is preferred that within the human transcriptome, the antisense-oligonucleotides have 100% complementarity over their full length only with the mRNA encoding TGF-RII. In addition, it was a goal of the present invention to find antisense-oligonucleotides without cross-reactivity within to the transcriptome of mammalian other than monkeys; in particular, the antisense-oligonucleotides have only cross-reactivity with the transcriptome of great apes. This should avoid off-effects. Thus the antisense-oligonucleotides of the present invention are highly specific concerning hybridization with the gene or with the mRNA encoding TGF-RII. The antisense-oligonucleotides of the invention bind preferably over their complete length with 100% complementarity specific to the gene encoding TGF-RII or to the mRNA encoding TGF-RII and do not bind to any other region in the complete human transcriptome. This means, the antisense-oligonucleotides of the present invention hybridize with the target (TGF-RII mRNA) without mismatch.

[0222] The term "mRNA", as used herein, may encompass both mRNA containing introns (also referred to as Pre-mRNA) as well as mRNA which does not contain any introns.

[0223] The antisense-oligonucleotides of the present invention are able to bind or hybridize with the Pre-mRNA and/or with the mRNA. That means the antisense-oligonucleotides can bind to or hybridize at an intron region or within an intron region of the Pre-mRNA or can bind to or hybridize at an overlapping intron exon region of the Pre-mRNA or can bind to or hybridize at an exon region or within an exon region of the Pre-mRNA and the exon region of the mRNA (see FIG. 1). Preferred are antisense-oligonucleotides which are able to bind to or hybridize with Pre-mRNA and mRNA. Binding or hybridization of the antisense-oligonucleotides (ASO) to the Pre-mRNA inhibits the 5' cap formation, inhibits splicing of the Pre-mRNA in order to obtain the mRNA and activates RNase H which cleaves the Pre-mRNA. Binding or hybridization of the antisense-oligonucleotides (ASO) to the mRNA activates RNase H which cleaves the mRNA and inhibits binding of the ribosomal subunits.

[0224] The antisense-oligonucleotides of the present invention consist of at least 10 and no more than 28, preferably no more than 24 and more preferably no more than 20 nucleotides and consequently consist of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, preferably of 11 to 20, or 11 to 19, or 12 to 19, or 13 to 19, or 13 to 18 nucleotides and more preferably of 14 to 18 nucleotides, wherein at least two, preferably three of these nucleotides are locked nucleic acid (LNA). Shorter antisense-oligonucleotides, i.e. antisense-oligonucleotides having less than 10 nucleotides, are also possible but the shorter the antisense-oligonucleotides the higher the risk that the hybridization is not sufficiently strong anymore and that selectivity will decrease or will get lost. Non-selective antisense-oligonucleotides bear the risk to bind to undesired regions in the human transcriptome and to undesired mRNAs coding for other proteins than TGF-R.sub.II thereby causing undesired side effects. Longer antisense-oligonucleotides having more than 20 nucleotides are also possible but further increasing the length make the synthesis of such antisense-oligonucleotides even more complicated and expensive without any further benefit in increasing selectivity or strength of hybridization or better stability in regard to degradation.

[0225] Thus the present invention is directed to antisense-oligonucleotides consisting of 10 to 20 nucleotides, wherein at least two nucleotides and preferably the 3' and 5' terminal nucleotides are LNAs. Thus, it is preferred that at least the terminal 3' nucleotide is an LNA and also at least the 5' terminal nucleotide is an LNA. In case more than 2 LNAs are present, it is preferred that the further LNAs are linked to the 3' or 5' terminal LNA like it is the case in gapmers as disclosed herein.

[0226] One nucleotide building block present in an antisense-oligonucleotide of the present invention can be represented by the following general formula (B1) and (B2):

##STR00001##

wherein B represents a nucleobase; IL' represents --X''--P(.dbd.X')(X.sup.-)--; R represents --H, --F, --OH, --NH.sub.2, --OCH.sub.3, --OCH.sub.2CH.sub.2OCH.sub.3 and R.sup.# represents --H; or R and R.sup.# form together the bridge --R.sup.#--R-- which is selected from --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--NH--, --CH.sub.2--N(CH.sub.3)--, --CH.sub.2--N(C.sub.2H.sub.5)--, --CH.sub.2--CH.sub.2--O--, --CH.sub.2--CH.sub.2--S--, --CH.sub.2--CH.sub.2--NH--, --CH.sub.2--CH.sub.2--N(CH.sub.3)--, or --CH.sub.2--CH.sub.2--N(C.sub.2H.sub.5)--; X' represents .dbd.O or .dbd.S; X.sup.- represents --O.sup.-, --OH, --OR.sup.H, --NHR.sup.H, --N(R.sup.H).sub.2, --OCH.sub.2CH.sub.2OR.sup.H, --OCH.sub.2CH.sub.2SR.sup.H, --BH.sub.3.sup.-, --R.sup.H, --SH, --SR.sup.H, or --S.sup.-; X'' represents --O--, --NH--, --NR.sup.H--, --CH.sub.2--, or --S--; Y is --O--, --NH--, --NR.sup.H--, --CH.sub.2-- or --S--; R.sup.H is selected from hydrogen and C.sub.1-4-alkyl and preferably --CH.sub.3 or --C.sub.2H.sub.5 and most preferably --CH.sub.3.

[0227] Preferably X.sup.- represents --O.sup.-, --OH, --OCH.sub.3, --NH(CH.sub.3), --N(CH.sub.3).sub.2, --OCH.sub.2CH.sub.2OCH.sub.3, --OCH.sub.2CH.sub.2SCH.sub.3, --BH.sub.3.sup.-, --CH.sub.3, --SH, --SCH.sub.3, or --S.sup.-; and more preferably --O.sup.-, --OH, --OCH.sub.3, --N(CH.sub.3).sub.2, --OCH.sub.2CH.sub.2OCH.sub.3, --BH.sub.3.sup.-, --SH, --SCH.sub.3, or --S.sup.-.

IL' represents preferably --O--P(O)(O.sup.-)--, --O--P(O)(S.sup.-)--, --O--P(S)(S.sup.-)--, --S--P(O)(O.sup.-)--, --S--P(O)(S.sup.-)--, --S--P(S)(S.sup.-)--, --O--P(O)(O.sup.-)--, --O--P(O)(S.sup.-)--, --S--P(O)(O.sup.-)--, --O--P(O)(R.sup.H)--, --O--P(O)(OR.sup.H)--, --O--P(O)(NHR.sup.H)--, --O--P(O)[N(R.sup.H).sub.2]--, --O--P(O)(BH.sub.3.sup.-)--, --O--P(O)(OCH.sub.2CH.sub.2OR.sup.H)--, --O--P(O)(OCH.sub.2CH.sub.2SR.sup.H)--, --P(O)(O.sup.-), --NR.sup.H--P(O)(O.sup.-)--, wherein R.sup.H is selected from hydrogen and C.sub.1-4-alkyl.

[0228] The group --O--P(O)(R.sup.H)--O-- is preferably --O--P(O)(CH.sub.3)--O-- or --O--P(O)(C.sub.2H.sub.5)--O-- and most preferably --O--P(O)(CH.sub.3)--O--.

[0229] The group --O--P(O)(OR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.3)--O-- or --O--P(O)(OC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.3)--O--.

[0230] The group --O--P(O)(NHR.sup.H)--O-- is preferably --O--P(O)(NHCH.sub.3)--O-- or --O--P(O)(NHC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(NHCH.sub.3)--O--.

[0231] The group --O--P(O)[N(R.sup.H).sub.2]--O-- is preferably --O--P(O)[N(CH.sub.3).sub.2]--O-- or --O--P(O)[N(C.sub.2H.sub.5).sub.2]--O-- and most preferably --O--P(O)[N(CH.sub.3).sub.2]--O--.

[0232] The group --O--P(O)(OCH.sub.2CH.sub.2OR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O-- or --O--P(O)(OCH.sub.2CH.sub.2OC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--.

[0233] The group --O--P(O)(OCH.sub.2CH.sub.2SR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O-- or --O--P(O)(OCH.sub.2CH.sub.2SC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--.

[0234] The group --O--P(O)(O.sup.-)--NR.sup.H-- is preferably --O--P(O)(O.sup.-)--NH-- or --O--P(O)(O.sup.-)--N(CH.sub.3)-- and most preferably --O--P(O)(O.sup.-)--NH--.

[0235] The group --NR.sup.H--P(O)(O.sup.-)--O-- is preferably --NH--P(O)(O.sup.-)--O-- or --N(CH.sub.3)--P(O)(O.sup.-)--O-- and most preferably --NH--P(O)(O.sup.-)--O--.

[0236] Even more preferably IL' represents --O--P(O)(O.sup.-)--, --O--P(O)(S.sup.-)--, --O--P(S)(S.sup.-)--, --O--P(O)(NHR.sup.H)--, or --O--P(O)[N(R.sup.H).sub.2]--, and still more preferably IL' represents --O--P(O)(O.sup.-)--, --O--P(O)(S.sup.-)--, or --O--P(S)(S.sup.-)--, and most preferably IL' represents --O--P(O)(S.sup.-)--, or --O--P(S)(S.sup.-)--.

[0237] Preferably Y represents --O--.

[0238] Preferably B represents a standard nucleobase selected from A, T, G, C, U.

[0239] Preferably IL represents --O--P(.dbd.O)(S.sup.-)-- or --O--P(.dbd.S)(S.sup.-)--.

[0240] The above definitions of B, Y and IL' apply also to the formula b.sup.1 to b.sup.9.

[0241] Thus the following general formula (B3) to (B6) are preferred:

##STR00002##

wherein B represents a nucleobase and preferably A, T, G, C, U; R represents --H, --F, --OH, --NH.sub.2, --N(CH.sub.3).sub.2, --OCH.sub.3, --OCH.sub.2CH.sub.2OCH.sub.3, --OCH.sub.2CH.sub.2CH.sub.2OH, --OCH.sub.2CH.sub.2CH.sub.2NH.sub.2 and preferably --H; R* represents the moiety --R.sup.#--R-- as defined below and is, for instance, preferably selected from --C(R.sup.aR.sup.b)--O--, --C(R.sup.aR.sup.b)--NR.sup.c--, --C(R.sup.aR.sup.b)--S--, and --C(R.sup.aR.sup.b)--C(R.sup.aR.sup.b)--O--, wherein the substituents R.sup.a, R.sup.b and R.sup.c have the meanings as defined herein. More preferably R* is selected from --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--NH--, --CH.sub.2--N(CH.sub.3)--, --CH.sub.2--CH.sub.2--O--, or --CH.sub.2--CH.sub.2--S--, and more preferably --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--CH.sub.2--O--, or --CH.sub.2--CH.sub.2--S--, and still more preferably --CH.sub.2--O--, --CH.sub.2--S--, or --CH.sub.2--CH.sub.2--O--, and still more preferably --CH.sub.2--O-- or --CH.sub.2--S--, and most preferably --CH.sub.2--O--.

[0242] Examples of preferred nucleotides which are non-LNA units are the following:

##STR00003## ##STR00004##

Internucleotide Linkages (IL)

[0243] The monomers of the antisense-oligonucleotides described herein are coupled together via an internucleotide linkage. Suitably, each monomer is linked to the 3' adjacent monomer via an internucleotide linkage. The person having ordinary skill in the art would understand that, in the context of the present invention, the 5' monomer at the end of an oligomer does not comprise a 5' internucleotide linkage, although it may or may not comprise a 5' terminal group. The term "internucleotide linkage" is intended to mean a group capable of covalently coupling together two nucleotides, two nucleotide analogues like two LNAs, and a nucleotide and a nucleotide analogue like an LNA. Specific and preferred examples include phosphate groups and phosphorothioate groups.

[0244] The nucleotides of the antisense-oligonucleotides of the present invention or contiguous nucleotide sequences thereof are coupled together via internucleotide linkages. Suitably each nucleotide is linked through the 5' position to the 3' adjacent nucleotide via an internucleotide linkage.

[0245] The antisense-oligonucleotides can be modified by several different ways. Modifications within the backbone are possible and refer to antisense-oligonucleotides wherein the phosphate groups (also named phosphodiester groups) in their internucleotide backbone are partially or completely replaced by other groups. Preferred modified antisense-oligonucleotide backbones include, for instance, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriester, aminoalkylphosphotriesters, methyl, ethyl and C.sub.3-C.sub.10-alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleotide units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acids forms thereof are also included and disclosed herein in further detail.

[0246] Suitable internucleotide linkages include those listed within WO2007/031091, for example the internucleotide linkages listed on the first paragraph of page 34 of WO2007/031091 (hereby incorporated by reference). It is, in some embodiments, preferred to modify the internucleotide linkage from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate or boranophosphate--these two, accepted by RNase H mediated cleavage, also allow that route of antisense inhibition in reducing the expression of the target gene.

[0247] The internucleotide linkage consists of the group IL' which is the group bound to the 3' carbon atom of the ribose moiety and the group Y which is the group bound to the 5' carbon atom of the contiguous ribose moiety as shown in the formula (IL'Y) below

##STR00005##

[0248] The internucleotide linkage IL is represented by --IL'-Y--. IL' represents --X''--P(.dbd.X')(X.sup.-)-- so that IL is represented by --X''--P(.dbd.X')(X.sup.-)--Y--, wherein the substituents X.sup.-, X', X'' and Y have the meanings as disclosed herein.

[0249] The internucleotide linkage IL=--X''--P(.dbd.X')(X.sup.-)--Y-- is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --S--P(S)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(R.sup.H)--O--, --O--P(O)(OR.sup.H)--O--, --O--P(O)(NHR.sup.H)--O--, --O--P(O)[N(R.sup.H).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OR.sup.H)--O--, --O--P(O)(OCH.sub.2CH.sub.2SR.sup.H)--, --O--P(O)(O.sup.-)--NR.sup.H--, --NR.sup.HP(O)(O.sup.-)--O--, where R.sup.H is selected from hydrogen and C1-4-alkyl.

[0250] The group --O--P(O)(R.sup.H)--O-- is preferably --O--P(O)(CH.sub.3)--O-- or --O--P(O)(C.sub.2H.sub.5)--O-- and most preferably --O--P(O)(CH.sub.3)--O--.

[0251] The group --O--P(O)(OR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.3)--O-- or --O--P(O)(OC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.3)--O--.

[0252] The group --O--P(O)(NHR.sup.H)--O-- is preferably --O--P(O)(NHCH.sub.3)--O-- or --O--P(O)(NHC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(NHCH.sub.3)--O--.

[0253] The group --O--P(O)[N(R.sup.H).sub.2]--O-- is preferably --O--P(O)[N(CH.sub.3).sub.2]--O-- or --O--P(O)[N(C.sub.2H.sub.5).sub.2]--O-- and most preferably --O--P(O)[N(CH.sub.3).sub.2]--O--.

[0254] The group --O--P(O)(OCH.sub.2CH.sub.2OR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O-- or --O--P(O)(OCH.sub.2CH.sub.2OC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--.

[0255] The group --O--P(O)(OCH.sub.2CH.sub.2SR.sup.H)--O-- is preferably --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O-- or --O--P(O)(OCH.sub.2CH.sub.2SC.sub.2H.sub.5)--O-- and most preferably --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--.

[0256] The group --O--P(O)(O.sup.-)--NR.sup.H-- is preferably --O--P(O)(O.sup.-)--NH-- or --O--P(O)(O.sup.-)--N(CH.sub.3)-- and most preferably --O--P(O)(O.sup.-)--NH--.

[0257] The group --NR.sup.H--P(O)(O.sup.-)--O-- is preferably --NH--P(O)(O.sup.-)--O-- or --N(CH.sub.3)--P(O)(O.sup.-)--O-- and most preferably --NH--P(O)(O.sup.-)--O--.

[0258] Even more preferably IL represents --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --O--P(O)(NHR.sup.H)--O--, or --O--P(O)[N(R.sup.H).sub.2]--O--, and still more preferably IL represents --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, or --O--P(S)(S.sup.-)--O--, and most preferably IL represents --O--P(O)(S.sup.-)--O--, or --O--P(O)(O.sup.-)--O--.

[0259] Thus IL is preferably a phosphate group (--O--P(O)(O.sup.-)--O--), a phosphorothioate group (--O--P(O)(S.sup.-)--O--) or a phosphorodithioate group (--O--P(S)(S.sup.-)--O--).

[0260] The nucleotide units or the nucleosides of the antisense-oligonucleotides are connected to each other by internucleotide linkages so that within one antisense-oligonucleotide different internucleotide linkages can be present. The LNA units are preferably linked by internucleotide linkages which are not phosphate groups. The LNA units are linked to each other by a group IL which is preferably selected from --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --O--P(O)(NHR.sup.H)--O--, and --O--P(O)[N(R.sup.H).sub.2]--O-- and more preferably from --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O--.

[0261] The non-LNA units are linked to each other by a group IL which is preferably selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --O--P(O)(NHR.sup.H)--O--, and --O--P(O)[N(R.sup.H).sub.2]--O-- and more preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O--.

[0262] A non-LNA unit is linked to an LNA unit by a group IL which is preferably selected from --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --O--P(O)(NHR.sup.H)--O--, and --O--P(O)[N(R.sup.H).sub.2]--O-- and more preferably from --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O--.

[0263] The term "LNA unit" as used herein refers to a nucleotide which is locked, i.e. to a nucleotide which has a bicyclic structure and especially a bicyclic ribose structure and more especially a bicyclic ribose structure as shown in general formula (II). The bridge "locks" the ribose in the 3'-endo (North) conformation. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. Alternatively used terms for LNA are bicyclic nucleotides or bridged nucleotides, thus, an alternative term for LNA unit is bicyclic nucleotide unit or bridged nucleotide unit.

[0264] The term "non-LNA unit" as used herein refers to a nucleotide which is not locked, i.e. to a nucleotide which has no bicyclic sugar moiety and especially no bicyclic ribose structure and more especially no bicyclic ribose structure as shown in general formula (II). The non-LNA units are most preferably DNA units.

[0265] The term "DNA unit" as used herein refers to a nucleotide containing a 2-deoxyribose as sugar. Thus, the nucleotide is made of a nucleobase and a 2-deoxyribose.

[0266] The term "unit" as used herein refers to a part or a fragment or a moiety of an antisense-oligonucleotide of the present invention. Thus a "unit" is not a complete molecule, it is a part or a fragment or a moiety of an antisense-oligonucleotide which has at least one position for a covalent linkage to another part or fragment or moiety of the antisense-oligonucleotide. For example, the general structures (B1) to (B6) are units, because they can be covalently linked through the group Y and IL' or --O-- and --O--P(O)(S.sup.-)-- respectively. Preferably a unit is a moiety consisting of a pentose structure, a nucleobase connected to the pentose structure a 5' radical group and an IL' radical group.

[0267] The term "building block" or "monomer" as used herein refers to a molecule and especially to a nucleoside which is used in the synthesis of an antisense-oligonucleotide of the present invention. Examples are the LNA molecules of general formula (I), wherein Y represents a 5'-terminal group and IL' represents a 3'-terminal group.

[0268] Furthermore, pure diastereomeric anti-sense-oligonucleotides are preferred. Preferred are Sp- and Rp-diastereomers as shown at hand-right side:

##STR00006##

[0269] Suitable sulphur (S) containing internucleotide linkages as provided herein are preferred.

[0270] Preferred are phosphorothioate moieties in the backbone where at least 50% of the internucleotide linkages are phosphorothioate groups. Also preferred is that the LNA units, if present, are linked through phosphorothioates as internucleotide linkages. Most preferred is a complete phosphorothioate backbone, i.e. most preferred is when all nucleotide units and also the LNA units (if present) are linked to each other through phosphorothioate groups which are defined as follows: --O--P(O)(S.sup.-)--O-- which is synonymous to --O--P(O,S)--O-- or to --O--P(O.sup.-)(S)--O--.

[0271] In case the antisense-oligonucleotide is a gapmer, it is preferred that the LNA regions have internucleotide linkages selected from --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O-- and that the non-LNA region, the middle part, has internucleotide linkages selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O-- and that the LNA regions are connected to the non-LNA region through internucleotide linkages selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O--.

[0272] It is even more preferred if all internucleotide linkages which are 9 in a 10-mer and 19 in a 20-mer are selected from --O--P(O)(S.sup.-)--O-- and --O--P(S)(S.sup.-)--O--. Still more preferred is that all internucleotide linkages are phosphorothioate groups (--O--P(O)(S.sup.-)--O--) or are phosphorodithioate groups (--O--P(S)(S.sup.-)--O--).

Locked Nucleic Acids (LNA.RTM.)

[0273] It is especially preferred that some of the nucleotides of the general formula (B1) or (B2) in the antisense-oligonucleotides are replaced by so-called LNAs (Locked Nucleic Acids). The abbreviation LNA is a registered trademark, but herein the term "LNA" is solely used in a descriptive manner.

[0274] Preferably the terminal nucleotides are replaced by LNAs and more preferred the last 1 to 4 nucleotides at the 3' end and/or the last 1 to 4 nucleotides at the 5' end are replaced by LNAs. It is also preferred to have at least the terminal nucleotide at the 3' end and at the 5' end replaced by an LNA each.

[0275] The term "LNA" as used herein, refers to a bicyclic nucleotide analogue, known as "Locked Nucleic Acid". It may refer to an LNA monomer, or, when used in the context of an "LNA antisense-oligonucleotide" or an "antisense-oligonucleotide containing LNAs", LNA refers to an oligonucleotide containing one or more such bicyclic nucleotide analogues. LNA nucleotides are characterized by the presence of a linker group (such as a bridge) between C2' and C4' of the ribose sugar ring--for example as shown as the biradical R.sup.#--R as described below. The LNA used in the antisense-oligonucleotides of the present invention preferably has the structure of the general formula (I)

##STR00007##

wherein for all chiral centers, asymmetric groups may be found in either R or S orientation; wherein X is selected from --O--, --S--, --N(R.sup.N)--, --C(R.sup.6R.sup.7)--, and preferably X is --O--; B is selected from hydrogen, optionally substituted C.sub.1-4-alkoxy, optionally substituted C.sub.1-4-alkyl, optionally substituted C.sub.1-4-acyloxy, nucleobases and nucleobase analogues, and preferably B is a nucleobase or a nucleobase analogue and most preferred a standard nucleobase; Y represents a part of an internucleotide linkage to an adjacent nucleotide in case the moiety of general formula (I) is an LNA unit of an antisense-oligonucleotide of the present invention, or a 5'-terminal group in case the moiety of general formula (I) is a monomer or building block for synthesizing an antisense-oligonucleotide of the present invention. The 5' carbon atom optionally includes the substituent R.sup.4 and R.sup.5; IL' represents a part of an internucleotide linkage to an adjacent nucleotide in case the moiety of general formula (I) is an LNA unit of an antisense-oligonucleotide of the present invention, or a 3'-terminal group in case the moiety of general formula (I) is a monomer or building block for synthesizing an antisense-oligonucleotide of the present invention. R.sup.# and R together represent a bivalent linker group consisting of 1-4 groups or atoms selected from --C(R.sup.aR.sup.b)--, --C(R.sup.a).dbd.C(R.sup.b)--, --C(R.sup.a).dbd.N--, --O--, --Si(R.sup.a).sub.2--, --S--, --SO.sub.2--, --N(R.sup.c)--, and >C.dbd.Z, wherein Z is selected from --O--, --S--, and --N(R.sup.a)--, and R.sup.a, R.sup.b and R.sup.c are independently of each other selected from hydrogen, optionally substituted C.sub.1-12-alkyl, optionally substituted C.sub.2-6-alkenyl, optionally substituted C.sub.2-6-alkynyl, hydroxy, optionally substituted C.sub.1-12-alkoxy, C.sub.1-6-alkoxy-C.sub.1-6-alkyl, C.sub.2-6-alkenyloxy, carboxy, C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and di(C.sub.1-6-alkyl)-amino-carbonyl, amino-C.sub.1-6-alkylenyl-aminocarbonyl, mono- and di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkylenyl-aminocarbonyl, C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy, sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C.sub.1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents R.sup.a and R.sup.b together may represent optionally substituted methylene (.dbd.CH.sub.2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation, and; each of the substituents R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6 and R.sup.7, which are present is independently selected from hydrogen, optionally substituted C.sub.1-12-alkyl, optionally substituted C.sub.2-6-alkenyl, optionally substituted C.sub.2-6-alkynyl, hydroxy, C.sub.1-12-alkoxy, C.sub.1-6-alkoxy-C.sub.1-6-alkyl, C.sub.2-6-alkenyloxy, carboxy, C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and di(C.sub.1-6-alkyl)-amino-carbonyl, amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl, C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy, sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C.sub.1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene;

[0276] wherein R.sup.N is selected from hydrogen and C.sub.1-4-alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and R.sup.N, when present and not involved in a biradical, is selected from hydrogen and C.sub.1-4-alkyl; and basic salts and acid addition salts thereof. For all chiral centers, asymmetric groups may be found in either R or S orientation.

[0277] In preferred embodiments, R.sup.# and R together represent a biradical consisting of a groups selected from the group consisting of --C(R.sup.aR.sup.b)--C(R.sup.aR.sup.b)--, --C(R.sup.aR.sup.b)--O--, --C(R.sup.aR.sup.b)--NR.sup.c--, --C(R.sup.aR.sup.b)--S--, and --C(R.sup.aR.sup.b)--C(R.sup.aR.sup.b)--O--, wherein each R.sup.a, R.sup.b and R.sup.c may optionally be independently selected.

[0278] In some embodiments, R.sup.a and R.sup.b may be, optionally independently selected from the group consisting of hydrogen and C.sub.1-6-alkyl, such as methyl, and preferred is hydrogen.

[0279] In preferred embodiments, R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl. For all chiral centers, asymmetric groups may be found in either R or S orientation.

[0280] In preferred embodiments R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are hydrogen.

[0281] In some embodiments, R.sup.1, R.sup.2, and R.sup.3, are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl. For all chiral centers, asymmetric groups may be found in either R or S orientation. In preferred embodiments R.sup.1, R.sup.2, and R.sup.3 are hydrogen.

[0282] In preferred embodiments, R.sup.4 and R.sup.5 are each independently selected from the group consisting of --H, --CH.sub.3, --CH.sub.2--CH.sub.3, --CH.sub.2--O--CH.sub.3, and --CH.dbd.CH.sub.2. Suitably in some embodiments, either R.sup.4 or R.sup.5 are hydrogen, whereas the other group (R.sup.4 or R.sup.5 respectively) is selected from the group consisting of C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.1-6-alkyl, substituted C.sub.2-6-alkenyl, substituted C.sub.2-6-alkynyl or substituted acyl (--C(.dbd.O)--); wherein each substituted group is mono or poly substituted with substituent groups independently selected from halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.2-6-alkynyl, --OJ.sub.1, --SJ.sub.1, --NJ.sub.1J.sub.2, --N.sub.3, --COOJ.sub.1, --CN, --O--C(.dbd.O)NJ.sub.1J.sub.2, --N(H)C(.dbd.NH)NJ.sub.1J.sub.2 or --N(H)C(.dbd.X)N(H)J.sub.2, wherein X is O or S; and each J.sub.1 and J.sub.2 is, independently --H, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.2-6-alkynyl, C.sub.1-6-aminoalkyl, substituted C.sub.1-6-aminoalkyl or a protecting group. In some embodiments either R.sup.4 or R.sup.5 is substituted C.sub.1-6-alkyl. In some embodiments either R.sup.4 or R.sup.5 is substituted methylene, wherein preferred substituent groups include one or more groups independently selected from --F, --NJ.sub.1J.sub.2, --N.sub.3, --CN, --OJ.sub.1, --SJ.sub.1, --O--C(.dbd.O)NJ.sub.1J.sub.2, --N(H)C(.dbd.NH)NJ.sub.1J.sub.2 or --N(H)C(.dbd.O)N(H)J.sub.2. In some embodiments each J.sub.1 and J.sub.2 is, independently --H or C.sub.1-6-alkyl. In some embodiments either R.sup.4 or R.sup.5 is methyl, ethyl or methoxymethyl. In some embodiments either R.sup.4 or R.sup.5 is methyl. In a further embodiment either R.sup.4 or R.sup.5 is ethylenyl. In some embodiments either R.sup.4 or R.sup.5 is substituted acyl. In some embodiments either R.sup.4 or R.sup.5 is --O--C(.dbd.O)NJ.sub.1J.sub.2. For all chiral centers, asymmetric groups may be found in either R or S orientation. Such 5' modified bicyclic nucleotides are disclosed in WO 2007/134181 A, which is hereby incorporated by reference in its entirety.

[0283] In some embodiments B is a nucleobase, including nucleobase analogues and naturally occurring nucleobases, such as a purine or pyrimidine, or a substituted purine or substituted pyrimidine, such as a nucleobase referred to herein, such as a nucleobase selected from the group consisting of adenine, cytosine, thymine, adenine, uracil, and/or a modified or substituted nucleobase, such as 5-thiazolo-uracil, 2-thio-uracil, 5-propynyl-uracil, 2'thio-thymine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, and 2,6-diaminopurine.

[0284] In preferred embodiments, R.sup.# and R together represent a biradical selected from --C(R.sup.aR.sup.b)--O--, --C(R.sup.aR.sup.b)--C(R.sup.cR.sup.d)--O--, --C(R.sup.aR.sup.b)--C(R.sup.cR.sup.d)--C(R.sup.eR.sup.f)--O--, --C(R.sup.aR.sup.b)--O--C(R.sup.dR.sup.e)--, --C(R.sup.aR.sup.b)--O--C(R.sup.dR.sup.e)--O--, --C(R.sup.aR.sup.b)--C(R.sup.dR.sup.e)--, --C(R.sup.aR.sup.b)--C(R.sup.cR.sup.d)--C(R.sup.eR.sup.f)--, --C(R.sup.a).dbd.C(R.sup.b)--C(R.sup.dR.sup.e)--, --C(R.sup.aR.sup.b)--N(R.sup.c)--, --C(R.sup.aR.sup.b)--C(R.sup.dR.sup.e)--N(R.sup.c)--, --C(R.sup.aR.sup.b)--N(R.sup.c)--O--, --C(R.sup.aR.sup.b)--S--, and --C(R.sup.aR.sup.b)--C(R.sup.dR.sup.e)--S--, wherein R.sup.a, R.sup.b, R.sup.c, R.sup.d, R.sup.e, and R.sup.f each is independently selected from hydrogen, optionally substituted C.sub.1-12-alkyl, optionally substituted C.sub.2-6-alkenyl, optionally substituted C.sub.2-6-alkynyl, hydroxy, C.sub.1-12-alkoxy, C.sub.1-6-alkoxy-C.sub.1-6-alkyl, C.sub.2-6-alkenyloxy, carboxy, C.sub.1-12-alkoxycarbonyl C.sub.1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and di(C.sub.1-6-alkyl)-amino-carbonyl, amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl, C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy, sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C.sub.1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents R.sup.a and R.sup.b together may designate optionally substituted methylene (.dbd.CH.sub.2). For all chiral centers, asymmetric groups may be found in either R or S orientation.

[0285] In a further embodiment R.sup.# and R together designate a biradical (bivalent group) selected from --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--NH--, --CH.sub.2--N(CH.sub.3)--, --CH.sub.2--CH.sub.2--O--, --CH.sub.2--CH(CH.sub.3)--, --CH.sub.2--CH.sub.2--S--, --CH.sub.2--CH.sub.2--NH--, --CH.sub.2--CH.sub.2--CH.sub.2--, --CH.sub.2--CH.sub.2--CH.sub.2--O--, --CH.sub.2--CH.sub.2--CH(CH.sub.3)--, --CH.dbd.CH--CH.sub.2--, --CH.sub.2--O--CH.sub.2--O--, --CH.sub.2--NH--O--, --CH.sub.2--N(CH.sub.3)--O--, --CH.sub.2--O--CH.sub.2--, --CH(CH.sub.3)--O--, --CH(CH.sub.2O--CH.sub.3)--O--, --CH.sub.2--CH.sub.2--, and --CH.dbd.CH--. For all chiral centers, asymmetric groups may be found in either R or S orientation.

[0286] In some embodiments, R.sup.# and R together designate the biradical --C(R.sup.aR.sup.b)--N(R.sup.c)--O--, wherein R.sup.a and R.sup.b are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl, such as hydrogen, and; wherein R.sup.c is selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl, and preferably hydrogen.

[0287] In preferred embodiments, R.sup.# and R together represent the biradical --C(R.sup.aR.sup.b)--O--C(R.sup.dR.sup.e)--O--, wherein R.sup.a, R.sup.b, R.sup.d, and R.sup.e are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl, and preferably hydrogen.

[0288] In preferred embodiments, R.sup.# and R form the biradical --CH(Z)--O--, wherein Z is selected from the group consisting of C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.1-6-alkyl, substituted C.sub.2-6-alkenyl, substituted C.sub.2-6-alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio; and wherein each of the substituted groups, is, independently, mono or poly substituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, --OJ.sub.1, --NJ.sub.1J.sub.2, --SJ.sub.1, --N.sub.3, --OC(.dbd.X)J.sub.1, --OC(.dbd.X)NJ.sub.1J.sub.2, --NJ.sup.3C(.dbd.X)NJ.sub.1J.sub.2 and --CN, wherein each J.sub.1, J.sub.2 and J.sub.3 is, independently, --H or C.sub.1-6-alkyl, and X is O, S or NJ.sub.1. In preferred embodiments Z is C.sub.1-6-alkyl or substituted C.sub.1-6-alkyl. In further preferred embodiments Z is methyl. In preferred embodiments Z is substituted C.sub.1-6-alkyl. In preferred embodiments said substituent group is C.sub.1-6-alkoxy. In some embodiments Z is CH.sub.3OCH.sub.2--. For all chiral centers, asymmetric groups may be found in either R or S orientation. Such bicyclic nucleotides are disclosed in U.S. Pat. No. 7,399,845 which is hereby incorporated by reference in its entirety. In preferred embodiments, R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are hydrogen. In preferred embodiments, R.sup.1, R.sup.2, and R.sup.3 are hydrogen, and one or both of R.sup.4, R.sup.5 may be other than hydrogen as referred to above and in WO 2007/134181.

[0289] In preferred embodiments, R.sup.# and R together represent a biradical which comprise a substituted amino group in the bridge such as the biradical --CH.sub.2--N(R.sup.c)--, wherein R.sup.c is C.sub.1-12-alkyloxy. In preferred embodiments R.sup.# and R together represent a biradical --Cq.sub.3q.sub.4-NOR--, wherein q.sub.3 and q.sub.4 are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl; wherein each substituted group is, independently, mono or poly substituted with substituent groups independently selected from halogen, --OJ.sub.1, --SJ.sub.1, --NJ.sub.1J.sub.2, --COOJ.sub.1, --CN, --OC(.dbd.O)NJ.sub.1J.sub.2, --NH--C(.dbd.NH)NJ.sub.1J.sub.2 or --NH--C(.dbd.X)NHJ.sub.2, wherein X is O or S; and each of J.sub.1 and J.sub.2 is, independently, --H, C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, C.sub.1-6-aminoalkyl or a protecting group. For all chiral centers, asymmetric groups may be found in either R or S orientation. Such bicyclic nucleotides are disclosed in WO2008/150729 which is hereby incorporated by reference in its entirety. In preferred embodiments, R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are independently selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl. In preferred embodiments, R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are hydrogen. In preferred embodiments, R.sup.1, R.sup.2, and R.sup.3 are hydrogen and one or both of R.sup.4, R.sup.5 may be other than hydrogen as referred to above and in WO 2007/134181.

[0290] In preferred embodiments R.sup.# and R together represent a biradical (bivalent group) --C(R.sup.aR.sup.b)--O--, wherein R.sup.a and R.sup.b are each independently halogen, C.sub.1-12-alkyl, substituted C.sub.1-12-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.2-6-alkynyl, C.sub.1-12-alkoxy, substituted C.sub.1-12-alkoxy, --OJ.sub.1, --SJ.sub.1, --S(O)J.sub.1, --SO.sub.2-J.sub.1, --NJ.sub.1J.sub.2, --N.sub.3, --CN, --C(.dbd.O)OJ.sub.1, --C(.dbd.O)NJ.sub.1J.sub.2, --C(.dbd.O)J.sub.1, --OC(.dbd.O)NJ.sub.1J.sub.2, --NH--C(.dbd.NH)NJ.sub.1J.sub.2, --NH--C(.dbd.O)NJ.sub.1J.sub.2, or, --NH--C(.dbd.S)NJ.sub.1J.sub.2; or R.sup.a and R.sup.b together are .dbd.C(q.sub.3)(q.sub.4); q.sub.3 and q.sub.4 are each, independently, --H, halogen, C.sub.1-12-alkyl or substituted C.sub.1-12-alkyl; each substituted group is, independently, mono or poly substituted with substituent groups independently selected from halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.2-6-alkynyl, --OJ.sub.1, --SJ.sub.1, --NJ.sub.1J.sub.2, --N.sub.3, --CN, --C(.dbd.O)OJ.sub.1, --C(.dbd.O)NJ.sub.1J.sub.2, --C(.dbd.O)J.sub.1, --OC(.dbd.O)NJ.sub.1J.sub.2, --NH--C(.dbd.O)NJ.sub.1J.sub.2, or --NH--C(.dbd.S)NJ.sub.1J.sub.2 and; each Ji and J.sub.2 is independently, --H, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, substituted C.sub.2-6-alkynyl, C.sub.1-6-aminoalkyl, substituted C.sub.1-6-aminoalkyl or a protecting group. Such compounds are disclosed in WO2009006478A, hereby incorporated in its entirety by reference.

[0291] In preferred embodiments, R.sup.# and R form the biradical -Q-, wherein Q is --C(q.sub.1)(q.sub.2)C(q.sub.3)(q.sub.4)-, --C(q.sub.1).dbd.C(q.sub.3)-, --C[.dbd.C(q.sub.1)(q.sub.2)]--C(q.sub.3)(q.sub.4)- or --C(q.sub.1)(q.sub.2)--C[.dbd.C(q.sub.3)(q.sub.4)]-;

q.sub.1, q.sub.2, q.sub.3, q.sub.4 are each independently of each other --H, halogen, C.sub.1-12-alkyl, substituted C.sub.1-12-alkyl, C.sub.2-6-alkenyl, substituted C.sub.1-12-alkoxy, --OJ.sub.1, --SJ.sub.1, --S(O)Ji, --SO.sub.2-J.sub.1, --NJ.sub.1J.sub.2, --N.sub.3, --CN, --C(.dbd.O)OJ.sub.1, --C(.dbd.O)NJ.sub.1J.sub.2, --C(.dbd.O)J.sub.1, --OC(.dbd.O)NJ.sub.1J.sub.2, --NH--C(.dbd.NH)NJ.sub.1J.sub.2, --NH--C(.dbd.O)NJ.sub.1J.sub.2, or --NH--C(.dbd.S)NJ.sub.1J.sub.2; each J.sub.1 and J.sub.2 is independently of each other --H, C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, C.sub.1-6-aminoalkyl or a protecting group; and optionally when Q is --C(q.sub.1)(q.sub.2)C(q.sub.3)(q.sub.4)- and one of q.sub.3 or q.sub.4 is --CH.sub.3, then at least one of the other of q.sub.3 or q.sub.4 or one of q.sub.1 and q.sub.2 is other than --H. In preferred embodiments R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are hydrogen. For all chiral centers, asymmetric groups may be found in either R or S orientation. Such bicyclic nucleotides are disclosed in WO2008/154401 which is hereby incorporated by reference in its entirety. In preferred embodiments R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are independently of each other selected from the group consisting of hydrogen, halogen, C.sub.1-6-alkyl, substituted C.sub.1-6-alkyl, C.sub.2-6-alkenyl, substituted C.sub.2-6-alkenyl, C.sub.2-6-alkynyl or substituted C.sub.2-6-alkynyl, C.sub.1-6-alkoxyl, substituted C.sub.1-6-alkoxyl, acyl, substituted acyl, C.sub.1-6-aminoalkyl or substituted C.sub.1-6-aminoalkyl. In preferred embodiments R.sup.1, R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are hydrogen. In preferred embodiments R.sup.1, R.sup.2, and R.sup.3 are hydrogen and one or both of R.sup.4, R.sup.5 may be other than hydrogen as referred to above and in WO 2007/134181 or WO2009/067647 (alpha-L-bicyclic nucleic acids analogues).

[0292] As used herein, the term "C.sub.1-C.sub.6-alkyl" refers to --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7, --CH(CH.sub.3).sub.2, --C.sub.4H.sub.9, --CH.sub.2--CH(CH.sub.3).sub.2, --CH(CH.sub.3)--C.sub.2H.sub.5, --C(CH.sub.3).sub.3, --C.sub.5H.sub.11, --CH(CH.sub.3)--C.sub.3H.sub.7, --CH.sub.2--CH(CH.sub.3)--C.sub.2H.sub.5, --CH(CH.sub.3)--CH(CH.sub.3).sub.2, --C(CH.sub.3).sub.2--C.sub.2H.sub.5, --CH.sub.2--C(CH.sub.3).sub.3, --CH(C.sub.2H.sub.5).sub.2, --C.sub.2H.sub.4--CH(CH.sub.3).sub.2, --C.sub.6H.sub.13, --C.sub.3H.sub.6--CH(CH.sub.3).sub.2, --C.sub.2H.sub.4--CH(CH.sub.3)--C.sub.2H.sub.5, --CH(CH.sub.3)--C.sub.4H.sub.9, --CH.sub.2--CH(CH.sub.3)--C.sub.3H.sub.7, --CH(CH.sub.3)--CH.sub.2--CH(CH.sub.3).sub.2, --CH(CH.sub.3)--CH(CH.sub.3)--C.sub.2H.sub.5, --CH.sub.2--CH(CH.sub.3)--CH(CH.sub.3).sub.2, --CH.sub.2--C(CH.sub.3).sub.2--C.sub.2H.sub.5, --C(CH.sub.3).sub.2--C.sub.3H.sub.7, --C(CH.sub.3).sub.2--CH(CH.sub.3).sub.2, --C.sub.2H.sub.4--C(CH.sub.3).sub.3, --CH.sub.2--CH(C.sub.2H.sub.5).sub.2, and --CH(CH.sub.3)--C(CH.sub.3).sub.3. The term "C.sub.1-C.sub.6-alkyl" shall also include "C.sub.1-C.sub.6-cycloalkyl" like cyclo-C.sub.3H.sub.5, cyclo-C.sub.4H.sub.7, cyclo-C.sub.5H.sub.9, and cyclo-C.sub.6H.sub.11.

[0293] Preferred are --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7, --CH(CH.sub.3).sub.2, --C.sub.4H.sub.9, --CH.sub.2--CH(CH.sub.3).sub.2, --CH(CH.sub.3)--C.sub.2H.sub.5, --C(CH.sub.3).sub.3, and --C.sub.5H.sub.11. Especially preferred are --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7, and --CH(CH.sub.3).sub.2.

[0294] The term "C.sub.1-C.sub.6-alkyl" shall also include "C.sub.1-C.sub.6-cycloalkyl" like cyclo-C.sub.3H.sub.5, cyclo-C.sub.4H.sub.7, cyclo-C.sub.5H.sub.9, and cyclo-C.sub.6H.sub.11.

[0295] As used herein, the term "C.sub.1-C.sub.12-alkyl" refers to C.sub.1-C.sub.6-alkyl, --C.sub.7H.sub.15, --C.sub.8H.sub.17, --CH.sub.19, --C.sub.10H.sub.21, --C.sub.11H.sub.23, --C.sub.12H.sub.25.

[0296] As used herein, the term "C.sub.1-C.sub.6-alkylenyl" refers to --CH.sub.2--, --C.sub.2H.sub.4--, --CH(CH.sub.3)--, --C.sub.3H.sub.6--, --CH.sub.2--CH(CH.sub.3)--, --CH(CH.sub.3)--CH.sub.2--, --C(CH.sub.3).sub.2--, --C.sub.4H.sub.8--, --CH.sub.2--C(CH.sub.3).sub.2--, --C(CH.sub.3).sub.2--CH.sub.2--, --C.sub.2H.sub.4--CH(CH.sub.3)--, --CH(CH.sub.3)--C.sub.2H.sub.4--, --CH.sub.2--CH(CH.sub.3)--CH.sub.2--, --CH(CH.sub.3)--CH(CH.sub.3)--, --C.sub.5H.sub.10--, --CH(CH.sub.3)--C.sub.3H.sub.6--, --CH.sub.2--CH(CH.sub.3)--C.sub.2H.sub.4--, --C.sub.2H.sub.4--CH(CH.sub.3)--CH.sub.2--, --C.sub.3H.sub.6--CH(CH.sub.3)--, --C.sub.2H.sub.4--C(CH.sub.3).sub.2--, --C(CH.sub.3).sub.2--C.sub.2H.sub.4--, --CH.sub.2--C(CH.sub.3).sub.2--CH.sub.2--, --CH.sub.2--CH(CH.sub.3)--CH(CH.sub.3)--, --CH(CH.sub.3)--CH.sub.2--CH(CH.sub.3)--, --CH(CH.sub.3)--CH(CH.sub.3)--CH.sub.2--, --CH(CH.sub.3)--CH(CH.sub.3)--CH(CH.sub.3)--, --C(CH.sub.3).sub.2--C.sub.3H.sub.6--, --CH.sub.2--C(CH.sub.3).sub.2--C.sub.2H.sub.4--, --C.sub.2H.sub.4--C(CH.sub.3).sub.2--CH.sub.2--, --C.sub.3H.sub.6--C(CH.sub.3).sub.2--, --CH(CH.sub.3)--C.sub.4H.sub.8--, --C.sub.6H.sub.12--, --CH.sub.2--CH(CH.sub.3)--C.sub.3H.sub.6--, --C.sub.2H.sub.4--CH(CH.sub.3)--C.sub.2H.sub.4--, --C.sub.3H.sub.6--CH(CH.sub.3)--CH.sub.2--, --C.sub.4H.sub.8--CH(CH.sub.3)--, --C.sub.2H.sub.4--CH(CH.sub.3)--CH(CH.sub.3)--, --CH.sub.2--CH(CH.sub.3)--CH(CH.sub.3)--CH.sub.2--, --CH.sub.2--CH(CH.sub.3)--CH.sub.2--CH(CH.sub.3)--, --CH(CH.sub.3)--C.sub.2H.sub.4--CH(CH.sub.3)--, --CH(CH.sub.3)--CH.sub.2--CH(CH.sub.3)--CH.sub.2--, and --CH(CH.sub.3)--CH(CH.sub.3)--C.sub.2H.sub.4--.

[0297] As used herein, the term "C.sub.2-C.sub.6-alkenyl" refers to --CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH.sub.2, --C(CH.sub.3).dbd.CH.sub.2, --CH.dbd.CH--CH.sub.3, --C.sub.2H.sub.4--CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH--CH.sub.3, --CH.dbd.CH--C.sub.2H.sub.5, --CH.sub.2--C(CH.sub.3).dbd.CH.sub.2, --CH(CH.sub.3)--CH.dbd.CH, --CH.dbd.C(CH.sub.3).sub.2, --C(CH.sub.3).dbd.CH--CH.sub.3, --CH.dbd.CH--CH.dbd.CH.sub.2, --C.sub.3H.sub.6--CH.dbd.CH.sub.2, --C.sub.2H.sub.4--CH.dbd.CH--CH.sub.3, --CH.sub.2--CH.dbd.CH--C.sub.2H.sub.5, --CH.dbd.CH--C.sub.3H.sub.7, --CH.sub.2--CH.dbd.CH--CH.dbd.CH.sub.2, --CH.dbd.CH--CH.dbd.CH--CH.sub.3, --CH.dbd.CH--CH.sub.2--CH.dbd.CH.sub.2, --C(CH.sub.3).dbd.CH--CH.dbd.CH.sub.2, --CH.dbd.C(CH.sub.3)--CH.dbd.CH.sub.2, --CH.dbd.CH--C(CH.sub.3).dbd.CH.sub.2, --C.sub.2H.sub.4--C(CH.sub.3).dbd.CH.sub.2, --CH.sub.2--CH(CH.sub.3)--CH.dbd.CH.sub.2, --CH(CH.sub.3)--CH.sub.2--CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.C(CH.sub.3).sub.2, --CH.sub.2--C(CH.sub.3).dbd.CH--CH.sub.3, --CH(CH.sub.3)--CH.dbd.CH--CH.sub.3, --CH.dbd.CH--CH(CH.sub.3).sub.2, --CH.dbd.C(CH.sub.3)--C.sub.2H.sub.5, --C(CH.sub.3).dbd.CH--C.sub.2H.sub.5, --C(CH.sub.3).dbd.C(CH.sub.3).sub.2, --C(CH.sub.3).sub.2--CH.dbd.CH.sub.2, --CH(CH.sub.3)--C(CH.sub.3).dbd.CH.sub.2, --C(CH.sub.3).dbd.CH--CH.dbd.CH.sub.2, --CH.dbd.C(CH.sub.3)--CH.dbd.CH.sub.2, --CH.dbd.CH--C(CH.sub.3).dbd.CH.sub.2, --C.sub.4H.sub.8--CH.dbd.CH.sub.2, --C.sub.3H.sub.6--CH.dbd.CH--CH.sub.3, --C.sub.2H.sub.4--CH.dbd.CH--C.sub.2H.sub.5, --CH.sub.2--CH.dbd.CH--C.sub.3H.sub.7, --CH.dbd.CH--C.sub.4H.sub.9, --C.sub.3H.sub.6--C(CH.sub.3).dbd.CH.sub.2, --C.sub.2H.sub.4--CH(CH.sub.3)--CH.dbd.CH.sub.2, --CH.sub.2--CH(CH.sub.3)--CH.sub.2--CH.dbd.CH.sub.2, --CH(CH.sub.3)--C.sub.2H.sub.4--CH.dbd.CH.sub.2, --C.sub.2H.sub.4--CH.dbd.C(CH.sub.3).sub.2, --C.sub.2H.sub.4--C(CH.sub.3).dbd.CH--CH.sub.3, --CH.sub.2--CH(CH.sub.3)--CH.dbd.CH--CH.sub.3, --CH(CH.sub.3)--CH.sub.2--CH.dbd.CH--CH.sub.3, --CH.sub.2--CH.dbd.CH--CH(CH.sub.3).sub.2, --CH.sub.2--CH.dbd.C(CH.sub.3)--C.sub.2H.sub.5, --CH.sub.2--C(CH.sub.3).dbd.CH--C.sub.2H.sub.5, --CH(CH.sub.3)--CH.dbd.CH--C.sub.2H.sub.5, --CH.dbd.CH--CH.sub.2--CH(CH.sub.3).sub.2, --CH.dbd.CH--CH(CH.sub.3)--C.sub.2H.sub.5, --CH.dbd.C(CH.sub.3)--C.sub.3H.sub.7, --C(CH.sub.3).dbd.CH--C.sub.3H.sub.7, --CH.sub.2--CH(CH.sub.3)--C(CH.sub.3).dbd.CH.sub.2, --CH(CH.sub.3)--CH.sub.2--C(CH.sub.3).dbd.CH.sub.2, --CH(CH.sub.3)--CH(CH.sub.3)--CH.dbd.CH.sub.2, --CH.sub.2--C(CH.sub.3).sub.2--CH.dbd.CH.sub.2, --C(CH.sub.3).sub.2--CH.sub.2--CH.dbd.CH.sub.2, --CH.sub.2--C(CH.sub.3).dbd.C(CH.sub.3).sub.2, --CH(CH.sub.3)--CH.dbd.C(CH.sub.3).sub.2, --C(CH.sub.3).sub.2--CH.dbd.CH--CH.sub.3, --CH(CH.sub.3)--C(CH.sub.3).dbd.CH--CH.sub.3, --CH.dbd.C(CH.sub.3)--CH(CH.sub.3).sub.2, --C(CH.sub.3).dbd.CH--CH(CH.sub.3).sub.2, --C(CH.sub.3).dbd.C(CH.sub.3)--C.sub.2H.sub.5, --CH.dbd.CH--C(CH.sub.3).sub.3, --C(CH.sub.3).sub.2--C(CH.sub.3).dbd.CH.sub.2, --CH(C.sub.2H.sub.5)--C(CH.sub.3).dbd.CH.sub.2, --C(CH.sub.3)(C.sub.2H.sub.5)--CH.dbd.CH.sub.2, --CH(CH.sub.3)--C(C.sub.2H.sub.5).dbd.CH.sub.2, --CH.sub.2--C(C.sub.3H.sub.7).dbd.CH.sub.2, --CH.sub.2--C(C.sub.2H.sub.5).dbd.CH--CH.sub.3, --CH(C.sub.2H.sub.5)--CH.dbd.CH--CH.sub.3, --C(C.sub.4H.sub.9).dbd.CH.sub.2, --C(C.sub.3H.sub.7).dbd.CH--CH.sub.3, --C(C.sub.2H.sub.5).dbd.CH--C.sub.2H.sub.5, --C(C.sub.2H.sub.5).dbd.C(CH.sub.3).sub.2, --C[C(CH.sub.3).sub.3].dbd.CH.sub.2, --C[CH(CH.sub.3)(C.sub.2H.sub.5)].dbd.CH.sub.2, --C[CH.sub.2--CH(CH.sub.3).sub.2].dbd.CH.sub.2, --C.sub.2H.sub.4--CH.dbd.CH--CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH--CH.sub.2--CH.dbd.CH.sub.2, --CH.dbd.CH--C.sub.2H.sub.4--CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH--CH.dbd.CH--CH.sub.3, --CH.dbd.CH--CH.sub.2--CH.dbd.CH--CH.sub.3, --CH.dbd.CH--CH.dbd.CH--C.sub.2H.sub.5, --CH.sub.2--CH.dbd.CH--C(CH.sub.3).dbd.CH.sub.2, --CH.sub.2--CH.dbd.C(CH.sub.3)--CH.dbd.CH.sub.2, --CH.sub.2--C(CH.sub.3).dbd.CH--CH.dbd.CH.sub.2, --CH(CH.sub.3)--CH.dbd.CH--CH.dbd.CH.sub.2, --CH.dbd.CH--CH.sub.2--C(CH.sub.3).dbd.CH.sub.2, --CH.dbd.CH--CH(CH.sub.3)--CH.dbd.CH.sub.2, --CH.dbd.C(CH.sub.3)--CH.sub.2--CH.dbd.CH.sub.2, --C(CH.sub.3).dbd.CH--CH.sub.2--CH.dbd.CH.sub.2, --CH.dbd.CH--CH.dbd.C(CH.sub.3).sub.2, --CH.dbd.CH--C(CH.sub.3).dbd.CH--CH.sub.3, --CH.dbd.C(CH.sub.3)--CH.dbd.CH--CH.sub.3, --C(CH.sub.3).dbd.CH--CH.dbd.CH--CH.sub.3, --CH.dbd.C(CH.sub.3)--C(CH.sub.3).dbd.CH.sub.2, --C(CH.sub.3).dbd.CH--C(CH.sub.3).dbd.CH.sub.2, --C(CH.sub.3).dbd.C(CH.sub.3)--CH.dbd.CH.sub.2, and --CH.dbd.CH--CH.dbd.CH--CH.dbd.CH.sub.2.

[0298] Preferred are --CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH.sub.2, --C(CH.sub.3).dbd.CH.sub.2, --CH.dbd.CH--CH.sub.3, --C.sub.2H.sub.4--CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH--CH.sub.3. Especially preferred are --CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH.sub.2, and --CH.dbd.CH--CH.sub.3.

[0299] As used herein, the term "C.sub.2-C.sub.6-alkynyl" refers to --C.ident.CH, --C.ident.C--CH.sub.3, --CH.sub.2--C.ident.CH, --C.sub.2H.sub.4--C.ident.CH, --CH.sub.2--C.ident.C--CH.sub.3, --C.ident.C--C.sub.2H.sub.5, --C.sub.3H.sub.4--C.ident.CH, --C.sub.2H.sub.4--C.ident.C--CH.sub.3, --CH.sub.2--C.ident.C--C.sub.2H.sub.5, --C.ident.C--C.sub.3H.sub.7, --CH(CH.sub.3)--C.ident.CH, --CH.sub.2--CH(CH.sub.3)--C.ident.CH, --CH(CH.sub.3)--CH.sub.2--C.ident.CH, --CH(CH.sub.3)--C.ident.C--CH.sub.3, --C.sub.4H.sub.8--C.ident.CH, --C.sub.3H.sub.6--C.ident.C--CH.sub.3, --C.sub.2H.sub.4--C.ident.C--C.sub.2H.sub.5, --CH.sub.2--C.ident.C--C.sub.3H.sub.7, --C.ident.C--C.sub.4H.sub.9, --C.sub.2H.sub.4--CH(CH.sub.3)--C.ident.CH, --CH.sub.2--CH(CH.sub.3)--CH.sub.2--C.ident.CH, --CH(CH.sub.3)--C.sub.2H.sub.4--C.ident.CH, --CH.sub.2--CH(CH.sub.3)--C.ident.C--CH.sub.3, --CH(CH.sub.3)--CH.sub.2--C.ident.C--CH.sub.3, --CH(CH.sub.3)--C.ident.C--C.sub.2H.sub.5, --CH.sub.2--C.ident.C--CH(CH.sub.3).sub.2, --C.ident.C--CH(CH.sub.3)--C.sub.2H.sub.5, --C.ident.C--CH.sub.2--CH(CH.sub.3).sub.2, --C--C--C(CH.sub.3).sub.3, --CH(C.sub.2H.sub.5)--C.ident.C--CH.sub.3, --C(CH.sub.3).sub.2--C.ident.C--CH.sub.3, --CH(C.sub.2H.sub.5)--CH.sub.2--C.ident.CH, --CH.sub.2--CH(C.sub.2H.sub.5)--C.ident.CH, --C(CH.sub.3).sub.2--CH.sub.2--C.ident.CH, --CH.sub.2--C(CH.sub.3).sub.2--C.ident.CH, --CH(CH.sub.3)--CH(CH.sub.3)--C.ident.CH, --CH(C.sub.3H.sub.7)--C.ident.CH, --C(CH.sub.3)(C.sub.2H.sub.5)--C.ident.CH, --C.ident.C--C.ident.CH, --CH.sub.2--C.ident.C--C.ident.CH, --C--C--C.ident.C--CH.sub.3, --CH(C.ident.CH).sub.2, --C.sub.2H.sub.4--C.ident.C--C.ident.CH, --CH.sub.2--C.ident.C--CH.sub.2--C.ident.CH, --C.ident.C--C.sub.2H.sub.4--C.ident.CH, --CH.sub.2--C.ident.C--C.ident.C--CH.sub.3, --C.ident.C--CH.sub.2--C.ident.C--CH.sub.3, --C.ident.C--C.ident.C--C.sub.2H.sub.5, --C.ident.C--CH(CH.sub.3)--C.ident.CH, --CH(CH.sub.3)--C.ident.C--C.ident.CH, --CH(C.ident.CH)--CH.sub.2--C.ident.CH, --C(C.ident.CH).sub.2--CH.sub.3, --CH.sub.2--CH(C.ident.CH).sub.2, --CH(C.ident.CH)--C.ident.C--CH.sub.3. Preferred are --C.ident.CH and --C--C--CH.sub.3.

[0300] The term "C.sub.1-6-alkoxyl" refers to "C.sub.1-C.sub.6-alkyl-O--".

[0301] The term "C.sub.1-12-alkoxyl" refers to "C.sub.1-C.sub.12-alkyl-O--".

[0302] The term "C.sub.1-6-aminoalkyl" refers to "H.sub.2N--C.sub.1-C.sub.6-alkyl-".

[0303] The term "C.sub.2-C.sub.6-alkenyloxy" refers to "C.sub.2-C.sub.6-alkenyl-O--".

[0304] The term "C.sub.1-6-alkylcarbonyl" refers to "C.sub.1-C.sub.6-alkyl-CO--". Also referred to as "acyl".

[0305] The term "C.sub.1-12-alkylcarbonyl" refers to "C.sub.1-C.sub.12-alkyl-CO--". Also referred to as "acyl".

[0306] The term "C.sub.1-6-alkoxycarbonyl" refers to "C.sub.1-C.sub.6-alkyl-O--CO--".

[0307] The term "C.sub.1-12-alkoxycarbonyl" refers to "C.sub.1-C.sub.12-alkyl-O--CO--".

[0308] The term "C.sub.1-C.sub.6-alkanoyloxy" refers to "C.sub.1-C.sub.6-alkyl-CO--O--".

[0309] The term "C.sub.1-6-alkylthio" refers to "C.sub.1-C.sub.6-alkyl-S--".

[0310] The term "C.sub.1-6-alkylsulphonyloxy" refers to "C.sub.1-C.sub.6-alkyl-SO.sub.2--O--".

[0311] The term "C.sub.1-6-alkylcarbonylamino" refers to "C.sub.1-C.sub.6-alkyl-CO--NH--".

[0312] The term "C.sub.1-6-alkylamino" refers to "C.sub.1-C.sub.6-alkyl-NH--".

[0313] The term "(C.sub.1-6-).sub.2alkylamino" refers to a dialkylamino group like "[C.sub.1-C.sub.6-alkyl][C.sub.1-C.sub.6-alkyl]N--".

[0314] The term "C.sub.1-6-alkylaminocarbonyl" refers to "C.sub.1-C.sub.6-alkyl-NH--CO--"

[0315] The term "(C.sub.1-6-).sub.2alkylaminocarbonyl" refers to a dialkylaminocarbonyl group like "[C.sub.1-C.sub.6-alkyl][C.sub.1-C.sub.6-alkyl]N--CO--".

[0316] The term "amino-C.sub.1-6-alkylaminocarbonyl" refers to "H.sub.2N--[C.sub.1-C.sub.6-alkylenyl]-NH--CO--".

[0317] The term "C.sub.1-6-alkyl-amino-C.sub.1-6-alkylaminocarbonyl" refers to "C.sub.1-6-alkyl-HN--[C.sub.1-C.sub.6-alkylenyl]-NH--CO--".

[0318] The term "(C.sub.1-6-).sub.2alkyl-amino-C.sub.1-6-alkylaminocarbonyl" refers to "[C.sub.1-C.sub.6-alkyl][C.sub.1-C.sub.6-alkyl]N--[C.sub.1-C.sub.6-alkyle- nyl]-NH--CO--".

[0319] The term "aryl" refers to phenyl, toluyl, substituted phenyl and substituted toluyl.

[0320] The term "aryloxy" refers to "aryl-O--".

[0321] The term "arylcarbonyl" refers to "aryl-CO--".

[0322] The term "aryloxycarbonyl" refers to "aryl-O--CO--".

[0323] The term "heteroaryl" refers to substituted or not substituted heteroaromatic groups which have from 4 to 9 ring atoms, from 1 to 4 of which are selected from O, N and/or S. Preferred "heteroaryl" groups have 1 or 2 heteroatoms in a 5- or 6-membered aromatic ring. Mono and bicyclic ring systems are included. Typical "heteroaryl" groups are pyridyl, furyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, pyridazinyl, pyrimidyl, pyrazinyl, 1,3,5-triazinyl, 1,2,3-triazolyl, 1,3,4-thiadiazolyl, indolizinyl, indolyl, isoindolyl, benzo[b]furyl, benzo[b]thienyl, indazolyl, benzimidazolyl, benzthiazolyl, purinyl, quinolizinyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, tetrahydroquinolyl, benzooxazolyl, chrom-2-onyl, indazolyl, and the like.

[0324] The term "heteroaryloxy" refers to "heteroaryl-O--".

[0325] The term "heteroarylcarbonyl" refers to "heteroaryl-CO--".

[0326] The term "heteroaryloxycarbonyl" refers to "heteroaryl-O--CO--".

[0327] The term "substituted" refers to groups wherein one or more hydrogen atoms are replaced by one or more of the following substituents: --OH, --OCH.sub.3, --OC.sub.2H.sub.5, --OC.sub.3H.sub.7, --O-cyclo-C.sub.3H.sub.5, --OCH(CH.sub.3).sub.2, --OCH.sub.2Ph, --F, --Cl, --COCH.sub.3, --COC.sub.2H.sub.5, --COC.sub.3H.sub.7, --CO-cyclo-C.sub.3H.sub.5, --COCH(CH.sub.3).sub.2, --COOH, --CONH.sub.2, --NH.sub.2, --NHCH.sub.3, --NHC.sub.2H.sub.5, --NHC.sub.3H.sub.7, --NH-cyclo-C.sub.3H.sub.5, --NHCH(CH.sub.3).sub.2, --N(CH.sub.3).sub.2, --N(C.sub.2H.sub.5).sub.2, --N(C.sub.3H.sub.7).sub.2, --N(cyclo-C.sub.3H.sub.5).sub.2, --N[CH(CH.sub.3).sub.2]2, --SO.sub.3H, --OCF.sub.3, --OC.sub.2F.sub.5, cyclo-C.sub.3H.sub.5, --CH.sub.3, --C.sub.2H.sub.5, --C.sub.3H.sub.7, --CH(CH.sub.3).sub.2, --CH.dbd.CH.sub.2, --CH.sub.2--CH.dbd.CH.sub.2, --C.ident.CH and/or --C.ident.C--CH.sub.3.

[0328] In case the general structure (I) represents monomers or building blocks for synthesizing the antisense-oligonucleotides of the present invention, the terminal groups Y and IL' are selected independently of each other from hydrogen, azido, halogen, cyano, nitro, hydroxy, PG-O--, AG-O--, mercapto, PG-S--, AG-S--, C.sub.1-6-alkylthio, amino, PG-N(R.sup.H)--, AG-N(R.sup.H)--, mono- or di(C.sub.1-6-alkyl)amino, optionally substituted C.sub.1-6-alkoxy, optionally substituted C.sub.1-6-alkyl, optionally substituted C.sub.2-6-alkenyl, optionally substituted C.sub.2-6-alkenyloxy, optionally substituted C.sub.2-6-alkynyl, optionally substituted C.sub.2-6-alkynyloxy, monophosphate, monothiophosphate, diphosphate, dithiophosphate triphosphate, trithiophosphate, carboxy, sulphono, hydroxymethyl, PG-O--CH.sub.2--, AG-O--CH.sub.2--, aminomethyl, PG-N(R.sup.H)--CH.sub.2--, AG-N(R.sup.H)--CH.sub.2--, carboxymethyl, sulphonomethyl, where PG is a protection group for --OH, --SH, and --NH(R.sup.H), respectively, AG is an activation group for --OH, --SH, and --NH(R.sup.H), respectively, and R.sup.H is selected from hydrogen and C.sub.1-6-alkyl.

[0329] The protection groups PG of hydroxy substituents comprise substituted trityl, such as 4,4'-dimethoxytrityl (DMT), 4-monomethoxytrityl (MMT), optionally substituted 9-(9-phenyl)xanthenyl (pixyl), optionally substituted methoxytetrahydropyranyl (mthp), silyl such as trimethylsilyl (TMS), triisopropylsilyl (TIPS), tert-butyldimethylsilyl (TBDMS), triethylsilyl, and phenyldimethylsilyl, tert-butylethers, acetals (including two hydroxy groups), acyl such as acetyl or halogen substituted acetyls, e.g. chloroacetyl or fluoroacetyl, isobutyryl, pivaloyl, benzoyl and substituted benzoyls, methoxymethyl (MOM), benzyl ethers or substituted benzyl ethers such as 2,6-dichlorobenzyl (2,6-Cl.sub.2Bzl). Alternatively when Y or IL' is hydroxyl they may be protected by attachment to a solid support optionally through a linker.

[0330] When Y or IL' is an amino group, illustrative examples of the amino protection groups are fluorenylmethoxycarbonyl (Fmoc), tert-butyloxycarbonyl (BOC), trifluoroacetyl, allyloxycarbonyl (alloc or AOC), benzyloxycarbonyl (Z or Cbz), substituted benzyloxycarbonyls such as 2-chloro benzyloxycarbonyl (2-CIZ), monomethoxytrityl (MMT), dimethoxytrityl (DMT), phthaloyl, and 9-(9-phenyl)xanthenyl (pixyl).

[0331] Act represents an activation group for --OH, --SH, and --NH(R.sup.H), respectively. Such activation groups are, for instance, selected from optionally substituted O-phosphoramidite, optionally substituted O-phosphortriester, optionally substituted O-phosphordiester, optionally substituted H-phosphonate, and optionally substituted O-phosphonate.

[0332] In the present context, the term "phosphoramidite" means a group of the formula --P(OR.sup.x)--N(R.sup.y).sub.2, wherein R.sup.x designates an optionally substituted alkyl group, e.g. methyl, 2-cyanoethyl, or benzyl, and each of R.sup.y designate optionally substituted alkyl groups, e.g. ethyl or isopropyl, or the group --N(R.sup.y).sub.2 forms a morpholino group (--N(CH.sub.2CH.sub.2).sub.2O). R.sup.x preferably designates 2-cyanoethyl and the two R.sup.y are preferably identical and designate isopropyl. Thus, an especially relevant phosphoramidite is N,N-diisopropyl-O-(2-cyanoethyl)-phosphoramidite.

LNA Monomers or LNA Building Blocks

[0333] The LNA monomers or LNA building blocks used as starting materials in the synthesis of the antisense-oligonucleotides of the present invention are preferably LNA nucleosides of the following general formulae:

##STR00008##

[0334] The LNA building blocks are normally provided as LNA phosphoramidites with the four different nucleobases: adenine (A), guanine (G), 5-methyl-cytosine (C*) and thymine (T). The antisense-oligonucleotides of the present invention containing LNA units are synthesized by standard phosphoramidite chemistry. In the LNA building blocks the nucleobases are protected. A preferred protecting group for the amino group of the purin base is a benzoyl group (Bz), indicated as A.sup.Bz. A preferred protecting group for the amino group of the 5-methylpyrimidinone base is a benzoyl group (Bz), indicated as C*.sup.Bz. A preferred protecting group for the amino group of the purinone base is a dimethylformamidine (DMF) group, a diethylformamidine (DEF), a dipropylformamidine (DPF), a dibutylformamidine (DBF), or a iso-butyryl (--CO--CH(CH.sub.3).sub.2) group, indicated as G.sup.DMF, G.sup.DEF, G.sup.DPF, G.sup.DBF, or G.sup.iBu. Thus the group -NDMF refers to --N.dbd.CH--N(CH.sub.3).sub.2. DMT refers to 4,4'-dimethoxytrityl.

[0335] Thus, LNA-T refers to 5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N-diisopropyl)-phosphora- midite-thymidine LNA. LNA-C*.sup.Bz refers to 5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphoram- idite-4-N-benzoyl-5-methyl-2'-cytidine LNA. LNA-A.sup.Bz refers to 5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N-di-isopropyl)phosphora- midite-6-N-benzoyl-2'-adenosine LNA. LNA-G.sup.DMF refers to 5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N-diisopropyl)-phosphora- midite-2-N-dim ethylformamidine-2'-guanosine LNA. LNA-G.sup.iBu refers to 5'-O-(4,4'-dimethoxy-trityl)-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphora- midite-2-N-butyryl-2'-guanosine LNA.

Terminal Groups

[0336] In case Y represents the 5'-terminal group of an antisense-oligonucleotide of the present invention, the residue Y is also named Y.sup.5' and represents:

--OH, --O--C.sub.1-6-alkyl, --S--C.sub.1-6-alkyl, --O--C.sub.6-9-phenyl, --O--C.sub.7-10-benzyl, --NH--C.sub.1-6-alkyl, --N(C.sub.1-6-alkyl).sub.2, --O--C.sub.2-6-alkenyl, --S--C.sub.2-6-alkenyl, --NH--C.sub.2-6-alkenyl, --N(C.sub.2-6-alkenyl).sub.2, --O--C.sub.2-6-alkynyl, --S--C.sub.2-6-alkynyl, --NH--C.sub.2-6-alkynyl, --N(C.sub.2-6-alkynyl).sub.2, --O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl, --O--[C.sub.1-6-alkylenyl-O]m-C.sub.1-6-alkyl, --O--CO--C.sub.1-6-alkyl, --O--CO--C.sub.2-6-alkenyl, --O--CO--C.sub.2-6-alkynyl, --O--S(O)--C.sub.1-6-alkyl, --O--SO.sub.2--C.sub.1-6-alkyl, --O--SO.sub.2--O--C.sub.1-6-alkyl, --O--P(O)(O.sup.-).sub.2, --O--P(O)(O.sup.-)(O--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkyl).sub.2, --O--P(O)(S.sup.-).sub.2, --O--P(O)(S--C.sub.1-6-alkyl).sub.2, --O--P(O)(S.sup.-)(O--C.sub.1-6-alkyl), --O--P(O)(O.sup.-)(NH--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkyl)(NH--C.sub.1-6-alkyl), --O--P(O)(O.sup.-)[N(C.sub.1-6-alkyl).sub.2], --O--P(O)(O--C.sub.1-6-alkyl)[N(C.sub.1-6-alkyl).sub.2], --O--P(O)(O.sup.-)(BH.sub.3.sup.-), --O--P(O)(O--C.sub.1-6-alkyl)(BH.sub.3.sup.-), --O--P(O)(O.sup.-)(O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(O--C.sub.1-6-alkylenyl-S--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkylenyl-S--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(OCH.sub.2CH.sub.2O--C.sub.1-6-alkyl), --O--P(O)(OCH.sub.2CH.sub.2O--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(OCH.sub.2CH.sub.2S--C.sub.1-6-alkyl), --O--P(O)(OCH.sub.2CH.sub.2S--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH, --O--P(S)(S.sup.-)OC.sub.3H.sub.6OH, wherein the C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, --O--C.sub.6-9-phenyl or --O--C.sub.7-10-benzyl may be further substituted by --F, --OH, C.sub.1-4-alkyl, C.sub.2-4-alkenyl and/or C.sub.2-4-alkynyl where m is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0337] More preferred are: --OCH.sub.3, --OC.sub.2H.sub.5, --OC.sub.3H.sub.7, --O-cyclo-C.sub.3H.sub.5, --OCH(CH.sub.3).sub.2, --OC(CH.sub.3).sub.3, --OC.sub.4H.sub.9, --OPh, --OCH.sub.2-Ph, --O--COCH.sub.3, --O--COC.sub.2H.sub.5, --O--COC.sub.3H.sub.7, --O--CO-cyclo-C.sub.3H.sub.5, --O--COCH(CH.sub.3).sub.2, --OCF.sub.3, --O--S(O)CH.sub.3, --O--S(O)C.sub.2H.sub.5, --O--S(O)C.sub.3H.sub.7, --O--S(O)-cyclo-C.sub.3H.sub.5, --O--SO.sub.2CH.sub.3, --O--SO.sub.2C.sub.2H.sub.5, --O--SO.sub.2C.sub.3H.sub.7, --O--SO.sub.2-cyclo-C.sub.3H.sub.5, --O--SO.sub.2--OCH.sub.3, --O--SO.sub.2--OC.sub.2H.sub.5, --O--SO.sub.2--OC.sub.3H.sub.7, --O--SO.sub.2--O-cyclo-C.sub.3H.sub.5, --O(CH.sub.2).sub.nN[(CH.sub.2).sub.nOH], --O(CH.sub.2).sub.nN[(CH.sub.2).sub.n--H], --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH,

even more preferred are: --OCH.sub.3, --OC.sub.2H.sub.5, --OCH.sub.2CH.sub.2OCH.sub.3 (also known as MOE), --OCH.sub.2CH.sub.2--N(CH.sub.3).sub.2 (also known as DMAOE), --O[(CH.sub.2).sub.nO].sub.mCH.sub.3, --O(CH.sub.2).sub.nOCH.sub.3, --O(CH.sub.2).sub.nNH.sub.2, --O(CH.sub.2).sub.nN(CH.sub.3).sub.2, --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH, where n is selected from 1, 2, 3, 4, 5, or 6; and where m is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0338] In case IL' represents the 3'-terminal group of an antisense-oligonucleotide of the present invention, the residue IL' is also named IL'.sup.3' and represents:

--OH, --O--C.sub.1-6-alkyl, --S--C.sub.1-6-alkyl, --O--C.sub.6-9-phenyl, --O--C.sub.7-10-benzyl, --NH--C.sub.1-6-alkyl, --N(C.sub.1-6-alkyl).sub.2, --O--C.sub.2-6-alkenyl, --S--C.sub.2-6-alkenyl, --NH--C.sub.2-6-alkenyl, --N(C.sub.2-6-alkenyl).sub.2, --O--C.sub.2-6-alkynyl, --S--C.sub.2-6-alkynyl, --NH--C.sub.2-6-alkynyl, --N(C.sub.2-6-alkynyl).sub.2, --O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl, --O--[C.sub.1-6-alkylenyl-O]m-C.sub.1-6-alkyl, --O--CO--C.sub.1-6-alkyl, --O--CO--C.sub.2-6-alkenyl, --O--CO--C.sub.2-6-alkynyl, --O--S(O)--C.sub.1-6-alkyl, --O--SO.sub.2--C.sub.1-6-alkyl, --O--SO.sub.2--O--C.sub.1-6-alkyl, --O--P(O)(O.sup.-).sub.2, --O--P(O)(O.sup.-)(O--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkyl).sub.2, --O--P(O)(S.sup.-).sub.2, --O--P(O)(S--C.sub.1-6-alkyl).sub.2, --O--P(O)(S.sup.-)(O--C.sub.1-6-alkyl), --O--P(O)(O.sup.-)(NH--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkyl)(NH--C.sub.1-6-alkyl), --O--P(O)(O.sup.-)[N(C.sub.1-6-alkyl).sub.2], --O--P(O)(O--C.sub.1-6-alkyl)[N(C.sub.1-6-alkyl).sub.2], --O--P(O)(O.sup.-)(BH.sub.3.sup.-), --O--P(O)(O--C.sub.1-6-alkyl)(BH.sub.3.sup.-), --O--P(O)(O.sup.-)(O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkylenyl-O--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(O--C.sub.1-6-alkylenyl-S--C.sub.1-6-alkyl), --O--P(O)(O--C.sub.1-6-alkylenyl-S--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(OCH.sub.2CH.sub.2O--C.sub.1-6-alkyl), --O--P(O)(OCH.sub.2CH.sub.2O--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)(OCH.sub.2CH.sub.2S--C.sub.1-6-alkyl), --O--P(O)(OCH.sub.2CH.sub.2S--C.sub.1-6-alkyl).sub.2, --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH, wherein the C.sub.1-6-alkyl, C.sub.2-6-alkenyl, C.sub.2-6-alkynyl, --O--C.sub.6-9-phenyl or --O--C.sub.7-10-benzyl may be further substituted by --F, --OH, C.sub.1-4-alkyl, C.sub.2-4-alkenyl and/or C.sub.2-4-alkynyl where m is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0339] More preferred are: --OCH.sub.3, --OC.sub.2H.sub.5, --OC.sub.3H.sub.7, --O-cyclo-C.sub.3H.sub.5, --OCH(CH.sub.3).sub.2, --OC(CH.sub.3).sub.3, --OC.sub.4H.sub.9, --OPh, --OCH.sub.2-Ph, --O--COCH.sub.3, --O--COC.sub.2H.sub.5, --O--COC.sub.3H.sub.7, --O--CO-cyclo-C.sub.3H.sub.5, --O--COCH(CH.sub.3).sub.2, --OCF.sub.3, --O--S(O)CH.sub.3, --O--S(O)C.sub.2H.sub.5, --O--S(O)C.sub.3H.sub.7, --O--S(O)-cyclo-C.sub.3H.sub.5, --O--SO.sub.2CH.sub.3, --O--SO.sub.2C.sub.2H.sub.5, --O--SO.sub.2C.sub.3H.sub.7, --O--SO.sub.2-cyclo-C.sub.3H.sub.5, --O--SO.sub.2--OCH.sub.3, --O--SO.sub.2--OC.sub.2H.sub.5, --O--SO.sub.2--OC.sub.3H.sub.7, --O--SO.sub.2--O-cyclo-C.sub.3H.sub.5, --O(CH.sub.2).sub.nN[(CH.sub.2).sub.nOH], --O(CH.sub.2).sub.nN[(CH.sub.2).sub.n--H], --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH,

even more preferred are: --OCH.sub.3, --OC.sub.2H.sub.5, --OCH.sub.2CH.sub.2OCH.sub.3 (also known as MOE), --OCH.sub.2CH.sub.2--N(CH.sub.3).sub.2 (also known as DMAOE), --O[(CH.sub.2).sub.nO].sub.mCH.sub.3, --O(CH.sub.2).sub.nOCH.sub.3, --O(CH.sub.2).sub.nNH.sub.2, --O(CH.sub.2).sub.nN(CH.sub.3).sub.2, --O--P(O)(O.sup.-)OC.sub.3H.sub.6OH, --O--P(O)(S.sup.-)OC.sub.3H.sub.6OH, where n is selected from 1, 2, 3, 4, 5, or 6; and where m is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

Preferred LNAs

[0340] In preferred embodiments LNA units used in the antisense-oligonucleotides of the present invention preferably have the structure of general formula (II):

##STR00009##

[0341] The moiety --C(R.sup.aR.sup.b)--X-- represents preferably --C(R.sup.aR.sup.b)--O--, --C(R.sup.aR.sup.b)--NR.sup.c--, --C(R.sup.aR.sup.b)--S--, and --C(R.sup.aR.sup.b)--C(R.sup.aR.sup.b)--O--, wherein the substituents R.sup.a, R.sup.b and R.sup.c have the meanings as defined herein and are preferably C.sub.1-6-alkyl and more preferably C.sub.1-4-alkyl. More preferably --C(R.sup.aR.sup.b)--X-- is selected from --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--NH--, --CH.sub.2--N(CH.sub.3)--, --CH.sub.2--CH.sub.2--O--, or --CH.sub.2--CH.sub.2--S--, and more preferably --CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--CH.sub.2--O--, or --CH.sub.2--CH.sub.2--S--, and still more preferably --CH.sub.2--O--, --CH.sub.2--S--, or --CH.sub.2--CH.sub.2--O--, and still more preferably --CH.sub.2--O-- or --CH.sub.2--S--, and most preferably --CH.sub.2--O--.

[0342] All chiral centers and asymmetric substituents (if any) can be either in R or in S orientation. For example, two exemplary stereochemical isomers are the beta-D and alpha-L isoforms as shown below:

##STR00010##

[0343] Preferred LNA units are selected from general formula (b.sup.1) to (b.sup.9):

##STR00011##

[0344] The term "thio-LNA" comprises a locked nucleotide in which X in the general formula (II) is selected from --S-- or --CH.sub.2--S--. Thio-LNA can be in both beta-D and alpha-L-configuration.

[0345] The term "amino-LNA" comprises a locked nucleotide in which X in the general formula (II) is selected from --NH--, --N(R)--, --CH.sub.2--NH--, and --CH.sub.2--N(R)--, where R is selected from hydrogen and C.sub.1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.

[0346] The term "oxy-LNA" comprises a locked nucleotide in which X in the general formula (II) is --O--. Oxy-LNA can be in both beta-D and alpha-L-configuration.

[0347] The term "ENA" comprises a locked nucleotide in which X in the general formula (II) is --CH.sub.2--O-- (where the oxygen atom of --CH.sub.2--O-- is attached to the 2'-position relative to the base B). R.sup.a and R.sup.b are independently of each other hydrogen or methyl.

[0348] In preferred exemplary embodiments LNA is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA and beta-D-thio-LNA, in particular beta-D-oxy-LNA.

[0349] Still more preferred are the following antisense-oligonucleotides (Table 1):

TABLE-US-00032 SP L Seq ID No. Sequence, 5'-3' 89 17 102a GCGAGTGACTCACTCAA 90 15 103a CGAGTGACTCACTCA 90 16 104a GCGAGTGACTCACTCA 90 17 105a CGCGAGTGACTCACTCA 91 14 106a CGAGTGACTCACTC 91 16 107a CGCGAGTGACTCACTC 91 17 108a GCGCGAGTGACTCACTC 92 14 109a GCGAGTGACTCACT 92 16 110a GCGCGAGTGACTCACT 92 17 111a CGCGCGAGTGACTCACT 93 12 112a CGAGTGACTCAC 93 13 113a GCGAGTGACTCAC 93 14 114a CGCGAGTGACTCAC 93 16 115a CGCGCGAGTGACTCAC 93 17 116a GCGCGCGAGTGACTCAC 94 13 117a CGCGAGTGACTCA 94 14 118a GCGCGAGTGACTCA 94 15 119a CGCGCGAGTGACTCA 94 16 120a GCGCGCGAGTGACTCA 94 17 121a TGCGCGCGAGTGACTCA 95 14 122a CGCGCGAGTGACTC 95 16 123a TGCGCGCGAGTGACTC 95 17 124a GTGCGCGCGAGTGACTC 96 13 125a CGCGCGAGTGACT 97 14 126a TGCGCGCGAGTGAC 97 16 127a CGTGCGCGCGAGTGAC 98 13 128a TGCGCGCGAGTGA 107 16 129a GTCGTCGCTCCGTGCG 108 15 130a GTCGTCGCTCCGTGC 108 17 131a GTGTCGTCGCTCCGTGC 109 13 132a TCGTCGCTCCGTG 109 15 133a TGTCGTCGCTCCGTG 110 12 134a TCGTCGCTCCGT 110 13 135a GTCGTCGCTCCGT 110 14 136a TGTCGTCGCTCCGT 110 15 137a GTGTCGTCGCTCCGT 110 16 138a GGTGTCGTCGCTCCGT 351 16 139a CGTCATAGACCGAGCC 351 12 140a ATAGACCGAGCC 354 16 141a GCTCGTCATAGACCGA 354 13 142a CGTCATAGACCGA 355 14 143a CTCGTCATAGACCG 355 15 144a GCTCGTCATAGACCG 356 14 145a GCTCGTCATAGACC 381 17 146a CAGCCCCCGACCCATGG 382 16 147a CAGCCCCCGACCCATG 383 14 148a AGCCCCCGACCCAT 384 14 149a CAGCCCCCGACCCA 422 17 150a CGCGTCCACAGGACGAT 425 14 151a CGCGTCCACAGGAC 429 15 152a CGATACGCGTCCACA 431 13 153a CGATACGCGTCCA 431 16 154a TGGCGATACGCGTCCA 432 12 155a CGATACGCGTCC 432 13 156a GCGATACGCGTCC 432 17 157a GCTGGCGATACGCGTCC 433 15 158a CTGGCGATACGCGTC 433 12 159a GCGATACGCGTC 433 16 160a GCTGGCGATACGCGTC 433 14 161a TGGCGATACGCGTC 434 13 162a TGGCGATACGCGT 434 14 163a CTGGCGATACGCGT 434 12 164a GGCGATACGCGT 435 13 165a CTGGCGATACGCG 435 12 166a TGGCGATACGCG 437 17 167a ATCGTGCTGGCGATACG 449 16 168a CGTGCGGTGGGATCGT 449 17 169a ACGTGCGGTGGGATCGT 450 17 170a AACGTGCGGTGGGATCG 452 15 171a AACGTGCGGTGGGAT 452 17 172a TGAACGTGCGGTGGGAT 459 17 173a CGACTTCTGAACGTGCG 941 17 174a TTAACGCGGTAGCAGTA 941 16 175a TAACGCGGTAGCAGTA 942 17 176a GTTAACGCGGTAGCAGT 943 15 177a TTAACGCGGTAGCAG 944 13 178a TAACGCGGTAGCA 945 12 179a TAACGCGGTAGC 945 13 180a TTAACGCGGTAGC 946 12 181a TTAACGCGGTAG 946 13 182a GTTAACGCGGTAG 946 15 183a CGGTTAACGCGGTAG 946 16 184a CCGGTTAACGCGGTAG 947 14 185a CGGTTAACGCGGTA 947 13 186a GGTTAACGCGGTA 947 15 187a CCGGTTAACGCGGTA 947 16 188a GCCGGTTAACGCGGTA 947 17 189a TGCCGGTTAACGCGGTA 948 13 190a CGGTTAACGCGGT 949 13 191a CCGGTTAACGCGG 949 14 192a GCCGGTTAACGCGG 949 15 193a TGCCGGTTAACGCGG 950 13 194a GCCGGTTAACGCG 950 15 195a CTGCCGGTTAACGCG 950 16 196a GCTGCCGGTTAACGCG 1387 16 197a ATGCCGCGTCAGGTAC 1392 13 198a ACATGCCGCGTCA 1393 16 199a GATGACATGCCGCGTC 1394 12 200a GACATGCCGCGT 1394 15 201a GATGACATGCCGCGT 1395 13 202a ATGACATGCCGCG 1805 17 203a TCCCGCACCTTGGAACC 1851 16 204a CGATCTCTCAACACGT 1851 17 205a TCGATCTCTCAACACGT 1852 15 206a CGATCTCTCAACACG 1852 16 207a TCGATCTCTCAACACG 1852 17 208a CTCGATCTCTCAACACG 2064 16 209a GTAGTGTTTAGGGAGC 2072 16 210a GCTATTTGGTAGTGTT 2284 15 211a AGCTTATCCTATGAC 2285 14 212a AGCTTATCCTATGA 2355 17 213a CAGGCATTAATAAAGTG 4120 16 214a CTAGGCGCCTCTATGC 4121 14 215a TAGGCGCCTCTATG 4121 15 216a CTAGGCGCCTCTATG 4122 13 217a TAGGCGCCTCTAT 4217 16 218a CATGAATGGACCAGTA SP: start position or start nucleotide on Seq. ID No. 2 L: length of the sequence

[0350] The antisense-oligonucleotides as disclosed herein such as the antisense-oligonucleotides of Tables 1 to 3 and especially the antisense-oligonucleotides of Tables 4 to 9 consist of nucleotides, preferably DNA nucleotides, which are non-LNA units (also named herein non-LNA nucleotides) as well as LNA units (also named herein LNA nucleotides).

[0351] Although not explicitly indicated, the antisense-oligonucleotides of the sequences Seq. ID Nos. 102a-218a of Table 1 comprise 2 to 4 LNA nucleotides (LNA units) at the 3' terminus and 2 to 4 LNA nucleotides (LNA units) at the 5' terminus. Although not explicitly indicated, the "C" in Table 2 which refer to LNA units preferably contain 5-methylcytosine (C*) as nucleobase.

[0352] That means, as long as not explicitly indicated, the antisense-oligonucleotides of the present invention or as disclosed herein by the letter code A, C, G, T and U may contain any internucleotide linkage, any end group and any nucleobase as disclosed herein. Moreover the antisense-oligonucleotides of the present invention or as disclosed herein are gapmers of any gapmer structure as disclosed herein with at least one LNA unit at the 3' terminus and at least one LNA unit at the 5' terminus. Moreover any LNA unit as disclosed herein can be used within the antisense-oligonucleotides of the present invention or as disclosed herein. Thus, for instance, the antisense-oligonucleotide GCTCGTCATAGACCGA (Seq. ID No. 13) or CGATACGCGTCCACAG (Seq. ID No. 14) or GTAGTGTTTAGGGAGC (Seq. ID No. 15) or GCTATTTGGTAGTGTT (Seq. ID No. 16) or CATGAATGGACCAGTA (Seq. ID No. 17) or AGGCATTAATAAAGTG (Seq. ID No. 18) contains at least one LNA unit at the 5' terminus and at least one LNA unit at the 3' terminus, any nucleobase, any 3' end group, any 5' end group, any gapmer structure, and any internucleotide linkage as disclosed herein and covers also salts and optical isomers of that antisense-oligonucleotide.

[0353] The use of LNA units is preferred especially at the 3' terminal and the 5' terminal end. Thus it is preferred if the last 1-5 nucleotides at the 3' terminal end and also the last 1-5 nucleotides at the 5' terminal end especially of the sequences disclosed herein and particularly of Seq. ID Nos. 102a-218a of Table 1 are LNA units (also named LNA nucleotides) while in between the 1-5 LNA units at the 3' and 5' end 2-14, preferably 3-12, more preferably 4-10, more preferably 5-9, still more preferably 6-8, non-LNA units (also named non-LNA nucleotides) are present. Such kind of antisense-oligonucleotides are called gapmers and are disclosed in more detail below. More preferred are 2-5 LNA nucleotides at the 3' end and 2-5 LNA nucleotides at the 5' end or 1-4 LNA nucleotides at the 3' end and 1-4 LNA nucleotides at the 5' end and still more preferred are 2-4 LNA nucleotides at the 3' end and 2-4 LNA nucleotides at the 5' end of the antisense-oligonucleotides with a number of preferably 4-10, more preferably 5-9, still more preferably 6-8 non-LNA units in between the LNA units at the 3' and the 5' end.

[0354] Moreover as internucleotide linkages between the LNA units and between the LNA units and the non-LNA units, the use of phosphorothioates or phosphorodithioates and preferably phosphorothioates is preferred.

[0355] Thus further preferred are antisense-oligonucleotides wherein more than 50%, preferably more than 60%, more preferably more than 70%, still more preferably more than 80%, and most preferably more than 90% of the internucleotide linkages are phosphorothioates or phosphates and more preferably phosphorothioate linkages and wherein the last 1-4 or 2-5 nucleotides at the 3' end are LNA units and the last 1-4 or 2-5 nucleotides at the 5' end are LNA units and between the LNA units at the ends a sequence of 6-14 nucleotides, preferably 7-12, preferably 8-11, more preferably 8-10 are present which are non-LNA units, preferably DNA units. Moreover it is preferred that these antisense-oligonucleotides in form of gapmers consist in total of 12 to 20, preferably 12 to 18 nucleotides.

Gapmers

[0356] The antisense-oligonucleotides of the invention may consist of nucleotide sequences which comprise both DNA nucleotides which are non-LNA units as well as LNA nucleotides, and may be arranged in the form of a gapmer.

[0357] Thus, the antisense-oligonucleotides of the present invention are preferably gapmers. A gapmer consists of a middle part of DNA nucleotide units which are not locked, thus which are non-LNA units. The DNA nucleotides of this middle part could be linked to each other by the internucleotide linkages (IL) as disclosed herein which preferably may be phosphate groups, phosphorothioate groups or phosphorodithioate groups and which may contain nucleobase analogues such as 5-propynyl cytosine, 7-methylguanine, 7-methyladenine, 2-aminoadenine, 2-thiothymine, 2-thiocytosine, or 5-methylcytosine. That DNA units or DNA nucleotides are not bicyclic pentose structures. The middle part of non-LNA units is flanked at the 3' end and the 5' end by sequences consisting of LNA units. Thus gapmers have the general formula:

LNA sequence 1-non-LNA sequence-LNA sequence 2

or

region A-region B-region C

[0358] The middle part of the antisense-oligonucleotide which consists of DNA nucleotide units which are non-LNA units is, when formed in a duplex with the complementary target RNA, capable of recruiting RNase. The 3' and 5' terminal nucleotide units are LNA units which are preferably in alpha-L configuration, particularly preferred being beta-D-oxy-LNA and alpha-L-oxy LNAs.

[0359] Thus, a gapmer is an antisense-oligonucleotide which comprises a contiguous stretch of DNA nucleotides which is capable of recruiting an RNase, such as RNaseH, such as a region of at least 6 or 7 DNA nucleotides which are non-LNA units, referred to herein as middle part or region B, wherein region B is flanked both 5' and 3' by regions of affinity enhancing nucleotide analogues which are LNA units, such as between 1-6 LNA units 5' and 3' to the contiguous stretch of DNA nucleotides which is capable of recruiting RNase--these flanking regions are referred to as regions A and C respectively. Preferably the gapmer comprises a (poly)nucleotide sequence of formula (5' to 3'), A-B-C, or optionally A-B-C-D or D-A-B-C, wherein; region A (5' region) consists of at least one nucleotide analogue, such as at least one LNA unit, such as between 1-6 LNA units, and region B consists of at least five consecutive DNA nucleotides which are non-LNA units and which are capable of recruiting RNase (when formed in a duplex with a complementary RNA molecule, such as the mRNA target), and region C (3'region) consists of at least one nucleotide analogue, such as at least one LNA unit, such as between 1-6 LNA units, and region D, when present consists of 1, 2 or 3 DNA nucleotide units which are non-LNA units.

[0360] In some embodiments, region A consists of 1, 2, 3, 4, 5 or 6 LNA units, such as between 2-5 LNA units, such as 3 or 4 LNA units; and/or region C consists of 1, 2, 3, 4, 5 or 6 LNA units, such as between 2-5 LNA units, such as 3 or 4 LNA units.

[0361] In some embodiments B consists of 5, 6, 7, 8, 9, 10, 11 or 12 consecutive DNA nucleotides which are capable of recruiting RNase, or between 6-10, or between 7-9, such as 8 consecutive nucleotides which are capable of recruiting RNase. In some embodiments region B consists of at least one DNA nucleotide unit, such as 1-12 DNA nucleotide units, preferably between 4-12 DNA nucleotide units, more preferably between 6-10 DNA nucleotide units, still more preferred such as between 7-10 DNA nucleotide units, and most preferably 8, 9 or 10 DNA nucleotide units which are non-LNA units.

[0362] In some embodiments region A consist of 3 or 4 LNA, region B consists of 7, 8, 9 or 10 DNA nucleotide units, and region C consists of 3 or 4 LNA units. Such designs include (A-B-C): 1-7-2, 2-7-1, 2-7-2, 3-7-1, 3-7-2, 1-7-3, 2-7-3, 3-7-3, 2-7-4, 3-7-4, 4-7-2, 4-7-3, 4-7-4, 1-8-1, 1-8-2, 2-8-1, 2-8-2, 1-8-3, 3-8-1, 3-8-3, 2-8-3, 3-8-2, 4-8-1, 4-8-2, 1-8-4, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 1-9-1, 1-9-2, 2-9-1, 2-9-2, 2-9-3, 3-9-2, 3-9-3, 1-9-3, 3-9-1, 4-9-1, 1-9-4, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 1-10-1, 1-10-2, 2-10-1, 2-10-2, 1-10-3, 3-10-1, 2-10-2, 2-10-3, 3-10-2, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 1-11-1, 1-11-2, 2-11-1, 2-11-2, 1-11-3, 3-11-1, 2-11-2, 2-11-3, 3-11-2, 3-11-3, 2-11-4, 4-11-2, 3-11-4, 4-11-3, 4-11-4, and may further include region D, which may have one or 2 DNA nucleotide units, which are non-LNA units.

[0363] Further gapmer designs are disclosed in WO2004/046160A and are hereby incorporated by reference. U.S. provisional application, 60/977,409, hereby incorporated by reference, refers to `shortmer` gapmer antisense-oligonucleotide, which are also suitable for the present invention.

[0364] In some embodiments the antisense-oligonucleotide consists of a contiguous nucleotide sequence of a total of 10, 11, 12, 13 or 14 nucleotide units (LNA units and non-LNA units together), wherein the contiguous nucleotide sequence is of formula (5'-3'), A-B-C, or optionally A-B-C-D or D-A-B-C, wherein A consists of 1, 2 or 3 LNA units, and B consists of 7, 8 or 9 contiguous DNA nucleotide units which are non-LNA units and which are capable of recruiting RNase when formed in a duplex with a complementary RNA molecule (such as a mRNA target), and C consists of 1, 2 or 3 LNA units. When present, D consists of a single DNA nucleotide unit which is a non-LNA unit.

[0365] In some embodiments A consists of 1 LNA unit. In some embodiments A consists of 2 LNA units. In some embodiments A consists of 3 LNA units. In some embodiments C consists of 1 LNA unit. In some embodiments C consists of 2 LNA units. In some embodiments C consists of 3 LNA units. In some embodiments B consists of 7 DNA nucleotide units which are non-LNA units. In some embodiments B consists of 8 DNA nucleotide units. In some embodiments B consists of 9 DNA nucleotide units. In some embodiments B consists of 1-9 DNA nucleotide units, such as 2, 3, 4, 5, 6, 7 or 8 DNA nucleotide units. The DNA nucleotide units are always non-LNA units. In some embodiments B comprises 1, 2 or 3 LNA units which are preferably in the alpha-L configuration and which are more preferably alpha-L-oxy LNA units. In some embodiments the number of nucleotides present in A-B-C are selected from the group consisting of (LNA units-region B-LNA units and more preferably alpha-L-oxy LNA units (region A)-region B-(region C) alpha-L-oxy LNA units): 1-8-1, 1-8-2, 2-8-1, 2-8-2, 1-8-3, 3-8-1, 3-8-3, 2-8-3, 3-8-2, 4-8-1, 4-8-2, 1-8-4, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 1-9-1, 1-9-2, 2-9-1, 2-9-2, 2-9-3, 3-9-2, 3-9-3, 1-9-3, 3-9-1, 4-9-1, 1-9-4, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 1-10-1, 1-10-2, 2-10-1, 2-10-2, 1-10-3, 3-10-1, 2-10-2, 2-10-3, 3-10-2, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 1-11-1, 1-11-2, 2-11-1, 2-11-2, 1-11-3, 3-11-1, 2-11-2, 2-11-3, 3-11-2, 3-11-3, 2-11-4, 4-11-2, 3-11-4, 4-11-3, 4-11-4. In further preferred embodiments the number of nucleotides in A-B-C are selected from the group consisting of: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred are: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0366] Phosphorothioate, phosphate or phosphorodithioate and especially phosphorothioate internucleotide linkages are also preferred, particularly for the gapmer region B. Phosphorothioate, phosphate or phosphorodithioate linkages and especially phosphorothioate internucleotide linkages may also be used for the flanking regions (A and C, and for linking A or C to D, and within region D, if present).

[0367] Regions A, B and C, may however comprise internucleotide linkages other than phosphorothioate or phosphorodithioate, such as phosphodiester linkages, particularly, for instance when the use of nucleotide analogues protects the internucleotide linkages within regions A and C from endo-nuclease degradation--such as when regions A and C consist of LNA units.

[0368] The internucleotide linkages in the antisense-oligonucleotide may be phosphodiester, phosphorothioate, phosphorodithioate or boranophosphate so as to allow RNase H cleavage of targeted RNA. Phosphorothioate or phosphorodithioate is preferred, for improved nuclease resistance and other reasons, such as ease of manufacture. In one aspect of the oligomer of the invention, the LNA units and/or the non-LNA units are linked together by means of phosphorothioate groups.

[0369] It is recognized that the inclusion of phosphodiester linkages, such as one or two linkages, into an otherwise phosphorothioate antisense-oligonucleotide, particularly between or adjacent to LNA units (typically in region A and or C) can modify the bioavailability and/or bio-distribution of an antisense-oligonucleotide (see WO2008/053314A which is hereby incorporated by reference).

[0370] In some embodiments, such as in the sequences of the antisense-oligonucleotides disclosed herein and where suitable and not specifically indicated, all remaining internucleotide linkage groups are either phosphodiester groups or phosphorothioate groups, or a mixture thereof.

[0371] In some embodiments all the internucleotide linkage groups are phosphorothioate groups. When referring to specific gapmer antisense-oligonucleotide sequences, such as those provided herein, it will be understood that, in various embodiments, when the linkages are phosphorothioate linkages, alternative linkages, such as those disclosed herein may be used, for example phosphate (also named phosphodiester) linkages may be used, particularly for linkages between nucleotide analogues, such as LNA units. Likewise, when referring to specific gapmer antisense-oligonucleotide sequences, such as those provided herein, when the C residues are annotated as 5'-methyl modified cytosine, in various embodiments, one or more of the Cs present in the oligomer may be unmodified C residues.

Legend

[0372] As used herein the abbreviations b, d, s, ss have the following meaning:

b LNA unit or LNA nucleotide (any one selected from b.sup.1-b.sup.7)

b.sup.1 .beta.-D-oxy-LNA

b.sup.2 .beta.-D-thio-LNA

b.sup.3 .beta.-D-amino-LNA

b.sup.4 .alpha.-L-oxy-LNA

b.sup.5 .beta.-D-ENA

b.sup.6 .beta.-D-(NH)-LNA

[0373] b.sup.7 .beta.-D-(NCH.sub.3)-LNA d 2-deoxy, that means 2-deoxyribose units (e.g. formula B3 or B5 with R=--H) C* methyl-C(5-methylcytosine); [consequently dC* is 5-methyl-2'-deoxycytidine] A* 2-aminoadenine [consequently dA* is 2-amino-2'-deoxyadenosine] s the internucleotide linkage is a phosphorothioate group (--O--P(O)(S.sup.-)--O--) ss the internucleotide linkage is a phosphorodithioate group (--O--P(S)(S.sup.-)--O--) /5SpC3/--O--P(O)(O.sup.-)OC.sub.3H.sub.6OH at 5'-terminal group of an antisense-oligonucleotide /3SpC3/--O--P(O)(O.sup.-)OC.sub.3H.sub.6OH at 3'-terminal group of an antisense-oligonucleotide /5SpC3s/--O--P(O)(S.sup.-)OC.sub.3H.sub.6OH at 5'-terminal group of an antisense-oligonucleotide /3SpC3s/--O--P(O)(S.sup.-)OC.sub.3H.sub.6OH at 3'-terminal group of an antisense-oligonucleotide nucleotides in bold are LNA nucleotides nucleotides not in bold are non-LNA nucleotides

Gapmer Sequences

[0374] The following antisense-oligonucleotides in form of gapmers as listed in Table 2 to Table 9 and more preferably in Table 4 to 9 are especially preferred.

TABLE-US-00033 TABLE 2 Seq SP L ID No. Sequence, 5'-3' 89 17 102b GbsCbsGbsAbsdGsdTsdGsdAsdCsdTsdCsdAsdCsTbsCbsAbsAb 90 15 103b CbsGbsAbsdGsdTsdGsdAsdCsdTsdCsdAsdCsTbsCbsAb 90 16 104b GbsCbsGbsdAsdGsdTsdGsdAsdCsdTsdCsdAsdCsTbsCbsAb 90 17 105b CbsGbsCbsGbsdAsdGsdTsdGsdAsdCsdTsdCsdAsCbsTbsCbsAb 91 14 106b CbsGbsAbsdGsdTsdGsdAsdCsdTsdCsdAsCbsTbsCb 91 16 107b CbsGbsCbsdGsdAsdGsdTsdGsdAsdCsdTsdCsdAsCbsTbsCb 91 17 108b GbsCbsGbsCbsdGsdAsdGsdTsdGsdAsdCsdTsdCsAbsCbsTbsCb 92 14 109b GbsCbsGbsdAsdGsdTsdGsdAsdCsdTsdCsAbsCbsTb 92 16 110b GbsCbsGbsdCsdGsdAsdGsdTsdGsdAsdCsdTsdCsAbsCbsTb 92 17 111b CbsGbsCbsGbsdCsdGsdAsdGsdTsdGsdAsdCsdTsCbsAbsCbsTb 93 12 112b CbsGbsdAsdGsdTsdGsdAsdCsdTsdCsAbsCb 93 13 113b GbsCbsGbsdAsdGsdTsdGsdAsdCsdTsdCsAbsCb 93 14 114b CbsGbsCbsdGsdAsdGsdTsdGsdAsdCsdTsCbsAbsCb 93 16 115b CbsGbsCbsdGsdCsdGsdAsdGsdTsdGsdAsdCsdTsCbsAbsCb 93 17 116b GbsCbsGbsCbsdGsdCsdGsdAsdGsdTsdGsdAsdCsTbsCbsAbsCb 94 13 117b CbsGbsCbsdGsdAsdGsdTsdGsdAsdCsdTsCbsAb 94 14 118b GbsCbsGbsdCsdGsdAsdGsdTsdGsdAsdCsTbsCbsAb 94 15 119b CbsGbsCbsdGsdCsdGsdAsdGsdTsdGsdAsdCsTbsCbsAb 94 16 120b GbsCbsGbsdCsdGsdCsdGsdAsdGsdTsdGsdAsdCsTbsCbsAb 94 17 121b TbsGbsCbsGbsdCsdGsdCsdGsdAsdGsdTsdGsdAsCbsTbsCbsAb 95 14 122b CbsGbsCbsdGsdCsdGsdAsdGsdTsdGsdAsCbsTbsCb 95 16 123b TbsGbsCbsdGsdCsdGsdCsdGsdAsdGsdTsdGsdAsCbsTbsCb 95 17 124b GbsTbsGbsCbsdGsdCsdGsdCsdGsdAsdGsdTsdGsAbsCbsTbsCb 96 13 125b CbsGbsCbsdGsdCsdGsdAsdGsdTsdGsdAsCbsTb 97 14 126b TbsGbsCbsdGsdCsdGsdCsdGsdAsdGsdTsGbsAbsCb 97 16 127b CbsGbsTbsdGsdCsdGsdCsdGsdCsdGsdAsdGsdTsGbsAbsCb 98 13 128b TbsGbsCbsdGsdCsdGsdCsdGsdAsdGsdTsGbsAb 107 16 129b GbsTbsCbsdGsdTsdCsdGsdCsdTsdCsdCsdGsdTsGbsCbsGb 108 15 130b GbsTbsCbsdGsdTsdCsdGsdCsdTsdCsdCsdGsTbsGbsCb 108 17 131b GbsTbsGbsTbsdCsdGsdTsdCsdGsdCsdTsdCsdCsGbsTbsGbsCb 109 13 132b TbsCbsGbsdTsdCsdGsdCsdTsdCsdCsdGsTbsGb 109 15 133b TbsGbsTbsdCsdGsdTsdCsdGsdCsdTsdCsdCsGbsTbsGb 110 12 134b TbsCbsdGsdTsdCsdGsdCsdTsdCsdCsGbsTb 110 13 135b GbsTbsCbsdGsdTsdCsdGsdCsdTsdCsdCsGbsTb 110 14 136b TbsGbsTbsdCsdGsdTsdCsdGsdCsdTsdCsCbsGbsTb 110 15 137b GbsTbsGbsdTsdCsdGsdTsdCsdGsdCsdTsdCsCbsGbsTb 110 16 138b GbsGbsTbsdGsdTsdCsdGsdTsdCsdGsdCsdTsdCsCbsGbsTb 351 16 139b CbsGbsTbsdCsdAsdTsdAsdGsdAsdCsdCsdGsdAsGbsCbsCb 351 12 140b AbsTbsdAsdGsdAsdCsdCsdGsdAsdGsCbsCb 354 16 141b GbsCbsTbsdCsdGsdTsdCsdAsdTsdAsdGsdAsdCsCbsGbsAb 354 13 142b CbsGbsTbsdCsdAsdTsdAsdGsdAsdCsdCsGbsAb 355 14 143b CbsTbsdCsdGsdTsdCsdAsdTsdAsdGsdAsCbsCbsGb 355 14 143c CbsTbsCbsdGsdTsdCsdAsdTsdAsdGsdAsdCsCbsGb 355 14 143d CbsTbsCbsdGsdTsdCsdAsdTsdAsdGsdAsCbsCbsGb 355 15 144b GbsCbsTbsdCsdGsdTsdCsdAsdTsdAsdGsdAsCbsCbsGb 356 14 145b GbsCbsTbsdCsdGsdTsdCsdAsdTsdAsdGsAbsCbsCb 381 17 146b CbsAbsGbsCbsdCsdCsdCsdCsdGsdAsdCsdCsdCsAbsTbsGbsGb 382 16 147b CbsAbsGbsdCsdCsdCsdCsdCsdGsdAsdCsdCsdCsAbsTbsGb 382 16 147c CbsAbsGbsdCsdCsdCsdCsdCsdGsdAsdCsdCsdCsAsTsG 382 16 147d CbsAbsGbsdCsdCsdCsdCsdCsdGsdAsdCsdCsCbsAbsTbsGb 382 16 147e CbsAbsGbsCbsdCsdCsdCsdCsdGsdAsdCsdCsdCsAbsTbsGb 382 16 147f CbsAbsGbsCbsdCsdCsdCsdCsdGsdAsdCsdCsCbsAbsTbsGb 383 14 148b AbsGbsdCsdCsdCsdCsdCsdGsdAsdCsdCsCbsAbsTb 383 14 148c AbsGbsCbsdCsdCsdCsdCsdGsdAsdCsdCsdCsAbsTb 383 14 148d AbsGbsCbsdCsdCsdCsdCsdGsdAsdCsdCsCbsAbsTb 384 14 149 CbsAbsGbsdCsdCsdCsdCsdCsdGsdAsdCsCbsCbsAb 422 17 150b CbsGbsCbsGbsdTsdCsdCsdAsdCsdAsdGsdGsdAsCbsGbsAbsTb 425 14 151b CbsGbsCbsdGsdTsdCsdCsdAsdCsdAsdGsGbsAbsCb 429 15 152b CbsGbsAbsdTsdAsdCsdGsdCsdGsdTsdCsdCsAbsCbsAb 429 15 152c CbsGbsAbsdTsdAsdCsdGsdCsdGsdTsdCsCbsAbsCbsAb 429 15 152d CbsGbsAbsTbsdAsdCsdGsdCsdGsdTsdCsdCsAbsCbsAb 432 12 155b CbsGbsdAsdTsdAsdCsdGsdCsdGsdTsCbsCb 431 13 153b CbsGbsAbsdTsdAsdCsdGsdCsdGsdTsdCsCbsAb 431 13 153c CbsGbsdAsdTsdAsdCsdGsdCsdGsdTsCbsCbsAb 431 16 154b TbsGbsGbsdCsdGsdAsdTsdAsdCsdGsdCsdGsdTsCbsCbsAb 432 12 155c CbsGbsdAsdTsdAsdCsdGsdCsdGsdTsdCsCb 432 12 155d CbsdGsdAsdTsdAsdCsdGsdCsdGsdTsCbsCb 432 13 156b GbsCbsGbsdAsdTsdAsdCsdGsdCsdGsdTsCbsCb 432 17 157b GbsCbsTbsGbsdGsdCsdGsdAsdTsdAsdCsdGsdCsGbsTbsCbsCb 433 15 158b CbsTbsGbsdGsdCsdGsdAsdTsdAsdCsdGsdCsGbsTbsCb 433 12 159b GbsCbsdGsdAsdTsdAsdCsdGsdCsdGsTbsCb 433 16 160b GbsCbsTbsdGsdGsdCsdGsdAsdTsdAsdCsdGsdCsGbsTbsCb 433 14 161b TbsGbsGbsdCsdGsdAsdTsdAsdCsdGsdCsGbsTbsCb 434 12 164b GbsGbsdCsdGsdAsdTsdAsdCsdGsdCsGbsTb 434 13 162b TbsGbsGbsdCsdGsdAsdTsdAsdCsdGsdCsGbsTb 434 13 162c TbsGbsdGsdCsdGsdAsdTsdAsdCsdGsCbsGbsTb 434 14 163b CbsTbsGbsdGsdCsdGsdAsdTsdAsdCsdGsCbsGbsTb 435 13 165b CbsTbsGbsdGsdCsdGsdAsdTsdAsdCsdGsCbsGb 435 12 166b TbsGbsdGsdCsdGsdAsdTsdAsdCsdGsCbsGb 437 17 167b AbsTbsCbsGbsdTsdGsdCsdTsdGsdGsdCsdGsdAsTbsAbsCbsGb 449 16 168b CbsGbsTbsdGsdCsdGsdGsdTsdGsdGsdGsdAsdTsCbsGbsTb 449 17 169b AbsCbsGbsTbsdGsdCsdGsdGsdTsdGsdGsdGsdAsTbsCbsGbsTb 450 17 170b AbsAbsCbsGbsdTsdGsdCsdGsdGsdTsdGsdGsdGsAbsTbsCbsGb 452 15 171b AbsAbsCbsdGsdTsdGsdCsdGsdGsdTsdGsdGsGbsAbsTb 452 17 172b TbsGbsAbsAbsdCsdGsdTsdGsdCsdGsdGsdTsdGsGbsGbsAbsTb 459 17 173b CbsGbsAbsCbsdTsdTsdCsdTsdGsdAsdAsdCsdGsTbsGbsCbsGb 941 17 174b TbsTbsAbsAbsdCsdGsdCsdGsdGsdTsdAsdGsdCsAbsGbsTbsAb 941 16 175b TbsAbsAbsdCsdGsdCsdGsdGsdTsdAsdGsdCsdAsGbsTbsAb 942 17 176b GbsTbsTbsAbsdAsdCsdGsdCsdGsdGsdTsdAsdGsCbsAbsGbsTb 943 15 177b TbsTbsAbsdAsdCsdGsdCsdGsdGsdTsdAsdGsCbsAbsGb 944 13 178b TbsAbsAbsdCsdGsdCsdGsdGsdTsdAsdGsCbsAb 945 12 179b TbsAbsdAsdCsdGsdCsdGsdGsdTsdAsGbsCb 945 13 180b TbsTbsAbsdAsdCsdGsdCsdGsdGsdTsdAsGbsCb 946 12 181b TbsTbsdAsdAsdCsdGsdCsdGsdGsdTsAbsGb 946 13 182b GbsTbsTbsdAsdAsdCsdGsdCsdGsdGsdTsAbsGb 946 15 183b CbsGbsGbsdTsdTsdAsdAsdCsdGsdCsdGsdGsTbsAbsGb 946 16 184b CbsCbsGbsdGsdTsdTsdAsdAsdCsdGsdCsdGsdGsTbsAbsGb 947 14 185b CbsGbsGbsdTsdTsdAsdAsdCsdGsdCsdGsGbsTbsAb 947 13 186b GbsGbsTbsdTsdAsdAsdCsdGsdCsdGsdGsTbsAb 947 15 187b CbsCbsGbsdGsdTsdTsdAsdAsdCsdGsdCsdGsGbsTbsAb 947 16 188b GbsCbsCbsdGsdGsdTsdTsdAsdAsdCsdGsdCsdGsGbsTbsAb 947 17 189b TbsGbsCbsCbsdGsdGsdTsdTsdAsdAsdCsdGsdCsGbsGbsTbsAb 948 13 190b CbsGbsGbsdTsdTsdAsdAsdCsdGsdCsdGsGbsTb 949 13 191b CbsCbsGbsdGsdTsdTsdAsdAsdCsdGsdCsGbsGb 949 14 192b GbsCbsCbsdGsdGsdTsdTsdAsdAsdCsdGsCbsGbsGb 949 15 193b TbsGbsCbsdCsdGsdGsdTsdTsdAsdAsdCsdGsCbsGbsGb 950 13 194b GbsCbsCbsdGsdGsdTsdTsdAsdAsdCsdGsCbsGb 950 15 195b CbsTbsGbsdCsdCsdGsdGsdTsdTsdAsdAsdCsGbsCbsGb 950 16 196b GbsCbsTbsdGsdCsdCsdGsdGsdTsdTsdAsdAsdCsGbsCbsGb 1387 16 197b AbsTbsGbsdCsdCsdGsdCsdGsdTsdCsdAsdGsdGsTbsAbsCb 1392 13 198b AbsCbsAbsdTsdGsdCsdCsdGsdCsdGsdTsCbsAb 1393 16 199b GbsAbsTbsdGsdAsdCsdAsdTsdGsdCsdCsdGsdCsGbsTbsCb 1393 16 199c GbsAbsTbsdGsdAsdCsdAsdTsdGsdCsdCsdGsCbsGbsTbsCb 1393 16 199d GbsAbsTbsGbsdAsdCsdAsdTsdGsdCsdCsdGsdCsGbsTbsCb 1393 16 199e GbsAbsTbsGbsdAsdCsdAsdTsdGsdCsdCsdGsCbsGbsTbsCb 1394 12 200b GbsAbsdCsdAsdTsdGsdCsdCsdGsdCsGbsTb 1394 15 201b GbsAbsTbsdGsdAsdCsdAsdTsdGsdCsdCsdGsCbsGbsTb 1395 13 202b AbsTbsGbsdAsdCsdAsdTsdGsdCsdCsdGsCbsGb 1805 17 203b TbsCbsCbsCbsdGsdCsdAsdCsdCsdTsdTsdGsdGsAbsAbsCbsCb 1851 16 204b CbsGbsAbsdTsdCsdTsdCsdTsdCsdAsdAsdCsdAsCbsGbsTb 1851 17 205b TbsCbsGbsAbsdTsdCsdTsdCsdTsdCsdAsdAsdCsAbsCbsGbsTb 1852 15 206b CbsGbsAbsdTsdCsdTsdCsdTsdCsdAsdAsdCsAbsCbsGb 1852 16 207b TbsCbsGbsdAsdTsdCsdTsdCsdTsdCsdAsdAsdCsAbsCbsGb

1852 17 208b CbsTbsCbsGbsdAsdTsdCsdTsdCsdTsdCsdAsdAsCbsAbsCbsGb 2064 16 209b GbsTbsdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsCb 2064 16 209c GbsTbsAbsGbsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsCb 2064 16 209d GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsCb 2064 16 209e GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGbsCb 2064 16 209f GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsGbsAbsGbsCb 2064 16 209g GbsTbsAbsGbsdTsdGsdTsdTsdTsdAsdGsdGsGbsAbsGbsCb 2064 16 209h GbsTbsdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsCb 2064 16 209i GbsTbsAbsGbsTbsdGsdTsdTsdTsdAsdGsdGsGbsAbsGbsCb 2064 16 209j GbsTbsAbsGbsdTsdGsdTsdTsdTsdAsdGsGbsGbsAbsGbsCb 2064 16 209k GbsTbsAbsGbsTbsdGsdTsdTsdTsdAsdGsGbsGbsAbsGbsCb 2072 16 210b GbsCbsdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 2072 16 210c GbsCbsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTbsTb 2072 16 210d GbsCbsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 2072 16 210e GbsCbsTbsAbsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 2072 16 210f GbsCbsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsTbsGbsTbsTb 2072 16 210g GbsCbsTbsAbsdTsdTsdTsdGsdGsdTsdAsdGsTbsGbsTbsTb 2284 15 211b AbsGbsCbsdTsdTsdAsdTsdCsdCsdTsdAsdTsGbsAbsCb 2284 15 211c AbsGbsCbsdTsdTsdAsdTsdCsdCsdTsdAsTbsGbsAbsCb 2284 15 211d AbsGbsCbsTbsdTsdAsdTsdCsdCsdTsdAsdTsGbsAbsCb 2285 14 212b AbsGbsdCsdTsdTsdAsdTsdCsdCsdTsdAsTbsGbsAb 2285 14 212c AbsGbsCbsdTsdTsdAsdTsdCsdCsdTsdAsdTsGbsAb 2285 14 212d AbsGbsCbsdTsdTsdAsdTsdCsdCsdTsdAsTbsGbsAb 2355 17 213b CbsAbsGbsdGsdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsGbsTbsGb 2355 17 213c CbsAbsGbsGbsdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsGbsTbsGb 2355 17 213d CbsAbsGbsdGsdCsdAsdTsdTsdAsdAsdTsdAsdAsAbsGbsTbsGb 2355 17 213e CbsAbsGbsGbsdCsdAsdTsdTsdAsdAsdTsdAsdAsAbsGbsTbsGb 4217 16 218d CbsAbsTbsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsGbsTbsAb 4217 16 218e CbsAbsTbsdGsdAsdAsdTsdGsdGsdAsdCsdCsAbsGbsTbsAb 4217 16 218f CbsAbsTbsGbsdAsdAsdTsdGsdGsdAsdCsdCsdAsGbsTbsAb 4217 16 218g CbsAbsTbsGbsdAsdAsdTsdGsdGsdAsdCsdCsAbsGbsTbsAb 4120 16 214 CbsTbsAbsdGsdGsdCsdGsdCsdCsdTsdCsdTsdAsTbsGbsCb 4121 14 215b TbsAbsGbsdGsdCsdGsdCsdCsdTsdCsdTsAbsTbsGb 4121 15 216b CbsTbsAbsdGsdGsdCsdGsdCsdCsdTsdCsdTsAbsTbsGb 4122 13 217b TbsAbsGbsdGsdCsdGsdCsdCsdTsdCsdTsAbsTb

TABLE-US-00034 TABLE 3 Seq SP L ID No. Sequence, 5'-3' 2064 16 209m GbsTbsAbsGbsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsC*b 2064 16 209n GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsC*b 2064 16 209o GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGbsC*b 2064 16 209p GbsTbsAbsdGsdTsdGsdTsdTsdTsdAsdGsdGsGbsAbsGbsC*b 2064 16 209q GbsTbsAbsGbsdTsdGsdTsdTsdTsdAsdGsdGsGbsAbsGbsC*b 2064 16 209r GbsTbsdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAbsGbsC*b 429 15 152e C*bsGbsAbsTbsdAsdC*sdGsdC*sdGsdTsdC*sdC*sAbsC*bsAb 4217 16 -218j C*bsAbsTbsdGsdAsdAsdTsdGsdGsdAsdC*sdC*sAbsGbsTbsAb 2355 17 213f C*bsAbsGbsdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsAbsGbsTbsGb 2355 17 213g C*bsAbsGbsdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGbsTbsGb 432 12 155e C*bsGbsdAsdTsdAsdC*sdGsdC*sdGsdTsC*bsC*b 4217 16 218h C*bsAbsTbsGbsdAsdAsdTsdGsdGsdAsdC*sdC*sAbsGbsTbsAb 2072 16 210h GbsC*bsTbsAbsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 2072 16 210i GbsC*bsdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 432 12 155f C*bsGbsdAsdTsdAsdC*sdGsdC*sdGsdTsdC*sC*b 2072 16 210j GbsC*bsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTbsTb 432 12 155g C*bsdGsdAsdTsdAsdC*sdGsdC*sdGsdTsC*bsC*b 431 13 153d C*bsGbsAbsdTsdAsdC*sdGsdC*sdGsdTsdC*sC*bsAb 429 15 152f C*bsGbsAbsdTsdAsdC*sdGsdC*sdGsdTsdC*sdC*sAbsC*bsAb 4217 16 218i C*bsAbsTbsGbsdAsdAsdTsdGsdGsdAsdC*sdC*sdAsGbsTbsAb 1393 16 199f GbsAbsTbsdGsdAsdC*sdAsdTsdGsdC*sdC*sdGsdC*sGbsTbsC*b 2285 14 212e AbsGbsC*bsdTsdTsdAsdTsdC*sdC*sdTsdAsdTsGbsAb 355 14 143e C*bsTbsdC*sdGsdTsdC*sdAsdTsdAsdGsdAsC*bsC*bsGb 2072 16 210k GbsC*bsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGbsTbsTb 1393 16 199g GbsAbsTbsdGsdAsdC*sdAsdTsdGsdC*sdC*sdGsC*bsGbsTbsC*b 2355 17 213h C*bsAbsGbsGbsdC*sdAsdTsdTsdAsdAsdTsdAsdAsAbsGbsTbsGb 429 15 152g C*bsGbsAbsdTsdAsdC*sdGsdC*sdGsdTsdC*sC*bsAbsC*bsAb 2285 14 212f AbsGbsC*bsdTsdTsdAsdTsdC*sdC*sdTsdAsTbsGbsAb 355 14 143f C*bsTbsC*bsdGsdTsdC*sdAsdTsdAsdGsdAsC*bsC*bsGb 1393 16 199h GbsAbsTbsGbsdAsdC*sdAsdTsdGsdC*sdC*sdGsC*bsGbsTbsC*b 1393 16 199i GbsAbsTbsGbsdAsdC*sdAsdTsdGsdC*sdC*sdGsdC*sGbsTbsC*b 4217 16 218k C*bsAbsTbsdGsdAsdAsdTsdGsdGsdAsdC*sdC*sdAsGbsTbsAb 2285 14 212g AbsGbsdC*sdTsdTsdAsdTsdC*sdC*sdTsdAsTbsGbsAb 434 13 162d TbsGbsGbsdC*sdGsdAsdTsdAsdC*sdGsdC*sGbsTb 383 14 148e AbsGbsC*bsdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sdC*sAbsTb 431 13 153e C*bsGbsdAsdTsdAsdC*sdGsdC*sdGsdTsC*bsC*bsAb 2284 15 211e AbsGbsC*bsdTsdTsdAsdTsdC*sdC*sdTsdAsdTsGbsAbsC*b 355 14 143g C*bsTbsC*bsdGsdTsdC*sdAsdTsdAsdGsdAsdC*sC*bsGb 2284 15 211f AbsGbsC*bsdTsdTsdAsdTsdC*sdC*sdTsdAsTbsGbsAbsC*b 383 14 148f AbsGbsC*bsdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sC*bsAbsTb 383 14 148g AbsGbsdC*sdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sC*bsAbsTb 382 16 147g C*bsAbsGbsdC*sdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sdC*sAbsTbsGb 2072 16 210m GbsC*bsTbsdAsdTsdTsdTsdGsdGsdTsdAsdGsTbsGbsTbsTb 2072 16 210n GbsC*bsTbsAbsdTsdTsdTsdGsdGsdTsdAsdGsTbsGbsTbsTb 434 13 162e TbsGbsdGsdC*sdGsdAsdTsdAsdC*sdGsC*bsGbsTb 2284 15 211g AbsGbsC*bsTbsdTsdAsdTsdC*sdC*sdTsdAsdTsGbsAbsC*b 382 16 147h C*bsAbsGbsdC*sdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sC*bsAbsTbsGb 382 16 147i C*bsAbsGbsC*bsdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sdC*sAbsTbsGb 382 16 147j C*bsAbsGbsdC*sdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sdC*sAbsTbsGb 2355 17 213i C*bsAbsGbsGbsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGbsTbsGb 382 16 147k C*bsAbsGbsC*bsdC*sdC*sdC*sdC*sdGsdAsdC*sdC*sC*bsAbsTbsGb

Preferred Antisense-Oligonucleotides

[0375] In the following preferred antisense-oligonucleotides of the present invention are disclosed.

[0376] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5`-N`-GTCATAGA-N.sup.2-3' (Seq. ID No. 12) or 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98) or 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10) or 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11) or 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100) or 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.1 represents: CATGGCAGACCCCGCTGCTC-, ATGGCAGACCCCGCTGCTC-, TGGCAGACCCCGCTGCTC-, GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, -CCGAGCCCCCAGCGCAG, -CCGAGCCCCCAGCGCAGC, -CCGAGCCCCCAGCGCAGCG, or -CCGAGCCCCCAGCGCAGCGG; N.sup.3 represents: GGTGGGATCGTGCTGGCGAT-, GTGGGATCGTGCTGGCGAT-, TGGGATCGTGCTGGCGAT-, GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGCGGC, -ACAGGACGATGTGCAGCGG, -ACAGGACGATGTGCAGCG, -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; N.sup.5 represents: GCCCAGCCTGCCCCAGAAGAGCTA-, CCCAGCCTGCCCCAGAAGAGCTA-, CCAGCCTGCCCCAGAAGAGCTA-, CAGCCTGCCCCAGAAGAGCTA-, AGCCTGCCCCAGAAGAGCTA-, GCCTGCCCCAGAAGAGCTA-, CCTGCCCCAGAAGAGCTA-, CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCTTCAGGAA, -TGTTTAGGGAGCCGTCTTCAGGA, -TGTTTAGGGAGCCGTCTTCAGG, -TGTTTAGGGAGCCGTCTTCAG, -TGTTTAGGGAGCCGTCTTCA, -TGTTTAGGGAGCCGTCTTC, -TGTTTAGGGAGCCGTCTT, -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T; N.sup.7 represents: TGAATCTTGAATATCTCATG-, GAATCTTGAATATCTCATG-, AATCTTGAATATCTCATG-, ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; N.sup.8 represents: -AGTATTCTAGAAACTCACCA, -AGTATTCTAGAAACTCACC, -AGTATTCTAGAAACTCAC, -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; N.sup.9 represents: ATTCATATTTATATACAGGC-, TTCATATTTATATACAGGC-, TCATATTTATATACAGGC-, CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sup.10 represents: -AGTGCAAATGTTATTGGCTA, -AGTGCAAATGTTATTGGCT, -AGTGCAAATGTTATTGGC, -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; N.sup.11 represents: TGCCCCAGAAGAGCTATTTGGTAG-, GCCCCAGAAGAGCTATTTGGTAG-, CCCCAGAAGAGCTATTTGGTAG-, CCCAGAAGAGCTATTTGGTAG-, CCAGAAGAGCTATTTGGTAG-, CAGAAGAGCTATTTGGTAG-, AGAAGAGCTATTTGGTAG-, GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAATCTTCTCC, -GAGCCGTCTTCAGGAATCTTCTC, -GAGCCGTCTTCAGGAATCTTCT, -GAGCCGTCTTCAGGAATCTTC, -GAGCCGTCTTCAGGAATCTT, -GAGCCGTCTTCAGGAATCT, -GAGCCGTCTTCAGGAATC, -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G; or wherein N.sup.1 to N.sup.12 represent any of the limited lists of residues as disclosed herein, and salts and optical isomers of the antisense-oligonucleotide.

[0377] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12), wherein

N.sup.1 represents: GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, or -CCGAGCCCCCAGCGCAG; and salts and optical isomers of the antisense-oligonucleotide. N.sup.1 and/or N.sup.2 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0378] Especially preferred gapmer antisense-oligonucleotides falling under general formula S1:

TABLE-US-00035 S1 (Seq. ID No. 12) 5'-N.sup.1-GTCATAGA-N.sup.2-3'

are the following:

TABLE-US-00036 (Seq. ID No. 19) CCGCTGCTCGTCATAGAC (Seq. ID No. 20) CGCTGCTCGTCATAGACC (Seq. ID No. 21) GCTGCTCGTCATAGACCG (Seq. ID No. 22) CTGCTCGTCATAGACCGA (Seq. ID No. 23) TGCTCGTCATAGACCGAG (Seq. ID No. 24) GCTCGTCATAGACCGAGC (Seq. ID No. 25) CTCGTCATAGACCGAGCC (Seq. ID No. 26) TCGTCATAGACCGAGCCC (Seq. ID No. 27) CGTCATAGACCGAGCCCC (Seq. ID No. 28) CGCTGCTCGTCATAGAC (Seq. ID No. 29) GCTGCTCGTCATAGACC (Seq. ID No. 30) CTGCTCGTCATAGACCG (Seq. ID No. 31) TGCTCGTCATAGACCGA (Seq. ID No. 32) GCTCGTCATAGACCGAG (Seq. ID No. 33) CTCGTCATAGACCGAGC (Seq. ID No. 34) TCGTCATAGACCGAGCC (Seq. ID No. 35) CGTCATAGACCGAGCCC (Seq. ID No. 36) GCTGCTCGTCATAGAC (Seq. ID No. 37) CTGCTCGTCATAGACC (Seq. ID No. 38) TGCTCGTCATAGACCG (Seq. ID No. 39) GCTCGTCATAGACCGA (Seq. ID No. 40) CTCGTCATAGACCGAG (Seq. ID No. 41) TCGTCATAGACCGAGC (Seq. ID No. 42) CGTCATAGACCGAGCC (Seq. ID No. 43) CTGCTCGTCATAGAC (Seq. ID No. 44) TGCTCGTCATAGACC (Seq. ID No. 45) GCTCGTCATAGACCG (Seq. ID No. 46) CTCGTCATAGACCGA (Seq. ID No. 47) TCGTCATAGACCGAG (Seq. ID No. 48) CGTCATAGACCGAGC (Seq. ID No. 49) TGCTCGTCATAGAC (Seq. ID No. 50) GCTCGTCATAGACC (Seq. ID No. 51) CTCGTCATAGACCG (Seq. ID No. 52) TCGTCATAGACCGA (Seq. ID No. 53) CGTCATAGACCGAG

[0379] The antisense-oligonucleotides of formula S1 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0380] The antisense-oligonucleotides of formula S1 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S1 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S1 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0381] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S1 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0382] The preferred gapmer structure of the antisense-oligonucleotides of formula S1 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0383] As LNA units for the antisense-oligonucleotides of formula S1 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0384] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0385] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--=--X''--P(.dbd.X')(X'')--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0386] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12), wherein

N.sup.1 represents: GGCAGACCCCGCTGCTC-, GCAGACCCCGCTGCTC-, CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, -CCGAGCCCCCAGCGC, -CCGAGCCCCCAGCGCA, or -CCGAGCCCCCAGCGCAG; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0387] More preferably N.sup.1 represents: CAGACCCCGCTGCTC-, AGACCCCGCTGCTC-, GACCCCGCTGCTC-, ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and

N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, -CCGAGCCCCC, -CCGAGCCCCCA, -CCGAGCCCCCAG, -CCGAGCCCCCAGC, -CCGAGCCCCCAGCG, or -CCGAGCCCCCAGCGC.

[0388] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.1-GTCATAGA-N.sup.2-3' (Seq. ID No. 12), wherein

N.sup.1 represents: ACCCCGCTGCTC-, CCCCGCTGCTC-, CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; preferably N.sup.1 represents: CCCGCTGCTC-, CCGCTGCTC-, CGCTGCTC-, GCTGCTC-, CTGCTC-, TGCTC-, GCTC-, CTC-, TC-, or C-; and N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, or -CCGAGCCCCC, -CCGAGCCCCCA, or -CCGAGCCCCCAG; preferably N.sup.2 represents: -C, -CC, -CCG, -CCGA, -CCGAG, -CCGAGC, -CCGAGCC, -CCGAGCCC, -CCGAGCCCC, or -CCGAGGOCCC; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0389] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 19 to Seq. ID No. 53 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0390] Also especially preferred are the gapmer antisense-oligonucleotides of Table 4 (Seq. ID No. 232a to 244b).

[0391] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98), wherein

N.sup.3 represents: GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; N.sup.4 represents: -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; and salts and optical isomers of the antisense-oligonucleotide. N.sup.3 and/or N.sup.4 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0392] Especially preferred gapmer antisense-oligonucleotides falling under general formula S2:

TABLE-US-00037 S2 (Seq. ID No. 98) 5'-N.sup.3-ACGCGTCC-N.sup.4-3'

are the following:

TABLE-US-00038 (Seq. ID No. 54) GCTGGCGATACGCGTCCA (Seq. ID No. 55) CTGGCGATACGCGTCCAC (Seq. ID No. 56) TGGCGATACGCGTCCACA (Seq. ID No. 57) GGCGATACGCGTCCACAG (Seq. ID No. 58) GCGATACGCGTCCACAGG (Seq. ID No. 59) CGATACGCGTCCACAGGA (Seq. ID No. 60) GATACGCGTCCACAGGAC (Seq. ID No. 61) ATACGCGTCCACAGGACG (Seq. ID No. 62) TACGCGTCCACAGGACGA (Seq. ID No. 63) CTGGCGATACGCGTCCA (Seq. ID No. 64) TGGCGATACGCGTCCAC (Seq. ID No. 65) GGCGATACGCGTCCACA (Seq. ID No. 66) GCGATACGCGTCCACAG (Seq. ID No. 67) CGATACGCGTCCACAGG (Seq. ID No. 68) GATACGCGTCCACAGGA (Seq. ID No. 349) ATACGCGTCCACAGGAC (Seq. ID No. 350) TACGCGTCCACAGGACG (Seq. ID No. 351) TGGCGATACGCGTCCA (Seq. ID No. 352) GGCGATACGCGTCCAC (Seq. ID No. 353) GCGATACGCGTCCACA (Seq. ID No. 354) CGATACGCGTCCACAG (Seq. ID No. 355) GATACGCGTCCACAGG (Seq. ID No. 356) ATACGCGTCCACAGGA (Seq. ID No. 357) TACGCGTCCACAGGAC (Seq. ID No. 358) GGCGATACGCGTCCA (Seq. ID No. 359) GCGATACGCGTCCAC (Seq. ID No. 360) CGATACGCGTCCACA (Seq. ID No. 361) GATACGCGTCCACAG (Seq. ID No. 362) ATACGCGTCCACAGG (Seq. ID No. 363) TACGCGTCCACAGGA (Seq. ID No. 364) GCGATACGCGTCCA (Seq. ID No. 365) CGATACGCGTCCAC (Seq. ID No. 366) GATACGCGTCCACA (Seq. ID No. 367) ATACGCGTCCACAG (Seq. ID No. 368) TACGCGTCCACAGG

[0393] The antisense-oligonucleotides of formula S2 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0394] The antisense-oligonucleotides of formula S2 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S2 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S2 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0395] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S2 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0396] The preferred gapmer structure of the antisense-oligonucleotides of formula S2 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0397] As LNA units for the antisense-oligonucleotides of formula S2 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0398] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0399] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--=--X''--P(.dbd.X')(X.sup.-)--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0400] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98), wherein

N.sup.3 represents: GGGATCGTGCTGGCGAT-, GGATCGTGCTGGCGAT-, GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACGATGTGCAGC, -ACAGGACGATGTGCAG, -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A, and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0401] More preferably N.sup.3 represents: GATCGTGCTGGCGAT-, ATCGTGCTGGCGAT-, TCGTGCTGGCGAT-, CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and

N.sup.4 represents: -ACAGGACGATGTGCA, -ACAGGACGATGTGC, -ACAGGACGATGTG, -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A.

[0402] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.3-ACGCGTCC-N.sup.4-3' (Seq. ID No. 98), wherein

N.sup.3 represents: CGTGCTGGCGAT-, GTGCTGGCGAT-, TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; preferably N.sup.3 represents: TGCTGGCGAT-, GCTGGCGAT-, CTGGCGAT-, TGGCGAT-, GGCGAT-, GCGAT-, CGAT-, GAT-, AT-, or T-; and N.sup.4 represents: -ACAGGACGATGT, -ACAGGACGATG, -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; preferably N.sup.4 represents: -ACAGGACGAT, -ACAGGACGA, -ACAGGACG, -ACAGGAC, -ACAGGA, -ACAGG, -ACAG, -ACA, -AC, or -A; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0403] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 54 to Seq. ID No. 68 and Seq. ID No. 349 to Seq. ID No. 368 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0404] Also especially preferred are the gapmer antisense-oligonucleotides of Table 5 (Seq. ID No. 245a to 257b).

[0405] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10), wherein

N.sup.11 represents: GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G; and salts and optical isomers of the antisense-oligonucleotide. N.sup.11 and/or N.sup.12 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0406] Especially preferred gapmer antisense-oligonucleotides falling under general formula S3:

TABLE-US-00039 S3 (Seq. ID No. 10) 5'-N.sup.11-TGTTTAGG-N.sup.12-3'

are the following:

TABLE-US-00040 (Seq. ID No. 369) ATTTGGTAGTGTTTAGGG (Seq. ID No. 370) TTTGGTAGTGTTTAGGGA (Seq. ID No. 371) TTGGTAGTGTTTAGGGAG (Seq. ID No. 372) TGGTAGTGTTTAGGGAGC (Seq. ID No. 373) GGTAGTGTTTAGGGAGCC (Seq. ID No. 374) GTAGTGTTTAGGGAGCCG (Seq. ID No. 375) TAGTGTTTAGGGAGCCGT (Seq. ID No. 376) AGTGTTTAGGGAGCCGTC (Seq. ID No. 377) GTGTTTAGGGAGCCGTCT (Seq. ID No. 378) TTTGGTAGTGTTTAGGG (Seq. ID No. 379) TTGGTAGTGTTTAGGGA (Seq. ID No. 380) TGGTAGTGTTTAGGGAG (Seq. ID No. 381) GGTAGTGTTTAGGGAGC (Seq. ID No. 382) GTAGTGTTTAGGGAGCC (Seq. ID No. 383) TAGTGTTTAGGGAGCCG (Seq. ID No. 384) AGTGTTTAGGGAGCCGT (Seq. ID No. 385) GTGTTTAGGGAGCCGTC (Seq. ID No. 386) TTGGTAGTGTTTAGGG (Seq. ID No. 387) TGGTAGTGTTTAGGGA (Seq. ID No. 388) GGTAGTGTTTAGGGAG (Seq. ID No. 389) GTAGTGTTTAGGGAGC (Seq. ID No. 390) TAGTGTTTAGGGAGCC (Seq. ID No. 391) AGTGTTTAGGGAGCCG (Seq. ID No. 392) GTGTTTAGGGAGCCGT (Seq. ID No. 393) TGGTAGTGTTTAGGG (Seq. ID No. 394) GGTAGTGTTTAGGGA (Seq. ID No. 395) GTAGTGTTTAGGGAG (Seq. ID No. 396) TAGTGTTTAGGGAGC (Seq. ID No. 397) AGTGTTTAGGGAGCC (Seq. ID No. 398) GTGTTTAGGGAGCCG (Seq. ID No. 399) GGTAGTGTTTAGGG (Seq. ID No. 400) GTAGTGTTTAGGGA (Seq. ID No. 401) TAGTGTTTAGGGAG (Seq. ID No. 402) AGTGTTTAGGGAGC (Seq. ID No. 403) GTGTTTAGGGAGCC

[0407] The antisense-oligonucleotides of formula S3 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0408] The antisense-oligonucleotides of formula S3 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S3 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S3 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0409] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S3 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0410] The preferred gapmer structure of the antisense-oligonucleotides of formula S3 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0411] As LNA units for the antisense-oligonucleotides of formula S3 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0412] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0413] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--=--X''--P(.dbd.X')(X.sup.-)--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0414] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10), wherein

N.sup.11 represents: GAAGAGCTATTTGGTAG-, AAGAGCTATTTGGTAG-, AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-, N.sup.12 represents: -GAGCCGTCTTCAGGAAT, -GAGCCGTCTTCAGGAA, -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G; the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0415] More preferably N.sup.11 represents: AGAGCTATTTGGTAG-, GAGCTATTTGGTAG-, AGCTATTTGGTAG-, GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; and

N.sup.12 represents: -GAGCCGTCTTCAGGA, -GAGCCGTCTTCAGG, -GAGCCGTCTTCAG, -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G.

[0416] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.11-TGTTTAGG-N.sup.12-3' (Seq. ID No. 10), wherein

N.sup.11 represents: GCTATTTGGTAG-, CTATTTGGTAG-, TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; preferably N.sup.11 represents: TATTTGGTAG-, ATTTGGTAG-, TTTGGTAG-, TTGGTAG-, TGGTAG-, GGTAG-, GTAG-, TAG-, AG- or G-; and N.sup.12 represents: -GAGCCGTCTTCA, -GAGCCGTCTTC, -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G; preferably N.sup.12 represents: -GAGCCGTCTT, -GAGCCGTCT, -GAGCCGTC, -GAGCCGT, -GAGCCG, -GAGCC, -GAGC, -GAG, -GA, or -G; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0417] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 369 to Seq. ID No. 403 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0418] Also especially preferred are the gapmer antisense-oligonucleotides of Table 6 (Seq. ID No. 258a to 270b).

[0419] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11), wherein

N.sup.5 represents: CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; N.sup.6 represents: -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T; and salts and optical isomers of the antisense-oligonucleotide. N.sup.5 and/or N.sup.6 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0420] Especially preferred gapmer antisense-oligonucleotides falling under general formula S4:

TABLE-US-00041 S4 (Seq. ID No. 11) 5'-N.sup.5-TTTGGTAG-N.sup.6-3'

are the following:

TABLE-US-00042 (Seq. ID No. 404) GAAGAGCTATTTGGTAGT (Seq. ID No. 405) AAGAGCTATTTGGTAGTG (Seq. ID No. 406) AGAGCTATTTGGTAGTGT (Seq. ID No. 407) GAGCTATTTGGTAGTGTT (Seq. ID No. 408) AGCTATTTGGTAGTGTTT (Seq. ID No. 409) GCTATTTGGTAGTGTTTA (Seq. ID No. 410) CTATTTGGTAGTGTTTAG (Seq. ID No. 411) TATTTGGTAGTGTTTAGG (Seq. ID No. 412) ATTTGGTAGTGTTTAGGG (Seq. ID No. 413) AAGAGCTATTTGGTAGT (Seq. ID No. 414) AGAGCTATTTGGTAGTG (Seq. ID No. 415) GAGCTATTTGGTAGTGT (Seq. ID No. 416) AGCTATTTGGTAGTGTT (Seq. ID No. 417) GCTATTTGGTAGTGTTT (Seq. ID No. 418) CTATTTGGTAGTGTTTA (Seq. ID No. 419) TATTTGGTAGTGTTTAG (Seq. ID No. 420) ATTTGGTAGTGTTTAGG (Seq. ID No. 421) AGAGCTATTTGGTAGT (Seq. ID No. 422) GAGCTATTTGGTAGTG (Seq. ID No. 423) AGCTATTTGGTAGTGT (Seq. ID No. 424) GCTATTTGGTAGTGTT (Seq. ID No. 425) CTATTTGGTAGTGTTT (Seq. ID No. 426) TATTTGGTAGTGTTTA (Seq. ID No. 427) ATTTGGTAGTGTTTAG (Seq. ID No. 428) GAGCTATTTGGTAGT (Seq. ID No. 429) AGCTATTTGGTAGTG (Seq. ID No. 430) GCTATTTGGTAGTGT (Seq. ID No. 431) CTATTTGGTAGTGTT (Seq. ID No. 432) TATTTGGTAGTGTTT (Seq. ID No. 433) ATTTGGTAGTGTTTA (Seq. ID No. 434) AGCTATTTGGTAGT (Seq. ID No. 435) GCTATTTGGTAGTG (Seq. ID No. 436) CTATTTGGTAGTGT (Seq. ID No. 437) TATTTGGTAGTGTT (Seq. ID No. 438) ATTTGGTAGTGTTT

[0421] The antisense-oligonucleotides of formula S4 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0422] The antisense-oligonucleotides of formula S4 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S4 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S4 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0423] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S4 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0424] The preferred gapmer structure of the antisense-oligonucleotides of formula S4 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0425] As LNA units for the antisense-oligonucleotides of formula S4 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0426] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0427] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--=--X''--P(.dbd.X')(X.sup.-)--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0428] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11), wherein

N.sup.5 represents: CTGCCCCAGAAGAGCTA-, TGCCCCAGAAGAGCTA-, GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 represents: -TGTTTAGGGAGCCGTCT, -TGTTTAGGGAGCCGTC, -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0429] More preferably N.sup.5 represents: GCCCCAGAAGAGCTA-, CCCCAGAAGAGCTA-, CCCAGAAGAGCTA-, CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and

N.sup.6 represents: -TGTTTAGGGAGCCGT, -TGTTTAGGGAGCCG, -TGTTTAGGGAGCC, -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T.

[0430] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.5-TTTGGTAG-N.sup.6-3' (Seq. ID No. 11)), wherein

N.sup.5 represents: CCAGAAGAGCTA-, CAGAAGAGCTA-, AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; preferably N.sup.5 represents: AGAAGAGCTA-, GAAGAGCTA-, AAGAGCTA-, AGAGCTA-, GAGCTA-, AGCTA-, GCTA-, CTA-, TA-, or A-; and N.sup.6 represents: -TGTTTAGGGAGC, -TGTTTAGGGAG, -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T; preferably N.sup.6 represents: -TGTTTAGGGA, -TGTTTAGGG, -TGTTTAGG, -TGTTTAG, -TGTTTA, -TGTTT, -TGTT, -TGT, -TG, or -T; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0431] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 404 to Seq. ID No. 438 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0432] Also especially preferred are the gapmer antisense-oligonucleotides of Table 7 (Seq. ID No. 271a to 283b).

[0433] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100), wherein

N.sup.7 represents: ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; N.sup.8 represents: -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; and salts and optical isomers of the antisense-oligonucleotide. N.sup.7 and/or N.sup.8 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0434] Especially preferred gapmer antisense-oligonucleotides falling under general formula S6:

TABLE-US-00043 S6 (Seq. ID No. 100) 5'-N.sup.7-AATGGACC-N.sup.8-3'

are the following:

TABLE-US-00044 (Seq. ID No. 439) TATCTCATGAATGGACCA (Seq. ID No. 440) ATCTCATGAATGGACCAG (Seq. ID No. 441) TCTCATGAATGGACCAGT (Seq. ID No. 442) CTCATGAATGGACCAGTA (Seq. ID No. 443) TCATGAATGGACCAGTAT (Seq. ID No. 444) CATGAATGGACCAGTATT (Seq. ID No. 445) ATGAATGGACCAGTATTC (Seq. ID No. 446) TGAATGGACCAGTATTCT (Seq. ID No. 447) GAATGGACCAGTATTCTA (Seq. ID No. 448) ATCTCATGAATGGACCA (Seq. ID No. 449) TCTCATGAATGGACCAG (Seq. ID No. 450) CTCATGAATGGACCAGT (Seq. ID No. 451) TCATGAATGGACCAGTA (Seq. ID No. 452) CATGAATGGACCAGTAT (Seq. ID No. 453) ATGAATGGACCAGTATT (Seq. ID No. 454) TGAATGGACCAGTATTC (Seq. ID No. 455) GAATGGACCAGTATTCT (Seq. ID No. 456) TCTCATGAATGGACCA (Seq. ID No. 457) CTCATGAATGGACCAG (Seq. ID No. 458) TCATGAATGGACCAGT (Seq. ID No. 459) CATGAATGGACCAGTA (Seq. ID No. 460) ATGAATGGACCAGTAT (Seq. ID No. 461) TGAATGGACCAGTATT (Seq. ID No. 462) GAATGGACCAGTATTC (Seq. ID No. 463) CTCATGAATGGACCA (Seq. ID No. 464) TCATGAATGGACCAG (Seq. ID No. 465) CATGAATGGACCAGT (Seq. ID No. 466) ATGAATGGACCAGTA (Seq. ID No. 467) TGAATGGACCAGTAT (Seq. ID No. 468) GAATGGACCAGTATT (Seq. ID No. 469) TCATGAATGGACCA (Seq. ID No. 470) CATGAATGGACCAG (Seq. ID No. 471) ATGAATGGACCAGT (Seq. ID No. 472) TGAATGGACCAGTA (Seq. ID No. 473) GAATGGACCAGTAT

[0435] The antisense-oligonucleotides of formula S6 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0436] The antisense-oligonucleotides of formula S6 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S6 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S6 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0437] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S6 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0438] The preferred gapmer structure of the antisense-oligonucleotides of formula S6 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0439] As LNA units for the antisense-oligonucleotides of formula S6 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0440] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0441] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--.dbd.--X''--P(.dbd.X')(X.sup.-)--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0442] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100), wherein

N.sup.7 represents: ATCTTGAATATCTCATG-, TCTTGAATATCTCATG-, CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 represents: -AGTATTCTAGAAACTCA, -AGTATTCTAGAAACTC, -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0443] More preferably N.sup.7 represents: CTTGAATATCTCATG-, TTGAATATCTCATG-, TGAATATCTCATG-, GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and

N.sup.8 represents: -AGTATTCTAGAAACT, -AGTATTCTAGAAAC, -AGTATTCTAGAAA, -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A.

[0444] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.7-AATGGACC-N.sup.8-3' (Seq. ID No. 100), wherein

N.sup.7 represents: GAATATCTCATG-, AATATCTCATG-, ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; preferably N.sup.7 represents: ATATCTCATG-, TATCTCATG-, ATCTCATG-, TCTCATG-, CTCATG-, TCATG-, CATG-, ATG-, TG-, or G-; and N.sup.8 represents: -AGTATTCTAGAA, -AGTATTCTAGA, -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; preferably N.sup.8 represents: -AGTATTCTAG, -AGTATTCTA, -AGTATTCT, -AGTATTC, -AGTATT, -AGTAT, -AGTA, -AGT, -AG, or -A; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0445] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 439 to Seq. ID No. 473 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0446] Also especially preferred are the gapmer antisense-oligonucleotides of Table 8 (Seq. ID No. 219a to 231b).

[0447] Moreover, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.9 represents: CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sub.10 represents: -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; and salts and optical isomers of the antisense-oligonucleotide. N.sup.9 and/or N.sup.10 may also represent any of the further limited lists of 3' and 5' residues as disclosed herein.

[0448] Especially preferred gapmer antisense-oligonucleotides falling under general formula S7:

TABLE-US-00045 S7 (Seq. ID No. 101) 5'-N.sup.9-ATTAATAA-N.sup.10-3'

are the following:

TABLE-US-00046 (Seq. ID No. 474) TATACAGGCATTAATAAA (Seq. ID No. 475) ATACAGGCATTAATAAAG (Seq. ID No. 476) TACAGGCATTAATAAAGT (Seq. ID No. 477) ACAGGCATTAATAAAGTG (Seq. ID No. 478) CAGGCATTAATAAAGTGC (Seq. ID No. 479) AGGCATTAATAAAGTGCA (Seq. ID No. 480) GGCATTAATAAAGTGCAA (Seq. ID No. 481) GCATTAATAAAGTGCAAA (Seq. ID No. 482) CATTAATAAAGTGCAAAT (Seq. ID No. 483) ATACAGGCATTAATAAA (Seq. ID No. 484) TACAGGCATTAATAAAG (Seq. ID No. 485) ACAGGCATTAATAAAGT (Seq. ID No. 486) CAGGCATTAATAAAGTG (Seq. ID No. 487) AGGCATTAATAAAGTGC (Seq. ID No. 488) GGCATTAATAAAGTGCA (Seq. ID No. 489) GCATTAATAAAGTGCAA (Seq. ID No. 490) CATTAATAAAGTGCAAA (Seq. ID No. 491) TACAGGCATTAATAAA (Seq. ID No. 492) ACAGGCATTAATAAAG (Seq. ID No. 493) CAGGCATTAATAAAGT (Seq. ID No. 494) AGGCATTAATAAAGTG (Seq. ID No. 495) GGCATTAATAAAGTGC (Seq. ID No. 496) GCATTAATAAAGTGCA (Seq. ID No. 497) CATTAATAAAGTGCAA (Seq. ID No. 498) ACAGGCATTAATAAA (Seq. ID No. 499) CAGGCATTAATAAAG (Seq. ID No. 500) AGGCATTAATAAAGT (Seq. ID No. 501) GGCATTAATAAAGTG (Seq. ID No. 502) GCATTAATAAAGTGC (Seq. ID No. 503) CATTAATAAAGTGCA (Seq. ID No. 504) CAGGCATTAATAAA (Seq. ID No. 505) AGGCATTAATAAAG (Seq. ID No. 506) GGCATTAATAAAGT (Seq. ID No. 507) GCATTAATAAAGTG (Seq. ID No. 508) CATTAATAAAGTGC

[0449] The antisense-oligonucleotides of formula S7 in form of gapmers (LNA segment 1-DNA segment-LNA segment 2) contain an LNA segment at the 5' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and contain an LNA segment at the 3' terminal end consisting of 2 to 5, preferably 2 to 4 LNA units and between the two LNA segments one DNA segment consisting of 6 to 14, preferably 7 to 12 and more preferably 8 to 11 DNA units.

[0450] The antisense-oligonucleotides of formula S7 contain the LNA nucleotides (LNA units) as disclosed herein, especially these disclosed in the chapter "Locked Nucleic Acids (LNA.RTM.)" and preferably these disclosed in the chapter "Preferred LNAs". The LNA units and the DNA units may comprise standard nucleobases such as adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), but may also contain modified nucleobases as disclosed in the chapter "Nucleobases". The antisense-oligonucleotides of formula S7 or the LNA segments and the DNA segment of the antisense-oligonucleotide may contain any internucleotide linkage as disclosed herein and especially these disclosed in the chapter "Internucleotide Linkages (IL)". The antisense-oligonucleotides of formula S7 may optionally also contain endgroups at the 3' terminal end and/or the 5' terminal end and especially these disclosed in the chapter "Terminal groups".

[0451] Experiments have shown that modified nucleobases do not considerably increase or change the activity of the inventive antisense-oligonucleotides in regard to tested neurological and oncological indications. The modified nucleobases 5-methylcytosine or 2-aminoadenine have been demonstrated to further increase the activity of the antisense-oligonucleotides of formula S7 especially if 5-methylcytosine is used in the LNA nucleotides only or in the LNA nucleotides and in the DNA nucleotides and/or if 2-aminoadenine is used in the DNA nucleotides and not in the LNA nucleotides.

[0452] The preferred gapmer structure of the antisense-oligonucleotides of formula S7 is as follows: 3-8-3, 4-8-2, 2-8-4, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-2, 2-9-4, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 2-10-4, 4-10-2, 3-10-4, 4-10-3, 4-10-4, 2-11-4, 4-11-2, 3-11-4, 4-11-3 and still more preferred: 3-8-3, 3-8-4, 4-8-3, 4-8-4, 3-9-3, 4-9-3, 3-9-4, 4-9-4, 3-10-3, 3-10-4, 4-10-3, 4-10-4, 3-11-4, and 4-11-3.

[0453] As LNA units for the antisense-oligonucleotides of formula S7 especially .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9) are preferred. Experiments have been shown that all of these LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, b.sup.7, b.sup.8, and b.sup.9 can be synthesized with the required effort and lead to antisense-oligonucleotides of comparable stability and activity. However based on the experiments the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.5, b.sup.6, and b.sup.7 are further preferred. Still further preferred are the LNA units b.sup.1, b.sup.2, b.sup.4, b.sup.6, and b.sup.7, and even more preferred are the LNA units b.sup.1 and b.sup.4 and most preferred also in regard to the complexity of the chemical synthesis is the .beta.-D-oxy-LNA (b.sup.1).

[0454] So far no special 3' terminal group or 5' terminal group could be found which remarkably had changed or increased the stability or activity for oncological or neurological indications, so that 3' and 5' end groups are possible but not explicitly preferred.

[0455] Various internucleotide bridges or internucleotide linkages are possible. In the formulae disclosed herein the internucleotide linkage IL is represented by --IL'-Y--. Thus, IL=--IL'-Y--=--X''--P(.dbd.X')(X.sup.-)--Y--, wherein IL is preferably selected form the group consisting of:

--O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--. Preferred are the internucleotide linkages IL selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, and more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, and still more preferred selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, and most preferably selected from --O--P(O)(O.sup.-)--O-- and --O--P(O)(S.sup.-)--O--.

[0456] Thus, the present invention is preferably directed to an antisense-oligonucleotide in form of a gapmer consisting of 10 to 28 nucleotides, preferably 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 1 to 5 of these nucleotides at the 5' terminal end and 1 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 6, preferably 7 and more preferably 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-R.sub.II or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.9 represents: CATATTTATATACAGGC-, ATATTTATATACAGGC-, TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; N.sup.10 represents: -AGTGCAAATGTTATTGG, -AGTGCAAATGTTATTG, -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-ENA (b.sup.5), .beta.-D-(NH)-LNA (b.sup.6), .beta.-D-(NCH.sub.3)-LNA (b.sup.7), .beta.-D-(ONH)-LNA (b.sup.8) and .beta.-D-(ONCH.sub.3)-LNA (b.sup.9); and preferably from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--, --O--P(O)(CH.sub.3)--O--, --O--P(O)(OCH.sub.3)--O--, --O--P(O)(NH(CH.sub.3))--O--, --O--P(O)[N(CH.sub.3).sub.2]--O--, --O--P(O)(BH.sub.3.sup.-)--O--, --O--P(O)(OCH.sub.2CH.sub.2OCH.sub.3)--O--, --O--P(O)(OCH.sub.2CH.sub.2SCH.sub.3)--O--, --O--P(O)(O.sup.-)--N(CH.sub.3)--, --N(CH.sub.3)--P(O)(O.sup.-)--O--; and preferably from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0457] More preferably N.sup.9 represents: TATTTATATACAGGC-, ATTTATATACAGGC-, TTTATATACAGGC-, TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and

N.sup.10 represents: -AGTGCAAATGTTATT, -AGTGCAAATGTTAT, -AGTGCAAATGTTA, -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A.

[0458] Still further preferred, the present invention is directed to an antisense-oligonucleotide in form of a gapmer consisting of 11 to 24 nucleotides, more preferably 12 to 20, and still more preferably 13 to 19 or 14 to 18 nucleotides and 2 to 5 of these nucleotides at the 5' terminal end and 2 to 5 nucleotides at the 3' terminal end of the antisense-oligonucleotide are LNA nucleotides and between the LNA nucleotides at the 5' terminal end and the 3' terminal end a sequence of at least 7, preferably at least 8 DNA nucleotides is present, and the antisense-oligonucleotide is capable of hybridizing with a region of the gene encoding the TGF-Ru or with a region of the mRNA encoding the TGF-R.sub.II, wherein the antisense-oligonucleotide is represented by the following sequence 5'-N.sup.9-ATTAATAA-N.sup.10-3' (Seq. ID No. 101), wherein

N.sup.9 represents: TTATATACAGGC-, TATATACAGGC-, ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; preferably N.sup.9 represents: ATATACAGGC-, TATACAGGC-, ATACAGGC-, TACAGGC-, ACAGGC-, CAGGC-, AGGC-, GGC-, GC-, or C-; and N.sup.10 represents: -AGTGCAAATGTT, -AGTGCAAATGT, -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; preferably N.sup.10 represents: -AGTGCAAATG, -AGTGCAAAT, -AGTGCAAA, -AGTGCAA, -AGTGCA, -AGTGC, -AGTG, -AGT, -AG, or -A; and the LNA nucleotides are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7); and the internucleotide linkages are selected from --O--P(O)(O.sup.-)--O--, --O--P(O)(S.sup.-)--O--, --O--P(S)(S.sup.-)--O--, --S--P(O)(O.sup.-)--O--, --S--P(O)(S.sup.-)--O--, --O--P(O)(O.sup.-)--S--, --O--P(O)(S.sup.-)--S--, --S--P(O)(O.sup.-)--S--; and preferably selected from phosphate, phosphorothioate and phosphorodithioate; and salts and optical isomers of the antisense-oligonucleotide. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine and/or 2-aminoadenine.

[0459] Especially preferred are the gapmer antisense-oligonucleotides of Seq. ID No. 474 to Seq. ID No. 508 containing a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 3' terminus and a segment of 2 to 5, preferably 2 to 4 and more preferably 3 to 4 LNA units at the 5' terminus and a segment of at least 6, preferably 7 and more preferably 8 DNA units between the two segments of LNA units, wherein the LNA units are selected from .beta.-D-oxy-LNA (b.sup.1), .beta.-D-thio-LNA (b.sup.2), .alpha.-L-oxy-LNA (b.sup.4), .beta.-D-(NH)-LNA (b.sup.6), and .beta.-D-(NCH.sub.3)-LNA (b.sup.7) and the internucleotide linkages are selected from phosphate, phosphorothioate and phosphorodithioate. Such preferred antisense-oligonucleotides may not contain any modified 3' and 5' terminal end or may not contain any 3' and 5' terminal group and may as modified nucleobase contain 5-methylcytosine in the LNA units, preferably all the LNA units and/or 2-aminoadenine in some or all DNA units and/or 5-methylcytosine in some or all DNA units.

[0460] Also especially preferred are the gapmer antisense-oligonucleotides of Table 9 (Seq. ID No. 284a to 236b).

TABLE-US-00047 TABLE 4 Seq ID SP L No. Sequence, 5'-3' 357 10 232a C*b.sup.1sGb.sup.1sdTsdC*sdAsdTsdAsdGsAb.sup.1sC*b.sup.1 357 10 232b C*b.sup.1Gb.sup.1dTdC*dAdTdAdGAb.sup.1C*b.sup.1 356 12 233a Tb.sup.1sC*b.sup.1sGb.sup.1sdTsdC*sdAsdTsdAsdGsAb.sup.1sC*b.sup.1sC*b.sup- .1 356 12 233b Tb.sup.1C*b.sup.1Gb.sup.1dTdC*dAdTdAdGAb.sup.1C*b.sup.1C*b.sup.1 356 12 233c Tb.sup.1sC*b.sup.1sGb.sup.1sdTsdC*sdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1 356 12 233d Tb.sup.1sdC*sdGsdTsdC*sdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1 356 12 233e Tb.sup.1sC*b.sup.1sdGsdTsdCsdAsdTsdAsdGsdAsdC*sC*b.sup.1 355 13 234a Tb.sup.1sC*b.sup.1sGb.sup.1sTb.sup.1sdCsdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.- 1sGb.sup.1 355 13 234b Tb.sup.1C*b.sup.1Gb.sup.1Tb.sup.1dCdAdUdAdGdAC*b.sup.1C*b.sup.1Gb.sup.1 355 13 234c Tb.sup.1sC*b.sup.1sGb.sup.1sTb.sup.1sdC*sdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup- .1sGb.sup.1 355 13 234d Tb.sup.1sC*b.sup.1sGb.sup.1sdTsdC*sdA*sdTsdA*sdGsdA*sdC*sC*b.sup.1sGb.sup- .1 355 13 234e Tb.sup.1sC*b.sup.1sdGsdTsdC*sdAsdTsdA*sdGsdA*sdC*sdCsGb.sup.1 355 13 234f Tb.sup.1sdCsdGsdTsdC*sdA*sdTsdAsdGsAb.sup.1sC*b.sup.1sC*b.sup.1sGb.sup.1 354 13 142c C*b.sup.1sGb.sup.1sTb.sup.1sdCsdAsdTsdAsdGsdAsdCsdCsGb.sup.1sAb.sup.1 355 14 143i C*b.sup.1sTb.sup.1sC*b.sup.1sGb.sup.1sdTsdCsdAsdTsdAsdGsAb.sup.1sC*b.sup.- 1sC*b.sup.1sGb.sup.1 355 14 143j C*b.sup.4ssTb.sup.4ssC*b.sup.4ssdGssdTssdCssdAssdTssdAssdGssdA*ssC*b.sup.- 4ssC*b.sup.4ss Gb.sup.4 355 14 143h C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1sGb.sup.- 1 355 14 143k C*b.sup.2ssTb.sup.2ssC*b.sup.2ssdGssdTssdCssdAssdTssdAssdGssdAssC*b.sup.2- ssC*b.sup.2ssG b.sup.2 355 14 143m C*b.sup.1Tb.sup.1C*b.sup.1Gb.sup.1dUsdCsdAsdTsdAsdGsAb.sup.1C*b.sup.1C*b.- sup.1Gb.sup.1 355 14 143n C*b.sup.1sTb.sup.1sC*b.sup.1sGb.sup.1sTb.sup.1sdCsdA*sdTsdA*sdGsdA*sC*b.s- up.1sC*b.sup.1sGb.sup.1 355 14 1430 C*b.sup.1sTb.sup.1sdCsdGsdUsdCsdAsdUsdAsGb.sup.1sAb.sup.1sC*b.sup.1sC*b.s- up.1sGb.sup.1 355 14 143p C*b.sup.6sTb.sup.6sC*b.sup.6sGb.sup.6sdTsdCsdAsdTsdAsdGsdAsC*b.sup.6sC*b.- sup.6sGb.sup.6 355 14 143q C*b.sup.7sTb.sup.7sC*b.sup.7sdGsdUsdCsdA*sdUsdA*sdGsdA*sC*b.sup.7sC*b.sup- .7sGb.sup.7 355 14 143r C*b.sup.4sTb.sup.4sC*b.sup.4sGb.sup.4sdTsdC*sdA*sdTsdAsdGsdAsdC*sC*b.sup.- 4sGb.sup.4 355 14 143s C*b.sup.4Tb.sup.4C*b.sup.4Gb.sup.4dTdCdAdTdAdGdAdCC*b.sup.4Gb.sup.4 355 14 143t C*b.sup.1ssTb.sup.1ssC*b.sup.1ssdGssdTssdC*ssdAssdTssdAssdGssdAssC*b.sup.- 1ssC*b.sup.1ss Gb.sup.1 355 14 143u C*b.sup.1Tb.sup.1sdCsdGsdUsdC*sdAsd UsdAsdGsdAsC*b.sup.1C*b.sup.1Gb.sup.1 355 14 143v C*b.sup.1Tb.sup.1sdC*sdGsdTsdC*sdA*sdTsdAsdGsdAsC*b1 C*b.sup.1Gb.sup.1 355 14 143w C*b.sup.6sTb.sup.6sdC*dGdTdC*dAdTdAdGdAsC*b.sup.6sC*b.sup.6sGb.sup.6 355 14 143x C*b.sup.7sTb.sup.7sC*b.sup.7sGb.sup.7sdTsdC*sdAsdTsdAsdGsdAsC*b.sup.7sC*b- .sup.7sGb.sup.7 355 14 143y C*b.sup.7sTb.sup.7sdC*sdGsdTsdCsdAsdUsdAsdGsAb.sup.7sC*b.sup.7sC*b.sup.7s- Gb.sup.7 355 14 143z C*b.sup.1sTb.sup.1sdC*sdGsdTsdC*sdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1sGb.su- p.1 355 14 143aa C*b.sup.1Tb.sup.1sdC*sdGsdTsdC*sdAsdTsdAsdGsdAsC*b.sup.1C*b.sup.1Gb.sup.1 355 14 143ab C*b.sup.1sTb.sup.1sdC*sdGsdTsdC*sdA*sdTsdAsdGsdA*sC*b.sup.1sC*b.sup.1sGb.- sup.1 355 14 143ac C*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1sGb.sup- .1 355 14 143ad C*b.sup.1Tb.sup.1dC*dGdTdCdAdTdAdGdAC*b.sup.1C*b.sup.1Gb.sup.1 355 14 143ae C*b.sup.1sTb.sup.1sdC*dGdTdC*dAdTdAdGdAsC*b.sup.1sC*b.sup.1sGb.sup.1 355 14 143af /5SpC3s/C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*dTdAdGdA*sC*b.sup.1sC*b.sup.1sGb.- sup.1 355 14 143ag C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*dTdAdGdA*sC*b.sup.1sC*b.sup.1sGb.sup.1/3S- pC3s/ 355 14 143ah /5SpC3s/C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*dTdAdGdA*sC*b.sup.1sC*b.sup.1sGb.- sup.1/3SpC3s/ 355 14 143ai C*b.sup.1sTb.sup.1sdC*sdGsdUsdC*sdA*sdUsdA*sdGsdA*sC*b.sup.1sC*b.sup.1sGb- .sup.1 355 14 143aj C*b.sup.1sTb.sup.1sC*b.sup.1sdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.1s- Gb.sup.1 356 14 145c Gb.sup.1sC*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGsAb.sup.1sC*b.sup.1sC*- b.sup.1 354 15 235i C*b.sup.1sTb.sup.1sC*b.sup.1sGb.sup.1sdTdC*dAdTdAdGdAsC*b.sup.1sC*b.sup.1- sGb.sup.1sAb.sup.1 354 15 235a C*b.sup.1ssTb.sup.1ssdCssdGssdTssdCssdAssdTssdAssdGssdAssdCssdCssdGssAb.s- up.1 354 15 235b C*b.sup.1Tb.sup.1dCdGdTdCdAdTdAdGdAdCdCdGAb.sup.1 354 15 235c C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdA*sdUsdAsdGsdAsdCsC*b.sup.1sGb.sup.1sAb.s- up.1 354 15 235d C*b.sup.1Tb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.1C*b.sup.1Gb.sup.1Ab- .sup.1 354 15 235e C*b.sup.4sTb.sup.4sC*b.sup.4sdGsdTsdCsdAsdTsdAsdGsdAsdCsdCsGb.sup.4sAb.su- p.4 354 15 235f C*b.sup.6sTb.sup.6sC*b.sup.6sdGdTdCdA*dTdAdGdAdC*sC*b.sup.6sGb.sup.6sAb.s- up.6 354 15 235g C*b.sup.1sTb.sup.1sC*b.sup.1sGb.sup.1sdTsdC*sdAsdTsdAsdGsdAsdC*sdC*sdGsAb- .sup.1 354 15 235h C*b.sup.1ssTb.sup.1ssdCssdGssdUssdCssdAssdUssdAssdGssdAssdCssdCssGb.sup.1 ssAb.sup.1 355 15 144c Gb.sup.1sC*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.1sC*b.sup.- 1sGb.sup.1 354 16 141c Gb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sdGsdTsdC*sdAsdTsdAsdGsdAsC*b.sup.1s- C*b.sup.1sGb.sup.1sAb.sup.1 354 16 141d Gb.sup.1C*b.sup.1Tb.sup.1C*b.sup.1sdGsdTsdC*sdAsdTsdAsdGsdAsdCsC*b.sup.1G- b.sup.1Ab.sup.1 354 16 141e Gb.sup.4sC*b.sup.4sTb.sup.4sC*b.sup.4sdGsdTsdC*sdAsdTsdAsdGsdA*sdC*sdC*sG- b.sup.4sAb.sup.4 354 16 141f Gb.sup.1sdC*sdTsdCsdGsdTsdC*sdA*sdTsdAsdGsdA*sdC*sdC*sdGsAb.sup.1 354 16 141g Gb.sup.2sC*b.sup.2sTb.sup.2sdCsdGsdUsdCsdAsdTsdA*sdGsdAsdCsC*b.sup.2sGb.s- up.2sAb.sup.2 354 16 141h Gb.sup.4ssC*b.sup.4ssTb.sup.4ssdCssdGssdTssdCssdAssdTssdAssdGssdAssC*b.su- p.4ssC*b.sup.4 ssGb.sup.4ssAb.sup.4 354 16 141i Gb.sup.1C*b.sup.1dTdCdGdTdCdA*dTdA*dGdA*dCC*b.sup.1Gb.sup.1Ab.sup.1 354 16 141j Gb.sup.1sC*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGsdAsdCsC*b.sup.1sGb.su- p.1sAb.sup.1 351 16 139c C*b.sup.1sGb.sup.1sTb.sup.1sdCsdAsdTsdAsdGsdAsdCsdCsdGsdAsGb.sup.1sC*b.su- p.1sC*b.sup.1 354 17 237a Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sdGsdTsdC*sdAsdTsdAsdGsAb.s- up.1sC*b.sup.1sC*b.sup.1sGb.sup.1 sAb.sup.1 354 17 237b Tb.sup.2sGb.sup.2sC*b.sup.2sdTsdGsdTsdC*sdAsdTsdAsdGsAb.sup.2sC*b.sup.2sC- *b.sup.2sGb.sup.2sAb.sup.2 354 17 237c Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sC*b.- sup.1sGb.sup.1sAb.sup.1 354 17 237d Tb.sup.1sdGsdCsdUsdC*sdGsdTsdC*sdAsdUsdAsdGsAb.sup.1sC*b.sup.1sC*b.sup.1s- Gb.sup.1sAb.sup.1

354 17 237e Tb.sup.1sGb.sup.1sC*b.sup.1sdTsdGsdTsdC*sdA*sdTsdA*sdGsAb.sup.1sC*b.sup.1- sC*b.sup.1sGb.sup.1sAb.sup.1 354 17 237f Tb.sup.1Gb.sup.1dC*dTdGdTdC*dAdTdAdGdAC*b.sup.1C*b.sup.1Gb.sup.1Ab.sup.1 354 17 237g Tb.sup.1sdGsdC*sdTsdGsdTsdC*sdAsdTsdAsdGsdAsdC*sC*b.sup.1sGb.sup.1sAb.sup- .1 354 17 237h Tb.sup.1Gb.sup.1C*b.sup.1Tb.sup.1C*b.sup.1dGdTdC*dA*dTdA*dGdA*dC*dC*Gb.su- p.1Ab.sup.1 354 17 237i Tb.sup.1ssGb.sup.1ssC*b.sup.1ssTb.sup.1ssC*b.sup.1ssdGssdTssdCssdAssdTssd- AssdGssdAssdC ssC*b.sup.1ssGb.sup.1ssAb.sup.1 354 17 237j Tb.sup.4sGb.sup.4sC*b.sup.4sdTdGdTdCdA*dTdA*dGdA*sC*b.sup.4sC*b.sup.4sGb.- sup.4sAb.sup.4 354 17 237k Tb.sup.6sGb.sup.6sC*b.sup.6sdUsdGsdUsdC*sdA*sdUsdA*sdGsdA*sdC*sC*b.sup.6s- Gb.sup.6sAb.sup.6 354 17 237m Tb.sup.7sGb.sup.7sC*b.sup.7sTb.sup.7sdC*dGdTdC*dAdTdAdGdAsC*b.sup.7sC*b.s- up.7sGb.sup.7sAb.sup.7 353 18 238a Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sdGsdTsdC*sdAsdTsdAsdGsdAsC- *b.sup.1sC*b.sup.1sGb.sup.1 sAb.sup.1sGb.sup.1 353 18 238b Tb.sup.7sGb.sup.7sC*b.sup.7sTb.sup.7sC*b.sup.7sdGsdTsdC*sdAsdTsdAsdGsdAsd- C*sdC*sdGsdA sGb.sup.7 353 18 238c Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sC*b.- sup.1sGb.sup.1sAb.sup.1 sGb.sup.1 353 18 238d Tb.sup.1sGb.sup.1sdC*sdTsdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sdC*sGb.sup.1sAb.- sup.1 sGb.sup.1 353 18 238e Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sdC*s- Gb.sup.1sAb.sup.1 sGb.sup.1 353 18 238f Tb.sup.1Gb.sup.1dC*dUdC*dGdTdC*dAdTdAdGdA*C*b.sup.1C*b.sup.1Gb.sup.1Ab.su- p.1Gb.sup.1 353 18 238g Tb.sup.4Gb.sup.4C*b.sup.4Tb.sup.4sdCsdGsdTsdCsdAsdTsdAsdGsdAsC*b.sup.4C*b- .sup.4Gb.sup.4Ab.sup.4Gb.sup.4 353 18 238h Tb.sup.1ssG b.sup.1ssC*b.sup.1ssdTssdC*ssdGssdTssdC*ssdAssdTssdA*ssdGssdAssdC* ssdC*ssGb.sup.1ssAb.sup.1ssGb.sup.1 353 18 238i Tb.sup.2Gb.sup.2C*b.sup.2dTdCdGdTdC*dAdTdAdGdAC*b.sup.2C*b.sup.2Gb.sup.2A- b.sup.2Gb.sup.2 352 19 239a Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sdGsdTsdCsdAsdTsdAsdGsdAsdC- *sC*b.sup.1sGb.sup.1 sAb.sup.1sGb.sup.1sC*b.sup.1 352 19 239b Tb.sup.6Gb.sup.6C*b.sup.6Tb.sup.6C*b.sup.6dGdTdC*dAdTdAdGdAdC*C*b.sup.6Gb- .sup.6Ab.sup.6Gb.sup.6C*b.sup.6 352 19 239c Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsdAsdCsdCsdG- sAb.sup.1 sGb.sup.1sC*b.sup.1 352 19 239d Tb.sup.1sdGsdCsdTsdCsdGsdTsdCsdAsdTsdAsdGsdA*sdC*sC*b.sup.1sGb.sup.1sAb.s- up.1 sGb.sup.1sC*b.sup.1 352 19 239e Tb.sup.4sGb.sup.4sdCsdUsdCsdGsdUsdCsdAsdTsdAsdGsdA*sdC*sdC*sGb.sup.4sAb.s- up.4 sGb.sup.4sC*b.sup.4 352 19 239f Tb.sup.2ssGb.sup.2ssC*b.sup.2ssTb.sup.2ssC*b.sup.2ssdGssdTssdCssdAssdTssd- AssdGssdAssdC ssdCssdGssdAssGb.sup.2ssC*b.sup.2 352 20 240a C*b.sup.1sTb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdC*sdGsdTsdCsdAsdTsdAsdGsd- AsdC*sC*b.sup.1 sGb.sup.1sAb.sup.1sGb.sup.1sC*b1 352 20 240b C*b.sup.2sTb.sup.2sGb.sup.2sdC*sdTsdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sC*b.su- p.2sGb.sup.2 sAb.sup.2sGb.sup.2sC*b.sup.2 352 20 240c C*b.sup.1Tb.sup.1Gb.sup.1dC*dTdC*dGdTdCdAdTdAdGdAdC*dC*Gb.sup.1Ab.sup.1Gb- .sup.1C*b.sup.1 352 20 240d C*b.sup.1sdUsdGsdCsdUsdC*sdGsdTsdCsdAsdTsdAsdGsdAsdC*sC*b.sup.1sGb.sup.1 sAb.sup.1sGb.sup.1sC*b.sup.1 352 20 240e C*b.sup.4sTb.sup.4sGb.sup.4sC*b.sup.4sdTsdCsdGsdTsdCsdAsdTsdAsdGsdAsdCsdC- sGb.sup.4 sAb.sup.4sGb.sup.4sC*b.sup.4 351 22 241a Gb.sup.1sC*b.sup.1sTb.sup.1sGb.sup.1sC*b.sup.1sdTsdC*sdGsdTsdCsdAsdTsdAsd- GsdAsdCsdC* sGb.sup.1sAb.sup.1sGb.sup.1sC*b.sup.1sC*b.sup.1 351 22 241b Gb.sup.1C*b.sup.1Tb.sup.1Gb.sup.1C*b.sup.1dTdC*dGdTdC*dAdTdAdGdAdC*dC*Gb.- sup.1Ab.sup.1Gb.sup.1C*b.sup.1 C*b.sup.1 351 22 241c Gb.sup.1sC*b.sup.1sTb.sup.1sGb.sup.1sC*b.sup.1sdTsdCsdGsdTsdCsdAsdTsdAsdG- sdAsdCsdCsGb.sup.1 sAb.sup.1sGb.sup.1sC*b.sup.1sC*b.sup.1 350 24 242a C*b.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sGb.sup.1sdCsdTsdCsdGsdTsdCsdAsdTsdA- sdGsdAsdCsdC* sdGsAb.sup.1sGb.sup.1sC*b.sup.1sC*b.sup.1sC*b.sup.1 350 24 242b C*b.sup.1Gb.sup.1C*b.sup.1Tb.sup.1Gb.sup.1dC*dTdCdGdTdCdAdTdAdGdAdCdC*dGA- b.sup.1Gb.sup.1C*b.sup.1 C*b.sup.1C*b.sup.1 349 26 243a C*b.sup.1sC*b.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdGsdC*sdTsdCsdGsdTsdC*sdA- sdTsdAsdGsdAs dCsdC*sdGsdAsGb.sup.1sC*b.sup.1sC*b.sup.1sC*b.sup.1sC*b.sup.1 349 26 243b C*b.sup.1C*b.sup.1Gb.sup.1C*b.sup.1Tb.sup.1dGdC*dTdCdGdTdC*dAdTdAdGdAdCdC- *dGdAGb.sup.1C*b.sup.1 C*b.sup.1C*b.sup.1C*b.sup.1 348 28 244a C*b.sup.1sC*b.sup.1sC*b.sup.1sGb.sup.1sC*b.sup.1sdTsdGsdCsdTsdCsdGsdTsdC*- sdAsdTsdAsdGs dAsdC*sdCsdGsdAsdGsC*b.sup.1sC*b.sup.1sC*b.sup.1sC*b.sup.1sC*b.sup.1 348 28 244b C*b.sup.1C*b.sup.1C*b.sup.1Gb.sup.1C*b.sup.1dTdGdC*dTdCdGdTdC*dAdTdAdGdAd- C*dCdGdAdG C*b.sup.1C*b.sup.1C*b.sup.1C*b.sup.1C*b.sup.1

TABLE-US-00048 TABLE 5 Seq ID SP L No. Sequence, 5'-3' 431 10 245a Tb.sup.1sAb.sup.1sdC*sdGsdCsdGsdTsdC*sC*b.sup.1sAb.sup.1 431 10 245b Tb.sup.1Ab.sup.1dCdGdC*dGdTdCC*b.sup.1Ab.sup.1 430 12 246a Ab.sup.1sTb.sup.1sAb.sup.1sdC*sdGsdCsdGsdTsdCsC*b.sup.1sAb.sup.1sC*b.sup.- 1 430 12 246b Ab.sup.1Tb.sup.1Ab.sup.1dCdGdCdGdTdC*C*b.sup.1Ab.sup.1C*b.sup.1 430 12 246c Ab.sup.1sTb.sup.1sAb.sup.1sdCsdGsdCsdGsdTsdC*sdC*sAb.sup.1sC*b.sup.1 430 12 246d Ab.sup.1sTb.sup.1sdA*sdC*sdGsdCsdGsdTsdC*sdC*sdA*sC*b.sup.1 430 12 246e Ab.sup.1sdTsdA*sdC*sdGsdC*sdGsdTsdC*sdC*sAb.sup.1sC*b.sup.1 430 13 247a Gb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sdCsdGsdCsdGsdTsdCsC*b.sup.1sAb.sup.1s- C*b.sup.1 430 13 247b Gb.sup.1Ab.sup.1Tb.sup.1Ab.sup.1dCdGdCdGdUdCC*b.sup.1Ab.sup.1C*b.sup.1 430 13 247c Gb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sdC*sdGsdCsdGsdTsdC*sC*b.sup.1sAb.sup.- 1sC*b.sup.1 430 13 247d Gb.sup.1sAb.sup.1sTb.sup.1sdA*sdCsdGsdCsdGsdTsdCsdC*sAb.sup.1sC*b.sup.1 430 13 247e Gb.sup.1sAb.sup.1sdTsdA*sdCsdGsdC*sdGsdTsdCsdC*sdA*sC*b.sup.1 430 13 247f Gb.sup.1sdA*sdTsdA*sdC*sdGsdCsdGsdTsC*b.sup.1sC*b.sup.1sAb.sup.1sC*b.sup.- 1 431 13 153f C*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdCsdGsdCsdGsdTsdCsC*b.sup.1sAb.sup.1 429 14 248a Gb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sdC*sdGsdC*sdGsdTsdC*sC*b.sup.1sAb.sup- .1sC*b.sup.1sAb.sup.1 429 14 248b Gb.sup.1Ab.sup.1Tb.sup.1Ab.sup.1sdC*sdGsdCsdGsdTsdC*sdC*sAb.sup.1C*b.sup.- 1Ab.sup.1 429 14 248c Gb.sup.4sAb.sup.4sTb.sup.4sAb.sup.4sdC*sdGsdCsdGsdTsdC*sdC*sdA*sC*b.sup.4- sAb.sup.4 429 14 248d Gb.sup.1sdA*sdTsdAsdCsdGsdCsdGsdTsdCsdC*sdA*sdCsAb.sup.1 429 14 248e Gb.sup.2sAb.sup.2sTb.sup.2sdA*sdCsdGsdCsdGsdUsdCsdCsAb.sup.2sC*b.sup.2sAb- .sup.2 429 14 248f Gb.sup.4ssAb.sup.4ssdTssdAssdCssdGssdCssdGssdTssdCssdCssAb.sup.4ssC*b.sup- .4ssAb.sup.4 429 14 248g Gb.sup.1Ab.sup.1dTdA*dCdGdCdGdTdCC*b.sup.1Ab.sup.1C*b.sup.1Ab.sup.1 429 15 152h C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsdCsdCsAb.sup.1sC*b- .sup.1sAb.sup.1 429 15 152i C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1sdAsdCsdGsdCsdGsdUsdCsdC*sAb.sup.1C*b.su- p.1Ab.sup.1 429 15 152j C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1sdA*sdCsdGsdCsdGsdUsdCsdCsAb.sup.1C*b.su- p.1Ab.sup.1 429 15 152k C*b.sup.6sGb.sup.6sAb.sup.6sTb.sup.6sdAdC*dGdCdGdTdCdC*sAb.sup.6sC*b.sup.- 6sAb.sup.6 429 15 152m C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsdC*sdC*sAb.sup.1sC- *b.sup.1sAb.sup.1 429 15 152n C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1sdAsdC*sdGsdC*sdGsdTsdC*sdC*sAb.sup.1C*b- .sup.1Ab.sup.1 429 15 1520 C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdA*sdCsdGsdCsdGsdTsdCsdC*sAb.sup.1sC- *b.sup.1sAb.sup.1 429 15 152p C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsdCsdC*sAb.sup.1sC*- b.sup.1sAb.sup.1 429 15 152q C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1dAdCdGdC*dGdTdCdC*Ab.sup.1C*b.sup.1Ab.su- p.1 429 15 152r C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAdC*dGdC*dGdTdC*dC*sAb.sup.1sC*b.su- p.1sAb.sup.1 429 15 152s /5SpC3s/C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdC*sdGsdTsdCsdCsAb- .sup.1sC*b.sup.1 sAb.sup.1 429 15 152t C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdCsdGsdTsdCsdC*sAb.sup.1sC- *b.sup.1sAb.sup.1 /3SpC3s/ 429 15 152u /5SpC3s/C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdC*sdGsdTsdCsdCsAb- .sup.1sC*b.sup.1 sAb.sup.1/3SpC3s/ 429 15 152v C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdA*sdC*sdGsdC*sdGsdUsdC*sdC*sAb.sup.- 1sC*b.sup.1sAb.sup.1 429 15 152w C*b.sup.7sGb.sup.7sAb.sup.7sdTsdAsdCsdGsdC*sdGsdTsdCsC*b.sup.7sAb.sup.7sC- *b.sup.7sAb.sup.7 429 15 152z C*b.sup.7sGb.sup.7sdAsdUsdAsdCsdGsdC*sdGsdUsdCsC*b.sup.7sAb.sup.7sC*b.sup- .7sAb.sup.7 429 15 152aa C*b.sup.1ssGb.sup.1ssAb.sup.1ssdTssdAssdC*ssdGssdCssdGssdTssdCssdC*ssAb.s- up.1 ssC*b.sup.1ssAb.sup.1 429 15 152ab C*b.sup.4ssGb.sup.4ssAb.sup.4ssdTssdA*ssdCssdGssdCssdGssdTssdCssdCssdA*ss C*b.sup.4ssAb.sup.4 429 15 152ac C*b.sup.2ssGb.sup.2ssAb.sup.2ssTb.sup.2ssdAssclCssdGssdCssdGssdTssdCssdCs- sdAssdCss Ab.sup.2 429 15 152ad C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1dAdCdGdCdGdUdCC*b.sup.1Ab.sup.1C*b.sup.1- Ab.sup.1 429 15 152ae C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sdCsdGsdCsdGsdUsdCsdCsAb.sup- .1sC*b.sup.1sAb.sup.1 429 15 152af C*b.sup.1sGb.sup.1sdA*sdTsdA*sdCsdGsdCsdGsdTsC*b.sup.1sC*b.sup.1sAb.sup.1- sC*b.sup.1sAb.sup.1 429 15 152ag C*b.sup.6sGb.sup.6sAb.sup.6sdTsdAsdCsdGsdCsdGsdTsdCsC*b.sup.6sAb.sup.6sC*- b.sup.6sAb.sup.6 429 15 152ah C*b.sup.7sGb.sup.7sAb.sup.7sdUsdA*sdCsdGsdCsdGsdUsdCsdCsAb.sup.7sC*b.sup.- 7sAb.sup.7 429 15 152ai C*b.sup.4sGb.sup.4sAb.sup.4sTb.sup.4sdA*sdCsdGsdCsdGsdTsdC*sdC*sdA*sC*b.s- up.4sAb.sup.4 429 15 152aj C*b.sup.4Gb.sup.4Ab.sup.4Tb.sup.4dAdCdGdCdGdTdCdCdAC*b.sup.4Ab.sup.4 429 15 152ak C*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdCsdGsdCsdGsdTsdCsdCsAb.sup.1sC*b.sup.1- sAb.sup.1 428 16 249a C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAdCdGdCdGdTdCdC*sAb.sup.1sC*b.sup.1- sAb.sup.1sGb.sup.1 428 16 249b C*b.sup.1ssGb.sup.1ssdAssdTssdAssdCssdGssdCssdGssdTssdCssdCssdAssdCssdA ssGb.sup.1 428 16 249c C*b.sup.1Gb.sup.1dAdTdAdCdGdCdGdTdCdCdAdCdAGb.sup.1 428 16 249d C*b.sup.1sGb.sup.1sdAsdUsdAsdC*sdGsdCsdGsdUsdCsdC*sdAsC*b.sup.1sAb.sup.1s- Gb.sup.1 428 16 249e C*b.sup.1Gb.sup.1sdAsdTsdAsdC*sdGsdC*sdGsdTsdCsdC*sAb.sup.1C*b.sup.1Ab.su- p.1Gb.sup.1 428 16 249f C*b.sup.4sGb.sup.4sAb.sup.4sdTsdAsdCsdGsdCsdGsdTsdCsdCsdAsdCsAb.sup.4sGb.- sup.4 428 16 249g C*b.sup.6Gb.sup.6Ab.sup.6dTdA*dCdGdCdGdTdC*dCdA*C*b.sup.6Ab.sup.6Gb.sup.6 428 16 249h C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdCsdGsdTsdCsdC*sdAsdC*sdAs- Gb.sup.1 428 16 249i C*b.sup.1ssGb.sup.1ssdAssdUssdAssdCssdGssdCssdGssdUssdCssdCssdAssdCss Ab.sup.1ssGb.sup.1 428 17 250a Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdC*sdGsdTsdCsC*b.s- up.1sAb.sup.1sC*b.sup.1sAb.sup.1 sGb.sup.1 428 17 250b Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdC*sdGsdC*sdGsdTsdC*sdC*sdAsC*- b.sup.1sAb.sup.1 sGb.sup.1 428 17 250c Gb.sup.1sdC*sdGsdAsdUsdAsdCsdGsdC*sdGsdUsdCsC*b.sup.1sAb.sup.1sC*b.sup.1s- Ab.sup.1sGb.sup.1 428 17 250d Gb.sup.1sC*b.sup.1sGb.sup.1sdA*sdTsdA*sdC*sdGsdC*sdGsdTsdC*sC*b.sup.1sAb.- sup.1sC*b.sup.1sAb.sup.1 sGb.sup.1 428 17 250e Gb.sup.1C*b.sup.1dGdAdTdAdCdGdC*dGdTdCdC*Ab.sup.1C*b.sup.1Ab.sup.1Gb.sup.- 1 428 17 250f Gb.sup.1sdC*sdGsdAsdTsdAsdCsdGsdC*sdGsdTsdCsdCsdAsC*b.sup.1sAb.sup.1sGb.s- up.1 428 17 250g Gb.sup.2sC*b.sup.2sGb.sup.2sdAsdTsdAsdCsdGsdC*sdGsdTsdC*sC*b.sup.2sAb.sup- .2sC*b.sup.2sAb.sup.2 sGb.sup.2

428 17 250h Gb.sup.1C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1dA*dCdGdC*dGdTdC*dCdA*dC*Ab.sup.- 1Gb.sup.1 428 17 250i Gb.sup.1ssC*b.sup.1ssGb.sup.1ssAb.sup.1ssTb.sup.1ssdAssdCssdGssdCssdGssdT- ssdCssdCssdAss C*b.sup.1ssAb.sup.1ssGb.sup.1 428 17 250j Gb.sup.4sC*b.sup.4sGb.sup.4sdA*sdTsdA*sdCsdGsdCsdGsdTsdCsdCsAb.sup.4sC*b.- sup.4sAb.sup.4sGb.sup.4 428 17 250k Gb.sup.6sC*b.sup.6sGb.sup.6sdA*sdUsdAsdCsdGsdCsdGsdUsdC*sdCsdA*sC*b.sup.6- sAb.sup.6sGb.sup.6 428 17 250m Gb.sup.7sC*b.sup.7sGb.sup.7sAb.sup.7sdTdAdCdGdCdGdTdC*dCsAb.sup.7sC*b.sup- .7sAb.sup.7sGb.sup.7 427 18 251a Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsdCsdC*sAb- .sup.1sC*b.sup.1sAb.sup.1 sGb.sup.1sGb.sup.1 427 18 251b Gb.sup.7sC*b.sup.7sGb.sup.7sAb.sup.7sTb.sup.7sdAsdC*sdGsdCsdGsdTsdCsdCsdA- sdCsdAsdGs Gb.sup.7 427 18 251c Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdC*sdGsdCsdGsdTsdCsdC*sdAsC*b.- sup.1sAb.sup.1sGb.sup.1 sGb.sup.1 427 18 251d Gb.sup.1sC*b.sup.1sGb.sup.1sdAsdTsdAsdC*sdGsdC*sdGsdTsdCsdC*sdAsC*b.sup.1- sAb.sup.1sGb.sup.1 sGb.sup.1 427 18 251e Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdC*sdGsdCsdGsdTsdCsdC*sdAsdC*s- Ab.sup.1sGb.sup.1 sGb.sup.1 427 18 251f Gb.sup.1C*b.sup.1dGdAdUdA*dCdGdCdGdTdC*dC*Ab.sup.1C*b.sup.1Ab.sup.1Gb.sup- .1Gb.sup.1 427 18 251g Gb.sup.4C*b.sup.4Gb.sup.4Ab.sup.4sdTsdAsdCsdGsdCsdGsdTsdCsdCsAb.sup.4C*b.- sup.4Ab.sup.4Gb.sup.4Gb.sup.4 427 18 251h Gb.sup.1ssC*b.sup.1ssGb.sup.1ssdA*ssdTssdA*ssdCssdGssdCssdGssdTssdCssdCss- dA* ssdC*ssAb.sup.1ssGb.sup.1ssGb.sup.1 427 18 251i Gb.sup.2C*b.sup.2Gb.sup.2dAdTdAdCdGdC*dGdTdCdC*Ab.sup.2C*b.sup.2Ab.sup.2G- b.sup.2Gb.sup.2 426 19 252a Gb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdCsdGsdTsdCsdCsdA- sC*b.sup.1sAb.sup.1sGb.sup.1 sGb.sup.1sAb.sup.1 426 19 252b Gb.sup.6C*b.sup.6Gb.sup.6Ab.sup.6Tb.sup.6dAdC*dGdCdGdTdCdC*dAC*b.sup.6Ab.- sup.6Gb.sup.6Gb.sup.6Ab.sup.6 426 19 252c Gb.sup.1sC*b.sup.1sGb.sup.1sdAsdTsdAsdCsdGsdCsdGsdTsdCsdCsdAsdC*sAb.sup.1- sGb.sup.1 sGb.sup.1sAb.sup.1 426 19 252d Gb.sup.1sdC*sdGsdA*sdTsdA*sdC*sdGsdCsdGsdTsdCsdCsdA*sC*b.sup.1sAb.sup.1sG- b.sup.1 sGb.sup.1sAb.sup.1 426 19 252e Gb.sup.4sC*b.sup.4sdGsdAsdUsdAsdCsdGsdCsdGsdUsdCsdCsdAsdC*sAb.sup.4sGb.su- p.4sGb.sup.4 sAb.sup.4 426 19 252f Gb.sup.2ssC*b.sup.2ssGb.sup.2ssAb.sup.2ssTb.sup.2ssdAssdCssdGssdCssdGssdT- ssdCssdCssdAss dCssdAssdGssGb.sup.2ssAb.sup.2 426 20 253a Gb.sup.1sGb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1sdTsdAsdCsdGsdCsdGsdTsdC*sdC- *sdAsC*b.sup.1sAb.sup.1 sGb.sup.1sGb.sup.1sAb.sup.1 426 20 253b Gb.sup.2sGb.sup.2sC*b.sup.2sdGsdAsdTsdAsdC*sdGsdCsdGsdTsdC*sdC*sdAsC*b.su- p.2sAb.sup.2 sGb.sup.2sGb.sup.2sAb.sup.2 426 20 253c Gb.sup.1Gb.sup.1C*b.sup.1dGdAdTdAdCdGdCdGdTdCdCdAdC*Ab.sup.1Gb.sup.1Gb.su- p.1Ab.sup.1 426 20 253d Gb.sup.1sdGsdCsdGsdAsdTsdAsdCsdGsdC*sdGsdUsdCsdCsdAsC*b.sup.1sAb.sup.1sGb- .sup.1 sGb.sup.1sAb.sup.1 426 20 253e Gb.sup.4sGb.sup.4sC*b.sup.4sGb.sup.4sdAsdTsdAsdCsdGsdCsdGsdTsdCsdCsdAsdCs- Ab.sup.4sGb.sup.4 sGb.sup.4sAb.sup.4 425 22 254a Tb.sup.1sGb.sup.1sGb.sup.1sC*Gb'sdAsdTsdAsdCsdGsdCsdGsdTsdCsdCsdAsdC*sAb.- sup.1 sGb.sup.1sGb.sup.1sAb.sup.1sC*b.sup.1 425 22 254b Tb.sup.1Gb.sup.1Gb.sup.1C*b.sup.1Gb.sup.1dAdTdAdC*dGdCdGdTdCdC*dAdCAb.sup- .1Gb.sup.1Gb.sup.1Ab.sup.1C*b.sup.1 425 22 254c Tb.sup.6sGb.sup.6sGb.sup.6sC*b.sup.6sdGsdAsdTsdAsdCsdGsdCsdGsdTsdCsdCsdAs- dCsdA sdGsGb.sup.6sAb.sup.6sC*b.sup.6 424 24 255a C*b.sup.1sTb.sup.1sGb.sup.1sGb.sup.1sC*b.sup.1sdGsdAsdTsdAsdCsdGsdC*sdGsd- TsdCsdC*sdA sdCsdAsGb.sup.1sGb.sup.1sAb.sup.1sC*b.sup.1sGb.sup.1 424 24 255b C*b.sup.1Tb.sup.1Gb.sup.1Gb.sup.1C*b.sup.1dGdAdTdAdCdGdC*dGdTdCdC*dAdC*dA- Gb.sup.1Gb.sup.1Ab.sup.1 C*b.sup.1Gb.sup.1 423 26 256a Gb.sup.1sC*b.sup.1sTb.sup.1sGb.sup.1sGb.sup.1sdC*sdGsdAsdTsdAsdCsdGsdCsdG- sdTsdCsdCsdA sdCsdAsdGsGb.sup.1sAb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1 423 26 256b Gb.sup.1C*b.sup.1Tb.sup.1Gb.sup.1Gb.sup.1dC*dGdAdTdAdCdGdCdGdTdCdCdAdC*dA- dGGb.sup.1Ab.sup.1 C*b.sup.1Gb.sup.1Ab.sup.1 422 28 257a Tb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sGb.sup.1sdGsdCsdGsdAsdTsdAsdC*sdGsdC- *sdGsdTsdCsdC sdAsdCsdAsdGsGb.sup.1sAb.sup.1sC*b.sup.1sGb.sup.1sAb.sup.1 422 28 257b Tb.sup.1Gb.sup.1C*b.sup.1Tb.sup.1Gb.sup.1dGdCdGdAdTdAdCdGdCdGdTdCdC*dAdC*- dAdGGb.sup.1Ab.sup.1 C*b.sup.1Gb.sup.1Ab.sup.1

TABLE-US-00049 TABLE 6 Seq ID SP L No. Sequence, 5'-3' 2067 10 258a Gb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsGb.sup.1sGb.sup.1 2067 10 258b Gb.sup.1sTb.sup.1sdGsdUsdTsdTsdA*sdGsGb.sup.1sGb.sup.1 2066 12 259a Ab.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsGb.sup.1sGb.sup.1sAb.sup.1 2066 12 259b Ab.sup.1Gb.sup.1Tb.sup.1dGdUdUdUdA*dGGb.sup.1Gb.sup.1Ab.sup.1 2066 12 259c Ab.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsdGsGb.sup.1sAb.sup.1 2066 12 259d Ab.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1 2066 12 259e Ab.sup.1sdGsdTsdGsdTsdTsdTsdA*sdGsdGsGb.sup.1sAb.sup.1 2066 13 260a Tb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdAsdGsGb.sup.1sGb.sup.1sA- b.sup.1 2066 13 260b Tb.sup.1Ab.sup.1Gb.sup.1Tb.sup.1dGdUdUdUdAdGGb.sup.1Gb.sup.1Ab.sup.1 2066 13 260c Tb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsGb.sup.1sGb.sup.1s- Ab.sup.1 2066 13 260d Tb.sup.1sAb.sup.1sGb.sup.1sdUsdGsdTsdTsdTsdA*sdGsdGsGb.sup.1sAb.sup.1 2066 13 260e Tb.sup.1sAb.sup.1sdGsdUsdGsdUsdUsdUsdA*sdGsdGsdGsAb.sup.1 2066 13 260f Tb.sup.1sdA*sdGsdTsdGsdTsdTsdUsdA*sGb.sup.1sGb.sup.1sGb.sup.1sAb.sup.1 2065 14 261a Tb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsGb.sup.1sGb.sup.1s- Ab.sup.1sGb.sup.1 2065 14 261b Tb.sup.1Ab.sup.1Gb.sup.1Tb.sup.1sdGsdTsdTsdTsdA*sdGsdGGb.sup.1Ab.sup.1Gb.- sup.1 2065 14 261c Tb.sup.4sAb.sup.4sGb.sup.4sTb.sup.4sdGsdUsdTsdUsdA*sdGsdGsdGsAb.sup.4sGb.- sup.4 2065 14 261d Tb.sup.1sdA*sdGsdUsdGsdTsdTsdUsdA*sdGsdGsdGsdA*sGb.sup.1 2065 14 261e Tb.sup.2sAb.sup.2sGb.sup.2sdUsdGsdUsdUsdTsdAsdGsdGsGb.sup.2sAb.sup.2sGb.s- up.2 2065 14 261f Tb.sup.4sAb.sup.4sdGsdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.4sAb.sup.4sGb.sup.4 2065 14 261g Tb.sup.1Ab.sup.1dGdTdGdTdTdTdA*dGGb.sup.1Gb.sup.1Ab.sup.1Gb.sup.1 2064 15 262a Tb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGdTdTdTdA*dGdGsGb.sup.1sAb.sup.1sGb.- sup.1sC*b.sup.1 2064 15 262b Tb.sup.1ssAb.sup.1ssdGssdTssdGssdTssdTssdTssdAssdGssdGssdGssdAssdGssC*b.s- up.1 2064 15 262c Tb.sup.1sAb.sup.1sdGsdUsdGsdUsdUsdUsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*b.su- p.1 2064 15 262d Tb.sup.1dAdGdTdGdTdTdTdAdGdGdGdAdGC*b.sup.1 2064 15 262e Tb.sup.1Ab.sup.1sdGsdUsdGsdUsdTsdUsdAsdGsdGsGb.sup.1Ab.sup.1Gb.sup.1C*b.s- up.1 2064 15 262f Tb.sup.4sAb.sup.4sGb.sup.4sdTsdGsdTsdTsdTsdAsdGsdGsdsdGsdAsGb.sup.4sC*b.s- up.4 2064 15 262g Tb.sup.6Ab.sup.6Gb6dUdGdTdTdUdAdGdGdGAb.sup.6Gb.sup.6C*b.sup.6 2064 15 262h Tb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdAsdGsdGsdGsdAsdGsC*b.sup- .1 2064 15 262i Tb.sup.1ssAb.sup.1ssdGssdTssdGssdUssdUssdUssdAssdGssdGssdGssdAssGb.sup.1 ssC*b.sup.1 2064 16 209s Gb.sup.1Tb.sup.1dAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1Gb.sup.1C*b.sup.- 1 2064 16 209t Gb.sup.1sTb.sup.1sdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*- b.sup.1 2064 16 209u Gb.sup.1Tb.sup.1dAdGdTdGdTdTdTdAdGdGdGAb.sup.1Gb.sup.1C*b.sup.1 2064 16 209v /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.su- p.1sC*b.sup.1 2064 16 209w Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1sC*b.- sup.1/s3SpC3/ 2064 16 209x /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.su- p.1sC*b.sup.1 /3SpC3s/ 2064 16 209y Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1sC*b.- sup.1 2064 16 209aa Gb.sup.1Tb.sup.1dA*sdGsdUsdGsdUsdUsdUsdAsdGsdGsdGsAb.sup.1Gb.sup.1C*b.sup- .1 2064 16 209ab Gb.sup.1Tb.sup.1dA*sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1Gb.sup.1C*b.sup- .1 2064 16 209ac Gb.sup.6sTb.sup.6sdA*dGdTdGdTdTdTdA*dGdGdGAb.sup.6sGb.sup.6sC*b.sup.6 2064 16 209ad Gb.sup.1sTb.sup.1sdA*sdGsdUsdGsdUsdUsdUsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*- b.sup.1 2064 16 209ae Gb.sup.1sTb.sup.1sdA*sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1sC*b- .sup.1 2064 16 209af Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*b- .sup.1 2064 16 209ag Gb.sup.1Tb.sup.1dA*dGdTdGdTdTdTdA*dGdGdGAb.sup.1Gb.sup.1C*b.sup.1 2064 16 209ah Gb.sup.1Tb.sup.1dAdGdTdGdTdTdTdA*dGdGdGAb.sup.1Gb.sup.1C*b.sup.1 2064 16 209ai Gb.sup.6sTb.sup.6sdA*dGdTdGdTdTdTdAdGdGdGAb.sup.6sGb.sup.6sC*b.sup.6 2064 16 209aj Gb.sup.1sTb.sup.1sdA*sdGsdUsdGsdTsdTsdUsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*- b.sup.1 2064 16 209ak Gb.sup.7sTb.sup.7sAb.sup.7sGb.sup.7sdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.7s- Gb.sup.7sC*b.sup.7 2064 16 209am Gb.sup.7sTb.sup.7sdAsdGsdTsdGsdTsdTsdUsdA*sdGsdGsGb.sup.7sAb.sup.7sGb.sup- .7sC*b.sup.7 2064 16 209an Gb.sup.1ssTb.sup.1ssAb.sup.1ssdGssdTssdGssdTssdTssdTssdA*ssdGssdGssdGssAb- .sup.1 ssGb.sup.1ssC*b.sup.1 2064 16 209a0 Gb.sup.4ssTb.sup.4ssAb.sup.4ssdGssdTssdGssdTssdTssdTssdAssdGssdGssdGssdA*- ss Gb.sup.4ssC*b.sup.4 2064 16 209ap Gb.sup.2ssTb.sup.2ssAb.sup.2ssGb.sup.2ssdTssdGssdTssdTssdTssdAssdGssdGssd- GssdAssd GssC*b.sup.2 2064 16 209aq Gb.sup.1Tb.sup.1Ab.sup.1Gb.sup.1dUdGdUdUdUdAdGdGGb.sup.1Ab.sup.1Gb.sup.1C- *b.sup.1 2064 16 209ar Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsdGsdGsAb.- sup.1sGb.sup.1sC*b.sup.1 2064 16 209as Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdUsdAsdGsGb.sup.1sGb.sup.1sAb.sup.1sG- b.sup.1sC*b.sup.1 2064 16 209at Gb.sup.6sTb.sup.6sAb.sup.6sGb.sup.6sdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.6sG- b.sup.6sC*b.sup.6 2064 16 209au Gb.sup.7sTb.sup.7sAb.sup.7sdGsdUsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.7sGb.sup- .7sC*b.sup.7 2064 16 209av Gb.sup.4sTb.sup.4sAb.sup.4sGb.sup.4sdUsdGsdTsdUsdTsdA*sdGsdGsdGsdA*sGb.su- p.4sC*b.sup.4 2064 16 209aw Gb.sup.4Tb.sup.4Ab.sup.4Gb.sup.4dTdGdTdTdTdAdGdGdGdAGb.sup.4C*b.sup.4 2064 16 209ax Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.- 1sC*b.sup.1 2064 16 209az Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.1sAb.sup.1sG- b.sup.1sC*b.sup.1 2064 16 209ba Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.1sAb.s- up.1sGb.sup.1sC*b.sup.1 2064 16 209bb Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGb.sup.1sC*b.- sup.1 2063 17 263a Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1sdGsdTsdTsdTsdA*sdGsdGsGb.sup- .1sAb.sup.1sGb.sup.1sC*b.sup.1 sc*b.sup.1 2063 17 263b Gb.sup.2sTb.sup.2sAb.sup.2sdGsdTsdGsdTsdTsdTsdA*sdGsdGsGb.sup.2sAb.sup.2s- Gb.sup.2sC*b.sup.2sC*b.sup.2 2063 17 263c Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1s- Gb.sup.1sC*b.sup.1sC*b.sup.1 2063 17 263d Gb.sup.1sdUsdA*sdGsdUsdGsdUsdTsdTsdA*sdGsdGsGb.sup.1sAb.sup.1sGb.sup.1sC*- b.sup.1sC*b.sup.1 2063 17 263e Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdUsdTsdTsdA*sdGsdGsGb.sup.1sAb.sup.1s- Gb.sup.1sC*b.sup.1sC*b.sup.1 2063 17 263f

Gb.sup.1Tb.sup.1dA*dGdTdGdTdTdTdA*dGdGdGAb.sup.1Gb.sup.1C*b.sup.1C*b.sup.- 1 2063 17 263g Gb.sup.1sdTsdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsdA*sGb.sup.1sC*b.sup.1sC*b- .sup.1 2063 17 263h Gb.sup.1Tb.sup.1Ab.sup.1Gb.sup.1Tb.sup.1dGdTdUdTdAdGdGdGdA*dGC*b.sup.1C*b- .sup.1 2063 17 263i Gb.sup.1ssTb.sup.1ssAb.sup.1ssGb.sup.1ssTb.sup.1ssdGssdTssdTssdTssdAssdGs- sdGssdGssdAss Gb.sup.1ssC*b.sup.1ssC*b.sup.1 2063 17 263j Gb.sup.4Tb.sup.4dA*dGdTdGdTdTdTdAdGdGdGdA*Gb.sup.4C*b.sup.4C*b.sup.4 2063 17 263k Gb.sup.6sTb.sup.6sAb.sup.6sdGsdTsdGsdUsdUsdTsdAsdGsdGsdGsdA*sGb.sup.6sC*b- .sup.6sC*b.sup.6 2063 17 263m Gb.sup.7sTb.sup.7sAb.sup.7sGb.sup.7sdTdGdTdTdTdA*dGdGdGsAb.sup.7sGb.sup.7- sC*b.sup.7sC*b.sup.7 2063 18 264a Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdA*sdGsdGsGb.- sup.1sAb.sup.1sGb.sup.1sC*b.sup.1 sc*b.sup.1 2063 18 264b Gb.sup.7sGb.sup.7sTb.sup.7sAb.sup.7sGb.sup.7sdTsdGsdTsdTsdTsdAsdGsdGsdGsd- AsdGsdC*sC*b.sup.7 2063 18 264c Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdAsdGsdGsdGsd- A*sdGsdC*s c*b.sup.1 2063 18 264d Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdUsdGsdTsdTsdTsdAsdGsdGsdGsd- A*sdGsdC*s c*b.sup.1 2063 18 264e Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup- .1sGb.sup.1sC*b.sup.1 sc*b.sup.1 2063 18 264f Gb.sup.1sGb.sup.1sTb.sup.1sdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1sGb- .sup.1sC*b.sup.1 sc*b.sup.1 2063 18 264g Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsdA*sGb- .sup.1sC*b.sup.1 sC*b.sup.1 2063 18 264h Gb.sup.1Gb.sup.1dUdA*dGdTdGdTdTdTdAdGdGGb.sup.1Ab.sup.1Gb.sup.1C*b.sup.1C- *b.sup.1 2063 18 264i Gb.sup.4Gb.sup.4Tb.sup.4Ab.sup.4dGsdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.4Ab.sup- .4Gb.sup.4C*b.sup.4C*b.sup.4 2063 18 264j Gb.sup.1ssGb.sup.1ssTb.sup.1ssdA*ssdGssdTssdGssdUssdTssdTssdA*ssdGssdGssd- Gss dA*ssGb.sup.1ssC*b.sup.1ssC*b.sup.1 2063 18 264k Gb.sup.2Gb.sup.2Tb.sup.2dA*dGdTdGdTdTdTdAdGdGGb.sup.2Ab.sup.2Gb.sup.2C*b.- sup.2C*b.sup.2 2062 19 265a Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdA*sdGsdGsdGs- Ab.sup.1sGb.sup.1sC*b.sup.1 sC*b.sup.1sGb.sup.1 2062 19 265b Gb.sup.6Gb.sup.6Tb.sup.6Ab.sup.6Gb.sup.6dTdGdTdTdTdA*dGdGdGAb.sup.6Gb.sup- .6C*b.sup.6C*b.sup.6Gb.sup.6 2062 19 265c Gb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsdA*sdG- sC*b.sup.1 sC*b.sup.1sGb.sup.1 2062 19 265d Gb.sup.1sdGsdTsdA*sdGsdUsdGsdTsdUsdTsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*b.s- up.1 sC*b.sup.1sGb.sup.1 2062 19 265e Gb.sup.4sGb.sup.4sdUsdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdA*sGb.sup.4sC*b.su- p.4sC*b.sup.4 sGb.sup.4 2062 19 265f Gb.sup.2ssGb.sup.2ssTb.sup.2ssAb.sup.2ssGb.sup.2ssdTssdGssdTssdTssdTssdAs- sdGssdGssdGss dAssdGssdCssC*b.sup.2ssGb.sup.2 2062 20 266a Tb.sup.1sGb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdA*sdGsdGs- dGsAb.sup.1sGb.sup.1 sC*b.sup.1sC*b.sup.1sGb.sup.1 2062 20 266b Tb.sup.2sGb.sup.2sGb.sup.2sdTsdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.2- sGb.sup.2 sC*b.sup.2sC*b.sup.2sGb.sup.2 2062 20 266c Gb.sup.1Gb.sup.1Tb.sup.1dA*dGdTdGdTdTdTdA*dGdGdGdA*Gb.sup.1C*b.sup.1C*b.s- up.1Gb.sup.1 2062 20 266d Tb.sup.1sdGsdGsdUsdA*sdGsdTsdGsdTsdUsdTsdA*sdGsdGsdGsAb.sup.1sGb.sup.1sC*- b.sup.1 sC*b.sup.1sGb.sup.1 2062 20 266e Tb.sup.4sGb.sup.4sGb.sup.4sTb.sup.4sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsG- b.sup.4sC*b.sup.4 sC*b.sup.4sGb.sup.4 2061 22 267a Tb.sup.1sTb.sup.1sGb.sup.1sGb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsd- GsdGsdA*sGb.sup.1 sc*b.sup.1sC*b.sup.1sGb.sup.1sTb.sup.1 2061 22 267b Tb.sup.1Tb.sup.1Gb.sup.1Gb.sup.1Tb.sup.1dA*dGdTdGdTdTdTdAdGdGdGdA*Gb.sup.- 1C*b.sup.1C*b.sup.1Gb.sup.1Tb.sup.1 2061 22 267c Tb.sup.6sTb.sup.6sGb.sup.6sdGsdTsdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGb.s- up.6 sc*b.sup.6sc*b.sup.6sGb.sup.6sTb.sup.6 2060 24 268a Tb.sup.1sTb.sup.1sTb.sup.1sGb.sup.1sGb.sup.1sdTsdA*sdGsdTsdGsdTsdTsdTsdAs- dGsdGsdGsdA sdGC*b.sup.1sC*b.sup.1sGb.sup.1sTb.sup.1sC*b.sup.1 2060 24 268b Tb.sup.1Tb.sup.1Tb.sup.1Gb.sup.1Gb.sup.1dTdA*dGdTdGdTdTdTdAdGdGdGdA*dGC*b- .sup.1C*b.sup.1Gb.sup.1Tb.sup.1 c*b.sup.1 2059 26 269a Ab.sup.1sTb.sup.1sTb.sup.1sTb.sup.1sGb.sup.1sdGsdTsdAsdGsdTsdGsdTsdTsdTsd- AsdGsdGsdG sdAsdGsdC*sC*b.sup.1sGb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1 2059 26 269b Ab.sup.1Tb.sup.1Tb.sup.1Tb.sup.1Gb.sup.1dGdTdAdGdTdGdTdTdTdAdGdGdGdAdGdC*- C*b.sup.1Gb.sup.1Tb.sup.1 C*b.sup.1Tb.sup.1 2058 28 270a Tb.sup.1sAb.sup.1sTb.sup.1sTb.sup.1sTb.sup.1sdGsdGsdTsdAsdGsdTsdGsdTsdTsd- TsdAsdGsdG sdGsdAsdGsdC*sdCsGb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sTb.sup.1 2058 28 270b Tb.sup.1Ab.sup.1Tb.sup.1Tb.sup.1Tb.sup.1dGdGdTdAdGdTdGdTdTdTdAdGdGdGdAdGd- C*dC*Gb.sup.1Tb.sup.1 C*b.sup.1Tb.sup.1Tb.sup.1

TABLE-US-00050 TABLE 7 Seq ID SP L No. Sequence, 5'-3' 2075 10 271a Ab.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sGb.sup.1sTb.sup.1 2075 10 271b Ab.sup.1Tb.sup.1dTdTdGdGdTdA*Gb.sup.1Tb.sup.1 2074 12 272a Tb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sGb.sup.1sTb.sup.1sGb.sup.1 2074 12 272b Tb.sup.1Ab.sup.1Tb.sup.1dTdTdGdGdTdA*Gb.sup.1Tb.sup.1Gb.sup.1 2074 12 272c Tb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sdGsTb.sup.1sGb.sup.1 2074 12 272d Tb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdA*sdGsdUsGb.sup.1 2074 12 272e Tb.sup.1sdAsdTsdUsdTsdGsdGsdUsdA*sdGsTb.sup.1sGb.sup.1 2073 13 273a Tb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdAsGb.sup.1sTb.sup.1sGb.sup.1sT- b.sup.1 2073 13 273b Tb.sup.1Ab.sup.1Tb.sup.1dUdUdGdGdUdAGb.sup.1Tb.sup.1Gb.sup.1Tb.sup.1 2073 13 273c Tb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sGb.sup.1sTb.sup.1sGb.sup.1s- Tb.sup.1 2073 13 273d Tb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sdGsdUsGb.sup.1sTb.sup.1 2073 13 273e Tb.sup.1sAb.sup.1sdUsdUsdUsdGsdGsdUsdA*sdGsdUsdGsTb.sup.1 2073 13 273f Tb.sup.1sdA*sdTsdTsdUsdGsdGsdTsdA*sGb.sup.1sTb.sup.1sGb.sup.1sTb.sup.1 2073 14 274a C*b.sup.1Tb.sup.1Ab.sup.1sdUsdTsdTsdGsdGsdTsdA*sGb.sup.1Tb.sup.1Gb.sup.1T- b.sup.1 2073 14 274b C*b.sup.4sTb.sup.4sAb.sup.4sTb.sup.4sdTsdTsdGsdGsdTsdA*sdGsdUsGb.sup.4sTb- .sup.4 2073 14 274c C*b.sup.1sdUsdA*sdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTb.sup.1 2073 14 274d C*b.sup.2sTb.sup.2sAb.sup.2sdTsdTsdUsdGsdGsdTsdA*sdGsTb.sup.2sGb.sup.2sTb- .sup.2 2073 14 274e C*b.sup.4ssTb.sup.4ssdAssdTssdTssdTssdGssdGssdTssdAssdGssTb.sup.4ssGb.sup- .4ssTb.sup.4 2073 14 274f C*b.sup.1Tb.sup.1Ab.sup.1dTdTdTdGdGdTdA*Gb.sup.1Tb.sup.1Gb.sup.1Tb.sup.1 2073 14 274g C*b.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sGb.sup.1sTb.sup.1- sGb.sup.1sTb.sup.1 2072 15 275a C*b.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sdGsdTsdGsdTsTb.su- p.1 2072 15 275h C*b.sup.1sTb.sup.1sdA*sdUsdTsdUsdGsdGsdTsdAsdGsdUsGb.sup.1sTb.sup.1sTb.su- p.1 2072 15 275c C*b.sup.4sTb.sup.4sAb.sup.4sdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTb.sup.4sTb.sup- .4 2072 15 275d C*b.sup.1ssTb.sup.1ssdAssdTssdTssdTssdGssdGssdTssdAssdGssdTssdGssdTssTb.s- up.1 2072 15 275e C*b.sup.1ssTb.sup.1ssdAssdUssdTssdTssdGssdGssdTssdAssdGssdUssdGssTb.sup.1 ssTb.sup.1 2072 15 275f C*b.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sdTdTdGdGdTdA*dGsTb.sup.1sGb.sup.1sTb- .sup.1sTb.sup.1 2072 15 275g C*b.sup.1Tb.sup.1sdAsdTsdTsdTsdGsdGsdTsdA*sdGsTb.sup.1Gb.sup.1Tb.sup.1Tb.- sup.1 2072 15 275h C*b.sup.6Tb.sup.6Ab.sup.6dUdTdTdGdGdTdA*dGdUGb.sup.6Tb.sup.6Tb.sup.6 2072 15 275i C*b.sup.1dTdAdTdTdTdGdGdTdAdGdTdGdTTb.sup.1 2072 16 210o Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1Tb.su- p.1Tb.sup.1 2072 16 210p Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1- sTb.sup.1sTb.sup.1 2072 16 210q Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1s- Tb.sup.1sTb.sup.1 2072 16 210r Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTdTdTdGdGdTdA*dGdTGb.sup.1Tb.sup.1Tb.su- p.1 2072 16 210s Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdUsdUsdTdGsdGsdTsdA*sdGsdTsGb.sup.1s- Tb.sup.1sTb.sup.1 2072 16 210t Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdUsdTsdTsdGsdGsdTsdAsdGsdUsGb.sup.1s- Tb.sup.1sTb.sup.1 2072 16 210u Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdUsdUsdUsdGsdGsdUsdA*sdGsdUsGb.sup.1- sTb.sup.1sTb.sup.1 2072 16 210v /5SpC3s/Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsG- b.sup.1sTb.sup.1 sTb.sup.1 2072 16 210w Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1s- Tb.sup.1sTb.sup.1 /3SpC3s/ 2072 16 210x /5SpC3s/Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsG- b.sup.1sTb.sup.1 sTb.sup.1/3SpC3s/ 2072 16 210y Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1sdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1Tb.- sup.1Tb.sup.1 2072 16 210z Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1sdUsdTsdTsdGsdGsdUsdA*sdGsdTsGb.sup.1Tb.- sup.1Tb.sup.1 2072 16 210aa Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTdTdTdGdGdTdA*dGdTsGb.sup.1sTb.sup.- 1sTb.sup.1 2072 16 210ab Gb.sup.6sC*b.sup.6sTb.sup.6sAb.sup.6sdTdTdTdGdGdTdA*dGdTsGb.sup.6sTb.sup.- 6sTb.sup.6 2072 16 210ac Gb.sup.6sC*b.sup.6sTb.sup.6sdAsdTsdTsdTsdGsdGsdTsdAsdGsTb.sup.6sGb.sup.6s- Tb.sup.6sTb.sup.6 2072 16 210ad Gb.sup.7sC*b.sup.7sTb.sup.7sdA*sdTsdTsdTsdGsdGsdTsdA*sdGsTb.sup.7sGb.sup.- 7sTb.sup.7sTb.sup.7 2072 16 210ae Gb.sup.7sC*b.sup.7sdUsdAsdTsdTsdUsdGsdGsdUsdA*sdGsTb.sup.7sGb.sup.7sTb.su- p.7sTb.sup.7 2072 16 210af Gb.sup.1ssC*b.sup.1ssTb.sup.1ssdAssdTssdTssdTssdGssdGssdTssdA*ssdGssdTssG- b.sup.1 ssTb.sup.1ssTb.sup.1 2072 16 210ag Gb.sup.4ssC*b.sup.4ssTb.sup.4ssdA*ssdTssdTssdTssdGssdGssdTssdAssdGssdTssd- Gss Tb.sup.4ssTb.sup.4 2072 16 210ah Gb.sup.2ssC*b.sup.2ssTb.sup.2ssAb.sup.2ssdTssdTssdTssdGssdGssdTssdAssdGss- dTssdGss dTssTb.sup.2 2072 16 210ai Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dUsdTsdTsdGsdGsdTsdAsdGsTb.sup.1Gb.sup.1- Tb.sup.1Tb.sup.1 2072 16 210aj Gb.sup.4C*b.sup.4Tb.sup.4Ab.sup.4dTsdTsdTsdGsdGsdTsdAsdGsdTdGTb.sup.4Tb.s- up.4 2072 16 210ak Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sdGsdTsGb- .sup.1sTb.sup.1sTb.sup.1 2072 16 210am Gb.sup.4sC*b.sup.4sTb.sup.4sAb.sup.4sdTsdTsdUsdGsdGsdTsdA*sdGsdTsdGsTb.su- p.4sTb.sup.4 2072 16 210an Gb.sup.7sC*b.sup.7sTb.sup.7sdA*sdTsdTsdUsdGsdGsdTsdA*sdGsdTsGb.sup.7sTb.s- up.7sTb.sup.7 2072 16 210ao Gb.sup.1sC*b.sup.1sdUsdAsdUsdUsdTsdGsdGsdUsdAsGb.sup.1sTb.sup.1sGb.sup.1s- Tb.sup.1sTb.sup.1 2072 16 210ap Gb.sup.1sC*b.sup.1sTb.sup.1sdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1sTb.sup- .1sTb.sup.1 2072 16 210aq Gb.sup.1sC*b.sup.1sTb.sup.1sdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTb.sup.1sTb.- sup.1 2071 17 276a Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sdTsdTsdGsdGsdTsdA*sdGsTb.su- p.1sGb.sup.1sTb.sup.1sTb.sup.1sTb.sup.1 2071 17 276b Gb.sup.2sC*b.sup.2sTb.sup.2sdAsdTsdTsdTsdGsdGsdTsdA*sdGsTb.sup.2sGb.sup.2- sTb.sup.2sTb.sup.2sTb.sup.2 2071 17 276c Gb.sup.1sC*b.sup.1sTb.sup.1sdAsdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1sTb.su- p.1sTb.sup.1sTb.sup.1 2071 17 276d Gb.sup.2sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsTb.sup.2sGb.sup.2sTb.sup.2sTb.- sup.2sTb.sup.2 2071 17 276e Gb.sup.6sC*b.sup.6sTb.sup.6sdA*sdUsdUsdUsdGsdGsdUsdA*sdGsdUsdGsTb.sup.6sT- b.sup.6sTb.sup.6 2071 17 276f Gb.sup.1sdC*sdTsdA*sdUsdUsdUsdGsdGsdUsdAsdGsdUsdGsTb.sup.1sTb.sup.1sTb.su- p.1 2071 17 276g Gb.sup.1C*b.sup.1dTdA*dTdTdTdGdGdTdA*dGdTGb.sup.1Tb.sup.1Tb.sup.1Tb.sup.1 2071 17 276h Gb.sup.4C*b.sup.4Tb.sup.4Ab.sup.4dTdTdTdGdGdTdA*dGdTdGTb.sup.4Tb.sup.4Tb.- sup.4

2071 17 276i Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1Tb.sup.1dUdTdGdGdTdA*dGdTdGdUTb.sup.1Tb.- sup.1 2071 17 276j Gb.sup.1ssC*b.sup.1ssTb.sup.1ssAb.sup.1ssTb.sup.1ssdTssdTssdGssdGssdTssdA- ssdGssdTssdGss Tb.sup.1ssTb.sup.1ssTb.sup.1 2071 17 276k Gb.sup.7sC*b.sup.7sTb.sup.7sAb.sup.7sdTdTdTdGdGdTdA*dGdTsGb.sup.7sTb.sup.- 7sTb.sup.7sTb.sup.7 2071 18 277a Ab.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdA*sdGsTb- .sup.1sGb.sup.1sTb.sup.1sTb.sup.1 sTb.sup.1 2071 18 277b Ab.sup.7sGb.sup.7sC*b.sup.7sTb.sup.7sAb.sup.7sdTsdTsdTsdGsdGsdTsdA*sdGsdT- sdGsdTsdTsTb.sup.7 2071 18 277c Ab.sup.1sGb.sup.1sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsTb.sup.1sGb.sup.1sTb.- sup.1sTb.sup.1sTb.sup.1 2071 18 277d Ab.sup.1sGb.sup.1sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdA*sdGsTb.sup.1sGb.sup.1sTb- .sup.1sTb.sup.1sTb.sup.1 2071 18 277e Ab.sup.1Gb.sup.1dC*dTdAdUdTdTdGdGdTdA*dGTb.sup.1Gb.sup.1Tb.sup.1Tb.sup.1T- b.sup.1 2071 18 277f Ab.sup.2Gb.sup.2C*b.sup.2dTdAdTdTdTdGdGdTdA*dGTb.sup.2Gb.sup.2Tb.sup.2Tb.- sup.2Tb.sup.2 2071 18 277g Ab.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdA*sdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.s- up.1sTb.sup.1sTb.sup.1 sTb.sup.1 2071 18 277h Ab.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdA*sdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTb- .sup.1sTb.sup.1sTb.sup.1 2071 18 277i Ab.sup.1sGb.sup.1sC*b.sup.1sdTsdA*sdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1sT- b.sup.1sTb.sup.1 sTb.sup.1 2071 18 277j Ab.sup.4Gb.sup.4C*b.sup.4Tb.sup.4sdAsdTsdTsdTsdGsdGsdTsdAsdGsTb.sup.4Gb.s- up.4Tb.sup.4Tb.sup.4Tb.sup.4 2071 18 277k Ab.sup.1ssGb.sup.1ssC*b.sup.1ssdTssdA*ssdTssdTssdTssdGssdGssdTssdA*ssdGss- dUssd GssTb.sup.1ssTb.sup.1ssTb.sup.1 2070 19 278a Ab.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdA*sdGsdT- sGb.sup.1sTb.sup.1sTb.sup.1 sTb.sup.1sAb.sup.1 2070 19 278b Ab.sup.2ssGb.sup.2ssC*b.sup.2ssTb.sup.2ssAb.sup.2ssdTssdTssdTssdGssdGssdT- ssdAssdGssdTss dGssdTssdTssTb.sup.2ssAb.sup.2 2070 19 278c Ab.sup.1sdGsdC*sdTsdAsdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1sTb.sup.1sTb.su- p.1sTb.sup.1 sAb.sup.1 2070 19 278d Ab.sup.1sdGsdC*sdTsdAsdTsdTsdTsdGsdGsdUsdA*sdGsdUsGb.sup.1sTb.sup.1sTb.su- p.1sTb.sup.1 sAb.sup.1 2070 19 278e Ab.sup.1sGb.sup.1sC*b.sup.1sdTsdAsdTsdTsdTsdGsdGsdTsdA*sdGsdTsdGsTb.sup.1- sTb.sup.1sTb.sup.1 sAb.sup.1 2070 19 278f Ab.sup.4sGb.sup.4sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsdGsTb.sup.4sTb.sup- .4sTb.sup.4 sAb.sup.4 2070 19 278g Ab.sup.6Gb.sup.6C*b.sup.6Tb.sup.6Ab.sup.6dTdTdTdGdGdTdA*dGdTGb.sup.6Tb.su- p.6Tb.sup.6Tb.sup.6Ab.sup.6 2070 20 279a Gb.sup.1sAb.sup.1sGb.sup.1sC*b.sup.1sTb.sup.1sdAsdTsdTsdTsdGsdGsdTsdA*sdG- sdTsGb.sup.1sTb.sup.1 sTb.sup.1sTb.sup.1sAb.sup.1 2070 20 279b Gb.sup.2sAb.sup.2sGb.sup.2sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.2s- Tb.sup.2sTb.sup.2 sTb.sup.2sAb.sup.2 2070 20 279c Gb.sup.1sdAsdGsdC*sdUsdAsdTsdTsdTsdGsdGsdTsdA*sdGsdTsGb.sup.1sTb.sup.1sTb- .sup.1 sTb.sup.1sAb.sup.1 2070 20 279d Gb.sup.4sAb.sup.4sGb.sup.4sC*b.sup.4sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTsdGs- Tb.sup.4sTb.sup.4 sTb.sup.4sAb.sup.4 2070 20 279e Gb.sup.1Ab.sup.1Gb.sup.1dC*dTdAdTdTdTdGdGdTdAdGdTdGTb.sup.1Tb.sup.1Tb.sup- .1Ab.sup.1 2069 22 280a Ab.sup.1sGb.sup.1sAb.sup.1sGb.sup.1sC*b.sup.1sdTsdAsdTsdTsdTsdGsdGsdTsdAs- dGsdTsdGsTb.sup.1 sTb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1 2069 22 280b Ab.sup.1Gb.sup.1Ab.sup.1Gb.sup.1C*b.sup.1dTdAdTdTdTdGdGdTdAdGdTdGTb.sup.1- Tb.sup.1Tb.sup.1Ab.sup.1Gb.sup.1 2069 22 280c Ab.sup.1sGb.sup.1sAb.sup.1sGb.sup.1sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdAsdGsdTs- dGsTb.sup.1 sTb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1 2069 22 280d Ab.sup.6sGb.sup.6sAb.sup.6sGb.sup.6sdC*sdTsdAsdTsdTsdTsdGsdGsdTsdA*sdGsdT- sdGsdTsd TsTb.sup.6sAb.sup.6sGb.sup.6 2068 24 281a Ab.sup.1sAb.sup.1sGb.sup.1sAb.sup.1sGb.sup.1sdC*sdTsdAsdTsdTsdTsdGsdGsdTs- dAsdGsdTsdGs dTsTb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sGb.sup.1 2068 24 281b Ab.sup.1Ab.sup.1Gb.sup.1Ab.sup.1Gb.sup.1dC*dTdAdTdTdTdGdGdTdAdGdTdGdTTb.s- up.1Tb.sup.1Ab.sup.1Gb.sup.1Gb.sup.1 2067 26 282a Gb.sup.1sAb.sup.1sAb.sup.1sGb.sup.1sAb.sup.1sdGsdC*sdTsdAsdTsdTsdTsdGsdGs- dTsdAsdGsdTs dGsdTsdTsTb.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sGb.sup.1 2067 26 282b Gb.sup.1Ab.sup.1Ab.sup.1Gb.sup.1Ab.sup.1dGdC*dTdAdTdTdTdGdGdTdAdGdTdGdTdT- Tb.sup.1Ab.sup.1Gb.sup.1 Gb.sup.1Gb.sup.1 2066 28 283a Ab.sup.1sGb.sup.1sAb.sup.1sAb.sup.1sGb.sup.1sdAsdGsdC*sdTsdAsdTsdTsdTsdGs- dGsdTsdAsdGs dTsdGsdTsdTsdTsAb.sup.1sGb.sup.1sGb.sup.1sGb.sup.1sAb.sup.1 2066 28 283b Ab.sup.1Gb.sup.1Ab.sup.1Ab.sup.1Gb.sup.1dAdGdC*dTdAdTdTdTdGdGdTdAdGdTdGdT- dTdTAb.sup.1Gb.sup.1 Gb.sup.1Gb.sup.1Ab.sup.1

TABLE-US-00051 TABLE 8 Seq ID SP L No. Sequence, 5'-3' 4220 10 219a Gb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdCsC*b.sup.1sAb.sup.1 4220 10 219b Gb.sup.1Ab.sup.1dAdTdGdGdAdCC*b.sup.1Ab.sup.1 4219 12 220a Tb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdCsC*b.sup.1sAb.sup.1sGb.sup.1 4219 12 220b Tb.sup.1Gb.sup.1Ab.sup.1dAdTdGdGdAdCC*b.sup.1Ab.sup.1Gb.sup.1 4219 12 220c Tb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdCsdC*sAb.sup.1sGb.sup.1 4219 12 220d Tb.sup.1sdGsdA*sdAsdTsdGsdGsdAsdC*sdCsAb.sup.1sGb.sup.1 4219 12 220e Tb.sup.1sGb.sup.1sdA*sdA*sdTsdGsdGsdA*sdC*sdC*sdAsGb.sup.1 4218 13 221a Tb.sup.1sGb.sup.1sAb.sup.1sAb.sup.1sdTsdGsdGsdAsdCsdCsAb.sup.1sGb.sup.1sT- b.sup.1 4218 13 221b Tb.sup.1Gb.sup.1Ab.sup.1Ab.sup.1dUdGdGdAdCdCAb.sup.1Gb.sup.1Tb.sup.1 4218 13 221c Tb.sup.1sGb.sup.1sAb.sup.1sAb.sup.1sdTsdGsdGsdAsdCsdC*sAb.sup.1sGb.sup.1s- Tb.sup.1 4218 13 221d Tb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdA*sdCsdC*sdAsGb.sup.1sTb.sup.1 4218 13 221e Tb.sup.1sGb.sup.1sdA*sdAsdTsdGsdGsdAsdC*sdCsdAsdGsTb.sup.1 4218 13 221f Tb.sup.1sdGsdAsdA*sdTsdGsdGsdAsdCsC*b.sup.1sAb.sup.1sGb.sup.1sTb.sup.1 4218 14 222a Ab.sup.1sTb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdCsC*b.sup.1sAb.sup.1s- Gb.sup.1sTb.sup.1 4218 14 222b Ab.sup.1Tb.sup.1Gb.sup.1Ab.sup.1dAsdTsdGsdGsdAsdCsdC*sAb.sup.1Gb.sup.1Tb.- sup.1 4218 14 222c Ab.sup.1Tb.sup.1dGdA*dAdTdGdGdA*dCC*b.sup.1Ab.sup.1Gb.sup.1Tb.sup.1 4218 14 222d Ab.sup.4sTb.sup.4sGb.sup.4sdA*sdAsdTsdGsdGsdAsdCsdC*sAbsGb.sup.4sTb.sup.4 4218 14 222e Ab.sup.1sdTsdGsdA*sdA*sdTsdGsdGsdA*sdC*sdC*sdA*sdGsTb.sup.1 4218 14 222f Ab.sup.2sTb.sup.2sGb.sup.2sdA*sdAsdUsdGsdGsdAsdCsdCsAb.sup.2sGb.sup.2sTb.- sup.2 4218 14 222g Ab.sup.4ssTb.sup.4ssdGssdAssdAssdTssdGssdGssdAssdCssdCssAb.sup.4ssGb.sup.- 4ssTb.sup.4 4217 15 223a Ab.sup.1sTb.sup.1sGb.sup.1sAb.sup.1sdAdTdGdGdAdCdC*sAb.sup.1sGb.sup.1sTb.- sup.1sAb.sup.1 4217 15 223b Ab.sup.1ssTb.sup.1ssdGssdAssdAssdTssdGssdGssdAssdCssdCssdAssdGssdTssAb.su- p.1 4217 15 223c Ab.sup.1dTdGdAdAdTdGdGdAdCdCdAdGdTAb.sup.1 4217 15 223d Ab.sup.1sTb.sup.1sdGsdAsdAsdUsdGsdGsdA*sdCsdCsdAsGb.sup.1sTb.sup.1sAb.sup- .1 4217 15 223e Ab.sup.6Tb.sup.6Gb.sup.6dA*dAdTdGdGdAdCdC*dAGb.sup.6Tb.sup.6Ab.sup.6 4217 15 223f Ab.sup.1Tb.sup.1dGsdAsdAsdTsdGsdGsdAsdC*sdC*sAb.sup.1Gb.sup.1Tb.sup.1Ab.s- up.1 4217 15 223g Ab.sup.4sTb.sup.4sGb.sup.4sdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsTb.sup.4sAb.sup.- 4 4217 15 223h Ab.sup.1sTb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdC*sdC*sdAsdGsdTsAb.su- p.1 4217 15 223i Ab.sup.1ssTb.sup.1ssdGssdAssdAssdUssdGssdGssdA*ssdCssdCssdAssdGssTb.sup.1 ssAb.sup.1 4217 16 218y C*b.sup.2sAb.sup.2sTb.sup.2sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.2sGb.sup.2s- Tb.sup.2sAb.sup.2 4217 16 218z C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdC*sdC*sAb.sup.1sGb.sup.- 1sTb.sup.1sAb.sup.1 4217 16 218aa C*b.sup.1ssAb.sup.1ssTb.sup.1ssdGssdAssdAssdTssdGssdGssdAssdCssdCssAb.sup- .1ssGb.sup.1 ssTb.sup.1ssAb.sup.1 4217 16 218ab C*b.sup.1Ab.sup.1Tb.sup.1dGsdAsdAsdUsdGsdGsdAsdC*sdC*sAb.sup.1Gb.sup.1Tb.- sup.1Ab.sup.1 4217 16 218ac C*b.sup.1Ab.sup.1Tb.sup.1dGsdA*sdA*sdTsdGsdGsdA*sdCsdCsAb.sup.1Gb.sup.1Tb- .sup.1Ab.sup.1 4217 16 218ad C*b.sup.6sAb.sup.6sTb.sup.6sdGdAdAdTdGdGdAdCdCAb.sup.6sGb.sup.6sTb.sup.6s- Ab.sup.6 4217 16 218ae C*b.sup.7sAb.sup.7sTb.sup.7sGb.sup.7sdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.7s- Tb.sup.7sAb.sup.7 4217 16 218af C*bs.sup.1Ab.sup.1sdUsdGsdAsdAsdUsdGsdGsdUsdCsdCsAb.sup.1sGb.sup.1sTb.sup- .1sAb.sup.1 4217 16 218b C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.1sGb.sup.1s- Tb.sup.1sAb.sup.1 4217 16 218m C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdC*sdC*sAb.sup.1sGb.sup.- 1sTb.sup.1sAb.sup.1 4217 16 218n C*b.sup.1Ab.sup.1Tb.sup.1dGsdAsdAsdTsdGsdGsdAsdC*sdC*sAb.sup.1Gb.sup.1Tb.- sup.1Ab.sup.1 4217 16 218o C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsdA*sdCsdCsAb.sup.1sGb.sup- .1sTb.sup.1sAb.sup.1 4217 16 218p C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsdA*sdC*sdC*sAb.sup.1sGb.s- up.1sTb.sup.1sAb.sup.1 4217 16 218q C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdC*sdCsAb.sup.1sGb.sup.1- sTb.sup.1sAb.sup.1 4217 16 218c C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdC*sAb.sup.1sGb.sup.1- sTb.sup.1sAb.sup.1 4217 16 218r C*b.sup.1Ab.sup.1Tb.sup.1dGdAdAdTdGdGdAdCdCAb.sup.1Gb.sup.1Tb.sup.1Ab.sup- .1 4217 16 218s C*b.sup.1sAb.sup.1sTb.sup.1sdGdAdAdTdGdGdAdC*sdC*sAb.sup.1sGb.sup.1sTb.su- p.1sAb.sup.1 4217 16 218t /5SpC3s/C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.1sG- b.sup.1sTb.sup.1 sAb.sup.1 4217 16 218u C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.1sGb.sup.1s- Tb.sup.1sAb.sup.1 /3SpC3s/ 4217 16 218v /5SpC3s/C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.1sG- b.sup.1sTb.sup.1 sAb.sup.1/3SpC3s/ 4217 16 218ag C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdUsdGsdGsdA*sdCsdCsAb.sup.1sGb.sup- .1sTb.sup.1sAb.sup.1 4217 16 218ah C*b.sup.4ssAb.sup.4ssTb.sup.4ssdGssdA*ssdA*ssdTssdGssdGssdA*ssdCssdCssdAs- sdGss Tb.sup.4ssAb.sup.4 4217 16 218ai C*b.sup.2ssAb.sup.2ssTb.sup.2ssGb.sup.2ssdAssdAssdTssdGssdGssdAssdCssdCss- dAssdGss dTssAb.sup.2 4217 16 218aj C*b.sup.1Ab.sup.1Tb.sup.1Gb.sup.1dAdAdUdGdGdAdCdCAb.sup.1Gb.sup.1Tb.sup.1- Ab.sup.1 4217 16 218ak C*b.sup.1sAb.sup.1sTb.sup.1sGb.sup.1sAb.sup.1sdA*sdUsdGsdGsdAsdCsdCsdA*sG- b.sup.1sTb.sup.1sAb.sup.1 4217 16 218am C*b.sup.1sAb.sup.1sdUsdGsdAsdAsdUsdGsdGsdAsdCsC*b.sup.1sAb.sup.1sGb.sup.1- sTb.sup.1sAb.sup.1 4217 16 218an C*b.sup.6sAb.sup.6sTb.sup.6sGb.sup.6sdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.6s- Tb.sup.6sAb.sup.6 4217 16 218ao C*b.sup.7sAb.sup.7sTb.sup.7sdGsdA*sdA*sdUsdGsdGsdAsdCsdCsdA*sGb.sup.7sTb.- sup.7sAb.sup.7 4217 16 218ap C*b.sup.4sAb.sup.4sTb.sup.4sGb.sup.4sdA*sdAsdTsdGsdGsdAsdCsdC*sdAsdGsTb.s- up.4sAb.sup.4 4217 16 218aq C*b.sup.4Ab.sup.4Tb.sup.4Gb.sup.4dAdAdTdGdGdAdCdCdAdGTb.sup.4Ab.sup.4 4217 16 218ar C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.1sTb.sup- .1sAb.sup.1 4216 17 224a C*b.sup.1sAb.sup.1sTb.sup.1sGb.sup.1sAb.sup.1sdAsdTsdGsdGsdAsdCsdCsAb.sup- .1sGb.sup.1sTb.sup.1sAb.sup.1sTb.sup.1 4216 17 224b C*b.sup.2sAb.sup.2sTb.sup.2sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.2sGb.sup.2s- Tb.sup.2sAb.sup.2sTb.sup.2 4216 17 224c C*b.sup.1sAb.sup.1sTb.sup.1sGb.sup.1sdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsTb.sup- .1sAb.sup.1sTb.sup.1 4216 17 224d C*b.sup.1sdAsdUsdGsdAsdAsdUsdGsdGsdAsdC*sdC*sAb.sup.1sGb.sup.1sTb.sup.1sA- b.sup.1sTb.sup.1 4216 17 224e C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsdA*sdC*sdC*sAb.sup.1sGb.s- up.1sTb.sup.1sAb.sup.1 sTb.sup.1

4216 17 224f C*b.sup.1Ab.sup.1dTdGdAdAdTdGdGdAdCdCdAGb.sup.1Tb.sup.1Ab.sup.1Tb.sup.1 4216 17 224g C*b.sup.1sdAsdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsTb.sup.1sAb.sup.1sTb.sup- .1 4216 17 224h C*b.sup.1Ab.sup.1Tb.sup.1Gb.sup.1Ab.sup.1dA*dTdGdGdA*dC*dC*dAdGdTAb.sup.1- Tb.sup.1 4216 17 224i C*b.sup.1ssAb.sup.1ssTb.sup.1ssGb.sup.1ssAb.sup.1ssdAssdTssdGssdGssdAssdC- ssdCssdAssdGss Tb.sup.1ssAb.sup.1ssTb.sup.1 4216 17 224j C*b.sup.4Ab.sup.4Tb.sup.4dGdA*dA*dTdGdGdA*dCdCdAGb.sup.4Tb.sup.4Ab.sup.4T- b.sup.4 4216 17 224k C*b.sup.6sAb.sup.6sTb.sup.6sdGsdA*sdA*sdUsdGsdGsdA*sdC*sdC*sdAsdGsTb.sup.- 6sAb.sup.6sTb.sup.6 4216 17 224m C*b.sup.7sAb.sup.7sTb.sup.7sGb.sup.7sdAdAdTdGdGdAdC*dC*dAsGb.sup.7sTb.sup- .7sAb.sup.7sTb.sup.7 4216 18 225a Tb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sGb.sup.1sdAsdAsdTsdGsdGsdAsdCsdCsAb.- sup.1sGb.sup.1sTb.sup.1sAb.sup.1 sTb.sup.1 4216 18 225b Tb.sup.7sC*b.sup.7sAb.sup.7sTb.sup.7sGb.sup.7sdAsdAsdTsdGsdGsdAsdCsdCsdAs- dGsdTsdAsTb.sup.7 4216 18 225c Tb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdC*sdC*sdAsGb.s- up.1sTb.sup.1sAb.sup.1 sTb.sup.1 4216 18 225d Tb.sup.1sC*b.sup.1sAb.sup.1sdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.1sTb.- sup.1sAb.sup.1sTb.sup.1 4216 18 225e Tb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsTb.- sup.1sAb.sup.1sTb.sup.1 4216 18 225f Tb.sup.1C*b.sup.1dA*dTdGdAdAdUdGdGdAdCdC*Ab.sup.1Gb.sup.1Tb.sup.1Ab.sup.1- Tb.sup.1 4216 18 225g Tb.sup.4C*b.sup.4Ab.sup.4Tb.sup.4sdGsdAsdAsdTsdGsdGsdAsdCsdCsAb.sup.4Gb.s- up.4Tb.sup.4Ab.sup.4Tb.sup.4 4216 18 225h Tb.sup.1ssC*b.sup.1ssAb.sup.1ssdTssdGssdA*ssdA*ssdTssdGssdGssdAssdCssdC*s- sdA* ssdGssTb.sup.1ssAb.sup.1ssTb.sup.1 4216 18 225i Tb.sup.2C*b.sup.2Ab.sup.2dTdGdAdAdTdGdGdAdC*dC*Ab.sup.2Gb.sup.2Tb.sup.2Ab- .sup.2Tb.sup.2 4215 19 226a Tb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sGb.sup.1sdAsdAsdTsdGsdGsdAsdCsdCsdAs- Gb.sup.1sTb.sup.1sAb.sup.1 sTb.sup.1sTb.sup.1 4215 19 226b Tb.sup.6C*b.sup.6Ab.sup.6Tb.sup.6Gb.sup.6dAdAdTdGdGdAdCdCdAGb.sup.6Tb.sup- .6Ab.sup.6Tb.sup.6Tb.sup.6 4215 19 226c Tb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsdTs- Ab.sup.1sTb.sup.1 sTb.sup.1 4215 19 226d Tb.sup.1sdCsdAsdTsdGsdAsdA*sdUsdGsdGsdAsdCsdCsdAsGb.sup.1sTb.sup.1sAb.sup- .1sTb.sup.1 sTb.sup.1 4215 19 226e Tb.sup.4sC*b.sup.4sdAsdUsdGsdAsdAsdUsdGsdGsdAsdCsdC*sdAsdGsTb.sup.4sAb.su- p.4sTb.sup.4 sTb.sup.4 4215 19 226f Tb.sup.2ssC*b.sup.2ssAb.sup.2ssTb.sup.2ssGb.sup.2ssdAssdAssdTssdGssdGssdA- ssdCssdCssdAss dGssdTssdAssTb.sup.2ssTb.sup.2 4215 20 227a C*b.sup.1sTb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsdCsdC- sdAsGb.sup.1sTb.sup.1 sAb.sup.1sTb.sup.1sTb.sup.1 4215 20 227b C*b.sup.2sTb.sup.2sC*b.sup.2sdAsdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.2- sTb.sup.2sAb.sup.2 sTb.sup.2sTb.sup.2 4215 20 227c C*b.sup.1Tb.sup.1C*b.sup.1dAdTdGdAdAdTdGdGdAdCdC*dAdGTb.sup.1Ab.sup.1Tb.s- up.1Tb.sup.1 4215 20 227d C*b.sup.1sdUsdCsdAsdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsGb.sup.1sTb.sup.1sAb.- sup.1 sTb.sup.1sTb.sup.1 4215 20 227e C*b.sup.4sTb.sup.4sC*b.sup.4sAb.sup.4sdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsdG- sTb.sup.4sAb.sup.4 sTb.sup.4sTb.sup.4 4214 22 228a Tb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sAb.sup.1sdTsdGsdAsdAsdTsdGsdGsdAsdC- sdCsdAsdGsTb.sup.1 sAb.sup.1sTb.sup.1sTb.sup.1sC*b.sup.1 4214 22 228b Tb.sup.1C*b.sup.1Tb.sup.1C*b.sup.1Ab.sup.1dTdGdAdAdTdGdGdAdC*dC*dAdGTb.su- p.1Ab.sup.1Tb.sup.1Tb.sup.1C*b.sup.1 4214 22 228c Tb.sup.6sC*b.sup.6sTb.sup.6sdCsdAsdTsdGsdAsdAsdTsdGsdGsdAsdCsdCsdAsdGsdTs Ab.sup.6sTb.sup.6sTb.sup.6sC*b.sup.6 4213 24 229a Ab.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sC*b.sup.1sdAsdTsdGsdAsdAsdTsdGsdGsdA- sdC*sdCsdAsdG sdTsAb.sup.1sTb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1 4213 24 229b Ab.sup.1Tb.sup.1C*b.sup.1Tb.sup.1C*b.sup.1AdTdGdAdAdTdGdGdAdCdCdAdGdTAb.s- up.1Tb.sup.1Tb.sup.1C*b.sup.1Tb.sup.1 4212 26 230a Tb.sup.1sAb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sdCsdAsdTsdGsdAsdAsdTsdGsdGs- dAsdCsdCsdAs dGsdTsdAsTb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1 4212 26 230a Tb.sup.1sAb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sdCsdAsdTsdGsdAsdAsdTsdGsdGs- dAsdCsdCsdAs dGsdTsdAsTb.sup.1sTb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1 4212 26 230b Tb.sup.1Ab.sup.1Tb.sup.1C*b.sup.1Tb.sup.1dCdAdTdGdAdAdTdGdGdAdCdCdAdGdTdA- Tb.sup.1Tb.sup.1C*b.sup.1 Tb.sup.1Ab.sup.1 4211 28 231a Ab.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sC*b.sup.1sdTsdCsdAsdTsdGsdAsdAsdTsdGs- dGsdAsdCsdCs dAsdGsdTsdAsdTsTb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sGb.sup.1 4211 28 231b Ab.sup.1Tb.sup.1Ab.sup.1Tb.sup.1C*b.sup.1dTdCdAdTdGdAdAdTdGdGdAdCdCdAdGdT- dAdTTb.sup.1C*b.sup.1 Tb.sup.1Ab.sup.1Gb.sup.1

TABLE-US-00052 TABLE 9 Seq ID SP L No. Sequence, 5'-3' 2358 10 284a C*b.sup.1sAb.sup.1sbTsdTsdAsdAsdTsdA*sAb.sup.1sAb.sup.1 2358 10 284b C*b.sup.1Ab.sup.1dTdTdA*dAdTdA*Ab.sup.1Ab.sup.1 2357 12 285a Gb.sup.1sC*b.sup.1sAb.sup.1sdTsdTsdA*sdA*sdTsdAsAb.sup.1sAb.sup.1sGb.sup.- 1 2357 12 285h Gb.sup.1sC*b.sup.1sAb.sup.1sdTsdTsdA*sdA*sdTsdAsdA*sAb.sup.1sGb.sup.1 2357 12 285c Gb.sup.1sC*b.sup.1sdAsdTsdTsdA*sdA*sdUsdAsdA*sdA*sGb.sup.1 2357 12 285d Gb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsAb.sup.1sGb.sup.1 2357 12 285e Gb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdA*sAb.sup.1sGb.sup.1 2357 12 285f Gb.sup.1C*b.sup.1Ab.sup.1dTdTdA*dA*dTdAAb.sup.1Ab.sup.1Gb.sup.1 2356 13 286a Gb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdTsdAsdAsdTsdAsdAsAb.sup.1sGb.sup.1s- Tb.sup.1 2356 13 286h Gb.sup.1sC*b.sup.1sAb.sup.1sTb.sup.1sdTsdA*sdA*sdTsdAsdAsAb.sup.1sGb.sup.- 1sTb.sup.1 2356 13 286c Gb.sup.1sC*b.sup.1sAb.sup.1sdUsdTsdAsdAsdTsdAsdAsdA*sGb.sup.1sTb.sup.1 2356 13 286d Gb.sup.1sC*b.sup.1sdAsdTsdTsdAsdA*sdUsdAsdAsdAsdGsTb.sup.1 2356 13 286e Gb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsAb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1 2356 13 286f Gb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdA*sAb.sup.1sAb.sup.1sGb.sup.1sTb.sup.1 2356 13 286g Gb.sup.1C*b.sup.1Ab.sup.1Tb.sup.1dUdAdAdUdAdAAb.sup.1Gb.sup.1Tb.sup.1 2356 14 287a Gb.sup.1sGb.sup.1sC*b.sup.1sAb.sup.1sdTsdTsdA*sdAsdTsdAsAb.sup.1sAb.sup.1- sGb.sup.1sTb.sup.1 2356 14 287b Gb.sup.4sGb.sup.4sC*b.sup.4sAb.sup.4sdTsdTsdA*sdAsdUsdAsdAsdA*sGb.sup.4sT- b.sup.4 2356 14 287b Gb.sup.1sdGsdCsdAsdUsdUsdAsdAsdTsdA*sdA*sdA*sdGsTb.sup.1 2356 14 287d Gb.sup.2sGb.sup.2sC*b.sup.2sdA*sdUsdTsdA*sdAsdTsdAsdA*sAb.sup.2sGb.sup.2s- Tb.sup.2 2356 14 287e Gb.sup.1Gb.sup.1C*b.sup.1Ab.sup.1sdTsdTsdAsdAsdTsdA*sdA*sAb.sup.1Gb.sup.1- Tb.sup.1 2356 14 287f Gb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsAb.sup.1sAb.sup.1sGb.sup.1sTb.- sup.1 2356 14 287g Gb.sup.1sGb.sup.1sdC*sdA*sdTsdTsdA*sdA*sdTsdA*sAb.sup.1sAb.sup.1sGb.sup.1- sTb.sup.1 2356 14 287h Gb.sup.1Gb.sup.1dC*dAdTdTdAdAdTdAAb.sup.1Ab.sup.1Gb.sup.1Tb.sup.1 2356 14 287i Gb.sup.4ssGb.sup.4ssdCssdAssdTssdTssdAssdAssdTssdAssAb.sup.4ssAb.sup.4ssG- b.sup.4ssTb.sup.4 2356 14 287j Gb.sup.4ssGb.sup.4ssdC*ssdAssdTssdTssdAssdAssdTssdAssAb.sup.4ssAb.sup.4ss- Gb.sup.4ssTb.sup.4 2355 15 288a Gb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup- .1 2355 15 288b Gb.sup.1sGb.sup.1sC*b.sup.1sAb.sup.1sdTsdTsdA*sdA*sdTsdAsdAsdAsdGsdTsGb.s- up.1 2355 15 288b Gb.sup.4sGb.sup.4sC*b.sup.4sdAsdTsdTsdAsdAsdTsdAsdAsdAsdGsTb.sup.4sGb.sup- .4 2355 15 288d Gb.sup.1sGb.sup.1sC*b.sup.1sAb.sup.1sdTdTdAdAdTdAdAsAb.sup.1sGb.sup.1sTb.- sup.1sGb.sup.1 2355 15 288e Gb.sup.1Gb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsAb.sup.1Gb.sup.1Tb.sup.1Gb.s- up.1 2355 15 288f Gb.sup.1ssGb.sup.1ssdCssdAssdUssdUssdAssdAssdUssdAssdAssdAssdGssTb.sup.1 ssGb.sup.1 2355 15 288g Gb.sup.1ssGb.sup.1ssdCssdAssdTssdTssdAssdAssdTssdAssdAssdAssdGssdTssGb.su- p.1 2355 15 288h Gb.sup.6Gb.sup.6C*b.sup.6dA*dTdTdAdAdUdA*dA*dAGb.sup.6Tb.sup.6Gb.sup.6 2355 15 288i Gb.sup.1Gb.sup.1C*b.sup.1dAdTdTdAdAdUdAdAdAGb.sup.1Tb.sup.1Gb.sup.1 2355 16 289a Ab.sup.1sGb.sup.1sGb.sup.1sC*b.sup.1sAb.sup.1sdTsdTsdA*sdA*sdTsdA*sAb.sup- .1sAb.sup.1sGb.sup.1sTb.sup.1sGb.sup.1 2355 16 289b Ab.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsAb.sup.1sAb.sup.1sGb.- sup.1sTb.sup.1sGb.sup.1 2355 16 289b Ab.sup.1sGb.sup.1sGb.sup.1sdC*sdA*sdTsdTsdA*sdA*sdTsdA*sAb.sup.1sAb.sup.1- sGb.sup.1sTb.sup.1sGb.sup.1 2355 16 289d Ab.sup.2sGb.sup.2sGb.sup.2sdC*sdAsdTsdTsdAsdAsdTsdAsAb.sup.2sAb.sup.2sGb.- sup.2sTb.sup.2sGb.sup.2 2355 16 289e Ab.sup.1sdGsdGsdC*sdAsdTsdTsdAsdAsdTsdAsAb.sup.1sAb.sup.1sGb.sup.1sTb.sup- .1sGb.sup.1 2355 16 289f Ab.sup.1sdGsdGsdC*sdAsdTsdUsdAsdAsdUsdAsAb.sup.1sAb.sup.1sGb.sup.1sTb.sup- .1sGb.sup.1 2355 16 289g Ab.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsAb.sup.1sGb.sup.1s- Tb.sup.1sGb.sup.1 2355 16 289h Ab.sup.1sGb.sup.1sGb.sup.1sC*b.sup.1sdA*sdTsdTsdA*sdA*sdTsdA*sdAsdAsGb.su- p.1sTb.sup.1sGb.sup.1 2355 16 289i Ab.sup.6sGb.sup.6sGb.sup.6sdC*sdA*sdUsdTsdAsdAsdTsdAsdAsdAsGb.sup.6sTb.su- p.6sGb.sup.6 2355 16 289j Ab.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb.sup- .1sGb.sup.1 2355 16 289k Ab.sup.1sdGsdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1 2355 16 289m Ab.sup.1Gb.sup.1Gb.sup.1C*b.sup.1Ab.sup.1dUdTdA*dA*dTdAdAdAdGTb.sup.1Gb.s- up.1 2355 16 289n Ab.sup.1Gb.sup.1dGdC*dAdTdTdAdAdTdAdAAb.sup.1Gb.sup.1Tb.sup.1Gb.sup.1 2355 16 289o Ab.sup.4Gb.sup.4Gb.sup.4dCdA*dTdTdAdAdTdAdA*Ab.sup.4Gb.sup.4Tb.sup.4Gb.su- p.4 2355 16 289p Ab.sup.1ssGb.sup.1ssGb.sup.1ssC*b.sup.1ssAb.sup.1ssdTssdTssdAssdAssdTssdA- ssdAssdAss Gb.sup.1ssTb.sup.1ssGb.sup.1 2355 16 289q Ab.sup.7sGb.sup.7sGb.sup.7sC*b.sup.7sdA*dTdTdAdAdTdAdA*sAb.sup.7sGb.sup.7- sTb.sup.7sGb.sup.7 2355 17 213j C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb- .sup.1sGb.sup.1 2355 17 213k C*b.sup.1sAb.sup.1sGb.sup.1sdGsdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb.- sup.1sGb.sup.1 2355 17 213m C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdA*sdA*sGb.sup.1s- Tb.sup.1sGb.sup.1 2355 17 213n C*b.sup.1Ab.sup.1Gb.sup.1dGdC*dAdTdTdAdAdTdAdAdAGb.sup.1Tb.sup.1Gb.sup.1 2355 17 213o /5SpC3s/C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.- sup.1sTb.sup.1 sGb.sup.1 2355 17 213p C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb- .sup.1sGb.sup.1 /3SpC3s/ 2355 17 213q /5SpC3s/C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.- sup.1sTb.sup.1 sGb.sup.1/3SpC3s/ 2355 17 213r C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdUsdAsdAsdA*sGb.sup.1sT- b.sup.1sGb.sup.1 2355 17 213s C*b.sup.6sAb.sup.6sGb.sup.6sdGdC*dAdTdTdAdAdTdAdAdAsGb.sup.6sTb.sup.6sGb.- sup.6 2355 17 213t C*b.sup.1sAb.sup.1sGb.sup.1sdGdC*dAdTdTdAdAdTdAdAdAsGb.sup.1sTb.sup.1sGb.- sup.1 2355 17 213u C*b.sup.1Ab.sup.1Gb.sup.1sdGsdC*sdAsdUsdUsdAsdAsdUsdAsdAsdAsGb.sup.1Tb.su- p.1Gb.sup.1 2355 17 213v C*b.sup.1Ab.sup.1Gb.sup.1sdGsdC*sdAsdTsdTsdAsdA*sdTsdAsdAsdA*sGb.sup.1Tb.- sup.1Gb.sup.1 2355 17 213w C*b.sup.1Ab.sup.1Gb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1Tb.su- p.1Gb.sup.1 2355 17 213x C*b.sup.7sAb.sup.7sGb.sup.7sGb.sup.7sdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.su- p.7sTb.sup.7sGb.sup.7 2355 17 213y C*b.sup.6sAb.sup.6sGb.sup.6sGb.sup.6sdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup- .6sTb.sup.6sGb.sup.6 2355 17 213z C*b.sup.7sAb.sup.7sGb.sup.7sdGsdCsdA*sdUsdTsdAsdAsdTsdAsdAsAb.sup.7sGb.su- p.7sTb.sup.7sGb.sup.7 2355 17 213aa C*b.sup.4sAb.sup.4sGb.sup.4sGb.sup.4sdC*sdA*sdTsdTsdAsdAsdTsdAsdA*sdAsdGs- Tb.sup.4sGb.sup.4

2355 17 213ab C*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sC*b.sup.1sdA*sdTsdTsdA*sdA*sdTsdAsdA- *sdA*sGb.sup.1sTb.sup.1 sGb.sup.1 2355 17 213ac C*b.sup.1sAb.sup.1sGb.sup.1sdGsdCsdAsdTsdTsdA*sdA*sdTsdAsAb.sup.1sAb.sup.- 1sGb.sup.1sTb.sup.1sGb.sup.1 2355 17 213ad C*b.sup.1sAb.sup.1sdGsdGsdC*sdAsdTsdTsdAsdAsdUsdAsdAsAb.sup.1sGb.sup.1sTb- .sup.1sGb.sup.1 2355 17 213ae C*b.sup.1ssAb.sup.1ssGb.sup.1ssdGssdC*ssdAssdTssdTssdAssdAssdTssdAssdAssA- b.sup.1 ssGb.sup.1ssTb.sup.1ssGb.sup.1 2355 17 213af C*b.sup.4ssAb.sup.4ssGb.sup.4ssdGssdCssdAssdTssdTssdA*ssdAssdTssdAssdAssd- Ass dGssTb.sup.4ssGb.sup.4 2355 17 213ag C*b.sup.2ssAb.sup.2ssGb.sup.2ssGb.sup.2ssdCssdAssdTssdTssdAssdAssdTssdAss- dAssdAss dGssdTssGb.sup.2 2355 17 213ah C*b.sup.1Ab.sup.1Gb.sup.1Gb.sup.1dCdAdTdTdAdAdUdAdAAb1 Gb.sup.1Tb.sup.1Gb.sup.1 2355 17 213ai C*b.sup.4Ab.sup.4Gb.sup.4Gb.sup.4dCdAdTdTdAdAdTdAdAdAdGTb.sup.4Gb.sup.4 2355 17 213aj C*b.sup.1Ab.sup.1Gb.sup.1dGdCdAdTdTdAdAdUdAdAdAGb.sup.1Tb.sup.1Gb.sup.1 2355 17 213ak C*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sdCsdAsdTsdTsdAsdAsdTsdAsdAsAb.sup.1s- Gb.sup.1sTb.sup.1sGb.sup.1 2354 18 290a C*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sC*b.sup.1sdAsdTsdTsdAsdAsdTsdA*sdAsA- b.sup.1sGb.sup.1sTb.sup.1sGb.sup.1 sC*b.sup.1 2354 18 290h C*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.su- p.1sTb.sup.1sGb.sup.1 sC*b.sup.1 2354 18 290c C*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsdGsTb- .sup.1sGb.sup.1 sC*b.sup.1 2354 18 290d C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.1sTb- .sup.1sGb.sup.1 sC*b.sup.1 2354 18 290e C*b.sup.7sAb.sup.7sGb.sup.7sGb.sup.7sC*b.sup.7sdA*sdTsdTsdAsdAsdTsdAsdAsd- AsdGsdTsdG sC*b.sup.7 2354 18 290f C*b.sup.4Ab.sup.4Gb.sup.4Gb.sup.4sdCsdAsdTsdTsdAsdAsdTsdA*sdAsAb.sup.4Gb.- sup.4Tb.sup.4Gb.sup.4C*b.sup.4 2354 18 290g C*b.sup.1ssAb.sup.1ssGb.sup.1ssdGssdC*ssdAssdTssdTssdA*ssdAssdTssdA*ssdAs- sdA* ssdGssTb.sup.1ssGb.sup.1ssC*b.sup.1 2354 18 290h C*b.sup.2Ab.sup.2Gb.sup.2dGdC*dAdTdTdAdAdTdAdAAb.sup.2Gb.sup.2Tb.sup.2Gb.- sup.2C*b.sup.2 2354 18 290i C*b.sup.1Ab.sup.1dGdGdC*dA*dUdUdAdAdUdA*dA*Ab.sup.1Gb.sup.1Tb.sup.1Gb.sup- .1C*b.sup.1 2354 19 291a Ab.sup.1sC*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdA- sAb.sup.1sGb.sup.1sTb.sup.1 sGb.sup.1sC*b.sup.1 2354 19 291b Ab.sup.1sC*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsdG- sTb.sup.1sGb.sup.1 sC*b.sup.1 2354 19 291c Ab.sup.4sC*b.sup.4sdAsdGsdGsdC*sdAsdTsdTsdAsdAsdUsdAsdAsdAsGb.sup.4sTb.su- p.4sGb.sup.4 sC*b.sup.4 2354 19 291d Ab.sup.1sdC*sdAsdGsdGsdC*sdA*sdTsdTsdAsdAsdTsdAsdAsAb.sup.1sGb.sup.1sTb.s- up.1sGb.sup.1 sC*b.sup.1 2354 19 291e Ab.sup.2ssC*b.sup.2ssAb.sup.2ssGb.sup.2ssGb.sup.2ssdCssdAssdTssdTssdAssdA- ssdTssdAssdAss dAssdGssdTssGb.sup.2ssC*b.sup.2 2354 19 291f Ab.sup.6C*b.sup.6Ab.sup.6Gb.sup.6Gb.sup.6dC*dAdTdTdAdAdTdAdAAb.sup.6Gb.su- p.6Tb.sup.6Gb.sup.6C*b.sup.6 2353 20 292a Ab.sup.1sC*b.sup.1sAb.sup.1sGb.sup.1sGb.sup.1sdC*sdAsdTsdTsdAsdAsdTsdAsdA- sdAsGb.sup.1sTb.sup.1 sGb.sup.1sC*b.sup.1sAb.sup.1 2353 20 292b Ab.sup.2sC*b.sup.2sAb.sup.2sdGsdGsdC*sdAsdTsdTsdAsdAsdTsdAsdAsdAsGb.sup.2- sTb.sup.2sGb.sup.2 sC*b.sup.2sAb.sup.2 2353 20 292c Ab.sup.1sdC*sdAsdGsdGsdC*sdAsdUsdUsdAsdAsdUsdAsdAsdAsGb.sup.1sTb.sup.1sGb- .sup.1 sC*b.sup.1sAb.sup.1 2353 20 292d Ab.sup.4sC*b.sup.4sAb.sup.4sGb.sup.4sdGsdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsdGs- Tb.sup.4sGb.sup.4 sC*b.sup.4sAb.sup.4 2353 20 292e Ab.sup.1C*b.sup.1Ab.sup.1dGdGdC*dAdTdTdAdAdTdAdAdAdGTb.sup.1Gb.sup.1C*b.s- up.1Ab.sup.1 2352 22 293a Tb.sup.1sAb.sup.1sC*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTsdA- sdAsdAsdGsTb.sup.1 sGb.sup.1sC*b.sup.1sAb.sup.1sAb.sup.1 2352 22 293h Tb.sup.1Ab.sup.1C*b.sup.1Ab.sup.1Gb.sup.1dGdC*dAdTdTdAdAdTdAdAdAdGTb.sup.- 1Gb.sup.1C*b.sup.1Ab.sup.1Ab.sup.1 2352 22 293c Tb.sup.6sAb.sup.6sC*b.sup.6sdAsdGsdGsdCsdAsdTsdTsdAsdAsdTsdAsdAsdAsdGsTb.- sup.6 sGb.sup.6sC*b.sup.6sAb.sup.6sAb.sup.6 2351 24 294a Ab.sup.1sTb.sup.1sAb.sup.1sC*b.sup.1sAb.sup.1sdGsdGsdC*sdAsdTsdTsdAsdAsdT- sdAsdAsdAsdG sdTsGb.sup.1sC*b.sup.1sAb.sup.1sAb.sup.1sAb.sup.1 2351 24 294b Ab.sup.1Tb.sup.1Ab.sup.1C*b.sup.1Ab.sup.1dGdGdC*dAdTdTdAdAdTdAdAdAdGdTGb.- sup.1C*b.sup.1Ab.sup.1Ab.sup.1 Ab.sup.1 2350 26 295a Tb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sC*b.sup.1sdAsdGsdGsdC*sdAsdTsdTsdAsdA- sdTsdAsdAsdAs dGsdTsdGsC*b.sup.1sAb.sup.1sAb.sup.1sAb.sup.1sTb.sup.1 2350 26 295b Tb.sup.1Ab.sup.1Tb.sup.1Ab.sup.1C*b.sup.1dAdGdGdC*dAdTdTdAdAdTdAdAdAdGdTd- GC*b.sup.1Ab.sup.1Ab.sup.1 Ab.sup.1Tb.sup.1 2349 28 236a Ab.sup.1sTb.sup.1sAb.sup.1sTb.sup.1sAb.sup.1sdC*sdAsdGsdGsdC*sdAsdTsdTsdA- sdAsdTsdAsdAs dAsdGsdTsdGsdC*sAb.sup.1sAb.sup.1sAb.sup.1sTb.sup.1sGb.sup.1 2349 28 236b Ab.sup.1Tb.sup.1Ab.sup.1Tb.sup.1Ab.sup.1dC*dAdGdGdCdAdTdTdAdAdTdAdAdAdGdT- dGdC*Ab.sup.1Ab.sup.1 Ab.sup.1Tb.sup.1Gb.sup.1

Pharmaceutical Compositions

[0461] The antisense-oligonucleotides of the present invention are preferably administered in form of their pharmaceutically active salts optionally using substantially nontoxic pharmaceutically acceptable carriers, excipients, adjuvants, solvents or diluents. The medications of the present invention are prepared in a conventional solid or liquid carrier or diluents and a conventional pharmaceutically-made adjuvant at suitable dosage level in a known way. The preferred preparations and formulations are in administrable form which is suitable for infusion or injection (intrathecal, intracerebroventricular, intracranial, intravenous, intraparenchymal, intratumoral, intra- or extraocular, intraperitoneal, intramuscular, subcutaneous), local administration into the brain, inhalation, local administration into a solid tumor or oral application. However also other application forms are possible such as absorption through epithelial or mucocutaneous linings (oral mucosa, rectal and vaginal epithelial linings, nasopharyngial mucosa, intestinal mucosa), rectally, transdermally, topically, intradermally, intragastrically, intracutaneously, intravaginally, intravasally, intranasally, intrabuccally, percutaneously, sublingually application, or any other means available within the pharmaceutical arts. The administrable formulations, for example, include injectable liquid formulations, retard formulations, powders especially for inhalation, pills, tablets, film tablets, coated tablets, dispersible granules, dragees, gels, syrups, slurries, suspensions, emulsions, capsules and deposits. Other administrable galenical formulations are also possible like a continuous injection through an implantable pump or a catheter into the brain.

[0462] As used herein the term "pharmaceutically acceptable" refers to any carrier which does not interfere with the effectiveness of the biological activity of the antisense-oligonucleotides as active ingredient in the formulation and that is not toxic to the host to which it is administered. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Such carriers can be formulated by conventional methods and the active compound can be administered to the subject at an effective dose.

[0463] An "effective dose" refers to an amount of the antisense-oligonucleotide as active ingredient that is sufficient to affect the course and the severity of the disease, leading to the reduction or remission of such pathology. An "effective dose" useful for treating and/or preventing these diseases or disorders may be determined using methods known to one skilled in the art. Furthermore, the antisense-oligonucleotides of the present invention may be mixed and administered together with liposomes, complex forming agents, receptor targeted molecules, solvents, preservatives and/or diluents.

[0464] Preferred are pharmaceutical preparations in form of infusion solutions or solid matrices for continuous release of the active ingredient, especially for continuous infusion for intrathecal administration, intracerebroventricular administration or intracranial administration of at least one antisense-oligonucleotide of the present invention. Also preferred are pharmaceutical preparations in form of solutions or solid matrices suitable for local administration into the brain. For fibrotic diseases of the lung, inhalation formulations are especially preferred.

[0465] A ready-to-use sterile solution comprises for example at least one antisense-oligonucleotide at a concentration ranging from 1 to 10 mg/ml, preferably from 5 to 10 mg/ml and an isotonic agent selected, for example, amongst sugars such as sucrose, lactose, mannitol or sorbitol. A suitable buffering agent, to control the solution pH to 6 to 8 (preferably 7-8), may be also included. Another optional ingredient of the formulation can be a non-ionic surfactant, such as Tween 20 or Tween 80.

[0466] A sterile lyophilized powder to be reconstituted for use comprises at least one antisense-oligonucleotide, and optionally a bulking agent (e.g. mannitol, trehalose, sorbitol, glycine) and/or a cryoprotectent (e.g. trehalose, mannitol). The solvent for reconstitution can be water for injectable compounds, with or without a buffering salt to control the pH to 6 to 8.

[0467] Aerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be in combination with a pharmaceutically acceptable carrier such as inert compressed gas, e.g. nitrogen.

[0468] A particularly preferred pharmaceutical composition is a lyophilized (freeze-dried) preparation (lyophilisate) suitable for administration by inhalation or for intravenous administration. To prepare the preferred lyophilized preparation at least one antisense-oligonucleotide of the invention is solubilized in a 4 to 5% (w/v) mannitol solution and the solution is then lyophilized. The mannitol solution can also be prepared in a suitable buffer solution as described above.

[0469] Further examples of suitable cryo-/lyoprotectants (otherwise referred to as bulking agents or stabilizers) include thiol-free albumin, immunoglobulins, polyalkyleneoxides (e.g. PEG, polypropylene glycols), trehalose, glucose, sucrose, sorbitol, dextran, maltose, raffinose, stachyose and other saccharides (cf. for instance WO 97/29782), while mannitol is used preferably. These can be used in conventional amounts in conventional lyophilization techniques. Methods of lyophilization are well known in the art of preparing pharmaceutical formulations.

[0470] For administration by inhalation the particle diameter of the lyophilized preparation is preferably between 2 to 5 .mu.m, more preferably between 3 to 4 .mu.m. The lyophilized preparation is particularly suitable for administration using an inhalator, for example the OPTINEB.RTM. or VENTA-NEB.RTM. inhalator (NEBU-TEC, Elsenfeld, Germany). The lyophilized product can be rehydrated in sterile distilled water or any other suitable liquid for inhalation administration. Alternatively, for intravenous administration the lyophilized product can be rehydrated in sterile distilled water or any other suitable liquid for intravenous administration.

[0471] After rehydration for administration in sterile distilled water or another suitable liquid the lyophilized preparation should have the approximate physiological osmolality of the target tissue for the rehydrated peptide preparation i.e. blood for intravenous administration or lung tissue for inhalation administration. Thus it is preferred that the rehydrated formulation is substantially isotonic.

[0472] The preferred dosage concentration for either intravenous, oral, or inhalation administration is between 10 to 2000 .mu.mol/ml, and more preferably is between 200 to 800 .mu.mol/ml.

[0473] For oral administration in the form of tablets or capsules, the at least one antisense-oligonucleotide may be combined with any oral nontoxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like. Moreover, when desired or needed, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated in the mixture. Powders and tablets may be comprised of from about 5 to about 95 percent inventive composition.

[0474] Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethyl-cellulose, polyethylene glycol and waxes. Among the lubricants that may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include starch, methylcellulose, guar gum and the like.

[0475] Additionally, the compositions of the present invention may be formulated in sustained release form to provide the rate controlled release of the at least one antisense-oligonucleotide to optimize the therapeutic effects. Suitable dosage forms for sustained release include implantable biodegradable matrices for sustained release containing the at least one antisense-oligonucleotide, layered tablets containing layers of varying disintegration rates or controlled release polymeric matrices impregnated with the at least one antisense-oligonucleotide.

[0476] Liquid form preparations include solutions, suspensions and emulsions. As an example may be mentioned water or water-propylene glycol solutions for parenteral injections or addition of sweeteners and opacifiers for oral solutions, suspensions and emulsions.

[0477] Suitable diluents are substances that usually make up the major portion of the composition or dosage form. Suitable diluents include sugars such as lactose, sucrose, mannitol and sorbitol, starches derived from wheat, corn rice and potato, and celluloses such as microcrystalline cellulose. The amount of diluents in the composition can range from about 5% to about 95% by weight of the total composition, preferably from about 25% to about 75% by weight.

[0478] The term disintegrants refers to materials added to the composition to help it break apart (disintegrate) and release the medicaments. Suitable disintegrants include starches, "cold water soluble" modified starches such as sodium carboxymethyl starch, natural and synthetic gums such as locust bean, karaya, guar, tragacanth and agar, cellulose derivatives such as methylcellulose and sodium carboxymethylcellulose, microcrystalline celluloses and cross-linked microcrystalline celluloses such as sodium croscarmellose, alginates such as alginic acid and sodium alginate, clays such as bentonites, and effervescent mixtures. The amount of disintegrant in the composition can range from about 1 to about 40% by weight of the composition, preferably 2 to about 30% by weight of the composition, more preferably from about 3 to 20% by weight of the composition, and most preferably from about 5 to about 10% by weight.

[0479] Binders characterize substances that bind or "glue" powders together and make them cohesive by forming granules, thus serving as the "adhesive" in the formulation. Binders add cohesive strength already available in the diluents or bulking agent. Suitable binders include sugars such as sucrose, starches derived from wheat, corn rice and potato; natural gums such as acacia, gelatin and tragacanth; derivatives of seaweed such as alginic acid, sodium alginate and ammonium calcium alginate; cellulosic materials such as methylcellulose and sodium carboxymethylcellulose and hydroxypropyl-methylcellulose; polyvinylpyrrolidone; and inorganics such as magnesium aluminum silicate. The amount of binder in the composition can range from about 1 to 30% by weight of the composition, preferably from about 2 to about 20% by weight of the composition, more preferably from about 3 to about 10% by weight, even more preferably from about 3 to about 6% by weight.

[0480] Lubricant refers to a substance added to the dosage form to enable the tablet, granules, etc. after it has been compressed, to release from the mold or die by reducing friction or wear. Suitable lubricants include metallic stearates, such as magnesium stearate, calcium stearate or potassium stearate, stearic acid; high melting point waxes; and water soluble lubricants, such as sodium chloride, sodium benzoate, sodium acetate, sodium oleate, polyethylene glycols and D,L-leucine. Lubricants are usually added at the very last step before compression, since they must be present on the surfaces of the granules and in between them and the parts of the tablet press. The amount of lubricant in the composition can range from about 0.05 to about 15% by weight of the composition, preferably 0.2 to about 5% by weight of the composition, more preferably from about 0.3 to about 3%, and most preferably from about 0.3 to about 1.5% by weight of the composition.

[0481] Glidents are materials that prevent caking and improve the flow characteristics of granulations, so that flow is smooth and uniform. Suitable glidents include silicon dioxide and talc. The amount of glident in the composition can range from about 0.01 to 10% by weight of the composition, preferably 0.1% to about 7% by weight of the total composition, more preferably from about 0.2 to 5% by weight, and most preferably from about 0.5 to about 2% by weight.

[0482] In the pharmaceutical compositions disclosed herein the antisense-oligonucleotides are incorporated preferably in the form of their salts and optionally together with other components which increase stability of the antisense-oligonucleotides, increase recruitment of RNase H, increase target finding properties, enhance cellular uptake and the like. In order to achieve these goals, the antisense-oligonucleotides may be chemically modified instead of or in addition to the use of the further components useful for achieving these purposes. Thus the antisense-oligonucleotides of the invention may be chemically linked to moieties or components which enhance the activity, cellular distribution or cellular uptake etc. of the antisense-oligonucleotides. Such moieties include lipid moieties such as a cholesterol moiety, cholic acid, a thioether, hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid such as di hexadecyl-rac-glycerol or triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantine acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. The present invention also includes antisense-oligonucleotides which are chimeric compounds. "Chimeric" antisense-oligonucleotides in the context of this invention, are antisense-oligonucleotides, which contain two or more chemically distinct regions, one is the oligonucleotide sequence as disclosed herein which is connected to a moiety or component for increasing cellular uptake, increasing resistance to nuclease degradation, increasing binding affinity for the target nucleic acid, increasing recruitment of RNase H and so on. For instance, the additional region or moiety or component of the antisense-oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA hybrids or RNA:RNA molecules. By way of example, RNase H is a cellular endoribonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target which is the mRNA coding for the TGF-R.sub.II, thereby greatly enhancing the efficiency of antisense-oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used.

Indications

[0483] The present invention relates to the use of the antisense-oligonucleotides disclosed herein for prophylaxis and treatment of neurodegenerative diseases, neurotrauma, neurovascular and neuroinflammatory diseases, including postinfectious and inflammatory disorders of the central nervous system (CNS).

[0484] The antisense-oligonucleotides of the present invention are especially useful for promoting regeneration and functional reconnection of damaged nerve pathways and/or for the treatment and compensation of age induced decreases in neuronal stem cell renewal.

[0485] Thus, another aspect of the present invention relates to the use of an antisense-oligonucleotide as disclosed herein for promoting regeneration neuronal tissue by reactivating neurogenesis, allowing neuronal differentiation and migration, and inducing integration of new neurons into anatomic and functional neuronal circuits.

[0486] A further aspect of the present invention relates to the use of an antisense-oligonucleotide as disclosed herein for promoting regeneration and clinical (structural) repair in patients with damage to the nervous system or damage to other organ systems induced by fibrosis or loss of stem cell turnover.

[0487] Moreover, the antisense-oligonucleotides are useful for compensation and treatment of decreases in neuronal stem cell renewal induced by age, inflammation or a gene defect.

[0488] The antisense-oligonucleotides of the present invention inhibit the TGF-R.sub.II expression and are consequently used for the treatment of diseases associated with up-regulated or enhanced TGF-R.sub.II and/or TGF-R.sub.II levels.

[0489] Thus, another aspect of the present invention relates to the use of the antisense-oligonucleotides in the prophylaxis and treatment of neurodegenerative diseases, neuroinflammatory disorders, traumatic or posttraumatic disorders, vascular or more precisely neurovascular disorders, hypoxic disorders, postinfectious central nervous system disorders, fibrotic diseases, hyperproliferative diseases, cancer, tumors, presbyakusis and presbyopie.

[0490] The term "neurodegenerative disease" or "neurological disease" or "neuroinflammatory disorder" refers to any disease, disorder, or condition affecting the central or peripheral nervous system, including ADHD, AIDS-neurological complications, absence of the Septum Pellucidum, acquired epileptiform aphasia, acute disseminated encephalomyelitis, adrenoleukodystrophy, agenesis of the Corpus Callosum, agnosia, Aicardi Syndrome, Alexander Disease, Alpers' Disease, alternating hemiplegia, Alzheimer's Disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angelman Syndrome, angiomatosis, anoxia, aphasia, apraxia, arachnoid cysts, arachnoiditis, Arnold-Chiari Malformation, arteriovenous malformation, aspartame, Asperger Syndrome, ataxia telangiectasia, ataxia, attention deficit-hyperactivity disorder, autism, autonomic dysfunction, back pain, Barth Syndrome, Batten Disease, Behcet's Disease, Bell's Palsy, benign essential blepharospasm, benign focal amyotrophy, benign intracranial hypertension, Bernhardt-Roth Syndrome, Binswanger's Disease, blepharospasm, Bloch-Sulzberger Syndrome, brachial plexus birth injuries, brachial plexus injuries, Bradbury-Eggleston Syndrome, brain aneurysm, brain injury, brain and spinal tumors, Brown-Sequard Syndrome, bulbospinal muscular atrophy, Canavan Disease, Carpal Tunnel Syndrome, causalgia, cavernomas, cavernous angioma, cavernous malformation, central cervical cord syndrome, central cord syndrome, central pain syndrome, cephalic disorders, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral beriberi, cerebral gigantism, cerebral hypoxia, cerebral palsy, cerebro-oculo-facio-skeletal syndrome, Charcot-Marie-Tooth Disorder, Chiari Malformation, chorea, choreoacanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne Syndrome Type II, Coffin Lowry Syndrome, coma, including persistent vegetative state, complex regional pain syndrome, congenital facial diplegia, congenital myasthenia, congenital myopathy, congenital vascular cavernous malformations, corticobasal degeneration, cranial arteritis, craniosynostosis, Creutzfeldt-Jakob Disease, cumulative trauma disorders, Cushing's Syndrome, cytomegalic inclusion body disease (CIBD), cytomegalovirus infection, dancing eyes-dancing feet syndrome, Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome, Dejerine-Klumpke Palsy, dementia-multi-infarct, dementia-subcortical, dementia with Lewy Bodies, dermatomyositis, developmental dyspraxia, Devic's Syndrome, diabetic neuropathy, diffuse sclerosis, Dravet's Syndrome, dysautonomia, dysgraphia, dyslexia, dysphagia, dyspraxia, dystonias, early infantile epileptic encephalopathy, Empty Sella Syndrome, encephalitis lethargica, encephalitis and meningitis, encephaloceles, encephalopathy, encephalotrigeminal angiomatosis, epilepsy, Erb's Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Fabry's Disease, Fahr's Syndrome, fainting, familial dysautonomia, familial hemangioma, familial idiopathic basal ganglia calcification, familial spastic paralysis, febrile seizures (e.g., GEFS and GEFS plus), Fisher Syndrome, Floppy Infant Syndrome, Friedreich's Ataxia, Gaucher's Disease, Gerstmann's Syndrome, Gerstmann-Straussler-Scheinker Disease, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, Guillain-Barre Syndrome, HTLV-1 associated myelopathy, Hallervorden-Spatz Disease, head injury, headache, hemicrania continua, hemifacial spasm, hemiplegia alterans, hereditary neuropathies, hereditary spastic paraplegia, heredopathia atactica polyneuritiformis, Herpes Zoster Oticus, Herpes Zoster, Hirayama Syndrome, holoprosencephaly, Huntington's Disease, hydranencephaly, hydrocephalus-normal pressure, hydrocephalus (in particular TGF.beta.-induced hydrocephalus), hydromyelia, hypercortisolism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile hypotonia, infantile phytanic acid storage disease, infantile refsum disease, infantile spasms, inflammatory myopathy, intestinal lipodystrophy, intracranial cysts, intracranial hypertension, Isaac's Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome, Kennedy's Disease, Kinsbourne syndrome, Kleine-Levin syndrome, Klippel Feil Syndrome, Klippel-Trenaunay Syndrome (KTS), KlUver-Bucy Syndrome, Korsakoff's Amnesic Syndrome, Krabbe Disease, Kugelberg-Welander Disease, kuru, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffner Syndrome, lateral femoral cutaneous nerve entrapment, lateral medullary syndrome, learning disabilities, Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome, leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia, lissencephaly, locked-in syndrome, Lou Gehrig's Disease, lupus-neurological sequelae, Lyme Disease-Neurological Complications, Machado-Joseph Disease, macrencephaly, megalencephaly, Melkersson-Rosenthal Syndrome, meningitis, Menkes Disease, meralgia paresthetica, metachromatic leukodystrophy, microcephaly, migraine, Miller Fisher Syndrome, mini-strokes, mitochondrial myopathies, Mobius Syndrome, monomelic amyotrophy, motor neuron diseases, Moyamoya Disease, mucolipidoses, mucopolysaccharidoses, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis (MS), multiple systems atrophy (MSA-C and MSA-P), multiple system atrophy with orthostatic hypotension, muscular dystrophy, myasthenia-congenital, myasthenia gravis, myelinoclastic diffuse sclerosis, myoclonic encephalopathy of infants, myoclonus, myopathy-congenital, myopathy-thyrotoxic, myopathy, myotonia congenita, myotonia, narcolepsy, neuroacanthocytosis, neurodegeneration with brain iron accumulation, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological manifestations of Pompe Disease, neuromyelitis optica, neuromyotonia, neuronal ceroid lipofuscinosis, neuronal migration disorders, neuropathy-hereditary, neurosarcoidosis, neurotoxicity, nevus cavernosus, Niemann-Pick Disease, O'Sullivan-McLeod Syndrome, occipital neuralgia, occult spinal dysraphism sequence, Ohtahara Syndrome, olivopontocerebellar atrophy, opsoclonus myoclonus, orthostatic hypotension, Overuse Syndrome, pain-chronic, paraneoplastic syndromes, paresthesia, Parkinson's Disease, parmyotonia congenita, paroxysmal choreoathetosis, paroxysmal hemicrania, Parry-Romberg, Pelizaeus-Merzbacher Disease, Pena Shokeir II Syndrome, perineural cysts, periodic paralyses, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorders, phytanic acid storage disease, Pick's Disease, Piriformis Syndrome, pituitary tumors, polymyositis, Pompe Disease, porencephaly, Post-Polio Syndrome, postherpetic neuralgia, postinfectious encephalomyelitis, postural hypotension, postural orthostatic tachycardia syndrome, postural tachycardia syndrome, primary lateral sclerosis, prion diseases, progressive hemifacial atrophy, progressive locomotor ataxia, progressive multifocal leukoencephalopathy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, pseudotumor cerebri, pyridoxine dependent and pyridoxine responsive siezure disorders, Ramsay Hunt Syndrome Type I, Ramsay Hunt Syndrome Type II, Rasmussen's Encephalitis and other autoimmune epilepsies, reflex sympathetic dystrophy syndrome, refsum disease-infantile, refsum disease, repetitive motion disorders, repetitive stress injuries, restless legs syndrome, retrovirus-associated myelopathy, Rett Syndrome, Reye's Syndrome, Riley-Day Syndrome, SUNCT headache, sacral nerve root cysts, Saint Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's Disease, schizencephaly, seizure disorders, septo-optic dysplasia, severe myoclonic epilepsy of infancy (SMEI), shaken baby syndrome, shingles, Shy-Drager Syndrome, Sjogren's Syndrome, sleep apnea, sleeping sickness, Soto's Syndrome, spasticity, spina bifida, spinal cord infarction, spinal cord injury, spinal cord tumors, spinal muscular atrophy, spinocerebellar atrophy, Steele-Richardson-Olszewski Syndrome, Stiff-Person Syndrome, striatonigral degeneration, stroke, Sturge-Weber Syndrome, subacute sclerosing panencephalitis, subcortical arteriosclerotic encephalopathy, Swallowing Disorders, Sydenham Chorea, syncope, syphilitic spinal sclerosis, syringohydromyelia, syringomyelia, systemic lupus erythematosus, Tabes Dorsalis, Tardive Dyskinesia, Tarlov Cysts, Tay-Sachs Disease, temporal arteritis, tethered spinal cord syndrome, Thomsen Disease, thoracic outlet syndrome, thyrotoxic myopathy, Tic Douloureux, Todd's Paralysis, Tourette Syndrome, transient ischemic attack, transmissible spongiform encephalopathies, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraparesis, tuberous sclerosis, vascular erectile tumor, vasculitis including temporal arteritis, Von Economo's Disease, Von Hippel-Lindau disease (VHL), Von Recklinghausen's Disease, Wallenberg's Syndrome, Werdnig-Hoffinan Disease, Wernicke-Korsakoff Syndrome, West Syndrome, Whipple's Disease, Williams Syndrome, Wilson's Disease, X-Linked Spinal and Bulbar Muscular Atrophy, and Zellweger Syndrome.

[0491] Preferred examples of neurodegenerative diseases and neuroinflammatory disorders are selected from the group comprising or consisting of:

Alzheimer's disease, Parkinson's disease, Creutzfeldt Jakob disease (CJD), new variant of Creutzfeldt Jakobs disease (nvCJD), Hallervorden Spatz disease, Huntington's disease, multisystem atrophy, dementia, frontotemporal dementia, motor neuron disorders of multiple spontaneous or genetic background, amyotrophic lateral sclerosis (ALS), spinal muscular atrophy, spinocerebellar atrophies (SCAs), schizophrenia, affective disorders, major depression, meningoencephalitis, bacterial meningoencephalitis, viral meningoencephalitis, CNS autoimmune disorders, multiple sclerosis (MS), acute ischemic/hypoxic lesions, stroke, CNS and spinal cord trauma, head and spinal trauma, brain traumatic injuries, arteriosclerosis, atherosclerosis, microangiopathic dementia, Binswanger' disease (Leukoaraiosis), retinal degeneration, cochlear degeneration, macular degeneration, cochlear deafness, AIDS-related dementia, retinitis pigmentosa, fragile X-associated tremor/ataxia syndrome (FXTAS), progressive supranuclear palsy (PSP), striatonigral degeneration (SND), olivopontocerebellear degeneration (OPCD), Shy Drager syndrome (SDS), age dependant memory deficits, neurodevelopmental disorders associated with dementia, Down's Syndrome, synucleinopathies, superoxide dismutase mutations, trinucleotide repeat disorders as Huntington's Disease, trauma, hypoxia, vascular diseases, vascular inflammations, CNS-ageing. Also age dependant decrease of stem cell renewal may be addressed.

[0492] Particularly referred examples of neurodegenerative diseases and neuroinflammatory disorders are selected from the group comprising or consisting of:

Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), hydrocephalus (in particular TGF.beta.-induced hydrocephalus), CNS and spinal cord trauma such as spinal cord injury, head and spinal trauma, brain traumatic injuries, retinal degeneration, macular degeneration, cochlear deafness, AIDS-related dementia, trinucleotide repeat disorders as Huntington's Disease, and CNS-ageing.

[0493] The antisense-oligonucleotides are also useful for prophylaxis and treatment of fibrotic diseases. Fibrosis or fibrotic disease is the formation of excess fibrous connective tissue in an organ or tissue in a reparative or reactive process. This can be a reactive, benign, or pathological state. In response to injury this is called scarring and if fibrosis arises from a single cell line this is called a fibroma. Physiologically this acts to deposit extracellular matrix, which can obliterate the architecture and function of the underlying organ or tissue. Fibrosis can be used to describe the pathological state of excess deposition of fibrous tissue, as well as the process of connective tissue deposition in healing. Fibrosis is a process involving stimulated cells to form connective tissue, including collagen and glycosaminoglycans. Subsequently macrophages and damaged tissue between the interstitium release TGF-.beta.. TGF-.beta. stimulates the proliferation and activation of fibroblasts which deposit connective tissue. Reducing the TGF-.beta. levels prevents and decreases the formation of connective tissue and thus prevents and treats fibrosis.

Examples for fibrotic diseases are

Lungs:



[0494] pulmonary fibrosis

[0495] idiopathic pulmonary fibrosis (idiopathic means cause is unknown)

[0496] cystic fibrosis

Liver:

[0496]

[0497] hepatic cirrhosis of multiple origin

[0498] Heart:

[0499] endomyocardial fibrosis

[0500] old myocardial infarction

[0501] atrial fibrosis

[0502] Other:

[0503] mediastinal fibrosis (soft tissue of the mediastinum)

[0504] glaucoma (eye, ocular)

[0505] myelofibrosis (bone marrow)

[0506] retroperitoneal fibrosis (soft tissue of the retroperitoneum)

[0507] progressive massive fibrosis (lungs); a complication of coal workers' pneumoconiosis

[0508] nephrogenic systemic fibrosis (skin)

[0509] Crohn's Disease (intestine)

[0510] keloid (skin)

[0511] scleroderma/systemic sclerosis (skin, lungs)

[0512] arthrofibrosis (knee, shoulder, other joints)

[0513] Peyronie's disease (penis)

[0514] Dupuytren's contracture (hands, fingers)

[0515] some forms of adhesive capsulitis (shoulder)

[0516] residuums after Lupus erythematodes

[0517] Thus another aspect of the present invention relates to the use of an antisense-oligonucleotide for prophylaxis and/or treatment of or to the use of an antisense-oligonucleotide for the preparation of a pharmaceutical composition for prophylaxis and/or treatment of pulmonary fibrosis, cystic fibrosis, hepatic cirrhosis, endomyocardial fibrosis, old myocardial infarction, atrial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis, nephrogenic systemic fibrosis, glaucoma, such as primary open angle glaucoma, Crohn's Disease, keloid, systemic sclerosis, arthrofibrosis, Peyronie's disease, Dupuytren's contracture, and residuums after Lupus erythematodes.

[0518] Still another aspect of the present invention relates to the use of an antisense-oligonucleotide for prophylaxis and/or treatment of hyperproliferative diseases, cancer, tumors and their metastases or to the use of an antisense-oligonucleotide for the preparation of a pharmaceutical composition for prophylaxis and/or treatment of hyperproliferative diseases, cancer, tumors and their metastases.

[0519] Examples for hyperproliferative diseases, cancer, tumors are selected from the group comprising or consisting of: adenocarcinoma, melanoma, acute leukemia, acoustic neurinoma, ampullary carcinoma, anal carcinoma, astrocytoma, basal cell carcinoma, pancreatic cancer, desmoid tumor, bladder cancer, bronchial carcinoma, non-small cell lung cancer (NSCLC), breast cancer, Burkitt's lymphoma, corpus cancer, CUP-syndrome (carcinoma of unknown primary), colorectal cancer, small intestine cancer, small intestinal tumors, ovarian cancer, endometrial carcinoma, ependymoma, epithelial cancer types, Ewing's tumors, gastrointestinal tumors, gastric cancer, gallbladder cancer, gall bladder carcinomas, uterine cancer, cervical cancer, cervix, glioblastomas, gynecologic tumors, ear, nose and throat tumors, hematologic neoplasias, hairy cell leukemia, urethral cancer, skin cancer, skin testis cancer, brain tumors (gliomas, e.g. astrocytomas, oligodendrogliomas, medulloblastomas, PNET's, mixed gliomas), brain metastases, testicle cancer, hypophysis tumor, carcinoids, Kaposi's sarcoma, laryngeal cancer, germ cell tumor, bone cancer, colorectal carcinoma, head and neck tumors (tumors of the ear, nose and throat area), colon carcinoma, craniopharyngiomas, oral cancer (cancer in the mouth area and on lips), cancer of the central nervous system, liver cancer, liver metastases, leukemia, eyelid tumor, lung cancer, lymph node cancer (Hodgkin's/Non-Hodgkin's), lymphomas, stomach cancer, malignant melanoma, malignant neoplasia, malignant tumors gastrointestinal tract, breast carcinoma, rectal cancer, medulloblastomas, melanoma, meningiomas, Hodgkin's disease, mycosis fungoides, nasal cancer, neurinoma, neuroblastoma, kidney cancer, renal cell carcinomas, non-Hodgkin's lymphomas, oligodendroglioma, esophageal carcinoma, osteolytic carcinomas and osteoplastic carcinomas, osteosarcomas, ovarial carcinoma, pancreatic carcinoma, penile cancer, plasmocytoma, squamous cell carcinoma of the head and neck (SCCHN), prostate cancer, pharyngeal cancer, rectal carcinoma, retinoblastoma, vaginal cancer, thyroid carcinoma, Schneeberger disease, esophageal cancer, spinalioms, T-cell lymphoma (mycosis fungoides), thymoma, tube carcinoma, eye/ocular tumors, urethral cancer, urologic tumors, urothelial carcinoma, vulva cancer, wart appearance, soft tissue tumors, soft tissue sarcoma, Wilm's tumor, cervical carcinoma and tongue cancer.

[0520] The term "cancer" refers preferably to a cancer selected from the group consisting of or comprising Lung cancer, such as Lung carcinoma, liver cancer such as hepatocellular carcinoma, melanoma or malignant melanoma, pancreatic cancer, such as pancreatic epithelioid carcinoma or pancreatic adenocarcinoma, colon cancer, such as colorectal adenocarcinoma, gastric cancer or gastric carcinoma, mamma carcinoma, malignant astrocytoma, prostatic cancer, such as gastric carcinoma, leukemia, such as acute myelogenous leukemia, chronic myelogenous leukemia, monocytic leukemia, promyelocytic leukemia, lymphocytic leukemia, acute lymphoblastic leukemia, lymphocytic leukemia, and acute lymphoblastic leukemia, and lymphoma, such as histiocytic lymphoma.

[0521] For the treatment of hyperproliferative diseases, cancer, tumors and their metastases the antisense-oligonucleotides may be administered at regular intervals (dose intervals, DI) of between 3 days and two weeks, such as 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days, such as about 1 week, such as 6, 7 or 8 days. Suitably at least two doses are provide with a DI period between the two dosages, such as 3, 4, 5, 6, 7, 8, 9 or 10 dosages, each with a dose interval (DI) between each dose of the antisense-oligonucleotide. The DI period between each dosage may the same, such as between 3 days and two weeks, such as 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 days, such as about 1 week, such as 6, 7 or 8 days.

[0522] Preferably, each dose of the antisense-oligonucleotide may be between about 0.25 mg/kg-about 10 mg/kg, such as about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg. In some embodiments, each does of the antisense-oligonucleotide may be between about 2 mg/kg-about 8 mg/kg, or about 4 to about 6 mg/kg or about 4 mg/kg to about 5 mg/kg. In some embodiments, each does of the antisense-oligonucleotide is at least 2 mg/kg, such as 2, 3, 4, 5, 6, 7 or 8 mg/kg, such as 6 mg/kg. In some embodiments the dosage regime for the antisense-oligonucleotide may be repeated after an initial dosage regime, for example after a rest period where no antisense-oligonucleotide is administered. Such as rest period may be more than 2 weeks in duration, such as about 3 weeks or about 4 weeks, or about 5 weeks or about 6 weeks. In some embodiments the dosage regimen for the antisense-oligonucleotide is one weekly dosage, repeated three, four or five times. This dosage regimen may then be repeated after a rest period of, for example, about 3-5 weeks, such as about 4 weeks. In some embodiments, the antisense-oligonucleotide is administered during a first dosage regimen at regular dosage intervals (DI) of between 4 and 13 days for between 2-10 administrations.

[0523] Administration of the antisense-oligonucleotide is typically performed by parenteral administration, such as subcutaneous, intramuscular, intravenous or intraperitoneal administration.

DESCRIPTION OF FIGURES

[0524] FIG. 1 shows the inhibitory effect of the antisense-oligonucleotides (ASO). The DNA is transcribed to the Pre-mRNA to which in the nucleus of the cell, the antisense-oligonucleotides (ASO) can bind or hybridize to the complementary sequence within an exon (as represented by the first ASO from the right side and the first ASO from the left side) or within an intron (as represented by the second ASO from the right side) or at allocation consisting of an area of an exon and an area of an adjacent intron (as represented by the second ASO from the left side). By post-transcriptional modification, i.e. the splicing, the mRNA is formed to which the ASO can bind or hybridize in the cytoplasma of the cell in order to inhibit translation of the mRNA into the protein sequence. Thus, the ASO knock down the target gene and the protein expression selectively.

[0525] FIG. 2 shows a nucleoside unit (without internucleotide linkage) or nucleotide unit (with internucleotide linkage) which are non-LNA units and which may be contained in the antisense-oligonucleotides of the present invention especially in the region B in case the antisense-oligonucleotide of the present invention is a gapmer.

[0526] FIG. 3 shows TGF-beta and its effects on neural stem cells, cancer stem cells, and tumors. TGFbeta inhibits neural stem cell proliferation. It may affect the transition to a cancer stem cell, which might escape from TGF-beta growth control. Later in tumor progression, TGF-beta acts as an oncogene; it further promotes tumor growth by promoting angiogenesis and suppressing the immune system. In addition, it promotes cellular migration, thereby driving cells into metastasis.

[0527] FIG. 4 shows the antisense-oligonucleotide of Seq ID No 218b in form of a gapmer consisting of 16 nucleotides with 3 LNA units (C*b.sup.1 and Ab.sup.1 and Tb.sup.1) at the 5' terminal end and 4 LNA units (Ab.sup.1 and Gb.sup.1 and Tb.sup.1 and Ab.sup.1) at the 3' terminal end and 9 DNA nucleotides (dG, dA, dA, dT, dG, dG, dA, dC, and dC) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first LNA unit from the 5' terminal end.

TABLE-US-00053 Seq ID SP L No Sequence, 5'-3' 4217 16 218b C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsd GsdGsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0528] FIG. 5: ASO (Seq. ID No. 218b) treatment leads to intracellular pSmad2 protein reduction. Labeling with an antibody against pSmad2 (left column, red) in A549 (FIG. 5A) and ReNcell CX.RTM. (FIG. 5B) cells after gymnotic transfer with ASO Seq. ID No. 218b for 72 h or 96 h respectively. Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b.

[0529] FIG. 6: ASO (Seq. ID No. 218c) treatment leads to intracellular pSmad2 protein reduction. Labeling with an antibody against pSmad2 (left column, red) in A549 (FIG. 6A) and ReNcell CX.RTM. (FIG. 6B) cells after gymnotic transfer with ASO Seq. ID No. 218c for 72 h or 96 h respectively. Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and Corel DRAW.RTM.X7 Software. A=untreated control, B=Ref.1, D=Seq. ID No. 218c.

[0530] FIG. 7: In presence of TGF-.beta.1, ASO (Seq. ID No. 218b) treatment leads to downregulation of TGF-R.sub.II mRNA. Potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 7A) and ReNcell CX.RTM. (FIG. 7B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1, .+-.=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

[0531] FIG. 8: In presence of TGF-.beta.1, ASO (Seq. ID No. 218c) treatment leads to downregulation of TGF-R.sub.II mRNA. Potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 8A) and ReNcell CX.RTM. (FIG. 8B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-.beta.1, .+-.=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

[0532] FIG. 9 shows the antisense-oligonucleotide of Seq ID No 209y in form of a gapmer consisting of 16 nucleotides with 2 LNA units (Gb.sup.1 and Tb.sup.1) at the 5' terminal end and 3 LNA units (Ab.sup.1 and Gb.sup.1 and C*b.sup.1) at the 3' terminal end and 11 DNA nucleotides (dA, dG, dT, dG, dT, dT, dT, dA, dG, dG, and dG) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the last LNA unit from the 5' terminal end.

TABLE-US-00054 Seq ID SP L No Sequence, 5'-3' 2064 16 209y Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsd TsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1sC*b.sup.1

[0533] FIG. 10 shows the antisense-oligonucleotide of Seq ID No 210q in form of a gapmer consisting of 16 nucleotides with 4 LNA units (Gb.sup.1 and C*b.sup.1 and Tb.sup.1 and Ab.sup.1) at the 5' terminal end and 3 LNA units (Gb.sup.1 and Tb.sup.1 and Tb.sup.1) at the 3' terminal end and 9 DNA nucleotides (dT, dT, dT, dG, dG, dT, dA, dG, and dTs) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the second LNA unit from the 5' terminal end.

TABLE-US-00055 Seq ID SP L No Sequence, 5'-3' 2072 16 210q Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsd GsdGsdTsdAsdGsdTsGb.sup.1sTb.sup.1sTb.sup.1

[0534] FIG. 11: In presence of TGF-.beta.1, ASO (Seq. ID No. 218b) treatment leads to downregulation of CTGF mRNA. Potent downregulation of CTGF mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 11A) and ReNcell CX.RTM. (FIG. 11B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1, .+-.=SEM, *p<0.05, **p<0.01 in reference to A, .sup.++p<0.01 in reference to E+B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

[0535] FIG. 12: In presence of TGF-.beta.1, ASO (Seq. ID No. 218b) treatment leads to reduction of CTGF cellular protein. CTGF protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 12A) and ReNcell CX.RTM. (FIG. 12B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. Cells were labeled with an antibody against CTGF (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID. 218b, E=TGF-.beta.1.

[0536] FIG. 13: In presence of TGF-.beta.1, ASO (Seq. ID No. 218b) treatment leads to intracellular pSmad2 protein reduction. pSmad2 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 13A) and ReNcell CX.RTM. (FIG. 13B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. Cells were labeled with an antibody against pSmad2 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID. 218b, E=TGF-.beta.1.

[0537] FIG. 14: In presence of TGF-.beta.1, ASO (Seq. ID No. 218c) treatment leads to downregulation of CTGF mRNA. Potent downregulation of CTGF mRNA after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 14A) and ReNcell CX.RTM. (FIG. 14B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-.beta.1, .+-.=SEM, *p<0.05, **p<0.01 in reference to A, Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons. Note different scales.

[0538] FIG. 15: In presence of TGF-.beta.1, ASO (Seq. ID No. 218c) treatment leads to reduction of CTGF cellular protein. CTGF protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 cells. ASOs were incubated for 72 h in presence of TGF-.beta.1. Cells were labeled with an antibody against CTGF (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, D=Seq. ID. 218c, E=TGF-.beta.1.

[0539] FIG. 16: In presence of TGF-.beta.1, ASO (Seq. ID No. 218c) treatment leads to intracellular pSmad2 protein reduction. pSmad2 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO in TGF-.beta.1 pre-incubated (48 h) A549 (FIG. 16A) and ReNcell CX.RTM. (FIG. 16B) cells. ASOs were incubated for 72 h or 96 h in presence of TGF-.beta.1, respectively. Cells were labeled with an antibody against pSmad2 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, D=Seq. ID. 218c, E=TGF-.beta.1.

[0540] FIG. 17: ASO (Seq. ID No. 218b) pretreatment and subsequent TGF-.beta.1 co-exposure leads to reduction of TGF-R.sub.II membrane protein. TGF-R.sub.II protein was reduced after gymnotic transfer of TGF-R.sub.II specific ASO followed by co-exposure of TGF-.beta.1 (48 h) A549 (FIG. 17A) and ReNcell CX.RTM. (FIG. 17B) cells. ASOs were incubated for 72 h or 96 h, respectively, in advance to 48 h TGF-.beta.1 co-exposure. Cells were labeled with an antibody against TGF-R.sub.II (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID. 218b, E=TGF-.beta.1.

[0541] FIG. 18: ASO (Seq. ID No. 218b) pretreatment and subsequent TGF-.beta.1 co-exposure leads to intracellular pSmad3 protein reduction. pSmad3 protein expression was reduced after gymnotic transfer of TGF-R.sub.II specific ASO followed by co-exposure of TGF-.beta.1 (48 h) A549 (FIG. 18A) and ReNcell CX.RTM. (FIG. 18B) cells. ASOs were incubated for 72 h or 96 h, respectively, in advance to 48 h TGF-.beta.1 co-exposure. Cells were labeled with an antibody against pSmad3 (left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID. 218b, E=TGF.beta.1.

[0542] FIG. 19: ASO (Seq. ID No. 218b) enhances and TGF-.beta.1 reduces neurogenesis in human neural precursor ReNcell CX.RTM. cells. Neurogenesis marker DCX mRNA is upregulated in ReNcell CX.RTM. cells after repeated gymnotic transfer (2.times.96 h) of inventive ASOs. A strong reduction of DCX mRNA expression was recognized after an 8-day TGF-.beta.1 exposure. mRNA levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post-hoc comparison. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1, .+-.=SEM, +p<0.05 in reference to C 2.5 .mu.M, #p<0.05 in reference to C 10 .mu.M.

[0543] FIG. 20: ASO (Seq. ID No. 218b) enhances and TGF-.beta.1 reduces proliferation in human neural precursor ReNcell CX.RTM. cells. Proliferation marker Ki67 protein expression is increased in ReNcell CX.RTM. cells after repeated gymnotic transfer (2.times.96 h) of inventive ASOs. Reduced Ki67 protein expression was recognized after an 8-day TGF-.beta.1 exposure. Cells were labeled with an antibody against Ki67 (left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1.

[0544] FIG. 21: Despite proliferative conditions ASO (Seq. ID No. 218b) enhances differentiation in human neural precursor ReNcell CX.RTM. cells. Neural markers NeuN (FIG. 23 A, left column, red) and .DELTA.III-Tubulin (FIG. 23 B, left column, red) in ReNcell CX.RTM. were observed. ASO treatment was applied for initial 4 days under proliferative conditions followed by further 4 days under either proliferative (+EGF/FGF) or differentiating conditions (-EGF/FGF). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1, +EGF/FGF=proliferation, -EGF/FGF=differentiation.

[0545] FIG. 22: ASO-mediated (Seq. ID No. 218b) rescue from TGF-.beta.-induced neural stem cell proliferation arrest. Human neural precursor ReNcell CX.RTM. cells proliferation was observed with or without TGF-.beta.1 exposure for 7 days followed by ASO treatment for 8 days. Upregulation of GFAP (FIG. 24A), Ki67 (FIG. 24B) and DCX (FIG. 24C) mRNA 7 days after TGF-.beta.1 pre-incubation indicates recovery of stem cell proliferation. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1, .+-.=SEM, *p<0.05 in reference to A, Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc multiple comparisons.

[0546] FIG. 23: ASO reduces proliferation of human lung-cancer cells (A549). Proliferation marker Ki67 protein expression is decreased in A549 cells after gymnotic transfer (72 h) of inventive ASOs. Reduced Ki67 protein expression was recognized (left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1.

[0547] FIG. 24: ASO reduces proliferation of several human tumor cell-lines. HPAFII, K562, MCF-7, Panc-1, and HTZ-19 cells were exposed 4.times.72 h to inventive ASOs and proliferation was analyzed by light microscopy (Nikon, TS-100.RTM. F LED). A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b.

[0548] FIG. 25: ASO treatment mediates neural anti-fibrotic effects and ameliorates cellular stress. ReNcell CX.RTM. cells were observed after TGF-.beta.1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-.beta.1 treatment for 96 h. Cells were labeled with an antibody against CTGF (FIG. 29A, left column, red), FN (FIG. 29B, left column, green) and of Phalloidin (actin-cytoskeleton, FIG. 29C, left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1.

[0549] FIG. 26: ASO treatment mediates tumor anti-fibrotic effects and ameliorates cellular stress. A549 cells were observed after treatment with either TGF-.beta.1 or gymnotic transfer of inventive ASO (72 h). Cells were labeled with an antibody against FN (FIG. 30A, left column, green), Phalloidin (actin-cytoskeleton, FIG. 30B, left column, red). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1.

[0550] FIG. 27: ASO treatment mediates tumor anti-fibrotic effects. A549 human lung cancer cells were observed after TGF-.beta.1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-.beta.1 treatment for 72 h. Cells were labeled with an antibody against CTGF (FIG. 31A, left column, red) and FN (FIG. 31B, left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, C.dbd.Seq. ID No. 218b, E=TGF-.beta.1.

[0551] FIG. 28: ASO treatment mediates tumor anti-fibrotic effects. A549 human lung cancer cells were observed after TGF-.beta.1-preincubation (48 h) followed by gymnotic transfer of inventive ASO and co-exposure with TGF-.beta.1 treatment for 72 h. Cells were labeled with an antibody against CTGF (FIG. 32A, left column, red) and FN (FIG. 32B, left column, green). Nuclear DNA was stained with DAPI (central column, blue). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software. A=untreated control, B=Ref.1, D=Seq. ID No. 218c, E=TGF-.beta.1.

[0552] FIG. 29 shows the antisense-oligonucleotide of Seq ID No 209.times. in form of a gapmer consisting of 16 nucleotides with 2 LNA units (Gb.sup.1 and Tb.sup.1) at the 5' terminal end and 3 LNA units (Ab.sup.1 and Gb.sup.1 and C*b.sup.1) at the 3' terminal end and 11 DNA nucleotides (dA, dG, dT, dG, dT, dT, dT, dA, dG, dG, and dG) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s), the nucleobase 5-methylcytosine (C*) in the last LNA unit from the 5' terminal end, and with O--P(O)(S'')OC.sub.3H.sub.6OH as terminal end groups at the 5' terminal end and at the 3' terminal end.

TABLE-US-00056 Seq ID SP L No Sequence, 5'-3' 2064 16 209x /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsd GsdTsdTsdTsdAsdGsdGsdGs Ab.sup.1sGb.sup.1sC*b.sup.1/3SpC3s/

[0553] FIG. 30 shows the antisense-oligonucleotide of Seq ID No 152h in form of a gapmer consisting of 15 nucleotides with 4 LNA units (C*b.sup.1 and Gb.sup.1 and Ab.sup.1 and Tb.sup.1) at the 5' terminal end and 3 LNA units (Ab.sup.1 and C*b.sup.1 and Ab.sup.1) at the 3' terminal end and 8 DNA nucleotides (dA, dC, dG, dC, dG, dT, dC, and dC) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first and second last LNA unit from the 5' terminal end.

TABLE-US-00057 Seq ID SP L No Sequence, 5'-3' 429 15 152h C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsd CsdGsdTsdCsdCsAb.sup.1sC*b.sup.1sAb.sup.1

[0554] FIG. 31 shows the antisense-oligonucleotide of Seq ID No 143h in form of a gapmer consisting of 14 nucleotides with 2 LNA units (C*b.sup.1 and Tb.sup.1s) at the 5' terminal end and 3 LNA units (C*b.sup.1 and C*b.sup.1 and Gb.sup.1) at the 3' terminal end and 9 DNA nucleotides (dC, dG, dT, dC, dA, dT, dA, dG, and dA) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first, third from last and second LNA unit from the 5' terminal end.

TABLE-US-00058 Seq ID SP L No Sequence, 5'-3' 355 14 143h C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsd TsdAsdGsdAsC*b.sup.1sC*b.sup.1sGb.sup.1

[0555] FIG. 32 shows the antisense-oligonucleotide of Seq ID No 213k in form of a gapmer consisting of 17 nucleotides with 3 LNA units (C*b.sup.1 and Ab.sup.1 and Gb.sup.1) at the 5' terminal end and 3 LNA units (Gb.sup.1 and Tb.sup.1 and Gb.sup.1) at the 3' terminal end and 11 DNA nucleotides (dG, dC, dA, dT, dT, dA, dA, dT, dA, dA, and dA) in between the LNA segments, with phosphorothioate internucleotiodes linkages (s) and the nucleobase 5-methylcytosine (C*) in the first LNA unit from the 5' terminal end.

TABLE-US-00059 Seq ID SP L No Sequence, 5'-3' 2355 17 213k C*b.sup.1sAb.sup.1sGb.sup.1sdGsdCsdAsdTsdTsd AsdAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1

EXAMPLES

Material and Methods

[0556] Most Antisense-Oligonucleotides as well as control or reference oligonucleotides used herein were synthesized by EXIQON as custom oligonucleotides according to the needs of the inventors/applicant. Oligonucleotides having the following sequences were used as references:

TABLE-US-00060 (Seq. ID No. 147c) Ref. 0 = dCsdAsdGsdCsdCsdCsdCsdCsdGsdAsdCsdCsdCsd AsdTsdG; (Seq. ID No. 76) Ref. 1 = Ab1sAb1sC*b1sdAsdCsdGsdTsdCsdTsdAsdTsdAs C*b1sGb1sC*b1; (Seq. ID No. 147m) Ref. 2 = C*b1sAb1sGb1sdCsdCsdCsdCsdCsdGsdAsdCsdC sdCsAb1sTb1sGb1; (Seq. ID No. 80) Ref. 3 = TTGAATATCTCATGAATGGA; having 2'-MOE-wings (5 units 5'and 3') and phosphorothioate linkages; (Seq. ID No. 82) Ref. 4 = ; CAGAAGAGCTATTTGGTAGT, having 2'-MOE-wings (5 units 5'and 3') and phosphorothioate linkages; (Seq. ID No. 85) Ref. 5 = TGGTAGTGTTTAGGGAGCCG, (Seq. ID No. 344) Ref. 6 = GTGCAGGGGAAAGATGAAAA, (Seq. ID No. 345) Ref. 7 = GAGCTCTTGAGGTCCCTGTG, (Seq. ID No. 346) Ref. 8 = AGCCTCTTTCCTCATGCAAA, (Seq. ID No. 347) Ref. 9 = CCTTCTCTGCTTGGTTCTGG, and (Seq. ID No. 348) Ref. 10 = GCCATGGAGTAGACATCGGT.

Standard Procedures Protocols

Cell Culture:

TABLE-US-00061

[0557] TABLE 10 The following human cell lines were used for antisense-oligonucleotide experiments: Cell CO.sub.2-- Description line Content Medium Melanoma HTZ-19 5% DMEM F12 (Gibco 31331-018) + 1% dM-Mix (Transferrin (30 mg/ml in water 835 .mu.l, non-essential AS (100x) 10 ml, Sodium-selenite (0.2 mg/ml in water) 70 .mu.l, 10 ml PBS), 1% P/S Lung carcinoma A549 5% Kaighn's F12 K + 10% FCS + 1% P/S hepatocellular HepG2 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S carcinoma hepatocellular Hep3B 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S carcinoma pancreatic Panc-1 5% DMEM (Sigma D6429) + 10% FCS + 1% P/S epithelioid carcinoma pancreatic HPAFII 5% DMEM (Sigma D5796) + 15 FCS, 1% P/S, 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution, 1% non-essential AS (100x) pancreatic BxPC-3 5% RPMI (Gibco A10491-01) + 10% FCS + 1% P/S + 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution pancreatic cancer L3.6pl 5% DMEM (Sigma D5796) + 15% FCS, 1% P/S, 1% liver metastasis Antibiotic/Antimycotic, 1% Vitamin, 1% non-essential AS (100x) colorectal HT-29 5% DMEM (Sigma D5796) + 15% FCS, 1% P/S, 1% adenocarcinoma Antibiotic/Antimycotic, 1% MEM Vitamin Solution, 1% non-essential AS (100x) epithelial CaCo2 5% DMEM (Sigma D5796) + 20% FCS + 1% P/S colorectal adenocarcinoma gastric carcinoma TMK-1 5% DMEM (Sigma D5796) + 10% FCS + 1% P/S, 1% Antibiotic/Antimycotic, 1% MEM Vitamin Solution malignant HTZ- 5% DMEM (Sigma D6046) + 10% FCS + 1% P/S + 1% astrocytoma 243 non-essential AS + 1% MEM Vitamin Solution Mamma- MCF-7 5% DMEM (Sigma D6046) + 10% FCS + 1% P/S Carcinoma prostatic PC-3M 5% RPMI (Gibco #61870-010), 10% FCS, 1% Sodium adenocarcinoma pyruvate, 1% Sodium bicarbonate, 1% P/S acute KG-1 5% RPMI (Gibco #61870-010) + 10% FCS + 1% P/S myelogenous leukemia chronic K562 5% RPMI (Gibco #61870-010) + 10% FCS + 1% P/S myelogenous leukemia monocytic THP-1 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia promyelocytic HL60 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia lymphocytic CEM- 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S leukemia C7H2 acute Pre- 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S lymphoblastic B697 leukemia histiocytic U937 5% RPMI (Gibco #61870-010) + 10% FCS + 0.5% P/S lymphoma Neuronal ReNcell 5% ReNcell Neural Stem Cell Maintenance Medium precursor cells of CX (Millipore #SCM005) + human FGF Basic human + cortical brain human EGF + N2-Supplement region

Material:

FCS (ATCC #30-2020)

[0558] Sodium pyruvate (Sigma #S8636) Sodium bicarbonate (Sigma #S8761-100ML)

Transferrin (Sigma #T8158-100MG)

Natrium Selenite (Sigma #S5261-10G)

Penicillin/Streptomycin (P/S) (Sigma-Aldrich #P4458)

Non-essential Amino Acids (AS) 100.times. (Sigma #M7145)

Antibiotic/Antimycotic (Sigma #A5955)

MEM Vitamin Solution (Sigma #M6895)

PBS (Sigma #D8537)

[0559] FGF Basic human (Millipore #GF003) EGF human (Millipore #GF144)

N-2 Supplement (Life Technologies #17502048)

ReNcell Neural Stem Cell Maintenance Medium (Millipore #SCM005)

Culturing and Disseminating Cells:

[0560] After removing the medium, cells were washed with PBS and incubated with accutase (Sigma-Aldrich #P4458) (5 min, RT). Following incubation, cells were peened and full medium (3 ml, company: see Tab.10 for respective cell lines) was added. Afterwards, cells were transferred into a 5 ml Eppendorf Cup and centrifuged (5 min, 1000 rpm, RT). Pellet from 1 T75-bottle (Sarstedt #833.910.302) was resuspended in 2.5 ml fresh medium. Cell number of cell suspension was determined with Luna-FL.TM. automated cell counter (Biozym #872040) by staining with acridine orange/propidium iodide assay viability kit (Biozym #872045). Laminin-coating (Millipore #CC095) of dishes was necessary for adhesion of ReNcell CX.RTM. cells before seeding the cells for experiments in a concentration of 2 .mu.g/cm.sup.2. Laminin-PBS solution was given in the respective amount directly to wells and flasks and was incubated for 1.5 h at 37.degree. C. For experiments cells were seeded and harvested as mentioned in method part of respective experimental chapter. After overnight incubation of cells at 37.degree. C. and 5% CO.sub.2, cells were treated as explained in respective experimental description. 500 .mu.l of remaining cell suspension was given into a new T75-bottle filled with 10 ml fresh full medium for culturing cells.

RNA-Analysis

[0561] Total RNA for cDNA synthesis was isolated using innuPREP.RTM. RNA Mini Kit (Analytik Jena #845-KS-2040250) according to manufacturer's instructions. In order to synthesize cDNA, total RNA content was determined using a photometer (Eppendorf, BioPhotometer D30 #6133000907), diluted with nuclease-free water. Afterwards first-strand cDNA was prepared with iScript.TM. cDNA Synthesis Kit (BioRad #170-8891) according to manufacturer's recommendations. For mRNA analysis real-time RT-PCR was performed using a CFX96 Touch.TM. Real Time PCR Detection System (BioRad #185-5196).

[0562] All primer pairs were ready-to-use standardized and were mixed with the respective ready-to-use Mastermix solution (SsoAdvanced.TM. Universial SYBR.RTM. Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Primer-pairs for in vivo experiments were adapted according to individual species.

TABLE-US-00062 TABLE 11 Primer pairs used for mRNA Analysis Primer pair Company Unique Assay ID Human CDKN1A BioRad qHsaCID0014498 Human CDNK1B BioRad qHsaCID0012509 Human CFLAR BioRad qHsaCID0038905 Human Col4A1 BioRad qHsaCID0010223 Human CTGF BioRad qHsaCED0002044 Human DCX BioRad qHsaCID0010869 Human FN1 BioRad qHsaCID0012349 Human GFAP BioRad qHsaCID0022307 Human GNB2L1 BioRad qHsaCEP0057912 Human ID-2 BioRad qHsaCED0043637 Human MKi67 BioRad qHsaCID0011882 Human Nestin BioRad qHsaCED0044457 Human SERPINE1 BioRad qHsaCED0043144 Human SOX2 BioRad qHsaCED0036871 Human TGF.beta.-RII BioRad qHsaCID0016240 Human TP53 BioRad qHsaCID0013658

[0563] As template, 1 .mu.l of respective cDNA was used. RNA that was not reverse transcribed served as negative control for real-time RT-PCR. For relative quantification housekeeping gene Guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1) was used. Real-time RT-PCR was performed with the following protocol:

TABLE-US-00063 TABLE 12 Protocol for real-time RT-PCR. Initiation period 2 min 95.degree. C. 1x Denaturation 5 s 95.degree. C. 40x Annealing, 30 s 60.degree. C. 40x Extension Melting curve 65.degree. C.-95.degree. C. 1x (0.5.degree. C. gradient)

[0564] Afterwards, BioRad CFX Manager 3.1 was used for quantification of respective mRNA-level relative to GNB2L1 mRNA and then normalized to untreated control.

Western Blot:

[0565] For protein analysis, cells/tissues were lysed using M-PER.RTM. Mammalian Protein Extraction Reagent/T-PER.RTM. Tissue Protein Extraction Reagent (Thermo Scientific, #78501/#78510) according to manufacturer instructions, respectively. SDS-acrylamide-gels (10%) were produced using TGX Stain Free.TM. Fast Cast.TM. Acrylamide Kit (BioRad #161-0183) according to manufacturer instructions. Protein samples (20 .mu.l) were diluted 1:5 with Lammli-buffer (6.5 .mu.l, Roti.RTM.-Load1, Roth #K929.1), incubated at 60.degree. C. for 30 min and loaded on the gel with the entire volume of the protein solution. Separation of proteins was performed by electrophoresis using PowerPac.TM. Basic Power Supply (Biorad #164-5050SP) and Mini-PROTEAN.RTM. Tetra cell electrophoresis chamber (BioRad #165-8001-SP) (200 V, 45 min). Following electrophoresis, the proteins were blotted using Trans-Blot.RTM. Turbo Transfer System (BioRad #170-4155SP). All materials for western blotting were included in Trans-Blot.RTM. Turbo RTA PVDF-Midi Kit (BioRad #170-4273).

[0566] The PVDF-membrane for blotting procedure was activated in methanol (Merck #1.06009.2511) and equilibrated in 1.times. transfer buffer. Following blotting (25 V, 1 A, 30 min), membranes were washed (3.times., 10 min, RT) with 1.times.TBS (Roth #10.60.1) containing 0.5 ml Tween-20 (Roth #9127.1). Afterwards, the membranes were blocked with 5% BSA (Albumin-IgG-free, Roth #3737.3) diluted with TBS-T for 1 h at RT, the primary antibodies (diluted in 0.5% BSA in TBS-T, Table 13) were added and incubated at 4.degree. C. for 2 days. Antibodies for in vivo experiments were chosen for species specificity accordingly.

TABLE-US-00064 TABLE 13 Antibodies used for Western Blot analysis. Dilution Company Order Number Primary Antibody Alpha-Tubulin 1:2000 Cell Signaling cs12351s HRP-linked (rabbit) ColIV (rabbit) 1:1000 Abcam ab6586 CTGF (rabbit) 1:1000 Genetex GTX-26992 FN (rabbit) 1:250 Proteintech 15613-1-AP GAPDH XP 1:1000 Cell Signaling cs8884s HRP-linked (rabbit) Ki67 (rabbit) 1:500 Abcam ab15580 pAkt (rabbit) 1:1000 Cell signaling cs4060s pErk1/2 (rabbit) 1:1000 Cell signaling cs4370s pSmad2 (rabbit) 1:500 Cell Signaling cs3104 TGF-.beta.RII (rabbit) 1:400 Aviva ARP44743-T100 Secondary Antibody Anti-rabbit IgG, 1:10000 Cell signaling cs#12351S HRP-linked

[0567] In the next step, membranes were washed in TBS-T (3.times.10 min, RT) and incubated with the secondary antibody (1 h, RT, Table 13). Following incubation, blots were washed with TBS-T, emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with a luminescent image analyzer (ImageQuant.TM. LAS 4000, GE Healthcare). Afterwards, the blots were washed in TBS-T (3.times.10 min, RT) and blocked with 5% BSA diluted in TBS-T (1 h, RT). For housekeeper comparison, the membranes were incubated with HRP-conjugated anti alpha-tubulin (1:2000 in 0.5% BSA, 4.degree. C., overnight). The next day blots were emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with the luminescent image analyzer. Finally, the blots were washed with TBS-T (3.times., 5 min) and stained using 1.times. Roti.RTM.-Blue solution (Roth #A152.2) and dried at RT.

Immunocytochemistry

[0568] Cells were treated and harvested as described before. Following fixation of cells with Roti.RTM.-Histofix 4% (Roth #P087.4) on 8-well, cell culture slide dishes (6 min, RT) were washed three times with PBS. After blocking cells for 1 h at RT with Blocking Solution (Zytomed #ZUC007-100) cells were incubated with respective primary antibodies listed in Table 14 and incubated at 4.degree. C. overnight.

[0569] Afterwards, cell culture slides were washed three times with PBS following incubation with secondary antibody (1 h, RT). All antibody-dilutions were prepared with Antibody-Diluent (Zytomed #ZUC025-100).

TABLE-US-00065 TABLE 14 Antibodies used for immunocytochemistry. Dilution Company Order Number Primary Antibody ColIV (rabbit) 1:50 Abcam ab6586 CTGF (rabbit) 1:50 Genetex GTX26992 .beta.III-Tubulin (rabbit) 1:100 cell signaling cs5568 FN (rabbit) 1:50 Proteintech 15613-1-AP Ki67 (rabbit) 1:100 Abcam ab15580 NeuN (rabbit) 1:250 Abcam Ab104225 Phalloidin Alexa Fluor 1:20 Cell signaling cs8953 555 pSmad2 (rabbit) 1:50 Cell signaling cs3104s pSmad3 (rabbit) 1:50 Cell signaling cs9520s TGF-R.sub.II (rabbit) 1:50 Millipore 06-227 Secondary Antibody Alexa Fluor 488 1:750 Life Technologies A21441 Cy3 goat-anti-rabbit 1:1000 Life Technologies A10520

[0570] Following incubation with secondary antibody, cells were washed three times with PBS, coverslips were separated from cell culture dish and mounted with VECTASHIELD.RTM. HardSet.TM. with DAPI (Biozol #VEC-H-1500). Slides were dried overnight at 4.degree. C. before fluorescence microscopy (Zeiss, Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CoreIDRAW.RTM. X7 Software.

In Vivo Experiments

Peripheral Blood Mononuclear Cell (PBMC) Assay

[0571] PBMCs were isolated from buffy coats corresponding to 500 ml full blood transfusion units. Each unit was obtained from healthy volunteers and glucose-citrate was used as an anti-agglutinant. The buffy coat blood was prepared and delivered by the Blood Bank Suhl of the Institute for Transfusion Medicine, Germany. Each blood donation was monitored for HIV antibody, HCV antibody, HBs antigen, TPHA, HIV RNA, and SPGT (ALAT). Only blood samples tested negative for infectious agents and with a normal SPGT value were used for leukocyte and erythrocyte separation by low-speed centrifugation. The isolation of PBMCs was performed about 40 h following blood donation by gradient centrifugation using Ficoll-Histopague.RTM. 1077 (Heraeus.TM. Multifuge.TM. 3 SR). For IFN.alpha. assay, PBMCs were seeded at 100,000 cells/96-well in 100 .mu.l complete medium plus additives (RPMI1640, +L-Glu, +10% FCS, +PHA-P (5 .mu.g/ml), +IL-3 (10 .mu.g/ml)) and test compounds (5 .mu.l) were added for direct incubation (24 h, 37.degree. C., 5% CO.sub.2). For TNF.alpha. assay, PBMCs were seeded at 100,000 cells/96-well in 100 .mu.l complete medium w/o additives (RPMI1640, +L-Glu, +10% FCS) and test compounds (5 .mu.l) were added for direct incubation (24 h, 37.degree. C., 5% CO.sub.2). ELISA (duplicate measurement out of pooled supernatants, 20 .mu.l) for huIFN.alpha. (eBioscience, #BMS216INSTCE) was performed according to the manufacturer's protocol. ELISA (duplicate measurement out of pooled supernatants, 20 .mu.l) for huTNF.alpha. (eBioscience, #BMS223INSTCE) was performed according to the manufacturer's protocol.

bDNA Assay

[0572] TGF-R.sub.II mRNA levels were determined in liver, kidney, and lung lysate by bDNA assay according to manufacturer's instructions (QuantiGene.RTM. kit, Panomics/Affimetrix).

Immunofluorescence

[0573] Paraffin-embedded spinal cord and brain tissue was cut into 5 .mu.m sections (3-4 slides per object plate). Paraffin sections were deparaffinized and demasked by heating in citrate buffer (10 mM, 40 min) in a microwave oven. Afterwards, deparaffinized sections were incubated with 0.3% H.sub.2O.sub.2 (30 min, RT), washed with PBS (10 min, RT) and blocked with Blocking Solution (Zytomed #ZUC007-100) for 30 min. After blocking for 1 h at RT with Blocking Solution (Zytomed) slides were incubated with 150 .mu.l of the respective primary antibodies and incubated at 4.degree. C. overnight. After washing with PBS (three times, 5 min RT) the slices were incubated with the secondary antibody for 1 h at RT. All antibody dilutions were prepared with Antibody Diluent (Zytomed #ZUC025-100). Afterwards the slices were washed again with PBS (three times, 5 min, RT) and mounted using VECTASHIELD.RTM. Mounting Medium with DAPI (Vector). Antibodies for immunofluorescence were comparable to cell culture experiments and adapted for each species.

Electrochemiluminescence

[0574] For immunological and hematological alterations, electrochemiluminescence technique (MesoScale Discovery.RTM., Maryland, United States) was used. For each assay, 25 .mu.l of the protein, blood, and liquor samples were used and the procedure was performed according to manufacturer's instructions.

BrdU Assay

[0575] Labeling of dividing cells was performed by intraperitoneal injection of the thymidine analogue BrdU (Sigma, Steinheim, Germany) at 50 mg/kg of body weight using a sterile solution of 10 mg/ml of BrdU dissolved in a 0.9% (w/v) NaCl solution. The BrdU injections were performed daily within the last experimental week.

Surgery

[0576] For chronic central infusion, animals underwent surgery for an icy cannula attached to an Alzet.RTM. osmotic minipump (mice, rats, infusion rate: 0.25 .mu.l/h, Alzet.RTM., Model 2004, Cupertino, USA) or a gas pressure pump (Cynomolgus monkeys, infusion rate 0.25 ml/24 h, Tricumed.RTM., Model IP 2000V, Germany). The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump/gas pressure pump was implanted subcutaneously in the abdominal region via a skin incision at the neck of the animals and connected with the icy cannula by silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, animals were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. Blood, liquor, and tissues were collected for analysis. Histological verification of the icy implantation sites was performed at 40 .mu.m coronal, cresyl violet-stained brain sections.

Outcome Parameters and Functional Analysis

[0577] Onset of symptomatic disease, onset of first paresis and survival were used as in vivo endpoints. Onset of symptomatic disease was defined as a lack of leg stretching in reaction to tail suspending. Time point at which gait impairments were first detected (e.g., hobbling or waddling) was classified as onset of first paresis. These parameters were determined daily starting at age 40 days.

[0578] To monitor disease progression, running wheel testing (LMTB, Berlin, Germany) was performed. Animals were caged separately with access to a running wheel starting at 33 days of age. Motor activity was directly correlated with the rotations per minute, generated by each animal in the running wheel. Each full turn of the wheel triggered two electromagnetic signals, directly fed into a computer attached to a maximum of 120 wheels. Running wheel data were recorded and analyzed with "Maus Vital" software (Laser- and Medizin-Technologie, Berlin, Germany). Assessment time lasted for 12 hours from 6:00 .mu.m to 6:00 am.

Spatial Learning Test (Morris-Water-Maze)

[0579] Behavioral testing was performed between 8:00 and 13:00.

[0580] Rats were trained in a black circular pool (1.4 m in diameter, 50 cm high, filled with 20.degree. C. warm water to a height of 30 cm) to find a visible white target (10 cm in diameter, raised above the water's surface of approximately 1 cm) that was located throughout the study in the center of the same imaginary quadrant (proximally cued). Each animal was trained to navigate to the platform in 3 consecutive sessions with 12 trials/sessions, one session per day and an inter-trial interval of 10-20 s.

Microbiological Analysis

[0581] Antisense-oligonucleotide samples were microbiologically analyzed according to Ph. Eur. 2.6.12, USP 30<61> regarding the Total Aerobic Microbial Count (TAMC) and the Total Combined Yeast and Mould Count (TYMC).

Anion-Exchange High-Performance Liquid Chromatography (AEX-HPLC)

[0582] Integrity and stability of antisense-oligonucleotide (ASO) samples was determined by AEX-HPLC using AKTAexplorer.TM. System (GE healthcare, Freiburg, Germany). The purified ASO samples were desalinated by ethanol precipitation. The identity of the ASO was confirmed by electrospray-ionization-mass-spectrometry (ESI-MS) and the purity was determined by AEX-HPLC with a Dionex DNAPac.TM. 200 (4.times.250 mm) column.

Example 1: Determination of Inhibitory Activity of Inventive Antisense-Oligonucleotides on mRNA Level

1.1 Transfection of Antisense-Oligonucleotides

[0583] The inhibitory activity of several antisense-oligonucleotides directed to TGF-R.sub.II was tested in human epithelial lung cancer cells (A549). TGF-R.sub.II mRNA was quantified by branched DNA assay in total mRNA isolated from cells incubated with TGF-R.sub.II specific oligonucleotides.

Description of Method:

[0584] Cells were obtained and cultured as described above. Transfection of antisense-oligonucleotides was performed directly after seeding 10,000 A549 cells/well on a 96-well plate, and was carried out with Lipofectamine.RTM. 2000 (Invitrogen GmbH, Karlsruhe, Germany, cat. No. 11668-019) as described by the manufacturer. In two independent single dose experiments performed in quadruplicates, oligonucleotides were transfected at a concentration of 20 nM. After transfection, cells were incubated for 24 h at 37.degree. C. and 5% CO.sub.2 in a humidified incubator (Heraeus GmbH, Hanau, Germany). For measurement of TGF-R.sub.II mRNA, cells were harvested and lysed at 53.degree. C. following procedures recommended by the manufacturer of the QuantiGene.RTM. Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) for isolation of branched DNA (bDNA). For quantitation of housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA the QuantiGene.RTM. Explore Kit was used, whereas quantitation of TGF-R.sub.II mRNA was conducted with QuantiGene.RTM. 2.0 (custom manufacturing for Axolabs GmbH, Kulmbach, Germany). After incubation and lysis, 10 .mu.l of the lysates were incubated with probe sets specific to human TGF-R.sub.II and human GAPDH. Both reaction types were processed according to the manufacturer's protocol for the respective QuantiGene.RTM. kit. Chemoluminescence was measured in a Victor.sup.2.TM. multilabel counter (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the TGF-R.sub.II probe sets were normalized to the respective GAPDH values for each well and then normalized to the corresponding mRNA readout from mock-treated cells.

Results

[0585] Results show the efficient downregulation of TGF-R.sub.II by several ASOs after transfection of A549 cells. Downregulation after transfection of reference oligonucleotides Ref. 6-Ref. 10 was not as efficient and resulted in downregulation of >60%.

TABLE-US-00066 TABLE 15 Downregulation of TGF-R.sub.II mRNA. Transfection with TGF-R.sub.II specific antisense-oligonucleotides (ASOs) in human epithelial lung carcinoma cells (A549). Quantitation of mRNA expression levels was performed relative to housekeeping gene GAPDH using QuantiGene .RTM. Kit. Probes were then normalized to the corresponding mRNA readout from mock-treated cells. A549 (c = 20 nM) GAPDH TGF-R.sub.II ASO mean SD mean SD Seq. ID No. 141j 1.41 0.05 0.02 0.01 Seq. ID No. 143aj 0.76 0.03 0.02 0.01 Seq. ID No. 139c 0.9 0.03 0.02 0.01 Seq. ID No. 145c 0.91 0.05 0.03 0.01 Seq. ID No. 209ax 1.52 0.58 0.03 0.01 Seq. ID No. 152ak 0.88 0.03 0.04 0 Seq. ID No. 218ar 1.08 0.03 0.04 0 Seq. ID No. 144c 0.5 0.07 0.05 0.03 Seq. ID No. 210ap 0.92 0.05 0.05 0.01 Seq. ID No. 142c 1.33 0.05 0.06 0.03 Seq. ID No. 213ak 1.2 0.03 0.07 0.01 Seq. ID No. 153f 1.09 0.07 0.08 0.03

Conclusion

[0586] TGF-R.sub.II mRNA was efficiently targeted by the inventive ASOs. The named ASOs achieved an effective target mRNA downregulation after transfection of A549 cells.

1.2 Gymnotic Uptake of Antisense-Oligonucleotides

1.2.1a Comparison of Target-Knockdown Between Inventive ASOs and Prior-Art Sequences by Gymnotic Transfer in A549 and Panc-1 Cells

[0587] The downregulatory activity of several antisense-oligonucleotides directed to TGF-R.sub.II was tested in human epithelial lung tumor cells (A549) by direct uptake without transfection reagents ("gymnotic uptake"). TGF-R.sub.II mRNA was quantified by branched DNA assay in total mRNA isolated from cells incubated with TGF-R.sub.II specific oligonucleotides.

Description of Method:

[0588] Cells were obtained and cultured as described in general methods. Gymnotic transfer of antisense-oligonucleotides was performed by preparing a 96-well plate with the respective antisense-oligonucleotides and subsequently seeding of 10,000 cells (Panc-1) or 8,000 cells (A549)/well. Experiments were performed in quadruplicates, oligonucleotides were used at final concentrations of 5 .mu.M (Panc-1) and 7.5 .mu.M (A549). Cells were incubated for 72 h at 37.degree. C. and 5% CO.sub.2 in a humidified incubator (Heraeus GmbH, Hanau, Germany). For measurement of TGF-R.sub.II mRNA, cells were harvested and lysed at 53.degree. C. following procedures recommended by the manufacturer of the QuantiGene.RTM. Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) for branched DNA (bDNA). For quantitation of housekeeping gene GAPDH mRNA the QuantiGene.RTM. Explore Kit was used, whereas quantitation of TGF-R.sub.II mRNA was conducted with QuantiGene.RTM. 2.0 (custom manufacturing for Axolabs GmbH, Kulmbach, Germany). After incubation and lysis, 10 .mu.l of the lysates were incubated with probe sets specific to human TGF-R.sub.II and human GAPDH. Both reaction types were processed according to the manufacturer's protocol for the respective QuantiGene.RTM. kit. Chemoluminescence was measured in a Victor.sup.2.TM. multilabel counter (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the TGF-R.sub.II probe sets were normalized to the respective GAPDH values for each well and then normalized to the corresponding mRNA readout from PBS treated cells.

[0589] Selected results are shown in Table 16a. Further modifications of Seq. ID No. 209ay, Seq. ID No. 209ax and Seq. ID No. 209y, namely ASOs listed in Table 6 of the description, showed comparable values to these three antisense-oligonucleotides. In addition, modifications of Seq. ID No. 152h, namely ASOs listed in Table 5 of the description, showed comparable values to this antisense-oligonucleotide. Modifications of Seq. ID No. 218b, namely ASOs listed in Table 8 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 218b. Modifications of Seq. ID No. 213k, namely ASOs listed in Table 9 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 213k. Also modifications of Seq. ID No. 210q, namely ASOs listed in Table 7 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 210q. Finally, modifications of Seq. ID No. 143h, namely ASOs listed in Table 4 of the description, showed comparable values to the antisense-oligonucleotide Seq. ID No. 143h. Transfer of antisense-oligonucleotides listed in Tables 4-9 resulted in a more potent downregulation of the target TGF-RII mRNA compared to the transfer of tested reference sequences (A549: downregulation<0.5; Panc1 cells: downregulation<0.4).

TABLE-US-00067 TABLE 16a Efficacy of target mRNA downregulation by gymnotic transfer. Remaining TGF-R.sub.II mRNA after gymnotic uptake of selected TGF-R.sub.II specific ASOs in A549 and Panc-1 cells. mRNA expression levels were determined relative to housekeeping gene Glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) and compared to PBS treated cells as reference control (=1) using QuantiGene .RTM. Kit. Remaining mRNA of TGF-R.sub.II (PBS treated cells = 1) A549 cells Panel cells ASO mean SD mean SD Seq. ID No. 209ay 0.11 0.01 0.07 0.02 Seq. ID No. 209ax 0.14 0.02 0.08 0.01 Seq. ID No. 209bb 0.19 0.01 0.11 0.01 Seq. ID No. 209az 0.19 0.03 0.13 0.02 Seq. ID No. 209ba 0.23 0.02 0.18 0.03 Seq. ID No. 209y 0.27 0.04 0.17 0.01 Seq. ID No. 152h 0.29 0.04 0.12 0.02 Seq. ID No. 218b 0.30 0.02 0.07 0.01 Seq. ID No. 213k 0.34 0.04 0.17 0.04 Seq. ID No. 210q 0.37 0.05 0.18 0.02 Seq. ID No. 210aq 0.39 0.03 0.18 0.02 Seq. ID No. 143h 0.43 0.04 0.35 0.05 Ref. 2 0.59 0.05 0.40 0.04 Ref. 0 0.89 0.06 1.10 0.07 Ref. 3 0.68 0.03 0.62 0.03 Ref. 4 0.74 0.04 0.71 0.01

Conclusion

[0590] Gymnotic transfer of inventive ASOs results in a continuously stronger downregulation of the target TGF-R.sub.II mRNA than the transfer of tested reference sequences. The claimed antisense-oligonucleotides outperformed all tested sequences known from prior-art, independently of the chosen human cell line. Nevertheless, in general antisense-oligonucleotides having a length of 12-20 nucleotides result in a more effective downregulation of the target TGF-R.sub.II mRNA than shorter or longer antisense-oligonucleotides. This effect was even more noticeable for antisense-oligonucleotides having a length of 14-18 nucleotides, which in general show the most potent effects.

1.2.1b Analysis of Gymnotic Transfer in A549 Cells by Branched DNA Assay

[0591] Most effective antisense-oligonucleotides against TGF-R.sub.II from the transfection screens were further characterized by gymnotic uptake in A549 cells. TGF-R.sub.II mRNA was quantified by branched DNA in total mRNA isolated from cells incubated with TGF-R.sub.II specific antisense-oligonucleotides.

Description of Method:

[0592] A549 cells were cultured as described before under standard conditions. For single-dose and dose-response experiments 80,000 A549 cells/well were seeded in a 6-well culture dish and incubated directly with oligonucleotides at a concentration of 7.5 .mu.M. For measurement of TGF-R.sub.II mRNA, cells were harvested, lysed at 53.degree. C. and analyzed by branched DNA Assay following procedures recommended by the manufacturer of the QuantiGene.RTM. Explore Kit (Panomics, Fremont, Calif., USA, cat. No. QG0004) as described above (see 1.1).

Results

[0593] Listed ASOs in Table 16b showed reduced target mRNA level of TGF-R.sub.II relative to the housekeeping gene GAPDH in A549 cells. The ten most efficient ASOs were also tested for inhibitory concentration 50 (IC.sub.50). All together Seq. ID No. 209t, Seq. ID No. 218b, Seq. ID No. 218c and Seq. ID No. 209y lead to most proper knockdown of TGF-R.sub.II at low concentration levels.

TABLE-US-00068 TABLE 16b Downregulation of TGF-R.sub.II mRNA after gymnotic uptake of TGF- R.sub.II specific ASOs in A549 cells. mRNA levels were determined relative to housekeeping gene GAPDH using QuantiGene .RTM. Kit. TGF-R.sub.II GAPDH IC.sub.50 ASO n = 4 SD n = 4 SD n = 4 Seq. ID No. 209t 0.19 0.05 1.13 0.11 1.63 Seq. ID No. 218c 0.25 0.04 0.94 0.18 1.17 Seq. ID No. 218b 0.26 0.08 1.08 0.28 2.54 Seq. ID No. 218q 0.27 0.07 1.11 0.08 2.39 Seq. ID No. 209y 0.34 0.06 0.96 0.06 1.57 Seq. ID No. 218t 0.36 0.12 0.76 0.04 2.57 Seq. ID No. 218m 0.41 0.06 1.16 0.29 1.66 Seq. ID No. 209w 0.44 0.07 1.00 0.11 5.76 Seq. ID No. 218p 0.46 0.12 0.88 0.07 Seq. ID No. 209v 0.48 0.25 0.96 0.07 3.10 Seq. ID No. 209x 0.52 0.02 0.87 0.06 5.60 Seq. ID No. 218u 0.53 0.20 0.79 0.05 Seq. ID No. 218v 0.54 0.13 0.77 0.04 Seq. ID No. 210q 0.60 0.23 1.11 0.11 Seq. ID No. 218o 0.61 0.15 0.96 0.06 Seq. ID No. 210p 0.65 0.24 1.01 0.23 Seq. ID No. 218n 0.89 0.36 1.07 0.22 Seq. ID No. 210o 0.95 0.08 0.97 0.14 Seq. ID No. 209s 0.96 0.31 1.14 0.24 pos. Ctrl aha-1 0.22 0.04 0.77 0.02 Ref. 1 1.43 0.40 1.27 0.18 IC.sub.50 = inhibitory concentration for 50% of downregulation, Pos. Ctrl: aha-1 = activator of heat shock 90 kDa protein ATPase homolog 1 (Aha1) directed LNA as positive control, Ref. 1 = Scrambled control.

Conclusion

[0594] The target downregulation by the most efficient inventive ASOs was again excellent without transfection reagents. Thus, gymnotic transfer is feasible and the preferred method for further drug development.

1.2.2 Analysis of Gymnotic Uptake in A549 and ReNcell CX.RTM. Cells

[0595] Inhibitory activity on the target mRNA by antisense-oligonucleotides (ASOs) was determined in human neuronal progenitor cells from cortical brain region (ReNcell CX.RTM. cells, Millipore #SCM007). Questions regarding adult neurogenesis as therapeutic target were assessed by gymnotic transfer studies with most effective ASOs. A549 cells were used as reference cell line.

Description of Method:

[0596] A549 and ReNcell CX.RTM. cells were cultured as described above. For treatment studies cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For treatment of A549 and ReNcell CX.RTM. cells, medium was removed and replaced by fresh full medium (0.5 ml for 24-well). Ref.1, ASO with Seq. ID No. 218b, and ASO with Seq. ID No. 218c were then added in medium at concentrations of 2.5 and 10 .mu.M for analysis of target downregulation at different time points (A549 cells: 18 h, 72 h, 6 d, ReNcell CX.RTM. cells: 18 h, 96 h, 8 d) at 37.degree. C. and 5% CO.sub.2. For harvesting, cells were washed twice with PBS and frozen at -20.degree. C. For analysis of mRNA by real-time RT-PCR, cells were processed as described above. Ready-to-use and standardized primer pairs for real-time RT-PCR (see Table 11) were used and mixed with the respective ready-to-use Mastermix solution (SsoAdvanced.TM. Universial SYBR.RTM. Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Probes were analyzed as triplicates and data was quantified relative to GNB2L1 mRNA using BioRad CFX Manager.TM. 3.1 and then normalized to untreated control. Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Results:

[0597] Results showed that gymnotic transfer with Seq. ID No. 218b and 218c result in a proper downregulation of TGF-R.sub.II mRNA in A549 and ReNcell CX.RTM. cells in a dose- and time dependent manner (Table 17). Target mRNA in A549 cells was significantly reduced after 18 h, and was even more efficient reduced after 72 h and 6 d. After 18 h in ReNcell CX.RTM. only a depression of TGF-R.sub.II mRNA after gymnotic uptake of 100 could be observed, but target downregulation was significant after 72 h for both tested concentrations and was stable until day 8.

TABLE-US-00069 TABLE 17 Dose- and time-dependent downregulation of TGF-R.sub.II mRNA after gymnotic transfer with TGF-R.sub.II specific ASO in A549 and ReNcell CX .RTM. cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line A549 Target TGF-R.sub.II TGF-R.sub.II TGF-R.sub.II Time point 18 h, n = 3 72 h, n = 3 6 d, n = 3 A 1.00 .+-. 0.03 1.00 .+-. 0.20 1.00 .+-. 0.38 B 2.5 .mu.M 1.17 .+-. 0.06 0.87 .+-. 0.21 0.88 .+-. 0.14 B 10 .mu.M 0.98 .+-. 0.10 0.77 .+-. 0.06 1.03 .+-. 0.10 C 2.5 .mu.M 0.60*++ .+-. 0.09 .sup. 0.41* .+-. 0.07 0.13 .+-. 0.03 C 10 .mu.M 0.49**++ .+-. 0.02 .sup. 0.15** .+-. 0.02 0.02*+ .+-. 0.00 .sup. D 2.5 .mu.M 0.46** .+-. 0.09 D 10 .mu.M 0.21* .+-. 0.04 Cell line ReNcell CX Target TGF-R.sub.II TGF-R.sub.II TGF-R.sub.II Time point 18 h, n = 3 96 h, n = 3 8 d, n = 3 A 1.00 .+-. 0.41 1.00 .+-. 0.04 1.00 .+-. 0.18 B 2.5 .mu.M 1.38 .+-. 0.58 0.89 .+-. 0.09 0.80 .+-. 0.33 B 10 .mu.M 1.70 .+-. 0.68 0.81 .+-. 0.10 1.16 .+-. 0.43 C 2.5 .mu.M 1.04 .+-. 0.36 0.32** .+-. 0.06 0.42 .+-. 0.16 C 10 .mu.M 0.64 .+-. 0.24 0.16** .+-. 0.02 0.21 .+-. 0.09 D 2.5 .mu.M 0.53 .+-. 0.07 D 10 .mu.M 0.23** .+-. 0.03 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, D = Seq. ID No. 218c, .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A, +p < 0.05, ++p < 0.01 in reference to B. Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0598] Efficient and stable downregulation of target mRNA by gymnotic uptake of ASOs is achieved even in long-term applications. ReNcell CX.RTM. cells could therefore be used e.g. for experiments addressing recovery of adult neurogenesis as a therapeutic option in patients. The same applies for other indications as shown by A549 experiments.

[0599] Taken together, efficient downregulation of TGF-R.sub.II is suitable independently from method of transfer and cell type. Gymnotic uptake of ASOs is the preferred transfer method as in clinical applications the absence of additional transfection agents suggests high safety for patients.

Example 2: Determination of Inhibitory Activity of the Antisense-Oligonucleotides Directed to TGF-R.sub.II on Protein Level

[0600] Western Blot Analysis and Immunocytochemistry was performed to determine whether reduced TGF-R.sub.II mRNA level, mediated by inventive antisense-oligonucleotides (ASOs) in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX.RTM.) results in a reduction of target protein.

Description of Method:

[0601] Cells were cultured as described above. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300, 80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802, 10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For gymnotic transfer of A549 and ReNcell CX.RTM. cell medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (scrambled control), the respective inventive ASO was then added in medium at concentrations of 2.5 and 10 .mu.M for protein analysis of target downregulation after 72 h in A549 cells and 96 h in ReNcell CX.RTM. cells. The cells were lysed and examined by Western Blot as described in general method part. The primary antibody anti-TGF-R.sub.II was diluted in 0.5% BSA in TBS-T and incubated at 4.degree. C. for 2 days. Afterward membranes were incubated with the second antibody anti-rabbit IgG HRP-linked diluted in 0.5% BSA in TBS-T (1 h, RT). Following incubation, blots were washed with TBS-T, emerged using LuminataTmForte Western HRP Substrate (Millipore #WBLUF0500) and bands were detected with a luminescent image analyzer (ImageQuant.TM. LAS 4000, GE Healthcare). For housekeeper comparison, the membranes were incubated with HRP-conjugated anti-GAPDH (1:1000 in 0.5% Blotto, 4.degree. C., overnight). Densitometric quantification was calculated relative to GAPDH and then normalized to untreated control with Image Studio.TM. Lite Software.

[0602] Procedure for immunocytochemistry was performed as described in standard protocol. For verification of target-downregulation anti-TGF-R.sub.II was diluted and incubated overnight at 4.degree. C. Cy3 goat-anti-rabbit was used as secondary antibody. All antibody-dilutions were prepared with Antibody-Diluent (Zytomed.RTM. #ZUC025-100). Examination of cells was performed by fluorescence microscopy (Zeiss Axio.RTM. Observer.Z1). Images were analyzed with Image J Software and CorelDRAW.RTM. X7 Software.

Results after Gymnotic Transfer:

[0603] Western Blot Analysis and immunocytochemistry were used to verify the reduction of TGF-R.sub.II protein level. 72 h after gymnotic transfer, TGF-R.sub.II protein was significantly reduced using high concentration of different ASOs according to the invention in comparison to untreated control in A549 cells (Table 18). Reduced TGF-R.sub.II levels were also observed in ReNcell CX.RTM. cells (Table 18). For both cell lines, reduction of TGF-R.sub.II protein level was shown by Western Blot Analysis. Immunocytochemistry revealed a strong dose-dependent reduction of TGF-R.sub.II protein in both cell lines in comparison to untreated cells and scrambled control treated cells.

TABLE-US-00070 TABLE 18 Densitometric analysis after TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after gymnotic transfer with TGF-R.sub.II specific ASOs in A549 and ReNcell CX .RTM. cells could be observed after 72 h or 96 h, respectively. Protein levels were determined relative to housekeeping gene GAPDH using Image Studio .TM. Lite Software and were normalized to untreated control. Cell line A549 ReNcell CX Target TGF-R.sub.II TGF-R.sub.II Time point 72 h, n = 3 96 h, n = 2 A 1.00 .+-. 0.00 1.00 .+-. 0.00 B 2.5 .mu.M 0.85 .+-. 0.13 0.91 .+-. 0.12 B 10 .mu.M 1.06 .+-. 0.47 1.23 .+-. 0.16 C 2.5 .mu.M 0.34 .+-. 0.11 0.59 .+-. 0.05 C 10 .mu.M 0.39* .+-. 0.11 0.63 .+-. 0.17 D 2.5 .mu.M 0.68 .+-. 0.14 1.21 .+-. 0.28 D 10 .mu.M 0.39* .+-. 0.07 0.77 .+-. 0.10 F 2.5 .mu.M 0.51 .+-. 0.08 0.71 .+-. 0.16 F 10 .mu.M 0.45 .+-. 0.09 0.57 .+-. 0.12 G 2.5 .mu.M 0.41 .+-. 0.13 0.61 .+-. 0.10 G 10 .mu.M 0.40* .+-. 0.06 0.58 .+-. 0.08 H 2.5 .mu.M 0.75 .+-. 0.12 0.83 .+-. 0.13 H 10 .mu.M 0.51 .+-. 0.07 0.77 .+-. 0.06 I 2.5 .mu.M 0.58 .+-. 0.14 0.91 .+-. 0.21 I 10 .mu.M 0.38* .+-. 0.14 0.67 .+-. 0.09 J 2.5 .mu.M 0.42 .+-. 0.15 0.75 .+-. 0.23 J 10 .mu.M 0.34* .+-. 0.05 0.59 .+-. 0.08 K 2.5 .mu.M 0.45 .+-. 0.17 0.69 .+-. 0.16 K 10 .mu.M 0.36* .+-. 0.09 0.49 .+-. 0.09 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, D = Seq. ID No. 218c, F = Seq. ID No. 210q, G = Seq. ID No. 213k, H = Seq. ID No. 143h, I = Seq. ID No. 152h, J = Seq. ID No. 209az, K = Seq. ID No. 209y, .+-. = SEM, *p < 0.05 in reference to A. Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0604] In addition to target mRNA downregulation, gymnotic transfer of Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, and Seq. ID No. 209y resulted in excellent reduction of protein level in A549 and ReNcell CX.RTM. cells. Staining of TGF-R.sub.II revealed a dose-dependent reduction of TGF-R.sub.II protein after treatment with these ASOs in both cell lines.

Results after Gymnotic Transfer with Further ASOs:

[0605] Protein analysis showed a reduced amount of TGF-R.sub.II in A549 cells and ReNcell CX.RTM. cells gymnotic transfer of tested ASOs (10 .mu.M, Table 19). This was also verified by immunocytochemistry. For both cell lines, reduction of TGF-R.sub.II protein level by gymnotic transfer of the tested ASOs could be detected in comparison to untreated cells and scrambled control treated cells.

TABLE-US-00071 TABLE 19 Densitometric analysis after TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after gymnotic transfer with further TGF-R.sub.II-specific antisense-oligonucleotides (ASO) in A549 and ReNcell CX .RTM. cells could be observed after 72 h or 96 h, respectively. Protein levels were determined relative to housekeeping-gene GAPDH using Studio .TM. Lite Software and were then normalized to untreated control. ASO No. in Test Seq ID No. Result 1 233d B 2 234d A 3 143j C 4 143p A 5 143q A 6 143r.sup. A 7 143w A 8 143af C 9 143ag C 10 143ah C 11 235b B 12 235d A 13 141d A 14 141g A 15 141i A 16 237b A 17 237c A 18 237i C 19 237m A 20 238c A 21 238f.sup. A 22 239e B 23 240c B 24 241b C 25 242a C 26 246e C 27 247d A 28 248b A 29 248e B 30 248g A 31 152k B 32 152s B 33 152t B 34 152u B 35 152ab C 36 152ag B 37 152ah C 38 152ai C 39 249c A 40 249e A 41 250b A 42 250g B 43 251c A 44 251f.sup. A 45 252e B 46 253c A 47 254b C 48 255a C 49 259e C 50 260d B 51 261b A 52 261e B 53 261g A 54 262d B 55 262e A 56 209s A 57 209v B 58 .sup. 209w B 59 209x C 60 209ai B 61 209an C 62 209at A 63 209au B 64 209av B 65 263b B 66 263c A 67 263i.sup. B 68 263m A 69 264e A 70 264h A 71 265e B 72 266c A 73 267b B 74 268a B 75 272e B 76 273d A 77 274a A 78 274d B 79 274f.sup. A 80 275g A 81 275i.sup. B 82 210o A 83 210v B 84 .sup. 210w B 85 210x C 86 210ab B 87 210ac A 88 210ad B 89 210af A 90 210am B 91 276b B 92 276c A 93 276j B 94 276k B 95 277d A 96 277e A 97 278f.sup. B 98 279c B 99 280b C 100 281a C 101 220d C 102 221d B 103 222b A 104 222c A 105 222f.sup. B 106 223c B 107 223f.sup. A 108 218ad B 109 218n A 110 218t.sup. B 111 218u B 112 218v C 113 218ah C 114 218an A 115 218ao B 116 218ap B 117 224i.sup. B 118 224m B 119 225c A 120 225f.sup. A 121 226e B 122 227c A 123 228b C 124 229a C 125 285d C 126 286d A 127 287d B 128 287e A 129 287f.sup. A 130 288e A 131 288i.sup. A 132 289d B 134 289h A 135 289o B 136 289p B 137 289q B 138 213o B 139 213p B 140 213q B 141 213s B 142 213y B 143 213z B 144 213aa B 145 213af B 146 290c A 147 290f.sup. B 148 290i.sup. A 149 291c B 150 292c C 151 293b C 152 294a C Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons. Reduction of protein level for ASO 1-25 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 143h; B = more than 10% but less than 20% inferior to SEQ ID No. 143h; C = more than 20% but less than 30% inferior to SEQ ID No. 143h. Reduction of protein level for ASO 26-48 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 152h; B = more than 10% but less than 20% inferior to SEQ ID No. 152h; C = more than 20% but less than 30% inferior to SEQ ID No. 152h. Reduction of protein level for ASO 49-74 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y. Reduction of protein level for ASO 75-100 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 210q; B = more than 10% but less than 20% inferior to SEQ ID No. 210q; C = more than 20% but less than 30% inferior to SEQ ID No. 210q. Reduction of protein level for ASO 101-124 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c. Reduction of protein level for ASO 125-152 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 213k; B = more than 10% but less than 20% inferior to SEQ ID No. 213k; C = more than 20% but less than 30% inferior to SEQ ID No. 213k.

Conclusion:

[0606] Taken together, dose-dependent downregulation of TGF-R.sub.II mRNA by gymnotic transfer in A549 and ReNcell CX.RTM. cells resulted in a dose-dependent reduction of protein levels. Inventive ASOs are potent in protein target downregulation as demonstrated in A549 and ReNcell CX.RTM. cells.

Example 3: Analysis of the Effects of the Antisense-Oligonucleotides to the Downstream Signaling Pathway of TGF-R.sub.II

[0607] Functional analyses were performed in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX.RTM.). TGF-.beta. downstream signaling pathway was analyzed, following to an effective downregulation of TGF-R.sub.II mRNA and reduction of protein levels by gymnotic transfer of the inventive ASOs. Therefore, mRNA and protein levels of Connective Tissue Growth Factor (CTGF), known as downstream-mediator of TGF-.beta., were evaluated. In addition, phosphorylation of Smad2 (mothers against decapentaphlegic homolog 2) was examined. The phosphorylation of Smad2 is a marker for an active TGF-.beta. pathway followed by the upregulation of the downstream target gene CTGF.

Description of Method:

[0608] Cells were cultured as described before. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For gymnotic transfer, A549 and ReNcell CX.RTM. cell medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (Scrambled control), ASO with sequence identification number 218b (Seq. ID No. 218b), No. 218c (Seq. ID No. 218c) was then added in medium at concentrations of 2.5 and 10 .mu.M and respective analysis was performed after 72 h in A549 cells and 96 h in ReNcell CX.RTM. cells. To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To check for CTGF and pSmad2 protein levels, Western Blot and immunocytochemistry were used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

3.1. Results for Seq. ID No. 218b

3.1.1 Effects on CTGF mRNA and Protein Level

[0609] CTGF mRNA was significantly and dose-dependently reduced after gymnotic transfer with ASO Seq. ID No. 218b in A549 (72 h) and ReNcell CX.RTM. (96 h) cells. Downstream-mediator of TGF-.beta. was reduced to 52%.+-.0.02 in ReNcell CX.RTM. cells and to 39%.+-.0.03 in A549 cells after gymnotic transfer with 10 .mu.M Seq. ID No. 218b (Table 20). According to these downregulated CTGF mRNA levels, a strong reduction of CTGF protein expression was observed in A549 cells (Table 21).

TABLE-US-00072 TABLE 20 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in A549 and ReNcell CX .RTM. cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. Cell line A549 ReNcell CX Target CTGF CTGF Time point 72 h, n = 3 96 h, n = 3 A 1.00 .+-. 0.08 1.00 .+-. 0.04 B 2.5 .mu.M 0.87 .+-. 0.06 0.97 .+-. 0.06 B 10 .mu.M 0.80 .+-. 0.03 0.86 .+-. 0.17 C 2.5 .mu.M 0.60** .+-. 0.04 0.66** .+-. 0.02 C 10 .mu.M 0.39** .+-. 0.03 0.52** .+-. 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

TABLE-US-00073 TABLE 21 Densitometric analysis of CTGF Western Blot. Downregulation of CTGF protein 72 h after gymnotic transfer with ASO Seq. ID No. 218b in A549 was recognized. Protein levels were determined relative to housekeeping gene alpha-Tubulin using Studio .TM. Lite Software and were normalized to untreated control. Cell line A549 Target CTGF Time point 72 h, n = 1 A 1.00 B 2.5 .mu.M 0.91 B 10 .mu.M 1.31 C 2.5 .mu.M 0.05 C 10 .mu.M 0.086 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

Conclusion:

[0610] Functional inhibition of TGF-.beta. signaling was achieved with gymnotic transfer of Seq. ID No. 218b as shown by downregulation of target CTGF mRNA and reduced CTGF protein levels in A549 and ReNcell CX.RTM. cells.

3.1.2 Effects on pSmad2 Protein Level

[0611] pSmad2 protein levels were analyzed to proof the CTGF downregulation as a specific result of the ASO-mediated TGF-.beta. signaling inhibition.

[0612] Staining against pSmad2 after gymnotic transfer of ASO Seq. ID No. 218b after 72 h in A549 and 96 h in ReNcell CX.RTM. cells showed a dose-dependent inhibition of Smad2 phosphorylation (FIG. 5). In addition, reduction of pSmad2 expression levels by ASO Seq. ID No. 218b was verified by Western Blot Analysis in A549 cells (Table 22).

TABLE-US-00074 TABLE 22 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein 72 h after gymnotic transfer with ASO Seq. ID No. 218b in A549 was recognized. Protein levels were determined relative to housekeeping gene GAPDH using Studio .TM. Lite Software and normalized to untreated control. Cell line A549 Target pSmad2 Time point 72 h, n = 1 A 1.00 B 2.5 .mu.M 1.81 B 10 .mu.M 1.79 C 2.5 .mu.M 0.66 C 10 .mu.M 0.72 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

Conclusion:

[0613] Gymnotic transfer of Seq. ID No. 218b in A549 and ReNcell CX.RTM. cells resulted in a dose-dependent inhibition of downstream mediators of TGF-.beta. signaling. CTGF and phosphorylation of Smad2 was reduced by ASO Seq. ID No. 218b, both indicating an inhibited TGF-.beta. pathway.

3.2 Results for Seq. ID No. 218c

3.2.1 Effects on CTGF mRNA and pSmad2 Protein Level

[0614] Gymnotic transfer of ASO Seq. ID No. 218c downregulates CTGF mRNA in A549 and ReNcell CX.RTM. cells (Table 23). Immunocytochemistry against pSmad2 confirmed an inhibition of TGF-.beta. signaling (FIG. 6). Therefore, downregulation of CTGF mRNA is an direct effect of reduced TGF-.beta. signaling.

TABLE-US-00075 TABLE 23 Significant downregulation of CTGF mRNA was observed in A549 and ReNcell CX .RTM. cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Cell line A549 ReNcell CX Target CTGF CTGF Time point 72 h, n = 4 96 h, n = 3 A 1.00 .+-. 0.08 1.00 .+-. 0.10 B 2.5 .mu.M 0.97 .+-. 0.07 0.88 .+-. 0.08 B 10 .mu.M 0.85 .+-. 0.06 0.89 .+-. 0.07 D 2.5 .mu.M 0.49** .+-. 0.05 1.10 .+-. 0.08 D 10 .mu.M 0.31** .+-. 0.03 0.82 .+-. 0.02 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. .+-. = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0615] ASO Seq. ID No. 218c was efficient in inhibiting TGF-.beta. signaling after downregulation of target TGF-R.sub.II mRNA. This was examined by determination of downregulated CTGF mRNA and reduced pSmad2 protein levels as a marker for TGF-.beta. signaling.

[0616] Taken together, inventive ASOs are efficient in mediating a functional inhibition of TGF-.beta. signaling by downregulation of TGF-R.sub.II. Thus, inventive ASOs will be beneficial for medical indications in which elevated TGF-.beta. levels are involved, e.g. neurological disorders, fibrosis and tumor progression.

Example 4: Inhibitory Activity of the Inventive ASOs on Target mRNA Levels in TGF-.beta.1 Treated Cells

4.1 Gymnotic Uptake of ASOs in A549 and ReNcell CX.RTM. Cells after TGF-.beta.1 Pre-Treatment

[0617] To analyze inhibitory activity of antisense oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX.RTM.) under pathological conditions, cells were pre-treated with Transforming Growth Factor-.beta. 1 (TGF-.beta.1). From previous studies it is known that TGF-.beta.1 is found in high concentrations in Cerebrospinal Fluid (CSF) of all neural disorders e.g. ALS. Therefore, inhibitory efficacy of ASOs on TGF.beta.-signaling was examined after pre-treatment and in presence with TGF-.beta.1. A549 cells were used as reference cell line.

Description of Method:

[0618] A549 and ReNcell CX.RTM. were cultured as described above. For treatment studies cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For treatment of A549 and ReNcell CX.RTM. cells, medium was removed and replaced by fresh full medium (0.5 ml for 24-well). Following TGF-.beta.1 (10 ng/ml, PromoCell #C-63499) exposition for 48 h, medium was changed, TGF-.beta.1 pre-treatment was performed in combination with Ref.1 (Scrambled control, 10 .mu.M), ASO Seq. ID No. 218b (10 .mu.M), or ASO Seq. ID No. 218c (10 .mu.M) in medium. A549 cells were incubated for further 72 h, whereas ReNcell CX.RTM. cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) as described before. Used primer pairs for real-time RT-PCR are listed in Table 11.

4.1.1 Results for Seq. ID No. 218b

[0619] Efficacy in mRNA downregulation of TGF-R.sub.II by ASO Seq. ID No. 218b was not influenced by TGF-.beta.1 pre-incubation in A549 and ReNcell CX.RTM. cells (Table 24, FIG. 7). Target mRNA in A549 cells was significantly downregulated after single treatment (remaining mRNA: 15%.+-.0.05) with ASO, but also after treatment in presence of TGF-.beta.1, following pre-treatment (remaining mRNA: 7%.+-.0.01). In ReNcell CX.RTM. cells ASO Seq. ID No. 218b showed similar potency in inhibiting TGF-R.sub.II mRNA in absence of TGF-.beta.1 (25%.+-.0.01) or in presence of TGF-.beta.1, following pre-treatment of TGF-.beta.1 (17%.+-.0.02).

TABLE-US-00076 TABLE 24 In presence of TGF-.beta.1, ASO Seq. ID No. 218b leads to a potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer in A549 and ReNcell CX .RTM. cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated controls. Target Time point TGF-R.sub.II 48 h TGF-.beta.1 -> 72 h/96 h TGF-.beta.1 + ASOs/single treatment A549 ReNcell CX Cell line n = 4 n = 3 A 1.00 .+-. 0.07 1.00 .+-. 0.11 B 10 .mu.M 0.90 .+-. 0.17 0.89 .+-. 0.26 C 10 .mu.M 0.15** .+-. 0.05 0.25 .+-. 0.01 E 10 ng/ml 0.71 .+-. 0.05 0.79 .+-. 0.34 E 10 ng/ml + B 10 .mu.M 0.74 .+-. 0.05 0.89 .+-. 0.25 E 10 ng/ml + C 10 .mu.M 0.07** .+-. 0.01 0.27 .+-. 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1, .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0620] Target mRNA was efficiently downregulated to approx. 20% by gymnotic uptake of inventive ASOs in presence of TGF-.beta.1, following pre-incubation in both tested cell lines.

4.1.2 Results for Seq. ID No. 218c

[0621] Downregulation of TGF-R.sub.II mRNA by ASO Seq. ID No. 218c was effective in presence of TGF-.beta.1 in A549 and ReNcell CX.RTM. cells (Table 25, FIG. 8). Target mRNA in both tested cell lines was significantly downregulated, regardless of a single treatment with ASO Seq. ID No. 218c or in presence with TGF-.beta.1.

TABLE-US-00077 TABLE 25 In presence of TGF-.beta.1, ASO Seq. ID No. 218c leads to a potent downregulation of TGF-R.sub.II mRNA after gymnotic transfer in A549 and ReNcell CX .RTM. cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and normalized to untreated control. Target Time point TGF-R.sub.II 48 h TGF-.beta.1 -> 72 h/96 h TGF-.beta.1 + ASOs/single treatment A549 ReNcell CX Cell line n = 2 n = 2 A 1.00 .+-. 0.12 1.00 .+-. 0.18 B 10 .mu.M 0.92 .+-. 0.06 0.51 .+-. 0.14 D 10 .mu.M 0.31** .+-. 0.04 0.05** .+-. 0.01 E 10 ng/ml 0.68 .+-. 0.05 0.88 .+-. 0.73 E 10 ng/ml + B 10 .mu.M 0.86 .+-. 0.04 0.45 .+-. 0.09 E 10 ng/ml + D 10 .mu.M 0.16** .+-. 0.05 0.03** .+-. 0.01 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-.beta.1, .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0622] Taken together, the inventive ASOs were effective in downregulating TGF-R.sub.II mRNA in presence of TGF-.beta.1, indicating that ASOs are functional under pathological conditions.

Example 5: Inhibitory Activity of the Inventive ASOs on Target Protein Levels in TGF-.beta.1 Treated Cells

[0623] To analyze inhibitory activity of antisense oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX.RTM.) under pathological conditions, cells were pre-treated with Transforming Growth Factor-.beta. 1 (TGF-.beta.1). From previous studies it is known that TGF-.beta.1 is found in high concentrations in Cerebrospinal Fluid (CSF) of all neural disorders e.g. ALS. Therefore, inhibitory efficacy of ASOs on TGF.beta.-signaling was examined after pre-treatment and in presence with TGF-.beta.1. A549 cells were used as reference cell line.

Description of Method:

[0624] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in a 6-well culture dish (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For investigation of gymnotic transfer effects (A549 and ReNcell CX), after pre-incubation with TGF-.beta.1 (Promocell #C-63499), medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-.beta.1 (10 ng/ml, 48 h) medium was changed, TGF-.beta.1 (10 ng/ml), Ref.1 (Scrambled control, 10 .mu.M), and inventive ASOs (10 .mu.M) was added, in combination and in single treatment, to the cells. A549 cells were incubated for further 72 h, whereas ReNcell CX.RTM. cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for protein isolation (6-well dishes) following Western Blot analysis or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Procedures for used techniques were performed as described before. Used antibodies and dilutions for respective methods are listed in Table 13 and 14.

Results after Gymnotic Transfer

[0625] Western Blot and immunocytochemical analysis for A549 cells showed that the ASOs having Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, Seq. ID No. 209y generate a potent target downregulation in presence of TGF-.beta.1 (Table 26). Staining of TGF-R.sub.II on fixed ReNcell CX.RTM. cells confirmed the results observed in A549 cells. Tested ASOs revealed a strong target downregulation after single treatment but also in presence with TGF-.beta.1.

TABLE-US-00078 TABLE 26 Densitometric analysis of TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after TGF-.beta.1 pre-incubation followed by gymnotic transfer with different ASOs in A549 was observed. Protein levels were determined relative to housekeeping gene GAPDH using Studio .TM. Lite Software and were then normalized to untreated control. Target Time point TGF-R.sub.II 48 h TGF-.beta.1 -> 72 h TGF-.beta.1 + ASOs/single treatment A549 Cell line n = 1 A 1.00 B 10 .mu.M 1.20 C 10 .mu.M 0.31 D 10 .mu.M 0.42 F 10 .mu.M 0.45 G 10 .mu.M 0.35 H 10 .mu.M 0.47 I 10 .mu.M 0.33 J 10 .mu.M 0.27 K 10 .mu.M 0.30 E 10 ng/ml 2.03 E 10 ng/ml + B 10 .mu.M 1.50 E 10 ng/ml + C 10 .mu.M 0.78 E 10 ng/ml + D 10 .mu.M 1.16 E 10 ng/ml + F 10 .mu.M 1.21 E 10 ng/ml + G 10 .mu.M 0.83 E 10 ng/ml + H 10 .mu.M 1.02 E 10 ng/ml + I 10 .mu.M 0.76 E 10 ng/ml + J 10 .mu.M 0.69 E 10 ng/ml + K 10 .mu.M 0.77 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, C = Seq. ID No. 218b, D = Seq. ID No. 218c, F = Seq. ID No. 210q, G = Seq. ID No. 213k, H = Seq. ID No. 143h, I = Seq. ID No. 152h, J = Seq. ID No. 209az, K = Seq. ID No. 209y, E = TGF-.beta.1.

Conclusion:

[0626] TGF-.beta.1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218b, Seq. ID No. 218c, Seq. ID No. 210q, Seq. ID No. 213k, Seq. ID No. 143h, Seq. ID No. 152h, Seq. ID No. 209az, and Seq. ID No. 209y resulted, in addition to target mRNA downregulation, in a reduction of protein level in A549 and ReNcell CX.RTM. cells.

Results after Gymnotic Transfer with Further ASOs:

[0627] Western Blot analysis showed a reduced amount of TGF-R.sub.II protein in A549 cells (Table 27) after gymnotic transfer for 72 h in comparison to untreated cells and cells treated with scrambled control. Pre-incubation of TGF-.beta.1 followed by gymnotic transfer of tested ASOs evoked a reduction in comparison to cells which were pre-treated with TGF-.beta.1 followed by gymnotic transfer with scrambled control. Immunocytochemical examination of A549 and ReNcell CX.RTM. after staining against TGF-R.sub.II showed that tested ASOs mediated a strong reduction of target protein after gymnotic transfer with or without pre-treatment of TGF-.beta.1.

TABLE-US-00079 TABLE 27 Densitometric analysis of TGF-R.sub.II Western Blot. Reduction of TGF-R.sub.II protein after TGF-.beta.1 pre-incubation followed by gymnotic transfer with further TGF-RII- specific antisense oligonucleotides (ASOs) in A549 could be detected. Protein levels were determined relative to housekeeping gene GAPDH using Studio .TM. Lite Software and were then normalized to untreated control. ASO No. in Test Seq ID No. Result 1 233d B 2 234d A 3 143j.sup. C 4 143p A 5 143q A 6 143r.sup. A 7 .sup. 143w A 8 143af B 9 143ag C 10 143ah C 11 235b B 12 235d A 13 141d A 14 141g A 15 141i.sup. B 16 237b A 17 237c A 18 237i.sup. C 19 237m A 20 238c A 21 238f.sup. A 22 239e B 23 240c B 24 241b C 25 242a C 26 246e C 27 247d A 28 248b A 29 248e B 30 248g A 31 152k B 32 152s B 33 152t.sup. B 34 152u B 35 152ab C 36 152ag B 37 152ah A 38 152ai A 39 249c A 40 249e A 41 250b A 42 250g B 43 251c A 44 251f.sup. A 45 252e B 46 253c A 47 254b C 48 255a C 49 259e C 50 260d B 51 261b A 52 261e B 53 261g A 54 262d B 55 262e A 56 209s A 57 209v B 58 .sup. 209w A 59 209x C 60 209ai B 61 209an C 62 209at B 63 209au B 64 209av B 65 263b B 66 263c A 67 263i.sup. B 68 263m A 69 264e A 70 264h A 71 265e B 72 266c A 73 267b B 74 268a B 75 272e B 76 273d B 77 274a A 78 274d B 79 274f.sup. A 80 275g A 81 275i.sup. B 82 210o A 83 210v B 84 .sup. 210w B 85 210x C 86 210ab B 87 210ac A 88 210ad B 89 210af A 90 210am B 91 276b B 92 276c A 93 276j.sup. B 94 276k B 95 277d A 96 277e A 97 278f.sup. B 98 279c B 99 280b C 100 281a C 101 220d C 102 221d B 103 222b A 104 222c A 105 222f.sup. B 106 223c B 107 223f.sup. A 108 218ad B 109 218n A 110 218t.sup. B 111 218u B 112 218v C 113 218ah C 114 218an A 115 218ao B 116 218ap B 117 224i.sup. B 118 224m B 119 225c A 120 225f.sup. A 121 226e B 122 227c B 123 228b C 124 229a C 125 285d C 126 286d A 127 287d B 128 287e A 129 287f.sup. A 130 288e A 131 288i.sup. A 132 289d B 134 289h A 135 289o B 136 289p A 137 289q B 138 213o B 139 213p B 140 213q B 141 213s B 142 213y B 143 213z B 144 213aa B 145 213af C 146 290c A 147 290f.sup. B 148 290i.sup. A 149 291c B 150 292c C 151 293b C 152 294a C 125 285d C Reduction of protein level for ASO 1-25 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 143h; B = more than 10% but less than 20% inferior to SEQ ID No. 143h; C = more than 20% but less than 30% inferior to SEQ ID No. 143h. Reduction of protein level for ASO 26-48 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 152h; B = more than 10% but less than 20% inferior to SEQ ID No. 152h; C = more than 20% but less than 30% inferior to SEQ ID No. 152h. Reduction of protein level for ASO 49-74 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 209az and Seq. ID No. 209y. Reduction of protein level for ASO 75-100 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 210q; B = more than 10% but less than 20% inferior to SEQ ID No. 210q; C = more than 20% but less than 30% inferior to SEQ ID No. 210q. Reduction of protein level for ASO 101-124 is indicated with the following key: A = less than 10% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; B = more than 10% but less than 20% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c; C = more than 20% but less than 30% inferior to the mean value derived from Seq. ID No. 218b and Seq. ID No. 218c. Reduction of protein level for ASO 125-152 is indicated with the following key: A = less than 10% inferior to SEQ ID No. 213k; B = more than 10 % but less than 20% inferior to SEQ ID No. 213k; C = more than 20% but less than 30% inferior to SEQ ID No. 213k.

Conclusion:

[0628] Even after TGF-.beta.1 pre-incubation, gymnotic transfer of inventive ASOs results in reduction of TGF-R.sub.II protein in A549 and ReNcell CX.RTM. cells.

Example 6: Analysis of the Effects of the Inventive ASOs to the Downstream Signaling Pathway of TGF-R.sub.II after TGF-.beta.1-Preincubation

[0629] Functional analyses were performed in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell MCC)). TGF-.beta.1 downstream signaling pathway was analyzed, following to an effective downregulation of TGF-R.sub.II mRNA and reduction of protein levels by gymnotic transfer of the inventive ASOs in presence of TGF-.beta.1. Therefore, mRNA and protein levels of Connective Tissue Growth Factor (CTGF), known as downstream-mediator of TGF-.beta., were evaluated. In addition, phosphorylation of Smad2 (mothers against decapentaphlegic homolog 2) was examined. The phosphorylation of Smad2 is a marker for an active TGF-.beta. pathway followed by the upregulation of the downstream target gene CTGF.

Description of Method:

[0630] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For investigation of gymnotic transfer effects (A549 and ReNcell CX.RTM. cells), after pre-incubation with TGF-.beta.1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-.beta.1 (10 ng/ml, 48 h) medium was changed, TGF-.beta.1 (10 ng/ml), Ref.1 (Scrambled control, 10 .mu.M), ASO with Seq. ID No. 218b (10 .mu.M), and ASO with Seq. ID No. 218c (10 .mu.M) was added in combination and in single treatment to cells. A549 cells were incubated for further 72 h, whereas ReNcell CX.RTM. cells were harvested after 96 h. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To check for CTGF and pSmad2 protein levels, Western Blot and immunocytochemistry were used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

6.1. Results for Seq. ID No. 218b

6.1.1 Effects on CTGF mRNA and Protein Levels

[0631] CTGF mRNA was downregulated after gymnotic transfer with ASO Seq. ID No. 218b in A549 (72 h, 0.52.+-.0.05) and ReNcell CX.RTM. (96 h, 0.70.+-.0.25) cells, whereas TGF-.beta.1 incubation for 5 days (A549: 48 h+72 h, 6.92.+-.2.32) or 6 days (ReNcell CX: 48 h+96 h, 1.60.+-.015) respectively, caused significant upregulation of CTGF mRNA. ASO Seq. ID No. 218b was potent enough to evoke a CTGF mRNA downregulation by blocking TGF-.beta.1 effects in presence of TGF-.beta.1 (Table 28, FIG. 11). According to observations for mRNA levels, immunochemical staining against CTGF also confirmed these observations for protein levels (FIG. 12).

TABLE-US-00080 TABLE 28 Downregulation of CTGF mRNA in presence of TGF-.beta.1 followed by gymnotic transfer with Seq. ID No. 218b in A549 and ReNcell CX .RTM. cells. MRNA expression levels were quantified relative to housekeeping GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Time point CTGF 48 h TGF-.beta.1 -> 72 h/96 h TGF-.beta.1 + ASOs/single treatment A549 ReNcell CX Cell line n = 5 n = 3 A 1.00 .+-. 0.22 1.00 .+-. 0.04 B 10 .mu.M 0.89 .+-. 0.19 0.85 .+-. 0.01 C 10 .mu.M 0.52 .+-. 0.05 0.70* .+-. 0.25 E 10 ng/ml 6.92* .+-. 2.32 1.60** .+-. 0.15 E 10 ng/ml + B 10 .mu.M 8.79** .+-. 2.72 1.71** .+-. 0.03 E 10 ng/ml + C 10 .mu.M 2.53.sup.++ .+-. 0.59.sup. .sup. 1.19.sup.++ .+-. 0.04 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1, .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

Conclusion:

[0632] In presence of TGF-.beta.1 and following treatment of ASO Seq. ID No. 218b resulted firstly in downregulation of TGF-R.sub.II mRNA and secondary in reduced CTGF mRNA and protein levels in A549 and ReNcell CX.RTM. cells. That indicates that ASO Seq. ID No. 218b is potent enough to be active under high TGF-.beta.1 pathological conditions and is able to rescue from TGF-.beta.1 mediated effects.

6.1.2 Effects on pSmad2 Protein Level

[0633] To verify if CTGF downregulation is a consequence of specific TGF-.beta. signaling inhibition, mediated by ASO Seq. ID No. 218b in presence of TGF-.beta.1, pSmad2 protein levels were analyzed.

[0634] Staining pSmad2 after TGF-.beta.1 pre-incubation followed by gymnotic transfer of ASO Seq. ID No. 218b with parallel TGF-.beta.1 exposition leads to an inhibition of Smad2 phosphorylation in both tested cell lines (FIG. 13). In addition, reduced pSmad2 protein levels were verified by Western Blot Analysis in A549 and ReNcell CX.RTM. cells (Table 29).

TABLE-US-00081 TABLE 29 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein after gymnotic transfer with ASO Seq. ID No. 218b was recognized. Also reversion of TGF-.beta.1 mediated effects by inventive ASOs was found, when combination treatments were compared. Protein levels were determined relative to housekeeping gene GAPDH using Studio .TM. Lite Software and were then normalized to untreated control. Target Time point pSmad2 48 h TGF-.beta.1 -> 72 h/96 h TGF-.beta.1 + ASOs/single treatment A549 ReNcell CX Cell line n = 2 n = 2 A 1.00 .+-. 0.00 1.00 .+-. 0.00 B 10 .mu.M 1.23 .+-. 0.47 0.89 .+-. 0.22 C 10 .mu.M 0.58 .+-. 0.08 0.66 .+-. 0.14 E 10 ng/ml 1.40 .+-. 0.31 1.19 .+-. 0.61 E 10 ng/ml + B 10 .mu.M 1.27 .+-. 0.46 2.19 .+-. 0.76 E 10 ng/ml + C 10 .mu.M 0.81 .+-. 0.31 1.55 .+-. 0.42 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0635] ASO Seq. ID No. 218b results in a functional inhibition of TGF-.beta. signaling in A549 and ReNcell CX.RTM. cells in presence of TGF-.beta.1, confirmed by reduced phosphorylation of Smad2.

6.2 Results for Seq. ID No. 218c

6.2.1 Effects on CTGF mRNA and Protein Level

[0636] Data show CTGF mRNA downregulation after combination treatment with ASO Seq. ID No. 218c and TGF-.beta.1 (A549: 0.86, ReNcell CX.RTM.: 0.23) compared to combination treatment with scrambled control and TGF-.beta.1 (A549: 5.89, ReNcell CX.RTM.: 1.25) (Table 30 and FIG. 14). In addition to these observations, immunochemical staining of CTGF confirmed prevention of TGF-.beta.1 mediated effects on protein level by ASO Seq. ID No. 218c (FIG. 15).

TABLE-US-00082 TABLE 30 CTGF mRNA levels after TGF-.beta.1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218c and parallel TGF- .beta.1 treatment in A549 and ReNcell CX .RTM. cells. Data confirmed effective prevention of TGF-.beta.1 effects on CTGF mRNA levels by ASO Seq. ID No. 218c. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated controls. Target Time point CTGF 48 h TGF-.beta.1 -> 72 h/96 h TGF-.beta.1 + ASOs/single treatment A549 ReNcell CX Cell line n = 3 n = 2 A 1.00 .+-. 0.05 1.00 .+-. 0.03 B 10 .mu.M 0.86 .+-. 0.11 0.85 .+-. 0.01 D 10 .mu.M 0.53 .+-. 0.10 0.17* .+-. 0.02 E 10 ng/ml 4.71 .+-. 1.76 1.39 .+-. 0.08 E 10 ng/ml + B 10 .mu.M 5.89* .+-. 2.16 1.25 .+-. 0.44 E 10 ng/ml + D 10 .mu.M 0.86.sup.++ .+-. 0.06.sup. 0.23*.sup.++ .+-. 0.02 .sup. A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-.beta.1, .+-. = SEM, **p < 0.01 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

Conclusion:

[0637] Data confirmed an effective prevention of TGF-.beta.1 induced effects on CTGF mRNA and protein levels by ASO Seq. ID No. 218c.

6.2.2 Effects on pSmad2 Protein Level

[0638] To verify if CTGF downregulation (6.2.1) is a consequence of TGF-.beta.1 signaling-inhibition mediated by ASO Seq. ID No. 218c, even in presence of TGF-.beta.1-preincubation, pSmad2 protein levels were analyzed.

[0639] Phosphorylation of Smad2 was induced by TGF-.beta.1 incubation (1.52.+-.0.19), whereas ASO gymnotic transfer mediated a reduction of pSmad2 in A549 cells (0.89.+-.0.05). TGF-.beta.1 pre-incubation with following combination treatment results in suppression of TGF-.beta.1 effects on phosphorylation of Smad2 (Western Blot Analysis, Table 31). Immunocytochemistry supported the data observed by Western Blot Analysis (FIG. 16).

TABLE-US-00083 TABLE 31 Densitometric analysis of pSmad2 Western Blot. Downregulation of pSmad2 protein after gymnotic transfer with ASO Seq. ID No. 218c was measured. Suppression of TGF-.beta.1 mediated effects by inventive ASOs was shown, when combination treatments were compared. Protein levels were determined relative to housekeeping gene GAPDH using Studio .TM. Lite Software and normalized to untreated controls. Target Time point pSmad2 48 h TGF-.beta.1 -> 72 h TGF-.beta.1 + ASOs/single treatment A549 Cell line n = 2 A 1.00 .+-. 0.00 B 10 .mu.M 1.23 .+-. 0.27 D 10 .mu.M 0.89 .+-. 0.05 E 10 ng/ml 1.52 .+-. 0.19 E 10 ng/ml + B 10 .mu.M 1.27 .+-. 0.29 E 10 ng/ml + D 10 .mu.M 0.93 .+-. 0.35 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-.beta.1. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion:

[0640] ASO Seq. ID No. 218c is efficiently inhibiting TGF-.beta. signaling after TGF-.beta.1 pre-incubation followed by ASO gymnotic transfer. This was shown by examination of downstream pSmad2 protein levels.

[0641] Taken together, inventive ASOs are extraordinary capable in mediating a functional inhibition of TGF-.beta. signaling in presence of pathological, high TGF-.beta.1 levels by efficiently downregulating TGF-R.sub.II mRNA. Thus, inventive ASOs will be beneficial in medical indications in which elevated TGF-.beta. levels are involved, e.g. neurological disorders, fibrosis, tumor progression and others.

Example 7: Determination of Prophylactic Activity of the Antisense-Oligonucleotides on mRNA Level (TGF-.beta.1 Post-Treatment)

[0642] To analyze prophylactic activity of antisense-oligonucleotides (ASOs) in human neuronal progenitor cells from cortical brain region (ReNcell CX.RTM.), ASOs were transferred to cells by gymnotic uptake following Transforming Growth Factor-.beta.1 (TGF-.beta.1) treatment.

Description of Method:

[0643] A549 and ReNcell CX.RTM. cells were cultured as described above. For prophylactic treatment studies, cells were seeded in a 24-well culture dish (Sarstedt #83.1836.300) (50,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. Afterwards, Ref. 1 (Scrambled control, 10 .mu.M) or ASO with Seq. ID No. 218b (10 .mu.M) were added to media for 72 h (A549) or 96 h (ReNcell CX.RTM.). Following incubation time after gymnotic transfer, TGF-.beta.1 (10 ng/ml, Promocell #C-63499) was added, without medium replacement, to the cells for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) following mRNA analysis by real-time RT-PCR. Ready-to-use and standardized primer pairs for real-time RT-PCR were used and mixed with the respective ready-to-use Mastermix solution (SsoAdvanced.TM. Universial SYBR.RTM. Green Supermix (BioRad #172-5271) according to manufacturer's instructions (BioRad Prime PCR Quick Guide). Methods were performed as described above.

7.1 Results for Seq. ID No. 218b

[0644] Efficacy in TGF-R.sub.II mRNA downregulation by ASO Seq. ID No. 218b was not influenced by TGF-.beta.1 post-incubation in A549 and ReNcell CX.RTM. cells (Table 32). Significant decrease of target mRNA in ReNcell CX.RTM. cells was shown after single treatment (0.33*.+-.0.11) with ASO Seq. ID No. 218b. ASO gymnotic transfer with post-treatment of TGF-131, strongly reduced the target TGF-R.sub.II mRNA. In A549 cells, Seq. ID No. 218b showed similar potency in inhibiting TGF-R.sub.II mRNA in single (0.25.+-.0.07) or combination treatment with post-incubation of TGF-.beta.1 (0.24.+-.0.06).

TABLE-US-00084 TABLE 32 Downregulation of TGF-R.sub.II mRNA after gymnotic transfer following TGF-.beta.1 treatment of inventive ASO in A549 and ReNcell CX .RTM. cells. mRNA expression levels were quantified relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Time point TGF-R.sub.II 72 h/96 h ASOs -> 48 h TGF-.beta.1 A549 ReNcell CX Cell line n = 3 n = 3 A 1.00 .+-. 0.44 1.00 .+-. 0.19 B 10 .mu.M 0.95 .+-. 0.22 1.42 .+-. 0.14 C 10 .mu.M 0.25 .+-. 0.07 0.33* .+-. 0.11 E 10 ng/ml 1.96 .+-. 0.16 1.42 .+-. 0.08 E 10 ng/ml + B 10 .mu.M 1.14 .+-. 0.39 1.25 .+-. 0.14 E 10 ng/ml + C 10 .mu.M 0.24.sup.++ .+-. 0.06.sup. 0.56.sup.++ .+-. 0.10.sup. A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1. .+-. = SEM, *p < 0.05 in reference to A, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

Conclusion:

[0645] Gymnotic uptake of ASO Seq. ID No. 218b followed by TGF-.beta.1 post-incubation was effective in target TGF-R.sub.II mRNA downregulation, indicating that ASO Seq. ID No. 218b is feasible for prophylactic treatment in medical indications.

Example 8: Determination of Inhibitory Activity of the Inventive ASOs on Protein Level Following TGF-.beta.1 Treatment

[0646] To analyze prophylactic activity of inventive ASOs in human neuronal progenitor cells from cortical brain region (ReNcellCX.RTM.), ASOs were transferred to cells by gymnotic uptake following TGF-.beta.1 treatment.

Description of Method:

[0647] Cells were cultured as described before in standard protocol. For treatment cells were seeded in 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. Afterwards, Ref.1 (Scrambled control, 10 .mu.M) or ASO sequence identification number 218b (Seq. ID No. 218b, 10 .mu.M) were added to media for 72 h (A549) or 96 h (ReNcell CX.RTM.). Following gymnotic transfer TGF-.beta.1 (10 ng/ml, Promocell #C-63499) was added, without medium replacement, to the cells for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for immunocytochemical analysis. Procedure was performed as described before. Used antibodies and dilutions for respective methods are listed in Table 13 and 14.

8.1 Results of TGF-R.sub.II Protein Reduction after Gymnotic Transfer with Seq. ID No. 218b Following TGF-.beta.1 Treatment

[0648] Immunocytochemical analysis against TGF-R.sub.II for A549 and ReNcell CX.RTM. cells showed that ASO Seq. ID No. 218b generates potent TGF-R.sub.II mRNA target downregulation after following TGF-.beta.1 treatment (FIG. 17).

Conclusion:

[0649] Gymnotic transfer of ASO Seq. ID No. 218b following TGF-.beta.1 treatment resulted in target mRNA downregulation, as well as a strong reduction of TGF-R.sub.II protein level in A549 and ReNcell CX.RTM. cells.

[0650] Taken together, efficacy of downregulating TGF-R.sub.II protein mediated by ASO Seq. ID No. 218b in combination with post-treatment of TGF-.beta.1 was still given, concluding that the inventive ASOs are effective for prophylactic applications.

Example 9: ASO Treatment Effects on Downstream Signaling Pathway of TGF-R.sub.II Following TGF-.beta.1 Treatment

[0651] Efficacy of inventive ASOs in mediating an inhibition of TGF-.beta. signaling was evaluated for TGF-.beta.1 treatment followed gymnotic transfer in human lung cancer cells (A549) and human neuronal precursor cells (ReNcell CX.RTM.). Therefore, downstream molecules of TGF-.beta. signaling, Smad3 (mothers against decapentaphlegic homolog 3) and Connective Tissue Growth factor (CTGF), were analyzed.

Description of Method:

[0652] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. Afterwards, Ref.1 (Scrambled control, 10 .mu.M) or ASO Seq. ID No. 218b (10 .mu.M) were added to media for 72 h (A549) or 96 h (ReNcell CX.RTM.). Following gymnotic transfer, TGF-.beta.1 (10 ng/ml, Promocell #C-63499) was added without medium replacement for further 48 h. For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). To evaluate effects on CTGF mRNA level, real-time RT-PCR was performed as described before. The primer pair for analysis of CTGF was ready-to-use and standardized. To determine pSmad3 protein levels, immunocytochemistry was used as described before. Type and used dilutions of antibodies for respective method are listed in Table 13 and 14.

9.1. Results for Seq. ID No. 218b 9.1.1 Effects on CTGF mRNA and pSmad3 Protein Level

[0653] CTGF mRNA was reduced after gymnotic transfer with ASO Seq. ID No. 218b in A549 (5 days: 0.67.+-.0.02) and ReNcell CX.RTM. (6 days: 0.70.+-.0.02) cells. Adding TGF-.beta.1 after 72 h or 96 h respectively, cells react with an increase of CTGF mRNA, but in comparison to gymnotic transfer of scrambled control following TGF-.beta.1 treatment, induction of CTGF mRNA was strongly reduced (Table 33). To verify if CTGF mRNA downregulation was a consequence of TGF-.beta. signaling inhibition, mediated by ASO Seq. ID No. 218b, also after followed TGF-.beta.1 treatment, pSmad3 protein levels were examined. FIG. 18 demonstrates that TGF-.beta. signaling was in fact blocked by gymnotic transfer of ASO Seq. ID No. 218b in A549 (FIG. 18 A) and ReNcell CX.RTM. cells (FIG. 18 B). This effect was also present after gymnotic transfer of tested ASO following TGF-.beta.1 treatment.

TABLE-US-00085 TABLE 33 Downregulation of CTGF mRNA after gymnotic transfer of ASO Seq. ID No. 218b followed by TGF-.beta.1 treatment in A549 and ReNcell CX .RTM. cells. Quantification of mRNA expression levels were performed relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point CTGF 72 h/96 h ASOs -> +/- 48 h TGF-.beta.1 A549 ReNcell CX Cell line n = 3 n = 3 A 1.00 .+-. 0.13 1.00 .+-. 0.09 B 10 .mu.M 0.80 .+-. 0.03 1.07 .+-. 0.07 C 10 .mu.M 0.67 .+-. 0.02 0.70 .+-. 0.02 E 10 ng/ml 4.54** .+-. 0.68 1.56* .+-. 0.08 E 10 ng/ml + B 10 .mu.M 4.07** .+-. 0.38 1.62* .+-. 0.09 E 10 ng/ml + C 10 .mu.M 1.90.sup.+ .+-. 0.03 0.97.sup.++ .+-. 0.10.sup. A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1. .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A, .sup.+p < 0.05, .sup.++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

Conclusion:

[0654] Gymnotic transfer of ASO Seq. ID No. 218b resulted in downregulation of TGF-R.sub.II mRNA and protein, as well as in reduced CTGF mRNA and pSmad3 protein levels in A549 and ReNcell CX.RTM. cells, independently of TGF-.beta.1 treatment.

[0655] That indicates that ASO Seq. ID No. 218b is potent enough to be also active under prophylactic conditions to resume or reduce ongoing TGF-.beta.1 mediated effects.

Example 10: Analysis of Potential Proinflammatory and Toxicological Effects of Antisense-Oligonucleotides

10.1 Peripheral Blood Mononuclear Cell (PBMC) Assay

[0656] To analyze antisense-oligonucleotide (ASO) for immunostimulatory properties, peripheral blood mononuclear cells (PBMCs) were incubated with control ASOs and test compounds followed by ELISAs for IFN.alpha. and TGF.alpha..

Description of Method:

[0657] PBMCs were isolated from buffy coats corresponding to 500 ml full blood transfusion units. Each unit was obtained from healthy volunteers and glucose-citrate was used as an anti-agglutinant. The buffy coat was prepared and delivered by the Blood Bank Suhl on the Institute for Transfusion Medicine, Germany. Each blood donation was monitored for HIV antibody, HCV antibody, HBs antigen, TPHA, HIV RNA, and SPGT (ALAT). Only blood samples tested negative for infectious agents and with a normal SPGT value were used for leukocyte and erythrocyte separation by low-speed centrifugation. The isolation of PBMCs was performed about 40 h following blood donation by gradient centrifugation using Ficoll-Histopague.RTM. 1077 (Heraeus.TM. Multifuge.TM. 3 SR). For IFN.alpha. assay, PBMCs were seeded at 100,000 cells/96-well in 100 .mu.l complete medium plus additives (RPMI1640, +L-Glu, +10% FCS, +PHA-P (5 .mu.g/ml), +IL-3 (10 .mu.g/ml)) and test compounds (5 .mu.l) were added for direct incubation (24 h, 37.degree. C., 5% CO.sub.2). For TNF.alpha. assay, PBMCs were seeded at 100,000 cells/96-well in 100 .mu.l complete medium w/o additives (RPMI1640, +L-Glu, +10% FCS) and test compounds (5 .mu.l) were added for direct incubation (24 h, 37.degree. C., 5% CO.sub.2). ELISA (duplicate measurement out of pooled supernatants, 20 .mu.l) for hulFN.alpha. (eBioscience, #BMS216INSTCE) was performed according to the manufacturer's protocol. ELISA (duplicate measurement out of pooled supernatants, 20 .mu.l) for huTNF.alpha. (eBioscience, #BMS223INSTCE) was performed according to the manufacturer's protocol.

Results:

[0658] There was no immunostimulatory effect of ASO treatment on PBMCs indicated by no detectable IFN.alpha. (Table 34) and TNF.alpha. (Table 35) secretion upon ASO incubation. Assay functionality is proven by the immunostimulatory effect of immunostimulatory, cholesterol-conjugated siRNA (XD-01024; IFN.alpha.) and polyinosinic:polycytidylic acid (poly I:C; TNF.alpha.; InvivoGen #tlrl-pic) which is a synthetic analog of double-stranded RNA, binds to TLR3 and stimulates the immune system.

TABLE-US-00086 TABLE 34 IFN.alpha. response to inventive ASO exposure: shows the IFN.alpha. response of PBMCs upon ASO incubation. Quantification of expression levels were determined to positive controls (ODN2216 [class A CpG oligonucleotide; recognized by TLR9 and leading to strong immunostimulatory effects; InvivoGen tlrl-2216], poly I:C, XD-01024) using ELISA assay. Mean of duplicates [pg/ml] Test candidate Donor 1 Donor 2 mock -0.084 0.720 Seq. ID No. 209y -0.061 -0.039 Seq. ID No. 209t -0.308 -0.520 Seq. ID No. 209v -0.191 -1.252 Seq. ID No. 218b -0.001 -0.093 Seq. ID No. 218m -0.140 -0.163 Seq. ID No. 218q -0.755 0.005 Seq. ID No. 218c -0.852 -0.805 Seq. ID No. 218t -0.469 0.450 ODN2216 0.300 1.311 poly I:C -1.378 2.053 XD-01024 13.961 26.821 All values except positive control (XD-01024) below limit of quantification

TABLE-US-00087 TABLE 35 TNF.alpha. response to inventive ASO exposure: Quantification of expression levels were determined to control candidates (ODN2216, poly I:C, XD-01024) using ELISA assay. Mean of duplicates [pg/ml] Test candidate Donor 1 Donor 2 mock 0.647 -0.137 Seq. ID No. 209y 2.397 -0.117 Seq. ID No. 209t 0.734 0.193 Seq. ID No. 209v 0.360 0.063 Seq. ID No. 218b 0.670 0.183 Seq. ID No. 218m 0.594 0.519 Seq. ID No. 218q 0.049 0.194 Seq. ID No. 218c -0.212 0.029 Seq. ID No. 218t 0.593 0.758 ODN2216 0.085 0.894 poly I:C 115.026 102.042 XD-01024 1.188 1.418 All values except positive control (poly I:C) below limit of quantification

10. 2 In Vivo Toxicology of Inventive Antisense-Oligonucleotides

[0659] To analyze antisense-oligonucleotides (ASOs) for toxicological properties, C57/Bl6N mice received three intravenous ASO injections, and following sacrification, transaminase levels within serum, liver and kidney were examined.

Description of Method:

[0660] Female C57/Bl6N mice at the age of 6 weeks were treated with test compounds (Seq. ID No. 218b, Seq. ID No. 218c) for seven days. ASOs (200 .mu.l, 15 mg/kg/BW) were injected intravenously on day one, two, and three of the treatment period. Body weight development (Seq. ID No. 218c) was monitored on every consecutive day and on day four serum was collected from the vena fascicularis. On day eight the animals were sacrificed (CO.sub.2) and serum from the vena cava, the liver (pieces of .apprxeq.50 mg), the kidneys, and the lung were collected for mRNA and transaminase quantification. TGF-R.sub.II mRNA levels were determined in liver, kidney, and lung lysate by bDNA assay (QuantiGene.RTM. kit, Panomics/Affimetrix). Aspartate transaminase (ASP) and alanine transaminase (ALT) were measured on Cobas Integra.RTM. 400 from 1:10 diluted serum.

TABLE-US-00088 TABLE 36 Serum expression levels of alanine transaminase and aspartate transaminase of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. Serum transaminases [U/L] 3 days post injection 7 days post injection Test compound ALT AST ALT AST Seq. ID No. 209ax 13.87 .+-. 1.44 47.33 .+-. 15.88 64.91 .+-. 21.01 108.99 .+-. 13.56 Seq. ID No. 143h 13.68 .+-. 3.33 53.50 .+-. 6.99 12.47 .+-. 1.64 33.35 .+-. 8.17 Seq. ID No. 152h 16.66 .+-. 6.29 67.23 .+-. 29.91 17.49 .+-. 2.81 45.75 .+-. 17.14 Seq. ID No. 209ay 18.29 .+-. 6.37 69.96 .+-. 35.44 287.29 .+-. 65.39 273.45 .+-. 101.33 Seq. ID No. 210q 11.70 .+-. 3.80 36.44 .+-. 5.36 11.11 .+-. 6.31 40.81 .+-. 13.32 Seq. ID No. 218b 19.60 .+-. 8.62 67.61 .+-. 42.75 18.38 .+-. 4.60 48.91 .+-. 17.86 Seq. ID No. 213k 13.59 .+-. 3.28 54.47 .+-. 36.15 96.00 .+-. 46.74 89.12 .+-. 21.82 Saline 9.52 .+-. 9.21 67.18 .+-. 28.60 9.99 .+-. 2.29 28.29 .+-. 2.23 .+-. = SEM.

TABLE-US-00089 TABLE 37 Expression levels of TGF-R.sub.II within liver, kidney, and lung tissue of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. TGF-RII mRNA/GAPDH mRNA expression Test compound Liver Kidney Lung Seq. ID No. 209ax 0.64 .+-. 0.03 1.31 .+-. 0.11 13.25 .+-. 0.67 Seq. ID No. 143h 0.26 .+-. 0.02 0.65 .+-. 0.22 11.10 .+-. 0.11 Seq. ID No. 152h 0.58 .+-. 0.10 0.87 .+-. 0.17 13.42 .+-. 0.69 Seq. ID No. 209ay 0.62 .+-. 0.06 1.30 .+-. 0.10 13.93 .+-. 0.57 Seq. ID No. 210q 0.39 .+-. 0.06 0.83 .+-. 0.15 13.53 .+-. 1.23 Seq. ID No. 218b 0.72 .+-. 0.08 0.97 .+-. 0.06 15.63 .+-. 1.45 Seq. ID No. 213k 0.42 .+-. 0.01 1.20 .+-. 0.04 14.44 .+-. 1.03 Saline 0.66 .+-. 0.04 1.10 .+-. 0.08 15.14 .+-. 0.65 .+-. = SEM.

TABLE-US-00090 TABLE 38 Serum expression levels of alanine transaminase and aspartate transaminase of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. Serum transaminases [U/L] Test 3 days post injection 7 days post injection compound ALT AST ALT AST Seq. ID No. 24.63 .+-. 2.10 51.87 .+-. 5.99 18.10 .+-. 4.01 39.99 .+-. 2.09 218c Saline 28.68 .+-. 3.23 79.95 .+-. 30.24 14.52 .+-. 4.89 36.08 .+-. 3.32 .+-. = SEM.

TABLE-US-00091 TABLE 39 Expression levels of TGF-R.sub.II within liver and kidney tissue of C57/BI6N mice following repeated ASO iv injection. Quantification of expression levels was achieved by comparing to the expression levels of saline-treated animals. TGF-RII mRNA/GAPDH mRNA expression Test compound Liver Kidney Seq. ID No. 218c 0.21 .+-. 0.03 0.16 .+-. 0.02 Saline 0.35 .+-. 0.05 0.24 .+-. 0.03 .+-. = SEM.

TABLE-US-00092 TABLE 40 Body weight development during the 7-day ASO treatment paradigm. Body weight gain was quantified compared to body weight on day 0, which was set to 100%. Body weight development [%] Test compound Day 0 Day 1 Day 2 Day 3 Day 4 Day 7 Seq. ID 100% 99% 99% 99% 102% 104% No. 218c Saline 100% 99% 100% 100% 101% 103%

Conclusion:

[0661] There were no proinflammatory or toxic effects of relevant inventive ASOs on PBMCs or C57/Bl6N mice. Therefore, ASO treatment targeting TGF-R.sub.II reflects a safe method to treat a variety of TGF-.beta. associated disorders.

Example 11: Determination of Intracerebroventricular Infusion of Inventive ASOs on TGF-.beta. Induced Neural Stem Inhibition and Neural Progenitor Cell Proliferation In Vivo

[0662] The goal of the present study was to evaluate the potential of inventive ASOs against TGF-R.sub.II i) to prevent and ii) to treat the TGF-.beta.1 induced effects on neural stem and progenitor cell proliferation in vivo.

Description of Method:

11.1 Prevention of TGF-.beta.1 Associated Downregulation of Neurogenesis

[0663] Two-month-old female Fischer-344 rats (n=32) received intracerebroventricular infusions via osmotic minipumps (Model 2002, Alzet) connected to stainless steel cannulas. The surgical implantation of the minipumps was performed under deep anesthesia using intramuscular injections. Animals were infused with inventive ASOs according to the invention (1.64 mM concentration present in the pump), scrambled ASO (1.64 mM concentration present in the pump) or aCSF (artificial cerebrospinal fluid) for 7 days. At day 8, pumps were changed and the animals were infused with either i) aCSF, ii) TGF-.beta.1 (500 ng/ml present in the pump), iii) TGF-.beta.1 (500 ng/ml present in the pump) plus scrambled ASO (1.64 mM concentration present in the pump), or iv) TGF-.beta.1 (500 ng/ml present in the pump) plus inventive ASO (1.64 mM concentration present in the pump) for 14 days. At the end of the infusion-period all animals were transcardially perfused with 4% paraformaldehyde. The brains were analyzed for cannula tract localization and animals with incorrect cannula placement were excluded from the analysis. During the last 24 hours of the pump period, the animals received an intraperitoneal injection of 200 mg/kg bromo-deoxyuridine (BrdU).

[0664] The tissue was processed for chromogenic immunodetection of BrdU-positive cells in 40 .mu.m sagital sections. BrdU positive cells were counted within three 50 .mu.m.times.50 .mu.m counting frames per section located at the lowest, middle and upper part of the subventricular zone. Positive profiles that intersected the uppermost focal plane (exclusion plane) or the lateral exclusion boundaries of the counting frame were not counted. For hippocampal analysis, the volume of the hippocampus was determined and all positive cells within and adjacent to the boundaries were counted. The total counts of positive profiles were multiplied by the ratio of reference volume to sampling volume in order to obtain the estimated number of BrdU-positive cells for each structure. All extrapolations were calculated for one cerebral hemisphere and should be doubled to represent the total brain values. Data are presented as mean values.+-.standard deviations (SD). Statistical analysis was performed using the unpaired, two-sided t-test comparison Student's t-test between the TGF-.beta.1 treated and control groups (Graph Pad Prism 4 software, USA). The significance level was assumed at p<0.05.

11.2 Treatment of TGF-.beta.1 Associated Down-Regulation of Neurogenesis

[0665] Animals received either aCSF or recombinant human TGF- 1 (500 ng/ml present in pump) at a flow rate of 0.5 .mu.l per hour for 14 days. After 14 days, pumps were changed and the animals were infused with either i) aCSF, ii) recombinant human TGF- 1 (500 ng/ml present in pump) or co-infused with iii) inventive ASO (1.64 mM concentration present in the pump) plus recombinant human TGF- 1 (500 ng/ml present in pump) or iv) scrambled ASO (1.64 mM concentration present in the pump) plus recombinant human TGF- 1 (500 ng/ml present in pump). At the end of the infusion-period all animals were transcardially perfused with 4% paraformaldehyde. The brains were analyzed for cannula tract localization and animals with incorrect cannula placement were excluded from the analysis. During the last 24 hours of the pump period, the animals received an intraperitoneal injection of 200 mg/kg bromo-deoxyuridine (BrdU). Histological analysis was done as described above (11.1).

Results:

[0666] The treatment with ASO of Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q specifically and partially reduced the effect of TGF-.beta.1 on cell proliferation in the hippocampus and in the ventricle wall. Treatment with an inventive ASO specifically and partially rescues from the inhibitory effect of TGF-.beta.1 on neurogenesis.

Conclusion:

[0667] The ASOs of the present invention demonstrating cross-reactivity with rodents induce neurogenesis in this in vivo experiment. The ASOs of the present invention demonstrating no cross-reactivity, exert mostly even more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF- 1 induced inhibition of neural stem and progenitor proliferation.

Example 12: Analysis of the Effect of the Inventive Antisense-Oligonucleotides on Proliferation and Specific Markers of Human Neural Progenitor Cells

[0668] Amyotrophic lateral sclerosis (ALS) is a neurodegenerative lethal disorder with no effective treatment so far. The current molecular genetic campaign is increasingly elucidating the molecular pathogenesis of this fatal disease, from previous studies it is known that TGF-.beta. is found in high concentrations in Cerebrospinal Fluid (CSF) of ALS patients. These high levels of circulating TGF-.beta. are known to promote stem cell quiescence and therefore cause inhibition of adult neurogenesis within the subventricular zone (SVZ) of the brain. Thus, regeneration of degenerating neurons seems to be prevented by an enhanced TGF-.beta. signaling.

[0669] To figure out if selective inhibition of TGF-.beta. signaling mediated by the inventive antisense-oligonucleotides might allow reactivation of adult neurogenesis, evidence of TGF-.beta. mediated cell cycle arrest has to be proofed.

Description of Methods:

Cell Cycle Arrest Studies:

[0670] Cells were cultured as described before in standard protocol. For experiments, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For determination of TGF-.beta.1 mediated effects on cell cycle under proliferative (+EGF/FGF) (Millipore: EGF #GF144, bFGF #GF003) or differentiating (-EGF/FGF) conditions, cells were treated for 4 d with TGF-.beta.1 (PromoCell #C-63499, 10 or 50 ng/ml) after removing and replacement of respective medium. At day 4 medium was refreshed and TGF-.beta.1 treatment was repeated until day 7. On day 7, cells were harvested by washing twice with PBS and subsequently used for RNA (24-well dishes) isolation as described above. For evaluating TGF-.beta.1-mediated effects on cell cycle by real-time RT-PCR, mRNA of proliferation marker Ki67, tumor suppressor gene p53, cyclin-dependent kinase inhibitor 1 (p21) and of neurogenesis marker Doublecortin (DCX) were analyzed. Respective primer pairs are listed in Table 11.

mRNA Analysis for Effects of ASO Seq. ID No. 218b on Human Neural Progenitor Cells:

[0671] Cells were cultured as described before in standard protocol. For experiments, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For present experiments, cell medium was changed and Ref.1 (Scrambled control, 2.5 and 10 .mu.M), ASO with Seq. ID No. 218b (2.5 and 10 .mu.M) or TGF-.beta.1 (10 ng/ml, Promocell #C-63499) were added to cells for 96 h. After incubation time, medium was changed once more and further treatment was performed for further 96 h. After 8 days of treatment cells were harvested. Cells were washed twice with PBS and subsequently used for RNA (24-well dishes) isolation. To evaluate effects on progenitor cells, Nestin (early neuronal marker), Sox2 (early neuronal marker), DCX (indicator of neurogenesis) and Ki67 (proliferation marker) mRNA levels were determined by real-time RT-PCR as described before. Respective primer pairs are listed in Table 11.

Proliferative and Differentiating Effects of TGFR.sub.II Specific ASOs by Gymnotic Transfer on ReNcell CX.RTM. Cells:

[0672] The next goal was to investigate, whether TGF-R.sub.II specific ASO influence the proliferation of ReNcell CX.RTM. cells. Therefore, cells were cultured as described before and seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) or 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. For obtaining a proliferation curve, cells were treated after medium change for 72 h with Ref.1 (Scrambled control, 2.5 and 10 .mu.M) and with ASO Seq. ID No. 218b (2.5 and 10 .mu.M). After incubation time, medium change and treatment was repeated two times. After collecting supernatant, remaining cells were harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2.times.), treated with accutase (500 .mu.l/well) and incubated for 5 min at 37.degree. C. Afterwards 500 .mu.l medium were added and cell number was determined using Luna FL.TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 .mu.l of the cell suspension were added to 2 .mu.l of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 .mu.l were added onto Cell Counting Slide (Biozym #872011), cells were counted and calculated in total cells/ml and percentage of alive cells compared to dead cells. After gymnotic transfer of Ref.1 (10 .mu.M), Seq. ID No. 218b (10 .mu.M) and corresponding treatment of TGF-.beta.1 (10 ng/ml) for 8 days, cells of 8-well cell culture slide dishes were fixed and stained with an antibody against Ki67. For investigating differentiation ability of ReNcell CX.RTM. cells after gymnotic transfer, other 8-well cell culture slide dishes were treated with Ref.1 (10 .mu.M), Seq. ID No. 218b (10 .mu.M) and corresponding treatment of TGF-.beta.1 (10 ng/ml) for 96 h under proliferative conditions (+EGF/FGF). Afterwards, one part of the cells was treated for further 96 h under proliferative conditions whereas the other part of cells was treated and hold under differentiating conditions (-EGF/FGF). Following staining of cells, Neurofilament N (NeuN) and .beta.III-Tubulin expression levels were determined by fluorescence microscopy. Protocol for harvesting, fixing and staining cells was described above and respective antibody dilutions are listed in Table 14.

mRNA Analysis of Markers for Proliferation and Neurogenesis after Gymnotic Transfer Following TGF-.beta.1 Pre-Incubation:

[0673] Cells were cultured as described before in standard protocol. For experiments cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) and incubated overnight at 37.degree. C. and 5% CO.sub.2. For inducing cell cycle arrest, ReNcell CX.RTM. cells were treated with TGF-.beta.1 for 4 days. Afterwards medium was changed and TGF-.beta.1 (10 ng/ml) was added freshly. One day 8 medium was changed on more time, and gymnotic transfer was performed for 96 h by adding Ref.1 (10 .mu.M), Seq. ID No. 218b (10 .mu.M) in combination with TGF-.beta.1 (10 ng/ml). Cells were harvested after incubation by washing twice with PBS. Following RNA isolation and mRNA analysis by real-time RT-PCR were performed as described.

12.1.1 Mediation of Cell Cycle Arrest by TGF-.beta.1 in Human Neural Progenitor Cells

[0674] Detection of stem cell quiescence markers showed that TGF-.beta.1 mediates cell cycle arrest 7 days after exposure of cells. Proliferation marker Ki67 mRNA expression was dose-dependently reduced. Also mRNA expression of tumor suppressor gene p53 was downregulated correlating to TGF-.beta.1 concentration. In contrast, cyclin-dependent kinase inhibitor 1 (p21) was significantly upregulated by TGF-.beta.1. In summary these results indicate stem cell quiescence induced by TGF-.beta.1. Interestingly, DCX, a marker for neurogenesis, was strongly reduced by TGF-.beta.1 (Table 41).

TABLE-US-00093 TABLE 41 mRNA expression of Ki67, p27, p21, and DCX 7 days after TGF-.beta.1 treatment in ReNcell CX .RTM. cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 7 days after TGF-.beta.1 exposure Ki67 p53 p21 DCX Target n = 3 n = 3 n = 3 n = 3 A + EGF/ 1.00 .+-. 0.38 1.00 .+-. 0.38 1.00 .+-. 0.25 1.00 .+-. 0.49 FGF E 10 ng/ml + 0.67 .+-. 0.20 0.66 .+-. 0.18 1.90* .+-. 0.22 0.37 .+-. 0.06 EGF/FGF E 50 ng/ml + 0.43 .+-. 0.09 0.42 .+-. 0.06 1.45 .+-. 0.16 0.16 .+-. 0.01 EGF/FGF A - EGF/ 1.00 .+-. 0.15 1.00 .+-. 0.13 1.00 .+-. 0.14 1.00 .+-. 0.31 FGF E 10 ng/ml - 0.87 .+-. 0.08 0.97 .+-. 0.10 1.00 .+-. 0.04 0.72 .+-. 0.14 EGF/FGF E 50 ng/ml - 0.93 .+-. 0.11 0.93 .+-. 0.09 0.90 .+-. 0.09 0.71 .+-. 0.24 EGF/FGF A = untreated control, E = TGF-.beta.1. .+-. = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparison.

Conclusion

[0675] Proliferation of ReNcell CX.RTM. cells was blocked by TGF-.beta.1.

12.1.2 Results of Antisense-Oligonucleotide Effects on Markers of Human Neuronal Stem Cells

[0676] To figure out the effect of ASO Seq. ID No. 218b on stem cell markers, 8 days after repeated gymnotic transfer (2.times.96 h) in ReNcell CX.RTM. cells, different markers of early neural progenitor cells were tested (Table 42). Gene expression levels of Nestin and Sox2 were not influenced by ASO Seq. ID No. 218b. GFAP mRNA was slightly upregulated after gymnotic transfer with 10 .mu.M ASO Seq. ID No. 218b and in contrast, DCX was clearly induced after gymnotic uptake of ASO Seq. ID No. 218b. Expression of all tested markers was strongly reduced after TGF-.beta.1 treatment (8 d) (Table 42, FIG. 19).

TABLE-US-00094 TABLE 42 mRNA expression of Nestin, Sox2, GFAP and DCX 8 days after gymnotic transfer of Seq. ID No. 218b in ReNcell CX .RTM. cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 8 days after gymnotic transfer or TGF-.beta.1 exposure Nestin Sox2 GFAP DCX Target n = 4 n = 4 n = 4 n = 4 A 1.00 .+-. 0.18 1.00 .+-. 0.25 1.00 .+-. 0.22 1.00 .+-. 0.32 B 2.5 0.97 .+-. 0.32 0.88 .+-. 0.33 0.78 .+-. 0.13 1.31 .+-. 0.42 .mu.M B 10 0.89 .+-. 0.16 0.79 .+-. 0.13 1.02 .+-. 0.20 1.44 .+-. 0.48 .mu.M C 2.5 1.09 .+-. 0.21 0.93 .+-. 0.09 0.99 .+-. 0.14 1.67 .+-. 0.46 .mu.M C 10 0.90 .+-. 0.09 0.89 .+-. 0.11 1.21 .+-. 0.11 1.95 .+-. 0.37 .mu.M E 10 0.48 .+-. 0.12 0.32 .+-. 0.06 0.41# .+-. 0.13 0.05+# .+-. 0.01 .sup. ng/ml A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1, .+-. = SEM, +p < 0.05 in reference to C 2.5 .mu.M, #p < 0.05 in reference to C 10 .mu.M. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparison.

Conclusion:

[0677] Results for mRNA analysis indicate that ASO Seq. ID No. 218b guides ReNcell CX.RTM. cells into the direction of an even more stem cell like state (GFAP upregulation). In addition, induction of DCX indicates an elevated neurogenesis. TGF-.beta.1 treatment results in an opposite direction.

12.1.3 Results of Antisense-Oligonucleotide Effects on Proliferation of Human Neuronal Stem Cells

[0678] Further analysis was performed to investigate whether gymnotic transfer of ASO Seq. ID No. 218b has really effects on proliferation rate by counting cells 9 days after repeated gymnotic transfer (3.times.72 h) and determination of Ki67 protein levels 8 days after gymnotic uptake (2.times.96 h).

Results

[0679] Cell number was increased after gymnotic uptake of ASO Seq. ID No. 218b in accordance to an increased protein expression of proliferation marker Ki67 observed in immunochemical staining of cells (Table 43, FIG. 20). Fluorescence analysis of immunocytochemical staining also revealed a proliferation stop mediated by TGF-.beta.1.

TABLE-US-00095 TABLE 43 Increased cell number 9 days after repeated gymnotic transfer (3 .times. 72 h) of ReNcell CX .RTM. cells. Cell number was determined using Luna FL .TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Cell line ReNcell CX Cell number alive cells .times. 10.sup.5, n = 2 dead cells .times. 10.sup.5, n = 2 A 3.34 .+-. 0.09 0.51 .+-. 0.05 B 2.5 .mu.M 4.34 .+-. 0.56 0.60 .+-. 0.09 B 10 .mu.M 4.36 .+-. 0.96 0.58 .+-. 0.09 C 2.5 .mu.M 4.63 .+-. 1.28 0.47 .+-. 0.02 C 10 .mu.M 5.24 .+-. 0.42 0.37 .+-. 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM.

Conclusion

[0680] Gymnotic transfer of ASO Seq. ID No. 218b in ReNcell CX.RTM. cells results in an increased cell number, paralleled by an enhanced Ki67 protein expression, altogether indicating increased neuronal precursor proliferation.

12.1.3 Results of Antisense-Oligonucleotide Effects on Differentiation Ability of Human Neuronal Stem Cells

[0681] To exclude an influence of ASO Seq. ID No. 218b on cell ability to differentiate, ASO Seq. ID No. 218b was transferred to cells by gymnotic uptake for 96 h under proliferative conditions (+EGF/FGF). After incubation time, medium was changed and to one part of cells proliferative medium was added whereas to the other part of cells differentiating medium (-EGF/FGF) was added. Afterwards, another gymnotic transfer for 96 h was performed. Cells were analyzed by expression levels of neuronal markers Neurofilament N (NeuN) and .beta.III-Tubulin.

Results

[0682] Immunochemical staining against NeuN (FIG. 23A) and .beta.III-Tubulin (FIG. 23B) demonstrates no effects on the ability to differentiate after gymnotic ASO transfer under proliferative conditions followed by gymnotic transfer under differentiating conditions. Signal for .beta.III-Tubulin, a human neuron specific protein, was not influenced by ASO Seq. ID No. 218b under differentiating conditions and was comparable to untreated control. Also NeuN expression was not influenced after gymnotic transfer under differentiating conditions. Thus, cells are still capable to differentiate into neural cells. Strikingly, ReNcell CX.RTM. cells expressed neuronal marker NeuN and .beta.III-Tubulin after gymnotic transfer of ASO under proliferative conditions (2.times.96 h) for both periods, indicating that gymnotic transfer of ASO could promote a specific shift into differentiation of neurons even under proliferative conditions. In addition, elevated proliferation rates of neural precursor cells were observed (Table 43, FIG. 20). Further, staining against NeuN revealed that cells treated with ASO Seq. ID 218b look more viable compared to all other treatments (FIG. 21A). Obviously, cells which were treated with TGF-.beta.1 were significantly less proliferative.

Conclusion

[0683] The ability to differentiate was not influenced by inventive ASO Seq. ID No. 218b. Interestingly, ReNcell CX.RTM. cells showed differentiation to neurons after gymnotic transfer under proliferative and differentiating conditions. This indicates in context to the observation of an increased proliferation rate, that inventive ASO Seq. ID No. 218b promotes neurogenesis with a tendency towards elevated neuronal differentiation.

12.1.4 Results of Inventive Antisense-Oligonucleotides on Proliferation of Human Neuronal Stem Cells after TGF-.beta.1 Pre-Incubation

[0684] To analyze whether gymnotic transfer of ASO Seq. ID No. 218b is efficient in reversing TGF-.beta.1 mediated effects on ReNcell CX.RTM. cells, further studies were performed with TGF-.beta.1 pre-incubation for 7 days followed by gymnotic transfer for 8 days (2.times.96 h).

Results

[0685] Gene expression of GFAP (Table 44, FIG. 22A) as an early neuronal marker, Ki67 (Table 44, FIG. 22B), as a marker for proliferation, and DCX (Table 44, FIG. 22C) as marker for neurogenesis were elevated after single ASO treatment, whereas TGF-.beta.1 resulted in the opposite. In addition, 7 days after TGF-.beta.1 pre-incubation, inventive ASO treatment reversed TGF-.beta.1-induced effects. Thus the analysis demonstrates that ASO Seq. ID No. 218b is potent in recovering TGF-.beta.1 mediated effects upon stem cell and proliferation markers

TABLE-US-00096 TABLE 44 mRNA expression of GFAP, Ki67 and DCX 7 days after TGF- .beta.1 pre-incubation followed by 2 .times. 96 h gymnotic transfer of Seq. ID No. 218b in ReNcell CX .RTM. cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels 7 d after TGF-.beta.1 pre-incubation followed by 2 .times. 96 h gymnotic transfer GFAP Ki67 DCX Target n = 2 n = 1 n = 2 A 1.00 .+-. 0.20 1.00 1.00 .+-. 0.16 B 10 .mu.M 1.62 .+-. 0.15 0.91 1.52 .+-. 0.24 C 10 .mu.M 2.23 .+-. 0.52 1.52 4.82 .+-. 1.15 E 10 ng/ml 0.76 .+-. 0.01 0.48 0.68 .+-. 0.03 E 10 ng/ml + B 10 .mu.M 0.58 .+-. 0.07 0.61 0.83 .+-. 0.10 E 10 ng/ml + C 10 .mu.M 2.04 .+-. 1.04 7.40 1.55 .+-. 0.24 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1, .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

Conclusion

[0686] Results indicate that adult neurogenesis could be reactivated by inventive TGF-R.sub.II specific ASO-mediated blocking of TGF-.beta. signaling.

[0687] Taken together, TGF-R.sub.II specific ASO Seq. ID No. 218b rescued cells from TGF-.beta. mediated stem cell quiescence and promotes adult neurogenesis without having an impact on differentiation. This makes it an ideal treatment drug for brain repair.

Example 13: Determination of Therapeutic Activity of Inventive Antisense-Oligonucleotides Disease Progression of ALS in SOD1 Mice

[0688] To analyze the therapeutic potential of ASOs as a medication for amyotrophic lateral sclerosis (ALS) male and female transgenic, SOD1 G93A mice were treated with different doses of inventive ASOs by icy administration into the lateral ventricle via osmotic ALZET.RTM. minipumps. In addition, riluzole was used as a reference. Riluzole is a drug used to treat amyotrophic lateral sclerosis and is marketed by Sanofi Pharmaceuticals. It delays the onset of ventilator-dependence or tracheostomy in selected patients and may increase survival by approximately two to three months

Description of Method:

[0689] For long-lasting central infusion an icy cannula attached to an Alzet.RTM. osmotic minipump (infusion rate: 0.25 .mu.l/h, Alzet.RTM., Model 2004, Cupertino, USA), was stereotaxically implanted under isoflurane anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the mouse and connected with the icy cannula by silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 0.3 mm, lateral 1 mm, depth 3 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM. Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the development and the progression of ALS, the onset of symptoms, paresis, and survival were used as in vivo endpoints. At the age of nine weeks, mice were sacrificed and brains were removed for neuropathology analysis. Histological verification of the icy implantation sites was performed at 40-.mu.m coronal, cresyl violet-stained brain sections.

[0690] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of ALS model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-.beta.1 induced inhibition of neural stem and progenitor proliferation, and thereby treating ALS and other neurodegenerative disorders.

Examples 14: Determination of the Therapeutic Activity of Antisense-Inventive ASOs Directed to TGF-R.sub.II on Disease Development and Progression of Huntington's Disease in R6/2 Mice

[0691] To analyze the therapeutic potential of ASOs as a medication for Huntington's disease (HD), male and female transgenic R6/2 mice were treated with different doses of inventive TGF-R.sub.II specific ASO by icy administration into the lateral ventricle via osmotic minipumps.

[0692] Description of Method:

[0693] For chronic central infusion, mice underwent surgery for an icy cannula attached to an Alzet.RTM. osmotic minipump (infusion rate: 0.25 .mu.l/h, Alzet.RTM., Model 2004, Cupertino, USA) at the age of five weeks. The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the mouse and connected with the icy cannula by a silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 0.3 mm, lateral 1 mm, depth 3 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the development and the progression of HD the onset of symptoms, grip strength, general motoric, and survival were used as in vivo endpoints. At the age of nine weeks, mice were sacrificed and brains were removed for histological analyzation. Histological verification of the icy implantation sites was performed at 40-.mu.m coronal, cresyl violet-stained brain sections.

[0694] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of Huntington model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-.beta.1 induced inhibition of neural stem and progenitor proliferation, and thereby treating HD and other neurodegenerative disorders.

Example 15: Determination of Therapeutic Activity of the Inventive ASOs on Disease Progression of TGF.beta.-Induced Hydrocephalus and Associated Cognitive Deficits in Fischer-344 Rats

[0695] The goal of the present study is to treat animals suffering from the TGF.beta. induced effects on i) neural stem cell proliferation and neurogenesis, ii) formation of hydrocephalus, and iii) spatial learning deficits by intraventricular infusion of inventive ASO in a dose-dependent manner.

[0696] Description of Method:

[0697] Osmotic minipumps for intracerebroventricular infusion were implanted into female Fischer-344 rats of 180 to 200 g body weight (n.sub.total=70, n.sub.group=10). Infused were a) artificial cerebrospinal fluid (aCSF: 148.0 mM NaCl, 3.0 mM KCl, 1.4 mM CaCl.sub.2), 0.8 mM MgCl.sub.2, 1.5 mM Na.sub.2HPO.sub.4, 0.2 mM NaH.sub.2PO.sub.4, 100 .mu.g/ml rat serum albumin, 50 .mu.g/ml Gentamycin, pH 7.4) as control, or b) TGF-.beta.1 1 .mu.g/mL in aCSF using an Alzet.RTM. osmotic pump 2004 with flow rate of 0.25 .mu.l/h for 14 days. After 14 days the pumps are changed and Alzet.RTM. osmotic pumps 2004 (flow rate 0.25 .mu.l/h) were used for the following infusions: aCSF or TGF-.beta.1 (1 .mu.g/ml) in combination with varying concentrations of TGF-R.sub.II ASO (1.1 mmol/L, 3.28 mmol/I, 9.84 mmol/I) or scrambled ASO (3.28 mmol/I) were infused (2.times.4 weeks). During the last four days of the infusion period, animals received a daily intraperitoneal injection of BrdU (50 mg/kg of body weight) to label proliferating cells. Pumps are removed, and two weeks later animals are functionally analyzed in a spatial learning test (Morris-Water-Maze) for 14 days. One day later, animals are perfused with 0.9% NaCl, brains are removed, the ipsilateral hemisphere is postfixed in 4% paraformaldehyde for quantitative histological analysis of PCNA, BrdU, DCX, BrdU/NeuN, and BrdU/GFAP, and for stereological analysis of the volume of the lateral ventricles as a measure for the hydrocephalus. The contralateral hemisphere is further dissected and different areas (ventricle wall, hippocampus, cortex) are processed for quantitative RT-PCR to analyze TGF-R.sub.II expression levels. MR images were taken of 4 animals of group 1, group 3, and group 6 at day four before pump implantation, one week after pump implantation, at the day of the first pump change and from then on every 2 weeks until the end of the infusion period. Histological verification of the icy implantation sites was performed at 40-.mu.m coronal, cresyl violet-stained brain sections.

TABLE-US-00097 TABLE 46 Treatment scheme and the group classification of the Hydrocephalus experiment. 2. aCSF + 4. TGF-.beta.1 + 5.-7. TGF-.beta.1 + Group 1. aCSF ASO 3. TGF-.beta.1 scramb-ASO ASO treatment aCSF- aCSF plus TGF-.beta.1- TGF-.beta.1 plus TGF-.beta.1 plus infusion ASO infusion ASO infusion ASO infusion infusion treatment week 1 week 1 and 2: week 1 and 2: week 1 and 2: week 1 and 2: scheme to 10 aCSF 1 .mu.g/ml TGF-.beta.1: 1 .mu.g/ml TGF-.beta.1: 1 .mu.g/ml week 3 to week 3 week 3 to 10: week 3 to 10: 10: ASO: to 10: TGF-.beta.1: 1 .mu.g/ml TGF-.beta.1: 1 .mu.g/ml 3.28 mmol/l 1 .mu.g/ml scramb.-ASO: ASO: 1.1 mmol/l 3.28 mmol/l 3.28 mmol/l 9.84 mmol/l n 10 10 10 10 10 per dose n-total 10 10 10 10 30

[0698] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of Hydrocephalus model animals. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-.beta.1 induced inhibition of neural stem and progenitor proliferation, and thereby treating Hydrocephalus and other neurodegenerative disorders.

Example 16: Determination of Therapeutic Activity of the Antisense-Oligonucleotides Directed to TGF-.beta.11 on Rehabilitation of Spinal Cord Injury in Fischer 344 Rats

[0699] To analyze the therapeutic potential of ASOs as a medication for spinal cord injury (SCI), male and female Fischer-344 rats were treated with different doses of inventive ASOs by icy administration into the lateral ventricle via osmotic minipumps.

Description of Method:

[0700] SCI was simulated by cervical tungsten wire knife dorsal column transection at the C3 level. In the next step, for chronic central infusion rats, (180-200 g body weight) underwent surgery for an icy cannula attached to an Alzet.RTM. osmotic minipump (infusion rate: 0.25 .mu.l/h, Alzet.RTM., Model 2004, Cupertino, USA). The cannula and the pump were stereotaxically implanted under ketamine/xylacin anesthesia (Baxter, GmbH, Germany) and semi-sterile conditions. Each osmotic minipump was implanted subcutaneously in the abdominal region via a 1 cm long skin incision at the neck of the rat and connected with the icy cannula by a silicone tubing. Animals were placed into a stereotaxic frame, and the icy cannula (23G, 3 mm length) was lowered into the right lateral ventricle (posterior 1.0 mm, lateral 1.0 mm, depth 1.8 mm relative to bregma). The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, rats were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 0.5 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective solution. To determine the effects of ASOs on the rehabilitation process following SCI, 4 weeks post-surgery an in vivo MRI structural analysis was performed (3T MRI, Allegra Siemens, phased array--small animal coil). 6 weeks after surgery, animals were sacrificed and the spinal cord was removed for histological and immunohistochemical analysis. Histological verification of the icy implantation sites was performed at 40-.mu.m coronal, cresyl violet-stained brain sections.

[0701] The inventive ASOs exert potential effects in in vitro experiments. Quite in line, the rodent cross-reactive inventive ASOs with Seq. ID No. 143aj, Seq. ID No. 143h and Seq. ID No. 210q were also effective in the above experiments proving an effect in the treatment of a Fischer-344--rat spinal cord paraplegia model. In MRI images and neuropathological analysis, the inventive ASOs showed high treatment efficacy. The ASOs of the present invention demonstrating no cross-reactivity exert more potential effects in in vitro experiments. As a result, it is assumed that these inventive ASOs are also more effective in in vivo set ups for non-human primates and humans and therefore act as a highly potent medication for preventing or treating TGF-.beta.1 induced inhibition of neural stem and progenitor proliferation, and thereby treating spinal cord injury and other neurodegenerative disorders.

Example 17: ASO-Mediated Effects on Proliferation of Human Lung Cancer Cell Line A549

[0702] mRNA of Ki67, p53, Caspase 8 (Casp8) and of DNA-binding protein inhibitor 2 (ID2) were analyzed as representative markers on proliferation in several tumor cells. It is known from previous studies, that expression of tumor suppressor gene p53 and ID2 is often dramatically elevated in tumor tissues. Ki67 is a proliferation marker and Casp8 is an indicator for apoptosis. In addition, cell numbers were determined after gymnotic transfer.

Description of Method:

[0703] A549 were cultured as described above. For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) or 8-x-well cell culture slide dishes (Sarstedt #94.6140.802) (20,000 cells/well) (0.5 ml for 24-well and 8-well cell culture slide dishes and 1 ml for 6-well dishes) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. To analyze mRNA expression and influence on proliferation, cells were treated with Ref.1 (Scrambled control) and ASO Seq. ID No. 218b at concentrations of 2.5 .mu.M and 10 .mu.M and were incubated for 72 h at 37.degree. C. and 5% CO.sub.2. Treatment including medium replacement was repeated for 3 times every 72 h (12 days in total). For immunocytochemical analysis of proliferation (Ki67), gymnotic transfer of ASO Seq. ID No. 218b was limited to 72 h. Afterwards, cells were washed twice with PBS and subsequently used for protein isolation (6-well dishes), immunocytochemistry (in 8-well cell culture slide dishes), proliferation curve and RNA isolation (24-well dishes). Protocols for RNA, protein and immunocytochemistry were performed as described above. For proliferation curve, remaining cells were harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2.times.), treated with accutase (500 .mu.l/well) and incubated for 7 min at 37.degree. C. Afterwards 500 .mu.l medium was added and cell number was determined using Luna FL.TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 .mu.l of the cell suspension was added to 2 .mu.l of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 .mu.l were added onto Cell Counting Slide (Biozym #872011). Cells were counted and calculated in distinction of alive and dead cells.

17.1 Results for ASO Seq. ID No. 218b

[0704] mRNA analysis showed reduced Ki67, p53 and ID2 expression levels 12 days after gymnotic transfer of ASO Seq. ID No. 218b. In contrast, Casp8 was elevated at low levels of ASO Seq. ID No. 218b (Table 46). These observations indicate that a reduced tumor growth is associated with a slight increase in apoptotic cells. Furthermore, Western Blot analysis showed reduction in protein level of Ki67 and pAkt 12 days after gymnotic transfer of inventive ASOs (Table 47). Immunochemical examination of A549 cells after gymnotic transfer of ASO Seq. ID No. 218b showed a reduced level of Ki67 signals in comparison to scrambled control for both concentrations applied (FIG. 23). Finally, cell number of A549 cells was reduced about nearly 50% 12 days after gymnotic transfer of ASO Seq. ID No. 218b (Table 48).

TABLE-US-00098 TABLE 46 mRNA expression of Ki67, p53, Casp8 and ID2, 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549 cells. Regulation of examined genes demonstrates diminished proliferation rates after gymnotic transfer of inventive ASOs. Reduced ID2 mRNA levels are beneficial in dampening expansion of tumor cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Cell line A549 mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) Ki67 p53 Casp8 ID2 Target n = 2 n = 2 n = 2 n = 2 A 1.00 .+-. 0.37 1.00 .+-. 0.31 1.00 .+-. 0.05 1.00 .+-. 0.03 B 2.5 .mu.M 0.92 .+-. 0.05 1.06 .+-. 0.02 1.36 .+-. 0.37 0.73 .+-. 0.01 B 10 .mu.M 0.96 .+-. 0.03 1.11 .+-. 0.92 1.52 .+-. 0.15 0.82 .+-. 0.15 C 2.5 .mu.M 0.55 .+-. 0.33 0.27 .+-. 0.04 1.59 .+-. 0.48 0.59 .+-. 0.01 C 10 .mu.M 0.57 .+-. 0.20 0.53 .+-. 0.07 0.98 .+-. 0.17 0.35 .+-. 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00099 TABLE 47 Densitometric analysis of Ki67 and pAkt Western Blot. Downregulation of Ki67 and pAkt protein 12 days after gymnotic transfer with TGF- R.sub.II specific ASO Seq. ID No. 218b was observed in A549 cells. Protein levels were determined relative to housekeeping gene GAPDH using Image Studio .TM. Lite Software and were then normalized to untreated control. Cell line A549 protein levels 12 days after repeated gymnotic transfer (4 .times. 72 h) Ki67 pAKT Target n = 1 n = 1 A 1.00 1.00 B 10 .mu.M 1.18 0.80 C 10 .mu.M 0.57 0.39 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM.

TABLE-US-00100 TABLE 48 Cell numbers 12 days after repeated gymnotic transfer. Cell numbers were determined 12 days after repeated gymnotic transfers (4 .times. 72 h) of A549 cells using Luna FL .TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Cell line A549 cell number 12 days after repeated gymnotic transfer (4 .times. 72 h) alive cells .times. 10.sup.5 dead cells .times. 10.sup.5 Cell number n = 3 n = 3 A 4.25 .+-. 0.50 0.47 .+-. 0.09 B 10 .mu.M 3.88 .+-. 0.95 0.31 .+-. 0.11 C 10 .mu.M 2.35 .+-. 0.07 0.35 .+-. 0.16 A = untreated control, C = Seq. ID No. 218b, .+-. = SEM.

Conclusion

[0705] These observations indicate that reduced tumorous growth is associated with an increase in apoptotic cells. Notably, ID2, which is a possible therapeutic target gene in tumors, is reduced after gymnotic transfer of TGF-R.sub.II specific ASO Seq. ID No. 218b. Taken together, ASO Seq. ID No. 218b is efficient in minimizing proliferation rates and reduces tumor promoting gene expression.

Example 18: Effect of ASO Gymnotic Transfer on Proliferation of Several Tumor Cell Lines

[0706] TGF-.beta. signaling is a critical pathway in cancer development. On the one hand TGF-.beta. promotes factors, which act tumor suppressive but on the other hand, this growth factor leads to stimulation of cell migration, cell invasion, cell proliferation, immune regulation, and promotes an environmental reorganization in advantage to progression and metastasis of tumor cells. Thus, TGF-.beta. is a key target in cancer treatment. mRNA and protein levels of proliferation marker (Ki67) and cell numbers were determined after gymnotic uptake of inventive ASOs as markers of proliferation rate in tumor cells. Furthermore, mRNA levels of tumor suppressor gene p53 and of DNA-binding protein inhibitor 2 (ID2) were examined.

Description of Methods

[0707] Several tumor cell lines were cultured as described above (Table 10). For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) (0.5 ml for 24-well and 1 ml for 6-well dishes) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. To analyze mRNA expression and influence on proliferation, cells were treated with Ref.1 (Scrambled control) and ASO Seq. ID No. 218b at concentrations of 2.5 .mu.M and 10 .mu.M and were incubated for 72 h at 37.degree. C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes), protein isolation (6-well dishes), or proliferation curve. Protocols for RNA and protein isolation were performed as described above. Before counting cells for proliferation curve, cells were analyzed by using light microscopy (Nikon, TS-100 F LED #MFA33500). Remaining cells were then harvested from 24-well dishes for determination of cell number. For this purpose, remaining cells were washed with PBS (2.times.), treated with accutase (500 .mu.l/well) and incubated for 5-7 min at 37.degree. C. Afterwards 500 .mu.l medium was added and cell number was determined using Luna FL.TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Briefly, 18 .mu.l of the cell suspension were added to 2 .mu.l of acridine orange/propidium iodide assay viability kit (Biozym #872045). After 1 min of settling, 10 .mu.l were added onto Cell Counting Slide (Biozym #872011). Cells were counted and calculated in distinction of alive and dead cells.

18.1 Results for Seq. ID No. 218b

[0708] Ki67 mRNA levels were efficiently decreased independently (A549, L3.6p1, Panc-1) or dependently (HT-29, Panc-1, CaCo2) of used ASO concentrations, 12 days after gymnotic transfer (Table 40). Gene expression level of p53 was also affected in A549, HT-29, K562, KG-1, CaCo2 and TMK-1 by tested ASO (Table 50). Verification of reduced Ki67 protein expression was shown for A549, L3.6p1, TMK-1, HT-29 and K562 (Table 51). Notably, ID2 mRNA expression showed a consistent efficiently and dose-dependently downregulation in A549, HT-29, K562 and TMK-1 cells mediated by ASO Seq. ID No. 218b (Table 51). In addition, ASO Seq. ID No. 218b resulted in a reduced proliferation rate of several tumor cell lines (Table 53). A dose-dependent decrease of cell number was recognized for HPAFII, MCF-7, KG1, K562, U937 and HTZ-19 cells. Lung cancer cells (A549) showed approx. 50% reduction of cell numbers elicited by ASO Seq. ID No. 218b. Reduced cell numbers were additionally confirmed by light microscopy for HPAFII, K562, MCF-7, Panc-1 and HTZ-1, 12 days after gymnotic transfer of ASO Seq. ID No. 218b (FIG. 24).

[0709] Comparable results are obtainable for the antisense-oligonucleotides of the Seq. ID Nos. 141d, 141g, 141i, 143r, 143w, 143af, 143ag, 143ah, 143j, 143p, 143q, 233d, 234d, 235b, 235d, 237b, 237c, 237i, 237m, 238c, 238f, 239e, 240c, 241b, 242a, 246e, 247d, 248b, 248e, 248g, 152k, 152s, 152t, 152u, 152ab, 152ag, 152ah, 152ai, 249c, 249e, 250b, 250g, 251c, 251f, 252e, 253c, 254b, 255a, 259e, 260d, 261b, 261e, 261g, 262d, 262e, 209s, 209v, 209w, 209x, 209ai, 209an, 209at, 209au, 209av, 2100, 210v, 210w, 210x, 210ab, 210ac, 210ad, 210af, 210 am, 263b, 263c, 263i, 263m, 264e, 264h, 265e, 266c, 267b, 268a, 272e, 273d, 274a, 274d, 274f, 275g, 275i, 276b, 276c, 276j, 276k, 277d, 277e, 278f, 279c, 280b, 281a, 218ad, 218n, 218t, 218u, 218v, 218ah, 218an, 218ao, 218ap, 220d, 221d, 222b, 222c, 222f, 223c, 223f, 224i, 224m, 225c, 225f, 226e, 227c, 2130, 213p, 213q, 213s, 213y, 213z, 213aa, 213af, 228b, 229a, 285d, 286d, 287d, 287e, 287f, 288e, 288i, 289d, 289h, 2890, 289p, 289q, 290c, 290f, 290i, 291c, 292c, 293b, and 294a. Most of the afore-mentioned antisense-oligonucleotides could not beat Seq. ID Nos. 218b and 218c, but are still far more advantageous than the state of the art antisense-oligonucleotides. Thus the antisense-oligonucleotides of the present invention are highly useful for the treatment of hyperproliferative diseases such as cancer and tumors.

TABLE-US-00101 TABLE 49 mRNA expression of proliferation marker Ki67. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, L3.6pl, KG1, Panc-1 and CaCo2 cells, Ki67 mRNA was decreased in all cell lines, respectively. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR normalized to untreated control. Target Ki67 mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) Cell line A549 HT-29 L3.6pl KG1 Panc-1 CaCo2 n = 2 n = 2 n = 2 n = 1 n = 1 n = 1 A 1.00 .+-. 0.37 1.00 .+-. 0.00 1.00 .+-. 0.25 1.00 1.00 1.00 B 2.5 .mu.M 0.92 .+-. 0.05 0.89 .+-. 0.46 0.93 .+-. 0.03 0.72 0.76 1.21 B 10 uM 0.96 .+-. 0.03 0.60 .+-. 0.11 0.96 .+-. 0.16 0.76 0.79 1.07 C 2.5 .mu.M 0.55 .+-. 0.33 0.34 .+-. 0.11 0.42 .+-. 0.03 0.16 0.68 0.99 C 10 .mu.M 0.57 .+-. 0.20 0.17 .+-. 0.02 0.64 .+-. 0.05 0.33 0.37 0.37 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00102 TABLE 50 mRNA expression of tumor suppressor p53. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, K562, KG1, CaCo2 and TMK-1 cells, p53 mRNA was decreased in all cell lines, respectively. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target p53 mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) Cell line A549 HT-29 K562 KG1 TMK-1 CaCo2 n = 2 n = 1 n = 1 n = 1 n = 1 n = 1 A 1.00 .+-. 0.31 1.00 1.00 1.00 1.00 .+-. 0.04 1.00 B 2.5 .mu.M 1.06 .+-. 0.02 0.72 0.90 1.37 0.74 .+-. 0.11 0.82 B 10 .mu.M 1.11 .+-. 0.92 0.68 1.35 0.87 0.71 .+-. 0.15 1.25 C 2.5 .mu.M 0.27 .+-. 0.04 0.51 0.27 0.65 0.14* .+-. 0.14 0.99 C 10 .mu.M 0.53 .+-. 0.07 0.32 0.46 0.67 0.21* .+-. 0.05 0.30 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, *p < 0.05 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00103 TABLE 51 mRNA expression of ID2. 12 days after gymnotic transfer of ASO Seq. ID No. 218b in A549, HT-29, K562 and TMK-1 cells, ID2 mRNA was dose-dependently downregulated in all cell lines, respectively. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target ID2 mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 HT-29 K562 TMK-1 Cell line n = 2 n = 1 n = 1 n = 1 A 1.00 .+-. 0.03 1.00 1.00 .+-. 0.23 1.00 .+-. 0.23 B 2.5 .mu.M 0.73 .+-. 0.01 0.93 0.97 .+-. 0.15 0.88 .+-. 0.15 B 10 .mu.M 0.82 .+-. 0.15 1.00 0.82 .+-. 0.05 0.82 .+-. 0.05 C 2.5 .mu.M 0.59 .+-. 0.01 0.31 0.70 .+-. 0.10 0.70 .+-. 0.10 C 10 .mu.M 0.35 .+-. 0.02 0.25 0.29* .+-. 0.09 0.30* .+-. 0.09 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, *p < 0.05 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc multiple comparisons.

TABLE-US-00104 TABLE 52 Densitometric analysis of Ki67 Western Blot. Downregulation of Ki67 protein after gymnotic transfer with ASO Seq. ID No. 218b was recognized. Protein level was quantified relative to housekeeping gene alpha-tubulin using Image Studio .TM. Lite Software and normalized to untreated controls. Target Ki67 protein level 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 L3.6pl TMK-1 HT29 K562 Cell line n = 1 n = 2 n = 2 n = 2 n = 1 A 1.00 1.00 .+-. 0.00 1.00 .+-. 0.00 1.00 .+-. 0.00 1.00 B 10 .mu.M 1.18 0.59 .+-. 0.00 0.75 .+-. 0.00 1.19 .+-. 0.68 1.05 C 10 .mu.M 0.57 0.19 .+-. 0.17 0.53 .+-. 0.26 0.69 .+-. 0.05 0.35 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

TABLE-US-00105 TABLE 53 Cell numbers in several cancer cell lines 12 days after repeated gymnotic transfer (4 .times. 72 h). ASO Seq. ID No. 218b was transferred to several cancer cell lines. Cell numbers were determined using Luna FL .TM. Automated Cell Counter Fluorescence and Bright Field (Biozym, #872040) according to manufacturer's instructions. Treatment A B 2.5 .mu.M B 10 .mu.M C 2.5 .mu.M C 10 .mu.M Cell cell number .times. 10.sup.5 Line a d a d a d a d a d n p= A549 4.25 .+-. 0.47 .+-. 3.88 .+-. 0.31 .+-. 2.35 .+-. 0.35 .+-. 3 0.50 0.09 0.95 0.11 0.07 0.16 HPAFII 2.80 .+-. 0.35 .+-. 2.88 .+-. 0.36 .+-. 2.56 .+-. 0.39 .+-. 0.66 .+-. 0.25 .+-. 0.20 .+-. 0.06 .+-. 2 0.33 0.11 2.04 0.06 0.45 0.06 0.47 0.07 0.09 0.02 KG1 17.40 .+-. 0.43 .+-. 16.5 .+-. 0.58 .+-. 13.80 .+-. 0.26 .+-. 10.90 .+-. 0.59 .+-. 7.63 .+-. 0.48*+ .+-. 3 A vs. C 3.00 0.16 0.85 0.24 0.80 0.17 0.20 0.18 3.08 0.14 10 .mu.M *p < 0.01 B 2.5 .mu.M vs. C 10 .mu.M +p < 0.01 C 10 .mu.M vs. D 10 .mu.M #p < 0.01 K562 10.93 .+-. 1.37 .+-. 7.44 .+-. 2.40 .+-. 6.40 .+-. 2.36 .+-. 5.60 .+-. 2.66 .+-. 3.33 .+-. 0.62* .+-. 3 A vs. C 1.58 0.40 1.05 0.62 0.38 0.30 0.08 0.41 0.54 0.07 10 .mu.M *p < 0.01 MCF-7 6.73 2.37 6.51 1.57 6.51 3.35 5.21 1.64 2.47 0.73 1 U937 26.43 .+-. 7.04 .+-. 14.5 .+-. 2.88 .+-. 17.67 .+-. 2.36 .+-. 11.34* .+-. 3.07 .+-. 7.56* .+-. 2.25 .+-. 3 A vs. C 2.05 0.28 2.73 0.37 0.50 0.30 2.85 0.97 1.49 0.44 2.5 .mu.M *p < 0.01 A vs. C 10 .mu.M *p < 0.01 Panc-1 2.16 .+-. 0.11 .+-. 1.82 .+-. 0.15 .+-. 2.98 .+-. 0.16 .+-. 1.15* .+-. 0.07 .+-. 1.20*+ .+-. 0.36 .+-. 3 A vs. C 0.08 0.02 0.36 0.04 0.27 0.02 0.51 0.02 0.23 0.02 2.5 .mu.M *p < 0.05 A vs. C 10 .mu.M *p < 0.05 B 10 .mu.M vs. C 10 .mu.M +p < 0.01 HTZ-19 2.06 .+-. 3.05 .+-. 2.57 .+-. 1.78 .+-. 2.55 .+-. 1.22 .+-. 1.78 .+-. 0.88 .+-. 1.17+ .+-. 0.49 .+-. 3 B 10 .mu.M vs. C 0.02 0.36 0.16 0.15 0.22 0.15 0.25 0.09 0.14 0.05 10 .mu.M +p < 0.05 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, a = alive cells, d = dead cells. .+-. = SEM. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons test.

Conclusion

[0710] Modulation of Ki67, p53 and ID2 mRNA by ASO Seq. ID No. 218b indicates a beneficial effect in dampening tumor expansion in several organs and with different origin. Ki67, ID2 and p53 are known to be upregulated and promote cell proliferation in different cancer types. Proliferation marker Ki67, p53 and ID2 were efficiently downregulated. Cell counting and light microscopy of several tumor cells 12 days after gymnotic transfer revealed ASO Seq. ID No. 218b as a potent agent to reduce cell proliferation. Taken together, TGF-R.sub.II specific ASO Seq. ID No. 218b was efficiently reducing proliferation rates parallel to recognized mRNA modulations of Ki67, p53 and ID2. These data suggest that the inventive ASOs are promising drug candidates for dampening tumor cell progression and metastasis of tumor cells.

Example 19: Analysis of the Effect of the Antisense-Oligonucleotides to Angiogenesis in Several Tumor Cell Lines

[0711] Modulation of angiogenesis is essential for organ growth and repair. An imbalance in blood vessel growth contributes to different diseases like e.g. tumor growth, ischemia, inflammatory and immune disorders. TGF-.beta. is known to be a pro-angiogenic factor. This may be most relevant in inflammatory and neoplastic processes, when overshooting angiogenesis is responsible for disease progression. These effects may go hand in hand with TGF-.beta.1 induced fibrosis. Therefore Inhibition of TGF-.beta. signaling by TGFR.sub.II specific ASO may represent an adequate therapeutic approach.

[0712] To test this assumption, these ASOs were transferred to several tumor cell lines by gymnotic uptake. 12 days after repeated gymnotic transfers, cell supernatant was analyzed for protein levels of pro-angiogenic factors by multiplex analysis. This technology allowed investigation of multiple pro-angiogenic proteins (VEGF, Tie-2, FLt-1, PlGF and bFGF) by electro-chemiluminescence. Vascular endothelial growth factor (VEGF) is a potent tumor secreted cytokine that promotes angiogenesis and therewith contributes to e.g. tumor proliferation. Tie-2 is a protein which is expressed from actively growing blood vessels. Fms-like tyrosine kinase 1 (Flt-1), also known as vascular endothelial growth factor receptor 1 (VEGFR1), is a transmembrane tyrosine receptor kinase that is highly expressed in vascular endothelial cells and Placental Growth Factor (PlGF) acts together with VEGF and is upregulated under pathological conditions e.g. in tumor formation. Besides, basic Fibroblast Growth Factor (bFGF) is a growth factor that also induces angiogenesis. PAI-1 is a target gene of TGF-.beta. and mediates scar formation and angiogenic effects of TGF-.beta.. Therefore, PAI-1 demonstrates also a key factor for tumor invasion and metastasis. Patients showing a high PAI-1 concentration level are considered to a poor prognostic factor e.g. in breast cancer, lung, colorectal and gastric cancer. High PAI-1 concentrations also are a risk factor for diseases where thrombosis plays a role (e.g. myocardial infarction, stroke). Thus, PAI-1 mRNA regulation by TGF-.beta. specific antisense oligonucleotides was also tested.

Description of Methods:

[0713] Tumor cell lines were cultured as described above (Table 10). For treating cells, medium was removed and replaced by fresh full medium in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well) incubated overnight at 37.degree. C. and 5% CO.sub.2. The next day, Ref.1 (Scrambled control) and ASO Seq. ID No. 218b (were added to refreshed medium at concentrations of 2.5 and 10 .mu.M and were incubated for 72 h at 37.degree. C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). Afterwards cell supernatant was collected and analyzed by a MesoScale Discovery.RTM. Assay (MSD Discovery). This technology allowed investigation of multiple pro-angiogenic proteins (VEGF, Tie-2, FLt-1, PlGF and bFGF) by electro-chemiluminescence. Experiment performance and information about the individual growth factors were extracted by manufacturer instructions (MSD MesoScale Discovery.RTM., #K15198G). The results were evaluated by GraphPad Prism.RTM. 6.0 Software.

[0714] Afterwards, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) to analyze, whether gymnotic transfer of ASO may regulate mRNA levels of Plasminogen Activator inhibitor-1 (PAI-1) by real-time RT-PCR. Protocols and primers were used and listed as described before.

19.1 Results for Seq. ID 218b

[0715] Table 54 demonstrates that PAI-1 mRNA was downregulated in a dose-dependent manner in several tested cancer cells (A549: lung cancer, HPAFII: pancreatic adenocarcinoma, HT-29: colorectal adenocarcinoma, HTZ-19: melanoma, TMK-1: gastric carcinoma, THP-1: monocytic leukemia) after repeated gymnotic transfer of ASO Seq. ID No. 218b. In addition, VEGF protein levels in stimulated cell supernatants showed also a dose-dependent decrease in A549, HTZ-19, HPAFII and PC3M (prostatic adenocarcinoma). For HPAFII and PC3M cells downregulation was significant (Table 55). Influence of ASO Seq. ID No. 218b to bFGF confirmed observations for VEGF, meaning that ASO Seq. ID No. 218b is potent to suppress angiogenesis (Table 56) In A549 and PC3M results showed also a significant reduction of bFGF. Protein amount of PlGF in cell supernatants was only slightly but dose-dependently depressed in A549 and HTZ-19 cells. In PC3M cells basic endogenous PlGF level was higher than in all other tested cells and ASO effect was also stronger (Table 57). Finally, downregulation of Flt-1 protein in HT-29 cells (Table 58) and Tie-2 depression in HTZ-19 (ASO Seq. ID No. 218b 2.5 .mu.M) and MCF-7 (mamma-carcinoma, 10 .mu.M) could be detected (Table 59).

[0716] Comparable results are obtainable for the antisense-oligonucleotides of the Seq. ID Nos. 141d, 141g, 141i, 143r, 143w, 143af, 143ag, 143ah, 143j, 143p, 143q, 152k, 152s, 152t, 152u, 152ab, 152ag, 152ah, 152ai, 209s, 209v, 209w, 209x, 209ai, 209an, 209at, 209au, 209av, 2100, 210v, 210w, 210x, 210ab, 210ac, 210ad, 210af, 210 am, 213o, 213p, 213q, 213s, 213y, 213z, 213aa, 213af, 218ad, 218n, 218t, 218u, 218v, 218ah, 218an, 218ao, 218ap, 220d, 221d, 222b, 222c, 222f, 223c, 223f, 224i, 224m, 225c, 225f, 226e, 227c, 228b, 229a, 233d, 234d, 235b, 235d, 237b, 237c, 237i, 237m, 238c, 238f, 239e, 240c, 241b, 242a, 246e, 247d, 248b, 248e, 248g, 249c, 249e, 250b, 250g, 251c, 251f, 252e, 253c, 254b, 255a, 259e, 260d, 261b, 261e, 261g, 262d, 262e, 263b, 263c, 263i, 263m, 264e, 264h, 265e, 266c, 267b, 268a, 272e, 273d, 274a, 274d, 274f, 275g, 275i, 276b, 276c, 276j, 276k, 277d, 277e, 278f, 279c, 280b, 281a, 285d, 286d, 287d, 287e, 287f, 288e, 288i, 289d, 289h, 2890, 289p, 289q, 290c, 290f, 290i, 291c, 292c, 293b, and 294a. Most of the afore-mentioned antisense-oligonucleotides could not beat Seq. ID Nos. 218b and 218c, but are still far more advantageous than the state of the art antisense-oligonucleotides. Thus the antisense-oligonucleotides of the present invention are highly useful for the treatment of hyperproliferative diseases such as cancer and tumors.

TABLE-US-00106 TABLE 54 mRNA expression of PAI-1 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HPAFII, HT-29, HTZ-19, TMK-1 and THP-1 cells. Regulation of PAI-1 gene expression is dose-dependently affected by ASO Seq. ID No. 218b in a manner for an improved disease prognosis. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target PAI-1 mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) Cell line A549 HPAFII HT-29 HTZ-19 TMK-1 THP-1 n = 3 n = 1 n = 2 n = 2 n = 2 n = 2 A 1.00 .+-. 0.10 1.00 1.00 .+-. 0.11 1.00 .+-. 0.21 1.00 .+-. 0.06 1.00 .+-. 0.11 B 2.5 .mu.M 1.28 .+-. 0.03 1.48 0.88 .+-. 0.27 0.99 .+-. 0.34 0.89 .+-. 0.04 1.14 .+-. 0.79 B 10 .mu.M 1.03 .+-. 0.27 1.05 0.81 .+-. 0.08 1.30 .+-. 0.00 1.16 .+-. 0.00 1.21 .+-. 0.37 C 2.5 .mu.M 0.91 .+-. 0.28 0.62 0.60 .+-. 0.13 1.13 .+-. 0.10 0.56 .+-. 0.04 0.83 .+-. 0.20 C 10 .mu.M 0.56 .+-. 0.13 0.32 0.50 .+-. 0.18 0.77 .+-. 0.10 0.45 .+-. 0.23 0.09 .+-. 0.02 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00107 TABLE 55 VEGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HPAFII, HTZ-19, PC3M cells by MesoScale Discovery .RTM. Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target VEGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 HPAFII HTZ-19 PC3M Cell line n = 1 n = 2 n = 2 n = 2 A 8186 23266 .+-. 876 4411 .+-. 66 2657 .+-. 103 B 2.5 .mu.M 8387 22278 .+-. 5711 3385 .+-. 57 1993 .+-. 5.4 B 10 .mu.M 8623 20776 .+-. 497 4044 .+-. 21 813 .+-. 0.8 C 2.5 .mu.M 8846 15479**++ .+-. 512 .sup. 3444 .+-. 197 1266*+ .+-. 20.5 .sup. C 10 .mu.M 6842 11214** .+-. 898 2882 .+-. 90 442** .+-. 14.3 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, *p < 0.05 and **p < 0.01 in reference to A, +p < 0.05 and ++p < 0.01 in reference to B 2.5 .mu.M. Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00108 TABLE 56 bFGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549 and PC3M cells by MesoScale Discovery .RTM. Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target bFGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 PC3M Cell line n = 2 n = 2 A 50.7 .+-. 2.9 21.2 .+-. 0.2 B 2.5 .mu.M 54.4 .+-. 3.1 16.8 .+-. 0.1 B 10 .mu.M 51.8 .+-. 2.7 14.7 .+-. 0.2 C 2.5 .mu.M 26.7**++ .+-. 2.1 .sup. 11.3**+ .+-. 0.0 .sup. C 10 .mu.M 24.2 .+-. 3.4 7.6**++ .+-. 0.0 .sup. A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, *p < 0.05 and **p < 0.01 in reference to A, +p < 0.05 and ++p < 0.01 in reference to B 2.5 .mu.M, #p < 0.05 and ##p < 0.01 in reference to B 10 .mu.M. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00109 TABLE 57 PIGF protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HTZ-19 and PC3M cells by MesoScale Discovery .RTM. Assay (MSD MesoScale Discovery .RTM., #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target PIGF protein (pg/ml) 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 HTZ-19 PC3M Cell line n = 2 n = 1 n = 2 A 9.9 .+-. 0.4 11.6 61.7 .+-. 2.1 B 2.5 .mu.M 9.6 .+-. 0.2 8.1 54.1 .+-. 1.9 B 10 .mu.M 8.6 .+-. 0.1 8.4 59.5 .+-. 3.2 C 2.5 .mu.M 8.2 .+-. 0.8 8.2 69.4 .+-. 2.4 C 10 .mu.M 6.3** .+-. 0.9 6.5 45.0 .+-. 3.5 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons

TABLE-US-00110 TABLE 58 Flt-1 protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in HTZ-19 cells by MesoScale Discovery .RTM. assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target Flt-1 protein (pg/ml) 12 days after repeated gymnotic transfer (4 .times. 72 h) HT-29 Cell line n = 1 A 33.9 B 2.5 .mu.M 27.7 B 10 .mu.M 27.7 C 2.5 .mu.M 18.2 C 10 .mu.M 18.7 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00111 TABLE 59 shows Tie-2 protein levels in cell supernatant 12 days after gymnotic transfer of Seq. ID No. 218b in HTZ-19 and MCF-7 cells by MesoScale Discovery .RTM. Assay (MSD Mesoscale Discovery, #K15198G). Protein levels were determined by measuring electro-chemiluminescence. Target Tie-2 protein (pg/ml) 12 days after repeated gymnotic transfer (4 .times. 72 h) HTZ-19 MCF-7 Cell line n = 1 n = 1 A 13.5 98.1 B 2.5 .mu.M 6.2 B 10 .mu.M 149.2 C 2.5 .mu.M 3.2 C 10 .mu.M 76.9 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, **p < 0.01 in reference to A, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

Conclusion

[0717] All analyzed pro-angiogenic factors (VEGF, bFGF, PlGF, Flt-1 and Tie-2) could be regulated by ASO Seq. ID No. 218b in a manner that would have a favorable impact on suppressing tumor progression and other pathological mechanisms dependent on enhanced angiogenesis. Furthermore, PAI-1 mRNA was dose-dependently reduced by ASO Seq. ID No. 218b. This factor, a TGF-.beta. target gene and e.g. an approved prognostic marker in breast cancer, was also dose-dependently downregulated. Taken together, all tested inventive ASOs were efficient in reducing angiogenic processes that favors tumor progression, metastasis, inflammation, and thrombosis. Thus, the inventive ASOs directed against TGF-R.sub.II are potent therapeutic candidate in different types of cancer and thrombosis related diseases.

Example 20: Analysis of the Effect of Inventive ASOs Upon Fibrosis

[0718] TGF-.beta. is involved in a lot of processes such as cell proliferation, migration, wound healing, angiogenesis and cell-cell interactions. It's known from several studies, that this factor is often elevated during pathogenesis in several diseases including primary open angle glaucoma, Alzheimer disease, pulmonal fibrosis and diabetic nephropathy. These diseases are related to pathologic modifications in extracellular matrix (ECM) and the aktin-cytoskeleton. Often, these observed alterations correlate with severity disease progression and resistance to treatment (Epithelial Mesenchymal transition--EMT--in tumors). Connective tissue growth factor (CTGF) is a downstream-mediator of TGF-.beta. and mediates fibrotic effects of TGF-.beta.. Thus, it is shown that CTGF mediates deposition of ECM and modulates reorganization of aktin-cytoskeleton. To investigate whether the inventive ASOs contribute to a resolution of fibrotic processes by inhibiting TGF-.beta. signaling, CTGF levels were evaluated in addition to fibronectin (FN) and Collagen IV (ColIV), which represent two main components of ECM in several different cancer cells. Furthermore, effects of ASOs on CTGF, FN and on aktin-cytoskeleton were examined in neural precursor (ReNcell CX) and human lung cancer (A549) cells.

20.1 Fibrosis in Neurodegeneration

Description of Methods

[0719] Cells were cultured as described before in standard protocol. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. To investigate a response of ReNcell CX.RTM. cells to TGF-.beta.1 cells were treated after refreshing of medium with TGF-.beta.1 (2 and 10 ng/ml, PromoCell #C63499) for 48 h, followed by mRNA analysis for CTGF. To figure out the ASO effect on CTGF and FN, ReNcell CX.RTM. cells, medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-well). Ref. 1 (Scrambled control), ASO Seq. ID No. 218b and Seq. ID No. 218b were then added in medium at concentrations of 2.5 and 10 .mu.M and respective analysis (real-time RT-PCR, Western Blot analysis and Immunocytochemistry) was performed after 96 h. To examine the ASO impact after investigation of pre-incubation with TGF-.beta.1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-.beta.1 (10 ng/ml, 48 h) medium was changed, TGF-.beta.1 (10 ng/ml), Ref.1 (10 .mu.M), ASO with Seq. ID No. 218b (10 .mu.M) and ASO with Seq. ID No. 218c (10 .mu.M) were added in combination and in single treatment to cells. ReNcell CX.RTM. cells were then harvested 96 h after gymnotic transfer. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Protocols, antibodies, dilutions and primers were used as described before.

20.1.1 Results of TGF-.beta.1 Effects on Neural Precursor Cells (ReNcell CX)

[0720] Nothing was known about reaction of ReNcell CX.RTM. to TGF-.beta.1 exposure. Thus ReNcell CX.RTM. cells were treated for 48 h with TGF-.beta.1 in two different concentrations (Table 60). Evaluation of real-time RT-PCR revealed a dose-dependent induction of CTGF- and TGF-.beta.1 gene expression.

TABLE-US-00112 TABLE 60 CTGF and TGF-.beta.1 mRNA expression 48 h after stimulation with TGF-.beta.1. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after 48 h TGF-.beta.1 treatment CTGF TGF-.beta.1 Target 48 h 48 h Time point n = 3 n = 3 A 1.00 .+-. 0.43 1.00 .+-. 0.10 E 2 ng/ml 1.73 .+-. 0.92 1.34 .+-. 0.45 E 10 ng/ml 2.15 .+-. 1.14 1.85 .+-. 0.65 A = untreated control, E = TGF-.beta.1. .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparison.

Conclusion

[0721] ReNcell CX.RTM. cells showed a response to TGF-.beta.1 exposure presenting self-induction of TGF-.beta.1 and elevation of TGF-.beta.1 target gene CTGF. Taken together, ReNcell CX.RTM. cells are ideal to examine questions addressing TGF-.beta. effects.

20.1.2 Results for Seq. ID No. 218b

20.1.2.1 Effects of Gymnotic Transfer

[0722] Gymnotic transfer of ASO Seq. ID No. 218b results in a dose-dependent and significant reduction of CTGF and FN (Table 61). This impact of ASO Seq. ID No. 218b was verified for FN protein level. FN protein level was depressed by about 70% 96 h after gymnotic transfer of tested ASO, whereas TGF-.beta.1 treatment of ReNcell CX.RTM. cells resulted in a 3.4-fold induction of FN (Table 62).

TABLE-US-00113 TABLE 61 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in ReNcell CX .RTM. cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after gymnotic transfer Target CTGF FN Time point 96 h, n = 3 96 h, n = 3 A 1.00 .+-. 0.04 1.00 .+-. 0.00 B 2.5 .mu.M 0.97 .+-. 0.06 0.81 .+-. 0.14 B 10 .mu.M 0.86 .+-. 0.17 0.67 .+-. 0.07 C 2.5 .mu.M 0.66** .+-. 0.02 0.59 .+-. 0.02 C 10 .mu.M 0.52** .+-. 0.02 0.39* .+-. 0.03 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

TABLE-US-00114 TABLE 62 Densitometric analysis after Western Blotting for Fibronectin. Downregulation of FN protein 96 h after gymnotic transfer of ASO Seq. ID No. 218b in ReNcell CX .RTM. cells could be recognized. Protein level was determined relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Cell line ReNcell CX protein levels after gymnotic transfer Target FN Time point 96 h, n = 1 A 1.00 B 2.5 .mu.M 1.06 B 10 .mu.M 0.60 C 2.5 .mu.M 0.46 C 10 .mu.M 0.30 E 10 ng/ml 3.43 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

Conclusion

[0723] ASO Seq. ID No. 218b was potent in downregulating mRNA levels of CTGF and FN in human neuronal precursor cells. ASO Seq. ID No. 218b treatment reduced FN protein, 96 h after gymnotic transfer. Thus, TGF-R.sub.II specific ASO mediates blocking of TGF-.beta. induced fibrotic effects ReNcell CX.RTM. cells.

20.1.2.2 Effects of Gymnotic Transfer after TGF-.beta. Pre-Incubation

[0724] To analyze whether ASO Seq. ID No. 218b is also potent in inhibiting fibrotic effects mediated by TGF-.beta. under pathological conditions, ReNcell CX.RTM. cells were pre-incubated with TGF-.beta. pre-incubation followed by gymnotic transfer for 96 h. Afterwards, determined mRNA levels of CTGF and FN indicate a strong anti-fibrotic effect of ASO Seq. ID No. 218b also after TGF-.beta. induction of CTGF and FN gene expression (Table 63). Immunocytochemical staining for CTGF (FIG. 25A) and FN (FIG. 25B) confirmed data from mRNA analysis. In addition, staining with phalloidin for analysis of actin-cytoskeleton showed an induction of stress-fibers after TGF-.beta. treatment, whereas ASO Seq. ID No. 218b was efficient in blocking TGF-.beta.-mediated stress fiber induction (FIG. 25C).

TABLE-US-00115 TABLE 63 Downregulation of CTGF and FN mRNA after TGF-.beta.1-pre- incubation followed by gymnotic transfer with Seq. ID No. 218b in ReNcell CX .RTM. cells (compared to scrambled control). mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and was then normalized to untreated control. Cell line ReNcell CX mRNA levels after 48 h TGF-.beta.1 -> 96 h TGF-.beta.1 + ASOs/single treatment Target CTGF FN Time point 96 h, n = 3 96 h, n = 3 A 1.00 .+-. 0.04 1.00 .+-. 0.10 B 10 .mu.M 0.85 .+-. 0.01 0.78 .+-. 0.20 C 10 .mu.M 0.70* .+-. 0.25 0.44 .+-. 0.04 E 10 ng/ml 1.60** .+-. 0.15 2.25 .+-. 0.31 E 10 ng/ml + B 10 .mu.M 1.71** .+-. 0.03 4.08*++ .+-. 0.90 .sup. E 10 ng/ml + C 10 .mu.M 1.19++ .+-. 0.04.sup. 1.74++ .+-. 0.61 .sup. A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta., .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion

[0725] ASO Seq. ID No. 218b showed strong anti-fibrotic effects under simulated pathological conditions (TGF-.beta.1 pre-incubation). Aside from downregulation of FN as one main component of ECM, actin-cytoskeleton was also affected by inventive ASO in a manner that may be beneficial for a better outcome in fibrotic diseases.

20.1.3 Results for Seq. ID No. 218c

20.1.3.1 Effects of Gymnotic Transfer

[0726] Gymnotic transfer of ASO Seq. ID No. 218c results in a strong and significant reduction of CTGF mRNA after gymnotic transfer of 10 .mu.M ASO Seq. ID No. 218c (Table 64).

TABLE-US-00116 TABLE 64 Downregulation of CTGF mRNA after gymnotic transfer of Seq. ID No. 218c in ReNcell CX .RTM. cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Cell line ReNcell CX mRNA levels after gymnotic transfer Target CTGF Time point 96 h, n = 3 A 1.00 .+-. 0.10 B 2.5 .mu.M 0.88 .+-. 0.08 B 10 .mu.M 0.89 .+-. 0.07 D 2.5 .mu.M 0.48 .+-. 0.08 D 10 .mu.M 0.17* .+-. 0.02 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. .+-. = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion

[0727] ASO Seq. ID No. 218c was efficient in dose-dependent reduction of CTGF mRNA.

20.1.3.2 Effects of Gymnotic Transfer after TGF-.beta. Pre-Incubation

[0728] Results for gymnotic transfer for ASO Seq. ID 218c followed by TGF-.beta.1 pre-incubation verified an effective blockage of TGF-.beta.1 induced effects on CTGF mRNA levels (Table 65). ASO was such potent in blocking TGF-.beta.1 effect on CTGF that combination treatment is comparable to ASO Seq. ID No. 218c single treatment.

TABLE-US-00117 TABLE 65 CTGF mRNA level after TGF-.beta.1 pre-incubation following gymnotic transfer of Seq. ID No. 218c and parallel TGF- .beta.1 treatment in ReNcell CX .RTM. cells. Data confirmed an effective blocking of TGF-.beta.1 induced effects on CTGF mRNA level by ASO Seq. ID No. 218c in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point ReNcell CX mRNA levels 48 h TGF-.beta.1 -> 96 h TGF-.beta.1 + ASOs/single treatment CTGF Cell line n = 3 A 1.00 .+-. 0.03 B 10 .mu.M 0.85 .+-. 0.01 D 10 .mu.M 0.17* .+-. 0.02 E 10 ng/ml 1.39 .+-. 0.08 E 10 ng/ml + B 10 .mu.M 1.25 .+-. 0.44 E 10 ng/ml + D 10 .mu.M 0.23* .+-. 0.02 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-.beta.1. .+-. = SEM, *p < 0.05 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion

[0729] ASO Seq. ID No. 218c showed a strong downregulation of CTGF mRNA and protein even under artificial pathological conditions (TGF-.beta.1 pre-incubation).

[0730] Taken together, aside from strong anti-fibrotic effects, TGF-R.sub.II specific ASOs showed a modulation of actin-cytoskeleton. Induction of stress fibers may cause an elevation of cell rigidity and stiffness that may play a role e.g. in Alzheimer disease and other Neurodegenerative Disorders. ECM deposition may also mediate fast pathogenic modifications e.g. in primary open angle glaucoma. Thus, reduction of ECM deposition and suppression of stress fiber formation may be profitable for a better prognosis in fibrotic related neurological disorders. Thereby, TGF-R.sub.II specific ASOs are potent therapeutic agents for the treatment e.g. Alzheimer disease and primary open angle glaucoma.

20.2. Pulmonary Fibrosis

Description of Methods

[0731] For investigation of ASO effects to ECM and actin-cytoskeleton in lung, human lung cancer (A549) cells were examined and cultured as described before. For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (50,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (80,000 cells/well) and 8-well cell culture slide dishes (Sarstedt #94.6140.802) (10,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. To investigate a response of A549 cells to TGF-.beta.1 cells were treated after refreshing of medium with TGF-.beta.1 (2 and 10 ng/ml, PromoCell #C63499) for 48 h following mRNA analysis for CTGF. To investigate the ASO effect on CTGF and FN A549 cells, medium was removed and replaced by fresh full medium (1 ml for 6-well and 0.5 ml for 8-x-well). Ref. 1 (scrambled control), ASO Seq. ID No. 218b and Seq. ID No. 218b were then added in medium at concentrations of 2.5 and 10 .mu.M and respective analysis (real-time RT-PCR, Western Blot analysis and Immunocytochemistry) was performed after 72 h in ReNcell CX.RTM. cells. To show possible ASO impact after pre-incubation with TGF-.beta.1, medium was removed and replaced by fresh full medium (1 ml for 6-well dishes and 8-well cell culture slide dishes). Following exposition of TGF-.beta.1 (10 ng/ml, 48 h) medium was changed, TGF-.beta.1 (10 ng/ml), Ref.1 (10 .mu.M), ASO with Seq. ID No. 218b (10 .mu.M) and ASO with Seq. ID No. 218c (10 .mu.M) was added in combination and in single treatment to cells. A549 cells were then harvested 72 h after gymnotic transfer. Therefore, cells were washed twice with PBS and subsequently used for RNA (24-well dishes) and protein isolation (6-well dishes) or immunocytochemical examination of cells (in 8-well cell culture slide dishes). Protocols, used antibodies, dilutions and primers were as described before.

20.2.1 Results of TGF-.beta.1 Effects on Lung Cancer Cells (A549)

[0732] To investigate the ability of A549 cells to react to TGF-.beta.1 exposure, cells were treated for 48 h with TGF-.beta.1 in two different concentrations (Table 66). Evaluation of real-time RT-PCR revealed for CTGF and TGF-.beta.1 itself a dose-dependent induction of gene expression.

TABLE-US-00118 TABLE 66 Induced CTGF and TGF-.beta.1 mRNA expression 48 h after stimulation with TGF-.beta.1 in A549 cells. mRNA expression levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA levels after 48 h TGF-.beta.1 treatment CTGF TGF-.beta.1 Target 48 h, 48 h, Time point n = 3 n = 3 A .sup. 1.00 .+-. 0.23 1.00 .+-. 0.31 E 2 ng/ml .sup. 2.44* .+-. 0.18 1.60 .+-. 0.34 E 10 ng/ml 11.35**++ .+-. 0.52 2.37 .+-. 0.36 A = untreated control, E = TGF-.beta.1. .+-. = SEM, *p < 0.05 and **p < 0.01 in reference to A, ++p < 0.05 in reference to E 2 ng/ml. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparison.

Conclusion

[0733] A549 cells showed a dose-dependent and significant mRNA upregulation of CTGF upon TGF-.beta.1 exposure. In addition, self-induction of TGF-.beta.1 was observed. Taken together, A549 cells are a good model to examine questions addressing TGF-.beta. effects in lung and lung cancer.

20.2.2 Results for Seq. ID No. 218b

20.2.2.1 Results for Effects of Gymnotic Transfer

[0734] Gymnotic transfer of ASO Seq. ID No. 218b causes a dose-dependent and highly significant reduction of CTGF gene expression (Table 67). FN mRNA level was also affected by tested ASO but not dose-dependently. In contrast, staining against FN revealed a dose-dependent reduction of FN in comparison to scrambled control (FIG. 260A). Furthermore, ASO and TGF-.beta. impact on actin-cytoskeleton was examined. FIG. 26B showed an induction of actin-fibers including stress-fiber formation after TGF-.beta.1 treatment in A549 cells in doss-dependent manner, whereas signal after gymnotic transfer of ASO Seq. ID No. 218b in A549 cells was significantly downregulated parallel to recognized reversion of TGF-.beta.1-mediated effects. For protein analysis a proper downregulation of CTGF parallel to an inhibition of pErk1/2 by which CTGF mediates its fibrotic effects could have been shown (Table 68). Furthermore, 72 h after gymnotic transfer of ASO Seq. ID No. 218b a decrease of both ECM main components FN and ColIV was remarkable (Table 68).

TABLE-US-00119 TABLE 67 Dose-dependent and significant downregulation of CTGF mRNA after gymnotic transfer with Seq. ID No. 218b in A549 cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA levels after gymnotic transfer CTGF FN Target 72 h, 72 h, Time point n = 3 n = 3 A 1.00 .+-. 0.08 1.00 .+-. 0.07 B 2.5 .mu.M 0.87 .+-. 0.06 1.08 .+-. 0.02 B 10 .mu.M 0.80 .+-. 0.03 0.87 .+-. 0.08 C 2.5 .mu.M 0.60** .+-. 0.04 0.77 .+-. 0.17 C 10 .mu.M 0.39** .+-. 0.03 0.74 .+-. 0.16 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. .+-. = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

TABLE-US-00120 TABLE 68 Densitometric analysis after CTGF, FN, ColIV and pErk11/2 Western Blot: 72 h after gymnotic transfer with ASO Seq. ID No 218b in A549. Protein level was determined relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Cell line A549 protein levels after gymnotic transfer CTGF FN ColIV pErk1/2 Target 72 h 72 h 72 h 72 h Time point n = 1 n = 1 n = 1 n = 2 A 1.00 1.00 1.00 1.00 .+-. 0.00 B 2.5 .mu.M 0.91 0.89 1.19 1.00 .+-. 0.14 B 10 .mu.M 1.31 0.76 0.87 0.98 .+-. 0.02 C 2.5 .mu.M 0.05 0.81 1.16 0.67 .+-. 0.26 C 10 .mu.M 0.09 0.46 0.65 0.61 .+-. 0.13 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b.

Conclusion

[0735] Gymnotic transfer of Seq. ID No. 218b was efficient in modulating factors which are involved in ECM deposition and actin-cytoskeleton reorganization in human lung cells.

20.2.2.2 Results for Effects of Gymnotic Transfer after TGF-.beta.1 Pre-Incubation

[0736] Results for gymnotic transfer of ASO Seq. ID 218b following TGF-.beta.1 pre-incubation verified an effective blockage of strong TGF-.beta.1 induced effects on CTGF and FN mRNA levels (Table 69). Immunocytochemical staining against CTGF (FIG. 27A) and FN (FIG. 27B) confirmed mRNA detection on protein level.

TABLE-US-00121 TABLE 69 CTGF and FN mRNA level after TGF-.beta.1-pre-incubation following gymnotic transfer of Seq. ID No. 218b and parallel TGF-.beta.1 treatment in A549 cells. Data confirmed an effective blocking of TGF-.beta.1 induced effects on CTGF and FN mRNA levels by ASO Seq. ID No. 218b in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target Time point A549 mRNA levels 48 h TGF-.beta.1 -> 72 h TGF-.beta.1 + ASOs/single treatment CTGF FN Cell line n = 5 n = 3 A 1.00 .+-. 0.22 1.00 .+-. 0.45 B 10 .mu.M 0.89 .+-. 0.19 1.02 .+-. 0.37 C 10 .mu.M 0.52 .+-. 0.05 0.35 .+-. 0.06 E 10 ng/ml 6.92* .+-. 2.32 2.92 .+-. 1.02 E 10 ng/ml + B 10 .mu.M 8.79** .+-. 2.72 2.90 .+-. 0.56 E 10 ng/ml + C 10 .mu.M 2.53 .+-. 0.59 1.18 .+-. 0.28 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, E = TGF-.beta.1. .+-. = SEM, *p < 0.05, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion

[0737] ASO Seq. ID No. 218b was efficient in mediating anti-fibrotic effects in A549 cells under artificial pathological conditions mimicked excessive concentrations of TGF-.beta.1.

20.2.3 Results for Seq. ID No. 218c

20.2.3.1 Results for Effects of Gymnotic Transfer

[0738] Gymnotic transfer of ASO Seq. ID No. 218c mediates a strong dose-dependent and significant reduction of CTGF mRNA 72 h after gymnotic transfer in A549 cells (Table 70).

TABLE-US-00122 TABLE 70 Downregulation of CTGF mRNA 72 h after gymnotic transfer of Seq. ID No. 218c in A549 cells. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Cell line A549 mRNA level after gymnotic transfer CTGF Target 72 h Time point n = 4 A 1.00 .+-. 0.08 B 2.5 .mu.M 0.97 .+-. 0.07 B 10 .mu.M 0.85 .+-. 0.06 D 2.5 .mu.M 0.49** .+-. 0.05 D 10 .mu.M 0.31** .+-. 0.03 A = untreated control, B = Ref. 1, D = Seq. ID No. 218c. .+-. = SEM, **p < 0.01 in reference to A. Statistics were calculated using the Ordinary-one-way-ANOVA followed by "Dunnett's" post hoc comparisons.

Conclusion

[0739] Gymnotic transfer of ASO Seq. ID No. 218c was efficient in reducing mRNA of TGF-.beta. downstream-mediator CTGF.

20.2.2.2 Results for Effects of Gymnotic Transfer after TGF-.beta. Pre-Incubation

[0740] Results for gymnotic transfer for ASO Seq. ID No. 218c following TGF-.beta.1 pre-incubation verified an effective blockage of strong TGF-.beta.1 induced effects on CTGF mRNA levels (Table 71). Immunocytochemical staining against CTGF confirmed these findings on protein level (FIG. 28).

TABLE-US-00123 TABLE 71 CTGF mRNA levels after TGF-.beta.1 pre-incubation followed by gymnotic transfer of Seq. ID No. 218c and parallel TGF-.beta.1 treatment in A549. Data verified an effective blockage of TGF-.beta.1 induced effects on CTGF mRNA levels by ASO Seq. ID No. 218c in comparison to combination treatments. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT- PCR and then normalized to untreated control. Target Time point A549 48 h TGF-.beta.1 -> 72 h TGF-.beta.1 + ASOs/single treatment CTGF Cell line n = 3 A 1.00 .+-. 0.05 B 10 .mu.M 0.86 .+-. 0.11 D 10 .mu.M 0.53 .+-.0.10 E 10 ng/ml 4.71 .+-.1.76 E 10 ng/ml + B 10 .mu.M 5.89* .+-.2.16 E 10 ng/ml + D 10 .mu.M 0.86++ .+-. 0.06.sup. A = untreated control, B = Ref. 1, D = Seq. ID No. 218c, E = TGF-.beta.1. .+-. = SEM, **p < 0.01 in reference to A, ++p < 0.01 in reference to E + B. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" post hoc comparisons.

Conclusion

[0741] ASO Seq. ID 218c was potent in mediating anti-fibrotic effects in A549 cells under artificial pathological conditions mimicked by excessive TGF-.beta.1 concentrations.

[0742] Taken together, ASO Seq. ID 218c is an effective therapeutic agent, because pathology of lung fibrosis could be slowed down by reducing CTGF, FN and ColIV. In addition, stress fiber formation can be reduced effectively by TGF-R.sub.II specific ASO, making inventive ASOs ideal therapeutic agents.

20.3 Effects on Several Cancer Cells

Description of Methods

[0743] For investigation of ASO effects addressing ECM (CTGF, FN, ColIV) cells were used and cultured as described before in standard protocol (Table 10). For treatment, cells were seeded in 24-well culture dishes (Sarstedt #83.1836.300) (30,000 cells/well), 6-well culture dishes (Sarstedt #83.3920.300) (50,000 cells/well) and were incubated overnight at 37.degree. C. and 5% CO.sub.2. To analyze mRNA expression and influence on CTGF, FN and ColIV mRNA and protein levels cells were treated with Ref.1 (Scrambled control) or ASO Seq. ID No. 218b at concentrations of 2.5 and 10 .mu.M and were incubated for 72 h at 37.degree. C. and 5% CO.sub.2. Treatment including medium replacement was repeated 3 times every 72 h (12 days in total). For harvesting, cells were washed twice with PBS and subsequently used for RNA isolation (24-well dishes) or protein isolation (6-well dishes). Protocols for RNA and protein isolation as well as used antibodies and dilutions were performed as described above.

20.3.1 Results for Seq. ID No. 218b

[0744] Anti-fibrotic effects were detected by analysis of CTGF, FN, ColIV mRNA and protein levels. CTGF mRNA (Table 72) was dose-dependently reduced by Seq. ID No. 218b in HT-29, HTZ-19, MCF-7 and THP-1 cells. For KG-1 cells downregulation of TGF-.beta. downstream-mediator was recognized for 2.5 .mu.M ASO Seq. ID No. 218b. For A549, Panc-1 and CaCo2 cells a decrease of FN was demonstrated (Table 73) in accordance to a dose-dependently decline of ColIV mRNA (Table 74) in THP-1, HTZ-19 and L3.6p1 cells (Table 65). Western Blot analysis revealed a strong reduction of CTGF protein in HT-29, MCF-7, TMK-1 and L3.6p1 cells. Result for MCF-7 was significant (Table 75). In addition, phosphorylation of Erk1/2 in A549 and TMK-1 cells was inhibited by ASO Seq. ID No. 218b. pErk1/2 is normally activated by CTGF to induce TGF-.beta. mediated fibrotic effects (Table 76). For FN (A549, MCF-7, HT-29, HTZ-19, HPAFII) and Col IV (A549, HTZ-19, HPAFII, PC3M) (Table 77 and 78), the two main components of ECM, protein levels were minimized by about 50%.

TABLE-US-00124 TABLE 72 mRNA expression of CTGF 12 days after gymnotic transfer of Seq. ID No. 218b in HT-29, HTZ-19, KG1, MCF-7 and THP-1 cells. CTGF mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT- PCR and then normalized to untreated control. Target CTGF mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) HT-29 HTZ-19 KG-1 MCF-7 THP-1 Cell line n = 2 n = 1 n = 1 n = 1 n = 2 A 1.00 .+-. 0.28 1.00 1.00 1.00 1.00 .+-. 0.28 B 2.5 .mu.M 0.68 .+-. 0.11 1.30 0.93 0.99 .+-. 0.68 B 10 .mu.M 0.65 .+-. 0.03 1.20 0.88 0.91 1.15 .+-. 0.34 C 2.5 .mu.M 0.40 .+-. 0.20 0.64 0.24 0.98 .+-. 0.11 C 10 .mu.M 0.33 .+-. 0.19 0.55 0.26 0.22 0.09 .+-. 0.03 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00125 TABLE 73 mRNA expression of FN 12 days after gymnotic transfer of Seq. ID No. 218b in A549, Panc-1 and CaCo2 cells. FN mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real-time RT-PCR and then normalized to untreated control. Target FN mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 Panc-1 CaCo2 Cell line n = 2 n = 1 n = 2 A 1.00 .+-. 0.39 1.00 1.00 .+-. 0.30 B 2.5 .mu.M 0.83 .+-. 0.08 1.29 0.55 .+-. 0.13 B 10 .mu.M 1.00 .+-. 0.76 C 2.5 .mu.M 0.35 .+-. 0.20 0.15 0.73 .+-. 0.54 C 10 .mu.M 0.18 .+-. 0.17 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00126 TABLE 74 mRNA expression of ColIV 12 days after gymnotic transfer of Seq. ID No. 218b in A549, HTZ-19, THP-1, L3.6pl, Panc-1 and CaCo2 cells. ColIV mRNA was decreased after gymnotic transfer of Seq. ID No. 218b for all tested cell lines. mRNA levels were determined relative to housekeeping gene GNB2L1 using quantitative real- time RT-PCR and then normalized to untreated control. Target Col IV mRNA levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 THP-1 HTZ-19 L3.6pl Panc-1 CaCo2 Cell line n = 2 n = 2 n = 1 n = 2 n = 1 n = 2 A 1.00 .+-. 0.00 1.00 .+-. 0.22 1.00 1.00 .+-. 0.20 1.00 1.00 .+-. 0.71 B 2.5 .mu.M 1.18 .+-. 0.31 0.71 .+-. 0.25 0.94 0.83 .+-. 0.09 0.98 1.37 .+-. 0.19 B 10 .mu.M 1.11 .+-. 0.60 0.61 .+-. 0.03 0.91 .+-. 0.29 0.57 2.61 .+-. 0.01 C 2.5 .mu.M 0.84 .+-. 0.02 0.65 .+-. 0.19 0.51 1.14 .+-. 0.13 0.59 1.30 .+-. 0.03 C 10 .mu.M 0.75 .+-. 0.02 0.30 .+-. 0.13 0.69 .+-. 0.05 0.30 0.57 .+-. 0.14 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b, .+-. = SEM, **p < 0.01 in reference to A. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00127 TABLE 75 Densitometric analysis after Western Blotting in HT-29, MCF-7, L3.6pl and TMK-1 cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of CTGF protein by ASO Seq. ID No. 218b could be recognized. Protein levels were determined relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Target CTGF protein levels 12 days after repeated gymnotic transfer (4 .times. 72 h) HT-29 MCF-7 TMK-1 L3.6pl Cell line n = 1 n = 2 n =1 n = 1 A 1.00 .sup. 1.00 .+-. 0.0 1.00 1.00 B 10 .mu.M 1.19 .sup. 1.12 .+-. 0.11 0.85 0.93 C 10 .mu.M 0.50 0.22**++ .+-. 0.03 0.38 0.22 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00128 TABLE 76 Densitometric analysis after Western Blotting in A549 and TMK-1 cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of pErk1/2 protein by ASO Seq. ID No. 218b was determined. Quantification of protein level was done relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Target pErk1/2 protein levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 TMK-1 Cell line n = 1 n =1 A 1.00 1.00 B 10 .mu.M 1.21 1.14 C 10 .mu.M 0.58 0.76 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00129 TABLE 77 Densitometric analysis after Western Blotting in A549, MCF-7, HT- 29, HTZ-19 and HPAFII cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of FN protein by ASO Seq. ID No. 218b was determined. Quantification of protein level was done relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Target FN protein levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 MCF-7 HT-29 HTZ-19 HPAFII Cell line n = 1 n = 2 n = 1 n = 1 n = 1 A 1.00 1.00 .+-. 0.22 1.00 1.00 1.00 B 10 .mu.M 1.10 1.08 .+-. 0.25 0.81 1.20 1.12 C 10 .mu.M 0.56 0.69 .+-. 0.18 0.40 0.83 0.56 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

TABLE-US-00130 TABLE 78 Densitometric analysis after Western Blotting in A549, MCF-7, HT-29, HTZ-19 and HPAFII cells 12 days after gymnotic transfer of Seq. ID No. 218b. Downregulation of FN protein by ASO Seq. ID No. 218b was determined. Protein levels were analyzed relative to housekeeping gene alpha-Tubulin using Image Studio .TM. Lite Software and was then normalized to untreated control. Target Col IV protein levels 12 days after repeated gymnotic transfer (4 .times. 72 h) A549 HTZ-19 HPAFII PC3M Cell line n = 1 n = 1 n = 1 n = 1 A 1.00 1.00 1.00 1.00 B 10 .mu.M 1.31 1.01 1.05 1.07 C 10 .mu.M 0.61 0.36 0.76 0.43 A = untreated control, B = Ref. 1, C = Seq. ID No. 218b. Statistics was calculated using the Ordinary-one-way-ANOVA followed by "Tukey's" multiple post hoc comparisons.

Conclusion

[0745] Increased deposition of ECM mediated by TGF-.beta.1, through its downstream-mediator CTGF, could be efficiently reversed by TGF-R.sub.II specific inventive ASOs in different tumor cell lines. A reduced level of ECM components could contribute to a less aggressive in tumor progression. Taken together, tested ASOs may demonstrate a new therapeutic strategy in different fibrosis-associated diseases.

Example 21: Threshold for Toxicity of Inventive ASOs by Chronic Intracerebroventricular Administration Using a Dose-Escalation Paradigm in Cynomolgus

[0746] To evaluate the ideal dose range for the GLP-toxicity study, a pre-experiment using chronic intracerebroventricular (icv) antisense-oligonucleotide (ASO) administration with escalating doses was performed in Cynomolgus monkeys. During the administration paradigm animals were monitored for immunological, hematological and physiological alterations.

Description of Method:

[0747] For chronic central ASO infusion in male and female Cynomolgus monkeys, a gas-pressure pump (0.25 ml/24 h, Tricumed-IP 2000V.RTM.) connected to a silicone catheter, targeting the right lateral ventricle was implanted subcutaneously under ketamine/xylacin anesthesia and semi-sterile conditions. A single male and a single female monkey were used for each treatment condition (Seq. ID No. 218b, Seq. ID No. 218c, concentrations given in Table 79). Each pump was implanted subcutaneously in the abdominal region via a 10 cm long skin incision at the neck of the monkey and was connected with the icy cannula by a silicone catheter. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, monkeys were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 1 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing and the resp. pump was filled with the respective treatment solution. ASO infusion periods (1 week for each dose) were interrupted by a one-week wash out period with 0.9% NaCl being administered exclusively. During the entire administration paradigm body weight development and food consumption were monitored. Further, blood and CSF samples were taken once a week to determine hematological as well as immunological alterations but also systemic ASO concentrations. On the last day, animals were sacrificed, and organs (liver, kidneys, brain) were removed, and analyzed for proliferation, apoptosis, mRNA knock down, and tumor formation.

TABLE-US-00131 TABLE 79 Experimental design and the doses of ASOs given during the 7-week administration paradigm. Week Week Week Week Week Week Week Treatment condition 1 2 3 4 5 6 7 Seq. ID No. 218b 0.048 0.9% 0.24 0.9% 1.2 0.9% 6 mM NaCl mM NaCl mM NaCl mM Seq. ID No 218c 0.048 0.9% 0.24 0.9% 1.2 0.9% 6 mM NaCl mM NaCl mM NaCl mM

Conclusion:

[0748] All tested, inventive ASOs were at least non-toxic in weeks 1-6 and were therefore used for further research and toxicological examination. However, infusion of antisense-oligonucleotides Seq. ID No. 214, Seq. ID No. 138b, Seq. ID No. 172b as well as Ref. 0 and Ref. 5. resulted in toxic effects early in the above scheme. Therefore, these antisense-oligonucleotides are not suitable as therapeutic agent and were not used for further studies.

Example 22: Determination of Behavioral and Physiological Abnormalities Following Central Antisense-Oligonucleotide Administration

[0749] The goal of this study was to investigate the effects of a single intracerebroventricular (icv) antisense-oligonucleotide administration on neurological and resulting behavioral parameters in rats.

Description of Method:

[0750] Stereotaxic procedures were performed under ketamine/xylacin anesthesia and semi-sterile conditions. Following surgery, rats had two days for recovery.

Implantation of Icv Guide Cannula

[0751] Animals were placed into a stereotaxic frame, and the guide cannula (12 mm) was implanted 2 mm above the left lateral ventricle (coordinates relative to bregma: 1.0 mm posterior, -1.6 mm lateral to midline, 1.8 mm beneath the surface of the skull. The guide cannula was anchored to two stainless steel screws using dental acrylic cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany) and was closed with a dummy cannula. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, mice were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 0.1 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany).

ICV Infusion

[0752] Slightly restrained rats received an icy infusion of either ASO (2 .mu.M/5 .mu.l, 10 .mu.M/5 .mu.l, 50 .mu.M/5 .mu.l, 250 .mu.M/5 .mu.l) or vehicle (5 .mu.l, 0.9% NaCl, pH 7.4, Braun) using a 27-gauge cannula, which extended 2 mm beyond the guide cannula and remained in place for 30 s to allow diffusion. Rats were monitored 15, 30, 60 and 120 minutes following icy administration for behavioral reactions, motor activity, CNS excitation, posture, motor coordination, muscle tone, reflexes, and body temperature.

Verification of Cannula and Microdialysis Probe Placement

[0753] After scarification, brains were removed, snap frozen and stored at -80.degree. C. until analyzation. Histological verification of the icy implantation sites was performed at 40-.mu.m coronal, cresyl violet-stained brain sections.

[0754] The present results demonstrate a single ASO (for both sequences Seq. ID No. 218b, Seq. ID No. 218c) icy administration, for different doses, to be a safe and secure technique in rats due to no effects on neurological parameters.

Example 23: Determination of the Ideal Dose Range for the Cynomolgus GLP-Toxicity Study (Pre-Toxicity Experiment in Rats)

[0755] To investigate any general toxicological effects of a daily intravenous (iv) antisense-oligonucleotide (ASO) administration, and to localize the perfect dose-range for the GLP-pre-toxicity study in rats, a pre-toxicity experiment in rats was performed.

Description of Method:

[0756] For repeated intravenous ASO injection 20 male and 20 female rats were divided into four treatment groups, a vehicle group, an ASO.sub.low, an ASO.sub.intermediate, and an ASO.sub.high group. This paradigm was performed for Seq. ID No. 218b and Seq. ID No. 218c. Rats received a daily iv bolus ASO injection for 15 consecutive days. Rats were monitored for mortality (twice daily), clinical symptoms (once daily, bod weight development (weekly), food consumption (weekly). On day 15 of the experimental paradigm, animals were sacrificed, organs (liver, kidney, brain) were removed and trunk blood was collected. Afterwards tissues and blood was analyzed for immunological and hematological alterations.

[0757] The results of the present study demonstrate the two ASOs Seq. ID No. 218b and Seq. ID No. 218c to be a safe medication for a variety of different disorders with no toxic effects when administered at low and intermediate doses.

Example 24: Determination of any General Toxicological Effects by Repeated Intravenous Antisense-Oligonucleotide Injection

[0758] The goal of this study was to investigate at which dose a daily intravenous (iv) antisense-oligonucleotide (ASO) administration exerts any general toxicological effects in rats.

Description of Method:

[0759] For repeated intravenous ASO injection 80 male and 80 female rats were divided into four treatment groups, a vehicle group, an ASO.sub.low, an ASO.sub.intermediate, and an ASO.sub.high group. Rats received a daily iv bolus ASO injection for 29 consecutive days. Rats were monitored for mortality (twice daily), clinical symptoms (once daily, bod weight development (weekly), food consumption (weekly). On day 29 of the experimental paradigm, animals were sacrificed, organs (liver, kidney, brain) were removed and trunk blood was collected. In addition, bone marrow smears were collected. Afterwards tissues and blood was analyzed for immunological and hematological, and histopathological alterations.

[0760] The results of the present study demonstrate the two ASOs Seq. ID No. 218b and Seq. ID No. 218c to be a safe medication for a variety of different disorders with no toxic effects when administered at low and intermediate doses.

Example 25: Determination of the Toxicological Properties of a Chronic Central Antisense-Oligonucleotide Administration in Cynomolgus Monkeys

[0761] To determine the effective, and to identify the toxic dose, male and female Cynomolgus monkeys received different doses of an inventive antisense-oligonucleotide (ASO) by chronic intracerebroventricular administration. During the administration paradigm, animals were monitored for immunological, hematological and physiological alterations.

Description of Method:

[0762] For chronic central ASO infusion in male and female Cynomolgus monkeys, a gas-pressure pump (0.25 ml/24 h, Tricumed IP-2000V.RTM.) connected to a silicone catheter, targeting the right lateral ventricle, was implanted subcutaneously under ketamine/xylacin anesthesia and semi-sterile conditions. Three male and three female monkeys were used for each treatment condition (vehicle, ASO.sub.low, ASO.sub.high, concentrations given in Table 79). Further, for investigating the timeframe for recovery, two male and two female monkeys (vehicle, and ASO.sub.high) were sacrificed four weeks after ASO administration was terminated. Each pump was implanted subcutaneously in the abdominal region via a 10 cm long skin incision at the neck of the monkey and connected with the icy cannula by a silicone catheter. Animals were placed into a stereotaxic frame, and the icy cannula was lowered into the right lateral ventricle. The cannula was fixed with two stainless steel screws using dental cement (Kallocryl, Speiko.RTM.-Dr. Speier GmbH, Munster, Germany). The skin of the neck was closed with sutures. During surgery, the body temperature was maintained by a heating pad. To avoid post-surgical infections, monkeys were locally treated with Betaisodona.RTM. (Mundipharma GmbH, Limburg, Germany) and received 1 ml antibiotics (sc, Baytril.RTM. 2.5% Bayer Vital GmbH, Leverkusen, Germany). The tubing was filled with the respective treatment solution. During the entire administration paradigm body weight development and food consumption was monitored. Further, blood and aCSF samples were taken once a week to determine hematological as well as immunological alterations but also systemic ASO concentrations. On the last day, animals of the main study were sacrificed, and organs (liver, kidneys, brain) were removed, and analyzed for proliferation, apoptosis, mRNA knock down, and tumor formation. After week 57, the additional animals used for investigating recovery periods were also sacrificed and the same read out parameters were determined.

TABLE-US-00132 TABLE 80 Treatment conditions and the animals per group for the 4-week GLP- toxicity study and for the additional 4-week recovery period. Treatment Main study 4-week recovery period condition Males [n] Females [n] Males [n] Females [n] Vehicle 3 3 2 2 ASO.sub.low 3 3 / / ASO.sub.high 3 3 2 2

[0763] The results of the present study demonstrate a chronic intracerebroventricular ASO administration to be a non-toxic and safe medication for the treatment of a variety of different diseases.

Example 26: Determination of the Stability and the Biological Activity of an Antisense-Oligonucleotide in Different Vehicle Solutions

[0764] To investigate, whether there are any interaction effects of the antisense-oligonucleotides (Seq. ID No. 218b, Seq. ID No. 218c) and the infusion solution, a 29-day pre-experiment was performed. Therefore, the two ASOs were reconstituted in different endotoxin-free vehicle solutions (PBS, water for injection [WFI], 0.9% NaCl) and stored at different conditions, respectively. Samples were collected every single week and were analyzed for pH-value, ASO stability, content, and integrity by AEX-HPLC. Any change in efficacy conditions were tested by proving the potency of TGF-RII mRNA knockdown in cell-culture assay with each sample, respectively.

Description of Method:

[0765] The lyophilized ASOs were diluted with the respective vehicle solution (Water for injection, 0.9% NaCl, PBS) under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience.RTM., 51 conditions). The 1.5 ml Eppendorf Cups were labeled and filled with 100 .mu.l (AEX-HPLC) or 250 .mu.l (target knock down) of the respective ASO solution (all steps under laminar flow, BIOWIZARD Golden GL-170 Ergoscience.RTM., 51 conditions, see pipetting/labeling scheme table 81). In the next step, all samples were stored at their respective storing conditions and samples were collected every single week (see sampling scheme table 82) and stored at -80.degree. C. until analyzation.

TABLE-US-00133 TABLE 81 Labeling scheme for the ASO-vehicle-stability study. The labeling scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 10 .mu.M and 0.24 mM) and for all three vehicles WFI, 0.9% NaCl, and PBS (=>12 different schemes). Day Vehicle (WFI, 0.9% NaCL Label or PBS) Condition 0 6 12 18 24 29 ASO X Baseline ASO [10 .mu.M] [10 X_Baseline .mu.M] ASO X -20.degree. C. ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] [10 X_-20.degree. X_-20.degree. X_-20.degree. X_-20.degree. X_-20.degree. .mu.M] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +4.degree. C. ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] [10 X_+4.degree. X_+4.degree. X_+4.degree. X_+4.degree. X_+4.degree. .mu.M] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +20.degree. C. ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] [10 X_+20.degree. X_+20.degree. X_+20.degree. X_+20.degree. X_+20.degree. .mu.M] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +37.degree. C. ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] [10 X_+37.degree. X_+37.degree. X_+37.degree._Day X_+37.degree._Day X_+37.degree. .mu.M] C._Day 6 C._Day 12 18 24 C._Day 29 ASO X +40.degree. C. ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] ASO [10 .mu.M] [10 X_40.degree. X_40.degree. X_40.degree. X_40.degree. X_40.degree. .mu.M] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X pH value ASO [10 .mu.M] ASO [10 .mu.M] [10 X_pH X_pH .mu.M] value_Day 0 value_Day 29 ASO X Baseline ASO [0.24 mM] [0.24 X_Baseline mM] ASO X -20.degree. C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_-20.degree. X_-20.degree. X_-20.degree. X_-20.degree. X_-20.degree. mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +4.degree. C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+4.degree. X_+4.degree. X_+4.degree. X_+4.degree. X_+4.degree. mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +20.degree. C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+20.degree. X_+20.degree. X_+20.degree. X_+20.degree. X_+20.degree. mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X +37.degree. C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_+37.degree. X_+37.degree. X_+37.degree._Day X_+37.degree._Day X_+37.degree. mM] C._Day 6 C._Day 12 18 24 C._Day 29 ASO X +40.degree. C. ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] ASO [0.24 mM] [0.24 X_40.degree. X_40.degree. X_40.degree. X_40.degree. X_40.degree. mM] C._Day 6 C._Day 12 C._Day 18 C._Day 24 C._Day 29 ASO X pH value ASO [0.24 mM] ASO [0.24 mM] [0.24 X_pH X_pH_value_Day mM] value Day 0 29

TABLE-US-00134 TABLE 82 Collection scheme for the ASO-vehicle-stability study. The collection scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 10 .mu.M and 0.24 mM) and for all three vehicles WFI, 0.9% NaCl, and PBS (=>12 different schemes). Sample Day Condition 0 6 12 18 24 29 Baseline X -20.degree. C. X X X X X +4.degree. C. X X X X X +20.degree. C. X X X X X +37.degree. C. X X X X X +40.degree. C. X X X X X pH value X X

[0766] Since there were no effects of any of the vehicle solutions on stability, content, and integrity of Seq. ID No. 218b and Seq. ID No. 218c, 0.9% NaCl was used for the ASO-in use-stability experiment.

Example 27: Determination of the In-Use Stability and the Biological Activity of Inventive Antisense-Oligonucleotides (ASOs) in Vehicle Solution

[0767] To investigate, whether there are any interaction effects of the antisense oligonucleotides (ASO) (Seq. ID No. 218b, Seq. ID No. 218c) and a gas pressure pump or a catheter, a 29-day pre-experiment was performed. Therefore, the two ASOs were reconstituted in 0.9% NaCl and the pump and the catheter were filled according to manufacturer's description. Samples were collected every single week and were analyzed for pH-value, microbiology, and oligo stability, content, and integrity by AEX-HPLC. Any change in efficacy conditions were also tested by proofing the potency to knockdown TGF-R.sub.II mRNA in cell-culture assay with every sample, respectively.

Description of Method:

[0768] The lyophilized ASOs were diluted with 0.9% NaCl under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience.RTM., 51 conditions). The 5 ml Eppendorf Cups were labeled according to the labeling scheme (see table 83) under sterile conditions (laminar flow, BIOWIZARD Golden GL-170 Ergoscience, 51 conditions). The two gas pressure pumps (Tricumed Model IP-2000 V.RTM.) and the catheter (spinal catheter set 4000) were filled according to manufacturer's description with the respective ASO solution (all steps under laminar flow, BIOWIZARD Golden GL-170 Ergoscience.RTM., 51 conditions, see pipetting/labeling scheme table 83). In the next step, the pump connected to the catheter which was connected to the lid of a 5 ml Eppendorf Cup and the remaining Cups were stored in a storage box with all openings being closed with Parafilm.RTM., to avoid any contamination. Every single week the samples were collected, stored at -80.degree. C. until analysis and the catheter connected to the lid of a 5 ml Eppendorf Cup was transferred to the following Cup to continue the sampling procedure. In addition, one sample was taken directly from the pump via the bolus port and stored at -80.degree. C. On the last day, an additional sample for microbiological analysis was collected.

TABLE-US-00135 TABLE 83 Labeling scheme for the ASO in-use-stability study. The labeling scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (each 0.24 mM). Day Sample Con- Oligo Cup dition 0 6 12 18 24 29 Seq. ID No. 5 ml PS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218b [0.24 No. 218b No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. mM] [10 .mu.M] PS_Day 6 PS_Day 12 PS_Day 18 PS_Day 24 PS_Day 29 Baseline Seq. ID No. 5 ml AS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218b [0.24 No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. No. 218b_+37.degree. C. mM] AS_Day 6 AS_Day 12 AS_Day 18 AS_Day 24 AS_Day 29 Seq. ID No. 5 ml MB Seq. ID 218b [0.24 No. 218b_+37.degree. C. mM] MB_Day 29 Seq. ID No. 5 ml pH Seq. ID Seq. ID 218b [0.24 value No. 218b No. 218b mM] pH value pH value Day 0 Day 29 Seq. ID No. 5 ml PS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218c [0.24 No. 218c No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. mM] Baseline PS_Day 6 PS_Day 12 PS_Day 18 PS_Day 24 PS_Day 29 Seq. ID No. 5 ml AS Seq. ID Seq. ID Seq. ID Seq. ID Seq. ID 218c [0.24 No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. No. 218c_+37.degree. C. mM] AS_Day 6 AS_Day 12 AS_Day 18 AS_Day 24 AS_Day 29 Seq. ID No. 5 ml MB Seq. ID 218c [0.24 No. 218c_+37.degree. C. mM] MB_Day 29 Seq. ID No. 5 ml pH Seq. ID Seq. ID 218c [0.24 value No. 218c No. 218c mM] pH value pH value Day 0 Day 29 PS: (PumpSample: sample directly from the catheter), AS: (AdditionalSample: sample directly from the reservoir inside the pump via bolus port, MB: (MicroBiology: 500 .mu.M from PS and AS)

TABLE-US-00136 TABLE 84 Collection scheme for the ASO in-use-stability study. The collection scheme was performed for Seq. ID No. 218b and Seq. ID No. 218c (0.24 mM). Sample Day Cup Condition 0 6 12 18 24 29 5 ml Baseline X 5 ml PS X X X X X 5 ml AS X X X X X 5 ml MB X 5 ml pH value X X PS: (PumpSample: sample directly from the catheter), AS: (AdditionalSample: sample directly from the reservoir inside the pump via bolus port, MB: (MicroBiology: 500 .mu.M from PS and AS)

[0769] Since there were no effects of the pump and the catheter on the stability, content, and integrity of Seq. ID No. 218b and Seq. ID No. 218c, and there were also no noticeable microbiological problems, this application paradigm represents the optimal technique for the intrathecal and intracerebroventricular administration in Cynomolgus monkeys and humans.

Chemical Synthesis

Abbreviations

[0770] Pybop: (Benzotriazol-1-yl-oxy)tripyrrolidinophosphonium-hexafluorophosphat

DCM: Dichloromethane

DMF: Dimethylformamide

DMAP: 4-Dimethylaminopyridine

[0771] DMT: 4,4'-dimethoxytrityl

LCAA: Long Chain Alkyl Amino

[0772] TRIS: Tris(hydroxymethyl)-aminomethan TRIS-HCl: Tris(hydroxymethyl)-aminomethan hydrochloride DEPC: Diethyl dicarbonate

Gapmer Antisense-Oligonucleotide Synthesis and Purification

[0773] The antisense-oligonucleotides in form of gapmers were assembled on an ABI 3900 or on an ABI 394 synthesizer, or on an Expedite.TM. (Applied Biosystems) according to the phosphoramidite oligomerization chemistry. On the ABI3900, the solid support was polystyrene loaded with UnySupport (purchased from Glen Research, Sterling, Va., USA) to give a synthesis scale of 0.2 .mu.mol. On the ABI 394 the solid support was 500 A controlled pore glass (CPG) loaded with Unylinker.TM. purchased from Chemgenes (Wilmington, Mass., USA) to give a 3 .mu.mol synthesis scale.

[0774] Ancillary synthesis reagents such as "Deblock", "Oxidizer", "CapA" and "CapB" as well as DNA phosphoramidites were obtained from SAFC Proligo (Hamburg, Germany). Specifically, 5'-O-(4,4'-dimethoxytrityl)-2'-O,3'-O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite monomers of deoxy thymidine (dT), 4-N-benzoyl-2'-deoxy-cytidine (dC.sup.Bz), 6-N-benzoyl-2'-deoxy-adenosine (dA.sup.Bz) and 2-N-isobutyryl-2'-deoxy-guanosine (dG.sup.iBu) were used as DNA building-units. 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethylformamidine-guanosine-3'-(2-- cyanoethyl-N,N-diisopropyl)phosphoramidite (LNA-G.sup.DMF), 5'-O-DMT-2'-O,4'-C-methylene-thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (LNA-Tb), 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (LNA-A.sup.Bz), 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (LNA-C*.sup.Bz) were used as LNA-building-units. The LNA phosphoramidites were purchased from Exiqon (Vebaek, Denmark).

[0775] As shown by the examples of the LNAs in table 85, the phosphoramidites were dissolved in dry acetonitrile to give 0.07 M-oligonucleotide except LNA-C*.sup.Bz which was dissolved in a mixture of THF/acetonitrile (25/75 (v/v)).

TABLE-US-00137 TABLE 85 To obtain Molecular a 0.07M weight solution g/mole CAS No. Solvent 100 mg LNA-A.sup.Bz 885.9 [206055-79-0] Anhydrous 1.6 ml Acetonitrile LNA-C*.sup.Bz 875.9 [206055-82-5] THF/Acetonitrile 1.6 ml 25/75 (v/v) LNA-G.sup.DMF 852.9 [709641-79-2] Anhydrous 1.7 ml Acetonitrile LNA-T 772.8 [206055-75-6] Anhydrous 1.8 ml Acetonitrile

[0776] The .beta.-D-thio-LNAs 5'-O-DMT-2'-deoxy-2'-mercapto-2'-S,4'-C-methylene-N.sup.6-benzoyladenosin- e-3'-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite, 5'-O-DMT-2'-deoxy-2'-mercapto-2'-S,4'-C-methylene-5-methyl-N.sup.4-benzoy- lcytidine-3'-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites, 5'-O-DMT-2'-deoxy-2'-mercapto-2'-S,4'-C-methylene-N.sup.2-dimethyformamid- ineguanosine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-O-DMT-2'-deoxy-2'-mercapto-2'-S,4'-C-methylene-thymidine-3'-[(2-cyanoe- thyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-O-DMT-2'-deoxy-2'-amino-2'-N,4'-C-methylene-N.sup.6-benzoyladenosine-3- '-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites were synthesized as described in J. Org. Chem. 1998, 63, 6078-6079.

[0777] The synthesis of the .beta.-D-amino-LNA 5'-O-DMT-2'-deoxy-2'-amino-2'-N,4'-C-methylene-5-methyl-N.sup.4-benzoylcy- tidine-3'-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidites, 5'-O-DMT-2'-deoxy-2'-amino-2'-N,4'-C-methylene-N.sup.2-dimethyformamidine- guanosine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-O-DMT-2'-deoxy-2'-amino-2'-N,4'-C-methylene-thymidine-3'-[(2-cyanoethy- l)-(N,N-diisopropyl)]-phosphoramidite, 5'-O-DMT-2'-deoxy-2'-methylamino-2'-N,4'-C-methylene-N.sup.6-benzoyladeno- sine-3'-[(2-cyanoethyl-N,N-diisopropyl)]-phosphoramidite, and 5'-O-DMT-2'-deoxy-2'-methylamino-2'-N,4'-C-methylene-5-methyl-N.sup.4-ben- zoylcytidine-3'-(2-cyanoethyl-N,N-diisopropyl)phosphoramidites, 5'-O-DMT-2'-deoxy-2'-methylamino-2'-N,4'-C-methylene-N.sup.2-dimethyforma- midineguanosine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite 5'-O-DMT-2'-deoxy-2'-methylamino-2'-N,4'-C-methylene-thymidine-3'-[(2-cya- noethyl)-(N,N-diisopropyl)]-phosphoramidite were carry out according to the literature procedure (J. Org Chem. 1998, 63, 6078-6079).

[0778] The .alpha.-L-oxy-LNAs .alpha.-L-5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cya- noethyl-N,N-diisopropyl)phosphoramidite, .alpha.-L-5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-- 3'-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite, .alpha.-L-5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosin- e-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and .alpha.-L-5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-[(2-cyanoethyl)-(N,N-- diisopropyl)]-phosphoramidite were performed similar to the procedures described in the literature (J. Am. Chem. Soc. 2002, 124, 2164-2176; Angew. Chem. Int. Ed. 200, 39, 1656-1659).

[0779] The (.beta.-benzoylmercapto)ethyl)pyrrolidinolthiophosphoramidites for the synthesis of the oligonucleotide with phosphorothioate backbone were prepared in analogy to the protocol reported by Caruthers (J. Org. Chem. 1996, 61, 4272-4281).

[0780] The "phosphoramidites-C3" (3-(4,4'-Dimethoxytrityloxy)propyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-p- hosphoramidite and the T-Spacer "3 CPG" (1-Dimethoxytrityloxy-propanediol-3-succinoyl)-long chain alkylamino-CPG were purchased from Glen Research.

General Procedure

Preparation of the LNA-Solid Support:

1) Preparation of the LNA Succinyl Hemiester (WO2007/112754)

[0781] 5'-O-DMT-3'-hydroxy-nucleoside monomer, succinic anhydride (1.2 eq.) and DMAP (1.2 eq.) were dissolved in 35 ml dichloromethane (DCM). The reaction was stirred at room temperature overnight. After extractions with NaH.sub.2PO.sub.4 0.1 M pH 5.5 (2.times.) and brine (1.times.), the organic layer was further dried with anhydrous NaSO.sub.4 filtered and evaporated. The hemiester derivative was obtained in 95% yield and was used without any further purification.

2) Preparation of the LNA-Support (WO2007/112754)

[0782] The above prepared hemiester derivative (90 .mu.mol) was dissolved in a minimum amount of DMF, DIEA and pyBOP (90 .mu.mol) were added and mixed together for 1 min. This pre-activated mixture was combined with LCAA-CPG (500 .ANG., 80-120 mesh size, 300 mg) in a manual synthesizer and stirred. After 1.5 hours at room temperature, the support was filtered off and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 .mu.mol/g (see Tom Brown, Dorcas J. S. Brown. Modern machine-aided methods of oligodeoxyribonucleotide synthesis. In: F. Eckstein, editor. Oligonucleotides and 35 Analogues A Practical Approach. Oxford: IRL Press, 1991: 13-14).

Elongation of the Oligonucleotide (Coupling)

[0783] 5-ethylthio-1H-tetrazole (ETT) as activator (0.5 M in acetonitrile) was employed for the coupling of the phosphoramidites. Instead of ETT other reagents such as 4,5-dicyanoimidazole (DCI) as described in WO2007/112754, 5-benzylthio-1H-tetrazole or saccharin-1-methylimidazol can be used as activator. 0.25 M DCI in acetonitrile was used for the coupling with LNA.

Capping

[0784] 10% acetic anhydride (Ac.sub.2O) in THF (HPLC grade) and 10% N-methylimidazol (NMI) in THF/pyridine (8:1) (HPLC grade) were added and allowed to react.

Oxidation

[0785] Phosphorous(III) to Phosphorous(V) is normally done with e.g. iodine/THF/pyridine/H.sub.2O using 0.02 M iodine in THF/Pyridine/H.sub.2O purchased from Glen Research or 0.5 M 1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO) in anhydrous acetonitrile from Glen Research.

[0786] In the case that a phosphorthioate internucleoside linkage is prepared, a thiolation step is performed using a 0.05 M solution of 3-((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (1:1 v/v). In case LNAs are used, the thiolation was carried out using 0.2 M 3,H-1,2-benzothiole-3-one 1,1-dioxide (Beaucage reagent) in anhydrous acetonitrile.

[0787] In general, the thiolation can also be carried out by using xanthane chloride (0.01 M in acetonitrile/pyridine 10%) as described in WO2007/112754.

[0788] Alternative, other reagents for the thiolation step such as xanthane hydride (5-imino-(1,2,4)dithiazolidine-3-thione), phenylacetyl disulfide (PADS) can be applied.

[0789] In the case that a phosphordithioate was synthesized, the resulting thiophosphite triester was oxidized to the phosphorothiotriester by addition of 0.05 M DDTT (3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione) in pyridine/acetonitrile (4:1 v/v).

Cleavage from the Solid Support and Deprotection

[0790] At the end of the solid phase synthesis, the antisense-oligonucleotide can either be cleaved "DMT-on" or "DMT-off". "DMT off" means that the final 5'-O-(4,4'-dimethoxytrityl) group was removed on the synthesizer using the "Deblock" reagent and DMT-on means that the group is present while the oligonucleotide is cleaved from the solid support. The DMT groups were removed with trichloroacetic acid.

"DMT-Off"

[0791] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone. Subsequently, the antisense-oligonucleotides were cleaved from the solid support and deprotected using 1 to 5 mL concentrated aqueous ammonia (obtained from Sigma Aldrich) for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0792] If the oligonucleotides contain phosphorodithioate triester, the thiol-groups were deprotected with thiophenol:triethylamine:dioxane, 1:1:2, v/v/v for 24 h, then the oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature, and further deprotected for 4 hours at 65.degree. C.

"DMT-On"

[0793] The oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature, and further deprotected for 4 hours at 65.degree. C. The oligonucleotides were purified by reverse phase HPLC (RP-HPLC), and then the DMT-group is removed with trichloroacetic acid.

[0794] If the oligonucleotides contain phosphorodithioate triester, the cleavage from the solid-support and the deprotection of the thiol-group were performed by the addition of 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h.

Terminal Groups

Terminal Groups at the 5'-End of the Antisense Oligonucleotide

[0795] The solid supported oligonucleotide was treated with 3% trichloroacetic acid in dichloromethane (w/v) to completely remove the 5'-DMT protection group. Further, the compound was converted with an appropriate terminal group with cyanoethyl-N,N-diisopropyl)phosphoramidite-moiety. After the oxidation of the phosphorus(III) to phosphorus(V), the deprotection, detachment from the solid support and deprotection sequence were performed as described above.

Purification

[0796] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. Analytics

[0797] Identity of the antisense-oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS) and purity was by analytical OligoPro Capillary Electrophoresis (CE).

[0798] The purification of the dithioate was performed on an Amersham Biosciences P920 FPLC instrument fitted with a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 28

TABLE-US-00138

[0799] (Seq. ID No. 209y) Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1s C*b.sup.1

[0800] 5'-O-DMT-2'-O,4'-C-methylene-5-methyl-N.sup.4-benzoxylcytidine-3'-O- -succinoyl-linked LCAA CPG (0.2 .mu.mol was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0801] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0802] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0803] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0804] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0805] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0806] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0807] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0808] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0809] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0810] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0811] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0812] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0813] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0814] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0815] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[0816] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0817] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. The antisense oligonucleotide was received with a purity of 93.7%. ESI-MS: experimental: 5387.3 Da; calculated: 5387.80 Da.

Example 29

TABLE-US-00139

[0818] (Seq. ID No. 209u) Gb.sup.1Tb.sup.1dAdGdTdGdTdTdTdAdGdGdGAb.sup.1Gb.sup.1C*b.sup.1

[0819] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 28. After the capping step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 95.3%. ESI-Ms: experimental: 5146.80 Da; calculated: 5146.4 Da.

Example 30

TABLE-US-00140

[0820] (Seq. ID No. 209v) /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsA b.sup.1sGb.sup.1sC*b.sup.1

[0821] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 28. After purification, the antisense oligonucleotide was received with a purity of 97.4%. HRMS (ESI): experimental: 5540.70 Da; calculated: 5541.4 Da.

Example 31

TABLE-US-00141

[0822] (Seq. ID No. 209w) Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1sGb.sup.1s C*b.sup.1/3SpC3s/

[0823] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-[(2-cya- noethyl-N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 28. After purification, the antisense oligonucleotide was received with a purity of 92.7%. ESI-sMS: experimental: 5541.70 Da; calculated: 5541.4 Da.

Example 32

TABLE-US-00142

[0824] (Seq. ID No. 209an) Gb.sup.1ssTb.sup.1ssAb.sup.1ssdGssdTssdGssdTssdTssdTssdA*ssdGssdGs sdGssAb.sup.1ssGb.sup.1ssC*b.sup.1

[0825] 5'-O-DMT-2'-O,4'-C-methylene-5-methyl-N.sup.4-benzoxylcytidine-3'-O- -succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(.be- ta.-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0826] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-[(.beta.-benzoyl- mercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0827] The further elongation of the oligonucleotide was performed in the same way.

[0828] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[0829] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 33

TABLE-US-00143

[0830] (Seq. ID No. 209az) Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsGbsAb.sup.1sGb.sup.1- s C*b.sup.1

[0831] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 90.5%. ESI-MS: experimental: 5442.9 Da; calculated: 5443.3 Da.

Example 34

TABLE-US-00144

[0832] (Seq. ID No. 209ba) Gb.sup.1sTb.sup.1sAb.sup.1sGb.sup.1sdTsdGsdTsdTsdTsdAsdGsdGsGb.sup.1sAb.su- p.1sG b.sup.1sC*b.sup.1

[0833] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 89.4%. ESI-MS: experimental: 5469.9 Da; calculated: 5471.3 Da.

Example 35

TABLE-US-00145

[0834] (Seq. ID No. 209bb) Gb.sup.1sTb.sup.1sAb.sup.1sdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsdAsGb.sup.1s C*b.sup.1

[0835] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28. After purification, the antisense oligonucleotide was received with a purity of 88.4%. ESI-MS: experimental: 5386.5 Da; calculated: 5387.3 Da.

Example 36

TABLE-US-00146

[0836] (Seq. ID No. 209s) Gb.sup.1Tb.sup.1dAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsAb.sup.1Gb.sup.1C*b.sup.1

[0837] The compound was synthesized according to the procedure as described in example 28 and example 29 with the appropriate DNA, DNA-derivatives and the LNA building units. After purification, the antisense oligonucleotide was received with a purity of 96.8%. ESI-MS: experimental: 5323.30 Da; calculated: 5323.0 Da.

Example 37

[0838] Gb.sup.1sTb.sup.1sdA*sdGsdTsdGsdTsdTsdTsdA*sdGsdGsdGsAb.sup.1sGb.su- p.1sC*b.sup.1 (Seq. ID No. 209t) The compound was synthesized according to the general procedure and as described in example 28 with the appropriate DNA and LNA building units. After purification, the antisense oligonucleotide was received with a purity of 91.4%. ESI-MS: experimental: 5416.30 Da; calculated: 5417.3 Da.

Example 38

TABLE-US-00147

[0839] (Seq. ID No. 209x) /5SpC3s/Gb.sup.1sTb.sup.1sdAsdGsdTsdGsdTsdTsdTsdAsdGsdGsdGsA b.sup.1sGb.sup.1sC*b.sup.1/3SpC3s/

[0840] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 28, example 30 and example 31. After purification, the antisense oligonucleotide was received with a purity of 95.1%. ESI-MS: experimental: 5696.30 Da; calculated: 5695.5 Da.

Examples 39-132

[0841] The other oligonucleotides of Table 6 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

Example 133

TABLE-US-00148

[0842] (Seq. ID No. 210q) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1sT b.sup.1sTb.sup.1

[0843] 5'-O-DMT-2'-O,4'-C-methylene thymidine-3'-O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0844] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0845] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0846] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidites (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0847] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0848] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0849] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0850] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0851] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0852] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0853] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0854] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0855] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0856] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0857] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0858] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[0859] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 ml concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0860] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

[0861] The antisense oligonucleotide was received with a purity of 87.1%. ESI-MS: experimental: 5384.30 Da; calculated: 5384.3 Da.

Example 134

TABLE-US-00149

[0862] (Seq. ID No. 210r) Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTdTdTdGdGdTdA*dGdTGb.sup.1Tb.sup.1Tb.su- p.1

[0863] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 133. After the capping step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 95.3%.

Example 135

TABLE-US-00150

[0864] (Seq. ID No. 210v) /5SpC3s/Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsd TsGb.sup.1sTb.sup.1sTb.sup.1

[0865] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 133. After purification, the antisense oligonucleotide was received with a purity of 93.9%.

Example 136

TABLE-US-00151

[0866] (Seq. ID No. 210w) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1sT b.sup.1sTb.sup.1/3SpC3s/

[0867] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-[(2-cyanoethyl)-(N,N-diisopropy- l)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 133. After purification, the antisense oligonucleotide was received with a purity of 89.7%.

Example 137

TABLE-US-00152

[0868] (Seq. ID No. 2100) Gb.sup.1C*b.sup.1Tb.sup.1Ab.sup.1dTsdTsdTsdGsdGsdTsdAsdGsdTsGb.sup.1Tb.sup- .1Tb.sup.1

[0869] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133 and example 134. After purification, the antisense oligonucleotide was received with a purity of 83.8%. ESI-MS: experimental: 5288.10 Da; calculated: 5287.9 Da.

Example 138

TABLE-US-00153

[0870] (Seq. ID No. 210p) Gb.sup.1sC*b.sup.1sTb.sup.1sAb.sup.1sdTsdTsdTdGsdGsdTsdA*sdGsdTsGb.sup.1sT b.sup.1sTb.sup.1

[0871] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 133. After purification, the antisense oligonucleotide was received with a purity of 80.7%. ESI-MS: experimental: 5398.40 Da; calculated: 5399.3 Da.

Example 139

TABLE-US-00154

[0872] (Seq. ID No. 210af) Gb.sup.1ssC*b.sup.1ssTb.sup.1ssdAssdTssdTssdTssdGssd GssdTssdA*ssdGssdTssGb.sup.1ssTb.sup.1ssTb.sup.1

[0873] 5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-[(.beta.-benzoylmercapto)ethyl]- pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0874] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(.be- ta.-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0875] The further elongation of the oligonucleotide was performed in the same way.

[0876] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[0877] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 140-233

[0878] The other oligonucleotides of Table 7 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

Example 234

TABLE-US-00155

[0879] (Seq. ID No. 218b) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinate

[0880] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine (500 mg, 0.73 mmol), 95 mg succinic anhydride (0.95 mmol, 1.2 eq.) and 116 mg DMAP (0.95 mmol, 1.2 eq.) were dissolved in 35 ml dichloromethane. The reaction was stirred at room temperature overnight. The reaction solution was washed 2 times with 10 ml NaH.sub.2PO.sub.4 (0.1 M, pH 5.5) and one time with 10 ml brine. The organic phase was dried under anhydrous NaSO.sub.4, filtered and concentrated to dryness in vacuo. The hemiester derivative was obtained in 95% yield and was used without further purification for the next step.

5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinoyl-linke- d LCAA CPG

[0881] 70 mg hemiester derivative (90 .mu.mol) was dissolved in 0.3 ml DMF, 11.6 .mu.l DIEA (90 .mu.mol) and pyBOP (90 .mu.mol) were added and mixed together for 1 min. This mixture was combined with LCAA-CPG (500 .ANG., 80-120 mesh size, 300 mg) in a manual synthesizer and stirred for 1.5 hours at room temperature. The support was filtered off and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 .mu.mol/g.

Elongation

[0882] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinoy- l-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0883] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-(2-cy- anoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0884] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0885] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0886] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0887] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0888] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0889] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0890] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0891] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0892] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0893] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0894] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0895] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0896] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0897] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[0898] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0899] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol. The antisense oligonucleotide was received with a purity of 94.8%. ESI-MS: experimental: 5365.80 Da; calculated: 5365.30 Da.

Example 235

TABLE-US-00156

[0900] (Seq. ID No. 218r) C*b.sup.1Ab.sup.1Tb.sup.1dGdAdAdTdGdGdAdCdCAb.sup.1Gb.sup.1Tb.sup.1Ab.sup- .1

[0901] The LNA was bound to CPG according the general procedure. The coupling reaction and capping step were also carried out as described in example 234. After the capping step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 97.8%. ESI-MS: experimental: 5125.10 Da.; calculated: 5124.4 Da.

Example 236

TABLE-US-00157

[0902] (Seq. ID No. 218t) /5SpC3s/C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsd GsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0903] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.2%. ESI-MS: experimental: 5519.60 Da; calculated: 5519.4 Da.

Example 237

TABLE-US-00158

[0904] (Seq. ID No. 218u) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1s/3SpC3/

[0905] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-[(2-cyanoethyl-N- ,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.3%. ESI-MS: experimental: 5519.10 Da; calculated: 5519.4 Da.

Example 238

TABLE-US-00159

[0906] (Seq. ID No. 218aa) C*b.sup.1ssAb.sup.1ssTb.sup.1ssdGssdAssdAssdTssdGssd GssdAssdCssdCssAb.sup.1ssGb.sup.1ssTb.sup.1ssAb.sup.1

[0907] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinoy- l-linked LCAA CPG (0.2 .mu.mol was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-[(.beta.-benzoylmercapto)ethyl]- pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0908] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(.be- ta.-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0909] The further elongation of the oligonucleotide was performed in the same way.

[0910] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[0911] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 239

TABLE-US-00160

[0912] (Seq. ID No. 218m) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd C*sdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0913] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 93.8%. ESI-MS: experimental: 5394.00 Da; calculated: 5393.3 Da.

Example 240

TABLE-US-00161

[0914] (Seq. ID No. 218n) C*b.sup.1Ab.sup.1Tb.sup.1dGsdAsdAsdTsdGsdGsdAsdC* sdC*sAb.sup.1Gb.sup.1Tb.sup.1Ab.sup.1

[0915] The compound was synthesized according to the general procedure with the appropriate DNA building units and LNA building units as exemplified in example 234 and example 235. After purification, the antisense oligonucleotide was received with a purity of 94.7%. ESI-MS: experimental: 5297.30 Da; calculated: 5297.0 Da.

Example 241

TABLE-US-00162

[0916] (Seq. ID No. 218o) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsd A*sdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0917] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 92.8%. ESI-MS: experimental: 5410.40 Da; calculated: 5410.3 Da.

Example 242

TABLE-US-00163

[0918] (Seq. ID. No. 218p) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdA*sdA*sdTsdGsdGsd A*sdC*sdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0919] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 95.3%. ESI-MS: experimental: 5437.40 Da; calculated: 5438.4 Da.

Example 243

TABLE-US-00164

[0920] (Seq. ID No. 218q) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdA sdC*sdCsAbsGb.sup.1sTb.sup.1sAb.sup.1

[0921] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 93.9%. ESI-MS: experimental: 5378.80 Da; calculated: 5379.3 Da.

Example 244

TABLE-US-00165

[0922] (Seq. ID No. 218c) C*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsdGsdGsdAsd CsdC*sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0923] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 92.9%. ESI-MS: experimental: 5379.10 Da; calculated: 5379.3 Da.

Example 245

TABLE-US-00166

[0924] (Seq. ID No. 218s) C*b.sup.1sAb.sup.1sTb.sup.1sdGdAdAdTdGdGdAdC*sdC* sAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1

[0925] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 234. After purification, the antisense oligonucleotide was received with a purity of 94.5%. ESI-MS: experimental: 5152.70 Da; calculated: 5152.4 Da.

Example 246

TABLE-US-00167

[0926] (Seq. ID No. 218v) /5SpC3/sC*b.sup.1sAb.sup.1sTb.sup.1sdGsdAsdAsdTsd GsdGsdAsdCsdCsAb.sup.1sGb.sup.1sTb.sup.1sAb.sup.1s/3SpC3/

[0927] The compound was synthesized according to the general procedure with the appropriate DNA building units and LNA building units as exemplified in example 234, example 236 and example 237. After purification, the antisense oligonucleotide was received with a purity of 94.4%. ESI-MS: experimental: 5673.50 Da; calculated: 5673.5 Da

Example 247-335

[0928] The other oligonucleotides of Table 8 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

Example 336

TABLE-US-00168

[0929] (Seq. ID No. 152h) C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdCsdGsdCsdGsdTsd CsdCsAb.sup.1sC*b.sup.1sAb.sup.1

[0930] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinoy- l-linked LCAA CPG (0.2 .mu.mol was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0931] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0932] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0933] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s. The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0934] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0935] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0936] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0937] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0938] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0939] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0940] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0941] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0942] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0943] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0944] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[0945] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0946] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

Example 337

TABLE-US-00169

[0947] (Seq. ID No. 152q) C*b.sup.1Gb.sup.1Ab.sup.1Tb.sup.1dAdCdGdC*dGdTdCdC*Ab.sup.1C*b.sup.1Ab.su- p.1

[0948] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 336. After the coupling step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. After the oxidation step, the system was flushed with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 93.1%.

Example 338

TABLE-US-00170

[0949] (Seq. ID. No. 152s) /5SpC3s/C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGs dC*sdGsdTsdCsdCsAb.sup.1sC*b.sup.1sAb.sup.1

[0950] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 336. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 336. After purification, the antisense oligonucleotide was received with a purity of 96.5%.

Example 339

TABLE-US-00171

[0951] (Seq. ID No. 152t) C*b.sup.1sGb.sup.1sAb.sup.1sTb.sup.1sdAsdC*sdGsdCsdGsd TsdCsdC*sAb.sup.1sC*b.sup.1sAb.sup.1/3SpC3s/

[0952] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-[(2-cyanoethyl-N- ,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 336. After purification, the antisense oligonucleotide was received with a purity of 92.1%.

Example 340

TABLE-US-00172

[0953] (Seq. ID No. 152aa) C*b.sup.1ssGb.sup.1ssAb.sup.1ssdTssdAssdC*ssdGssdC ssdGssdTssdCssdC*ssAb.sup.1ssC*b.sup.1ssAb.sup.1

[0954] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-O-succinoy- l-linked LCAA CPG (0.2 .mu.mol was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-[(.beta- .-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0955] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-[(.beta.-benzoyl- mercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0956] The further elongation of the oligonucleotide was performed in the same way.

[0957] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[0958] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 341-433

[0959] The other oligonucleotides of Table 5 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

Example 434

TABLE-US-00173

[0960] (Seq. ID No. 143h) C*b.sup.1sTb.sup.1sdCsdGsdTsdCsdAsdTsdAsdGs dAsC*b.sup.1sC*b.sup.1sGb.sup.1

[0961] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine -3'-O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(- 2-cyanoethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0962] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0963] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0964] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0965] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0966] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0967] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0968] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0969] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0970] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0971] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0972] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0973] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0974] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[0975] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[0976] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

Example 435

TABLE-US-00174

[0977] (Seq. ID No. 143ad) C*b.sup.1Tb.sup.1dC*dGdTdCdAdTdAdGdAC*b.sup.1C*b.sup.1Gb.sup.1

[0978] The LNA was bound to CPG according to the general procedure. The coupling reaction and capping step were also carried out as described in example 434. After the capping step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 88.7%.

Example 436

TABLE-US-00175

[0979] (Seq. ID No. 143af) /5SpC3s/C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*d TdAdGdA*sC*b.sup.1sC*b.sup.1sGb.sup.1

[0980] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 434 and example 435. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 434 and example 435. After purification, the antisense oligonucleotide was received with a purity of 94.4%.

Example 437

TABLE-US-00176

[0981] (Seq. ID No. 143ag) C*b.sup.1sTb.sup.1sdC*dGdTdC*dA*dTdAdGdA*s C*b.sup.1sC*b.sup.1sGb.sup.1/3SpC3s/

[0982] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-diemthyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 434 and example 435. After purification, the antisense oligonucleotide was received with a purity of 91.6%.

Example 438

TABLE-US-00177

[0983] (Seq. ID No. 143t) C*b.sup.1ssTb.sup.1ssC*b.sup.1ssdGssdTssdC*ssdAssd TssdAssdGssdAssC*b.sup.1ssC*b.sup.1ssGb.sup.1

[0984] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'- -O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-[(.beta- .-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0985] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-[(.beta- .-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0986] The further elongation of the oligonucleotide was performed in the same way.

[0987] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[0988] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Example 439-534

[0989] The other oligonucleotides of Table 4 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

Example 535

TABLE-US-00178

[0990] (Seq. ID No. 213k) C*b1sAb1sGb1sdGsdCsdAsdTsdTsdAsdAsd TsdAsdAsdAsGb1sTb1sGb1

[0991] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-T-- O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene thymidine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0992] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0993] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0994] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0995] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0996] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0997] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0998] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[0999] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1000] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-deoxythymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor- amidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1001] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.6-benzoyl-2'-deoxyadenosine-3'-(2-cyanoethyl-N,N-diisoprop- yl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1002] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.4-benzoyl-2'-deoxycytidine-3'-(2-cyanoethyl-N,N-diisopropy- l)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1003] The coupling was carried out with 80 .mu.l 5'-O-DMT-N.sup.2-isobutyryl-2'-deoxyguanosine-3'-(2-cyanoethyl-N,N-diisop- ropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1004] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1005] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.6-benzoyladenosine-3'-(2-cyanoethyl-N,- N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s. The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1006] The coupling was carried out with 80 .mu.l 5'-O-DMT-2'-O-,4'-C-methylene-5-methyl-N.sup.4-benzoylcytidine-3'-(2-cyan- oethyl-N,N-diisopropyl)phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1007] Upon completion of the solid phase synthesis antisense-oligonucleotides were treated with a 20% diethylamine solution in acetonitrile (Biosolve BV, Valkenswaard, The Netherlands) for 20 min. to remove the cyanoethyl protecting groups on the phosphate backbone.

[1008] Subsequently, the antisense-oligonucleotides were cleaved from the solid support and further deprotected using 5 mL concentrated aqueous ammonia for 16 hours at 55.degree. C. The solid support was separated from the antisense-oligonucleotides by filtration or centrifugation.

[1009] Next, the crude antisense-oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) and a column packed with Source Q15 (GE Helthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 and contained 20% acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 15% B to 55% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3 M NaOAc, pH=5.2 and 70% ethanol. Finally, the pellet was washed with 70% ethanol.

Example 536

TABLE-US-00179

[1010] (Seq. ID No. 213n) C*b.sup.1Ab.sup.1Gb.sup.1dGdC*dAdTdTdAdAdTdAdAdAGb.sup.1Tb.sup.1Gb.sup.1

[1011] The LNA was bound to CPG according to general procedure. The coupling reaction and capping step were also carried out as described in example 535. After the capping step, the system was flushed out with 800 .mu.l acetonitrile, and 400 .mu.l of 0.02 M Iodine in THF/pyridine/H.sub.2O were inserted to the column for 45 s. The system was flushed after the oxidation step with 24 .mu.l acetonitrile. After purification, the antisense oligonucleotide was received with a purity of 91.4%.

Example 537

TABLE-US-00180

[1012] (Seq. ID No. 213o) /5SpC3s/C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAs dAsdTsdAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1

[1013] The compound was synthesized according to the general procedure with the appropriate DNA and LNA building units as exemplified in example 535. But with the exception that after the last nucleotide has been coupled to the oligonucleotide and the subsequent oxidation and capping steps were carried out, 80 .mu.l of phosphoramidite-C3 (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M) were added. The coupling was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile. The subsequent steps were performed as described in example 535. After purification, the antisense oligonucleotide was received with a purity of 87.1%.

Example 538

TABLE-US-00181

[1014] (Seq. ID No. 213p) C*b.sup.1sAb.sup.1sGb.sup.1sdGsdC*sdAsdTsdTsdAsdAsdTs dAsdAsdAsGb.sup.1sTb.sup.1sGb.sup.1/3SpC3s/

[1015] 3'-Spacer C3 CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 80 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-diemthyformamidineguanosine-3'-[(2-c- yanoethyl)-(N,N-diisopropyl)]-phosphoramidite (0.07 M) and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 640 .mu.l of Beaucage (0.2 M) were inserted to the column for 180 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. The subsequent reactions were performed as described in example 535. After purification, the antisense oligonucleotide was received with a purity of 95.7%.

Example 539

TABLE-US-00182

[1016] (Seq. ID No. 213ae) C*b.sup.1ssAb.sup.1ssGb.sup.1ssdGssdC*ssdAssdTssdTs sdAssdAssdTssdAssdAssAb.sup.1ssGb.sup.1ssTb.sup.1s sGb.sup.1

[1017] 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'- -O-succinoyl-linked LCAA CPG (0.2 .mu.mol) was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group. After several washes with a total amount of 800 .mu.l acetonitrile, the coupling reaction was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-thymidine-3'-[(.beta.-benzoylmercapto)ethyl]- pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/V) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1018] The coupling was carried out with 38 .mu.l 5'-O-DMT-2'-O,4'-C-methylene-N.sup.2-dimethyformamidineguanosine-3'-[(.be- ta.-benzoylmercapto)ethyl]pyrrolidinolthiophosphoramidite (0.15 M) in 10% dichloromethane (v/v) in acetonitrile and 236 .mu.l DCI in acetonitrile (0.25 M). The coupling reaction was allowed to take place for 250 sec., and excess reagents were flashed out with 800 .mu.l acetonitrile, and 900 .mu.l of DDTT (0.05 M in pyridine/acetonitrile 4:1 v/v) were inserted to the column for 240 s The system was flushed with 320 .mu.l acetonitrile. For the capping step, 448 .mu.l of acetic anhydride in THF (1:9 v/v) and 448 .mu.l N-methylimidazol (NMI)/THF/pyridine (1:8:1) were added and allowed to react for 45 sec. At the end of this cycle, the system was washed with 480 .mu.l acetonitrile. The compound was treated with 1400 .mu.l 3% trichloroacetic acid in dichloromethane for 60 s to completely remove the 5'-DMT protection group.

[1019] The further elongation of the oligonucleotide was performed in the same way.

[1020] Upon completion of the solid phase synthesis, the antisense-oligonucleotides were treated 850 .mu.l ammonia in concentrated ethanol (ammonia/ethanol 3:1 v/v) at 55.degree. C. for 15-16h in order to cleave antisense-oligonucleotide from the solid-support and to deprotect the thiol-group.

[1021] Next, the crude antisense-oligonucleotide was purified by anion-exchange chromatography using a Mono Q 10/100 GL column. The buffers were prepared with DEPC-treated water, and their compositions were as follows: Buffer A: 25 mM Tris-HCl, 1 mM EDTA, pH 8.0; Buffer B: 25 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, pH 8.0.

Examples 540-640

[1022] The other oligonucleotides of Table 9 were synthesized according to the general procedure and as shown in the examples. The preparation of the antisense-oligonucleotide including .beta.-D-thio-LNA, .alpha.-L-oxy-LNA, .beta.-D-(NH)-LNA, or .beta.-D-(NCH.sub.3)-LNA units were performed in the same way as the antisense-oligonucleotides containing .beta.-D-oxy-LNA units.

TABLE-US-00183 Sequence Listing Seq. ID No. 1: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, (antisense; DNA code) TTTAGCTACT AGGAATGGGA ACAGGAGGCA GGATGCTCAC CTGAGTATTT TGCTTTATTC 60 AATCTAATAA ACATTTTATT TATGTAAAAG ACAAACAATG CATAGAATAA AAATAAGTGC 120 TTGAGACTTT TGATATAAAA AGAGTATATA GCATTCACAT TCCTATTTTA ATACATGAGT 180 ACAGCTGAAG TGTTCCATAA AAGAATAAAA CTTTCCCTTT ATGTATAGTA GTGAAAAAAG 240 TCAGTATTTT TAGGAACTAC AGAATGTTAT TCCTTGGTCT TTTTTCTTGA ATAAGAAAAA 300 AAAACATAAA CAAAACAAGC CACAGTATCC TCTGACACTA CATTCCAGTT TATGCTGATA 360 ACCCAGAAGT GAGAATACTC TTGAATCTTG AATATCTCAT GAATGGACCA GTATTCTAGA 420 AACTCACCAC TAGAGGTCAA TGGGCAACAG CTATTGGGAT GGTATCAGCA TGCCCTACGG 480 TGCAAGTGGA ATTTCTAGGC GCCTCTATGC TACTGCAGCC ACACTGTCTT TAACTCTCAG 540 CCCACCCACA CTGAGGAGGG TGCCTAGAGG TTCTATTTCC AAACCTTTGC ATGTATCTTA 600 AAAATCTCAA TAAAATGAGA CCTTCCACCA TCCAAACAGA GCTGATATTC TCACTACCAG 660 TCCCTCTCTA ATATTCCTAT TTGGCTGAAA ATAAGTAGCT TCAAAAAGTT TTAAAAAAGA 720 GATTACTTGC AGCATTAACA CTTCTTTGTT GATTAACAAG TTTCCTATGG AGTTTTAAAG 780 CTCATACTTT GTTCTTGTCC TTGTGGACAC AAATTTTCTA ACTGCAAATG GGACCTTTGT 840 GTCCCACATT CAAATCCTCT CTAGTAATTT CTGCAAAGGT TGAGAAGGCT GGCATGATGG 900 AGAGAACGGT AACCATGAGG AAAGCTTCTT GGAGTAAAGC ACTCCTCTCT CCAATGCAGA 960 GGGTAAAACT ATTAACATAT AAGCAAAAGA AACTTGGGCT AACTGAGACC CTTAAAGGAG 1020 TTCCCCTTTA GTCCAATAAA AGGCCAACTT CAAATCTTAA CACCAGATAA GGTAGTCAAA 1080 ATCATATTAT ATACCCAGAG AATGACTGCT TGAATGGACA TTTCTTACAA GGGACCTTGG 1140 TTAGGTGCAG ATTTAATTCC TAGACTGGGG TCCAGGTAGG CAGTGGAAAG AGCTAATGTT 1200 TACAGTGAGA AGTGAGGCAG CTTTGTAAGT GTCTCCACAC CTTCACATTT TGTGAACGTG 1260 GACTGGAGAT AACTGAAAAC CATCTGCTAT CCTTACCTGG GGATCCAGAT TTTCCTGCAA 1320 AATCTCCAAA TATTTATAAA GTGGCTTCAC TTTTTGAAAC GCTGTGCTGA CCAAACAAAA 1380 CATATGTTTA GAGTGCCTGA GGTCATAGTC CTGACAATGA TAGTATTGTG TAGTTGAAAT 1440 CCTCTTCATC AGGCCAAACT GTGCTTGAGC AATCAGGAGC CCAGAAAGAT GGAACCCATT 1500 GGTGTTTGTA TAGAAAACTA GAAAATCAAG TCAAGTGTAA TGAAAAAGTA AACACGATAA 1560 AGCCTAGAGT GAGAATTTGC TCCTTTTTAG AAAAGGATGA AGGCTGGGAG CAGAGAATAG 1620 TAACATAAGT GCAGGGGAAA GATGAAAAAA AGAACAATTT TTCATTAGTA GATGGTGGGG 1680 CAATCGCATG GATGGGGACA TCTGTTCTGA TTTTTCTGCA ACCCATGAAG GTAAAAAGTG 1740 GGGTTCAAAA CATTCAAGGT ATTAAAGATG GGGTAGAGTT TCTAAACTAG GTTGAGGGAG 1800 AGTTTCTAAA CTAGCCCCCC AGATTTGGGG CTTGGAGCTT AAATGAAAAG TCCAGGAGAA 1860 ATAAGGGCAC ACAGGAACCC CGGGAACACT GGTCCTCAAA CAGTGCCACT GTACTTAGTT 1920 CCATGGCCAG AAGAGAAGTG CTAGGCAGGG AATGATTATT TTGCAAAAGC AAGTGCAATG 1980 TGGTCATAGC TGGCTGTGAG ACATGGAGCC TCTTTCCTCA TGCAAAGTTC ACTGTTTTAC 2040 AGTCAGAGAA CCACTGCATG TGTGATTGTC AAATGCTAAT GCTGTCATGG GTCCCTTCCT 2100 TCTCTGCTTG GTTCTGGAGT TCTCCAATAA AACCAATTTC CTGGGAATAT TTGATGTTTT 2160 TCCTTGTCTC TTTTCAAGGT ATGGCTATAT ATATAGAGCT ATAGACATAT ATAGATATAT 2220 ATATATATAT ATAAAACATA GCTATTCATA TTTATATACA GGCATTAATA AAGTGCAAAT 2280 GTTATTGGCT ATTGTAAAAA TCAATCTCAT TTCCTGAGGA AGTGCTAACA CAGCTTATCC 2340 TATGACAATG TCAAAGGCAT AGAATGCTCT ATGTCACCCA CTCCCTGCTG CTGTTGTTTC 2400 TGCTTATCCC CACAGCTTAC AGGGAGGGGA GTGACCCCCT TGGTTTTCCA GGAAGCATCA 2460 GTTCAGGGGC AGCTTCCTGC TGCCTCTGTT CTTTGGTGAG AGGGGCAGCC TCTTTGGACA 2520 TGGCCCAGCC TGCCCCAGAA GAGCTATTTG GTAGTGTTTA GGGAGCCGTC TTCAGGAATC 2580 TTCTCCTCCG AGCAGCTCCT CCCCGAGAGC CTGTCCAGAT GCTCCAGCTC ACTGAAGCGT 2640 TCTGCCACAC ACTGGGCTGT GAGACGGGCC TCTGGGTCGT GGTCCCAGCA CTCAGTCAAC 2700 GTCTCACACA CCATCTGGAT GCCCTGGTGG TTGAGCCAGA AGCTGGGAAT TTCTGGTCGC 2760 CCTCGATCTC TCAACACGTT GTCCTTCATG CTTTCGACAC AGGGGTGCTC CCGCACCTTG 2820 GAACCAAATG GAGGCTCATA ATCTTTTACT TCTCCCACTG CATTACAGCG AGATGTCATT 2880 TCCCAGAGCA CCAGAGCCAT GGAGTAGACA TCGGTCTGCT TGAAGGACTC AACATTCTCC 2940 AAATTCATCC TGGATTCTAG GACTTCTGGA GCCATGTATC TTGCAGTTCC CACCTGCCCA 3000 CTGTTAGCCA GGTCATCCAC AGACAGAGTA GGGTCCAGAC GCAGGGAAAG CCCAAAGTCA 3060 CACAGGCAGC AGGTTAGGTC GTTCTTCACG AGGATATTGG AGCTCTTGAG GTCCCTGTGC 3120 ACGATGGGCA TCTTGGGCCT CCCACATGGA GTGTGATCAC TGTGGAGGTG AGCAATCCCC 3180 CGGGCGAGGG AGCTGCCCAG CTTGCGCAGG TCCTCCCAGC TGATGACATG CCGCGTCAGG 3240 TACTCCTGTA GGTTGCCCTT GGCGTGGAAG GCGGTGATCA GCCAGTATTG TTTCCCCAAC 3300 TCCGTCTTCC GCTCCTCAGC CGTCAGGAAC TGGAGTATGT TCTCATGCTT CAGATTGATG 3360 TCTGAGAAGA TGTCCTTCTC TGTCTTCCAA GAGGCATACT CCTCATAGGG AAAGATCTTG 3420 ACTGCCACTG TCTCAAACTG CTCTGAAGTG TTCTGCTTCA GCTTGGCCTT ATAGACCTCA 3480 GCAAAGCGAC CTTTCCCCAC CAGGGTGTCC AGCTCAATGG GCAGCAGCTC TGTGTTGTGG 3540 TTGATGTTGT TGGCACACGT GGAGCTGATG TCAGAGCGGT CATCTTCCAG GATGATGGCA 3600 CAGTGCTCGC TGAACTCCAT GAGCTTCCGC GTCTTGCCGG TTTCCCAGGT TGAACTCAGC 3660 TTCTGCTGCC GGTTAACGCG GTAGCAGTAG AAGATGATGA TGACAGATAT GGCAACTCCC 3720 AGTGGTGGCA GGAGGCTGAT GCCTGTCACT TGAAATATGA CTAGCAACAA GTCAGGATTG 3780 CTGGTGTTAT ATTCTTCTGA GAAGATGATG TTGTCATTGC ACTCATCAGA GCTACAGGAA 3840 CACATGAAGA AAGTCTCACC AGGCTTTTTT TTTTCCTTCA TAATGCACTT TGGAGAAGCA 3900 GCATCTTCCA GAATAAAGTC ATGGTAGGGG AGCTTGGGGT CATGGCAAAC TGTCTCTAGT 3960 GTTATGTTCT CGTCATTCTT TCTCCATACA GCCACACAGA CTTCCTGTGG CTTCTCACAG 4020 ATGGAGGTGA TGCTGCAGTT GCTCATGCAG GATTTCTGGT TGTCACAGGT GGAAAATCTC 4080 ACATCACAAA ATTTACACAG TTGTGGAAAC TTGACTGCAC CGTTGTTGTC AGTGACTATC 4140 ATGTCGTTAT TAACCGACTT CTGAACGTGC GGTGGGATCG TGCTGGCGAT ACGCGTCCAC 4200 AGGACGATGT GCAGCGGCCA CAGGCCCCTG AGCAGCCCCC GACCCATGGC AGACCCCGCT 4260 GCTCGTCATA GACCGAGCCC CCAGCGCAGC GGACGGCGCC TTCCCGGACC CCTGGCTGCG 4320 CCTCCGCGCC GCGCCCTCTC CGGACCCCGC GCCGGGCCGG CAGCGCAGAT GTGCGGGCCA 4380 GATGTGGCGC CCGCTCGCCA GCCAGGAGGG GGCCTGGAGG CCGGCGAGGC GCGGGGAGGC 4440 CCCCGGCGGC CGAGGGAAGC TGCACAGGAG TCCGGCTCCT GTCCCGAGCG GGTGCACGCG 4500 CGGGGGTGTC GTCGCTCCGT GCGCGCGAGT GACTCACTCA ACTTCAACTC AGCGCTGCGG 4560 GGGAAACAGG AAACTCCTCG CCAACAGCTG GGCAGGACCT CTCTCCGCCC GAGAGCCTTC 4620 TCCCTCTCC 4629 Seq. ID No. 2: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, mRNA (sense; written in DNA code) GGAGAGGGAG AAGGCTCTCG GGCGGAGAGA GGTCCTGCCC AGCTGTTGGC GAGGAGTTTC 60 CTGTTTCCCC CGCAGCGCTG AGTTGAAGTT GAGTGAGTCA CTCGCGCGCA CGGAGCGACG 120 ACACCCCCGC GCGTGCACCC GCTCGGGACA GGAGCCGGAC TCCTGTGCAG CTTCCCTCGG 180 CCGCCGGGGG CCTCCCCGCG CCTCGCCGGC CTCCAGGCCC CCTCCTGGCT GGCGAGCGGG 240 CGCCACATCT GGCCCGCACA TCTGCGCTGC CGGCCCGGCG CGGGGTCCGG AGAGGGCGCG 300 GCGCGGAGGC GCAGCCAGGG GTCCGGGAAG GCGCCGTCCG CTGCGCTGGG GGCTCGGTCT 360 ATGACGAGCA GCGGGGTCTG CCATGGGTCG GGGGCTGCTC AGGGGCCTGT GGCCGCTGCA 420 CATCGTCCTG TGGACGCGTA TCGCCAGCAC GATCCCACCG CACGTTCAGA AGTCGGTTAA 480 TAACGACATG ATAGTCACTG ACAACAACGG TGCAGTCAAG TTTCCACAAC TGTGTAAATT 540 TTGTGATGTG AGATTTTCCA CCTGTGACAA CCAGAAATCC TGCATGAGCA ACTGCAGCAT 600 CACCTCCATC TGTGAGAAGC CACAGGAAGT CTGTGTGGCT GTATGGAGAA AGAATGACGA 660 GAACATAACA CTAGAGACAG TTTGCCATGA CCCCAAGCTC CCCTACCATG ACTTTATTCT 720 GGAAGATGCT GCTTCTCCAA AGTGCATTAT GAAGGAAAAA AAAAAGCCTG GTGAGACTTT 780 CTTCATGTGT TCCTGTAGCT CTGATGAGTG CAATGACAAC ATCATCTTCT CAGAAGAATA 840 TAACACCAGC AATCCTGACT TGTTGCTAGT CATATTTCAA GTGACAGGCA TCAGCCTCCT 900 GCCACCACTG GGAGTTGCCA TATCTGTCAT CATCATCTTC TACTGCTACC GCGTTAACCG 960 GCAGCAGAAG CTGAGTTCAA CCTGGGAAAC CGGCAAGACG CGGAAGCTCA TGGAGTTCAG 1020 CGAGCACTGT GCCATCATCC TGGAAGATGA CCGCTCTGAC ATCAGCTCCA CGTGTGCCAA 1080 CAACATCAAC CACAACACAG AGCTGCTGCC CATTGAGCTG GACACCCTGG TGGGGAAAGG 1140 TCGCTTTGCT GAGGTCTATA AGGCCAAGCT GAAGCAGAAC ACTTCAGAGC AGTTTGAGAC 1200 AGTGGCAGTC AAGATCTTTC CCTATGAGGA GTATGCCTCT TGGAAGACAG AGAAGGACAT 1260 CTTCTCAGAC ATCAATCTGA AGCATGAGAA CATACTCCAG TTCCTGACGG CTGAGGAGCG 1320 GAAGACGGAG TTGGGGAAAC AATACTGGCT GATCACCGCC TTCCACGCCA AGGGCAACCT 1380 ACAGGAGTAC CTGACGCGGC ATGTCATCAG CTGGGAGGAC CTGCGCAAGC TGGGCAGCTC 1440 CCTCGCCCGG GGGATTGCTC ACCTCCACAG TGATCACACT CCATGTGGGA GGCCCAAGAT 1500 GCCCATCGTG CACAGGGACC TCAAGAGCTC CAATATCCTC GTGAAGAACG ACCTAACCTG 1560 CTGCCTGTGT GACTTTGGGC TTTCCCTGCG TCTGGACCCT ACTCTGTCTG TGGATGACCT 1620 GGCTAACAGT GGGCAGGTGG GAACTGCAAG ATACATGGCT CCAGAAGTCC TAGAATCCAG 1680 GATGAATTTG GAGAATGTTG AGTCCTTCAA GCAGACCGAT GTCTACTCCA TGGCTCTGGT 1740 GCTCTGGGAA ATGACATCTC GCTGTAATGC AGTGGGAGAA GTAAAAGATT ATGAGCCTCC 1800 ATTTGGTTCC AAGGTGCGGG AGCACCCCTG TGTCGAAAGC ATGAAGGACA ACGTGTTGAG 1860 AGATCGAGGG CGACCAGAAA TTCCCAGCTT CTGGCTCAAC CACCAGGGCA TCCAGATGGT 1920 GTGTGAGACG TTGACTGAGT GCTGGGACCA CGACCCAGAG GCCCGTCTCA CAGCCCAGTG 1980 TGTGGCAGAA CGCTTCAGTG AGCTGGAGCA TCTGGACAGG CTCTCGGGGA GGAGCTGCTC 2040 GGAGGAGAAG ATTCCTGAAG ACGGCTCCCT AAACACTACC AAATAGCTCT TCTGGGGCAG 2100 GCTGGGCCAT GTCCAAAGAG GCTGCCCCTC TCACCAAAGA ACAGAGGCAG CAGGAAGCTG 2160 CCCCTGAACT GATGCTTCCT GGAAAACCAA GGGGGTCACT CCCCTCCCTG TAAGCTGTGG 2220 GGATAAGCAG AAACAACAGC AGCAGGGAGT GGGTGACATA GAGCATTCTA TGCCTTTGAC 2280 ATTGTCATAG GATAAGCTGT GTTAGCACTT CCTCAGGAAA TGAGATTGAT TTTTACAATA 2340 GCCAATAACA TTTGCACTTT ATTAATGCCT GTATATAAAT ATGAATAGCT ATGTTTTATA 2400 TATATATATA TATATCTATA TATGTCTATA GCTCTATATA TATAGCCATA CCTTGAAAAG 2460 AGACAAGGAA AAACATCAAA TATTCCCAGG AAATTGGTTT TATTGGAGAA CTCCAGAACC 2520 AAGCAGAGAA GGAAGGGACC CATGACAGCA TTAGCATTTG ACAATCACAC ATGCAGTGGT 2580 TCTCTGACTG TAAAACAGTG AACTTTGCAT GAGGAAAGAG GCTCCATGTC TCACAGCCAG 2640

CTATGACCAC ATTGCACTTG CTTTTGCAAA ATAATCATTC CCTGCCTAGC ACTTCTCTTC 2700 TGGCCATGGA ACTAAGTACA GTGGCACTGT TTGAGGACCA GTGTTCCCGG GGTTCCTGTG 2760 TGCCCTTATT TCTCCTGGAC TTTTCATTTA AGCTCCAAGC CCCAAATCTG GGGGGCTAGT 2820 TTAGAAACTC TCCCTCAACC TAGTTTAGAA ACTCTACCCC ATCTTTAATA CCTTGAATGT 2880 TTTGAACCCC ACTTTTTACC TTCATGGGTT GCAGAAAAAT CAGAACAGAT GTCCCCATCC 2940 ATGCGATTGC CCCACCATCT ACTAATGAAA AATTGTTCTT TTTTTCATCT TTCCCCTGCA 3000 CTTATGTTAC TATTCTCTGC TCCCAGCCTT CATCCTTTTC TAAAAAGGAG CAAATTCTCA 3060 CTCTAGGCTT TATCGTGTTT ACTTTTTCAT TACACTTGAC TTGATTTTCT AGTTTTCTAT 3120 ACAAACACCA ATGGGTTCCA TCTTTCTGGG CTCCTGATTG CTCAAGCACA GTTTGGCCTG 3180 ATGAAGAGGA TTTCAACTAC ACAATACTAT CATTGTCAGG ACTATGACCT CAGGCACTCT 3240 AAACATATGT TTTGTTTGGT CAGCACAGCG TTTCAAAAAG TGAAGCCACT TTATAAATAT 3300 TTGGAGATTT TGCAGGAAAA TCTGGATCCC CAGGTAAGGA TAGCAGATGG TTTTCAGTTA 3360 TCTCCAGTCC ACGTTCACAA AATGTGAAGG TGTGGAGACA CTTACAAAGC TGCCTCACTT 3420 CTCACTGTAA ACATTAGCTC TTTCCACTGC CTACCTGGAC CCCAGTCTAG GAATTAAATC 3480 TGCACCTAAC CAAGGTCCCT TGTAAGAAAT GTCCATTCAA GCAGTCATTC TCTGGGTATA 3540 TAATATGATT TTGACTACCT TATCTGGTGT TAAGATTTGA AGTTGGCCTT TTATTGGACT 3600 AAAGGGGAAC TCCTTTAAGG GTCTCAGTTA GCCCAAGTTT CTTTTGCTTA TATGTTAATA 3660 GTTTTACCCT CTGCATTGGA GAGAGGAGTG CTTTACTCCA AGAAGCTTTC CTCATGGTTA 3720 CCGTTCTCTC CATCATGCCA GCCTTCTCAA CCTTTGCAGA AATTACTAGA GAGGATTTGA 3780 ATGTGGGACA CAAAGGTCCC ATTTGCAGTT AGAAAATTTG TGTCCACAAG GACAAGAACA 3840 AAGTATGAGC TTTAAAACTC CATAGGAAAC TTGTTAATCA ACAAAGAAGT GTTAATGCTG 3900 CAAGTAATCT CTTTTTTAAA ACTTTTTGAA GCTACTTATT TTCAGCCAAA TAGGAATATT 3960 AGAGAGGGAC TGGTAGTGAG AATATCAGCT CTGTTTGGAT GGTGGAAGGT CTCATTTTAT 4020 TGAGATTTTT AAGATACATG CAAAGGTTTG GAAATAGAAC CTCTAGGCAC CCTCCTCAGT 4080 GTGGGTGGGC TGAGAGTTAA AGACAGTGTG GCTGCAGTAG CATAGAGGCG CCTAGAAATT 4140 CCACTTGCAC CGTAGGGCAT GCTGATACCA TCCCAATAGC TGTTGCCCAT TGACCTCTAG 4200 TGGTGAGTTT CTAGAATACT GGTCCATTCA TGAGATATTC AAGATTCAAG AGTATTCTCA 4260 CTTCTGGGTT ATCAGCATAA ACTGGAATGT AGTGTCAGAG GATACTGTGG CTTGTTTTGT 4320 TTATGTTTTT TTTTCTTATT CAAGAAAAAA GACCAAGGAA TAACATTCTG TAGTTCCTAA 4380 AAATACTGAC TTTTTTCACT ACTATACATA AAGGGAAAGT TTTATTCTTT TATGGAACAC 4440 TTCAGCTGTA CTCATGTATT AAAATAGGAA TGTGAATGCT ATATACTCTT TTTATATCAA 4500 AAGTCTCAAG CACTTATTTT TATTCTATGC ATTGTTTGTC TTTTACATAA ATAAAATGTT 4560 TATTAGATTG AATAAAGCAA AATACTCAGG TGAGCATCCT GCCTCCTGTT CCCATTCCTA 4620 GTAGCTAAA 4629 Seq. ID No. 3: Homo sapiens transforming growth factor, beta receptor II (TGFBR2), transcript variant 2, mRNA (sense; written in RNA code) GGAGAGGGAG AAGGCUCUCG GGCGGAGAGA GGUCCUGCCC AGCUGUUGGC GAGGAGUUUC 60 CUGUUUCCCC CGCAGCGCUG AGUUGAAGUU GAGUGAGUCA CUCGCGCGCA CGGAGCGACG 120 ACACCCCCGC GCGUGCACCC GCUCGGGACA GGAGCCGGAC UCCUGUGCAG CUUCCCUCGG 180 CCGCCGGGGG CCUCCCCGCG CCUCGCCGGC CUCCAGGCCC CCUCCUGGCU GGCGAGCGGG 240 CGCCACAUCU GGCCCGCACA UCUGCGCUGC CGGCCCGGCG CGGGGUCCGG AGAGGGCGCG 300 GCGCGGAGGC GCAGCCAGGG GUCCGGGAAG GCGCCGUCCG CUGCGCUGGG GGCUCGGUCU 360 AUGACGAGCA GCGGGGUCUG CCAUGGGUCG GGGGCUGCUC AGGGGCCUGU GGCCGCUGCA 420 CAUCGUCCUG UGGACGCGUA UCGCCAGCAC GAUCCCACCG CACGUUCAGA AGUCGGUUAA 480 UAACGACAUG AUAGUCACUG ACAACAACGG UGCAGUCAAG UUUCCACAAC UGUGUAAAUU 540 UUGUGAUGUG AGAUUUUCCA CCUGUGACAA CCAGAAAUCC UGCAUGAGCA ACUGCAGCAU 600 CACCUCCAUC UGUGAGAAGC CACAGGAAGU CUGUGUGGCU GUAUGGAGAA AGAAUGACGA 660 GAACAUAACA CUAGAGACAG UUUGCCAUGA CCCCAAGCUC CCCUACCAUG ACUUUAUUCU 720 GGAAGAUGCU GCUUCUCCAA AGUGCAUUAU GAAGGAAAAA AAAAAGCCUG GUGAGACUUU 780 CUUCAUGUGU UCCUGUAGCU CUGAUGAGUG CAAUGACAAC AUCAUCUUCU CAGAAGAAUA 840 UAACACCAGC AAUCCUGACU UGUUGCUAGU CAUAUUUCAA GUGACAGGCA UCAGCCUCCU 900 GCCACCACUG GGAGUUGCCA UAUCUGUCAU CAUCAUCUUC UACUGCUACC GCGUUAACCG 960 GCAGCAGAAG CUGAGUUCAA CCUGGGAAAC CGGCAAGACG CGGAAGCUCA UGGAGUUCAG 1020 CGAGCACUGU GCCAUCAUCC UGGAAGAUGA CCGCUCUGAC AUCAGCUCCA CGUGUGCCAA 1080 CAACAUCAAC CACAACACAG AGCUGCUGCC CAUUGAGCUG GACACCCUGG UGGGGAAAGG 1140 UCGCUUUGCU GAGGUCUAUA AGGCCAAGCU GAAGCAGAAC ACUUCAGAGC AGUUUGAGAC 1200 AGUGGCAGUC AAGAUCUUUC CCUAUGAGGA GUAUGCCUCU UGGAAGACAG AGAAGGACAU 1260 CUUCUCAGAC AUCAAUCUGA AGCAUGAGAA CAUACUCCAG UUCCUGACGG CUGAGGAGCG 1320 GAAGACGGAG UUGGGGAAAC AAUACUGGCU GAUCACCGCC UUCCACGCCA AGGGCAACCU 1380 ACAGGAGUAC CUGACGCGGC AUGUCAUCAG CUGGGAGGAC CUGCGCAAGC UGGGCAGCUC 1440 CCUCGCCCGG GGGAUUGCUC ACCUCCACAG UGAUCACACU CCAUGUGGGA GGCCCAAGAU 1500 GCCCAUCGUG CACAGGGACC UCAAGAGCUC CAAUAUCCUC GUGAAGAACG ACCUAACCUG 1560 CUGCCUGUGU GACUUUGGGC UUUCCCUGCG UCUGGACCCU ACUCUGUCUG UGGAUGACCU 1620 GGCUAACAGU GGGCAGGUGG GAACUGCAAG AUACAUGGCU CCAGAAGUCC UAGAAUCCAG 1680 GAUGAAUUUG GAGAAUGUUG AGUCCUUCAA GCAGACCGAU GUCUACUCCA UGGCUCUGGU 1740 GCUCUGGGAA AUGACAUCUC GCUGUAAUGC AGUGGGAGAA GUAAAAGAUU AUGAGCCUCC 1800 AUUUGGUUCC AAGGUGCGGG AGCACCCCUG UGUCGAAAGC AUGAAGGACA ACGUGUUGAG 1860 AGAUCGAGGG CGACCAGAAA UUCCCAGCUU CUGGCUCAAC CACCAGGGCA UCCAGAUGGU 1920 GUGUGAGACG UUGACUGAGU GCUGGGACCA CGACCCAGAG GCCCGUCUCA CAGCCCAGUG 1980 UGUGGCAGAA CGCUUCAGUG AGCUGGAGCA UCUGGACAGG CUCUCGGGGA GGAGCUGCUC 2040 GGAGGAGAAG AUUCCUGAAG ACGGCUCCCU AAACACUACC AAAUAGCUCU UCUGGGGCAG 2100 GCUGGGCCAU GUCCAAAGAG GCUGCCCCUC UCACCAAAGA ACAGAGGCAG CAGGAAGCUG 2160 CCCCUGAACU GAUGCUUCCU GGAAAACCAA GGGGGUCACU CCCCUCCCUG UAAGCUGUGG 2220 GGAUAAGCAG AAACAACAGC AGCAGGGAGU GGGUGACAUA GAGCAUUCUA UGCCUUUGAC 2280 AUUGUCAUAG GAUAAGCUGU GUUAGCACUU CCUCAGGAAA UGAGAUUGAU UUUUACAAUA 2340 GCCAAUAACA UUUGCACUUU AUUAAUGCCU GUAUAUAAAU AUGAAUAGCU AUGUUUUAUA 2400 UAUAUAUAUA UAUAUCUAUA UAUGUCUAUA GCUCUAUAUA UAUAGCCAUA CCUUGAAAAG 2460 AGACAAGGAA AAACAUCAAA UAUUCCCAGG AAAUUGGUUU UAUUGGAGAA CUCCAGAACC 2520 AAGCAGAGAA GGAAGGGACC CAUGACAGCA UUAGCAUUUG ACAAUCACAC AUGCAGUGGU 2580 UCUCUGACUG UAAAACAGUG AACUUUGCAU GAGGAAAGAG GCUCCAUGUC UCACAGCCAG 2640 CUAUGACCAC AUUGCACUUG CUUUUGCAAA AUAAUCAUUC CCUGCCUAGC ACUUCUCUUC 2700 UGGCCAUGGA ACUAAGUACA GUGGCACUGU UUGAGGACCA GUGUUCCCGG GGUUCCUGUG 2760 UGCCCUUAUU UCUCCUGGAC UUUUCAUUUA AGCUCCAAGC CCCAAAUCUG GGGGGCUAGU 2820 UUAGAAACUC UCCCUCAACC UAGUUUAGAA ACUCUACCCC AUCUUUAAUA CCUUGAAUGU 2880 UUUGAACCCC ACUUUUUACC UUCAUGGGUU GCAGAAAAAU CAGAACAGAU GUCCCCAUCC 2940 AUGCGAUUGC CCCACCAUCU ACUAAUGAAA AAUUGUUCUU UUUUUCAUCU UUCCCCUGCA 3000 CUUAUGUUAC UAUUCUCUGC UCCCAGCCUU CAUCCUUUUC UAAAAAGGAG CAAAUUCUCA 3060 CUCUAGGCUU UAUCGUGUUU ACUUUUUCAU UACACUUGAC UUGAUUUUCU AGUUUUCUAU 3120 ACAAACACCA AUGGGUUCCA UCUUUCUGGG CUCCUGAUUG CUCAAGCACA GUUUGGCCUG 3180 AUGAAGAGGA UUUCAACUAC ACAAUACUAU CAUUGUCAGG ACUAUGACCU CAGGCACUCU 3240 AAACAUAUGU UUUGUUUGGU CAGCACAGCG UUUCAAAAAG UGAAGCCACU UUAUAAAUAU 3300 UUGGAGAUUU UGCAGGAAAA UCUGGAUCCC CAGGUAAGGA UAGCAGAUGG UUUUCAGUUA 3360 UCUCCAGUCC ACGUUCACAA AAUGUGAAGG UGUGGAGACA CUUACAAAGC UGCCUCACUU 3420 CUCACUGUAA ACAUUAGCUC UUUCCACUGC CUACCUGGAC CCCAGUCUAG GAAUUAAAUC 3480 UGCACCUAAC CAAGGUCCCU UGUAAGAAAU GUCCAUUCAA GCAGUCAUUC UCUGGGUAUA 3540 UAAUAUGAUU UUGACUACCU UAUCUGGUGU UAAGAUUUGA AGUUGGCCUU UUAUUGGACU 3600 AAAGGGGAAC UCCUUUAAGG GUCUCAGUUA GCCCAAGUUU CUUUUGCUUA UAUGUUAAUA 3660 GUUUUACCCU CUGCAUUGGA GAGAGGAGUG CUUUACUCCA AGAAGCUUUC CUCAUGGUUA 3720 CCGUUCUCUC CAUCAUGCCA GCCUUCUCAA CCUUUGCAGA AAUUACUAGA GAGGAUUUGA 3780 AUGUGGGACA CAAAGGUCCC AUUUGCAGUU AGAAAAUUUG UGUCCACAAG GACAAGAACA 3840 AAGUAUGAGC UUUAAAACUC CAUAGGAAAC UUGUUAAUCA ACAAAGAAGU GUUAAUGCUG 3900 CAAGUAAUCU CUUUUUUAAA ACUUUUUGAA GCUACUUAUU UUCAGCCAAA UAGGAAUAUU 3960 AGAGAGGGAC UGGUAGUGAG AAUAUCAGCU CUGUUUGGAU GGUGGAAGGU CUCAUUUUAU 4020 UGAGAUUUUU AAGAUACAUG CAAAGGUUUG GAAAUAGAAC CUCUAGGCAC CCUCCUCAGU 4080 GUGGGUGGGC UGAGAGUUAA AGACAGUGUG GCUGCAGUAG CAUAGAGGCG CCUAGAAAUU 4140 CCACUUGCAC CGUAGGGCAU GCUGAUACCA UCCCAAUAGC UGUUGCCCAU UGACCUCUAG 4200 UGGUGAGUUU CUAGAAUACU GGUCCAUUCA UGAGAUAUUC AAGAUUCAAG AGUAUUCUCA 4260 CUUCUGGGUU AUCAGCAUAA ACUGGAAUGU AGUGUCAGAG GAUACUGUGG CUUGUUUUGU 4320 UUAUGUUUUU UUUUCUUAUU CAAGAAAAAA GACCAAGGAA UAACAUUCUG UAGUUCCUAA 4380 AAAUACUGAC UUUUUUCACU ACUAUACAUA AAGGGAAAGU UUUAUUCUUU UAUGGAACAC 4440 UUCAGCUGUA CUCAUGUAUU AAAAUAGGAA UGUGAAUGCU AUAUACUCUU UUUAUAUCAA 4500 AAGUCUCAAG CACUUAUUUU UAUUCUAUGC AUUGUUUGUC UUUUACAUAA AUAAAAUGUU 4560 UAUUAGAUUG AAUAAAGCAA AAUACUCAGG UGAGCAUCCU GCCUCCUGUU CCCAUUCCUA 4620 GUAGCUAAA 4629

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 828 <210> SEQ ID NO 1 <211> LENGTH: 4629 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, antisense DNA <400> SEQUENCE: 1 tttagctact aggaatggga acaggaggca ggatgctcac ctgagtattt tgctttattc 60 aatctaataa acattttatt tatgtaaaag acaaacaatg catagaataa aaataagtgc 120 ttgagacttt tgatataaaa agagtatata gcattcacat tcctatttta atacatgagt 180 acagctgaag tgttccataa aagaataaaa ctttcccttt atgtatagta gtgaaaaaag 240 tcagtatttt taggaactac agaatgttat tccttggtct tttttcttga ataagaaaaa 300 aaaacataaa caaaacaagc cacagtatcc tctgacacta cattccagtt tatgctgata 360 acccagaagt gagaatactc ttgaatcttg aatatctcat gaatggacca gtattctaga 420 aactcaccac tagaggtcaa tgggcaacag ctattgggat ggtatcagca tgccctacgg 480 tgcaagtgga atttctaggc gcctctatgc tactgcagcc acactgtctt taactctcag 540 cccacccaca ctgaggaggg tgcctagagg ttctatttcc aaacctttgc atgtatctta 600 aaaatctcaa taaaatgaga ccttccacca tccaaacaga gctgatattc tcactaccag 660 tccctctcta atattcctat ttggctgaaa ataagtagct tcaaaaagtt ttaaaaaaga 720 gattacttgc agcattaaca cttctttgtt gattaacaag tttcctatgg agttttaaag 780 ctcatacttt gttcttgtcc ttgtggacac aaattttcta actgcaaatg ggacctttgt 840 gtcccacatt caaatcctct ctagtaattt ctgcaaaggt tgagaaggct ggcatgatgg 900 agagaacggt aaccatgagg aaagcttctt ggagtaaagc actcctctct ccaatgcaga 960 gggtaaaact attaacatat aagcaaaaga aacttgggct aactgagacc cttaaaggag 1020 ttccccttta gtccaataaa aggccaactt caaatcttaa caccagataa ggtagtcaaa 1080 atcatattat atacccagag aatgactgct tgaatggaca tttcttacaa gggaccttgg 1140 ttaggtgcag atttaattcc tagactgggg tccaggtagg cagtggaaag agctaatgtt 1200 tacagtgaga agtgaggcag ctttgtaagt gtctccacac cttcacattt tgtgaacgtg 1260 gactggagat aactgaaaac catctgctat ccttacctgg ggatccagat tttcctgcaa 1320 aatctccaaa tatttataaa gtggcttcac tttttgaaac gctgtgctga ccaaacaaaa 1380 catatgttta gagtgcctga ggtcatagtc ctgacaatga tagtattgtg tagttgaaat 1440 cctcttcatc aggccaaact gtgcttgagc aatcaggagc ccagaaagat ggaacccatt 1500 ggtgtttgta tagaaaacta gaaaatcaag tcaagtgtaa tgaaaaagta aacacgataa 1560 agcctagagt gagaatttgc tcctttttag aaaaggatga aggctgggag cagagaatag 1620 taacataagt gcaggggaaa gatgaaaaaa agaacaattt ttcattagta gatggtgggg 1680 caatcgcatg gatggggaca tctgttctga tttttctgca acccatgaag gtaaaaagtg 1740 gggttcaaaa cattcaaggt attaaagatg gggtagagtt tctaaactag gttgagggag 1800 agtttctaaa ctagcccccc agatttgggg cttggagctt aaatgaaaag tccaggagaa 1860 ataagggcac acaggaaccc cgggaacact ggtcctcaaa cagtgccact gtacttagtt 1920 ccatggccag aagagaagtg ctaggcaggg aatgattatt ttgcaaaagc aagtgcaatg 1980 tggtcatagc tggctgtgag acatggagcc tctttcctca tgcaaagttc actgttttac 2040 agtcagagaa ccactgcatg tgtgattgtc aaatgctaat gctgtcatgg gtcccttcct 2100 tctctgcttg gttctggagt tctccaataa aaccaatttc ctgggaatat ttgatgtttt 2160 tccttgtctc ttttcaaggt atggctatat atatagagct atagacatat atagatatat 2220 atatatatat ataaaacata gctattcata tttatataca ggcattaata aagtgcaaat 2280 gttattggct attgtaaaaa tcaatctcat ttcctgagga agtgctaaca cagcttatcc 2340 tatgacaatg tcaaaggcat agaatgctct atgtcaccca ctccctgctg ctgttgtttc 2400 tgcttatccc cacagcttac agggagggga gtgaccccct tggttttcca ggaagcatca 2460 gttcaggggc agcttcctgc tgcctctgtt ctttggtgag aggggcagcc tctttggaca 2520 tggcccagcc tgccccagaa gagctatttg gtagtgttta gggagccgtc ttcaggaatc 2580 ttctcctccg agcagctcct ccccgagagc ctgtccagat gctccagctc actgaagcgt 2640 tctgccacac actgggctgt gagacgggcc tctgggtcgt ggtcccagca ctcagtcaac 2700 gtctcacaca ccatctggat gccctggtgg ttgagccaga agctgggaat ttctggtcgc 2760 cctcgatctc tcaacacgtt gtccttcatg ctttcgacac aggggtgctc ccgcaccttg 2820 gaaccaaatg gaggctcata atcttttact tctcccactg cattacagcg agatgtcatt 2880 tcccagagca ccagagccat ggagtagaca tcggtctgct tgaaggactc aacattctcc 2940 aaattcatcc tggattctag gacttctgga gccatgtatc ttgcagttcc cacctgccca 3000 ctgttagcca ggtcatccac agacagagta gggtccagac gcagggaaag cccaaagtca 3060 cacaggcagc aggttaggtc gttcttcacg aggatattgg agctcttgag gtccctgtgc 3120 acgatgggca tcttgggcct cccacatgga gtgtgatcac tgtggaggtg agcaatcccc 3180 cgggcgaggg agctgcccag cttgcgcagg tcctcccagc tgatgacatg ccgcgtcagg 3240 tactcctgta ggttgccctt ggcgtggaag gcggtgatca gccagtattg tttccccaac 3300 tccgtcttcc gctcctcagc cgtcaggaac tggagtatgt tctcatgctt cagattgatg 3360 tctgagaaga tgtccttctc tgtcttccaa gaggcatact cctcataggg aaagatcttg 3420 actgccactg tctcaaactg ctctgaagtg ttctgcttca gcttggcctt atagacctca 3480 gcaaagcgac ctttccccac cagggtgtcc agctcaatgg gcagcagctc tgtgttgtgg 3540 ttgatgttgt tggcacacgt ggagctgatg tcagagcggt catcttccag gatgatggca 3600 cagtgctcgc tgaactccat gagcttccgc gtcttgccgg tttcccaggt tgaactcagc 3660 ttctgctgcc ggttaacgcg gtagcagtag aagatgatga tgacagatat ggcaactccc 3720 agtggtggca ggaggctgat gcctgtcact tgaaatatga ctagcaacaa gtcaggattg 3780 ctggtgttat attcttctga gaagatgatg ttgtcattgc actcatcaga gctacaggaa 3840 cacatgaaga aagtctcacc aggctttttt ttttccttca taatgcactt tggagaagca 3900 gcatcttcca gaataaagtc atggtagggg agcttggggt catggcaaac tgtctctagt 3960 gttatgttct cgtcattctt tctccataca gccacacaga cttcctgtgg cttctcacag 4020 atggaggtga tgctgcagtt gctcatgcag gatttctggt tgtcacaggt ggaaaatctc 4080 acatcacaaa atttacacag ttgtggaaac ttgactgcac cgttgttgtc agtgactatc 4140 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 4200 aggacgatgt gcagcggcca caggcccctg agcagccccc gacccatggc agaccccgct 4260 gctcgtcata gaccgagccc ccagcgcagc ggacggcgcc ttcccggacc cctggctgcg 4320 cctccgcgcc gcgccctctc cggaccccgc gccgggccgg cagcgcagat gtgcgggcca 4380 gatgtggcgc ccgctcgcca gccaggaggg ggcctggagg ccggcgaggc gcggggaggc 4440 ccccggcggc cgagggaagc tgcacaggag tccggctcct gtcccgagcg ggtgcacgcg 4500 cgggggtgtc gtcgctccgt gcgcgcgagt gactcactca acttcaactc agcgctgcgg 4560 gggaaacagg aaactcctcg ccaacagctg ggcaggacct ctctccgccc gagagccttc 4620 tccctctcc 4629 <210> SEQ ID NO 2 <211> LENGTH: 4629 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 ggagagggag aaggctctcg ggcggagaga ggtcctgccc agctgttggc gaggagtttc 60 ctgtttcccc cgcagcgctg agttgaagtt gagtgagtca ctcgcgcgca cggagcgacg 120 acacccccgc gcgtgcaccc gctcgggaca ggagccggac tcctgtgcag cttccctcgg 180 ccgccggggg cctccccgcg cctcgccggc ctccaggccc cctcctggct ggcgagcggg 240 cgccacatct ggcccgcaca tctgcgctgc cggcccggcg cggggtccgg agagggcgcg 300 gcgcggaggc gcagccaggg gtccgggaag gcgccgtccg ctgcgctggg ggctcggtct 360 atgacgagca gcggggtctg ccatgggtcg ggggctgctc aggggcctgt ggccgctgca 420 catcgtcctg tggacgcgta tcgccagcac gatcccaccg cacgttcaga agtcggttaa 480 taacgacatg atagtcactg acaacaacgg tgcagtcaag tttccacaac tgtgtaaatt 540 ttgtgatgtg agattttcca cctgtgacaa ccagaaatcc tgcatgagca actgcagcat 600 cacctccatc tgtgagaagc cacaggaagt ctgtgtggct gtatggagaa agaatgacga 660 gaacataaca ctagagacag tttgccatga ccccaagctc ccctaccatg actttattct 720 ggaagatgct gcttctccaa agtgcattat gaaggaaaaa aaaaagcctg gtgagacttt 780 cttcatgtgt tcctgtagct ctgatgagtg caatgacaac atcatcttct cagaagaata 840 taacaccagc aatcctgact tgttgctagt catatttcaa gtgacaggca tcagcctcct 900 gccaccactg ggagttgcca tatctgtcat catcatcttc tactgctacc gcgttaaccg 960 gcagcagaag ctgagttcaa cctgggaaac cggcaagacg cggaagctca tggagttcag 1020 cgagcactgt gccatcatcc tggaagatga ccgctctgac atcagctcca cgtgtgccaa 1080 caacatcaac cacaacacag agctgctgcc cattgagctg gacaccctgg tggggaaagg 1140 tcgctttgct gaggtctata aggccaagct gaagcagaac acttcagagc agtttgagac 1200 agtggcagtc aagatctttc cctatgagga gtatgcctct tggaagacag agaaggacat 1260 cttctcagac atcaatctga agcatgagaa catactccag ttcctgacgg ctgaggagcg 1320 gaagacggag ttggggaaac aatactggct gatcaccgcc ttccacgcca agggcaacct 1380 acaggagtac ctgacgcggc atgtcatcag ctgggaggac ctgcgcaagc tgggcagctc 1440 cctcgcccgg gggattgctc acctccacag tgatcacact ccatgtggga ggcccaagat 1500 gcccatcgtg cacagggacc tcaagagctc caatatcctc gtgaagaacg acctaacctg 1560 ctgcctgtgt gactttgggc tttccctgcg tctggaccct actctgtctg tggatgacct 1620 ggctaacagt gggcaggtgg gaactgcaag atacatggct ccagaagtcc tagaatccag 1680 gatgaatttg gagaatgttg agtccttcaa gcagaccgat gtctactcca tggctctggt 1740 gctctgggaa atgacatctc gctgtaatgc agtgggagaa gtaaaagatt atgagcctcc 1800 atttggttcc aaggtgcggg agcacccctg tgtcgaaagc atgaaggaca acgtgttgag 1860 agatcgaggg cgaccagaaa ttcccagctt ctggctcaac caccagggca tccagatggt 1920 gtgtgagacg ttgactgagt gctgggacca cgacccagag gcccgtctca cagcccagtg 1980 tgtggcagaa cgcttcagtg agctggagca tctggacagg ctctcgggga ggagctgctc 2040 ggaggagaag attcctgaag acggctccct aaacactacc aaatagctct tctggggcag 2100 gctgggccat gtccaaagag gctgcccctc tcaccaaaga acagaggcag caggaagctg 2160 cccctgaact gatgcttcct ggaaaaccaa gggggtcact cccctccctg taagctgtgg 2220 ggataagcag aaacaacagc agcagggagt gggtgacata gagcattcta tgcctttgac 2280 attgtcatag gataagctgt gttagcactt cctcaggaaa tgagattgat ttttacaata 2340 gccaataaca tttgcacttt attaatgcct gtatataaat atgaatagct atgttttata 2400 tatatatata tatatctata tatgtctata gctctatata tatagccata ccttgaaaag 2460 agacaaggaa aaacatcaaa tattcccagg aaattggttt tattggagaa ctccagaacc 2520 aagcagagaa ggaagggacc catgacagca ttagcatttg acaatcacac atgcagtggt 2580 tctctgactg taaaacagtg aactttgcat gaggaaagag gctccatgtc tcacagccag 2640 ctatgaccac attgcacttg cttttgcaaa ataatcattc cctgcctagc acttctcttc 2700 tggccatgga actaagtaca gtggcactgt ttgaggacca gtgttcccgg ggttcctgtg 2760 tgcccttatt tctcctggac ttttcattta agctccaagc cccaaatctg gggggctagt 2820 ttagaaactc tccctcaacc tagtttagaa actctacccc atctttaata ccttgaatgt 2880 tttgaacccc actttttacc ttcatgggtt gcagaaaaat cagaacagat gtccccatcc 2940 atgcgattgc cccaccatct actaatgaaa aattgttctt tttttcatct ttcccctgca 3000 cttatgttac tattctctgc tcccagcctt catccttttc taaaaaggag caaattctca 3060 ctctaggctt tatcgtgttt actttttcat tacacttgac ttgattttct agttttctat 3120 acaaacacca atgggttcca tctttctggg ctcctgattg ctcaagcaca gtttggcctg 3180 atgaagagga tttcaactac acaatactat cattgtcagg actatgacct caggcactct 3240 aaacatatgt tttgtttggt cagcacagcg tttcaaaaag tgaagccact ttataaatat 3300 ttggagattt tgcaggaaaa tctggatccc caggtaagga tagcagatgg ttttcagtta 3360 tctccagtcc acgttcacaa aatgtgaagg tgtggagaca cttacaaagc tgcctcactt 3420 ctcactgtaa acattagctc tttccactgc ctacctggac cccagtctag gaattaaatc 3480 tgcacctaac caaggtccct tgtaagaaat gtccattcaa gcagtcattc tctgggtata 3540 taatatgatt ttgactacct tatctggtgt taagatttga agttggcctt ttattggact 3600 aaaggggaac tcctttaagg gtctcagtta gcccaagttt cttttgctta tatgttaata 3660 gttttaccct ctgcattgga gagaggagtg ctttactcca agaagctttc ctcatggtta 3720 ccgttctctc catcatgcca gccttctcaa cctttgcaga aattactaga gaggatttga 3780 atgtgggaca caaaggtccc atttgcagtt agaaaatttg tgtccacaag gacaagaaca 3840 aagtatgagc tttaaaactc cataggaaac ttgttaatca acaaagaagt gttaatgctg 3900 caagtaatct cttttttaaa actttttgaa gctacttatt ttcagccaaa taggaatatt 3960 agagagggac tggtagtgag aatatcagct ctgtttggat ggtggaaggt ctcattttat 4020 tgagattttt aagatacatg caaaggtttg gaaatagaac ctctaggcac cctcctcagt 4080 gtgggtgggc tgagagttaa agacagtgtg gctgcagtag catagaggcg cctagaaatt 4140 ccacttgcac cgtagggcat gctgatacca tcccaatagc tgttgcccat tgacctctag 4200 tggtgagttt ctagaatact ggtccattca tgagatattc aagattcaag agtattctca 4260 cttctgggtt atcagcataa actggaatgt agtgtcagag gatactgtgg cttgttttgt 4320 ttatgttttt ttttcttatt caagaaaaaa gaccaaggaa taacattctg tagttcctaa 4380 aaatactgac ttttttcact actatacata aagggaaagt tttattcttt tatggaacac 4440 ttcagctgta ctcatgtatt aaaataggaa tgtgaatgct atatactctt tttatatcaa 4500 aagtctcaag cacttatttt tattctatgc attgtttgtc ttttacataa ataaaatgtt 4560 tattagattg aataaagcaa aatactcagg tgagcatcct gcctcctgtt cccattccta 4620 gtagctaaa 4629 <210> SEQ ID NO 3 <211> LENGTH: 4629 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 ggagagggag aaggcucucg ggcggagaga gguccugccc agcuguuggc gaggaguuuc 60 cuguuucccc cgcagcgcug aguugaaguu gagugaguca cucgcgcgca cggagcgacg 120 acacccccgc gcgugcaccc gcucgggaca ggagccggac uccugugcag cuucccucgg 180 ccgccggggg ccuccccgcg ccucgccggc cuccaggccc ccuccuggcu ggcgagcggg 240 cgccacaucu ggcccgcaca ucugcgcugc cggcccggcg cgggguccgg agagggcgcg 300 gcgcggaggc gcagccaggg guccgggaag gcgccguccg cugcgcuggg ggcucggucu 360 augacgagca gcggggucug ccaugggucg ggggcugcuc aggggccugu ggccgcugca 420 caucguccug uggacgcgua ucgccagcac gaucccaccg cacguucaga agucgguuaa 480 uaacgacaug auagucacug acaacaacgg ugcagucaag uuuccacaac uguguaaauu 540 uugugaugug agauuuucca ccugugacaa ccagaaaucc ugcaugagca acugcagcau 600 caccuccauc ugugagaagc cacaggaagu cuguguggcu guauggagaa agaaugacga 660 gaacauaaca cuagagacag uuugccauga ccccaagcuc cccuaccaug acuuuauucu 720 ggaagaugcu gcuucuccaa agugcauuau gaaggaaaaa aaaaagccug gugagacuuu 780 cuucaugugu uccuguagcu cugaugagug caaugacaac aucaucuucu cagaagaaua 840 uaacaccagc aauccugacu uguugcuagu cauauuucaa gugacaggca ucagccuccu 900 gccaccacug ggaguugcca uaucugucau caucaucuuc uacugcuacc gcguuaaccg 960 gcagcagaag cugaguucaa ccugggaaac cggcaagacg cggaagcuca uggaguucag 1020 cgagcacugu gccaucaucc uggaagauga ccgcucugac aucagcucca cgugugccaa 1080 caacaucaac cacaacacag agcugcugcc cauugagcug gacacccugg uggggaaagg 1140 ucgcuuugcu gaggucuaua aggccaagcu gaagcagaac acuucagagc aguuugagac 1200 aguggcaguc aagaucuuuc ccuaugagga guaugccucu uggaagacag agaaggacau 1260 cuucucagac aucaaucuga agcaugagaa cauacuccag uuccugacgg cugaggagcg 1320 gaagacggag uuggggaaac aauacuggcu gaucaccgcc uuccacgcca agggcaaccu 1380 acaggaguac cugacgcggc augucaucag cugggaggac cugcgcaagc ugggcagcuc 1440 ccucgcccgg gggauugcuc accuccacag ugaucacacu ccauguggga ggcccaagau 1500 gcccaucgug cacagggacc ucaagagcuc caauauccuc gugaagaacg accuaaccug 1560 cugccugugu gacuuugggc uuucccugcg ucuggacccu acucugucug uggaugaccu 1620 ggcuaacagu gggcaggugg gaacugcaag auacauggcu ccagaagucc uagaauccag 1680 gaugaauuug gagaauguug aguccuucaa gcagaccgau gucuacucca uggcucuggu 1740 gcucugggaa augacaucuc gcuguaaugc agugggagaa guaaaagauu augagccucc 1800 auuugguucc aaggugcggg agcaccccug ugucgaaagc augaaggaca acguguugag 1860 agaucgaggg cgaccagaaa uucccagcuu cuggcucaac caccagggca uccagauggu 1920 gugugagacg uugacugagu gcugggacca cgacccagag gcccgucuca cagcccagug 1980 uguggcagaa cgcuucagug agcuggagca ucuggacagg cucucgggga ggagcugcuc 2040 ggaggagaag auuccugaag acggcucccu aaacacuacc aaauagcucu ucuggggcag 2100 gcugggccau guccaaagag gcugccccuc ucaccaaaga acagaggcag caggaagcug 2160 ccccugaacu gaugcuuccu ggaaaaccaa gggggucacu ccccucccug uaagcugugg 2220 ggauaagcag aaacaacagc agcagggagu gggugacaua gagcauucua ugccuuugac 2280 auugucauag gauaagcugu guuagcacuu ccucaggaaa ugagauugau uuuuacaaua 2340 gccaauaaca uuugcacuuu auuaaugccu guauauaaau augaauagcu auguuuuaua 2400 uauauauaua uauaucuaua uaugucuaua gcucuauaua uauagccaua ccuugaaaag 2460 agacaaggaa aaacaucaaa uauucccagg aaauugguuu uauuggagaa cuccagaacc 2520 aagcagagaa ggaagggacc caugacagca uuagcauuug acaaucacac augcaguggu 2580 ucucugacug uaaaacagug aacuuugcau gaggaaagag gcuccauguc ucacagccag 2640 cuaugaccac auugcacuug cuuuugcaaa auaaucauuc ccugccuagc acuucucuuc 2700 uggccaugga acuaaguaca guggcacugu uugaggacca guguucccgg gguuccugug 2760 ugcccuuauu ucuccuggac uuuucauuua agcuccaagc cccaaaucug gggggcuagu 2820 uuagaaacuc ucccucaacc uaguuuagaa acucuacccc aucuuuaaua ccuugaaugu 2880 uuugaacccc acuuuuuacc uucauggguu gcagaaaaau cagaacagau guccccaucc 2940 augcgauugc cccaccaucu acuaaugaaa aauuguucuu uuuuucaucu uuccccugca 3000 cuuauguuac uauucucugc ucccagccuu cauccuuuuc uaaaaaggag caaauucuca 3060 cucuaggcuu uaucguguuu acuuuuucau uacacuugac uugauuuucu aguuuucuau 3120 acaaacacca auggguucca ucuuucuggg cuccugauug cucaagcaca guuuggccug 3180 augaagagga uuucaacuac acaauacuau cauugucagg acuaugaccu caggcacucu 3240 aaacauaugu uuuguuuggu cagcacagcg uuucaaaaag ugaagccacu uuauaaauau 3300 uuggagauuu ugcaggaaaa ucuggauccc cagguaagga uagcagaugg uuuucaguua 3360 ucuccagucc acguucacaa aaugugaagg uguggagaca cuuacaaagc ugccucacuu 3420 cucacuguaa acauuagcuc uuuccacugc cuaccuggac cccagucuag gaauuaaauc 3480 ugcaccuaac caaggucccu uguaagaaau guccauucaa gcagucauuc ucuggguaua 3540 uaauaugauu uugacuaccu uaucuggugu uaagauuuga aguuggccuu uuauuggacu 3600 aaaggggaac uccuuuaagg gucucaguua gcccaaguuu cuuuugcuua uauguuaaua 3660 guuuuacccu cugcauugga gagaggagug cuuuacucca agaagcuuuc cucaugguua 3720 ccguucucuc caucaugcca gccuucucaa ccuuugcaga aauuacuaga gaggauuuga 3780 augugggaca caaagguccc auuugcaguu agaaaauuug uguccacaag gacaagaaca 3840 aaguaugagc uuuaaaacuc cauaggaaac uuguuaauca acaaagaagu guuaaugcug 3900 caaguaaucu cuuuuuuaaa acuuuuugaa gcuacuuauu uucagccaaa uaggaauauu 3960 agagagggac ugguagugag aauaucagcu cuguuuggau gguggaaggu cucauuuuau 4020 ugagauuuuu aagauacaug caaagguuug gaaauagaac cucuaggcac ccuccucagu 4080 gugggugggc ugagaguuaa agacagugug gcugcaguag cauagaggcg ccuagaaauu 4140 ccacuugcac cguagggcau gcugauacca ucccaauagc uguugcccau ugaccucuag 4200 uggugaguuu cuagaauacu gguccauuca ugagauauuc aagauucaag aguauucuca 4260 cuucuggguu aucagcauaa acuggaaugu agugucagag gauacugugg cuuguuuugu 4320 uuauguuuuu uuuucuuauu caagaaaaaa gaccaaggaa uaacauucug uaguuccuaa 4380 aaauacugac uuuuuucacu acuauacaua aagggaaagu uuuauucuuu uauggaacac 4440 uucagcugua cucauguauu aaaauaggaa ugugaaugcu auauacucuu uuuauaucaa 4500 aagucucaag cacuuauuuu uauucuaugc auuguuuguc uuuuacauaa auaaaauguu 4560 uauuagauug aauaaagcaa aauacucagg ugagcauccu gccuccuguu cccauuccua 4620 guagcuaaa 4629 <210> SEQ ID NO 4 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 4 tggtccattc 10 <210> SEQ ID NO 5 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 5 ccctaaacac 10 <210> SEQ ID NO 6 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 6 actaccaaat 10 <210> SEQ ID NO 7 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 7 ggacgcgtat 10 <210> SEQ ID NO 8 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 8 gtctatgacg 10 <210> SEQ ID NO 9 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 9 ttattaatgc 10 <210> SEQ ID NO 10 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S3 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGCCCCAGAAGAGCTATTTGGTAG'3 or sequences derived from 5'TGCCCCAGAAGAGCTATTTGGTAG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'GAGCCGTCTTCAGGAATCTTCTCC'3 or sequences derived from 5'GAGCCGTCTTCAGGAATCTTCTCC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 10 ntgtttaggn 10 <210> SEQ ID NO 11 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S4 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GCCCAGCCTGCCCCAGAAGAGCTA'3 or sequences derived from 5'GCCCAGCCTGCCCCAGAAGAGCTA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'TGTTTAGGGAGCCGTCTTCAGGAA'3 or sequences derived from 5'TGTTTAGGGAGCCGTCTTCAGGAA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least T <400> SEQUENCE: 11 ntttggtagn 10 <210> SEQ ID NO 12 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S1 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'CATGGCAGACCCCGCTGCTC'3 or sequences derived from 5'CATGGCAGACCCCGCTGCTC'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'CCGAGCCCCCAGCGCAGCGG'3 or sequences derived from 5'CCGAGCCCCCAGCGCAGCGG'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <400> SEQUENCE: 12 ngtcatagan 10 <210> SEQ ID NO 13 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 13 gctcgtcata gaccga 16 <210> SEQ ID NO 14 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 14 cgatacgcgt ccacag 16 <210> SEQ ID NO 15 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 15 gtagtgttta gggagc 16 <210> SEQ ID NO 16 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 16 gctatttggt agtgtt 16 <210> SEQ ID NO 17 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 17 catgaatgga ccagta 16 <210> SEQ ID NO 18 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 18 aggcattaat aaagtg 16 <210> SEQ ID NO 19 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 19 ccgctgctcg tcatagac 18 <210> SEQ ID NO 20 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 20 cgctgctcgt catagacc 18 <210> SEQ ID NO 21 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 21 gctgctcgtc atagaccg 18 <210> SEQ ID NO 22 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 22 ctgctcgtca tagaccga 18 <210> SEQ ID NO 23 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 23 tgctcgtcat agaccgag 18 <210> SEQ ID NO 24 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 24 gctcgtcata gaccgagc 18 <210> SEQ ID NO 25 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 25 ctcgtcatag accgagcc 18 <210> SEQ ID NO 26 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 26 tcgtcataga ccgagccc 18 <210> SEQ ID NO 27 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 27 cgtcatagac cgagcccc 18 <210> SEQ ID NO 28 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 28 cgctgctcgt catagac 17 <210> SEQ ID NO 29 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 29 gctgctcgtc atagacc 17 <210> SEQ ID NO 30 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 30 ctgctcgtca tagaccg 17 <210> SEQ ID NO 31 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 31 tgctcgtcat agaccga 17 <210> SEQ ID NO 32 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 32 gctcgtcata gaccgag 17 <210> SEQ ID NO 33 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 33 ctcgtcatag accgagc 17 <210> SEQ ID NO 34 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 34 tcgtcataga ccgagcc 17 <210> SEQ ID NO 35 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 35 cgtcatagac cgagccc 17 <210> SEQ ID NO 36 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 36 gctgctcgtc atagac 16 <210> SEQ ID NO 37 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 37 ctgctcgtca tagacc 16 <210> SEQ ID NO 38 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 38 tgctcgtcat agaccg 16 <210> SEQ ID NO 39 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 39 gctcgtcata gaccga 16 <210> SEQ ID NO 40 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 40 ctcgtcatag accgag 16 <210> SEQ ID NO 41 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 41 tcgtcataga ccgagc 16 <210> SEQ ID NO 42 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 42 cgtcatagac cgagcc 16 <210> SEQ ID NO 43 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 43 ctgctcgtca tagac 15 <210> SEQ ID NO 44 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 44 tgctcgtcat agacc 15 <210> SEQ ID NO 45 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 45 gctcgtcata gaccg 15 <210> SEQ ID NO 46 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 46 ctcgtcatag accga 15 <210> SEQ ID NO 47 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 47 tcgtcataga ccgag 15 <210> SEQ ID NO 48 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 48 cgtcatagac cgagc 15 <210> SEQ ID NO 49 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 49 tgctcgtcat agac 14 <210> SEQ ID NO 50 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 50 gctcgtcata gacc 14 <210> SEQ ID NO 51 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 51 ctcgtcatag accg 14 <210> SEQ ID NO 52 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 52 tcgtcataga ccga 14 <210> SEQ ID NO 53 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 53 cgtcatagac cgag 14 <210> SEQ ID NO 54 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 54 gctggcgata cgcgtcca 18 <210> SEQ ID NO 55 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 55 ctggcgatac gcgtccac 18 <210> SEQ ID NO 56 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 56 tggcgatacg cgtccaca 18 <210> SEQ ID NO 57 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 57 ggcgatacgc gtccacag 18 <210> SEQ ID NO 58 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 58 gcgatacgcg tccacagg 18 <210> SEQ ID NO 59 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 59 cgatacgcgt ccacagga 18 <210> SEQ ID NO 60 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 60 gatacgcgtc cacaggac 18 <210> SEQ ID NO 61 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 61 atacgcgtcc acaggacg 18 <210> SEQ ID NO 62 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 62 tacgcgtcca caggacga 18 <210> SEQ ID NO 63 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 63 ctggcgatac gcgtcca 17 <210> SEQ ID NO 64 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 64 tggcgatacg cgtccac 17 <210> SEQ ID NO 65 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 65 ggcgatacgc gtccaca 17 <210> SEQ ID NO 66 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 66 gcgatacgcg tccacag 17 <210> SEQ ID NO 67 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 67 cgatacgcgt ccacagg 17 <210> SEQ ID NO 68 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 68 gatacgcgtc cacagga 17 <210> SEQ ID NO 69 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'CATGGCAGACCCCGCTGCT'3 or sequences derived from 5'CATGGCAGACCCCGCTGCT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'CGAGCCCCCAGCGCAGCGG'3 or sequences derived from 5'CGAGCCCCCAGCGCAGCGG'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 69 ncgtcataga cn 12 <210> SEQ ID NO 70 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GGTGGGATCGTGCTGGCGA'3 or sequences derived from 5'GGTGGGATCGTGCTGGCGA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'CAGGACGATGTGCAGCGGC'3 or sequences derived from 5'CAGGACGATGTGCAGCGGC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <400> SEQUENCE: 70 ntacgcgtcc an 12 <210> SEQ ID NO 71 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGCCCCAGAAGAGCTATTTGGTA'3 or sequences derived from 5'TGCCCCAGAAGAGCTATTTGGTA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'AGCCGTCTTCAGGAATCTTCTCC'3 or sequences derived from 5'AGCCGTCTTCAGGAATCTTCTCC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least A <400> SEQUENCE: 71 ngtgtttagg gn 12 <210> SEQ ID NO 72 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GCCCAGCCTGCCCCAGAAGAGCT'3 or sequences derived from 5'GCCCAGCCTGCCCCAGAAGAGCT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTTTAGGGAGCCGTCTTCAGGAA'3 or sequences derived from 5'GTTTAGGGAGCCGTCTTCAGGAA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 72 natttggtag tn 12 <210> SEQ ID NO 73 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGAATCTTGAATATCTCAT'3 or sequences derived from 5'TGAATCTTGAATATCTCAT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTATTCTAGAAACTCACCA'3 or sequences derived from 5'GTATTCTAGAAACTCACCA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <400> SEQUENCE: 73 ngaatggacc an 12 <210> SEQ ID NO 74 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'ATTCATATTTATATACAGG'3 or sequences derived from 5'ATTCATATTTATATACAGG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTGCAAATGTTATTGGCTA'3 or sequences derived from 5'GTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 74 ncattaataa an 12 <210> SEQ ID NO 75 <211> LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 75 gaatcttgaa tatctcatga atggaccagt attctagaaa c 41 <210> SEQ ID NO 76 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide (scrambled control) <400> SEQUENCE: 76 aacacgtcta tacgc 15 <210> SEQ ID NO 77 <211> LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 77 ttcatattta tatacaggca ttaataaagt gcaaatgtta t 41 <210> SEQ ID NO 78 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 78 tgaggaagtg ctaacacagc ttatcctatg acaatgtcaa ag 42 <210> SEQ ID NO 79 <211> LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 79 gcctgcccca gaagagctat ttggtagtgt ttagggagcc gtcttcagg 49 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 80 ttgaatatct catgaatgga 20 <210> SEQ ID NO 81 <211> LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 81 cgcaggtcct cccagctgat gacatgccgc gtcaggtact cctgtaggt 49 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 82 cagaagagct atttggtagt 20 <210> SEQ ID NO 83 <211> LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 83 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 60 aggacgatgt gcagcggc 78 <210> SEQ ID NO 84 <211> LENGTH: 74 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 84 ggccacaggc ccctgagcag cccccgaccc atggcagacc ccgctgctcg tcatagaccg 60 agcccccagc gcag 74 <210> SEQ ID NO 85 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 85 tggtagtgtt tagggagccg 20 <210> SEQ ID NO 86 <211> LENGTH: 149 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 86 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 60 aggacgatgt gcagcggcca caggcccctg agcagccccc gacccatggc agaccccgct 120 gctcgtcata gaccgagccc ccagcgcag 149 <210> SEQ ID NO 87 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 87 ttgaatatct catgaatgga ccagtattct a 31 <210> SEQ ID NO 88 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 88 caagtggaat ttctaggcgc ctctatgcta ctg 33 <210> SEQ ID NO 89 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 89 atttatatac aggcattaat aaagtgcaaa t 31 <210> SEQ ID NO 90 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 90 aagtgctaac acagcttatc ctatgacaat gt 32 <210> SEQ ID NO 91 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 91 ccccagaaga gctatttggt agtgtttagg gagccgtct 39 <210> SEQ ID NO 92 <211> LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 92 ctggtcgccc tcgatctctc aacacgttgt ccttcatgct ttcgacacag gggtgctccc 60 gcaccttgga accaaatg 78 <210> SEQ ID NO 93 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 93 gtcctcccag ctgatgacat gccgcgtcag gtactcctg 39 <210> SEQ ID NO 94 <211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 94 ctcagcttct gctgccggtt aacgcggtag cagtagaaga 40 <210> SEQ ID NO 95 <211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 95 gttattaacc gacttctgaa cgtgcggtgg gatcgtgctg gcgatacgcg tccacaggac 60 gatgtgca 68 <210> SEQ ID NO 96 <211> LENGTH: 64 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 96 caggcccctg agcagccccc gacccatggc agaccccgct gctcgtcata gaccgagccc 60 ccag 64 <210> SEQ ID NO 97 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 97 cacgcgcggg ggtgtcgtcg ctccgtgcgc gcgagtgact cactcaactt ca 52 <210> SEQ ID NO 98 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S2 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'GGTGGGATCGTGCTGGCGAT'3 or sequences derived from 5'GGTGGGATCGTGCTGGCGAT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'ACAGGACGATGTGCAGCGGC'3 or sequences derived from 5'ACAGGACGATGTGCAGCGGC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <400> SEQUENCE: 98 nacgcgtccn 10 <210> SEQ ID NO 99 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S5 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'CCCAGCCTGCCCCAGAAGAGCTATTTG'3 or sequences derived from 5'CCCAGCCTGCCCCAGAAGAGCTATTTG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'TAGGGAGCCGTCTTCAGGAATCTTCTC'3 or sequences derived from 5'TAGGGAGCCGTCTTCAGGAATCTTCTC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least G <400> SEQUENCE: 99 ngtagtgttn 10 <210> SEQ ID NO 100 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S6 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'TGAATCTTGAATATCTCATG'3 or sequences derived from 5'TGAATCTTGAATATCTCATG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGAATCTTGAATATCTCATG'3 or sequences derived from 5'TGAATCTTGAATATCTCATG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'AGTATTCTAGAAACTCACCA'3 or sequences derived from 5'AGTATTCTAGAAACTCACCA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <400> SEQUENCE: 100 naatggaccn 10 <210> SEQ ID NO 101 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S7 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'ATTCATATTTATATACAGGC'3 or sequences derived from 5'ATTCATATTTATATACAGGC'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'AGTGCAAATGTTATTGGCTA'3 or sequences derived from 5'AGTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'AGTGCAAATGTTATTGGCTA'3 or sequences derived from 5'AGTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least A <400> SEQUENCE: 101 nattaataan 10 <210> SEQ ID NO 102 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 102 gcgagtgact cactcaa 17 <210> SEQ ID NO 103 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 103 cgagtgactc actca 15 <210> SEQ ID NO 104 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 104 gcgagtgact cactca 16 <210> SEQ ID NO 105 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 105 cgcgagtgac tcactca 17 <210> SEQ ID NO 106 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 106 cgagtgactc actc 14 <210> SEQ ID NO 107 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 107 cgcgagtgac tcactc 16 <210> SEQ ID NO 108 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 108 gcgcgagtga ctcactc 17 <210> SEQ ID NO 109 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 109 gcgagtgact cact 14 <210> SEQ ID NO 110 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 110 gcgcgagtga ctcact 16 <210> SEQ ID NO 111 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 111 cgcgcgagtg actcact 17 <210> SEQ ID NO 112 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 112 cgagtgactc ac 12 <210> SEQ ID NO 113 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 113 gcgagtgact cac 13 <210> SEQ ID NO 114 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 114 cgcgagtgac tcac 14 <210> SEQ ID NO 115 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 115 cgcgcgagtg actcac 16 <210> SEQ ID NO 116 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 116 gcgcgcgagt gactcac 17 <210> SEQ ID NO 117 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 117 cgcgagtgac tca 13 <210> SEQ ID NO 118 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 118 gcgcgagtga ctca 14 <210> SEQ ID NO 119 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 119 cgcgcgagtg actca 15 <210> SEQ ID NO 120 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 120 gcgcgcgagt gactca 16 <210> SEQ ID NO 121 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 121 tgcgcgcgag tgactca 17 <210> SEQ ID NO 122 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 122 cgcgcgagtg actc 14 <210> SEQ ID NO 123 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 123 tgcgcgcgag tgactc 16 <210> SEQ ID NO 124 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 124 gtgcgcgcga gtgactc 17 <210> SEQ ID NO 125 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 125 cgcgcgagtg act 13 <210> SEQ ID NO 126 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 126 tgcgcgcgag tgac 14 <210> SEQ ID NO 127 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 127 cgtgcgcgcg agtgac 16 <210> SEQ ID NO 128 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 128 tgcgcgcgag tga 13 <210> SEQ ID NO 129 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 129 gtcgtcgctc cgtgcg 16 <210> SEQ ID NO 130 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 130 gtcgtcgctc cgtgc 15 <210> SEQ ID NO 131 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 131 gtgtcgtcgc tccgtgc 17 <210> SEQ ID NO 132 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 132 tcgtcgctcc gtg 13 <210> SEQ ID NO 133 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 133 tgtcgtcgct ccgtg 15 <210> SEQ ID NO 134 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 134 tcgtcgctcc gt 12 <210> SEQ ID NO 135 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 135 gtcgtcgctc cgt 13 <210> SEQ ID NO 136 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 136 tgtcgtcgct ccgt 14 <210> SEQ ID NO 137 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 137 gtgtcgtcgc tccgt 15 <210> SEQ ID NO 138 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 138 ggtgtcgtcg ctccgt 16 <210> SEQ ID NO 139 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 139 cgtcatagac cgagcc 16 <210> SEQ ID NO 140 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 140 atagaccgag cc 12 <210> SEQ ID NO 141 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 141 gctcgtcata gaccga 16 <210> SEQ ID NO 142 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 142 cgtcatagac cga 13 <210> SEQ ID NO 143 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 143 ctcgtcatag accg 14 <210> SEQ ID NO 144 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 144 gctcgtcata gaccg 15 <210> SEQ ID NO 145 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 145 gctcgtcata gacc 14 <210> SEQ ID NO 146 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 146 cagcccccga cccatgg 17 <210> SEQ ID NO 147 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 147 cagcccccga cccatg 16 <210> SEQ ID NO 148 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 148 agcccccgac ccat 14 <210> SEQ ID NO 149 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 149 cagcccccga cccaagcccc cgacccat 28 <210> SEQ ID NO 150 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 150 cgcgtccaca ggacgat 17 <210> SEQ ID NO 151 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 151 cgcgtccaca ggac 14 <210> SEQ ID NO 152 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 152 cgatacgcgt ccaca 15 <210> SEQ ID NO 153 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 153 cgatacgcgt cca 13 <210> SEQ ID NO 154 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 154 tggcgatacg cgtcca 16 <210> SEQ ID NO 155 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 155 cgatacgcgt cc 12 <210> SEQ ID NO 156 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 156 gcgatacgcg tcc 13 <210> SEQ ID NO 157 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 157 gctggcgata cgcgtcc 17 <210> SEQ ID NO 158 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 158 ctggcgatac gcgtc 15 <210> SEQ ID NO 159 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 159 gcgatacgcg tc 12 <210> SEQ ID NO 160 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 160 gctggcgata cgcgtc 16 <210> SEQ ID NO 161 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 161 tggcgatacg cgtc 14 <210> SEQ ID NO 162 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 162 tggcgatacg cgt 13 <210> SEQ ID NO 163 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 163 ctggcgatac gcgt 14 <210> SEQ ID NO 164 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 164 ggcgatacgc gt 12 <210> SEQ ID NO 165 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 165 ctggcgatac gcg 13 <210> SEQ ID NO 166 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 166 tggcgatacg cg 12 <210> SEQ ID NO 167 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 167 atcgtgctgg cgatacg 17 <210> SEQ ID NO 168 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 168 cgtgcggtgg gatcgt 16 <210> SEQ ID NO 169 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 169 acgtgcggtg ggatcgt 17 <210> SEQ ID NO 170 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 170 aacgtgcggt gggatcg 17 <210> SEQ ID NO 171 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 171 aacgtgcggt gggat 15 <210> SEQ ID NO 172 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 172 tgaacgtgcg gtgggat 17 <210> SEQ ID NO 173 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 173 cgacttctga acgtgcg 17 <210> SEQ ID NO 174 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 174 ttaacgcggt agcagta 17 <210> SEQ ID NO 175 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 175 taacgcggta gcagta 16 <210> SEQ ID NO 176 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 176 gttaacgcgg tagcagt 17 <210> SEQ ID NO 177 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 177 ttaacgcggt agcag 15 <210> SEQ ID NO 178 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 178 taacgcggta gca 13 <210> SEQ ID NO 179 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 179 taacgcggta gc 12 <210> SEQ ID NO 180 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 180 ttaacgcggt agc 13 <210> SEQ ID NO 181 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 181 ttaacgcggt ag 12 <210> SEQ ID NO 182 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 182 gttaacgcgg tag 13 <210> SEQ ID NO 183 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 183 cggttaacgc ggtag 15 <210> SEQ ID NO 184 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 184 ccggttaacg cggtag 16 <210> SEQ ID NO 185 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 185 cggttaacgc ggta 14 <210> SEQ ID NO 186 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 186 ggttaacgcg gta 13 <210> SEQ ID NO 187 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 187 ccggttaacg cggta 15 <210> SEQ ID NO 188 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 188 gccggttaac gcggta 16 <210> SEQ ID NO 189 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 189 tgccggttaa cgcggta 17 <210> SEQ ID NO 190 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 190 cggttaacgc ggt 13 <210> SEQ ID NO 191 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 191 ccggttaacg cgg 13 <210> SEQ ID NO 192 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 192 gccggttaac gcgg 14 <210> SEQ ID NO 193 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 193 tgccggttaa cgcgg 15 <210> SEQ ID NO 194 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 194 gccggttaac gcg 13 <210> SEQ ID NO 195 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 195 ctgccggtta acgcg 15 <210> SEQ ID NO 196 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 196 gctgccggtt aacgcg 16 <210> SEQ ID NO 197 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 197 atgccgcgtc aggtac 16 <210> SEQ ID NO 198 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 198 acatgccgcg tca 13 <210> SEQ ID NO 199 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 199 gatgacatgc cgcgtc 16 <210> SEQ ID NO 200 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 200 gacatgccgc gt 12 <210> SEQ ID NO 201 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 201 gatgacatgc cgcgt 15 <210> SEQ ID NO 202 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 202 atgacatgcc gcg 13 <210> SEQ ID NO 203 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 203 tcccgcacct tggaacc 17 <210> SEQ ID NO 204 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 204 cgatctctca acacgt 16 <210> SEQ ID NO 205 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 205 tcgatctctc aacacgt 17 <210> SEQ ID NO 206 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 206 cgatctctca acacg 15 <210> SEQ ID NO 207 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 207 tcgatctctc aacacg 16 <210> SEQ ID NO 208 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 208 ctcgatctct caacacg 17 <210> SEQ ID NO 209 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 209 gtagtgttta gggagc 16 <210> SEQ ID NO 210 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 210 gctatttggt agtgtt 16 <210> SEQ ID NO 211 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 211 agcttatcct atgac 15 <210> SEQ ID NO 212 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 212 agcttatcct atga 14 <210> SEQ ID NO 213 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 213 caggcattaa taaagtg 17 <210> SEQ ID NO 214 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 214 ctaggcgcct ctatgc 16 <210> SEQ ID NO 215 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 215 taggcgcctc tatg 14 <210> SEQ ID NO 216 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 216 ctaggcgcct ctatg 15 <210> SEQ ID NO 217 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 217 taggcgcctc tat 13 <210> SEQ ID NO 218 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 218 catgaatgga ccagta 16 <210> SEQ ID NO 219 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 219 gaatggacca 10 <210> SEQ ID NO 220 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 220 tgaatggacc ag 12 <210> SEQ ID NO 221 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 221 tgaatggacc agt 13 <210> SEQ ID NO 222 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 222 atgaatggac cagt 14 <210> SEQ ID NO 223 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 223 atgaatggac cagta 15 <210> SEQ ID NO 224 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 224 catgaatgga ccagtat 17 <210> SEQ ID NO 225 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 225 tcatgaatgg accagtat 18 <210> SEQ ID NO 226 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 226 tcatgaatgg accagtatt 19 <210> SEQ ID NO 227 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 227 ctcatgaatg gaccagtatt 20 <210> SEQ ID NO 228 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 228 tctcatgaat ggaccagtat tc 22 <210> SEQ ID NO 229 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 229 atctcatgaa tggaccagta ttct 24 <210> SEQ ID NO 230 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 230 tatctcatga atggaccagt attcta 26 <210> SEQ ID NO 231 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 231 atatctcatg aatggaccag tattctag 28 <210> SEQ ID NO 232 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 232 cgtcatagac 10 <210> SEQ ID NO 233 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 233 tcgtcataga cc 12 <210> SEQ ID NO 234 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 234 tcgtcataga ccg 13 <210> SEQ ID NO 235 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 235 ctcgtcatag accga 15 <210> SEQ ID NO 236 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 236 atatacaggc attaataaag tgcaaatg 28 <210> SEQ ID NO 237 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 237 tgctcgtcat agaccga 17 <210> SEQ ID NO 238 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 238 tgctcgtcat agaccgag 18 <210> SEQ ID NO 239 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 239 tgctcgtcat agaccgagc 19 <210> SEQ ID NO 240 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 240 ctgctcgtca tagaccgagc 20 <210> SEQ ID NO 241 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 241 gctgctcgtc atagaccgag cc 22 <210> SEQ ID NO 242 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 242 cgctgctcgt catagaccga gccc 24 <210> SEQ ID NO 243 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 243 ccgctgctcg tcatagaccg agcccc 26 <210> SEQ ID NO 244 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 244 cccgctgctc gtcatagacc gagccccc 28 <210> SEQ ID NO 245 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 245 tacgcgtcca 10 <210> SEQ ID NO 246 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 246 atacgcgtcc ac 12 <210> SEQ ID NO 247 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 247 gatacgcgtc cac 13 <210> SEQ ID NO 248 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 248 gatacgcgtc caca 14 <210> SEQ ID NO 249 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 249 cgatacgcgt ccacag 16 <210> SEQ ID NO 250 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 250 gcgatacgcg tccacag 17 <210> SEQ ID NO 251 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 251 gcgatacgcg tccacagg 18 <210> SEQ ID NO 252 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 252 gcgatacgcg tccacagga 19 <210> SEQ ID NO 253 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 253 ggcgatacgc gtccacagga 20 <210> SEQ ID NO 254 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 254 tggcgatacg cgtccacagg ac 22 <210> SEQ ID NO 255 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 255 ctggcgatac gcgtccacag gacg 24 <210> SEQ ID NO 256 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 256 gctggcgata cgcgtccaca ggacga 26 <210> SEQ ID NO 257 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 257 tgctggcgat acgcgtccac aggacgat 28 <210> SEQ ID NO 258 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 258 gtgtttaggg 10 <210> SEQ ID NO 259 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 259 agtgtttagg ga 12 <210> SEQ ID NO 260 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 260 tagtgtttag gga 13 <210> SEQ ID NO 261 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 261 tagtgtttag ggag 14 <210> SEQ ID NO 262 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 262 tagtgtttag ggagc 15 <210> SEQ ID NO 263 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 263 gtagtgttta gggagcc 17 <210> SEQ ID NO 264 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 264 ggtagtgttt agggagcc 18 <210> SEQ ID NO 265 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 265 ggtagtgttt agggagccg 19 <210> SEQ ID NO 266 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 266 tggtagtgtt tagggagccg 20 <210> SEQ ID NO 267 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 267 ttggtagtgt ttagggagcc gt 22 <210> SEQ ID NO 268 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 268 tttggtagtg tttagggagc cgtc 24 <210> SEQ ID NO 269 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 269 atttggtagt gtttagggag ccgtct 26 <210> SEQ ID NO 270 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 270 tatttggtag tgtttaggga gccgtctt 28 <210> SEQ ID NO 271 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 271 atttggtagt 10 <210> SEQ ID NO 272 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 272 tatttggtag tg 12 <210> SEQ ID NO 273 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 273 tatttggtag tgt 13 <210> SEQ ID NO 274 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 274 ctatttggta gtgt 14 <210> SEQ ID NO 275 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 275 ctatttggta gtgtt 15 <210> SEQ ID NO 276 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 276 gctatttggt agtgttt 17 <210> SEQ ID NO 277 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 277 agctatttgg tagtgttt 18 <210> SEQ ID NO 278 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 278 agctatttgg tagtgttta 19 <210> SEQ ID NO 279 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 279 gagctatttg gtagtgttta 20 <210> SEQ ID NO 280 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 280 agagctattt ggtagtgttt ag 22 <210> SEQ ID NO 281 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 281 aagagctatt tggtagtgtt tagg 24 <210> SEQ ID NO 282 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 282 gaagagctat ttggtagtgt ttaggg 26 <210> SEQ ID NO 283 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 283 agaagagcta tttggtagtg tttaggga 28 <210> SEQ ID NO 284 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 284 cattaataaa 10 <210> SEQ ID NO 285 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 285 gcattaataa ag 12 <210> SEQ ID NO 286 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 286 gcattaataa agt 13 <210> SEQ ID NO 287 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 287 ggcattaata aagt 14 <210> SEQ ID NO 288 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 288 ggcattaata aagtg 15 <210> SEQ ID NO 289 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 289 aggcattaat aaagtg 16 <210> SEQ ID NO 290 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 290 caggcattaa taaagtgc 18 <210> SEQ ID NO 291 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 291 acaggcatta ataaagtgc 19 <210> SEQ ID NO 292 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 292 acaggcatta ataaagtgca 20 <210> SEQ ID NO 293 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 293 tacaggcatt aataaagtgc aa 22 <210> SEQ ID NO 294 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 294 atacaggcat taataaagtg caaa 24 <210> SEQ ID NO 295 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 295 tatacaggca ttaataaagt gcaaat 26 <210> SEQ ID NO 296 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 296 ctggtccatt c 11 <210> SEQ ID NO 297 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 297 tggtccattc a 11 <210> SEQ ID NO 298 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 298 ctggtccatt ca 12 <210> SEQ ID NO 299 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 299 tccctaaaca c 11 <210> SEQ ID NO 300 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 300 ccctaaacac t 11 <210> SEQ ID NO 301 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 301 tccctaaaca ct 12 <210> SEQ ID NO 302 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 302 cactaccaaa t 11 <210> SEQ ID NO 303 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 303 actaccaaat a 11 <210> SEQ ID NO 304 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 304 cactaccaaa ta 12 <210> SEQ ID NO 305 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 305 tggacgcgta t 11 <210> SEQ ID NO 306 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 306 ggacgcgtat c 11 <210> SEQ ID NO 307 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 307 tggacgcgta tc 12 <210> SEQ ID NO 308 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 308 ggtctatgac g 11 <210> SEQ ID NO 309 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 309 gtctatgacg a 11 <210> SEQ ID NO 310 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 310 ggtctatgac ga 12 <210> SEQ ID NO 311 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 311 tttattaatg c 11 <210> SEQ ID NO 312 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 312 ttattaatgc c 11 <210> SEQ ID NO 313 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 313 tttattaatg cc 12 <210> SEQ ID NO 314 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 314 actggtccat tc 12 <210> SEQ ID NO 315 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 315 tggtccattc at 12 <210> SEQ ID NO 316 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 316 ctggtccatt cat 13 <210> SEQ ID NO 317 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 317 actggtccat tca 13 <210> SEQ ID NO 318 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 318 actggtccat tcat 14 <210> SEQ ID NO 319 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 319 ctccctaaac ac 12 <210> SEQ ID NO 320 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 320 ccctaaacac ta 12 <210> SEQ ID NO 321 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 321 tccctaaaca cta 13 <210> SEQ ID NO 322 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 322 ctccctaaac act 13 <210> SEQ ID NO 323 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 323 ctccctaaac acta 14 <210> SEQ ID NO 324 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 324 acactaccaa at 12 <210> SEQ ID NO 325 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 325 actaccaaat ag 12 <210> SEQ ID NO 326 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 326 cactaccaaa tag 13 <210> SEQ ID NO 327 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 327 acactaccaa ata 13 <210> SEQ ID NO 328 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 328 acactaccaa atag 14 <210> SEQ ID NO 329 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 329 gtggacgcgt at 12 <210> SEQ ID NO 330 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 330 ggacgcgtat cg 12 <210> SEQ ID NO 331 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 331 tggacgcgta tcg 13 <210> SEQ ID NO 332 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 332 gtggacgcgt atc 13 <210> SEQ ID NO 333 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 333 gtggacgcgt atcg 14 <210> SEQ ID NO 334 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 334 cggtctatga cg 12 <210> SEQ ID NO 335 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 335 gtctatgacg ag 12 <210> SEQ ID NO 336 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 336 ggtctatgac gag 13 <210> SEQ ID NO 337 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 337 cggtctatga cga 13 <210> SEQ ID NO 338 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 338 cggtctatga cgag 14 <210> SEQ ID NO 339 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 339 ctttattaat gc 12 <210> SEQ ID NO 340 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 340 ttattaatgc ct 12 <210> SEQ ID NO 341 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 341 tttattaatg cct 13 <210> SEQ ID NO 342 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 342 ctttattaat gcc 13 <210> SEQ ID NO 343 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 343 ctttattaat gcct 14 <210> SEQ ID NO 344 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 344 gtgcagggga aagatgaaaa 20 <210> SEQ ID NO 345 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 345 gagctcttga ggtccctgtg 20 <210> SEQ ID NO 346 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 346 agcctctttc ctcatgcaaa 20 <210> SEQ ID NO 347 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 347 ccttctctgc ttggttctgg 20 <210> SEQ ID NO 348 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 348 gccatggagt agacatcggt 20 <210> SEQ ID NO 349 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 349 atacgcgtcc acaggac 17 <210> SEQ ID NO 350 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 350 tacgcgtcca caggacg 17 <210> SEQ ID NO 351 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 351 tggcgatacg cgtcca 16 <210> SEQ ID NO 352 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 352 ggcgatacgc gtccac 16 <210> SEQ ID NO 353 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 353 gcgatacgcg tccaca 16 <210> SEQ ID NO 354 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 354 cgatacgcgt ccacag 16 <210> SEQ ID NO 355 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 355 gatacgcgtc cacagg 16 <210> SEQ ID NO 356 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 356 atacgcgtcc acagga 16 <210> SEQ ID NO 357 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 357 tacgcgtcca caggac 16 <210> SEQ ID NO 358 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 358 ggcgatacgc gtcca 15 <210> SEQ ID NO 359 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 359 gcgatacgcg tccac 15 <210> SEQ ID NO 360 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 360 cgatacgcgt ccaca 15 <210> SEQ ID NO 361 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 361 gatacgcgtc cacag 15 <210> SEQ ID NO 362 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 362 atacgcgtcc acagg 15 <210> SEQ ID NO 363 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 363 tacgcgtcca cagga 15 <210> SEQ ID NO 364 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 364 gcgatacgcg tcca 14 <210> SEQ ID NO 365 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 365 cgatacgcgt ccac 14 <210> SEQ ID NO 366 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 366 gatacgcgtc caca 14 <210> SEQ ID NO 367 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 367 atacgcgtcc acag 14 <210> SEQ ID NO 368 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 368 tacgcgtcca cagg 14 <210> SEQ ID NO 369 <400> SEQUENCE: 369 000 <210> SEQ ID NO 370 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 370 tttggtagtg tttaggga 18 <210> SEQ ID NO 371 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 371 ttggtagtgt ttagggag 18 <210> SEQ ID NO 372 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 372 tggtagtgtt tagggagc 18 <210> SEQ ID NO 373 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 373 ggtagtgttt agggagcc 18 <210> SEQ ID NO 374 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 374 gtagtgttta gggagccg 18 <210> SEQ ID NO 375 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 375 tagtgtttag ggagccgt 18 <210> SEQ ID NO 376 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 376 agtgtttagg gagccgtc 18 <210> SEQ ID NO 377 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 377 gtgtttaggg agccgtct 18 <210> SEQ ID NO 378 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 378 tttggtagtg tttaggg 17 <210> SEQ ID NO 379 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 379 ttggtagtgt ttaggga 17 <210> SEQ ID NO 380 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 380 tggtagtgtt tagggag 17 <210> SEQ ID NO 381 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 381 ggtagtgttt agggagc 17 <210> SEQ ID NO 382 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 382 gtagtgttta gggagcc 17 <210> SEQ ID NO 383 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 383 tagtgtttag ggagccg 17 <210> SEQ ID NO 384 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 384 agtgtttagg gagccgt 17 <210> SEQ ID NO 385 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 385 gtgtttaggg agccgtc 17 <210> SEQ ID NO 386 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 386 ttggtagtgt ttaggg 16 <210> SEQ ID NO 387 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 387 tggtagtgtt taggga 16 <210> SEQ ID NO 388 <400> SEQUENCE: 388 000 <210> SEQ ID NO 389 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 389 gtagtgttta gggagc 16 <210> SEQ ID NO 390 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 390 tagtgtttag ggagcc 16 <210> SEQ ID NO 391 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 391 agtgtttagg gagccg 16 <210> SEQ ID NO 392 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 392 gtgtttaggg agccgt 16 <210> SEQ ID NO 393 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 393 tggtagtgtt taggg 15 <210> SEQ ID NO 394 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 394 ggtagtgttt aggga 15 <210> SEQ ID NO 395 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 395 gtagtgttta gggag 15 <210> SEQ ID NO 396 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 396 tagtgtttag ggagc 15 <210> SEQ ID NO 397 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 397 agtgtttagg gagcc 15 <210> SEQ ID NO 398 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 398 gtgtttaggg agccg 15 <210> SEQ ID NO 399 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 399 ggtagtgttt aggg 14 <210> SEQ ID NO 400 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 400 gtagtgttta ggga 14 <210> SEQ ID NO 401 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 401 tagtgtttag ggag 14 <210> SEQ ID NO 402 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 402 agtgtttagg gagc 14 <210> SEQ ID NO 403 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 403 gtgtttaggg agcc 14 <210> SEQ ID NO 404 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 404 gaagagctat ttggtagt 18 <210> SEQ ID NO 405 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 405 aagagctatt tggtagtg 18 <210> SEQ ID NO 406 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 406 agagctattt ggtagtgt 18 <210> SEQ ID NO 407 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 407 gagctatttg gtagtgtt 18 <210> SEQ ID NO 408 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 408 agctatttgg tagtgttt 18 <210> SEQ ID NO 409 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 409 gctatttggt agtgttta 18 <210> SEQ ID NO 410 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 410 ctatttggta gtgtttag 18 <210> SEQ ID NO 411 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 411 tatttggtag tgtttagg 18 <210> SEQ ID NO 412 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 412 atttggtagt gtttaggg 18 <210> SEQ ID NO 413 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 413 aagagctatt tggtagt 17 <210> SEQ ID NO 414 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 414 agagctattt ggtagtg 17 <210> SEQ ID NO 415 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 415 gagctatttg gtagtgt 17 <210> SEQ ID NO 416 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 416 agctatttgg tagtgtt 17 <210> SEQ ID NO 417 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 417 gctatttggt agtgttt 17 <210> SEQ ID NO 418 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 418 ctatttggta gtgttta 17 <210> SEQ ID NO 419 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 419 atttggtagt gtttagg 17 <210> SEQ ID NO 420 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 420 atttggtagt gtttagg 17 <210> SEQ ID NO 421 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 421 agagctattt ggtagt 16 <210> SEQ ID NO 422 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 422 gagctatttg gtagtg 16 <210> SEQ ID NO 423 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 423 agctatttgg tagtgt 16 <210> SEQ ID NO 424 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 424 gctatttggt agtgtt 16 <210> SEQ ID NO 425 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 425 ctatttggta gtgttt 16 <210> SEQ ID NO 426 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 426 tatttggtag tgttta 16 <210> SEQ ID NO 427 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 427 atttggtagt gtttag 16 <210> SEQ ID NO 428 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 428 gagctatttg gtagt 15 <210> SEQ ID NO 429 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 429 agctatttgg tagtg 15 <210> SEQ ID NO 430 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 430 gctatttggt agtgt 15 <210> SEQ ID NO 431 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 431 ctatttggta gtgtt 15 <210> SEQ ID NO 432 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 432 tatttggtag tgttt 15 <210> SEQ ID NO 433 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 433 atttggtagt gttta 15 <210> SEQ ID NO 434 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 434 agctatttgg tagt 14 <210> SEQ ID NO 435 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 435 gctatttggt agtg 14 <210> SEQ ID NO 436 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 436 ctatttggta gtgt 14 <210> SEQ ID NO 437 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 437 tatttggtag tgtt 14 <210> SEQ ID NO 438 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 438 atttggtagt gttt 14 <210> SEQ ID NO 439 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 439 tatctcatga atggacca 18 <210> SEQ ID NO 440 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 440 atctcatgaa tggaccag 18 <210> SEQ ID NO 441 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 441 tctcatgaat ggaccagt 18 <210> SEQ ID NO 442 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 442 ctcatgaatg gaccagta 18 <210> SEQ ID NO 443 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 443 tcatgaatgg accagtat 18 <210> SEQ ID NO 444 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 444 catgaatgga ccagtatt 18 <210> SEQ ID NO 445 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 445 atgaatggac cagtattc 18 <210> SEQ ID NO 446 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 446 tgaatggacc agtattct 18 <210> SEQ ID NO 447 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 447 gaatggacca gtattcta 18 <210> SEQ ID NO 448 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 448 atctcatgaa tggacca 17 <210> SEQ ID NO 449 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 449 tctcatgaat ggaccag 17 <210> SEQ ID NO 450 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 450 ctcatgaatg gaccagt 17 <210> SEQ ID NO 451 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 451 tcatgaatgg accagta 17 <210> SEQ ID NO 452 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 452 catgaatgga ccagtat 17 <210> SEQ ID NO 453 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 453 atgaatggac cagtatt 17 <210> SEQ ID NO 454 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 454 tgaatggacc agtattc 17 <210> SEQ ID NO 455 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 455 gaatggacca gtattct 17 <210> SEQ ID NO 456 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 456 tctcatgaat ggacca 16 <210> SEQ ID NO 457 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 457 ctcatgaatg gaccag 16 <210> SEQ ID NO 458 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 458 tcatgaatgg accagt 16 <210> SEQ ID NO 459 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 459 catgaatgga ccagta 16 <210> SEQ ID NO 460 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 460 atgaatggac cagtat 16 <210> SEQ ID NO 461 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 461 tgaatggacc agtatt 16 <210> SEQ ID NO 462 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 462 gaatggacca gtattc 16 <210> SEQ ID NO 463 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 463 ctcatgaatg gacca 15 <210> SEQ ID NO 464 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 464 tcatgaatgg accag 15 <210> SEQ ID NO 465 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 465 catgaatgga ccagt 15 <210> SEQ ID NO 466 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 466 atgaatggac cagta 15 <210> SEQ ID NO 467 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 467 tgaatggacc agtat 15 <210> SEQ ID NO 468 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 468 gaatggacca gtatt 15 <210> SEQ ID NO 469 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 469 tcatgaatgg acca 14 <210> SEQ ID NO 470 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 470 catgaatgga ccag 14 <210> SEQ ID NO 471 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 471 atgaatggac cagt 14 <210> SEQ ID NO 472 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 472 tgaatggacc agta 14 <210> SEQ ID NO 473 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 473 gaatggacca gtat 14 <210> SEQ ID NO 474 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 474 tatacaggca ttaataaa 18 <210> SEQ ID NO 475 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 475 atacaggcat taataaag 18 <210> SEQ ID NO 476 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 476 tacaggcatt aataaagt 18 <210> SEQ ID NO 477 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 477 acaggcatta ataaagtg 18 <210> SEQ ID NO 478 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 478 caggcattaa taaagtgc 18 <210> SEQ ID NO 479 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 479 aggcattaat aaagtgca 18 <210> SEQ ID NO 480 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 480 ggcattaata aagtgcaa 18 <210> SEQ ID NO 481 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 481 gcattaataa agtgcaaa 18 <210> SEQ ID NO 482 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 482 cattaataaa gtgcaaat 18 <210> SEQ ID NO 483 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 483 atacaggcat taataaa 17 <210> SEQ ID NO 484 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 484 tacaggcatt aataaag 17 <210> SEQ ID NO 485 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 485 acaggcatta ataaagt 17 <210> SEQ ID NO 486 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 486 caggcattaa taaagtg 17 <210> SEQ ID NO 487 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 487 aggcattaat aaagtgc 17 <210> SEQ ID NO 488 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 488 ggcattaata aagtgca 17 <210> SEQ ID NO 489 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 489 gcattaataa agtgcaa 17 <210> SEQ ID NO 490 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 490 cattaataaa gtgcaaa 17 <210> SEQ ID NO 491 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 491 tacaggcatt aataaa 16 <210> SEQ ID NO 492 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 492 acaggcatta ataaag 16 <210> SEQ ID NO 493 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 493 caggcattaa taaagt 16 <210> SEQ ID NO 494 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 494 aggcattaat aaagtg 16 <210> SEQ ID NO 495 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 495 ggcattaata aagtgc 16 <210> SEQ ID NO 496 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 496 gcattaataa agtgca 16 <210> SEQ ID NO 497 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 497 cattaataaa gtgcaa 16 <210> SEQ ID NO 498 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 498 acaggcatta ataaa 15 <210> SEQ ID NO 499 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 499 caggcattaa taaag 15 <210> SEQ ID NO 500 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 500 aggcattaat aaagt 15 <210> SEQ ID NO 501 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 501 ggcattaata aagtg 15 <210> SEQ ID NO 502 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 502 gcattaataa agtgc 15 <210> SEQ ID NO 503 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 503 cattaataaa gtgca 15 <210> SEQ ID NO 504 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 504 caggcattaa taaa 14 <210> SEQ ID NO 505 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 505 aggcattaat aaag 14 <210> SEQ ID NO 506 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 506 ggcattaata aagt 14 <210> SEQ ID NO 507 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 507 gcattaataa agtg 14 <210> SEQ ID NO 508 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 508 cattaataaa gtgc 14 <210> SEQ ID NO 509 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 509 catggcagac cccgctgctc 20 <210> SEQ ID NO 510 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 510 atggcagacc ccgctgctc 19 <210> SEQ ID NO 511 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 511 tggcagaccc cgctgctc 18 <210> SEQ ID NO 512 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 512 ggcagacccc gctgctc 17 <210> SEQ ID NO 513 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 513 gcagaccccg ctgctc 16 <210> SEQ ID NO 514 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 514 cagaccccgc tgctc 15 <210> SEQ ID NO 515 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 515 agaccccgct gctc 14 <210> SEQ ID NO 516 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 516 gaccccgctg ctc 13 <210> SEQ ID NO 517 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 517 accccgctgc tc 12 <210> SEQ ID NO 518 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 518 ccccgctgct c 11 <210> SEQ ID NO 519 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 519 cccgctgctc 10 <210> SEQ ID NO 520 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 520 ccgagccccc 10 <210> SEQ ID NO 521 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 521 ccgagccccc a 11 <210> SEQ ID NO 522 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 522 ccgagccccc ag 12 <210> SEQ ID NO 523 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 523 ccgagccccc agc 13 <210> SEQ ID NO 524 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 524 ccgagccccc agcg 14 <210> SEQ ID NO 525 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 525 ccgagccccc agcgc 15 <210> SEQ ID NO 526 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 526 ccgagccccc agcgca 16 <210> SEQ ID NO 527 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 527 ccgagccccc agcgcag 17 <210> SEQ ID NO 528 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 528 ccgagccccc agcgcagc 18 <210> SEQ ID NO 529 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 529 ccgagccccc agcgcagcg 19 <210> SEQ ID NO 530 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 530 ccgagccccc agcgcagcgg 20 <210> SEQ ID NO 531 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 531 ggtgggatcg tgctggcgat 20 <210> SEQ ID NO 532 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 532 gtgggatcgt gctggcgat 19 <210> SEQ ID NO 533 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 533 tgggatcgtg ctggcgat 18 <210> SEQ ID NO 534 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 534 gggatcgtgc tggcgat 17 <210> SEQ ID NO 535 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 535 ggatcgtgct ggcgat 16 <210> SEQ ID NO 536 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 536 gatcgtgctg gcgat 15 <210> SEQ ID NO 537 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 537 atcgtgctgg cgat 14 <210> SEQ ID NO 538 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 538 tcgtgctggc gat 13 <210> SEQ ID NO 539 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 539 cgtgctggcg at 12 <210> SEQ ID NO 540 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 540 gtgctggcga t 11 <210> SEQ ID NO 541 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 541 tgctggcgat 10 <210> SEQ ID NO 542 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 542 acaggacgat gtgcagcggc 20 <210> SEQ ID NO 543 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 543 acaggacgat gtgcagcgg 19 <210> SEQ ID NO 544 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 544 acaggacgat gtgcagcg 18 <210> SEQ ID NO 545 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 545 acaggacgat gtgcagc 17 <210> SEQ ID NO 546 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 546 acaggacgat gtgcag 16 <210> SEQ ID NO 547 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 547 acaggacgat gtgca 15 <210> SEQ ID NO 548 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 548 acaggacgat gtgc 14 <210> SEQ ID NO 549 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 549 acaggacgat gtg 13 <210> SEQ ID NO 550 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 550 acaggacgat gt 12 <210> SEQ ID NO 551 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 551 acaggacgat g 11 <210> SEQ ID NO 552 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 552 acaggacgat 10 <210> SEQ ID NO 553 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 553 gcccagcctg ccccagaaga gcta 24 <210> SEQ ID NO 554 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 554 cccagcctgc cccagaagag cta 23 <210> SEQ ID NO 555 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 555 ccagcctgcc ccagaagagc ta 22 <210> SEQ ID NO 556 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 556 cagcctgccc cagaagagct a 21 <210> SEQ ID NO 557 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 557 agcctgcccc agaagagcta 20 <210> SEQ ID NO 558 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 558 gcctgcccca gaagagcta 19 <210> SEQ ID NO 559 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 559 cctgccccag aagagcta 18 <210> SEQ ID NO 560 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 560 ctgccccaga agagcta 17 <210> SEQ ID NO 561 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 561 tgccccagaa gagcta 16 <210> SEQ ID NO 562 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 562 gccccagaag agcta 15 <210> SEQ ID NO 563 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 563 ccccagaaga gcta 14 <210> SEQ ID NO 564 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 564 cccagaagag cta 13 <210> SEQ ID NO 565 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 565 ccagaagagc ta 12 <210> SEQ ID NO 566 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 566 cagaagagct a 11 <210> SEQ ID NO 567 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 567 agaagagcta 10 <210> SEQ ID NO 568 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 568 tgtttaggga gccgtcttca ggaa 24 <210> SEQ ID NO 569 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 569 tgtttaggga gccgtcttca gga 23 <210> SEQ ID NO 570 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 570 tgtttaggga gccgtcttca gg 22 <210> SEQ ID NO 571 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 571 tgtttaggga gccgtcttca g 21 <210> SEQ ID NO 572 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 572 tgtttaggga gccgtcttca 20 <210> SEQ ID NO 573 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 573 tgtttaggga gccgtcttc 19 <210> SEQ ID NO 574 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 574 tgtttaggga gccgtctt 18 <210> SEQ ID NO 575 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 575 tgtttaggga gccgtct 17 <210> SEQ ID NO 576 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 576 tgtttaggga gccgtc 16 <210> SEQ ID NO 577 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 577 tgtttaggga gccgt 15 <210> SEQ ID NO 578 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 578 tgtttaggga gccg 14 <210> SEQ ID NO 579 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 579 tgtttaggga gcc 13 <210> SEQ ID NO 580 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 580 tgtttaggga gc 12 <210> SEQ ID NO 581 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 581 tgtttaggga g 11 <210> SEQ ID NO 582 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 582 tgtttaggga 10 <210> SEQ ID NO 583 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 583 tgaatcttga atatctcatg 20 <210> SEQ ID NO 584 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 584 gaatcttgaa tatctcatg 19 <210> SEQ ID NO 585 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 585 aatcttgaat atctcatg 18 <210> SEQ ID NO 586 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 586 atcttgaata tctcatg 17 <210> SEQ ID NO 587 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 587 tcttgaatat ctcatg 16 <210> SEQ ID NO 588 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 588 cttgaatatc tcatg 15 <210> SEQ ID NO 589 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 589 ttgaatatct catg 14 <210> SEQ ID NO 590 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 590 tgaatatctc atg 13 <210> SEQ ID NO 591 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 591 gaatatctca tg 12 <210> SEQ ID NO 592 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 592 aatatctcat g 11 <210> SEQ ID NO 593 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 593 atatctcatg 10 <210> SEQ ID NO 594 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 594 agtattctag aaactcacca 20 <210> SEQ ID NO 595 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 595 agtattctag aaactcacc 19 <210> SEQ ID NO 596 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 596 agtattctag aaactcac 18 <210> SEQ ID NO 597 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 597 agtattctag aaactca 17 <210> SEQ ID NO 598 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 598 agtattctag aaactc 16 <210> SEQ ID NO 599 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 599 agtattctag aaact 15 <210> SEQ ID NO 600 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 600 agtattctag aaac 14 <210> SEQ ID NO 601 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 601 agtattctag aaa 13 <210> SEQ ID NO 602 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 602 agtattctag aa 12 <210> SEQ ID NO 603 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 603 agtattctag a 11 <210> SEQ ID NO 604 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 604 agtattctag 10 <210> SEQ ID NO 605 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 605 attcatattt atatacaggc 20 <210> SEQ ID NO 606 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 606 ttcatattta tatacaggc 19 <210> SEQ ID NO 607 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 607 tcatatttat atacaggc 18 <210> SEQ ID NO 608 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 608 catatttata tacaggc 17 <210> SEQ ID NO 609 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 609 atatttatat acaggc 16 <210> SEQ ID NO 610 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 610 tatttatata caggc 15 <210> SEQ ID NO 611 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 611 atttatatac aggc 14 <210> SEQ ID NO 612 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 612 tttatataca ggc 13 <210> SEQ ID NO 613 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 613 ttatatacag gc 12 <210> SEQ ID NO 614 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 614 tatatacagg c 11 <210> SEQ ID NO 615 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 615 atatacaggc 10 <210> SEQ ID NO 616 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 616 agtgcaaatg ttattggcta 20 <210> SEQ ID NO 617 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 617 agtgcaaatg ttattggct 19 <210> SEQ ID NO 618 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 618 agtgcaaatg ttattggc 18 <210> SEQ ID NO 619 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 619 agtgcaaatg ttattgg 17 <210> SEQ ID NO 620 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 620 agtgcaaatg ttattg 16 <210> SEQ ID NO 621 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 621 agtgcaaatg ttatt 15 <210> SEQ ID NO 622 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 622 agtgcaaatg ttat 14 <210> SEQ ID NO 623 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 623 agtgcaaatg tta 13 <210> SEQ ID NO 624 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 624 agtgcaaatg tt 12 <210> SEQ ID NO 625 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 625 agtgcaaatg t 11 <210> SEQ ID NO 626 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 626 agtgcaaatg 10 <210> SEQ ID NO 627 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 627 tgccccagaa gagctatttg gtag 24 <210> SEQ ID NO 628 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 628 gccccagaag agctatttgg tag 23 <210> SEQ ID NO 629 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 629 ccccagaaga gctatttggt ag 22 <210> SEQ ID NO 630 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 630 cccagaagag ctatttggta g 21 <210> SEQ ID NO 631 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 631 ccagaagagc tatttggtag 20 <210> SEQ ID NO 632 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 632 cagaagagct atttggtag 19 <210> SEQ ID NO 633 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 633 agaagagcta tttggtag 18 <210> SEQ ID NO 634 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 634 gaagagctat ttggtag 17 <210> SEQ ID NO 635 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 635 aagagctatt tggtag 16 <210> SEQ ID NO 636 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 636 agagctattt ggtag 15 <210> SEQ ID NO 637 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 637 gagctatttg gtag 14 <210> SEQ ID NO 638 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 638 agctatttgg tag 13 <210> SEQ ID NO 639 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 639 gctatttggt ag 12 <210> SEQ ID NO 640 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 640 ctatttggta g 11 <210> SEQ ID NO 641 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 641 tatttggtag 10 <210> SEQ ID NO 642 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 642 gagccgtctt caggaatctt ctcc 24 <210> SEQ ID NO 643 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 643 gagccgtctt caggaatctt ctc 23 <210> SEQ ID NO 644 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 644 gagccgtctt caggaatctt ct 22 <210> SEQ ID NO 645 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 645 gagccgtctt caggaatctt c 21 <210> SEQ ID NO 646 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 646 gagccgtctt caggaatctt 20 <210> SEQ ID NO 647 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 647 gagccgtctt caggaatct 19 <210> SEQ ID NO 648 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 648 gagccgtctt caggaatc 18 <210> SEQ ID NO 649 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 649 gagccgtctt caggaat 17 <210> SEQ ID NO 650 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 650 gagccgtctt caggaa 16 <210> SEQ ID NO 651 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 651 gagccgtctt cagga 15 <210> SEQ ID NO 652 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 652 gagccgtctt cagg 14 <210> SEQ ID NO 653 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 653 gagccgtctt cag 13 <210> SEQ ID NO 654 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 654 gagccgtctt ca 12 <210> SEQ ID NO 655 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 655 gagccgtctt c 11 <210> SEQ ID NO 656 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 656 gagccgtctt 10 <210> SEQ ID NO 657 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 657 catggcagac cccgctgct 19 <210> SEQ ID NO 658 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 658 atggcagacc ccgctgct 18 <210> SEQ ID NO 659 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 659 tggcagaccc cgctgct 17 <210> SEQ ID NO 660 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 660 ggcagacccc gctgct 16 <210> SEQ ID NO 661 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 661 gcagaccccg ctgct 15 <210> SEQ ID NO 662 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 662 cagaccccgc tgct 14 <210> SEQ ID NO 663 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 663 agaccccgct gct 13 <210> SEQ ID NO 664 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 664 gaccccgctg ct 12 <210> SEQ ID NO 665 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 665 accccgctgc t 11 <210> SEQ ID NO 666 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 666 ccccgctgct 10 <210> SEQ ID NO 667 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 667 cgagccccca 10 <210> SEQ ID NO 668 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 668 cgagccccca g 11 <210> SEQ ID NO 669 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 669 cgagccccca gc 12 <210> SEQ ID NO 670 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 670 cgagccccca gcg 13 <210> SEQ ID NO 671 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 671 cgagccccca gcgc 14 <210> SEQ ID NO 672 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 672 cgagccccca gcgca 15 <210> SEQ ID NO 673 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 673 cgagccccca gcgcag 16 <210> SEQ ID NO 674 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 674 cgagccccca gcgcagc 17 <210> SEQ ID NO 675 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 675 cgagccccca gcgcagcg 18 <210> SEQ ID NO 676 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 676 cgagccccca gcgcagcgg 19 <210> SEQ ID NO 677 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 677 ggtgggatcg tgctggcga 19 <210> SEQ ID NO 678 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 678 gtgggatcgt gctggcga 18 <210> SEQ ID NO 679 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 679 tgggatcgtg ctggcga 17 <210> SEQ ID NO 680 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 680 gggatcgtgc tggcga 16 <210> SEQ ID NO 681 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 681 ggatcgtgct ggcga 15 <210> SEQ ID NO 682 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 682 gatcgtgctg gcga 14 <210> SEQ ID NO 683 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 683 atcgtgctgg cga 13 <210> SEQ ID NO 684 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 684 tcgtgctggc ga 12 <210> SEQ ID NO 685 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 685 cgtgctggcg a 11 <210> SEQ ID NO 686 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 686 gtgctggcga 10 <210> SEQ ID NO 687 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 687 caggacgatg tgcagcggc 19 <210> SEQ ID NO 688 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 688 caggacgatg tgcagcgg 18 <210> SEQ ID NO 689 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 689 caggacgatg tgcagcg 17 <210> SEQ ID NO 690 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 690 caggacgatg tgcagc 16 <210> SEQ ID NO 691 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 691 caggacgatg tgcag 15 <210> SEQ ID NO 692 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 692 caggacgatg tgca 14 <210> SEQ ID NO 693 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 693 caggacgatg tgc 13 <210> SEQ ID NO 694 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 694 caggacgatg tg 12 <210> SEQ ID NO 695 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 695 caggacgatg t 11 <210> SEQ ID NO 696 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 696 caggacgatg 10 <210> SEQ ID NO 697 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 697 gcccagcctg ccccagaaga gct 23 <210> SEQ ID NO 698 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 698 cccagcctgc cccagaagag ct 22 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 699 ccagcctgcc ccagaagagc t 21 <210> SEQ ID NO 700 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 700 cagcctgccc cagaagagct 20 <210> SEQ ID NO 701 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 701 agcctgcccc agaagagct 19 <210> SEQ ID NO 702 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 702 gcctgcccca gaagagct 18 <210> SEQ ID NO 703 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 703 cctgccccag aagagct 17 <210> SEQ ID NO 704 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 704 ctgccccaga agagct 16 <210> SEQ ID NO 705 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 705 tgccccagaa gagct 15 <210> SEQ ID NO 706 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 706 gccccagaag agct 14 <210> SEQ ID NO 707 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 707 ccccagaaga gct 13 <210> SEQ ID NO 708 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 708 cccagaagag ct 12 <210> SEQ ID NO 709 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 709 ccagaagagc t 11 <210> SEQ ID NO 710 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 710 cagaagagct 10 <210> SEQ ID NO 711 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 711 gtttagggag ccgtcttcag gaa 23 <210> SEQ ID NO 712 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 712 gtttagggag ccgtcttcag ga 22 <210> SEQ ID NO 713 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 713 gtttagggag ccgtcttcag g 21 <210> SEQ ID NO 714 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 714 gtttagggag ccgtcttcag 20 <210> SEQ ID NO 715 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 715 gtttagggag ccgtcttca 19 <210> SEQ ID NO 716 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 716 gtttagggag ccgtcttc 18 <210> SEQ ID NO 717 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 717 gtttagggag ccgtctt 17 <210> SEQ ID NO 718 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 718 gtttagggag ccgtct 16 <210> SEQ ID NO 719 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 719 gtttagggag ccgtc 15 <210> SEQ ID NO 720 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 720 gtttagggag ccgt 14 <210> SEQ ID NO 721 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 721 gtttagggag ccg 13 <210> SEQ ID NO 722 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 722 gtttagggag cc 12 <210> SEQ ID NO 723 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 723 gtttagggag c 11 <210> SEQ ID NO 724 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 724 gtttagggag 10 <210> SEQ ID NO 725 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 725 tgaatcttga atatctcat 19 <210> SEQ ID NO 726 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 726 gaatcttgaa tatctcat 18 <210> SEQ ID NO 727 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 727 aatcttgaat atctcat 17 <210> SEQ ID NO 728 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 728 atcttgaata tctcat 16 <210> SEQ ID NO 729 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 729 tcttgaatat ctcat 15 <210> SEQ ID NO 730 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 730 cttgaatatc tcat 14 <210> SEQ ID NO 731 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 731 ttgaatatct cat 13 <210> SEQ ID NO 732 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 732 tgaatatctc at 12 <210> SEQ ID NO 733 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 733 gaatatctca t 11 <210> SEQ ID NO 734 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 734 aatatctcat 10 <210> SEQ ID NO 735 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 735 gtattctaga aactcacca 19 <210> SEQ ID NO 736 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 736 gtattctaga aactcacc 18 <210> SEQ ID NO 737 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 737 gtattctaga aactcac 17 <210> SEQ ID NO 738 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 738 gtattctaga aactca 16 <210> SEQ ID NO 739 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 739 gtattctaga aactc 15 <210> SEQ ID NO 740 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 740 gtattctaga aact 14 <210> SEQ ID NO 741 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 741 gtattctaga aac 13 <210> SEQ ID NO 742 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 742 gtattctaga aa 12 <210> SEQ ID NO 743 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 743 gtattctaga a 11 <210> SEQ ID NO 744 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 744 gtattctaga 10 <210> SEQ ID NO 745 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 745 attcatattt atatacagg 19 <210> SEQ ID NO 746 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 746 ttcatattta tatacagg 18 <210> SEQ ID NO 747 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 747 tcatatttat atacagg 17 <210> SEQ ID NO 748 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 748 catatttata tacagg 16 <210> SEQ ID NO 749 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 749 atatttatat acagg 15 <210> SEQ ID NO 750 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 750 tatttatata cagg 14 <210> SEQ ID NO 751 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 751 atttatatac agg 13 <210> SEQ ID NO 752 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 752 tttatataca gg 12 <210> SEQ ID NO 753 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 753 ttatatacag g 11 <210> SEQ ID NO 754 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 754 tatatacagg 10 <210> SEQ ID NO 755 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 755 gtgcaaatgt tattggcta 19 <210> SEQ ID NO 756 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 756 gtgcaaatgt tattggct 18 <210> SEQ ID NO 757 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 757 gtgcaaatgt tattggc 17 <210> SEQ ID NO 758 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 758 gtgcaaatgt tattgg 16 <210> SEQ ID NO 759 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 759 gtgcaaatgt tattg 15 <210> SEQ ID NO 760 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 760 gtgcaaatgt tatt 14 <210> SEQ ID NO 761 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 761 gtgcaaatgt tat 13 <210> SEQ ID NO 762 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 762 gtgcaaatgt ta 12 <210> SEQ ID NO 763 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 763 gtgcaaatgt t 11 <210> SEQ ID NO 764 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 764 gtgcaaatgt 10 <210> SEQ ID NO 765 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 765 tgccccagaa gagctatttg gta 23 <210> SEQ ID NO 766 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 766 gccccagaag agctatttgg ta 22 <210> SEQ ID NO 767 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 767 ccccagaaga gctatttggt a 21 <210> SEQ ID NO 768 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 768 cccagaagag ctatttggta 20 <210> SEQ ID NO 769 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 769 ccagaagagc tatttggta 19 <210> SEQ ID NO 770 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 770 cagaagagct atttggta 18 <210> SEQ ID NO 771 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 771 agaagagcta tttggta 17 <210> SEQ ID NO 772 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 772 gaagagctat ttggta 16 <210> SEQ ID NO 773 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 773 aagagctatt tggta 15 <210> SEQ ID NO 774 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 774 agagctattt ggta 14 <210> SEQ ID NO 775 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 775 gagctatttg gta 13 <210> SEQ ID NO 776 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 776 agctatttgg ta 12 <210> SEQ ID NO 777 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 777 gctatttggt a 11 <210> SEQ ID NO 778 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 778 ctatttggta 10 <210> SEQ ID NO 779 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 779 agccgtcttc aggaatcttc tcc 23 <210> SEQ ID NO 780 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 780 agccgtcttc aggaatcttc tc 22 <210> SEQ ID NO 781 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 781 agccgtcttc aggaatcttc t 21 <210> SEQ ID NO 782 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 782 agccgtcttc aggaatcttc 20 <210> SEQ ID NO 783 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 783 agccgtcttc aggaatctt 19 <210> SEQ ID NO 784 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 784 agccgtcttc aggaatct 18 <210> SEQ ID NO 785 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 785 agccgtcttc aggaatc 17 <210> SEQ ID NO 786 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 786 agccgtcttc aggaat 16 <210> SEQ ID NO 787 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 787 agccgtcttc aggaa 15 <210> SEQ ID NO 788 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 788 agccgtcttc agga 14 <210> SEQ ID NO 789 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 789 agccgtcttc agg 13 <210> SEQ ID NO 790 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 790 agccgtcttc ag 12 <210> SEQ ID NO 791 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 791 agccgtcttc a 11 <210> SEQ ID NO 792 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 792 agccgtcttc 10 <210> SEQ ID NO 793 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 793 cccagcctgc cccagaagag ctatttg 27 <210> SEQ ID NO 794 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 794 ccagcctgcc ccagaagagc tatttg 26 <210> SEQ ID NO 795 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 795 cagcctgccc cagaagagct atttg 25 <210> SEQ ID NO 796 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 796 agcctgcccc agaagagcta tttg 24 <210> SEQ ID NO 797 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 797 gcctgcccca gaagagctat ttg 23 <210> SEQ ID NO 798 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 798 cctgccccag aagagctatt tg 22 <210> SEQ ID NO 799 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 799 ctgccccaga agagctattt g 21 <210> SEQ ID NO 800 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 800 tgccccagaa gagctatttg 20 <210> SEQ ID NO 801 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 801 gccccagaag agctatttg 19 <210> SEQ ID NO 802 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 802 ccccagaaga gctatttg 18 <210> SEQ ID NO 803 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 803 cccagaagag ctatttg 17 <210> SEQ ID NO 804 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 804 ccagaagagc tatttg 16 <210> SEQ ID NO 805 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 805 cagaagagct atttg 15 <210> SEQ ID NO 806 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 806 agaagagcta tttg 14 <210> SEQ ID NO 807 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 807 gaagagctat ttg 13 <210> SEQ ID NO 808 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 808 aagagctatt tg 12 <210> SEQ ID NO 809 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 809 agagctattt g 11 <210> SEQ ID NO 810 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 810 gagctatttg 10 <210> SEQ ID NO 811 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 811 tagggagccg tcttcaggaa tcttctc 27 <210> SEQ ID NO 812 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 812 tagggagccg tcttcaggaa tcttct 26 <210> SEQ ID NO 813 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 813 tagggagccg tcttcaggaa tcttc 25 <210> SEQ ID NO 814 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 814 tagggagccg tcttcaggaa tctt 24 <210> SEQ ID NO 815 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 815 tagggagccg tcttcaggaa tct 23 <210> SEQ ID NO 816 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 816 tagggagccg tcttcaggaa tc 22 <210> SEQ ID NO 817 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 817 tagggagccg tcttcaggaa t 21 <210> SEQ ID NO 818 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 818 tagggagccg tcttcaggaa 20 <210> SEQ ID NO 819 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 819 tagggagccg tcttcagga 19 <210> SEQ ID NO 820 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 820 tagggagccg tcttcagg 18 <210> SEQ ID NO 821 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 821 tagggagccg tcttcag 17 <210> SEQ ID NO 822 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 822 tagggagccg tcttca 16 <210> SEQ ID NO 823 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 823 tagggagccg tcttc 15 <210> SEQ ID NO 824 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 824 tagggagccg tctt 14 <210> SEQ ID NO 825 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 825 tagggagccg tct 13 <210> SEQ ID NO 826 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 826 tagggagccg tc 12 <210> SEQ ID NO 827 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 827 tagggagccg t 11 <210> SEQ ID NO 828 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 828 tagggagccg 10

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 828 <210> SEQ ID NO 1 <211> LENGTH: 4629 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, antisense DNA <400> SEQUENCE: 1 tttagctact aggaatggga acaggaggca ggatgctcac ctgagtattt tgctttattc 60 aatctaataa acattttatt tatgtaaaag acaaacaatg catagaataa aaataagtgc 120 ttgagacttt tgatataaaa agagtatata gcattcacat tcctatttta atacatgagt 180 acagctgaag tgttccataa aagaataaaa ctttcccttt atgtatagta gtgaaaaaag 240 tcagtatttt taggaactac agaatgttat tccttggtct tttttcttga ataagaaaaa 300 aaaacataaa caaaacaagc cacagtatcc tctgacacta cattccagtt tatgctgata 360 acccagaagt gagaatactc ttgaatcttg aatatctcat gaatggacca gtattctaga 420 aactcaccac tagaggtcaa tgggcaacag ctattgggat ggtatcagca tgccctacgg 480 tgcaagtgga atttctaggc gcctctatgc tactgcagcc acactgtctt taactctcag 540 cccacccaca ctgaggaggg tgcctagagg ttctatttcc aaacctttgc atgtatctta 600 aaaatctcaa taaaatgaga ccttccacca tccaaacaga gctgatattc tcactaccag 660 tccctctcta atattcctat ttggctgaaa ataagtagct tcaaaaagtt ttaaaaaaga 720 gattacttgc agcattaaca cttctttgtt gattaacaag tttcctatgg agttttaaag 780 ctcatacttt gttcttgtcc ttgtggacac aaattttcta actgcaaatg ggacctttgt 840 gtcccacatt caaatcctct ctagtaattt ctgcaaaggt tgagaaggct ggcatgatgg 900 agagaacggt aaccatgagg aaagcttctt ggagtaaagc actcctctct ccaatgcaga 960 gggtaaaact attaacatat aagcaaaaga aacttgggct aactgagacc cttaaaggag 1020 ttccccttta gtccaataaa aggccaactt caaatcttaa caccagataa ggtagtcaaa 1080 atcatattat atacccagag aatgactgct tgaatggaca tttcttacaa gggaccttgg 1140 ttaggtgcag atttaattcc tagactgggg tccaggtagg cagtggaaag agctaatgtt 1200 tacagtgaga agtgaggcag ctttgtaagt gtctccacac cttcacattt tgtgaacgtg 1260 gactggagat aactgaaaac catctgctat ccttacctgg ggatccagat tttcctgcaa 1320 aatctccaaa tatttataaa gtggcttcac tttttgaaac gctgtgctga ccaaacaaaa 1380 catatgttta gagtgcctga ggtcatagtc ctgacaatga tagtattgtg tagttgaaat 1440 cctcttcatc aggccaaact gtgcttgagc aatcaggagc ccagaaagat ggaacccatt 1500 ggtgtttgta tagaaaacta gaaaatcaag tcaagtgtaa tgaaaaagta aacacgataa 1560 agcctagagt gagaatttgc tcctttttag aaaaggatga aggctgggag cagagaatag 1620 taacataagt gcaggggaaa gatgaaaaaa agaacaattt ttcattagta gatggtgggg 1680 caatcgcatg gatggggaca tctgttctga tttttctgca acccatgaag gtaaaaagtg 1740 gggttcaaaa cattcaaggt attaaagatg gggtagagtt tctaaactag gttgagggag 1800 agtttctaaa ctagcccccc agatttgggg cttggagctt aaatgaaaag tccaggagaa 1860 ataagggcac acaggaaccc cgggaacact ggtcctcaaa cagtgccact gtacttagtt 1920 ccatggccag aagagaagtg ctaggcaggg aatgattatt ttgcaaaagc aagtgcaatg 1980 tggtcatagc tggctgtgag acatggagcc tctttcctca tgcaaagttc actgttttac 2040 agtcagagaa ccactgcatg tgtgattgtc aaatgctaat gctgtcatgg gtcccttcct 2100 tctctgcttg gttctggagt tctccaataa aaccaatttc ctgggaatat ttgatgtttt 2160 tccttgtctc ttttcaaggt atggctatat atatagagct atagacatat atagatatat 2220 atatatatat ataaaacata gctattcata tttatataca ggcattaata aagtgcaaat 2280 gttattggct attgtaaaaa tcaatctcat ttcctgagga agtgctaaca cagcttatcc 2340 tatgacaatg tcaaaggcat agaatgctct atgtcaccca ctccctgctg ctgttgtttc 2400 tgcttatccc cacagcttac agggagggga gtgaccccct tggttttcca ggaagcatca 2460 gttcaggggc agcttcctgc tgcctctgtt ctttggtgag aggggcagcc tctttggaca 2520 tggcccagcc tgccccagaa gagctatttg gtagtgttta gggagccgtc ttcaggaatc 2580 ttctcctccg agcagctcct ccccgagagc ctgtccagat gctccagctc actgaagcgt 2640 tctgccacac actgggctgt gagacgggcc tctgggtcgt ggtcccagca ctcagtcaac 2700 gtctcacaca ccatctggat gccctggtgg ttgagccaga agctgggaat ttctggtcgc 2760 cctcgatctc tcaacacgtt gtccttcatg ctttcgacac aggggtgctc ccgcaccttg 2820 gaaccaaatg gaggctcata atcttttact tctcccactg cattacagcg agatgtcatt 2880 tcccagagca ccagagccat ggagtagaca tcggtctgct tgaaggactc aacattctcc 2940 aaattcatcc tggattctag gacttctgga gccatgtatc ttgcagttcc cacctgccca 3000 ctgttagcca ggtcatccac agacagagta gggtccagac gcagggaaag cccaaagtca 3060 cacaggcagc aggttaggtc gttcttcacg aggatattgg agctcttgag gtccctgtgc 3120 acgatgggca tcttgggcct cccacatgga gtgtgatcac tgtggaggtg agcaatcccc 3180 cgggcgaggg agctgcccag cttgcgcagg tcctcccagc tgatgacatg ccgcgtcagg 3240 tactcctgta ggttgccctt ggcgtggaag gcggtgatca gccagtattg tttccccaac 3300 tccgtcttcc gctcctcagc cgtcaggaac tggagtatgt tctcatgctt cagattgatg 3360 tctgagaaga tgtccttctc tgtcttccaa gaggcatact cctcataggg aaagatcttg 3420 actgccactg tctcaaactg ctctgaagtg ttctgcttca gcttggcctt atagacctca 3480 gcaaagcgac ctttccccac cagggtgtcc agctcaatgg gcagcagctc tgtgttgtgg 3540 ttgatgttgt tggcacacgt ggagctgatg tcagagcggt catcttccag gatgatggca 3600 cagtgctcgc tgaactccat gagcttccgc gtcttgccgg tttcccaggt tgaactcagc 3660 ttctgctgcc ggttaacgcg gtagcagtag aagatgatga tgacagatat ggcaactccc 3720 agtggtggca ggaggctgat gcctgtcact tgaaatatga ctagcaacaa gtcaggattg 3780 ctggtgttat attcttctga gaagatgatg ttgtcattgc actcatcaga gctacaggaa 3840 cacatgaaga aagtctcacc aggctttttt ttttccttca taatgcactt tggagaagca 3900 gcatcttcca gaataaagtc atggtagggg agcttggggt catggcaaac tgtctctagt 3960 gttatgttct cgtcattctt tctccataca gccacacaga cttcctgtgg cttctcacag 4020 atggaggtga tgctgcagtt gctcatgcag gatttctggt tgtcacaggt ggaaaatctc 4080 acatcacaaa atttacacag ttgtggaaac ttgactgcac cgttgttgtc agtgactatc 4140 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 4200 aggacgatgt gcagcggcca caggcccctg agcagccccc gacccatggc agaccccgct 4260 gctcgtcata gaccgagccc ccagcgcagc ggacggcgcc ttcccggacc cctggctgcg 4320 cctccgcgcc gcgccctctc cggaccccgc gccgggccgg cagcgcagat gtgcgggcca 4380 gatgtggcgc ccgctcgcca gccaggaggg ggcctggagg ccggcgaggc gcggggaggc 4440 ccccggcggc cgagggaagc tgcacaggag tccggctcct gtcccgagcg ggtgcacgcg 4500 cgggggtgtc gtcgctccgt gcgcgcgagt gactcactca acttcaactc agcgctgcgg 4560 gggaaacagg aaactcctcg ccaacagctg ggcaggacct ctctccgccc gagagccttc 4620 tccctctcc 4629 <210> SEQ ID NO 2 <211> LENGTH: 4629 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 ggagagggag aaggctctcg ggcggagaga ggtcctgccc agctgttggc gaggagtttc 60 ctgtttcccc cgcagcgctg agttgaagtt gagtgagtca ctcgcgcgca cggagcgacg 120 acacccccgc gcgtgcaccc gctcgggaca ggagccggac tcctgtgcag cttccctcgg 180 ccgccggggg cctccccgcg cctcgccggc ctccaggccc cctcctggct ggcgagcggg 240 cgccacatct ggcccgcaca tctgcgctgc cggcccggcg cggggtccgg agagggcgcg 300 gcgcggaggc gcagccaggg gtccgggaag gcgccgtccg ctgcgctggg ggctcggtct 360 atgacgagca gcggggtctg ccatgggtcg ggggctgctc aggggcctgt ggccgctgca 420 catcgtcctg tggacgcgta tcgccagcac gatcccaccg cacgttcaga agtcggttaa 480 taacgacatg atagtcactg acaacaacgg tgcagtcaag tttccacaac tgtgtaaatt 540 ttgtgatgtg agattttcca cctgtgacaa ccagaaatcc tgcatgagca actgcagcat 600 cacctccatc tgtgagaagc cacaggaagt ctgtgtggct gtatggagaa agaatgacga 660 gaacataaca ctagagacag tttgccatga ccccaagctc ccctaccatg actttattct 720 ggaagatgct gcttctccaa agtgcattat gaaggaaaaa aaaaagcctg gtgagacttt 780 cttcatgtgt tcctgtagct ctgatgagtg caatgacaac atcatcttct cagaagaata 840 taacaccagc aatcctgact tgttgctagt catatttcaa gtgacaggca tcagcctcct 900 gccaccactg ggagttgcca tatctgtcat catcatcttc tactgctacc gcgttaaccg 960 gcagcagaag ctgagttcaa cctgggaaac cggcaagacg cggaagctca tggagttcag 1020 cgagcactgt gccatcatcc tggaagatga ccgctctgac atcagctcca cgtgtgccaa 1080 caacatcaac cacaacacag agctgctgcc cattgagctg gacaccctgg tggggaaagg 1140 tcgctttgct gaggtctata aggccaagct gaagcagaac acttcagagc agtttgagac 1200 agtggcagtc aagatctttc cctatgagga gtatgcctct tggaagacag agaaggacat 1260 cttctcagac atcaatctga agcatgagaa catactccag ttcctgacgg ctgaggagcg 1320 gaagacggag ttggggaaac aatactggct gatcaccgcc ttccacgcca agggcaacct 1380 acaggagtac ctgacgcggc atgtcatcag ctgggaggac ctgcgcaagc tgggcagctc 1440 cctcgcccgg gggattgctc acctccacag tgatcacact ccatgtggga ggcccaagat 1500 gcccatcgtg cacagggacc tcaagagctc caatatcctc gtgaagaacg acctaacctg 1560 ctgcctgtgt gactttgggc tttccctgcg tctggaccct actctgtctg tggatgacct 1620 ggctaacagt gggcaggtgg gaactgcaag atacatggct ccagaagtcc tagaatccag 1680 gatgaatttg gagaatgttg agtccttcaa gcagaccgat gtctactcca tggctctggt 1740 gctctgggaa atgacatctc gctgtaatgc agtgggagaa gtaaaagatt atgagcctcc 1800 atttggttcc aaggtgcggg agcacccctg tgtcgaaagc atgaaggaca acgtgttgag 1860 agatcgaggg cgaccagaaa ttcccagctt ctggctcaac caccagggca tccagatggt 1920 gtgtgagacg ttgactgagt gctgggacca cgacccagag gcccgtctca cagcccagtg 1980 tgtggcagaa cgcttcagtg agctggagca tctggacagg ctctcgggga ggagctgctc 2040

ggaggagaag attcctgaag acggctccct aaacactacc aaatagctct tctggggcag 2100 gctgggccat gtccaaagag gctgcccctc tcaccaaaga acagaggcag caggaagctg 2160 cccctgaact gatgcttcct ggaaaaccaa gggggtcact cccctccctg taagctgtgg 2220 ggataagcag aaacaacagc agcagggagt gggtgacata gagcattcta tgcctttgac 2280 attgtcatag gataagctgt gttagcactt cctcaggaaa tgagattgat ttttacaata 2340 gccaataaca tttgcacttt attaatgcct gtatataaat atgaatagct atgttttata 2400 tatatatata tatatctata tatgtctata gctctatata tatagccata ccttgaaaag 2460 agacaaggaa aaacatcaaa tattcccagg aaattggttt tattggagaa ctccagaacc 2520 aagcagagaa ggaagggacc catgacagca ttagcatttg acaatcacac atgcagtggt 2580 tctctgactg taaaacagtg aactttgcat gaggaaagag gctccatgtc tcacagccag 2640 ctatgaccac attgcacttg cttttgcaaa ataatcattc cctgcctagc acttctcttc 2700 tggccatgga actaagtaca gtggcactgt ttgaggacca gtgttcccgg ggttcctgtg 2760 tgcccttatt tctcctggac ttttcattta agctccaagc cccaaatctg gggggctagt 2820 ttagaaactc tccctcaacc tagtttagaa actctacccc atctttaata ccttgaatgt 2880 tttgaacccc actttttacc ttcatgggtt gcagaaaaat cagaacagat gtccccatcc 2940 atgcgattgc cccaccatct actaatgaaa aattgttctt tttttcatct ttcccctgca 3000 cttatgttac tattctctgc tcccagcctt catccttttc taaaaaggag caaattctca 3060 ctctaggctt tatcgtgttt actttttcat tacacttgac ttgattttct agttttctat 3120 acaaacacca atgggttcca tctttctggg ctcctgattg ctcaagcaca gtttggcctg 3180 atgaagagga tttcaactac acaatactat cattgtcagg actatgacct caggcactct 3240 aaacatatgt tttgtttggt cagcacagcg tttcaaaaag tgaagccact ttataaatat 3300 ttggagattt tgcaggaaaa tctggatccc caggtaagga tagcagatgg ttttcagtta 3360 tctccagtcc acgttcacaa aatgtgaagg tgtggagaca cttacaaagc tgcctcactt 3420 ctcactgtaa acattagctc tttccactgc ctacctggac cccagtctag gaattaaatc 3480 tgcacctaac caaggtccct tgtaagaaat gtccattcaa gcagtcattc tctgggtata 3540 taatatgatt ttgactacct tatctggtgt taagatttga agttggcctt ttattggact 3600 aaaggggaac tcctttaagg gtctcagtta gcccaagttt cttttgctta tatgttaata 3660 gttttaccct ctgcattgga gagaggagtg ctttactcca agaagctttc ctcatggtta 3720 ccgttctctc catcatgcca gccttctcaa cctttgcaga aattactaga gaggatttga 3780 atgtgggaca caaaggtccc atttgcagtt agaaaatttg tgtccacaag gacaagaaca 3840 aagtatgagc tttaaaactc cataggaaac ttgttaatca acaaagaagt gttaatgctg 3900 caagtaatct cttttttaaa actttttgaa gctacttatt ttcagccaaa taggaatatt 3960 agagagggac tggtagtgag aatatcagct ctgtttggat ggtggaaggt ctcattttat 4020 tgagattttt aagatacatg caaaggtttg gaaatagaac ctctaggcac cctcctcagt 4080 gtgggtgggc tgagagttaa agacagtgtg gctgcagtag catagaggcg cctagaaatt 4140 ccacttgcac cgtagggcat gctgatacca tcccaatagc tgttgcccat tgacctctag 4200 tggtgagttt ctagaatact ggtccattca tgagatattc aagattcaag agtattctca 4260 cttctgggtt atcagcataa actggaatgt agtgtcagag gatactgtgg cttgttttgt 4320 ttatgttttt ttttcttatt caagaaaaaa gaccaaggaa taacattctg tagttcctaa 4380 aaatactgac ttttttcact actatacata aagggaaagt tttattcttt tatggaacac 4440 ttcagctgta ctcatgtatt aaaataggaa tgtgaatgct atatactctt tttatatcaa 4500 aagtctcaag cacttatttt tattctatgc attgtttgtc ttttacataa ataaaatgtt 4560 tattagattg aataaagcaa aatactcagg tgagcatcct gcctcctgtt cccattccta 4620 gtagctaaa 4629 <210> SEQ ID NO 3 <211> LENGTH: 4629 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 ggagagggag aaggcucucg ggcggagaga gguccugccc agcuguuggc gaggaguuuc 60 cuguuucccc cgcagcgcug aguugaaguu gagugaguca cucgcgcgca cggagcgacg 120 acacccccgc gcgugcaccc gcucgggaca ggagccggac uccugugcag cuucccucgg 180 ccgccggggg ccuccccgcg ccucgccggc cuccaggccc ccuccuggcu ggcgagcggg 240 cgccacaucu ggcccgcaca ucugcgcugc cggcccggcg cgggguccgg agagggcgcg 300 gcgcggaggc gcagccaggg guccgggaag gcgccguccg cugcgcuggg ggcucggucu 360 augacgagca gcggggucug ccaugggucg ggggcugcuc aggggccugu ggccgcugca 420 caucguccug uggacgcgua ucgccagcac gaucccaccg cacguucaga agucgguuaa 480 uaacgacaug auagucacug acaacaacgg ugcagucaag uuuccacaac uguguaaauu 540 uugugaugug agauuuucca ccugugacaa ccagaaaucc ugcaugagca acugcagcau 600 caccuccauc ugugagaagc cacaggaagu cuguguggcu guauggagaa agaaugacga 660 gaacauaaca cuagagacag uuugccauga ccccaagcuc cccuaccaug acuuuauucu 720 ggaagaugcu gcuucuccaa agugcauuau gaaggaaaaa aaaaagccug gugagacuuu 780 cuucaugugu uccuguagcu cugaugagug caaugacaac aucaucuucu cagaagaaua 840 uaacaccagc aauccugacu uguugcuagu cauauuucaa gugacaggca ucagccuccu 900 gccaccacug ggaguugcca uaucugucau caucaucuuc uacugcuacc gcguuaaccg 960 gcagcagaag cugaguucaa ccugggaaac cggcaagacg cggaagcuca uggaguucag 1020 cgagcacugu gccaucaucc uggaagauga ccgcucugac aucagcucca cgugugccaa 1080 caacaucaac cacaacacag agcugcugcc cauugagcug gacacccugg uggggaaagg 1140 ucgcuuugcu gaggucuaua aggccaagcu gaagcagaac acuucagagc aguuugagac 1200 aguggcaguc aagaucuuuc ccuaugagga guaugccucu uggaagacag agaaggacau 1260 cuucucagac aucaaucuga agcaugagaa cauacuccag uuccugacgg cugaggagcg 1320 gaagacggag uuggggaaac aauacuggcu gaucaccgcc uuccacgcca agggcaaccu 1380 acaggaguac cugacgcggc augucaucag cugggaggac cugcgcaagc ugggcagcuc 1440 ccucgcccgg gggauugcuc accuccacag ugaucacacu ccauguggga ggcccaagau 1500 gcccaucgug cacagggacc ucaagagcuc caauauccuc gugaagaacg accuaaccug 1560 cugccugugu gacuuugggc uuucccugcg ucuggacccu acucugucug uggaugaccu 1620 ggcuaacagu gggcaggugg gaacugcaag auacauggcu ccagaagucc uagaauccag 1680 gaugaauuug gagaauguug aguccuucaa gcagaccgau gucuacucca uggcucuggu 1740 gcucugggaa augacaucuc gcuguaaugc agugggagaa guaaaagauu augagccucc 1800 auuugguucc aaggugcggg agcaccccug ugucgaaagc augaaggaca acguguugag 1860 agaucgaggg cgaccagaaa uucccagcuu cuggcucaac caccagggca uccagauggu 1920 gugugagacg uugacugagu gcugggacca cgacccagag gcccgucuca cagcccagug 1980 uguggcagaa cgcuucagug agcuggagca ucuggacagg cucucgggga ggagcugcuc 2040 ggaggagaag auuccugaag acggcucccu aaacacuacc aaauagcucu ucuggggcag 2100 gcugggccau guccaaagag gcugccccuc ucaccaaaga acagaggcag caggaagcug 2160 ccccugaacu gaugcuuccu ggaaaaccaa gggggucacu ccccucccug uaagcugugg 2220 ggauaagcag aaacaacagc agcagggagu gggugacaua gagcauucua ugccuuugac 2280 auugucauag gauaagcugu guuagcacuu ccucaggaaa ugagauugau uuuuacaaua 2340 gccaauaaca uuugcacuuu auuaaugccu guauauaaau augaauagcu auguuuuaua 2400 uauauauaua uauaucuaua uaugucuaua gcucuauaua uauagccaua ccuugaaaag 2460 agacaaggaa aaacaucaaa uauucccagg aaauugguuu uauuggagaa cuccagaacc 2520 aagcagagaa ggaagggacc caugacagca uuagcauuug acaaucacac augcaguggu 2580 ucucugacug uaaaacagug aacuuugcau gaggaaagag gcuccauguc ucacagccag 2640 cuaugaccac auugcacuug cuuuugcaaa auaaucauuc ccugccuagc acuucucuuc 2700 uggccaugga acuaaguaca guggcacugu uugaggacca guguucccgg gguuccugug 2760 ugcccuuauu ucuccuggac uuuucauuua agcuccaagc cccaaaucug gggggcuagu 2820 uuagaaacuc ucccucaacc uaguuuagaa acucuacccc aucuuuaaua ccuugaaugu 2880 uuugaacccc acuuuuuacc uucauggguu gcagaaaaau cagaacagau guccccaucc 2940 augcgauugc cccaccaucu acuaaugaaa aauuguucuu uuuuucaucu uuccccugca 3000 cuuauguuac uauucucugc ucccagccuu cauccuuuuc uaaaaaggag caaauucuca 3060 cucuaggcuu uaucguguuu acuuuuucau uacacuugac uugauuuucu aguuuucuau 3120 acaaacacca auggguucca ucuuucuggg cuccugauug cucaagcaca guuuggccug 3180 augaagagga uuucaacuac acaauacuau cauugucagg acuaugaccu caggcacucu 3240 aaacauaugu uuuguuuggu cagcacagcg uuucaaaaag ugaagccacu uuauaaauau 3300 uuggagauuu ugcaggaaaa ucuggauccc cagguaagga uagcagaugg uuuucaguua 3360 ucuccagucc acguucacaa aaugugaagg uguggagaca cuuacaaagc ugccucacuu 3420 cucacuguaa acauuagcuc uuuccacugc cuaccuggac cccagucuag gaauuaaauc 3480 ugcaccuaac caaggucccu uguaagaaau guccauucaa gcagucauuc ucuggguaua 3540 uaauaugauu uugacuaccu uaucuggugu uaagauuuga aguuggccuu uuauuggacu 3600 aaaggggaac uccuuuaagg gucucaguua gcccaaguuu cuuuugcuua uauguuaaua 3660 guuuuacccu cugcauugga gagaggagug cuuuacucca agaagcuuuc cucaugguua 3720 ccguucucuc caucaugcca gccuucucaa ccuuugcaga aauuacuaga gaggauuuga 3780 augugggaca caaagguccc auuugcaguu agaaaauuug uguccacaag gacaagaaca 3840 aaguaugagc uuuaaaacuc cauaggaaac uuguuaauca acaaagaagu guuaaugcug 3900 caaguaaucu cuuuuuuaaa acuuuuugaa gcuacuuauu uucagccaaa uaggaauauu 3960 agagagggac ugguagugag aauaucagcu cuguuuggau gguggaaggu cucauuuuau 4020 ugagauuuuu aagauacaug caaagguuug gaaauagaac cucuaggcac ccuccucagu 4080 gugggugggc ugagaguuaa agacagugug gcugcaguag cauagaggcg ccuagaaauu 4140 ccacuugcac cguagggcau gcugauacca ucccaauagc uguugcccau ugaccucuag 4200 uggugaguuu cuagaauacu gguccauuca ugagauauuc aagauucaag aguauucuca 4260 cuucuggguu aucagcauaa acuggaaugu agugucagag gauacugugg cuuguuuugu 4320 uuauguuuuu uuuucuuauu caagaaaaaa gaccaaggaa uaacauucug uaguuccuaa 4380 aaauacugac uuuuuucacu acuauacaua aagggaaagu uuuauucuuu uauggaacac 4440 uucagcugua cucauguauu aaaauaggaa ugugaaugcu auauacucuu uuuauaucaa 4500 aagucucaag cacuuauuuu uauucuaugc auuguuuguc uuuuacauaa auaaaauguu 4560 uauuagauug aauaaagcaa aauacucagg ugagcauccu gccuccuguu cccauuccua 4620 guagcuaaa 4629

<210> SEQ ID NO 4 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 4 tggtccattc 10 <210> SEQ ID NO 5 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 5 ccctaaacac 10 <210> SEQ ID NO 6 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 6 actaccaaat 10 <210> SEQ ID NO 7 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 7 ggacgcgtat 10 <210> SEQ ID NO 8 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 8 gtctatgacg 10 <210> SEQ ID NO 9 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 9 ttattaatgc 10 <210> SEQ ID NO 10 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S3 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGCCCCAGAAGAGCTATTTGGTAG'3 or sequences derived from 5'TGCCCCAGAAGAGCTATTTGGTAG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'GAGCCGTCTTCAGGAATCTTCTCC'3 or sequences derived from 5'GAGCCGTCTTCAGGAATCTTCTCC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 10 ntgtttaggn 10 <210> SEQ ID NO 11 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S4 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GCCCAGCCTGCCCCAGAAGAGCTA'3 or sequences derived from 5'GCCCAGCCTGCCCCAGAAGAGCTA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'TGTTTAGGGAGCCGTCTTCAGGAA'3 or sequences derived from 5'TGTTTAGGGAGCCGTCTTCAGGAA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least T <400> SEQUENCE: 11 ntttggtagn 10 <210> SEQ ID NO 12 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula S1 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'CATGGCAGACCCCGCTGCTC'3 or sequences derived from 5'CATGGCAGACCCCGCTGCTC'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'CCGAGCCCCCAGCGCAGCGG'3 or sequences derived from 5'CCGAGCCCCCAGCGCAGCGG'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <400> SEQUENCE: 12 ngtcatagan 10 <210> SEQ ID NO 13 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 13 gctcgtcata gaccga 16 <210> SEQ ID NO 14 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 14 cgatacgcgt ccacag 16 <210> SEQ ID NO 15 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 15 gtagtgttta gggagc 16 <210> SEQ ID NO 16 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 16 gctatttggt agtgtt 16 <210> SEQ ID NO 17 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 17 catgaatgga ccagta 16 <210> SEQ ID NO 18 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo

sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 18 aggcattaat aaagtg 16 <210> SEQ ID NO 19 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 19 ccgctgctcg tcatagac 18 <210> SEQ ID NO 20 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 20 cgctgctcgt catagacc 18 <210> SEQ ID NO 21 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 21 gctgctcgtc atagaccg 18 <210> SEQ ID NO 22 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 22 ctgctcgtca tagaccga 18 <210> SEQ ID NO 23 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 23 tgctcgtcat agaccgag 18 <210> SEQ ID NO 24 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 24 gctcgtcata gaccgagc 18 <210> SEQ ID NO 25 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 25 ctcgtcatag accgagcc 18 <210> SEQ ID NO 26 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 26 tcgtcataga ccgagccc 18 <210> SEQ ID NO 27 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 27 cgtcatagac cgagcccc 18 <210> SEQ ID NO 28 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 28 cgctgctcgt catagac 17 <210> SEQ ID NO 29 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 29 gctgctcgtc atagacc 17 <210> SEQ ID NO 30 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 30 ctgctcgtca tagaccg 17 <210> SEQ ID NO 31 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 31 tgctcgtcat agaccga 17 <210> SEQ ID NO 32 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 32 gctcgtcata gaccgag 17 <210> SEQ ID NO 33 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 33 ctcgtcatag accgagc 17 <210> SEQ ID NO 34 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 34 tcgtcataga ccgagcc 17 <210> SEQ ID NO 35 <211> LENGTH: 17

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 35 cgtcatagac cgagccc 17 <210> SEQ ID NO 36 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 36 gctgctcgtc atagac 16 <210> SEQ ID NO 37 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 37 ctgctcgtca tagacc 16 <210> SEQ ID NO 38 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 38 tgctcgtcat agaccg 16 <210> SEQ ID NO 39 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 39 gctcgtcata gaccga 16 <210> SEQ ID NO 40 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 40 ctcgtcatag accgag 16 <210> SEQ ID NO 41 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 41 tcgtcataga ccgagc 16 <210> SEQ ID NO 42 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 42 cgtcatagac cgagcc 16 <210> SEQ ID NO 43 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 43 ctgctcgtca tagac 15 <210> SEQ ID NO 44 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 44 tgctcgtcat agacc 15 <210> SEQ ID NO 45 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 45 gctcgtcata gaccg 15 <210> SEQ ID NO 46 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 46 ctcgtcatag accga 15 <210> SEQ ID NO 47 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 47 tcgtcataga ccgag 15 <210> SEQ ID NO 48 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 48 cgtcatagac cgagc 15 <210> SEQ ID NO 49 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 49 tgctcgtcat agac 14 <210> SEQ ID NO 50 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 50 gctcgtcata gacc 14 <210> SEQ ID NO 51 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 51 ctcgtcatag accg 14

<210> SEQ ID NO 52 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 52 tcgtcataga ccga 14 <210> SEQ ID NO 53 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 53 cgtcatagac cgag 14 <210> SEQ ID NO 54 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 54 gctggcgata cgcgtcca 18 <210> SEQ ID NO 55 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 55 ctggcgatac gcgtccac 18 <210> SEQ ID NO 56 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 56 tggcgatacg cgtccaca 18 <210> SEQ ID NO 57 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 57 ggcgatacgc gtccacag 18 <210> SEQ ID NO 58 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 58 gcgatacgcg tccacagg 18 <210> SEQ ID NO 59 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 59 cgatacgcgt ccacagga 18 <210> SEQ ID NO 60 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 60 gatacgcgtc cacaggac 18 <210> SEQ ID NO 61 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 61 atacgcgtcc acaggacg 18 <210> SEQ ID NO 62 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 62 tacgcgtcca caggacga 18 <210> SEQ ID NO 63 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 63 ctggcgatac gcgtcca 17 <210> SEQ ID NO 64 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 64 tggcgatacg cgtccac 17 <210> SEQ ID NO 65 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 65 ggcgatacgc gtccaca 17 <210> SEQ ID NO 66 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 66 gcgatacgcg tccacag 17 <210> SEQ ID NO 67 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 67 cgatacgcgt ccacagg 17 <210> SEQ ID NO 68 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2

<400> SEQUENCE: 68 gatacgcgtc cacagga 17 <210> SEQ ID NO 69 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'CATGGCAGACCCCGCTGCT'3 or sequences derived from 5'CATGGCAGACCCCGCTGCT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'CGAGCCCCCAGCGCAGCGG'3 or sequences derived from 5'CGAGCCCCCAGCGCAGCGG'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n is a, c, g, or t <400> SEQUENCE: 69 ncgtcataga cn 12 <210> SEQ ID NO 70 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Formula <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GGTGGGATCGTGCTGGCGA'3 or sequences derived from 5'GGTGGGATCGTGCTGGCGA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'CAGGACGATGTGCAGCGGC'3 or sequences derived from 5'CAGGACGATGTGCAGCGGC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least C <400> SEQUENCE: 70 ntacgcgtcc an 12 <210> SEQ ID NO 71 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGCCCCAGAAGAGCTATTTGGTA'3 or sequences derived from 5'TGCCCCAGAAGAGCTATTTGGTA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'AGCCGTCTTCAGGAATCTTCTCC'3 or sequences derived from 5'AGCCGTCTTCAGGAATCTTCTCC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least A <400> SEQUENCE: 71 ngtgtttagg gn 12 <210> SEQ ID NO 72 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'GCCCAGCCTGCCCCAGAAGAGCT'3 or sequences derived from 5'GCCCAGCCTGCCCCAGAAGAGCT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTTTAGGGAGCCGTCTTCAGGAA'3 or sequences derived from 5'GTTTAGGGAGCCGTCTTCAGGAA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 72 natttggtag tn 12 <210> SEQ ID NO 73 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGAATCTTGAATATCTCAT'3 or sequences derived from 5'TGAATCTTGAATATCTCAT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTATTCTAGAAACTCACCA'3 or sequences derived from 5'GTATTCTAGAAACTCACCA'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <400> SEQUENCE: 73 ngaatggacc an 12 <210> SEQ ID NO 74 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General Sequence <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'ATTCATATTTATATACAGG'3 or sequences derived from 5'ATTCATATTTATATACAGG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: n may represent 5'GTGCAAATGTTATTGGCTA'3 or sequences derived from 5'GTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least G <400> SEQUENCE: 74 ncattaataa an 12 <210> SEQ ID NO 75 <211> LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 75 gaatcttgaa tatctcatga atggaccagt attctagaaa c 41 <210> SEQ ID NO 76 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide (scrambled control) <400> SEQUENCE: 76 aacacgtcta tacgc 15 <210> SEQ ID NO 77 <211> LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 77 ttcatattta tatacaggca ttaataaagt gcaaatgtta t 41 <210> SEQ ID NO 78 <211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 78 tgaggaagtg ctaacacagc ttatcctatg acaatgtcaa ag 42 <210> SEQ ID NO 79 <211> LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 79 gcctgcccca gaagagctat ttggtagtgt ttagggagcc gtcttcagg 49 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 80

ttgaatatct catgaatgga 20 <210> SEQ ID NO 81 <211> LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 81 cgcaggtcct cccagctgat gacatgccgc gtcaggtact cctgtaggt 49 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 82 cagaagagct atttggtagt 20 <210> SEQ ID NO 83 <211> LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 83 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 60 aggacgatgt gcagcggc 78 <210> SEQ ID NO 84 <211> LENGTH: 74 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 84 ggccacaggc ccctgagcag cccccgaccc atggcagacc ccgctgctcg tcatagaccg 60 agcccccagc gcag 74 <210> SEQ ID NO 85 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 85 tggtagtgtt tagggagccg 20 <210> SEQ ID NO 86 <211> LENGTH: 149 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 86 atgtcgttat taaccgactt ctgaacgtgc ggtgggatcg tgctggcgat acgcgtccac 60 aggacgatgt gcagcggcca caggcccctg agcagccccc gacccatggc agaccccgct 120 gctcgtcata gaccgagccc ccagcgcag 149 <210> SEQ ID NO 87 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 87 ttgaatatct catgaatgga ccagtattct a 31 <210> SEQ ID NO 88 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 88 caagtggaat ttctaggcgc ctctatgcta ctg 33 <210> SEQ ID NO 89 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 89 atttatatac aggcattaat aaagtgcaaa t 31 <210> SEQ ID NO 90 <211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 90 aagtgctaac acagcttatc ctatgacaat gt 32 <210> SEQ ID NO 91 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 91 ccccagaaga gctatttggt agtgtttagg gagccgtct 39 <210> SEQ ID NO 92 <211> LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 92 ctggtcgccc tcgatctctc aacacgttgt ccttcatgct ttcgacacag gggtgctccc 60 gcaccttgga accaaatg 78 <210> SEQ ID NO 93 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 93 gtcctcccag ctgatgacat gccgcgtcag gtactcctg 39 <210> SEQ ID NO 94 <211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 94 ctcagcttct gctgccggtt aacgcggtag cagtagaaga 40 <210> SEQ ID NO 95 <211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 95 gttattaacc gacttctgaa cgtgcggtgg gatcgtgctg gcgatacgcg tccacaggac 60 gatgtgca 68 <210> SEQ ID NO 96 <211> LENGTH: 64 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 96 caggcccctg agcagccccc gacccatggc agaccccgct gctcgtcata gaccgagccc 60 ccag 64

<210> SEQ ID NO 97 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 97 cacgcgcggg ggtgtcgtcg ctccgtgcgc gcgagtgact cactcaactt ca 52 <210> SEQ ID NO 98 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S2 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'GGTGGGATCGTGCTGGCGAT'3 or sequences derived from 5'GGTGGGATCGTGCTGGCGAT'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least T <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'ACAGGACGATGTGCAGCGGC'3 or sequences derived from 5'ACAGGACGATGTGCAGCGGC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <400> SEQUENCE: 98 nacgcgtccn 10 <210> SEQ ID NO 99 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S5 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'CCCAGCCTGCCCCAGAAGAGCTATTTG'3 or sequences derived from 5'CCCAGCCTGCCCCAGAAGAGCTATTTG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'TAGGGAGCCGTCTTCAGGAATCTTCTC'3 or sequences derived from 5'TAGGGAGCCGTCTTCAGGAATCTTCTC'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least G <400> SEQUENCE: 99 ngtagtgttn 10 <210> SEQ ID NO 100 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S6 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'TGAATCTTGAATATCTCATG'3 or sequences derived from 5'TGAATCTTGAATATCTCATG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: n may represent 5'TGAATCTTGAATATCTCATG'3 or sequences derived from 5'TGAATCTTGAATATCTCATG'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein n is at least G <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'AGTATTCTAGAAACTCACCA'3 or sequences derived from 5'AGTATTCTAGAAACTCACCA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <400> SEQUENCE: 100 naatggaccn 10 <210> SEQ ID NO 101 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: General formula S7 <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: w may represent 5'ATTCATATTTATATACAGGC'3 or sequences derived from 5'ATTCATATTTATATACAGGC'3, wherein one or more nucleotides are eliminated from the 5'-end and wherein w is at least C <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: r may represent 5'AGTGCAAATGTTATTGGCTA'3 or sequences derived from 5'AGTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein w is at least A <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223> OTHER INFORMATION: n may represent 5'AGTGCAAATGTTATTGGCTA'3 or sequences derived from 5'AGTGCAAATGTTATTGGCTA'3, wherein one or more nucleotides are eliminated from the 3'-end and wherein n is at least A <400> SEQUENCE: 101 nattaataan 10 <210> SEQ ID NO 102 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 102 gcgagtgact cactcaa 17 <210> SEQ ID NO 103 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 103 cgagtgactc actca 15 <210> SEQ ID NO 104 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 104 gcgagtgact cactca 16 <210> SEQ ID NO 105 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 105 cgcgagtgac tcactca 17 <210> SEQ ID NO 106 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 106 cgagtgactc actc 14 <210> SEQ ID NO 107 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 107 cgcgagtgac tcactc 16 <210> SEQ ID NO 108 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 108 gcgcgagtga ctcactc 17 <210> SEQ ID NO 109 <211> LENGTH: 14

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 109 gcgagtgact cact 14 <210> SEQ ID NO 110 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 110 gcgcgagtga ctcact 16 <210> SEQ ID NO 111 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 111 cgcgcgagtg actcact 17 <210> SEQ ID NO 112 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 112 cgagtgactc ac 12 <210> SEQ ID NO 113 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 113 gcgagtgact cac 13 <210> SEQ ID NO 114 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 114 cgcgagtgac tcac 14 <210> SEQ ID NO 115 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 115 cgcgcgagtg actcac 16 <210> SEQ ID NO 116 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 116 gcgcgcgagt gactcac 17 <210> SEQ ID NO 117 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 117 cgcgagtgac tca 13 <210> SEQ ID NO 118 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 118 gcgcgagtga ctca 14 <210> SEQ ID NO 119 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 119 cgcgcgagtg actca 15 <210> SEQ ID NO 120 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 120 gcgcgcgagt gactca 16 <210> SEQ ID NO 121 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 121 tgcgcgcgag tgactca 17 <210> SEQ ID NO 122 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 122 cgcgcgagtg actc 14 <210> SEQ ID NO 123 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 123 tgcgcgcgag tgactc 16 <210> SEQ ID NO 124 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 124 gtgcgcgcga gtgactc 17 <210> SEQ ID NO 125 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 125 cgcgcgagtg act 13

<210> SEQ ID NO 126 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 126 tgcgcgcgag tgac 14 <210> SEQ ID NO 127 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 127 cgtgcgcgcg agtgac 16 <210> SEQ ID NO 128 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 128 tgcgcgcgag tga 13 <210> SEQ ID NO 129 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 129 gtcgtcgctc cgtgcg 16 <210> SEQ ID NO 130 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 130 gtcgtcgctc cgtgc 15 <210> SEQ ID NO 131 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 131 gtgtcgtcgc tccgtgc 17 <210> SEQ ID NO 132 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 132 tcgtcgctcc gtg 13 <210> SEQ ID NO 133 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 133 tgtcgtcgct ccgtg 15 <210> SEQ ID NO 134 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 134 tcgtcgctcc gt 12 <210> SEQ ID NO 135 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 135 gtcgtcgctc cgt 13 <210> SEQ ID NO 136 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 136 tgtcgtcgct ccgt 14 <210> SEQ ID NO 137 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 137 gtgtcgtcgc tccgt 15 <210> SEQ ID NO 138 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 138 ggtgtcgtcg ctccgt 16 <210> SEQ ID NO 139 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 139 cgtcatagac cgagcc 16 <210> SEQ ID NO 140 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 140 atagaccgag cc 12 <210> SEQ ID NO 141 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 141 gctcgtcata gaccga 16 <210> SEQ ID NO 142 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2

<400> SEQUENCE: 142 cgtcatagac cga 13 <210> SEQ ID NO 143 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 143 ctcgtcatag accg 14 <210> SEQ ID NO 144 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 144 gctcgtcata gaccg 15 <210> SEQ ID NO 145 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 145 gctcgtcata gacc 14 <210> SEQ ID NO 146 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 146 cagcccccga cccatgg 17 <210> SEQ ID NO 147 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 147 cagcccccga cccatg 16 <210> SEQ ID NO 148 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 148 agcccccgac ccat 14 <210> SEQ ID NO 149 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 149 cagcccccga cccaagcccc cgacccat 28 <210> SEQ ID NO 150 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 150 cgcgtccaca ggacgat 17 <210> SEQ ID NO 151 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 151 cgcgtccaca ggac 14 <210> SEQ ID NO 152 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 152 cgatacgcgt ccaca 15 <210> SEQ ID NO 153 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 153 cgatacgcgt cca 13 <210> SEQ ID NO 154 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 154 tggcgatacg cgtcca 16 <210> SEQ ID NO 155 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 155 cgatacgcgt cc 12 <210> SEQ ID NO 156 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 156 gcgatacgcg tcc 13 <210> SEQ ID NO 157 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 157 gctggcgata cgcgtcc 17 <210> SEQ ID NO 158 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 158 ctggcgatac gcgtc 15 <210> SEQ ID NO 159 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2),

transcript variant 2 <400> SEQUENCE: 159 gcgatacgcg tc 12 <210> SEQ ID NO 160 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 160 gctggcgata cgcgtc 16 <210> SEQ ID NO 161 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 161 tggcgatacg cgtc 14 <210> SEQ ID NO 162 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 162 tggcgatacg cgt 13 <210> SEQ ID NO 163 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 163 ctggcgatac gcgt 14 <210> SEQ ID NO 164 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 164 ggcgatacgc gt 12 <210> SEQ ID NO 165 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 165 ctggcgatac gcg 13 <210> SEQ ID NO 166 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 166 tggcgatacg cg 12 <210> SEQ ID NO 167 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 167 atcgtgctgg cgatacg 17 <210> SEQ ID NO 168 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 168 cgtgcggtgg gatcgt 16 <210> SEQ ID NO 169 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 169 acgtgcggtg ggatcgt 17 <210> SEQ ID NO 170 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 170 aacgtgcggt gggatcg 17 <210> SEQ ID NO 171 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 171 aacgtgcggt gggat 15 <210> SEQ ID NO 172 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 172 tgaacgtgcg gtgggat 17 <210> SEQ ID NO 173 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 173 cgacttctga acgtgcg 17 <210> SEQ ID NO 174 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 174 ttaacgcggt agcagta 17 <210> SEQ ID NO 175 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 175 taacgcggta gcagta 16 <210> SEQ ID NO 176 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 176 gttaacgcgg tagcagt 17 <210> SEQ ID NO 177 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 177 ttaacgcggt agcag 15 <210> SEQ ID NO 178 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 178 taacgcggta gca 13 <210> SEQ ID NO 179 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 179 taacgcggta gc 12 <210> SEQ ID NO 180 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 180 ttaacgcggt agc 13 <210> SEQ ID NO 181 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 181 ttaacgcggt ag 12 <210> SEQ ID NO 182 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 182 gttaacgcgg tag 13 <210> SEQ ID NO 183 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 183 cggttaacgc ggtag 15 <210> SEQ ID NO 184 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 184 ccggttaacg cggtag 16 <210> SEQ ID NO 185 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 185 cggttaacgc ggta 14 <210> SEQ ID NO 186 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 186 ggttaacgcg gta 13 <210> SEQ ID NO 187 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 187 ccggttaacg cggta 15 <210> SEQ ID NO 188 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 188 gccggttaac gcggta 16 <210> SEQ ID NO 189 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 189 tgccggttaa cgcggta 17 <210> SEQ ID NO 190 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 190 cggttaacgc ggt 13 <210> SEQ ID NO 191 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 191 ccggttaacg cgg 13 <210> SEQ ID NO 192 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 192 gccggttaac gcgg 14

<210> SEQ ID NO 193 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 193 tgccggttaa cgcgg 15 <210> SEQ ID NO 194 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 194 gccggttaac gcg 13 <210> SEQ ID NO 195 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 195 ctgccggtta acgcg 15 <210> SEQ ID NO 196 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 196 gctgccggtt aacgcg 16 <210> SEQ ID NO 197 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 197 atgccgcgtc aggtac 16 <210> SEQ ID NO 198 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 198 acatgccgcg tca 13 <210> SEQ ID NO 199 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 199 gatgacatgc cgcgtc 16 <210> SEQ ID NO 200 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 200 gacatgccgc gt 12 <210> SEQ ID NO 201 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 201 gatgacatgc cgcgt 15 <210> SEQ ID NO 202 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 202 atgacatgcc gcg 13 <210> SEQ ID NO 203 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 203 tcccgcacct tggaacc 17 <210> SEQ ID NO 204 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 204 cgatctctca acacgt 16 <210> SEQ ID NO 205 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 205 tcgatctctc aacacgt 17 <210> SEQ ID NO 206 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 206 cgatctctca acacg 15 <210> SEQ ID NO 207 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 207 tcgatctctc aacacg 16 <210> SEQ ID NO 208 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 208 ctcgatctct caacacg 17 <210> SEQ ID NO 209 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 209

gtagtgttta gggagc 16 <210> SEQ ID NO 210 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 210 gctatttggt agtgtt 16 <210> SEQ ID NO 211 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 211 agcttatcct atgac 15 <210> SEQ ID NO 212 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 212 agcttatcct atga 14 <210> SEQ ID NO 213 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 213 caggcattaa taaagtg 17 <210> SEQ ID NO 214 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 214 ctaggcgcct ctatgc 16 <210> SEQ ID NO 215 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 215 taggcgcctc tatg 14 <210> SEQ ID NO 216 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 216 ctaggcgcct ctatg 15 <210> SEQ ID NO 217 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 217 taggcgcctc tat 13 <210> SEQ ID NO 218 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 218 catgaatgga ccagta 16 <210> SEQ ID NO 219 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 219 gaatggacca 10 <210> SEQ ID NO 220 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 220 tgaatggacc ag 12 <210> SEQ ID NO 221 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 221 tgaatggacc agt 13 <210> SEQ ID NO 222 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 222 atgaatggac cagt 14 <210> SEQ ID NO 223 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 223 atgaatggac cagta 15 <210> SEQ ID NO 224 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 224 catgaatgga ccagtat 17 <210> SEQ ID NO 225 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 225 tcatgaatgg accagtat 18 <210> SEQ ID NO 226 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens

transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 226 tcatgaatgg accagtatt 19 <210> SEQ ID NO 227 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 227 ctcatgaatg gaccagtatt 20 <210> SEQ ID NO 228 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 228 tctcatgaat ggaccagtat tc 22 <210> SEQ ID NO 229 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 229 atctcatgaa tggaccagta ttct 24 <210> SEQ ID NO 230 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 230 tatctcatga atggaccagt attcta 26 <210> SEQ ID NO 231 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 231 atatctcatg aatggaccag tattctag 28 <210> SEQ ID NO 232 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 232 cgtcatagac 10 <210> SEQ ID NO 233 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 233 tcgtcataga cc 12 <210> SEQ ID NO 234 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 234 tcgtcataga ccg 13 <210> SEQ ID NO 235 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 235 ctcgtcatag accga 15 <210> SEQ ID NO 236 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 236 atatacaggc attaataaag tgcaaatg 28 <210> SEQ ID NO 237 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 237 tgctcgtcat agaccga 17 <210> SEQ ID NO 238 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 238 tgctcgtcat agaccgag 18 <210> SEQ ID NO 239 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 239 tgctcgtcat agaccgagc 19 <210> SEQ ID NO 240 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 240 ctgctcgtca tagaccgagc 20 <210> SEQ ID NO 241 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 241 gctgctcgtc atagaccgag cc 22 <210> SEQ ID NO 242 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 242 cgctgctcgt catagaccga gccc 24 <210> SEQ ID NO 243 <211> LENGTH: 26 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 243 ccgctgctcg tcatagaccg agcccc 26 <210> SEQ ID NO 244 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 244 cccgctgctc gtcatagacc gagccccc 28 <210> SEQ ID NO 245 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 245 tacgcgtcca 10 <210> SEQ ID NO 246 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 246 atacgcgtcc ac 12 <210> SEQ ID NO 247 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 247 gatacgcgtc cac 13 <210> SEQ ID NO 248 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 248 gatacgcgtc caca 14 <210> SEQ ID NO 249 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 249 cgatacgcgt ccacag 16 <210> SEQ ID NO 250 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 250 gcgatacgcg tccacag 17 <210> SEQ ID NO 251 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 251 gcgatacgcg tccacagg 18 <210> SEQ ID NO 252 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 252 gcgatacgcg tccacagga 19 <210> SEQ ID NO 253 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 253 ggcgatacgc gtccacagga 20 <210> SEQ ID NO 254 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 254 tggcgatacg cgtccacagg ac 22 <210> SEQ ID NO 255 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 255 ctggcgatac gcgtccacag gacg 24 <210> SEQ ID NO 256 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 256 gctggcgata cgcgtccaca ggacga 26 <210> SEQ ID NO 257 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 257 tgctggcgat acgcgtccac aggacgat 28 <210> SEQ ID NO 258 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 258 gtgtttaggg 10 <210> SEQ ID NO 259 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 259 agtgtttagg ga 12

<210> SEQ ID NO 260 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 260 tagtgtttag gga 13 <210> SEQ ID NO 261 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 261 tagtgtttag ggag 14 <210> SEQ ID NO 262 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 262 tagtgtttag ggagc 15 <210> SEQ ID NO 263 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 263 gtagtgttta gggagcc 17 <210> SEQ ID NO 264 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 264 ggtagtgttt agggagcc 18 <210> SEQ ID NO 265 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 265 ggtagtgttt agggagccg 19 <210> SEQ ID NO 266 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 266 tggtagtgtt tagggagccg 20 <210> SEQ ID NO 267 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 267 ttggtagtgt ttagggagcc gt 22 <210> SEQ ID NO 268 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 268 tttggtagtg tttagggagc cgtc 24 <210> SEQ ID NO 269 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 269 atttggtagt gtttagggag ccgtct 26 <210> SEQ ID NO 270 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 270 tatttggtag tgtttaggga gccgtctt 28 <210> SEQ ID NO 271 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 271 atttggtagt 10 <210> SEQ ID NO 272 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 272 tatttggtag tg 12 <210> SEQ ID NO 273 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 273 tatttggtag tgt 13 <210> SEQ ID NO 274 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 274 ctatttggta gtgt 14 <210> SEQ ID NO 275 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 275 ctatttggta gtgtt 15 <210> SEQ ID NO 276 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2

<400> SEQUENCE: 276 gctatttggt agtgttt 17 <210> SEQ ID NO 277 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 277 agctatttgg tagtgttt 18 <210> SEQ ID NO 278 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 278 agctatttgg tagtgttta 19 <210> SEQ ID NO 279 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 279 gagctatttg gtagtgttta 20 <210> SEQ ID NO 280 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 280 agagctattt ggtagtgttt ag 22 <210> SEQ ID NO 281 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 281 aagagctatt tggtagtgtt tagg 24 <210> SEQ ID NO 282 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 282 gaagagctat ttggtagtgt ttaggg 26 <210> SEQ ID NO 283 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 283 agaagagcta tttggtagtg tttaggga 28 <210> SEQ ID NO 284 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 284 cattaataaa 10 <210> SEQ ID NO 285 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 285 gcattaataa ag 12 <210> SEQ ID NO 286 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 286 gcattaataa agt 13 <210> SEQ ID NO 287 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 287 ggcattaata aagt 14 <210> SEQ ID NO 288 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 288 ggcattaata aagtg 15 <210> SEQ ID NO 289 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 289 aggcattaat aaagtg 16 <210> SEQ ID NO 290 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 290 caggcattaa taaagtgc 18 <210> SEQ ID NO 291 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 291 acaggcatta ataaagtgc 19 <210> SEQ ID NO 292 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 292 acaggcatta ataaagtgca 20 <210> SEQ ID NO 293 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo

sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 293 tacaggcatt aataaagtgc aa 22 <210> SEQ ID NO 294 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 294 atacaggcat taataaagtg caaa 24 <210> SEQ ID NO 295 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 295 tatacaggca ttaataaagt gcaaat 26 <210> SEQ ID NO 296 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 296 ctggtccatt c 11 <210> SEQ ID NO 297 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 297 tggtccattc a 11 <210> SEQ ID NO 298 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 298 ctggtccatt ca 12 <210> SEQ ID NO 299 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 299 tccctaaaca c 11 <210> SEQ ID NO 300 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 300 ccctaaacac t 11 <210> SEQ ID NO 301 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 301 tccctaaaca ct 12 <210> SEQ ID NO 302 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 302 cactaccaaa t 11 <210> SEQ ID NO 303 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 303 actaccaaat a 11 <210> SEQ ID NO 304 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 304 cactaccaaa ta 12 <210> SEQ ID NO 305 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 305 tggacgcgta t 11 <210> SEQ ID NO 306 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 306 ggacgcgtat c 11 <210> SEQ ID NO 307 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 307 tggacgcgta tc 12 <210> SEQ ID NO 308 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 308 ggtctatgac g 11 <210> SEQ ID NO 309 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 309 gtctatgacg a 11 <210> SEQ ID NO 310 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 310 ggtctatgac ga 12 <210> SEQ ID NO 311 <211> LENGTH: 11

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 311 tttattaatg c 11 <210> SEQ ID NO 312 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 312 ttattaatgc c 11 <210> SEQ ID NO 313 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 313 tttattaatg cc 12 <210> SEQ ID NO 314 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 314 actggtccat tc 12 <210> SEQ ID NO 315 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 315 tggtccattc at 12 <210> SEQ ID NO 316 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 316 ctggtccatt cat 13 <210> SEQ ID NO 317 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 317 actggtccat tca 13 <210> SEQ ID NO 318 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 318 actggtccat tcat 14 <210> SEQ ID NO 319 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 319 ctccctaaac ac 12 <210> SEQ ID NO 320 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 320 ccctaaacac ta 12 <210> SEQ ID NO 321 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 321 tccctaaaca cta 13 <210> SEQ ID NO 322 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 322 ctccctaaac act 13 <210> SEQ ID NO 323 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 323 ctccctaaac acta 14 <210> SEQ ID NO 324 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 324 acactaccaa at 12 <210> SEQ ID NO 325 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 325 actaccaaat ag 12 <210> SEQ ID NO 326 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 326 cactaccaaa tag 13 <210> SEQ ID NO 327 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 327 acactaccaa ata 13 <210> SEQ ID NO 328 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 328 acactaccaa atag 14 <210> SEQ ID NO 329

<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 329 gtggacgcgt at 12 <210> SEQ ID NO 330 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 330 ggacgcgtat cg 12 <210> SEQ ID NO 331 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 331 tggacgcgta tcg 13 <210> SEQ ID NO 332 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 332 gtggacgcgt atc 13 <210> SEQ ID NO 333 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 333 gtggacgcgt atcg 14 <210> SEQ ID NO 334 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 334 cggtctatga cg 12 <210> SEQ ID NO 335 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 335 gtctatgacg ag 12 <210> SEQ ID NO 336 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 336 ggtctatgac gag 13 <210> SEQ ID NO 337 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 337 cggtctatga cga 13 <210> SEQ ID NO 338 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 338 cggtctatga cgag 14 <210> SEQ ID NO 339 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 339 ctttattaat gc 12 <210> SEQ ID NO 340 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 340 ttattaatgc ct 12 <210> SEQ ID NO 341 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 341 tttattaatg cct 13 <210> SEQ ID NO 342 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 342 ctttattaat gcc 13 <210> SEQ ID NO 343 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Target sequence within the homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2, sense <400> SEQUENCE: 343 ctttattaat gcct 14 <210> SEQ ID NO 344 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 344 gtgcagggga aagatgaaaa 20 <210> SEQ ID NO 345 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 345 gagctcttga ggtccctgtg 20 <210> SEQ ID NO 346 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 346 agcctctttc ctcatgcaaa 20 <210> SEQ ID NO 347 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide

<400> SEQUENCE: 347 ccttctctgc ttggttctgg 20 <210> SEQ ID NO 348 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Reference Oligonucleotide <400> SEQUENCE: 348 gccatggagt agacatcggt 20 <210> SEQ ID NO 349 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 349 atacgcgtcc acaggac 17 <210> SEQ ID NO 350 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 350 tacgcgtcca caggacg 17 <210> SEQ ID NO 351 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 351 tggcgatacg cgtcca 16 <210> SEQ ID NO 352 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 352 ggcgatacgc gtccac 16 <210> SEQ ID NO 353 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 353 gcgatacgcg tccaca 16 <210> SEQ ID NO 354 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 354 cgatacgcgt ccacag 16 <210> SEQ ID NO 355 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 355 gatacgcgtc cacagg 16 <210> SEQ ID NO 356 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 356 atacgcgtcc acagga 16 <210> SEQ ID NO 357 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 357 tacgcgtcca caggac 16 <210> SEQ ID NO 358 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 358 ggcgatacgc gtcca 15 <210> SEQ ID NO 359 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 359 gcgatacgcg tccac 15 <210> SEQ ID NO 360 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 360 cgatacgcgt ccaca 15 <210> SEQ ID NO 361 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 361 gatacgcgtc cacag 15 <210> SEQ ID NO 362 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 362 atacgcgtcc acagg 15 <210> SEQ ID NO 363 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 363 tacgcgtcca cagga 15 <210> SEQ ID NO 364 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2),

transcript variant 2 <400> SEQUENCE: 364 gcgatacgcg tcca 14 <210> SEQ ID NO 365 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 365 cgatacgcgt ccac 14 <210> SEQ ID NO 366 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 366 gatacgcgtc caca 14 <210> SEQ ID NO 367 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 367 atacgcgtcc acag 14 <210> SEQ ID NO 368 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 368 tacgcgtcca cagg 14 <210> SEQ ID NO 369 <400> SEQUENCE: 369 000 <210> SEQ ID NO 370 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 370 tttggtagtg tttaggga 18 <210> SEQ ID NO 371 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 371 ttggtagtgt ttagggag 18 <210> SEQ ID NO 372 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 372 tggtagtgtt tagggagc 18 <210> SEQ ID NO 373 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 373 ggtagtgttt agggagcc 18 <210> SEQ ID NO 374 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 374 gtagtgttta gggagccg 18 <210> SEQ ID NO 375 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 375 tagtgtttag ggagccgt 18 <210> SEQ ID NO 376 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 376 agtgtttagg gagccgtc 18 <210> SEQ ID NO 377 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 377 gtgtttaggg agccgtct 18 <210> SEQ ID NO 378 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 378 tttggtagtg tttaggg 17 <210> SEQ ID NO 379 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 379 ttggtagtgt ttaggga 17 <210> SEQ ID NO 380 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 380 tggtagtgtt tagggag 17 <210> SEQ ID NO 381 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 381

ggtagtgttt agggagc 17 <210> SEQ ID NO 382 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 382 gtagtgttta gggagcc 17 <210> SEQ ID NO 383 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 383 tagtgtttag ggagccg 17 <210> SEQ ID NO 384 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 384 agtgtttagg gagccgt 17 <210> SEQ ID NO 385 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 385 gtgtttaggg agccgtc 17 <210> SEQ ID NO 386 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 386 ttggtagtgt ttaggg 16 <210> SEQ ID NO 387 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 387 tggtagtgtt taggga 16 <210> SEQ ID NO 388 <400> SEQUENCE: 388 000 <210> SEQ ID NO 389 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 389 gtagtgttta gggagc 16 <210> SEQ ID NO 390 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 390 tagtgtttag ggagcc 16 <210> SEQ ID NO 391 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 391 agtgtttagg gagccg 16 <210> SEQ ID NO 392 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 392 gtgtttaggg agccgt 16 <210> SEQ ID NO 393 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 393 tggtagtgtt taggg 15 <210> SEQ ID NO 394 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 394 ggtagtgttt aggga 15 <210> SEQ ID NO 395 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 395 gtagtgttta gggag 15 <210> SEQ ID NO 396 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 396 tagtgtttag ggagc 15 <210> SEQ ID NO 397 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 397 agtgtttagg gagcc 15 <210> SEQ ID NO 398 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 398 gtgtttaggg agccg 15 <210> SEQ ID NO 399

<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 399 ggtagtgttt aggg 14 <210> SEQ ID NO 400 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 400 gtagtgttta ggga 14 <210> SEQ ID NO 401 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 401 tagtgtttag ggag 14 <210> SEQ ID NO 402 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 402 agtgtttagg gagc 14 <210> SEQ ID NO 403 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 403 gtgtttaggg agcc 14 <210> SEQ ID NO 404 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 404 gaagagctat ttggtagt 18 <210> SEQ ID NO 405 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 405 aagagctatt tggtagtg 18 <210> SEQ ID NO 406 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 406 agagctattt ggtagtgt 18 <210> SEQ ID NO 407 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 407 gagctatttg gtagtgtt 18 <210> SEQ ID NO 408 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 408 agctatttgg tagtgttt 18 <210> SEQ ID NO 409 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 409 gctatttggt agtgttta 18 <210> SEQ ID NO 410 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 410 ctatttggta gtgtttag 18 <210> SEQ ID NO 411 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 411 tatttggtag tgtttagg 18 <210> SEQ ID NO 412 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 412 atttggtagt gtttaggg 18 <210> SEQ ID NO 413 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 413 aagagctatt tggtagt 17 <210> SEQ ID NO 414 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 414 agagctattt ggtagtg 17 <210> SEQ ID NO 415 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 415

gagctatttg gtagtgt 17 <210> SEQ ID NO 416 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 416 agctatttgg tagtgtt 17 <210> SEQ ID NO 417 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 417 gctatttggt agtgttt 17 <210> SEQ ID NO 418 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 418 ctatttggta gtgttta 17 <210> SEQ ID NO 419 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 419 atttggtagt gtttagg 17 <210> SEQ ID NO 420 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 420 atttggtagt gtttagg 17 <210> SEQ ID NO 421 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 421 agagctattt ggtagt 16 <210> SEQ ID NO 422 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 422 gagctatttg gtagtg 16 <210> SEQ ID NO 423 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 423 agctatttgg tagtgt 16 <210> SEQ ID NO 424 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 424 gctatttggt agtgtt 16 <210> SEQ ID NO 425 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 425 ctatttggta gtgttt 16 <210> SEQ ID NO 426 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 426 tatttggtag tgttta 16 <210> SEQ ID NO 427 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 427 atttggtagt gtttag 16 <210> SEQ ID NO 428 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 428 gagctatttg gtagt 15 <210> SEQ ID NO 429 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 429 agctatttgg tagtg 15 <210> SEQ ID NO 430 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 430 gctatttggt agtgt 15 <210> SEQ ID NO 431 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 431 ctatttggta gtgtt 15 <210> SEQ ID NO 432 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2),

transcript variant 2 <400> SEQUENCE: 432 tatttggtag tgttt 15 <210> SEQ ID NO 433 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 433 atttggtagt gttta 15 <210> SEQ ID NO 434 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 434 agctatttgg tagt 14 <210> SEQ ID NO 435 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 435 gctatttggt agtg 14 <210> SEQ ID NO 436 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 436 ctatttggta gtgt 14 <210> SEQ ID NO 437 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 437 tatttggtag tgtt 14 <210> SEQ ID NO 438 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 438 atttggtagt gttt 14 <210> SEQ ID NO 439 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 439 tatctcatga atggacca 18 <210> SEQ ID NO 440 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 440 atctcatgaa tggaccag 18 <210> SEQ ID NO 441 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 441 tctcatgaat ggaccagt 18 <210> SEQ ID NO 442 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 442 ctcatgaatg gaccagta 18 <210> SEQ ID NO 443 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 443 tcatgaatgg accagtat 18 <210> SEQ ID NO 444 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 444 catgaatgga ccagtatt 18 <210> SEQ ID NO 445 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 445 atgaatggac cagtattc 18 <210> SEQ ID NO 446 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 446 tgaatggacc agtattct 18 <210> SEQ ID NO 447 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 447 gaatggacca gtattcta 18 <210> SEQ ID NO 448 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 448 atctcatgaa tggacca 17 <210> SEQ ID NO 449 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 449 tctcatgaat ggaccag 17 <210> SEQ ID NO 450 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 450 ctcatgaatg gaccagt 17 <210> SEQ ID NO 451 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 451 tcatgaatgg accagta 17 <210> SEQ ID NO 452 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 452 catgaatgga ccagtat 17 <210> SEQ ID NO 453 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 453 atgaatggac cagtatt 17 <210> SEQ ID NO 454 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 454 tgaatggacc agtattc 17 <210> SEQ ID NO 455 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 455 gaatggacca gtattct 17 <210> SEQ ID NO 456 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 456 tctcatgaat ggacca 16 <210> SEQ ID NO 457 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 457 ctcatgaatg gaccag 16 <210> SEQ ID NO 458 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 458 tcatgaatgg accagt 16 <210> SEQ ID NO 459 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 459 catgaatgga ccagta 16 <210> SEQ ID NO 460 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 460 atgaatggac cagtat 16 <210> SEQ ID NO 461 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 461 tgaatggacc agtatt 16 <210> SEQ ID NO 462 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 462 gaatggacca gtattc 16 <210> SEQ ID NO 463 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 463 ctcatgaatg gacca 15 <210> SEQ ID NO 464 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 464 tcatgaatgg accag 15 <210> SEQ ID NO 465 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 465 catgaatgga ccagt 15

<210> SEQ ID NO 466 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 466 atgaatggac cagta 15 <210> SEQ ID NO 467 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 467 tgaatggacc agtat 15 <210> SEQ ID NO 468 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 468 gaatggacca gtatt 15 <210> SEQ ID NO 469 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 469 tcatgaatgg acca 14 <210> SEQ ID NO 470 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 470 catgaatgga ccag 14 <210> SEQ ID NO 471 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 471 atgaatggac cagt 14 <210> SEQ ID NO 472 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 472 tgaatggacc agta 14 <210> SEQ ID NO 473 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 473 gaatggacca gtat 14 <210> SEQ ID NO 474 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 474 tatacaggca ttaataaa 18 <210> SEQ ID NO 475 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 475 atacaggcat taataaag 18 <210> SEQ ID NO 476 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 476 tacaggcatt aataaagt 18 <210> SEQ ID NO 477 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 477 acaggcatta ataaagtg 18 <210> SEQ ID NO 478 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 478 caggcattaa taaagtgc 18 <210> SEQ ID NO 479 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 479 aggcattaat aaagtgca 18 <210> SEQ ID NO 480 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 480 ggcattaata aagtgcaa 18 <210> SEQ ID NO 481 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 481 gcattaataa agtgcaaa 18 <210> SEQ ID NO 482 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 482

cattaataaa gtgcaaat 18 <210> SEQ ID NO 483 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 483 atacaggcat taataaa 17 <210> SEQ ID NO 484 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 484 tacaggcatt aataaag 17 <210> SEQ ID NO 485 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 485 acaggcatta ataaagt 17 <210> SEQ ID NO 486 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 486 caggcattaa taaagtg 17 <210> SEQ ID NO 487 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 487 aggcattaat aaagtgc 17 <210> SEQ ID NO 488 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 488 ggcattaata aagtgca 17 <210> SEQ ID NO 489 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 489 gcattaataa agtgcaa 17 <210> SEQ ID NO 490 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 490 cattaataaa gtgcaaa 17 <210> SEQ ID NO 491 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 491 tacaggcatt aataaa 16 <210> SEQ ID NO 492 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 492 acaggcatta ataaag 16 <210> SEQ ID NO 493 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 493 caggcattaa taaagt 16 <210> SEQ ID NO 494 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 494 aggcattaat aaagtg 16 <210> SEQ ID NO 495 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 495 ggcattaata aagtgc 16 <210> SEQ ID NO 496 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 496 gcattaataa agtgca 16 <210> SEQ ID NO 497 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 497 cattaataaa gtgcaa 16 <210> SEQ ID NO 498 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 498 acaggcatta ataaa 15 <210> SEQ ID NO 499 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens

transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 499 caggcattaa taaag 15 <210> SEQ ID NO 500 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 500 aggcattaat aaagt 15 <210> SEQ ID NO 501 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 501 ggcattaata aagtg 15 <210> SEQ ID NO 502 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 502 gcattaataa agtgc 15 <210> SEQ ID NO 503 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 503 cattaataaa gtgca 15 <210> SEQ ID NO 504 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 504 caggcattaa taaa 14 <210> SEQ ID NO 505 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 505 aggcattaat aaag 14 <210> SEQ ID NO 506 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 506 ggcattaata aagt 14 <210> SEQ ID NO 507 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 507 gcattaataa agtg 14 <210> SEQ ID NO 508 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide against Homo sapiens transforming growth factor, beta receptor II (70/80kDa) (TGFBR2), transcript variant 2 <400> SEQUENCE: 508 cattaataaa gtgc 14 <210> SEQ ID NO 509 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 509 catggcagac cccgctgctc 20 <210> SEQ ID NO 510 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 510 atggcagacc ccgctgctc 19 <210> SEQ ID NO 511 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 511 tggcagaccc cgctgctc 18 <210> SEQ ID NO 512 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 512 ggcagacccc gctgctc 17 <210> SEQ ID NO 513 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 513 gcagaccccg ctgctc 16 <210> SEQ ID NO 514 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 514 cagaccccgc tgctc 15 <210> SEQ ID NO 515 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 515 agaccccgct gctc 14 <210> SEQ ID NO 516 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 516 gaccccgctg ctc 13 <210> SEQ ID NO 517 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 517 accccgctgc tc 12

<210> SEQ ID NO 518 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 518 ccccgctgct c 11 <210> SEQ ID NO 519 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1 Sequence <400> SEQUENCE: 519 cccgctgctc 10 <210> SEQ ID NO 520 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 520 ccgagccccc 10 <210> SEQ ID NO 521 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 521 ccgagccccc a 11 <210> SEQ ID NO 522 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 522 ccgagccccc ag 12 <210> SEQ ID NO 523 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 523 ccgagccccc agc 13 <210> SEQ ID NO 524 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 524 ccgagccccc agcg 14 <210> SEQ ID NO 525 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 525 ccgagccccc agcgc 15 <210> SEQ ID NO 526 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 526 ccgagccccc agcgca 16 <210> SEQ ID NO 527 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 527 ccgagccccc agcgcag 17 <210> SEQ ID NO 528 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 528 ccgagccccc agcgcagc 18 <210> SEQ ID NO 529 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 529 ccgagccccc agcgcagcg 19 <210> SEQ ID NO 530 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2 Sequence <400> SEQUENCE: 530 ccgagccccc agcgcagcgg 20 <210> SEQ ID NO 531 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 531 ggtgggatcg tgctggcgat 20 <210> SEQ ID NO 532 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 532 gtgggatcgt gctggcgat 19 <210> SEQ ID NO 533 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 533 tgggatcgtg ctggcgat 18 <210> SEQ ID NO 534 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 534 gggatcgtgc tggcgat 17 <210> SEQ ID NO 535 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 535 ggatcgtgct ggcgat 16 <210> SEQ ID NO 536 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 536 gatcgtgctg gcgat 15 <210> SEQ ID NO 537 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 537 atcgtgctgg cgat 14 <210> SEQ ID NO 538 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 538 tcgtgctggc gat 13

<210> SEQ ID NO 539 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 539 cgtgctggcg at 12 <210> SEQ ID NO 540 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 540 gtgctggcga t 11 <210> SEQ ID NO 541 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3 Sequence <400> SEQUENCE: 541 tgctggcgat 10 <210> SEQ ID NO 542 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 542 acaggacgat gtgcagcggc 20 <210> SEQ ID NO 543 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 543 acaggacgat gtgcagcgg 19 <210> SEQ ID NO 544 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 544 acaggacgat gtgcagcg 18 <210> SEQ ID NO 545 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 545 acaggacgat gtgcagc 17 <210> SEQ ID NO 546 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 546 acaggacgat gtgcag 16 <210> SEQ ID NO 547 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 547 acaggacgat gtgca 15 <210> SEQ ID NO 548 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 548 acaggacgat gtgc 14 <210> SEQ ID NO 549 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 549 acaggacgat gtg 13 <210> SEQ ID NO 550 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 550 acaggacgat gt 12 <210> SEQ ID NO 551 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 551 acaggacgat g 11 <210> SEQ ID NO 552 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4 Sequence <400> SEQUENCE: 552 acaggacgat 10 <210> SEQ ID NO 553 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 553 gcccagcctg ccccagaaga gcta 24 <210> SEQ ID NO 554 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 554 cccagcctgc cccagaagag cta 23 <210> SEQ ID NO 555 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 555 ccagcctgcc ccagaagagc ta 22 <210> SEQ ID NO 556 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 556 cagcctgccc cagaagagct a 21 <210> SEQ ID NO 557 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 557 agcctgcccc agaagagcta 20 <210> SEQ ID NO 558 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 558 gcctgcccca gaagagcta 19 <210> SEQ ID NO 559 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 559 cctgccccag aagagcta 18

<210> SEQ ID NO 560 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 560 ctgccccaga agagcta 17 <210> SEQ ID NO 561 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 561 tgccccagaa gagcta 16 <210> SEQ ID NO 562 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 562 gccccagaag agcta 15 <210> SEQ ID NO 563 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 563 ccccagaaga gcta 14 <210> SEQ ID NO 564 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 564 cccagaagag cta 13 <210> SEQ ID NO 565 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 565 ccagaagagc ta 12 <210> SEQ ID NO 566 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 566 cagaagagct a 11 <210> SEQ ID NO 567 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5 Sequence <400> SEQUENCE: 567 agaagagcta 10 <210> SEQ ID NO 568 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 568 tgtttaggga gccgtcttca ggaa 24 <210> SEQ ID NO 569 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 569 tgtttaggga gccgtcttca gga 23 <210> SEQ ID NO 570 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 570 tgtttaggga gccgtcttca gg 22 <210> SEQ ID NO 571 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 571 tgtttaggga gccgtcttca g 21 <210> SEQ ID NO 572 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 572 tgtttaggga gccgtcttca 20 <210> SEQ ID NO 573 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 573 tgtttaggga gccgtcttc 19 <210> SEQ ID NO 574 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 574 tgtttaggga gccgtctt 18 <210> SEQ ID NO 575 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 575 tgtttaggga gccgtct 17 <210> SEQ ID NO 576 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 576 tgtttaggga gccgtc 16 <210> SEQ ID NO 577 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 577 tgtttaggga gccgt 15 <210> SEQ ID NO 578 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 578 tgtttaggga gccg 14 <210> SEQ ID NO 579 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 579 tgtttaggga gcc 13 <210> SEQ ID NO 580 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 580

tgtttaggga gc 12 <210> SEQ ID NO 581 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 581 tgtttaggga g 11 <210> SEQ ID NO 582 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6 Sequence <400> SEQUENCE: 582 tgtttaggga 10 <210> SEQ ID NO 583 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 583 tgaatcttga atatctcatg 20 <210> SEQ ID NO 584 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 584 gaatcttgaa tatctcatg 19 <210> SEQ ID NO 585 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 585 aatcttgaat atctcatg 18 <210> SEQ ID NO 586 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 586 atcttgaata tctcatg 17 <210> SEQ ID NO 587 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 587 tcttgaatat ctcatg 16 <210> SEQ ID NO 588 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 588 cttgaatatc tcatg 15 <210> SEQ ID NO 589 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 589 ttgaatatct catg 14 <210> SEQ ID NO 590 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 590 tgaatatctc atg 13 <210> SEQ ID NO 591 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 591 gaatatctca tg 12 <210> SEQ ID NO 592 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 592 aatatctcat g 11 <210> SEQ ID NO 593 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7 Sequence <400> SEQUENCE: 593 atatctcatg 10 <210> SEQ ID NO 594 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 594 agtattctag aaactcacca 20 <210> SEQ ID NO 595 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 595 agtattctag aaactcacc 19 <210> SEQ ID NO 596 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 596 agtattctag aaactcac 18 <210> SEQ ID NO 597 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 597 agtattctag aaactca 17 <210> SEQ ID NO 598 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 598 agtattctag aaactc 16 <210> SEQ ID NO 599 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 599 agtattctag aaact 15 <210> SEQ ID NO 600 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 600 agtattctag aaac 14 <210> SEQ ID NO 601 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 601

agtattctag aaa 13 <210> SEQ ID NO 602 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 602 agtattctag aa 12 <210> SEQ ID NO 603 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 603 agtattctag a 11 <210> SEQ ID NO 604 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8 Sequence <400> SEQUENCE: 604 agtattctag 10 <210> SEQ ID NO 605 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 605 attcatattt atatacaggc 20 <210> SEQ ID NO 606 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 606 ttcatattta tatacaggc 19 <210> SEQ ID NO 607 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 607 tcatatttat atacaggc 18 <210> SEQ ID NO 608 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 608 catatttata tacaggc 17 <210> SEQ ID NO 609 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 609 atatttatat acaggc 16 <210> SEQ ID NO 610 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 610 tatttatata caggc 15 <210> SEQ ID NO 611 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 611 atttatatac aggc 14 <210> SEQ ID NO 612 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 612 tttatataca ggc 13 <210> SEQ ID NO 613 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 613 ttatatacag gc 12 <210> SEQ ID NO 614 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 614 tatatacagg c 11 <210> SEQ ID NO 615 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9 Sequence <400> SEQUENCE: 615 atatacaggc 10 <210> SEQ ID NO 616 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 616 agtgcaaatg ttattggcta 20 <210> SEQ ID NO 617 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 617 agtgcaaatg ttattggct 19 <210> SEQ ID NO 618 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 618 agtgcaaatg ttattggc 18 <210> SEQ ID NO 619 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 619 agtgcaaatg ttattgg 17 <210> SEQ ID NO 620 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 620 agtgcaaatg ttattg 16 <210> SEQ ID NO 621 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 621 agtgcaaatg ttatt 15 <210> SEQ ID NO 622 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence

<400> SEQUENCE: 622 agtgcaaatg ttat 14 <210> SEQ ID NO 623 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 623 agtgcaaatg tta 13 <210> SEQ ID NO 624 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 624 agtgcaaatg tt 12 <210> SEQ ID NO 625 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 625 agtgcaaatg t 11 <210> SEQ ID NO 626 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10 Sequence <400> SEQUENCE: 626 agtgcaaatg 10 <210> SEQ ID NO 627 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 627 tgccccagaa gagctatttg gtag 24 <210> SEQ ID NO 628 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 628 gccccagaag agctatttgg tag 23 <210> SEQ ID NO 629 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 629 ccccagaaga gctatttggt ag 22 <210> SEQ ID NO 630 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 630 cccagaagag ctatttggta g 21 <210> SEQ ID NO 631 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 631 ccagaagagc tatttggtag 20 <210> SEQ ID NO 632 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 632 cagaagagct atttggtag 19 <210> SEQ ID NO 633 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 633 agaagagcta tttggtag 18 <210> SEQ ID NO 634 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 634 gaagagctat ttggtag 17 <210> SEQ ID NO 635 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 635 aagagctatt tggtag 16 <210> SEQ ID NO 636 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 636 agagctattt ggtag 15 <210> SEQ ID NO 637 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 637 gagctatttg gtag 14 <210> SEQ ID NO 638 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 638 agctatttgg tag 13 <210> SEQ ID NO 639 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 639 gctatttggt ag 12 <210> SEQ ID NO 640 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 640 ctatttggta g 11 <210> SEQ ID NO 641 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11 Sequence <400> SEQUENCE: 641 tatttggtag 10 <210> SEQ ID NO 642 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 642 gagccgtctt caggaatctt ctcc 24 <210> SEQ ID NO 643 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence

<400> SEQUENCE: 643 gagccgtctt caggaatctt ctc 23 <210> SEQ ID NO 644 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 644 gagccgtctt caggaatctt ct 22 <210> SEQ ID NO 645 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 645 gagccgtctt caggaatctt c 21 <210> SEQ ID NO 646 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 646 gagccgtctt caggaatctt 20 <210> SEQ ID NO 647 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 647 gagccgtctt caggaatct 19 <210> SEQ ID NO 648 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 648 gagccgtctt caggaatc 18 <210> SEQ ID NO 649 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 649 gagccgtctt caggaat 17 <210> SEQ ID NO 650 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 650 gagccgtctt caggaa 16 <210> SEQ ID NO 651 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 651 gagccgtctt cagga 15 <210> SEQ ID NO 652 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 652 gagccgtctt cagg 14 <210> SEQ ID NO 653 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 653 gagccgtctt cag 13 <210> SEQ ID NO 654 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 654 gagccgtctt ca 12 <210> SEQ ID NO 655 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 655 gagccgtctt c 11 <210> SEQ ID NO 656 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12 Sequence <400> SEQUENCE: 656 gagccgtctt 10 <210> SEQ ID NO 657 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 657 catggcagac cccgctgct 19 <210> SEQ ID NO 658 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 658 atggcagacc ccgctgct 18 <210> SEQ ID NO 659 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 659 tggcagaccc cgctgct 17 <210> SEQ ID NO 660 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 660 ggcagacccc gctgct 16 <210> SEQ ID NO 661 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 661 gcagaccccg ctgct 15 <210> SEQ ID NO 662 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 662 cagaccccgc tgct 14 <210> SEQ ID NO 663 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 663 agaccccgct gct 13 <210> SEQ ID NO 664 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 664 gaccccgctg ct 12 <210> SEQ ID NO 665 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 665 accccgctgc t 11 <210> SEQ ID NO 666 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N1A Sequence <400> SEQUENCE: 666 ccccgctgct 10 <210> SEQ ID NO 667 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 667 cgagccccca 10 <210> SEQ ID NO 668 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 668 cgagccccca g 11 <210> SEQ ID NO 669 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 669 cgagccccca gc 12 <210> SEQ ID NO 670 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 670 cgagccccca gcg 13 <210> SEQ ID NO 671 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 671 cgagccccca gcgc 14 <210> SEQ ID NO 672 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 672 cgagccccca gcgca 15 <210> SEQ ID NO 673 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 673 cgagccccca gcgcag 16 <210> SEQ ID NO 674 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 674 cgagccccca gcgcagc 17 <210> SEQ ID NO 675 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 675 cgagccccca gcgcagcg 18 <210> SEQ ID NO 676 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N2A Sequence <400> SEQUENCE: 676 cgagccccca gcgcagcgg 19 <210> SEQ ID NO 677 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 677 ggtgggatcg tgctggcga 19 <210> SEQ ID NO 678 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 678 gtgggatcgt gctggcga 18 <210> SEQ ID NO 679 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 679 tgggatcgtg ctggcga 17 <210> SEQ ID NO 680 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 680 gggatcgtgc tggcga 16 <210> SEQ ID NO 681 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 681 ggatcgtgct ggcga 15 <210> SEQ ID NO 682 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 682 gatcgtgctg gcga 14 <210> SEQ ID NO 683 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 683 atcgtgctgg cga 13 <210> SEQ ID NO 684 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 684 tcgtgctggc ga 12 <210> SEQ ID NO 685 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 685 cgtgctggcg a 11 <210> SEQ ID NO 686 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N3A Sequence <400> SEQUENCE: 686 gtgctggcga 10 <210> SEQ ID NO 687 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 687 caggacgatg tgcagcggc 19 <210> SEQ ID NO 688 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 688 caggacgatg tgcagcgg 18 <210> SEQ ID NO 689 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 689 caggacgatg tgcagcg 17 <210> SEQ ID NO 690 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 690 caggacgatg tgcagc 16 <210> SEQ ID NO 691 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 691 caggacgatg tgcag 15 <210> SEQ ID NO 692 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 692 caggacgatg tgca 14 <210> SEQ ID NO 693 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 693 caggacgatg tgc 13 <210> SEQ ID NO 694 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 694 caggacgatg tg 12 <210> SEQ ID NO 695 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 695 caggacgatg t 11 <210> SEQ ID NO 696 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N4A Sequence <400> SEQUENCE: 696 caggacgatg 10 <210> SEQ ID NO 697 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 697 gcccagcctg ccccagaaga gct 23 <210> SEQ ID NO 698 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 698 cccagcctgc cccagaagag ct 22 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 699 ccagcctgcc ccagaagagc t 21 <210> SEQ ID NO 700 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 700 cagcctgccc cagaagagct 20 <210> SEQ ID NO 701 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 701 agcctgcccc agaagagct 19 <210> SEQ ID NO 702 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 702 gcctgcccca gaagagct 18 <210> SEQ ID NO 703 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 703 cctgccccag aagagct 17 <210> SEQ ID NO 704 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 704 ctgccccaga agagct 16 <210> SEQ ID NO 705 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 705 tgccccagaa gagct 15 <210> SEQ ID NO 706 <211> LENGTH: 14 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 706 gccccagaag agct 14 <210> SEQ ID NO 707 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 707 ccccagaaga gct 13 <210> SEQ ID NO 708 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 708 cccagaagag ct 12 <210> SEQ ID NO 709 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 709 ccagaagagc t 11 <210> SEQ ID NO 710 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N5A Sequence <400> SEQUENCE: 710 cagaagagct 10 <210> SEQ ID NO 711 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 711 gtttagggag ccgtcttcag gaa 23 <210> SEQ ID NO 712 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 712 gtttagggag ccgtcttcag ga 22 <210> SEQ ID NO 713 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 713 gtttagggag ccgtcttcag g 21 <210> SEQ ID NO 714 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 714 gtttagggag ccgtcttcag 20 <210> SEQ ID NO 715 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 715 gtttagggag ccgtcttca 19 <210> SEQ ID NO 716 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 716 gtttagggag ccgtcttc 18 <210> SEQ ID NO 717 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 717 gtttagggag ccgtctt 17 <210> SEQ ID NO 718 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 718 gtttagggag ccgtct 16 <210> SEQ ID NO 719 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 719 gtttagggag ccgtc 15 <210> SEQ ID NO 720 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 720 gtttagggag ccgt 14 <210> SEQ ID NO 721 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 721 gtttagggag ccg 13 <210> SEQ ID NO 722 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 722 gtttagggag cc 12 <210> SEQ ID NO 723 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 723 gtttagggag c 11 <210> SEQ ID NO 724 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N6A Sequence <400> SEQUENCE: 724 gtttagggag 10 <210> SEQ ID NO 725 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 725 tgaatcttga atatctcat 19 <210> SEQ ID NO 726 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 726 gaatcttgaa tatctcat 18 <210> SEQ ID NO 727 <211> LENGTH: 17

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 727 aatcttgaat atctcat 17 <210> SEQ ID NO 728 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 728 atcttgaata tctcat 16 <210> SEQ ID NO 729 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 729 tcttgaatat ctcat 15 <210> SEQ ID NO 730 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 730 cttgaatatc tcat 14 <210> SEQ ID NO 731 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 731 ttgaatatct cat 13 <210> SEQ ID NO 732 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 732 tgaatatctc at 12 <210> SEQ ID NO 733 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 733 gaatatctca t 11 <210> SEQ ID NO 734 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N7A Sequence <400> SEQUENCE: 734 aatatctcat 10 <210> SEQ ID NO 735 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 735 gtattctaga aactcacca 19 <210> SEQ ID NO 736 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 736 gtattctaga aactcacc 18 <210> SEQ ID NO 737 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 737 gtattctaga aactcac 17 <210> SEQ ID NO 738 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 738 gtattctaga aactca 16 <210> SEQ ID NO 739 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 739 gtattctaga aactc 15 <210> SEQ ID NO 740 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 740 gtattctaga aact 14 <210> SEQ ID NO 741 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 741 gtattctaga aac 13 <210> SEQ ID NO 742 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 742 gtattctaga aa 12 <210> SEQ ID NO 743 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 743 gtattctaga a 11 <210> SEQ ID NO 744 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N8A Sequence <400> SEQUENCE: 744 gtattctaga 10 <210> SEQ ID NO 745 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 745 attcatattt atatacagg 19 <210> SEQ ID NO 746 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 746 ttcatattta tatacagg 18 <210> SEQ ID NO 747 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 747 tcatatttat atacagg 17 <210> SEQ ID NO 748

<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 748 catatttata tacagg 16 <210> SEQ ID NO 749 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 749 atatttatat acagg 15 <210> SEQ ID NO 750 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 750 tatttatata cagg 14 <210> SEQ ID NO 751 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 751 atttatatac agg 13 <210> SEQ ID NO 752 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 752 tttatataca gg 12 <210> SEQ ID NO 753 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 753 ttatatacag g 11 <210> SEQ ID NO 754 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N9A Sequence <400> SEQUENCE: 754 tatatacagg 10 <210> SEQ ID NO 755 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 755 gtgcaaatgt tattggcta 19 <210> SEQ ID NO 756 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 756 gtgcaaatgt tattggct 18 <210> SEQ ID NO 757 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 757 gtgcaaatgt tattggc 17 <210> SEQ ID NO 758 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 758 gtgcaaatgt tattgg 16 <210> SEQ ID NO 759 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 759 gtgcaaatgt tattg 15 <210> SEQ ID NO 760 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 760 gtgcaaatgt tatt 14 <210> SEQ ID NO 761 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 761 gtgcaaatgt tat 13 <210> SEQ ID NO 762 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 762 gtgcaaatgt ta 12 <210> SEQ ID NO 763 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 763 gtgcaaatgt t 11 <210> SEQ ID NO 764 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N10A Sequence <400> SEQUENCE: 764 gtgcaaatgt 10 <210> SEQ ID NO 765 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 765 tgccccagaa gagctatttg gta 23 <210> SEQ ID NO 766 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 766 gccccagaag agctatttgg ta 22 <210> SEQ ID NO 767 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 767 ccccagaaga gctatttggt a 21 <210> SEQ ID NO 768 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 768 cccagaagag ctatttggta 20

<210> SEQ ID NO 769 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 769 ccagaagagc tatttggta 19 <210> SEQ ID NO 770 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 770 cagaagagct atttggta 18 <210> SEQ ID NO 771 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 771 agaagagcta tttggta 17 <210> SEQ ID NO 772 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 772 gaagagctat ttggta 16 <210> SEQ ID NO 773 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 773 aagagctatt tggta 15 <210> SEQ ID NO 774 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 774 agagctattt ggta 14 <210> SEQ ID NO 775 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 775 gagctatttg gta 13 <210> SEQ ID NO 776 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 776 agctatttgg ta 12 <210> SEQ ID NO 777 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 777 gctatttggt a 11 <210> SEQ ID NO 778 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N11A Sequence <400> SEQUENCE: 778 ctatttggta 10 <210> SEQ ID NO 779 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 779 agccgtcttc aggaatcttc tcc 23 <210> SEQ ID NO 780 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 780 agccgtcttc aggaatcttc tc 22 <210> SEQ ID NO 781 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 781 agccgtcttc aggaatcttc t 21 <210> SEQ ID NO 782 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 782 agccgtcttc aggaatcttc 20 <210> SEQ ID NO 783 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 783 agccgtcttc aggaatctt 19 <210> SEQ ID NO 784 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 784 agccgtcttc aggaatct 18 <210> SEQ ID NO 785 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 785 agccgtcttc aggaatc 17 <210> SEQ ID NO 786 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 786 agccgtcttc aggaat 16 <210> SEQ ID NO 787 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 787 agccgtcttc aggaa 15 <210> SEQ ID NO 788 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 788 agccgtcttc agga 14 <210> SEQ ID NO 789 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 789 agccgtcttc agg 13

<210> SEQ ID NO 790 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 790 agccgtcttc ag 12 <210> SEQ ID NO 791 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 791 agccgtcttc a 11 <210> SEQ ID NO 792 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N12A Sequence <400> SEQUENCE: 792 agccgtcttc 10 <210> SEQ ID NO 793 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 793 cccagcctgc cccagaagag ctatttg 27 <210> SEQ ID NO 794 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 794 ccagcctgcc ccagaagagc tatttg 26 <210> SEQ ID NO 795 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 795 cagcctgccc cagaagagct atttg 25 <210> SEQ ID NO 796 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 796 agcctgcccc agaagagcta tttg 24 <210> SEQ ID NO 797 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 797 gcctgcccca gaagagctat ttg 23 <210> SEQ ID NO 798 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 798 cctgccccag aagagctatt tg 22 <210> SEQ ID NO 799 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 799 ctgccccaga agagctattt g 21 <210> SEQ ID NO 800 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 800 tgccccagaa gagctatttg 20 <210> SEQ ID NO 801 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 801 gccccagaag agctatttg 19 <210> SEQ ID NO 802 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 802 ccccagaaga gctatttg 18 <210> SEQ ID NO 803 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 803 cccagaagag ctatttg 17 <210> SEQ ID NO 804 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 804 ccagaagagc tatttg 16 <210> SEQ ID NO 805 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 805 cagaagagct atttg 15 <210> SEQ ID NO 806 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 806 agaagagcta tttg 14 <210> SEQ ID NO 807 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 807 gaagagctat ttg 13 <210> SEQ ID NO 808 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 808 aagagctatt tg 12 <210> SEQ ID NO 809 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 809 agagctattt g 11 <210> SEQ ID NO 810 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N13 Sequence <400> SEQUENCE: 810 gagctatttg 10

<210> SEQ ID NO 811 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 811 tagggagccg tcttcaggaa tcttctc 27 <210> SEQ ID NO 812 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 812 tagggagccg tcttcaggaa tcttct 26 <210> SEQ ID NO 813 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 813 tagggagccg tcttcaggaa tcttc 25 <210> SEQ ID NO 814 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 814 tagggagccg tcttcaggaa tctt 24 <210> SEQ ID NO 815 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 815 tagggagccg tcttcaggaa tct 23 <210> SEQ ID NO 816 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 816 tagggagccg tcttcaggaa tc 22 <210> SEQ ID NO 817 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 817 tagggagccg tcttcaggaa t 21 <210> SEQ ID NO 818 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 818 tagggagccg tcttcaggaa 20 <210> SEQ ID NO 819 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 819 tagggagccg tcttcagga 19 <210> SEQ ID NO 820 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 820 tagggagccg tcttcagg 18 <210> SEQ ID NO 821 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 821 tagggagccg tcttcag 17 <210> SEQ ID NO 822 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 822 tagggagccg tcttca 16 <210> SEQ ID NO 823 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 823 tagggagccg tcttc 15 <210> SEQ ID NO 824 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 824 tagggagccg tctt 14 <210> SEQ ID NO 825 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 825 tagggagccg tct 13 <210> SEQ ID NO 826 <211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 826 tagggagccg tc 12 <210> SEQ ID NO 827 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 827 tagggagccg t 11 <210> SEQ ID NO 828 <211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: N14 Sequence <400> SEQUENCE: 828 tagggagccg 10



User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
New patent applications in this class:
DateTitle
2022-09-08Shrub rose plant named 'vlr003'
2022-08-25Cherry tree named 'v84031'
2022-08-25Miniature rose plant named 'poulty026'
2022-08-25Information processing system and information processing method
2022-08-25Data reassembly method and apparatus
Website © 2025 Advameg, Inc.