Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: S-ANTIGEN TRANSPORT INHIBITING OLIGONUCLEOTIDE POLYMERS AND METHODS

Inventors:
IPC8 Class: AA61K317125FI
USPC Class: 1 1
Class name:
Publication date: 2022-04-28
Patent application number: 20220125825



Abstract:

Various embodiments provide STOPS.TM. polymers that are S-antigen transport inhibiting oligonucleotide polymers, processes for making them and methods of using them to treat diseases and conditions. In some embodiments the STOPS.TM. modified oligonucleotides include an at least partially phosphorothioated sequence of alternating A and C units having modifications as described herein. The sequence independent antiviral activity against hepatitis B of embodiments of STOPS.TM. modified oligonucleotides, as determined by HBsAg Secretion Assay, is greater than that of a reference compound.

Claims:

1. A method of treating hepatitis B and/or hepatitis D, comprising administering an effective amount of a modified oligonucleotide or complex thereof to a subject in need thereof, wherein the modified oligonucleotide is represented by the following formula: TABLE-US-00042 (SEQ ID NO: 146) 5'mApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln (5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m) CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln (5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m) CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln (5m)CpsmApsln(5m)CpsmApsln(5m)C 3',

wherein mA is 2'-O-methyladenosine, ps is phosphorothioate, ln(5m)C is locked 5-methylcytidine, and rA is ribo-adenosine.

2. The method of claim 1, wherein the modified oligonucleotide or complex thereof is administered to the subject by a parenteral route.

3. The method of claim 2, wherein the modified oligonucleotide or complex thereof is administered to the subject intravenously.

4. The method of claim 2, wherein the modified oligonucleotide or complex thereof is administered to the subject subcutaneously.

5. The method of claim 1, further comprising administering an effective amount of one or more of a second treatment for hepatitis B to the subject.

6. The method of claim 5, wherein the second treatment for hepatitis B comprises an siRNA oligonucleotide, an anti-sense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or a combination thereof.

7. The method of claim 6, wherein the second treatment for hepatitis B comprises an anti-sense oligonucleotide.

8. The method of claim 6, wherein the second treatment for hepatitis B comprises a capsid assembly modulator.

9. The method of claim 1, comprising subcutaneously administering the modified oligonucleotide or complex thereof to a human subject in need thereof, at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration.

10. The method of claim 9, wherein the complex is a chelate complex.

11. The method of claim 9, wherein the complex is a monovalent counterion complex.

12. The method of claim 11, wherein the complex is a lithium, sodium or potassium complex of the modified oligonucleotide.

13. The method of claim 1, wherein the modified oligonucleotide or complex thereof is administered to the subject in the form of a pharmaceutical composition, wherein the pharmaceutical composition comprises the modified oligonucleotide or complex thereof and a pharmaceutically acceptable carrier.

14. The method of claim 13, wherein the pharmaceutical composition is administered to the subject subcutaneously.

Description:

RELATED APPLICATION INFORMATION

[0001] This application is a divisional of U.S. Ser. No. 17/018,822, filed Sep. 11, 2020, which is a continuation-in-part of U.S. Ser. No. 16/676,929, filed Nov. 7, 2019, which claims priority to U.S. Ser. No. 62/757,632, filed Nov. 8, 2018; U.S. Ser. No. 62/855,323, filed May 31, 2019; and to U.S. Ser. No. 62/907,845, filed Sep. 30, 2019. Each of the foregoing is incorporated herein by reference in its entirety.

REFERENCE TO SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled ALIG008D1.TXT, which was created and last modified on Oct. 15, 2021 and is about 35 kilobytes in size. The information in the electronic Sequence Listing is hereby incorporated by reference in its entirety.

BACKGROUND

Field

[0003] This application relates to STOPS.TM. antiviral compounds that are S-antigen transport inhibiting oligonucleotide polymers, processes for making them and methods of using them to treat diseases and conditions.

Description

[0004] The STOPS.TM. compounds described herein are antiviral oligonucleotides that can be at least partially phosphorothioated and exert their antiviral activity by a non-sequence dependent mode of action. See A. Vaillant, "Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimization for the treatment of hepatitis B and hepatitis D infection", Antiviral Research 133, 32-40 (2016). The term "Nucleic Acid Polymer" (NAP) has been used in the literature to refer to such oligonucleotides, although that term does not necessarily connotate antiviral activity. A number of patent applications filed in the early 2000s disclosed the structures of certain specific compounds and identified various structural options as potential areas for future experimentation. See, e.g., U.S. Pat. Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385. These efforts resulted in the identification of the compound known to those skilled in the art as REP 2139, a phosphorothioated 40-mer having repeating adenosine-cytidine (AC) units with 5-methylation of all cytosines and 2'-O methyl modification of all riboses, along with the compound known as its clinical progenitor, REP 2055. See I. Roehl et al., "Nucleic Acid Polymers with Accelerated Plasma and Tissue Clearance for Chronic Hepatitis B Therapy", Molecular Therapy: Nucleic Acids Vol. 8, 1-12 (2017). The authors of that publication indicated that the structural features of these compounds had been optimized for the treatment of hepatitis B (HBV) and hepatitis D (HBD). See also A. Vaillant, "Nucleic acid polymers: Broad spectrum antiviral activity, antiviral mechanisms and optimization for the treatment of hepatitis B and hepatitis D infection", Antiviral Research 133 (2016) 32-40. According to these authors and related literature, such compounds preserve antiviral activity against HBV while preventing recognition by the innate immune response to allow their safe use with immunotherapies such as pegylated interferon. However, there remains a long-felt need for more effective compounds in this class.

SUMMARY

[0005] It has now been discovered that, contrary to the teachings in the art regarding the optimum combination of desirable structural features for antiviral compounds, significantly improved properties can be obtained by modifying them to provide STOPS.TM. compounds as described herein. For example, in some embodiments the sequence independent antiviral activity of the new STOPS.TM. compounds against HBV, as determined by HBsAg Secretion Assay, is greater than that of a reference compound. In view of the many years of research culminating in the art-recognized optimized structure of REP 2139, there had been little expectation by those skilled in the art that embodiments of the modified STOPS.TM. compounds described herein would be reasonably likely to display such improvements in potency. Thus, the structures of the new STOPS.TM. compounds and methods of using them to treat HBV and HBD are surprising and unexpected.

[0006] Some embodiments described herein relate to a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, that can include an at least partially phosphorothioated sequence of alternating A and C units, wherein:

[0007] the A units comprise one or more selected from:

##STR00001## ##STR00002## ##STR00003## ##STR00004##

[0008] the C units comprise one or more selected from

##STR00005## ##STR00006## ##STR00007## ##STR00008##

[0009] each terminal independently hydroxyl, an O,O-dihydrogen phosphorothioate, a dihydrogen phosphate, an endcap or a linking group;

[0010] each internal is a phosphorus-containing linkage to a neighboring A or C unit, the phosphorus-containing linkage being a phosphorothioate linkage or a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate, 5'-phosphoramidate, 3',5'-phosphordiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphordiamidate or diphosphodiester; and

[0011] the sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, is greater than that of a reference compound;

[0012] with the proviso that, when the sequence of alternating A and C units comprises a Ribo-A unit, the sequence further comprises at least one A unit that is not a Ribo-A unit; and

[0013] with the proviso that, when the sequence of alternating A and C units comprises a Ribo-C unit, the sequence further comprises at least one C unit that is not a Ribo-C unit.

[0014] Some embodiments described herein relate to a method of treating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a modified oligonucleotide modified oligonucleotide as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide as described herein.

[0015] Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide modified oligonucleotide as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide as described herein.

[0016] These are other embodiments are described in greater detail below

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1 illustrates an embodiment of a modified oligonucleotide that comprises a C.sub.2-6 alkylene linkage.

[0018] FIG. 2 illustrates an embodiment of a modified oligonucleotide that comprises a propylene oxide linkage.

[0019] FIG. 3A illustrates an embodiment of a modified oligonucleotide having cholesterol attached via a 5' tetraethylene glycol (TEG) linkage.

[0020] FIG. 3B illustrates an embodiment of a modified oligonucleotide having cholesterol attached via a 3' TEG linkage.

[0021] FIG. 3C illustrates an embodiment of a modified oligonucleotide having a tocopherol (Vitamin E) attached via a 5' TEG linkage.

[0022] FIG. 3D illustrates an embodiment of a modified oligonucleotide having a tocopherol (Vitamin E) attached via a 3' TEG linkage.

[0023] FIGS. 4A and 4B illustrate embodiments of modified oligonucleotides having GalNac attached via a linking group.

[0024] FIG. 5 illustrates an embodiment of a reaction scheme for preparing a 5'-EP building block.

[0025] FIG. 6A illustrates embodiments of modified oligonucleotides and corresponding values of sequence independent antiviral activity against hepatitis B (as determined by HBsAg Secretion Assay) and cytotoxicity.

[0026] FIG. 6B illustrates embodiments of modified oligonucleotides and corresponding values of sequence independent antiviral activity against hepatitis B (as determined by HBsAg Secretion Assay) and cytotoxicity.

[0027] FIG. 7 illustrates an embodiment of a reaction scheme for preparing compound 5'-VP.

[0028] FIG. 8 illustrates an embodiment of a reaction scheme for preparing compounds 8-5 and 8-6.

[0029] FIG. 9A illustrates an embodiment of a reaction scheme for preparing compound 9R.

[0030] FIG. 9B illustrates an embodiment of a reaction scheme for preparing compound 9S.

[0031] FIG. 10 illustrates an embodiment of a reaction scheme for preparing compounds 10-5 and 10-6.

[0032] FIG. 11A illustrates an embodiment of a reaction scheme for preparing compound 11R.

[0033] FIG. 11B illustrates an embodiment of a reaction scheme for preparing compound 11S.

[0034] FIG. 12 illustrates liver exposure results following subcutaneous administration to non-human primates of embodiments of modified oligonucleotide compounds.

[0035] FIG. 13 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0036] FIG. 14 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0037] FIG. 15 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0038] FIG. 16 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0039] FIG. 17 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0040] FIG. 18 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0041] FIG. 19 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0042] FIG. 20 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0043] FIG. 21 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0044] FIG. 22 illustrates PBMC assay results illustrating the immune reaction of embodiments of modified oligonucleotide compounds.

[0045] FIG. 23 illustrates a graph that is utilized in connection with the HBsAg Secretion Assays described in Examples B3 and B4.

DETAILED DESCRIPTION

Definitions

[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. In the event that there are a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.

[0047] The hepatitis B virus (HBV) is a DNA virus and a member of the Hepadnaviridae family. HBV infects more than 300 million worldwide and is a causative agent of liver cancer and liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. HBV can be acute and/or chronic. Acute HBV infection can be either asymptomatic or present with symptomatic acute hepatitis. HBV is classified into eight genotypes, A to H.

[0048] HBV is a partially double-stranded circular DNA of about 3.2 kilobase (kb) pairs. The HBV replication pathway has been studied in great detail. T. J. Liang, Heptaology (2009) 49(5 Supply: S13-S21. One part of replication includes the formation of the covalently closed circular (cccDNA) form. The presence of the cccDNA gives rise to the risk of viral reemergence throughout the life of the host organism. HBV carriers can transmit the disease for many years. An estimated 257 million people are living with hepatitis B virus infection, and it is estimated that over 750,000 people worldwide die of hepatitis B each year. In addition, immunosuppressed individuals or individuals undergoing chemotherapy are especially at risk for reactivation of an HBV infection.

[0049] HBV can be transmitted by blood, semen, and/or another body fluid. This can occur through direct blood-to-blood contact, unprotected sex, sharing of needles, and from an infected mother to her baby during the delivery process. The HBV surface antigen (HBsAg) is most frequently used to screen for the presence of this infection. Currently available medications do not cure an HBV and/or HDV infection. Rather, the medications suppress replication of the virus.

[0050] The hepatitis D virus (HDV) is a DNA virus, also in the Hepadnaviridae family of viruses. HDV can propagate only in the presence of HBV. The routes of transmission of HDV are similar to those for HBV. Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or in addition to chronic hepatitis B or hepatitis B carrier state (superinfection). Both superinfection and coinfection with HDV results in more severe complications compared to infection with HBV alone. These complications include a greater likelihood of experiencing liver failure in acute infections and a rapid progression to liver cirrhosis, with an increased risk of developing liver cancer in chronic infections. In combination with hepatitis B, hepatitis D has the highest fatality rate of all the hepatitis infections, at 20%. There is currently no cure or vaccine for hepatitis D.

[0051] As used herein in the context of oligonucleotides or other materials, the term "antiviral" has its usual meaning as understood by those skilled in the art and thus includes an effect of the presence of the oligonucleotides or other material that inhibits production of viral particles, typically by reducing the number of infectious viral particles formed in a system otherwise suitable for formation of infectious viral particles for at least one virus. In certain embodiments, the antiviral oligonucleotide has antiviral activity against multiple different virus, e.g., both HBV and HDV.

[0052] As used herein the term "oligonucleotide" (or "oligo") has its usual meaning as understood by those skilled in the art and thus refers to a class of compounds that includes oligodeoxynucleotides, oligodeoxyribonucleotides and oligoribonucleotides. Thus, "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof, including reference to oligonucleotides composed of naturally-occurring nucleobases, sugars and phosphodiester (PO) internucleoside (backbone) linkages as well as "modified" or substituted oligonucleotides having non-naturally-occurring portions which function similarly. Thus, the term "modified" (or "substituted") oligonucleotide has its usual meaning as understood by those skilled in the art and includes oligonucleotides having one or more of various modifications, e.g., stabilizing modifications, and thus can include at least one modification in the internucleoside linkage and/or on the ribose, and/or on the base. For example, a modified oligonucleotide can include modifications at the 2'-position of the ribose, acyclic nucleotide analogs, methylation of the base, phosphorothioated (PS) linkages, phosphorodithioate linkages, methylphosphonate linkages, linkages that connect to the sugar ring via sulfur or nitrogen, and/or other modifications as described elsewhere herein. Thus, a modified oligonucleotide can include one or more phosphorothioated (PS) linkages, instead of or in addition to PO linkages. Like unmodified oligonucleotides, modified oligonucleotides that include such PS linkages are considered to be in the same class of compounds because even though the PS linkage contains a phosphorous-sulfur double bond instead of the phosphorous-oxygen double bond of a PO linkage, both PS and PO linkages connect to the sugar rings through oxygen atoms.

[0053] As used herein in the context of modified oligonucleotides, the term "phosphorothioated" oligonucleotide has its usual meaning as understood by those skilled in the art and thus refers to a modified oligonucleotide in which all of the phosphodiester internucleoside linkages have been replaced by phosphorothioate linkages. Those skilled in the art thus understand that the term "phosphorothioated" oligonucleotide is synonymous with "fully phosphorothioated" oligonucleotide. A phosphorothioated oligonucleotide (or a sequence of phosphorothioated oligonucleotides within a partially phosphorothioated oligonucleotide) can be modified analogously, including (for example) by replacing one or more phosphorothioated internucleoside linkages by phosphodiester linkages. Thus, the term "modified phosphorothioated" oligonucleotide refers to a phosphorothioated oligonucleotide that has been modified in the manner analogous to that described herein with respect to oligonucleotides, e.g., by replacing a phosphorothioated linkage with a modified linkage such as phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate, 5'-phosphoramidate, 3',5'-phosphordiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphordiamidate or diphosphodiester. An at least partially phosphorothioated sequence of a modified oligonucleotide can be modified similarly, and thus, for example, can be modified to contain a non-phosphorothioated linkage such as phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate 5'-phosphoramidate, 3',5'-phosphordiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphordiamidate or diphosphodiester. In the context of describing modifications to a phosphorothioated oligonucleotide, or to an at least partially phosphorothioated sequence of a modified oligonucleotide, modification by inclusion of a phosphodiester linkage may be considered to result in a modified phosphorothioated oligonucleotide, or to a modified phosphorothioated sequence, respectively. Analogously, in the context of describing modifications to an oligonucleotide, or to an at least partially phosphodiesterified sequence of a modified oligonucleotide, the inclusion of a phosphorothioated linkage may be considered to result in a modified oligonucleotide or a modified phosphodiesterified sequence, respectively.

[0054] As used herein in the context of dinucleotides or oligonucleotides, the term "stereochemically defined phosphorothioate linkage" has its usual meaning as understood by those skilled in the art and thus refers to a phosphorothioate linkage having a phosphorus stereocenter with a selected chirality (R or S configuration). A composition containing such a dinucleotide or oligonucleotide can be enriched in molecules having the selected chirality. The stereopurity of such a composition can vary over a broad range, e.g. from about 51% to about 100% stereopure. In various embodiments, the stereopurity is greater than 55%, 65%, 75%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%; or in a range defined as having any two of the foregoing stereopurity values as endpoints.

[0055] The term "sequence independent" antiviral activity has its usual meaning as understood by those skilled in the art and thus refers to an antiviral activity of an oligonucleotide (e.g., a modified oligonucleotide) that is independent of the sequence of the oligonucleotide. Methods for determining whether the antiviral activity of an oligonucleotide is sequence independent are known to those skilled in the art and include the tests for determining if an oligonucleotide acts predominantly by a non-sequence complementary mode of action as disclosed in Example 10 of U.S. Pat. Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385, which is hereby incorporated herein by reference and particularly for the purpose of describing such tests.

[0056] In the context of describing modified oligonucleotides having sequence independent antiviral activity and comprising a sequence (e.g., an at least partially phosphorothioated sequence) of A and C units (e.g., alternating A and C units, or AC units), the terms "A" and "C" refer to the modified adenosine-containing (A) units and modified cystosine-containing (C) units set forth in Tables 1 and 2 below, respectively.

TABLE-US-00001 TABLE 1 "A" UNITS Abbreviation (A Unit) Structure (A Unit) 2'-OMe-A ##STR00009## 2'-O-MOE-A ##STR00010## LNA-A ##STR00011## LNA-A 2'-O-Propargyl-A ##STR00012## 2'-F-A ##STR00013## 2'-araF-A ##STR00014## 3'-OMe-A ##STR00015## UNA-A ##STR00016## 2'-NH.sub.2-A ##STR00017## GNA-A ##STR00018## ENA-A ##STR00019## 2'-O-Butynyl-A ##STR00020## scp-BNA-A ##STR00021## AmNA(NMe)-A ##STR00022## nmLNA-A ##STR00023## 4etl-A ##STR00024## Ribo-A ##STR00025##

TABLE-US-00002 TABLE 2 "C" UNITS Abbreviation (C Unit) Structure (C Unit) 2'-OMe-(5m)C ##STR00026## 2'-O-MOE-(5m)C ##STR00027## LNA-(5m)C ##STR00028## LNA-5mC 2'-O-Propargyl-(5m)C ##STR00029## 2'-F-(5m)C ##STR00030## 2'-araF-(5m)C ##STR00031## 3'-OMe-(5m)C ##STR00032## UNA-(5m)C ##STR00033## 2'-NH.sub.2-(5m)C ##STR00034## GNA-(5m)C ##STR00035## ENA-(5m)C ##STR00036## 2'-O-Butynyl-(5m)C ##STR00037## scp-BNA-(5m)C ##STR00038## AmNA-(NMe)-(5m)C ##STR00039## 4etl-(5m)C ##STR00040## nmLNA-(5m)C ##STR00041## Ribo-C ##STR00042## Ribo-(5m)C ##STR00043##

[0057] Modified Oligonucleotide Compounds

[0058] An embodiment provides a STOPS.TM. modified oligonucleotide compound having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units, wherein the A units are any one or more selected from those set forth in Table 1 and the C units are any one or more selected from those set forth in Table 2. Various combinations of A and C units can be included in the at least partially phosphorothioated AC sequence, including the combinations described in Table 3 below.

TABLE-US-00003 TABLE 3 EXAMPLES OF AC UNITS No. A Unit C Unit 1 2'-OMe-A 2'-OMe-(5m)C 2 2'-OMe-A 2'-O-MOE-(5m)C 3 2'-OMe-A LNA-(5m)C 4 2'-OMe-A ENA-(5m)C 5 2'-OMe-A scp-BNA-(5m)C 6 2'-OMe-A AmNA-(NMe)-(5m)C 7 2'-OMe-A 2'-O-Propargyl-(5m)C 8 2'-OMe-A 2'-O-Butynyl-(5m)C 9 2'-OMe-A 2'-F-(5m)C 10 2'-OMe-A 2'-araF-(5m)C 11 2'-OMe-A 3'-OMe-(5m)C 12 2'-OMe-A UNA-(5m)C 13 2'-OMe-A 2'-NH.sub.2-(5m)C 14 2'-OMe-A GNA-(5m)C 15 2'-OMe-A 4etl-(5m)C 16 2'-OMe-A nmLNA-(5m)C 17 2'-O-MOE-A 2'-OMe-(5m)C 18 2'-O-MOE-A 2'-O-MOE-(5m)C 19 2'-O-MOE-A LNA-(5m)C 20 2'-O-MOE-A ENA-(5m)C 21 2'-O-MOE-A scp-BNA-(5m)C 22 2'-O-MOE-A AmNA-(NMe)-(5m)C 23 2'-O-MOE-A 2'-O-Propargyl-(5m)C 24 2'-O-MOE-A 2'-O-Butynyl-(5m)C 25 2'-O-MOE-A 2'-F-(5m)C 26 2'-O-MOE-A 2'-araF-(5m)C 27 2'-O-MOE-A 3'-OMe-(5m)C 28 2'-O-MOE-A UNA-(5m)C 29 2'-O-MOE-A 2'-NH.sub.2-(5m)C 30 2'- O-MOE-A GNA-(5m)C 31 2'-O-MOE-A 4etl-(5m)C 32 2'-O-MOE-A nmLNA-(5m)C 33 LNA-A 2'-OMe-(5m)C 34 LNA-A 2'-O-MOE-(5m)C 35 LNA-A LNA-(5m)C 36 LNA-A ENA-(5m)C 37 LNA-A scp-BNA-(5m)C 38 LNA-A AmNA-(NMe)-(5m)C 39 LNA-A 2'-O-Propargyl-(5m)C 40 LNA-A 2'-O-Butynyl-(5m)C 41 LNA-A 2'-F-(5m)C 42 LNA-A 2'-araF-(5m)C 43 LNA-A 3'-OMe-(5m)C 44 LNA-A UNA-(5m)C 45 LNA-A 2'-NH.sub.2-(5m)C 46 LNA-A GNA-(5m)C 47 LNA-A 4etl-(5m)C 48 LNA-A nmLNA-(5m)C 49 ENA-A 2'-OMe-(5m)C 50 ENA-A 2'- O-MOE-(5m)C 51 ENA-A LNA-(5m)C 52 ENA-A ENA-(5m)C 53 ENA-A scp-BNA-(5m)C 54 ENA-A AmNA-(NMe)-(5m)C 55 ENA-A 2'-O-Propargyl-(5m)C 56 ENA-A 2'-O-Butynyl-(5m)C 57 ENA-A 2'-F-(5m)C 58 ENA-A 2'-araF-(5m)C 59 ENA-A 3'-OMe-(5m)C 60 ENA-A UNA-(5m)C 61 ENA-A 2'-NH.sub.2-(5m)C 62 ENA-A GNA-(5m)C 63 ENA-A 4etl-(5m)C 64 ENA-A nmLNA-(5m)C 65 scp-BNA-A 2'-OMe-(5m)C 66 scp-BNA-A 2'- O-MOE-(5m)C 67 scp-BNA-A LNA-(5m)C 68 scp-BNA-A ENA-(5m)C 69 scp-BNA-A scp-BNA-(5m)C 70 scp-BNA-A AmNA-(NMe)-(5m)C 71 scp-BNA-A 2'-O-Propargyl-(5m)C 72 scp-BNA-A 2'-O-Butynyl-(5m)C 73 scp-BNA-A 2'-F-(5m)C 74 scp-BNA-A 2'-araF-(5m)C 75 scp-BNA-A 3'-OMe-(5m)C 76 scp-BNA-A UNA-(5m)C 77 scp-BNA-A 2'-NH.sub.2-(5m)C 78 scp-BNA-A GNA-(5m)C 79 scp-BNA-A 4etl-(5m)C 80 scp-BNA-A nmLNA-(5m)C 81 AmNA(N-Me)-A 2'-OMe-(5m)C 82 AmNA(N-Me)-A 2'- O-MOE-(5m)C 83 AmNA(N-Me)-A LNA-(5m)C 84 AmNA(N-Me)-A ENA-(5m)C 85 AmNA(N-Me)-A scp-BNA-(5m)C 86 AmNA(N-Me)-A AmNA-(NMe)-(5m)C 87 AmNA(N-Me)-A 2'-O-Propargyl-(5m)C 88 AmNA(N-Me)-A 2'-O-Butynyl-(5m)C 89 AmNA(N-Me)-A 2'-F-(5m)C 90 AmNA(N-Me)-A 2'-ara-F-(5m)C 91 AmNA(N-Me)-A 3'-OMe-(5m)C 92 AmNA(N-Me)-A UNA-(5m)C 93 AmNA(N-Me)-A 2'-NH.sub.2-(5m)C 94 AmNA(N-Me)-A GNA-(5m)C 95 AmNA(N-Me)-A 4etl-(5m)C 96 AmNA(N-Me)-A nmLNA-(5m)C 97 2'-O-Propargyl-A 2'-OMe-(5m)C 98 2'-O-Propargyl-A 2'- O-MOE-(5m)C 99 2'-O-Propargyl-A LNA-(5m)C 100 2'-O-Propargyl-A ENA-(5m)C 101 2'-O-Propargyl-A scp-BNA-(5m)C 102 2'-O-Propargyl-A AmNA-(NMe)-(5m)C 103 2'-O-Propargyl-A 2'-O-Propargyl-(5m)C 104 2'-O-Propargyl-A 2'-O-Butyne-(5m)C 105 2'-O-Propargyl-A 2'-F-(5m)C 106 2'-O-Propargyl-A 2'-araF-(5m)C 107 2'-O-Propargyl-A 3'-OMe-(5m)C 108 2'-O-Propargyl-A UNA-(5m)C 109 2'-O-Propargyl-A 2'-NH.sub.2-(5m)C 110 2'-O-Propargyl-A GNA-(5m)C 111 2'-O-Propargyl-A 4etl-(5m)C 112 2'-O-Propargyl-A nmLNA-(5m)C 113 2'-O-Butynyl-A 2'-OMe-(5m)C 114 2'-O-Butynyl-A 2'- O-MOE-(5m)C 115 2'-O-Butynyl-A LNA-(5m)C 116 2'-O-Butynyl-A ENA-(5m)C 117 2'-O-Butynyl-A scp-BNA-(5m)C 118 2'-O-Butynyl-A AmNA-(NMe)-(5m)C 119 2'-O-Butynyl-A 2'-O-Propargyl-(5m)C 120 2'-O-Butynyl-A 2'-O-Butynyl-(5m)C 121 2'-O-Butynyl-A 2'-F-(5m)C 122 2'-O-Butynyl-A 2'-araF-(5m)C 123 2'-O-Butynyl-A 3'-OMe-(5m)C 124 2'-O-Butynyl-A UNA-(5m)C 125 2'-O-Butynyl-A 2'-NH.sub.2-(5m)C 126 2'-O-Butynyl-A GNA-(5m)C 127 2'-O-Butynyl-A 4etl-(5m)C 128 2'-O-Butynyl-A nmLNA-(5m)C 129 2'-F A 2'-OMe-(5m)C 130 2'-F A 2'- O-MOE-(5m)C 131 2'-F A LNA-(5m)C 132 2'-F A ENA-(5m)C 133 2'-F A scp-BNA-(5m)C 134 2'-F A AmNA-(NMe)-(5m)C 135 2'-F A 2'-O-Propargyl-(5m)C 136 2'-F A 2'-O-Butynyl-(5m)C 137 2'-F A 2'-F-(5m)C 138 2'-F A 2'-ara-F-(5m)C 139 2'-F A 3'-OMe-(5m)C 140 2'-F A UNA-(5m)C 141 2'-F A 2'-NH.sub.2-(5m)C 142 2'-F A GNA-(5m)C 143 2'-F A 4etl-(5m)C 144 2'-F A nmLNA-(5m)C 145 2'-araF A 2'-OMe-(5m)C 146 2'-araF A 2'- O-MOE-(5m)C 147 2'-araF A LNA-(5m)C 148 2'-araF A ENA-(5m)C 149 2'-araF A scp-BNA-(5m)C 150 2'-araF A AmNA-(NMe)-(5m)C 151 2'-araF A 2'-O-Propargyl-(5m)C 152 2'-araF A 2'-O-Butynyl-(5m)C 153 2'-araF A 2'-F-(5m)C 154 2'-araF A 2'-araF-(5m)C 155 2'-araF A 3'-OMe-(5m)C 159 2'-araF A UNA-(5m)C 157 2'-araF A 2'-NH.sub.2-(5m)C 158 2'-araF A GNA-(5m)C 159 2'-araF A 4etl-(5m)C 160 2'-araF A nmLNA-(5m)C 161 3'-OMe-A 2'-OMe-(5m)C 162 3'-OMe-A 2'-O-MOE-(5m)C 163 3'-OMe-A LNA-(5m)C 164 3'-OMe-A ENA-(5m)C 165 3'-OMe-A scp-BNA-(5m)C 166 3'-OMe-A AmNA-(NMe)-(5m)C 167 3'-OMe-A 2'-O-Propargyl-(5m)C 168 3'-OMe-A 2'-O-Butynyl-(5m)C 169 3'-OMe-A 2'-F-(5m)C 170 3'-OMe-A 2'-ara-F-(5m)C 171 3'-OMe-A 3'-OMe-(5m)C 172 3'-OMe-A UNA-(5m)C 173 3'-OMe-A 2'-NH.sub.2-(5m)C 174 3'-OMe-A GNA-(5m)C 175 3'-OMe-A 4etl-(5m)C 176 3'-OMe-A nmLNA-(5m)C 177 UNA-A 2'-OMe-(5m)C 178 UNA-A 2'-O-MOE-(5m)C 179 UNA-A LNA-(5m)C 180 UNA-A ENA-(5m)C 181 UNA-A scp-BNA-(5m)C 182 UNA-A AmNA-(NMe)-(5m)C 183 UNA-A 2'-O-Propargyl-(5m)C 184 UNA-A 2'-O-Butynyl-(5m)C 185 UNA-A 2'-F-(5m)C 186 UNA-A 2'-araF-(5m)C 187 UNA-A 3'-OMe-(5m)C 188 UNA-A UNA-(5m)C 189 UNA-A 2'-NH.sub.2-(5m)C 190 UNA-A GNA-(5m)C 191 UNA-A 4etl-(5m)C 192 UNA-A nmLNA-(5m)C 193 2'-NH.sub.2-A 2'-OMe-(5m)C 194 2'-NH.sub.2-A 2'-O-MOE-(5m)C 195 2'-NH.sub.2-A LNA-(5m)C 196 2'-NH.sub.2-A ENA-(5m)C 197 2'-NH.sub.2-A scp-BNA-(5m)C 198 2'-NH.sub.2-A AmNA-(NMe)-(5m)C 199 2'-NH.sub.2-A 2'-O-Propargyl-(5m)C 200 2'-NH.sub.2-A 2'-O-Butynyl-(5m)C 201 2'-NH.sub.2-A 2'-F-(5m)C 202 2'-NH.sub.2-A 2'-ara-F-(5m)C 203 2'-NH.sub.2-A 3'-OMe-(5m)C 204 2'-NH.sub.2-A UNA-(5m)C 205 2'-NH.sub.2-A 2'-NH.sub.2-(5m)C 206 2'-NH.sub.2-A GNA-(5m)C 207 2'-NH.sub.2-A 4etl-(5m)C 208 2'-NH.sub.2-A nmLNA-(5m)C 209 GNA-A 2'-OMe-(5m)C 210 GNA-A 2'-O-MOE-(5m)C 211 GNA-A LNA-(5m)C 212 GNA-A ENA-(5m)C 213 GNA-A scp-BNA-(5m)C 214 GNA-A AmNA-(NMe)-(5m)C 215 GNA-A 2'-O-Propargyl-(5m)C 216 GNA-A 2'-O-Butynyl-(5m)C 217 GNA-A 2'-F-(5m)C 218 GNA-A 2'-ara-F-(5m)C 219 GNA-A 3'-OMe-(5m)C 220 GNA-A UNA-(5m)C 221 GNA-A 2'-NH.sub.2-(5m)C 222 GNA-A GNA-(5m)C 223 GNA-A 4etl-(5m)C 224 GNA-A nmLNA-(5m)C 225 nmLNA-A 2'-OMe-(5m)C 226 nmLNA-A 2'-O-MOE-(5m)C 227 nmLNA-A LNA-(5m)C 228 nmLNA-A ENA-(5m)C 229 nmLNA-A scp-BNA-(5m)C 230 nmLNA-A AmNA-(NMe)-(5m)C 231 nmLNA-A 2'-O-Propargyl-(5m)C 232 nmLNA-A 2'-O-Butynyl-(5m)C 233 nmLNA-A 2'-F-(5m)C 234 nmLNA-A 2'-ara-F-(5m)C 235 nmLNA-A 3'-OMe-(5m)C 236 nmLNA-A UNA-(5m)C 237 nmLNA-A 2'-NH.sub.2-(5m)C 238 nmLNA-A GNA-(5m)C 239 nmLNA-A 4etl-(5m)C 240 nmLNA-A nmLNA-(5m)C 241 4etl-A 2'-OMe-(5m)C 242 4etl-A 2'-O-MOE-(5m)C 243 4etl-A LNA-(5m)C 244 4etl-A ENA-(5m)C 245 4etl-A scp-BNA-(5m)C

246 4etl-A AmNA-(NMe)-(5m)C 247 4etl-A 2'-O-Propargyl-(5m)C 248 4etl-A 2'-O-Butynyl-(5m)C 249 4etl-A 2'-F-(5m)C 250 4etl-A 2'-ara-F-(5m)C 251 4etl-A 3'-OMe-(5m)C 252 4etl-A UNA-(5m)C 253 4etl-A 2'-NH.sub.2-(5m)C 254 4etl-A GNA-(5m)C 255 4etl-A 4etl-(5m)C 256 4etl-A nmLNA-(5m)C

[0059] The length of a modified oligonucleotide as described herein can vary over a broad range. In various embodiments, a modified oligonucleotide as described herein comprises an at least partially phosphorothioated sequence of alternating A and C units that has a sequence length of about 8 units, about 10 units, about 12 units, about 14 units, about 16 units, about 18 units, about 20 units, about 24 units, about 30 units, about 34 units, about 36 units, about 38 units, about 40 units, about 44 units, about 50 units, about 60 units, about 76 units, about 100 units, about 122 units, about 124 units, about 150 units, about 172 units, about 200 units, or a sequence length in a range between any two of the aforementioned values. For example, in an embodiment, the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 8 units to 200 units. In another embodiment, the at least partially phosphorothioated sequence of alternating A and C units has a sequence length that is in any one or more (as applicable) of the following ranges: about 8 units to about 36 units; about 16 units to about 36 units; 20 units to 36 units; 16 units to 30 units; 18 units to 60 units; 20 units to 30 units; 30 units to 50 units; 34 units to 46 units, 36 units to 44 units; 44 units to 200 units; 44 units to 150 units; 44 units to 120 units; 50 units to 200 units; 50 units to 150 units; 50 units to 120 units; 60 units to 200 units; 60 units to 150 units; and/or 60 units to 120 units.

[0060] As described elsewhere herein, a modified oligonucleotide can comprise a single at least partially phosphorothioated sequence of alternating A and C units in some embodiments, or in other embodiments the modified oligonucleotide can comprise a plurality of at least partially phosphorothioated sequences of alternating A and C units that are linked together. Thus, a modified oligonucleotide that contains a single at least partially phosphorothioated sequence of alternating A and C units can have the same sequence length as that sequence. Examples of such sequence lengths are described elsewhere herein. Similarly, a modified oligonucleotide that contains a plurality of at least partially phosphorothioated sequences of alternating A and C units can have sequence length that is the result of linking those sequences as described elsewhere herein. Examples of sequence lengths for a modified oligonucleotide that contains a plurality of at least partially phosphorothioated sequences of alternating A and C units are expressed elsewhere herein in terms of the lengths of the individual sequences, and also taking into account the length of the linking group.

[0061] A modified oligonucleotide as described herein can comprises a plurality of at least partially phosphorothioated sequences of alternating A and C units. In an embodiment, when the sequence of alternating A and C units comprises a Ribo-A unit, the sequence further comprises at least one A unit that is not a Ribo-A unit. Similarly, in an embodiment, when the sequence of alternating A and C units comprises a Ribo-C unit, the sequence further comprises at least one C unit that is not a Ribo-C unit. In an embodiment, the modified oligonucleotide can contain one or more of various nucleotide units (known to those skilled in the art, e.g., thymine, cytosine, adenine, guanine and modified versions thereof) that are not A or C units, e.g., as an end group(s) and/or as a linking group(s) between two or more at least partially phosphorothioated sequences of alternating A and C units. For example, in an embodiment, the modified oligonucleotide comprises one or more cytosine units that link together at least two or more of the at least partially phosphorothioated sequences of alternating A and C units. In an embodiment, the two or more at least partially phosphorothioated sequences of alternating A and C units, which are linked together by a non-A/non-C linking group, are identical to one another. An example of such a modified oligonucleotide is (AC).sub.8-cytosine-(AC).sub.8. Such a modified oligonucleotide that comprises a plurality of identical sequences that are joined together may be referred to herein as a concatemer. The two or more at least partially phosphorothioated sequences of alternating A and C units that are linked together can also be different from one another. An example of such a modified oligonucleotide is (AC).sub.8-cytosine-(AC).sub.16.

[0062] The modified oligonucleotide can contain two or more different A groups and/or two or more different C groups. When an A or C group is replaced by a different A or C group, such a replacement is not ordinarily considered to interrupt the alternating sequence of A and C units. For example, in an embodiment, at least some of the A units are not 2' O-methylated on the ribose ring and/or at least some of the C units are not 2'O-methylated on the ribose ring. However, in some embodiments the group linking the two at least partially phosphorothioated sequences of alternating A and C units is itself an A or C unit that interrupts the alternating sequence of A and C units. For example, an at least partially phosphorothioated 16-mer of alternating A and C units may be linked by an A unit to another such 16-mer to form (AC).sub.8-A-(AC).sub.8. Similarly, such a 16-mer may be linked by a C unit to another such 16-mer to form (AC).sub.8-C-(AC).sub.8. As noted above, when a plurality of at least partially phosphorothioated sequences of alternating A and C units that are identical to one another are joined together by a linking group, the modified oligonucleotide may be referred to herein as a concatemer. As noted above, the two or more at least partially phosphorothioated sequences of alternating A and C units that are linked together can also be different from one another. Examples of such modified oligonucleotides include (AC).sub.8-A-(AC).sub.16 and (AC).sub.8--C-(AC).sub.16.

[0063] In an embodiment, the modified oligonucleotide comprises a 5' endcap. In various embodiments, the 5' endcap is selected from

##STR00044##

In an embodiment, R.sup.1 and R.sup.2 are each individually selected from hydrogen, deuterium, phosphate, thioC.sub.1-6alkyl, and cyano. For example, in an embodiment, R.sup.1 and R.sup.2 are both hydrogen and the modified oligonucleotide comprises a vinyl phosphonate endcap. In other embodiments, R.sup.1 and R.sup.2 are not both hydrogen. In some embodiments, the 5' endcap is selected from

##STR00045##

[0064] In other embodiments, the modified oligonucleotide comprises a 3' and/or 5' linking group. For example, with respect to modified oligonucleotide compounds comprising A and C units as described herein, such as the A and C units of Tables 1 and 2, respectively, at least one terminal can be a linking group. Various linking groups known to those skilled in the art can be used to link the modified oligonucleotide to another moiety (such as one or more second oligonucleotides and/or targeting ligands). In an embodiment, the linking group comprises a non-A/non-C linking group or an A or C unit that interrupts the alternating sequence of A and C units as discussed above, or the linking group comprises a C.sub.2-6alkylene linkage (FIG. 1), a C.sub.2-6alkylene oxide linkage, such as a propylene oxide linkage (FIG. 2), or a tetraethylene glycol (TEG) linkage (FIGS. 3A-D).

[0065] In various embodiments, two, three, four or more of the modified oligonucleotides can be connected to each other in various ways. For example, the modified oligonucleotides can be connected end-to-end via 3' and/or 5' linking groups, and/or a linking group can be connected to a one 3' or 5' end of multiple modified oligonucleotides, e.g., as illustrated in FIGS. 1 and 2.

[0066] In various embodiments, the modified oligonucleotide further comprises a targeting ligand that is attached to the modified oligonucleotide via the linking group. For example, in various embodiments the targeting ligand is, or comprises, a N-acetylgalactosamine (GalNac) (e.g., triantennary-GalNAc), a tocopherol or cholesterol. FIGS. 3A and 3B illustrate embodiments of modified oligonucleotides having cholesterol attached via a 5' TEG linking group and a 3'TEG linking group, respectively. FIGS. 3C and 3D illustrate embodiments of modified oligonucleotides having a tocopherol (Vitamin E) attached via a 5' TEG linking group and a 3'TEG linking group, respectively. FIGS. 4A and 4B illustrate embodiments of modified oligonucleotides having GalNac attached via a linking group. In an embodiment, the GalNac is a triantennary GalNac.

[0067] In various embodiments, the at least partially phosphorothioated sequence of alternating A and C units can include modification(s) to one or more phosphorothioated linkages. The inclusion of such a modified linkage is not ordinarily considered to interrupt the alternating sequence of A and C units because those skilled in the art understand that such a sequence may be only partially phosphorothioated and thus may comprise one or more modifications to a phosphorothioate linkage. In various embodiments, the modification to the phosphorothioate linkage is a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate and diphosphodiester. For example, in an embodiment, the modified linkage is a phosphodiester linkage.

[0068] In various embodiments, the at least partially phosphorothioated sequence of alternating A and C units can have various degrees of phosphorothioation. For example, in an embodiment, the at least partially phosphorothioated sequence of alternating A and C units is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% phosphorothioated. In an embodiment, the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated. In an embodiment, the at least partially phosphorothioated sequence of alternating A and C units is fully phosphorothioated.

[0069] In various embodiments, the at least partially phosphorothioated sequence of alternating A and C units can include stereochemical modification(s) to one or more phosphorothioated linkages. In an embodiment, the modified oligonucleotides described herein can comprise at least one stereochemically defined phosphorothioate linkage. In various embodiments, the stereochemically defined phosphorothioate linkage has an R configuration. In various embodiments, the stereochemically defined phosphorothioate linkage has an S configuration.

[0070] Those skilled in the art will recognize that modified oligonucleotide compounds comprising A and C units as described herein, such as the A and C units of Tables 1 and 2, respectively, contain internal linkages between the A and C units as well as terminal groups at the 3' and 5' ends. Thus, with respect to the A and C units described herein, such as the A and C units of Tables 1 and 2, respectively, each represents an internal or a terminal . In various embodiments, each terminal is independently hydroxyl, an O,O-dihydrogen phosphorothioate, a dihydrogen phosphate, an endcap or a linking group. In various embodiments, each internal is a phosphorus-containing linkage to a neighboring A or C unit, the phosphorus-containing linkage being a phosphorothioate linkage or a modified linkage selected from phosphodiester, phosphorodithioate, methylphosphonate, diphosphorothioate 5'-phosphoramidate, 3',5'-phosphordiamidate, 5'-thiophosphoramidate, 3',5'-thiophosphordiamidate or diphosphodiester.

[0071] As noted above, the STOPS.TM. compounds described herein are antiviral oligonucleotides. In various embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, has sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is greater than that of a reference compound. For example, in an embodiment, the sequence independent antiviral activity against hepatitis B is at least 2-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 2-fold greater than a reference compound to 5-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at least 5-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 5-fold greater than a reference compound to 10-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at least 10-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is in the range of from 10-fold greater than a reference compound to 25-fold greater than a reference compound. In another embodiment, the sequence independent antiviral activity against hepatitis B is at least 25-fold greater than a reference compound. In this context, the aforementioned terms 2-fold, 5-fold, 10-fold and 25-fold refer to the increased potency of a modified oligonucleotide as described herein as compared to another compound in HBsAg Secretion Assay, as indicated by an EC.sub.50 value that is one-half, one-fifth, one-tenth or one-twenty-fifth that of a reference compound, respectively. For example, a modified oligonucleotide having a potency that is two-fold greater than a reference compound has an EC.sub.50 value in HBsAg Secretion Assay that is one-half that of the EC.sub.50 value of a reference compound. Likewise, a modified oligonucleotide having a potency that is five-fold greater than a reference compound has an EC.sub.50 value in HBsAg Secretion Assay that is one-fifth that of a reference compound. Similarly, a modified oligonucleotide having a potency that is ten-fold greater than a reference compound has an EC.sub.50 value in HBsAg Secretion Assay that is one-tenth that of a reference compound. Likewise, a modified oligonucleotide having a potency that is twentyfive-fold greater than a reference compound has an EC.sub.50 value in HBsAg Secretion Assay that is one-twenty-fifth that of a reference compound. In some embodiments, the reference compound can be the phosphorothioated AC 40-mer oligonucleotide known as REP 2139 discussed above. In some embodiments, the reference compound can be the AC 40-mer oligonucleotide having the structure 5' mApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsm CpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmApsmCpsmAps mCpsmApsmCpsmApsmCpsmApsmCpsmApsmC 3' (2'-OMe-A, 2'-OMe-C).

[0072] In various embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, has sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nanomolar (nM); in a "B" activity range of 30 nM to less than 100 nM; in a "C" activity range of 100 nM to less than 300 nM; or in a "D" activity range of greater than 300 nM. In some embodiments, a modified oligonucleotide as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, has sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is less than 50 nM.

[0073] The modified oligonucleotides described herein can be prepared in the form of various complexes. Thus, an embodiment provides a chelate complex of a modified oligonucleotide as described herein. For example, in an embodiment such a chelate complex comprises a calcium, magnesium or zinc chelate complex of the modified oligonucleotide. The modified oligonucleotides described herein can also be prepared in the form of various monovalent counterion complexes. For example, in an embodiment such a counterion complex comprises a lithium, sodium or potassium complex of the modified oligonucleotide.

[0074] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;

[0075] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;

[0076] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;

[0077] the A units comprise at least 12 2'-OMe-A units (e.g., at least 15 2'-OMe-A units) and at least 1 Ribo-A unit (e.g., at least 2 Ribo-A units);

[0078] the C units comprise at least 15 LNA-5mC units; and

[0079] the modified oligonucleotide has an EC.sub.50 value, as determined by HBsAg Secretion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).

[0080] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;

[0081] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;

[0082] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;

[0083] the A units comprise at least 15 2'-OMe-A units;

[0084] the C units comprise at least 7 LNA-5mC units; and

[0085] the modified oligonucleotide has an EC.sub.50 value, as determined by HBsAg Secretion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).

[0086] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;

[0087] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;

[0088] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;

[0089] the A units comprise at least 15 2'-OMe-A units;

[0090] the C units comprise at least 3 LNA-5mC units; and

[0091] the modified oligonucleotide has an EC.sub.50 value, as determined by HBsAg Secretion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).

[0092] An embodiment provides a modified oligonucleotide or complex thereof having sequence independent antiviral activity against hepatitis B, comprising an at least partially phosphorothioated sequence of alternating A and C units as described herein, wherein;

[0093] the at least partially phosphorothioated sequence of alternating A and C units is at least 85% phosphorothioated;

[0094] the at least partially phosphorothioated sequence of alternating A and C units has a sequence length in the range of 36 units to 44 units;

[0095] the A units comprise at least 18 2'-OMe-A units;

[0096] the C units comprise at least 15 LNA-5mC units; and

[0097] the modified oligonucleotide has an EC.sub.50 value, as determined by HBsAg Secretion Assay, that is less than 100 nM (e.g., less than 50 nM or less than 30 nM).

Synthesis

[0098] The modified oligonucleotides described herein can be prepared in various ways. In an embodiment, the building block monomers described in Tables 4 and 5 are employed to make the modified oligonucleotides described herein by applying standard phosphoramidite chemistry. The building blocks described in Tables 4 and 5 and other building block phosphoramidite monomers can be prepared by known methods or obtained from commercial sources (Thermo Fischer Scientific US, Hongene Biotechnology USA Inc., Chemgenes Corporation). Exemplary procedures for making modified oligonucleotides are set forth in the Examples below.

TABLE-US-00004 TABLE 4 BUILDING BLOCKS FOR "A" UNITS Abbreviation Structure 2'-OMe-A PHOSPHORAMIDITE ##STR00046## 2'-F-A PHOSPHORAMIDITE ##STR00047## 2'-O-MOE-A PHOSPHORAMIDITE ##STR00048## LNA-A PHOSPHORAMIDITE ##STR00049## ENA-A PHOSPHORAMIDITE ##STR00050## 2'-O-Butyne-A PHOSPHORAMIDITE ##STR00051## 2'-NH.sub.2-A PHOSPHORAMIDITE ##STR00052## 2'-F-Ara-A PHOSPHORAMIDITE ##STR00053## 2'-O-Propargyl-A PHOSPHORAMIDITE ##STR00054## UNA-A PHOSPHORAMIDITE ##STR00055## GNA-A PHOSPHORAMIDITE ##STR00056## 3'-O-Methyl-A PHOSPHORAMIDITE ##STR00057## scp-BNA-A PHOSPHORAMIDITE ##STR00058## AmNA-(N--Me)-A PHOSPHORAMIDITE ##STR00059## nmLNA-A PHOSPHORAMIDITE ##STR00060## 4etl-A PHOSPHORAMIDITE ##STR00061## Ribo-A PHOSPHORAMIDITE ##STR00062##

TABLE-US-00005 TABLE 5 BUILDING BLOCKS FOR "C" UNITS Abbreviation Structure 2'-OMe-(5m)C PHOSPHOR- AMIDITE ##STR00063## 2'-F-(5m)C PHOSPHOR- AMIDITE ##STR00064## 2'-O-MOE- (5m)C PHOSPHOR- AMIDITE ##STR00065## LNA-(5m)C PHOSPHOR- AMIDITE ##STR00066## ENA-(5m)C PHOSPHOR- AMIDITE ##STR00067## 2'-O-Butyne- (5m)C PHOSPHOR- AMIDITE ##STR00068## 2'-NH.sub.2-(5m)C PHOSPHOR- AMIDITE ##STR00069## 2'-F-Ara-(5m)C PHOSPHOR- AMIDITE ##STR00070## 2'-O-Propargyl- (5m)C PHOSPHOR- AMIDITE ##STR00071## UNA-(5m)C PHOSPHOR- AMIDITE ##STR00072## GNA-(5m)C PHOSPHOR- AMIDITE ##STR00073## 3'-O-Methyl- (5m)C PHOSPHOR- AMIDITE ##STR00074## scp-BNA-(5m)C PHOSPHOR- AMIDITE ##STR00075## AmNA-(NMe)- (5m)C PHOSPHOR- AMIDITE ##STR00076## 4etl-(5m)C PHOSPHOR- AMIDITE ##STR00077## nmLNA-(5m)C PHOSPHOR- AMIDITE ##STR00078## Ribo-C PHOSPHOR- AMIDITE ##STR00079## Ribo-(5m)C PHOSPHOR- AMIDITE ##STR00080##

[0099] In various embodiments, the STOPS.TM. modified oligonucleotides described herein can also be prepared using dinucleotides that comprise or consist of any two of the building block monomers described in Tables 4 and 5. Exemplary procedures for making dinucleotides and the corresponding modified oligonucleotides are set forth in the Examples below.

[0100] An embodiment provides a dinucleotide comprising, or consisting of, an A unit and a C unit connected by a stereochemically defined phosphorothioate linkage, wherein the A unit is selected from any of the building block monomers described in Table 4 and the C unit is selected from any of the building block monomers described in Table 5, and wherein each is independently hydroxyl, an O,O-dihydrogen phosphorothioate, an O,O-dihydrogen phosphate, a phosphoramidite, a dimethoxytrityl ether, or the stereochemically defined phosphorothioate linkage. In an embodiment, the is a phosphoramidite of the following formula (A):

##STR00081##

[0101] In various embodiments R.sup.1 and R.sup.2 of formula (A) are each individually a C.sub.1-6 alkyl, and R.sup.3 is a C.sub.1-6 alkyl or a cyanoC.sub.1-6 alkyl. For example, in an embodiment the phosphoramidite of the formula (A) is a phosphoramidite of the following formula (A1):

##STR00082##

[0102] In another embodiment, the is a stereochemically defined phosphorothioate linkage that is a phosphorothioate. For example, in an embodiment, the stereochemically defined phosphorothioate linkage is a phosphorothioate of the following Formula (B1) or (B2):

##STR00083##

[0103] In various embodiments R.sup.4 of formulae (B1) and (B2) is a C.sub.1-6 alkyl or a cyanoC.sub.1-6 alkyl. For example, in an embodiment, the phosphorothioates of the formulae (B1) and (B2) are phosphorothioates of the following Formulae (B3) or (B4), respectively:

##STR00084##

[0104] Various embodiments provide methods of making a modified oligonucleotide as described herein, comprising coupling one or more dinucleotides as described herein. Exemplary methods of carrying out such coupling are illustrated in the Examples below.

Pharmaceutical Compositions

[0105] Some embodiments described herein relate to a pharmaceutical composition, that can include an effective amount of a compound described herein (e.g., a STOPS.TM. modified oligonucleotide compound or complex thereof as described herein) and a pharmaceutically acceptable carrier, excipient or combination thereof. A pharmaceutical composition described herein is suitable for human and/or veterinary applications.

[0106] As used herein, a "carrier" refers to a compound that facilitates the incorporation of a compound into cells or tissues. For example, without limitation, dimethyl sulfoxide (DMSO) is a commonly utilized carrier that facilitates the uptake of many organic compounds into cells or tissues of a subject.

[0107] As used herein, a "diluent" refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and/or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.

[0108] As used herein, an "excipient" refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, binding ability, lubrication, disintegrating ability etc., to the composition. A "diluent" is a type of excipient.

[0109] Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art including, but not limited to, oral, rectal, topical, aerosol, injection and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and intraocular injections. Pharmaceutical compositions will generally be tailored to the specific intended route of administration.

[0110] One may also administer the compound in a local rather than systemic manner, for example, via injection of the compound directly into the infected area, optionally in a depot or sustained release formulation. Furthermore, one may administer the compound in a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody. The liposomes may be targeted to and taken up selectively by the organ.

[0111] The pharmaceutical compositions disclosed herein may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes. As described herein, compounds used in a pharmaceutical composition may be provided as salts with pharmaceutically compatible counterions.

Methods of Use

[0112] Some embodiments described herein relate to a method of treating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein or a pharmaceutical composition that includes a modified oligonucleotide as described herein for treating a HBV and/or HDV infection.

[0113] Various routes may be used to administer a modified oligonucleotide or complex thereof to a subject in need thereof as indicated elsewhere herein. In an embodiment, the modified oligonucleotide or complex thereof is administered to the subject by a parenteral route. For example, in an embodiment, the modified oligonucleotide or complex thereof is administered to the subject intravenously. In another embodiment, the modified oligonucleotide or complex thereof is administered to the subject subcutaneously. Surprisingly, it has now been found that embodiments of a modified oligonucleotide or complex thereof as described herein can be subcutaneously administered to a primate in an amount that is both safe and effective for treatment. Previously, subcutaneous administration of a modified oligonucleotide or complex thereof (such as REP 2139, REP 2055 or those described in U.S. Pat. Nos. 7,358,068; 8,008,269; 8,008,270 and 8,067,385) to a primate was considered unlikely to be safe and effective because of the relatively high dosages believed required to achieve efficacy and the concomitant increase in the potential risk of safety concerns such as undesirable injection site reactions. Thus, for example, prior clinical studies involving the administration of REP 2139 to humans are believed to have utilized only intravenous routes. At the dosage levels that were believed to be necessary for efficacy, it is believed that safety concerns such as undesirable injection site reactions would have precluded subcutaneous administration.

[0114] Unexpectedly, as illustrated in FIG. 12 and Example B5 below, it has now been found that liver exposure following subcutaneous administration to non-human primates is much higher than expected based on liver exposure levels resulting from otherwise comparable intravenous dosing. This finding means that embodiments of modified oligonucleotides or complexes thereof as described herein, and particularly embodiments of highly potent STOPS.TM. compounds or complexes as described herein, can be safely and effectively administered to primates via subcutaneous administration at dosages lower than previously considered likely to be effective. These lower dosages reduce the risk profile (e.g., reduce risk of injection site reactions) and thus provide a clinically acceptable safety profile for human use.

[0115] Some embodiments disclosed herein relate to a method of treating a HBV and/or HDV infection that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0116] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating a HBV and/or HDV infection. In an embodiment, such uses comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0117] Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of inhibiting replication of HBV and/or HDV comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0118] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for inhibiting replication of HBV and/or HDV. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein, for inhibiting replication of HBV and/or HDV. In an embodiment, such uses for inhibiting replication of HBV and/or HDV comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0119] In some embodiments, the HBV infection can be an acute HBV infection. In some embodiments, the HBV infection can be a chronic HBV infection.

[0120] Some embodiments disclosed herein relate to a method of treating liver cirrhosis that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver cirrhosis and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver cirrhosis with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating liver cirrhosis that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0121] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for treating liver cirrhosis that is developed because of a HBV and/or HDV infection, with an effective amount of the modified oligonucleotide(s). Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating liver cirrhosis that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver cirrhosis comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0122] Some embodiments disclosed herein relate to a method of treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from the liver cancer and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from the liver cancer with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0123] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver cancer (such as hepatocellular carcinoma) comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0124] Some embodiments disclosed herein relate to a method of treating liver failure that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver failure and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver failure with an effective amount of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein. In an embodiment, such a method of treating liver failure that is developed because of a HBV and/or HDV infection comprises safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0125] Other embodiments described herein relate to using a modified oligonucleotide or complex thereof as described herein in the manufacture of a medicament for treating liver failure that is developed because of a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a modified oligonucleotide or complex thereof as described herein, or a pharmaceutical composition that includes an effective amount of a modified oligonucleotide or complex thereof as described herein for treating liver failure that is developed because of a HBV and/or HDV infection. In an embodiment, such uses for treating liver failure comprise safe and effective subcutaneous administration of the modified oligonucleotide or complex thereof to a human at a dosage lower than otherwise expected based on liver levels observed following otherwise comparable intravenous administration. For example, in an embodiment, the modified oligonucleotide or complex thereof is REP-2139 or a complex thereof. In another embodiment, the modified oligonucleotide or complex thereof comprises a highly potent STOPS.TM. compound or complex thereof as described herein. For example, in an embodiment, the STOPS.TM. compound or complex thereof is a modified oligonucleotide or complex thereof as described herein, comprising an at least partially phosphorothioated sequence of alternating A and C units, having sequence independent antiviral activity against hepatitis B, as determined by HBsAg Secretion Assay, that is in an "A" activity range of less than 30 nM.

[0126] Various indicators for determining the effectiveness of a method for treating an HBV and/or HDV infection are also known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a reduction in viral load indicated by reduction in HBV DNA (or load), HBV surface antigen (HBsAg) and HBV e-antigen (HBeAg), a reduction in plasma viral load, a reduction in viral replication, a reduction in time to seroconversion (virus undetectable in patient serum), an increase in the rate of sustained viral response to therapy, an improvement in hepatic function, and/or a reduction of morbidity or mortality in clinical outcomes.

[0127] In some embodiments, an effective amount of a modified oligonucleotide or complex thereof as described herein is an amount that is effective to achieve a sustained virologic response, for example, a sustained viral response 12 month after completion of treatment.

[0128] Subjects who are clinically diagnosed with an HBV and/or HDV infection include "naive" subjects (e.g., subjects not previously treated for HBV and/or HDV) and subjects who have failed prior treatment for HBV and/or HDV ("treatment failure" subjects). Treatment failure subjects include "non-responders" (subjects who did not achieve sufficient reduction in ALT levels, for example, subject who failed to achieve more than 1 log 10 decrease from base-line within 6 months of starting an anti-HBV and/or anti-HDV therapy) and "relapsers" (subjects who were previously treated for HBV and/or HDV whose ALT levels have increased, for example, ALT>twice the upper normal limit and detectable serum HBV DNA by hybridization assays). Further examples of subjects include subjects with a HBV and/or HDV infection who are asymptomatic.

[0129] In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a treatment failure subject suffering from HBV and/or HDV. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a non-responder subject suffering from HBV and/or HDV. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a relapser subject suffering from HBV and/or HDV. In some embodiments, the subject can have HBeAg positive chronic hepatitis B. In some embodiments, the subject can have HBeAg negative chronic hepatitis B. In some embodiments, the subject can have liver cirrhosis. In some embodiments, the subject can be asymptomatic, for example, the subject can be infected with HBV and/or HDV but does not exhibit any symptoms of the viral infection. In some embodiments, the subject can be immunocompromised. In some embodiments, the subject can be undergoing chemotherapy.

[0130] Examples of agents that have been used to treat HBV and/or HDV include interferons (such as IFN-.alpha. and pegylated interferons that include PEG-IFN-.alpha.-2a), and nucleosides/nucleotides (such as lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil). However, some of the drawbacks associated with interferon treatment are the adverse side effects, the need for subcutaneous administration and high cost. A drawback with nucleoside/nucleotide treatment can be the development of resistance.

[0131] Resistance can be a cause for treatment failure. The term "resistance" as used herein refers to a viral strain displaying a delayed, lessened and/or null response to an anti-viral agent. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be provided to a subject infected with an HBV and/or HDV strain that is resistant to one or more anti-HBV and/or anti-HDV agents. Examples of anti-viral agents wherein resistance can develop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. In some embodiments, development of resistant HBV and/or HDV strains is delayed when a subject is treated with a modified oligonucleotide as described herein compared to the development of HBV and/or HDV strains resistant to other HBV and/or HDV anti-viral agents, such as those described.

[0132] Various embodiments provide a treatment for hepatitis B, hepatitis D or both, comprising an effective amount of the modified oligonucleotide or complex thereof as described herein. Some embodiments provide a cross genotypic treatment for hepatitis B, hepatitis D or both, comprising an effective amount of the modified oligonucleotide or complex thereof as described herein. For example, in an embodiment, the modified oligonucleotide or complex thereof is effective to treat viral infections caused by two or more hepatitis B genotypes selected from genotype A, genotype B, genotype C, genotype D, genotype E, genotype F, genotype G, genotype H, genotype I and genotype J. In another embodiment, the modified oligonucleotide or complex thereof is effective to treat viral infections caused by two or more hepatitis B genotypes selected from genotype A, genotype B, genotype C and genotype D. In other embodiments, the modified oligonucleotide or complex thereof is effective to treat viral infections caused by two or more hepatitis D genotypes selected from genotype 1, genotype 2, genotype 3, genotype 4, genotype 5, genotype 6, genotype 7 and genotype 8.

Combination Therapies

[0133] In some embodiments, a modified oligonucleotide or complex thereof as described herein can be used in combination with one or more additional agent(s) for treating and/or inhibiting replication HBV and/or HDV. Additional agents include, but are not limited to, an interferon, nucleoside/nucleotide analogs, a capsid assembly modulator, a sequence specific oligonucleotide (such as anti-sense oligonucleotide and/or siRNA), an entry inhibitor and/or a small molecule immunomodulator. For example, in an embodiment, a modified oligonucleotide or complex thereof as described herein can be used as a first treatment in combination with one or more second treatment(s) for HBV, wherein the second treatment comprises a second oligonucleotide having sequence independent antiviral activity against hepatitis B, an siRNA oligonucleotide (or nucleotides), an anti-sense oligonucleotide, a nucleoside, an interferon, an immunomodulator, a capsid assembly modulator, or a combination thereof. Examples of additional agents include recombinant interferon alpha 2b, IFN-.alpha., PEG-IFN-.alpha.-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, AB-729, VIR-2218, DCR-HBVS, JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, AB-423, AB-506 and ABI-H2158. In an embodiment, the additional agent is a capsid assembly modulator (CAM). In an embodiment, the additional agent is an anti-sense oligonucleotide (ASO).

[0134] In some embodiments, a modified oligonucleotide or complex thereof as described herein can be administered with one or more additional agent(s) together in a single pharmaceutical composition. In some embodiments, a modified oligonucleotide or complex thereof as described herein can be administered with one or more additional agent(s) as two or more separate pharmaceutical compositions. Further, the order of administration of a modified oligonucleotide or complex thereof as described herein with one or more additional agent(s) can vary.

EXAMPLES

[0135] Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the claims.

Examples 1-116

[0136] A series of modified oligonucleotides containing phosphorothioated sequences of alternating A and C units were synthesized on an ABI 394 synthesizer using standard phosphoramidite chemistry. The solid support was controlled pore glass (CPG, 1000A, Glen Research, Sterling Va.) and the building block monomers are described in Tables 4 and 5. The reagent (dimethylamino-methylidene) amino)-3H-1,2,4-dithiazaoline-3-thione (DDTT) was used as the sulfur-transfer agent for the synthesis of oligoribonucleotide phosphorothioates (PS linkages). An extended coupling of 0.1M solution of phosphoramidite in CH.sub.3CN in the presence of 5-(ethylthio)-1H-tetrazole activator to a solid bound oligonucleotide followed by standard capping, oxidation and deprotection afforded modified oligonucleotides. The stepwise coupling efficiency of all modified phosphoramidites was more than 95%. Several modified oligonucleotides containing sequences of alternating A and C units but having phosphodiester (PO) linkages instead of phosphorothioate (PS) linkages were also made.

Deprotection

[0137] After completion of synthesis the controlled pore glass (CPG) was transferred to a screw cap vial or screw caps RNase free microfuge tube. The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 1.0 mL of a mixture of ethanolic ammonia (ammonia: ethanol (3:1)) for 5-15 hr at 55.degree. C. The vial was cooled briefly on ice and then the ethanolic ammonia mixture was transferred to a new microfuge tube. The CPG was washed with 2.times.0.1 mL portions of deionized water, put in dry ice for 10 min then dried in speed vac.

Quantitation of Crude Oligomer or Raw Analysis

[0138] Samples were dissolved in deionized water (1.0 mL) and quantitated as follows: Blanking was first performed with water alone (1 mL). 20 ul of sample and 980 uL of water were mixed well in a microfuge tube, transferred to cuvette and absorbance reading obtained at 260 nm. The crude material is dried down and stored at -20.degree. C.

HPLC Purification of Oligomer

[0139] The crude oligomers were analyzed and purified by HPLC (Dionex PA 100). The buffer system is A=Water B=0.25 M Tris-HCl pH 8, C: 0.375 M Sodium per chlorate, flow 5.0 mL/min, wavelength 260 nm. First inject a small amount of material (.about.5 OD) and analyze by LC-MS. Once the identity of this material is confirmed the crude oligomer can then be purified using a larger amount of material, e.g., 60 OD's per run, flow rate of 5 mL/min. Fractions containing the full-length oligonucleotides are then pooled together, evaporated and finally desalted as described below.

Desalting of Purified Oligomer

[0140] The purified dry oligomer was then desalted using Sephadex G-25M (Amersham Biosciences). The cartridge was conditioned with 10 mL of water. The purified oligomer dissolved thoroughly in 2.5 mL RNAse free water was applied to the cartridge with very slow dropwise elution. The salt free oligomer was eluted with 3.5 ml water directly into a screw cap vial.

HPLC Analysis and Electrospray LC/Ms

[0141] Approximately 0.2 OD oligomer is first dried down, redissolved in water (50 ul) and then pipetted in special vials for HPLC and LC-MS analysis.

[0142] Table 6 summarizes the sequence length, alternating A and C units and whether the backbone is phosphorothioate (PS) or phosphodiester (PO) for the resulting exemplified modified oligonucleotides.

TABLE-US-00006 TABLE 6 No. Length A modification C modification Backbone 1 (AC)20 2'-OMe 2'-OMe PS 2 (AC)15 2'-OMe 2'-OMe PS 3 (AC)25 2'-OMe 2'-OMe PS 4 (AC)30 2'-OMe 2'-OMe PS 5 (AC)20 2'-O-MOE 2'-O-MOE PS 6 (AC)20 LNA LNA PS 7 (AC)20 2'-F 2'-F PS 8 (AC)20 2'-O-Propargyl 2'-O-Propargyl PS 9 (AC)20 2'-O-butyne 2'-O-butyne PS 10 (AC)20 2'-F-Ara 2'-F-Ara PS 11 (AC)20 UNA UNA PS 12 (AC)20 ENA ENA PS 13 (AC)20 2'-OMe 2'-O-MOE PS 14 (AC)20 2'-OMe LNA PS 15 (AC)20 2'-OMe 2'-F PS 16 (AC)20 2'-OMe 2'-O-Propargyl PS 17 (AC)20 2'-OMe 2'-O-butyne PS 18 (AC)20 2'-OMe 2'-F-Ara PS 19 (AC)20 2'-OMe UNA PS 20 (AC)20 2'-OMe ENA PS 21 (AC)20 2'-OMe 2'-NH.sub.2 PS 22 (AC)20 2'-O-MOE 2'-OMe PS 23 (AC)20 2'-O-MOE LNA PS 24 (AC)20 2'-O-MOE 2'-F PS 25 (AC)20 2'-O-MOE 2'-O-Propargyl PS 26 (AC)20 2'-O-MOE 2'-O-butyne PS 27 (AC)20 2'-O-MOE 2'-F-Ara PS 28 (AC)20 2'-O-MOE UNA PS 29 (AC)20 2'-O-MOE ENA PS 30 (AC)20 2'-O-MOE 2'-NH.sub.2 PS 31 (AC)20 LNA 2'-OMe PS 32 (AC)20 LNA 2'-O-MOE PS 33 (AC)20 LNA 2'-F PS 34 (AC)20 LNA 2'-O-Propargyl PS 35 (AC)20 LNA 2'-O-butyne PS 36 (AC)20 LNA 2'-F-Ara PS 37 (AC)20 LNA UNA PS 38 (AC)20 LNA ENA PS 39 (AC)20 LNA 2'-NH.sub.2 PS 40 (AC)20 2'-F LNA PS 41 (AC)20 2'-F 2'-OMe PS 42 (AC)20 2'-F 2'-O-MOE PS 43 (AC)20 2'-F 2'-O-Propargyl PS 44 (AC)20 2'-F 2'-O-butyne PS 45 (AC)20 2'-F 2'-F-Ara PS 46 (AC)20 2'-F UNA PS 47 (AC)20 2'-F ENA PS 48 (AC)20 2'-F 2'-NH.sub.2 PS 49 (AC)20 2'-O-Propargyl 2'-OMe PS 50 (AC)20 2'-O-Propargyl 2'-O-MOE PS 51 (AC)20 2'-O-Propargyl LNA PS 52 (AC)20 2'-O-Propargyl 2'-F PS 53 (AC)20 2'-O-Propargyl 2'-O-butyne PS 54 (AC)20 2'-O-Propargyl 2'-F-Ara PS 55 (AC)20 2'-O-Propargyl UNA PS 56 (AC)20 2'-O-Propargyl ENA PS 57 (AC)20 2'-O-Propargyl 2'-NH.sub.2 PS 58 (AC)20 2'-O-butyne 2'-OMe PS 59 (AC)20 2'-O-butyne 2'-O-MOE PS 60 (AC)20 2'-O-butyne LNA PS 61 (AC)20 2'-O-butyne 2'-F PS 62 (AC)20 2'-O-butyne 2'-O-Propargyl PS 63 (AC)20 2'-O-butyne 2'-F-Ara PS 64 (AC)20 2'-O-butyne UNA PS 65 (AC)20 2'-O-butyne ENA PS 66 (AC)20 2'-O-butyne 2'-NH.sub.2 PS 67 (AC)20 2'-F-Ara 2'-OMe PS 68 (AC)20 2'-F-Ara 2'-O-MOE PS 69 (AC)20 2'-F-Ara LNA PS 70 (AC)20 2'-F-Ara 2'-F PS 71 (AC)20 2'-F-Ara 2'-O-Propargyl PS 72 (AC)20 2'-F-Ara 2'-O-butyne PS 73 (AC)20 2'-F-Ara UNA PS 74 (AC)20 2'-F-Ara ENA PS 75 (AC)20 2'-F-Ara 2'-NH.sub.2 PS 76 (AC)20 UNA 2'-OMe PS 77 (AC)20 UNA 2'-O-MOE PS 78 (AC)20 UNA LNA PS 79 (AC)20 UNA 2'-F PS 80 (AC)20 UNA 2'-O-Propargyl PS 81 (AC)20 UNA 2'-O-butyne PS 82 (AC)20 UNA 2'-F-Ara PS 83 (AC)20 UNA ENA PS 84 (AC)20 UNA 2'-NH.sub.2 PS 85 (AC)20 ENA 2'-OMe PS 86 (AC)20 ENA 2'-O-MOE PS 87 (AC)20 ENA LNA PS 88 (AC)20 ENA 2'-F PS 89 (AC)20 ENA 2'-O-Propargyl PS 90 (AC)20 ENA 2'-O-butyne PS 91 (AC)20 ENA 2'-F-Ara PS 92 (AC)20 ENA UNA PS 93 (AC)20 ENA 2'-NH.sub.2 PS 94 (AC)20 LNA 2'-O-MOE PS 95 (AC)20 2'-F LNA PS 96 (AC)25 2'-OMe 2'-OMe PO 97 (AC)25 2'-OMe 2'-OMe PS 98 (AC)20 2'-F 2'-OMe PS 99 (AC)20 LNA 2-O-Me PS 100 (AC)20 2'-OMe 2'-F PS 101 (AC)20 2'-OMe 2'-OMe PO 102 (AC)20 2'-F 2'-O-MOE PS 103 (AC)30 2'-OMe 2'-OMe PS 104 (AC)15 2'-OMe 2'-OMe PS 105 (AC)20 2'-OMe LNA PS 106 (AC)20 LNA LNA PS 107 (AC)20 2'-OMe 2'-O'MOE PS 108 (AC)20 2'-O-MOE 2'-OMe PS 109 (AC)20 2'-OMe 2'-OMe PS 110 (AC)30 2'-OMe 2'-O-butyne PO 111 (AC)20 2'-F 2'-F PS 112 (AC)20 2'-OMe 2'-OMe PS 113 (AC)15 2'-OMe 2'-OMe PO 114 (AC)20 2'-O-MOE 2'-O-MOE PS 115 (AC)20 2'-O-MOE 2'-F PS 116 (AC)20 LNA 2'-F PS

Examples 117-130

[0143] The effect of 5' modification was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above in Examples 1-116. End capped oligonucleotides were made by using a 5'-vinyl phosphonate building block to incorporate 5'-vinyl phosphonate endcaps:

##STR00085##

[0144] With reference to FIG. 7, the 5'-vinyl phosphonate building block (5'-VP) was prepared as follows:

[0145] Preparation of compound 7-2: To a solution of 7-1 (15.0 g, 53.3 mmol) in dry pyridine (150 mL) was added TBSCl (20.0 g, 133.3 mmol) and Imidazole (10.8 g, 159.9 mmol). The mixture was stirred at r.t. for 15 h. TLC showed 7-1 was consumed completely. The reaction mixture was concentrated in vacuo to give residue. The residue was quenched with DCM (500 mL). The DCM layer was washed with H.sub.2O (1 L*2) 2 times and brine. The DCM layer concentrated in vacuo to give crude 7-2 (27.2 g, 53.3 mmol) as a yellow oil. The crude 7-2 was used in next step directly. ESI-LCMS m/z 510.5 [M+H]*.

[0146] Preparation of compound 7-3: To a solution of 7-2 (26.2 g, 51.3 mmol) in pyridine (183 mL) was added dropwise the benzoyl chloride (15.8 g, 113.0 mmol) at 5.degree. C. The reaction mixture was stirred at r.t. for 2 hours. TLC showed the 7-2 was consumed completely. The reaction mixture was quenched with H.sub.2O (4 mL). Then NH.sub.3.H.sub.2O (20 mL) was added to the reaction mixture and stirred at r.t for 30 min. Then the Pyridine was removed from the mixture by concentration under reduced pressure. The residue was added to H.sub.2O (100 mL) and extracted with EA (150 mL*3) and the EA layers combined. The EA layer was washed with brine and dried over Na.sub.2SO.sub.4. Filtered and concentrated to give the crude 7-3 (45.0 g). ESI-LCMS m/z=614.5 [M+H]*.

[0147] Preparation of compound 7-4: To a mixture solution of 7-3 (44.0 g, crude) in THF (440 mL) was added the H.sub.2O (220 mL) and TFA (220 mL) at 0.degree. C. Then the reaction mixture was stirred at 0.degree. C. for 1.5 h. TLC showed the 7-3 was consumed completely. The reaction mixture pH was adjusted to 7-8 with NH.sub.3.H.sub.2O. Then the mixture was extracted with EA (300 mL*7). The combined EA layer was washed with brine and concentrated in vacuo to give crude. The crude was purified by column chromatography (EA:PE=1:5.about.1:1) to give compound 7-4 (15.8 g) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=11.24 (s, 1H, exchanged with D.sub.2O), 8.77 (s, 2H), 8.04-8.06 (m, 2H), 7.64-7.66 (m, 2H), 7.54-7.58 (m, 2H), 6.14-6.16 (d, J=5.9 Hz, 1H), 5.20-5.23 (m, 1H), 4.58-4.60 (m, 1H), 4.52-4.55 (m, 1H), 3.99-4.01 (m, 1H), 3.69-3.75 (m, 1H), 3.57-3.61 (m, 1H), 3.34 (s, 4H), 0.93 (s, 9H), 0.14-0.15 (d, J=1.44 Hz, 6H). ESI-LCMS m/z=500.3 [M+H]*.

[0148] Preparation of compound 7-5: To a 500 mL, round-bottom flask was added the DMSO (132 mL) and 7-4 (13.2 g, 26.4 mmol), EDCI (15.19 g, 79.2 mmol) in turn at r.t. Then the Pyridine (2.09 g, 26.4 mmol, 2.1 mL) was added to the reaction mixture. After stirring 5 min, the TFA (1.51 g, 13.2 mmol) was added to the reaction mixture. Then reaction mixture was stirred at r.t for 3 hrs. LC-MS showed the 7-4 was consumed completely. The reaction mixture was added to the ice water (500 mL) and extracted with EA (300 mL*3) 3 times. The combined EA layer was washed with H.sub.2O 2 times and brine 1 time. Dried over Na.sub.2SO.sub.4 and filtered. The filtrate was concentrated to get crude 7-5 (14.6 g) as a white solid. ESI-LCMS m/z=516.3 [M+H]*.

[0149] Preparation of compound 7-6: The 5A (24.4 g, 38.5 mmol) was added to a mixture solution of NaH (2.5 g, 64.3 mmol, 60% purity) in THF (50 mL) at 0.degree. C. After stirring 15 min, the 7-5 (16.0 g, 32.1 mmol) in THF (60 mL) was added to the reaction mixture. Then the reaction mixture was stirred at r.t for 1 hr. LC-MS showed the 7-5 was consumed completely. Then the reaction mixture was quenched with sat. NH.sub.4Cl (500 mL) and extracted with EA (400 mL*3) 3 times. The combined EA layer was washed with brine, dried over Na.sub.2SO.sub.4 and filtered. The filtrate was concentrated in vacuo to get crude. The crude was purified by c.c (EA:PE=1:5.about.1:1) to give 7-6 (10.0 g, 12.4 mmol, 38.6% yield) as a white solid. ESI-LCMS m/z=804.4 [M+H].sup.+; .sup.31P NMR (162 MHz, DMSO-d.sub.6) .delta. 17.01.

[0150] Preparation of compound 7-7: To a 500 mL round-bottom flask was added the 7-6 (9.0 g, 11.2 mmol) and H.sub.2O (225 mL), HCOOH (225 mL) in turn. The reaction mixture was stirred at 26.degree. C. for 15 h. LC-MS showed the 7-6 was consumed completely. The reaction mixture was adjusted the pH=6-7 with NH.sub.3.H.sub.2O. Then the mixture was extracted with EA (300 mL*3) 3 times. The combined EA layer was dried over Na.sub.2SO.sub.4, filtered and filtrate was concentrated to get crude. The crude was purified by column chromatography (DCM/MeOH=100:1.about.60:1) to give product 7-7 (7.0 g, 10.1 mmol, 90.6% yield). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=11.11 (s, 1H, exchanged with D.sub.2O), 8.71-8.75 (d, J=14.4, 2H), 8.04-8.06 (m, 2H), 7.64-7.65 (m, 1H), 7.54-7.58 (m, 2H), 6.88-7.00 (m, 1H), 6.20-6.22 (d, J=5.4, 2H), 6.06-6.16 (m, 1H), 5.74-5.75 (d, J=5.72, 2H), 5.56-5.64 (m, 4H), 4.64-4.67 (m, 1H), 4.58-4.59 (m, 1H), 4.49-4.52 (m, 1H), 3.37 (s, 3H), 1.09-1.10 (d, J=1.96, 18H). .sup.31P NMR (162 MHz, DMS O-d.sub.6) .delta. 17.45. ESI-LCMS m/z=690.4 [M+H].sup.+.

[0151] Preparation of compound 5'-VP: To a solution of 7-7 (5.5 g, 7.9 mmol) in DCM (55 mL) was added the DCI (750 mg, 6.3 mmol), then CEP[N(iPr).sub.2].sub.2 (3.1 g, 10.3 mmol) was added. The mixture was stirred at r.t. for 2 h. TLC showed 3.5% of 7.7 remained. The reaction mixture was washed with H.sub.2O (40 mL*2) and brine (50 mL*2), dried over Na.sub.2SO.sub.4 and concentrated to give crude. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/5 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 30 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=3/1; Detector, UV 254 nm. The product was concentrated and extracted with EA (50 mL*3). The combined EA layer was washed with brine and dried over Na.sub.2SO.sub.4, filtered and filtrate was concentrated to get resulting 5'-VP (6.0 g, 98% purity) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=11.27 (s, 1H, exchanged with D.sub.2O), 8.72-8.75 (m, 2H), 8.04-8.06 (m, 2H), 7.54-7.68 (m, 3H), 6.85-7.05 (m, 1H), 6.09-6.26 (m, 2H), 5.57-5.64 (m, 4H), 4.70-4.87 (m, 3H), 3.66-3.88 (m, 4H), 3.37-3.41 (m, 3H), 2.82-2.86 (m, 2H), 1.20-1.21 (m, 12H), 1.08-1.09 (m, 18H). .sup.31PNMR (162 MHz, DMSO-d.sub.6):149.99, 149.16, 17.05, 16.81. ESI-LCMS m/z=890.8 [M+H].sup.+.

[0152] Table 7 summarizes the sequence length, alternating A and C units, and 5' modification for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00007 TABLE 7 No. Length A C 5'-Modification 117 (AC)17 LNA-A LNA-(5m)C OH 118 (AC)18 LNA-A LNA-(5m)C OH 119 (AC)19 LNA-A LNA-(5m)C OH 120 (AC)17 LNA-A LNA-(5m)C Vinyl-phosphonate-A 121 (AC)18 LNA-A LNA-(5m)C Vinyl-phosphonate-A 122 (AC)19 LNA-A LNA-(5m)C Vinyl-phosphonate-A 123 (AC)20 LNA-A LNA-(5m)C Vinyl-phosphonate-A 124 (AC)17 2'-OMe-A 2'-OMe-(5m)C OH 125 (AC)18 2'-OMe-A 2'-OMe-(5m)C OH 126 (AC)19 2'-OMe-A 2'-OMe-(5m)C OH 127 (AC)17 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 128 (AC)18 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 129 (AC)19 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 130 (AC)20 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A

Examples 131-174

[0153] The effect of sequence length, LNA incorporation and 5'-modification was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above in Examples 1-116. Table 8 summarizes the sequence length, alternating A and C units, 5' modification, and length and position of LNA units for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00008 TABLE 8 No. Length A C 5'-Modification LNA Modification 131 (AC)17 2'-OMe-A LNA-(5m)C OH 132 (AC)18 2'-OMe-A LNA-(5m)C OH 133 (AC)19 2'-OMe-A LNA-(5m)C OH 134 (AC)20 2'-OMe-A LNA-(5m)C OH 135 (AC)17 2'-OMe-A LNA-(5m)C Vinyl-phosphonate-A 136 (AC)18 2'-OMe-A LNA-(5m)C Vinyl-phosphonate-A 137 (AC)19 2'-OMe-A LNA-(5m)C Vinyl-phosphonate-A 138 (AC)20 2'-OMe-A LNA-(5m)C Vinyl-phosphonate-A 139 (AC)17 LNA-A 2'-OMe-(5m)C OH 140 (AC)18 LNA-A 2'-OMe-(5m)C OH 141 (AC)19 LNA-A 2'-OMe-(5m)C OH 142 (AC)20 LNA-A 2'-OMe-(5m)C OH 143 (AC)17 LNA-A 2'-OMe-(5m)C Vinyl-phosphonate-A 144 (AC)18 LNA-A 2'-OMe-(5m)C Vinyl-phosphonate-A 145 (AC)19 LNA-A 2'-OMe-(5m)C Vinyl-phosphonate-A 146 (AC)20 LNA-A 2'-OMe-(5m)C Vinyl-phosphonate-A 147 (AC)17 UNA-A LNA-(5m)C OH 148 (AC)18 UNA-A LNA-(5m)C OH 149 (AC)19 UNA-A LNA-(5m)C OH 150 (AC)20 UNA-A LNA-(5m)C OH 151 (AC)17 UNA-A LNA-(5m)C Vinyl-phosphonate-A 152 (AC)18 UNA-A LNA-(5m)C Vinyl-phosphonate-A 153 (AC)19 UNA-A LNA-(5m)C Vinyl-phosphonate-A 154 (AC)20 UNA-A LNA-(5m)C Vinyl-phosphonate-A 155 (AC)17 LNA-A UNA-(5m)C OH 156 (AC)18 LNA-A UNA-(5m)C OH 157 (AC)19 LNA-A UNA-(5m)C OH 158 (AC)20 LNA-A UNA-(5m)C OH 159 (AC)20 LNA-A UNA-(5m)C OH Block of 4 LNA 160 (AC)17 LNA-A UNA-(5m)C Vinyl-phosphonate-A 161 (AC)18 LNA-A UNA-(5m)C Vinyl-phosphonate-A 162 (AC)19 LNA-A UNA-(5m)C Vinyl-phosphonate-A 163 (AC)20 LNA-A UNA-(5m)C Vinyl-phosphonate-A 164 (AC)20 2'-OMe-A 2'-OMe-(5m)C OH Every 3.sup.rd base is LNA LNA-A LNA-(5m)C 165 (AC)20 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A Every 3.sup.rd base is LNA LNA-A LNA-(5m)C 166 (AC)20 2'-OMe-A 2'-OMe-(5m)C OH Every 4th base is LNA LNA-(5m)C 167 (AC)20 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A Every 4th base is LNA LNA-(5m)C 168 (AC)17 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 5 (5m)lnC in the middle LNA(5m)C 169 (AC)18 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 6 lnAps(5m)C in the middle 170 (AC)19 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 6 lnAps(5m)C in the LNA(5m)C middle 171 (AC)20 2'-OMe-A 2'-OMe-(5m)C OH 5 (5m)lnC in the middle LNA(5m)C 172 (AC)20 LNA-A 2'-OMe-(5m)C OH 10 lnAps(5m)C in the 2'-OMe-A LNA(5m)C middle 173 (AC)20 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 5 (5m)lnC in the middle LNA(5m)C 174 (AC)20 2'-OMe-A 2'-OMe-(5m)C Vinyl-phosphonate-A 10 lnAps(5m)C in the LNA-A LNA-(5m)C middle

Examples 175-216

[0154] The effect of sequence length, LNA incorporation, stereochemical modification and 5' modification was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above in Examples 1-116, except that the oligonucleotides were prepared by a modified method using a dinucleotide building block consisting of an A unit and a C unit connected by a stereochemically defined phosphorothioate linkage as follows:

##STR00086##

[0155] With reference to FIGS. 8, 9A and 9B, the dinucleotide building blocks 9R and 9S were prepared as follows:

[0156] Preparation of compound 8-2: To a solution of 8-1 (300.0 g, 445.1 mmol) in 3000 mL of dry dioxane with an inert atmosphere of nitrogen was added levulinic acid (309.3 g, 2.67 mol) dropwise at room temperature. Then the dicyclohexylcarbodiimide (274.6 g, 1.33 mol) and 4-dimethylaminopyridine (27.1 g, 222.0 mmol) were added in order at room temperature. The resulting solution was stirred at room temperature for 5 h and diluted with 5000 mL of dichloromethane and filtered. The organic phase was washed with 2.times.3000 mL of 2% aqueous sodium bicarbonate and 1.times.3000 mL of water respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. 345.0 g (crude) of 8-2 was obtained as a white solid and used for next step without further purification. ESI-LCMS: m/z 774 [M-H].sup.+.

[0157] Preparation of compound 8-3: To a solution of 8-2 (345 g, 445.1 mmol) was dissolved in 3000 mL dichloromethane with an inert atmosphere of nitrogen was added p-toluenesulfonic acid (84.6 g, 445.1 mmol) dropwise at 0.degree. C. The resulting solution was stirred at 0.degree. C. for 0.5 h and diluted with 3000 mL of dichloromethane and washed with 2.times.2000 mL of saturated aqueous sodium bicarbonate and 1.times.2000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, and concentrated under reduced pressure and the residue was purified by silica gel column chromatography (SiO.sub.2, dichloromethane:methanol=30:1) to give 8-3 (210.0 g, 90% over two steps) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.88 (s, 1H), 8.17-8.10 (m, 3H), 7.62-7.60 (m, 1H), 7.58-7.48 (m, 2H), 5.97-5.91 (m, 1H), 5.42 (d, J=5.9 Hz, 1H), 5.25 (s, 1H), 4.21-4.08 (m, 2H), 3.78-3.59 (m, 2H), 2.75-2.74 (m, 2H), 2.57 (m, 2H), 2.13 (d, J=2.3 Hz, 3H), 2.02 (s, 3H), 1.81 (m, 1H), 1.77-1.56 (m, 1H), 1.33-0.98 (m, 1H). ESI-LCMS: m/z 474 [M+H].sup.+.

[0158] Preparation of compound 8-4: To a solution of 8-3 (210.0 g, 444.9 mmol) in 2000 mL of acetonitrile with an inert atmosphere of nitrogen was added 8-3a (360.0 g, 405.4 mmol) and ETT (58.0 g, 445.9 mmol) in order at 0.degree. C. The resulting solution was stirred for 2 h at room temperature. Then the mixture was filtered and used for next step without further purification. ESI-LCMS: m/z 1258 [M+H].sup.+.

[0159] Preparation of compounds 8-5 and 8-6: To a solution of 8-4 (509.9 g, 405.4 mmol) in 2000 mL of acetonitrile with an inert atmosphere of nitrogen was added pyridine (128.0 g, 1.62 mol) and 5-amino-3H-1,2,4-dithiazole-3-thione (121.8 g, 810.9 mmol) in order at room temperature. The reaction solution was stirred for 30 minutes at room temperature. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in a mixture of 8-5 and 8-6 (430.0 g, 90% over two steps) as a white solid. The fractions were diluted with 3000 mL of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC with the following conditions: CHIRALPAK IB N-5(IB50CD-VD008)/SFC 0.46 cm I.D..times.25 cm L 10.0 ul Mobile phase: (DCM/EtOAc=80/20(V/V)), Detector, UV 254 nm. The fractions were concentrated until no residual solvent left under reduced pressure. 105.0 g (35.0%) of 8-5 were obtained as a white solid and used to make 9R as described below. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.88 (s, 1H), 11.26 (s, 1H), 8.62 (d, J=8.06 Hz, 2H), 8.18 (m, 2H), 8.05 (d, J=7.2 Hz, 2H), 7.79 (s, 1H), 7.67-7.48 (m, 6H), 7.40 (d, J=7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.86-6.83 (m, 4H), 6.21 (d, J=6.6 Hz, 1H), 5.91 (d, J=5.0 Hz, 1H), 5.44-5.41 (m, 1H), 5.28-5.26 (m, 1H), 5.06 (m, 1H), 4.45-4.24 (m, 7H), 3.71 (s, 6H), 3.39 (s, 4H), 3.31 (s, 3H), 2.98 (m, 2H), 2.75 (m, 2H), 2.56 (m, 2H), 2.01 (s, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=67.17. ESI-LCMS: m/z 1292 [M+H].sup.+; 170.0 g (56.6%) of 8-6 were obtained as a white solid and used to make 9S as described below. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.86 (s, 1H), 11.25 (s, 1H), 8.62 (d, J=16.6 Hz, 2H), 8.18 (d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.78 (s, 1H), 7.67-7.48 (m, 6H), 7.40 (d, J=7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.87-6.85 (m, 4H), 6.21 (d, J=6.8 Hz, 1H), 5.91 (d, J=5.2 Hz, 1H), 5.43-5.39 (m, 1H), 5.28-5.26 (m, 1H), 5.06 (m, 1H), 4.48-4.21 (m, 7H), 3.72 (s, 6H), 3.36 (s, 4H), 3.26 (s, 3H), 2.95 (m, 2H), 2.73 (m, 2H), 2.55 (m, 2H), 2.04 (s, 3H); .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=66.84; ESI-LCMS: m/z 1292 [M+H].sup.+.

[0160] Preparation of compound 9-1: To a solution of 8-5 (100.0 g, 77.4 mmol) in 700 mL acetonitrile with an inert atmosphere of nitrogen was added 0.5 M hydrazine hydrate (20.0 g, 0.4 mol) in pyridine/acetic acid (3:2) at 0.degree. C. The resulting solution was stirred for 0.5 h at 0.degree. C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room temperature and stirred for additional 15 min. The solution was diluted with DCM (2000 mL) and washed with sat. aq. NH.sub.4Cl twice and washed with brine and dried over Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 9-1 (67.0 g, 80%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.97 (s, 1H), 11.26 (s, 1H), 8.62 (d, J=11.2 Hz, 2H), 8.19 (d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.74 (s, 1H), 7.67-7.48. (m, 6H), 7.40 (d, J=7.2 Hz, 2H), 7.28-7.18 (m, 7H), 6.85 (m, 4H), 6.21 (m, 1H), 5.90 (d, J=3.2 Hz, 1H), 5.49-5.43 (m, 2H), 5.05 (m, 1H), 4.45 (m, 1H), 4.40-4.30 (m, 4H), 4.18-4.11 (m, 2H), 3.93 (m, 1H), 3.71 (s, 6H), 3.40-3.32 (m, 8H), 2.98 (m, 2H), 2.04 (s, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=67.30. ESI-LCMS: m/z 1194 [M+H].sup.+.

[0161] Preparation of compound 9R: To a solution of 9-1 (58.0 g, 48.6 mmol) in 600 mL of dichloromethane with an inert atmosphere of nitrogen was added CEP[N(iPr).sub.2].sub.2 (18.7 g, 62.1 mmol) and DCI (5.1 g, 43.7 mmol) in order at room temperature. The resulting solution was stirred for 1 hour at room temperature and diluted with 1000 mL dichloromethane and washed with 2.times.1000 mL of saturated aqueous sodium bicarbonate and 1.times.1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 9R (51.2 g, 70%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d6) .delta.=12.94 (m, 1H), 11.26 (s, 1H), 8.62 (m, 2H), 8.19 (d, J=7.2 Hz, 2H), 8.05 (m, 2H), 7.77 (m, 1H), 7.69-7.46 (m, 6H), 7.39 (d, J=6.6 Hz, 2H), 7.26-7.20 (m, 7H), 6.84 (m, 4H), 6.20 (m, 1H), 5.90 (m, 1H), 5.43 (m, 1H), 5.06 (s, 1H), 4.46-4.17 (m, 7H), 4.12 (m, 1H), 3.82-3.80 (m, 2H), 3.73-3.66 (s, 6H), 3.64-3.58 (m, 2H), 3.48-3.29 (m, 8H), 2.98 (s, 2H), 2.82-2.77 (m, 2H), 2.03 (s, 3H), 1.24-1.15 (m, 12H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=149.87, 149.80, 67.43, 67.33. ESI-LCMS: m/z 1394 [M+H].sup.+.

[0162] Preparation of compound 9-2: To a solution of 8-6 (110.0 g, 85.1 mmol) in 700 mL acetonitrile with an inert atmosphere of nitrogen was added 0.5 M hydrazine hydrate (21.1 g, 423.6 mmol) in pyridine/acetic acid (3:2) at 0.degree. C. The resulting solution was stirred for 0.5 h at 0.degree. C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room temperature and stirred for additional 15 min, The solution was diluted with DCM (2000 mL) and washed with sat. aq. NH.sub.4Cl twice and washed with brine and dried over Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 9-2 (72.0 g, 80%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.94 (s, 1H), 11.24 (s, 1H), 8.61-8.57 (m, 2H), 8.18 (d, J=7.6 Hz, 2H), 8.03 (d, J=7.6 Hz, 2H), 7.74 (s, 1H), 7.66-7.47 (m, 6H), 7.40 (d, J=7.1 Hz, 2H), 7.27-7.20 (m, 7H), 6.86 (m, 4H), 6.20 (d, J=6.6 Hz, 1H), 5.87 (d, J=4.0 Hz, 1H), 5.42 (m, 2H), 5.05 (m, 1H), 4.45 (m, 2H), 4.40-4.24 (m, 1H), 4.22-4.06 (m, 4H), 3.92 (m, 1H), 3.71 (s, 6H), 3.40-3.32 (m, 8H), 2.94 (m, 2H), 2.03 (m, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=66.87. ESI-LCMS: m/z 1194 [M+H].sup.+.

[0163] Preparation of compound 9S: To a solution of 9-2 (62.0 g, 51.9 mmol) in 600 mL of dichloromethane with an inert atmosphere of nitrogen was added CEP[N(iPr).sub.2].sub.2 (19.0 g, 63.1 mmol) and DCI (5.55 g, 47.0 mmol) in order at room temperature. The resulting solution was stirred for 1 hour at room temperature and diluted with 1000 mL dichloromethane and washed with 2.times.1000 mL of saturated aqueous sodium bicarbonate and 1.times.1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 9S (51.5 g, 70%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=12.90 (s, 1H), 11.25 (s, 1H), 8.60 (m, 2H), 8.19 (d, J=6.6 Hz, 2H), 8.04 (m, 2H), 7.77 (s, 1H), 7.67-7.48 (m, 6H), 7.41 (d, J=8.0 Hz, 2H), 7.29-7.19 (m, 7H), 6.85 (m, 4H), 6.21 (d, J=6.8 Hz, 1H), 5.91-5.87 (m, 1H), 5.41 (m, 1H), 5.06 (m, 1H), 4.46-4.21 (m, 7H), 4.10 (m, 1H), 3.83-3.75 (m, 2H), 3.73-3.68 (s, 6H), 3.68-3.59 (m, 2H), 3.40-3.32 (m, 8H), 2.93 (m, 2H), 2.80 (m, 2H), 2.02 (s, 3H), 1.18-1.13 (m, 12H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=149.96, 149.73, 66.99, 66.86. ESI-LCMS: m/z 1394 [M+H].sup.+.

[0164] The modified method also used a longer coupling time (8 min) and a greater number of equivalents of amidites (8 equivalents). Table 9 summarizes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothioate (PS) linkages, and 5'-modification for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00009 TABLE 9 No. Length A C PS Modification 5'-Modification 175 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5 R isomer OH 176 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6 R isomer OH 177 (AC)19 2'-OMe-A 2'-OMe-(5m)C 4 R isomer OH 178 (AC)20 2'-OMe-A 2'-OMe-(5m)C 4 R isomer OH 179 (AC)20 2'-OMe-A 2'-OMe-(5m)C 5 R isomer OH 180 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6 R isomer OH 181 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6 R isomer Vinyl-phosphonate-A 182 (AC)20 2'-OMe-A 2'-OMe-(5m)C 7 R isomer OH 183 (AC)20 2'-OMe-A 2'-OMe-(5m)C 13 R isomer OH 184 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20 R isomer OH 185 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20 R isomer Vinyl-phosphonate-A 186 (AC)20 2'-OMe-A 2'-OMe-(5m)C 19 R isomer Vinyl-phosphonate-A 187 (AC)17 LNA-A LNA-(5m)C 5 R isomer OH 188 (AC)18 LNA-A LNA-(5m)C 6 R isomer OH 189 (AC)19 LNA-A LNA-(5m)C 6 R isomer OH 190 (AC)20 LNA-A LNA-(5m)C 4 R isomer OH 191 (AC)20 LNA-A LNA-(5m)C 5 R isomer OH 192 (AC)20 LNA-A LNA-(5m)C 6 R isomer OH 193 (AC)20 LNA-A LNA-(5m)C 6 R isomer, Vinyl-phosphonate-A 194 (AC)20 LNA-A LNA-(5m)C 13 R isomer OH 195 (AC)20 LNA-A LNA-(5m)C 20 R isomer OH 196 (AC)20 LNA-A LNA-(5m)C 20 R isomer Vinyl-phosphonate-A 197 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5 S isomer OH 198 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6 S isomer OH 199 (AC)19 2'-OMe-A 2'-OMe-(5m)C 6 S isomer OH 200 (AC)20 2'-OMe-A 2'-OMe-(5m)C 4 S isomer OH 201 (AC)20 2'-OMe-A 2'-OMe-(5m)C 5 S isomer OH 202 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6 S isomer OH 203 (AC)20 2'-OMe-A 2'-OMe-(5m)C 7 S isomer OH 204 (AC)20 2'-OMe-A 2'-OMe-(5m)C 13 S isomer OH 205 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20 S isomer OH 206 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20 S isomer Vinyl-phosphonate-A 207 (AC)17 LNA-A LNA-(5m)C 5 S isomer OH 208 (AC)18 LNA-A LNA-(5m)C 6 S isomer OH 209 (AC)19 LNA-A LNA-(5m)C 6 S isomer OH 210 (AC)20 LNA-A LNA-(5m)C 4 S isomer OH 211 (AC)20 LNA-A LNA-(5m)C 5 S isomer OH 212 (AC)20 LNA-A LNA-(5m)C 6 S isomer OH 213 (AC)20 LNA-A LNA-(5m)C 6 S isomer Vinyl-phosphonate-A 214 (AC)20 LNA-A LNA-(5m)C 13 S isomer OH 215 (AC)20 LNA-A LNA-(5m)C 20 S isomer OH 216 (AC)20 LNA-A LNA-(5m)C 20 S isomer Vinyl-phosphonate-A

Examples 217-234

[0165] The effect of sequence length, LNA incorporation, stereochemical modification and 5' modification was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above in Examples 175-216, except that the oligonucleotides were prepared by a modified method using a dinucleotide building block consisting of an A unit and a C unit connected by a stereochemically defined phosphorothioate linkage as follows:

##STR00087##

[0166] With reference to FIGS. 10, 11A and 11B, the dinucleotide building blocks 11R and 11S were prepared as follows:

[0167] Preparation of compound 10-2: To a solution of 10-1 (50.0 g, 74.0 mmol) in 500 mL of dry dioxane with an inert atmosphere of nitrogen was added levulinic acid (51.5 g, 44.4 mol) dropwise at room temperature. Then the dicyclohexylcarbodiimide (45.7 g, 0.2 mol) and 4-dimethylaminopyridine (4.6 g, 37.0 mmol) were added in order at room temperature. The resulting solution was stirred at room temperature for 5 h and diluted with 3000 mL of dichloromethane and filtered. The organic phase was washed with 2.times.1000 mL of 2% aqueous sodium bicarbonate and 1.times.1000 mL of water respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. 52.0 g (crude) of 10-2 was obtained as a white solid and used for next step without further purification. ESI-LCMS: m/z 774 [M+H].sup.+.

[0168] Preparation of compound 10-3: To a solution of 10-2 (52.0 g, 67.0 mmol) was dissolved in 400 mL dichloromethane with an inert atmosphere of nitrogen was added p-toluenesulfonic acid (51.5 g, 0.4 mol) dropwise at 0.degree. C. The resulting solution was stirred at 0.degree. C. for 0.5 h and diluted with 2000 mL of dichloromethane and washed with 2.times.1000 mL of saturated aqueous sodium bicarbonate and 1.times.1000 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure and the residue was purified by silica gel column chromatography (SiO.sub.2, dichloromethane:methanol=30:1) to give 10-3 (32.0 g, 80% over two steps) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.05 (s, 1H), 8.20-7.91 (m, 4H), 7.60-7.49 (m, 4H), 5.57 (m, 2H), 5.32 (d, J=10.8 Hz, 1H), 4.88 (s, 1H), 4.49 (s, 1H), 4.18 (s, 1H), 3.91-3.78 (m, 5H), 2.74-2.69 (m, 4H), 2.59-2.49 (m, 7H), 2.10 (s, 5H), 2.06 (s, 4H), 1.74-1.49 (m, 3H), 1.26-1.02 (m, 3H). ESI-LCMS: m/z 472 [M+H].sup.+.

[0169] Preparation of compound 10-4: To a solution of 10-3 (28.0 g, 59.4 mmol) in 300 mL of acetonitrile with an inert atmosphere of nitrogen was added 8-3a (50.0 g, 56.3 mmol) and ETT (7.9 g, 59.4 mmol) in order at 0.degree. C. The resulting solution was stirred for 2 h at room temperature. Then the mixture was filtered and used for next step without further purification. ESI-LCMS: m/z 1258 [M+H].sup.+.

[0170] Preparation of compounds 10-5 and 10-6: To a solution of 10-4 (70.9 g, 56.3 mmol) in 300 mL of acetonitrile with an inert atmosphere of nitrogen was added pyridine (17.8 g, 225.2 mmol) and 5-amino-3H-1,2,4-dithiazole-3-thione (16.9 g, 112.6 mmol) in order at room temperature. The reaction solution was stirred for 30 minutes at room temperature. The resulting solution was filtered and concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in a mixture of 10-5 and 10-6. The fractions were diluted with 3000 mL of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by SFC with the following conditions: CHIRAL CEL OD-H/SFC 20 mm*250 mmL Sum (Phase A: CO.sub.2; Phase B: 50% ethanol-50% acetonitrile), Detector, UV 220 nm. The fractions were concentrated until no residual solvent left under reduced pressure. 9.0 g (25.7%) of 10-5 were obtained as a white solid and used to make 11R as described below. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.06 (s, 1H), 11.28 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.20 (m, 2H), 8.05 (d, J=8 Hz, 2H), 7.84 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H), 6.86-6.83 (m, 4H), 6.24 (d, J=6.6 Hz, 1H), 5.66 (s, 2H), 5.45-5.43 (m, 1H), 5.10-5.03 (m, 2H), 4.82-4.76 (m, 1H), 4.60 (s, 1H), 4.50-4.33 (m, 4H), 4.03-3.96 (m, 2H), 3.72 (s, 6H), 3.41-3.35 (m, 7H), 3.03-3.00 (m, 2H), 2.75-2.72 (m, 2H), 2.56-2.53 (m, 2H), 2.08-2.05 (m, 6H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=67.02. ESI-LCMS: m/z 1290 [M+H].sup.+. 15.0 g (42.8%) of 10-6 were obtained as a white solid and used to make 11S as described below. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.05 (s, 1H), 11.26 (s, 1H), 8.63 (d, J=24 Hz, 2H), 8.-7.96 (m, 4H), 7.76 (s, 1H), 7.67-7.39 (m, 8H), 7.28-7.19 (m, 7H), 6.86 (d, J=7.2 Hz, 4H), 6.24 (d, J=6.4 Hz, 1H), 5.76 (s, 1H), 5.63 (s, 1H), 5.43-5.41 (m, 1H), 5.12 (m, 1H), 4.97 (s, 1H), 4.82-4.79 (m, 1H), 4.57-4.49 (m, 3H), 4.27-4.25 (m, 2H), 4.07-4.03 (m, 2H), 3.72 (s, 6H), 3.44-3.36 (m, 6H), 2.96 (m, 2H), 2.74-2.71 (m, 2H), 2.55-2.53 (m, 2H), 2.08 (s, 3H), 1.94 (s, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=66.58. ESI-LCMS: m/z 1290 [M+H].sup.+.

[0171] Preparation of compound 11-1: To a solution of 10-5 (10.0 g, 7.7 mmol) in 100 mL acetonitrile with an inert atmosphere of nitrogen was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3:2) at 0.degree. C. The resulting solution was stirred for 0.5 h at 0.degree. C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room temperature and stirred for additional 15 min. The solution was diluted with DCM (500 mL) and washed with sat. aq. NH.sub.4Cl twice and washed with brine and dried over Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 11-1 (6.0 g, 65%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.13 (s, 1H), 11.28 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.21 (d, J=8 Hz, 2H), 8.06-7.95 (m, 3H), 7.80 (s, 1H), 7.67-7.48. (m, 8H), 7.40 (d, J=7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (d, J=8 Hz, 1H), 6.04 (d, J=4.0 Hz, 1H), 5.57 (s, 2H), 5.44-5.42 (m, 1H), 5.19-5.17 (m, 2H), 5.10-5.08 (m, 1H), 4.80-4.76 (m, 2H), 4.50 (d, J=5.6 Hz, 1H), 4.37-4.32 (m, 4H), 4.06-3.99 (m, 2H), 3.81 (m, 1H), 3.72 (s, 7H), 3.40-3.36 (m, 8H), 3.03-3.00 (m, 2H), 2.05 (m, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=67.21. ESI-LCMS: m/z 1192 [M+H].sup.+.

[0172] Preparation of compound 11R: To a solution of 11-1 (6.0 g, 5.0 mmol) in 60 mL of dichloromethane with an inert atmosphere of nitrogen was added CEP[N(iPr).sub.2].sub.2 (1.9 g, 6.5 mmol) and DCI (0.6 g, 5.0 mmol) in order at room temperature. The resulting solution was stirred for 1 hours at room temperature and diluted with 1000 mL dichloromethane and washed with 2.times.250 mL of saturated aqueous sodium bicarbonate and 1.times.250 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 11R (5.0 g, 70%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.10 (s, 1H), 11.28 (s, 1H), 8.20 (d, J=8.0 Hz, 2H), 8.04 (d, J=7.2 Hz, 2H), 7.79 (d, J=14 Hz, 2H), 7.67-7.48 (m, 6H), 7.39 (d, J=7.2 Hz, 2H), 7.27-7.18 (m, 7H), 6.85-6.82 (m, 4H), 6.23-6.20 (m, 1H), 5.64 (d, J=6.0 Hz, 1H), 5.44-5.41 (m, 1H), 5.08-5.07 (m, 1H), 4.82-4.77 (m, 1H), 4.56-4.46 (m, 3H), 4.36-4.30 (m, 2H), 4.22 (d, J=7.2 Hz, 1H), 3.98 (m, 1H), 3.89 (m, 1H), 3.71 (s, 7H), 3.59-3.55 (m, 2H), 3.40-3.34 (m, 10H), 3.02-2.98 (m, 2H), 2.77-2.72 (m, 2H), 2.08-2.05 (m, 3H), 1.13-1.08 (m, 12H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=148.71, 148.11, 67.51, 67.44. ESI-LCMS: m/z 1392 [M+H].sup.+.

[0173] Preparation of compound 11-2: To a solution of 10-6 (10.0 g, 7.7 mmol) in 100 mL acetonitrile with an inert atmosphere of nitrogen was added 0.5 M hydrazine hydrate (1.8 g, 37.5 mmol) in pyridine/acetic acid (3:2) at 0.degree. C. The resulting solution was stirred for 0.5 h at 0.degree. C. Then the reaction was added 2,4-pentanedione at once, the mixture was allowed to warm to room temperature and stirred for additional 15 min. The solution was diluted with DCM (500 mL) and washed with sat. aq. NH.sub.4Cl twice and washed with brine and dried over Na.sub.2SO.sub.4. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 11-2 (7.5 g, 80%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.11 (s, 1H), 11.26 (s, 1H), 8.63 (d, J=20 Hz, 2H), 8.20 (d, J=7.2 Hz, 2H), 8.15 (m, 3H), 7.73 (s, 1H), 7.66-7.47. (m, 8H), 7.41 (d, J=7.6 Hz, 2H), 7.32-7.19 (m, 10H), 6.85 (m, 5H), 6.24 (m, 1H), 5.99 (s, 1H), 5.54 (s, H), 5.41 (m, 1H), 5.10 (m, 1H), 4.79-4.75 (m, 1H), 4.57-4.49 (m, 3H), 4.30-4.24 (m, 4H), 4.02 (m, 2H), 3.85 (m, 1H), 3.72 (s, 7H), 3.38-3.35 (m, 7H), 2.95 (m, 2H), 1.98 (m, 3H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=66.79. ESI-LCMS: m/z 1192 [M+H].sup.+.

[0174] Preparation of compound 11S: To a solution of 11-2 (7.0 g, 5.0 mmol) in 70 mL of dichloromethane with an inert atmosphere of nitrogen was added CEP[N(iPr).sub.2].sub.2 (2.0 g, 6.5 mmol) and DCI (0.6 g, 5.0 mmol) in order at room temperature. The resulting solution was stirred for 1 hours at room temperature and diluted with 1000 mL dichloromethane and washed with 2.times.250 mL of saturated aqueous sodium bicarbonate and 1.times.250 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated until no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/1 increasing to CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0 within 20 min, the eluted product was collected at CH.sub.3CN/H.sub.2O (0.5% NH.sub.4HCO.sub.3)=1/0; Detector, UV 254 nm. This resulted in 11S (6.3 g, 70%) as a white solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.=13.10 (s, 1H), 11.27 (s, 1H), 8.65 (s, 1H), 8.61 (s, 1H), 8.19 (m, 2H), 8.02 (d, J=7.2 Hz, 2H), 7.76-7.73 (m, 1H), 7.66-7.47 (m, 6H), 7.40 (d, J=7.2 Hz, 2H), 7.28-7.19 (m, 7H), 6.86-6.85 (m, 4H), 6.24 (d, J=6.8 Hz, 1H), 5.62 (m, 1H), 5.43-5.41 (m, 1H), 5.10 (s, 1H), 4.84-4.78 (m, 1H), 4.66-4.49 (m, 3H), 4.30-4.18 (m, 3H), 4.04-3.95 (m, 2H), 3.83-3.77 (m, 1H), 3.72 (s, 7H), 3.62-3.54 (m, 2H), 3.44-3.32 (m, 6H), 2.96-2.92 (m, 2H), 2.77-2.72 (m, 2H), 1.98-1.97 (m, 3H), 1.12-1.11 (m, 12H). .sup.31P-NMR (162 MHz, DMSO-d.sub.6) .delta.=148.53, 148.09, 67.04. ESI-LCMS: m/z 1392 [M+H].sup.+.

[0175] As in Examples 175-216, the modified method also used a longer coupling time (8 min) and a greater number of equivalents of amidites (8 equivalents). Table 10 summarizes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothioate (PS) linkages, and 5' modification for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00010 TABLE 10 No. Length A C PS Modification 5'-Modification 217 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5; 2'-OMeApsR(5m)lnC OH 218 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC OH 219 (AC)19 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC OH 220 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC OH 221 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20; 2'-OMeApsR(5m)lnC OH 222 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5; 2'-OMeApsR(5m)lnC Vinyl-phosphonate-A 223 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC Vinyl-phosphonate-A 224 (AC)19 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC Vinyl-phosphonate-A 225 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsR(5m)lnC Vinyl-phosphonate-A 226 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20; 2'-OMeApsR(5m)lnC Vinyl-phosphonate-A 227 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5; 2'-OMeApsS(5m)lnC.sup. OH 228 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC.sup. OH 229 (AC)19 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC.sup. OH 230 (AC)20 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC.sup. OH 231 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20; 2'-OMeApsS(5m)lnC .sup. OH 232 (AC)17 2'-OMe-A 2'-OMe-(5m)C 5; 2'-OMeApsS(5m)lnC.sup. Vinyl-phosphonate-A 233 (AC)18 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC.sup. Vinyl-phosphonate-A 234 (AC)19 2'-OMe-A 2'-OMe-(5m)C 6; 2'-OMeApsS(5m)lnC.sup. Vinyl-phosphonate-A

Examples 235-240

[0176] The effect of branching was evaluated by preparing a series of phosphorothioated oligonucleotides having a branched doubler design in which two of the oligonucleotides are attached to one another via a linking group. An example of a phosphorothioated oligonucleotide having a doubler design is illustrated in FIG. 1. Table 11 summarizes the sequence length, alternating A and C units, and 5' modification for the resulting exemplified phosphorothioated oligonucleotides.

TABLE-US-00011 TABLE 11 No. Length A C 5'-Modification 235 (AC)9-(5m)lnC LNA-A LNA-(5m)C 5' OH, 19mer 236 (AC)15-(5m)lnC LNA-A LNA-(5m)C 5' OH, 31mer 237 (AC)20-(5m)lnC LNA-A LNA-(5m)C 5' OH, 41mer 238 (AC)9-(5m)mC 2'-OMe-A 2'-OMe-(5m)C 5' OH, 19mer 239 (AC)15-(5m)mC 2'-OMe-A 2'-OMe-(5m)C 5' OH, 31mer 240 (AC)20-(5m)mC 2'-OMe-A 2'-OMe-(5m)C 5' OH, 41mer

Examples 241-246

[0177] The effect of branching was evaluated by preparing a series of phosphorothioated oligonucleotides having a branched trebler design in which three phosphorothioated oligonucleotides are attached to one another via a linking group. An example of a phosphorothioated oligonucleotide having a trebler design is illustrated in FIG. 2. Table 12 summarizes the sequence length, alternating A and C units, and 5' modification for the resulting exemplified phosphorothioated oligonucleotides.

TABLE-US-00012 TABLE 12 No. Length A C 5'-Modification 241 (AC)10-TREB-(5m)mC LNA-A LNA-(5m)C 5' OH, 31mer 242 (AC)13-TREB-(5m)mC LNA-A LNA-(5m)C 5' OH, 40mer 243 (AC)15-TREB-(5m)mC LNA-A LNA-(5m)C 5' OH, 46mer 244 (AC)10-TREB-(5m)mC 2'- 2'-OMe- 5' OH, 31mer OMe-A (5m)C 245 (AC)13-TREB-(5m)mC 2'- 2'-OMe- 5' OH, 40mer OMe-A (5m)C 246 (AC)15-TREB-(5m)mC 2'- 2'-OMe- 5' OH, 46mer OMe-A (5m)C

Examples 247-252

[0178] The effect of amido-bridge nucleic acid (AmNA-(N-Me)) modification and spirocyclopropylene-bridged nucleic acid (scp-BNA) modification was evaluated by preparing a series of modified phosphorothioated oligonucleotides. The AmNA-N-Me 6-N-benzoyladenosine (A.sup.Bz), 4-N-benzoyl-5-methyl cytidine were obtained from Luxna Biotech Co, Ltd and scp-BNA phosphoramidite monomers with 6-N-benzoyladenosine (A.sup.Bz), 4-N-benzoyl-5-methyl cytidine were synthesized by using the procedure described in the references Takao Yamaguchi, Masahiko Horiba and Satoshi Obika; Chem. Commun. 2015, 51, 9737-9740, and Masahiko Horiba, Takao Yamaguchi, and Satoshi Obika; Journal of Organic Chemistry, 2016, 81, 11000-11008. The monomers were dried in a vacuum desiccator with desiccant (P.sub.2O.sub.5, at room temperature for 24 hours). For the AmNA and scp-BNA modifications, the synthesis was carried out on a 1 .mu.M scale in a 3' to 5' direction with the phosphoramidite monomers diluted to a concentration of 0.12 M in anhydrous CH.sub.3CN in the presence of 0.3 M 5-(benzylthio)-1H-tetrazole activator (coupling time 16-20 min) to a solid bound oligonucleotide followed by modified capping, oxidation and deprotection to afford the modified oligonucleotides. The stepwise coupling efficiency of all modified phosphoramidites was more than 97%. The DDTT (dimethylamino-methylidene) amino)-3H-1, 2, 4-dithiazaoline-3-thione was used as the sulfur-transfer agent for the synthesis of the oligoribonucleotide phosphorothioates. Oligonucleotide-bearing solid supports were washed with 20% DEA solution in acetonitrile for 15 min then the column was washed thoroughly with AcCN. The support was heated at 65.degree. C. with diisopropylamine:water:methanol (1:1:2) for 5 h in a heat block to cleave from the support and deprotect the base labile protecting groups. Table 13 summarizes the sequence length, alternating A and C units, and 5' modification for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00013 TABLE 13 No. Length A C 5'-Modification 247 (AmAps(5m)AmC)20 AmNA(NMe)-A AmNA(NMe)-(5m)C 5' OH, 40mer, All AmNA 248 (ScpAps(5m)scpC)20 Scp-BNA-A Scp-BNA-(5m)C 5' OH, 40mer, All Scp-BNA 249 AmAps(5m)mC (AC)19 2'-OMe-A 2'-OMe-(5m)C One AmNA at 5'-end, 40mer 250 (AC)19-mAps(5m)AmC 2'-OMe-A 2'-OMe-(5m)C One AmNA at 3'-end, 40mer 251 ScpAps(5m)mC (AC)19 2'-OMe-A 2'-OMe-(5m)C One ScpA at 5'-end, 40mer 252 (AC)19-mAps(5m)ScpC 2'-OMe-A 2'-OMe-(5m)C One ScpC at 3'-end, 40mer

Examples 253-256

[0179] The effect of attaching a targeting ligand was evaluated by preparing a series of modified phosphorothioated oligonucleotides. The targeting ligands, cholesterol and a tocopherol (vitamin E), were attached to phosphorothioated oligonucleotides via an alkylene oxide linking group (tetraethylene glycol, TEG) in accordance with the methods described above in Examples 1-116 except that solid phase synthesis was conducted on cholesterol and tocopherol supports with attachment by a TEG linker for 3'-conjugation while final coupling of the phosphoramidite provided the 5'-conjugated oligonucleotides. FIGS. 3A-D and Table 14 illustrate the structures and summarize the sequence length, alternating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00014 TABLE 14 No. Length A C Targeting Ligand 253 Chol-(AC)20 2'-OMe-A 2'-OMe-(5m)C 5'-Cholesterol, 40mer 254 (AC)20-Chol 2'-OMe-A 2'-OMe-(5m)C 3'-Cholesterol, 40mer 255 Toco-(AC)20 2'-OMe-A 2'-OMe-(5m)C 5'-Tocopherol, 40mer 256 (AC)20-Toco 2'-OMe-A 2'-OMe-(5m)C 3'-Tocopherol, 40mer

Examples 257-268

[0180] The effect of attaching a targeting ligand was evaluated by preparing a series of modified phosphorothioated oligonucleotides. N-acetylgalactosamine (GalNac) was attached to phosphorothioated oligonucleotides via various linking groups by reacting with a GalNAc building block as illustrated in FIG. 4A. GalNAc-3 and GalNAc-5 amidites were purchased from AM Chemicals LLC and Glen Research respectively. GalNAc-4 and GalNAc-6 were obtained from AM Chemicals LLC. Table 15 illustrates the structures and summarizes the sequence length, alternating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides.

TABLE-US-00015 TABLE 15 No. Length A C Targeting Ligand 257 GalNAc3ps-GalNAc3ps- 2'-OMe-A 2'-OMe-(5m)C 5'-GalNAc-3; GalNAc3po-(AC)20 40mer 258 (AC)20-po-GalNAc3ps- 2'-OMe-A 2'-OMe-(5m)C 3'-GalNAc-3; GalNAc3ps-GalNAc3 40mer 259 GalNAc3ps-GalNAc3ps- LNA-A LNA-(5m)C 5'-GalNAc-3; GalNAc3po-(AC)20 40mer 260 (AC)20-po-GalNAc3ps- LNA-A LNA-(5m)C 3'-GalNAc-3; GalNAc3ps-GalNAc3 40mer 261 GalNAc4ps-GalNAc4ps- 2'-OMe-A 2'-OMe-(5m)C 5'-GalNAc-4; GalNAc4po-(AC)20 40mer 262 (AC)20-po-GalNAc4ps- 2'-OMe-A 2'-OMe-(5m)C 3'-GalNAc-4; GalNAc4ps-GalNAc4 40mer 263 GalNAc4ps-GalNAc4ps- LNA-A LNA-(5m)C 5'-GalNAc-4; GalNAc4po-(AC)20 40mer 264 (AC)20-po-GalNAc4ps- LNA-A LNA-(5m)C 3'-GalNAc-4; GalNAc4ps-GalNAc4 40mer 265 GalNAc5ps-GalNAc5ps- 2'-OMe-A 2'-OMe-(5m)C 5'-GalNAc-5; GalNAc5po-(AC)20 40mer 266 (AC)20-po-GalNAc5ps- 2'-OMe-A 2'-OMe-(5m)C 3'-GalNAc-5; GalNAc5ps-GalNAc5 40mer 267 GalNAc5ps-GalNAc5ps- LNA-A LNA-(5m)C 5'-GalNAc-5; GalNAc5po-(AC)20 40mer 268 (AC)20-po-GalNAc5ps- LNA-A LNA-(5m)C 3'-GalNAc-5; GalNAc5ps-GalNAc5 40mer

Examples 269-272

[0181] The effect of attaching a targeting ligand was evaluated by preparing a series of modified phosphorothioated oligonucleotides. N-acetylgalactosamine (GalNAc) was attached to phosphorothioated oligonucleotides via a linking group by preparing the starting oligonucleotides, forming a precursor by attaching a C.sub.6--NH.sub.2 linking group at the 5'-terminal, and then reacting the precursor with a GalNAc ester. The sequences were synthesized at 10 .mu.mol scale using universal support (Loading 65 .mu.mol/g). The C.sub.6--NH.sub.2 linker was attached to the 5'-terminal to form the precursor by reacting with 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N, N-diisopropyl)-phosphoramidite in 0.1 M acetonitrile was a coupling time of 10 min. The phosphorothioated oligonucleotide-bearing solid supports were heated at room temperature with aqueous ammonia/methylamine (1:1) solution for 3 h in a shaker to cleave from the support and deprotect the base labile protecting groups.

[0182] After IEX purification and desalting, the precursors were dissolved in 0.2 M sodium bicarbonate buffer, pH 8.5 (0.015 mM) and 5-7 mol equivalent of GalNAc ester dissolved in DMSO was added. The structures of the GalNAc esters are illustrated in FIG. 4B. The reaction mixture was stirred at room temperature for 4 h. The sample was analyzed to confirm the absence of precursor. To this aqueous ammonia (28 wt. %) was added (5.times. reaction volume) and stirred at room temperature for 2-3 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was dissolved in water and purified by HPLC on a strong anion exchange column.

[0183] Table 16 illustrates the structures and summarizes the sequence length, alternating A and C units, and targeting ligands for the resulting exemplified modified phosphorothioated oligonucleotides. GalNAc-1 and GalNAc-2 were prepared in accordance with procedures described in J. Med. Chem. 2016 59(6) 2718-2733 and WO 2017/021385A1, respectively

TABLE-US-00016 TABLE 16 No. Length A C Targeting Ligand 269 GalNAc1-NH- 2'-OMe-A 2'-OMe-(5m)C 5'-GalNAc-1; C6-po-(AC)20 40mer 270 GalNAc1-NH- LNA-A LNA-(5m)C 5'-GalNAc-1; C6-po-(AC)20 40mer 271 GalNAc2-NH- 2'-OMe-A 2'-OMe-(5m)C 5'-GalNAc-2; C6-po-(AC)20 40mer 272 GalNAc2-NH- LNA-A LNA-(5m)C 5'-GalNAc-2; C6-po-(AC)20 40mer

Examples 273-281

[0184] The effect of 5' modification was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above, except that the following 5'-ethyl phosphonate (EP) building block was utilized to incorporate 5'-ethyl phosphonate endcaps:

##STR00088##

[0185] With reference to FIG. 5, the 5'-Ethyl phosphonate building block was prepared as follows:

[0186] To a mixture of 5-1 (3.0 g, 4.35 mmol, 1 eq) in MeOH (5 mL) was added Pd/C (900 mg, 72.50 umol, 10% purity) under N.sub.2. The suspension was degassed under vacuum and purged with H.sub.2 for several times. The mixture was stirred under H.sub.2 (15 psi) at 20.degree. C. for 12 hr. .sup.1H NMR and .sup.31P NMR showed 5-1 was consumed completely to form desired product. The reaction mixture was filtered and concentrated to give [2-[(2R,3R,4R,5R)-5-(6-benzamidopurin-9-yl)-3-hydroxy-4-methoxy-tetr- ahydrofuran-2-yl]ethyl-(2,2-dimethylpropanoyloxymethoxy)phosphoryl]oxymeth- yl 2,2-dimethylpropanoate, compound 5-2, (2.8 g, 4.05 mmol, 93.06% yield) as a white solid. .sup.1H NMR (400 MHz, CD.sub.3OD) .delta.=8.75 (s, 1H), 8.53 (s, 1H), 8.08 (d, J=7.5 Hz, 2H), 7.68-7.61 (m, 1H), 7.59-7.50 (m, 2H), 7.23-7.17 (m, 1H), 7.15-7.10 (m, 1H), 6.15 (d, J=4.2 Hz, 1H), 5.71-5.61 (m, 4H), 4.57 (t, J=4.7 Hz, 1H), 4.41 (t, J=5.3 Hz, 1H), 4.09-3.99 (m, 1H), 3.49 (s, 3H), 2.16-1.97 (m, 4H), 1.17 (d, J=3.5 Hz, 18H); .sup.31P NMR (162 MHz, CD.sub.3CN) .delta.=32.91 (s, 1P).

[0187] To a solution of 5-2 (2.3 g, 3.33 mmol, 1 eq) in DCM (30 mL) was added 1H-imidazole-4,5-dicarbonitrile (589.06 mg, 4.99 mmol, 1.5 eq) followed by 3-bis(diisopropylamino)phosphanyloxypropanenitrile (2.00 g, 6.65 mmol, 2.11 mL, 2.0 eq), and the mixture was stirred at 25.degree. C. for 2 hr. TLC indicated that majority of 5-2 was consumed and one major new spot was formed. The reaction mixture was washed with H.sub.2O (50 mL*2) and brine (50 mL*2), dried over Na.sub.2SO.sub.4, and concentrated to give a residue. The residue was purified by Flash-C-18 column using the following conditions: Column, C18 silica gel; mobile phase, water and acetonitrile (0%-70% acetonitrile) to give [2-[(2R,3R,4R,5R)-5-(6-benzamidopurin-9-yl)-3-[2-cyanoethoxy-(diisopropyl- amino)phosphanyl]oxy-4-methoxy-tetrahydrofuran-2-yl]ethyl-(2,2-dimethylpro- panoyloxymethoxy)phosphoryl]oxymethyl 2,2-dimethylpropanoate, (5'-EP building block), (1.4 g, 1.53 mmol, 45.88% yield, 97.2% purity) as a light yellow solid. LCMS (ESI): RT=3.785 min, m/z calcd. for C.sub.40H.sub.60N.sub.7O.sub.12P.sub.2 892.37 [M+H].sup.+, found 892.0. HPLC: Mobile Phase: 10 mMol NH4Ac in water (solvent C) and acetonitrile (solvent D), sing the elution gradient 80%-100% (solvent D) over 10 minutes and holding at 100% for 5 minutes at a flow rate of 1.0 mL/minute; Column30: Waters Xbridge C18 3.5 um, 150*4.6 mm; .sup.1H NMR (400 MHz, CD.sub.3CN) .delta.=.delta.=9.40 (s, 1H), 8.67 (s, 1H), 8.27 (d, J=1.8 Hz, 1H), 8.01 (d, J=7.5 Hz, 2H), 7.68-7.60 (m, 1H), 7.58-7.52 (m, 2H), 6.05 (dd, J=5.1, 8.4 Hz, 1H), 5.62-5.54 (m, 4H), 4.68 (t, J=1.8, 5.0 Hz, 1H), 4.64-4.55 (m, 1H), 4.25-4.11 (m, 1H), 3.93-3.66 (m, 4H), 3.40 (d, J=19.2 Hz, 3H), 2.75-2.67 (m, 2H), 2.14-1.95 (m, 4H), 1.25-1.20 (m, 12H), 1.15-1.11 (m, 18H); .sup.31P NMR (162 MHz, CD.sub.3CN) .delta.=149.95, 149.27, 32.29, 32.05.

[0188] Table 17 summarizes the sequence length, alternating A and C units, the number and type (R or S) of stereochemically defined phosphorothioate (PS) linkages and LNA modification for the resulting exemplified 5'-EP endcapped modified phosphorothioated oligonucleotides.

TABLE-US-00017 TABLE 17 No. Length A C PS Modification Comments 273 (AC)20 2'0-Me-A 2'-OMe-(5m)C PS 40mer 274 (AC)20 LNA-A LNA-(5m)C PS 40mer 275 (AC)20 2'-OMe-A 2'-OMe-(5m)C 20; 2'-OMeApsR(5m)lnC 20 R isomer, 41mer 276 (AC)20 2'-OMe-A 2'-OMe-(5m)C 19; 2'-OMeApsR(5m)lnC 19 R isomer, 40mer 277 (AC)20 2'-OMe-A LNA-(5m)C PS 40mer Alternate 2'-OMe/LNA 278 (AC)20 2'-OMe-A 2'-OMe-(5m)C PS Every 3rd base is LNA LNA-A LNA-(5m)C 279 (AC)20 2'-OMe-A 2'-OMe-(5m)C PS Every 4th base is LNA LNA-(5m)C 280 (AC)20 2'-OMe-A 2'-OMe-(5m)C PS 5 LNA in the middle LNA-(5m)C 281 (AC)20 2'-OMe-A 2'-OMe-(5m)C PS 10 LNA in the middle LNA-A LNA-(5m)C

Examples 282-298

[0189] FIG. 6A describes compound nos. 282-295, which were prepared in accordance with the methods described above.

Examples 296-304

[0190] The effect of sequence length, LNA incorporation, and RNA incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 18.

TABLE-US-00018 TABLE 18 No. Length A C RNA Modification 296 (AC)20 2'-OMe-A LNA-(5m)C 5 RNA 297 (AC)20 2'-OMe-A 2'-OMe-(5m)C 7 RNA 298 (AC)20 2'-OMe-A 2'-OMe-(5m)C 14 RNA 299 (AC)15 2'-OMe-A 2'-OMe-(5m)C 5 RNA 300 (AC)15 2'-OMe-A 2'-OMe-(5m)C 10 RNA 301 (AC)20 LNA-A LNA-(5m)C 7 RNA 302 (AC)20 LNA-A LNA-(5m)C 14 RNA 303 (AC)15 LNA-A LNA-(5m)C 5 RNA 304 (AC)15 LNA-A LNA-(5m)C 10 RNA

Examples 305-313

[0191] The effect of sequence length, LNA incorporation, and backbone was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 19.

TABLE-US-00019 TABLE 19 No. Length A C Backbone 305 (AC)20 LNA-A LNA-(5m)C 40mer; 20 PO; 19 PS 306 (AC)20 LNA-A LNA-(5m)C 40mer; 7 PO; 32 PS 307 (AC)20 LNA-A LNA-(5m)C 40mer; 14 PO; 25 PS 308 (AC)15 LNA-A LNA-(5m)C 30mer; 5 PO; 24 PS 309 (AC)15 LNA-A LNA-(5m)C 30mer; 10 PO; 19 PS 310 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 7 PO; 32 PS 311 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 14 PO; 25 PS 312 (AC)15 2'-OMe-A 2'-OMe-(5m)C 30mer; 5 PO; 24 PS 313 (AC)15 2'-OMe-A 2'-OMe-(5m)C 30mer; 10 PO; 19 PS

Examples 314-322

[0192] The effect of sequence length, LNA incorporation, and ethyl phosphonate endcap was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 20.

TABLE-US-00020 TABLE 20 No. Length A C Modification 314 (AC)20 2'-OMe-A LNA-(5m)C Ethyl-phosphonate-A 315 (AC)20 2'-OMe-A 2'-OMe-(5m)C 19 R dimer block; Ethyl-phosphonate-A 316 (AC)20 2'-OMe-A 2'-OMe-(5m)C 5 LNA, Ethyl-phosphonate-A 317 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; Every 4.sup.th base is LNA LNA-(5m)C Ethyl-phosphonate-A 318 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; Every 3rd base is LNA LNA-(5m)C Ethyl-phosphonate-A 319 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; Ethyl-phosphonate-A 320 (AC)18 2'-OMe-A LNA-(5m)C 36mer; Alternate 2'-OMe and LNA 321 (AC)20 2'-OMe-A 2'-OMe-(5m)C 36mer; Every 3rd base is LNA LNA-A LNA-(5m)C 322 (AC)20 2'-OMe-A LNA-(5m)C 36mer; Every 4.sup.th base is LNA

Examples 323-324

[0193] The effect of LNA incorporation and phosphate endcap was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 21.

TABLE-US-00021 TABLE 21 No. Length A C Endcap 323 (AC)20 LNA-A LNA-(5m)C 5'-Phosphate 324 (AC)20 2'-OMe-A 2'-OMe-(5m)C 5'-Phosphate

Examples 325-338

[0194] The effect of level of LNA incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 22.

TABLE-US-00022 TABLE 22 No. Length A C Modification 325 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 75% 2'-OMe, LNA-A LNA-(5m)C 25% LNA 326 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 67.5% 2'-OMe LNA-A LNA-(5m)C 37.5% LNA 327 (AC)20 2'-O-MOE-A 2'-O-MOE-(5m)C 40mer; 75% 2'-O-MOE, LNA-A LNA-(5m)C 25% LNA 328 (AC)20 2'-O-MOE-A 2'-O-MOE-(5m)C 40mer; 67.5% 2'-O-MOE LNA-A LNA-(5m)C 37.5% LNA 329 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 75% LNA, LNA-A LNA-(5m)C 25% 2'-OMe (10mer block) 330 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer; 50% LNA; 50% LNA-A LNA-(5m)C 2'-OMe(20mer block) 331 (AC)20 2'-O-OE-A 2'-O-MOE-(5m)C 40mer; 75% LNA, LNA-A LNA-(5m)C 25% 2'-O-MOE (10mer block) 332 (AC)20 2'-O-MOE-A 2'-O-MOE-(5m)C 40mer; 50% LNA; 50% LNA-A LNA-(5m)C 2'-O-MOE (20mer block) 333 (AC)20 LNA-A LNA-(5m)C 40mer; 7 DNA DNA-A DNA-(5m)C 334 (AC)20 LNA-A LNA-(5m)C 40mer; 14 DNA DNA-A DNA-(5m)C 335 (AC)20 LNA-A LNA-(5m)C 30mer; 5 DNA DNA-A DNA-(5m)C 336 (AC)20 LNA-A LNA-(5m)C 30mer; 10 DNA DNA-A DNA-(5m)C 337 (AC)20 LNA-A LNA-(5m)C 40mer; 50% LNA; 50% DNA-A DNA-(5m)C DNA (10mer DNA block) 338 (AC)20 LNA-A LNA-(5m)C 40mer; 50% LNA; 50% DNA-A DNA-(5m)C DNA (20mer DNA block)

Examples 339-340

[0195] The effect of ScpA and AmNA incorporation was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 23.

TABLE-US-00023 TABLE 23 No. Length A C Modification 339 (AC)20 2'-OMe-A LNA-(5m)C One ScpA at 3'-end, 40mer 340 (AC)20 2'-OMe-A LNA-(5m)C One AmNA at 3'-end, 40mer

Examples 341-346

[0196] The effect of GNA and UNA incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 24.

TABLE-US-00024 TABLE 24 No. Length A C 341 (AC)20 LNA-A GNA-(5m)C 342 (AC)20 GNA-A 2'-OMe-(5m)C 343 (AC)20 2'-OMe-A GNA-(5m)C 345 (AC)20 UNA-A UNA-(5m)C 346 (AC)20 UNA-A UNA-(5m)C

Examples 347-350

[0197] The effect of attaching a targeting ligand was evaluated by preparing a series of modified phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 25.

TABLE-US-00025 TABLE 25 No. Length A C Modification 347 GalNAc5ps-GalNAc5ps- 2'-OMe-A LNA-(5m)C 40mer, alternate GalNAc5po-(AC)20 2'-OMe-LNA; 5'-GalNac 348 GalNAc5ps-GalNAc5ps- 2'-OMe-A 2'-OMe-(5m)C 40mer, every GalNAc5po-(AC)20 LNA-(5m)C 4.sup.th base is LNA; 5'-GalNac 349 GalNAc5ps-GalNAc5ps- 2'-OMe-A 2'-OMe-(5m)C 40mer, 5 LNA; GalNAc5po-(AC)20 LNA-A 5'-GalNac 350 GalNAc5ps-GalNAc5ps- 2'-OMe-A LNA-(5m)C 40mer, alternate GalNAc5po-(AC)20 2'-OMe-LNA 5 RNA; 5'-GalNac

Examples 351-355

[0198] The effect of attaching a cholesterol or tocopherol targeting ligand was evaluated by preparing a series of modified phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 26.

TABLE-US-00026 TABLE 26 No. Length A C Targeting Ligand 351 Chol-(AC)20 2'-OMe-A (5m)-Propargyl-C 3'-Cholesterol, 40mer 352 (AC)20- 2'-OMe-A (5m)-Propargyl-C 3'-Palmitoyl, 40mer Chol 353 (AC)20 3'-OMe-A 3'-OMe-(5m)C 3'-OMe, 40mer 354 (AC)20- 3'-OMe-A 3'-OMe-(5m)C 3'-cholesterol, Chol 40mer 355 (AC)20- 3'-OMe-A 3'-OMe-(5m)C 3'-Tocopherol, Toco 40mer

Examples 356-358

[0199] The effect of endcap structure (methyl, allyl, cytosine) was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 27.

TABLE-US-00027 TABLE 27 No. Length A C Endcap 356 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 4'-Me at 5'end 357 (AC)20 2'-OMe-A LNA-A 40mer, 5 3'-C-allyl-A 3'-C-allyl-A LNA-(5m)C 358 (AC)20 LNA-A LNA-(5m)C 40mer, Cy-5 at 3'-end

Examples 359-362

[0200] The effect of including G and U bases was evaluated by preparing phosphorothioated oligonucleotides in accordance with the methods described above. The compounds are summarized in Table 28.

TABLE-US-00028 TABLE 28 No. Length Base 1 Base 2 Modification 359 (AG)20 2'-OMe-A 2'-OMe-G AG repeat 360 (GA)20 2'-OMe-G 2'-OMe-A GA repeat 361 (CA)20 2'-OMe-(5m)C 2'-OMe-A CA repeat 362 (AU)20 2'-OMe-A 2'-OMe-U AU repeat

Examples 363-376

[0201] The effect of sequence length was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The compounds are summarized in Table 29.

TABLE-US-00029 TABLE 29 No. Length A C Modification 363 (AC)14 2'-OMe-A 2'-OMe-C 28mer 364 (AC)15-A 2'-OMe-A 2'-OMe-(5m)C 31mer 365 (AC)17 2'-OMe-A 2'-OMe-(5m)C 34mer 366 (AC)18-A 2'-OMe-A 2'-OMe-(5m)C 37mer 367 (AC)20 2'-OMe-A 2'-OMe-C 20mer 368 (AC)9 2'-OMe-A 2'-OMe-(5m)C 18mer 369 (AC)9-A 2'-OMe-A 2'-OMe-(5m)C 19mer 370 (AC)10 2'-OMe-A 2'-OMe-(5m)C 20mer 371 (AC)9-A LNA-A LNA-(5m)C 19mer 372 (AC)9 LNA-A LNA-(5m)C 18mer 373 (AC)15 LNA-A LNA-(5m)C 30mer 374 (AC)12-A 2'-OMe-A 2'-OMe-(5m)C 25mer 375 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer, 5 S isomers 376 (AC)10 LNA-A LNA-(5m)C 20mer

Examples 377-380 and 384

[0202] The effect of RNA incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 30.

TABLE-US-00030 TABLE 30 No. Length A C Modification 377 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 4 RNA Ribo-A 378 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 3 RNA Ribo-A 379 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 2 RNA Ribo-A 380 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer, 4mer UNA-A UNA-(5m)C blocks of 2'-OMe and UNA 384 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 1 RNA Ribo-A

Examples 381-383

[0203] The effect of 4etl (4-ethyl-LNA) incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The 4etl monomers were prepared in accordance with known methods (Seth, P. P., J. Org. Chem. 2010,75, (5), 1569-1581). The results are summarized in Table 31.

TABLE-US-00031 TABLE 31 No. Length A C Modification 381 (AC)20 4etl-A 4etl-(5m)C 40mer, 100% 4etl 382 (AC)20 2'-OMe-A 4etl-(5m)C 40mer, 50% 4etl 383 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer, 25% 4etl 4etl-(5m)C

Examples 385-389

[0204] The effect of nmLNA (N-methyl LNA) A and C incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The nmLNA monomers were obtained from commercial sources (Bio-Synthesis Inc., Lewisville, Tex.). The results are summarized in Table 32.

TABLE-US-00032 TABLE 32 No. Length A C Modification 385 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 1 nmLNA nmLNA-A 386 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 3 nmLNA nmLNA-A 387 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 3 nmLNA nmLNA-A nmLNA (5m)-C 388 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 3 nmLNA nmLNA (5m)-C 389 (AC)20 2'-OMe-A LNA-(5m)C 40mer, 4 nmLNA nmLNA-A nmLNA (5m)-C

Examples 390-392

[0205] The effect of AmNA and Scp-BNA A and C incorporation was evaluated by preparing a series of phosphorothioated oligonucleotides in accordance with the methods described above. The results are summarized in Table 33 (also see Table 23).

TABLE-US-00033 TABLE 33 No. Length A C Modification 390 (AC)20 2'-OMe-A AmNA-(5m)C 40mer, 20 AmNA(50%) 391 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer, Scp-(5m)C 10 scp-BNA (25%) 392 (AC)20 2'-OMe-A 2'-OMe-(5m)C 40mer, Scp-A 5 scp-BNA (12.5%)

Example B1

HBsAG Secretion Assay and Cytotoxicty Assay

[0206] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Secretion Assay) and the cytotoxicity of a number of exemplified modified oligonucleotide compounds was determined as described below and summarized in Tables 34-35 and FIGS. 6A and 6B.

HBsAg Release Assay Protocol

Cell Culture

[0207] HepG2.2.15 cells were maintained in DMEM medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate and 380 ug/ml G418. Cells were maintained at 37.degree. C. in a 5% CO.sub.2 atmosphere.

HBsAg Secretion Assay

[0208] HepG2.2.15 cells were grown in DMEM medium as described above. Cells were plated at a concentration of 45,000 cells/well in collagen-I coated 96 well plates. Immediately after addition of the cells, test compounds are added.

[0209] Selected compounds may also be tested following Lipofectamine.RTM. RNAiMAX transfection. Lipofectamine.RTM. RNAiMAX Transfection Reagent (Thermo Fisher) is used following the manufacturer's instructions.

[0210] The 50% inhibitory concentration (EC.sub.50) and 50% cytotoxic concentration (CC.sub.50; below) were assessed by solubilizing in 1.times.PBS to 100.times. the desired final testing concentration. Each compound was then serially diluted (1:3) up to 8 distinct concentrations to 10.times. the desired final testing concentration in DMEM medium with 10% FBS. A 10 .mu.L sample of the 10.times. compounds in cell culture media was used to treat the HepG2.2.15 cells in a 96-well format. Cells were initially incubated with compounds for 3 days at 37.degree. C. in a 5% CO.sub.2 atmosphere.

[0211] Three days post compound addition/transfection replace media and compound with fresh media/compound with RNAiMax and incubate for a further 3 days for a total incubation time of 6 days. Collect both the cellular supernatant and cell lysate (see below) for quantification of HBsAg.

[0212] Secreted HBsAg was measured quantitatively using HBsAg ELISA kit (Autobio-CL0310).

[0213] The EC.sub.50, the concentration of the drug required for reducing HBsAg secretion by 50% in relation to the untreated cell control value was calculated from the plot of the percentage reduction of the HBsAg level against the drug concentrations using Microsoft Excel (forecast function).

[0214] Set up a parallel set of plates that are to be used for testing compound induced cellular cytotoxicity (see below).

Cytotoxicity Assay

[0215] HepG2.2.15 cells were cultured and treated as above. At Day 6, cellular cytotoxicity was assessed using a cell proliferation assay (CellTiter-Glo Luminescent Cell Viability Assay; Promega) according to the manufacturer's instructions or a suitable alternative.

[0216] The CC.sub.50, the concentration of the drug required for reducing cell viability by 50% in relation to the untreated cell control value was calculated from the plot of the percentage reduction of viable cells against the drug concentrations using Microsoft Excel (forecast function).

TABLE-US-00034 TABLE 34 POTENCY AND CYTOTOXICITY Compound No. EC.sub.50 (.mu.M) CC.sub.50 (.mu.M) 3 B A 6 A B 8 B A 9 A A 10 A A 12 A A 13 B A 18 C A 20 B B 23 B B 26 C A 34 B A 36 B A 38 A A 39 B C 44 A A 45 A A 63 B A 97 B A 98 B A 99 B A 105 B A 106 B A 120 C A 121 B A 122 B A 127 B A 128 D A 129 D A 130 B A 134 A A 142 C A 147 D A 148 D A 149 B A 150 A A 151 D A 152 D A 153 B A 158 B A 159 C A 178 A A 179 A A 180 A A 182 A A 183 A A 184 A A 190 B A 191 B A 192 A A 199 B A 200 C A 201 B A 202 B A 204 B A 205 B A 220 C A 221 A A 223 C A 235 D B 236 D B 237 A B 238 D A 239 D A 240 B A 241 B A 242 A A 243 A A 244 C A 245 D A

TABLE-US-00035 TABLE 35 POTENCY AND CYTOTOXICITY Compound No..sup.1 EC.sub.50 CC.sub.50 6, 274, 283 A B 376 D A 371 D A 372 D A 273, 282 D A 367 C A 368 D A 369 D A 370 D A 345 B A 346 A A 351 D B 352 D B 373 B B 308 C A 239 D A 235 D B 236 D B 237 A B 301 A B 303 B B 305 C A 315 C A 309 D B 297 C A 298 D A 300 D A 312 D A 313 D A 299 D A 304 D A 302 D A 307 D A 375 B A 201 C A 202 C A 203 B A 204 D A 205 D A 353 B A 351 D A 352 D A 178 A A 179 A A 180 C A 182 A A 183 D A 184, 290 A A 177 B A 374 D A 363 D A 364 D A 365 D A 366 D A 238 D A 240 B A 241 B A 242 A A 243 A A 130 A A 380 D A 310 D A 311 D A 254 D A 325 D A 326 D A 327 D A 328 D A 158 B A 150 A A 159 C A 341 D A 342 B A 244 C A 245 C A 343 B A 329 C A 330 B B 331 D A 332 D A 333 B A 334 B A 335 C A 336 C A 337 A B 338 B B 117 B A 118 B A 134, 277, 284 A A 142 C A 190 B A 191 B A 192 B A 210 B A 211 B A 212 B A 218 C A 223 C A 221 A A 127 D A 128 C A 129 C A 120 B A 121 B A 122 A A 181 C A 147 D A 148 D A 149 B A 151 D A 152 D A 153 B A 294 B A 276, 291 A A 275, 295 A B 173, 293 A A 165, 287 B A 167, 289 B A 164, 286 C A 166, 288 A A 171, 280, 292 B A 314 A B 281, 316 A A 296 A A 285 A B 251 A A 356 A A 320 A A 321 A B 322 B A 317 A B 318 B B 319 A B 357 A A 339 A A 252 A A 340 A A 250 A A 359 D A 360 D A 361 D A 362 D A 12 A A 20 B A 38 A A 385 A A 386 A A 387 A A 388 A A 389 A A 376 A A 377 A A 378 A A 379 A A 384 A A 381 A A 382 A A 383 B A 390 A B 391 A B 392 B B .sup.1A number of compounds described herein are referred to by more than a single compound no. as indicated here and elsewhere throughout the disclosure. Potency: A: EC.sub.50 < 30 nM; B: EC.sub.50 .gtoreq. 30 nM and EC.sub.50 < 100 nM; C: EC.sub.50 .gtoreq. 100 nM and EC.sub.50 < 300 nM; D: EC.sub.50 > 300 nM. Cytotoxicity: A: CC.sub.50 .gtoreq. 1000 nM; B: CC.sub.50 < 1000 nM

Example B2

Live Infection Assay

[0217] HepG2-NTCP cells were maintained in DMEM/F12 medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate. Cells were maintained at 37.degree. C. in a 5% CO.sub.2 atmosphere.

[0218] HepG2-NTCP cells were resuspended with above mentioned medium and plated at a concentration of 15,000 cells/well in collagen-I coated 96 well plates. On the second day (day 0), the cells were infected with HBV (purified HBV from HepAD38 cells) at 200 moi (ge) in the presence of 4% PEG8000 and 2% DMSO and incubated at 37.degree. C. overnight. The inoculum was vacuumed and cells were washed three times with DMEM/F12 with 2% FBS before replacing with the HepG2-NTCP culture medium.

[0219] Treat the cells on day 5. On Day 5, the test compounds were diluted 3-fold with Opti-MEM I media and mixed with Lipofectamine.RTM. RNAiMAX transfection reagent following the manufacturer's instructions. After media replacement on Day 8, the test compounds were transfected as described. After incubation for an additional 3 days, the supernatant was harvested and HBsAg was measured by ELISA (Diasino). The cell viability was measured with CellTiter-Glo (Promega).

[0220] The EC50, the concentration of the drug required for reducing HBsAg secretion by 50% in relation to the untreated cell control value, was calculated from the plot of the percent reduction of the HBsAg level against the drug concentrations using the Microsoft Excel forecast function or GraphPad Prism and summarized in Table 36.

TABLE-US-00036 TABLE 36 POTENCY AND CYTOTOXICITY Compound No. EC.sub.50 CC.sub.50 6, 274, 283 A A 273, 282 C A 315 D A 290 A A 184 134, 277, 284 A A 192 A A 221 A A 294 C A 291 A A 276 295 B A 275 173, 293 B A 165, 287 A A 167, 289 B A 164, 286 B A 166, 288 B A 171, 280, 292 B A 314 A A 281, 316 C A 296 A A 285 A A 251 B A 356 A A 320 A A Potency: A: EC.sub.50 < 30 nM; B: EC.sub.50 .gtoreq. 30 nM and EC.sub.50 < 100 nM; C: EC.sub.50 .gtoreq. 100 nM and EC.sub.50 < 300 nM; D: EC.sub.50 > 300 nM. Cytotoxicity: A: CC.sub.50 .gtoreq. 1000 nM; B: CC.sub.50 < 1000 nM

Example B3

HBsAG Secretion Assay for Combinations

[0221] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Secretion Assay) of exemplified modified oligonucleotide compounds in combination with antisense oligonucleotides (ASOs) was determined as described below and summarized in Table 37.

Cell Culture

[0222] HepG2.2.15 cells were maintained in DMEM/F12 medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate. Cells were maintained at 37.degree. C. in a 5% CO.sub.2 atmosphere.

HBsAg Secretion Assay

[0223] HepG2.2.15 cells were grown in DMEM/F12 medium as described above. Cells were seeded at a concentration of 35,000 cells/well in collagen-I coated 96-well plates. Immediately after addition of the cells, add test compounds. Do double transfections on day 0 and 3.

Transfection Method

[0224] Lipofectamine.RTM. RNAiMAX transfection. Lipofectamine.RTM. RNAiMAX Transfection Reagent (Thermo Fisher, cat #: 13778-150) is used following the manufacturer's instructions.

[0225] A: mix RNAiMAX (0.3 ul/well for 96-well plate) with Opti-MEM I (make 20% extra), incubate for 5 min at RT.

[0226] B: dilute combinations of ASOs and modified oligonucleotides in Opti-MEM I to make 40.times. of final concentration (8-point, 3-fold dilution, include concentration 0 nM). The top concentration is about 100-200 folds of EC.sub.50 value. Then mix equal volume dilutions from both compound1 and compound2 at opposite direction as indicated in the graph shown in FIG. 23.

[0227] Mix A and B at equal volume (make 20% extra volume), incubate another 5-10 min. Then add mixture of A and B at 1/10 of the final culture volume to each well, swirl the plates for 10 seconds by hand. There should be at least triplicate for the plates. Incubate at 37.degree. C. for 3 days, refresh medium, repeat the transfection process. On day 6 upon treatment, harvest supernatant for ELISA assay, measure cell viability with CellTiter-Glo (Promega).

Data Analysis

[0228] To analyze the synergism, the percentage of HBsAg (or DNA) reduction is calculated for each well. Percentage of reduction=(1-well/average of no drug control)*100. These numbers are input to MacSynergy II software and the synergism/antagonism volume is obtained following the instruction of the software.

[0229] Synergy volume <25 indicates no synergism/antagonism.

[0230] Synergy volume 25-50 indicates minor synergism/antagonism.

[0231] Synergy volume 50-100 indicates moderate synergism/antagonism.

[0232] Synergy volume >100 indicates strong synergism/antagonism.

[0233] Synergy volume >1,000 indicates possible errors, check the data.

[0234] Percentage of cell viability=(well/average of no drug control)*100. Monitor cytotoxicity as previously described.

HBsAg Quantification

[0235] Secreted HBsAg was measured quantitatively using HBsAg ELISA kit (Autobio-CL0310). Synergy values for combinations of modified oligonucleotides with ASOs are provided in Table 37.

TABLE-US-00037 TABLE 37 SYNERGY OF COMBINATIONS HBsAg 95% Compound No. ASO.sup.1 Synergy Volume 166, 288 ASO-1 335.08 134, 277, 284 ASO-2 52.98 296 ASO-2 43.05 .sup.1ASO-1 is an unconjugated HBV ASO SSO-1 as disclosed in in Javanbakht, H. et al. Molecular Therapy: Nucleic Acids Vol. 11 June 2018, having the following structure: 5-lnApslnGpsln(5m)CpsGpsApsApsGpsTpsGps(5m)CpsAps(5m)CpsApsln(5m)CpslnGps- lnG-3. ASO-2 is an ASO having a structure as described for the ASO referred to as Sequence #9 in U.S. application Ser. No. 62/855,793, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the Sequence #9.

Example B4

HBsAG Secretion Assay for Combinations

[0236] The sequence independent antiviral activity against hepatitis B (as determined by HBsAg Secretion Assay) of exemplified modified oligonucleotide compounds in combination with an ASO, capsid assembly modulators (CAM compound 1 or CAM compound 2), or nucleoside analog (Entecavir, ETV) was determined as described below and summarized in Table 38.

Cell Culture

[0237] The following assay procedure describes the HBV antiviral assay. This assay uses HepG2.2.15 cells, which have been transfected with HBV genome, and extracellular HBV DNA quantification as endpoint. Cell viability is assessed in parallel by measuring the intracellular ATP content using the CellTiter-Glo.RTM. reagent from Promega.

HBsAg Secretion Assay

[0238] HepG2.2.15 cells were grown in DMEM/F12 medium as described above. Cells were seeded at a concentration of 35,000 cells/well in collagen-I coated 96-well plates. Immediately after addition of the cells, add test compounds. Do double transfections on day 0 and 3.

HBV DNA Quantification Assay

[0239] Extracellular DNA was isolated with QIAamp 96 DNA Blood Kit per the manufacturer's manual. HBV DNA was then quantified by qPCR with HBV specific primers and probes as specified below using the FastStart Universal MasterMix from Roche on an ABI-7900HT. The PCR cycle program consisted of 95.degree. C. for 10 min, followed by 40 cycles at 95.degree. C. for 15 sec and 60.degree. C. for 1 min.

TABLE-US-00038 Items Name Sequence (5'.fwdarw.3') HBV HBV- GTGTCTGCGGCGTTTTATCA Primer forward HBV- GACAAACGGGCAACATACCTT reverse HBV HBV FAM-CCTCTKCATCCTGCTGCTATGCCTCATC- Probe probe TAMRA

Transfection Method

[0240] Lipofectamine.RTM. RNAiMAX transfection. Lipofectamine.RTM. RNAiMAX Transfection Reagent (Thermo Fisher, cat #: 13778-150) is used following the manufacturer's instructions.

[0241] A: mix RNAiMAX (0.3 ul/well for 96-well plate) with Opti-MEM I (make 20% extra), incubate for 5 min at RT

[0242] B: dilute combinations of a CAM, ASO or ETV with modified oligonucleotides in Opti-MEM I to make 40.times. of final concentration (8-point, 3-fold dilution, include concentration 0 nM). The top concentration is about 100-200 folds of EC.sub.50 value. Then mix equal volume dilutions from both compound1 and compound2 at opposite direction as indicated in the graph shown in FIG. 23.

[0243] Mix A and B at equal volume (make 20% extra volume), incubate another 5-10 min. Then add mixture of A and B at 1/10 of the final culture volume to each well, swirl the plates for 10 seconds by hands. There should be at least triplicate for the plates. Incubate at 37.degree. C. for 4-hrs before adding the ASO, ETV or CAMs to let the cells recover from tranfection. On day 3 upon treatment, harvest supernatant for ELISA assay, measure cell viability with CellTiter-Glo (Promega).

Data Analysis

[0244] The synergism data was analyzed as described in Example B3 above.

HBsAg Quantification

[0245] Secreted HBsAg was measured quantitatively using HBsAg ELISA kit (Autobio-CL0310). Synergy values for combinations of modified oligonucleotides with ASOs are provided in Table 38.

TABLE-US-00039 TABLE 38 SYNERGY OF COMBINATIONS HBV HBV DNA 95% Compound No. ASO, CAM or ETV.sup.1 DNA Synergy Volume 166, 288 ASO-1 Additive 23.99 134, 277, 284 ETV Synergy 25.91 134, 277, 284 CAM compound 1 Additive 1.35 134, 277, 284 CAM compound 2 Synergy 41.86 .sup.1CAM compound 1 is a CAM having a structure as described for the CAM compound referred to as compound 3 in WO2017/181141, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the compound 3. CAM compound 2 is a CAM having a structure as described for the CAM compound referred to as compound 1 in U.S. Ser. No. 62/805,725, which is hereby incorporated herein by reference and particularly for the purpose of describing the structure of the compound 1. ASO-1 is as described above for Table 37.

Example B5

Liver Exposure in Non-Human Primates

[0246] Terminal liver exposures in non-human primates were evaluated by dosing exemplified modified oligonucleotide compounds to female cynomolgus monkeys by either the intravenous (IV) or subcutaneous (SC) route. For the IV route, the compound was administered in sterile phosphate-buffered saline (PBS) vehicle and infused over a 2-hr period at 1 mL/kg. For subcutaneous dosing, the vehicle was also sterile PBS and the compound was administered as a single bolus at 1 mL/kg. There were two animals per dose group, and the data shown is the average of the two animals. Liver levels were determined at the 24-hour timepoint. The doses utilized for this study and the data obtained is shown in FIG. 12. Unexpectedly, liver exposure following subcutaneous administration to non-human primates is much higher than expected based on liver exposure levels resulting from otherwise comparable intravenous dosing.

Example B6

PBMC Assay

[0247] The effect of exemplified modified oligonucleotide compounds on the release of cytokines from peripheral blood mononuclear cells (PBMC) was evaluated as described below and summarized in Table 39 and FIGS. 13-22.

[0248] Buffy coats (N=3) were obtained from Stanford Blood Center and processed to isolate PBMC as per Aragen's standard protocol using Ficoll density gradient centrifugation. PBMC (1 million/mL) were suspended in complete culture (RPMI supplemented with 10% heat inactivated-low IgG FBS and PSG) and plated at 100 .mu.L/well in a 96-well round bottom plate. PBMC were treated with test articles (list on next slide) (concentration range: 10 .mu.M to 0 .mu.M-3 fold dilution) and PHA and Poly IC (concentration range: 10 .mu.g/mL to 0 .mu.g/mL-3 fold dilution). All was set up in triplicates. After 24 hours incubation at 37.degree. C./5% CO.sub.2 humidified standard cell culture incubator, supernatants were harvested and stored at -80.degree. C. until assayed for cytokines. Cytokines (GM-CSF, IL-1b, IL-2, IL-6, IL-10, IL-8, IL-12p70, IFNg, TNFa) were tested on Intellicyt iQue Screener and analyzed using ForeCyt analysis software. Cytokine (IFNa) was tested by standard ELISA. Results are expressed as pg/ml calculated based on the standard curve.

TABLE-US-00040 TABLE 39 Compound No. FIG. No. Immune Reaction.sup.1 PHA Control 13 Strong REP-2139 14 Weak 171, 280, 292 15 Weak 296 16 None 134, 277, 284 17 Weak 166, 288 18 None 167, 289 19 None 281, 316 20 None 294 21 Weak 276, 291 22 Weak .sup.1Strong: significant induction observed in more than two types of cytokines in the panel tested; Weak: induction observed in one or two types of cytokines in the panel tested; None: no induction observed in any cytokine in the panel tested.

Example B7

Cross-Genotype Activities of Modified Oligonucleotides in HBV HBsAG Release Inhibition

[0249] The cross-genotype activities of the compound of Example 296 and REP-2139 were evaluated as described below and summarized in Table 40.

Testing in Stable Cell Line

[0250] For HBV Genotype D: The HepG2.2.15 cell line (Sells M A, Chen M, Acs G. Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc Nat Acad Sci USA 1987; 84:1005-1009), which contains 2 head-to-tail integrated copies of the HBV genome and produces infectious HBV particles, was used as an in vitro model of HBV infection. The cell line was licensed and obtained from the Fox Chase Cancer Center (Philadelphia, Pa.). HepG2.2.15 cells were maintained in DMEM/F12 (Catalog 10-092-CM, Corning) with 10% fetal bovine serum, 1% penicillin and streptomycin, 2 mM glutamine, 1% non-essential amino acids, and 1% sodium pyruvate. To prepare the HepG2.2.15 for assay, the cells were trypsinized at 37.degree. C. and diluted to 0.35.times.10.sup.6/mL with maintenance medium.

[0251] The transfection mixture was prepared as follows: First, a master mixture was prepared by combining RNAiMAX (Catalog 13778-150, Thermo Fisher; 0.3 .mu.L/well for a 96-well plate) with Opti-MEM I (5.2 .mu.L/well), which was then vortexed and incubated for 5 minutes at room temperature. At least a 20% excess volume of the master mixture was prepared. Next, serial dilutions of the test compounds (3-fold) were made with Opti-MEM I at 20.times. of final concentration (8-point dose response), which was mixed with equal volumes of master mixture and then incubated for another 5-10 minutes.

[0252] The resulting test compound/RNAiMAX mixtures were added to 96-well plates at a volume of 11 .mu.L per well and then 100 .mu.L of HepG2.2.15 cells per well were added. The plates were swirled for 10 seconds by hand then incubated at 37.degree. C. for 3 days. After 3 days, the medium was refreshed, and the same test compound and RNAiMAX transfection mixture was added a second time, swirled for 10 seconds by hand, then incubated at 37.degree. C. for another 3 days.

[0253] On Day 6, the supernatant was harvested for HBsAg quantitation and the cells were assayed for viability. The HBsAg was measured with an ELISA kit (Catalog DS187701, Diasino) and cell viability was measured with the CellTiter-Glo (Promega) assay kit according to the manufacturer's instructions.

[0254] The HepG2-GtA and HepG2-GtB cell lines were established at Aligos Therapeutics, Inc. These cell lines contain 1.3.times.HBV genomes (AB246338.1 genotype A and AB246341 genotype B) and produce HBV viral products continuously. Otherwise the protocol was the same as HepG2.2.15.

Live HBV-Infected HepG2-NTCP

[0255] HepG2-NTCP cells contain an over-expressed NTCP receptor in the HepG2 cell line and have been shown to be a robust cell culture system supporting the complete life cycle of HBV (see Michailidis E, Pabon J, Xiang K, et al. A robust cell culture system supporting the complete life cycle of hepatitis B virus. Sci Rep 2017; 7(1):16616. doi:10.1038/s41598-017-16882-5). The cell line was licensed and obtained from the Fox Chase Cancer Center (Philadelphia, Pa.). HepG2-NTCP cells were maintained in DMEM/F12 (Catalog 10-092-CM, Corning) with 10% fetal bovine serum, 1% penicillin and streptomycin, 2 mM glutamine, 1% non-essential amino acids and 1% sodium pyruvate. The cells were trypsinized at 37.degree. C. and diluted to 0.15.times.10.sup.6/mL with maintenance medium. Briefly, the cells were seeded at 20,000/well in a 96-well plate on Day -2 and infected with HBV at a multiplicity of infection of 500 on Day 0. Infectious HBV particles (Genotype D) were harvested and concentrated from the supernatant of HepG2.2.15 cells (see Sells et. al. 1987), also licensed from the Fox Chase Cancer Center. Genotype B HBV (GenBank Accession No. JN406371) and Genotype C HBV (GenBank Accession No. AB246345) clinical isolates were purified from the supernatant of cultured HepG2 cells that had been transfected with plasmid DNA containing the corresponding HBV genomes.

[0256] The infected cells were transfected with test compounds on Days 5 and 8. The HBsAg was measured in the supernatant on Day 11 and the remaining cells were measured for cell viability.

[0257] The transfection mixture was prepared as follows: First, a master mixture was prepared by combining RNAiMAX (Catalog 13778-150, Thermo Fisher; 0.3 .mu.L/well for a 96-well plate) with Opti-MEM I (5.2 .mu.L/well), which was then vortexed and incubated for 5 minutes at room temperature. At least a 20% excess volume of master mixture was prepared. Next, serial dilutions of the test compounds (3-fold) were made with Opti-MEM I at 20.times. of final concentration (8-point dose response), which was then mixed with equal volumes of the master mixture and then incubated for another 5-10 minutes.

[0258] The above test compound/RNAiMAX mixtures were added to 96-well plates containing HBV-infected HepG2-NTCP cells in a volume of 11 .mu.L per well. The plates were swirled for 10 seconds by hand and then incubated at 37.degree. C. for 3 days. After 3 days, the medium was refreshed, and the same test compound and RNAiMAX transfection mixture was added for a second time, swirled for 10 seconds by hand, then incubated at 37.degree. C. for an additional 3 days.

[0259] Three days after the second compound treatment, the supernatant was harvested for HBsAg detection. HBsAg was measured with an ELISA kit (Catalog DS187701, Diasino) and cell viability was measured with the CellTiter-Glo (Promega) assay kit according to the manufacturer's instructions.

[0260] The results are summarized in Table 40 below and demonstrate that the modified oligonucleotide (Example 296) demonstrated greater potency than REP-2139. The compound of Example 296 also demonstrated enhanced cross genotypic activity, inhibiting the HBsAg release in cells containing HBV genotype A, B, C and D viruses with EC.sub.50 values of 7.9, 9.25, 0.72 and 3.9 nM, respectively.

TABLE-US-00041 TABLE 40 Activity (EC.sub.50) Activity (EC.sub.50) HBV in Stable in Live HBV-Infected Genotype Compound Cell Lines (nM) HepG2-NTCP (nM) A Example 296 7.6 .+-. 2.0 -- REP-2139 71.7 .+-. 15.6 -- B Example 296 18.24 .+-. 8.1 9.25 .+-. 1.26 REP-2139 >10,000 71.89 .+-. 10.74 C Example 296 -- 0.72 .+-. 0.03 REP-2139 -- 71.04 .+-. 15.69 D Example 296 4.8 .+-. 1.1 2.7 .+-. 0.9 REP-2139 260.3 .+-. 98 320.7 .+-. 110

Sequence CWU 1

1

169118DNAArtificial SequenceModified Oligonucleotide 1acacacacac acacacac 18218DNAArtificial SequenceModified Oligonucleotide 2acacacacac acacacac 18318DNAArtificial SequenceModified Oligonucleotide 3acacacacaa cacacaca 18418DNAArtificial SequenceModified Oligonucleotide 4acacacacaa cacacaca 18519DNAArtificial SequenceModified Oligonucleotide 5acacacacac acacacaca 19619DNAArtificial SequenceModified Oligonucleotide 6acacacacac acacacaca 19720DNAArtificial SequenceModified Oligonucleotide 7acacacacac acacacacac 20820DNAArtificial SequenceModified Oligonucleotide 8acacacacac acacacacac 20925DNAArtificial SequenceModified Oligonucleotide 9acacacacac acacacacac acaca 251028DNAArtificial SequenceModified Oligonucleotide 10acacacacac acacacacac acacacac 281130DNAArtificial SequenceModified Oligonucleotide 11acacacacac acacacacac acacacacac 301230DNAArtificial SequenceModified Oligonucleotide 12acacacacac acacacacac acacacacac 301330DNAArtificial SequenceModified Oligonucleotide 13acacacacac acacacacac acacacacac 301430DNAArtificial SequenceModified Oligonucleotide 14acacacacac acacacacac acacacacac 301530DNAArtificial SequenceModified Oligonucleotide 15acacacacac acacacacac acacacacac 301630DNAArtificial SequenceModified Oligonucleotide 16acacacacac acacacacac acacacacac 301730DNAArtificial SequenceModified Oligonucleotide 17acacacacac acacacacac acacacacac 301830DNAArtificial SequenceModified Oligonucleotide 18acacacacac acacacacac acacacacac 301930DNAArtificial SequenceModified Oligonucleotide 19acacacacac acacacacac acacacacac 302030DNAArtificial SequenceModified Oligonucleotide 20acacacacac acacacacac acacacacac 302130DNAArtificial SequenceModified Oligonucleotide 21acacacacac acacacacac acacacacac 302230DNAArtificial SequenceModified Oligonucleotide 22acacacacac acacaacaca cacacacaca 302330DNAArtificial SequenceModified Oligonucleotide 23acacacacac acacaacaca cacacacaca 302431DNAArtificial SequenceModified Oligonucleotide 24acacacacac acacacacac acacacacac a 312530DNAArtificial SequenceModified Oligonucleotide 25acacacacac acacacacac acacacacac 302630DNAArtificial SequenceModified Oligonucleotide 26acacacacac acacacacac acacacacac 302734DNAArtificial SequenceModified Oligonucleotide 27acacacacac acacacacac acacacacac acac 342834DNAArtificial SequenceModified Oligonucleotide 28acacacacac acacacacac acacacacac acac 342934DNAArtificial SequenceModified Oligonucleotide 29acacacacac acacacacac acacacacac acac 343034DNAArtificial SequenceModified Oligonucleotide 30acacacacac acacacacac acacacacac acac 343134DNAArtificial SequenceModified Oligonucleotide 31acacacacac acacacacac acacacacac acac 343234DNAArtificial SequenceModified Oligonucleotide 32acacacacac acacacacac acacacacac acac 343334DNAArtificial SequenceModified Oligonucleotide 33acacacacac acacacacac acacacacac acac 343436DNAArtificial SequenceModified Oligonucleotide 34acacacacac acacacacac acacacacac acacac 363536DNAArtificial SequenceModified Oligonucleotide 35acacacacac acacacacac acacacacac acacac 363636DNAArtificial SequenceModified Oligonucleotide 36acacacacac acacacacac acacacacac acacac 363736DNAArtificial SequenceModified Oligonucleotide 37acacacacac acacacacac acacacacac acacac 363836DNAArtificial SequenceModified Oligonucleotide 38acacacacac acacacacac acacacacac acacac 363936DNAArtificial SequenceModified Oligonucleotide 39acacacacac acacacacac acacacacac acacac 364036DNAArtificial SequenceModified Oligonucleotide 40acacacacac acacacacac acacacacac acacac 364136DNAArtificial SequenceModified Oligonucleotide 41acacacacac acacacacac acacacacac acacac 364237DNAArtificial SequenceModified Oligonucleotide 42acacacacac acacacacac acacacacac acacaca 374337DNAArtificial SequenceModified Oligonucleotide 43acacacacac acacacacac acacacacac acacaca 374438DNAArtificial SequenceModified Oligonucleotide 44acacacacac acacacacac acacacacac acacacac 384538DNAArtificial SequenceModified Oligonucleotide 45acacacacac acacacacac acacacacac acacacac 384638DNAArtificial SequenceModified Oligonucleotide 46acacacacac acacacacac acacacacac acacacac 384738DNAArtificial SequenceModified Oligonucleotide 47acacacacac acacacacac acacacacac acacacac 384838DNAArtificial SequenceModified Oligonucleotide 48acacacacac acacacacac acacacacac acacacac 384938DNAArtificial SequenceModified Oligonucleotide 49acacacacac acacacacac acacacacac acacacac 385038DNAArtificial SequenceModified Oligonucleotide 50acacacacac acacacacac acacacacac acacacac 385140DNAArtificial SequenceModified Oligonucleotide 51acacacacac acacacacac acacacacac acacacacac 405240DNAArtificial SequenceModified Oligonucleotide 52acacacacac acacacacac acacacacac acacacacac 405340DNAArtificial SequenceModified Oligonucleotide 53acacacacac acacacacac acacacacac acacacacac 405440DNAArtificial SequenceModified Oligonucleotide 54acacacacac acacacacac acacacacac acacacacac 405540DNAArtificial SequenceModified Oligonucleotide 55acacacacac acacacacac acacacacac acacacacac 405640DNAArtificial SequenceModified Oligonucleotide 56acacacacac acacacacac acacacacac acacacacac 405740DNAArtificial SequenceModified Oligonucleotide 57acacacacac acacacacac acacacacac acacacacac 405840DNAArtificial SequenceModified Oligonucleotide 58acacacacac acacacacac acacacacac acacacacac 405940DNAArtificial SequenceModified Oligonucleotide 59acacacacac acacacacac acacacacac acacacacac 406040DNAArtificial SequenceModified Oligonucleotide 60acacacacac acacacacac acacacacac acacacacac 406140DNAArtificial SequenceModified Oligonucleotide 61acacacacac acacacacac acacacacac acacacacac 406240DNAArtificial SequenceModified Oligonucleotide 62acacacacac acacacacac acacacacac acacacacac 406340DNAArtificial SequenceModified Oligonucleotide 63acacacacac acacacacac acacacacac acacacacac 406440DNAArtificial SequenceModified Oligonucleotide 64acacacacac acacacacac acacacacac acacacacac 406540DNAArtificial SequenceModified Oligonucleotide 65acacacacac acacacacac acacacacac acacacacac 406640DNAArtificial SequenceModified Oligonucleotide 66acacacacac acacacacac acacacacac acacacacac 406740DNAArtificial SequenceModified Oligonucleotide 67acacacacac acacacacac acacacacac acacacacac 406840DNAArtificial SequenceModified Oligonucleotide 68acacacacac acacacacac acacacacac acacacacac 406940DNAArtificial SequenceModified Oligonucleotide 69acacacacac acacacacac acacacacac acacacacac 407040DNAArtificial SequenceModified Oligonucleotide 70acacacacac acacacacac acacacacac acacacacac 407140DNAArtificial SequenceModified Oligonucleotide 71acacacacac acacacacac acacacacac acacacacac 407240DNAArtificial SequenceModified Oligonucleotide 72acacacacac acacacacac acacacacac acacacacac 407340DNAArtificial SequenceModified Oligonucleotide 73acacacacac acacacacac acacacacac acacacacac 407440DNAArtificial SequenceModified Oligonucleotide 74acacacacac acacacacac acacacacac acacacacac 407540DNAArtificial SequenceModified Oligonucleotide 75acacacacac acacacacac acacacacac acacacacac 407640DNAArtificial SequenceModified Oligonucleotide 76acacacacac acacacacac acacacacac acacacacac 407740DNAArtificial SequenceModified Oligonucleotide 77acacacacac acacacacac acacacacac acacacacac 407840DNAArtificial SequenceModified Oligonucleotide 78acacacacac acacacacac acacacacac acacacacac 407940DNAArtificial SequenceModified Oligonucleotide 79acacacacac acacacacac acacacacac acacacacac 408040DNAArtificial SequenceModified Oligonucleotide 80acacacacac acacacacac acacacacac acacacacac 408140DNAArtificial SequenceModified Oligonucleotide 81acacacacac acacacacac acacacacac acacacacac 408240DNAArtificial SequenceModified Oligonucleotide 82acacacacac acacacacac acacacacac acacacacac 408340DNAArtificial SequenceModified Oligonucleotide 83acacacacac acacacacac acacacacac acacacacac 408440DNAArtificial SequenceModified Oligonucleotide 84acacacacac acacacacac acacacacac acacacacac 408540DNAArtificial SequenceModified Oligonucleotide 85acacacacac acacacacac acacacacac acacacacac 408640DNAArtificial SequenceModified Oligonucleotide 86acacacacac acacacacac acacacacac acacacacac 408740DNAArtificial SequenceModified Oligonucleotide 87acacacacac acacacacac acacacacac acacacacac 408840DNAArtificial SequenceModified Oligonucleotide 88acacacacac acacacacac acacacacac acacacacac 408940DNAArtificial SequenceModified Oligonucleotide 89acacacacac acacacacac acacacacac acacacacac 409040DNAArtificial SequenceModified Oligonucleotide 90acacacacac acacacacac acacacacac acacacacac 409140DNAArtificial SequenceModified Oligonucleotide 91acacacacac acacacacac acacacacac acacacacac 409240DNAArtificial SequenceModified Oligonucleotide 92acacacacac acacacacac acacacacac acacacacac 409340DNAArtificial SequenceModified Oligonucleotide 93acacacacac acacacacac acacacacac acacacacac 409440DNAArtificial SequenceModified Oligonucleotide 94acacacacac acacacacac acacacacac acacacacac 409540DNAArtificial SequenceModified Oligonucleotide 95acacacacac acacacacac acacacacac acacacacac 409640DNAArtificial SequenceModified Oligonucleotide 96acacacacac acacacacac acacacacac acacacacac 409740DNAArtificial SequenceModified Oligonucleotide 97acacacacac acacacacac acacacacac acacacacac 409840DNAArtificial SequenceModified Oligonucleotide 98acacacacac acacacacac acacacacac acacacacac 409940DNAArtificial SequenceModified Oligonucleotide 99acacacacac acacacacac acacacacac acacacacac 4010040DNAArtificial SequenceModified Oligonucleotide 100acacacacac acacacacac acacacacac acacacacac 4010140DNAArtificial SequenceModified Oligonucleotide 101acacacacac acacacacac acacacacac acacacacac 4010240DNAArtificial SequenceModified Oligonucleotide 102acacacacac acacacacac acacacacac acacacacac 4010340DNAArtificial SequenceModified Oligonucleotide 103acacacacac acacacacac acacacacac acacacacac 4010440DNAArtificial SequenceModified Oligonucleotide 104acacacacac acacacacac acacacacac acacacacac 4010540DNAArtificial SequenceModified Oligonucleotide 105acacacacac acacacacac acacacacac acacacacac 4010640DNAArtificial SequenceModified Oligonucleotide 106acacacacac acacacacac acacacacac acacacacac 4010740DNAArtificial SequenceModified Oligonucleotide 107acacacacac acacacacac acacacacac acacacacac 4010840DNAArtificial SequenceModified Oligonucleotide 108acacacacac acacacacac acacacacac acacacacac 4010940DNAArtificial SequenceModified Oligonucleotide 109acacacacac acacacacac acacacacac acacacacac 4011040DNAArtificial SequenceModified Oligonucleotide 110acacacacac acacacacac acacacacac acacacacac 4011140DNAArtificial SequenceModified Oligonucleotide 111acacacacac acacacacac acacacacac acacacacac 4011240DNAArtificial SequenceModified Oligonucleotide 112acacacacac acacacacac acacacacac acacacacac 4011340DNAArtificial SequenceModified Oligonucleotide 113acacacacac acacacacac acacacacac acacacacac 4011440DNAArtificial SequenceModified Oligonucleotide 114acacacacac acacacacac acacacacac acacacacac 4011540DNAArtificial SequenceModified Oligonucleotide 115acacacacac acacacacac acacacacac acacacacac 4011640DNAArtificial SequenceModified Oligonucleotide 116acacacacac acacacacac acacacacac acacacacac 4011740DNAArtificial SequenceModified Oligonucleotide 117acacacacac acacacacac acacacacac acacacacac 4011840DNAArtificial SequenceModified Oligonucleotide 118acacacacac acacacacac acacacacac acacacacac 4011940DNAArtificial SequenceModified Oligonucleotide 119acacacacac acacacacac acacacacac acacacacac 4012040DNAArtificial SequenceModified Oligonucleotide 120acacacacac acacacacac acacacacac acacacacac 4012140DNAArtificial SequenceModified Oligonucleotide 121acacacacac acacacacac acacacacac acacacacac 4012240DNAArtificial SequenceModified Oligonucleotide 122acacacacac acacacacac acacacacac acacacacac 4012340DNAArtificial SequenceModified Oligonucleotide 123acacacacac acacacacac acacacacac acacacacac 4012440DNAArtificial SequenceModified Oligonucleotide 124acacacacac acacacacac acacacacac acacacacac 4012540DNAArtificial SequenceModified Oligonucleotide 125acacacacac acacacacac acacacacac acacacacac 4012640DNAArtificial SequenceModified Oligonucleotide 126acacacacac acacacacac acacacacac acacacacac 4012740DNAArtificial SequenceModified Oligonucleotide 127acacacacac

acacacacac acacacacac acacacacac 4012840DNAArtificial SequenceModified Oligonucleotide 128acacacacac acacacacac acacacacac acacacacac 4012940DNAArtificial SequenceModified Oligonucleotide 129acacacacac acacacacac acacacacac acacacacac 4013040DNAArtificial SequenceModified Oligonucleotide 130acacacacac acacacacac acacacacac acacacacac 4013140DNAArtificial SequenceModified Oligonucleotide 131acacacacac acacacacac acacacacac acacacacac 4013240DNAArtificial SequenceModified Oligonucleotide 132acacacacac acacacacac acacacacac acacacacac 4013340DNAArtificial SequenceModified Oligonucleotide 133acacacacac acacacacac acacacacac acacacacac 4013440DNAArtificial SequenceModified Oligonucleotide 134acacacacac acacacacac acacacacac acacacacac 4013540DNAArtificial SequenceModified Oligonucleotide 135acacacacac acacacacac acacacacac acacacacac 4013640DNAArtificial SequenceModified Oligonucleotide 136acacacacac acacacacac acacacacac acacacacac 4013740DNAArtificial SequenceModified Oligonucleotide 137acacacacac acacacacac acacacacac acacacacac 4013840DNAArtificial SequenceModified Oligonucleotide 138acacacacac acacacacac acacacacac acacacacac 4013940DNAArtificial SequenceModified Oligonucleotide 139acacacacac acacacacac acacacacac acacacacac 4014040DNAArtificial SequenceModified Oligonucleotide 140acacacacac acacacacac acacacacac acacacacac 4014140DNAArtificial SequenceModified Oligonucleotide 141acacacacac acacacacac acacacacac acacacacac 4014240DNAArtificial SequenceModified Oligonucleotide 142acacacacac acacacacac acacacacac acacacacac 4014340DNAArtificial SequenceModified Oligonucleotide 143acacacacac acacacacac acacacacac acacacacac 4014440DNAArtificial SequenceModified Oligonucleotide 144acacacacac acacacacac acacacacac acacacacac 4014540DNAArtificial SequenceModified Oligonucleotide 145acacacacac acacacacac acacacacac acacacacac 4014640DNAArtificial SequenceModified Oligonucleotidemodified_base(1)...(40)Phosphorothioate linkagemodified_base(1)...(1)2'-OMe-nucleotidemodified_base(2)...(2)locke- d 5-methyl-nucleotidemodified_base(3)...(3)2'-OMe-nucleotidemodified_base(- 4)...(4)locked 5-methyl-nucleotidemodified_base(5)...(5)2'-OMe-nucleotidemodified_base(6- )...(6)locked 5-methyl-nucleotidemodified_base(7)...(7)2'-OMe-nucleotidemodified_base(8- )...(8)locked 5-methyl-nucleotidemodified_base(9)...(9)2'-OMe-nucleotidemodified_base(1- 0)...(10)locked 5-methyl-nucleotidemodified_base(11)...(11)ribo-nucleotidemodified_base(1- 2)...(12)locked 5-methyl-nucleotidemodified_base(13)...(13)2'-OMe-nucleotidemodified_base- (14)...(14)locked 5-methyl-nucleotidemodified_base(15)...(15)2'-OMe-nucleotidemodified_base- (16)...(16)locked 5-methyl-nucleotidemodified_base(17)...(17)ribo-nucleotidemodified_base(1- 8)...(18)locked 5-methyl-nucleotidemodified_base(19)...(19)2'-OMe-nucleotidemodified_base- (20)...(20)locked 5-methyl-nucleotidemodified_base(21)...(21)2'-OMe-nucleotidemodified_base- (22)...(22)locked 5-methyl-nucleotidemodified_base(23)...(23)ribo-nucleotidemodified_base(2- 4)...(24)locked 5-methyl-nucleotidemodified_base(25)...(25)2'-OMe-nucleotidemodified_base- (26)...(26)locked 5-methyl-nucleotidemodified_base(27)...(27)2'-OMe-nucleotidemodified_base- (28)...(28)locked 5-methyl-nucleotidemodified_base(29)...(29)ribo-nucleotidemodified_base(3- 0)...(30)locked 5-methyl-nucleotidemodified_base(31)...(31)2'-OMe-nucleotidemodified_base- (32)...(32)locked 5-methyl-nucleotidemodified_base(33)...(33)2'-OMe-nucleotidemodified_base- (34)...(34)locked 5-methyl-nucleotidemodified_base(35)...(35)ribo-nucleotidemodified_base(3- 6)...(36)locked 5-methyl-nucleotidemodified_base(37)...(37)2'-OMe-nucleotidemodified_base- (38)...(38)locked 5-methyl-nucleotidemodified_base(39)...(39)2'-OMe-nucleotidemodified_base- (40)...(40)locked 5-methyl-nucleotide 146acacacacac acacacacac acacacacac acacacacac 4014740DNAArtificial SequenceModified Oligonucleotide 147acacacacac acacacacac acacacacac acacacacac 4014840DNAArtificial SequenceModified Oligonucleotide 148acacacacac acacacacac acacacacac acacacacac 4014940DNAArtificial SequenceModified Oligonucleotide 149acacacacac acacacacac acacacacac acacacacac 4015040DNAArtificial SequenceModified Oligonucleotide 150acacacacac acacacacac acacacacac acacacacac 4015140DNAArtificial SequenceModified Oligonucleotide 151acacacacac acacacacac acacacacac acacacacac 4015240DNAArtificial SequenceModified Oligonucleotide 152acacacacac acacacacac acacacacac acacacacac 4015340DNAArtificial SequenceModified Oligonucleotide 153acacacacac acacacacac acacacacac acacacacac 4015440DNAArtificial SequenceModified Oligonucleotide 154acacacacac acacacacac acacacacac acacacacac 4015540DNAArtificial SequenceModified Oligonucleotide 155acacacacac acacacacac acacacacac acacacacac 4015640DNAArtificial SequenceModified Oligonucleotide 156acacacacac acacacacac acacacacac acacacacac 4015740DNAArtificial SequenceModified Oligonucleotide 157acacacacac acacacacac acacacacac acacacacac 4015840DNAArtificial SequenceModified Oligonucleotide 158acacacacac acacacacac acacacacac acacacacac 4015940DNAArtificial SequenceModified Oligonucleotide 159agagagagag agagagagag agagagagag agagagagag 4016040RNAArtificial SequenceModified Oligonucleotide 160auauauauau auauauauau auauauauau auauauauau 4016140DNAArtificial SequenceModified Oligonucleotide 161cacacacaca cacacacaca cacacacaca cacacacaca 4016240RNAArtificial SequenceModified Oligonucleotide 162gagagagaga gagagagaga gagagagaga gagagagaga 4016341DNAArtificial SequenceModified Oligonucleotide 163aacacacaca cacacacaca cacacacaca cacacacaca c 4116439DNAArtificial SequenceModified Oligonucleotide 164acacacacac acaacacaca cacacaacac acacacaca 3916539DNAArtificial SequenceModified Oligonucleotide 165acacacacac acaacacaca cacacaacac acacacaca 3916640DNAArtificial SequenceModified Oligonucleotide 166acacacacac acacacacac acacacacac acacacacac 4016740DNAArtificial SequenceModified Oligonucleotide 167acacacacac acacacacac acacacacac acacacacac 4016846DNAArtificial SequenceModified Oligonucleotide 168acacacacac acacacacac acacacacac acacacacac acacac 4616945DNAArtificial SequenceModified Oligonucleotide 169acacacacac acacaacaca cacacacaca acacacacac acaca 45



User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
New patent applications in this class:
DateTitle
2022-09-22Electronic device
2022-09-22Front-facing proximity detection using capacitive sensor
2022-09-22Touch-control panel and touch-control display apparatus
2022-09-22Sensing circuit with signal compensation
2022-09-22Reduced-size interfaces for managing alerts
Website © 2025 Advameg, Inc.